Sample records for lacking functional p53

  1. p53: traffic cop at the crossroads of DNA repair and recombination.

    PubMed

    Sengupta, Sagar; Harris, Curtis C

    2005-01-01

    p53 mutants that lack DNA-binding activities, and therefore, transcriptional activities, are among the most common mutations in human cancer. Recently, a new role for p53 has come to light, as the tumour suppressor also functions in DNA repair and recombination. In cooperation with its function in transcription, the transcription-independent roles of p53 contribute to the control and efficiency of DNA repair and recombination.

  2. Functional characterization of p53 pathway components in the ancient metazoan Trichoplax adhaerens

    NASA Astrophysics Data System (ADS)

    Siau, Jia Wei; Coffill, Cynthia R.; Zhang, Weiyun Villien; Tan, Yaw Sing; Hundt, Juliane; Lane, David; Verma, Chandra; Ghadessy, Farid

    2016-09-01

    The identification of genes encoding a p53 family member and an Mdm2 ortholog in the ancient placozoan Trichoplax adhaerens advocates for the evolutionary conservation of a pivotal stress-response pathway observed in all higher eukaryotes. Here, we recapitulate several key functionalities ascribed to this known interacting protein pair by analysis of the placozoan proteins (Tap53 and TaMdm2) using both in vitro and cellular assays. In addition to interacting with each other, the Tap53 and TaMdm2 proteins are also able to respectively bind human Mdm2 and p53, providing strong evidence for functional conservation. The key p53-degrading function of Mdm2 is also conserved in TaMdm2. Tap53 retained DNA binding associated with p53 transcription activation function. However, it lacked transactivation function in reporter genes assays using a heterologous cell line, suggesting a cofactor incompatibility. Overall, the data supports functional roles for TaMdm2 and Tap53, and further defines the p53 pathway as an evolutionary conserved fulcrum mediating cellular response to stress.

  3. p73 Protein Expression Correlates With Radiation-Induced Apoptosis in the Lack of p53 Response to Radiation Therapy for Cervical Cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wakatsuki, Masaru; Research Center for Charged Particle Therapy, National Institute of Radiological Sciences, Chiba; Ohno, Tatsuya

    2008-03-15

    Purpose: p73 belongs to the p53 tumor suppressor family of genes and can inhibit cell growth in a p53-like manner by inducing apoptosis or cell cycle arrest. Here, we investigated whether p73 could compensate for impaired p53 function in apoptosis induced by radiation therapy (RT) for cervical cancer. Methods and Materials: Sixty-eight patients with squamous cell carcinoma of the cervix who received definitive RT combined with (n = 37) or without (n = 31) cisplatin were investigated. Biopsy specimens were excised from the cervical tumor before RT and after 9 Gy. Results: Mean apoptosis index (AI) was 0.93% before RTmore » and 1.97% after 9 Gy with a significant increase (p < 0.001). For all patients, there was a significant correlation between p73 expression positivity after 9 Gy and AI ratio (AI after 9 Gy/AI before RT) (p = 0.021). Forty-one patients were regarded as the p53-responding group according to the expression of p53 after 9 Gy, whereas the remaining 27 patients were regarded as the p53-nonresponding group. A significant correlation between p73 expression after 9 Gy and AI ratio was observed in the p53-non-responding group (p < 0.001) but not in the p53-responding group (p = 0.940). Conclusion: Our results suggest that p73 plays an important role in compensating for the lack of p53 function in radiation-induced apoptosis of cervical cancer.« less

  4. Acentriolar mitosis activates a p53-dependent apoptosis pathway in the mouse embryo

    PubMed Central

    Bazzi, Hisham; Anderson, Kathryn V.

    2014-01-01

    Centrosomes are the microtubule-organizing centers of animal cells that organize interphase microtubules and mitotic spindles. Centrioles are the microtubule-based structures that organize centrosomes, and a defined set of proteins, including spindle assembly defective-4 (SAS4) (CPAP/CENPJ), is required for centriole biogenesis. The biological functions of centrioles and centrosomes vary among animals, and the functions of mammalian centrosomes have not been genetically defined. Here we use a null mutation in mouse Sas4 to define the cellular and developmental functions of mammalian centrioles in vivo. Sas4-null embryos lack centrosomes but survive until midgestation. As expected, Sas4−/− mutants lack primary cilia and therefore cannot respond to Hedgehog signals, but other developmental signaling pathways are normal in the mutants. Unlike mutants that lack cilia, Sas4−/− embryos show widespread apoptosis associated with global elevated expression of p53. Cell death is rescued in Sas4−/− p53−/− double-mutant embryos, demonstrating that mammalian centrioles prevent activation of a p53-dependent apoptotic pathway. Expression of p53 is not activated by abnormalities in bipolar spindle organization, chromosome segregation, cell-cycle profile, or DNA damage response, which are normal in Sas4−/− mutants. Instead, live imaging shows that the duration of prometaphase is prolonged in the mutants while two acentriolar spindle poles are assembled. Independent experiments show that prolonging spindle assembly is sufficient to trigger p53-dependent apoptosis. We conclude that a short delay in the prometaphase caused by the absence of centrioles activates a previously undescribed p53-dependent cell death pathway in the rapidly dividing cells of the mouse embryo. PMID:24706806

  5. Human Cytomegalovirus nuclear egress and secondary envelopment are negatively affected in the absence of cellular p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuan, Man I; O’Dowd, John M.; Chughtai, Kamila

    2016-10-15

    Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, withmore » a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm. -- Highlights: •The majority of p53KO cells release fewer functional virions than wt cells. •Nucleocapsids do not efficiently exit the nucleus in p53KO cells. •Infoldings of the inner nuclear membrane are not efficiently formed in p53KO cells. •Cytoplasmic capsids are not efficiently re-enveloped in p53KO cells. •Reintroduction of p53 largely ameliorates these phenotypes.« less

  6. Alterations of mitochondrial biogenesis in chronic lymphocytic leukemia cells with loss of p53

    PubMed Central

    Ogasawara, Marcia A.; Liu, Jinyun; Pelicano, Helene; Hammoudi, Naima; Croce, Carlo M.; Keating, Michael J.; Huang, Peng

    2016-01-01

    Deletion of chromosome 17p with a loss of p53 is an unfavorable cytogenetic change in chronic lymphocytic leukemia (CLL) with poor clinical outcome. Since p53 affects mitochondrial function and integrity, we examined possible mitochondrial changes in CLL mice with TCL1-Tg/p53−/− and TCL1-Tg/p53+/+ genotypes and in primary leukemia cells from CLL patients with or without 17p-deletion. Although the expression of mitochondrial COX1, ND2, and ND6 decreased in p53−/−CLL cells, there was an increase in mitochondrial biogenesis as evidenced by higher mitochondrial mass and mtDNA copy number associated with an elevated expression of TFAM and PGC-1α. Surprisingly, the overall mitochondrial respiratory activity and maximum reserved capacity increased in p53−/− CLL cells. Our study suggests that leukemia cells lacking p53 seem able to maintain respiratory function by compensatory increase in mitochondrial biogenesis. PMID:27650502

  7. Structure and stability insights into tumour suppressor p53 evolutionary related proteins.

    PubMed

    Pagano, Bruno; Jama, Abdullah; Martinez, Pierre; Akanho, Ester; Bui, Tam T T; Drake, Alex F; Fraternali, Franca; Nikolova, Penka V

    2013-01-01

    The p53 family of genes and their protein products, namely, p53, p63 and p73, have over one billion years of evolutionary history. Advances in computational biology and genomics are enabling studies of the complexities of the molecular evolution of p53 protein family to decipher the underpinnings of key biological conditions spanning from cancer through to various metabolic and developmental disorders and facilitate the design of personalised medicines. However, a complete understanding of the inherent nature of the thermodynamic and structural stability of the p53 protein family is still lacking. This is due, to a degree, to the lack of comprehensive structural information for a large number of homologous proteins and to an incomplete knowledge of the intrinsic factors responsible for their stability and how these might influence function. Here we investigate the thermal stability, secondary structure and folding properties of the DNA-binding domains (DBDs) of a range of proteins from the p53 family using biophysical methods. While the N- and the C-terminal domains of the p53 family show sequence diversity and are normally targets for post-translational modifications and alternative splicing, the central DBD is highly conserved. Together with data obtained from Molecular Dynamics simulations in solution and with structure based homology modelling, our results provide further insights into the molecular properties of evolutionary related p53 proteins. We identify some marked structural differences within the p53 family, which could account for the divergence in biological functions as well as the subtleties manifested in the oligomerization properties of this family.

  8. Mutation at p53 serine 389 does not rescue the embryonic lethality in mdm2 or mdm4 null mice.

    PubMed

    Iwakuma, Tomoo; Parant, John M; Fasulo, Mark; Zwart, Edwin; Jacks, Tyler; de Vries, Annemieke; Lozano, Guillermina

    2004-10-07

    Mdm2 and its homolog Mdm4 inhibit the function of the tumor suppressor p53. Targeted disruption of either mdm2 or mdm4 genes in mice results in embryonic lethality that is completely rescued by concomitant deletion of p53, suggesting that deletion of negative regulators of p53 results in a constitutively active p53. Thus, these mouse models offer a unique in vivo system to assay the functional significance of different p53 modifications. Phosphorylation of serine 389 in murine p53 occurs specifically after ultraviolet-light-induced DNA damage, and phosphorylation of this site enhances p53 activity both in vitro and in vivo. Recently, mice with a serine to alanine substitution at serine 389 (p53S389A) in the endogenous p53 locus were generated. To examine the in vivo significance of serine 389 phosphorylation during embryogenesis, we crossed these mutant mice to mice lacking mdm2 or mdm4. The p53S389A allele did not alter the embryonic lethality of mdm2 or mdm4. Additional crosses to assay the effect of one p53S389A allele with a p53 null allele also did not rescue the lethal phenotypes. In conclusion, the phenotypes due to loss of mdm2 or mdm4 were not even partially rescued by p53S389A, suggesting that p53S389A is functionally wild type during embryogenesis.

  9. Inability of p53-reactivating compounds Nutlin-3 and RITA to overcome p53 resistance in tumor cells deficient in p53Ser46 phosphorylation.

    PubMed

    Ma, Teng; Yamada, Shumpei; Ichwan, Solachuddin J A; Iseki, Sachiko; Ohtani, Kiyoshi; Otsu, Megumi; Ikeda, Masa-Aki

    2012-01-20

    The p53 tumor suppressor protein plays key roles in protecting cells from tumorigenesis. Phosphorylation of p53 at Ser46 (p53Ser46) is considered to be a crucial modification regulating p53-mediated apoptosis. Because the activity of p53 is impaired in most human cancers, restoration of wild-type p53 (wt-p53) function by its gene transfer or by p53-reactivating small molecules has been extensively investigated. The p53-reactivating compounds Nutlin-3 and RITA activate p53 in the absence of genotoxic stress by antagonizing the action of its negative regulator Mdm2. Although controversial, Nutlin-3 was shown to induce p53-mediated apoptosis in a manner independent of p53 phosphorylation. Recently, RITA was shown to induce apoptosis by promoting p53Ser46 phosphorylation. Here we examined whether Nutlin-3 or RITA can overcome resistance to p53-mediated apoptosis in p53-resistant tumor cell lines lacking the ability to phosphorylate p53Ser46. We show that Nutlin-3 did not rescue the apoptotic defect of a Ser46 phosphorylation-defective p53 mutant in p53-sensitive tumor cells, and that RITA neither restored p53Ser46 phosphorylation nor induced apoptosis in p53Ser46 phosphorylation-deficient cells retaining wt-p53. Furthermore, treatment with Nutlin-3 or RITA together with adenoviral p53 gene transfer also failed to induce apoptosis in p53Ser46 phosphorylation-deficient cells either expressing or lacking wt-p53. These results indicate that neither Nutlin-3 nor RITA in able to induce p53-mediated apoptosis in the absence of p53Ser46 phosphorylation. Thus, the dysregulation of this phosphorylation in tumor cells may be a critical factor that limits the efficacy of these p53-based cancer therapies. Copyright © 2011 Elsevier Inc. All rights reserved.

  10. Induction of Mitotic Cell Death by Overriding G2/M Checkpoint in Endometrial Cancer Cells with Non-functional p53

    PubMed Central

    Meng, Xiangbing; Laidler, Laura L.; Kosmacek, Elizabeth A.; Yang, Shujie; Xiong, Zhi; Zhu, Danlin; Wang, Xinjun; Dai, Donghai; Zhang, Yuping; Wang, Xiaofang; Brachova, Pavla; Albitar, Lina; Liu, Dawei; Ianzini, Fiorenza; Mackey, Michael A.; Leslie, Kimberly K.

    2012-01-01

    Objective Endometrial tumors with non-functional p53, such as serous uterine endometrial carcinomas, are aggressive malignancies with a poor outcome, yet they have an Achilles’ heel: due to loss of p53 function, these tumors may be sensitive to treatments which abrogate the G2/M checkpoint. Our objective was to exploit this weakness to induce mitotic cell death using two strategies: (1) EGFR inhibitor gefitinib combined with paclitaxel to arrest cells at mitosis, or (2) BI2536, an inhibitor of polo-like kinase 1 (PLK1), to block PLK1 activity. Methods We examined the impact of combining gefitinib and paclitaxel or PLK1 inhibitor on expression of G2/M checkpoint controllers, cell viability, and cell cycle progression in endometrial cancer cells with mutant p53. Results In cells lacking normal p53 activity, each treatment activated CDC25C and inactivated Wee1, which in turn activated cdc2 and sent cells rapidly through the G2/M checkpoint and into mitosis. Live cell imaging demonstrated irreversible mitotic arrest and eventual cell death. Combinatorial therapy with paclitaxel and gefitinib was highly synergistic and resulted in a 10-fold reduction in the IC50 for paclitaxel, from 14 nM as a single agent to 1.3 nM in the presence of gefitinib. However, BI2536 alone at low concentrations (5 nM) was the most effective treatment and resulted in massive mitotic cell death. In a xenograft mouse model with p53-deficient cells, low dose BI2536 significantly inhibited tumor growth. Conclusions These findings reveal induction of mitotic cell death as a therapeutic strategy for endometrial tumors lacking functional p53. PMID:23146687

  11. p53-dependent control of cell death by nicastrin: lack of requirement for presenilin-dependent gamma-secretase complex.

    PubMed

    Pardossi-Piquard, Raphaëlle; Dunys, Julie; Giaime, Emilie; Guillot-Sestier, Marie-Victoire; St George-Hyslop, Peter; Checler, Frédéric; Alves da Costa, Cristine

    2009-04-01

    Nicastrin (NCT) is a component of the presenilin (PS)-dependent gamma-secretase complexes that liberate amyloid beta-peptides from the beta-Amyloid Precursor Protein. Several lines of evidence indicate that the members of these complexes could also contribute to the control of cell death. Here we show that over-expression of NCT increases the viability of human embryonic kidney (HEK293) cells and decreases staurosporine (STS)- and thapsigargin (TPS)-induced caspase-3 activation in various cell lines from human and neuronal origins by Akt-dependent pathway. NCT lowers p53 expression, transcriptional activity and promoter transactivation and reduces p53 phosphorylation. NCT-associated protection against STS-stimulated cell death was completely abolished by p53 deficiency. Conversely, the depletion of NCT drastically enhances STS-induced caspase-3 activation and p53 pathway and favored p53 nuclear translocation. We examined whether NCT protective function depends on PS-dependent gamma-secretase activity. First, a 29-amino acid deletion known to reduce NCT-dependent amyloid beta-peptide production did not affect NCT-associated protective phenotype. Second, NCT still reduces STS-induced caspase-3 activation in fibroblasts lacking PS1 and PS2. Third, the gamma-secretase inhibitor DFK167 did not affect NCT-mediated reduction of p53 activity. Altogether, our study indicates that NCT controls cell death via phosphoinositide 3-kinase/Akt and p53-dependent pathways and that this function remains independent of the activity and molecular integrity of the gamma-secretase complexes.

  12. Loss of p53 promotes anaplasia and local invasion in ret/PTC1-induced thyroid carcinomas.

    PubMed

    La Perle, K M; Jhiang, S M; Capen, C C

    2000-08-01

    Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53-/- mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53-/- mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53-/- mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/- mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/- mice

  13. Functional Analysis of Interactions Between 53BP1, BRCA1 and p53

    DTIC Science & Technology

    2004-07-01

    deficiency synergize in tumorigenesis. Furthermore, the loss of a single 53BP1 allele enhances the susceptibility to cancer in the absence of p53. 14...specific antibodies against these sites and showed that at least two of them (S25 and S29) are phosphorylated in vivo by ATM, the kinase mutated in cancer ...characterized by chromosomal aberrations, genetic instability and cancer predisposition. +HU 153BP1 Fig. 5: Lack of 53BP1 prevents the efficient accumulation

  14. Loss of p53 induces M-phase retardation following G2 DNA damage checkpoint abrogation.

    PubMed

    Minemoto, Yuzuru; Uchida, Sanae; Ohtsubo, Motoaki; Shimura, Mari; Sasagawa, Toshiyuki; Hirata, Masato; Nakagama, Hitoshi; Ishizaka, Yukihito; Yamashita, Katsumi

    2003-04-01

    Most cell lines that lack functional p53 protein are arrested in the G2 phase of the cell cycle due to DNA damage. When the G2 checkpoint is abrogated, these cells are forced into mitotic catastrophe. A549 lung adenocarcinoma cells, in which p53 was eliminated with the HPV16 E6 gene, exhibited efficient arrest in the G2 phase when treated with adriamycin. Administration of caffeine to G2-arrested cells induced a drastic change in cell phenotype, the nature of which depended on the status of p53. Flow cytometric and microscopic observations revealed that cells that either contained or lacked p53 resumed their cell cycles and entered mitosis upon caffeine treatment. However, transit to the M phase was slower in p53-negative cells than in p53-positive cells. Consistent with these observations, CDK1 activity was maintained at high levels, along with stable cyclin B1, in p53-negative cells. The addition of butyrolactone I, which is an inhibitor of CDK1 and CDK2, to the p53-negative cells reduced the floating round cell population and induced the disappearance of cyclin B1. These results suggest a relationship between the p53 pathway and the ubiquitin-mediated degradation of mitotic cyclins and possible cross-talk between the G2-DNA damage checkpoint and the mitotic checkpoint.

  15. Loss of p53 Promotes Anaplasia and Local Invasion in ret/PTC1-Induced Thyroid Carcinomas

    PubMed Central

    La Perle, Krista M. D.; Jhiang, Sissy M.; Capen, Charles C.

    2000-01-01

    Papillary thyroid carcinomas in humans are associated with the ret/PTC oncogene and, following loss of p53 function, may progress to anaplastic carcinomas. Mice with thyroid-targeted expression of ret/PTC1 developed papillary thyroid carcinomas that were minimally invasive and did not metastasize. These mice were crossed with p53−/− mice to investigate whether loss of p53 would promote anaplasia and metastasis of ret/PTC1-induced thyroid tumors. The majority of p53−/− mice died or were euthanized by 17 weeks of age due to the development of thymic lymphomas, soft tissue sarcomas, and testicular teratomas. All ret/PTC1 mice developed thyroid carcinomas, but tumors in p53−/− mice were more anaplastic, larger in diameter, more invasive, and had a higher mitotic index than tumors in p53+/+ and p53+/− mice. Thyroid tumors did not metastasize in any of the experimental p53+/+ and p53+/− mice ≤28 weeks of age or p53−/− mice ≤ 17 weeks of age; however, an older (170-day-old) male p53−/− mouse used to maintain the colony developed anaplastic thyroid carcinoma with liver metastases. These findings demonstrate that the lack of functional p53 in ret/PTC1 mice promotes anaplasia and invasiveness of thyroid carcinomas. PMID:10934169

  16. Increased sensitivity of p53-deficient cells to anticancer agents due to loss of Pms2

    PubMed Central

    Fedier, A; Ruefenacht, U B; Schwarz, V A; Haller, U; Fink, D

    2002-01-01

    A large fraction of human tumours carries mutations in the p53 gene. p53 plays a central role in controlling cell cycle checkpoint regulation, DNA repair, transcription, and apoptosis upon genotoxic stress. Lack of p53 function impairs these cellular processes, and this may be the basis of resistance to chemotherapeutic regimens. By virtue of the involvement of DNA mismatch repair in modulating cytotoxic pathways in response to DNA damaging agents, we investigated the effects of loss of Pms2 on the sensitivity to a panel of widely used anticancer agents in E1A/Ha-Ras-transformed p53-null mouse fibroblasts either proficient or deficient in Pms2. We report that lack of the Pms2 gene is associated with an increased sensitivity, ranging from 2–6-fold, to some types of anticancer agents including the topoisomerase II poisons doxorubicin, etoposide and mitoxantrone, the platinum compounds cisplatin and oxaliplatin, the taxanes docetaxel and paclitaxel, and the antimetabolite gemcitabine. In contrast, no change in sensitivity was found after treatment with 5-fluorouracil. Cell cycle analysis revealed that both, Pms2-deficient and -proficient cells, retain the ability to arrest at the G2/M upon cisplatin treatment. The data indicate that the concomitant loss of Pms2 function chemosensitises p53-deficient cells to some types of anticancer agents, that Pms2 positively modulates cell survival by mechanisms independent of p53, and that increased cytotoxicity is paralleled by increased apoptosis. Tumour-targeted functional inhibition of Pms2 may be a valuable strategy for increasing the efficacy of anticancer agents in the treatment of p53-mutant cancers. British Journal of Cancer (2002) 87, 1027–1033. doi:10.1038/sj.bjc.6600599 www.bjcancer.com © 2002 Cancer Research UK PMID:12434296

  17. Mutant p53-R273H mediates cancer cell survival and anoikis resistance through AKT-dependent suppression of BCL2-modifying factor (BMF).

    PubMed

    Tan, B S; Tiong, K H; Choo, H L; Chung, F Fei-Lei; Hii, L-W; Tan, S H; Yap, I K S; Pani, S; Khor, N T W; Wong, S F; Rosli, R; Cheong, S-K; Leong, C-O

    2015-07-16

    p53 is the most frequently mutated tumor-suppressor gene in human cancers. Unlike other tumor-suppressor genes, p53 mutations mainly occur as missense mutations within the DNA-binding domain, leading to the expression of full-length mutant p53 protein. Mutant p53 proteins not only lose their tumor-suppressor function, but may also gain new oncogenic functions and promote tumorigenesis. Here, we showed that silencing of endogenous p53-R273H contact mutant, but not p53-R175H conformational mutant, reduced AKT phosphorylation, induced BCL2-modifying factor (BMF) expression, sensitized BIM dissociation from BCL-XL and induced mitochondria-dependent apoptosis in cancer cells. Importantly, cancer cells harboring endogenous p53-R273H mutant were also found to be inherently resistant to anoikis and lack BMF induction following culture in suspension. Underlying these activities is the ability of p53-R273H mutant to suppress BMF expression that is dependent on constitutively active PI3K/AKT signaling. Collectively, these findings suggest that p53-R273H can specifically drive AKT signaling and suppress BMF expression, resulting in enhanced cell survivability and anoikis resistance. These findings open the possibility that blocking of PI3K/AKT will have therapeutic benefit in mutant p53-R273H expressing cancers.

  18. β-Catenin C-terminal signals suppress p53 and are essential for artery formation

    PubMed Central

    Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.

    2016-01-01

    Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

  19. Integrated High Throughput Analysis Identifies GSK3 as a Crucial Determinant of p53-Mediated Apoptosis in Lung Cancer Cells.

    PubMed

    Zhang, Yu; Zhu, Chenyang; Sun, Bangyao; Lv, Jiawei; Liu, Zhonghua; Liu, Shengwang; Li, Hai

    2017-01-01

    p53 dysfunction is frequently observed in lung cancer. Although restoring the tumour suppressor function of p53 is recently approved as a putative strategy for combating cancers, the lack of understanding of the molecular mechanism underlying p53-mediated lung cancer suppression has limited the application of p53-based therapies in lung cancer. Using RNA sequencing, we determined the transcriptional profile of human non-small cell lung carcinoma A549 cells after treatment with two p53-activating chemical compounds, nutlin and RITA, which could induce A549 cell cycle arrest and apoptosis, respectively. Bioinformatics analysis of genome-wide gene expression data showed that distinct transcription profiles were induced by nutlin and RITA and 66 pathways were differentially regulated by these two compounds. However, only two of these pathways, 'Adherens junction' and 'Axon guidance', were found to be synthetic lethal with p53 re-activation, as determined via integrated analysis of genome-wide gene expression profile and short hairpin RNA (shRNA) screening. Further functional protein association analysis of significantly regulated genes associated with these two synthetic lethal pathways indicated that GSK3 played a key role in p53-mediated A549 cell apoptosis, and then gene function study was performed, which revealed that GSK3 inhibition promoted p53-mediated A549 cell apoptosis in a p53 post-translational activity-dependent manner. Our findings provide us with new insights regarding the mechanism by which p53 mediates A549 apoptosis and may cast light on the development of more efficient p53-based strategies for treating lung cancer. © 201 The Author(s). Published by S. Karger AG, Basel.

  20. Roles of HAUSP-mediated p53 regulation in central nervous system development.

    PubMed

    Kon, N; Zhong, J; Kobayashi, Y; Li, M; Szabolcs, M; Ludwig, T; Canoll, P D; Gu, W

    2011-08-01

    The deubiquitinase HAUSP (herpesvirus-associated ubiquitin-specific protease; also called USP7) has a critical role in regulating the p53-Mdm2 (murine double minute 2) pathway. By using the conventional knockout approach, we previously showed that hausp inactivation leads to early embryonic lethality. To fully understand the physiological functions of hausp, we have generated mice lacking hausp specifically in the brain and examined the impacts of this manipulation on brain development. We found that deletion of hausp in neural cells resulted in neonatal lethality. The brains from these mice displayed hypoplasia and deficiencies in development, which were mainly caused by p53-mediated apoptosis. Detailed analysis also showed an increase of both p53 levels and p53-dependent transcriptional activation in hausp knockout brains. Notably, neural cell survival and brain development of hausp-mutant mice can largely be restored in the p53-null background. Nevertheless, in contrast to the case of mdm2- and mdm4 (murine double minute 4)-mutant mice, inactivation of p53 failed to completely rescue the neonatal lethality of these hausp-mutant mice. These results indicate that HAUSP-mediated p53 regulation is crucial for brain development, and also suggest that both the p53-dependent and the p53-independent functions of HAUSP contribute to the neonatal lethality of hausp-mutant mice.

  1. Relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation in chronic lymphocytic leukemia.

    PubMed

    Lin, Ke; Sherrington, Paul D; Dennis, Michael; Matrai, Zoltan; Cawley, John C; Pettitt, Andrew R

    2002-08-15

    Established adverse prognostic factors in chronic lymphocytic leukemia (CLL) include CD38 expression, relative lack of IgV(H) mutation, and defects of the TP53 gene. However, disruption of the p53 pathway can occur through mechanisms other than TP53 mutation, and we have recently developed a simple screening test that detects p53 dysfunction due to mutation of the genes encoding either p53 or ATM, a kinase that regulates p53. The present study was conducted to examine the predictive value of this test and to establish the relationship between p53 dysfunction, CD38 expression, and IgV(H) mutation. CLL cells from 71 patients were examined for IgV(H) mutation, CD38 expression, and p53 dysfunction (detected as an impaired p53/p21 response to ionizing radiation). Survival data obtained from 69 patients were analyzed according to each of these parameters. Relative lack of IgV(H) mutation (less than 5%; n = 45), CD38 positivity (antigen expressed on more than 20% of malignant cells; n = 19), and p53 dysfunction (n = 19) were independently confirmed as adverse prognostic factors. Intriguingly, all p53-dysfunctional patients and all but one of the CD38(+) patients had less [corrected] than 5% IgV(H) mutation. Moreover, patients with p53 dysfunction and/or CD38 positivity (n = 31) accounted for the short survival of the less mutated group. These findings indicate that the poor outcome associated with having less than 5% IgV(H) mutation may be due to the overrepresentation of high-risk patients with p53 dysfunction and/or CD38 positivity within this group, and that CD38(-) patients with functionally intact p53 may have a prolonged survival regardless of the extent of IgV(H) mutation.

  2. p53 isoform Δ113p53/Δ133p53 promotes DNA double-strand break repair to protect cell from death and senescence in response to DNA damage.

    PubMed

    Gong, Lu; Gong, Hongjian; Pan, Xiao; Chang, Changqing; Ou, Zhao; Ye, Shengfan; Yin, Le; Yang, Lina; Tao, Ting; Zhang, Zhenhai; Liu, Cong; Lane, David P; Peng, Jinrong; Chen, Jun

    2015-03-01

    The inhibitory role of p53 in DNA double-strand break (DSB) repair seems contradictory to its tumor-suppressing property. The p53 isoform Δ113p53/Δ133p53 is a p53 target gene that antagonizes p53 apoptotic activity. However, information on its functions in DNA damage repair is lacking. Here we report that Δ113p53 expression is strongly induced by γ-irradiation, but not by UV-irradiation or heat shock treatment. Strikingly, Δ113p53 promotes DNA DSB repair pathways, including homologous recombination, non-homologous end joining and single-strand annealing. To study the biological significance of Δ113p53 in promoting DNA DSB repair, we generated a zebrafish Δ113p53(M/M) mutant via the transcription activator-like effector nuclease technique and found that the mutant is more sensitive to γ-irradiation. The human ortholog, Δ133p53, is also only induced by γ-irradiation and functions to promote DNA DSB repair. Δ133p53-knockdown cells were arrested at the G2 phase at the later stage in response to γ-irradiation due to a high level of unrepaired DNA DSBs, which finally led to cell senescence. Furthermore, Δ113p53/Δ133p53 promotes DNA DSB repair via upregulating the transcription of repair genes rad51, lig4 and rad52 by binding to a novel type of p53-responsive element in their promoters. Our results demonstrate that Δ113p53/Δ133p53 is an evolutionally conserved pro-survival factor for DNA damage stress by preventing apoptosis and promoting DNA DSB repair to inhibit cell senescence. Our data also suggest that the induction of Δ133p53 expression in normal cells or tissues provides an important tolerance marker for cancer patients to radiotherapy.

  3. p53-dependent p21-mediated growth arrest pre-empts and protects HCT116 cells from PUMA-mediated apoptosis induced by EGCG

    PubMed Central

    Thakur, Vijay S; Amin, A.R.M. Ruhul; Paul, Rajib K; Gupta, Kalpana; Hastak, Kedar; Agarwal, Mukesh K; Jackson, Mark W; Wald, David N; Mukhtar, Hasan; Agarwal, Munna L

    2010-01-01

    The tumor suppressor protein p53 plays a key role in regulation of negative cellular growth in response to EGCG. To further explore the role of p53 signaling and elucidate the molecular mechanism, we employed colon cancer HCT116 cell line and its derivatives in which a specific transcriptional target of p53 is knocked down by homologous recombination. Cells expressing p53 and p21 accumulate in G1 upon treatment with EGCG. In contrast, same cells lacking p21 traverse through the cell cycle and eventually undergo apoptosis as revealed by TUNEL staining. Treatment with EGCG leads to induction of p53, p21 and PUMA in p21 wild-type, and p53 and PUMA in p21−/− cells. Ablation of p53 by RNAi protects p21−/− cells, thus indicating a p53-dependent apoptosis by EGCG. Furthermore, analysis of cells lacking PUMA or Bax with or without p21 but with p53 reveals that all the cells expressing p53 and p21 survived after EGCG treatment. More interestingly, cells lacking both PUMA and p21 survived ECGC treatment whereas those lacking p21 and Bax did not. Taken together, our results present a novel concept wherein p21-dependent growth arrest pre-empts and protects cells from otherwise, in its absence, apoptosis which is mediated by activation of pro-apoptotic protein PUMA. Furthermore, we find that p53-dependent activation of PUMA in response to EGCG directly leads to apoptosis with out requiring Bax as is the case in response to agents that induce DNA damage. p21, thus can be used as a molecular switch for therapeutic intervention of colon cancer. PMID:20444544

  4. Telomere dysfunction and cell survival: roles for distinctTIN2-containing complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Sahn-Ho; Davalos, Albert R.; Heo, Seok-Jin

    Telomeres are maintained by three DNA binding proteins, TRF1, TRF2 and POT1, and several associated factors. One factor, TIN2, binds TRF1 and TRF2 directly and POT1 indirectly. These and two other proteins form a soluble complex that may be the core telomere-maintenance complex. It is not clear whether subcomplexes exist or function in vivo. Here, we provide evidence for two TIN2 subcomplexes with distinct functions in human cells. TIN2 ablation by RNA interference caused telomere uncapping and p53-independent cell death in all cells tested. However, we isolated two TIN2 complexes from cell lysates, each selectively sensitive to a TIN2 mutantmore » (TIN2-13, TIN2-15C). In cells with wild-type p53 function, TIN2-15C was more potent than TIN2-13 in causing telomere uncapping and eventual growth arrest. In cells lacking p53 function, TIN215C more than TIN2-13 caused genomic instability and cell death. Thus, TIN2 subcomplexes likely have distinct functions in telomere maintenance, and may provide selective targets for eliminating cells with mutant p53.« less

  5. p53 functional impairment and high p21waf1/cip1 expression in human T-cell lymphotropic/leukemia virus type I-transformed T cells.

    PubMed

    Cereseto, A; Diella, F; Mulloy, J C; Cara, A; Michieli, P; Grassmann, R; Franchini, G; Klotman, M E

    1996-09-01

    Human T-cell lymphotropic/leukemia virus type I (HTLV-I) is associated with T-cell transformation both in vivo and in vitro. Although some of the mechanisms responsible for transformation remain unknown, increasing evidence supports a direct role of viral as well as dysregulated cellular proteins in transformation. We investigated the potential role of the tumor suppressor gene p53 and of the p53-regulated gene, p21waf1/cip1 (wild-type p53 activated fragment 1/cycling dependent kinases [cdks] interacting protein 1), in HTLV-I-infected T cells. We have found that the majority of HTLV-I-infected T cells have the wild-type p53 gene. However, its function in HTLV-I-transformed cells appears to be impaired, as shown by the lack of appropriate p53-mediated responses to ionizing radiation (IR). Interestingly, the expression of the p53 inducible gene, p21waf1/cip1, is elevated at the messenger ribonucleic acid and protein levels in all HTLV-I-infected T-cell lines examined as well as in Taxl-1, a human T-cell line stably expressing Tax. Additionally, Tax induces upregulation of a p21waf1/cip1 promoter-driven luciferase gene in p53 null cells, and increases p21waf1/cip1 expression in Jurkat T cells. These findings suggest that the Tax protein is at least partially responsible for the p53-independent expression of p21waf1/cip1 in HTLV-I-infected cells. Dysregulation of p53 and p21waf1/cip1 proteins regulating cell-cycle progression, may represent an important step in HTLV-I-induced T-cell transformation.

  6. ΔNp63 promotes pediatric neuroblastoma and osteosarcoma by regulating tumor angiogenesis

    PubMed Central

    Bid, Hemant K.; Roberts, Ryan D.; Cam, Maren; Audino, Anthony; Kurmasheva, Raushan T.; Lin, Jiayuh; Houghton, Peter J.; Cam, Hakan

    2013-01-01

    The tumor suppressor gene p53 and its family members p63/p73 are critical determinants of tumorigenesis. ΔNp63 is a splice variant of p63, which lacks the N-terminal transactivation domain. It is thought to antagonize p53-, p63- and p73- dependent translation, thus blocking their tumor suppressor activity. In our studies of the pediatric solid tumors neuroblastoma and osteosarcoma, we find overexpression of ΔNp63; however, there is no correlation of ΔNp63 expression with p53 mutation status. Our data suggest that ΔNp63 itself endows cells with a gain of function that leads to malignant transformation, a function independent of any p53 antagonism. Here, we demonstrate that ΔNp63 overexpression, independent of p53, increases secretion of interleukin-6 (IL-6) and interleukin-8 (IL-8), leading to elevated phosphorylation of STAT-3 (Tyr-705). We show that elevated phosphorylation of STAT-3 leads to stabilization of HIF-1α protein, resulting in VEGF secretion. We also show human clinical data, which suggests a mechanistic role for ΔNp63 in osteosarcoma metastasis. In summary, our studies reveal the mechanism by which ΔNp63, as a master transcription factor, modulates tumor angiogenesis. PMID:24154873

  7. Pharmacological targeting of p53 through RITA is an effective antitumoral strategy for malignant pleural mesothelioma.

    PubMed

    Di Marzo, Domenico; Forte, Iris Maria; Indovina, Paola; Di Gennaro, Elena; Rizzo, Valeria; Giorgi, Francesca; Mattioli, Eliseo; Iannuzzi, Carmelina Antonella; Budillon, Alfredo; Giordano, Antonio; Pentimalli, Francesca

    2014-01-01

    Malignant mesothelioma, a very aggressive tumor associated to asbestos exposure, is expected to increase in incidence, and unfortunately, no curative modality exists. Reactivation of p53 is a new attractive antitumoral strategy. p53 is rarely mutated in mesothelioma, but it is inactivated in most tumors by the lack of p14(ARF). Here, we evaluated the feasibility of this approach in pleural mesothelioma by testing RITA and nutlin-3, two molecules able to restore p53 function through a different mechanism, on a panel of mesothelioma cell lines representing the epithelioid (NCI-H28, NCI-H2452, IST-MES 2), biphasic (MSTO-211H), and sarcomatoid (NCI-H2052) histotypes compared with the normal mesothelial HMC-hTERT. RITA triggered robust caspase-dependent apoptosis specifically in epithelioid and biphasic mesothelioma cell lines, both through wild-type and mutant p53, concomitant to p21 downregulation. Conversely, nutlin-3 induced a p21-dependent growth arrest, rather than apoptosis, and was slightly toxic on HMC-hTERT.   Interestingly, we identified a previously undetected point mutation of p53 (p.Arg249Ser) in IST-MES 2, and showed that RITA is also able to reactivate this p53 mutant protein and its apoptotic function. RITA reduced tumor growth in a MSTO-211H-derived xenograft model of mesothelioma and synergized with cisplatin, which is the mainstay of treatment for this tumor. Our data indicate that reactivation of p53 and concomitant p21 downregulation effectively induce cell death in mesothelioma, a tumor characterized by a high intrinsic resistance to apoptosis. Altogether, our findings provide the preclinical framework supporting the use of p53-reactivating agents alone, or in combination regimens, to improve the outcome of patients with mesothelioma.

  8. The absence of p53 during Human Cytomegalovirus infection leads to decreased UL53 expression, disrupting UL50 localization to the inner nuclear membrane, and thereby inhibiting capsid nuclear egress

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kuan, Man I; O’Dowd, John M.; Fortunato, Elizabeth

    Our electron microscopy study (Kuan et al., 2016) found HCMV nuclear capsid egress was significantly reduced in p53 knockout cells (p53KOs), correlating with inhibited formation of infoldings of the inner nuclear membrane (IINMs). Molecular examination of these phenomena has found p53KOs expressed UL97 and phosphorylated lamins, however the lamina failed to remodel. The nuclear egress complex (NEC) protein UL50 was expressed in almost all cells. UL50 re-localized to the inner nuclear membrane (INM) in ~90% of wt cells, but only ~35% of p53KOs. UL53 expression was significantly reduced in p53KOs, and cells lacking UL50 nuclear staining, expressed no UL53. Re-introductionmore » of p53 into p53KOs largely recovered UL53 positivity and UL50 nuclear re-localization. Nuclear rim located UL50/53 puncta, which co-localized with the major capsid protein, were largely absent in p53KOs. We believe these puncta were IINMs. In the absence of p53, UL53 expression was inhibited, disrupting formation of the NEC/IINMs, and reducing functional virion secretion. -- Highlights: •Phosphorylated nuclear lamins were inefficiently remodeled in p53KO cells. •p53KO cells expressed UL50, but it was not efficiently targeted to the nuclear rim. •UL53 was not expressed in the large majority of p53KO cells. •Cells failing to express UL53 did not localize UL50 to the nucleus. •NEC puncta/infoldings of the inner nuclear membrane were scarce in p53KO cells.« less

  9. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.

    PubMed

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel

    2016-04-12

    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia.

  10. p53 protects against genome instability following centriole duplication failure

    PubMed Central

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield

    2015-01-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  11. p53 prevents progression of nevi to melanoma predominantly through cell cycle regulation

    PubMed Central

    Terzian, Tamara; Torchia, Enrique C.; Dai, Daisy; Robinson, Steven E.; Murao, Kazutoshi; Stiegmann, Regan A.; Gonzalez, Victoria; Boyle, Glen M.; Powell, Marianne B.; Pollock, Pamela M.; Lozano, Guillermina; Robinson, William A.; Roop, Dennis R.; Box, Neil F.

    2011-01-01

    p53 is the central member of a critical tumor suppressor pathway in virtually all tumor types, where it is silenced mainly by missense mutations. In melanoma, p53 predominantly remains wild type, thus its role has been neglected. To study the effect of p53 on melanocyte function and melanomagenesis, we crossed the ‘high-p53’ Mdm4+/− mouse to the well-established TP-ras0/+ murine melanoma progression model. After treatment with the carcinogen dimethylbenzanthracene (DMBA), TP-ras0/+ mice on the Mdm4+/− background developed fewer tumors with a delay in the age of onset of melanomas compared to TP-ras0/+ mice. Furthermore, we observed a dramatic decrease in tumor growth, lack of metastasis with increased survival of TP-ras0/+: Mdm4+/− mice. Thus, p53 effectively prevented the conversion of small benign tumors to malignant and metastatic melanoma. p53 activation in cultured primary melanocyte and melanoma cell lines using Nutlin-3, a specific Mdm2 antagonist, supported these findings. Moreover, global gene expression and network analysis of Nutlin-3-treated primary human melanocytes indicated that cell cycle regulation through the p21WAF1/CIP1 signaling network may be the key anti-melanomagenic activity of p53. PMID:20849464

  12. A combination of p53-activating APR-246 and phosphatidylserine-targeting antibody potently inhibits tumor development in hormone-dependent mutant p53-expressing breast cancer xenografts

    PubMed Central

    Liang, Yayun; Mafuvadze, Benford; Besch-Williford, Cynthia; Hyder, Salman M

    2018-01-01

    Background Between 30 and 40% of human breast cancers express a defective tumor suppressor p53 gene. Wild-type p53 tumor suppressor protein promotes cell-cycle arrest and apoptosis and inhibits vascular endothelial growth factor–dependent angiogenesis, whereas mutant p53 protein (mtp53) lacks these functions, resulting in tumor cell survival and metastasis. Restoration of p53 function is therefore a promising drug-targeted strategy for combating mtp53-expressing breast cancer. Methods In this study, we sought to determine whether administration of APR-246, a small-molecule drug that restores p53 function, in combination with 2aG4, an antibody that targets phosphatidylserine residues on tumor blood vessels and disrupts tumor vasculature, effectively inhibits advanced hormone-dependent breast cancer tumor growth. Results APR-246 reduced cell viability in mtp53-expressing BT-474 and T47-D human breast cancer cells in vitro, and significantly induced apoptosis in a dose-dependent manner. However, APR-246 did not reduce cell viability in MCF-7 breast cancer cells, which express wild-type p53. We next examined APR-246’s anti-tumor effects in vivo using BT-474 and T47-D tumor xenografts established in female nude mice. Tumor-bearing mice were treated with APR-246 and/or 2aG4 and tumor volume followed over time. Tumor growth was more effectively suppressed by combination treatment than by either agent alone, and combination therapy completely eradicated some tumors. Immunohistochemistry analysis of tumor tissue sections demonstrated that combination therapy more effectively induced apoptosis and reduced cell proliferation in tumor xenografts than either agent alone. Importantly, combination therapy dramatically reduced the density of blood vessels, which serve as the major route for tumor metastasis, in tumor xenografts compared with either agent alone. Conclusion Based on our findings, we contend that breast tumor growth might effectively be controlled by simultaneous targeting of mtp53 protein and tumor blood vessels in mtp53-expressing cancers. PMID:29606888

  13. Immortal, telomerase-negative cell lines derived from a Li-Fraumeni syndrome patient exhibit telomere length variability and chromosomal and minisatellite instabilities.

    PubMed

    Tsutsui, Takeki; Kumakura, Shin-Ichi; Tamura, Yukiko; Tsutsui, Takeo W; Sekiguchi, Mizuki; Higuchi, Tokihiro; Barrett, J Carl

    2003-05-01

    Five immortal cell lines derived from a Li-Fraumeni syndrome patient (MDAH 087) with a germline mutant p53 allele were characterized with respect to telomere length and genomic instability. The remaining wild-type p53 allele is lost in the cell lines. Telomerase activity was undetectable in all immortal cell lines. Five subclones of each cell line and five re-subclones of each of the subclones also showed undetectable telomerase activity. All five immortal cell lines exhibited variability in the mean length of terminal restriction fragments (TRFs). Subclones of each cell line, and re-subclones of the subclones also showed TRF variability, indicating that the variability is owing to clonal heterogeneity. Chromosome aberrations were observed at high frequencies in these cell lines including the subclones and re-subclones, and the principal types of aberrations were breaks, double minute chromosomes and dicentric chromosomes. In addition, minisatellite instability detected by DNA fingerprints was observed in the immortal cell lines. However, all of the cell lines were negative for microsatellite instability. As minisatellite sequences are considered recombinogenic in mammalian cells, these results suggest that recombination rates can be increased in these cell lines. Tumor-derived human cell lines, HT1080 cells and HeLa cells that also lack p53 function, exhibited little genomic instability involving chromosomal and minisatellite instabilities, indicating that chromosomal and minisatellite instabilities observed in the immortal cell lines lacking telomerase activity could not result from loss of p53 function.

  14. Constant p53 Pathway Inactivation in a Large Series of Soft Tissue Sarcomas with Complex Genetics

    PubMed Central

    Pérot, Gaëlle; Chibon, Frédéric; Montero, Audrey; Lagarde, Pauline; de Thé, Hugues; Terrier, Philippe; Guillou, Louis; Ranchère, Dominique; Coindre, Jean-Michel; Aurias, Alain

    2010-01-01

    Alterations of the p53 pathway are among the most frequent aberrations observed in human cancers. We have performed an exhaustive analysis of TP53, p14, p15, and p16 status in a large series of 143 soft tissue sarcomas, rare tumors accounting for around 1% of all adult cancers, with complex genetics. For this purpose, we performed genomic studies, combining sequencing, copy number assessment, and expression analyses. TP53 mutations and deletions are more frequent in leiomyosarcomas than in undifferentiated pleomorphic sarcomas. Moreover, 50% of leiomyosarcomas present TP53 biallelic inactivation, whereas most undifferentiated pleomorphic sarcomas retain one wild-type TP53 allele (87.2%). The spectrum of mutations between these two groups of sarcomas is different, particularly with a higher rate of complex mutations in undifferentiated pleomorphic sarcomas. Most tumors without TP53 alteration exhibit a deletion of p14 and/or lack of mRNA expression, suggesting that p14 loss could be an alternative genotype for direct TP53 inactivation. Nevertheless, the fact that even in tumors altered for TP53, we could not detect p14 protein suggests that other p14 functions, independent of p53, could be implicated in sarcoma oncogenesis. In addition, both p15 and p16 are frequently codeleted or transcriptionally co-inhibited with p14, essentially in tumors with two wild-type TP53 alleles. Conversely, in TP53-altered tumors, p15 and p16 are well expressed, a feature not incompatible with an oncogenic process. PMID:20884963

  15. L'effet de p53 sur la radiosensibilité des cellules humaines normales et cancéreuses

    NASA Astrophysics Data System (ADS)

    Little, J. B.; Li, C. Y.; Nagasawa, H.; Huang, H.

    1998-04-01

    The radiosensitivity of normal human fibroblasts in p53 dependent and associated with the loss of cells from the cycling population as the result of an irreversible G1 arrest; cells lacking normal p53 function show no arrest and are more radioresistant. Under conditions in which the repair potentially lethal radiation damage is facilitated, the fraction of cells arrested in G1 is reduced and survival is enhanced. The response of human tumor cells differs significantly. The radiation-induced G1 arrest is minimal or absent in p53+ tumor cells, and loss of normal p53 function has no consistent effect on their radiosensitivity. These results suggest that p53 status may not be a useful predictive marker for the response of human solid tumors to radiation therapy. La radiosensibilité des fibroblastes diploïdes humains est liée à l'expression de p53, et à la perte de cellules en cycle résultant d'un arrêt irréversible en phase G1 ; dans les cellules n'ayant pas une fonction p53 normale, on ne constate aucun arrêt, et elles sont plus radio-résistantes. Dans des conditions favorables à la réparation de lésions potentiellement léthales dues à l'irradiation, la proportion de cellules bloquées en phase G1 baisse, et les chances de survie sont accrues. Bien différente est la réaction des cellules cancéreuses humaines. Le blocage par irradiation en phase G1 est minime ou inexistant dans les cellules cancéreuses p53^+, et la perte de la fonction normale p53 n'a pas d'effet constant sur leur radiosensibilité. Ces résultats laissent penser que l'expression de p53 n'est pas un indice fiable permettant de prévoir la réaction des tumeurs solides à la radiothérapie.

  16. p73 coordinates with Δ133p53 to promote DNA double-strand break repair.

    PubMed

    Gong, Hongjian; Zhang, Yuxi; Jiang, Kunpeng; Ye, Shengfan; Chen, Shuming; Zhang, Qinghe; Peng, Jinrong; Chen, Jun

    2018-03-06

    Tumour repressor p53 isoform Δ133p53 is a target gene of p53 and an antagonist of p53-mediated apoptotic activity. We recently demonstrated that Δ133p53 promotes DNA double-strand break (DSB) repair by upregulating transcription of the repair genes RAD51, LIG4 and RAD52 in a p53-independent manner. However, Δ133p53 lacks the transactivation domain of full-length p53, and the mechanism by which it exerts transcriptional activity independently of full-length p53 remains unclear. In this report, we describe the accumulation of high levels of both Δ133p53 and p73 (a p53 family member) at 24 h post γ-irradiation (hpi). Δ133p53 can form a complex with p73 upon γ-irradiation. The co-expression of Δ133p53 and p73, but not either protein alone, can significantly promote DNA DSB repair mechanisms, including homologous recombination (HR), non-homologous end joining (NHEJ) and single-strand annealing (SSA). p73 and Δ133p53 act synergistically to promote the expression of RAD51, LIG4 and RAD52 by joining together to bind to region containing a Δ133p53-responsive element (RE) and a p73-RE in the promoters of all three repair genes. In addition to its accumulation at 24 hpi, p73 protein expression also peaks at 4 hpi. The depletion of p73 not only reduces early-stage apoptotic frequency (4-6 hpi), but also significantly increases later-stage DNA DSB accumulation (48 hpi), leading to cell cycle arrest in the G2 phase and, ultimately, cell senescence. In summary, the apoptotic regulator p73 also coordinates with Δ133p53 to promote DNA DSB repair, and the loss of function of p73 in DNA DSB repair may underlie spontaneous and carcinogen-induced tumorigenesis in p73 knockout mice.

  17. Reduced hippocampal damage and epileptic seizures after status epilepticus in mice lacking proapoptotic Puma

    PubMed Central

    Engel, Tobias; Murphy, Brona M.; Hatazaki, Seiji; Jimenez-Mateos, Eva M.; Concannon, Caoimhin G.; Woods, Ina; Prehn, Jochen H. M.; Henshall, David C.

    2010-01-01

    The functional significance of neuronal death for pathogenesis of epilepsy and the underlying molecular mechanisms thereof remain incompletely understood. The p53 transcription factor has been implicated in seizure damage, but its target genes and the influence of cell death under its control on epilepsy development are unknown. In the present study, we report that status epilepticus (SE) triggered by intra-amygdala kainic acid in mice causes rapid p53 accumulation and subsequent hippocampal damage. Expression of p53-up-regulated mediator of apoptosis (Puma), a proapoptotic Bcl-2 homology domain 3-only protein under p53 control, was increased within a few hours of SE. Induction of Puma was blocked by pharmacologic inhibition of p53, and hippocampal damage was also reduced. Puma induction was also blocked in p53-deficient mice subject to SE. Compared to Puma-expressing mice, Puma-deficient mice had significantly smaller hippocampal lesions after SE. Long-term, continuous telemetric EEG monitoring revealed a ∼60% reduction in the frequency of epileptic seizures in the Puma-deficient mice compared to Puma-expressing mice. These are the first data showing genetic deletion of a proapoptotic protein acting acutely to influence neuronal death subsequently alters the phenotype of epilepsy in the long-term, supporting the concept that apoptotic pathway activation is a trigger of epileptogenesis.—Engel, T., Murphy, B. M., Hatazaki, S., Jimenez-Mateos, E. M., Concannon, C. G., Woods, I., Prehn, J. H. M., Henshall, D. C. Reduced hippocampal damage and epileptic seizures after status epilepticus in mice lacking proapoptotic Puma. PMID:19890018

  18. Heterogeneity of p53 dependent genomic responses following ethanol exposure in a developmental mouse model of fetal alcohol spectrum disorder.

    PubMed

    Camargo Moreno, Maria; Mooney, Sandra M; Middleton, Frank A

    2017-01-01

    Prenatal ethanol exposure can produce structural and functional deficits in the brain and result in Fetal Alcohol Spectrum Disorder (FASD). In rodent models acute exposure to a high concentration of alcohol causes increased apoptosis in the developing brain. A single causal molecular switch that signals for this increase in apoptosis has yet to be identified. The protein p53 has been suggested to play a pivotal role in enabling cells to engage in pro-apoptotic processes, and thus figures prominently as a hub molecule in the intracellular cascade of responses elicited by alcohol exposure. In the present study we examined the effect of ethanol-induced cellular and molecular responses in primary somatosensory cortex (SI) and hippocampus of 7-day-old wild-type (WT) and p53-knockout (KO) mice. We quantified apoptosis by active caspase-3 immunohistochemistry and ApopTag™ labeling, then determined total RNA expression levels in laminae of SI and hippocampal subregions. Immunohistochemical results confirmed increased incidence of apoptotic cells in both regions in WT and KO mice following ethanol exposure. The lack of p53 was not protective in these brain regions. Molecular analyses revealed a heterogeneous response to ethanol exposure that varied depending on the subregion, and which may go undetected using a global approach. Gene network analyses suggest that the presence or absence of p53 alters neuronal function and synaptic modifications following ethanol exposure, in addition to playing a classic role in cell cycle signaling. Thus, p53 may function in a way that underlies the intellectual and behavioral deficits observed in FASD.

  19. E3 ubiquitin ligase Pirh2 enhances tumorigenic properties of human non-small cell lung carcinoma cells

    PubMed Central

    Fedorova, Olga; Shuvalov, Oleg; Merkulov, Valeriy; Vasileva, Elena; Antonov, Alexey; Barlev, Nikolai A.

    2016-01-01

    The product of RCHY1 human gene, Pirh2, is a RING-finger containing E3 ligase that modifies p53 with ubiquitin residues resulting in its subsequent degradation in proteasomes. Transcription of RCHY1 is regulated by p53 itself thus forming a negative regulatory feedback loop. Functionally, by eliminating p53, Pirh2 facilitates tumorigenesis. However, the role of Pirh2 in cancer cells lacking p53 is yet not well understood. Therefore, we decided to elucidate the role of Pirh2 in p53-negative human non-small cell lung carcinoma cells, H1299. We found that ectopic expression of Pirh2 enhanced cell proliferation, resistance to doxorubicin, and increased migration potential. Ablation of Pirh2 by specific shRNA reversed these phenotypes. Mechanistically, Pirh2 increased mRNA and protein levels of the c-Myc oncogene. The bioinformatics data indicate that co-expression of both c-Myc and Pirh2 strongly correlated with poor survival of lung cancer patients. Collectively, our results suggest that Pirh2 can be considered as a potential pharmacological target for developing anticancer therapies to treat p53-negative cancers. PMID:28191284

  20. Monitoring p53 by MDM2 and MDMX is required for endocrine pancreas development and function in a spatio-temporal manner.

    PubMed

    Zhang, Yiwei; Zeng, Shelya X; Hao, Qian; Lu, Hua

    2017-03-01

    Although p53 is not essential for normal embryonic development, it plays a pivotal role in many biological and pathological processes, including cell fate determination-dependent and independent events and diseases. The expression and activity of p53 largely depend on its two biological inhibitors, MDM2 and MDMX, which have been shown to form a complex in order to tightly control p53 to an undetectable level during early stages of embryonic development. However, more delicate studies using conditional gene-modification mouse models show that MDM2 and MDMX may function separately or synergistically on p53 regulation during later stages of embryonic development and adulthood in a cell and tissue-specific manner. Here, we report the role of the MDM2/MDMX-p53 pathway in pancreatic islet morphogenesis and functional maintenance, using mouse lines with specific deletion of MDM2 or MDMX in pancreatic endocrine progenitor cells. Interestingly, deletion of MDM2 results in defects of embryonic endocrine pancreas development, followed by neonatal hyperglycemia and lethality, by inducing pancreatic progenitor cell apoptosis and inhibiting cell proliferation. However, unlike MDM2-knockout animals, mice lacking MDMX in endocrine progenitor cells develop normally. But, surprisingly, the survival rate of adult MDMX-knockout mice drastically declines compared to control mice, as blockage of neonatal development of endocrine pancreas by inhibition of cell proliferation and subsequent islet dysfunction and hyperglycemia eventually lead to type 1 diabetes-like disease with advanced diabetic nephropathy. As expected, both MDM2 and MDMX deletion-caused pancreatic defects are completely rescued by loss of p53, verifying the crucial role of the MDM2 and/or MDMX in regulating p53 in a spatio-temporal manner during the development, functional maintenance, and related disease progress of endocrine pancreas. Also, our study suggests a possible mouse model of advanced diabetic nephropathy, which is complementary to other established diabetic models and perhaps useful for the development of anti-diabetes therapies. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Chronic centrosome amplification without tumorigenesis

    PubMed Central

    Vitre, Benjamin; Holland, Andrew J.; Kulukian, Anita; Shoshani, Ofer; Hirai, Maretoshi; Wang, Yin; Maldonado, Marcus; Cho, Thomas; Boubaker, Jihane; Swing, Deborah A.; Tessarollo, Lino; Evans, Sylvia M.; Fuchs, Elaine; Cleveland, Don W.

    2015-01-01

    Centrosomes are microtubule-organizing centers that facilitate bipolar mitotic spindle assembly and chromosome segregation. Recognizing that centrosome amplification is a common feature of aneuploid cancer cells, we tested whether supernumerary centrosomes are sufficient to drive tumor development. To do this, we constructed and analyzed mice in which centrosome amplification can be induced by a Cre-recombinase–mediated increase in expression of Polo-like kinase 4 (Plk4). Elevated Plk4 in mouse fibroblasts produced supernumerary centrosomes and enhanced the expected mitotic errors, but proliferation continued only after inactivation of the p53 tumor suppressor. Increasing Plk4 levels in mice with functional p53 produced centrosome amplification in liver and skin, but this did not promote spontaneous tumor development in these tissues or enhance the growth of chemically induced skin tumors. In the absence of p53, Plk4 overexpression generated widespread centrosome amplification, but did not drive additional tumors or affect development of the fatal thymic lymphomas that arise in animals lacking p53. We conclude that, independent of p53 status, supernumerary centrosomes are not sufficient to drive tumor formation. PMID:26578792

  2. Heterogeneity of p53 dependent genomic responses following ethanol exposure in a developmental mouse model of fetal alcohol spectrum disorder

    PubMed Central

    Mooney, Sandra M.; Middleton, Frank A.

    2017-01-01

    Prenatal ethanol exposure can produce structural and functional deficits in the brain and result in Fetal Alcohol Spectrum Disorder (FASD). In rodent models acute exposure to a high concentration of alcohol causes increased apoptosis in the developing brain. A single causal molecular switch that signals for this increase in apoptosis has yet to be identified. The protein p53 has been suggested to play a pivotal role in enabling cells to engage in pro-apoptotic processes, and thus figures prominently as a hub molecule in the intracellular cascade of responses elicited by alcohol exposure. In the present study we examined the effect of ethanol-induced cellular and molecular responses in primary somatosensory cortex (SI) and hippocampus of 7-day-old wild-type (WT) and p53-knockout (KO) mice. We quantified apoptosis by active caspase-3 immunohistochemistry and ApopTag™ labeling, then determined total RNA expression levels in laminae of SI and hippocampal subregions. Immunohistochemical results confirmed increased incidence of apoptotic cells in both regions in WT and KO mice following ethanol exposure. The lack of p53 was not protective in these brain regions. Molecular analyses revealed a heterogeneous response to ethanol exposure that varied depending on the subregion, and which may go undetected using a global approach. Gene network analyses suggest that the presence or absence of p53 alters neuronal function and synaptic modifications following ethanol exposure, in addition to playing a classic role in cell cycle signaling. Thus, p53 may function in a way that underlies the intellectual and behavioral deficits observed in FASD. PMID:28723918

  3. The ubiquitin ligase LIN41/TRIM71 targets p53 to antagonize cell death and differentiation pathways during stem cell differentiation

    PubMed Central

    Nguyen, Duong Thi Thuy; Richter, Daniel; Michel, Geert; Mitschka, Sibylle; Kolanus, Waldemar; Cuevas, Elisa; Gregory Wulczyn, F

    2017-01-01

    Rapidity and specificity are characteristic features of proteolysis mediated by the ubiquitin-proteasome system. Therefore, the UPS is ideally suited for the remodeling of the embryonic stem cell proteome during the transition from pluripotent to differentiated states and its inverse, the generation of inducible pluripotent stem cells. The Trim-NHL family member LIN41 is among the first E3 ubiquitin ligases to be linked to stem cell pluripotency and reprogramming. Initially discovered in C. elegans as a downstream target of the let-7 miRNA, LIN41 is now recognized as a critical regulator of stem cell fates as well as the timing of neurogenesis. Despite being indispensable for embryonic development and neural tube closure in mice, the underlying mechanisms for LIN41 function in these processes are poorly understood. To better understand the specific contributions of the E3 ligase activity for the stem cell functions of LIN41, we characterized global changes in ubiquitin or ubiquitin-like modifications using Lin41-inducible mouse embryonic stem cells. The tumor suppressor protein p53 was among the five most strongly affected proteins in cells undergoing neural differentiation in response to LIN41 induction. We show that LIN41 interacts with p53, controls its abundance by ubiquitination and antagonizes p53-dependent pro-apoptotic and pro-differentiation responses. In vivo, the lack of LIN41 is associated with upregulation of Grhl3 and widespread caspase-3 activation, two downstream effectors of p53 with essential roles in neural tube closure. As Lin41-deficient mice display neural tube closure defects, we conclude that LIN41 is critical for the regulation of p53 functions in cell fate specification and survival during early brain development. PMID:28430184

  4. Impact of p53 status on heavy-ion radiation-induced micronuclei in circulating erythrocytes

    NASA Technical Reports Server (NTRS)

    Chang, P. Y.; Torous, D.; Lutze-Mann, L.; Winegar, R.

    2000-01-01

    Transgenic mice that differed in their p53 genetic status were exposed to an acute dose of highly charged and energetic (HZE) iron particle radiation. Micronuclei (MN) in two distinct populations of circulating peripheral blood erythrocytes, the immature reticulocytes (RETs) and the mature normochromatic erythrocytes (NCEs), were measured using a simple and efficient flow cytometric procedure. Our results show significant elevation in the frequency of micronucleated RETs (%MN-RETs) at 2 and 3 days post-radiation. At 3 days post-irradiation, the magnitude of the radiation-induced MN-RET was 2.3-fold higher in the irradiated p53 wild-type animals compared to the unirradiated controls, 2.5-fold higher in the p53 hemizygotes and 4.3-fold higher in the p53 nullizygotes. The persistence of this radiation-induced elevation of MN-RETs is dependent on the p53 genetic background of the animal. In the p53 wild-type and p53 hemizygotes, %MN-RETs returned to control levels by 9 days post-radiation. However, elevated levels of %MN-RETs in p53 nullizygous mice persisted beyond 56 days post-radiation. We also observed elevated MN-NCEs in the peripheral circulation after radiation, but the changes in radiation-induced levels of MN-NCEs appear dampened compared to those of the MN-RETs for all three strains of animals. These results suggest that the lack of p53 gene function may play a role in the iron particle radiation-induced genomic instability in stem cell populations in the hematopoietic system.

  5. Activating mutations for transformation by p53 produce a gene product that forms an hsc70-p53 complex with an altered half-life

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Finlay, C.A.; Hinds, P.W.; Tan, T.H.

    1988-02-01

    The 11-4 p53 cDNA clone failed to transform primary rat fibroblasts when cotransfected with the ras oncogene. Two linker insertion mutations at amino acid 158 or 215 (of 390 amino acids) activated this p53 cDNA for transformation with ras. These mutant cDNAs produced a p53 protein that lacked an epitope, recognized by monoclonal antibody PAb246 (localized at amino acids 88 to 110 in the protein) and preferentially bound to a heat shock protein, hsc70. In rat cells transformed by a genomic p53 clone plus ras, two populations of p53 proteins were detected, PAb246/sup +/ and PAb246/sup -/, which did ormore » did not bind to this monoclonal antibody, respectively. The PAb246/sup -/ p53 preferentially associated with hsc70, and this protein has a half-life 4- to 20-fold longer than free p53 (PAb246/sup +/). These data suggest a possible functional role for hsc70 in the transformation process. cDNAs for p53 derived from methylcholanthrene-transformed cells transform rat cells in cooperation with the ras oncogene and produce a protein that bound with the heat shock proteins. Recombinant clones produced between a Meth A cDNA and 11-4 were tested for the ability to transform rat cells. A single amino acid substitution at residue 132 was sufficient to activate the 11-4 p53 cDNA for transformation. These studies have identified a region between amino acids 132 and 215 in the p53 protein which, when mutated, can activate the p53 cDNA. These results also call into question what the correct p53 wild-type sequence is and whether a wild-type p53 gene can transform cells in culture.« less

  6. Reversible p53 inhibition prevents cisplatin ototoxicity without blocking chemotherapeutic efficacy.

    PubMed

    Benkafadar, Nesrine; Menardo, Julien; Bourien, Jérôme; Nouvian, Régis; François, Florence; Decaudin, Didier; Maiorano, Domenico; Puel, Jean-Luc; Wang, Jing

    2017-01-01

    Cisplatin is a widely used chemotherapy drug, despite its significant ototoxic side effects. To date, the mechanism of cisplatin-induced ototoxicity remains unclear, and hearing preservation during cisplatin-based chemotherapy in patients is lacking. We found activation of the ATM-Chk2-p53 pathway to be a major determinant of cisplatin ototoxicity. However, prevention of cisplatin-induced ototoxicity is hampered by opposite effects of ATM activation upon sensory hair cells: promoting both outer hair cell death and inner hair cell survival. Encouragingly, however, genetic or pharmacological ablation of p53 substantially attenuated cochlear cell apoptosis, thus preserving hearing. Importantly, systemic administration of a p53 inhibitor in mice bearing patient-derived triple-negative breast cancer protected auditory function, without compromising the anti-tumor efficacy of cisplatin. Altogether, these findings highlight a novel and effective strategy for hearing protection in cisplatin-based chemotherapy. © 2016 The Authors. Published under the terms of the CC BY 4.0 license.

  7. Down-Regulation of p53 by Double-Stranded RNA Modulates the Antiviral Response

    PubMed Central

    Marques, Joao T.; Rebouillat, Dominique; Ramana, Chilakamarti V.; Murakami, Junko; Hill, Jason E.; Gudkov, Andrei; Silverman, Robert H.; Stark, George R.; Williams, Bryan R. G.

    2005-01-01

    p53 has been well characterized as a tumor suppressor gene, but its role in antiviral defense remains unclear. A recent report has demonstrated that p53 can be induced by interferons and is activated after vesicular stomatitis virus (VSV) infection. We observed that different nononcogenic viruses, including encephalomyocarditis virus (EMCV) and human parainfluenza virus type 3 (HPIV3), induced down-regulation of p53 in infected cells. Double-stranded RNA (dsRNA) and a mutant vaccinia virus lacking the dsRNA binding protein E3L can also induce this effect, indicating that dsRNA formed during viral infection is likely the trigger for down-regulation of p53. The mechanism of down-regulation of p53 by dsRNA relies on translation inhibition mediated by the PKR and RNase L pathways. In the absence of p53, the replication of both EMCV and HPIV3 was retarded, whereas, conversely, VSV replication was enhanced. Cell cycle analysis indicated that wild-type (WT) but not p53 knockout (KO) fibroblasts undergo an early-G1 arrest following dsRNA treatment. Moreover, in WT cells the onset of dsRNA-induced apoptosis begins after p53 levels are down-regulated, whereas p53 KO cells, which lack the early-G1 arrest, rapidly undergo apoptosis. Hence, our data suggest that the down-regulation of p53 facilitates apoptosis, thereby limiting viral replication. PMID:16103161

  8. Preferential Binding of Hot Spot Mutant p53 Proteins to Supercoiled DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Navrátilová, Lucie; Tichý, Vlastimil; Němcová, Kateřina; Lexa, Matej; Hrstka, Roman; Pečinka, Petr; Adámik, Matej; Vojtesek, Borivoj; Paleček, Emil; Deppert, Wolfgang; Fojta, Miroslav

    2013-01-01

    Hot spot mutant p53 (mutp53) proteins exert oncogenic gain-of-function activities. Binding of mutp53 to DNA is assumed to be involved in mutp53-mediated repression or activation of several mutp53 target genes. To investigate the importance of DNA topology on mutp53-DNA recognition in vitro and in cells, we analyzed the interaction of seven hot spot mutp53 proteins with topologically different DNA substrates (supercoiled, linear and relaxed) containing and/or lacking mutp53 binding sites (mutp53BS) using a variety of electrophoresis and immunoprecipitation based techniques. All seven hot spot mutp53 proteins (R175H, G245S, R248W, R249S, R273C, R273H and R282W) were found to have retained the ability of wild-type p53 to preferentially bind circular DNA at native negative superhelix density, while linear or relaxed circular DNA was a poor substrate. The preference of mutp53 proteins for supercoiled DNA (supercoil-selective binding) was further substantiated by competition experiments with linear DNA or relaxed DNA in vitro and ex vivo. Using chromatin immunoprecipitation, the preferential binding of mutp53 to a sc mutp53BS was detected also in cells. Furthermore, we have shown by luciferase reporter assay that the DNA topology influences p53 regulation of BAX and MSP/MST1 promoters. Possible modes of mutp53 binding to topologically constrained DNA substrates and their biological consequences are discussed. PMID:23555710

  9. Chk1/2 inhibition overcomes the cisplatin resistance of head and neck cancer cells secondary to the loss of functional p53

    PubMed Central

    Gadhikar, Mayur A.; Sciuto, Maria Rita; Alves, Marcus Vinicius Ortega; Pickering, Curtis R.; Osman, Abdullah A.; Neskey, David M.; Zhao, Mei; Fitzgerald, Alison L.; Myers, Jeffrey N.; Frederick, Mitchell J

    2014-01-01

    Despite the use of multimodality therapy employing cisplatin to treat patients with advanced stage head and neck squamous cell carcinoma (HNSCC), there is an unacceptably high rate of treatment failure. TP53 is the most commonly mutated gene in HNSCC, and the impact of p53 mutation on response to cisplatin treatment is poorly understood. Here we show unambiguously that wild type TP53 (wtp53) is associated with sensitivity of HNSCC cells to cisplatin treatment while mutation or loss of TP53 is associated with cisplatin resistance. We also demonstrate that senescence is the major cellular response to cisplatin in wtp53 HNSCC cells and that cisplatin resistance in p53 null or mutant TP53 cells is due to their lack of senescence. Given the dependence on Chk1/2 kinases to mediate the DNA damage response in p53 deficient cells, there is potential to exploit this to therapeutic advantage through targeted inhibition of the Chk1/2 kinases. Treatment of p53 deficient HNSCC cells with the Chk inhibitor AZD7762 sensitizes them to cisplatin through induction of mitotic cell death. This is the first report demonstrating the ability of a Chk kinase inhibitor to sensitize TP53-deficient HNSCC to cisplatin in a synthetic lethal manner, which has significance given the frequency of TP53 mutations in this disease and because cisplatin has become part of standard therapy for aggressive HNSCC tumors. These pre-clinical data provide evidence that a personalized approach to the treatment of HNSCC based on Chk inhibition in p53 mutant tumors may be feasible. PMID:23839309

  10. Gamma rays induce a p53-independent mitochondrial biogenesis that is counter-regulated by HIF1α

    PubMed Central

    Bartoletti-Stella, A; Mariani, E; Kurelac, I; Maresca, A; Caratozzolo, M F; Iommarini, L; Carelli, V; Eusebi, L H; Guido, A; Cenacchi, G; Fuccio, L; Rugolo, M; Tullo, A; Porcelli, A M; Gasparre, G

    2013-01-01

    Mitochondrial biogenesis is an orchestrated process that presides to the regulation of the organelles homeostasis within a cell. We show that γ-rays, at doses commonly used in the radiation therapy for cancer treatment, induce an increase in mitochondrial mass and function, in response to a genotoxic stress that pushes cells into senescence, in the presence of a functional p53. Although the main effector of the response to γ-rays is the p53-p21 axis, we demonstrated that mitochondrial biogenesis is only indirectly regulated by p53, whose activation triggers a murine double minute 2 (MDM2)-mediated hypoxia-inducible factor 1α (HIF1α) degradation, leading to the release of peroxisome-proliferator activated receptor gamma co-activator 1β inhibition by HIF1α, thus promoting mitochondrial biogenesis. Mimicking hypoxia by HIF1α stabilization, in fact, blunts the mitochondrial response to γ-rays as well as the induction of p21-mediated cell senescence, indicating prevalence of the hypoxic over the genotoxic response. Finally, we also show in vivo that post-radiotherapy mitochondrial DNA copy number increase well correlates with lack of HIF1α increase in the tissue, concluding this may be a useful molecular tool to infer the trigger of a hypoxic response during radiotherapy, which may lead to failure of activation of cell senescence. PMID:23764844

  11. Telomere dysfunction and cell survival: Roles for distinct TIN2-containing complexes

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Sahn-ho; Davalos, Albert R.; Heo, Seok-Jin

    Telomeres are maintained by three DNA binding proteins (TRF1, TRF2 and POT1), and several associated factors. One factor, TIN2, binds TRF1 and TRF2 directly and POT1 indirectly. Along with two other proteins, TPP1 and hRap1, these form a soluble complex that may be the core telomere maintenance complex. It is not clear whether sub-complexes also exist in vivo. We provide evidence for two TIN2 sub-complexes with distinct functions in human cells. We isolated these two TIN2 sub-complexes from nuclear lysates of unperturbed cells and cells expressing TIN2 mutants TIN2-13, TIN2-15C, which cannot bind TRF2 or TRF1, respectively. In cells withmore » wild-type p53 function, TIN2-15C was more potent than TIN2-13 in causing telomere uncapping and eventual growth arrest. In cells lacking p53 function, TIN2-15C was more potent than TIN2-13 in causing telomere dysfunction and cell death. Our findings suggest that distinct TIN2 complexes exist, and that TIN2-15C-sensitive subcomplexes are particularly important for cell survival in the absence of functional p53.« less

  12. Loss of p53 protein during radiation transformation of primary human mammary epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wazer, D.E.; Chu, Qiuming; Liu, Xiao Long

    1994-04-01

    The causative factors leading to breast cancer are largely unknown. Increased incidence of breast cancer following diagnostic or therapeutic radiation suggests that radiation may contribute to mammary oncogenesis. This report describes the in vitro neoplastic transformation of a normal human mammary epithelial cell strain, 76N, by fractionated [gamma]-irradiation at a clinically used dose (30 Gy). The transformed cells (76R-30) were immortal, had reduced growth factor requirements, and produced tumors in nude mice. Remarkably, the 76R-30 cells completely lacked the p53 tumor suppressor protein. Loss of p53 was due to deletion of the gene on one allele and a 26-bp deletionmore » within the third intron on the second allele which resulted in abnormal splicing out of either the third or fourth exon from the mRNA. PCR with a mutation-specific primer showed that intron 3 mutation was present in irradiated cells before selection for immortal phenotype. 76R-30 cells did not exhibit G[sub 1] arrest in response to radiation, indicating a loss of p53-mediated function. Expression of the wild-type p53 gene in 76R-30 cells led to their growth inhibition. Thus, loss of p53 protein appears to have contributed to neoplastic transformation of these cells. This unique model should facilitate analyses of molecular mechanisms of radiation-induced breast cancer and allow identification of p53-regulated cellular genes in breast cells. 44 refs., 8 figs., 1 tab.« less

  13. Loss of p53 induces cell proliferation via Ras-independent activation of the Raf/Mek/Erk signaling pathway

    PubMed Central

    Drosten, Matthias; Sum, Eleanor Y. M.; Lechuga, Carmen G.; Simón-Carrasco, Lucía; Jacob, Harrys K. C.; García-Medina, Raquel; Huang, Sidong; Beijersbergen, Roderick L.; Bernards, Rene; Barbacid, Mariano

    2014-01-01

    The Ras family of small GTPases constitutes a central node in the transmission of mitogenic stimuli to the cell cycle machinery. The ultimate receptor of these mitogenic signals is the retinoblastoma (Rb) family of pocket proteins, whose inactivation is a required step to license cell proliferation. However, little is known regarding the molecular events that connect Ras signaling with the cell cycle. Here, we provide genetic evidence to illustrate that the p53/p21 Cdk-interacting protein 1 (Cip1)/Rb axis is an essential component of the Ras signaling pathway. Indeed, knockdown of p53, p21Cip1, or Rb restores proliferative properties in cells arrested by ablation of the three Ras loci, H-, N- and K-Ras. Ras signaling selectively inactivates p53-mediated induction of p21Cip1 expression by inhibiting acetylation of specific lysine residues in the p53 DNA binding domain. Proliferation of cells lacking both Ras proteins and p53 can be prevented by reexpression of the human p53 ortholog, provided that it retains an active DNA binding domain and an intact lysine residue at position 164. These results unveil a previously unidentified role for p53 in preventing cell proliferation under unfavorable mitogenic conditions. Moreover, we provide evidence that cells lacking Ras and p53 proteins owe their proliferative properties to the unexpected retroactivation of the Raf/Mek/Erk cascade by a Ras-independent mechanism. PMID:25288756

  14. Cyclophosphamide dose intensification may circumvent anthracycline resistance of p53 mutant breast cancers.

    PubMed

    Lehmann-Che, Jacqueline; André, Fabrice; Desmedt, Christine; Mazouni, Chafika; Giacchetti, Sylvie; Turpin, Elisabeth; Espié, Marc; Plassa, Louis-François; Marty, Michel; Bertheau, Philippe; Sotiriou, Christos; Piccart, Martine; Symmans, W Fraser; Pusztai, Lajos; de Thé, Hugues

    2010-01-01

    The predictive value of p53 for the efficacy of front-line anthracycline-based chemotherapy regimens has been a matter of significant controversy. Anthracyclines are usually combined with widely different doses of alkylating agents, which may significantly modulate tumor response to these combinations. We analyzed three series of de novo stage II-III breast cancer patients treated front line with anthracycline-based regimens of various cyclophosphamide dose intensities: 65 patients with estrogen receptor (ER)(-) tumors treated with anthracyclines alone (Institut Jules Bordet, Brussels), 51 unselected breast cancer patients treated with intermediate doses of cyclophosphamide (MD Anderson Cancer Center, Houston, TX), and 128 others treated with a dose-dense anthracycline-cyclophosphamide combination (St. Louis, Paris). After chemotherapy and surgery, pathologic complete response (pCR) was evaluated. p53 status was determined by a yeast functional assay on the pretreatment tumor sample. In a multivariate analysis of the pooled results, a lack of ER expression and high-dose cyclophosphamide administration were associated with a higher likelihood of pCR. A sharp statistical interaction was detected between p53 status and cyclophosphamide dose intensity. Indeed, when restricting our analysis to patients with ER(-) tumors, we confirmed that a mutant p53 status was associated with anthracycline resistance, but found that p53 inactivation was required for response to the dose-intense alkylating regimen. The latter allowed very high levels of pCR in triple-negative tumors. Thus, our data strongly suggest that cyclophosphamide dose intensification in ER(-) p53-mutated breast cancer patients could significantly improve their response.

  15. PRMT1-Mediated Translation Regulation Is a Crucial Vulnerability of Cancer.

    PubMed

    Hsu, Jessie Hao-Ru; Hubbell-Engler, Benjamin; Adelmant, Guillaume; Huang, Jialiang; Joyce, Cailin E; Vazquez, Francisca; Weir, Barbara A; Montgomery, Philip; Tsherniak, Aviad; Giacomelli, Andrew O; Perry, Jennifer A; Trowbridge, Jennifer; Fujiwara, Yuko; Cowley, Glenn S; Xie, Huafeng; Kim, Woojin; Novina, Carl D; Hahn, William C; Marto, Jarrod A; Orkin, Stuart H

    2017-09-01

    Through an shRNA screen, we identified the protein arginine methyltransferase Prmt1 as a vulnerable intervention point in murine p53/Rb-null osteosarcomas, the human counterpart of which lacks effective therapeutic options. Depletion of Prmt1 in p53-deficient cells impaired tumor initiation and maintenance in vitro and in vivo Mechanistic studies reveal that translation-associated pathways were enriched for Prmt1 downstream targets, implicating Prmt1 in translation control. In particular, loss of Prmt1 led to a decrease in arginine methylation of the translation initiation complex, thereby disrupting its assembly and inhibiting translation. p53/Rb-null cells were sensitive to p53-induced translation stress, and analysis of human cancer cell line data from Project Achilles further revealed that Prmt1 and translation-associated pathways converged on the same functional networks. We propose that targeted therapy against Prmt1 and its associated translation-related pathways offer a mechanistic rationale for treatment of osteosarcomas and other cancers that exhibit dependencies on translation stress response. Cancer Res; 77(17); 4613-25. ©2017 AACR . ©2017 American Association for Cancer Research.

  16. Small-molecule MDM2 antagonists attenuate the senescence-associated secretory phenotype.

    PubMed

    Wiley, Christopher D; Schaum, Nicholas; Alimirah, Fatouma; Lopez-Dominguez, Jose Alberto; Orjalo, Arturo V; Scott, Gary; Desprez, Pierre-Yves; Benz, Christopher; Davalos, Albert R; Campisi, Judith

    2018-02-05

    Processes that have been linked to aging and cancer include an inflammatory milieu driven by senescent cells. Senescent cells lose the ability to divide, essentially irreversibly, and secrete numerous proteases, cytokines and growth factors, termed the senescence-associated secretory phenotype (SASP). Senescent cells that lack p53 tumor suppressor function show an exaggerated SASP, suggesting the SASP is negatively controlled by p53. Here, we show that increased p53 activity caused by small molecule inhibitors of MDM2, which promotes p53 degradation, reduces inflammatory cytokine production by senescent cells. Upon treatment with the MDM2 inhibitors nutlin-3a or MI-63, human cells acquired a senescence-like growth arrest, but the arrest was reversible. Importantly, the inhibitors reduced expression of the signature SASP factors IL-6 and IL-1α by cells made senescent by genotoxic stimuli, and suppressed the ability of senescent fibroblasts to stimulate breast cancer cell aggressiveness. Our findings suggest that MDM2 inhibitors could reduce cancer progression in part by reducing the pro-inflammatory environment created by senescent cells.

  17. Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy.

    PubMed

    Shchors, Ksenya; Persson, Anders I; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S; Hanahan, Douglas; Weiss, William A; Evan, Gerard I

    2013-04-16

    Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRas(V12) mouse model crossed into the p53ER(TAM) background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ER(TAM) allele. The p53ER(TAM) protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRas(V12);p53(+/KI) mice abrogate the p53 pathway by mutating p19(ARF)/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ER(TAM) allele. By contrast, gliomas arising in GFAP-HRas(V12);p53(KI/KI) mice develop in the absence of functional p53. Such tumors retain a functional p19(ARF)/MDM2-signaling pathway, and restoration of p53ER(TAM) allele triggers p53-tumor-suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14(ARF)/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRas(V12);p53(KI/KI) animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ER(TAM) activity mitigated the selective pressure to inactivate the p19(ARF)/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance.

  18. Using a preclinical mouse model of high-grade astrocytoma to optimize p53 restoration therapy

    PubMed Central

    Shchors, Ksenya; Persson, Anders I.; Rostker, Fanya; Tihan, Tarik; Lyubynska, Natalya; Li, Nan; Swigart, Lamorna Brown; Berger, Mitchel S.; Hanahan, Douglas; Weiss, William A.; Evan, Gerard I.

    2013-01-01

    Based on clinical presentation, glioblastoma (GBM) is stratified into primary and secondary types. The protein 53 (p53) pathway is functionally incapacitated in most GBMs by distinctive type-specific mechanisms. To model human gliomagenesis, we used a GFAP-HRasV12 mouse model crossed into the p53ERTAM background, such that either one or both copies of endogenous p53 is replaced by a conditional p53ERTAM allele. The p53ERTAM protein can be toggled reversibly in vivo between wild-type and inactive conformations by administration or withdrawal of 4-hydroxytamoxifen (4-OHT), respectively. Surprisingly, gliomas that develop in GFAP-HRasV12;p53+/KI mice abrogate the p53 pathway by mutating p19ARF/MDM2 while retaining wild-type p53 allele. Consequently, such tumors are unaffected by restoration of their p53ERTAM allele. By contrast, gliomas arising in GFAP-HRasV12;p53KI/KI mice develop in the absence of functional p53. Such tumors retain a functional p19ARF/MDM2-signaling pathway, and restoration of p53ERTAM allele triggers p53-tumor–suppressor activity. Congruently, growth inhibition upon normalization of mutant p53 by a small molecule, Prima-1, in human GBM cultures also requires p14ARF/MDM2 functionality. Notably, the antitumoral efficacy of p53 restoration in tumor-bearing GFAP-HRasV12;p53KI/KI animals depends on the duration and frequency of p53 restoration. Thus, intermittent exposure to p53ERTAM activity mitigated the selective pressure to inactivate the p19ARF/MDM2/p53 pathway as a means of resistance, extending progression-free survival. Our results suggest that intermittent dosing regimes of drugs that restore wild-type tumor-suppressor function onto mutant, inactive p53 proteins will prove to be more efficacious than traditional chronic dosing by similarly reducing adaptive resistance. PMID:23542378

  19. Lack of association of the TP53 Arg72Pro SNP and the MDM2 SNP309 with systemic lupus erythematosus in Caucasian, African American, and Asian children and adults.

    PubMed

    Onel, K B; Huo, D; Hastings, D; Fryer-Biggs, J; Crow, M K; Onel, K

    2009-01-01

    The p53 tumour suppressor is the central regulator of apoptosis. Previously, the functional TP53 Arg72Pro polymorphism was found to be associated with systemic lupus erythematosus (SLE) in Koreans but not Spaniards. MDM2 is the major negative regulator of p53. An intronic polymorphism in MDM2, the SNP309, attenuates p53 activity and is associated with accelerated tumour development in premenopausal women. Polymorphic variation in MDM2 has never been studied in SLE. The aim of this study is to further assess the contribution of p53-pathway genetic variation to SLE by testing the association of the TP53 Arg72Pro polymorphism and the MDM2 SNP309 with SLE in a well-characterised and ethnically diverse cohort of patients with both childhood- and adult-onset SLE (n = 314). No association was found between the TP53 Arg72Pro polymorphism and SLE in patients of European descent, Asian descent or in African Americans, nor was an association found between the MDM2 SNP309 and SLE in patients of European descent or in African Americans. In addition, there was no correlation between either variant and early-onset disease or nephritis, an index of severe disease. It is concluded that neither the TP53 Arg72Pro polymorphism nor the MDM2 SNP309 contributes significantly to either susceptibility or disease severity in SLE.

  20. WWOX and p53 Dysregulation Synergize to Drive the Development of Osteosarcoma.

    PubMed

    Del Mare, Sara; Husanie, Hussam; Iancu, Ortal; Abu-Odeh, Mohammad; Evangelou, Konstantinos; Lovat, Francesca; Volinia, Stefano; Gordon, Jonathan; Amir, Gail; Stein, Janet; Stein, Gary S; Croce, Carlo M; Gorgoulis, Vassilis; Lian, Jane B; Aqeilan, Rami I

    2016-10-15

    Osteosarcoma is a highly metastatic form of bone cancer in adolescents and young adults that is resistant to existing treatments. Development of an effective therapy has been hindered by very limited understanding of the mechanisms of osteosarcomagenesis. Here, we used genetically engineered mice to investigate the effects of deleting the tumor suppressor Wwox selectively in either osteoblast progenitors or mature osteoblasts. Mice with conditional deletion of Wwox in preosteoblasts (Wwox Δosx1 ) displayed a severe inhibition of osteogenesis accompanied by p53 upregulation, effects that were not observed in mice lacking Wwox in mature osteoblasts. Deletion of p53 in Wwox Δosx1 mice rescued the osteogenic defect. In addition, the Wwox;p53 Δosx1 double knockout mice developed poorly differentiated osteosarcomas that resemble human osteosarcoma in histology, location, metastatic behavior, and gene expression. Strikingly, the development of osteosarcomas in these mice was greatly accelerated compared with mice lacking p53 only. In contrast, combined WWOX and p53 inactivation in mature osteoblasts did not accelerate osteosarcomagenesis compared with p53 inactivation alone. These findings provide evidence that a WWOX-p53 network regulates normal bone formation and that disruption of this network in osteoprogenitors results in accelerated osteosarcoma. The Wwox;p53 Δosx1 double knockout establishes a new osteosarcoma model with significant advancement over existing models. Cancer Res; 76(20); 6107-17. ©2016 AACR. ©2016 American Association for Cancer Research.

  1. Downregulated long non-coding RNA MEG3 in breast cancer regulates proliferation, migration and invasion by depending on p53’s transcriptional activity

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sun, Lin; Li, Yu; Yang, Bangxiang, E-mail: b19933009@qq.coom

    Long non-coding RNAs (lncRNAs) was found to play critical roles in tumorigenesis, hence, screen of tumor-related lncRNAs, identification of their biological roles is important for understanding the processes of tumorigenesis. In this study, we identified the expressing difference of several tumor-related lncRNAs in breast cancer samples and found that, MEG3, which is downregulated in non-small cell lung cancer (NSCLC) tumor tissues, is also downregulated in breast cancer samples compared with adjacent tissues. For figuring out the effect of MEG3 in breast cancer cells MCF7 and MB231, we overexpressed MEG3 in these cells, and found that it resulted the inhibition ofmore » proliferation, colony formation, migration and invasion capacities by enhancing p53’s transcriptional activity on its target genes, including p21, Maspin and KAI1. MEG3 presented similar effects in MB157, which is a p53-null breast cancer cell line, when functional p53 but not p53R273H mutant, which lacks transcriptional activity, was introduced. Surprisingly, overexpression of MEG3 activates p53’s transcriptional activity by decreasing MDM2’s transcription level, and thus stabilizes and accumulates P53. Taken together, our findings indicate that MEG3 is downregulated in breast cancer tissues and affects breast cancer cells’ malignant behaviors, which indicate MEG3 a potential therapeutic target for breast cancer. - Highlights: • MEG3 RNA is widely downregulated in breast tumor tissue. • MEG3 regulates P53 indirectly through transcriptional regulation of MDM2. • Under unstressed condition, MEG3-related P53 accumulation transcriptionally activates p53’s target genes. • MEG3 expression level tightly regulates proliferation, colony formation, migration and invasion in breast tumor cells.« less

  2. Insights into wild-type and mutant p53 functions provided by genetically engineered mice.

    PubMed

    Donehower, Lawrence A

    2014-06-01

    Recent whole-exome sequencing studies of numerous human cancers have now conclusively shown that the TP53 tumor-suppressor gene is the most frequently mutated gene in human cancers. Despite extensive studies of the TP53 gene and its encoded protein (p53), our understanding of how TP53 mutations contribute to cancer initiation and progression remain incomplete. Genetically engineered mice with germline or inducible Trp53 somatic mutations have provided important insights into the mechanisms by which different types of p53 mutation influence cancer development. Trp53 germline mutations that alter specific p53 structural domains or posttranslation modification sites have benefitted our understanding of wild-type p53 functions in a whole organism context. Moreover, genetic approaches to reestablish functional wild-type p53 to p53-deficient tissues and tumors have increased our understanding of the therapeutic potential of restoring functional p53 signaling to cancers. This review outlines many of the key insights provided by the various categories of Trp53 mutant mice that have been generated by multiple genetic engineering approaches. © 2014 WILEY PERIODICALS, INC.

  3. Therapeutic targeting of the p53 pathway in cancer stem cells

    PubMed Central

    Prabhu, Varun V.; Allen, Joshua E.; Hong, Bo; Zhang, Shengliang; Cheng, Hairong; El-Deiry, Wafik S.

    2013-01-01

    Introduction Cancer stem cells are a high profile drug target for cancer therapeutics due to their indispensable role in cancer progression, maintenance, and therapeutic resistance. Restoring wild-type p53 function is an attractive new therapeutic approach for the treatment of cancer due to the well-described powerful tumor suppressor function of p53. As emerging evidence intimately links p53 and stem cell biology, this approach also provides an opportunity to target cancer stem cells. Areas covered Therapeutic approaches to restore the function of wild-type p53, cancer and normal stem cell biology in relation to p53, and the downstream effects of p53 on cancer stem cells. Expert opinion The restoration of wild-type p53 function by targeting p53 directly, its interacting proteins, or its family members holds promise as a new class of cancer therapies. This review examines the impact that such therapies may have on normal and cancer stem cells based on the current evidence linking p53 signaling with these populations. PMID:22998602

  4. Gain-of-function mutant p53 but not p53 deletion promotes head and neck cancer progression in response to oncogenic K-ras

    PubMed Central

    Acin, Sergio; Li, Zhongyou; Mejia, Olga; Roop, Dennis R; El-Naggar, Adel K; Caulin, Carlos

    2015-01-01

    Mutations in p53 occur in over 50% of the human head and neck squamous cell carcinomas (SCCHN). The majority of these mutations result in the expression of mutant forms of p53, rather than deletions in the p53 gene. Some p53 mutants are associated with poor prognosis in SCCHN patients. However, the molecular mechanisms that determine the poor outcome of cancers carrying p53 mutations are unknown. Here, we generated a mouse model for SCCHN and found that activation of the endogenous p53 gain-of-function mutation p53R172H, but not deletion of p53, cooperates with oncogenic K-ras during SCCHN initiation, accelerates oral tumour growth, and promotes progression to carcinoma. Mechanistically, expression profiling of the tumours that developed in these mice and studies using cell lines derived from these tumours determined that mutant p53 induces the expression of genes involved in mitosis, including cyclin B1 and cyclin A, and accelerates entry in mitosis. Additionally, we discovered that this oncogenic function of mutant p53 was dependent on K-ras because the expression of cyclin B1 and cyclin A decreased, and entry in mitosis was delayed, after suppressing K-ras expression in oral tumour cells that express p53R172H. The presence of double-strand breaks in the tumours suggests that oncogene-dependent DNA damage resulting from K-ras activation promotes the oncogenic function of mutant p53. Accordingly, DNA damage induced by doxorubicin also induced increased expression of cyclin B1 and cyclin A in cells that express p53R172H. These findings represent strong in vivo evidence for an oncogenic function of endogenous p53 gain-of-function mutations in SCCHN and provide a mechanistic explanation for the genetic interaction between oncogenic K-ras and mutant p53. PMID:21952947

  5. The critical role of catalase in prooxidant and antioxidant function of p53

    PubMed Central

    Kang, M Y; Kim, H-B; Piao, C; Lee, K H; Hyun, J W; Chang, I-Y; You, H J

    2013-01-01

    The tumor suppressor p53 is an important regulator of intracellular reactive oxygen species (ROS) levels, although downstream mediators of p53 remain to be elucidated. Here, we show that p53 and its downstream targets, p53-inducible ribonucleotide reductase (p53R2) and p53-inducible gene 3 (PIG3), physically and functionally interact with catalase for efficient regulation of intracellular ROS, depending on stress intensity. Under physiological conditions, the antioxidant functions of p53 are mediated by p53R2, which maintains increased catalase activity and thereby protects against endogenous ROS. After genotoxic stress, high levels of p53 and PIG3 cooperate to inhibit catalase activity, leading to a shift in the oxidant/antioxidant balance toward an oxidative status, which could augment apoptotic cell death. These results highlight the essential role of catalase in p53-mediated ROS regulation and suggest that the p53/p53R2–catalase and p53/PIG3–catalase pathways are critically involved in intracellular ROS regulation under physiological conditions and during the response to DNA damage, respectively. PMID:22918438

  6. Rescue of the apoptotic-inducing function of mutant p53 by small molecule RITA.

    PubMed

    Zhao, Carolyn Y; Grinkevich, Vera V; Nikulenkov, Fedor; Bao, Wenjie; Selivanova, Galina

    2010-05-01

    Expression of mutant p53 correlates with poor prognosis in many tumors, therefore strategies aimed at reactivation of mutant p53 are likely to provide important benefits for treatment of tumors that are resistant to chemotherapy and radiotherapy. We have previously identified and characterized a small molecule RITA which binds p53 and induces a conformational change which prevents the binding of p53 to several inhibitors, including its own destructor MDM2. In this way, RITA rescues the tumor suppression function of wild type p53. Here, we demonstrate that RITA suppressed the growth and induced apoptosis in human tumor cell lines of a diverse origin carrying mutant p53 proteins. RITA restored transcriptional transactivation and transrepression function of several hot spot p53 mutants. The ability of RITA to rescue the activity of different p53 mutants suggests its generic mechanism of action. Thus, RITA is a promising lead for the development of anti-cancer drugs that reactivate the tumor suppressor function of p53 in cancer cells irrespective whether they express mutant or wild type p53.

  7. The In Vivo DNA Binding Properties of Wild-Type and Mutant p53 Proteins in Mammary Cell Lines During the Course of Cell Cycle.

    DTIC Science & Technology

    1996-08-01

    J-4030 TITLE: The In Vivo DNA Binding Properties of Wild-Type and Mutant p53 Proteins in Mammary Cell Lines During the Course of Cell Cycle PRINCIPAL...The In Vivo DNA Binding Properties of 5. FUNDING NUMBERS Wild-Type and Mutant p53 Proteins in Mammary Cell Lines DAMD17-94-J-4030 During the Course of...ABSTRACT (Maximum 200 Using a pair of murine cell lines, one lacking p53 and a derivative cell line containing temperature sensitive p53 val 135

  8. Human urinary bladder epithelial cells lacking wild-type p53 function are deficient in the repair of 4-aminobiphenyl-DNA adducts in genomic DNA.

    PubMed

    Swaminathan, Santhanam; Torino, Jennifer L; Burger, Melissa S

    2002-01-29

    The effect of the tumor suppressor gene TP53 on repair of genomic DNA damage was examined in human urinary bladder transitional cell carcinoma (TCC) cell lines. Utilizing TCC10 containing wild-type p53 (wt-p53) as the parental line, an isogenic set of cell lines was derived by retroviral infection that expressed a transdominant mutant p53 (Arg --> His at codon 273, TDM273-TCC10), or the human papilloma virus 16-E6 oncoprotein (E6-TCC10). 32P-postlabeling analyses were performed on DNA from TCC cultures obtained after treatment with N-hydroxy-4-aminobiphenyl (N-OH-ABP), N-hydroxy-4-acetylaminobiphenyl (N-OH-AABP) and N-acetoxy-4-acetylaminobiphenyl (N-OAc-AABP). The major adduct was identified as N-(deoxyguanosin-8-yl)-4-aminobiphenyl (dG-C8-ABP) with all three chemicals. The amount of adducts in urothelial DNA ranged between 0.1 and 20 per 10(6) nucleotides, N-OAc-AABP yielding the highest levels, followed by N-OH-ABP and N-OH-AABP. To determine, if the functional status of p53 affects the rate of repair of dG-C8-ABP in genomic DNA, TCC10 and the TDM273-TCC10 and E6-TCC10 isotypes were exposed to N-OH-AABP for 12h and the DNA damage was allowed to repair up to 24h. The adduct levels were quantified and compared between the TCC10 isotypes. The amounts of dG-C8-ABP that remained in genomic DNA from E6-TCC10 and TDM273-TCC10 were approximately two-fold higher, as compared to the parental TCC10. At the dose used for DNA repair studies, N-OH-AABP or N-OAc-AABP did not induce apoptosis in TCC10. However, N-OAc-AABP at high doses (>5 microM) induced apoptosis, as evidenced by DNA fragmentation analyses. Furthermore, N-OAc-AABP-mediated apoptosis was independent of the functional status of wt-p53, since both E6-TCC10 and the parental TCC10 exhibited DNA fragmentation following treatment. These results suggest that p53 might modulate the repair of DNA adducts generated from the human bladder carcinogen ABP in its target human uroepithelial cells. This implies that in p53 null cells the unrepaired DNA damage could cause accumulation of mutation, which might contribute to increased genomic instability and neoplastic progression.

  9. [Interaction between p53 and MDM2 in human lung cancer cells].

    PubMed

    Rybárová, S; Hodorová, I; Vecanová, J; Muri, J; Mihalik, J

    2014-01-01

    The oncoprotein p53 protein induces cell growth arrest (apoptosis) in response to endo  or exogenous stimuli. Mutation of TP53 (gene encoding the p53 protein) is common in human malignancies and alters the conformation of p53. The result is a more stable protein which accumulates in nuclei of tumor cells with loss of function. Mutant p53 is stabilized, and it is possible to detect this form very clearly by immunohistochemistry (IHC). Expression of the MDM2 protein is used as a potential marker of p53 function. P53 levels in normal cells are highly determined by the MDM2 protein (murine double minute 2) -  mediated degradation of p53. MDM2 overexpression represents at least one mechanism by which p53 function can be abrogated during tumorigenesis. Lung carcinoma samples were obtained from patients, who underwent radical resection (lobectomy or pulmonectomy and lymphadectomy). Pathological dia-gnosis was based on the WHO criteria. In our study, we investigated the expression of p53 and MDM2 protein that might improve IHC as a marker for p53 status. Proteins were IHC detected in 136 samples of primary lung carcinoma. Immunostaining results of p53 positive samples were compared to IHC expression of MDM2 positive and MDM2 negative samples. Strong brown nuclear staining was visible in p53 and MDM2 positive cells. The most p53 positive cases were samples of squamocellular carcinoma (55%), then samples of large cell carcinoma (53%) and 26% adenocarcinoma samples showed the p53 immunoreactivity. No one sample of different types was p53 positive. When we compared the p53 expression and grade of tumor, we found that the p53 expression increased with the grade of tumor. For statistical evaluation, the chi square test was used. The relationship between p53 expression and type of tumor, also the p53 expression and grade of tumor was statistically significant (p = 0.000425; p = 0.00157). Regarding p53 and MDM2 expression, only nine samples (7%) were simultaneously p53 and MDM2 positive. In 46 (34%) cases, elevation of p53 was combined with MDM2 negative expression. Other tumor samples were either negative for both proteins (71/ 52%), or p53 negative and MDM2 positive in 10 (7%) tumor samples. Absence of p53 staining in most studies indicates absence of p53 mutation, and on the contrary, positive expression of p53 is a sign of p53 mutations with loss of function. In our study, 34% of cases with extensively high level of p53 without increased level of MDM2 were identified. We suppose that these are tumors with inactivating mutations that stabilize p53. On the other hand, tumors with high level of stabilized wildtype p53 protein and simultaneously with increased MDM2 staining (9 samples/7%) represent group with functional p53. In this group of patients, we could expect better prognosis with regard to function of p53 protein.

  10. TRIM25 has a dual function in the p53/Mdm2 circuit.

    PubMed

    Zhang, P; Elabd, S; Hammer, S; Solozobova, V; Yan, H; Bartel, F; Inoue, S; Henrich, T; Wittbrodt, J; Loosli, F; Davidson, G; Blattner, C

    2015-11-12

    P53 is an important tumor suppressor that, upon activation, induces growth arrest and cell death. Control of p53 is thus of prime importance for proliferating cells, but also for cancer therapy, where p53 activity contributes to the eradication of tumors. Mdm2 functionally inhibits p53 and targets the tumor suppressor protein for degradation. In a genetic screen, we identified TRIM25 as a novel regulator of p53 and Mdm2. TRIM25 increased p53 and Mdm2 abundance by inhibiting their ubiquitination and degradation in 26 S proteasomes. TRIM25 co-precipitated with p53 and Mdm2 and interfered with the association of p300 and Mdm2, a critical step for p53 polyubiquitination. Despite the increase in p53 levels, p53 activity was inhibited in the presence of TRIM25. Downregulation of TRIM25 resulted in an increased acetylation of p53 and p53-dependent cell death in HCT116 cells. Upon genotoxic insults, TRIM25 dampened the p53-dependent DNA damage response. The downregulation of TRIM25 furthermore resulted in massive apoptosis during early embryogenesis of medaka, which was rescued by the concomitant downregulation of p53, demonstrating the functional relevance of the regulation of p53 by TRIM25 in an organismal context.

  11. Andrographolide induces degradation of mutant p53 via activation of Hsp70.

    PubMed

    Sato, Hirofumi; Hiraki, Masatsugu; Namba, Takushi; Egawa, Noriyuki; Baba, Koichi; Tanaka, Tomokazu; Noshiro, Hirokazu

    2018-05-22

    The tumor suppressor gene p53 encodes a transcription factor that regulates various cellular functions, including DNA repair, apoptosis and cell cycle progression. Approximately half of all human cancers carry mutations in p53 that lead to loss of tumor suppressor function or gain of functions that promote the cancer phenotype. Thus, targeting mutant p53 as an anticancer therapy has attracted considerable attention. In the current study, a small-molecule screen identified andrographlide (ANDRO) as a mutant p53 suppressor. The effects of ANDRO, a small molecule isolated from the Chinese herb Andrographis paniculata, on tumor cells carrying wild-type or mutant p53 were examined. ANDRO suppressed expression of mutant p53, induced expression of the cyclin-dependent kinase inhibitor p21 and pro-apoptotic proteins genes, and inhibited the growth of cancer cells harboring mutant p53. ANDRO also induced expression of the heat-shock protein (Hsp70) and increased binding between Hsp70 and mutant p53 protein, thus promoting proteasomal degradation of p53. These results provide novel insights into the mechanisms regulating the function of mutant p53 and suggest that activation of Hsp70 may be a new strategy for the treatment of cancers harboring mutant p53.

  12. Inactivation of p53 by Human T-Cell Lymphotropic Virus Type 1 Tax Requires Activation of the NF-κB Pathway and Is Dependent on p53 Phosphorylation

    PubMed Central

    Pise-Masison, Cynthia A.; Mahieux, Renaud; Jiang, Hua; Ashcroft, Margaret; Radonovich, Michael; Duvall, Janet; Guillerm, Claire; Brady, John N.

    2000-01-01

    p53 plays a key role in guarding cells against DNA damage and transformation. We previously demonstrated that the human T-cell lymphotropic virus type 1 (HTLV-1) Tax can inactivate p53 transactivation function in lymphocytes. The present study demonstrates that in T cells, Tax-induced p53 inactivation is dependent upon NF-κB activation. Analysis of Tax mutants demonstrated that Tax inactivation of p53 function correlates with the ability of Tax to induce NF-κB but not p300 binding or CREB transactivation. The Tax-induced p53 inactivation can be overcome by overexpression of a dominant IκB mutant. Tax-NF-κB-induced p53 inactivation is not due to p300 squelching, since overexpression of p300 does not recover p53 activity in the presence of Tax. Further, using wild-type and p65 knockout mouse embryo fibroblasts (MEFs), we demonstrate that the p65 subunit of NF-κB is critical for Tax-induced p53 inactivation. While Tax can inactivate endogenous p53 function in wild-type MEFs, it fails to inactivate p53 function in p65 knockout MEFs. Importantly, Tax-induced p53 inactivation can be restored by expression of p65 in the knockout MEFs. Finally, we present evidence that phosphorylation of serines 15 and 392 correlates with inactivation of p53 by Tax in T cells. This study provides evidence that the divergent NF-κB proliferative and p53 cell cycle arrest pathways may be cross-regulated at several levels, including posttranslational modification of p53. PMID:10779327

  13. Interaction of p53 with prolyl isomerases: Healthy and unhealthy relationships.

    PubMed

    Mantovani, Fiamma; Zannini, Alessandro; Rustighi, Alessandra; Del Sal, Giannino

    2015-10-01

    The p53 protein family, comprising p53, p63 and p73, is primarily involved in preserving genome integrity and preventing tumor onset, and also affects a range of physiological processes. Signal-dependent modifications of its members and of other pathway components provide cells with a sophisticated code to transduce a variety of stress signaling into appropriate responses. TP53 mutations are highly frequent in cancer and lead to the expression of mutant p53 proteins that are endowed with oncogenic activities and sensitive to stress signaling. p53 family proteins have unique structural and functional plasticity, and here we discuss the relevance of prolyl-isomerization to actively shape these features. The anti-proliferative functions of the p53 family are carefully activated upon severe stress and this involves the interaction with prolyl-isomerases. In particular, stress-induced stabilization of p53, activation of its transcriptional control over arrest- and cell death-related target genes and of its mitochondrial apoptotic function, as well as certain p63 and p73 functions, all require phosphorylation of specific S/T-P motifs and their subsequent isomerization by the prolyl-isomerase Pin1. While these functions of p53 counteract tumorigenesis, under some circumstances their activation by prolyl-isomerases may have negative repercussions (e.g. tissue damage induced by anticancer therapies and ischemia-reperfusion, neurodegeneration). Moreover, elevated Pin1 levels in tumor cells may transduce deregulated phosphorylation signaling into activation of mutant p53 oncogenic functions. The complex repertoire of biological outcomes induced by p53 finds mechanistic explanations, at least in part, in the association between prolyl-isomerases and the p53 pathway. This article is part of a Special Issue entitled Proline-directed foldases: Cell signaling catalysts and drug targets. Copyright © 2015 Elsevier B.V. All rights reserved.

  14. Enhanced breast cancer progression by mutant p53 is inhibited by the circular RNA circ-Ccnb1.

    PubMed

    Fang, Ling; Du, William W; Lyu, Juanjuan; Dong, Jun; Zhang, Chao; Yang, Weining; He, Alina; Kwok, Yat Sze Sheila; Ma, Jian; Wu, Nan; Li, Feiya; Awan, Faryal Mehwish; He, Chengyan; Yang, Bing L; Peng, Chun; MacKay, Helen J; Yee, Albert J; Yang, Burton B

    2018-05-23

    TP53 mutations occur in many different types of cancers that produce mutant p53 proteins. The mutant p53 proteins have lost wild-type p53 activity and gained new functions that contribute to malignant tumor progression. Different p53 mutations create distinct profiles in loss of wild-type p53 activity and gain of functions. Targeting the consequences generated by the great number of p53 mutations would be extremely complex. Therefore, in this study we used a workaround and took advantage of the fact that mutant p53 cannot bind H2AX. Using this, we developed a new approach to repress the acquisition of mutant p53 functions. We show here that the delivery of a circular RNA circ-Ccnb1 inhibited the function of three p53 mutations. By microarray analysis and real-time PCR, we detected decreased circ-Ccnb1 expression levels in patients bearing breast carcinoma. Ectopic delivery of circ-Ccnb1 inhibited tumor growth and extended mouse viability. Using proteomics, we found that circ-Ccnb1 precipitated p53 in p53 wild-type cells, but instead precipitated Bclaf1 in p53 mutant cells. Further experiments showed that H2AX serves as a bridge, linking the interaction of circ-Ccnb1 and wild-type p53, thus allowing Bclaf1 to bind Bcl2 resulting in cell survival. In the p53 mutant cells, circ-Ccnb1 formed a complex with H2AX and Bclaf1, resulting in the induction of cell death. We found that this occurred in three p53 mutations. These results shed light on the possible development of new approaches to inhibit the malignancy of p53 mutations.

  15. Roles of p53 and p27 Kip1 in the regulation of neurogenesis in the murine adult subventricular zone

    PubMed Central

    Gil-Perotin, Sara; Haines, Jeffery D.; Kaur, Jasbir; Marin-Husstege, Mireya; Spinetta, Michael J.; Kim, Kwi-Hye; Duran-Moreno, Maria; Schallert, Timothy; Zindy, Frederique; Roussel, Martine F.; Garcia-Verdugo, Jose M.; Casaccia, Patrizia

    2011-01-01

    The tumor suppressor protein p53 (Trp53) and the cell cycle inhibitor p27 Kip1 (Cdknb1) have both been implicated in regulating proliferation of adult subventricular zone (aSVZ) cells. We previously reported that genetic ablation of Trp53 (Trp53 −/−) or Cdknb1 (p27 Kip1−/−) increased proliferation of cells in the aSVZ, but differentially affected the number of adult born neuroblasts. We therefore hypothesized that these molecules might play non-redundant roles. To test this hypothesis we generated mice lacking both genes (Trp53 −/−;p27 Kip1−/−) and analysed the consequences on aSVZ cells and adult neuroblasts. Proliferation and self-renewal of cultured aSVZ cells were increased in the double mutants compared with control, but the mice did not develop spontaneous brain tumors. In contrast, the number of adult-born neuroblasts in the double mutants was similar to wild-type animals and suggested a complementation of the p27 Kip1−/− phenotype due to loss of Trp53. Cellular differences detected in the aSVZ correlated with cellular changes in the olfactory bulb and behavioral data on novel odor recognition. The exploration time for new odors was reduced in p27 Kip1−/− mice, increased in Trp53 −/− mice and normalized in the double Trp53−/−;p27 Kip1−/− mutants. At the molecular level, Trp53 −/− aSVZ cells were characterized by higher levels of NeuroD and Math3 and by the ability to generate neurons more readily. In contrast, p27 Kip1−/− cells generated fewer neurons, due to enhanced proteasomal degradation of pro-neural transcription factors. Together, these results suggest that p27 Kip1 and p53 function non-redundantly to modulate proliferation and self-renewal of aSVZ cells and antagonistically in regulating adult neurogenesis. PMID:21899604

  16. In Vitro Analysis of the Role of Replication Protein A (RPA) and RPA Phosphorylation in ATR-mediated Checkpoint Signaling*

    PubMed Central

    Lindsey-Boltz, Laura A.; Reardon, Joyce T.; Wold, Marc S.; Sancar, Aziz

    2012-01-01

    Replication protein A (RPA) plays essential roles in DNA metabolism, including replication, checkpoint, and repair. Recently, we described an in vitro system in which the phosphorylation of human Chk1 kinase by ATR (ataxia telangiectasia mutated and Rad3-related) is dependent on RPA bound to single-stranded DNA. Here, we report that phosphorylation of other ATR targets, p53 and Rad17, has the same requirements and that RPA is also phosphorylated in this system. At high p53 or Rad17 concentrations, RPA phosphorylation is inhibited and, in this system, RPA with phosphomimetic mutations cannot support ATR kinase function, whereas a non-phosphorylatable RPA mutant exhibits full activity. Phosphorylation of these ATR substrates depends on the recruitment of ATR and the substrates by RPA to the RPA-ssDNA complex. Finally, mutant RPAs lacking checkpoint function exhibit essentially normal activity in nucleotide excision repair, revealing RPA separation of function for checkpoint and excision repair. PMID:22948311

  17. In vitro analysis of the role of replication protein A (RPA) and RPA phosphorylation in ATR-mediated checkpoint signaling.

    PubMed

    Lindsey-Boltz, Laura A; Reardon, Joyce T; Wold, Marc S; Sancar, Aziz

    2012-10-19

    Replication protein A (RPA) plays essential roles in DNA metabolism, including replication, checkpoint, and repair. Recently, we described an in vitro system in which the phosphorylation of human Chk1 kinase by ATR (ataxia telangiectasia mutated and Rad3-related) is dependent on RPA bound to single-stranded DNA. Here, we report that phosphorylation of other ATR targets, p53 and Rad17, has the same requirements and that RPA is also phosphorylated in this system. At high p53 or Rad17 concentrations, RPA phosphorylation is inhibited and, in this system, RPA with phosphomimetic mutations cannot support ATR kinase function, whereas a non-phosphorylatable RPA mutant exhibits full activity. Phosphorylation of these ATR substrates depends on the recruitment of ATR and the substrates by RPA to the RPA-ssDNA complex. Finally, mutant RPAs lacking checkpoint function exhibit essentially normal activity in nucleotide excision repair, revealing RPA separation of function for checkpoint and excision repair.

  18. Lack of Association of the TP53 Arg72Pro SNP and the MDM2 SNP309 with systemic lupus erythematosus in Caucasian, African American, and Asian children and adults

    PubMed Central

    Onel, KB; Huo, D; Hastings, D; Fryer-Biggs, J; Crow, MK; Onel, K

    2009-01-01

    The p53 tumour suppressor is the central regulator of apoptosis. Previously, the functional TP53 Arg72Pro polymorphism was found to be associated with systemic lupus erythematosus (SLE) in Koreans but not Spaniards. MDM2 is the major negative regulator of p53. An intronic polymorphism in MDM2, the SNP309, attenuates p53 activity and is associated with accelerated tumour development in premenopausal women. Polymorphic variation in MDM2 has never been studied in SLE. The aim of this study is to further assess the contribution of p53-pathway genetic variation to SLE by testing the association of the TP53 Arg72Pro polymorphism and the MDM2 SNP309 with SLE in a well-characterised and ethnically diverse cohort of patients with both childhood- and adult-onset SLE (n = 314). No association was found between the TP53 Arg72Pro polymorphism and SLE in patients of European descent, Asian descent or in African Americans, nor was an association found between the MDM2 SNP309 and SLE in patients of European descent or in African Americans. In addition, there was no correlation between either variant and early-onset disease or nephritis, an index of severe disease. It is concluded that neither the TP53 Arg72Pro polymorphism nor the MDM2 SNP309 contributes significantly to either susceptibility or disease severity in SLE. PMID:19074170

  19. Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils

    PubMed Central

    Stegh, Alexander H.

    2012-01-01

    Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435

  20. Identification of a p53-response element in the promoter of the proline oxidase gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Maxwell, Steve A.; Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significantmore » p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.« less

  1. A protein folding molecular imaging biosensor monitors the effects of drugs that restore mutant p53 structure and its downstream function in glioblastoma cells

    PubMed Central

    Paulmurugan, Ramasamy; Afjei, Rayhaneh; Sekar, Thillai V.; Babikir, Husam A.; Massoud, Tarik F.

    2018-01-01

    Misfolding mutations in the DNA-binding domain of p53 alter its conformation, affecting the efficiency with which it binds to chromatin to regulate target gene expression and cell cycle checkpoint functions in many cancers, including glioblastoma. Small molecule drugs that recover misfolded p53 structure and function may improve chemotherapy by activating p53-mediated senescence. We constructed and optimized a split Renilla luciferase (RLUC) complementation molecular biosensor (NRLUC-p53-CRLUC) to determine small molecule-meditated folding changes in p53 protein. After initial evaluation of the biosensor in three different cells lines, we engineered endogenously p53P98L mutant (i.e. not affecting the DNA-binding domain) Ln229 glioblastoma cells, to express the biosensor containing one of four different p53 proteins: p53wt, p53Y220C, p53G245S and p53R282W. We evaluated the consequent phenotypic changes in these four variant cells as well as the parental cells after exposure to PhiKan083 and SCH529074, drugs previously reported to activate mutant p53 folding. Specifically, we measured induced RLUC complementation and consequent therapeutic response. Upon stable transduction with the p53 biosensors, we demonstrated that these originally p53P98L Ln229 cells had acquired p53 cellular phenotypes representative of each p53 protein expressed within the biosensor fusion protein. In these engineered variants we found a differential drug response when treated with doxorubicin and temozolomide, either independently or in combination with PhiKan083 or SCH529074. We thus developed a molecular imaging complementation biosensor that mimics endogenous p53 function for use in future applications to screen novel or repurposed drugs that counter the effects of misfolding mutations responsible for oncogenic structural changes in p53. PMID:29765555

  2. p53 mutations promote proteasomal activity.

    PubMed

    Oren, Moshe; Kotler, Eran

    2016-07-27

    p53 mutations occur very frequently in human cancer. Besides abrogating the tumour suppressive functions of wild-type p53, many of those mutations also acquire oncogenic gain-of-function activities. Augmentation of proteasome activity is now reported as a common gain-of-function mechanism shared by different p53 mutants, which promotes cancer resistance to proteasome inhibitors.

  3. The Tumor Suppressor Protein p53 and its Physiological Splicing Variant p53as in a Mouse Mammary Cancer Model

    DTIC Science & Technology

    1997-10-01

    and Biomedical Laboratories. PI - Signature Date TABLE OF CONTENTS Report Documentation Page ii Foreword m Introduction 1-2 Experimental Methods...life studies of P53 or p53as in G1, S, and G2/ M was unsuccessful as reported last year. Long cell cycle times may be responsible for lack of separation...of S-phase 5 cells from G2/ M -phase cells by centrifugal elutriation. Attempts to synchronize cells by density arrest and/or serum starvation resulted

  4. p53 downregulates the Fanconi anaemia DNA repair pathway

    PubMed Central

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-01-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104

  5. p53 downregulates the Fanconi anaemia DNA repair pathway.

    PubMed

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-04-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53(Δ31), a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53(Δ31/Δ31) fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53(Δ31/Δ31) fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop.

  6. The anticancer effect of saffron in two p53 isogenic colorectal cancer cell lines

    PubMed Central

    2012-01-01

    Background Saffron extract, a natural product, has been shown to induce apoptosis in several tumor cell lines. Nevertheless, the p53-dependency of saffron’s mechanism of action in colon cancer remains unexplored. Material and methods In order to examine saffron’s anti-proliferative and pro-apoptotic effects in colorectal cancer cells, we treated two p53 isogenic HCT116 cell lines (HCT wildtype and HCT p53−/−) with different doses of the drug and analyzed cell proliferation and apoptosis in a time-dependent manner. MTT viability and crystal violet assays were performed in order to determine the effective dose of saffron on both cell lines. The cell cycle progress was examined by Flow cytometric analysis. Apoptosis was assessed using Annexin-PI-staining and Western Blotting for caspase 3 and PARP cleavage. Autophagy was determined by Western Blotting of the light chain 3 (LC3)-II and Beclin 1 proteins. The protein content of phospho-H2AX (γH2AX), a sensor of DNA double strand breaks, was also analyzed by Western Blotting. Results Saffron extract induced a p53-dependent pattern of cell cycle distribution with a full G2/M stop in HCT116 p53 wildtype cells. However, it induced a remarkable delay in S/G2 phase transit with entry into mitosis in HCT116 p53 −/− cells. The apoptotic Pre-G1 cell fraction as well as Annexin V staining and caspase 3 cleavage showed a more pronounced apoptosis induction in HCT116 p53 wildtype cells. Obviously, the significantly higher DNA-damage, reflected by ɣH2AX protein levels in cells lacking p53, was coped by up-regulation of autophagy. The saffron-induced LC3-II protein level was a remarkable indication of the accumulation of autophagosomes, a response to the cellular stress condition of drug treatment. Conclusions This is the first study showing the effect of saffron in HCT116 colorectal cancer cells with different p53 status. Saffron induced DNA-damage and apoptosis in both cell lines. However, autophagy has delayed the induction of apoptosis in HCT116 p53 −/− cells. Considering the fact that most tumors show a functional p53 inactivation, further research is needed to elucidate the long-term effects of saffron in p53 −/− tumors. PMID:22640402

  7. Inhibition of NAMPT pathway by FK866 activates the function of p53 in HEK293T cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Thakur, Basant Kumar, E-mail: thakur.basant@mh-hannover.de; Department of Molecular Hematopoiesis, Hannover Medical School, Carl Neuberg Str-1, 30625 Hannover; Dittrich, Tino

    2012-08-03

    Highlights: Black-Right-Pointing-Pointer In 293T cells, p53 is considered to be inactive due to its interaction with the large T-antigen. Black-Right-Pointing-Pointer Acetylation of p53 at lysine 382 is important for its functional activation. Black-Right-Pointing-Pointer First evidence to document the presence of a functional p53 in 293T cells. Black-Right-Pointing-Pointer Inhibition of NAMPT/SIRT pathway by FK866 in 293T cells increases the functional activity of p53. Black-Right-Pointing-Pointer This activation of p53 involves reversible acetylation of p53 at lysine 382. -- Abstract: Inactivation of p53 protein by endogenous and exogenous carcinogens is involved in the pathogenesis of different human malignancies. In cancer associated with SV-40more » DNA tumor virus, p53 is considered to be non-functional mainly due to its interaction with the large T-antigen. Using the 293T cell line (HEK293 cells transformed with large T antigen) as a model, we provide evidence that p53 is one of the critical downstream targets involved in FK866-mediated killing of 293T cells. A reduced rate of apoptosis and an increased number of cells in S-phase was accompanied after knockdown of p53 in these cells. Inhibition of NAMPT by FK866, or inhibition of SIRT by nicotinamide decreased proliferation and triggered death of 293T cells involving the p53 acetylation pathway. Additionally, knockdown of p53 attenuated the effect of FK866 on cell proliferation, apoptosis, and cell cycle arrest. The data presented here shed light on two important facts: (1) that p53 in 293T cells is active in the presence of FK866, an inhibitor of NAMPT pathway; (2) the apoptosis induced by FK866 in 293T cells is associated with increased acetylation of p53 at Lys382, which is required for the functional activity of p53.« less

  8. The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

    PubMed Central

    2010-01-01

    Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1) are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development. PMID:21138557

  9. Okadaic acid mediates p53 hyperphosphorylation and growth arrest in cells with wild-type p53 but increases aberrant mitoses in cells with non-functional p53.

    PubMed

    Milczarek, G J; Chen, W; Gupta, A; Martinez, J D; Bowden, G T

    1999-06-01

    The protein phosphatase inhibitor and tumor promoting agent okadaic acid (OA), has been shown previously to induce hyperphosphorylation of p53 protein, which in turn correlated with increased transactivation or apoptotic function. However, how the tumor promotion effects of OA relate to p53 tumor supressor function (or dysfunction) remain unclear. Rat embryonic fibroblasts harboring a temperature-sensitive mouse p53 transgene were treated with 50 nM doses of OA. At the wild-type permissive temperature this treatment resulted in: (i) the hyperphosphorylation of sites within tryptic peptides of the transactivation domain of p53; (ii) an increase in p53 affinity for a p21(waf1) promotor oligonucleotide; (iii) an increase in cellular steady state levels of p21(waf1) message; (iv) a G2/M cell cycle blockage in addition to the G1/S arrest previously associated with p53; and (v) no increased incidence of apoptosis. On the other hand, OA treatment at the mutated p53 permissive temperature resulted in a relatively high incidence of aberrant mitosis with no upregulation of p21(waf1) message. These results suggest that while wild-type p53 blocks the proliferative effects of OA through p21(waf1)-mediated growth arrest, cells with non-functional p53 cannot arrest and suffer relatively high levels of OA-mediated aberrant mitoses.

  10. p53 suppresses hyper-recombination by modulating BRCA1 function

    PubMed Central

    Dong, Chao; Zhang, Fengmei; Luo, Yue; Wang, Hui; Zhao, Xipeng; Guo, Gongshe; Powell, Simon N.; Feng, Zhihui

    2015-01-01

    Both p53 and BRCA1 are tumor suppressors and are involved in a number of cellular processes including cell cycle arrest, apoptosis, transcriptional regulation, and DNA damage repair. Some studies have suggested that the association of BRCA1 and p53 is required for transcriptional regulation of genes involved in cell replication and DNA repair pathways. However, the relationship between the two proteins in molecular mechanisms of DNA repair is still not clear. Therefore, we sought to determine whether there is a functional link between p53 and BRCA1 in DNA repair. Firstly, using a plasmid recombination substrate, pDR-GFP, integrated into the genome of breast cancer cell line MCF7, we have demonstrated that p53 suppressed Rad51-mediated hyper-recombinational repair by two independent cell models of HPV-E6 induced p53 inactivation and p53 knockdown assay. Our study further indicated that p53 mediated homologous recombination (HR) through inhibiting BRCA1 over-function via mechanism of transcription regulation in response to DNA repair. Since it was found p53 and BRCA1 existed in a protein complex, indicating both proteins may be associated at post-transcriptional level. Moreover, defective p53-induced hyper-recombination was associated with cell radioresistance and chromosomal stability, strongly supporting the involvement of p53 in the inhibition of hyper-recombination, which led to genetic stability and cellular function in response to DNA damage. In addition, it was found that p53 loss rescued BRCA1 deficiency via recovering HR and chromosomal stability, suggesting that p53 is also involved in the HR-inhibition independently of BRCA1. Thus, our data indicated that p53 was involved in inhibiting recombination by both BRCA1-dependent and -independent mechanisms, and there is a functional link between p53-suppression and BRCA1-promotion in regulation of HR activity at transcription level and possible post-transcription level. PMID:26162908

  11. Aberrant AKT activation drives well-differentiated liposarcoma

    PubMed Central

    Gutierrez, Alejandro; Snyder, Eric L.; Marino-Enriquez, Adrian; Zhang, Yi-Xiang; Sioletic, Stefano; Kozakewich, Elena; Grebliunaite, Ruta; Ou, Wen-bin; Sicinska, Ewa; Raut, Chandrajit P.; Demetri, George D.; Perez-Atayde, Antonio R.; Wagner, Andrew J.; Fletcher, Jonathan A.; Fletcher, Christopher D. M.; Look, A. Thomas

    2011-01-01

    Well-differentiated liposarcoma (WDLPS), one of the most common human sarcomas, is poorly responsive to radiation and chemotherapy, and the lack of animal models suitable for experimental analysis has seriously impeded functional investigation of its pathobiology and development of effective targeted therapies. Here, we show that zebrafish expressing constitutively active Akt2 in mesenchymal progenitors develop WDLPS that closely resembles the human disease. Tumor incidence rates were 8% in p53 wild-type zebrafish, 6% in p53 heterozygotes, and 29% in p53-homozygous mutant zebrafish (P = 0.013), indicating that aberrant Akt activation collaborates with p53 mutation in WDLPS pathogenesis. Analysis of primary clinical specimens of WDLPS, and of the closely related dedifferentiated liposarcoma (DDLPS) subtype, revealed immunohistochemical evidence of AKT activation in 27% of cases. Western blot analysis of a panel of cell lines derived from patients with WDLPS or DDLPS revealed robust AKT phosphorylation in all cell lines examined, even when these cells were cultured in serum-free media. Moreover, BEZ235, a small molecule inhibitor of PI3K and mammalian target of rapamycin that effectively inhibits AKT activation in these cells, impaired viability at nanomolar concentrations. Our findings are unique in providing an animal model to decipher the molecular pathogenesis of WDLPS, and implicate AKT as a previously unexplored therapeutic target in this chemoresistant sarcoma. PMID:21930930

  12. Suppression of gain-of-function mutant p53 with metabolic inhibitors reduces tumor growth in vivo

    PubMed Central

    Jung, Chae Lim; Mun, Hyemin; Jo, Se-Young; Oh, Ju-Hee; Lee, ChuHee; Choi, Eun-Kyung; Jang, Se Jin; Suh, Young-Ah

    2016-01-01

    Mutation of p53 occasionally results in a gain of function, which promotes tumor growth. We asked whether destabilizing the gain-of-function protein would kill tumor cells. Downregulation of the gene reduced cell proliferation in p53-mutant cells, but not in p53-null cells, indicating that the former depended on the mutant protein for survival. Moreover, phenformin and 2-deoxyglucose suppressed cell growth and simultaneously destabilized mutant p53. The AMPK pathway, MAPK pathway, chaperone proteins and ubiquitination all contributed to this process. Interestingly, phenformin and 2-deoxyglucose also reduced tumor growth in syngeneic mice harboring the p53 mutation. Thus, destabilizing mutant p53 protein in order to kill cells exhibiting “oncogene addiction” could be a promising strategy for combatting p53 mutant tumors. PMID:27765910

  13. Suppression of gain-of-function mutant p53 with metabolic inhibitors reduces tumor growth in vivo.

    PubMed

    Jung, Chae Lim; Mun, Hyemin; Jo, Se-Young; Oh, Ju-Hee; Lee, ChuHee; Choi, Eun-Kyung; Jang, Se Jin; Suh, Young-Ah

    2016-11-22

    Mutation of p53 occasionally results in a gain of function, which promotes tumor growth. We asked whether destabilizing the gain-of-function protein would kill tumor cells. Downregulation of the gene reduced cell proliferation in p53-mutant cells, but not in p53-null cells, indicating that the former depended on the mutant protein for survival. Moreover, phenformin and 2-deoxyglucose suppressed cell growth and simultaneously destabilized mutant p53. The AMPK pathway, MAPK pathway, chaperone proteins and ubiquitination all contributed to this process. Interestingly, phenformin and 2-deoxyglucose also reduced tumor growth in syngeneic mice harboring the p53 mutation. Thus, destabilizing mutant p53 protein in order to kill cells exhibiting "oncogene addiction" could be a promising strategy for combatting p53 mutant tumors.

  14. p53 genes function to restrain mobile elements

    PubMed Central

    Wylie, Annika; Jones, Amanda E.; D'Brot, Alejandro; Lu, Wan-Jin; Kurtz, Paula; Moran, John V.; Rakheja, Dinesh; Chen, Kenneth S.; Hammer, Robert E.; Comerford, Sarah A.; Amatruda, James F.; Abrams, John M.

    2016-01-01

    Throughout the animal kingdom, p53 genes govern stress response networks by specifying adaptive transcriptional responses. The human member of this gene family is mutated in most cancers, but precisely how p53 functions to mediate tumor suppression is not well understood. Using Drosophila and zebrafish models, we show that p53 restricts retrotransposon activity and genetically interacts with components of the piRNA (piwi-interacting RNA) pathway. Furthermore, transposon eruptions occurring in the p53− germline were incited by meiotic recombination, and transcripts produced from these mobile elements accumulated in the germ plasm. In gene complementation studies, normal human p53 alleles suppressed transposons, but mutant p53 alleles from cancer patients could not. Consistent with these observations, we also found patterns of unrestrained retrotransposons in p53-driven mouse and human cancers. Furthermore, p53 status correlated with repressive chromatin marks in the 5′ sequence of a synthetic LINE-1 element. Together, these observations indicate that ancestral functions of p53 operate through conserved mechanisms to contain retrotransposons. Since human p53 mutants are disabled for this activity, our findings raise the possibility that p53 mitigates oncogenic disease in part by restricting transposon mobility. PMID:26701264

  15. Lack of dependence on p53 for DNA double strand break repair of episomal vectors in human lymphoblasts

    NASA Technical Reports Server (NTRS)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.

  16. Tetramer formation of tumor suppressor protein p53: Structure, function, and applications.

    PubMed

    Kamada, Rui; Toguchi, Yu; Nomura, Takao; Imagawa, Toshiaki; Sakaguchi, Kazuyasu

    2016-11-04

    Tetramer formation of p53 is essential for its tumor suppressor function. p53 not only acts as a tumor suppressor protein by inducing cell cycle arrest and apoptosis in response to genotoxic stress, but it also regulates other cellular processes, including autophagy, stem cell self-renewal, and reprogramming of differentiated cells into stem cells, immune system, and metastasis. More than 50% of human tumors have TP53 gene mutations, and most of them are missense mutations that presumably reduce tumor suppressor activity of p53. This review focuses on the role of the tetramerization (oligomerization), which is modulated by the protein concentration of p53, posttranslational modifications, and/or interactions with its binding proteins, in regulating the tumor suppressor function of p53. Functional control of p53 by stabilizing or inhibiting oligomer formation and its bio-applications are also discussed. © 2015 Wiley Periodicals, Inc. Biopolymers (Pept Sci) 106: 598-612, 2016. © 2015 Wiley Periodicals, Inc.

  17. Epigallocatechin-3-Gallate Prevents Autoimmune-Associated Down-Regulation of p21 in Salivary Gland Cells Through a p53-Independent Pathway

    PubMed Central

    Dickinson, Douglas; Yu, Hongfang; Ohno, Seiji; Thomas, Cristina; DeRossi, Scott; Ma, Yat-Ho; Yates, Nicole; Hahn, Emily; Bisch, Frederick; Yamamoto, Tetsuya; Hsu, Stephen

    2015-01-01

    The submandibular salivary glands of non-obese diabetic (NOD) mice, a model for Sjogren’s syndrome and type-1 diabetes, show an elevated level of proliferating cell nuclear antigen (PCNA), a protein involved in cell proliferation and repair of DNA damage. We reported previously that epigallocatechin-3-gallate (EGCG), the most abundant green tea catechin, normalizes the PCNA level. PCNA’s activity can be regulated by the cyclin-dependent kinase inhibitor p21, which is also important for epithelial cell differentiation. In turn, expression of p21 and PCNA are partially regulated by Rb phosphorylation levels. EGCG was found to modulate p21 expression in epithelial cells, suggesting that EGCG-induced p21 could be associated with down-regulation of PCNA in vivo. The current study examined the protein levels of p21 and p53 (which can up-regulate p21) in NOD mice fed with either water or EGCG, and the effect of EGCG on p21 and p53 in cell line models with either normal or defective Rb. In NOD mice, the p21 level was low, and EGCG normalized it. In contrast to HSG cells with functional Rb, negligible expression of p21 in NS-SV-AC cells that lack Rb was not altered by EGCG treatment. Inhibition of p53 by siRNA demonstrated that p21 and p53 were induced independently in HSG cells by a physiological concentration range of EGCG, suggesting p53 could be an important but not conditional factor associated with p21 expression. In conclusion, PCNA and p21 levels are altered inversely in the NOD model for SS and in HSG cells, and warrant further study as candidate new markers for salivary dysfunction associated with xerostomia. Induction of p21 by EGCG could provide clinically useful normalization of salivary glands by promoting differentiation and reducing PCNA levels. PMID:24329914

  18. Simulation-Based Validation of the p53 Transcriptional Activity with Hybrid Functional Petri Net.

    PubMed

    Doi, Atsushi; Nagasaki, Masao; Matsuno, Hiroshi; Miyano, Satoru

    2011-01-01

    MDM2 and p19ARF are essential proteins in cancer pathways forming a complex with protein p53 to control the transcriptional activity of protein p53. It is confirmed that protein p53 loses its transcriptional activity by forming the functional dimer with protein MDM2. However, it is still unclear that protein p53 keeps its transcriptional activity when it forms the trimer with proteins MDM2 and p19ARF. We have observed mutual behaviors among genes p53, MDM2, p19ARF and their products on a computational model with hybrid functional Petri net (HFPN) which is constructed based on information described in the literature. The simulation results suggested that protein p53 should have the transcriptional activity in the forms of the trimer of proteins p53, MDM2, and p19ARF. This paper also discusses the advantages of HFPN based modeling method in terms of pathway description for simulations.

  19. Identification of two novel functional p53 responsive elements in the Herpes Simplex Virus-1 genome

    PubMed Central

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R.; Boehmer, Paul E.

    2014-01-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. PMID:25010269

  20. ERK mediated upregulation of death receptor 5 overcomes the lack of p53 functionality in the diaminothiazole DAT1 induced apoptosis in colon cancer models: efficiency of DAT1 in Ras-Raf mutated cells.

    PubMed

    Thamkachy, Reshma; Kumar, Rohith; Rajasekharan, K N; Sengupta, Suparna

    2016-03-08

    p53 is a tumour suppressor protein that plays a key role in many steps of apoptosis, and malfunctioning of this transcription factor leads to tumorigenesis. Prognosis of many tumours also depends upon the p53 status. Most of the clinically used anticancer compounds activate p53 dependent pathway of apoptosis and hence require p53 for their mechanism of action. Further, Ras/Raf/MEK/ERK axis is an important signaling pathway activated in many cancers. Dependence of diaminothiazoles, compounds that have gained importance recently due to their anticancer and anti angiogenic activities, were tested in cancer models with varying p53 or Ras/Raf mutational status. In this study we have used p53 mutated and knock out colon cancer cells and xenograft tumours to study the role of p53 in apoptosis mediated by diaminothiazoles. Colon cancer cell lines with varying mutational status for Ras or Raf were also used. We have also examined the toxicity and in vivo efficacy of a lead diaminothiazole 4-Amino-5-benzoyl-2-(4-methoxy phenylamino)thiazole (DAT1) in colon cancer xenografts. We have found that DAT1 is active in both in vitro and in vivo models with nonfunctional p53. Earlier studies have shown that extrinsic pathway plays major role in DAT1 mediated apoptosis. In this study, we have found that DAT1 is causing p53 independent upregulation of the death receptor 5 by activating the Ras/Raf/MEK/ERK signaling pathway both in wild type and p53 suppressed colon cancer cells. These findings are also confirmed by the in vivo results. Further, DAT1 is more efficient to induce apoptosis in colon cancer cells with mutated Ras or Raf. Minimal toxicity in both acute and subacute studies along with the in vitro and in vivo efficacy of DAT1 in cancers with both wild type and nonfunctional p53 place it as a highly beneficial candidate for cancer chemotherapy. Besides, efficiency in cancer cells with mutations in the Ras oncoprotein or its downstream kinase Raf raise interest in diaminothiazole class of compounds for further follow-up.

  1. Endothelial cell senescence with aging in healthy humans: prevention by habitual exercise and relation to vascular endothelial function.

    PubMed

    Rossman, Matthew J; Kaplon, Rachelle E; Hill, Sierra D; McNamara, Molly N; Santos-Parker, Jessica R; Pierce, Gary L; Seals, Douglas R; Donato, Anthony J

    2017-11-01

    Cellular senescence is emerging as a key mechanism of age-related vascular endothelial dysfunction, but evidence in healthy humans is lacking. Moreover, the influence of lifestyle factors such as habitual exercise on endothelial cell (EC) senescence is unknown. We tested the hypothesis that EC senescence increases with sedentary, but not physically active, aging and is associated with vascular endothelial dysfunction. Protein expression (quantitative immunofluorescence) of p53, a transcription factor related to increased cellular senescence, and the cyclin-dependent kinase inhibitors p21 and p16 were 116%, 119%, and 128% greater (all P < 0.05), respectively, in ECs obtained from antecubital veins of older sedentary (60 ± 1 yr, n = 12) versus young sedentary (22 ± 1 yr, n = 9) adults. These age-related differences were not present (all P > 0.05) in venous ECs from older exercising adults (57 ± 1 yr, n = 13). Furthermore, venous EC protein levels of p53 ( r  = -0.49, P = 0.003), p21 ( r  = -0.38, P = 0.03), and p16 ( r  = -0.58, P = 0.002) were inversely associated with vascular endothelial function (brachial artery flow-mediated dilation). Similarly, protein expression of p53 and p21 was 26% and 23% higher (both P < 0.05), respectively, in ECs sampled from brachial arteries of healthy older sedentary (63 ± 1 yr, n = 18) versus young sedentary (25 ± 1 yr, n = 9) adults; age-related changes in arterial EC p53 and p21 expression were not observed ( P > 0.05) in older habitually exercising adults (59 ± 1 yr, n = 14). These data indicate that EC senescence is associated with sedentary aging and is linked to endothelial dysfunction. Moreover, these data suggest that prevention of EC senescence may be one mechanism by which aerobic exercise protects against endothelial dysfunction with age. NEW & NOTEWORTHY Our study provides novel evidence in humans of increased endothelial cell senescence with sedentary aging, which is associated with impaired vascular endothelial function. Furthermore, our data suggest an absence of age-related increases in endothelial cell senescence in older exercising adults, which is linked with preserved vascular endothelial function. Copyright © 2017 the American Physiological Society.

  2. Disruption of p53 function sensitizes breast cancer MCF-7 cells to cisplatin and pentoxifylline.

    PubMed

    Fan, S; Smith, M L; Rivet, D J; Duba, D; Zhan, Q; Kohn, K W; Fornace, A J; O'Connor, P M

    1995-04-15

    The possibility that appropriately designed chemotherapy could act selectively against p53-defective tumor cells was explored in MCF-7 human breast cancer cells. These cells were chosen because they have normal p53 function but are representative of a tumor cell type that does not readily undergo p53-dependent apoptosis. Two sublines (MCF-7/E6 and MCF-7/mu-p53) were established in which p53 function was disrupted by transfection with either the human papillomavirus type-16 E6 gene or a dominant-negative mutant p53 gene. p53 function in MCF-7/E6 and MCF-7/mu-p53 cells was defective relative to control cells in that there were no increases in p53 or p21Waf1/Cip1 protein levels and no G1 arrest following exposure to ionizing radiation. Survival assays showed that p53 disruption sensitized MCF-7 cells to cisplatin (CDDP) but not to several other DNA-damaging agents. CDDP sensitization was not limited to MCF-7 cells since p53 disruption in human colon carcinoma RKO cells also enhanced sensitivity to CDDP. Contrary to the other DNA-damaging agents tested, CDDP-induced DNA lesions are repaired extensively by nucleotide excision, and in agreement with a defect in this process, MCF-7/E6 and MCF-7/mu-p53 cells exhibited a reduced ability to repair a CDDP-damaged chloramphenicol acetyltransferase-reporter plasmid transfected into the cells. Therefore, we attributed the increased CDDP sensitivity of MCF-7 cells with disrupted p53 to defects in G1 checkpoint control, nucleotide excision repair, or both. The G2 checkpoint inhibitor pentoxifylline exhibited synergism with CDDP in killing MCF-7/E6 cells but did not affect sensitivity of the control cells. Moreover, pentoxifylline inhibited G2 checkpoint function to a greater extent in MCF-7/E6 than in the parental cells. These results suggested that, in the absence of p53 function, cancer cells are more vulnerable to G2 checkpoint abrogators. Our results show that a combination of CDDP and pentoxifylline is capable of synergistic and preferential killing of p53-defective tumor cells that do not readily undergo apoptosis.

  3. Transcriptional repression of epithelial cell adhesion molecule (EpCAM) contributes to p53 control of breast cancer invasion

    PubMed Central

    Sankpal, NV; Willman, MW; Fleming, TP; Mayfield, J; Gillanders, WE

    2014-01-01

    p53 is a tumor suppressor gene with well-characterized roles in cell cycle regulation, apoptosis and the maintenance of genome stability. Recent evidence suggests that p53 may also contribute to the regulation of migration and invasion. Epithelial cell adhesion molecule (EpCAM) is a transmembrane glycoprotein that is overexpressed in the majority of human epithelial carcinomas, including breast and colorectal carcinomas. We demonstrate by chromatin immunoprecipitation assays that p53 interacts with a candidate p53 binding site within the EpCAM gene. p53-mediated transcriptional repression of EpCAM was confirmed in gain-of-function, and loss-of-function experimental systems. Induction of wildtype p53 was associated with a significant dose-dependent decrease in EpCAM expression; conversely, specific ablation of p53 was associated with a significant increase in EpCAM expression. At the functional level, specific ablation of p53 expression is associated with increased breast cancer invasion, and this effect is abrogated by concomitant specific ablation of EpCAM expression. Taken together, these biochemical and functional data are the first demonstration that (1) wildtype p53 protein binds to a response element within the EpCAM gene and negatively regulates EpCAM expression, and (2) transcriptional repression of EpCAM contributes to p53 control of breast cancer invasion. PMID:19141643

  4. Lipidomic Perturbations in Lung, Kidney, and Liver Tissues of p53 Knockout Mice Analyzed by Nanoflow UPLC-ESI-MS/MS.

    PubMed

    Park, Se Mi; Byeon, Seul Kee; Sung, Hyerim; Cho, Soo Young; Seong, Je Kyung; Moon, Myeong Hee

    2016-10-07

    Lipids are important signaling molecules regulating biological processes under normal and diseased conditions. Although p53 mutation is well-known for causing cancer, the relationship between p53-related tumorigenesis and altered lipid profile is unclear. We profiled differences in lipid expressions in liver, lung, and kidney in p53 knockout (KO) mice by high-speed quantitative analysis of 320 lipids (399 species identified) using nanoflow ultrahigh performance liquid chromatography-tandem mass spectrometry (nUPLC-MS/MS). Lung tissues were most severely affected by the lack of p53 gene, as shown by significant reduction (24-44%, P < 0.05) in total phosphatidylcholine (PC), phosphatidylethanolamine (PE), sphingomyelin (SM), diacylglycerol (DG), and triacylglycerol (TG), and significant increases (30-50%) in phosphatidylserine (PS), phosphatidylinositol (PI), and monohexosylceramide (MHC). MHC levels increased in all tissues. Dihexosylceramide (DHC) level decreased only in kidney tissue. Most PI, PS, and phosphatidic acid (PA) species showing significant increases contained a saturated acyl chain (18:0) in lung and liver tissues. Neutral glycerolipids (16:0/22:0-DG and most TGs with saturated and monounsaturated acyl chains) decreased 2-4-fold in the liver tissue. Our results suggest that the lack of p53 and altered lipid profiles are closely related, but as their changes vary from one tissue to another, the lipid alterations are tissue-specific.

  5. The Transcription Factor p53 Influences Microglial Activation Phenotype

    PubMed Central

    Jayadev, Suman; Nesser, Nicole K.; Hopkins, Stephanie; Myers, Scott J.; Case, Amanda; Lee, Rona J.; Seaburg, Luke A.; Uo, Takuma; Murphy, Sean P.; Morrison, Richard S.; Garden, Gwenn A.

    2011-01-01

    Several neurodegenerative diseases are influenced by the innate immune response in the central nervous system (CNS). Microglia, have pro-inflammatory and subsequently neurotoxic actions as well as anti-inflammatory functions that promote recovery and repair. Very little is known about the transcriptional control of these specific microglial behaviors. We have previously shown that in HIV associated neurocognitive disorders (HAND), the transcription factor p53 accumulates in microglia and that microglial p53 expression is required for the in vitro neurotoxicity of the HIV coat glycoprotein gp120. These findings suggested a novel function for p53 in regulating microglial activation. Here we report that in the absence of p53, microglia demonstrate a blunted response to interferon-γ, failing to increase expression of genes associated with classical macrophage activation or secrete pro-inflammatory cytokines. Microarray analysis of global gene expression profiles revealed increased expression of genes associated with anti-inflammatory functions, phagocytosis and tissue repair in p53 knockout (p53−/−) microglia compared with those cultured from strain matched p53 expressing (p53+/+) mice. We further observed that p53−/− microglia demonstrate increased phagocytic activity in vitro and expression of markers for alternative macrophage activation both in vitro and in vivo. In HAND brain tissue, the alternative activation marker CD163 was expressed in a separate subset of microglia than those demonstrating p53 accumulation. These data suggest that p53 influences microglial behavior, supporting the adoption of a pro-inflammatory phenotype, while p53 deficiency promotes phagocytosis and gene expression associated with alternative activation and anti-inflammatory functions. PMID:21598312

  6. MDM4 is a key therapeutic target in cutaneous melanoma

    PubMed Central

    Gembarska, Agnieszka; Luciani, Flavie; Fedele, Clare; Russell, Elisabeth A; Dewaele, Michael; Villar, Stéphanie; Zwolinska, Aleksandra; Haupt, Sue; de Lange, Job; Yip, Dana; Goydos, James; Haigh, Jody J; Haupt, Ygal; Larue, Lionel; Jochemsen, Aart; Shi, Hubing; Moriceau, Gatien; Lo, Roger S; Ghanem, Ghanem; Shackleton, Mark; Bernal, Federico; Marine, Jean-Christophe

    2013-01-01

    The inactivation of the p53 tumor suppressor pathway, which often occurs through mutations in TP53 (encoding tumor protein 53) is a common step in human cancer. However, in melanoma—a highly chemotherapy-resistant disease—TP53 mutations are rare, raising the possibility that this cancer uses alternative ways to overcome p53-mediated tumor suppression. Here we show that Mdm4 p53 binding protein homolog (MDM4), a negative regulator of p53, is upregulated in a substantial proportion (∼65%) of stage I–IV human melanomas and that melanocyte-specific Mdm4 overexpression enhanced tumorigenesis in a mouse model of melanoma induced by the oncogene Nras. MDM4 promotes the survival of human metastatic melanoma by antagonizing p53 proapoptotic function. Notably, inhibition of the MDM4-p53 interaction restored p53 function in melanoma cells, resulting in increased sensitivity to cytotoxic chemotherapy and to inhibitors of the BRAF (V600E) oncogene. Our results identify MDM4 as a key determinant of impaired p53 function in human melanoma and designate MDM4 as a promising target for antimelanoma combination therapy. PMID:22820643

  7. Lung tumors with distinct p53 mutations respond similarly to p53 targeted therapy but exhibit genotype-specific statin sensitivity

    PubMed Central

    Turrell, Frances K.; Kerr, Emma M.; Gao, Meiling; Thorpe, Hannah; Doherty, Gary J.; Cridge, Jake; Shorthouse, David; Speed, Alyson; Samarajiwa, Shamith; Hall, Benjamin A.; Griffiths, Meryl; Martins, Carla P.

    2017-01-01

    Lung adenocarcinoma accounts for ∼40% of lung cancers, the leading cause of cancer-related death worldwide, and current therapies provide only limited survival benefit. Approximately half of lung adenocarcinomas harbor mutations in TP53 (p53), making these mutants appealing targets for lung cancer therapy. As mutant p53 remains untargetable, mutant p53-dependent phenotypes represent alternative targeting opportunities, but the prevalence and therapeutic relevance of such effects (gain of function and dominant-negative activity) in lung adenocarcinoma are unclear. Through transcriptional and functional analysis of murine KrasG12D-p53null, -p53R172H (conformational), and -p53R270H (contact) mutant lung tumors, we identified genotype-independent and genotype-dependent therapeutic sensitivities. Unexpectedly, we found that wild-type p53 exerts a dominant tumor-suppressive effect on mutant tumors, as all genotypes were similarly sensitive to its restoration in vivo. These data show that the potential of p53 targeted therapies is comparable across all p53-deficient genotypes and may explain the high incidence of p53 loss of heterozygosity in mutant tumors. In contrast, mutant p53 gain of function and their associated vulnerabilities can vary according to mutation type. Notably, we identified a p53R270H-specific sensitivity to simvastatin in lung tumors, and the transcriptional signature that underlies this sensitivity was also present in human lung tumors, indicating that this therapeutic approach may be clinically relevant. PMID:28790158

  8. Role of Tumor Suppressor P53 in Megakaryopoiesis and Platelet Function

    PubMed Central

    Apostolidis, Pani A.; Woulfe, Donna S.; Chavez, Massiel; Miller, William M.; Papoutsakis, Eleftherios T.

    2011-01-01

    The pathobiological role of p53 has been widely studied, however its role in normophysiology is relatively unexplored. We previously showed that p53 knock-down increased ploidy in megakaryocytic cultures. This study aims to examine the effect of p53 loss on in vivo megakaryopoiesis, platelet production and function, and to investigate the basis for greater ploidy in p53−/− megakaryocytic cultures. Here, we used flow cytometry to analyze ploidy, DNA synthesis and apoptosis in murine cultured and bone marrow megakaryocytes following thrombopoietin administration and to analyze fibrinogen binding to platelets in vitro. Culture of p53−/− marrow cells for 6 days with thrombopoietin gave rise to 1.7-fold more megakaryocytes, 26.1±3.6% of which reached ploidy classes ≥64N compared to 8.2±0.9% of p53+/+ megakaryocytes. This was due to 30% greater DNA synthesis in p53−/− megakaryocytes and 31% greater apoptosis in p53+/+ megakaryocytes by day 4 of culture. Although the bone marrow and spleen steady-state megakaryocytic content and ploidy were similar in p53+/+ and p53−/− mice, thrombopoietin administration resulted in increased megakaryocytic polyploidization in p53−/− mice. Although their platelet counts were normal, p53−/− mice exhibited significantly longer bleeding times and p53−/− platelets were less sensitive than p53+/+ platelets to agonist-induced fibrinogen binding and P-selectin secretion. In summary, our in vivo and ex-vivo studies indicate that p53 loss leads to increased polyploidization during megakaryopoiesis. Our findings also suggest for the first time a direct link between p53 loss and the development of fully functional platelets resulting in hemostatic deficiencies. PMID:22024107

  9. The roles of p53R2 in cancer progression based on the new function of mutant p53 and cytoplasmic p21.

    PubMed

    Yousefi, Bahman; Rahmati, Mohammad; Ahmadi, Yasin

    2014-03-18

    Although the deregulated expression of p53R2, a p53-inducible protein and homologue of the R2 subunit of ribonucleotide reductase, has been detected in several human cancers, p53R2 roles in cancer progression and malignancy still remains controversial. In this article, we present a viable hypothesis about the roles of p53R2 in cancer progression and therapy resistance based on the roles of cytoplasmic p21 and mutant p53. Since p53R2 can up-regulate p21 and p21, it in turn has a dual role in cell cycle. Hence, p53R2 can play a dual role in cell cycle progression. In addition, because p53 is the main regulator of p53R2, the mutant p53 may induce the expression of p53R2 in some cancer cells based on the "keep of function" phenomenon. Therefore, depending on the locations of p21 and the new abilities of mutant p53, p53R2 has dual role in cell cycle progression. Since the DNA damaging therapies induce p53R2 expression through the induction of p53, p53R2 can be the main therapy resistance mediator in cancers with cytoplasmic p21. Copyright © 2014 Elsevier Inc. All rights reserved.

  10. Tripeptidyl peptidase II plays a role in the radiation response of selected primary cell types but not based on nuclear translocation and p53 stabilization.

    PubMed

    Firat, Elke; Tsurumi, Chizuko; Gaedicke, Simone; Huai, Jisen; Niedermann, Gabriele

    2009-04-15

    The giant cytosolic protease tripeptidyl peptidase II (TPPII) was recently proposed to play a role in the DNA damage response. Shown were nuclear translocation of TPPII after gamma-irradiation, lack of radiation-induced p53 stabilization in TPPII-siRNA-treated cells, and complete tumor regression in mice after gamma-irradiation when combined with TPPII-siRNA silencing or a protease inhibitor reported to inhibit TPPII. This suggested that TPPII could be a novel target for tumor radiosensitization and prompted us to study radiation responses using TPPII-knockout mice. Neither the sensitivity to total body irradiation nor the radiosensitivity of resting lymphoid cells, which both strongly depend on p53, was altered in the absence of TPPII. Functional integrity of p53 in TPPII-knockout cells is further shown by a proper G(1) arrest and by the accumulation of p53 and its transcriptional targets, p21, Bax, and Fas, on gamma-irradiation. Furthermore, we could not confirm radiation-induced nuclear translocation of TPPII. Nevertheless, after gamma-irradiation, we found slightly increased mitotic catastrophe of TPPII-deficient primary fibroblasts and increased apoptosis of TPPII-deficient activated CD8(+) T cells. The latter was accompanied by delayed resolution of the DNA double-strand break marker gammaH2AX. This could, however, be due to increased apoptotic DNA damage rather than reduced DNA damage repair. Our data do not confirm a role for TPPII in the DNA damage response based on nuclear TPPII translocation and p53 stabilization but nevertheless do show increased radiation-induced cell death of selected nontransformed cell types in the absence of the TPPII protease.

  11. Identification of two novel functional p53 responsive elements in the herpes simplex virus-1 genome.

    PubMed

    Hsieh, Jui-Cheng; Kuta, Ryan; Armour, Courtney R; Boehmer, Paul E

    2014-07-01

    Analysis of the herpes simplex virus-1 (HSV-1) genome reveals two candidate p53 responsive elements (p53RE), located in proximity to the replication origins oriL and oriS, referred to as p53RE-L and p53RE-S, respectively. The sequences of p53RE-L and p53RE-S conform to the p53 consensus site and are present in HSV-1 strains KOS, 17, and F. p53 binds to both elements in vitro and in virus-infected cells. Both p53RE-L and p53RE-S are capable of conferring p53-dependent transcriptional activation onto a heterologous reporter gene. Importantly, expression of the essential immediate early viral transactivator ICP4 and the essential DNA replication protein ICP8, that are adjacent to p53RE-S and p53RE-L, are repressed in a p53-dependent manner. Taken together, this study identifies two novel functional p53RE in the HSV-1 genome and suggests a complex mechanism of viral gene regulation by p53 which may determine progression of the lytic viral replication cycle or the establishment of latency. Copyright © 2014 Elsevier Inc. All rights reserved.

  12. Vitamin D receptor deficit induces activation of renin angiotensin system via SIRT1 modulation in podocytes.

    PubMed

    Chandel, Nirupama; Ayasolla, Kamesh; Wen, Hongxiu; Lan, Xiqian; Haque, Shabirul; Saleem, Moin A; Malhotra, Ashwani; Singhal, Pravin C

    2017-02-01

    Vitamin D receptor (VDR) deficient status has been shown to be associated with the activation of renin angiotensin system (RAS). We hypothesized that lack of VDR would enhance p53 expression in podocytes through down regulation of SIRT1; the former would enhance the transcription of angiotensinogen (Agt) and angiotensinogen II type 1 receptor (AT1R) leading to the activation of RAS. Renal tissues of VDR mutant (M) mice displayed increased expression of p53, Agt, renin, and AT1R. In vitro studies, VDR knockout podocytes not only displayed up regulation p53 but also displayed enhanced expression of Agt, renin and AT1R. VDR deficient podocytes also displayed an increase in mRNA expression for p53, Agt, renin, and AT1R. Interestingly, renal tissues of VDR-M as well as VDR heterozygous (h) mice displayed attenuated expression of deacetylase SIRT1. Renal tissues of VDR-M mice showed acetylation of p53 at lysine (K) 382 residues inferring that enhanced p53 expression in renal tissues could be the result of ongoing acetylation, a consequence of SIRT1 deficient state. Notably, podocytes lacking SIRT1 not only showed acetylation of p53 at lysine (K) 382 residues but also displayed enhanced p53 expression. Either silencing of SIRT1/VDR or treatment with high glucose enhanced podocyte PPAR-y expression, whereas, immunoprecipitation (IP) of their lysates with anti-retinoid X receptor (RXR) antibody revealed presence of PPAR-y. It appears that either the deficit of SIRT1 has de-repressed expression of PPAR-y or enhanced podocyte expression of PPAR-y (in the absence of VDR) has contributed to the down regulation of SIRT1. Copyright © 2017 Elsevier Inc. All rights reserved.

  13. Zn(II)-curc targets p53 in thyroid cancer cells.

    PubMed

    Garufi, Alessia; D'Orazi, Valerio; Crispini, Alessandra; D'Orazi, Gabriella

    2015-10-01

    TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers.

  14. The Origins and Evolution of the p53 Family of Genes

    PubMed Central

    Belyi, Vladimir A.; Ak, Prashanth; Markert, Elke; Wang, Haijian; Hu, Wenwei; Puzio-Kuter, Anna; Levine, Arnold J.

    2010-01-01

    A common ancestor to the three p53 family members of human genes p53, p63, and p73 is first detected in the evolution of modern‐day sea anemones, in which both structurally and functionally it acts to protect the germ line from genomic instabilities in response to stresses. This p63/p73 common ancestor gene is found in almost all invertebrates and first duplicates to produce a p53 gene and a p63/p73 ancestor in cartilaginous fish. Bony fish contain all three genes, p53, p63, and p73, and the functions of these three transcription factors diversify in the higher vertebrates. Thus, this gene family has preserved its structural features and functional activities for over one billion years of evolution. PMID:20516129

  15. The impact of p53 protein core domain structural alteration on ovarian cancer survival.

    PubMed

    Rose, Stephen L; Robertson, Andrew D; Goodheart, Michael J; Smith, Brian J; DeYoung, Barry R; Buller, Richard E

    2003-09-15

    Although survival with a p53 missense mutation is highly variable, p53-null mutation is an independent adverse prognostic factor for advanced stage ovarian cancer. By evaluating ovarian cancer survival based upon a structure function analysis of the p53 protein, we tested the hypothesis that not all missense mutations are equivalent. The p53 gene was sequenced from 267 consecutive ovarian cancers. The effect of individual missense mutations on p53 structure was analyzed using the International Agency for Research on Cancer p53 Mutational Database, which specifies the effects of p53 mutations on p53 core domain structure. Mutations in the p53 core domain were classified as either explained or not explained in structural or functional terms by their predicted effects on protein folding, protein-DNA contacts, or mutation in highly conserved residues. Null mutations were classified by their mechanism of origin. Mutations were sequenced from 125 tumors. Effects of 62 of the 82 missense mutations (76%) could be explained by alterations in the p53 protein. Twenty-three (28%) of the explained mutations occurred in highly conserved regions of the p53 core protein. Twenty-two nonsense point mutations and 21 frameshift null mutations were sequenced. Survival was independent of missense mutation type and mechanism of null mutation. The hypothesis that not all missense mutations are equivalent is, therefore, rejected. Furthermore, p53 core domain structural alteration secondary to missense point mutation is not functionally equivalent to a p53-null mutation. The poor prognosis associated with p53-null mutation is independent of the mutation mechanism.

  16. A dual role of p53 in the control of autophagy.

    PubMed

    Tasdemir, Ezgi; Chiara Maiuri, M; Morselli, Eugenia; Criollo, Alfredo; D'Amelio, Marcello; Djavaheri-Mergny, Mojgan; Cecconi, Francesco; Tavernarakis, Nektarios; Kroemer, Guido

    2008-08-01

    Genotoxic stress can induce autophagy in a p53-dependent fashion and p53 can transactivate autophagy-inducing genes. We have observed recently that inactivation of p53 by deletion, depletion or inhibition can trigger autophagy. Thus, human and mouse cells subjected to knockout, knockdown or pharmacological inhibition of p53 manifest signs of autophagy such as depletion of p62/SQSTM1, LC3 lipidation, redistribution of GFP-LC3 in cytoplasmic puncta, and accumulation of autophagosomes and autolysosomes, both in vitro and in vivo. Inhibition of p53 causes autophagy in enucleated cells, indicating that the cytoplasmic, non-nuclear pool of p53 can regulate autophagy. Accordingly, retransfection of p53(-/-) cells with wild-type p53 as well as a p53 mutant that is excluded from the nucleus (due to the deletion of the nuclear localization sequence) can inhibit autophagy, whereas retransfection with a nucleus-restricted p53 mutant (in which the nuclear localization sequence has been deleted) does not inhibit autophagy. Several distinct autophagy inducers (e.g., starvation, rapamycin, lithium, tunicamycin and thapsigargin) stimulate the rapid degradation of p53. In these conditions, inhibition of the p53-specific E3 ubiquitin ligase HDM2 can avoid p53 depletion and simultaneously prevent the activation of autophagy. Moreover, a p53 mutant that lacks the HDM2 ubiquitinylation site and hence is more stable than wild-type p53 is particularly efficient in suppressing autophagy. In conclusion, p53 plays a dual role in the control of autophagy. On the one hand, nuclear p53 can induce autophagy through transcriptional effects. On the other hand, cytoplasmic p53 may act as a master repressor of autophagy.

  17. A novel p53 mutational hotspot in skin tumors from UV-irradiated Xpc mutant mice alters transactivation functions.

    PubMed

    Inga, Alberto; Nahari, Dorit; Velasco-Miguel, Susana; Friedberg, Errol C; Resnick, Michael A

    2002-08-22

    A mutation in codon 122 of the mouse p53 gene resulting in a T to L amino acid substitution (T122-->L) is frequently associated with skin cancer in UV-irradiated mice that are both homozygous mutant for the nucleotide excision repair (NER) gene Xpc (Xpc(-/-)) and hemizygous mutant for the p53 gene. We investigated the functional consequences of the mouse T122-->L mutation when expressed either in mammalian cells or in the yeast Saccharomyces cerevisiae. Similar to a non-functional allele, high expression of the T122-->L allele in p53(-/-) mouse embryo fibroblasts and human Saos-2 cells failed to suppress growth. However, the T122-->L mutant p53 showed wild-type transactivation levels with Bax and MDM2 promoters when expressed in either cell type and retained transactivation of the p21 and the c-Fos promoters in one cell line. Using a recently developed rheostatable p53 induction system in yeast we assessed the T122-->L transactivation capacity at low levels of protein expression using 12 different p53 response elements (REs). Compared to wild-type p53 the T122-->L protein manifested an unusual transactivation pattern comprising reduced and enhanced activity with specific REs. The high incidence of the T122-->L mutant allele in the Xpc(-/-) background suggests that both genetic and epigenetic conditions may facilitate the emergence of particular functional p53 mutations. Furthermore, the approach that we have taken also provides for the dissection of functions that may be retained in many p53 tumor alleles.

  18. MicroRNAs as Key Effectors in the p53 Network.

    PubMed

    Goeman, Frauke; Strano, Sabrina; Blandino, Giovanni

    2017-01-01

    The guardian of the genome p53 is embedded in a fine-spun network of MicroRNAs. p53 is able to activate or repress directly the transcription of MicroRNAs that are participating in the tumor-suppressive mission of p53. On the other hand, the expression of p53 is under tight control of MicroRNAs that are either targeting directly p53 or factors that are modifying its protein level or activity. Although the most important function of p53 is suggested to be transcriptional regulation, there are several nontranscriptional functions described. One of those regards the modulation of MicroRNA biogenesis. Wild-type p53 is increasing the maturation of selected MicroRNAs from the primary transcript to the precursor MiRNA by interacting with the Microprocessor complex. Furthermore, p53 is modulating the mRNA accessibility for certain MicroRNAs by association with the RISC complex and transcriptional regulation of RNA-binding proteins. In this way p53 is able to remodel the MiRNA-mRNA interaction network. As wild-type p53 is employing MicroRNAs to suppress cancer development, gain-of-function mutant p53 proteins use MicroRNAs to confer oncogenic properties like chemoresistance and the ability to drive metastasis. Like its wild-type counterpart mutant p53 is able to regulate MicroRNAs transcriptionally and posttranscriptionally. Mutant p53 affects the MiRNA processing at two cleavage steps through interfering with the Microprocessor complex and by downregulating Dicer and KSRP, a modulator of MiRNA biogenesis. Thus, MicroRNAs are essential components in the p53 pathway, contributing substantially to combat or enhance tumor development depending on the wild-type or mutant p53 context. © 2017 Elsevier Inc. All rights reserved.

  19. Friend or Foe: MicroRNAs in the p53 network.

    PubMed

    Luo, Zhenghua; Cui, Ri; Tili, Esmerina; Croce, Carlo

    2018-04-10

    The critical tumor suppressor gene TP53 is either lost or mutated in more than half of human cancers. As an important transcriptional regulator, p53 modulates the expression of many microRNAs. While wild-type p53 uses microRNAs to suppress cancer development, microRNAs that are activated by gain-of-function mutant p53 confer oncogenic properties. On the other hand, the expression of p53 is tightly controlled by a fine-tune machinery including microRNAs. MicroRNAs can target the TP53 gene directly or other factors in the p53 network so that expression and function of either the wild-type or the mutant forms of p53 is downregulated. Therefore, depending on the wild-type or mutant p53 context, microRNAs contribute substantially to suppress or exacerbate tumor development. Copyright © 2018. Published by Elsevier B.V.

  20. TP53 Mutation Status of Tubo-ovarian and Peritoneal High-grade Serous Carcinoma with a Wild-type p53 Immunostaining Pattern.

    PubMed

    Na, Kiyong; Sung, Ji-Youn; Kim, Hyun-Soo

    2017-12-01

    Diffuse and strong nuclear p53 immunoreactivity and a complete lack of p53 expression are regarded as indicative of missense and nonsense mutations, respectively, of the TP53 gene. Tubo-ovarian and peritoneal high-grade serous carcinoma (HGSC) is characterized by aberrant p53 expression induced by a TP53 mutation. However, our experience with some HGSC cases with a wild-type p53 immunostaining pattern led us to comprehensively review previous cases and investigate the TP53 mutational status of the exceptional cases. We analyzed the immunophenotype of 153 cases of HGSC and performed TP53 gene sequencing analysis in those with a wild-type p53 immunostaining pattern. Immunostaining revealed that 109 (71.3%) cases displayed diffuse and strong p53 expression (missense mutation pattern), while 39 (25.5%) had no p53 expression (nonsense mutation pattern). The remaining five cases of HGSC showed a wild-type p53 immunostaining pattern. Direct sequencing analysis revealed that three of these cases harbored nonsense TP53 mutations and two had novel splice site deletions. TP53 mutation is almost invariably present in HGSC, and p53 immunostaining can be used as a surrogate marker of TP53 mutation. In cases with a wild-type p53 immunostaining pattern, direct sequencing for TP53 mutational status can be helpful to confirm the presence of a TP53 mutation. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  1. Forced Expression of Heat Shock Protein 27 (Hsp27) Reverses P-Glycoprotein (ABCB1)-mediated Drug Efflux and MDR1 Gene Expression in Adriamycin-resistant Human Breast Cancer Cells*

    PubMed Central

    Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J.; Ilangovan, Govindasamy

    2011-01-01

    Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G2/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer. PMID:21784846

  2. Forced expression of heat shock protein 27 (Hsp27) reverses P-glycoprotein (ABCB1)-mediated drug efflux and MDR1 gene expression in Adriamycin-resistant human breast cancer cells.

    PubMed

    Kanagasabai, Ragu; Krishnamurthy, Karthikeyan; Druhan, Lawrence J; Ilangovan, Govindasamy

    2011-09-23

    Mutant p53 accumulation has been shown to induce the multidrug resistance gene (MDR1) and ATP binding cassette (ABC)-based drug efflux in human breast cancer cells. In the present work, we have found that transcriptional activation of the oxidative stress-responsive heat shock factor 1 (HSF-1) and expression of heat shock proteins, including Hsp27, which is normally known to augment proteasomal p53 degradation, are inhibited in Adriamycin (doxorubicin)-resistant MCF-7 cells (MCF-7/adr). Such an endogenous inhibition of HSF-1 and Hsp27 in turn results in p53 mutation with gain of function in its transcriptional activity and accumulation in MCF-7/adr. Also, lack of HSF-1 enhances nuclear factor κB (NF-κB) DNA binding activity together with mutant p53 and induces MDR1 gene and P-glycoprotein (P-gp, ABCB1), resulting in a multidrug-resistant phenotype. Ectopic expression of Hsp27, however, significantly depleted both mutant p53 and NF-κB (p65), reversed the drug resistance by inhibiting MDR1/P-gp expression in MCF-7/adr cells, and induced cell death by increased G(2)/M population and apoptosis. We conclude from these results that HSF-1 inhibition and depletion of Hsp27 is a trigger, at least in part, for the accumulation of transcriptionally active mutant p53, which can either directly or NF-κB-dependently induce an MDR1/P-gp phenotype in MCF-7 cells. Upon Hsp27 overexpression, this pathway is abrogated, and the acquired multidrug resistance is significantly abolished so that MCF-7/adr cells are sensitized to Dox. Thus, clinical alteration in Hsp27 or NF-κB level will be a potential approach to circumvent drug resistance in breast cancer.

  3. Suppression of p53 Activity through the Cooperative Action of Ski and Histone Deacetylase SIRT1*

    PubMed Central

    Inoue, Yasumichi; Iemura, Shun-ichiro; Natsume, Tohru; Miyazawa, Keiji; Imamura, Takeshi

    2011-01-01

    Ski was originally identified as an oncogene based on the fact that Ski overexpression transformed chicken and quail embryo fibroblasts. Consistent with these proposed oncogenic roles, Ski is overexpressed in various human tumors. However, whether and how Ski functions in mammalian tumorigenesis has not been fully investigated. Here, we show that Ski interacts with p53 and attenuates the biological functions of p53. Ski overexpression attenuated p53-dependent transactivation, whereas Ski knockdown enhanced the transcriptional activity of p53. Interestingly, Ski bound to the histone deacetylase SIRT1 and stabilized p53-SIRT1 interaction to promote p53 deacetylation, which subsequently decreased the DNA binding activity of p53. Consistent with the ability of Ski to inactivate p53, overexpressing Ski desensitized cells to genotoxic drugs and Nutlin-3, a small-molecule antagonist of Mdm2 that stabilizes p53 and activates the p53 pathway, whereas knocking down Ski increased the cellular sensitivity to these agents. These results indicate that Ski negatively regulates p53 and suggest that the p53-Ski-SIRT1 axis is an attractive target for cancer therapy. PMID:21149449

  4. TP53INP1 is a novel p73 target gene that induces cell cycle arrest and cell death by modulating p73 transcriptional activity.

    PubMed

    Tomasini, Richard; Seux, Mylène; Nowak, Jonathan; Bontemps, Caroline; Carrier, Alice; Dagorn, Jean-Charles; Pébusque, Marie-Josèphe; Iovanna, Juan L; Dusetti, Nelson J

    2005-12-08

    TP53INP1 is an alternatively spliced gene encoding two nuclear protein isoforms (TP53INP1alpha and TP53INP1beta), whose transcription is activated by p53. When overexpressed, both isoforms induce cell cycle arrest in G1 and enhance p53-mediated apoptosis. TP53INP1s also interact with the p53 gene and regulate p53 transcriptional activity. We report here that TP53INP1 expression is induced during experimental acute pancreatitis in p53-/- mice and in cisplatin-treated p53-/- mouse embryo fibroblasts (MEFs). We demonstrate that ectopic expression of p73, a p53 homologue, leads to TP53INP1 induction in p53-deficient cells. In turn, TP53INP1s alters the transactivation capacity of p73 on several p53-target genes, including TP53INP1 itself, demonstrating a functional association between p73 and TP53INP1s. Also, when overexpressed in p53-deficient cells, TP53INP1s inhibit cell growth and promote cell death as assessed by cell cycle analysis and colony formation assays. Finally, we show that TP53INP1s potentiate the capacity of p73 to inhibit cell growth, that effect being prevented when the p53 mutant R175H is expressed or when p73 expression is blocked by a siRNA. These results suggest that TP53INP1s are functionally associated with p73 to regulate cell cycle progression and apoptosis, independently from p53.

  5. Functional activation of mutant p53V172F by platinum analogs in cisplatin-resistant human tumor cells is dependent on serine-20 phosphorylation

    PubMed Central

    Xie, Xiaolei; He, Guangan; Siddik, Zahid H.

    2017-01-01

    Dysfunctionality of the p53 tumor suppressor is a major cause of therapeutic drug resistance in cancer. Recently we reported that mutant, but otherwise functional, p53V172F was inactivated in cisplatin-resistant 2780CP/Cl-16 and 2780CP/Cl-24 human ovarian tumor cells by increased recruitment of the inhibitor MDM4. The current study demonstrates that, unlike cisplatin, platinum analogs oxaliplatin and DACH-diacetato-dichloro-Pt(IV) (DAP), strongly stabilize and activate p53V172F in resistant cells, as indicated by prolonged p53 half-life and transactivation of targets p21 (CDKN1A) and MDM2. This increase in MDM2 reduced MDM4 levels in cell lysates as well as the p53 immunocomplex and prevented reversion of p53 to the inactive p53-MDM2-MDM4 bound state. Phosphorylation of p53 at Ser15 was demonstrated by all three drugs in sensitive A2780 and corresponding resistant 2780CP/Cl-16 and 2780CP/Cl-24 cell lines. However, cisplatin induced Ser20 phosphorylation in A2780 cells only, but not in resistant cells; in contrast, both DAP and oxaliplatin induced this phosphorylation in all three cell lines. The inference that Ser20 phosphorylation is more important for p53 activation was confirmed by ectopic expression of a phosphomimetic (S20D) mutant p53 that displayed reduced binding, relative to wild-type p53, to both MDM2 and MDM4 in p53-knockout A2780 cells. In consonance, temporal studies demonstrated drug-induced Ser15 phosphorylation coincided with p53 stabilization, whereas Ser20 phosphorylation coincided with p53 transactivation. Implications Cisplatin fails to activate the pathway involved in phosphorylating mutant p53V172F at Ser20 in resistant cells, but this phosphorylation is restored by oxaliplatin and DAP that reactivates p53 function and circumvents cisplatin resistance. PMID:28031409

  6. Ensemble-Based Computational Approach Discriminates Functional Activity of p53 Cancer and Rescue Mutants

    PubMed Central

    Demir, Özlem; Baronio, Roberta; Salehi, Faezeh; Wassman, Christopher D.; Hall, Linda; Hatfield, G. Wesley; Chamberlin, Richard; Kaiser, Peter; Lathrop, Richard H.; Amaro, Rommie E.

    2011-01-01

    The tumor suppressor protein p53 can lose its function upon single-point missense mutations in the core DNA-binding domain (“cancer mutants”). Activity can be restored by second-site suppressor mutations (“rescue mutants”). This paper relates the functional activity of p53 cancer and rescue mutants to their overall molecular dynamics (MD), without focusing on local structural details. A novel global measure of protein flexibility for the p53 core DNA-binding domain, the number of clusters at a certain RMSD cutoff, was computed by clustering over 0.7 µs of explicitly solvated all-atom MD simulations. For wild-type p53 and a sample of p53 cancer or rescue mutants, the number of clusters was a good predictor of in vivo p53 functional activity in cell-based assays. This number-of-clusters (NOC) metric was strongly correlated (r2 = 0.77) with reported values of experimentally measured ΔΔG protein thermodynamic stability. Interpreting the number of clusters as a measure of protein flexibility: (i) p53 cancer mutants were more flexible than wild-type protein, (ii) second-site rescue mutations decreased the flexibility of cancer mutants, and (iii) negative controls of non-rescue second-site mutants did not. This new method reflects the overall stability of the p53 core domain and can discriminate which second-site mutations restore activity to p53 cancer mutants. PMID:22028641

  7. Molecular dynamics simulation of S100B protein to explore ligand blockage of the interaction with p53 protein

    NASA Astrophysics Data System (ADS)

    Zhou, Zhigang; Li, Yumin

    2009-10-01

    As a tumor suppressor, p53 plays an important role in cancer suppression. The biological function of p53 as a tumor suppressor is disabled when it binds to S100B. Developing the ligands to block the S100B-p53 interaction has been proposed as one of the most important approaches to the development of anti-cancer agents. We screened a small compound library against the binding interface of S100B and p53 to identify potential compounds to interfere with the interaction. The ligand-binding effect on the S100B-p53 interaction was explored by molecular dynamics at the atomic level. The results show that the ligand bound between S100B and p53 propels the two proteins apart by about 2 Å compared to the unligated S100B-p53 complex. The binding affinity of S100B and p53 decreases by 8.5-14.6 kcal/mol after a ligand binds to the interface from the original unligated state of the S100B-p53 complex. Ligand-binding interferes with the interaction of S100B and p53. Such interference could impact the association of S100B and p53, which would free more p53 protein from the pairing with S100B and restore the biological function of p53 as a tumor suppressor. The analysis of the binding mode and ligand structural features would facilitate our effort to identify and design ligands to block S100B-p53 interaction effectively. The results from the work suggest that developing ligands targeting the interface of S100B and p53 could be a promising approach to recover the normal function of p53 as a tumor suppressor.

  8. Impact of the p53 status of tumor cells on extrinsic and intrinsic apoptosis signaling.

    PubMed

    Wachter, Franziska; Grunert, Michaela; Blaj, Cristina; Weinstock, David M; Jeremias, Irmela; Ehrhardt, Harald

    2013-04-17

    The p53 protein is the best studied target in human cancer. For decades, p53 has been believed to act mainly as a tumor suppressor and by transcriptional regulation. Only recently, the complex and diverse function of p53 has attracted more attention. Using several molecular approaches, we studied the impact of different p53 variants on extrinsic and intrinsic apoptosis signaling. We reproduced the previously published results within intrinsic apoptosis induction: while wild-type p53 promoted cell death, different p53 mutations reduced apoptosis sensitivity. The prediction of the impact of the p53 status on the extrinsic cell death induction was much more complex. The presence of p53 in tumor cell lines and primary xenograft tumor cells resulted in either augmented, unchanged or reduced cell death. The substitution of wild-type p53 by mutant p53 did not affect the extrinsic apoptosis inducing capacity. In summary, we have identified a non-expected impact of p53 on extrinsic cell death induction. We suggest that the impact of the p53 status of tumor cells on extrinsic apoptosis signaling should be studied in detail especially in the context of therapeutic approaches that aim to restore p53 function to facilitate cell death via the extrinsic apoptosis pathway.

  9. UBE4B targets phosphorylated p53 at serines 15 and 392 for degradation

    PubMed Central

    Du, Cheng; Wu, Hong; Leng, Roger P.

    2016-01-01

    Phosphorylation of p53 is a key mechanism responsible for the activation of its tumor suppressor functions in response to various stresses. In unstressed cells, p53 is rapidly turned over and is maintained at a low basal level. After DNA damage or other forms of cellular stress, the p53 level increases, and the protein becomes metabolically stable. However, the mechanism of phosphorylated p53 regulation is unclear. In this study, we studied the kinetics of UBE4B, Hdm2, Pirh2, Cop1 and CHIP induction in response to p53 activation. We show that UBE4B coimmunoprecipitates with phosphorylated p53 at serines 15 and 392. Notably, the affinity between UBE4B and Hdm2 is greatly decreased after DNA damage. Furthermore, we observe that UBE4B promotes endogenous phospho-p53(S15) and phospho-p53(S392) degradation in response to IR. We demonstrate that UBE4B and Hdm2 repress p53S15A, p53S392A, and p53-2A(S15A, S392A) functions, including p53-dependent transactivation and growth inhibition. Overall, our results reveal that UBE4B plays an important role in regulating phosphorylated p53 following DNA damage. PMID:26673821

  10. Small-molecule MDM2 antagonists reveal aberrant p53 signaling in cancer: Implications for therapy

    PubMed Central

    Tovar, Christian; Rosinski, James; Filipovic, Zoran; Higgins, Brian; Kolinsky, Kenneth; Hilton, Holly; Zhao, Xiaolan; Vu, Binh T.; Qing, Weiguo; Packman, Kathryn; Myklebost, Ola; Heimbrook, David C.; Vassilev, Lyubomir T.

    2006-01-01

    The p53 tumor suppressor retains its wild-type conformation and transcriptional activity in half of all human tumors, and its activation may offer a therapeutic benefit. However, p53 function could be compromised by defective signaling in the p53 pathway. Using a small-molecule MDM2 antagonist, nutlin-3, to probe downstream p53 signaling we find that the cell-cycle arrest function of the p53 pathway is preserved in multiple tumor-derived cell lines expressing wild-type p53, but many have a reduced ability to undergo p53-dependent apoptosis. Gene array analysis revealed attenuated expression of multiple apoptosis-related genes. Cancer cells with mdm2 gene amplification were most sensitive to nutlin-3 in vitro and in vivo, suggesting that MDM2 overexpression may be the only abnormality in the p53 pathway of these cells. Nutlin-3 also showed good efficacy against tumors with normal MDM2 expression, suggesting that many of the patients with wild-type p53 tumors may benefit from antagonists of the p53–MDM2 interaction. PMID:16443686

  11. Residues in the alternative reading frame tumor suppressor that influence its stability and p53-independent activities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tommaso, Anne di; Hagen, Jussara; Tompkins, Van

    2009-04-15

    The Alternative Reading Frame (ARF) protein suppresses tumorigenesis through p53-dependent and p53-independent pathways. Most of ARF's anti-proliferative activity is conferred by sequences in its first exon. Previous work showed specific amino acid changes occurred in that region during primate evolution, so we programmed those changes into human p14ARF to assay their functional impact. Two human p14ARF residues (Ala{sup 14} and Thr{sup 31}) were found to destabilize the protein while two others (Val{sup 24} and Ala{sup 41}) promoted more efficient p53 stabilization and activation. Despite those effects, all modified p14ARF forms displayed robust p53-dependent anti-proliferative activity demonstrating there are no significantmore » biological differences in p53-mediated growth suppression associated with simian versus human p14ARF residues. In contrast, p53-independent p14ARF function was considerably altered by several residue changes. Val{sup 24} was required for p53-independent growth suppression whereas multiple residues (Val{sup 24}, Thr{sup 31}, Ala{sup 41} and His{sup 60}) enabled p14ARF to block or reverse the inherent chromosomal instability of p53-null MEFs. Together, these data pinpoint specific residues outside of established p14ARF functional domains that influence its expression and signaling activities. Most intriguingly, this work reveals a novel and direct role for p14ARF in the p53-independent maintenance of genomic stability.« less

  12. What is the best frontline therapy for patients with CLL and 17p deletion?

    PubMed

    Badoux, Xavier C; Keating, Michael J; Wierda, William G

    2011-03-01

    Chronic lymphocytic leukemia (CLL) is a lymphoproliferative disease with significant variation in disease progression, response to therapy, and survival outcome. Deletions of 17p or mutations of TP53 have been identified as one of the poorest prognostic factors, being predictive of short time for disease progression, lack of response to therapy, short response duration, and short overall survival. The treatment of patients with CLL has improved significantly with the development of chemoimmunotherapy, but this benefit was not pronounced in patients with 17p deletion. We compare various treatment strategies used in these patients, including FCR-like chemoimmunotherapy, alemtuzumab, other antibody combinations, or novel targeted therapies with promising results. Allogeneic stem cell transplantation offers the possibility for long-term disease control in these patients and should be considered early in younger, transplant-eligible patients. The current state of therapy is far from optimal and resources should be applied to studying therapeutic options for patients who have CLL with loss of p53 function.

  13. Lipoic acid induces p53-independent cell death in colorectal cancer cells and potentiates the cytotoxicity of 5-fluorouracil.

    PubMed

    Dörsam, Bastian; Göder, Anja; Seiwert, Nina; Kaina, Bernd; Fahrer, Jörg

    2015-10-01

    Alpha-lipoic acid (LA), which plays a pivotal role in mitochondrial energy metabolism, is an endogenous dithiol compound with an array of antioxidative functions. It has been shown that LA triggers cell death in tumor cell lines, whereas non-transformed cells are hardly affected. In the present study, we analyzed the cytotoxicity of LA on colorectal cancer (CRC) cells differing in their p53 status and investigated a putative synergistic effect with the anticancer drug 5-fluorouracil (5-FU). We show that LA induces a dose-dependent decrease in cell viability, which was independent of the p53 status as attested in isogenic p53-proficient and p53-deficient cell lines. This effect was largely attributable to cell death induction as revealed by Annexin-V/PI staining. LA-treated HCT116 cells underwent caspase-dependent and caspase-independent cell death, which was blocked by the pan-caspase inhibitor zVAD and the RIP-kinase inhibitor Necrostatin-1, respectively. In CaCO-2 and HT29 cells, LA induced caspase-dependent cell demise via activation of caspase-9, caspase-3 and caspase-7 with subsequent PARP-1 cleavage as demonstrated by immunoblot analysis, activity assays and pan-caspase inhibition. Interestingly, LA treatment did neither activate p53 nor induced genotoxic effects as shown by lack of DNA strand breaks and phosphorylation of histone 2AX. Finally, we provide evidence that LA increases the cytotoxic effect induced by the anticancer drug 5-FU as revealed by significantly enhanced cell death rates in HCT116 and CaCO-2 cells. Collectively, these findings demonstrate that LA induces CRC cell death independent of their p53 status and potentiates the cytotoxicity of 5-FU without causing DNA damage on its own, which makes it a candidate for tumor therapy.

  14. Mutant p53 Promotes Tumor Cell Malignancy by Both Positive and Negative Regulation of the Transforming Growth Factor β (TGF-β) Pathway*

    PubMed Central

    Ji, Lei; Xu, Jinjin; Liu, Jian; Amjad, Ali; Zhang, Kun; Liu, Qingwu; Zhou, Lei; Xiao, Jianru; Li, Xiaotao

    2015-01-01

    Specific p53 mutations abrogate tumor-suppressive functions by gaining new abilities to promote tumorigenesis. Inactivation of p53 is known to distort TGF-β signaling, which paradoxically displays both tumor-suppressive and pro-oncogenic functions. The molecular mechanisms of how mutant p53 simultaneously antagonizes the tumor-suppressive and synergizes the tumor-promoting function of the TGF-β pathway remain elusive. Here we demonstrate that mutant p53 differentially regulates subsets of TGF-β target genes by enhanced binding to the MH2 domain in Smad3 upon the integration of ERK signaling, therefore disrupting Smad3/Smad4 complex formation. Silencing Smad2, inhibition of ERK, or introducing a phosphorylation-defective mutation at Ser-392 in p53 abrogates the R175H mutant p53-dependent regulation of these TGF-β target genes. Our study shows a mechanism to reconcile the seemingly contradictory observations that mutant p53 can both attenuate and cooperate with the TGF-β pathway to promote cancer cell malignancy in the same cell type. PMID:25767119

  15. P53 alters the cytotoxicity and genotoxicity for oxidized graphene in human B-lymphoblastoid cells

    NASA Astrophysics Data System (ADS)

    Petibone, Dayton Matthew

    Widespread use of oxidized graphene nanomaterials in industry, medicine, and consumer products raises concern about potential adverse impacts on human health. The p53 tumor suppressor protein is crucial to maintaining cellular and genetic stability to prevent carcinogenesis. Here, we show that oxygen functionalized graphene (f-G) absorption and p53 functional status correlate with cytotoxicity and genotoxicity in human B-lymphoblastoid cells. Trends in f-G absorption by were dose-dependent. Cells with functional p53 exposed to f-G arrested in G0/G1 phase of the cell cycle, suppressed f-G induced reactive oxygen species (ROS), and had elevated apoptosis. While compared to p53 competent cells, the p53 deficient cells exposed to f-G accumulated in S-phase of the cell cycle, had elevated ROS levels, and evaded apoptosis. The f-G genotoxicity was evident as increased loss-of-heterozygosity mutants independent of p53 status, and structural chromosome damage in p53 deficient cells. These findings have broad implications for the safety and efficacy of oxidized graphene nanomaterials in industrial, consumer products and biomedical applications.

  16. Small-molecule RETRA suppresses mutant p53-bearing cancer cells through a p73-dependent salvage pathway

    PubMed Central

    Kravchenko, J. E.; Ilyinskaya, G. V.; Komarov, P. G.; Agapova, L. S.; Kochetkov, D. V.; Strom, E.; Frolova, E. I.; Kovriga, I.; Gudkov, A. V.; Feinstein, E.; Chumakov, P. M.

    2008-01-01

    Identification of unique features of cancer cells is important for defining specific and efficient therapeutic targets. Mutant p53 is present in nearly half of all cancer cases, forming a promising target for pharmacological reactivation. In addition to being defective for the tumor-suppressor function, mutant p53 contributes to malignancy by blocking a p53 family member p73. Here, we describe a small-molecule RETRA that activates a set of p53-regulated genes and specifically suppresses mutant p53-bearing tumor cells in vitro and in mouse xenografts. Although the effect is strictly limited to the cells expressing mutant p53, it is abrogated by inhibition with RNAi to p73. Treatment of mutant p53-expressing cancer cells with RETRA results in a substantial increase in the expression level of p73, and a release of p73 from the blocking complex with mutant p53, which produces tumor-suppressor effects similar to the functional reactivation of p53. RETRA is active against tumor cells expressing a variety of p53 mutants and does not affect normal cells. The results validate the mutant p53–p73 complex as a promising and highly specific potential target for cancer therapy. PMID:18424558

  17. Integrative Analysis Reveals an Outcome-associated and Targetable Pattern of p53 and Cell Cycle Deregulation in Diffuse Large B-cell Lymphoma

    PubMed Central

    Monti, Stefano; Chapuy, Bjoern; Takeyama, Kunihiko; Rodig, Scott J; Hao, Yangsheng; Yeda, Kelly T.; Inguilizian, Haig; Mermel, Craig; Curie, Treeve; Dogan, Ahmed; Kutok, Jeffery L; Beroukim, Rameen; Neuberg, Donna; Habermann, Thomas; Getz, Gad; Kung, Andrew L; Golub, Todd R; Shipp, Margaret A

    2013-01-01

    Summary Diffuse large B-cell lymphoma (DLBCL) is a clinically and biologically heterogeneous disease with a high proliferation rate. By integrating copy number data with transcriptional profiles and performing pathway analysis in primary DLBCLs, we identified a comprehensive set of copy number alterations (CNAs) that decreased p53 activity and perturbed cell cycle regulation. Primary tumors either had multiple complementary alterations of p53 and cell cycle components or largely lacked these lesions. DLBCLs with p53 and cell cycle pathway CNAs had decreased abundance of p53 target transcripts and increased expression of E2F target genes and the Ki67 proliferation marker. CNAs of the CDKN2A-TP53-RB-E2F axis provide a structural basis for increased proliferation in DLBCL, predict outcome with current therapy and suggest targeted treatment approaches. PMID:22975378

  18. Role of p53 in silibinin-mediated inhibition of ultraviolet B radiation-induced DNA damage, inflammation and skin carcinogenesis.

    PubMed

    Rigby, Cynthia M; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K; Dhar, Deepanshi; Orlicky, David J; Agarwal, Chapla; Agarwal, Rajesh

    2017-01-01

    Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53 +/- ) and p53 knockout (p53 -/- ) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53 +/+ mice, p53 +/- mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53 +/+ mice but silibinin' protective efficacy was significantly compromised in p53 +/- mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53 -/- mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53 +/+ mice while its efficacy was partially compromised in p53 -/- mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Role of p53 in silibinin-mediated inhibition of ultraviolet B radiation-induced DNA damage, inflammation and skin carcinogenesis

    PubMed Central

    Rigby, Cynthia M.; Roy, Srirupa; Deep, Gagan; Guillermo-Lagae, Ruth; Jain, Anil K.; Dhar, Deepanshi; Orlicky, David J.; Agarwal, Chapla; Agarwal, Rajesh

    2017-01-01

    Non-melanoma skin cancers (NMSC) are a growing problem given that solar ultraviolet B (UVB) radiation exposure is increasing most likely due to depletion of the atmospheric ozone layer and lack of adequate sun protection. Better preventive methods are urgently required to reduce UV-caused photodamage and NMSC incidence. Earlier, we have reported that silibinin treatment activates p53 and reduces photodamage and NMSC, both in vitro and in vivo; but whether silibinin exerts its protective effects primarily through p53 remains unknown. To address this question, we generated p53 heterozygous (p53+/−) and p53 knockout (p53−/−) mice on SKH-1 hairless mouse background, and assessed silibinin efficacy in both short- and long-term UVB exposure experiments. In the chronic UVB-exposed skin tumorigenesis study, compared to p53+/+ mice, p53+/− mice developed skin tumors earlier and had higher tumor number, multiplicity and volume. Silibinin topical treatment significantly reduced the tumor number, multiplicity and volume in p53+/+ mice but silibinin’ protective efficacy was significantly compromised in p53+/− mice. Additionally, silibinin treatment failed to inhibit precursor skin cancer lesions in p53−/− mice but improved the survival of the mice. In short-term studies, silibinin application accelerated the removal of UVB-induced DNA damage in p53+/+ mice while its efficacy was partially compromised in p53−/− mice. Interestingly, silibinin treatment also inhibited the UVB-induced inflammatory markers in skin tissue. These results further confirmed that absence of the p53 allele predisposes mice to photodamage and photocarcinogenesis, and established that silibinin mediates its protection against UVB-induced photodamage, inflammation and photocarcinogenesis partly through p53 activation. PMID:27729375

  20. Differential S-phase progression after irradiation of p53 functional versus non-functional tumour cells

    PubMed Central

    Zölzer, Friedo; Mußfeldt, Tamare; Streffer, Christian

    2014-01-01

    Background Many pathways seem to be involved in the regulation of the intra-S-phase checkpoint after exposure to ionizing radiation, but the role of p53 has proven to be rather elusive. Here we have a closer look at the progression of irradiated cells through S-phase in dependence of their p53 status. Materials and methods. Three pairs of tumour cell lines were used, each consisting of one p53 functional and one p53 non-functional line. Cells were labelled with bromodeoxyuridine(BrdU) immediately after irradiation, they were then incubated in label-free medium, and at different times afterwards their position within the S-phase was determined by means of flow cytometry. Results While in the p53 deficient cells progression through S-phase was slowed significantly over at least a few hours, it was halted for just about an hour in the p53 proficient cells and then proceeded without further delay or even at a slightly accelerated pace. Conclusions It is clear from the experiments presented here that p53 does play a role for the progress of cells through the S-phase after X-ray exposure, but the exact mechanisms by which replicon initiation and elongation is controlled in irradiated cells remain to be elucidated. PMID:25435848

  1. Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway.

    PubMed

    Namba, Takushi; Chu, Kiki; Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W

    2015-08-21

    Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53.

  2. Loss of p53 enhances the function of the endoplasmic reticulum through activation of the IRE1α/XBP1 pathway

    PubMed Central

    Kodama, Rika; Byun, Sanguine; Yoon, Kyoung Wan; Hiraki, Masatsugu; Mandinova, Anna; Lee, Sam W.

    2015-01-01

    Altered regulation of ER stress response has been implicated in a variety of human diseases, such as cancer and metabolic diseases. Excessive ER function contributes to malignant phenotypes, such as chemoresistance and metastasis. Here we report that the tumor suppressor p53 regulates ER function in response to stress. We found that loss of p53 function activates the IRE1α/XBP1 pathway to enhance protein folding and secretion through upregulation of IRE1α and subsequent activation of its target XBP1. We also show that wild-type p53 interacts with synoviolin (SYVN1)/HRD1/DER3, a transmembrane E3 ubiquitin ligase localized to ER during ER stress and removes unfolded proteins by reversing transport to the cytosol from the ER, and its interaction stimulates IRE1α degradation. Moreover, IRE1α inhibitor suppressed protein secretion, induced cell death in p53-deficient cells, and strongly suppressed the formation of tumors by p53-deficient human tumor cells in vivo compared with those that expressed wild-type p53. Therefore, our data imply that the IRE1α/XBP1 pathway serves as a target for therapy of chemoresistant tumors that express mutant p53. PMID:26254280

  3. The p53-p21WAF1 checkpoint pathway plays a protective role in preventing DNA rereplication induced by abrogation of FOXF1 function

    PubMed Central

    Lo, Pang-Kuo; Lee, Ji Shin; Sukumar, Saraswati

    2011-01-01

    We previously identified FOXF1 as a potential tumor suppressor gene with an essential role in preventing DNA rereplication to maintain genomic stability, which is frequently inactivated in breast cancer through the epigenetic mechanism. Here we further addressed the role of the p53-p21WAF1 checkpoint pathway in DNA rereplication induced by silencing of FOXF1. Knockdown of FOXF1 by small interference RNA (siRNA) rendered colorectal p53-null and p21WAF1-null HCT116 cancer cells more susceptible to rereplication and apoptosis than the wild-type parental cells. In parental HCT116 cells with a functional p53 checkpoint, the p53-p21WAF1 checkpoint pathway was activated upon FOXF1 knockdown, which was concurrent with suppression of the CDK2-Rb cascade and induction of G1 arrest. In contrast, these events were not observed in FOXF1-depleted HCT116-p53−/− and HCT116-p21−/− cells, indicating the p53-dependent checkpoint function is vital for inhibiting CDK2 to induce G1 arrest and protect cells from rereplication. The pharmacologic inhibitor (caffeine) of Ataxia telangiectasia mutated (ATM) and ataxia telangiectasia and Rad3 related (ATR) protein kinases abolished activation of the p53-p21WAF1 pathway upon FOXF1 knockdown, suggesting that suppression of FOXF1 function triggered the ATM/ATR-mediated DNA damage response. Cosilencing of p53 by siRNA synergistically enhanced the effect of FOXF1 depletion on stimulation of DNA rereplication and apoptosis in wild-type HCT116. Finally, we show that FOXF1 expression is predominantly silenced in breast and colorectal cancer cell lines with inactive p53. Our study demonstrated that the p53-p21WAF1 checkpoint pathway is an intrinsically protective mechanism to prevent DNA rereplication induced by silencing of FOXF1. PMID:21964066

  4. A Polymorphic p53 Response Element in KIT Ligand Influences Cancer Risk and Has Undergone Natural Selection

    PubMed Central

    Zeron-Medina, Jorge; Wang, Xuting; Repapi, Emmanouela; Campbell, Michelle R.; Su, Dan; Castro-Giner, Francesc; Davies, Benjamin; Peterse, Elisabeth F.P.; Sacilotto, Natalia; Walker, Graeme J.; Terzian, Tamara; Tomlinson, Ian P.; Box, Neil F.; Meinshausen, Nicolai; De Val, Sarah; Bell, Douglas A.; Bond, Gareth L.

    2014-01-01

    SUMMARY The ability of p53 to regulate transcription is crucial for tumor suppression and implies that inherited polymorphisms in functional p53-binding sites could influence cancer. Here, we identify a polymorphic p53 responsive element and demonstrate its influence on cancer risk using genome-wide data sets of cancer susceptibility loci, genetic variation, p53 occupancy, and p53-binding sites. We uncover a single-nucleotide polymorphism (SNP) in a functional p53-binding site and establish its influence on the ability of p53 to bind to and regulate transcription of the KITLG gene. The SNP resides in KITLG and associates with one of the largest risks identified among cancer genome-wide association studies. We establish that the SNP has undergone positive selection throughout evolution, signifying a selective benefit, but go on to show that similar SNPs are rare in the genome due to negative selection, indicating that polymorphisms in p53-binding sites are primarily detrimental to humans. PMID:24120139

  5. p53 in survival, death and metabolic health: a lifeguard with a licence to kill.

    PubMed

    Kruiswijk, Flore; Labuschagne, Christiaan F; Vousden, Karen H

    2015-07-01

    The function of p53 as a tumour suppressor has been attributed to its ability to promote cell death or permanently inhibit cell proliferation. However, in recent years, it has become clear that p53 can also contribute to cell survival. p53 regulates various metabolic pathways, helping to balance glycolysis and oxidative phosphorylation, limiting the production of reactive oxygen species, and contributing to the ability of cells to adapt to and survive mild metabolic stresses. Although these activities may be integrated into the tumour suppressive functions of p53, deregulation of some elements of the p53-induced response might also provide tumours with a survival advantage.

  6. The transcription factor p53: Not a repressor, solely an activator

    PubMed Central

    Fischer, Martin; Steiner, Lydia; Engeland, Kurt

    2014-01-01

    The predominant function of the tumor suppressor p53 is transcriptional regulation. It is generally accepted that p53-dependent transcriptional activation occurs by binding to a specific recognition site in promoters of target genes. Additionally, several models for p53-dependent transcriptional repression have been postulated. Here, we evaluate these models based on a computational meta-analysis of genome-wide data. Surprisingly, several major models of p53-dependent gene regulation are implausible. Meta-analysis of large-scale data is unable to confirm reports on directly repressed p53 target genes and falsifies models of direct repression. This notion is supported by experimental re-analysis of representative genes reported as directly repressed by p53. Therefore, p53 is not a direct repressor of transcription, but solely activates its target genes. Moreover, models based on interference of p53 with activating transcription factors as well as models based on the function of ncRNAs are also not supported by the meta-analysis. As an alternative to models of direct repression, the meta-analysis leads to the conclusion that p53 represses transcription indirectly by activation of the p53-p21-DREAM/RB pathway. PMID:25486564

  7. Reciprocal regulation of p53 and malic enzymes modulates metabolism and senescence.

    PubMed

    Jiang, Peng; Du, Wenjing; Mancuso, Anthony; Wellen, Kathryn E; Yang, Xiaolu

    2013-01-31

    Cellular senescence both protects multicellular organisms from cancer and contributes to their ageing. The pre-eminent tumour suppressor p53 has an important role in the induction and maintenance of senescence, but how it carries out this function remains poorly understood. In addition, although increasing evidence supports the idea that metabolic changes underlie many cell-fate decisions and p53-mediated tumour suppression, few connections between metabolic enzymes and senescence have been established. Here we describe a new mechanism by which p53 links these functions. We show that p53 represses the expression of the tricarboxylic-acid-cycle-associated malic enzymes ME1 and ME2 in human and mouse cells. Both malic enzymes are important for NADPH production, lipogenesis and glutamine metabolism, but ME2 has a more profound effect. Through the inhibition of malic enzymes, p53 regulates cell metabolism and proliferation. Downregulation of ME1 and ME2 reciprocally activates p53 through distinct MDM2- and AMP-activated protein kinase-mediated mechanisms in a feed-forward manner, bolstering this pathway and enhancing p53 activation. Downregulation of ME1 and ME2 also modulates the outcome of p53 activation, leading to strong induction of senescence, but not apoptosis, whereas enforced expression of either malic enzyme suppresses senescence. Our findings define physiological functions of malic enzymes, demonstrate a positive-feedback mechanism that sustains p53 activation, and reveal a connection between metabolism and senescence mediated by p53.

  8. Wip1 and p53 contribute to HTLV-1 Tax-induced tumorigenesis

    PubMed Central

    2012-01-01

    Background Human T-cell Leukemia Virus type 1 (HTLV-1) infects 20 million individuals world-wide and causes Adult T-cell Leukemia/Lymphoma (ATLL), a highly aggressive T-cell cancer. ATLL is refractory to treatment with conventional chemotherapy and fewer than 10% of afflicted individuals survive more than 5 years after diagnosis. HTLV-1 encodes a viral oncoprotein, Tax, that functions in transforming virus-infected T-cells into leukemic cells. All ATLL cases are believed to have reduced p53 activity although only a minority of ATLLs have genetic mutations in their p53 gene. It has been suggested that p53 function is inactivated by the Tax protein. Results Using genetically altered mice, we report here that Tax expression does not achieve a functional equivalence of p53 inactivation as that seen with genetic mutation of p53 (i.e. a p53−/− genotype). Thus, we find statistically significant differences in tumorigenesis between Tax+p53+/+versus Tax+p53−/− mice. We also find a role contributed by the cellular Wip1 phosphatase protein in tumor formation in Tax transgenic mice. Notably, Tax+Wip1−/− mice show statistically significant reduced prevalence of tumorigenesis compared to Tax+Wip1+/+ counterparts. Conclusions Our findings provide new insights into contributions by p53 and Wip1 in the in vivo oncogenesis of Tax-induced tumors in mice. PMID:23256545

  9. Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status

    PubMed Central

    Mirjolet, J-F; Barberi-Heyob, M; Didelot, C; Peyrat, J-P; Abecassis, J; Millon, R; Merlin, J-L

    2000-01-01

    p53 tumour-suppressor gene is involved in cell growth control, arrest and apoptosis. Nevertheless cell cycle arrest and apoptosis induction can be observed in p53-defective cells after exposure to DNA-damaging agents such as 5-fluorouracil (5-FU) suggesting the importance of alternative pathways via p53-independent mechanisms. In order to establish relationship between p53 status, cell cycle arrest, Bcl-2/Bax regulation and 5-FU sensitivity, we examined p53 mRNA and protein expression and p53 protein functionality in wild-type (wt) and mutant (mt) p53 cell lines. p53 mRNA and p53 protein expression were determined before and after exposure to equitoxic 5-FU concentration in six human carcinoma cell lines differing in p53 status and displaying marked differences in 5-FU sensitivity, with IC 50 values ranging from 0.2–22.6 mM. 5-FU induced a rise in p53 mRNA expression in mt p53 cell lines and in human papilloma virus positive wt p53 cell line, whereas significant decrease in p53 mRNA expression was found in wt p53 cell line. Whatever p53 status, 5-FU altered p53 transcriptional and translational regulation leading to up-regulation of p53 protein. In relation with p53 functionality, but independently of p53 mutational status, after exposure to 5-FU equitoxic concentration, all cell lines were able to arrest in G1. No relationship was evidenced between G1 accumulation ability and 5-FU sensitivity. Moreover, after 5-FU exposure, Bax and Bcl-2 proteins regulation was under p53 protein control and a statistically significant relationship (r= 0.880,P= 0.0097) was observed between Bcl-2/Bax ratio and 5-FU sensitivity. In conclusion, whatever p53 status, Bcl-2 or Bax induction and Bcl-2/Bax protein ratio were correlated to 5-FU sensitivity. © 2000 Cancer Research Campaign PMID:11044365

  10. P53 oncosuppressor influences selection of genomic imbalances in response to ionizing radiations in human osteosarcoma cell line SAOS-2.

    PubMed

    Zuffa, Elisa; Mancini, Manuela; Brusa, Gianluca; Pagnotta, Eleonora; Hattinger, Claudia Maria; Serra, Massimo; Remondini, Daniel; Castellani, Gastone; Corrado, Patrizia; Barbieri, Enza; Santucci, Maria Alessandra

    2008-07-01

    To investigate the impact of TP53 (tumor protein 53, p53) on genomic stability of osteosarcoma (OS). In first instance, we expressed in OS cell line SAOS-2 (lacking p53) a wild type (wt) p53 construct, whose protein undergoes nuclear import and activation in response to ionizing radiations (IR). Thereafter, we investigated genomic imbalances (amplifications and deletions at genes or DNA regions most frequently altered in human cancers) associated with radio-resistance relative to p53 expression by mean of an array-based comparative genomic hybridization (aCGH) strategy. Finally we investigated a putative marker of radio-induced oxidative stress, a 4,977 bp deletion at mitochondrial (mt) DNA usually referred to as 'common' deletion, by mean of a polimerase chain reaction (PCR) strategy. In radio-resistant subclones generated from wt p53-transfected SAOS-2 cells DNA deletions were remarkably reduced and the accumulation of 'common' deletion at mtDNA (that may let the persistence of oxidative damage by precluding detoxification from reactive oxygen species [ROS]) completely abrogated. The results of our study confirm that wt p53 has a role in protection of OS cell DNA integrity. Multiple mechanisms involved in p53 safeguard of genomic integrity and prevention of deletion outcome are discussed.

  11. Rb and p53 Liver Functions Are Essential for Xenobiotic Metabolism and Tumor Suppression

    PubMed Central

    Nantasanti, Sathidpak; Toussaint, Mathilda J. M.; Youssef, Sameh A.; Tooten, Peter C. J.; de Bruin, Alain

    2016-01-01

    The tumor suppressors Retinoblastoma (Rb) and p53 are frequently inactivated in liver diseases, such as hepatocellular carcinomas (HCC) or infections with Hepatitis B or C viruses. Here, we discovered a novel role for Rb and p53 in xenobiotic metabolism, which represent a key function of the liver for metabolizing therapeutic drugs or toxins. We demonstrate that Rb and p53 cooperate to metabolize the xenobiotic 3,5-diethoxycarbonyl-1,4-dihydrocollidine (DDC). DDC is metabolized mainly by cytochrome P450 (Cyp)3a enzymes resulting in inhibition of heme synthesis and accumulation of protoporphyrin, an intermediate of heme pathway. Protoporphyrin accumulation causes bile injury and ductular reaction. We show that loss of Rb and p53 resulted in reduced Cyp3a expression decreased accumulation of protoporphyrin and consequently less ductular reaction in livers of mice fed with DDC for 3 weeks. These findings provide strong evidence that synergistic functions of Rb and p53 are essential for metabolism of DDC. Because Rb and p53 functions are frequently disabled in liver diseases, our results suggest that liver patients might have altered ability to remove toxins or properly metabolize therapeutic drugs. Strikingly the reduced biliary injury towards the oxidative stress inducer DCC was accompanied by enhanced hepatocellular injury and formation of HCCs in Rb and p53 deficient livers. The increase in hepatocellular injury might be related to reduce protoporphyrin accumulation, because protoporphrin is well known for its anti-oxidative activity. Furthermore our results indicate that Rb and p53 not only function as tumor suppressors in response to carcinogenic injury, but also in response to non-carcinogenic injury such as DDC. PMID:26967735

  12. Binding of Amphipathic Cell Penetrating Peptide p28 to Wild Type and Mutated p53 as studied by Raman, Atomic Force and Surface Plasmon Resonance spectroscopies.

    PubMed

    Signorelli, Sara; Santini, Simona; Yamada, Tohru; Bizzarri, Anna Rita; Beattie, Craig W; Cannistraro, Salvatore

    2017-04-01

    Mutations within the DNA binding domain (DBD) of the tumor suppressor p53 are found in >50% of human cancers and may significantly modify p53 secondary structure impairing its function. p28, an amphipathic cell-penetrating peptide, binds to the DBD through hydrophobic interaction and induces a posttranslational increase in wildtype and mutant p53 restoring functionality. We use mutation analyses to explore which elements of secondary structure may be critical to p28 binding. Molecular modeling, Raman spectroscopy, Atomic Force Spectroscopy (AFS) and Surface Plasmon Resonance (SPR) were used to identify which secondary structure of site-directed and naturally occurring mutant DBDs are potentially altered by discrete changes in hydrophobicity and the molecular interaction with p28. We show that specific point mutations that alter hydrophobicity within non-mutable and mutable regions of the p53 DBD alter specific secondary structures. The affinity of p28 was positively correlated with the β-sheet content of a mutant DBD, and reduced by an increase in unstructured or random coil that resulted from a loss in hydrophobicity and redistribution of surface charge. These results help refine our knowledge of how mutations within p53-DBD alter secondary structure and provide insight on how potential structural alterations in p28 or similar molecules improve their ability to restore p53 function. Raman spectroscopy, AFS, SPR and computational modeling are useful approaches to characterize how mutations within the p53DBD potentially affect secondary structure and identify those structural elements prone to influence the binding affinity of agents designed to increase the functionality of p53. Copyright © 2017 Elsevier B.V. All rights reserved.

  13. Rescue of p53 function by small-molecule RITA in cervical carcinoma by blocking E6-mediated degradation.

    PubMed

    Zhao, Carolyn Ying; Szekely, Laszlo; Bao, Wenjie; Selivanova, Galina

    2010-04-15

    Proteasomal degradation of p53 by human papilloma virus (HPV) E6 oncoprotein plays a pivotal role in the survival of cervical carcinoma cells. Abrogation of HPV-E6-dependent p53 destruction can therefore be a good strategy to combat cervical carcinomas. Here, we show that a small-molecule reactivation of p53 and induction of tumor cell apoptosis (RITA) is able to induce the accumulation of p53 and rescue its tumor suppressor function in cells containing high-risk HPV16 and HPV18 by inhibiting HPV-E6-mediated proteasomal degradation. RITA blocks p53 ubiquitination by preventing p53 interaction with E6-associated protein, required for HPV-E6-mediated degradation. RITA activates the transcription of proapoptotic p53 targets Noxa, PUMA, and BAX, and repressed the expression of pro-proliferative factors CyclinB1, CDC2, and CDC25C, resulting in p53-dependent apoptosis and cell cycle arrest. Importantly, RITA showed substantial suppression of cervical carcinoma xenografts in vivo. These results provide a proof of principle for the treatment of cervical cancer in a p53-dependent manner by using small molecules that target p53. (c)2010 AACR.

  14. p53-competent cells and p53-deficient cells display different susceptibility to oxygen functionalized graphene cytotoxicity and genotoxicity.

    PubMed

    Petibone, Dayton M; Mustafa, Thikra; Bourdo, Shawn E; Lafont, Andersen; Ding, Wei; Karmakar, Alokita; Nima, Zeid A; Watanabe, Fumiya; Casciano, Daniel; Morris, Suzanne M; Dobrovolsky, Vasily N; Biris, Alexandru S

    2017-11-01

    Due to the distinctive physical, electrical, and chemical properties of graphene nanomaterials, numerous efforts pursuing graphene-based biomedical and industrial applications are underway. Oxidation of pristine graphene surfaces mitigates its otherwise hydrophobic characteristic thereby improving its biocompatibility and functionality. Yet, the potential widespread use of oxidized graphene derivatives raises concern about adverse impacts on human health. The p53 tumor suppressor protein maintains cellular and genetic stability after toxic exposures. Here, we show that p53 functional status correlates with oxygen functionalized graphene (f-G) cytotoxicity and genotoxicity in vitro. The f-G exposed p53-competent cells, but not p53-deficient cells, initiated G 0 /G 1 phase cell cycle arrest, suppressed reactive oxygen species, and entered apoptosis. There was p53-dependent f-G genotoxicity evident as increased structural chromosome damage, but not increased gene mutation or chromatin loss. In conclusion, the cytotoxic and genotoxic potential for f-G in exposed cells was dependent on the p53 functional status. These findings have broad implications for the safe and effective implementation of oxidized graphene derivatives into biomedical and industrial applications. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA. Published 2017. This article has been contributed to by US Government employees and their work is in the public domain in the USA.

  15. The role of p53 in cancer drug resistance and targeted chemotherapy.

    PubMed

    Hientz, Karin; Mohr, André; Bhakta-Guha, Dipita; Efferth, Thomas

    2017-01-31

    Cancer has long been a grievous disease complicated by innumerable players aggravating its cure. Many clinical studies demonstrated the prognostic relevance of the tumor suppressor protein p53 for many human tumor types. Overexpression of mutated p53 with reduced or abolished function is often connected to resistance to standard medications, including cisplatin, alkylating agents (temozolomide), anthracyclines, (doxorubicin), antimetabolites (gemcitabine), antiestrogenes (tamoxifen) and EGFR-inhibitors (cetuximab). Such mutations in the TP53 gene are often accompanied by changes in the conformation of the p53 protein. Small molecules that restore the wild-type conformation of p53 and, consequently, rebuild its proper function have been identified. These promising agents include PRIMA-1, MIRA-1, and several derivatives of the thiosemicarbazone family. In addition to mutations in p53 itself, p53 activity may be also be impaired due to alterations in p53's regulating proteins such as MDM2. MDM2 functions as primary cellular p53 inhibitor and deregulation of the MDM2/p53-balance has serious consequences. MDM2 alterations often result in its overexpression and therefore promote inhibition of p53 activity. To deal with this problem, a judicious approach is to employ MDM2 inhibitors. Several promising MDM2 inhibitors have been described such as nutlins, benzodiazepinediones or spiro-oxindoles as well as novel compound classes such as xanthone derivatives and trisubstituted aminothiophenes. Furthermore, even naturally derived inhibitor compounds such as α-mangostin, gambogic acid and siladenoserinols have been discovered. In this review, we discuss in detail such small molecules that play a pertinent role in affecting the p53-MDM2 signaling axis and analyze their potential as cancer chemotherapeutics.

  16. Patients, care partners, and shared access to the patient portal: online practices at an integrated health system.

    PubMed

    Wolff, Jennifer L; Berger, Andrea; Clarke, Deserae; Green, Jamie A; Stametz, Rebecca; Yule, Christina; Darer, Jonathan D

    2016-11-01

    To describe the characteristics and online practices of patients and "care partners" who share explicit access to a patient portal account at a large integrated health system that implemented shared access functionality in 2003. Survey of 323 patients and 389 care partners at Geisinger Health System with linked information regarding access and use of patient portal functionality. Few (0.4%) registered adult patient portal users shared access to their account. Patients varied in age (range: 18-102); more than half had a high school education or less (53.6%). Patient motivations for sharing access included: to help manage care (41.9%), for emergency reasons (29.7%), lack of technology experience (18.4%), or care partner request (10.0%). Care partners were parents (39.8%), adult children (27.9%), spouses (26.2%), and other relatives (6.1%). Patients were more likely than care partners to have inadequate health literacy (54.8% versus 8.8%, P < .001) and less confident in their ability to manage their care (53.0% versus 88.1%; P < .001). Care partners were more likely than patients to perform health management activities electronically (95.5% versus 48.4%; P < .001), access the patient portal (89.2% versus 30.3%; P < .001), and use patient portal functionality such as secure messaging (39.6% versus 13.9%; P < .001). Care partners used their own credentials (89.1%) and patient credentials (23.3%) to access the patient portal. Shared access is an underused strategy that may bridge patients' health literacy deficits and lack of technology experience and that helps but does not fully resolve concerns regarding patient and care partner identity credentials. © The Author 2016. Published by Oxford University Press on behalf of the American Medical Informatics Association. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  17. Cellular characteristics of primary and immortal canine embryonic fibroblast cells.

    PubMed

    You, Seungkwon; Moon, Jai-Hee; Kim, Tae-Kyung; Kim, Sung-Chan; Kim, Jai-Woo; Yoon, Du-Hak; Kwak, Sungwook; Hong, Ki-Chang; Choi, Yun-Jaie; Kim, Hyunggee

    2004-08-31

    Using normal canine embryonic fibroblasts (CaEF) that were shown to be senescent at passages 7th-9th, we established two spontaneously immortalized CaEF cell lines (designated CGFR-Ca-1 and -2) from normal senescent CaEF cells, and an immortal CaEF cell line by exogenous introduction of a catalytic telomerase subunit (designated CGFR-Ca-3). Immortal CGFR- Ca-1, -2 and -3 cell lines grew faster than primary CaEF counterpart in the presence of either 0.1% or 10% FBS. Cell cycle analysis demonstrated that all three immortal CaEF cell lines contained a significantly high proportion of S-phase cells compared to primary CaEF cells. CGFR-Ca-1 and -3 cell lines showed a loss of p53 mRNA and protein expression leading to inactivation of p53 regulatory function, while the CGFR-Ca-2 cell line was found to have the inactive mutant p53. Unlike the CGFR-Ca-3 cell line that down-regulated p16INK4a mRNA due to its promoter methylation but had an intact p16INK4a regulatory function, CGFR-Ca-1 and -2 cell lines expressed p16INK4a mRNA but had a functionally inactive p16INK4a regulatory pathway as judged by the lack of obvious differences in cell growth and phenotype when reconstituted with wild-type p16INK4a. All CGFR-Ca-1, -2 and -3 cell lines were shown to be untransformed but immortal as determined by anchorage-dependent assay, while these cell lines were fully transformed when overexpressed oncogenic H-rasG12V. Taken together, similar to the nature of murine embryo fibroblasts, the present study suggests that normal primary CaEF cells have relatively short in vitro lifespans and should be spontaneously immortalized at high frequency.

  18. Functional census of mutation sequence spaces: The example of p53 cancer rescue mutants

    PubMed Central

    Danziger, Samuel A.; Swamidass, S. Joshua; Zeng, Jue; Dearth, Lawrence R.; Lu, Qiang; Chen, Jonathan H.; Cheng, Jainlin; Hoang, Vinh P.; Saigo, Hiroto; Luo, Ray; Baldi, Pierre; Brachmann, Rainer K.; Lathrop, Richard H.

    2009-01-01

    Many biomedical problems relate to mutant functional properties across a sequence space of interest, e.g., flu, cancer, and HIV. Detailed knowledge of mutant properties and function improves medical treatment and prevention. A functional census of p53 cancer rescue mutants would aid the search for cancer treatments from p53 rescue. We devised a general methodology for conducting a functional census of a mutation sequence space, and conducted a double-blind predictive test on the functional rescue property of 71 novel putative p53 cancer rescue mutants iteratively predicted in sets of 3. Double-blind predictive accuracy (15-point moving window) rose from 47% to 86% over the trial (r = 0.74). Code and data are available upon request1. PMID:17048398

  19. Expression of C-terminal deleted p53 isoforms in neuroblastoma

    PubMed Central

    Goldschneider, David; Horvilleur, Emilie; Plassa, Louis-François; Guillaud-Bataille, Marine; Million, Karine; Wittmer-Dupret, Evelyne; Danglot, Gisèle; de Thé, Hughes; Bénard, Jean; May, Evelyne; Douc-Rasy, Sétha

    2006-01-01

    The tumor suppressor gene, p53, is rarely mutated in neuroblastomas (NB) at the time of diagnosis, but its dysfunction could result from a nonfunctional conformation or cytoplasmic sequestration of the wild-type p53 protein. However, p53 mutation, when it occurs, is found in NB tumors with drug resistance acquired over the course of chemotherapy. As yet, no study has been devoted to the function of the specific p53 mutants identified in NB cells. This study includes characterization and functional analysis of p53 expressed in eight cell lines: three wild-type cell lines and five cell lines harboring mutations. We identified two transcription-inactive p53 variants truncated in the C-terminus, one of which corresponded to the p53β isoform recently identified in normal tissue by Bourdon et al. [J. C. Bourdon, K. Fernandes, F. Murray-Zmijewski, G. Liu, A. Diot, D. P. Xirodimas, M. K. Saville and D. P. Lane (2005) Genes Dev., 19, 2122–2137]. Our results show, for the first time, that the p53β isoform is the only p53 species to be endogenously expressed in the human NB cell line SK-N-AS, suggesting that the C-terminus truncated p53 isoforms may play an important role in NB tumor development. PMID:17028100

  20. Transcriptional Inhibition of the Human Papilloma Virus Reactivates Tumor Suppressor p53 in Cervical Carcinoma Cells

    PubMed Central

    Kochetkov, D. V.; Ilyinskaya, G. V.; Komarov, P. G.; Strom, E.; Agapova, L. S.; Ivanov, A. V.; Budanov, A. V.; Frolova, E. I.; Chumakov, P. M.

    2009-01-01

    Inactivation of tumor suppressor p53 accompanies the majority of human malignancies. Restoration of p53 function causes death of tumor cells and is potentially suitable for gene therapy of cancer. In cervical carcinoma, human papilloma virus (HPV) E6 facilitates proteasomal degradation of p53. Hence, a possible approach to p53 reactivation is the use of small molecules suppressing the function of viral proteins. HeLa cervical carcinoma cells (HPV-18) with a reporter construct containing the b-galactosidase gene under the control of a p53-responsive promoter were used as a test system to screen a library of small molecules for restoration of the transcriptional activity of p53. The effect of the two most active compounds was studied with cell lines differing in the state of p53-dependent signaling pathways. The compounds each specifically activated p53 in cells expressing HPV-18 and, to a lesser extent, HPV-16 and exerted no effect on control p53-negative cells or cells with the intact p53-dependent pathways. Activation of p53 in cervical carcinoma cells was accompanied by induction of p53-dependent CDKN1 (p21), inhibition of cell proliferation, and induction of apoptosis. In addition, the two compounds dramatically decreased transcription of the HPV genome, which was assumed to cause p53 reactivation. The compounds were low-toxic for normal cells and can be considered as prototypes of new anticancer drugs. PMID:17685229

  1. 53BP1 and USP28 mediate p53-dependent cell cycle arrest in response to centrosome loss and prolonged mitosis.

    PubMed

    Fong, Chii Shyang; Mazo, Gregory; Das, Tuhin; Goodman, Joshua; Kim, Minhee; O'Rourke, Brian P; Izquierdo, Denisse; Tsou, Meng-Fu Bryan

    2016-07-02

    Mitosis occurs efficiently, but when it is disturbed or delayed, p53-dependent cell death or senescence is often triggered after mitotic exit. To characterize this process, we conducted CRISPR-mediated loss-of-function screens using a cell-based assay in which mitosis is consistently disturbed by centrosome loss. We identified 53BP1 and USP28 as essential components acting upstream of p53, evoking p21-dependent cell cycle arrest in response not only to centrosome loss, but also to other distinct defects causing prolonged mitosis. Intriguingly, 53BP1 mediates p53 activation independently of its DNA repair activity, but requiring its interacting protein USP28 that can directly deubiquitinate p53 in vitro and ectopically stabilize p53 in vivo. Moreover, 53BP1 can transduce prolonged mitosis to cell cycle arrest independently of the spindle assembly checkpoint (SAC), suggesting that while SAC protects mitotic accuracy by slowing down mitosis, 53BP1 and USP28 function in parallel to select against disturbed or delayed mitosis, promoting mitotic efficiency.

  2. Accumulation of p53 in infectious mononucleosis tissues.

    PubMed

    Ehsan, A; Fan, H; Eagan, P A; Siddiqui, H A; Gulley, M L

    2000-11-01

    Epstein-Barr virus (EBV) infects lymphocytes, where it persists indefinitely for the life of the host; whether the virus interacts with p53 to maintain itself in these cells is unknown. Lymphoid biopsy samples from 10 patients with infectious mononucleosis (IM) were examined for expression of p53 by immunohistochemistry. Accumulation of p53 was detected in all 10 cases, primarily in large lymphocytes of the expanded paracortex. The presence of EBV was confirmed in all 10 cases by EBER1 (EBV-encoded RNA) in situ hybridization, whereas 11 non-IM control samples lacked significant EBER1 and did not express p53 in paracortical lymphocytes. Interestingly, EBV infection alone does not cause accumulation of intracellular p53, because many more cells expressed EBER1 than p53 in the IM tissues. To determine whether p53 was confined to the subset of infected cells in which viral replication was occurring, BZLF1 immunostains were performed. Viral BZLF1 was detected in 8 of 10 IM tissues; however, the paucity and small size of the BZLF1-expressing lymphocytes suggests that they are not the same cells overexpressing p53. To further examine the relationship between p53 and EBV gene expression, the tissues were studied for latent membrane protein 1 (LMP1) expression by immunohistochemistry. Viral LMP1 was observed in the large paracortical lymphocytes of all 10 cases of IM, indicating co-localization of p53 and LMP1 in these cells. Our findings confirm that p53 overexpression is not specific for nodal malignancy and that p53 accumulation is characteristic of IM. Because p53 was not coexpressed in the same cells as BZLF1, it appears that BZLF1 is not directly responsible for p53 accumulation. Nevertheless, co-localization of p53 and LMP1 in activated-appearing lymphocytes suggests that EBV infection is responsible for p53 accumulation. HUM PATHOL 31:1397-1403. Copyright 2000 by W.B. Saunders Company

  3. TSPAN12 is a critical factor for cancer–fibroblast cell contact-mediated cancer invasion

    PubMed Central

    Otomo, Ryo; Otsubo, Chihiro; Matsushima-Hibiya, Yuko; Miyazaki, Makoto; Tashiro, Fumio; Ichikawa, Hitoshi; Kohno, Takashi; Ochiya, Takahiro; Yokota, Jun; Nakagama, Hitoshi; Taya, Yoichi; Enari, Masato

    2014-01-01

    Communication between cancer cells and their microenvironment controls cancer progression. Although the tumor suppressor p53 functions in a cell-autonomous manner, it has also recently been shown to function in a non–cell-autonomous fashion. Although functional defects have been reported in p53 in stromal cells surrounding cancer, including mutations in the p53 gene and decreased p53 expression, the role of p53 in stromal cells during cancer progression remains unclear. We herein show that the expression of α-smooth muscle actin (α-SMA), a marker of cancer-associated fibroblasts (CAFs), was increased by the ablation of p53 in lung fibroblasts. CAFs enhanced the invasion and proliferation of lung cancer cells when cocultured with p53-depleted fibroblasts and required contact between cancer and stromal cells. A comprehensive analysis using a DNA chip revealed that tetraspanin 12 (TSPAN12), which belongs to the tetraspanin protein family, was derepressed by p53 knockdown. TSPAN12 knockdown in p53-depleted fibroblasts inhibited cancer cell proliferation and invasion elicited by coculturing with p53-depleted fibroblasts in vitro, and inhibited tumor growth in vivo. It also decreased CXC chemokine ligand 6 (CXCL6) secretion through the β-catenin signaling pathway, suggesting that cancer cell contact with TSPAN12 in fibroblasts transduced β-catenin signaling into fibroblasts, leading to the secretion of CXCL6 to efficiently promote invasion. These results suggest that stroma-derived p53 plays a pivotal role in epithelial cancer progression and that TSPAN12 and CXCL6 are potential targets for lung cancer therapy. PMID:25512506

  4. TP53 dysfunction in CLL: Implications for prognosis and treatment.

    PubMed

    Te Raa, Gera D; Kater, Arnon P

    2016-03-01

    Despite the availability of novel targeted agents, TP53 defects remain the most important adverse prognostic factor in chronic lymphocytic leukemia (CLL). Detection of deletion of TP53 locus (17p deletion) by fluorescent in situ hybridization (FISH) has become standard and performed prior to every line of treatment as the incidence dramatically increases as relapses occur. As monoallelic mutations of TP53 equally affect outcome, novel methods are being developed to improve detection of TP53 defects and include next-generation sequencing (NGS) and functional assays. TP53 defects highly affect outcome of immunochemotherapy but also alter response durations of tyrosine kinase inhibitors. Although BCR-targeting agents and Bcl-2-inhibitos have achieved durable responses in some patients with TP53 defects, long-term follow-up is currently lacking. In this review biological and clinical consequences of TP53 dysfunction as well as applicability of currently available methods to detect TP53 defects are described. In addition, proposed novel therapeutic strategies specifically for patients with TP53 dysfunction are discussed. In summary, the only curative treatment option for TP53-defective CLL is still allogeneic hematopoietic stem cell transplantation. Other treatment strategies such as rationale combinations of agents with different (TP53 independent) targets, including kinase inhibitors and inhibitors of anti-apoptotic molecules but also immunomodulatory agents need to be further explored. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38

    PubMed Central

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-01-01

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug. PMID:25010984

  6. RITA can induce cell death in p53-defective cells independently of p53 function via activation of JNK/SAPK and p38.

    PubMed

    Weilbacher, A; Gutekunst, M; Oren, M; Aulitzky, W E; van der Kuip, H

    2014-07-10

    Significant advances have been made in the development of small molecules blocking the p53/MDM2 interaction. The Mdm2 inhibitor Nutlin-3 is restricted to tumors carrying wtp53. In contrast, RITA, a compound that binds p53, has recently been shown also to restore transcriptional functions of mtp53. As more than 50% of solid tumors carry p53 mutations, RITA promises to be a more effective therapeutic strategy than Nutlin-3. We investigated effects of RITA on apoptosis, cell cycle and induction of 45 p53 target genes in a panel of 14 cell lines from different tumor entities with different p53 status as well as primary lymphocytes and fibroblasts. Nine cell strains expressed wtp53, four harbored mtp53, and three were characterized by the loss of p53 protein. A significant induction of cell death upon RITA was observed in 7 of 16 cell lines. The nonmalignant cells in our panel were substantially less sensitive. We found that in contrast to Nultin-3, RITA is capable to induce cell death not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells. Importantly, whereas p53 has a central role for RITA-mediated effects in wtp53 cells, neither p53 nor p63 or p73 were essential for the RITA response in mtp53 or p53-null cells in our panel demonstrating that besides the known p53-dependent action of RITA in wtp53 cells, RITA can induce cell death also independently of p53 in cells harboring defective p53. We identified an important role of both p38 and JNK/SAPK for sensitivity to RITA in these cells leading to a typical caspase- and BAX/BAK-dependent mitochondrial apoptosis. In conclusion, our data demonstrate that RITA can induce apoptosis through p38 and JNK/SAPK not only in tumor cells harboring wtp53 and mtp53 but also in p53-null cells, making RITA an interesting tumor-selective drug.

  7. Synthesis of cytochrome C oxidase 2: a p53-dependent metabolic regulator that promotes respiratory function and protects glioma and colon cancer cells from hypoxia-induced cell death.

    PubMed

    Wanka, C; Brucker, D P; Bähr, O; Ronellenfitsch, M; Weller, M; Steinbach, J P; Rieger, J

    2012-08-16

    P53 has an important role in the processing of starvation signals. P53-dependent molecular mediators of the Warburg effect reduce glucose consumption and promote mitochondrial function. We therefore hypothesized that the retention of wild-type p53 characteristic of primary glioblastomas limits metabolic demands induced by deregulated signal transduction in the presence of hypoxia and nutrient depletion. Here we report that short hairpin RNA-mediated gene suppression of wild-type p53 or ectopic expression of mutant temperature-sensitive dominant-negative p53(V135A) increased glucose consumption and lactate production, decreased oxygen consumption and enhanced hypoxia-induced cell death in p53 wild-type human glioblastoma cells. Similarly, genetic knockout of p53 in HCT116 colon carcinoma cells resulted in reduced respiration and hypersensitivity towards hypoxia-induced cell death. Further, wild-type p53 gene silencing reduced the expression of synthesis of cytochrome c oxidase 2 (SCO2), an effector necessary for respiratory chain function. An SCO2 transgene reverted the metabolic phenotype and restored resistance towards hypoxia in p53-depleted and p53 mutant glioma cells in a rotenone-sensitive manner, demonstrating that this effect was dependent on intact oxidative phosphorylation. Supplementation with methyl-pyruvate, a mitochondrial substrate, rescued p53 wild-type but not p53 mutant cells from hypoxic cell death, demonstrating a p53-mediated selective aptitude to metabolize mitochondrial substrates. Further, SCO2 gene silencing in p53 wild-type glioma cells sensitized these cells towards hypoxia. Finally, lentiviral gene suppression of SCO2 significantly enhanced tumor necrosis in a subcutaneous HCT116 xenograft tumor model, compatible with impaired energy metabolism in these cells. These findings demonstrate that glioma and colon cancer cells with p53 wild-type status can skew the Warburg effect and thereby reduce their vulnerability towards tumor hypoxia in an SCO2-dependent manner. Targeting SCO2 may therefore represent a valuable strategy to enhance sensitivity towards hypoxia and may complement strategies targeting glucose metabolism.

  8. The p53-reactivating small-molecule RITA enhances cisplatin-induced cytotoxicity and apoptosis in head and neck cancer.

    PubMed

    Roh, Jong-Lyel; Ko, Jung Ho; Moon, Soo Jin; Ryu, Chang Hwan; Choi, Jun Young; Koch, Wayne M

    2012-12-01

    We evaluated whether the restoration of p53 function by the p53-reactivating small molecule RITA (reactivation of p53 and induction of tumor cell apoptosis enhances cisplatin-induced cytotoxicity and apoptosis in head-and-neck cancer (HNC). RITA induced prominent accumulation and reactivation of p53 in a wild-type TP53-bearing HNC cell line. RITA showed maximal growth suppression in tumor cells showing MDM2-dependent p53 degradation. RITA promoted apoptosis in association with upregulation of p21, BAX, and cleaved caspase-3; notably, the apoptotic response was blocked by pifithrin-α, demonstrating its p53 dependence. With increasing concentrations, RITA strongly induced apoptosis rather than G2-phase arrest. In combination therapy, RITA enhanced cisplatin-induced growth inhibition and apoptosis of HNC cells invitro and in vivo. Our data suggest that the restoration of p53 tumor-suppressive function by RITA enhances the cytotoxicity and apoptosis of cisplatin, an action that may offer an attractive strategy for treating HNC. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  9. CP-31398 prevents the growth of p53-mutated colorectal cancer cells in vitro and in vivo.

    PubMed

    He, Xingxing; Kong, Xinjuan; Yan, Junwei; Yan, Jingjun; Zhang, Yunan; Wu, Qian; Chang, Ying; Shang, Haitao; Dou, Qian; Song, Yuhu; Liu, Fang

    2015-03-01

    Rescuing the function of mutant p53 protein is an attractive cancer therapeutic strategy. Small molecule CP-31398 was shown to restore mutant p53 tumor suppressor functions in cancer cells. Here, we determined the effects of CP-31398 on the growth of p53-mutated colorectal cancer (CRC) cells in vitro and in vivo. CRC cells which carry p53 mutation in codon 273 were treated with CP-31398 and the control, and the effects of CP-31398 on cell cycle, cell apoptosis, and proliferation were determined. The expression of p53-responsive downstream genes was evaluated by quantitative reverse transcriptase PCR (RT-PCR) and Western blot. CP-31398 was administrated into xenograft tumors created by the inoculation of HT-29 cells, and then the effect of CP-31398 on the growth of xenograft tumors was examined. CP-31398 induced p53 downstream target molecules in cultured HT-29 cells, which resulted in the inhibition of CRC cell growth assessed by the determination of cell cycle, apoptosis, and cell proliferation. In xenograft tumors, CP-31398 modulated the expression of Bax, Bcl-2, caspase 3, cyclin D, and Mdm2 and then blocked the growth of xenograft tumors. CP-31398 would be developed as a therapeutic candidate for p53-mutated CRC due to the restoration of mutant p53 tumor suppressor functions.

  10. Evolution of p53 transactivation specificity through the lens of a yeast-based functional assay.

    PubMed

    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

    2015-01-01

    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective.

  11. Evolution of p53 Transactivation Specificity through the Lens of a Yeast-Based Functional Assay

    PubMed Central

    Lion, Mattia; Raimondi, Ivan; Donati, Stefano; Jousson, Olivier; Ciribilli, Yari; Inga, Alberto

    2015-01-01

    Co-evolution of transcription factors (TFs) with their respective cis-regulatory network enhances functional diversity in the course of evolution. We present a new approach to investigate transactivation capacity of sequence-specific TFs in evolutionary studies. Saccharomyces cerevisiae was used as an in vivo test tube and p53 proteins derived from human and five commonly used animal models were chosen as proof of concept. p53 is a highly conserved master regulator of environmental stress responses. Previous reports indicated conserved p53 DNA binding specificity in vitro, even for evolutionary distant species. We used isogenic yeast strains where p53-dependent transactivation was measured towards chromosomally integrated p53 response elements (REs). Ten REs were chosen to sample a wide range of DNA binding affinity and transactivation capacity for human p53 and proteins were expressed at two levels using an inducible expression system. We showed that the assay is amenable to study thermo-sensitivity of frog p53, and that chimeric constructs containing an ectopic transactivation domain could be rapidly developed to enhance the activity of proteins, such as fruit fly p53, that are poorly effective in engaging the yeast transcriptional machinery. Changes in the profile of relative transactivation towards the ten REs were measured for each p53 protein and compared to the profile obtained with human p53. These results, which are largely independent from relative p53 protein levels, revealed widespread evolutionary divergence of p53 transactivation specificity, even between human and mouse p53. Fruit fly and human p53 exhibited the largest discrimination among REs while zebrafish p53 was the least selective. PMID:25668429

  12. A planarian p53 homolog regulates proliferation and self-renewal in adult stem cell lineages.

    PubMed

    Pearson, Bret J; Sánchez Alvarado, Alejandro

    2010-01-01

    The functions of adult stem cells and tumor suppressor genes are known to intersect. However, when and how tumor suppressors function in the lineages produced by adult stem cells is unknown. With a large population of stem cells that can be manipulated and studied in vivo, the freshwater planarian is an ideal system with which to investigate these questions. Here, we focus on the tumor suppressor p53, homologs of which have no known role in stem cell biology in any invertebrate examined thus far. Planaria have a single p53 family member, Smed-p53, which is predominantly expressed in newly made stem cell progeny. When Smed-p53 is targeted by RNAi, the stem cell population increases at the expense of progeny, resulting in hyper-proliferation. However, ultimately the stem cell population fails to self-renew. Our results suggest that prior to the vertebrates, an ancestral p53-like molecule already had functions in stem cell proliferation control and self-renewal.

  13. The influence of SV40 immortalization of human fibroblasts on p53-dependent radiation responses

    NASA Technical Reports Server (NTRS)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The simian virus 40 large tumor antigen (SV40 Tag) has been ascribed many functions critical to viral propagation, including binding to the mammalian tumor suppressor p53. Recent studies have demonstrated that SV40-transformed murine cells have functional p53. The status of p53 in SV40-immortalized human cells, however, has not been characterized. We have found that in response to ionizing radiation, p53-dependent p21 transactivation activity is present, albeit reduced, in SV40-immortalized cells and that this activity can be further reduced with either dominant negative p53 expression or higher SV40 Tag expression. Furthermore, overexpression of p53 in SV40-immortalized ataxia-telangiectasia (A-T) cells restores p53-dependent p21 induction to typical A-T levels. All SV40-immortalized cell lines exhibited an absence of G1 arrest. Moreover, all SV40-immortalized cell lines exhibited increased apoptosis relative to primary cells in response to ionizing radiation, suggesting that SV40 immortalization results in a unique phenotype with regard to DNA damage responses. Copyright 1999 Academic Press.

  14. Classification of TP53 Mutations and HPV Predict Survival in Advanced Larynx Cancer

    PubMed Central

    Scheel, Adam; Bellile, Emily; McHugh, Jonathan B.; Walline, Heather M.; Prince, Mark E.; Urba, Susan; Wolf, Gregory T.; Eisbruch, Avraham; Worden, Francis; Carey, Thomas E.; Bradford, Carol

    2016-01-01

    OBJECTIVE Assess TP53 functional mutations in the context of other biomarkers in advanced larynx cancer. STUDY DESIGN Prospective analysis of pretreatment tumor TP53, HPV, Bcl-xL and cyclin D1 status in stage III and IV larynx cancer patients in a clinical trial. METHODS TP53 exons 4-9 from 58 tumors were sequenced. Mutations were grouped using three classifications based on their expected function. Each functional group was analyzed for response to induction chemotherapy, time to surgery, survival, HPV status, p16INK4a, Bcl-xl and cyclin D1 expression. RESULTS TP53 Mutations were found in 22/58 (37.9%) patients with advanced larynx cancer, including missense mutations in 13/58 (22.4%) patients, nonsense mutations in 4/58 (6.9%), and deletions in 5/58 (8.6%). High risk HPV was found in 20/52 (38.5%) tumors. A classification based on crystal Evolutionary Action score of p53 (EAp53) distinguished missense mutations with high risk for decreased survival from low risk mutations (p=0.0315). A model including this TP53 classification, HPV status, cyclin D1 and Bcl-xL staining significantly predicts survival (p=0.0017). CONCLUSION EAp53 functional classification of TP53 mutants and biomarkers predict survival in advanced larynx cancer. PMID:27345657

  15. B-cell posttransplant lymphoproliferative disorder isolated to the central nervous system is Epstein-Barr virus positive and lacks p53 and Myc expression by immunohistochemistry.

    PubMed

    Sundin, Andrew; Grzywacz, Bartosz J; Yohe, Sophia; Linden, Michael A; Courville, Elizabeth L

    2017-03-01

    In this retrospective study from one institution, we performed a clinicopathological study of a cohort of patients with posttransplant lymphoproliferative disorder (PTLD) confined to the central nervous system. We also identified a comparison cohort of patients with de novo primary diffuse large B-cell lymphoma of the central nervous system. We performed a detailed morphologic review, evaluated Epstein-Barr virus (EBV) by in situ hybridization, and interpreted a panel of immunohistochemical stains in a subset of cases including Hans classification markers (CD10, BCL6, MUM1), p53, CD30, Myc, and BCL2. All 17 of the posttransplant and none of 11 de novo cases were EBV positive (P < .005). Morphologic patterns identified in the PTLD cases were monomorphic diffuse large B-cell lymphoma pattern (10 patients) and "T-cell-rich" pattern (7 patients). The monomorphic posttransplant cases were more likely to be Myc negative (P = .015) and CD30 positive (P < .005) than the de novo cases, and showed a similarly low rate of p53 positivity by immunohistochemistry. No prognostic factors for overall survival were identified. Central nervous system PTLD is EBV positive, typically lacks p53 and Myc expression by immunohistochemistry, and can present with numerous background T lymphocytes. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. Classification of TP53 mutations and HPV predict survival in advanced larynx cancer.

    PubMed

    Scheel, Adam; Bellile, Emily; McHugh, Jonathan B; Walline, Heather M; Prince, Mark E; Urba, Susan; Wolf, Gregory T; Eisbruch, Avraham; Worden, Francis; Carey, Thomas E; Bradford, Carol

    2016-09-01

    Assess tumor suppressor p53 (TP53) functional mutations in the context of other biomarkers in advanced larynx cancer. Prospective analysis of pretreatment tumor TP53, human papillomavirus (HPV), Bcl-xL, and cyclin D1 status in stage III and IV larynx cancer patients in a clinical trial. TP53 exons 4 through 9 from 58 tumors were sequenced. Mutations were grouped using three classifications based on their expected function. Each functional group was analyzed for response to induction chemotherapy, time to surgery, survival, HPV status, p16INK4a, Bcl-xl, and cyclin D1 expression. TP53 mutations were found in 22 of 58 (37.9%) patients with advanced larynx cancer, including missense mutations in 13 of 58 (22.4%) patients, nonsense mutations in four of 58 (6.9%), and deletions in five of 58 (8.6%). High-risk HPV was found in 20 of 52 (38.5%) tumors. A classification based on Evolutionary Action score of p53 (EAp53) distinguished missense mutations with high risk for decreased survival from low-risk mutations (P = 0.0315). A model including this TP53 classification, HPV status, cyclin D1, and Bcl-xL staining significantly predicts survival (P = 0.0017). EAp53 functional classification of TP53 mutants and biomarkers predict survival in advanced larynx cancer. NA. Laryngoscope, 126:E292-E299, 2016. © 2016 The American Laryngological, Rhinological and Otological Society, Inc.

  17. p53 improves aerobic exercise capacity and augments skeletal muscle mitochondrial DNA content.

    PubMed

    Park, Joon-Young; Wang, Ping-Yuan; Matsumoto, Takumi; Sung, Ho Joong; Ma, Wenzhe; Choi, Jeong W; Anderson, Stasia A; Leary, Scot C; Balaban, Robert S; Kang, Ju-Gyeong; Hwang, Paul M

    2009-09-25

    Exercise capacity is a physiological characteristic associated with protection from both cardiovascular and all-cause mortality. p53 regulates mitochondrial function and its deletion markedly diminishes exercise capacity, but the underlying genetic mechanism orchestrating this is unclear. Understanding the biology of how p53 improves exercise capacity may provide useful insights for improving both cardiovascular as well as general health. The purpose of this study was to understand the genetic mechanism by which p53 regulates aerobic exercise capacity. Using a variety of physiological, metabolic, and molecular techniques, we further characterized maximum exercise capacity and the effects of training, measured various nonmitochondrial and mitochondrial determinants of exercise capacity, and examined putative regulators of mitochondrial biogenesis. As p53 did not affect baseline cardiac function or inotropic reserve, we focused on the involvement of skeletal muscle and now report a wider role for p53 in modulating skeletal muscle mitochondrial function. p53 interacts with Mitochondrial Transcription Factor A (TFAM), a nuclear-encoded gene important for mitochondrial DNA (mtDNA) transcription and maintenance, and regulates mtDNA content. The increased mtDNA in p53(+/+) compared to p53(-/-) mice was more marked in aerobic versus glycolytic skeletal muscle groups with no significant changes in cardiac tissue. These in vivo observations were further supported by in vitro studies showing overexpression of p53 in mouse myoblasts increases both TFAM and mtDNA levels whereas depletion of TFAM by shRNA decreases mtDNA content. Our current findings indicate that p53 promotes aerobic metabolism and exercise capacity by using different mitochondrial genes and mechanisms in a tissue-specific manner.

  18. Transcriptional specificity in various p53-mutant cells.

    PubMed

    Okaichi, Kumio; Izumi, Nanaka; Takamura, Yuma; Fukui, Shoichi; Kudo, Takashi

    2013-03-01

    Mutation of the tumor suppressor gene p53 is the most common genetic alteration observed in human tumors. However, the relationship between the mutation point of p53 and the transcriptional specificity is not so obvious. We prepared Saos-2 cells with various mutations of p53 that are found in human tumors, and examined the resulting transcriptional alterations in the cells. Loss of function and gain of function were observed in all p53 mutants. Hot-spot mutations of p53 are frequently found in tumor cells. We compared hot-spot mutations and other mutations of p53 and found that a more than 2-fold transcription of CADPS2, PIWIL4 and TRIM9 was induced by hot spot mutations, but not by other mutations. As PIWIL4 suppresses the p16(INK4A) and ARF pathway, restraining cell growth and genomic instability, induction of PIWIL4 expression may be one reason why hot-spot mutations are frequently found in tumor cells.

  19. Mutant p53 perturbs DNA replication checkpoint control through TopBP1 and Treslin.

    PubMed

    Liu, Kang; Lin, Fang-Tsyr; Graves, Joshua D; Lee, Yu-Ju; Lin, Weei-Chin

    2017-05-09

    Accumulating evidence supports the gain-of-function of mutant forms of p53 (mutp53s). However, whether mutp53 directly perturbs the DNA replication checkpoint remains unclear. Previously, we have demonstrated that TopBP1 forms a complex with mutp53s and mediates their gain-of-function through NF-Y and p63/p73. Akt phosphorylates TopBP1 and induces its oligomerization, which inhibits its ATR-activating function. Here we show that various contact and conformational mutp53s bypass Akt to induce TopBP1 oligomerization and attenuate ATR checkpoint response during replication stress. The effect on ATR response caused by mutp53 can be exploited in a synthetic lethality strategy, as depletion of another ATR activator, DNA2, in mutp53-R273H-expressing cancer cells renders cells hypersensitive to cisplatin. Expression of mutp53-R273H also makes cancer cells more sensitive to DNA2 depletion or DNA2 inhibitors. In addition to ATR-activating function during replication stress, TopBP1 interacts with Treslin in a Cdk-dependent manner to initiate DNA replication during normal growth. We find that mutp53 also interferes with TopBP1 replication function. Several contact, but not conformational, mutp53s enhance the interaction between TopBP1 and Treslin and promote DNA replication despite the presence of a Cdk2 inhibitor. Together, these data uncover two distinct mechanisms by which mutp53 enhances DNA replication: ( i ) Both contact and conformational mutp53s can bind TopBP1 and attenuate the checkpoint response to replication stress, and ( ii ) during normal growth, contact (but not conformational) mutp53s can override the Cdk2 requirement to promote replication by facilitating the TopBP1/Treslin interaction.

  20. Molecular Mechanism of Mutant p53 Stabilization: The Role of HSP70 and MDM2

    PubMed Central

    Wiech, Milena; Olszewski, Maciej B.; Tracz-Gaszewska, Zuzanna; Wawrzynow, Bartosz; Zylicz, Maciej; Zylicz, Alicja

    2012-01-01

    Numerous p53 missense mutations possess gain-of-function activities. Studies in mouse models have demonstrated that the stabilization of p53 R172H (R175H in human) mutant protein, by currently unknown factors, is a prerequisite for its oncogenic gain-of-function phenotype such as tumour progression and metastasis. Here we show that MDM2-dependent ubiquitination and degradation of p53 R175H mutant protein in mouse embryonic fibroblasts is partially inhibited by increasing concentration of heat shock protein 70 (HSP70/HSPA1-A). These phenomena correlate well with the appearance of HSP70-dependent folding intermediates in the form of dynamic cytoplasmic spots containing aggregate-prone p53 R175H and several molecular chaperones. We propose that a transient but recurrent interaction with HSP70 may lead to an increase in mutant p53 protein half-life. In the presence of MDM2 these pseudoaggregates can form stable amyloid-like structures, which occasionally merge into an aggresome. Interestingly, formation of folding intermediates is not observed in the presence of HSC70/HSPA8, the dominant-negative K71S variant of HSP70 or HSP70 inhibitor. In cancer cells, where endogenous HSP70 levels are already elevated, mutant p53 protein forms nuclear aggregates without the addition of exogenous HSP70. Aggregates containing p53 are also visible under conditions where p53 is partially unfolded: 37°C for temperature-sensitive variant p53 V143A and 42°C for wild-type p53. Refolding kinetics of p53 indicate that HSP70 causes transient exposure of p53 aggregate-prone domain(s). We propose that formation of HSP70- and MDM2-dependent protein coaggregates in tumours with high levels of these two proteins could be one of the mechanisms by which mutant p53 is stabilized. Moreover, sequestration of p73 tumour suppressor protein by these nuclear aggregates may lead to gain-of-function phenotypes. PMID:23251530

  1. Distinct tumor protein p53 mutants in breast cancer subgroups.

    PubMed

    Dumay, Anne; Feugeas, Jean-Paul; Wittmer, Evelyne; Lehmann-Che, Jacqueline; Bertheau, Philippe; Espié, Marc; Plassa, Louis-François; Cottu, Paul; Marty, Michel; André, Fabrice; Sotiriou, Christos; Pusztai, Lajos; de Thé, Hugues

    2013-03-01

    Tumor protein p53 (TP53) is mutated in approximately 30% of breast cancers, but this frequency fluctuates widely between subclasses. We investigated the p53 mutation status in 572 breast tumors, classified into luminal, basal and molecular apocrine subgroups. As expected, the lowest mutation frequency was observed in luminal (26%), and the highest in basal (88%) tumors. Luminal tumors showed significantly higher frequency of substitutions (82 vs. 65%), notably A/T to G/C transitions (31 vs. 15%), whereas molecular apocrine and basal tumors presented much higher frequencies of complex mutations (deletions/insertions) (36 and 33%, respectively, vs. 18%). Accordingly, missense mutations were significantly more frequent in luminal tumors (75 vs. 54%), whereas basal tumors displayed significantly increased rates of TP53 truncations (43 vs. 25%), resulting in loss of function and/or expression. Interestingly, as basal tumors, molecular apocrine tumors presented with a high rate of complex mutations, but paradoxically, these were not associated with increased frequency of p53 truncation. As in luminal tumors, this could reflect a selective pressure for p53 gain of function, possibly through P63/P73 inactivation. Collectively, these observations point not only to different mechanisms of TP53 alterations, but also to different functional consequences in the different breast cancer subtypes. Copyright © 2012 UICC.

  2. MicroRNA-214 Promotes Apoptosis in Canine Hemangiosarcoma by Targeting the COP1-p53 Axis.

    PubMed

    Heishima, Kazuki; Mori, Takashi; Sakai, Hiroki; Sugito, Nobuhiko; Murakami, Mami; Yamada, Nami; Akao, Yukihiro; Maruo, Kohji

    2015-01-01

    MicroRNA-214 regulates both angiogenic function in endothelial cells and apoptosis in various cancers. However, the regulation and function of miR-214 is unclear in canine hemangiosarcoma, which is a spontaneous model of human angiosarcoma. The expression and functional roles of miR-214 in canine hemangiosarcoma were presently explored by performing miRNA TaqMan qRT-PCR and transfecting cells with synthetic microRNA. Here, we report that miR-214 was significantly down-regulated in the cell lines used and in clinical samples of canine hemangiosarcoma. Restoration of miR-214 expression reduced cell growth and induced apoptosis in canine hemangiosarcoma cell lines through transcriptional activation of p53-regulated genes although miR-214 had a slight effect of growth inhibition on normal endothelial cells. We identified COP1, which is a critical negative regulator of p53, as a novel direct target of miR-214. COP1 was overexpressed and the specific COP1 knockdown induced apoptosis through transcriptional activation of p53-regulated genes as well as did miR-214-transfection in HSA cell lines. Furthermore, p53 knockdown abolished the miR-214-COP1-mediated apoptosis; thus, miR-214 and COP1 regulated apoptosis through controlling p53 in HSA. In conclusion, miR-214 functioned as a tumor suppressor in canine hemangiosarcoma by inducing apoptosis through recovering the function of p53. miR-214 down-regulation and COP1 overexpression is likely to contribute to tumorigenesis of HSA. Therefore, targeting miR-214-COP1-p53 axis would possibly be a novel effective strategy for treatment of canine hemangiosarcoma and capable of being applied to the development of novel therapeutics for human angiosarcoma.

  3. Various stress stimuli rewire the profile of liver secretome in a p53-dependent manner.

    PubMed

    Charni-Natan, Meital; Solomon, Hilla; Molchadsky, Alina; Jacob-Berger, Adi; Goldfinger, Naomi; Rotter, Varda

    2018-05-29

    Liver is an important secretory organ that consistently manages various insults in order to retain whole-body homeostasis. Importantly, it was suggested that the tumor-suppressor p53 plays a role in a variety of liver physiological processes and thus it is being regarded as a systemic homeostasis regulator. Using high-throughput mass spectrometric analysis, we identified various p53-dependent liver secretome profiles. This allowed a global view on the role of p53 in maintaining the harmony of liver and whole-body homeostasis. We found that p53 altered the liver secretome differently under various conditions. Under physiological conditions, p53 controls factors that are related mainly to lipid metabolism and injury response. Upon exposure to various types of cancer therapy agents, the hepatic p53 is activated and induces the secretion of proteins related to additional pathways, such as hemostasis, immune response, and cell adhesion. Interestingly, we identified a possible relationship between p53-dependent liver functions and lung tumors. The latter modify differently liver secretome profile toward the secretion of proteins mainly related to cell migration and immune response. The notion that p53 may rewire the liver secretome profile suggests a new non-cell autonomous role of p53 that affect different liver functions and whole organism homeostasis.

  4. Disruption of the nucleolus mediates stabilization of p53 in response to DNA damage and other stresses

    PubMed Central

    Rubbi, Carlos P.; Milner, Jo

    2003-01-01

    p53 protects against cancer through its capacity to induce cell cycle arrest or apoptosis under a large variety of cellular stresses. It is not known how such diversity of signals can be integrated by a single molecule. However, the literature reveals that a common denominator in all p53-inducing stresses is nucleolar disruption. We thus postulated that the impairment of nucleolar function might stabilize p53 by preventing its degradation. Using micropore irradiation, we demonstrate that large amounts of nuclear DNA damage fail to stabilize p53 unless the nucleolus is also disrupted. Forcing nucleolar disruption by anti-upstream binding factor (UBF) microinjection (in the absence of DNA damage) also causes p53 stabilization. We propose that the nucleolus is a stress sensor responsible for maintenance of low levels of p53, which are automatically elevated as soon as nucleolar function is impaired in response to stress. Our model integrates all known p53-inducing agents and also explains cell cycle-related variations in p53 levels which correlate with established phases of nucleolar assembly/disassembly through the cell cycle. PMID:14609953

  5. Novel MDM2 inhibitor SAR405838 (MI-773) induces p53-mediated apoptosis in neuroblastoma

    PubMed Central

    Lu, Jiaxiong; Guan, Shan; Zhao, Yanling; Yu, Yang; Wang, Yongfeng; Shi, Yonghua; Mao, Xinfang; Yang, Kristine L.; Sun, Wenjing; Xu, Xin; Yi, Joanna S.; Yang, Tianshu; Yang, Jianhua; Nuchtern, Jed G.

    2016-01-01

    Neuroblastoma (NB), which accounts for about 15% of cancer-related mortality in children, is the most common childhood extracranial malignant tumor. In NB, somatic mutations of the tumor suppressor, p53, are exceedingly rare. Unlike in adult tumors, the majority of p53 downstream functions are still intact in NB cells with wild-type p53. Thus, restoring p53 function by blocking its interaction with p53 suppressors such as MDM2 is a viable therapeutic strategy for NB treatment. Herein, we show that MDM2 inhibitor SAR405838 is a potent therapeutic drug for NB. SAR405838 caused significantly decreased cell viability of p53 wild-type NB cells and induced p53-mediated apoptosis, as well as augmenting the cytotoxic effects of doxorubicin (Dox). In an in vivo orthotopic NB mouse model, SAR405838 induced apoptosis in NB tumor cells. In summary, our data strongly suggest that MDM2-specific inhibitors like SAR405838 may serve not only as a stand-alone therapy, but also as an effective adjunct to current chemotherapeutic regimens for treating NB with an intact MDM2-p53 axis. PMID:27764791

  6. RNF38 encodes a nuclear ubiquitin protein ligase that modifies p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sheren, Jamie E.; Kassenbrock, C. Kenneth, E-mail: ken.kassenbrock@ucdenver.edu; Department of Biology, Colorado State University, Fort Collins, CO 80523-1878

    2013-11-01

    Highlights: •RNF38 is shown to be a nuclear protein with a bipartite nuclear localization signal. •RNF38 protein is purified and shown to have ubiquitin protein ligase (E3) activity. •We show that RNF38 binds p53 and can ubiquitinate p53 in vitro. •Overexpression of RNF38 increases p53 ubiquitination in HEK293T cells. •Overexpression of RNF38 in HEK293T cells alters p53 localization. -- Abstract: The RNF38 gene encodes a RING finger protein of unknown function. Here we demonstrate that RNF38 is a functional ubiquitin protein ligase (E3). We show that RNF38 isoform 1 is localized to the nucleus by a bipartite nuclear localization sequencemore » (NLS). We confirm that RNF38 is a binding partner of p53 and demonstrate that RNF38 can ubiquitinate p53 in vitro and in vivo. Finally, we show that overexpression of RNF38 in HEK293T cells results in relocalization of p53 to discrete foci associated with PML nuclear bodies. These results suggest RNF38 is an E3 ubiquitin ligase that may play a role in regulating p53.« less

  7. PUMA promotes Bax translocation in FOXO3a-dependent pathway during STS-induced apoptosis

    NASA Astrophysics Data System (ADS)

    Zhang, Yingjie; Chen, Qun

    2009-08-01

    PUMA (p53 up-regulated modulator of apoptosis, also called Bbc3) was first identified as a BH3-only Bcl-2 family protein that is transcriptionally up-regulated by p53 and activated upon p53-dependent apoptotic stimuli, such as treatment with DNA-damaging drugs or UV irradiation. Recently studies have been shown that Puma is also up-regulated in response to certain p53-independent apoptotic stimuli, such as growth factor deprivation or treatment with glucocorticoids or STS (staurosporine). However, the molecular mechanisms of PUMA up-regulation and how PUMA functions in response to p53-independent apoptotic stimuli remain poorly understood. In this study, based on real-time single cell analysis, flow cytometry and western blotting technique, we investigated the function of PUMA in living human lung adenocarcinoma cells (ASTC-a-1) after STS treatment. Our results show that FOXO3a was activated by STS stimulation and then translocated from cytosol to nucleus. The expression of PUMA was up-regulated via a FOXO3a-dependent manner after STS treatment, while p53 had little function in this process. Moreover, cell apoptosis and Bax translocation induced by STS were not blocked by Pifithrin-α (p53 inhibitor), which suggested that p53 was not involved in this signaling pathway. Taken together, these results indicate that PUMA promoted Bax translocation in a FOXO3a-dependment pathway during STS-induced apoptosis, while p53 was dispensable in this process.

  8. Replication of damaged DNA in vitro is blocked by p53

    PubMed Central

    Zhou, Jianmin; Prives, Carol

    2003-01-01

    The tumor suppressor protein p53 may have other roles and functions in addition to its well-documented ability to serve as a sequence-specific transcriptional activator in response to DNA damage. We showed previously that p53 can block the replication of polyomavirus origin-containing DNA (Py ori-DNA) in vitro when p53 binding sites are present on the late side of the Py ori. Here we have both further extended these observations and have also examined whether p53 might be able to bind directly to and inhibit the replication of damaged DNA. We found that p53 strongly inhibits replication of γ-irradiated Py ori-DNA and such inhibition requires both the central DNA binding domain and the extreme C-terminus of the p53 protein. An endogenous p53 binding site lies within the Py origin and is required for the ability of p53 to block initiation of replication from γ-irradiated Py ori-DNA, suggesting the possibility of DNA looping caused by p53 binding both non-specifically to sites of DNA damage and specifically to the endogenous site in the polyomavirus origin. Our results thus suggest the possibility that under some circumstances p53 might serve as a direct regulator of DNA replication and suggest as well an additional function for cooperation between its two autonomous DNA binding domains. PMID:12853603

  9. Molecular Dynamic Simulation Insights into the Normal State and Restoration of p53 Function

    PubMed Central

    Fu, Ting; Min, Hanyi; Xu, Yong; Chen, Jianzhong; Li, Guohui

    2012-01-01

    As a tumor suppressor protein, p53 plays a crucial role in the cell cycle and in cancer prevention. Almost 50 percent of all human malignant tumors are closely related to a deletion or mutation in p53. The activity of p53 is inhibited by over-active celluar antagonists, especially by the over-expression of the negative regulators MDM2 and MDMX. Protein-protein interactions, or post-translational modifications of the C-terminal negative regulatory domain of p53, also regulate its tumor suppressor activity. Restoration of p53 function through peptide and small molecular inhibitors has become a promising strategy for novel anti-cancer drug design and development. Molecular dynamics simulations have been extensively applied to investigate the conformation changes of p53 induced by protein-protein interactions and protein-ligand interactions, including peptide and small molecular inhibitors. This review focuses on the latest MD simulation research, to provide an overview of the current understanding of interactions between p53 and its partners at an atomic level. PMID:22949826

  10. Activation of endogenous p53 by combined p19Arf gene transfer and nutlin-3 drug treatment modalities in the murine cell lines B16 and C6

    PubMed Central

    2010-01-01

    Background Reactivation of p53 by either gene transfer or pharmacologic approaches may compensate for loss of p19Arf or excess mdm2 expression, common events in melanoma and glioma. In our previous work, we constructed the pCLPG retroviral vector where transgene expression is controlled by p53 through a p53-responsive promoter. The use of this vector to introduce p19Arf into tumor cells that harbor p53wt should yield viral expression of p19Arf which, in turn, would activate the endogenous p53 and result in enhanced vector expression and tumor suppression. Since nutlin-3 can activate p53 by blocking its interaction with mdm2, we explored the possibility that the combination of p19Arf gene transfer and nutlin-3 drug treatment may provide an additive benefit in stimulating p53 function. Methods B16 (mouse melanoma) and C6 (rat glioma) cell lines, which harbor p53wt, were transduced with pCLPGp19 and these were additionally treated with nutlin-3 or the DNA damaging agent, doxorubicin. Viral expression was confirmed by Western, Northern and immunofluorescence assays. p53 function was assessed by reporter gene activity provided by a p53-responsive construct. Alterations in proliferation and viability were measured by colony formation, growth curve, cell cycle and MTT assays. In an animal model, B16 cells were treated with the pCLPGp19 virus and/or drugs before subcutaneous injection in C57BL/6 mice, observation of tumor progression and histopathologic analyses. Results Here we show that the functional activation of endogenous p53wt in B16 was particularly challenging, but accomplished when combined gene transfer and drug treatments were applied, resulting in increased transactivation by p53, marked cell cycle alteration and reduced viability in culture. In an animal model, B16 cells treated with both p19Arf and nutlin-3 yielded increased necrosis and decreased BrdU marking. In comparison, C6 cells were quite susceptible to either treatment, yet p53 was further activated by the combination of p19Arf and nutlin-3. Conclusions To the best of our knowledge, this is the first study to apply both p19Arf and nutlin-3 for the stimulation of p53 activity. These results support the notion that a p53 responsive vector may prove to be an interesting gene transfer tool, especially when combined with p53-activating agents, for the treatment of tumors that retain wild-type p53. PMID:20569441

  11. Rapid colorimetric detection of p53 protein function using DNA-gold nanoconjugates with applications for drug discovery and cancer diagnostics.

    PubMed

    Assah, Enock; Goh, Walter; Zheng, Xin Ting; Lim, Ting Xiang; Li, Jun; Lane, David; Ghadessy, Farid; Tan, Yen Nee

    2018-05-05

    The tumor suppressor protein p53 plays a central role in preventing cancer through interaction with DNA response elements (REs) to regulate target gene expression in cells. Due to its significance in cancer biology, relentless efforts have been directed toward understanding p53-DNA interactions for the development of cancer therapeutics and diagnostics. In this paper, we report a rapid, label-free and versatile colorimetric assay to detect wildtype p53 DNA-binding function in complex solutions. The assay design is based on a concept that alters interparticle-distances between RE-AuNPs from a crosslinking effect induced through tetramerization of wildtype p53 protein (p53-WT) upon binding to canonical DNA motifs modified on gold nanoparticles (RE-AuNPs). This leads to a visible solution color change from red to blue, which is quantifiable by the UV- visible absorption spectra with a detection limit of 5 nM. Contrastingly, no color change was observed for the binding-deficient p53 mutants and non-specific proteins due to their inability to crosslink RE-AuNPs. Based on this sensing principle, we further demonstrate its utility for fast detection of drug-induced DNA binding function to cancer-associated Y220C mutant p53 protein using well-established reactivating compounds. By exploiting the dominant-negative property of mutant p53 over p53-WT and interactions with RE-AuNPs, this assay is configurable to detect low numbers of mutant p53 expressing cells in miniscule sample fractions obtained from typical core needle biopsy-sized tissues without signal attrition, alluding to the potential for biopsy sampling in cancer diagnostics or for defining cancer margins. This nanogold enabled colorimetric assay provides a facile yet robust method for studying important parameters influencing p53-DNA interactions with great promises for clinically pertinent applications. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. Missense mutations located in structural p53 DNA-binding motifs are associated with extremely poor survival in chronic lymphocytic leukemia.

    PubMed

    Trbusek, Martin; Smardova, Jana; Malcikova, Jitka; Sebejova, Ludmila; Dobes, Petr; Svitakova, Miluse; Vranova, Vladimira; Mraz, Marek; Francova, Hana Skuhrova; Doubek, Michael; Brychtova, Yvona; Kuglik, Petr; Pospisilova, Sarka; Mayer, Jiri

    2011-07-01

    There is a distinct connection between TP53 defects and poor prognosis in chronic lymphocytic leukemia (CLL). It remains unclear whether patients harboring TP53 mutations represent a homogenous prognostic group. We evaluated the survival of patients with CLL and p53 defects identified at our institution by p53 yeast functional assay and complementary interphase fluorescence in situ hybridization analysis detecting del(17p) from 2003 to 2010. A defect of the TP53 gene was identified in 100 of 550 patients. p53 mutations were strongly associated with the deletion of 17p and the unmutated IgVH locus (both P < .001). Survival assessed from the time of abnormality detection was significantly reduced in patients with both missense (P < .001) and nonmissense p53 mutations (P = .004). In addition, patients harboring missense mutation located in p53 DNA-binding motifs (DBMs), structurally well-defined parts of the DNA-binding domain, manifested a clearly shorter median survival (12 months) compared with patients having missense mutations outside DBMs (41 months; P = .002) or nonmissense alterations (36 months; P = .005). The difference in survival was similar in the analysis limited to patients harboring mutation accompanied by del(17p) and was also confirmed in a subgroup harboring TP53 defect at diagnosis. The patients with p53 DBMs mutation (at diagnosis) also manifested a short median time to first therapy (TTFT; 1 month). The substantially worse survival and the short TTFT suggest a strong mutated p53 gain-of-function phenotype in patients with CLL with DBMs mutations. The impact of p53 DBMs mutations on prognosis and response to therapy should be analyzed in investigative clinical trials.

  13. Suppression of p53-inducible gene 3 is significant for glioblastoma progression and predicts poor patient prognosis.

    PubMed

    Quan, Jishu; Li, Yong; Jin, Meihua; Chen, Dunfu; Yin, Xuezhe; Jin, Ming

    2017-03-01

    Glioblastoma is the most malignant and invasive brain tumor with extremely poor prognosis. p53-inducible gene 3, a downstream molecule of the tumor suppressor p53, has been found involved in apoptosis and oxidative stress response. However, the functions of p53-inducible gene 3(PIG3) in cancer are far from clear including glioblastoma. In this study, we found that p53-inducible gene 3 expression was suppressed in glioblastoma tissues compared with normal tissues. And the expression of p53-inducible gene 3 was significantly associated with the World Health Organization grade. Patients with high p53-inducible gene 3 expression have a significantly longer median survival time (15 months) than those with low p53-inducible gene 3 expression (8 months). According to Cox regression analysis, p53-inducible gene 3 was an independent prognostic factor with multivariate hazard ratio of 0.578 (95% confidence interval, 0.352-0.947; p = 0.030) for overall survival. Additionally, gain and loss of function experiments showed that knockdown of p53-inducible gene 3 significantly increased the proliferation and invasion ability of glioblastoma cells while overexpression of p53-inducible gene 3 inhibited the proliferation and invasion ability. The results of in vivo glioblastoma models further confirmed that p53-inducible gene 3 suppression promoted glioblastoma progression. Altogether, our data suggest that high expression of p53-inducible gene 3 is significant for glioblastoma inhibition and p53-inducible gene 3 independently indicates good prognosis in patients, which might be a novel prognostic biomarker or potential therapeutic target in glioblastoma.

  14. p53-dependent cell death/apoptosis is required for a productive adenovirus infection.

    PubMed

    Hall, A R; Dix, B R; O'Carroll, S J; Braithwaite, A W

    1998-09-01

    The p53 tumor suppressor protein binds to both cellular and viral proteins, which influence its biological activity. One such protein is the large E1b tumor antigen (E1b58kDa) from adenoviruses (Ads), which abrogates the ability of p53 to transactivate various promoters. This inactivation of p53 function is believed to be the mechanism by which E1b58kDa contributes to the cell transformation process. Although the p53-E1b58kDa complex occurs during infection and is conserved among different serotypes, there are limited data demonstrating that it has a role in virus replication. However, loss of p53 expression occurs after adenovirus infection of human cells and an E1b58kDa deletion mutant (Onyx-015, also called dl 1520) selectively replicates in p53-defective cells. These (and other) data indicate a plausible hypothesis is that loss of p53 function may be conducive to efficient adenovirus replication. However, wild-type (wt) Ad5 grows more efficiently in cells expressing a wt p53 protein. These studies indicate that the hypothesis may be an oversimplification. Here, we show that cells expressing wt p53, as well as p53-defective cells, allow adenovirus replication, but only cells expressing wt p53 show evidence of virus-induced cytopathic effect. This correlates with the ability of adenovirus to induce cell death. Our data indicate that p53 plays a necessary part in mediating cellular destruction to allow a productive adenovirus infection. In contrast, p53-deficient cells are less sensitive to the cytolytic effects of adenovirus and as such raise questions about the use of E1b58kDa-deficient adenoviruses in tumor therapy.

  15. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions

    PubMed Central

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-01-01

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. PMID:27604871

  16. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice.

    PubMed

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-12-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here, we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/-Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas wild-type cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53.

  17. Differential p53 engagement in response to oxidative and oncogenic stresses in Fanconi anemia mice

    PubMed Central

    Rani, Reena; Li, Jie; Pang, Qishen

    2008-01-01

    Members of the Fanconi anemia (FA) protein family are involved in repair of genetic damage caused by DNA cross-linkers. It is not clear whether the FA proteins function in oxidative DNA damage and oncogenic stress response. Here we report that deficiency in the Fanca gene in mice elicits a p53-dependent growth arrest and DNA damage response to oxidative DNA damage and oncogenic stress. Using a Fanca-/- Trp53-/- double knockout model and a functionally switchable p53 retrovirus, we define the kinetics, dependence, and persistence of p53-mediated response to oxidative and oncogenic stresses in Fanca-/- cells. Notably, oxidative stress induces persistent p53 response in Fanca-/- cells, likely due to accumulation of unrepaired DNA damage. On the other hand, whereas WT cells exhibit prolonged response to oncogene activation, the p53-activating signals induced by oncogenic ras are short-lived in Fanca-/- cells, suggesting that Fanca may be required for the cell to engage p53 during constitutive ras activation. We propose that the FA proteins protect cells from stress-induced proliferative arrest and tumor evolution by acting as a modulator of the signaling pathways that link FA to p53. PMID:19047147

  18. The p53-reactivating small molecule RITA induces senescence in head and neck cancer cells.

    PubMed

    Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N; Skinner, Heath D

    2014-01-01

    TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC.

  19. Redundant functions of I-BAR family members, IRSp53 and IRTKS, are essential for embryonic development

    PubMed Central

    Chou, Ai Mei; Sem, Kai Ping; Lam, Wei Jun; Ahmed, Sohail; Lim, Chin Yan

    2017-01-01

    The insulin receptor substrate of 53 kDa, IRSp53, is an adaptor protein that works with activated GTPases, Cdc42 and Rac, to modulate actin dynamics and generate membrane protrusions in response to cell signaling. Adult mice that lack IRSp53 fail to regulate synaptic plasticity and exhibit hippocampus-associated learning deficiencies. Here, we show that 60% of IRSp53 null embryos die at mid to late gestation, indicating a vital IRSp53 function in embryonic development. We find that IRSp53 KO embryos displayed pleiotropic phenotypes such as developmental delay, oligodactyly and subcutaneous edema, and died of severely impaired cardiac and placental development. We further show that double knockout of IRSp53 and its closest family member, IRTKS, resulted in exacerbated placental abnormalities, particularly in spongiotrophoblast differentiation and development, giving rise to complete embryonic lethality. Hence, our findings demonstrate a hitherto under-appreciated IRSp53 function in embryonic development, and further establish an essential genetic interaction between IRSp53 and IRTKS in placental formation. PMID:28067313

  20. EBNA3C regulates p53 through induction of Aurora kinase B

    PubMed Central

    Jha, Hem C.; Yang, Karren; El-Naccache, Darine W.; Sun, Zhiguo; Robertson, Erle S.

    2015-01-01

    In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation. PMID:25691063

  1. An in silico algorithm for identifying stabilizing pockets in proteins: test case, the Y220C mutant of the p53 tumor suppressor protein

    PubMed Central

    Bromley, Dennis; Bauer, Matthias R.; Fersht, Alan R.; Daggett, Valerie

    2016-01-01

    The p53 tumor suppressor protein performs a critical role in stimulating apoptosis and cell cycle arrest in response to oncogenic stress. The function of p53 can be compromised by mutation, leading to increased risk of cancer; approximately 50% of cancers are associated with mutations in the p53 gene, the majority of which are in the core DNA-binding domain. The Y220C mutation of p53, for example, destabilizes the core domain by 4 kcal/mol, leading to rapid denaturation and aggregation. The associated loss of tumor suppressor functionality is associated with approximately 75 000 new cancer cases every year. Destabilized p53 mutants can be ‘rescued’ and their function restored; binding of a small molecule into a pocket on the surface of mutant p53 can stabilize its wild-type structure and restore its function. Here, we describe an in silico algorithm for identifying potential rescue pockets, including the algorithm's integration with the Dynameomics molecular dynamics data warehouse and the DIVE visual analytics engine. We discuss the results of the application of the method to the Y220C p53 mutant, entailing finding a putative rescue pocket through MD simulations followed by an in silico search for stabilizing ligands that dock into the putative rescue pocket. The top three compounds from this search were tested experimentally and one of them bound in the pocket, as shown by nuclear magnetic resonance, and weakly stabilized the mutant. PMID:27503952

  2. Induction of MDM2-P2 Transcripts Correlates with Stabilized Wild-Type p53 in Betel- and Tobacco-Related Human Oral Cancer

    PubMed Central

    Ralhan, Ranju; Sandhya, Agarwal; Meera, Mathur; Bohdan, Wasylyk; Nootan, Shukla K.

    2000-01-01

    MDM2, a critical element of cellular homeostasis mechanisms, is involved in complex interactions with important cell-cycle and stress-response regulators including p53. The mdm2-P2 promoter is a transcriptional target of p53. The aim of this study was to determine the association between mdm2-P2 transcripts and the status of the p53 gene in betel- and tobacco-related oral squamous cell carcinomas (SCCs) to understand the mechanism of deregulation of MDM2 and p53 expression and their prognostic implications in oral tumorigenesis. Elevated levels of MDM2 proteins were observed in 11 of 25 (44%) oral hyperplastic lesions, nine of 15 (60%) dysplastic lesions, and 71 of 100 (71%) SCCs. The intriguing feature of the study was the identification and different subcellular localization of three isoforms of MDM2 (ie, 90 kd, 76 kd, and 57 kd) in oral SCCs and their correlation with p53 overexpression in each tumor. The hallmark of the study was the detection of mdm2-P2 transcripts in 12 of 20 oral SCCs overexpressing both MDM2 and p53 proteins while harboring wild-type p53 alleles. Furthermore, mdm2 amplification was an infrequent event in betel- and tobacco-associated oral tumorigenesis. The differential compartmentalization of the three isoforms of MDM2 suggests that each has a distinct function, potentially in the regulation of p53 and other gene products implicated in oral tumorigenesis. In conclusion, we report herein the first evidence suggesting that enhanced translation of mdm2-P2 transcripts (S-mdm2) may represent an important mechanism of overexpression and consequent stabilization and functional inactivation of wild-type p53 serving as an adverse prognosticator in betel- and tobacco-related oral cancer. The clinical significance of the functional inactivation of wild-type p53 by MDM2 is underscored by the significantly shorter median disease-free survival time (16 months) observed in p53/MDM2-positive cases as compared to those which did not show co-expression of these proteins (median time, 26 months; P = 0.02). PMID:10934161

  3. Wilms tumor gene 1 (WT1), TP53, RAS/BRAF and KIT aberrations in testicular germ cell tumors.

    PubMed

    Boublikova, L; Bakardjieva-Mihaylova, V; Skvarova Kramarzova, K; Kuzilkova, D; Dobiasova, A; Fiser, K; Stuchly, J; Kotrova, M; Buchler, T; Dusek, P; Grega, M; Rosova, B; Vernerova, Z; Klezl, P; Pesl, M; Zachoval, R; Krolupper, M; Kubecova, M; Stahalova, V; Abrahamova, J; Babjuk, M; Kodet, R; Trka, J

    2016-07-01

    Wilms tumor gene 1 (WT1), a zinc-finger transcription factor essential for testis development and function, along with other genes, was investigated for their role in the pathogenesis of testicular germ cell tumors (TGCT). In total, 284 TGCT and 100 control samples were investigated, including qPCR for WT1 expression and BRAF mutation, p53 immunohistochemistry detection, and massively parallel amplicon sequencing. WT1 was significantly (p < 0.0001) under-expressed in TGCT, with an increased ratio of exon 5-lacking isoforms, reaching low levels in chemo-naïve relapsed TGCT patients vs. high levels in chemotherapy-pretreated relapsed patients. BRAF V600E mutation was identified in 1% of patients only. p53 protein was lowly expressed in TGCT metastases compared to the matched primary tumors. Of 9 selected TGCT-linked genes, RAS/BRAF and WT1 mutations were frequent while significant TP53 and KIT variants were not detected (p = 0.0003). WT1 has been identified as a novel factor involved in TGCT pathogenesis, with a potential prognostic impact. Distinct biologic nature of the two types of relapses occurring in TGCT has been demonstrated. Differential mutation rate of the key TGCT-related genes has been documented. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  4. Integration of Genomic, Biologic, and Chemical Approaches to Target p53 Loss and Gain-of-Function in Triple Negative Breast Cancer

    DTIC Science & Technology

    2015-09-01

    dissertation research is determining the mechanism and “targetability” of a mutant p53-adapted state in triple-negative breast cancer . Tim’s...Negative Breast Cancer PRINCIPAL INVESTIGATOR: Jennifer A. Pietenpol, Ph.D. CONTRACTING ORGANIZATION: The Vanderbilt University Nashville, TN...Loss and Gain-of-Function in Triple Negative Breast Cancer 5a. CONTRACT NUMBER W81XWH-13-1-0287 p53 Loss and Gain-of-Function in Triple Negative

  5. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents

    PubMed Central

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Wilhelm Doerr, H; Rödel, F; Speidel, D; Cinatl, J

    2012-01-01

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3rRITA10 μM to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells. PMID:22476102

  6. Human neuroblastoma cells with acquired resistance to the p53 activator RITA retain functional p53 and sensitivity to other p53 activating agents.

    PubMed

    Michaelis, M; Rothweiler, F; Agha, B; Barth, S; Voges, Y; Löschmann, N; von Deimling, A; Breitling, R; Doerr, H Wilhelm; Rödel, F; Speidel, D; Cinatl, J

    2012-04-05

    Adaptation of wild-type p53 expressing UKF-NB-3 cancer cells to the murine double minute 2 inhibitor nutlin-3 causes de novo p53 mutations at high frequency (13/20) and multi-drug resistance. Here, we show that the same cells respond very differently when adapted to RITA, a drug that, like nutlin-3, also disrupts the p53/Mdm2 interaction. All of the 11 UKF-NB-3 sub-lines adapted to RITA that we established retained functional wild-type p53 although RITA induced a substantial p53 response. Moreover, all RITA-adapted cell lines remained sensitive to nutlin-3, whereas only five out of 10 nutlin-3-adapted cell lines retained their sensitivity to RITA. In addition, repeated adaptation of the RITA-adapted sub-line UKF-NB-3(r)RITA(10 μM) to nutlin-3 resulted in p53 mutations. The RITA-adapted UKF-NB-3 sub-lines displayed no or less pronounced resistance to vincristine, cisplatin, and irradiation than nutlin-3-adapted UKF-NB-3 sub-lines. Furthermore, adaptation to RITA was associated with fewer changes at the expression level of antiapoptotic factors than observed with adaptation to nutlin-3. Transcriptomic analyses indicated the RITA-adapted sub-lines to be more similar at the gene expression level to the parental UKF-NB-3 cells than nutlin-3-adapted UKF-NB-3 sub-lines, which correlates with the observed chemotherapy and irradiation sensitivity phenotypes. In conclusion, RITA-adapted cells retain functional p53, remain sensitive to nutlin-3, and display a less pronounced resistance phenotype than nutlin-3-adapted cells.

  7. Canine gastric carcinoma: immunohistochemical expression of cell cycle proteins (p53, p21, and p16) and heat shock proteins (Hsp27 and Hsp70).

    PubMed

    Carrasco, V; Canfrán, S; Rodríguez-Franco, F; Benito, A; Sáinz, A; Rodríguez-Bertos, A

    2011-01-01

    Immunohistochemical staining for cell cycle proteins and heat shock proteins was performed on 17 canine gastric carcinomas. The immunoexpression of p53, p21, p16, Hsp27, and Hsp70 was investigated. A study was conducted to determine the histological type and parameters related to tumor malignancy. Possible associations and trends were assessed between the immunoexpression of each protein and tumor type as well as specific parameters of malignancy. High intratumor frequency of cellular p53 immunostaining was observed (61.96% average), but lower frequencies of p21 and p16 expression were present (34.65% and 10.41%, respectively). The p53 overexpression was associated with tumor infiltration (P = .0258). Expression of p21 was lower in undifferentiated carcinomas, and the loss of expression was associated with histopathological parameters characteristic of a poor prognosis such as lymphatic vessel invasion (P = .0258). The lack of p16 immunoreactivity was related to histopathological characteristics of malignancy such as the presence of evident and multiple nucleoli (P = .0475). In contrast, deep tumor infiltration was observed in those carcinomas with a high p16 index (P = .0475). Hsp70 appeared to be overexpressed in all gastric neoplasms included in this study. This is in contrast to Hsp27, because a group of tumors showed complete lack of Hsp27 immunoexpression, whereas the others displayed extensive Hsp27 immunostaining. The differences in Hsp27 did not correlate with any of the histopathological parameters, but Hsp27 immunoexpression was higher in the undifferentiated carcinoma. No significant differences in the expression of the proteins were found in canine gastric carcinomas according to their histological type. These findings may be useful for establishing a prognosis for canine gastric carcinoma.

  8. p53-dependent programmed necrosis controls germ cell homeostasis during spermatogenesis.

    PubMed

    Napoletano, Francesco; Gibert, Benjamin; Yacobi-Sharon, Keren; Vincent, Stéphane; Favrot, Clémentine; Mehlen, Patrick; Girard, Victor; Teil, Margaux; Chatelain, Gilles; Walter, Ludivine; Arama, Eli; Mollereau, Bertrand

    2017-09-01

    The importance of regulated necrosis in pathologies such as cerebral stroke and myocardial infarction is now fully recognized. However, the physiological relevance of regulated necrosis remains unclear. Here, we report a conserved role for p53 in regulating necrosis in Drosophila and mammalian spermatogenesis. We found that Drosophila p53 is required for the programmed necrosis that occurs spontaneously in mitotic germ cells during spermatogenesis. This form of necrosis involved an atypical function of the initiator caspase Dronc/Caspase 9, independent of its catalytic activity. Prevention of p53-dependent necrosis resulted in testicular hyperplasia, which was reversed by restoring necrosis in spermatogonia. In mouse testes, p53 was required for heat-induced germ cell necrosis, indicating that regulation of necrosis is a primordial function of p53 conserved from invertebrates to vertebrates. Drosophila and mouse spermatogenesis will thus be useful models to identify inducers of necrosis to treat cancers that are refractory to apoptosis.

  9. Cytoplasmic destruction of p53 by the endoplasmic reticulum-resident ubiquitin ligase ‘Synoviolin'

    PubMed Central

    Yamasaki, Satoshi; Yagishita, Naoko; Sasaki, Takeshi; Nakazawa, Minako; Kato, Yukihiro; Yamadera, Tadayuki; Bae, Eunkyung; Toriyama, Sayumi; Ikeda, Rie; Zhang, Lei; Fujitani, Kazuko; Yoo, Eunkyung; Tsuchimochi, Kaneyuki; Ohta, Tomohiko; Araya, Natsumi; Fujita, Hidetoshi; Aratani, Satoko; Eguchi, Katsumi; Komiya, Setsuro; Maruyama, Ikuro; Higashi, Nobuyo; Sato, Mitsuru; Senoo, Haruki; Ochi, Takahiro; Yokoyama, Shigeyuki; Amano, Tetsuya; Kim, Jaeseob; Gay, Steffen; Fukamizu, Akiyoshi; Nishioka, Kusuki; Tanaka, Keiji; Nakajima, Toshihiro

    2007-01-01

    Synoviolin, also called HRD1, is an E3 ubiquitin ligase and is implicated in endoplasmic reticulum -associated degradation. In mammals, Synoviolin plays crucial roles in various physiological and pathological processes, including embryogenesis and the pathogenesis of arthropathy. However, little is known about the molecular mechanisms of Synoviolin in these actions. To clarify these issues, we analyzed the profile of protein expression in synoviolin-null cells. Here, we report that Synoviolin targets tumor suppressor gene p53 for ubiquitination. Synoviolin sequestrated and metabolized p53 in the cytoplasm and negatively regulated its cellular level and biological functions, including transcription, cell cycle regulation and apoptosis. Furthermore, these p53 regulatory functions of Synoviolin were irrelevant to other E3 ubiquitin ligases for p53, such as MDM2, Pirh2 and Cop1, which form autoregulatory feedback loops. Our results provide novel insights into p53 signaling mediated by Synoviolin. PMID:17170702

  10. Cytoplasmic destruction of p53 by the endoplasmic reticulum-resident ubiquitin ligase 'Synoviolin'.

    PubMed

    Yamasaki, Satoshi; Yagishita, Naoko; Sasaki, Takeshi; Nakazawa, Minako; Kato, Yukihiro; Yamadera, Tadayuki; Bae, Eunkyung; Toriyama, Sayumi; Ikeda, Rie; Zhang, Lei; Fujitani, Kazuko; Yoo, Eunkyung; Tsuchimochi, Kaneyuki; Ohta, Tomohiko; Araya, Natsumi; Fujita, Hidetoshi; Aratani, Satoko; Eguchi, Katsumi; Komiya, Setsuro; Maruyama, Ikuro; Higashi, Nobuyo; Sato, Mitsuru; Senoo, Haruki; Ochi, Takahiro; Yokoyama, Shigeyuki; Amano, Tetsuya; Kim, Jaeseob; Gay, Steffen; Fukamizu, Akiyoshi; Nishioka, Kusuki; Tanaka, Keiji; Nakajima, Toshihiro

    2007-01-10

    Synoviolin, also called HRD1, is an E3 ubiquitin ligase and is implicated in endoplasmic reticulum -associated degradation. In mammals, Synoviolin plays crucial roles in various physiological and pathological processes, including embryogenesis and the pathogenesis of arthropathy. However, little is known about the molecular mechanisms of Synoviolin in these actions. To clarify these issues, we analyzed the profile of protein expression in synoviolin-null cells. Here, we report that Synoviolin targets tumor suppressor gene p53 for ubiquitination. Synoviolin sequestrated and metabolized p53 in the cytoplasm and negatively regulated its cellular level and biological functions, including transcription, cell cycle regulation and apoptosis. Furthermore, these p53 regulatory functions of Synoviolin were irrelevant to other E3 ubiquitin ligases for p53, such as MDM2, Pirh2 and Cop1, which form autoregulatory feedback loops. Our results provide novel insights into p53 signaling mediated by Synoviolin.

  11. TP53 mutations, expression and interaction networks in human cancers

    PubMed Central

    Wang, Xiaosheng; Sun, Qingrong

    2017-01-01

    Although the associations of p53 dysfunction, p53 interaction networks and oncogenesis have been widely explored, a systematic analysis of TP53 mutations and its related interaction networks in various types of human cancers is lacking. Our study explored the associations of TP53 mutations, gene expression, clinical outcomes, and TP53 interaction networks across 33 cancer types using data from The Cancer Genome Atlas (TCGA). We show that TP53 is the most frequently mutated gene in a number of cancers, and its mutations appear to be early events in cancer initiation. We identified genes potentially repressed by p53, and genes whose expression correlates significantly with TP53 expression. These gene products may be especially important nodes in p53 interaction networks in human cancers. This study shows that while TP53-truncating mutations often result in decreased TP53 expression, other non-truncating TP53 mutations result in increased TP53 expression in some cancers. Survival analyses in a number of cancers show that patients with TP53 mutations are more likely to have worse prognoses than TP53-wildtype patients, and that elevated TP53 expression often leads to poor clinical outcomes. We identified a set of candidate synthetic lethal (SL) genes for TP53, and validated some of these SL interactions using data from the Cancer Cell Line Project. These predicted SL genes are promising candidates for experimental validation and the development of personalized therapeutics for patients with TP53-mutated cancers. PMID:27880943

  12. TP53 mutations, expression and interaction networks in human cancers.

    PubMed

    Wang, Xiaosheng; Sun, Qingrong

    2017-01-03

    Although the associations of p53 dysfunction, p53 interaction networks and oncogenesis have been widely explored, a systematic analysis of TP53 mutations and its related interaction networks in various types of human cancers is lacking. Our study explored the associations of TP53 mutations, gene expression, clinical outcomes, and TP53 interaction networks across 33 cancer types using data from The Cancer Genome Atlas (TCGA). We show that TP53 is the most frequently mutated gene in a number of cancers, and its mutations appear to be early events in cancer initiation. We identified genes potentially repressed by p53, and genes whose expression correlates significantly with TP53 expression. These gene products may be especially important nodes in p53 interaction networks in human cancers. This study shows that while TP53-truncating mutations often result in decreased TP53 expression, other non-truncating TP53 mutations result in increased TP53 expression in some cancers. Survival analyses in a number of cancers show that patients with TP53 mutations are more likely to have worse prognoses than TP53-wildtype patients, and that elevated TP53 expression often leads to poor clinical outcomes. We identified a set of candidate synthetic lethal (SL) genes for TP53, and validated some of these SL interactions using data from the Cancer Cell Line Project. These predicted SL genes are promising candidates for experimental validation and the development of personalized therapeutics for patients with TP53-mutated cancers.

  13. p53 status determines the role of autophagy in pancreatic tumour development

    NASA Astrophysics Data System (ADS)

    Rosenfeldt, Mathias T.; O'Prey, Jim; Morton, Jennifer P.; Nixon, Colin; Mackay, Gillian; Mrowinska, Agata; Au, Amy; Rai, Taranjit Singh; Zheng, Liang; Ridgway, Rachel; Adams, Peter D.; Anderson, Kurt I.; Gottlieb, Eyal; Sansom, Owen J.; Ryan, Kevin M.

    2013-12-01

    Macroautophagy (hereafter referred to as autophagy) is a process in which organelles termed autophagosomes deliver cytoplasmic constituents to lysosomes for degradation. Autophagy has a major role in cellular homeostasis and has been implicated in various forms of human disease. The role of autophagy in cancer seems to be complex, with reports indicating both pro-tumorigenic and tumour-suppressive roles. Here we show, in a humanized genetically-modified mouse model of pancreatic ductal adenocarcinoma (PDAC), that autophagy's role in tumour development is intrinsically connected to the status of the tumour suppressor p53. Mice with pancreases containing an activated oncogenic allele of Kras (also called Ki-Ras)--the most common mutational event in PDAC--develop a small number of pre-cancerous lesions that stochastically develop into PDAC over time. However, mice also lacking the essential autophagy genes Atg5 or Atg7 accumulate low-grade, pre-malignant pancreatic intraepithelial neoplasia lesions, but progression to high-grade pancreatic intraepithelial neoplasias and PDAC is blocked. In marked contrast, in mice containing oncogenic Kras and lacking p53, loss of autophagy no longer blocks tumour progression, but actually accelerates tumour onset, with metabolic analysis revealing enhanced glucose uptake and enrichment of anabolic pathways, which can fuel tumour growth. These findings provide considerable insight into the role of autophagy in cancer and have important implications for autophagy inhibition in cancer therapy. In this regard, we also show that treatment of mice with the autophagy inhibitor hydroxychloroquine, which is currently being used in several clinical trials, significantly accelerates tumour formation in mice containing oncogenic Kras but lacking p53.

  14. Control of G1 arrest after DNA damage.

    PubMed Central

    Kastan, M B; Kuerbitz, S J

    1993-01-01

    The temporal relationship between DNA damage and DNA replication may be critical in determining whether the genetic changes necessary for cellular transformation occur after DNA damage. Recent characterization of the mechanisms responsible for alterations in cell-cycle progression after DNA damage in our laboratory have implicated the p53 (tumor suppressor) protein in the G1 arrest that occurs after certain types of DNA damage. In particular, we found that levels of p53 protein increased rapidly and transiently after nonlethal doses of gamma irradiation (XRT) in hematopoietic cells with wild-type, but not mutant, p53 genes. These changes in p53 protein levels were temporally linked to a transient G1 arrest in these cells. Hematopoietic cells with mutant or absent p53 genes did not exhibit this G1 arrest, through they continued to demonstrate a G2 arrest. We recently extended these observations of a tight correlation between the status of the endogenous p53 genes and this G1 arrest after XRT and this cell-cycle alteration after XRT was then established by transfecting cells lacking endogenous p53 genes with a wild-type gene and observing acquisition of the G1 arrest and by transfecting cells processing endogenous wild-type p53 genes with a mutant p53 gene and observing loss of the G1 arrest after XRT. These observations and their significance for our understanding of the mechanisms of DNA damage-induced cellular transformation are discussed. PMID:8013425

  15. Hsp90 inhibitors sensitise human colon cancer cells to topoisomerase I poisons by depletion of key anti-apoptotic and cell cycle checkpoint proteins.

    PubMed

    McNamara, Anne V; Barclay, Monica; Watson, Alastair J M; Jenkins, John R

    2012-02-01

    Hsp90 and topoisomerase I are both targets for chemotherapeutic agents. Topoisomerase I poisons are standard clinical treatments, whilst Hsp90 inhibitors are progressing through clinical trials. We have demonstrated that when an Hsp90 inhibitor and topoisomerase I poison are combined they produce a synergistic increase in apoptosis in both p53⁺/⁺ and p53⁻/⁻ HCT116 human colon cancer cells. Lack of p53 is associated with an increase in sensitivity to the combination treatment; p53⁺/⁺ cells treated with the topoisomerase I poison topotecan (TPT) arrest at G2, whereas in p53⁻/⁻ cells the additional presence of the Hsp90 inhibitor geldanamycin (GA) selectively abrogates the G2M checkpoint. More importantly we report that there is a common underlying p53-independent mechanism behind the observed synergistic combined drug effect. We show that concurrent treatment with GA and TPT is able to reverse TPT induced up-regulation of the anti-apoptotic protein Bcl2 in both p53⁺/⁺ and p53⁻/⁻ HCT116 cells. The data suggests that inhibition of Hsp90 mediates down-regulation of Bcl2 following the combination treatment and cause a synergistic increase in apoptosis in both p53⁺/⁺ and p53⁻/⁻ HCT116 cells; p53⁻/⁻ HCT116 cells are more sensitive to the treatment because they also fail to arrest at G2 in the cell cycle. Copyright © 2011 Elsevier Inc. All rights reserved.

  16. Chk2 mediates RITA-induced apoptosis.

    PubMed

    de Lange, J; Verlaan-de Vries, M; Teunisse, A F A S; Jochemsen, A G

    2012-06-01

    Reactivation of the p53 tumor-suppressor protein by small molecules like Nutlin-3 and RITA (reactivation of p53 and induction of tumor cell apoptosis) is a promising strategy for cancer therapy. The molecular mechanisms involved in the responses to RITA remain enigmatic. Several groups reported the induction of a p53-dependent DNA damage response. Furthermore, the existence of a p53-dependent S-phase checkpoint has been suggested, involving the checkpoint kinase Chk1. We have recently shown synergistic induction of apoptosis by RITA in combination with Nutlin-3, and we observed concomitant Chk2 phosphorylation. Therefore, we investigated whether Chk2 contributes to the cellular responses to RITA. Strikingly, the induction of apoptosis seemed entirely Chk2 dependent. Transcriptional activity of p53 in response to RITA required the presence of Chk2. A partial rescue of apoptosis observed in Noxa knockdown cells emphasized the relevance of p53 transcriptional activity for RITA-induced apoptosis. In addition, we observed an early p53- and Chk2-dependent block of DNA replication upon RITA treatment. Replicating cells seemed more prone to entering RITA-induced apoptosis. Furthermore, the RITA-induced DNA damage response, which was not a secondary effect of apoptosis induction, was strongly attenuated in cells lacking p53 or Chk2. In conclusion, we identified Chk2 as an essential mediator of the cellular responses to RITA.

  17. Chk2 mediates RITA-induced apoptosis

    PubMed Central

    de Lange, J; Verlaan-de Vries, M; Teunisse, A F A S; Jochemsen, A G

    2012-01-01

    Reactivation of the p53 tumor-suppressor protein by small molecules like Nutlin-3 and RITA (reactivation of p53 and induction of tumor cell apoptosis) is a promising strategy for cancer therapy. The molecular mechanisms involved in the responses to RITA remain enigmatic. Several groups reported the induction of a p53-dependent DNA damage response. Furthermore, the existence of a p53-dependent S-phase checkpoint has been suggested, involving the checkpoint kinase Chk1. We have recently shown synergistic induction of apoptosis by RITA in combination with Nutlin-3, and we observed concomitant Chk2 phosphorylation. Therefore, we investigated whether Chk2 contributes to the cellular responses to RITA. Strikingly, the induction of apoptosis seemed entirely Chk2 dependent. Transcriptional activity of p53 in response to RITA required the presence of Chk2. A partial rescue of apoptosis observed in Noxa knockdown cells emphasized the relevance of p53 transcriptional activity for RITA-induced apoptosis. In addition, we observed an early p53- and Chk2-dependent block of DNA replication upon RITA treatment. Replicating cells seemed more prone to entering RITA-induced apoptosis. Furthermore, the RITA-induced DNA damage response, which was not a secondary effect of apoptosis induction, was strongly attenuated in cells lacking p53 or Chk2. In conclusion, we identified Chk2 as an essential mediator of the cellular responses to RITA. PMID:22158418

  18. Effect of Mutant p53 Proteins on Glycolysis and Mitochondrial Metabolism.

    PubMed

    Eriksson, Matilda; Ambroise, Gorbatchev; Ouchida, Amanda Tomie; Lima Queiroz, Andre; Smith, Dominique; Gimenez-Cassina, Alfredo; Iwanicki, Marcin P; Muller, Patricia A; Norberg, Erik; Vakifahmetoglu-Norberg, Helin

    2017-12-15

    TP53 is one of the most commonly mutated genes in human cancers. Unlike other tumor suppressors that are frequently deleted or acquire loss-of-function mutations, the majority of TP53 mutations in tumors are missense substitutions, which lead to the expression of full-length mutant proteins that accumulate in cancer cells and may confer unique gain-of-function (GOF) activities to promote tumorigenic events. Recently, mutant p53 proteins have been shown to mediate metabolic changes as a novel GOF to promote tumor development. There is a strong rationale that the GOF activities, including alterations in cellular metabolism, might vary between the different p53 mutants. Accordingly, the effect of different mutant p53 proteins on cancer cell metabolism is largely unknown. In this study, we have metabolically profiled several individual frequently occurring p53 mutants in cancers, focusing on glycolytic and mitochondrial oxidative phosphorylation pathways. Our investigation highlights the diversity of different p53 mutants in terms of their effect on metabolism, which might provide a foundation for the development of more effective targeted pharmacological approaches toward variants of mutant p53. Copyright © 2017 American Society for Microbiology.

  19. p53 Hypersensitivity Is the Predominant Mechanism of the Unique Responsiveness of Testicular Germ Cell Tumor (TGCT) Cells to Cisplatin

    PubMed Central

    Gutekunst, Matthias; Oren, Moshe; Weilbacher, Andrea; Dengler, Michael A.; Markwardt, Christiane; Thomale, Jürgen; Aulitzky, Walter E.; van der Kuip, Heiko

    2011-01-01

    Consistent with the excellent clinical results in testicular germ cell tumors (TGCT), most cell lines derived from this cancer show an exquisite sensitivity to Cisplatin. It is well accepted that the high susceptibility of TGCT cells to apoptosis plays a central role in this hypersensitive phenotype. The role of the tumor suppressor p53 in this response, however, remains controversial. Here we show that siRNA-mediated silencing of p53 is sufficient to completely abrogate hypersensitivity not only to Cisplatin but also to non-genotoxic inducers of p53 such as the Mdm2 antagonist Nutlin-3 and the proteasome inhibitor Bortezomib. The close relationship between p53 protein levels and induction of apoptosis is lost upon short-term differentiation, indicating that this predominant pro-apoptotic function of p53 is unique in pluripotent embryonal carcinoma (EC) cells. RNA interference experiments as well as microarray analysis demonstrated a central role of the pro-apoptotic p53 target gene NOXA in the p53-dependent apoptotic response of these cells. In conclusion, our data indicate that the hypersensitivity of TGCT cells is a result of their unique sensitivity to p53 activation. Furthermore, in the very specific cellular context of germ cell-derived pluripotent EC cells, p53 function appears to be limited to induction of apoptosis. PMID:21532991

  20. Radiation-Induced Salivary Gland Dysfunction Results From p53-Dependent Apoptosis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Avila, Jennifer L.; Grundmann, Oliver; Burd, Randy

    2009-02-01

    Purpose: Radiotherapy for head-and-neck cancer causes adverse secondary side effects in the salivary glands and results in diminished quality of life for the patient. A previous in vivo study in parotid salivary glands demonstrated that targeted head-and-neck irradiation resulted in marked increases in phosphorylated p53 (serine{sup 18}) and apoptosis, which was suppressed in transgenic mice expressing a constitutively active mutant of Akt1 (myr-Akt1). Methods and Materials: Transgenic and knockout mouse models were exposed to irradiation, and p53-mediated transcription, apoptosis, and salivary gland dysfunction were analyzed. Results: The proapoptotic p53 target genes PUMA and Bax were induced in parotid salivary glandsmore » of mice at early time points after therapeutic radiation. This dose-dependent induction requires expression of p53 because no radiation-induced expression of PUMA and Bax was observed in p53-/- mice. Radiation also induced apoptosis in the parotid gland in a dose-dependent manner, which was p53 dependent. Furthermore, expression of p53 was required for the acute and chronic loss of salivary function after irradiation. In contrast, apoptosis was not induced in p53-/- mice, and their salivary function was preserved after radiation exposure. Conclusions: Apoptosis in the salivary glands after therapeutic head-and-neck irradiation is mediated by p53 and corresponds to salivary gland dysfunction in vivo.« less

  1. Lack of correlation between p53 codon 72 polymorphism and anal cancer risk

    PubMed Central

    Contu, Simone S; Agnes, Grasiela; Damin, Andrea P; Contu, Paulo C; Rosito, Mário A; Alexandre, Claudio O; Damin, Daniel C

    2009-01-01

    AIM: To investigate the potential role of p53 codon 72 polymorphism as a risk factor for development of anal cancer. METHODS: Thirty-two patients with invasive anal carcinoma and 103 healthy blood donors were included in the study. p53 codon 72 polymorphism was analyzed in blood samples through polymerase chain reaction-restriction fragment length polymorphism and DNA sequencing. RESULTS: The relative frequency of each allele was 0.60 for Arg and 0.40 for Pro in patients with anal cancer, and 0.61 for Arg and 0.39 for Pro in normal controls. No significant differences in distribution of the codon 72 genotypes between patients and controls were found. CONCLUSION: These results do not support a role for the p53 codon 72 polymorphism in anal carcinogenesis. PMID:19777616

  2. p53 is required for brain growth but is dispensable for resistance to nutrient restriction during Drosophila larval development

    PubMed Central

    Contreras, Esteban G.; Sierralta, Jimena

    2018-01-01

    Background Animal growth is influenced by the genetic background and the environmental circumstances. How genes promote growth and coordinate adaptation to nutrient availability is still an open question. p53 is a transcription factor that commands the cellular response to different types of stresses. In adult Drosophila melanogaster, p53 regulates the metabolic adaptation to nutrient restriction that supports fly viability. Furthermore, the larval brain is protected from nutrient restriction in a phenomenon called ‘brain sparing’. Therefore, we hypothesised that p53 may regulate brain growth and show a protective role over brain development under nutrient restriction. Results Here, we studied the function of p53 during brain growth in normal conditions and in animals subjected to developmental nutrient restriction. We showed that p53 loss of function reduced animal growth and larval brain size. Endogenous p53 was expressed in larval neural stem cells, but its levels and activity were not affected by nutritional stress. Interestingly, p53 knockdown only in neural stem cells was sufficient to decrease larval brain growth. Finally, we showed that in p53 mutant larvae under nutrient restriction, the energy storage levels were not altered, and these larvae generated adults with brains of similar size than wild-type animals. Conclusions Using genetic approaches, we demonstrate that p53 is required for proper growth of the larval brain. This developmental role of p53 does not have an impact on animal resistance to nutritional stress since brain growth in p53 mutants under nutrient restriction is similar to control animals. PMID:29621246

  3. p53 is required for brain growth but is dispensable for resistance to nutrient restriction during Drosophila larval development.

    PubMed

    Contreras, Esteban G; Sierralta, Jimena; Glavic, Alvaro

    2018-01-01

    Animal growth is influenced by the genetic background and the environmental circumstances. How genes promote growth and coordinate adaptation to nutrient availability is still an open question. p53 is a transcription factor that commands the cellular response to different types of stresses. In adult Drosophila melanogaster, p53 regulates the metabolic adaptation to nutrient restriction that supports fly viability. Furthermore, the larval brain is protected from nutrient restriction in a phenomenon called 'brain sparing'. Therefore, we hypothesised that p53 may regulate brain growth and show a protective role over brain development under nutrient restriction. Here, we studied the function of p53 during brain growth in normal conditions and in animals subjected to developmental nutrient restriction. We showed that p53 loss of function reduced animal growth and larval brain size. Endogenous p53 was expressed in larval neural stem cells, but its levels and activity were not affected by nutritional stress. Interestingly, p53 knockdown only in neural stem cells was sufficient to decrease larval brain growth. Finally, we showed that in p53 mutant larvae under nutrient restriction, the energy storage levels were not altered, and these larvae generated adults with brains of similar size than wild-type animals. Using genetic approaches, we demonstrate that p53 is required for proper growth of the larval brain. This developmental role of p53 does not have an impact on animal resistance to nutritional stress since brain growth in p53 mutants under nutrient restriction is similar to control animals.

  4. Cisplatin-Induced Renal Injury is Independently Mediated by OCT2 and p53

    PubMed Central

    Sprowl, Sprowl; Lancaster, Cynthia S.; Pabla, Navjotsingh; Hermann, Edwin; Kosloske, Ashley M.; Gibson, Alice A.; Li, Lie; Zeeh, Dorothea; Schlatter, Eberhard; Janke, Laura J.; Ciarimboli, Giuliano; Sparreboom, Alex

    2014-01-01

    Purpose Tubular secretion of cisplatin is abolished in mice deficient for the organic cation transporters Oct1 and Oct2 [Oct1/2(−/−) mice], and these animals are protected from severe cisplatin-induced kidney damage. Since tubular necrosis is not completely absent in Oct1/2(−/−) mice, we hypothesized that alternate pathways are involved in the observed injury. Experimental Design Studies were done in wildtype, Oct1/2(−/−), or p53-deficient animals, all on an FVB background, receiving i.p. cisplatin at 15 mg/kg. The cisplatin metabolites were analyzed using mass spectrometry, and gene expression was assessed using Affymetrix microarrays and RT-PCR arrays. Results KEGG pathway analyses on kidneys from mice exposed to cisplatin revealed that most significantly altered genes were associated with the p53 signaling network, including Cdnk1a and Mdm2, in both wildtype (P=2.40×10–11) and Oct1/2(−/−) mice (P=1.92×10-8). This was confirmed by demonstrating that homozygosity for a p53-null allele partially reduced renal tubular damage, while loss of p53 in Oct1/2(−/−) mice [p53(−/−)/Oct1/2(−/−)] completely abolished nephrotoxicity. We found that pifithrin-α, an inhibitor of p53-dependent transcriptional activation, inhibits Oct2 and can mimic the lack of nephrotoxicity observed in p53(−/−)/Oct1/2(−/−) mice. Conclusions These findings indicate that (i) the p53 pathway plays a crucial role in the kidney in response to cisplatin treatment and (ii) clinical exploration of OCT2 inhibitors may not lead to complete nephroprotection unless the p53 pathway is simultaneously antagonized. PMID:24916697

  5. Tumor suppressor p53 negatively regulates glycolysis stimulated by hypoxia through its target RRAD

    PubMed Central

    Wu, Rui; Liang, Yingjian; Lin, Meihua; Liu, Jia; Chan, Chang S.; Hu, Wenwei; Feng, Zhaohui

    2014-01-01

    Cancer cells display enhanced glycolysis to meet their energetic and biosynthetic demands even under normal oxygen concentrations. Recent studies have revealed that tumor suppressor p53 represses glycolysis under normoxia as a novel mechanism for tumor suppression. As the common microenvironmental stress for tumors, hypoxia drives the metabolic switch from the oxidative phosphorylation to glycolysis, which is crucial for survival and proliferation of cancer cells under hypoxia. The p53's role and mechanism in regulating glycolysis under hypoxia is poorly understood. Here, we found that p53 represses hypoxia-stimulated glycolysis in cancer cells through RRAD, a newly-identified p53 target. RRAD expression is frequently decreased in lung cancer. Ectopic expression of RRAD greatly reduces glycolysis whereas knockdown of RRAD promotes glycolysis in lung cancer cells. Furthermore, RRAD represses glycolysis mainly through inhibition of GLUT1 translocation to the plasma membrane. Under hypoxic conditions, p53 induces RRAD, which in turn inhibits the translocation of GLUT1 and represses glycolysis in lung cancer cells. Blocking RRAD by siRNA greatly abolishes p53's function in repressing glycolysis under hypoxia. Taken together, our results revealed an important role and mechanism of p53 in antagonizing the stimulating effect of hypoxia on glycolysis, which contributes to p53's function in tumor suppression. PMID:25114038

  6. Myc, Aurora Kinase-A, and mutant p53R172H co-operate in a mouse model of metastatic skin carcinoma

    PubMed Central

    Torchia, Enrique C.; Caulin, Carlos; Acin, Sergio; Terzian, Tamara; Kubick, Bradley J.; Box, Neil F.; Roop, Dennis R.

    2015-01-01

    Clinical observations, as well as data obtained from the analysis of genetically engineered mouse models, firmly established the gain-of-function (GOF) properties of certain p53 mutations. However, little is known about the underlying mechanisms. We have used two independent microarray platforms to perform a comprehensive and global analysis of tumors arising in a model of metastatic skin cancer progression, which compares the consequences of a GOF p53R172H mutant vs. p53 deficiency. DNA profiling revealed a higher level of genomic instability in GOF vs. loss-of-function (LOF) p53 squamous cell carcinomas (SCCs). Moreover, GOF p53 SCCs showed preferential amplification of Myc with a corresponding increase in its expression and deregulation of Aurora Kinase-A. Fluorescent in situ hybridization confirmed amplification of Myc in primary GOF p53 SCCs and its retention in metastatic tumors. We also identified by RNA profiling distinct gene expression profiles in GOF p53 tumors, which included enriched integrin and Rho signaling, independent of tumor stage. Thus, the progression of GOF p53 papillomas to carcinoma was marked by the acquisition of epithelial to mesenchymal transition and metastatic signatures. In contrast, LOF p53 tumors showed enrichment of genes associated with cancer proliferation and chromosomal instability. Collectively, these observations suggest that genomic instability plays a prominent role in the early stages of GOF p53 tumor progression (i.e., papillomas), while it is implicated at a later stage in LOF p53 tumors (i.e., SCCs). This model will allow us to identify specific targets in mutant p53 SCCs, which may lead to the development of new therapeutic agents for the treatment of metastatic SCCs. PMID:21963848

  7. p53 Mediates Vast Gene Expression Changes That Contribute to Poor Chemotherapeutic Response in a Mouse Model of Breast Cancer.

    PubMed

    Tonnessen-Murray, Crystal; Ungerleider, Nathan A; Rao, Sonia G; Wasylishen, Amanda R; Frey, Wesley D; Jackson, James G

    2018-05-28

    p53 is a transcription factor that regulates expression of genes involved in cell cycle arrest, senescence, and apoptosis. TP53 harbors mutations that inactivate its transcriptional activity in roughly 30% of breast cancers, and these tumors are much more likely to undergo a pathological complete response to chemotherapy. Thus, the gene expression program activated by wild-type p53 contributes to a poor response. We used an in vivo genetic model system to comprehensively define the p53- and p21-dependent genes and pathways modulated in tumors following doxorubicin treatment. We identified genes differentially expressed in spontaneous mammary tumors harvested from treated MMTV-Wnt1 mice that respond poorly (Trp53+/+) or favorably (Trp53-null) and those that lack the critical senescence/arrest p53 target gene Cdkn1a. Trp53 wild-type tumors differentially expressed nearly 10-fold more genes than Trp53-null tumors after treatment. Pathway analyses showed that genes involved in cell cycle, senescence, and inflammation were enriched in treated Trp53 wild-type tumors; however, no genes/pathways were identified that adequately explain the superior cell death/tumor regression observed in Trp53-null tumors. Cdkn1a-null tumors that retained arrest capacity (responded poorly) and those that proliferated (responded well) after treatment had remarkably different gene regulation. For instance, Cdkn1a-null tumors that arrested upregulated Cdkn2a (p16), suggesting an alternative, p21-independent route to arrest. Live animal imaging of longitudinal gene expression of a senescence/inflammation gene reporter in Trp53+/+ tumors showed induction during and after chemotherapy treatment, while tumors were arrested, but expression rapidly diminished immediately upon relapse. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

  8. Resveratrol and Pterostilbene Exhibit Anticancer Properties Involving the Downregulation of HPV Oncoprotein E6 in Cervical Cancer Cells.

    PubMed

    Chatterjee, Kaushiki; AlSharif, Dina; Mazza, Christina; Syar, Palwasha; Al Sharif, Mohamed; Fata, Jimmie E

    2018-02-21

    Cervical cancer is one of the most common cancers in women living in developing countries. Due to a lack of affordable effective therapy, research into alternative anticancer compounds with low toxicity such as dietary polyphenols has continued. Our aim is to determine whether two structurally similar plant polyphenols, resveratrol and pterostilbene, exhibit anticancer and anti-HPV (Human papillomavirus) activity against cervical cancer cells. To determine anticancer activity, extensive in vitro analyses were performed. Anti-HPV activity, through measuring E6 protein levels, subsequent downstream p53 effects, and caspase-3 activation, were studied to understand a possible mechanism of action. Both polyphenols are effective agents in targeting cervical cancer cells, having low IC50 values in the µM range. They decrease clonogenic survival, reduce cell migration, arrest cells at the S-phase, and reduce the number of mitotic cells. These findings were significant, with pterostilbene often being more effective than resveratrol. Resveratrol and to a greater extent pterostilbene downregulates the HPV oncoprotein E6, induces caspase-3 activation, and upregulates p53 protein levels. Results point to a mechanism that may involve the downregulation of the HPV E6 oncoprotein, activation of apoptotic pathways, and re-establishment of functional p53 protein, with pterostilbene showing greater efficacy than resveratrol.

  9. Functional repair of p53 mutation in colorectal cancer cells using trans-splicing.

    PubMed

    He, Xingxing; Liao, Jiazhi; Liu, Fang; Yan, Junwei; Yan, Jingjun; Shang, Haitao; Dou, Qian; Chang, Ying; Lin, Jusheng; Song, Yuhu

    2015-02-10

    Mutation in the p53 gene is arguably the most frequent type of gene-specific alterations in human cancers. Current p53-based gene therapy contains the administration of wt-p53 or the suppression of mutant p53 expression in p53-defective cancer cells. . We hypothesized that trans-splicing could be exploited as a tool for the correction of mutant p53 transcripts in p53-mutated human colorectal cancer (CRC) cells. In this study, the plasmids encoding p53 pre-trans-splicing molecules (PTM) were transfected into human CRC cells carrying p53 mutation. The plasmids carrying p53-PTM repaired mutant p53 transcripts in p53-mutated CRC cells, which resulted in a reduction in mutant p53 transcripts and an induction of wt-p53 simultaneously. Intratumoral administration of adenovirus vectors carrying p53 trans-splicing cassettes suppressed the growth of tumor xenografts. Repair of mutant p53 transcripts by trans-splicing induced cell-cycle arrest and apoptosis in p53-defective colorectal cancer cells in vitro and in vivo. In conclusion, the present study demonstrated for the first time that trans-splicing was exploited as a strategy for the repair of mutant p53 transcripts, which revealed that trans-splicing would be developed as a new therapeutic approach for human colorectal cancers carrying p53 mutation.

  10. Battle against cancer: an everlasting saga of p53.

    PubMed

    Hao, Qian; Cho, William C

    2014-12-01

    Cancer is one of the most life-threatening diseases characterized by uncontrolled growth and spread of malignant cells. The tumor suppressor p53 is the master regulator of tumor cell growth and proliferation. In response to various stress signals, p53 can be activated and transcriptionally induces a myriad of target genes, including both protein-encoding and non-coding genes, controlling cell cycle progression, DNA repair, senescence, apoptosis, autophagy and metabolism of tumor cells. However, around 50% of human cancers harbor mutant p53 and, in the majority of the remaining cancers, p53 is inactivated through multiple mechanisms. Herein, we review the recent progress in understanding the molecular basis of p53 signaling, particularly the newly identified ribosomal stress-p53 pathway, and the development of chemotherapeutics via activating wild-type p53 or restoring mutant p53 functions in cancer. A full understanding of p53 regulation will aid the development of effective cancer treatments.

  11. A Nanoparticle Carrying the p53 Gene Targets Tumors Including Cancer Stem Cells, Sensitizes Glioblastoma to Chemotherapy and Improves Survival

    PubMed Central

    2015-01-01

    Temozolomide (TMZ)-resistance in glioblastoma multiforme (GBM) has been linked to upregulation of O6-methylguanine-DNA methyltransferase (MGMT). Wild-type (wt) p53 was previously shown to down-modulate MGMT. However, p53 therapy for GBM is limited by lack of efficient delivery across the blood brain barrier (BBB). We have developed a systemic nanodelivery platform (scL) for tumor-specific targeting (primary and metastatic), which is currently in multiple clinical trials. This self-assembling nanocomplex is formed by simple mixing of the components in a defined order and a specific ratio. Here, we demonstrate that scL crosses the BBB and efficiently targets GBM, as well as cancer stem cells (CSCs), which have been implicated in recurrence and treatment resistance in many human cancers. Moreover, systemic delivery of scL-p53 down-modulates MGMT and induces apoptosis in intracranial GBM xenografts. The combination of scL-p53 and TMZ increased the antitumor efficacy of TMZ with enhanced survival benefit in a mouse model of highly TMZ-resistant GBM. scL-p53 also sensitized both CSCs and bulk tumor cells to TMZ, increasing apoptosis. These results suggest that combining scL-p53 with standard TMZ treatment could be a more effective therapy for GBM. PMID:24811110

  12. Basal p53 expression is indispensable for mesenchymal stem cell integrity.

    PubMed

    Boregowda, Siddaraju V; Krishnappa, Veena; Strivelli, Jacqueline; Haga, Christopher L; Booker, Cori N; Phinney, Donald G

    2018-03-01

    Marrow-resident mesenchymal stem cells (MSCs) serve as a functional component of the perivascular niche that regulates hematopoiesis. They also represent the main source of bone formed in adult bone marrow, and their bifurcation to osteoblast and adipocyte lineages plays a key role in skeletal homeostasis and aging. Although the tumor suppressor p53 also functions in bone organogenesis, homeostasis, and neoplasia, its role in MSCs remains poorly described. Herein, we examined the normal physiological role of p53 in primary MSCs cultured under physiologic oxygen levels. Using knockout mice and gene silencing we show that p53 inactivation downregulates expression of TWIST2, which normally restrains cellular differentiation to maintain wild-type MSCs in a multipotent state, depletes mitochondrial reactive oxygen species (ROS) levels, and suppresses ROS generation and PPARG gene and protein induction in response to adipogenic stimuli. Mechanistically, this loss of adipogenic potential skews MSCs toward an osteogenic fate, which is further potentiated by TWIST2 downregulation, resulting in highly augmented osteogenic differentiation. We also show that p53 - /- MSCs are defective in supporting hematopoiesis as measured in standard colony assays because of decreased secretion of various cytokines including CXCL12 and CSF1. Lastly, we show that transient exposure of wild-type MSCs to 21% oxygen upregulates p53 protein expression, resulting in increased mitochondrial ROS production and enhanced adipogenic differentiation at the expense of osteogenesis, and that treatment of cells with FGF2 mitigates these effects by inducing TWIST2. Together, these findings indicate that basal p53 levels are necessary to maintain MSC bi-potency, and oxygen-induced increases in p53 expression modulate cell fate and survival decisions. Because of the critical function of basal p53 in MSCs, our findings question the use of p53 null cell lines as MSC surrogates, and also implicate dysfunctional MSC responses in the pathophysiology of p53-related skeletal disorders.

  13. The impact of p53 on the early stage replication of retrovirus.

    PubMed

    Kinnetz, Michaela; Alghamdi, Faris; Racz, Michael; Hu, Wenwei; Shi, Binshan

    2017-08-09

    The function of p53 in cancer biology has been studied extensively, but its role in anti-retrovirus infection has been elusive for many years. The restriction of retrovirus early stage replication by p53 was investigated in this study. VSV-G pseudotyped retrovirus with GFP reporter gene was used to infect both HCT116 p53 +/+ cells and its isogenic p53 knockout HCT116 p53 -/- cells. The infection was detected by flow cytometry. Reverse transcription products were quantified by real time PCR. Mutation analysis was performed after 1-LTR cycle and 2-LTR cycle DNA were amplified and PCR products were sequenced. Transcription and translation of cyclin-dependent kinase inhibitor 1 (p21 Cip1 ) and SAM domain and HD domain-containing protein 1 (SAMHD1) were analyzed by TaqMan PCR and Western blot experiments. siRNA experiment was applied to study the role of p53 downstream gene p21 Cip1 in the restriction of retrovirus infection. It was found that the block of retrovirus infection in non-cycling cells was significantly attenuated in HCT116 p53 -/- cells when compared to HCT116 p53 +/+ cells. It was found that both late reverse transcription products and viral 2-LTR cycle DNA were significantly increased in infected non-cycling HCT116 p53 -/- cells. Furthermore, the mutation frequency detected in 1-LTR DNA from HCT116 p53 +/+ cells were significantly decreased in comparison to HCT116 p53 -/- cells. A higher number of insertion and deletion mutations were detected in the joint region of 2-LTR cycle DNA in infected p53 +/+ cells. Cell cycle analysis showed retrovirus infection promoted host cell replication. Higher levels of mRNA and protein of p21 Cip1 were found in HCT116 p53 +/+ cells in comparison to the HCT116 p53 -/- cells. Furthermore, knockdown of p21 Cip1 in non-cycling HCT116 p53 +/+ cells significantly increased the infection. The results of this study showed that p53 is an important restriction factor that interferes with retrovirus infection in its early stage of replication. Our results suggested that p53 mediates the inhibition of retrovirus infection in non-cycling cells through it downstream gene p21 Cip1 , and p53 also functions to influence formation of 1-LTR cycle and 2-LTR cycle DNA.

  14. Mitomycin C and decarbamoyl mitomycin C induce p53-independent p21WAF1/CIP1 activation

    PubMed Central

    Cheng, Shu-Yuan; Seo, Jiwon; Huang, Bik Tzu; Napolitano, Tanya; Champeil, Elise

    2016-01-01

    Mitomycin C (MC), a commonly used anticancer drug, induces DNA damage via DNA alkylation. Decarbamoyl mitomycin C (DMC), another mitomycin lacking the carbamate at C10, generates similar lesions as MC. Interstrand cross-links (ICLs) are believed to be the lesions primarily responsible for the cytotoxicity of MC and DMC. The major ICL generated by MC (α-ICL) has a trans stereochemistry at the guanine-drug linkage whereas the major ICL from DMC (β-ICL) has the opposite, cis, stereochemistry. In addition, DMC can provoke strong p53-independent cell death. Our hypothesis is that the stereochemistry of the major unique β-ICL generated by DMC is responsible for this p53-independent cell death signaling. p53 gene is inactively mutated in more than half of human cancers. p21WAF1/CIP1 known as a major effector of p53 is involved in p53-dependent and -independent control of cell proliferation and death. This study revealed the role of p21WAF1/CIP1 on MC and DMC triggered cell damage. MCF-7 (p53-proficient) and K562 (p53-deficient) cells were used. Cell cycle distributions were shifted to the G1/S phase in MCF-7 treated with MC and DMC, but were shifted to the S phase in K562. p21WAF1/CIP1 activation was observed in both cells treated with MC and DMC, and DMC triggered more significant activation. Knocking down p53 in MCF-7 did not attenuate MC and DMC induced p21WAF1/CIP1 activation. The α-ICL itself was enough to cause p21WAF1/CIP1 activation. PMID:27666201

  15. DNA-binding protects p53 from interactions with cofactors involved in transcription-independent functions.

    PubMed

    Lambrughi, Matteo; De Gioia, Luca; Gervasio, Francesco Luigi; Lindorff-Larsen, Kresten; Nussinov, Ruth; Urani, Chiara; Bruschi, Maurizio; Papaleo, Elena

    2016-11-02

    Binding-induced conformational changes of a protein at regions distant from the binding site may play crucial roles in protein function and regulation. The p53 tumour suppressor is an example of such an allosterically regulated protein. Little is known, however, about how DNA binding can affect distal sites for transcription factors. Furthermore, the molecular details of how a local perturbation is transmitted through a protein structure are generally elusive and occur on timescales hard to explore by simulations. Thus, we employed state-of-the-art enhanced sampling atomistic simulations to unveil DNA-induced effects on p53 structure and dynamics that modulate the recruitment of cofactors and the impact of phosphorylation at Ser215. We show that DNA interaction promotes a conformational change in a region 3 nm away from the DNA binding site. Specifically, binding to DNA increases the population of an occluded minor state at this distal site by more than 4-fold, whereas phosphorylation traps the protein in its major state. In the minor conformation, the interface of p53 that binds biological partners related to p53 transcription-independent functions is not accessible. Significantly, our study reveals a mechanism of DNA-mediated protection of p53 from interactions with partners involved in the p53 transcription-independent signalling. This also suggests that conformational dynamics is tightly related to p53 signalling. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  16. P53 Suppression of Homologous Recombination and Tumorigenesis

    DTIC Science & Technology

    2013-01-01

    absence or mutation of p53 and the mechanism of p53 control of HR in an in vivo system. p53 is often a targeted therapy and further insight into the...function of p53 in DNA repair pathways can be vital to finding novel points of targeted therapy . Our data will add insight to the important paradigm...cancers. Cisplatin works by the aquation of a chloride ligand that results in the formation of a DNA adduct, usually crosslinking the DNA, which impedes

  17. Transcriptional analysis of immune-related gene expression in p53-deficient mice with increased susceptibility to influenza A virus infection.

    PubMed

    Yan, Wenjun; Wei, Jianchao; Deng, Xufang; Shi, Zixue; Zhu, Zixiang; Shao, Donghua; Li, Beibei; Wang, Shaohui; Tong, Guangzhi; Ma, Zhiyong

    2015-08-18

    p53 is a tumor suppressor that contributes to the host immune response against viral infections in addition to its well-established protective role against cancer development. In response to influenza A virus (IAV) infection, p53 is activated and plays an essential role in inhibiting IAV replication. As a transcription factor, p53 regulates the expression of a range of downstream responsive genes either directly or indirectly in response to viral infection. We compared the expression profiles of immune-related genes between IAV-infected wild-type p53 (p53WT) and p53-deficient (p53KO) mice to gain an insight into the basis of p53-mediated antiviral response. p53KO and p53WT mice were infected with influenza A/Puerto Rico/8/1934 (PR8) strain. Clinical symptoms and body weight changes were monitored daily. Lung specimens of IAV-infected mice were collected for analysis of virus titers and gene expression profiles. The difference in immune-related gene expression levels between IAV-infected p53KO and p53WT mice was comparatively determined using microarray analysis and confirmed by quantitative real-time reverse transcription polymerase chain reaction. p53KO mice showed an increased susceptibility to IAV infection compared to p53WT mice. Microarray analysis of gene expression profiles in the lungs of IAV-infected mice indicated that the increased susceptibility was associated with significantly changed expression levels in a range of immune-related genes in IAV-infected p53KO mice. A significantly attenuated expression of Ifng (encoding interferon (IFN)-gamma), Irf7 (encoding IFN regulator factor 7), and antiviral genes, such as Mx2 and Eif2ak2 (encoding PKR), were observed in IAV-infected p53KO mice, suggesting an impaired IFN-mediated immune response against IAV infection in the absence of p53. In addition, dysregulated expression levels of proinflammatory cytokines and chemokines, such as Ccl2 (encoding MCP-1), Cxcl9, Cxcl10 (encoding IP-10), and Tnf, were detected in IAV-infected p53KO mice during early IAV infection, reflecting an aberrant inflammatory response. Lack of p53 resulted in the impaired expression of genes involved in IFN signaling and the dysregulated expression of cytokine and chemokine genes in IAV-infected mice, suggesting an essential role of p53 in the regulation of antiviral and inflammatory responses during IAV infection.

  18. The p53-Reactivating Small Molecule RITA Induces Senescence in Head and Neck Cancer Cells

    PubMed Central

    Chuang, Hui-Ching; Yang, Liang Peng; Fitzgerald, Alison L.; Osman, Abdullah; Woo, Sang Hyeok; Myers, Jeffrey N.; Skinner, Heath D.

    2014-01-01

    TP53 is the most commonly mutated gene in head and neck cancer (HNSCC), with mutations being associated with resistance to conventional therapy. Restoring normal p53 function has previously been investigated via the use of RITA (reactivation of p53 and induction of tumor cell apoptosis), a small molecule that induces a conformational change in p53, leading to activation of its downstream targets. In the current study we found that RITA indeed exerts significant effects in HNSCC cells. However, in this model, we found that a significant outcome of RITA treatment was accelerated senescence. RITA-induced senescence in a variety of p53 backgrounds, including p53 null cells. Also, inhibition of p53 expression did not appear to significantly inhibit RITA-induced senescence. Thus, this phenomenon appears to be partially p53-independent. Additionally, RITA-induced senescence appears to be partially mediated by activation of the DNA damage response and SIRT1 (Silent information regulator T1) inhibition, with a synergistic effect seen by combining either ionizing radiation or SIRT1 inhibition with RITA treatment. These data point toward a novel mechanism of RITA function as well as hint to its possible therapeutic benefit in HNSCC. PMID:25119136

  19. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents

    PubMed Central

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-01-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy. PMID:22801474

  20. N-methylpurine DNA glycosylase inhibits p53-mediated cell cycle arrest and coordinates with p53 to determine sensitivity to alkylating agents.

    PubMed

    Song, Shanshan; Xing, Guichun; Yuan, Lin; Wang, Jian; Wang, Shan; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang

    2012-08-01

    Alkylating agents induce genome-wide base damage, which is repaired mainly by N-methylpurine DNA glycosylase (MPG). An elevated expression of MPG in certain types of tumor cells confers higher sensitivity to alkylation agents because MPG-induced apurinic/apyrimidic (AP) sites trigger more strand breaks. However, the determinant of drug sensitivity or insensitivity still remains unclear. Here, we report that the p53 status coordinates with MPG to play a pivotal role in such process. MPG expression is positive in breast, lung and colon cancers (38.7%, 43.4% and 25.3%, respectively) but negative in all adjacent normal tissues. MPG directly binds to the tumor suppressor p53 and represses p53 activity in unstressed cells. The overexpression of MPG reduced, whereas depletion of MPG increased, the expression levels of pro-arrest gene downstream of p53 including p21, 14-3-3σ and Gadd45 but not proapoptotic ones. The N-terminal region of MPG was specifically required for the interaction with the DNA binding domain of p53. Upon DNA alkylation stress, in p53 wild-type tumor cells, p53 dissociated from MPG and induced cell growth arrest. Then, AP sites were repaired efficiently, which led to insensitivity to alkylating agents. By contrast, in p53-mutated cells, the AP sites were repaired with low efficacy. To our knowledge, this is the first direct evidence to show that a DNA repair enzyme functions as a selective regulator of p53, and these findings provide new insights into the functional linkage between MPG and p53 in cancer therapy.

  1. MiR-142-3p is downregulated in aggressive p53 mutant mouse models of pancreatic ductal adenocarcinoma by hypermethylation of its locus.

    PubMed

    Godfrey, Jack D; Morton, Jennifer P; Wilczynska, Ania; Sansom, Owen J; Bushell, Martin D

    2018-05-29

    Pancreatic ductal adenocarcinoma (PDAC) is an extremely aggressive disease with poor prognostic implications. This is partly due to a large proportion of PDACs carrying mutations in TP53, which impart gain-of-function characteristics that promote metastasis. There is evidence that microRNAs (miRNAs) may play a role in both gain-of-function TP53 mutations and metastasis, but this has not been fully explored in PDAC. Here we set out to identify miRNAs which are specifically dysregulated in metastatic PDAC. To achieve this, we utilised established mouse models of PDAC to profile miRNA expression in primary tumours expressing the metastasis-inducing mutant p53 R172H and compared these to two control models carrying mutations, which promote tumour progression but do not induce metastasis. We show that a subset of miRNAs are dysregulated in mouse PDAC tumour tissues expressing mutant p53 R172H , primary cell lines derived from mice with the same mutations and in TP53 null cells with ectopic expression of the orthologous human mutation, p53 R175H . Specifically, miR-142-3p is downregulated in all of these experimental models. We found that DNA methyltransferase 1 (Dnmt1) is upregulated in tumour tissue and cell lines, which express p53 R172H . Inhibition or depletion of Dnmt1 restores miR-142-3p expression. Overexpression of miR-142-3p attenuates the invasive capacity of p53 R172H -expressing tumour cells. MiR-142-3p dysregulation is known to be associated with cancer progression, metastasis and the miRNA is downregulated in patients with PDAC. Here we link TP53 gain-of-function mutations to Dnmt1 expression and in turn miR-142-3p expression. Additionally, we show a correlation between expression of these genes and patient survival, suggesting that they may have potential to be therapeutic targets.

  2. Adenovirus Type 5 Early Region 1B 55K Oncoprotein-Dependent Degradation of Cellular Factor Daxx Is Required for Efficient Transformation of Primary Rodent Cells▿

    PubMed Central

    Schreiner, Sabrina; Wimmer, Peter; Groitl, Peter; Chen, Shuen-Yuan; Blanchette, Paola; Branton, Philip E.; Dobner, Thomas

    2011-01-01

    Early region 1B 55K (E1B-55K) from adenovirus type 5 (Ad5) is a multifunctional regulator of lytic infection and contributes in vitro to complete cell transformation of primary rodent cells in combination with Ad5 E1A. Inhibition of p53 activated transcription plays a key role in processes by which E1B-55K executes its oncogenic potential. Nevertheless, additional functions of E1B-55K or further protein interactions with cellular factors of DNA repair, transcription, and apoptosis, including Mre11, PML, and Daxx, may also contribute to the transformation process. In line with previous results, we performed mutational analysis to define a Daxx interaction motif within the E1B-55K polypeptide. The results from these studies showed that E1B-55K/Daxx binding is not required for inhibition of p53-mediated transactivation or binding and degradation of cellular factors (p53/Mre11). Surprisingly, these mutants lost the ability to degrade Daxx and showed reduced transforming potential in primary rodent cells. In addition, we observed that E1B-55K lacking the SUMO-1 conjugation site (SCS/K104R) was sufficient for Daxx interaction but no longer capable of E1B-55K-dependent proteasomal degradation of the cellular factor Daxx. These results, together with the observation that E1B-55K SUMOylation is required for efficient transformation, provides evidence for the idea that SUMO-1-conjugated E1B-55K-mediated degradation of Daxx plays a key role in adenoviral oncogenic transformation. We assume that the viral protein contributes to cell transformation through the modulation of Daxx-dependent pathways. This further substantiates the assumption that further mechanisms for efficient transformation of primary cells can be separated from functions required for the inhibition of p53-stimulated transcription. PMID:21697482

  3. Healthy control subjects are poorly defined in case-control studies of irritable bowel syndrome

    PubMed Central

    Ghorbani, Shireen; Nejad, Amir; Law, David; Chua, Kathleen S.; Amichai, Meridythe M.; Pimentel, Mark

    2015-01-01

    Background Case-control studies are vital for understanding the pathophysiology of gastrointestinal disease. While the definition of disease is clear, the definition of healthy control is not. This is particularly relevant for functional bowel diseases such as irritable bowel syndrome (IBS). In this study, a systematic review formed the basis for a prospective study evaluating the effectiveness of commonly used techniques for defining healthy controls in IBS. Methods A systematic review of the literature was conducted to identify case-control studies involving functional gastrointestinal disorders. “Lack of Rome criteria”, self-description as “healthy” and the bowel disease questionnaire (BDQ) were common methods for identifying healthy controls. These 3 methods were then applied to a cohort of 53 non-patient subjects to determine their validity compared to objective outcome measures (7-day stool diary). Results “Lack of Rome criteria” and “healthy” self-description were the most common methods for identifying healthy control subjects, but many studies failed to describe the methods used. In the prospective study, more subjects were identified as non-healthy using the BDQ than using either lack of Rome criteria (P=0.01) or “healthy” self-description (P=0.026). Furthermore, stool diaries identified several subjects with abnormal stool form and/or frequency which were not identified using lack of Rome criteria or the “healthy” question. Comparisons revealed no agreement (κ) between the different methods for defining healthy controls. Conclusions The definitions of healthy controls in studies of functional bowel diseases such as IBS are inconsistent. Since functional symptoms are common, a strict definition of “normal” is needed in this area of research. PMID:25609236

  4. The expanding regulatory universe of p53 in gastrointestinal cancer.

    PubMed

    Fesler, Andrew; Zhang, Ning; Ju, Jingfang

    2016-01-01

    Tumor suppresser gene TP53 is one of the most frequently deleted or mutated genes in gastrointestinal cancers. As a transcription factor, p53 regulates a number of important protein coding genes to control cell cycle, cell death, DNA damage/repair, stemness, differentiation and other key cellular functions. In addition, p53 is also able to activate the expression of a number of small non-coding microRNAs (miRNAs) through direct binding to the promoter region of these miRNAs.  Many miRNAs have been identified to be potential tumor suppressors by regulating key effecter target mRNAs. Our understanding of the regulatory network of p53 has recently expanded to include long non-coding RNAs (lncRNAs). Like miRNA, lncRNAs have been found to play important roles in cancer biology.  With our increased understanding of the important functions of these non-coding RNAs and their relationship with p53, we are gaining exciting new insights into the biology and function of cells in response to various growth environment changes. In this review we summarize the current understanding of the ever expanding involvement of non-coding RNAs in the p53 regulatory network and its implications for our understanding of gastrointestinal cancer.

  5. Pifithrin-α provides neuroprotective effects at the level of mitochondria independently of p53 inhibition.

    PubMed

    Neitemeier, Sandra; Ganjam, Goutham K; Diemert, Sebastian; Culmsee, Carsten

    2014-12-01

    Impaired mitochondrial integrity and function are key features of intrinsic death pathways in neuronal cells. Therefore, key regulators of intrinsic death pathways acting upstream of mitochondria are potential targets for therapeutic approaches of neuroprotection. The tumor suppressor p53 is a well-established regulator of cellular responses towards different kinds of lethal stress, including oxidative stress. Recent reports suggested that p53 may affect mitochondrial integrity and function through both, transcriptional activation of mitochondria-targeted pro-death proteins and direct effects at the mitochondrial membrane. In the present study, we compared the effects of pharmacological inhibition of p53 by pifithrin-α with those of selective p53 gene silencing by RNA interference. Using MTT assay and real-time cell impedance measurements we confirmed the protective effect of both strategies against glutamate-induced oxidative stress in immortalized mouse hippocampal HT-22 neurons. Further, we observed full restoration of mitochondrial membrane potential and inhibition of glutamate-induced mitochondrial fragmentation by pifithrin-α which was, in contrast, not achieved by p53 gene silencing. Downregulation of p53 by siRNA decreased p53 transcriptional activity and reduced expression levels of p21 mRNA, while pifithrin-α did not affect these endpoints. These results suggest a neuroprotective effect of pifithrin-α which occurred at the level of mitochondria and independently of p53 inhibition.

  6. Immunohistochemical co-expression status of cytokeratin 5/6, androgen receptor, and p53 as prognostic factors of adjuvant chemotherapy for triple negative breast cancer.

    PubMed

    Maeda, Tetsuyo; Nakanishi, Yoko; Hirotani, Yukari; Fuchinoue, Fumi; Enomoto, Katsuhisa; Sakurai, Kenichi; Amano, Sadao; Nemoto, Norimichi

    2016-03-01

    Triple negative breast cancer (TNBC) is immunohistochemically characterised by the lack of expression of the estrogen receptor (ER), progesterone receptor (PR), and human epidermal growth factor receptor type 2 (HER2). TNBC is known for its poor prognosis and high recurrence probability. There is no effective targeted treatment for TNBC, but only adjuvant chemotherapies. There are two TNBC subtypes, basal-like and non-basal-like, which are defined based on positive cytokeratin (CK) 5/6 and/or epidermal growth factor receptor (EGFR) expression. In particular, CK5/6 expression is reported to correlate with TNBC recurrence. TNBC lacks ER-α expression, but some TNBCs are known to express the androgen receptor (AR). Moreover, although p53 accumulation is detected in various malignant tumors, its influence on adjuvant chemotherapy for patients with TNBC remains unclear. The aim of this study was to assess the combined immunohistochemical expression of CK 5/6, AR, and p53 as a potential prognostic marker of adjuvant chemotherapy for patients with TNBC. The expression of CK5/6, AR, and p53 in formalin-fixed and paraffin-embedded (FFPE) surgical sections from 52 patients with TNBC was analysed by immunohistochemistry (IHC) and the co-expression patterns in individual cells were investigated by immunofluorescent (IF) staining. Low AR expression was correlated with high clinical stage (P < 0.05) and low nuclear grade (P < 0.05). The expression of CK5/6 and p53 did not correlate with clinicopathological features. Patients who needed adjuvant chemotherapy presented the worst prognosis. In particular, when the IHC expression pattern was CK5/6 (-), AR (-), and p53 (+), the disease free survival (DFS) and overall survival (OS) were the worst. On the other hand, patients with AR (+) and p53 (-) TNBC presented a good prognosis. The analysis of the co-expression status of these three markers showed that no cells presented both AR and CK5/6 expression. Furthermore, TP53 mRNA expression was higher in patients with AR-negative TNBC (P < 0.05) and in patients with the worst prognosis (P < 0.05) than in the other patients. These results suggested that, in patients with CK5/6-negative TNBC, AR expression correlated with good prognosis, but p53 accumulation correlated with poor prognosis. The present IHC markers allowed us to predict the post-surgery prognosis of patients with TNBC. In conclusion, TNBCs are heterogeneous. Patients with the CK5/6 (-), AR (-), and p53 (+) TNBC subtype, evaluated by IHC, presented the worst prognosis. These IHC markers will be helpful to follow patients with TNBC.

  7. Prosurvival long noncoding RNA PINCR regulates a subset of p53 targets in human colorectal cancer cells by binding to Matrin 3

    PubMed Central

    Chaudhary, Ritu; Gryder, Berkley; Woods, Wendy S; Subramanian, Murugan; Jones, Matthew F; Li, Xiao Ling; Jenkins, Lisa M; Shabalina, Svetlana A; Mo, Min; Dasso, Mary; Yang, Yuan; Wakefield, Lalage M; Zhu, Yuelin; Frier, Susan M; Moriarity, Branden S; Prasanth, Kannanganattu V; Perez-Pinera, Pablo; Lal, Ashish

    2017-01-01

    Thousands of long noncoding RNAs (lncRNAs) have been discovered, yet the function of the vast majority remains unclear. Here, we show that a p53-regulated lncRNA which we named PINCR (p53-induced noncoding RNA), is induced ~100-fold after DNA damage and exerts a prosurvival function in human colorectal cancer cells (CRC) in vitro and tumor growth in vivo. Targeted deletion of PINCR in CRC cells significantly impaired G1 arrest and induced hypersensitivity to chemotherapeutic drugs. PINCR regulates the induction of a subset of p53 targets involved in G1 arrest and apoptosis, including BTG2, RRM2B and GPX1. Using a novel RNA pulldown approach that utilized endogenous S1-tagged PINCR, we show that PINCR associates with the enhancer region of these genes by binding to RNA-binding protein Matrin 3 that, in turn, associates with p53. Our findings uncover a critical prosurvival function of a p53/PINCR/Matrin 3 axis in response to DNA damage in CRC cells. DOI: http://dx.doi.org/10.7554/eLife.23244.001 PMID:28580901

  8. Changes in O-Linked N-Acetylglucosamine (O-GlcNAc) Homeostasis Activate the p53 Pathway in Ovarian Cancer Cells*

    PubMed Central

    de Queiroz, Rafaela Muniz; Madan, Rashna; Chien, Jeremy; Dias, Wagner Barbosa; Slawson, Chad

    2016-01-01

    O-GlcNAcylation is a dynamic post-translational modification consisting of the addition of a single N-acetylglucosamine sugar to serine and threonine residues in proteins by the enzyme O-linked β-N-acetylglucosamine transferase (OGT), whereas the enzyme O-GlcNAcase (OGA) removes the modification. In cancer, tumor samples present with altered O-GlcNAcylation; however, changes in O-GlcNAcylation are not consistent between tumor types. Interestingly, the tumor suppressor p53 is modified by O-GlcNAc, and most solid tumors contain mutations in p53 leading to the loss of p53 function. Because ovarian cancer has a high frequency of p53 mutation rates, we decided to investigate the relationship between O-GlcNAcylation and p53 function in ovarian cancer. We measured a significant decrease in O-GlcNAcylation of tumor tissue in an ovarian tumor microarray. Furthermore, O-GlcNAcylation was increased, and OGA protein and mRNA levels were decreased in ovarian tumor cell lines not expressing the protein p53. Treatment with the OGA inhibitor Thiamet-G (TMG), silencing of OGA, or overexpression of OGA and OGT led to p53 stabilization, increased nuclear localization, and increased protein and mRNA levels of p53 target genes. These data suggest that changes in O-GlcNAc homeostasis activate the p53 pathway. Combination treatment of the chemotherapeutic cisplatin with TMG decreased tumor cell growth and enhanced cell cycle arrest without impairing cytotoxicity. The effects of TMG on tumor cell growth were partially dependent on wild type p53 activation. In conclusion, changes in O-GlcNAc homeostasis activate the wild type p53 pathway in ovarian cancer cells, and OGA inhibition has the potential as an adjuvant treatment for ovarian carcinoma. PMID:27402830

  9. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    PubMed Central

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-01-01

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance. Images PMID:1631137

  10. Germ-line mutations of the p53 tumor suppressor gene in patients with high risk for cancer inactivate the p53 protein.

    PubMed

    Frebourg, T; Kassel, J; Lam, K T; Gryka, M A; Barbier, N; Andersen, T I; Børresen, A L; Friend, S H

    1992-07-15

    Germ-line mutations in the p53 tumor suppressor gene have been observed in patients with Li-Fraumeni syndrome, brain tumors, second malignancies, and breast cancers. It is unclear whether all of these mutations have inactivated p53 and thereby provide an increased risk for cancer. Therefore, it is necessary to establish the biological significance of these germ-line mutations by the functional and structural analysis of the resulting mutant p53 proteins. We analyzed the ability of seven germ-line mutant proteins observed in patients with Li-Fraumeni syndrome, second primary neoplasms, or familial breast cancer to block the growth of malignant cells and compared the structural properties of the mutant proteins to that of the wild-type protein. Six of seven missense mutations disrupted the growth inhibitory properties and structure of the wild-type protein. One germ-line mutation retained the features of the wild-type p53. Genetic analysis of the breast cancer family in which this mutation was observed indicated that this germ-line mutation was not associated with the development of cancer. These results demonstrate that germ-line p53 mutations observed in patients with Li-Fraumeni syndrome and with second malignancies have inactivated the p53 tumor suppressor gene. The inability of the germ-line p53 mutants to block the growth of malignant cells can explain why patients with these germ-line mutations have an increased risk for cancer. The observation of a functionally silent germ-line mutation indicates that, before associating a germ-line tumor suppressor gene mutation with cancer risk, it is prudent to consider its functional significance.

  11. Wild-type p53 reactivation by small-molecule Minnelide™ in human papillomavirus (HPV)-positive head and neck squamous cell carcinoma.

    PubMed

    Caicedo-Granados, Emiro; Lin, Rui; Fujisawa, Caitlin; Yueh, Bevan; Sangwan, Veena; Saluja, Ashok

    2014-12-01

    The incidence of high-risk human papillomavirus (HR-HPV) head and neck squamous cell carcinoma (HNSCC) continues to increase, particularly oropharyngeal squamous cell carcinoma (OPSCC) cases. The inactivation of the p53 tumor suppressor gene promotes a chain of molecular events, including cell cycle progression and apoptosis resistance. Reactivation of wild-type p53 function is an intriguing therapeutic strategy. The aim of this study was to investigate whether a novel compound derived from diterpene triepoxide (Minnelide™) can reactivate wild-type p53 function in HPV-positive HNSCC. For all of our in vitro experiments, we used 2 HPV-positive HNSCC cell lines, University of Michigan squamous cell carcinoma (UM-SCC) 47 and 93-VU-147, and 2 HPV-positive human cervical cancer cell lines, SiHa and CaSki. Cells were treated with different concentrations of triptolide and analyzed for p53 activation. Mice bearing UM-SCC 47 subcutaneous xenografts and HPV-positive patient-derived tumor xenografts were treated with Minnelide and evaluated for tumor growth and p53 activation. In HPV-positive HNSCC, Minnelide reactivated p53 by suppressing E6 oncoprotein. Activation of apoptosis followed, both in vitro and in vivo. In 2 preclinical HNSCC animal models (a subcutaneous xenograft model and a patient-derived tumor xenograft model), Minnelide reactivated p53 function and significantly decreased tumor progression and tumor volume. Triptolide and Minnelide caused cell death in vitro and in vivo in HPV-positive HNSCC by reactivating wild-type p53 and thus inducing apoptosis. In addition, in 2 HPV-positive HNSCC animal models, Minnelide decreased tumor progression and induced apoptosis. Copyright © 2014 Elsevier Ltd. All rights reserved.

  12. Apoptotic actions of p53 require transcriptional activation of PUMA and do not involve a direct mitochondrial/cytoplasmic site of action in postnatal cortical neurons.

    PubMed

    Uo, Takuma; Kinoshita, Yoshito; Morrison, Richard S

    2007-11-07

    Recent studies in non-neuronal cells have shown that the tumor suppressor p53 can promote cell death through a transcription-independent mechanism involving its direct action with a subset of Bcl-2 family member proteins in the cytosol and at the mitochondria. In cultured cortical neurons, however, we could not find evidence supporting a significant contribution of the cytosolic/mitochondrial p53 pathway, and available evidence instead corroborated the requirement for the transcriptional activity of p53. When directly targeted to the cytosol/mitochondria, wild-type p53 lost its apoptosis-inducing activity in neurons but not in non-neuronal cells. The N-terminal p53 fragment (transactivation and proline-rich domains), which induces apoptosis in non-neuronal cells via the cytosolic/mitochondrial pathway, displayed no apoptogenic activity in neurons. In neuronal apoptosis induced by camptothecin or an MDM2 (murine double minute 2) inhibitor, nutlin-3, endogenous p53 protein did not accumulate in the cytosol/mitochondria, and transcriptional inhibition after p53 induction effectively blocked cell death. In addition, overexpression of a dominant-negative form of p53 (R273H) completely suppressed induction of proapoptotic p53 target genes and cell death. PUMA (p53-upregulated modulator of apoptosis) was one such gene induced by camptothecin, and its overexpression was sufficient to induce Bax (Bcl-2-associated X protein)-dependent neuronal death, whereas Noxa was not apoptogenic. These results collectively demonstrate that, in contrast to non-neuronal cells, the apoptotic activity of p53 in postnatal cortical neurons does not rely on its direct action at the cytosol/mitochondria but is exclusively mediated through its transcription-dependent functions. The uniqueness of p53-mediated apoptotic signaling in postnatal cortical neurons was further illustrated by the dispensable function of the proline-rich domain of p53.

  13. Mathematical Modeling of E6-p53 interactions in Cervical Cancer

    PubMed

    Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, A I; Ullah, Mukhtar

    2017-04-01

    Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. Creative Commons Attribution License

  14. Mathematical Modeling of E6-p53 interactions in Cervical Cancer

    PubMed Central

    Khattak, Faryal; Haseeb, Muhammad; Fazal, Sahar; Bhatti, AI; Ullah, Mukhtar

    2017-01-01

    Background: Cervical cancer is the third most common cancer in women throughout the world. The human papillomavirus (HPV) E6 viral protein plays an essential role in proteasomal degradation of the cancer suppressant protein p53. As a result, p53 negative regulation and apoptosis relevant activities are abrogated, facilitating development of cervical cancer. Methods: A mathematical model of E6-p53 interactions was developed using mathematical laws. In-silico simulations were carried out on CellDesigner and as a test case the small molecule drug RITA was considered for its ability to rescue the functions of tumor suppressor p53 by inhibiting E6 mediated proteasomal degradation. Results: Using a computational model we scrutinized how p53 responds to RITA, and chemical reactions of this small molecule drug were incorporated to perceive the full effects. The evolved strategy allowed the p53 response and rescue of its tumor suppressor function to be delineated, RITA being found to block p53 interactions with E6 associated proteins. Conclusion: We could develop a model of E6-p53 interactions with incorporation of actions of the small molecule drug RITA. Suppression of E6 associated proteins by RITA induces accumulation of tumor suppressant p53. Using CellDesigner to encode the model ensured that it can be easily modified and extended as more data become available. This strategy should play an effective role in the development of therapies against cancer. PMID:28547941

  15. The UbL-UBA Ubiquilin4 protein functions as a tumor suppressor in gastric cancer by p53-dependent and p53-independent regulation of p21.

    PubMed

    Huang, Shengkai; Li, Yan; Yuan, Xinghua; Zhao, Mei; Wang, Jia; Li, You; Li, Yuan; Lin, Hong; Zhang, Qiao; Wang, Wenjie; Li, Dongdong; Dong, Xin; Li, Lanfen; Liu, Min; Huang, Weiyan; Huang, Changzhi

    2018-06-13

    Ubiquilin4 (Ubqln4), a member of the UbL-UBA protein family, serves as an adaptor in the degradation of specific substrates via the proteasomal pathway. However, the biological function of Ubqln4 remains largely unknown, especially in cancer. Here, we reported that Ubqln4 was downregulated in gastric cancer tissues and functioned as a tumor suppressor by inhibiting gastric cancer cell proliferation in vivo and in vitro. Overexpression of Ubqln4-induced cellular senescence and G1-S cell cycle arrest in gastric cancer cells and activated the p53/p21 axis. Moreover, Ubqln4 regulated p21 through both p53-dependent and p53-independent manners. Ubqln4 interacted with RNF114, an E3 ubiquitin ligase of p21, and negatively regulated its expression level, which in turn stabilized p21 by attenuating proteasomal degradation of p21. These effects of Ubqln4 were partly abrogated in gastric cancer cells upon silencing of p21. Our findings not only establish the anti-tumor potential of Ubqln4 in gastric cancer but also reveal a role for Ubqln4 in regulation of the cell cycle and cellular senescence via stabilizing p21.

  16. The p53–Mdm2 feedback loop protects against DNA damage by inhibiting p53 activity but is dispensable for p53 stability, development, and longevity

    PubMed Central

    Pant, Vinod; Xiong, Shunbin; Jackson, James G.; Post, Sean M.; Abbas, Hussein A.; Quintás-Cardama, Alfonso; Hamir, Amirali N.; Lozano, Guillermina

    2013-01-01

    The p53–Mdm2 feedback loop is perceived to be critical for regulating stress-induced p53 activity and levels. However, this has never been tested in vivo. Using a genetically engineered mouse with mutated p53 response elements in the Mdm2 P2 promoter, we show that feedback loop-deficient Mdm2P2/P2 mice are viable and aphenotypic and age normally. p53 degradation kinetics after DNA damage in radiosensitive tissues remains similar to wild-type controls. Nonetheless, DNA damage response is elevated in Mdm2P2/P2 mice. Enhanced p53-dependent apoptosis sensitizes hematopoietic stem cells (HSCs), causing drastic myeloablation and lethality. These results suggest that while basal Mdm2 levels are sufficient to regulate p53 in most tissues under homeostatic conditions, the p53–Mdm2 feedback loop is critical for regulating p53 activity and sustaining HSC function after DNA damage. Therefore, transient disruption of p53–Mdm2 interaction could be explored as a potential adjuvant/therapeutic strategy for targeting stem cells in hematological malignancies. PMID:23973961

  17. p53-dependent programmed necrosis controls germ cell homeostasis during spermatogenesis

    PubMed Central

    Napoletano, Francesco; Vincent, Stéphane; Favrot, Clémentine; Mehlen, Patrick; Girard, Victor; Chatelain, Gilles; Walter, Ludivine; Arama, Eli

    2017-01-01

    The importance of regulated necrosis in pathologies such as cerebral stroke and myocardial infarction is now fully recognized. However, the physiological relevance of regulated necrosis remains unclear. Here, we report a conserved role for p53 in regulating necrosis in Drosophila and mammalian spermatogenesis. We found that Drosophila p53 is required for the programmed necrosis that occurs spontaneously in mitotic germ cells during spermatogenesis. This form of necrosis involved an atypical function of the initiator caspase Dronc/Caspase 9, independent of its catalytic activity. Prevention of p53-dependent necrosis resulted in testicular hyperplasia, which was reversed by restoring necrosis in spermatogonia. In mouse testes, p53 was required for heat-induced germ cell necrosis, indicating that regulation of necrosis is a primordial function of p53 conserved from invertebrates to vertebrates. Drosophila and mouse spermatogenesis will thus be useful models to identify inducers of necrosis to treat cancers that are refractory to apoptosis. PMID:28945745

  18. MUSCLE WEAKNESS, FATIGUE, AND TORQUE VARIABILITY: EFFECTS OF AGE AND MOBILITY STATUS

    PubMed Central

    KENT-BRAUN, JANE A.; CALLAHAN, DAMIEN M.; FAY, JESSICA L.; FOULIS, STEPHEN A.; BUONACCORSI, JOHN P.

    2013-01-01

    Introduction Whereas deficits in muscle function, particularly power production, develop in old age and are risk factors for mobility impairment, a complete understanding of muscle fatigue during dynamic contractions is lacking. We tested hypotheses related to torque-producing capacity, fatigue resistance, and variability of torque production during repeated maximal contractions in healthy older, mobility-impaired older, and young women. Methods Knee extensor fatigue (decline in torque) was measured during 4 min of dynamic contractions. Torque variability was characterized using a novel 4-component logistic regression model. Results Young women produced more torque at baseline and during the protocol than older women (P < 0.001). Although fatigue did not differ between groups (P = 0.53), torque variability differed by group (P = 0.022) and was greater in older impaired compared with young women (P = 0.010). Conclusions These results suggest that increased torque variability may combine with baseline muscle weakness to limit function, particularly in older adults with mobility impairments. PMID:23674266

  19. p53 Protein interacts specifically with the meiosis-specific mammalian RecA-like protein DMC1 in meiosis.

    PubMed

    Habu, Toshiyuki; Wakabayashi, Nobunao; Yoshida, Kayo; Yomogida, Kenntaro; Nishimune, Yoshitake; Morita, Takashi

    2004-06-01

    The tumor suppressor protein p53 is specifically expressed during meiosis in spermatocytes. Subsets of p53 knockout mice exhibit testicular giant cell degenerative syndrome, which suggests p53 may be associated with meiotic cell cycle and/or DNA metabolism. Here, we show that p53 binds to the mouse meiosis-specific RecA-like protein Mus musculus DMC1 (MmDMC1). The C-terminal domain (amino acid 234-340) of MmDMC1 binds to DNA-binding domain of p53 protein. p53 might be involved in homologous recombination and/or checkpoint function by directly binding to DMC1 protein to repress genomic instability in meiotic germ cells.

  20. The expanding universe of p53 targets.

    PubMed

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  1. Recognition of Local DNA Structures by p53 Protein

    PubMed Central

    Brázda, Václav; Coufal, Jan

    2017-01-01

    p53 plays critical roles in regulating cell cycle, apoptosis, senescence and metabolism and is commonly mutated in human cancer. These roles are achieved by interaction with other proteins, but particularly by interaction with DNA. As a transcription factor, p53 is well known to bind consensus target sequences in linear B-DNA. Recent findings indicate that p53 binds with higher affinity to target sequences that form cruciform DNA structure. Moreover, p53 binds very tightly to non-B DNA structures and local DNA structures are increasingly recognized to influence the activity of wild-type and mutant p53. Apart from cruciform structures, p53 binds to quadruplex DNA, triplex DNA, DNA loops, bulged DNA and hemicatenane DNA. In this review, we describe local DNA structures and summarize information about interactions of p53 with these structural DNA motifs. These recent data provide important insights into the complexity of the p53 pathway and the functional consequences of wild-type and mutant p53 activation in normal and tumor cells. PMID:28208646

  2. Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma.

    PubMed

    Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne-Marie; Brenton, James D

    2016-10-01

    TP53 mutations are ubiquitous in high-grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low-grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged-amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain-of-function (GOF or nonsynonymous), loss-of-function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low-grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of mutation to 96%.

  3. Optimized p53 immunohistochemistry is an accurate predictor of TP53 mutation in ovarian carcinoma

    PubMed Central

    Köbel, Martin; Piskorz, Anna M; Lee, Sandra; Lui, Shuhong; LePage, Cecile; Marass, Francesco; Rosenfeld, Nitzan; Mes Masson, Anne‐Marie

    2016-01-01

    Abstract TP53 mutations are ubiquitous in high‐grade serous ovarian carcinomas (HGSOC), and the presence of TP53 mutation discriminates between high and low‐grade serous carcinomas and is now an important biomarker for clinical trials targeting mutant p53. p53 immunohistochemistry (IHC) is widely used as a surrogate for TP53 mutation but its accuracy has not been established. The objective of this study was to test whether improved methods for p53 IHC could reliably predict TP53 mutations independently identified by next generation sequencing (NGS). Four clinical p53 IHC assays and tagged‐amplicon NGS for TP53 were performed on 171 HGSOC and 80 endometrioid carcinomas (EC). p53 expression was scored as overexpression (OE), complete absence (CA), cytoplasmic (CY) or wild type (WT). p53 IHC was evaluated as a binary classifier where any abnormal staining predicted deleterious TP53 mutation and as a ternary classifier where OE, CA or WT staining predicted gain‐of‐function (GOF or nonsynonymous), loss‐of‐function (LOF including stopgain, indel, splicing) or no detectable TP53 mutations (NDM), respectively. Deleterious TP53 mutations were detected in 169/171 (99%) HGSOC and 7/80 (8.8%) EC. The overall accuracy for the best performing IHC assay for binary and ternary prediction was 0.94 and 0.91 respectively, which improved to 0.97 (sensitivity 0.96, specificity 1.00) and 0.95 after secondary analysis of discordant cases. The sensitivity for predicting LOF mutations was lower at 0.76 because p53 IHC detected mutant p53 protein in 13 HGSOC with LOF mutations. CY staining associated with LOF was seen in 4 (2.3%) of HGSOC. Optimized p53 IHC can approach 100% specificity for the presence of TP53 mutation and its high negative predictive value is clinically useful as it can exclude the possibility of a low‐grade serous tumour. 4.1% of HGSOC cases have detectable WT staining while harboring a TP53 LOF mutation, which limits sensitivity for binary prediction of mutation to 96%. PMID:27840695

  4. Cell cycle control, checkpoint mechanisms, and genotoxic stress.

    PubMed Central

    Shackelford, R E; Kaufmann, W K; Paules, R S

    1999-01-01

    The ability of cells to maintain genomic integrity is vital for cell survival and proliferation. Lack of fidelity in DNA replication and maintenance can result in deleterious mutations leading to cell death or, in multicellular organisms, cancer. The purpose of this review is to discuss the known signal transduction pathways that regulate cell cycle progression and the mechanisms cells employ to insure DNA stability in the face of genotoxic stress. In particular, we focus on mammalian cell cycle checkpoint functions, their role in maintaining DNA stability during the cell cycle following exposure to genotoxic agents, and the gene products that act in checkpoint function signal transduction cascades. Key transitions in the cell cycle are regulated by the activities of various protein kinase complexes composed of cyclin and cyclin-dependent kinase (Cdk) molecules. Surveillance control mechanisms that check to ensure proper completion of early events and cellular integrity before initiation of subsequent events in cell cycle progression are referred to as cell cycle checkpoints and can generate a transient delay that provides the cell more time to repair damage before progressing to the next phase of the cycle. A variety of cellular responses are elicited that function in checkpoint signaling to inhibit cyclin/Cdk activities. These responses include the p53-dependent and p53-independent induction of Cdk inhibitors and the p53-independent inhibitory phosphorylation of Cdk molecules themselves. Eliciting proper G1, S, and G2 checkpoint responses to double-strand DNA breaks requires the function of the Ataxia telangiectasia mutated gene product. Several human heritable cancer-prone syndromes known to alter DNA stability have been found to have defects in checkpoint surveillance pathways. Exposures to several common sources of genotoxic stress, including oxidative stress, ionizing radiation, UV radiation, and the genotoxic compound benzo[a]pyrene, elicit cell cycle checkpoint responses that show both similarities and differences in their molecular signaling. Images Figure 3 PMID:10229703

  5. p53-regulated autophagy is controlled by glycolysis and determines cell fate

    PubMed Central

    Duan, Lei; Perez, Ricardo E.; Davaadelger, Batzaya; Dedkova, Elena N.; Blatter, Lothar A.; Maki, Carl G.

    2015-01-01

    The tumor suppressor p53 regulates downstream targets that determine cell fate. Canonical p53 functions include inducing apoptosis, growth arrest, and senescence. Non-canonical p53 functions include its ability to promote or inhibit autophagy and its ability to regulate metabolism. The extent to which autophagy and/or metabolic regulation determines cell fate by p53 is unclear. To address this, we compared cells resistant or sensitive to apoptosis by the p53 activator Nutlin-3a. In resistant cells, glycolysis was maintained upon Nutlin-3a treatment, and activated p53 promoted prosurvival autophagy. In contrast, in apoptosis sensitive cells activated p53 increased superoxide levels and inhibited glycolysis through repression of glycolytic pathway genes. Glycolysis inhibition and increased superoxide inhibited autophagy by repressing ATG genes essential for autophagic vesicle maturation. Inhibiting glycolysis increased superoxide and blocked autophagy in apoptosis-resistant cells, causing p62-dependent caspase-8 activation. Finally, treatment with 2-DG or the autophagy inhibitors chloroquine or bafilomycin A1 sensitized resistant cells to Nutlin-3a-induced apoptosis. Together, these findings reveal novel links between glycolysis and autophagy that determine apoptosis-sensitivity in response to p53. Specifically, the findings indicate 1) that glycolysis plays an essential role in autophagy by limiting superoxide levels and maintaining expression of ATG genes required for autophagic vesicle maturation, 2) that p53 can promote or inhibit autophagy depending on the status of glycolysis, and 3) that inhibiting protective autophagy can expand the breadth of cells susceptible to Nutlin-3a induced apoptosis. PMID:26337205

  6. Structure and Kinetic Stability of the p63 Tetramerization Domain

    PubMed Central

    Natan, Eviatar; Joerger, Andreas C.

    2012-01-01

    The p53 family of transcription factors—comprising p53, p63 and p73—plays an important role in tumor prevention and development. Essential to their function is the formation of tetramers, allowing cooperative binding to their DNA response elements. We solved crystal structures of the human p63 tetramerization domain, showing that p63 forms a dimer of dimers with D2 symmetry composed of highly intertwined monomers. The primary dimers are formed via an intramolecular β-sheet and hydrophobic helix packing (H1), a hallmark of all p53 family members. Like p73, but unlike p53, p63 requires a second helix (H2) to stabilize the architecture of the tetramer. In order to investigate the impact of structural differences on tetramer stability, we measured the subunit exchange reaction of p53 family homotetramers by nanoflow electrospray mass spectrometry. There were differences in both the kinetics and the pattern of the exchange reaction, with the p53 and p63 tetramers exhibiting much faster exchange kinetics than p73. The structural similarity between p63 and p73 rationalizes previous observations that p63 and p73 form mixed tetramers, and the kinetic data reveal the dissociation of the p73 homotetramers as the rate-limiting step for heterotetramer formation. Differential stability of the tetramers may play an important role in the cross talk between different isoforms and regulation of p53, p63 and p73 function in the cell cycle. PMID:22100306

  7. Interaction of the Tumor Suppressor p53 with Replication Protein A.

    DTIC Science & Technology

    1996-08-01

    The DNA replication factor RPA physically associates with the tumor suppressor protein p53, an interaction that could be important for the function...binding single-stranded DNA, this mutant of RPA fails to support DNA replication . Therefore the region of RPA which interacts with p53 is essential for...of p53, p21/WAFl/CIPl, inhibits the cell-cycle by associating with cyclin-cdk kinases. It also inhibits DNA replication by interacting with a

  8. Human Oncoprotein MDM2 Up-regulates Expression of NF-κB2 Precursor p100 Conferring a Survival Advantage to Lung Cells

    PubMed Central

    Vaughan, Catherine; Mohanraj, Lathika; Singh, Shilpa; Dumur, Catherine I.; Ramamoorthy, Mahesh; Garrett, Carleton T.; Windle, Brad; Yeudall, W. Andrew; Deb, Sumitra

    2011-01-01

    The current model predicts that MDM2 is primarily overexpressed in cancers with wild-type (WT) p53 and contributes to oncogenesis by degrading p53. Following a correlated expression of MDM2 and NF-κB2 transcripts in human lung tumors, we have identified a novel transactivation function of MDM2. Here, we report that in human lung tumors, overexpression of MDM2 was found in approximately 30% of cases irrespective of their p53 status, and expression of MDM2 and NF-κB2 transcripts showed a highly significant statistical correlation in tumors with WT p53. We investigated the significance of this correlated expression in terms of mechanism and biological function. Increase in MDM2 expression from its own promoter in transgenic mice remarkably enhanced expression of NF-κB2 compared with its non-transgenic littermates. Knockdown or elimination of endogenous MDM2 expression in cultured non-transformed or lung tumor cells drastically reduced expression of NF-κB2 transcripts, suggesting a normal physiological role of MDM2 in regulating NF-κB2 transcription. MDM2 could up-regulate expression of NF-κB2 transcripts when its p53-interaction domain was blocked with Nutlin-3, indicating that the MDM2-p53 interaction is dispensable for up-regulation of NF-κB2 expression. Consistently, analysis of functional domains of MDM2 indicated that although the p53-interaction domain of MDM2 contributes to the up-regulation of the NFκB2 promoter, MDM2 does not require direct interactions with p53 for this function. Accordingly, MDM2 overexpression in non-transformed or lung cancer cells devoid of p53 also generated a significant increase in the expression of NF-κB2 transcript and its targets CXCL-1 and CXCL-10, whereas elimination of MDM2 expression had the opposite effects. MDM2-mediated increase in p100/NF-κB2 expression reduced cell death mediated by paclitaxel. Furthermore, knockdown of NF-κB2 expression retarded cell proliferation. Based on these data, we propose that MDM2-mediated NF-κB2 up-regulation is a combined effect of p53-dependent and independent mechanisms and that it confers a survival advantage to lung cancer cells. PMID:22701761

  9. Expressions of p53 and p21 in primary gastric lymphomas.

    PubMed Central

    Go, J. H.; Yang, W. I.

    2001-01-01

    The p21 overexpression is thought to be a consequence of the p53 induced activation of the p21 gene. The immunohistochemical evaluation of p53 and p21 can be a valuable means of assessing the functional status of the p53 gene product. We examined the overexpression of p21 and p53 proteins in primary gastric lymphomas and the correlation with prognosis. A total of 32 cases of gastric lymphomas was classified into low-grade lymphomas of mucosa-associated lymphoid tissue type (n=16) and high-grade B-cell lymphomas (n=16). In low-grade lymphomas, only one case showed p53 positivity and all cases were p21-negative. In high-grade lymphomas, seven cases were p53+/p21- (44%), one case was p53+/p21+ (6%), and eight cases were p53-/p21- (50%). The p53+/p21- cases had a much lower percentage of patients sustaining a continuous complete remission state (3/7, 43%) compared with other cases (6/7, 86%). From these results, we concluded that p21 expression is rare in primary gastric lymphomas. Therefore, p53-positive lymphomas can be assumed as having p53 mutation. And combined studies of p53 and p21 may be used as a prognostic indicator in primary gastric high-grade lymphomas. PMID:11748353

  10. E2 Ubiquitin-conjugating Enzyme, UBE2C Gene, Is Reciprocally Regulated by Wild-type and Gain-of-Function Mutant p53.

    PubMed

    Bajaj, Swati; Alam, Sk Kayum; Roy, Kumar Singha; Datta, Arindam; Nath, Somsubhra; Roychoudhury, Susanta

    2016-07-01

    Spindle assembly checkpoint governs proper chromosomal segregation during mitosis to ensure genomic stability. At the cellular level, this event is tightly regulated by UBE2C, an E2 ubiquitin-conjugating enzyme that donates ubiquitin to the anaphase-promoting complex/cyclosome. This, in turn, facilitates anaphase-onset by ubiquitin-mediated degradation of mitotic substrates. UBE2C is an important marker of chromosomal instability and has been associated with malignant growth. However, the mechanism of its regulation is largely unexplored. In this study, we report that UBE2C is transcriptionally activated by the gain-of-function (GOF) mutant p53, although it is transcriptionally repressed by wild-type p53. We showed that wild-type p53-mediated inhibition of UBE2C is p21-E2F4-dependent and GOF mutant p53-mediated transactivation of UBE2C is NF-Y-dependent. We further explored that DNA damage-induced wild-type p53 leads to spindle assembly checkpoint arrest by repressing UBE2C, whereas mutant p53 causes premature anaphase exit by increasing UBE2C expression in the presence of 5-fluorouracil. Identification of UBE2C as a target of wild-type and GOF mutant p53 further highlights the contribution of p53 in regulation of spindle assembly checkpoint. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. PHTS, a novel putative tumor suppressor, is involved in the transformation reversion of HeLaHF cells independently of the p53 pathway

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yu Dehua; Fan, Wufang; Liu, Guohong

    2006-04-01

    HeLaHF is a non-transformed revertant of HeLa cells, likely resulting from the activation of a putative tumor suppressor(s). p53 protein was stabilized in this revertant and reactivated for certain transactivation functions. Although p53 stabilization has not conclusively been linked to the reversion, it is clear that the genes in p53 pathway are involved. The present study confirms the direct role of p53 in HeLaHF reversion by demonstrating that RNAi-mediated p53 silencing partially restores anchorage-independent growth potential of the revertant through the suppression of anoikis. In addition, we identified a novel gene, named PHTS, with putative tumor suppressor properties, and showedmore » that this gene is also involved in HeLaHF reversion independently of the p53 pathway. Expression profiling revealed that PHTS is one of the genes that is up-regulated in HeLaHF but not in HeLa. It encodes a putative protein with CD59-like domains. RNAi-mediated PHTS silencing resulted in the partial restoration of transformation (anchorage-independent growth) in HeLaHF cells, similar to that of p53 gene silencing, implying its tumor suppressor effect. However, the observed increased transformation potential by PHTS silencing appears to be due to an increased anchorage-independent proliferation rate rather than suppression of anoikis, unlike the effect of p53 silencing. p53 silencing did not affect PHTS gene expression, and vice versa, suggesting PHTS may function in a new and p53-independent tumor suppressor pathway. Furthermore, over-expression of PHTS in different cancer cell lines, in addition to HeLa, reduces cell growth likely via induced apoptosis, confirming the broad PHTS tumor suppressor properties.« less

  12. Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction.

    PubMed

    Pettersson, Mariell; Quant, Maria; Min, Jaeki; Iconaru, Luigi; Kriwacki, Richard W; Waddell, M Brett; Guy, R Kiplin; Luthman, Kristina; Grøtli, Morten

    2015-01-01

    The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2) via a direct protein-protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay.

  13. Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction

    PubMed Central

    Pettersson, Mariell; Quant, Maria; Min, Jaeki; Iconaru, Luigi; Kriwacki, Richard W.; Waddell, M. Brett; Guy, R. Kiplin; Luthman, Kristina; Grøtli, Morten

    2015-01-01

    The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2) via a direct protein—protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay. PMID:26427060

  14. Ribosomal stress induces L11- and p53-dependent apoptosis in mouse pluripotent stem cells.

    PubMed

    Morgado-Palacin, Lucia; Llanos, Susana; Serrano, Manuel

    2012-02-01

    Ribosome biogenesis is the most demanding energetic process in proliferating cells and it is emerging as a critical sensor of cellular homeostasis. Upon disturbance of ribosome biogenesis, specific free ribosomal proteins, most notably L11, bind and inhibit Mdm2, resulting in activation of the tumor suppressor p53. This pathway has been characterized in somatic and cancer cells, but its function in embryonic pluripotent cells has remained unexplored. Here, we show that treatment with low doses of Actinomycin D or depletion of ribosomal protein L37, two well-established inducers of ribosomal stress, activate p53 in an L11-dependent manner in mouse embryonic stem cells (ESCs) and in induced pluripotent stem cells (iPSCs). Activation of p53 results in transcriptional induction of p53 targets, including p21, Mdm2, Pidd, Puma, Noxa and Bax. Finally, ribosomal stress elicits L11- and p53-dependent apoptosis in ESCs/iPSCs. These results extend to pluripotent cells the functionality of the ribosomal stress pathway and we speculate that this could be a relevant cellular checkpoint during early embryogenesis.

  15. Diagnostic value of progesterone receptor, p16, p53 and pHH3 expression in uterine atypical leiomyoma.

    PubMed

    Liang, Yun; Zhang, Xiaofei; Chen, Xiaoduan; Lü, Weiguo

    2015-01-01

    The differential diagnosis between atypical leiomyoma and leiomyosarcoma may be hard based on morphological criterion at times. It would be helpful to find out biomarkers that can be used to distinguish them. The aim of the study was to investigate the diagnostic value of progesterone receptor (PR), p16, p53 and pHH3 expression in a series of uterine smooth muscle tumors. Immunohistochemical expression of PR, p16, p53 and pHH3 was investigated on 32 atypical leiomyomas, 15 leiomyosarcomas and 15 usual leomyomas. The difference in expression was compared between atypical leiomyoma and other groups. The expression of PR, p16, and pHH3 was found significantly different between atypical leiomyomas and leiomyosarcomas, but lack of significant difference between atypical leiomyomas and usual leiomyomas. There was no significant difference with regard to p53 distribution among these uterine smooth muscle tumors. High p16, pHH3 expression and low PR expression preferred the diagnosis of leiomyosarcoma. The panel of antibodies used in this study is a useful complementary analysis in the assessment of problematic uterine smooth muscle tumors.

  16. Diagnostic value of progesterone receptor, p16, p53 and pHH3 expression in uterine atypical leiomyoma

    PubMed Central

    Liang, Yun; Zhang, Xiaofei; Chen, Xiaoduan; Lü, Weiguo

    2015-01-01

    The differential diagnosis between atypical leiomyoma and leiomyosarcoma may be hard based on morphological criterion at times. It would be helpful to find out biomarkers that can be used to distinguish them. The aim of the study was to investigate the diagnostic value of progesterone receptor (PR), p16, p53 and pHH3 expression in a series of uterine smooth muscle tumors. Immunohistochemical expression of PR, p16, p53 and pHH3 was investigated on 32 atypical leiomyomas, 15 leiomyosarcomas and 15 usual leomyomas. The difference in expression was compared between atypical leiomyoma and other groups. The expression of PR, p16, and pHH3 was found significantly different between atypical leiomyomas and leiomyosarcomas, but lack of significant difference between atypical leiomyomas and usual leiomyomas. There was no significant difference with regard to p53 distribution among these uterine smooth muscle tumors. High p16, pHH3 expression and low PR expression preferred the diagnosis of leiomyosarcoma. The panel of antibodies used in this study is a useful complementary analysis in the assessment of problematic uterine smooth muscle tumors. PMID:26261614

  17. An advanced glycation end product (AGE)-receptor for AGEs (RAGE) axis restores adipogenic potential of senescent preadipocytes through modulation of p53 protein function.

    PubMed

    Chen, Chih-Yu; Abell, Allison Martorano; Moon, Yang Soo; Kim, Kee-Hong

    2012-12-28

    The impaired adipogenic potential of senescent preadipocytes is a hallmark of adipose aging and aging-related adipose dysfunction. Although advanced glycation end products (AGEs) derived from both foods and endogenous nonenzymatic glycation and AGE-associated signaling pathways are known to play a key role in aging and its related diseases, the role of AGEs in adipose aging remains elusive. We show a novel pro-adipogenic function of AGEs in replicative senescent preadipocytes and mouse embryonic fibroblasts, as well as primary preadipocytes isolated from aged mice. Using glycated bovine serum albumin (BSA) as a model protein of AGEs, we found that glycated BSA restores the impaired adipogenic potential of senescent preadipocytes in vitro and ex vivo. However, glycated BSA showed no effect on adipogenesis in nonsenescent preadipocytes. The AGE-induced receptor for AGE (RAGE) expression is required for the pro-adipogenic function of AGEs in senescent preadipocytes. RAGE is required for impairment of p53 expression and p53 function in regulating p21 expression in senescent preadipocytes. We also observed a direct binding between RAGE and p53 in senescent preadipocytes. Taken together, our findings reveal a novel pro-adipogenic function of the AGE-RAGE axis in p53-regulated adipogenesis of senescent preadipocytes, providing new insights into aging-dependent adiposity by diet-driven and/or endogenous glycated proteins.

  18. An Advanced Glycation End Product (AGE)-Receptor for AGEs (RAGE) Axis Restores Adipogenic Potential of Senescent Preadipocytes through Modulation of p53 Protein Function*

    PubMed Central

    Chen, Chih-Yu; Abell, Allison Martorano; Moon, Yang Soo; Kim, Kee-Hong

    2012-01-01

    The impaired adipogenic potential of senescent preadipocytes is a hallmark of adipose aging and aging-related adipose dysfunction. Although advanced glycation end products (AGEs) derived from both foods and endogenous nonenzymatic glycation and AGE-associated signaling pathways are known to play a key role in aging and its related diseases, the role of AGEs in adipose aging remains elusive. We show a novel pro-adipogenic function of AGEs in replicative senescent preadipocytes and mouse embryonic fibroblasts, as well as primary preadipocytes isolated from aged mice. Using glycated bovine serum albumin (BSA) as a model protein of AGEs, we found that glycated BSA restores the impaired adipogenic potential of senescent preadipocytes in vitro and ex vivo. However, glycated BSA showed no effect on adipogenesis in nonsenescent preadipocytes. The AGE-induced receptor for AGE (RAGE) expression is required for the pro-adipogenic function of AGEs in senescent preadipocytes. RAGE is required for impairment of p53 expression and p53 function in regulating p21 expression in senescent preadipocytes. We also observed a direct binding between RAGE and p53 in senescent preadipocytes. Taken together, our findings reveal a novel pro-adipogenic function of the AGE-RAGE axis in p53-regulated adipogenesis of senescent preadipocytes, providing new insights into aging-dependent adiposity by diet-driven and/or endogenous glycated proteins. PMID:23150674

  19. AAVPG: A vigilant vector where transgene expression is induced by p53

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bajgelman, Marcio C.; Medrano, Ruan F.V.; Carvalho, Anna Carolina P.V.

    2013-12-15

    Using p53 to drive transgene expression from viral vectors may provide on demand expression in response to physiologic stress, such as hypoxia or DNA damage. Here we introduce AAVPG, an adeno-associated viral (AAV) vector where a p53-responsive promoter, termed PG, is used to control transgene expression. In vitro assays show that expression from the AAVPG-luc vector was induced specifically in the presence of functional p53 (1038±202 fold increase, p<0.001). The AAVPG-luc vector was an effective biosensor of p53 activation in response to hypoxia (4.48±0.6 fold increase in the presence of 250 µM CoCl{sub 2}, p<0.001) and biomechanical stress (2.53±0.4 foldmore » increase with stretching, p<0.05). In vivo, the vigilant nature of the AAVPG-luc vector was revealed after treatment of tumor-bearing mice with doxorubicin (pre-treatment, 3.4×10{sup 5}±0.43×10{sup 5} photons/s; post-treatment, 6.6×10{sup 5}±2.1×10{sup 5} photons/s, p<0.05). These results indicate that the AAVPG vector is an interesting option for detecting p53 activity both in vitro and in vivo. - Highlights: • AAV vector where transgene expression is controlled by the tumor suppressor p53. • The new vector, AAVPG, shown to function as a biosensor of p53 activity, in vitro and in vivo. • The p53 activity monitored by the AAVPG vector is relevant to cancer and other diseases. • AAVPG reporter gene expression was activated upon DNA damage, hypoxia and mechanical stress.« less

  20. The PTTG1-targeting miRNAs miR-329, miR-300, miR-381, and miR-655 inhibit pituitary tumor cell tumorigenesis and are involved in a p53/PTTG1 regulation feedback loop

    PubMed Central

    Diao, Cai-feng; Li, Jian-wei; Su, Jing-liang; Zhang, Sai

    2015-01-01

    Deregulation of the pituitary tumor transforming gene (PTTG1), a newly discovered oncogene, is a hallmark of various malignancies, including pituitary tumors. However, the mechanisms regulating PTTG1 expression are still needed to be explored. MicroRNAs (miRNAs) are a novel class of small RNA molecules that act as posttranscriptional regulators of gene expression and can play a significant role in tumor development. Here, we identified a series of miRNAs, namely, miR-329, miR-300, miR-381 and miR-655, which could target PTTG1 messenger RNA and inhibit its expression. Interestingly, all four miRNAs significantly that are downregulated in pituitary tumors were mapped to the 14q32.31 locus, which acts as a tumor suppressor in several cancers. Functional studies show that the PTTG1-targeting miRNAs inhibit proliferation, migration and invasion but induce apoptosis in GH3 and MMQ cells. Furthermore, overexpression of a PTTG1 expression vector lacking the 3′UTR partially reverses the tumor suppressive effects of these miRNAs. Next, we identified the promoter region of PTTG1-targeting miRNAs with binding sites for p53. In our hands, p53 transcriptionally activated the expression of these miRNAs in pituitary tumor cells. Finally, we found that PTTG1 could inhibit p53 transcriptional activity to the four miRNAs. These data indicate the existence of a feedback loop between PTTG1 targeting miRNAs, PTTG1 and p53 that promotes pituitary tumorigenesis. Together, these findings suggest that these PTTG1-targeting miRNAs are important players in the regulation of pituitary tumorigenesis and that these miRNAs may serve as valuable therapeutic targets for cancer treatment. PMID:26320179

  1. The curcumin analog HO-3867 selectively kills cancer cells by converting mutant p53 protein to transcriptionally active wildtype p53.

    PubMed

    Madan, Esha; Parker, Taylor M; Bauer, Matthias R; Dhiman, Alisha; Pelham, Christopher J; Nagane, Masaki; Kuppusamy, M Lakshmi; Holmes, Matti; Holmes, Thomas R; Shaik, Kranti; Shee, Kevin; Kiparoidze, Salome; Smith, Sean D; Park, Yu-Soon A; Gomm, Jennifer J; Jones, Louise J; Tomás, Ana R; Cunha, Ana C; Selvendiran, Karuppaiyah; Hansen, Laura A; Fersht, Alan R; Hideg, Kálmán; Gogna, Rajan; Kuppusamy, Periannan

    2018-03-23

    p53 is an important tumor-suppressor protein that is mutated in more than 50% of cancers. Strategies for restoring normal p53 function are complicated by the oncogenic properties of mutant p53 and have not met with clinical success. To counteract mutant p53 activity, a variety of drugs with the potential to reconvert mutant p53 to an active wildtype form have been developed. However, these drugs are associated with various negative effects such as cellular toxicity, nonspecific binding to other proteins, and inability to induce a wildtype p53 response in cancer tissue. Here, we report on the effects of a curcumin analog, HO-3867, on p53 activity in cancer cells from different origins. We found that HO-3867 covalently binds to mutant p53, initiates a wildtype p53-like anticancer genetic response, is exclusively cytotoxic toward cancer cells, and exhibits high anticancer efficacy in tumor models. In conclusion, HO-3867 is a p53 mutant-reactivating drug with high clinical anticancer potential. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.

  2. TP53 and MDM2 single nucleotide polymorphisms influence survival in non-del(5q) myelodysplastic syndromes

    PubMed Central

    Sallman, David A.; Basiorka, Ashley A.; Irvine, Brittany A.; Zhang, Ling; Epling-Burnette, P.K.; Rollison, Dana E.; Mallo, Mar; Sokol, Lubomir; Solé, Francesc; Maciejewski, Jaroslaw; List, Alan F.

    2015-01-01

    P53 is a key regulator of many cellular processes and is negatively regulated by the human homolog of murine double minute-2 (MDM2) E3 ubiquitin ligase. Single nucleotide polymorphisms (SNPs) of either gene alone, and in combination, are linked to cancer susceptibility, disease progression, and therapy response. We analyzed the interaction of TP53 R72P and MDM2 SNP309 SNPs in relationship to outcome in patients with myelodysplastic syndromes (MDS). Sanger sequencing was performed on DNA isolated from 208 MDS cases. Utilizing a novel functional SNP scoring system ranging from +2 to −2 based on predicted p53 activity, we found statistically significant differences in overall survival (OS) (p = 0.02) and progression-free survival (PFS) (p = 0.02) in non-del(5q) MDS patients with low functional scores. In univariate analysis, only IPSS and the functional SNP score predicted OS and PFS in non-del(5q) patients. In multivariate analysis, the functional SNP score was independent of IPSS for OS and PFS. These data underscore the importance of TP53 R72P and MDM2 SNP309 SNPs in MDS, and provide a novel scoring system independent of IPSS that is predictive for disease outcome. PMID:26416416

  3. Modulation of p53 cellular function and cell death by African swine fever virus.

    PubMed

    Granja, Aitor G; Nogal, María L; Hurtado, Carolina; Salas, José; Salas, María L; Carrascosa, Angel L; Revilla, Yolanda

    2004-07-01

    Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells.

  4. Modulation of p53 Cellular Function and Cell Death by African Swine Fever Virus

    PubMed Central

    Granja, Aitor G.; Nogal, María L.; Hurtado, Carolina; Salas, José; Salas, María L.; Carrascosa, Angel L.; Revilla, Yolanda

    2004-01-01

    Modulation of the activity of tumor suppressor p53 is a key event in the replication of many viruses. We have studied the function of p53 in African swine fever virus (ASFV) infection by determining the expression and activity of this transcription factor in infected cells. p53 levels are increased at early times of infection and are maintained throughout the infectious cycle. The protein is transcriptionally active, stabilized by phosphorylation, and localized in the nucleus. p53 induces the expression of p21 and Mdm2. Strikingly, these two proteins are located at the cytoplasmic virus factories. The retention of Mdm2 at the factory may represent a viral mechanism to prevent p53 inactivation by the protein. The expression of apoptotic proteins, such as Bax or active caspase-3, is also increased following ASFV infection, although the increase in caspase-3 does not appear to be, at least exclusively, p53 dependent. Bax probably plays a role in the induction of apoptosis in the infected cells, as suggested by the release of cytochrome c from the mitochondria. The significance of p21 induction and localization is discussed in relation to the shutoff of cellular DNA synthesis that is observed in ASFV-infected cells. PMID:15194793

  5. A mutant p53/let-7i-axis-regulated gene network drives cell migration, invasion and metastasis

    PubMed Central

    Subramanian, M; Francis, P; Bilke, S; Li, XL; Hara, T; Lu, X; Jones, MF; Walker, RL; Zhu, Y; Pineda, M; Lee, C; Varanasi, L; Yang, Y; Martinez, LA; Luo, J; Ambs, S; Sharma, S; Wakefield, LM; Meltzer, PS; Lal, A

    2015-01-01

    Most p53 mutations in human cancers are missense mutations resulting in a full-length mutant p53 protein. Besides losing tumor suppressor activity, some hotspot p53 mutants gain oncogenic functions. This effect is mediated in part, through gene expression changes due to inhibition of p63 and p73 by mutant p53 at their target gene promoters. Here, we report that the tumor suppressor microRNA let-7i is downregulated by mutant p53 in multiple cell lines expressing endogenous mutant p53. In breast cancer patients, significantly decreased let-7i levels were associated with missense mutations in p53. Chromatin immunoprecipitation and promoter luciferase assays established let-7i as a transcriptional target of mutant p53 through p63. Introduction of let-7i to mutant p53 cells significantly inhibited migration, invasion and metastasis by repressing a network of oncogenes including E2F5, LIN28B, MYC and NRAS. Our findings demonstrate that repression of let-7i expression by mutant p53 has a key role in enhancing migration, invasion and metastasis. PMID:24662829

  6. p63 and p73 coordinate p53 function to determine the balance between survival, cell death, and senescence in adult neural precursor cells

    PubMed Central

    Fatt, M P; Cancino, G I; Miller, F D; Kaplan, D R

    2014-01-01

    The p53 family members p73 and p63 have been implicated in various aspects of stem cell regulation. Here, we have asked whether they work together to regulate stem cell biology, focusing upon neural precursor cells (NPCs) in the adult murine brain. By studying mice that are haploinsufficient for p63 and/or p73, we show that these two proteins cooperate to ensure appropriate NPC self-renewal and long-term maintenance in the hippocampus and forebrain, and that when both are haploinsufficient, the NPC deficits are significantly greater than haploinsufficiency for either alone. We show that, in the case of p63+/− mice, this decrease in adult NPCs is caused by enhanced apoptosis. However, when p73 is coincidently haploinsufficient, this rescues the enhanced apoptosis of p63+/− NPCs under both basal conditions and following genotoxic stress, instead causing increased cellular senescence. This increase in cellular senescence is likely due, at least in part, to increased levels of basal DNA damage and p53 activation, as genetic ablation of p53 completely rescues the senescence phenotype observed in p63+/−; p73+/− mice. Thus, the presence of p73 determines whether p63+/− NPCs exhibit increased p53-dependent apoptosis or senescence. Together, these studies demonstrate that p63 and p73 cooperate to maintain adult NPC pools through regulation of p53 function; p63 antagonizes p53 to promote cellular survival, whereas p73 regulates self-renewal and p53-mediated apoptosis versus senescence. PMID:24809925

  7. LincRNA-p21 activates p21 in cis to promote Polycomb target gene expression and to enforce the G1/S checkpoint

    PubMed Central

    Dimitrova, Nadya; Zamudio, Jesse R.; Jong, Robyn M.; Soukup, Dylan; Resnick, Rebecca; Sarma, Kavitha; Ward, Amanda J.; Raj, Arjun; Lee, Jeannie; Sharp, Phillip A.; Jacks, Tyler

    2014-01-01

    SUMMARY The p53-regulated long non-coding RNA lincRNA-p21 has been proposed to act in trans via several mechanisms ranging from repressing genes in the p53 transcriptional network to regulating mRNA translation and protein stability. To further examine lincRNA-p21 function we generated a conditional knockout mouse model. We find that lincRNA-p21 predominantly functions in cis to activate expression of its neighboring gene, p21. Mechanistically, we show that lincRNA-p21 acts in concert with hnRNP-K as a co-activator for p53-dependent p21 transcription. Additional phenotypes of lincRNA-p21 deficiency could be attributed to diminished p21 levels, including deregulated expression and altered chromatin state of some Polycomb target genes, defective G1/S checkpoint, increased proliferation rates, and enhanced reprogramming efficiency. These findings indicate that lincRNA-p21 affects global gene expression and influences the p53 tumor suppressor pathway by acting in cis as a locus-restricted co-activator for p53-mediated p21 expression. PMID:24857549

  8. Novel function of STAT1beta in B cells: induction of cell death by a mechanism different from that of STAT1alpha.

    PubMed

    Najjar, Imen; Schischmanoff, Pierre Olivier; Baran-Marszak, Fanny; Deglesne, Pierre-Antoine; Youlyouz-Marfak, Ibtissam; Pampin, Mathieu; Feuillard, Jean; Bornkamm, Georg W; Chelbi-Alix, Mounira K; Fagard, Remi

    2008-12-01

    Alternate splicing of STAT1 produces two isoforms: alpha, known as the active form, and beta, previously shown to act as a dominant-negative factor. Most studies have dealt with STAT1alpha, showing its involvement in cell growth control and cell death. To examine the specific function of either isoform in cell death, a naturally STAT1-deficient human B cell line was transfected to express STAT1alpha or STAT1beta. STAT1alpha, expressed alone, enhanced cell death, potentiated the fludarabine-induced apoptosis, and enhanced the nuclear location, the phosphorylation, and the transcriptional activity of p53. Unexpectedly, STAT1beta, expressed alone, induced cell death through a mechanism that was independent of the nuclear function of p53. Indeed, in STAT1beta-expressing B cells, p53 was strictly cytoplasmic where it formed clusters, and there was no induction of the transcriptional activity of p53. These data reveal a novel role of STAT1beta in programmed cell death, which is independent of p53.

  9. DCAF1 controls T-cell function via p53-dependent and -independent mechanisms.

    PubMed

    Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K; Xiong, Yue; Chen, Xian; Wan, Yisong Y

    2016-01-05

    On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1-cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms.

  10. DCAF1 controls T-cell function via p53-dependent and -independent mechanisms

    PubMed Central

    Guo, Zengli; Kong, Qing; Liu, Cui; Zhang, Song; Zou, Liyun; Yan, Feng; Whitmire, Jason K.; Xiong, Yue; Chen, Xian; Wan, Yisong Y.

    2016-01-01

    On activation, naive T cells grow in size and enter cell cycle to mount immune response. How the fundamental processes of T-cell growth and cell cycle entry are regulated is poorly understood. Here we report that DCAF1 (Ddb1–cullin4-associated-factor 1) is essential for these processes. The deletion of DCAF1 in T cells impairs their peripheral homeostasis. DCAF1 is upregulated on T-cell receptor activation and critical for activation-induced T-cell growth, cell cycle entry and proliferation. In addition, DCAF1 is required for T-cell expansion and function during anti-viral and autoimmune responses in vivo. DCAF1 deletion leads to a drastic stabilization of p53 protein, which can be attributed to a requirement of DCAF1 for MDM2-mediated p53 poly-ubiquitination. Importantly, p53 deletion rescues the cell cycle entry defect but not the growth defect of DCAF1-deficient cells. Therefore, DCAF1 is vital for T-cell function through p53-dependent and -independent mechanisms. PMID:26728942

  11. BTK blocks the inhibitory effects of MDM2 on p53 activity

    PubMed Central

    Rada, Miran; Althubiti, Mohammad; Ekpenyong-Akiba, Akang E.; Lee, Koon-Guan; Lam, Kong Peng; Fedorova, Olga; Barlev, Nickolai A.; Macip, Salvador

    2017-01-01

    p53 is a tumour suppressor that is activated in response to various types of stress. It is regulated by a complex pattern of over 50 different post-translational modifications, including ubiquitination by the E3 ligase MDM2, which leads to its proteasomal degradation. We have previously reported that expression of Bruton’s Tyrosine Kinase (BTK) induces phosphorylation of p53 at the N-terminus, including Serine 15, and increases its protein levels and activity. The mechanisms involved in this process are not completely understood. Here, we show that BTK also increases MDM2 and is necessary for MDM2 upregulation after DNA damage, consistent with what we have shown for other p53 target genes. Moreover, we found that BTK binds to MDM2 on its PH domain and induces its phosphorylation. This suggested a negative regulation of MDM2 functions by BTK, supported by the fact BTK expression rescued the inhibitory effects of MDM2 on p53 transcriptional activity. Indeed, we observed that BTK mediated the loss of the ubiquitination activity of MDM2, a process that was dependent on the phosphorylation functions of BTK. Our data together shows that the kinase activity of BTK plays an important role in disrupting the MDM2-p53 negative feedback loop by acting at different levels, including binding to and inactivation of MDM2. This study provides a potential mechanism to explain how BTK modulates p53 functions. PMID:29290977

  12. New orally active DNA minor groove binding small molecule CT-1 acts against breast cancer by targeting tumor DNA damage leading to p53-dependent apoptosis.

    PubMed

    Saini, Karan Singh; Hamidullah; Ashraf, Raghib; Mandalapu, Dhanaraju; Das, Sharmistha; Siddiqui, Mohd Quadir; Dwivedi, Sonam; Sarkar, Jayanta; Sharma, Vishnu Lal; Konwar, Rituraj

    2017-04-01

    Targeting tumor DNA damage and p53 pathway is a clinically established strategy in the development of cancer chemotherapeutics. Majority of anti-cancer drugs are delivered through parenteral route for reasons like severe toxicity, lack of stability, and poor enteral absorption. Current DNA targeting drugs in clinical like anthracycline suffers from major drawbacks like cardiotoxicity. Here, we report identification of a new orally active small molecule curcumin-triazole conjugate (CT-1) with significant anti-breast cancer activity in vitro and in vivo. CT-1 selectively and significantly inhibits viability of breast cancer cell lines; retards cells cycle progression at S phase and induce mitochondrial-mediated cell apoptosis. CT-1 selectively binds to minor groove of DNA and induces DNA damage leading to increase in p53 along with decrease in its ubiquitination. Inhibition of p53 with pharmacological inhibitor as well as siRNA revealed the necessity of p53 in CT-1-mediated anti-cancer effects in breast cancer cells. Studies using several other intact p53 and deficient p53 cancer cell lines further confirmed necessity of p53 in CT-1-mediated anti-cancer response. Pharmacological inhibition of pan-caspase showed CT-1 induces caspase-dependent cell death in breast cancer cells. Most interestingly, oral administration of CT-1 induces significant inhibition of tumor growth in LA-7 syngeneic orthotropic rat mammary tumor model. CT-1 treated mammary tumor shows enhancement in DNA damage, p53 upregulation, and apoptosis. Collectively, CT-1 exhibits potent anti-cancer effect both in vitro and in vivo and could serve as a safe orally active lead for anti-cancer drug development. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

  13. The Central Sirtuin 1/p53 Pathway Is Essential for the Orexigenic Action of Ghrelin

    PubMed Central

    Velásquez, Douglas A.; Martínez, Gloria; Romero, Amparo; Vázquez, María J.; Boit, Katia D.; Dopeso-Reyes, Iria G.; López, Miguel; Vidal, Anxo; Nogueiras, Ruben; Diéguez, Carlos

    2011-01-01

    OBJECTIVE Ghrelin is a stomach-derived peptide that increases food intake through the activation of hypothalamic AMP-activated protein kinase (AMPK). However, the molecular mechanisms initiated by the activation of the ghrelin receptor, which in turn lead to AMPK activation, remain unclear. Sirtuin 1 (SIRT1) is a deacetylase activated in response to calorie restriction that acts through the tumor suppressor gene p53. We tested the hypothesis that the central SIRT1/p53 pathway might be mediating the orexigenic action of ghrelin. RESEARCH DESIGN AND METHODS SIRT1 inhibitors, such as Ex527 and sirtinol, and AMPK activators, such as AICAR, were administered alongside ghrelin in the brain of rats and mice (wild-type versus p53 knockout [KO]). Their hypothalamic effects on lipid metabolism and changes in transcription factors and neuropeptides were assessed by Western blot and in situ hybridization. RESULTS The central pretreatment with Ex527, a potent SIRT1 inhibitor, blunted the ghrelin-induced food intake in rats. Mice lacking p53, a target of SIRT1 action, failed to respond to ghrelin in feeding behavior. Ghrelin failed to phosphorylate hypothalamic AMPK when rats were pretreated with Ex527, as it did in p53 KO mice. It is noteworthy that the hypothalamic SIRT1/p53 pathway seems to be specific for mediating the orexigenic action of ghrelin, because central administration of AICAR, a potent AMPK activator, increased food intake in p53 KO mice. Finally, blockade of the central SIRT1 pathway did not modify ghrelin-induced growth hormone secretion. CONCLUSIONS Ghrelin specifically triggers a central SIRT1/p53 pathway that is essential for its orexigenic action, but not for the release of growth hormone. PMID:21386086

  14. Substrate phosphorylation and feedback regulation in JFK-promoted p53 destabilization.

    PubMed

    Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

    2011-02-11

    The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G(1) arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation.

  15. Substrate Phosphorylation and Feedback Regulation in JFK-promoted p53 Destabilization*

    PubMed Central

    Sun, Luyang; Shi, Lei; Wang, Feng; Huangyang, Peiwei; Si, Wenzhe; Yang, Jie; Yao, Zhi; Shang, Yongfeng

    2011-01-01

    The p53 tumor suppressor plays a central role in integrating cellular responses to various stresses. Tight regulation of p53 is thus essential for the maintenance of genome integrity and normal cell proliferation. Previously, we reported that JFK, the only Kelch domain-containing F-box protein in human, promotes ubiquitination and degradation of p53 and that unlike the other E3 ligases for p53, all of which possess an intrinsic ubiquitin ligase activity, JFK destabilizes p53 through the assembly of a Skp1-Cul1-F-box complex. Here, we report that the substrate recognition by JFK requires phosphorylation of p53 in its central core region by CSN (COP9 signalosome)-associated kinase. Significantly, inhibition of CSN-associated kinase activity or knockdown of CSN5 impairs JFK-promoted p53 degradation, enhances p53-dependent transcription, and promotes cell growth suppression, G1 arrest, and apoptosis. Moreover, we showed that JFK is transcriptionally regulated by p53 and forms an auto-regulatory negative feedback loop with p53. These data may shed new light on the functional connection between CSN, Skp1-Cul1-F-box ubiquitin ligase, and p53 and provide a molecular mechanism for the regulation of JFK-promoted p53 degradation. PMID:21127074

  16. Cytochrome P450 monooxygenase CYP53 family in fungi: comparative structural and evolutionary analysis and its role as a common alternative anti-fungal drug target.

    PubMed

    Jawallapersand, Poojah; Mashele, Samson Sitheni; Kovačič, Lidija; Stojan, Jure; Komel, Radovan; Pakala, Suresh Babu; Kraševec, Nada; Syed, Khajamohiddin

    2014-01-01

    Cytochrome P450 monooxygenases (CYPs/P450s) are heme-thiolate proteins whose role as a drug target against pathogenic microbes has been explored because of their stereo- and regio-specific oxidation activity. We aimed to assess the CYP53 family's role as a common alternative drug target against animal (including human) and plant pathogenic fungi and its role in fungal-mediated wood degradation. Genome-wide analysis of fungal species revealed the presence of CYP53 members in ascomycetes and basidiomycetes. Basidiomycetes had a higher number of CYP53 members in their genomes than ascomycetes. Only two CYP53 subfamilies were found in ascomycetes and six subfamilies in basidiomycetes, suggesting that during the divergence of phyla ascomycetes lost CYP53 P450s. According to phylogenetic and gene-structure analysis, enrichment of CYP53 P450s in basidiomycetes occurred due to the extensive duplication of CYP53 P450s in their genomes. Numerous amino acids (103) were found to be conserved in the ascomycetes CYP53 P450s, against only seven in basidiomycetes CYP53 P450s. 3D-modelling and active-site cavity mapping data revealed that the ascomycetes CYP53 P450s have a highly conserved protein structure whereby 78% amino acids in the active-site cavity were found to be conserved. Because of this rigid nature of ascomycetes CYP53 P450s' active site cavity, any inhibitor directed against this P450 family can serve as a common anti-fungal drug target, particularly toward pathogenic ascomycetes. The dynamic nature of basidiomycetes CYP53 P450s at a gene and protein level indicates that these P450s are destined to acquire novel functions. Functional analysis of CYP53 P450s strongly supported our hypothesis that the ascomycetes CYP53 P450s ability is limited for detoxification of toxic molecules, whereas basidiomycetes CYP53 P450s play an additional role, i.e. involvement in degradation of wood and its derived components. This study is the first report on genome-wide comparative structural (gene and protein structure-level) and evolutionary analysis of a fungal P450 family.

  17. Synergistic effect of p53 on TSA-induced stanniocalcin 1 expression in human nasopharyngeal carcinoma cells, CNE2.

    PubMed

    Ching, L Y; Yeung, Bonnie H Y; Wong, Chris K C

    2012-06-01

    Human stanniocalcin 1 (STC1) has recently been identified as a putative protein factor involved in cellular apoptosis. The use of histone deacetylase inhibitor (i.e. trichostatin A (TSA)) and doxorubicin (Dox) is one of the common treatment methods to induce apoptosis in human cancer cells. A study on TSA and Dox-mediated apoptosis may shed light on the regulation and function of STC1 in cancer treatment. In this study, TSA and Dox cotreatment in human nasopharyngeal carcinoma cells (CNE2) elicited synergistic effects on STC1 gene expression and cellular apoptosis. An activation of p53 (TP53) transcriptional activity in Dox- or Dox+TSA-treated cells was revealed by the increased expression levels of p53 mRNA/protein as well as p53-driven luciferase activities. To elucidate the possible involvement of p53 in STC1 gene transcription, a vector expressing wild-type or dominant negative (DN) p53 was transiently transfected into the cells. Both STC1 promoter luciferase constructs and chromatin immunoprecipitation assays did not support the direct role of p53 in STC1 gene transactivation. However, the synergistic effects of p53 on the induction of NF-κB phosphorylation and the recruitment of acetylated histone H3 in STC1 promoter were observed in TSA-cotreated cells. The overexpression of exogenous STC1 sensitized apoptosis in Dox-treated cells. Taken together, this study provides data to show the cross talk of NF-κB, p53, and histone protein in the regulation of STC1 expression and function.

  18. Curcumin causes superoxide anion production and p53-independent apoptosis in human colon cancer cells.

    PubMed

    Watson, Jane L; Hill, Richard; Yaffe, Paul B; Greenshields, Anna; Walsh, Mark; Lee, Patrick W; Giacomantonio, Carman A; Hoskin, David W

    2010-11-01

    Curcumin from the rhizome of theCurcuma longa plant has chemopreventative activity and inhibits the growth of neoplastic cells. Since p53 has been suggested to be important for anticancer activity by curcumin, we investigated curcumin-induced cytotoxicity in cultures of p53(+/+) and p53(-/-) HCT-116 colon cancer cells, as well as mutant p53 HT-29 colon cancer cells. Curcumin killed wild-type p53 HCT-116 cells and mutant p53 HT-29 cells in a dose- and time-dependent manner. In addition, curcumin-treated p53(+/+) HCT-116 cells and mutant p53 HT-29 cells showed upregulation of total and activated p53, as well as increased expression of p53-regulated p21, PUMA (p53 upregulated modulator of apoptosis), and Bax; however, an equivalent cytotoxic effect by curcumin was observed in p53(+/+) and p53(-/-) HCT-116 cells, demonstrating that curcumin-induced cytotoxicity was independent of p53 status. Similar results were obtained when the cytotoxic effect of curcumin was assessed in wild-type p53 HCT-116 cells after siRNA-mediated p53 knockdown. Chromatin condensation, poly (ADP-ribose) polymerase-1 cleavage and reduced pro-caspase-3 levels in curcumin-treated p53(+/+) and p53(-/-) HCT-116 cells suggested that curcumin caused apoptosis. In addition, exposure to curcumin resulted in superoxide anion production and phosphorylation of oxidative stress proteins in p53(+/+) and p53(-/-) HCT-116 cells. Collectively, our results indicate that, despite p53 upregulation and activation, curcumin-induced apoptosis in colon cancer cells was independent of p53 status and involved oxidative stress. Curcumin may therefore have therapeutic potential in the management of colon cancer, especially in tumorsthatare resistant to conventional chemotherapydue todefects inp53 expression or function. 2010 Elsevier Ireland Ltd. All rights reserved.

  19. PRMT1-Mediated Translation Regulation is a Crucial Vulnerability of Cancer | Office of Cancer Genomics

    Cancer.gov

    Through an shRNA screen, we identified the protein arginine methyltransferase Prmt1 as a vulnerable intervention point in murine p53/Rb-null osteosarcomas, the human counterpart of which lacks effective therapeutic options. Depletion of Prmt1 in p53-deficient cells impaired tumor initiation and maintenance in vitro and in vivo Mechanistic studies reveal that translation-associated pathways were enriched for Prmt1 downstream targets, implicating Prmt1 in translation control.

  20. Free Radicals Generated by Ionizing Radiation Signal Nuclear Translocation of p53

    NASA Technical Reports Server (NTRS)

    Martinez, J. D.; Pennington, M. E.; Craven, M. T.; Warters, R. L.

    1997-01-01

    The p53 tumor suppressor is a transcription factor that regulates several pathways, which function collectively to maintain the integrity of the genome. Nuclear localization is critical for wild-type function. However, the signals that regulate subcellular localization of p53 have not been identified. Here, we examine the effect of ionizing radiation on the subcellular localization of p53 in two cell lines in which p63 is normally sequestered in the cytoplasm and found that ionizing radiation caused a biphasic translocation response. p53 entered the nucleus 1-2 hours postirradiation (early response), subsequently emerged from the nucleus, and then again entered the nucleus 12-24 hours after the cells had been irradiated (delayed response). These changes in subcellular localization could be completely blocked by the free radical scavenger, WR1065. By comparison, two DNA-damaging agents that do not generate free radicals, mitomycin C and doxorubicin, caused translocation only after 12-24 h of exposure to the drugs, and this effect could not be inhibited by WR1065. Hence, although all three DNA-damaging agents induced relocalization of p53 to the nucleus, only the translocation caused by radiation was sensitive to free radical scavenging. We suggest that the free radicals generated by ionizing radiation can signal p53 translocation to the nucleus.

  1. The nucleolus directly regulates p53 export and degradation.

    PubMed

    Boyd, Mark T; Vlatkovic, Nikolina; Rubbi, Carlos P

    2011-09-05

    The correlation between stress-induced nucleolar disruption and abrogation of p53 degradation is evident after a wide variety of cellular stresses. This link may be caused by steps in p53 regulation occurring in nucleoli, as suggested by some biochemical evidence. Alternatively, nucleolar disruption also causes redistribution of nucleolar proteins, potentially altering their interactions with p53 and/or MDM2. This raises the fundamental question of whether the nucleolus controls p53 directly, i.e., as a site where p53 regulatory processes occur, or indirectly, i.e., by determining the cellular localization of p53/MDM2-interacting factors. In this work, transport experiments based on heterokaryons, photobleaching, and micronucleation demonstrate that p53 regulatory events are directly regulated by nucleoli and are dependent on intact nucleolar structure and function. Subcellular fractionation and nucleolar isolation revealed a distribution of ubiquitylated p53 that supports these findings. In addition, our results indicate that p53 is exported by two pathways: one stress sensitive and one stress insensitive, the latter being regulated by activities present in the nucleolus.

  2. p53 -Dependent and -Independent Nucleolar Stress Responses

    PubMed Central

    Olausson, Karl Holmberg; Nistér, Monica; Lindström, Mikael S.

    2012-01-01

    The nucleolus has emerged as a cellular stress sensor and key regulator of p53-dependent and -independent stress responses. A variety of abnormal metabolic conditions, cytotoxic compounds, and physical insults induce alterations in nucleolar structure and function, a situation known as nucleolar or ribosomal stress. Ribosomal proteins, including RPL11 and RPL5, become increasingly bound to the p53 regulatory protein MDM2 following nucleolar stress. Ribosomal protein binding to MDM2 blocks its E3 ligase function leading to stabilization and activation of p53. In this review we focus on a number of novel regulators of the RPL5/RPL11-MDM2-p53 complex including PICT1 (GLTSCR2), MYBBP1A, PML and NEDD8. p53-independent pathways mediating the nucleolar stress response are also emerging and in particular the negative control that RPL11 exerts on Myc oncoprotein is of importance, given the role of Myc as a master regulator of ribosome biogenesis. We also briefly discuss the potential of chemotherapeutic drugs that specifically target RNA polymerase I to induce nucleolar stress. PMID:24710530

  3. Structure and kinetic stability of the p63 tetramerization domain.

    PubMed

    Natan, Eviatar; Joerger, Andreas C

    2012-01-20

    The p53 family of transcription factors--comprising p53, p63 and p73--plays an important role in tumor prevention and development. Essential to their function is the formation of tetramers, allowing cooperative binding to their DNA response elements. We solved crystal structures of the human p63 tetramerization domain, showing that p63 forms a dimer of dimers with D₂ symmetry composed of highly intertwined monomers. The primary dimers are formed via an intramolecular β-sheet and hydrophobic helix packing (H1), a hallmark of all p53 family members. Like p73, but unlike p53, p63 requires a second helix (H2) to stabilize the architecture of the tetramer. In order to investigate the impact of structural differences on tetramer stability, we measured the subunit exchange reaction of p53 family homotetramers by nanoflow electrospray mass spectrometry. There were differences in both the kinetics and the pattern of the exchange reaction, with the p53 and p63 tetramers exhibiting much faster exchange kinetics than p73. The structural similarity between p63 and p73 rationalizes previous observations that p63 and p73 form mixed tetramers, and the kinetic data reveal the dissociation of the p73 homotetramers as the rate-limiting step for heterotetramer formation. Differential stability of the tetramers may play an important role in the cross talk between different isoforms and regulation of p53, p63 and p73 function in the cell cycle. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Comparison of the QuantiGene 2.0 Assay and Real-Time RT-PCR in the Detection of p53 Isoform mRNA Expression in Formalin-Fixed Paraffin-Embedded Tissues- A Preliminary Study

    PubMed Central

    Morten, Brianna C.; Scott, Rodney J.; Avery-Kiejda, Kelly A.

    2016-01-01

    p53 is expressed as multiple smaller isoforms whose functions in cancer are not well understood. The p53 isoforms demonstrate abnormal expression in different cancers, suggesting they are important in modulating the function of full-length p53 (FLp53). The quantification of relative mRNA expression has routinely been performed using real-time PCR (qPCR). However, there are serious limitations when detecting p53 isoforms using this method, particularly for formalin-fixed paraffin-embedded (FFPE) tissues. The use of FFPE tumours would be advantageous to correlate expression of p53 isoforms with important clinical features of cancer. One alternative method of RNA detection is the hybridization-based QuantiGene 2.0 Assay, which has been shown to be advantageous for the detection of RNA from FFPE tissues. In this pilot study, we compared the QuantiGene 2.0 Assay to qPCR for the detection of FLp53 and its isoform Δ40p53 in matched fresh frozen (FF) and FFPE breast tumours. FLp53 mRNA expression was detected using qPCR in FF and FFPE tissues, but Δ40p53 mRNA was only detectable in FF tissues. Similar results were obtained for the QuantiGene 2.0 Assay. FLp53 relative mRNA expression was shown to be strongly correlated between the two methods (R2 = 0.9927, p = 0.0031) in FF tissues, however Δ40p53 was not (R2 = 0.4429, p = 0.3345). When comparing the different methods for the detection of FLp53 mRNA from FFPE and FF samples, no correlation (R2 = 0.0002, p = 0.9863) was shown using the QuantiGene 2.0 Assay, and in contrast, the level of expression was highly correlated between the two tissues using qPCR (R2 = 0.8753, p = 0.0644). These results suggest that both the QuantiGene 2.0 Assay and qPCR methods are inadequate for the quantification of Δ40p53 mRNA in FFPE tissues. Therefore, alternative methods of RNA detection and quantification are required to study the relative expression of Δ40p53 in FFPE samples. PMID:27832134

  5. Poly(beta-amino ester) nanoparticle-delivery of p53 has activity against small cell lung cancer in vitro and in vivo

    PubMed Central

    Kamat, Chandrashekhar D.; Shmueli, Ron B.; Connis, Nick; Rudin, Charles M.; Green, Jordan J.; Hann, Christine L.

    2013-01-01

    Small cell lung cancer (SCLC) is an aggressive disease with one of the highest case-fatality rates among cancer. The recommended therapy for SCLC has not changed significantly over the past 30 years; new therapeutic approaches are a critical need. TP53 is mutated in the majority of SCLC cases and its loss is required in transgenic mouse models of the disease. We synthesized an array of biodegradable poly(beta-amino ester) (PBAE) polymers which self-assemble with DNA and assayed for transfection efficiency in the p53-mutant H446 SCLC cell line using high-throughput methodologies. Two of the top candidates were selected for further characterization and TP53 delivery in vitro and in vivo. Nanoparticle delivery of TP53 resulted in expression of exogenous p53, induction of p21, induction of apoptosis and accumulation of cells in sub-G1 consistent with functional p53 activity. Intratumoral injection of subcutaneous H446 xenografts with polymers carrying TP53 caused marked tumor growth inhibition. This is the first demonstration of TP53 gene therapy in SCLC using non-viral polymeric nanoparticles. This technology may have general applicability as a novel anti-cancer strategy based on restoration of tumor suppressor gene function. PMID:23364678

  6. ATM phosphorylation of Mdm2 Ser394 regulates the amplitude and duration of the DNA damage response in mice

    PubMed Central

    Gannon, Hugh S.; Woda, Bruce A.; Jones, Stephen N.

    2012-01-01

    Summary DNA damage induced by ionizing radiation (IR) activates the ATM kinase, which subsequently stabilizes and activates the p53 tumor suppressor protein. Although phosphorylation of p53 by ATM was found previously to modulate p53 levels and transcriptional activities in vivo, it does not appear to be a major regulator of p53 stability. We have utilized mice bearing altered Mdm2 alleles to demonstrate that ATM phosphorylation of Mdm2 serine 394 is required for robust p53 stabilization and activation after DNA damage. In addition, we demonstrate that dephosphorylation of Mdm2 Ser394 regulates attenuation of the p53-mediated response to DNA damage. Therefore, the phosphorylation status of Mdm2 Ser394 governs p53 protein levels and functions in cells undergoing DNA damage. PMID:22624716

  7. MYCN acts as a direct co-regulator of p53 in MYCN amplified neuroblastoma.

    PubMed

    Agarwal, Saurabh; Milazzo, Giorgio; Rajapakshe, Kimal; Bernardi, Ronald; Chen, Zaowen; Barberi, Eveline; Koster, Jan; Perini, Giovanni; Coarfa, Cristian; Shohet, Jason M

    2018-04-17

    The MYC oncogenes and p53 have opposing yet interrelated roles in normal development and tumorigenesis. How MYCN expression alters the biology and clinical responsiveness of pediatric neuroblastoma remains poorly defined. Neuroblastoma is p53 wild type at diagnosis and repression of p53 signaling is required for tumorigenesis. Here, we tested the hypothesis that MYCN amplification alters p53 transcriptional activity in neuroblastoma. Interestingly, we found that MYCN directly binds to the tetrameric form of p53 at its C-terminal domain, and this interaction is independent of MYCN/MAX heterodimer formation. Chromatin analysis of MYCN and p53 targets reveals dramatic changes in binding, as well as co-localization of the MYCN-p53 complex at p53-REs and E-boxes of genes critical to DNA damage responses and cell cycle progression. RNA sequencing studies show that MYCN-p53 co-localization significantly modulated the expression of p53 target genes. Furthermore, MYCN-p53 interaction leads to regulation of alternative p53 targets not regulated in the presence of low MYCN levels. These novel targets include a number of genes involved in lipid metabolism, DNA repair, and apoptosis. Taken together, our findings demonstrate a novel oncogenic role of MYCN as a transcriptional co-regulator of p53 in high-risk MYCN amplified neuroblastoma. Targeting this novel oncogenic function of MYCN may enhance p53-mediated responses and sensitize MYCN amplified tumors to chemotherapy.

  8. Integration of Genomic, Biologic, and Chemical Approaches to Target p53 Loss and Gain-of-Function in Triple Negative Breast Cancer

    DTIC Science & Technology

    2016-09-01

    in this progress report: p53 triple-negative breast cancer subtypes gene expression somatic cell genetics CRISPR /Cas 3. ACCOMPLISHMENTS Major...report, we described the creation of an isogenic p53 mutant TNBC cell line panel using CRISPR /Cas-mediated genome editing8 and the resultant...LOF null state. To validate that mutant p53 is directly responsible for this altered transcription, we will use the same CRISPR -mediated genome

  9. Long Non-coding RNA, PANDA, Contributes to the Stabilization of p53 Tumor Suppressor Protein.

    PubMed

    Kotake, Yojiro; Kitagawa, Kyoko; Ohhata, Tatsuya; Sakai, Satoshi; Uchida, Chiharu; Niida, Hiroyuki; Naemura, Madoka; Kitagawa, Masatoshi

    2016-04-01

    P21-associated noncoding RNA DNA damage-activated (PANDA) is induced in response to DNA damage and represses apoptosis by inhibiting the function of nuclear transcription factor Y subunit alpha (NF-YA) transcription factor. Herein, we report that PANDA affects regulation of p53 tumor-suppressor protein. U2OS cells were transfected with PANDA siRNAs. At 72 h post-transfection, cells were subjected to immunoblotting and quantitative reverse transcription-polymerase chain reaction. Depletion of PANDA was associated with decreased levels of p53 protein, but not p53 mRNA. The stability of p53 protein was markedly reduced by PANDA silencing. Degradation of p53 protein by silencing PANDA was prevented by treatment of MG132, a proteasome inhibitor. Moreover, depletion of PANDA prevented accumulation of p53 protein, as a result of DNA damage, induced by the genotoxic agent etoposide. These results suggest that PANDA stabilizes p53 protein in response to DNA damage, and provide new insight into the regulatory mechanisms of p53. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  10. p53 regulates cytoskeleton remodeling to suppress tumor progression.

    PubMed

    Araki, Keigo; Ebata, Takahiro; Guo, Alvin Kunyao; Tobiume, Kei; Wolf, Steven John; Kawauchi, Keiko

    2015-11-01

    Cancer cells possess unique characteristics such as invasiveness, the ability to undergo epithelial-mesenchymal transition, and an inherent stemness. Cell morphology is altered during these processes and this is highly dependent on actin cytoskeleton remodeling. Regulation of the actin cytoskeleton is, therefore, important for determination of cell fate. Mutations within the TP53 (tumor suppressor p53) gene leading to loss or gain of function (GOF) of the protein are often observed in aggressive cancer cells. Here, we highlight the roles of p53 and its GOF mutants in cancer cell invasion from the perspective of the actin cytoskeleton; in particular its reorganization and regulation by cell adhesion molecules such as integrins and cadherins. We emphasize the multiple functions of p53 in the regulation of actin cytoskeleton remodeling in response to the extracellular microenvironment, and oncogene activation. Such an approach provides a new perspective in the consideration of novel targets for anti-cancer therapy.

  11. Mutant p53 establishes targetable tumor dependency by promoting unscheduled replication

    PubMed Central

    Singh, Shilpa; Vaughan, Catherine A.; Frum, Rebecca A.; Grossman, Steven R.; Deb, Sumitra

    2017-01-01

    Gain-of-function (GOF) p53 mutations are observed frequently in most intractable human cancers and establish dependency for tumor maintenance and progression. While some of the genes induced by GOF p53 have been implicated in more rapid cell proliferation compared with p53-null cancer cells, the mechanism for dependency of tumor growth on mutant p53 is unknown. This report reveals a therapeutically targetable mechanism for GOF p53 dependency. We have shown that GOF p53 increases DNA replication origin firing, stabilizes replication forks, and promotes micronuclei formation, thus facilitating the proliferation of cells with genomic abnormalities. In contrast, absence or depletion of GOF p53 leads to decreased origin firing and a higher frequency of fork collapse in isogenic cells, explaining their poorer proliferation rate. Following genome-wide analyses utilizing ChIP-Seq and RNA-Seq, GOF p53–induced origin firing, micronuclei formation, and fork protection were traced to the ability of GOF p53 to transactivate cyclin A and CHK1. Highlighting the therapeutic potential of CHK1’s role in GOF p53 dependency, experiments in cell culture and mouse xenografts demonstrated that inhibition of CHK1 selectively blocked proliferation of cells and tumors expressing GOF p53. Our data suggest the possibility that checkpoint inhibitors could efficiently and selectively target cancers expressing GOF p53 alleles. PMID:28394262

  12. Nuclear Interaction between ADR-Induced p65 and p53 Mediates Cardiac Injury in iNOS (−/−) Mice

    PubMed Central

    Cole, Marsha P.; Tangpong, Jitbanjong; Oberley, Terry D.; Chaiswing, Luksana; Kiningham, Kinsley K.; St. Clair, Daret K.

    2014-01-01

    Adriamycin (ADR) treatment causes an imbalance in the levels of nitric oxide (•NO) and superoxide (O2 •−) production leading to cardiac injury. Previously we demonstrated that mice lacking inducible nitric oxide synthase (iNOS) have increased oxidative stress and mitochondrial injury. The molecular events leading to increased mitochondrial injury in iNOS deficient mice is unknown. ADR in the absence of iNOS preferentially activates a proapoptotic pathway without a concurrent increase in prosurvival pathways. Treatment with ADR leads to an increase in DNA binding activity of nuclear factor kappa B (NFκB) and p53 in wildtype mice. Following ADR treatment, p53, but not NFκB DNA binding activity, as well as the level of Bax, a p53 target gene, was increased in iNOS (−/−) mice. This apoptotic signaling effect in iNOS (−/−) is alleviated by overexpression of manganese superoxide dismutase (MnSOD). Increases in NFκB and p53 in ADR-treated wildtype mice did not lead to increases in target genes such as MnSOD, bcl-xL, or Bax. Moreover, co-immunoprecipitation analysis revealed that p65, a prominent member of the NFκB family, interacts with p53 in the nucleus. These results suggest that NFκB and p53 may counter act one another's actions in ADR-treated wildtype (WT) mice. Further, these results identify a novel mechanism by which oxidative stress may regulate transcription of proapoptotic genes. PMID:24586632

  13. p53-Mediated Cellular Response to DNA Damage in Cells with Replicative Hepatitis B Virus

    NASA Astrophysics Data System (ADS)

    Puisieux, Alain; Ji, Jingwei; Guillot, Celine; Legros, Yann; Soussi, Thierry; Isselbacher, Kurt; Ozturk, Mehmet

    1995-02-01

    Wild-type p53 acts as a tumor suppressor gene by protecting cells from deleterious effects of genotoxic agents through the induction of a G_1/S arrest or apoptosis as a response to DNA damage. Transforming proteins of several oncogenic DNA viruses inactivate tumor suppressor activity of p53 by blocking this cellular response. To test whether hepatitis B virus displays a similar effect, we studied the p53-mediated cellular response to DNA damage in 2215 hepatoma cells with replicative hepatitis B virus. We demonstrate that hepatitis B virus replication does not interfere with known cellular functions of p53 protein.

  14. Olfaction in People with Down Syndrome: A Comprehensive Assessment across Four Decades of Age.

    PubMed

    Cecchini, Maria Paola; Viviani, Dario; Sandri, Marco; Hähner, Antje; Hummel, Thomas; Zancanaro, Carlo

    2016-01-01

    Down syndrome (DS) shows neuropathology similar to Alzheimer disease, which presents olfactory impairment. Previous work showed olfactory impairment in DS, but a comprehensive evaluation of olfactory function in DS is lacking. We investigated a large number (n = 56; M = 31, F = 25) DS participants (age range18-57y) using the "Sniffin' Sticks" Extended test. This comprises three subtests (threshold, discrimination, and identification) yielding a global score (TDI) defining normosmia, hyposmia, and functional anosmia. To the best of our knowledge, this is the second largest group of DS people investigated for olfactory function ever. Age- and sex matched euploid individuals (n = 53) were the control. In DS, TDI was lower (16.7±5.13 vs. 35.4±3.74; P<0.001), with DS people performing worse in any subtests (P<0.001 for all); 27 DS participants showed functional anosmia (i.e., TDI<16). In DS, age was weakly and negatively correlated with TDI (r = -0.28, P = 0.036) and identification (r = -0.34, P = 0.012). When participants were stratified in young adults (18-29y) and older adults (30-61y), a significant effect of age was found for identification in both DS (young adults, 8.3±2.58; older adults, 6.9±2.99; P = 0.031) and control (young-adult, 14.3±1.18, older adult, 13.0±1.54; P = 0.016). Olfactory function is overall severely impaired in DS people and may be globally impaired at relatively young age, despite of reportedly normal smell. However, specificity of this olfactory profile to DS should be considered with some caution because cognition was not evaluated in all DS participants and comparison with a control group of non-DS individuals having cognitive disabilities was lacking. Further study is required to longitudinally assess olfactory dysfunction in DS and to correlate it with brain pathology.

  15. Olfaction in People with Down Syndrome: A Comprehensive Assessment across Four Decades of Age

    PubMed Central

    Cecchini, Maria Paola; Viviani, Dario; Sandri, Marco; Hähner, Antje; Hummel, Thomas; Zancanaro, Carlo

    2016-01-01

    Background Down syndrome (DS) shows neuropathology similar to Alzheimer disease, which presents olfactory impairment. Previous work showed olfactory impairment in DS, but a comprehensive evaluation of olfactory function in DS is lacking. Methods We investigated a large number (n = 56; M = 31, F = 25) DS participants (age range18-57y) using the “Sniffin’ Sticks” Extended test. This comprises three subtests (threshold, discrimination, and identification) yielding a global score (TDI) defining normosmia, hyposmia, and functional anosmia. To the best of our knowledge, this is the second largest group of DS people investigated for olfactory function ever. Age- and sex matched euploid individuals (n = 53) were the control. Results In DS, TDI was lower (16.7±5.13 vs. 35.4±3.74; P<0.001), with DS people performing worse in any subtests (P<0.001 for all); 27 DS participants showed functional anosmia (i.e., TDI<16). In DS, age was weakly and negatively correlated with TDI (r = -0.28, P = 0.036) and identification (r = -0.34, P = 0.012). When participants were stratified in young adults (18-29y) and older adults (30-61y), a significant effect of age was found for identification in both DS (young adults, 8.3±2.58; older adults, 6.9±2.99; P = 0.031) and control (young-adult, 14.3±1.18, older adult, 13.0±1.54; P = 0.016). Conclusion Olfactory function is overall severely impaired in DS people and may be globally impaired at relatively young age, despite of reportedly normal smell. However, specificity of this olfactory profile to DS should be considered with some caution because cognition was not evaluated in all DS participants and comparison with a control group of non-DS individuals having cognitive disabilities was lacking. Further study is required to longitudinally assess olfactory dysfunction in DS and to correlate it with brain pathology. PMID:26730728

  16. Overexpression of p53 mRNA in colorectal cancer and its relationship to p53 gene mutation.

    PubMed Central

    el-Mahdani, N.; Vaillant, J. C.; Guiguet, M.; Prévot, S.; Bertrand, V.; Bernard, C.; Parc, R.; Béréziat, G.; Hermelin, B.

    1997-01-01

    We analysed the frequency of p53 mRNA overexpression in a series of 109 primary colorectal carcinomas and its association with p53 gene mutation, which has been correlated with short survival. Sixty-nine of the 109 cases (63%) demonstrated p53 mRNA overexpression, without any correlation with stage or site of disease. Comparison with p53 gene mutation indicated that, besides cases in which p53 gene mutation and p53 mRNA overexpression were either both present (40 cases) or both absent (36 cases), there were also cases in which p53 mRNA was overexpressed in the absence of any mutation (29 cases) and those with a mutant gene in which the mRNA was not overexpressed (four cases). Moreover, the mutant p53 tumours exhibited an increase of p53 mRNA expression, which was significantly higher in tumours expressing the mutated allele alone than in tumours expressing both wild- and mutated-type alleles. These data (1) show that p53 mRNA overexpression is a frequent event in colorectal tumours and is not predictive of the status of the gene, i.e. whether or not a mutation is present; (2) provide further evidence that p53 protein overexpression does not only result from an increase in the half-life of mutated p53 and suggest that inactivation of the p53 function in colorectal cancers involves at least two distinct mechanisms, including p53 overexpression and/or mutation; and (3) suggest that p53 mRNA overexpression is an early event, since it is not correlated with Dukes stage. PMID:9052405

  17. Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F₀-ATP synthase

    PubMed Central

    Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

    2013-01-01

    We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53+/+ cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria. PMID:23966169

  18. Mitochondrial p53 mediates a transcription-independent regulation of cell respiration and interacts with the mitochondrial F₁F0-ATP synthase.

    PubMed

    Bergeaud, Marie; Mathieu, Lise; Guillaume, Arnaud; Moll, Ute M; Mignotte, Bernard; Le Floch, Nathalie; Vayssière, Jean-Luc; Rincheval, Vincent

    2013-09-01

    We and others previously reported that endogenous p53 can be located at mitochondria in the absence of stress, suggesting that p53 has a role in the normal physiology of this organelle. The aim of this study was to characterize in unstressed cells the intramitochondrial localization of p53 and identify new partners and functions of p53 in mitochondria. We find that the intramitochondrial pool of p53 is located in the intermembrane space and the matrix. Of note, unstressed HCT116 p53(+/+) cells simultaneously show increased O₂ consumption and decreased mitochondrial superoxide production compared with their p53-null counterpart. This data was confirmed by stable H1299 cell lines expressing low levels of p53 specifically targeted to the matrix. Using immunoprecipitation and mass spectrometry, we identified the oligomycin sensitivity-conferring protein (OSCP), a subunit of the F₁F₀-ATP synthase complex, as a new partner of endogenous p53, specifically interacting with p53 localized in the matrix. Interestingly, this interaction seems implicated in mitochondrial p53 localization. Moreover, p53 localized in the matrix promotes the assembly of F₁F₀-ATP synthase. Taking into account that deregulations of mitochondrial respiration and reactive oxygen species production are tightly linked to cancer development, we suggest that mitochondrial p53 may be an important regulator of normal mitochondrial and cellular physiology, potentially exerting tumor suppression activity inside mitochondria.

  19. p53 regulates the mevalonate pathway in human glioblastoma multiforme

    PubMed Central

    Laezza, C; D'Alessandro, A; Di Croce, L; Picardi, P; Ciaglia, E; Pisanti, S; Malfitano, A M; Comegna, M; Faraonio, R; Gazzerro, P; Bifulco, M

    2015-01-01

    The mevalonate (MVA) pathway is an important metabolic pathway implicated in multiple aspects of tumorigenesis. In this study, we provided evidence that p53 induces the expression of a group of enzymes of the MVA pathway including 3′-hydroxy-3′-methylglutaryl-coenzyme A reductase, MVA kinase, farnesyl diphosphate synthase and farnesyl diphosphate farnesyl transferase 1, in the human glioblastoma multiforme cell line, U343 cells, and in normal human astrocytes, NHAs. Genetic and pharmacologic perturbation of p53 directly influences the expression of these genes. Furthermore, p53 is recruited to the gene promoters in designated p53-responsive elements, thereby increasing their transcription. Such effect was abolished by site-directed mutagenesis in the p53-responsive element of promoter of the genes. These findings highlight another aspect of p53 functions unrelated to tumor suppression and suggest p53 as a novel regulator of the MVA pathway providing insight into the role of this pathway in cancer progression. PMID:26469958

  20. The tumour suppressor CYLD regulates the p53 DNA damage response

    PubMed Central

    Fernández-Majada, Vanesa; Welz, Patrick-Simon; Ermolaeva, Maria A.; Schell, Michael; Adam, Alexander; Dietlein, Felix; Komander, David; Büttner, Reinhard; Thomas, Roman K.; Schumacher, Björn; Pasparakis, Manolis

    2016-01-01

    The tumour suppressor CYLD is a deubiquitinase previously shown to inhibit NF-κB, MAP kinase and Wnt signalling. However, the tumour suppressing mechanisms of CYLD remain poorly understood. Here we show that loss of CYLD catalytic activity causes impaired DNA damage-induced p53 stabilization and activation in epithelial cells and sensitizes mice to chemical carcinogen-induced intestinal and skin tumorigenesis. Mechanistically, CYLD interacts with and deubiquitinates p53 facilitating its stabilization in response to genotoxic stress. Ubiquitin chain-restriction analysis provides evidence that CYLD removes K48 ubiquitin chains from p53 indirectly by cleaving K63 linkages, suggesting that p53 is decorated with complex K48/K63 chains. Moreover, CYLD deficiency also diminishes CEP-1/p53-dependent DNA damage-induced germ cell apoptosis in the nematode Caenorhabditis elegans. Collectively, our results identify CYLD as a deubiquitinase facilitating DNA damage-induced p53 activation and suggest that regulation of p53 responses to genotoxic stress contributes to the tumour suppressor function of CYLD. PMID:27561390

  1. Conformational detection of p53's oligomeric state by FlAsH Fluorescence.

    PubMed

    Webber, Tawnya M; Allen, Andrew C; Ma, Wai Kit; Molloy, Rhett G; Kettelkamp, Charisse N; Dow, Caitlin A; Gage, Matthew J

    2009-06-19

    The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo.

  2. Conformational detection of p53's oligomeric state by FlAsH Fluorescence

    PubMed Central

    Webber, Tawnya M.; Allen, Andrew C.; Ma, Wai Kit; Molloy, Rhett G.; Kettelkamp, Charisse N.; Dow, Caitlin A.; Gage, Matthew J.

    2009-01-01

    The p53 tumor suppressor protein is a critical checkpoint in prevention of tumor formation, and the function of p53 is dependent on proper formation of the active tetramer. In vitro studies have shown that p53 binds DNA most efficiently as a tetramer, though inactive p53 is predicted to be monomeric in vivo. We demonstrate that FlAsH binding can be used to distinguish between oligomeric states of p53, providing a potential tool to explore p53 oligomerization in vivo. The FlAsH tetra-cysteine binding motif has been incorporated along the dimer and tetramer interfaces in the p53 tetramerization domain to create reporters for the dimeric and tetrameric states of p53, though the geometry of the four cysteines is critical for efficient FlAsH binding. Furthermore, we demonstrate that FlAsH binding can be used to monitor tetramer formation in real-time. These results demonstrate the potential for using FlAsH fluorescence to monitor protein-protein interactions in vivo. PMID:19393630

  3. CRISPR-Cas9-based target validation for p53-reactivating model compounds

    PubMed Central

    Wanzel, Michael; Vischedyk, Jonas B; Gittler, Miriam P; Gremke, Niklas; Seiz, Julia R; Hefter, Mirjam; Noack, Magdalena; Savai, Rajkumar; Mernberger, Marco; Charles, Joël P; Schneikert, Jean; Bretz, Anne Catherine; Nist, Andrea; Stiewe, Thorsten

    2015-01-01

    Inactivation of the p53 tumor suppressor by Mdm2 is one of the most frequent events in cancer, so compounds targeting the p53-Mdm2 interaction are promising for cancer therapy. Mechanisms conferring resistance to p53-reactivating compounds are largely unknown. Here we show using CRISPR-Cas9–based target validation in lung and colorectal cancer that the activity of nutlin, which blocks the p53-binding pocket of Mdm2, strictly depends on functional p53. In contrast, sensitivity to the drug RITA, which binds the Mdm2-interacting N terminus of p53, correlates with induction of DNA damage. Cells with primary or acquired RITA resistance display cross-resistance to DNA crosslinking compounds such as cisplatin and show increased DNA cross-link repair. Inhibition of FancD2 by RNA interference or pharmacological mTOR inhibitors restores RITA sensitivity. The therapeutic response to p53-reactivating compounds is therefore limited by compound-specific resistance mechanisms that can be resolved by CRISPR-Cas9-based target validation and should be considered when allocating patients to p53-reactivating treatments. PMID:26595461

  4. Inhibition of p53 Mutant Peptide Aggregation In Vitro by Cationic Osmolyte Acetylcholine Chloride.

    PubMed

    Chen, Zhaolin; Kanapathipillai, Mathumai

    2017-01-01

    Mutations of tumor suppressor protein p53 are present in almost about 50% of all cancers. It has been reported that the p53 mutations cause aggregation and subsequent loss of p53 function, leading to cancer progression. Here in this study we focus on the inhibitory effects of cationic osmolyte molecules acetylcholine chloride, and choline on an aggregation prone 10 amino acid p53 mutant peptide WRPILTIITL, and the corresponding wildtype peptide RRPILTIITL in vitro. The characterization tools used for this study include Thioflavin- T (ThT) induced fluorescence, transmission electron microscopy (TEM), congo red binding, turbidity, dynamic light scattering (DLS), and cell viability assays. The results show that acetylcholine chloride in micromolar concentrations significantly inhibit p53 mutant peptide aggregation in vitro, and could be promising candidate for p53 mutant/ misfolded protein aggregation inhibition. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  5. Self-aggregation and coaggregation of the p53 core fragment with its aggregation gatekeeper variant.

    PubMed

    Lei, Jiangtao; Qi, Ruxi; Wei, Guanghong; Nussinov, Ruth; Ma, Buyong

    2016-03-21

    Recent studies suggested that p53 aggregation can lead to loss-of-function (LoF), dominant-negative (DN) and gain-of-function (GoF) effects, with adverse cancer consequences. The p53 aggregation-nucleating (251)ILTIITL(257) fragment is a key segment in wild-type p53 aggregation; however, an I254R mutation can prevent it. It was suggested that self-assembly of wild-type p53 and its cross-interaction with mutants differ from the classical amyloid nucleation-growth mechanism. Here, using replica exchange molecular dynamics (REMD) simulations, we studied the cross-interactions of this p53 core fragment and its aggregation rescue I254R mutant. We found that the core fragment displays strong aggregation propensity, whereas the gatekeeper I254R mutant tends to be disordered, consistent with experiments. Our cross-interaction results reveal that the wild-type p53 fragment promotes β-sheet formation of the I254R mutant by shifting the disordered mutant peptides into aggregating states. As a result, the system has similar oligomeric structures, inter-peptide interactions and free energy landscape as the wild type fragment does, revealing a prion-like process. We also found that in the cross-interaction system, the wild-type species has higher tendency to interact with the mutant than with itself. This phenomenon illustrates synergistic effects between the p53 (251)ILTIITL(257) fragment and the mutant resembling prion cross-species propagation, cautioning against exploiting it in drug discovery.

  6. Unbalancing p53/Mdm2/IGF-1R axis by Mdm2 activation restrains the IGF-1-dependent invasive phenotype of skin melanoma

    PubMed Central

    Worrall, C; Suleymanova, N; Crudden, C; Trocoli Drakensjö, I; Candrea, E; Nedelcu, D; Takahashi, S-I; Girnita, L; Girnita, A

    2017-01-01

    Melanoma tumors usually retain wild-type p53; however, its tumor-suppressor activity is functionally disabled, most commonly through an inactivating interaction with mouse double-minute 2 homolog (Mdm2), indicating p53 release from this complex as a potential therapeutic approach. P53 and the tumor-promoter insulin-like growth factor type 1 receptor (IGF-1R) compete as substrates for the E3 ubiquitin ligase Mdm2, making their relative abundance intricately linked. Hence we investigated the effects of pharmacological Mdm2 release from the Mdm2/p53 complex on the expression and function of the IGF-1R. Nutlin-3 treatment increased IGF-1R/Mdm2 association with enhanced IGF-1R ubiquitination and a dual functional outcome: receptor downregulation and selective downstream signaling activation confined to the mitogen-activated protein kinase/extracellular signal-regulated kinase pathway. This Nutlin-3 functional selectivity translated into IGF-1-mediated bioactivities with biphasic effects on the proliferative and metastatic phenotype: an early increase and late decrease in the number of proliferative and migratory cells, while the invasiveness was completely inhibited following Nutlin-3 treatment through an impaired IGF-1-mediated matrix metalloproteinases type 2 activation mechanism. Taken together, these experiments reveal the biased agonistic properties of Nutlin-3 for the mitogen-activated protein kinase pathway, mediated by Mdm2 through IGF-1R ubiquitination and provide fundamental insights into destabilizing p53/Mdm2/IGF-1R circuitry that could be developed for therapeutic gain. PMID:28092675

  7. Genomic Characterization of Vulvar (Pre)cancers Identifies Distinct Molecular Subtypes with Prognostic Significance.

    PubMed

    Nooij, Linda S; Ter Haar, Natalja T; Ruano, Dina; Rakislova, Natalia; van Wezel, Tom; Smit, Vincent T H B M; Trimbos, Baptist J B M Z; Ordi, Jaume; van Poelgeest, Mariette I E; Bosse, Tjalling

    2017-11-15

    Purpose: Vulvar cancer (VC) can be subclassified by human papillomavirus (HPV) status. HPV-negative VCs frequently harbor TP53 mutations; however, in-depth analysis of other potential molecular genetic alterations is lacking. We comprehensively assessed somatic mutations in a large series of vulvar (pre)cancers. Experimental Design: We performed targeted next-generation sequencing (17 genes), p53 immunohistochemistry and HPV testing on 36 VC and 82 precursors (sequencing cohort). Subsequently, the prognostic significance of the three subtypes identified in the sequencing cohort was assessed in a series of 236 VC patients (follow-up cohort). Results: Frequent recurrent mutations were identified in HPV-negative vulvar (pre)cancers in TP53 (42% and 68%), NOTCH1 (28% and 41%), and HRAS (20% and 31%). Mutation frequency in HPV-positive vulvar (pre)cancers was significantly lower ( P = 0.001). Furthermore, a substantial subset of the HPV-negative precursors (35/60, 58.3%) and VC (10/29, 34.5%) were TP53 wild-type (wt), suggesting a third, not-previously described, molecular subtype. Clinical outcomes in the three different subtypes (HPV + , HPV - /p53wt, HPV - /p53abn) were evaluated in a follow-up cohort consisting of 236 VC patients. Local recurrence rate was 5.3% for HPV + , 16.3% for HPV - /p53wt and 22.6% for HPV - /p53abn tumors ( P = 0.044). HPV positivity remained an independent prognostic factor for favorable outcome in the multivariable analysis ( P = 0.020). Conclusions: HPV - and HPV + vulvar (pre)cancers display striking differences in somatic mutation patterns. HPV - /p53wt VC appear to be a distinct clinicopathologic subgroup with frequent NOTCH1 mutations. HPV + VC have a significantly lower local recurrence rate, independent of clinicopathological variables, opening opportunities for reducing overtreatment in VC. Clin Cancer Res; 23(22); 6781-9. ©2017 AACR . ©2017 American Association for Cancer Research.

  8. Prevention of the neurocristopathy Treacher Collins syndrome through inhibition of p53 function.

    PubMed

    Jones, Natalie C; Lynn, Megan L; Gaudenz, Karin; Sakai, Daisuke; Aoto, Kazushi; Rey, Jean-Phillipe; Glynn, Earl F; Ellington, Lacey; Du, Chunying; Dixon, Jill; Dixon, Michael J; Trainor, Paul A

    2008-02-01

    Treacher Collins syndrome (TCS) is a congenital disorder of craniofacial development arising from mutations in TCOF1, which encodes the nucleolar phosphoprotein Treacle. Haploinsufficiency of Tcof1 perturbs mature ribosome biogenesis, resulting in stabilization of p53 and the cyclin G1-mediated cell-cycle arrest that underpins the specificity of neuroepithelial apoptosis and neural crest cell hypoplasia characteristic of TCS. Here we show that inhibition of p53 prevents cyclin G1-driven apoptotic elimination of neural crest cells while rescuing the craniofacial abnormalities associated with mutations in Tcof1 and extending life span. These improvements, however, occur independently of the effects on ribosome biogenesis; thus suggesting that it is p53-dependent neuroepithelial apoptosis that is the primary mechanism underlying the pathogenesis of TCS. Our work further implies that neuroepithelial and neural crest cells are particularly sensitive to cellular stress during embryogenesis and that suppression of p53 function provides an attractive avenue for possible clinical prevention of TCS craniofacial birth defects and possibly those of other neurocristopathies.

  9. Combined CSL and p53 downregulation promotes cancer-associated fibroblast activation

    PubMed Central

    Procopio, Maria-Giuseppina; Laszlo, Csaba; Labban, Dania Al; Kim, Dong Eun; Bordignon, Pino; Jo, Seunghee; Goruppi, Sandro; Menietti, Elena; Ostano, Paola; Ala, Ugo; Provero, Paolo; Hoetzenecker, Wolfram; Neel, Victor; Kilarski, Witek; Swartz, Melody A.; Brisken, Cathrin; Lefort, Karine; Dotto, G. Paolo

    2015-01-01

    Stromal fibroblast senescence has been linked to aging-associated cancer risk. However, density and proliferation of cancer-associated fibroblasts (CAF) are frequently increased. Loss or down-modulation of the Notch effector CSL/RBP-Jκ in dermal fibroblasts is sufficient for CAF activation and ensuing keratinocyte-derived tumors. We report that CSL silencing induces senescence of primary fibroblasts from dermis, oral mucosa, breast and lung. CSL functions in these cells as direct repressor of multiple senescence- and CAF-effector genes. It also physically interacts with p53, repressing its activity. CSL is down-modulated in stromal fibroblasts of premalignant skin actinic keratosis lesions and squamous cell carcinomas (SCC), while p53 expression and function is down-modulated only in the latter, with paracrine FGF signaling as likely culprit. Concomitant loss of CSL and p53 overcomes fibroblast senescence, enhances expression of CAF effectors and promotes stromal and cancer cell expansion. The findings support a CAF activation/stromal co-evolution model under convergent CSL/p53 control. PMID:26302407

  10. NF-Y loss triggers p53 stabilization and apoptosis in HPV18-positive cells by affecting E6 transcription.

    PubMed

    Benatti, Paolo; Basile, Valentina; Dolfini, Diletta; Belluti, Silvia; Tomei, Margherita; Imbriano, Carol

    2016-07-19

    The expression of the high risk HPV18 E6 and E7 oncogenic proteins induces the transformation of epithelial cells, through the disruption of p53 and Rb function. The binding of cellular transcription factors to cis-regulatory elements in the viral Upstream Regulatory Region (URR) stimulates E6/E7 transcription. Here, we demonstrate that the CCAAT-transcription factor NF-Y binds to a non-canonical motif within the URR and activates viral gene expression. In addition, NF-Y indirectly up-regulates HPV18 transcription through the transactivation of multiple cellular transcription factors. NF-YA depletion inhibits the expression of E6 and E7 genes and re-establishes functional p53. The activation of p53 target genes in turn leads to apoptotic cell death. Finally, we show that NF-YA loss sensitizes HPV18-positive cells toward the DNA damaging agent Doxorubicin, via p53-mediated transcriptional response.

  11. Cytotoxicity of the indole alkaloid reserpine from Rauwolfia serpentina against drug-resistant tumor cells.

    PubMed

    Abdelfatah, Sara A A; Efferth, Thomas

    2015-02-15

    The antihypertensive reserpine is an indole alkaloid from Rauwolfia serpentina and exerts also profound activity against cancer cells in vitro and in vivo. The present investigation was undertaken to investigate possible modes of action to explain its activity toward drug-resistant tumor cells. Sensitive and drug-resistant tumor cell lines overexpressing P-glycoprotein (ABCB1/MDR1), breast cancer resistance protein (ABCG2/BCRP), mutation-activated epidermal growth factor receptor (EGFR), wild-type and p53-knockout cells as well as the NCI panel of cell lines from different tumor origin were analyzed. Reserpine's cytotoxicity was investigated by resazurin and sulforhodamine assays, flow cytometry, and COMPARE and hierarchical cluster analyses of transcriptome-wide microarray-based RNA expressions. P-glycoprotein- or BCRP overexpressing tumor cells did not reveal cross-resistance to reserpine. EGFR-overexpressing cells were collateral sensitive and p53- Knockout cells cross-resistant to this drug compared to their wild-type parental cell lines. Reserpine increased the uptake of doxorubicin in P-glycoprotein-overexpressing cells, indicating that reserpine inhibited the efflux function of P-glycoprotein. Using molecular docking, we found that reserpine bound with even higher binding energy to P-glycoprotein and EGFR than the control drugs verapamil (P-glycoprotein inhibitor) and erlotinib (EGFR inhibitor). COMPARE and cluster analyses of microarray data showed that the mRNA expression of a panel of genes predicted the sensitivity or resistance of the NCI tumor cell line panel with statistical significance. The genes belonged to diverse pathways and biological functions, e.g. cell survival and apoptosis, EGFR activation, regulation of angiogenesis, cell mobility, cell adhesion, immunological functions, mTOR signaling, and Wnt signaling. The lack of cross-resistance to most resistance mechanisms and the collateral sensitivity in EGFR-transfectants compared to wild-type cells speak for a promising role of reserpine in cancer chemotherapy. Reserpine deserves further consideration for cancer therapy in the clinical setting. Copyright © 2015 Elsevier GmbH. All rights reserved.

  12. CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

    PubMed

    He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

    2016-01-01

    The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

  13. A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53

    PubMed Central

    Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena

    2016-01-01

    p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407

  14. Roles of the functional loss of p53 and other genes in astrocytoma tumorigenesis and progression.

    PubMed Central

    Nozaki, M.; Tada, M.; Kobayashi, H.; Zhang, C. L.; Sawamura, Y.; Abe, H.; Ishii, N.; Van Meir, E. G.

    1999-01-01

    Loss of function of the p53 tumor suppressor gene due to mutation occurs early in astrocytoma tumorigenesis in about 30-40% of cases. This is believed to confer a growth advantage to the cells, allowing them to clonally expand due to loss of the p53-controlled G1 checkpoint and apoptosis. Genetic instability due to the impaired ability of p53 to mediate DNA damage repair further facilitates the acquisition of new genetic abnormalities, leading to malignant progression of an astrocytoma into anaplastic astrocytoma. This is reflected by a high rate of p53 mutation (60-70%) in anaplastic astrocytomas. The cell cycle control gets further compromised in astrocytoma by alterations in one of the G1/S transition control genes, either loss of the p16/CDKN2 or RB genes or amplification of the cyclin D gene. The final progression process leading to glioblastoma multiforme seems to need additional genetic abnormalities in the long arm of chromosome 10; one of which is deletion and/or functional loss of the PTEN/MMAC1 gene. Glioblastomas also occur as primary (de novo) lesions in patients of older age, without p53 gene loss but with amplification of the epidermal growth factor receptor (EGFR) genes. In contrast to the secondary glioblastomas that evolve from astrocytoma cells with p53 mutations in younger patients, primary glioblastomas seem to be resistant to radiation therapy and thus show a poorer prognosis. The evaluation and design of therapeutic modalities aimed at preventing malignant progression of astrocytomas and glioblastomas should now be based on stratifying patients with astrocytic tumors according to their genetic diagnosis. PMID:11550308

  15. p53 functions as a cell cycle control protein in osteosarcomas.

    PubMed

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-11-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae.

  16. miR-300 promotes proliferation and EMT-mediated colorectal cancer migration and invasion by targeting p53.

    PubMed

    Wang, Lin; Yu, Peiwu

    2016-12-01

    p53 mutations in tumors can induce the loss of wild-type tumor-suppressing p53 function, which results in the increase in proliferation, migration and invasion ability in cancer cells. Studies have shown that the expression of p53 is regulated by several microRNAs (miRNAs). In the present study, we found that miR-300 and p53 were significantly increased in colorectal cancer (CRC) tissues when compared with levels noted in adjacent colorectal tissues. Both miR-300 and p53 were significantly correlated with lymphatic metastasis and TNM stage. Both miR-300 and p53 promoted CRC cell (SW480 and HT29) proliferation, migration, and invasion, respectively, in vitro. In addition, we found that miR-300 is a direct positive regulator of p53 through binding to the binding site in the 3'UTR of the p53 gene in human CRC cells. Moreover, both miR-300 and p53 induced CRC cell epithelial‑mesenchymal transition (EMT) respectively. Taken together, we demonstrated that miR-300 promoted proliferation and EMT-mediated CRC migration and invasion by targeting p53. These findings provide a new theoretical basis and potential therapeutic targets, and thus lays the foundation for exploring the pathogenesis of CRC.

  17. Phosphorylated (pT371)TRF1 is recruited to sites of DNA damage to facilitate homologous recombination and checkpoint activation

    PubMed Central

    McKerlie, Megan; Walker, John R.; Mitchell, Taylor R. H.; Wilson, Florence R.; Zhu, Xu-Dong

    2013-01-01

    TRF1, a duplex telomeric DNA-binding protein, plays an important role in telomere metabolism. We have previously reported that a fraction of endogenous TRF1 can stably exist free of telomere chromatin when it is phosphorylated at T371 by Cdk1; however, the role of this telomere-free (pT371)TRF1 has yet to be fully characterized. Here we show that phosphorylated (pT371)TRF1 is recruited to sites of DNA damage, forming damage-induced foci in response to ionizing radiation (IR), etoposide and camptothecin. We find that IR-induced (pT371)TRF1 foci formation is dependent on the ATM- and Mre11/Rad50/Nbs1-mediated DNA damage response. While loss of functional BRCA1 impairs the formation of IR-induced (pT371)TRF1 foci, depletion of either 53BP1 or Rif1 stimulates IR-induced (pT371)TRF1 foci formation. In addition, we show that TRF1 depletion or the lack of its phosphorylation at T371 impairs DNA end resection and repair of nontelomeric DNA double-strand breaks by homologous recombination. The lack of TRF1 phosphorylation at T371 also hampers the activation of the G2/M checkpoint and sensitizes cells to PARP inhibition, IR and camptothecin. Collectively, these results reveal a novel but important function of phosphorylated (pT371)TRF1 in facilitating DNA double-strand break repair and the maintenance of genome integrity. PMID:23997120

  18. Nutlin-3 down-regulates retinoblastoma protein expression and inhibits muscle cell differentiation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Walsh, Erica M.; Niu, MengMeng; Bergholz, Johann

    The p53 tumor suppressor gene plays a critical role in regulation of proliferation, cell death and differentiation. The MDM2 oncoprotein is a major negative regulator for p53 by binding to and targeting p53 for proteasome-mediated degradation. The small molecule inhibitor, nutlin-3, disrupts MDM2-p53 interaction resulting in stabilization and activation of p53 protein. We have previously shown that nutlin-3 activates p53, leading to MDM2 accumulation as concomitant of reduced retinoblastoma (Rb) protein stability. It is well known that Rb is important in muscle development and myoblast differentiation and that rhabdomyosarcoma (RMS), or cancer of the skeletal muscle, typically harbors MDM2 amplification.more » In this study, we show that nutlin-3 inhibited myoblast proliferation and effectively prevented myoblast differentiation, as evidenced by lack of expression of muscle differentiation markers including myogenin and myosin heavy chain (MyHC), as well as a failure to form multinucleated myotubes, which were associated with dramatic increases in MDM2 expression and decrease in Rb protein levels. These results indicate that nutlin-3 can effectively inhibit muscle cell differentiation. - Highlights: • Nutlin-3 inhibits myoblast proliferation and prevents differentiation into myotubes. • Nutlin-3 increases MDM2 expression and down-regulates Rb protein levels. • This study has implication in nutlin-3 treatment of rhabdomyosarcomas.« less

  19. Nucleophosmin regulates the stability and transcriptional activity of p53.

    PubMed

    Colombo, Emanuela; Marine, Jean-Christophe; Danovi, Davide; Falini, Brunangelo; Pelicci, Pier Giuseppe

    2002-07-01

    Nucleophosmin (NPM) is a ubiquitously expressed nucleolar phosphoprotein that continuously shuttles between the nucleus and cytoplasm. It has been proposed to function in ribosomal protein assembly and transport, and also as a molecular chaperone that prevents proteins from aggregating in the crowded environment of the nucleolus. The NPM gene is involved in several tumour-associated chromosome translocations, which have resulted in the formation of fusion proteins that retain the amino terminus of NPM, including NPM ALK, NPM RAR and NPM MLF1 (ref. 6). It is generally thought that the NPM component is not involved in the transforming potential of these fusion proteins, but instead provides a dimerization interface for the oligomerization and the oncogenic conversion of the various NPM partners (ALK, RAR, MLF1). Here we show that NPM interacts directly with the tumour suppressor p53, regulates the increase in stability and transcriptional activation of p53 after different types of stress, and induces p53-dependent premature senescence on overexpression in diploid fibroblasts. These findings indicate that NPM is a crucial regulator of p53 and suggest that alterations of the NPM function by NPM fusion proteins might lead to deregulation of p53 in tumours.

  20. Prognostic value of the expression of tumor suppressor genes p53, p21, p16 and prb, and Ki-67 labelling in high grade astrocytomas treated with radiotherapy.

    PubMed

    Kirla, R; Salminen, E; Huhtala, S; Nuutinen, J; Talve, L; Haapasalo, H; Kalimo, H

    2000-01-01

    Cumulative inactivation of tumor suppressor genes and/or amplification of oncogenes lead to progressively more malignant astrocytic tumors. We have analyzed the significance of tumor suppressor genes p53, p21, p16 and retinoblastoma protein (pRb) and proliferative activity for survival in 77 high grade astrocytic tumors. After operation, the patients--25 anaplastic astrocytomas (AA) and 52 glioblastomas (GBs)--were treated with similar radiotherapy. The expression of the suppressor genes and the proliferative activity were analyzed immunohistochemically. p53 immunopositivity was found in 44% of AAs and 46% of GBs. Tumors with aberrant p53 expression had lower proliferation indices than p53 immunonegative tumors. Neither p53 expression nor p21 immunonegativity (52% of AAs and 48% of GBs) correlated with survival. p16 immunostaining was negative in 16% of AAs and in 44% of GBs, and it correlated inversely with survival in both uni- and multivariate analyses. pRb immunostaining was negative only in 8% of both AAs and GBs and the absence of p16 and pRb were mutually exclusive. Ki-67 labelling index (LI) was significantly higher in GBs (26.8%) than in AAs (20.3%), and in multivariate analysis it was an independent prognostic factor for survival. In 48% of AAs Ki-67 LI exceeded 20% and this subset of AAs had similar prognosis as GB. In high grade astrocytic tumors p16 immunonegativity was an independent indicator of poor prognosis in addition to the previously established patient's age, histopathology and Ki-67 LI. Furthermore, there was a subset of AAs with a high proliferation rate (> 20%) in which the histopathological hallmarks of GB were lacking, but which had similarly dismal prognosis as GB.

  1. Suppression of Innate Immune Response by Primary Human Keratinocytes Expressing HPV-16 E6 and E7

    DTIC Science & Technology

    2005-01-01

    respectively. High-risk HPVs have been correlated with at least 90% of cervical cancers and more than 50% of other anogenital cancers (113). 10 An in vitro...substantiated by the lack of p53 mutations discovered in HPV -related cancers . Through the binding and degradation of p53, E6 can drive cells with chromosomal...of class I molecules and accessory proteins, such as TAP-1, are down-regulated in HPV infections and cervical cancers [reviewed in (71, 108

  2. Regulation of the p73 protein stability and degradation

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Oberst, Andrew; Rossi, Mario; Salomoni, Paolo

    2005-06-10

    p73, a homologue to the tumor suppressor gene p53, is involved in tumorigenesis, though its specific role remains unclear. The gene has two distinct promoters which allow the formation of two protein isoforms with opposite effects: full-length transactivating (TA) p73 shows pro-apoptotic effects, while the shorter {delta}Np73, which lacks the N-terminal transactivating domain, has an evident anti-apoptotic function. Unlike p53, the p73 gene is rarely mutated in human cancers. However, alterations in the relative levels of TA and {delta}Np73 have been shown to correlate with prognosis in several human cancers, suggesting that the fine regulation of these two isoforms ismore » of pivotal importance in controlling proliferation and cell death. Much effort is currently focused on the elucidation of the mechanisms that differentially control TA and {delta}Np73 activity and protein stability, a process complicated by the finding that both proteins are regulated by a similar suite of complex post-translational modifications that include ubiquitination, sequential phosphorylation, prolyl-isomerization, recruitment into the PML-nuclear body (PML-NB), and acetylation. Here we shall consider the main regulatory partners of p73, with particular attention to the recently discovered Itch- and Nedd8-mediated degradation pathways, along with the emerging roles of PML, p38 MAP kinase, Pin1, and p300 in p73 transcriptional activation, and possible mechanisms for the differential regulation of the TAp73 and {delta}Np73 isoforms.« less

  3. Proposed megakaryocytic regulon of p53: the genes engaged to control cell cycle and apoptosis during megakaryocytic differentiation

    PubMed Central

    Apostolidis, Pani A.; Lindsey, Stephan; Miller, William M.

    2012-01-01

    During endomitosis, megakaryocytes undergo several rounds of DNA synthesis without division leading to polyploidization. In primary megakaryocytes and in the megakaryocytic cell line CHRF, loss or knock-down of p53 enhances cell cycling and inhibits apoptosis, leading to increased polyploidization. To support the hypothesis that p53 suppresses megakaryocytic polyploidization, we show that stable expression of wild-type p53 in K562 cells (a p53-null cell line) attenuates the cells' ability to undergo polyploidization during megakaryocytic differentiation due to diminished DNA synthesis and greater apoptosis. This suggested that p53's effects during megakaryopoiesis are mediated through cell cycle- and apoptosis-related target genes, possibly by arresting DNA synthesis and promoting apoptosis. To identify candidate genes through which p53 mediates these effects, gene expression was compared between p53 knock-down (p53-KD) and control CHRF cells induced to undergo terminal megakaryocytic differentiation using microarray analysis. Among substantially downregulated p53 targets in p53-KD megakaryocytes were cell cycle regulators CDKN1A (p21) and PLK2, proapoptotic FAS, TNFRSF10B, CASP8, NOTCH1, TP53INP1, TP53I3, DRAM1, ZMAT3 and PHLDA3, DNA-damage-related RRM2B and SESN1, and actin component ACTA2, while antiapoptotic CKS1B, BCL2, GTSE1, and p53 family member TP63 were upregulated in p53-KD cells. Additionally, a number of cell cycle-related, proapoptotic, and cytoskeleton-related genes with known functions in megakaryocytes but not known to carry p53-responsive elements were differentially expressed between p53-KD and control CHRF cells. Our data support a model whereby p53 expression during megakaryopoiesis serves to control polyploidization and the transition from endomitosis to apoptosis by impeding cell cycling and promoting apoptosis. Furthermore, we identify a putative p53 regulon that is proposed to orchestrate these effects. PMID:22548738

  4. IRSp53/BAIAP2 in dendritic spine development, NMDA receptor regulation, and psychiatric disorders.

    PubMed

    Kang, Jaeseung; Park, Haram; Kim, Eunjoon

    2016-01-01

    IRSp53 (also known as BAIAP2) is a multi-domain scaffolding and adaptor protein that has been implicated in the regulation of membrane and actin dynamics at subcellular structures, including filopodia and lamellipodia. Accumulating evidence indicates that IRSp53 is an abundant component of the postsynaptic density at excitatory synapses and an important regulator of actin-rich dendritic spines. In addition, IRSp53 has been implicated in diverse psychiatric disorders, including autism spectrum disorders, schizophrenia, and attention deficit/hyperactivity disorder. Mice lacking IRSp53 display enhanced NMDA (N-methyl-d-aspartate) receptor function accompanied by social and cognitive deficits, which are reversed by pharmacological suppression of NMDA receptor function. These results suggest the hypothesis that defective actin/membrane modulation in IRSp53-deficient dendritic spines may lead to social and cognitive deficits through NMDA receptor dysfunction. This article is part of the Special Issue entitled 'Synaptopathy--from Biology to Therapy'. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. Regulation of p53 Stability and Apoptosis by a ROR Agonist

    PubMed Central

    Wang, Yongjun; Solt, Laura A.; Kojetin, Douglas J.; Burris, Thomas P.

    2012-01-01

    Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer. PMID:22509368

  6. Regulation of p53 stability and apoptosis by a ROR agonist.

    PubMed

    Wang, Yongjun; Solt, Laura A; Kojetin, Douglas J; Burris, Thomas P

    2012-01-01

    Activation of p53 function leading to cell-cycle arrest and/or apoptosis is a promising strategy for development of anti-cancer therapeutic agents. Here, we describe a novel mechanism for stabilization of p53 protein expression via activation of the orphan nuclear receptor, RORα. We demonstrate that treatment of cancer cells with a newly described synthetic ROR agonist, SR1078, leads to p53 stabilization and induction of apoptosis. These data suggest that synthetic ROR agonists may hold utility in the treatment of cancer.

  7. Discovery and Cocrystal Structure of Benzodiazepinedione HDM2 Antagonists that Activate

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Grasberger,B.; Lu, T.; Schubert, C.

    2005-01-01

    HDM2 binds to an {alpha}-helical transactivation domain of p53, inhibiting its tumor suppressive functions. A miniaturized thermal denaturation assay was used to screen chemical libraries, resulting in the discovery of a novel series of benzodiazepinedione antagonists of the HDM2-p53 interaction. The X-ray crystal structure of improved antagonists bound to HDM2 reveals their {alpha}-helix mimetic properties. These optimized molecules increase the transcription of p53 target genes and decrease proliferation of tumor cells expressing wild-type p53.

  8. p53 mediates bcl-2 phosphorylation and apoptosis via activation of the Cdc42/JNK1 pathway.

    PubMed

    Thomas, A; Giesler, T; White, E

    2000-11-02

    A member of the small G protein family, cdc42, was isolated from a screen undertaken to identify p53-inducible genes during apoptosis in primary baby rat kidney (BRK) cells transformed with E1A and a temperature-sensitive mutant p53 using a PCR-based subtractive hybridization method. Cdc42 is a GTPase that belongs to the Rho/Rac subfamily of Ras-like GTPases. In response to external stimuli, Cdc42 is known to transduce signals to regulate the organization of the actin cytoskeleton, induce DNA synthesis in quiescent fibroblasts, and promote apoptosis in neuronal and immune cells. In this study, we have demonstrated that cdc42 mRNA and protein were up-regulated in the presence of wild-type p53 in BRK cells, followed by cytoplasmic to plasma membrane translocation of Cdc42. Overexpression of Cdc42 in the presence of a dominant-negative mutant p53 induced apoptosis rapidly, indicating that Cdc42 functions downstream of p53. Furthermore, stable expression of a dominant-negative mutant of Cdc42 partially inhibited p53-mediated apoptosis. The Bcl-2 family members Bcl-xL, and the adenovirus protein E1B 19K, inhibited Cdc42-mediated apoptosis, whereas Bcl-2 did not. We provide evidence that PAK1 and JNK1 may play a role downstream of Cdc42 to transduce its apoptotic signal. Cdc42/PAK1 activates JNK1-induced phosphorylation of Bcl-2, thereby inactivating its function, and that a phosphorylation resistant mutant (Bcl-2S70,87A,T56,74A) gains the ability to inhibit Cdc42- and p53-mediated apoptosis. Thus, one mechanism by which p53 promotes apoptosis is through activation of Cdc42 and inactivation of Bcl-2.

  9. Screening of medicinal plant phytochemicals as natural antagonists of p53-MDM2 interaction to reactivate p53 functioning.

    PubMed

    Riaz, Muhammad; Ashfaq, Usman A; Qasim, Muhammad; Yasmeen, Erum; Ul Qamar, Muhammad T; Anwar, Farooq

    2017-10-01

    In most types of cancer, overexpression of murine double minute 2 (MDM2) often leads to inactivation of p53. The crystal structure of MDM2, with a 109-residue amino-terminal domain, reveals that MDM2 has a core hydrophobic region to which p53 binds as an amphipathic α helix. The interface depends on the steric complementarity between MDM2 and the hydrophobic region of p53. Especially, on p53's triad, amino acids Phe19, Trp23 and Leu26 bind to the MDM2 core. Results from studies suggest that the structural motif of both p53 and MDM2 can be attributed to similarities in the amphipathic α helix. Thus, in the current investigation it is hypothesized that the similarity in the structural motif might be the cause of p53 inactivation by MDM2. Hence, molecular docking and phytochemical screening approaches are appraised to inhibit the hydrophobic cleft of MDM2 and to stop p53-MDM2 interaction, resulting in reactivation of p53 activity. For this purpose, a library of 2295 phytochemicals were screened against p53-MDM2 to find potential candidates. Of these, four phytochemicals including epigallocatechin gallate, alvaradoin M, alvaradoin E and nordihydroguaiaretic acid were found to be potential inhibitors of p53-MDM2 interaction. The screened phytochemicals, derived from natural extracts, may have negligible side effects and can be explored as potent antagonists of p53-MDM2 interactions, resulting in reactivation of the normal transcription of p53.

  10. Impact of a lung transplantation donor-management protocol on lung donation and recipient outcomes.

    PubMed

    Angel, Luis F; Levine, Deborah J; Restrepo, Marcos I; Johnson, Scott; Sako, Edward; Carpenter, Andrea; Calhoon, John; Cornell, John E; Adams, Sandra G; Chisholm, Gary B; Nespral, Joe; Roberson, Ann; Levine, Stephanie M

    2006-09-15

    One of the limitations associated with lung transplantation is the lack of available organs. To determine whether a lung donor-management protocol could increase the number of lungs for transplantation without affecting the survival rates of the recipients. We implemented the San Antonio Lung Transplant protocol for managing potential lung donors according to modifications of standard criteria for donor selection and strategies for donor management. We then compared information gathered during a 4-yr period, during which the protocol was used with information gathered during a 4-yr period before protocol implementation. Primary outcome measures were the procurement rate of lungs and the 30-d and 1-yr survival rates of recipients. We reviewed data from 711 potential lung donors. The mean rate of lung procurement was significantly higher (p < 0.0001) during the protocol period (25.5%) than during the pre-protocol period (11.5%), with an estimated risk ratio of 2.2 in favor of the protocol period. More patients received transplants during the protocol period (n = 121) than during the pre-protocol period (n = 53; p < 0.0001). Of 98 actual lung donors during the protocol period, 53 (54%) had initially been considered poor donors; these donors provided 64 (53%) of the 121 lung transplants. The type of donor was not associated with significant differences in recipients' 30-d and 1-yr survival rates or any clinical measures of adequate graft function. The protocol was associated with a significant increase in the number of lung donors and transplant procedures without compromising pulmonary function, length of stay, or survival of the recipients.

  11. Jmjd5 functions as a regulator of p53 signaling during mouse embryogenesis.

    PubMed

    Ishimura, Akihiko; Terashima, Minoru; Tange, Shoichiro; Suzuki, Takeshi

    2016-03-01

    Genetic studies have shown that aberrant activation of p53 signaling leads to embryonic lethality. Maintenance of a fine balance of the p53 protein level is critical for normal development. Previously, we have reported that Jmjd5, a member of the Jumonji C (JmjC) family, regulates embryonic cell proliferation through the control of Cdkn1a expression. Since Cdkn1a is the representative p53-regulated gene, we have examined whether the expression of other p53 target genes is coincidentally upregulated with Cdkn1a in Jmjd5-deficient embryos. The expression of a subset of p53-regulated genes was increased in both Jmjd5 hypomorphic mouse embryonic fibroblasts (MEFs) and Jmjd5-deficient embryos at embryonic day 8.25 without the induced expression of Trp53. Intercrossing of Jmjd5-deficient mice with Trp53 knockout mice showed that the growth defect of Jmjd5 mutant cells was significantly recovered under a Trp53 null genetic background. Chromatin immunoprecipitation analysis in Jmjd5 hypomorphic MEFs indicated the increased recruitment of p53 at several p53 target gene loci, such as Cdkn1a, Pmaip1, and Mdm2. These results suggest that Jmjd5 is involved in the transcriptional regulation of a subset of p53-regulated genes, possibly through the control of p53 recruitment at the gene loci. In Jmjd5-deficient embryos, the enhanced recruitment of p53 might result in the abnormal activation of p53 signaling leading to embryonic lethality.

  12. DRAGO (KIAA0247), a new DNA damage-responsive, p53-inducible gene that cooperates with p53 as oncosuppressor. [Corrected].

    PubMed

    Polato, Federica; Rusconi, Paolo; Zangrossi, Stefano; Morelli, Federica; Boeri, Mattia; Musi, Alberto; Marchini, Sergio; Castiglioni, Vittoria; Scanziani, Eugenio; Torri, Valter; Broggini, Massimo

    2014-04-01

    p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53(-/-) and 107 p53(+/-) mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan-Meier curves and the Mantel-Haenszel test. All statistical tests were two-sided. We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO(-/-) mice are viable without macroscopic alterations. However, in p53(-/-) or p53(+/-) mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53(-/-) or p53(+/-) mice bearing wild-type DRAGO alleles (p53(-/-), DRAGO(-/-) mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53(+/-), DRAGO(-/-) mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO(+/+) counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional-through p53 (and p73) and methylation-dependent control-and post-transcriptional levels by miRNAs. DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions.

  13. DRAGO (KIAA0247), a New DNA Damage–Responsive, p53-Inducible Gene That Cooperates With p53 as Oncosupprossor

    PubMed Central

    Polato, Federica; Rusconi, Paolo

    2014-01-01

    Background p53 influences genomic stability, apoptosis, autophagy, response to stress, and DNA damage. New p53-target genes could elucidate mechanisms through which p53 controls cell integrity and response to damage. Methods DRAGO (drug-activated gene overexpressed, KIAA0247) was characterized by bioinformatics methods as well as by real-time polymerase chain reaction, chromatin immunoprecipitation and luciferase assays, time-lapse microscopy, and cell viability assays. Transgenic mice (94 p53−/− and 107 p53+/− mice on a C57BL/6J background) were used to assess DRAGO activity in vivo. Survival analyses were performed using Kaplan–Meier curves and the Mantel–Haenszel test. All statistical tests were two-sided. Results We identified DRAGO as a new p53-responsive gene induced upon treatment with DNA-damaging agents. DRAGO is highly conserved, and its ectopic overexpression resulted in growth suppression and cell death. DRAGO−/− mice are viable without macroscopic alterations. However, in p53−/− or p53+/− mice, the deletion of both DRAGO alleles statistically significantly accelerated tumor development and shortened lifespan compared with p53−/− or p53+/− mice bearing wild-type DRAGO alleles (p53−/−, DRAGO−/− mice: hazard ratio [HR] = 3.25, 95% confidence interval [CI] = 1.7 to 6.1, P < .001; p53+/−, DRAGO−/− mice: HR = 2.35, 95% CI = 1.3 to 4.0, P < .001; both groups compared with DRAGO+/+ counterparts). DRAGO mRNA levels were statistically significantly reduced in advanced-stage, compared with early-stage, ovarian tumors, but no mutations were found in several human tumors. We show that DRAGO expression is regulated both at transcriptional—through p53 (and p73) and methylation-dependent control—and post-transcriptional levels by miRNAs. Conclusions DRAGO represents a new p53-dependent gene highly regulated in human cells and whose expression cooperates with p53 in tumor suppressor functions. PMID:24652652

  14. Aberrant p53 protein expression is associated with an increased risk of neoplastic progression in patients with Barrett's oesophagus.

    PubMed

    Kastelein, Florine; Biermann, Katharina; Steyerberg, Ewout W; Verheij, Joanne; Kalisvaart, Marit; Looijenga, Leendert H J; Stoop, Hans A; Walter, Laurens; Kuipers, Ernst J; Spaander, Manon C W; Bruno, Marco J

    2013-12-01

    The value of surveillance for patients with Barrett's oesophagus (BO) is under discussion given the overall low incidence of neoplastic progression and lack of discriminative tests for risk stratification. Histological diagnosis of low-grade dysplasia (LGD) is the only accepted predictor for progression to date, but has a low predictive value. The aim of this study was therefore to evaluate the value of p53 immunohistochemistry for predicting neoplastic progression in patients with BO. We conducted a case-control study within a prospective cohort of 720 patients with BO. Patients who developed high-grade dysplasia (HGD) or oesophageal adenocarcinoma (OAC) were classified as cases and patients without neoplastic progression were classified as controls. P53 protein expression was determined by immunohistochemistry in more than 12 000 biopsies from 635 patients and was scored independently by two expert pathologists who were blinded to long-term outcome. During follow-up, 49 (8%) patients developed HGD or OAC. P53 overexpression was associated with an increased risk of neoplastic progression in patients with BO after adjusting for age, gender, Barrett length and oesophagitis (adjusted relative risks (RR(a)) 5.6; 95% CI 3.1 to 10.3), but the risk was even higher with loss of p53 expression (RR(a) 14.0; 95% CI 5.3 to 37.2). The positive predictive value for neoplastic progression increased from 15% with histological diagnosis of LGD to 33% with LGD and concurrent aberrant p53 expression. Aberrant p53 protein expression is associated with an increased risk of neoplastic progression in patients with BO and appears to be a more powerful predictor of neoplastic progression than histological diagnosis of LGD.

  15. E2F1 and E2F2 prevent replicative stress and subsequent p53-dependent organ involution.

    PubMed

    Iglesias-Ara, A; Zenarruzabeitia, O; Buelta, L; Merino, J; Zubiaga, A M

    2015-10-01

    Tissue homeostasis requires tight regulation of cellular proliferation, differentiation and apoptosis. E2F1 and E2F2 transcription factors share a critical role in tissue homeostasis, since their combined inactivation results in overall organ involution, specially affecting the pancreatic gland, which subsequently triggers diabetes. We have examined the mechanism by which these E2Fs regulate tissue homeostasis. We show that pancreas atrophy in E2F1/E2F2 double-knockout (DKO) mice is associated with mitochondrial apoptosis and activation of the p53 pathway in young animals, before the development of diabetes. A deregulated expression of E2F target genes was detected in pancreatic cells of young DKO animals, along with unscheduled DNA replication and activation of a DNA damage response. Importantly, suppression of DNA replication in vivo with aphidicolin led to a significant inhibition of the p53 pathway in DKO pancreas, implying a causal link between DNA replication stress and p53 activation in this model. We further show that activation of the p53 pathway has a key role in the aberrant phenotype of DKO mice, since targeted inactivation of p53 gene abrogated cellular apoptosis and prevented organ involution and insulin-dependent diabetes in mice lacking E2F1/E2F2. Unexpectedly, p53 inactivation unmasked oncogenic features of E2F1/E2F2-depleted cells, as evidenced by an accelerated tumor development in triple-knockout mice compared with p53(-/-) mice. Collectively, our data reveal a role for E2F1 and E2F2 as suppressors of replicative stress in differentiating cells, and uncover the existence of a robust E2F-p53 regulatory axis to enable tissue homeostasis and prevent tumorigenesis. These findings have implications in the design of approaches targeting E2F for cancer therapy.

  16. E2F1 and E2F2 prevent replicative stress and subsequent p53-dependent organ involution

    PubMed Central

    Iglesias-Ara, A; Zenarruzabeitia, O; Buelta, L; Merino, J; Zubiaga, A M

    2015-01-01

    Tissue homeostasis requires tight regulation of cellular proliferation, differentiation and apoptosis. E2F1 and E2F2 transcription factors share a critical role in tissue homeostasis, since their combined inactivation results in overall organ involution, specially affecting the pancreatic gland, which subsequently triggers diabetes. We have examined the mechanism by which these E2Fs regulate tissue homeostasis. We show that pancreas atrophy in E2F1/E2F2 double-knockout (DKO) mice is associated with mitochondrial apoptosis and activation of the p53 pathway in young animals, before the development of diabetes. A deregulated expression of E2F target genes was detected in pancreatic cells of young DKO animals, along with unscheduled DNA replication and activation of a DNA damage response. Importantly, suppression of DNA replication in vivo with aphidicolin led to a significant inhibition of the p53 pathway in DKO pancreas, implying a causal link between DNA replication stress and p53 activation in this model. We further show that activation of the p53 pathway has a key role in the aberrant phenotype of DKO mice, since targeted inactivation of p53 gene abrogated cellular apoptosis and prevented organ involution and insulin-dependent diabetes in mice lacking E2F1/E2F2. Unexpectedly, p53 inactivation unmasked oncogenic features of E2F1/E2F2-depleted cells, as evidenced by an accelerated tumor development in triple-knockout mice compared with p53−/− mice. Collectively, our data reveal a role for E2F1 and E2F2 as suppressors of replicative stress in differentiating cells, and uncover the existence of a robust E2F-p53 regulatory axis to enable tissue homeostasis and prevent tumorigenesis. These findings have implications in the design of approaches targeting E2F for cancer therapy. PMID:25656653

  17. Growth factor independence-1 antagonizes a p53-induced DNA damage response pathway in lymphoblastic leukemia

    PubMed Central

    Khandanpour, Cyrus; Phelan, James D.; Vassen, Lothar; Schütte, Judith; Chen, Riyan; Horman, Shane R.; Gaudreau, Marie-Claude; Krongold, Joseph; Zhu, Jinfang; Paul, William E.; Dührsen, Ulrich; Göttgens, Bertie; Grimes, H. Leighton; Möröy, Tarik

    2013-01-01

    Summary Most patients with acute lymphoblastic leukemia (ALL) fail current treatments highlighting the need for better therapies. Since oncogenic signaling activates a p53-dependent DNA-damage response and apoptosis, leukemic cells must devise appropriate countermeasures. We show here that growth factor independence 1 (Gfi1) can serve such a function, since Gfi1 ablation exacerbates p53 responses, and lowers the threshold for p53-induced cell death. Specifically, Gfi1 restricts p53 activity and expression of pro-apoptotic p53 targets such as Bax, Noxa (Pmaip1) and Puma (Bbc3). Subsequently, Gfi1 ablation cures mice from leukemia and limits the expansion of primary human T-ALL xenografts in mice. This suggests that targeting Gfi1 could improve the prognosis of patients with T-ALL or other lymphoid leukemias. PMID:23410974

  18. p53 functions as a cell cycle control protein in osteosarcomas.

    PubMed Central

    Diller, L; Kassel, J; Nelson, C E; Gryka, M A; Litwak, G; Gebhardt, M; Bressac, B; Ozturk, M; Baker, S J; Vogelstein, B

    1990-01-01

    Mutations in the p53 gene have been associated with a wide range of human tumors, including osteosarcomas. Although it has been shown that wild-type p53 can block the ability of E1a and ras to cotransform primary rodent cells, it is poorly understood why inactivation of the p53 gene is important for tumor formation. We show that overexpression of the gene encoding wild-type p53 blocks the growth of osteosarcoma cells. The growth arrest was determined to be due to an inability of the transfected cells to progress into S phase. This suggests that the role of the p53 gene as an antioncogene may be in controlling the cell cycle in a fashion analogous to the check-point control genes in Saccharomyces cerevisiae. Images PMID:2233717

  19. p53 and TAp63 Promote Keratinocyte Proliferation and Differentiation in Breeding Tubercles of the Zebrafish

    PubMed Central

    Fischer, Boris; Metzger, Manuel; Richardson, Rebecca; Knyphausen, Philipp; Ramezani, Thomas; Franzen, Rainer; Schmelzer, Elmon; Bloch, Wilhelm; Carney, Thomas J.; Hammerschmidt, Matthias

    2014-01-01

    p63 is a multi-isoform member of the p53 family of transcription factors. There is compelling genetic evidence that ΔNp63 isoforms are needed for keratinocyte proliferation and stemness in the developing vertebrate epidermis. However, the role of TAp63 isoforms is not fully understood, and TAp63 knockout mice display normal epidermal development. Here, we show that zebrafish mutants specifically lacking TAp63 isoforms, or p53, display compromised development of breeding tubercles, epidermal appendages which according to our analyses display more advanced stratification and keratinization than regular epidermis, including continuous desquamation and renewal of superficial cells by derivatives of basal keratinocytes. Defects are further enhanced in TAp63/p53 double mutants, pointing to partially redundant roles of the two related factors. Molecular analyses, treatments with chemical inhibitors and epistasis studies further reveal the existence of a linear TAp63/p53->Notch->caspase 3 pathway required both for enhanced proliferation of keratinocytes at the base of the tubercles and their subsequent differentiation in upper layers. Together, these studies identify the zebrafish breeding tubercles as specific epidermal structures sharing crucial features with the cornified mammalian epidermis. In addition, they unravel essential roles of TAp63 and p53 to promote both keratinocyte proliferation and their terminal differentiation by promoting Notch signalling and caspase 3 activity, ensuring formation and proper homeostasis of this self-renewing stratified epithelium. PMID:24415949

  20. Wee-1 Kinase Inhibition Overcomes Cisplatin Resistance Associated with High-Risk TP53 Mutations in Head and Neck Cancer through Mitotic Arrest Followed by Senescence

    PubMed Central

    Osman, Abdullah A.; Monroe, Marcus M.; Ortega Alves, Marcus V.; Patel, Ameeta A.; Katsonis, Panagiotis; Fitzgerald, Alison L.; Neskey, David M.; Frederick, Mitchell J.; Woo, Sang Hyeok; Caulin, Carlos; Hsu, Teng-Kuei; McDonald, Thomas O.; Kimmel, Marek; Meyn, Raymond E.; Lichtarge, Olivier; Myers, Jeffrey N.

    2015-01-01

    Although cisplatin has played a role in “standard-of-care” multimodality therapy for patients with advanced squamous cell carcinoma of the head and neck (HNSCC), the rate of treatment failure remains particularly high for patients receiving cisplatin whose tumors have mutations in the TP53 gene. We found that cisplatin treatment of HNSCC cells with mutant TP53 leads to arrest of cells in the G2 phase of the cell cycle, leading us to hypothesize that the wee-1 kinase inhibitor MK-1775 would abrogate the cisplatin-induced G2 block and thereby sensitize isogenic HNSCC cells with mutant TP53 or lacking p53 expression to cisplatin. We tested this hypothesis using clonogenic survival assays, flow cytometry, and in vivo tumor growth delay experiments with an orthotopic nude mouse model of oral tongue cancer. We also used a novel TP53 mutation classification scheme to identify which TP53 mutations are associated with limited tumor responses to cisplatin treatment. Clonogenic survival analyses indicate that nanomolar concentration of MK-1775 sensitizes HNSCC cells with high-risk mutant p53 to cisplatin. Consistent with its ability to chemosensitize, MK-1775 abrogated the cisplatin-induced G2 block in p53-defective cells leading to mitotic arrest associated with a senescence-like phenotype. Furthermore, MK-1775 enhanced the efficacy of cisplatin in vivo in tumors harboring TP53 mutations. These results indicate that HNSCC cells expressing high-risk p53 mutations are significantly sensitized to cisplatin therapy by the selective wee-1 kinase inhibitor, supporting the clinical evaluation of MK-1775 in combination with cisplatin for the treatment of patients with TP53 mutant HNSCC. PMID:25504633

  1. New Insights into the Mechanism of Inhibition of p53 by Simian Virus 40 Large T Antigen

    PubMed Central

    Sheppard, Hilary M.; Corneillie, Siska I.; Espiritu, Christine; Gatti, Andrea; Liu, Xuan

    1999-01-01

    Simian virus 40 (SV40) large tumor antigen (T antigen) has been shown to inhibit p53-dependent transcription by preventing p53 from binding to its cognate cis element. Data presented in this report provide the first direct functional evidence that T antigen, under certain conditions, may also repress p53-dependent transcription by a mechanism in which the transactivation domain of p53 is abrogated while DNA binding is unaffected. Specifically, p53 purified as a complex with T antigen from mouse cells was found to bind DNA as a transcriptionally inactive intact complex, while that purified from human cells was found to bind DNA independently of T antigen and could activate p53-dependent transcription. This difference in activity may be dependent on a different interaction of T antigen with mouse and human p53 and, in addition, on the presence of super T, which is found only in transformed rodent cells. These results suggest that subtle yet important differences exist between the inhibition of p53 by T antigen in mouse and human cells. The implications of this finding with respect to SV40-associated malignancies are discussed. PMID:10082540

  2. Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis

    PubMed Central

    Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika

    2016-01-01

    Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

  3. p53 as the focus of gene therapy: past, present and future.

    PubMed

    Valente, Joana Fa; Queiroz, Joao A; Sousa, Fani

    2018-01-15

    Several gene deviations can be responsible for triggering oncogenic processes. However, mutations in tumour suppressor genes are usually more associated to malignant diseases, being p53 one of the most affected and studied element. p53 is implicated in a number of known cellular functions, including DNA damage repair, cell cycle arrest in G1/S and G2/M and apoptosis, being an interesting target for cancer treatment. Considering these facts, the development of gene therapy approaches focused on p53 expression and regulation seems to be a promising strategy for cancer therapy. Several studies have shown that transfection of cancer cells with wild-type p53 expressing plasmids could directly drive cells into apoptosis and/or growth arrest, suggesting that a gene therapy approach for cancer treatment can be based on the re-establishment of the normal p53 expression levels and function. Up until now, several clinical research studies using viral and non-viral vectors delivering p53 genes, isolated or combined with other therapeutic agents, have been accomplished and there are already in the market therapies based on the use of this gene. This review summarizes the different methods used to deliver and/or target the p53 as well as the main results of therapeutic effect obtained with the different strategies applied. Finally, the ongoing approaches are described, also focusing the combinatorial therapeutics to show the increased therapeutic potential of combining gene therapy vectors with chemo or radiotherapy. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  4. Degradation of phosphorylated p53 by viral protein-ECS E3 ligase complex.

    PubMed

    Sato, Yoshitaka; Kamura, Takumi; Shirata, Noriko; Murata, Takayuki; Kudoh, Ayumi; Iwahori, Satoko; Nakayama, Sanae; Isomura, Hiroki; Nishiyama, Yukihiro; Tsurumi, Tatsuya

    2009-07-01

    p53-signaling is modulated by viruses to establish a host cellular environment advantageous for their propagation. The Epstein-Barr virus (EBV) lytic program induces phosphorylation of p53, which prevents interaction with MDM2. Here, we show that induction of EBV lytic program leads to degradation of p53 via an ubiquitin-proteasome pathway independent of MDM2. The BZLF1 protein directly functions as an adaptor component of the ECS (Elongin B/C-Cul2/5-SOCS-box protein) ubiquitin ligase complex targeting p53 for degradation. Intringuingly, C-terminal phosphorylation of p53 resulting from activated DNA damage response by viral lytic replication enhances its binding to BZLF1 protein. Purified BZLF1 protein-associated ECS could be shown to catalyze ubiquitination of phospho-mimetic p53 more efficiently than the wild-type in vitro. The compensation of p53 at middle and late stages of the lytic infection inhibits viral DNA replication and production during lytic infection, suggesting that the degradation of p53 is required for efficient viral propagation. Taken together, these findings demonstrate a role for the BZLF1 protein-associated ECS ligase complex in regulation of p53 phosphorylated by activated DNA damage signaling during viral lytic infection.

  5. Loss of P53 regresses cardiac remodeling induced by pressure overload partially through inhibiting HIF1α signaling in mice.

    PubMed

    Li, Jiming; Zeng, Jingjing; Wu, Lianpin; Tao, Luyuan; Liao, Zhiyong; Chu, Maoping; Li, Lei

    2018-06-22

    The tumor suppressor p53 is recognized as the guardian of the genome in cell cycle and cell death. P53 expression increases as cardiac hypertrophy worsens to heart failure, suggesting that p53 may play important role in cardiac remodeling. In the present study, deletion of p53 in the mice heart would ameliorate cardiac hypertrophy induced by pressure overload. The role of p53 on heart was investigated using in vivo models. Cardiac hypertrophy in mice was induced by transverse aortic banding surgery. The extent of cardiac hypertrophy was examined by echocardiography, as well as pathological and molecular analyses of heart tissue. Global knockout of p53 in the mice reduced the hypertrophic response and markedly reduced cardiac apoptosis, and fibrosis. Ejection fraction of heart was also improved in hearts without p53 in response to pressure overload. Protein determination further suggested loss of p53 expression markedly increased Hypoxia-inducible factor 1-alpha (HIF1α) and vascular endothelial growth factor (VEGF) expression. The study indicated p53 deteriorated cardiac functions and cardiac hypertrophy, apoptosis, and fibrosis by partially inhibition of HIF1α and VEGF. Copyright © 2018 Elsevier Inc. All rights reserved.

  6. Human T-cell leukemia virus type-1-encoded protein HBZ represses p53 function by inhibiting the acetyltransferase activity of p300/CBP and HBO1

    PubMed Central

    Hoang, Kimson; Ankney, John A.; Nguyen, Stephanie T.; Rushing, Amanda W.; Polakowski, Nicholas; Miotto, Benoit; Lemasson, Isabelle

    2016-01-01

    Adult T-cell leukemia (ATL) is an often fatal malignancy caused by infection with the complex retrovirus, human T-cell Leukemia Virus, type 1 (HTLV-1). In ATL patient samples, the tumor suppressor, p53, is infrequently mutated; however, it has been shown to be inactivated by the viral protein, Tax. Here, we show that another HTLV-1 protein, HBZ, represses p53 activity. In HCT116 p53+/+ cells treated with the DNA-damaging agent, etoposide, HBZ reduced p53-mediated activation of p21/CDKN1A and GADD45A expression, which was associated with a delay in G2 phase-arrest. These effects were attributed to direct inhibition of the histone acetyltransferase (HAT) activity of p300/CBP by HBZ, causing a reduction in p53 acetylation, which has be linked to decreased p53 activity. In addition, HBZ bound to, and inhibited the HAT activity of HBO1. Although HBO1 did not acetylate p53, it acted as a coactivator for p53 at the p21/CDKN1A promoter. Therefore, through interactions with two separate HAT proteins, HBZ impairs the ability of p53 to activate transcription. This mechanism may explain how p53 activity is restricted in ATL cells that do not express Tax due to modifications of the HTLV-1 provirus, which accounts for a majority of patient samples. PMID:26625199

  7. Deubiquitinating enzyme regulation of the p53 pathway: A lesson from Otub1

    PubMed Central

    Sun, Xiao-Xin; Dai, Mu-Shui

    2014-01-01

    Deubiquitination has emerged as an important mechanism of p53 regulation. A number of deubiquitinating enzymes (DUBs) from the ubiquitin-specific protease family have been shown to regulate the p53-MDM2-MDMX networks. We recently reported that Otub1, a DUB from the OTU-domain containing protease family, is a novel p53 regulator. Interestingly, Otub1 abrogates p53 ubiquitination and stabilizes and activates p53 in cells independently of its deubiquitinating enzyme activity. Instead, it does so by inhibiting the MDM2 cognate ubiquitin-conjugating enzyme (E2) UbcH5. Otub1 also regulates other biological signaling through this non-canonical mechanism, suppression of E2, including the inhibition of DNA-damage-induced chromatin ubiquitination. Thus, Otub1 evolves as a unique DUB that mainly suppresses E2 to regulate substrates. Here we review the current progress made towards the understanding of the complex regulation of the p53 tumor suppressor pathway by DUBs, the biological function of Otub1 including its positive regulation of p53, and the mechanistic insights into how Otub1 suppresses E2. PMID:24920999

  8. Caspase-2-mediated cleavage of Mdm2 creates p53-induced positive feedback loop

    PubMed Central

    Oliver, Trudy G.; Meylan, Etienne; Chang, Gregory P.; Xue, Wen; Burke, James R.; Humpton, Timothy J.; Hubbard, Diana; Bhutkar, Arjun; Jacks, Tyler

    2011-01-01

    SUMMARY Caspase-2 is an evolutionarily conserved caspase, yet its biological function and cleavage targets are poorly understood. Caspase-2 is activated by the p53 target gene product PIDD (also known as LRDD) in a complex called the Caspase-2-PIDDosome. We show that PIDD expression promotes growth arrest and chemotherapy resistance by a mechanism that depends on Caspase-2 and wild-type p53. PIDD-induced Caspase-2 directly cleaves the E3 ubiquitin ligase Mdm2 at Asp 367, leading to loss of the C-terminal RING domain responsible for p53 ubiquitination. As a consequence, N-terminally truncated Mdm2 binds p53 and promotes its stability. Upon DNA damage, p53 induction of the Caspase-2-PIDDosome creates a positive feedback loop that inhibits Mdm2 and reinforces p53 stability and activity, contributing to cell survival and drug resistance. These data establish Mdm2 as a cleavage target of Caspase-2 and provide insight into a mechanism of Mdm2 inhibition that impacts p53 dynamics upon genotoxic stress. PMID:21726810

  9. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage

    PubMed Central

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-01-01

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments. PMID:23235459

  10. PRAP1 is a novel executor of p53-dependent mechanisms in cell survival after DNA damage.

    PubMed

    Huang, B H; Zhuo, J L; Leung, C H W; Lu, G D; Liu, J J; Yap, C T; Hooi, S C

    2012-12-13

    p53 has a crucial role in governing cellular mechanisms in response to a broad range of genotoxic stresses. During DNA damage, p53 can either promote cell survival by activating senescence or cell-cycle arrest and DNA repair to maintain genomic integrity for cell survival or direct cells to undergo apoptosis to eliminate extensively damaged cells. The ability of p53 to execute these two opposing cell fates depends on distinct signaling pathways downstream of p53. In this study, we showed that under DNA damage conditions induced by chemotherapeutic drugs, gamma irradiation and hydrogen peroxide, p53 upregulates a novel protein, proline-rich acidic protein 1 (PRAP1). We identified functional p53-response elements within intron 1 of PRAP1 gene and showed that these regions interact directly with p53 using ChIP assays, indicating that PRAP1 is a novel p53 target gene. The induction of PRAP1 expression by p53 may promote resistance of cancer cells to chemotherapeutic drugs such as 5-fluorouracil (5-FU), as knockdown of PRAP1 increases apoptosis in cancer cells after 5-FU treatment. PRAP1 appears to protect cells from apoptosis by inducing cell-cycle arrest, suggesting that the induction of PRAP1 expression by p53 in response to DNA-damaging agents contributes to cancer cell survival. Our findings provide a greater insight into the mechanisms underlying the pro-survival role of p53 in response to cytotoxic treatments.

  11. Involvement of stromal p53 in tumor-stroma interactions

    PubMed Central

    Bar, Jair; Moskovits, Neta; Oren, Moshe

    2009-01-01

    p53 is a major tumor-suppressor gene, inactivated by mutations in about half of all human cancer cases, and probably incapacitated by other means in most other cases. Most research regarding the role of p53 in cancer has focused on its ability to elicit apoptosis or growth arrest of cells that are prone to become malignant owing to DNA damage or oncogene activation, i.e. cell-autonomous activities of p53. However, p53 activation within a cell can also exert a variety of effects upon neighboring cells, through secreted factors and paracrine and endocrine mechanisms. Of note, p53 within cancer stromal cells can inhibit tumor growth and malignant progression. Cancer cells that evolve under this inhibitory influence acquire mechanisms to silence stromal p53, either by direct inhibition of p53 within stromal cells, or through pressure for selection of stromal cells with compromised p53 function. Hence, activation of stromal p53 by chemotherapy or radiotherapy might be part of the mechanisms by which these treatments cause cancer regression. However, in certain circumstances, activation of stromal p53 by cytotoxic anti-cancer agents might actually promote treatment resistance, probably through stromal p53-mediated growth arrest of the cancer cells or through protection of the tumor vasculature. Better understanding of the underlying molecular mechanisms is thus required. Hopefully, this will allow their manipulation towards better inhibition of cancer initiation, progression and metastasis. PMID:19914385

  12. p53 isoform Δ133p53 promotes efficiency of induced pluripotent stem cells and ensures genomic integrity during reprogramming.

    PubMed

    Gong, Lu; Pan, Xiao; Chen, Haide; Rao, Lingjun; Zeng, Yelin; Hang, Honghui; Peng, Jinrong; Xiao, Lei; Chen, Jun

    2016-11-22

    Human induced pluripotent stem (iPS) cells have great potential in regenerative medicine, but this depends on the integrity of their genomes. iPS cells have been found to contain a large number of de novo genetic alterations due to DNA damage response during reprogramming. Thus, to maintain the genetic stability of iPS cells is an important goal in iPS cell technology. DNA damage response can trigger tumor suppressor p53 activation, which ensures genome integrity of reprogramming cells by inducing apoptosis and senescence. p53 isoform Δ133p53 is a p53 target gene and functions to not only antagonize p53 mediated apoptosis, but also promote DNA double-strand break (DSB) repair. Here we report that Δ133p53 is induced in reprogramming. Knockdown of Δ133p53 results 2-fold decrease in reprogramming efficiency, 4-fold increase in chromosomal aberrations, whereas overexpression of Δ133p53 with 4 Yamanaka factors showes 4-fold increase in reprogamming efficiency and 2-fold decrease in chromosomal aberrations, compared to those in iPS cells induced only with 4 Yamanaka factors. Overexpression of Δ133p53 can inhibit cell apoptosis and promote DNA DSB repair foci formation during reprogramming. Our finding demonstrates that the overexpression of Δ133p53 not only enhances reprogramming efficiency, but also results better genetic quality in iPS cells.

  13. Benzo[a]pyrene-7,8-dihydrodiol promotes checkpoint activation and G2/M arrest in human bronchoalveolar carcinoma H358 cells.

    PubMed

    Caino, M Cecilia; Oliva, Jose L; Jiang, Hao; Penning, Trevor M; Kazanietz, Marcelo G

    2007-03-01

    Polycyclic aromatic hydrocarbons (PAHs) are potent carcinogens that require metabolic activation inside cells. The proximate carcinogens PAH-diols can be converted to o-quinones by aldo-keto reductases (AKRs) or to diol-epoxides by cytochrome P450 (P450) enzymes. We assessed the effect of benzo[a]pyrene-7,8-dihydrodiol (BPD) on proliferation in p53-null bronchoalveolar carcinoma H358 cells. BPD treatment led to a significant inhibition of proliferation and arrest in G2/M in H358 cells. The relative contribution of the AKR and P450 pathways to cell cycle arrest was assessed. Overexpression of AKR1A1 did not affect cell proliferation or cell cycle progression, and benzo[a]pyrene-7,8-dione did not cause any noticeable effect on cell growth, suggesting that AKR1A1 metabolic products were not involved in the antiproliferative effect of BPD. On the other hand, blockade of P450 induction or inhibition of P450 activity greatly impaired the effect of BPD. Moreover, P450 induction by 2,3,7,8-tetrachlorodibenzo-p-dioxin significantly enhanced the antiproliferative effect of BPD. Mechanistic studies revealed that BPD caused a DNA damage response, Chk1 activation, and accumulation of phospho-Cdc2 (Tyr15) in H358 cells, effects that were impaired by an ataxia-telangectasia mutated (ATM)/ATM-related (ATR) inhibitor. Similar results were observed in human bronchoepithelial BEAS-2B cells, arguing for analogous mechanisms in tumorigenic and immortalized nontumorigenic cells lacking functional p53. Our data suggest that a p53-independent pathway operates in lung epithelial cells in response to BPD that involves P450 induction and subsequent activation of the ATR/ATM/Chk1 damage check-point pathway and cell cycle arrest in G2/M.

  14. Nuclear inclusion bodies of mutant and wild-type p53 in cancer: a hallmark of p53 inactivation and proteostasis remodelling by p53 aggregation.

    PubMed

    De Smet, Frederik; Saiz Rubio, Mirian; Hompes, Daphne; Naus, Evelyne; De Baets, Greet; Langenberg, Tobias; Hipp, Mark S; Houben, Bert; Claes, Filip; Charbonneau, Sarah; Delgado Blanco, Javier; Plaisance, Stephane; Ramkissoon, Shakti; Ramkissoon, Lori; Simons, Colinda; van den Brandt, Piet; Weijenberg, Matty; Van England, Manon; Lambrechts, Sandrina; Amant, Frederic; D'Hoore, André; Ligon, Keith L; Sagaert, Xavier; Schymkowitz, Joost; Rousseau, Frederic

    2017-05-01

    Although p53 protein aggregates have been observed in cancer cell lines and tumour tissue, their impact in cancer remains largely unknown. Here, we extensively screened for p53 aggregation phenotypes in tumour biopsies, and identified nuclear inclusion bodies (nIBs) of transcriptionally inactive mutant or wild-type p53 as the most frequent aggregation-like phenotype across six different cancer types. p53-positive nIBs co-stained with nuclear aggregation markers, and shared molecular hallmarks of nIBs commonly found in neurodegenerative disorders. In cell culture, tumour-associated stress was a strong inducer of p53 aggregation and nIB formation. This was most prominent for mutant p53, but could also be observed in wild-type p53 cell lines, for which nIB formation correlated with the loss of p53's transcriptional activity. Importantly, protein aggregation also fuelled the dysregulation of the proteostasis network in the tumour cell by inducing a hyperactivated, oncogenic heat-shock response, to which tumours are commonly addicted, and by overloading the proteasomal degradation system, an observation that was most pronounced for structurally destabilized mutant p53. Patients showing tumours with p53-positive nIBs suffered from a poor clinical outcome, similar to those with loss of p53 expression, and tumour biopsies showed a differential proteostatic expression profile associated with p53-positive nIBs. p53-positive nIBs therefore highlight a malignant state of the tumour that results from the interplay between (1) the functional inactivation of p53 through mutation and/or aggregation, and (2) microenvironmental stress, a combination that catalyses proteostatic dysregulation. This study highlights several unexpected clinical, biological and therapeutically unexplored parallels between cancer and neurodegeneration. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  15. miR-24-3p Suppresses Malignant Behavior of Lacrimal Adenoid Cystic Carcinoma by Targeting PRKCH to Regulate p53/p21 Pathway.

    PubMed

    Zhang, Ming-Xue; Zhang, Jie; Zhang, Hong; Tang, Hua

    2016-01-01

    MicroRNA (miRNA) may function as an oncogene or a tumor suppressor in tumorigenesis. However, the mechanism of miRNAs in adenoid cystic carcinoma (ACC) is unclear. Here, we provide evidence that miR-24-3p was downreglated and functions as a tumor suppressor in human lacrimal adenoid cystic carcinoma by suppressing proliferation and migration/invasion while promoting apoptosis. miR-24-3p down-regulated protein kinase C eta (PRKCH) by binding to its untranslated region (3'UTR). PRKCH increased the of the cell growth and migration/invasion in ACC cells and suppressed the expression of p53 and p21 in both mRNA and protein level. The overexpression of miR-24-3p decreased its malignant phenotype. Ectopic expression of PRKCH counteracted the suppression of malignancy induced by miR-24-3p, as well as ectopic expression of miR-24-3p rescued the suppression of PRKCH in the p53/p21 pathway. These results suggest that miR-24-3p promotes the p53/p21 pathway by down-regulating PRKCH expression in lacrimal adenoid cystic carcinoma cells.

  16. p53 and its mutants on the slippery road from stemness to carcinogenesis.

    PubMed

    Molchadsky, Alina; Rotter, Varda

    2017-04-01

    Normal development, tissue homeostasis and regeneration following injury rely on the proper functions of wide repertoire of stem cells (SCs) persisting during embryonic period and throughout the adult life. Therefore, SCs employ robust mechanisms to preserve their genomic integrity and avoid heritage of mutations to their daughter cells. Importantly, propagation of SCs with faulty DNA as well as dedifferentiation of genomically altered somatic cells may result in derivation of cancer SCs, which are considered to be the driving force of the tumorigenic process. Multiple experimental evidence suggest that p53, the central tumor suppressor gene, plays a critical regulatory role in determination of SCs destiny, thereby eliminating damaged SCs from the general SC population. Notably, mutant p53 proteins do not only lose the tumor suppressive function, but rather gain new oncogenic function that markedly promotes various aspects of carcinogenesis. In this review, we elaborate on the role of wild type and mutant p53 proteins in the various SCs types that appear under homeostatic conditions as well as in cancer. It is plausible that the growing understanding of the mechanisms underlying cancer SC phenotype and p53 malfunction will allow future optimization of cancer therapeutics in the context of precision medicine. © Crown copyright 2017.

  17. TRIM65 negatively regulates p53 through ubiquitination

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Li, Yang; Ma, Chengyuan; Zhou, Tong

    2016-04-22

    Tripartite-motif protein family member 65 (TRIM65) is an important protein involved in white matter lesion. However, the role of TRIM65 in human cancer remains less understood. Through the Cancer Genome Atlas (TCGA) gene alteration database, we found that TRIM65 is upregulated in a significant portion of non-small cell lung carcinoma (NSCLC) patients. Our cell growth assay revealed that TRIM65 overexpression promotes cell proliferation, while knockdown of TRIM65 displays opposite effect. Mechanistically, TRIM65 binds to p53, one of the most critical tumor suppressors, and serves as an E3 ligase toward p53. Consequently, TRIM65 inactivates p53 through facilitating p53 poly-ubiquitination and proteasome-mediatedmore » degradation. Notably, chemotherapeutic reagent cisplatin induction of p53 is markedly attenuated in response to ectopic expression of TRIM65. Cell growth inhibition by TRIM65 knockdown is more significant in p53 positive H460 than p53 negative H1299 cells, and knockdown of p53 in H460 cells also shows compromised cell growth inhibition by TRIM65 knockdown, indicating that p53 is required, at least in part, for TRIM65 function. Our findings demonstrate TRIM65 as a potential oncogenic protein, highly likely through p53 inactivation, and provide insight into development of novel approaches targeting TRIM65 for NSCLC treatment, and also overcoming chemotherapy resistance. - Highlights: • TRIM65 expression is elevated in NSCLC. • TRIM65 inactivates p53 through mediating p53 ubiquitination and degradation. • TRIM65 attenuates the response of NSCLC cells to cisplatin.« less

  18. Hypoxia induces p53 accumulation in the S-phase and accumulation of hypophosphorylated retinoblastoma protein in all cell cycle phases of human melanoma cells.

    PubMed Central

    Danielsen, T.; Hvidsten, M.; Stokke, T.; Solberg, K.; Rofstad, E. K.

    1998-01-01

    Hypoxia has been shown to induce accumulation of p53 and of hypophosphorylated retinoblastoma protein (pRb) in tumour cells. In this study, the cell cycle dependence of p53 accumulation and pRb hypophosphorylation in four human melanoma cell lines that are wild type for p53 was investigated using two-parameter flow cytometry measurements of p53 or pRb protein content and DNA content. The hypoxia-induced increase in p53 protein was higher in S-phase than in G1 and G2 phases in all cell lines. The accumulation of p53 in S-phase during hypoxia was not related to hypoxia-induced apoptosis or substantial cell cycle specific cell inactivation during the first 24 h of reoxygenation. pRb was hypophosphorylated in all cell cycle phases by hypoxia treatment. The results did not support a direct link between p53 and pRb during hypoxia because p53 was induced in a cell cycle-specific manner, whereas no cell cycle-dependent differences in pRb hypophosphorylation were detected. Only a fraction of the cell populations (0.60+/-0.10) showed hypophosphorylated pRb. Thus, pRb is probably not the only mediator of the hypoxia-induced cell cycle block seen in all cells and all cell cycle phases. Moreover, the cell cycle-dependent induction of p53 by hypoxia suggests that the primary function of p53 accumulation during hypoxia is other than to arrest the cells. Images Figure 4 Figure 7 PMID:9862563

  19. Ginsenoside Rg3 Inhibits Melanoma Cell Proliferation through Down-Regulation of Histone Deacetylase 3 (HDAC3) and Increase of p53 Acetylation

    PubMed Central

    Shan, Xiu; Fu, Yuan-Shan; Aziz, Faisal; Wang, Xiao-Qi; Yan, Qiu; Liu, Ji-Wei

    2014-01-01

    Malignant melanoma is an aggressive and deadly form of skin cancer, and despite recent advances in available therapies, is still lacking in completely effective treatments. Rg3, a monomer extracted from ginseng roots, has been attempted for the treatment of many cancers. It is reported that the expressions of histone deacetylase 3 (HDAC3) and p53 acetylation correlate with tumor cell growth. However, the antitumor effect of Rg3 on melanoma and the mechanism by which it regulates HDAC3 expression and p53 acetylation remain unknown. We found high expression of HDAC3 in human melanoma tissues to be significantly correlated to lymph node metastasis and clinical stage of disease (p<0.05). In melanoma cells, Rg3 inhibited cell proliferation and induced G0/G1 cell cycle arrest. Rg3 also decreased the expression of HDAC3 and increased the acetylation of p53 on lysine (k373/k382). Moreover, suppression of HDAC3 by either siRNA or a potent HDAC3 inhibitor (MS-275) inhibited cell proliferation, increased p53 acetylation and transcription activity. In A375 melanoma xenograft studies, we demonstrated that Rg3 and HDAC3 short hairpin RNA (shHDAC3) inhibited the growth of xenograft tumors with down-regulation of HDAC3 expression and up-regulation of p53 acetylation. In conclusion, Rg3 has antiproliferative activity against melanoma by decreasing HDAC3 and increasing acetylation of p53 both in vitro and in vivo. Thus, Rg3 serves as a potential therapeutic agent for the treatment of melanoma. PMID:25521755

  20. MicroRNA-125b is a novel negative regulator of p53.

    PubMed

    Le, Minh T N; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F; Lim, Bing

    2009-04-01

    The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3' untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with gamma-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response.

  1. MicroRNA-125b is a novel negative regulator of p53

    PubMed Central

    Le, Minh T.N.; Teh, Cathleen; Shyh-Chang, Ng; Xie, Huangming; Zhou, Beiyan; Korzh, Vladimir; Lodish, Harvey F.; Lim, Bing

    2009-01-01

    The p53 transcription factor is a key tumor suppressor and a central regulator of the stress response. To ensure a robust and precise response to cellular signals, p53 gene expression must be tightly regulated from the transcriptional to the post-translational levels. Computational predictions suggest that several microRNAs are involved in the post-transcriptional regulation of p53. Here we demonstrate that miR-125b, a brain-enriched microRNA, is a bona fide negative regulator of p53 in both zebrafish and humans. miR-125b-mediated down-regulation of p53 is strictly dependent on the binding of miR-125b to a microRNA response element in the 3′ untranslated region of p53 mRNA. Overexpression of miR-125b represses the endogenous level of p53 protein and suppresses apoptosis in human neuroblastoma cells and human lung fibroblast cells. In contrast, knockdown of miR-125b elevates the level of p53 protein and induces apoptosis in human lung fibroblasts and in the zebrafish brain. This phenotype can be rescued significantly by either an ablation of endogenous p53 function or ectopic expression of miR-125b in zebrafish. Interestingly, miR-125b is down-regulated when zebrafish embryos are treated with γ-irradiation or camptothecin, corresponding to the rapid increase in p53 protein in response to DNA damage. Ectopic expression of miR-125b suppresses the increase of p53 and stress-induced apoptosis. Together, our study demonstrates that miR-125b is an important negative regulator of p53 and p53-induced apoptosis during development and during the stress response. PMID:19293287

  2. Aggregation-primed molten globule conformers of the p53 core domain provide potential tools for studying p53C aggregation in cancer.

    PubMed

    Pedrote, Murilo M; de Oliveira, Guilherme A P; Felix, Adriani L; Mota, Michelle F; Marques, Mayra de A; Soares, Iaci N; Iqbal, Anwar; Norberto, Douglas R; Gomes, Andre M O; Gratton, Enrico; Cino, Elio A; Silva, Jerson L

    2018-05-31

    The functionality of the tumor suppressor p53 is altered in more than 50% of human cancers, and many individuals with cancer exhibit amyloid-like buildups of aggregated p53. An understanding of what triggers the pathogenic amyloid conversion of p53 is required for the further development of cancer therapies. Here, perturbation of the p53 core domain (p53C) with sub-denaturing concentrations of guanidine hydrochloride and high hydrostatic pressure revealed native-like molten globule (MG) states, a subset of which were highly prone to amyloidogenic aggregation. We found that MG conformers of p53C, likely representing population-weighted averages of multiple states, have different volumetric properties, as determined by pressure perturbation and size-exclusion chromatography. We also found that they bind the fluorescent dye 4,4'-dianilino-1,1'-binaphthyl-5,5'-disulfonic acid (bis-ANS) and have a native-like tertiary structure that occludes the single Trp residue in p53. Fluorescence experiments revealed conformational changes of the single Trp and Tyr residues before p53 unfolding and the presence of MG conformers, some of which were highly prone to aggregation. P53C exhibited marginal unfolding cooperativity, which could be modulated from unfolding to aggregation pathways with chemical or physical forces. We conclude that trapping amyloid precursor states in solution is a promising approach for understanding p53 aggregation in cancer. Our findings support the use of single-Trp fluorescence as a probe for evaluating p53 stability, effects of mutations, and the efficacy of therapeutics designed to stabilize p53. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Both germ line and somatic genetics of the p53 pathway affect ovarian cancer incidence and survival.

    PubMed

    Bartel, Frank; Jung, Juliane; Böhnke, Anja; Gradhand, Elise; Zeng, Katharina; Thomssen, Christoph; Hauptmann, Steffen

    2008-01-01

    Although p53 is one of the most studied genes/proteins in ovarian carcinomas, the predictive value of p53 alterations is still ambiguous. We performed analyses of the TP53 mutational status and its protein expression using immunohistochemistry. Moreover, the single nucleotide polymorphism SNP309 in the P2 promoter of the MDM2 gene was investigated. We correlated the results with age of onset and outcome from 107 patients with ovarian carcinoma. In our study, we identified a large group of patients with p53 overexpression despite having a wild-type gene (49% of all patients with wild-type TP53). This was associated with a significantly shortened overall survival time (P = 0.019). Patients with p53 alterations (especially those with overexpression of wild-type TP53) were also more refractory to chemotherapy compared with patients with normal p53 (P = 0.027). The G-allele of SNP309 is associated with an earlier age of onset in patients with estrogen receptor-overexpressing FIGO stage III disease (P = 0.048). In contrast, in patients with FIGO stage III disease, a weakened p53 pathway (either the G-allele of SNP309 or a TP53 mutation) was correlated with increased overall survival compared with patients whose tumors were wild-type for both TP53 and SNP309 (P = 0.0035). Our study provides evidence that both germ line and somatic alterations of the p53 pathway influence the incidence and survival of ovarian carcinoma, and it underscores the importance of assessing the functionality of p53 in order to predict the sensitivity of platinum-based chemotherapies and patient outcome.

  4. Enhanced radiosensitivity of malignant glioma cells after adenoviral p53 transduction.

    PubMed

    Broaddus, W C; Liu, Y; Steele, L L; Gillies, G T; Lin, P S; Loudon, W G; Valerie, K; Schmidt-Ullrich, R K; Fillmore, H L

    1999-12-01

    The goal of this study was to determine whether adenoviral vector-mediated expression of human wildtype p53 can enhance the radiosensitivity of malignant glioma cells that express native wild-type p53. The p53 gene is thought to function abnormally in the majority of malignant gliomas, although it has been demonstrated to be mutated in only approximately 30%. This has led to studies in which adenoviral transduction with wild-type human p53 has been investigated in an attempt to slow tumor cell growth. Recent studies suggest that reconstitution of wild-type p53 can render cells more susceptible to radiation-mediated death, primarily by p53-mediated apoptosis. Rat RT2 glioma cells were analyzed for native p53 status by reverse transcriptase-polymerase chain reaction and sequence analysis and for p53 expression by Western blot analysis. Clonogenic survival and the terminal deoxynucleotidyl transferase-mediated deoxyuridine triphosphate nick-end labeling assay were used to characterize RT2 cell radiosensitivity and apoptosis, respectively, with and without prior transduction with p53-containing and control adenoviral vectors. Animal survival length was monitored after intracerebral implantation with transduced and nontransduced RT2 cells, with and without cranial radiation. The RT2 cells were demonstrated to express native rat wild-type p53 and to markedly overexpress human p53 following adenoviral p53 transduction. The combination of p53 transduction followed by radiation resulted in marked decreases in RT2 cell survival and increases in apoptosis at radiation doses from 2 to 6 Gy. Animals receiving cranial radiation after intracerebral implantation with RT2 cells previously transduced with p53 survived significantly longer than control animals (p<0.01). The ability to enhance the radiosensitivity of malignant glioma cells that express wild-type p53 by using adenoviral transduction to induce overexpression of p53 offers hope for this approach as a therapeutic strategy, not only in human gliomas that express mutant p53, but also in those that express wild-type p53.

  5. Prevention of the neurocristopathy Treacher Collins syndrome through inhibition of p53 function

    PubMed Central

    Jones, Natalie C; Lynn, Megan L; Gaudenz, Karin; Sakai, Daisuke; Aoto, Kazushi; Rey, Jean-Phillipe; Glynn, Earl F; Ellington, Lacey; Du, Chunying; Dixon, Jill; Dixon, Michael J; Trainor, Paul A

    2010-01-01

    Treacher Collins syndrome (TCS) is a congenital disorder of craniofacial development arising from mutations in TCOF1, which encodes the nucleolar phosphoprotein Treacle. Haploinsufficiency of Tcof1 perturbs mature ribosome biogenesis, resulting in stabilization of p53 and the cyclin G1–mediated cell-cycle arrest that underpins the specificity of neuroepithelial apoptosis and neural crest cell hypoplasia characteristic of TCS. Here we show that inhibition of p53 prevents cyclin G1–driven apoptotic elimination of neural crest cells while rescuing the craniofacial abnormalities associated with mutations in Tcof1 and extending life span. These improvements, however, occur independently of the effects on ribosome biogenesis; thus suggesting that it is p53-dependent neuroepithelial apoptosis that is the primary mechanism underlying the pathogenesis of TCS. Our work further implies that neuroepithelial and neural crest cells are particularly sensitive to cellular stress during embryogenesis and that suppression of p53 function provides an attractive avenue for possible clinical prevention of TCS craniofacial birth defects and possibly those of other neurocristopathies. PMID:18246078

  6. Cerebellum Development and Tumorigenesis: A p53-Centric Perspective.

    PubMed

    Barthelery, Nicolas J; Manfredi, James J

    2016-05-01

    The p53 protein has been extensively studied for its role in suppressing tumorigenesis, in part through surveillance and maintenance of genomic stability. p53 has been associated with the induction of a variety of cellular outcomes including cell cycle arrest, senescence, and apoptosis. This occurs primarily, but not exclusively, through transcriptional activation of specific target genes. By contrast, the participation of p53 in normal developmental processes has been largely understudied. This review focuses on possible functions of p53 in cerebellar development. It can be argued that a better understanding of such mechanisms will provide needed insight into the genesis of certain embryonic cancers including medulloblastomas, and thus lead to more effective therapies. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. Survivin safeguards chromosome numbers and protects from aneuploidy independently from p53

    PubMed Central

    2014-01-01

    Background Survivin, a member of the inhibitor of apoptosis (IAP) gene family, has a dual role in mitosis and in apoptosis. It is abundantly expressed in every human tumor, compared with normal tissues. During mitosis Survivin assembles with the chromosomal passenger complex and regulates chromosomal segregation. Here, we aim to explore whether interference with the mitotic function of Survivin is linked to p53-mediated G1 cell cycle arrest and affects chromosomal stability. Methods In this study, we used HCT116, SBC-2, and U87-MG and generated corresponding isogenic p53-deficient cells. Retroviral vectors were used to stably knockdown Survivin. The resulting phenotype, in particular the mechanisms of cell cycle arrest and of initiation of aneuploidy, were investigated by Western Blot analysis, confocal laser scan microscopy, proliferation assays, spectral karyotyping and RNAi. Results In all cell lines Survivin-RNAi did not induce instant apoptosis but caused polyplodization irrespective of p53 status. Strikingly, polyploidization after knockdown of Survivin resulted in merotelic kinetochore spindle assemblies, γH2AX-foci, and DNA damage response (DDR), which was accompanied by a transient p53-mediated G1-arrest. That p53 wild type cells specifically arrest due to DNA damage was shown by simultaneous inhibition of ATM and DNA-PK, which abolished induction of p21waf/cip. Cytogenetic analysis revealed chromosomal aberrations indicative for DNA double strand break repair by the mechanism of non-homologous end joining (NHEJ), only in Survivin-depleted cells. Conclusion Our findings suggest that Survivin plays an essential role in proper amphitelic kinetochore-spindle assembly and that constraining Survivin’s mitotic function results in polyploidy and aneuploidy which cannot be controlled by p53. Therefore, Survivin critically safeguards chromosomal stability independently from p53. PMID:24886358

  8. Molecular Regulation of DNA Damage-Induced Apoptosis in Neurons of Cerebral Cortex

    PubMed Central

    Liu, Zhiping; Pipino, Jacqueline; Chestnut, Barry; Landek, Melissa A.

    2009-01-01

    Cerebral cortical neuron degeneration occurs in brain disorders manifesting throughout life, but the mechanisms are understood poorly. We used cultured embryonic mouse cortical neurons and an in vivo mouse model to study mechanisms of DNA damaged-induced apoptosis in immature and differentiated neurons. p53 drives apoptosis of immature and differentiated cortical neurons through its rapid and prominent activation stimulated by DNA strand breaks induced by topoisomerase-I and -II inhibition. Blocking p53-DNA transactivation with α-pifithrin protects immature neurons; blocking p53-mitochondrial functions with μ-pifithrin protects differentiated neurons. Mitochondrial death proteins are upregulated in apoptotic immature and differentiated neurons and have nonredundant proapoptotic functions; Bak is more dominant than Bax in differentiated neurons. p53 phosphorylation is mediated by ataxia telangiectasia mutated (ATM) kinase. ATM inactivation is antiapoptotic, particularly in differentiated neurons, whereas inhibition of c-Abl protects immature neurons but not differentiated neurons. Cell death protein expression patterns in mouse forebrain are mostly similar to cultured neurons. DNA damage induces prominent p53 activation and apoptosis in cerebral cortex in vivo. Thus, DNA strand breaks in cortical neurons induce rapid p53-mediated apoptosis through actions of upstream ATM and c-Abl kinases and downstream mitochondrial death proteins. This molecular network operates through variations depending on neuron maturity. PMID:18820287

  9. Improving survival by exploiting tumor dependence on stabilized mutant p53 for treatment

    PubMed Central

    Alexandrova, EM; Yallowitz, AR; Li, D; Xu, S; Schulz, R; Proia, DA; Lozano, G; Dobbelstein, M; Moll, UM

    2015-01-01

    SUMMARY Missense mutations in p53 generate aberrant proteins with abrogated tumor suppressor functions that can also acquire oncogenic gain-of-functions (GOF) that promote malignant progression, invasion, metastasis and chemoresistance1–5. Mutant p53 (mutp53) proteins undergo massive constitutive stabilization specifically in tumors, which is the key requisite for GOF6–8. Although currently 11 million patients worldwide live with tumors expressing highly stabilized mutp53, it is unknown whether mutp53 is a therapeutic target in vivo. Here we use a novel mutp53 mouse model expressing an inactivatible R248Q hotspot mutation (floxQ) to show that tumors depend on sustained mutp53 expression. Upon Tamoxifen-induced mutp53 ablation, allo-transplanted and autochthonous tumors curb their growth, thus extending animal survival by 37%, and advanced tumors undergo apoptosis and tumor regression or stagnation. The HSP90/HDAC6 chaperone machinery, which is significantly upregulated in cancer compared to normal tissues, is a major determinant of mutp53 stabilization9–12. We show that long-term HSP90 inhibition significantly extends the survival of mutp53 Q/−2 and H/H (R172H allele3) mice by 59% and 48%, respectively, but not their respective p53−/− littermates. This mutp53-dependent drug effect occurs in H/H mice treated with 17DMAG+SAHA and in H/H and Q/− mice treated with the potent Hsp90 inhibitor ganetespib. Notably, drug activity correlates with induction of mutp53 degradation, tumor apoptosis and prevention of T-lymphomagenesis. These proof-of-principle data identify mutp53 as an actionable cancer-specific drug target. PMID:26009011

  10. Human papilloma virus type16 E6 deregulates CHK1 and sensitizes human fibroblasts to environmental carcinogens independently of its effect on p53

    PubMed Central

    Chen, Bo; Simpson, Dennis A.; Zhou, Yingchun; Mitra, Amritava; Mitchell, David L.; Cordeiro-Stone, Marila; Kaufmann, William K.

    2015-01-01

    After treatment with ultraviolet radiation (UV), human fibroblasts that express the HPV type 16 E6 oncoprotein display defects in repair of cyclobutane pyrimidine dimers, hypersensitivity to inactivation of clonogenic survival and an inability to sustain DNA replication. To determine whether these effects are specific to depletion of p53 or inactivation of its function, fibroblast lines were constructed with ectopic expression of a dominant-negative p53 allele (p53-H179Q) to inactivate function or a short-hairpin RNA (p53-RNAi) to deplete expression of p53. Only the expression of HPV16E6 sensitized fibroblasts to UV or the chemical carcinogen, benzo[a]pyrene diolepoxide I (BPDE). Carcinogen-treated cells expressing p53-H179Q or p53-RNAi were resistant to inactivation of colony formation and did not suffer replication arrest. CHK1 is a key checkpoint kinase in the response to carcinogen-induced DNA damage. Control and p53-RNAi-expressing fibroblasts displayed phosphorylation of Ser345 on CHK1 45–120 min after carcinogen treatment with a return to near baseline phosphorylation by 6 h after treatment. HPV16E6-expressing fibroblasts displayed enhanced and sustained phosphorylation of CHK1. This was associated with enhanced phosphorylation of Thr68 on CHK2 and Ser139 on H2AX, both markers of severe replication stress and DNA double strand breaks. Incubation with the phosphatase inhibitor okadaic acid produced more phosphorylation of CHK1 in UV-treated HPV16E6-expressing cells than in p53-H179Q-expressing cells suggesting that HPV16E6 may interfere with the recovery of coupled DNA replication at replication forks that are stalled at [6-4]pyrimidine-pyrimidone photoproducts and BPDE-DNA adducts. The results indicate that HPV16E6 targets a protein or proteins other than p53 to deregulate the activity of CHK1 in carcinogen-damaged cells. PMID:19411857

  11. Influence of p53 status on the effects of boron neutron capture therapy in glioblastoma.

    PubMed

    Seki, Keiko; Kinashi, Yuko; Takahashi, Sentaro

    2015-01-01

    The tumor suppressor gene p53 is mutated in glioblastoma. We studied the relationship between the p53 gene and the biological effects of boron neutron capture therapy (BNCT). The human glioblastoma cells; A172, expressing wild-type p53, and T98G, with mutant p53, were irradiated by the Kyoto University Research Reactor (KUR). The biological effects after neutron irradiation were evaluated by the cell killing effect, 53BP1 foci assay and apoptosis induction. The survival-fraction data revealed that A172 was more radiosensitive than T98G, but the difference was reduced when boronophenylalanine (BPA) was present. Both cell lines exhibited similar numbers of foci, suggesting that the initial levels of DNA damage did not depend on p53 function. Detection of apoptosis revealed a lower rate of apoptosis in the T98G. BNCT causes cell death in glioblastoma cells, regardless of p53 mutation status. In T98G cells, cell killing and apoptosis occurred effectively following BNCT. Copyright© 2015 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

  12. Irradiation With Carbon Ion Beams Induces Apoptosis, Autophagy, and Cellular Senescence in a Human Glioma-Derived Cell Line

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jinno-Oue, Atsushi; Shimizu, Nobuaki; 21st Century Center of Excellence Program for Biomedical Research Using Accelerator Technology, Maebashi, Gunma

    2010-01-15

    Purpose: We examined biological responses of human glioma cells to irradiation with carbon ion beams (C-ions). Methods and Materials: A human glioma-derived cell line, NP-2, was irradiated with C-ions. Apoptotic cell nuclei were stained with Hoechst 33342. Induction of autophagy was examined either by staining cells with monodansylcadaverine (MDC) or by Western blotting to detect conversion of microtuble-associated protein light chain 3 (MAP-LC3) (LC3-I) to the membrane-bound form (LC3-II). Cellular senescence markers including induction of senescence-associated beta-galactosidase (SA-beta-gal) were examined. The mean telomere length of irradiated cells was determined by Southern blot hybridization. Expression of tumor suppressor p53 and cyclin/cyclin-dependentmore » kinase inhibitor p21{sup WAF1/CIP1} in the irradiated cells was analyzed by Western blotting. Results: When NP-2 cells were irradiated with C-ions at 6 Gy, the major population of the cells died of apoptosis and autophagy. The residual fraction of attached cells (<1% of initially irradiated cells) could not form a colony: however, they showed a morphological phenotype consistent with cellular senescence, that is, enlarged and flattened appearance. The senescent nature of these attached cells was further indicated by staining for SA-beta-gal. The mean telomere length was not changed after irradiation with C-ions. Phosphorylation of p53 at serine 15 as well as the expression of p21{sup WAF1/CIP1} was induced in NP-2 cells after irradiation. Furthermore, we found that irradiation with C-ions induced cellular senescence in a human glioma cell line lacking functional p53. Conclusions: Irradiation with C-ions induced apoptosis, autophagy, and cellular senescence in human glioma cells.« less

  13. Conserved Regulation of p53 Network Dosage by MicroRNA–125b Occurs through Evolving miRNA–Target Gene Pairs

    PubMed Central

    Khaw, Swea Ling; Chin, Lingzi; Teh, Cathleen; Tay, Junliang; O'Day, Elizabeth; Korzh, Vladimir; Yang, Henry; Lal, Ashish; Lieberman, Judy; Lodish, Harvey F.; Lim, Bing

    2011-01-01

    MicroRNAs regulate networks of genes to orchestrate cellular functions. MiR-125b, the vertebrate homologue of the Caenorhabditis elegans microRNA lin-4, has been implicated in the regulation of neural and hematopoietic stem cell homeostasis, analogous to how lin-4 regulates stem cells in C. elegans. Depending on the cell context, miR-125b has been proposed to regulate both apoptosis and proliferation. Because the p53 network is a central regulator of both apoptosis and proliferation, the dual roles of miR-125b raise the question of what genes in the p53 network might be regulated by miR-125b. By using a gain- and loss-of-function screen for miR-125b targets in humans, mice, and zebrafish and by validating these targets with the luciferase assay and a novel miRNA pull-down assay, we demonstrate that miR-125b directly represses 20 novel targets in the p53 network. These targets include both apoptosis regulators like Bak1, Igfbp3, Itch, Puma, Prkra, Tp53inp1, Tp53, Zac1, and also cell-cycle regulators like cyclin C, Cdc25c, Cdkn2c, Edn1, Ppp1ca, Sel1l, in the p53 network. We found that, although each miRNA–target pair was seldom conserved, miR-125b regulation of the p53 pathway is conserved at the network level. Our results lead us to propose that miR-125b buffers and fine-tunes p53 network activity by regulating the dose of both proliferative and apoptotic regulators, with implications for tissue stem cell homeostasis and oncogenesis. PMID:21935352

  14. Down-regulation of Toll-like Receptor TLR4 Is Associated with HPV DNA Integration in Penile Carcinoma.

    PubMed

    Damasdi, Miklos; Kovacs, Krisztina; Farkas, Nelli; Jakab, Ferenc; Kovacs, Gyula

    2017-10-01

    Development of penile cancers is attributed to HPV-related carcinogenesis. Our aim was to analyze HPV positivity and TLR4, p16 ink4a and p53 expression. HPV presence was assessed with virus-specific TaqMan PCR and HPV Genotyping Test in 31 penile cancers. Immunohistochemistry was carried out on tissue microarray. TLR4 expression was detected in 4 of the 16 HPV positive and 13 of the 15 HPV negative tumors. We found a significant inverse correlation between HPV positivity and TLR4 expression (p=0.0006). Ten of the 16 HPV-positive but none of the 15 HPV-negative tumors expressed p16INK4a. A significant correlation was seen between p53 expression and lack of HPV DNA (p=0.0191) as well as between TLR4 and p53 expression (p=0.0198) in penile cancers. Our findings suggest a protective role of TLR4 expression against HPV DNA integration and the viral and non-viral carcinogenesis of penile cancer. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.

  15. Pathways connecting telomeres and p53 in senescence, apoptosis, and cancer

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Artandi, Steven E.; Attardi, Laura D.

    2005-06-10

    The ends of eukaryotic chromosomes are protected by specialized structures termed telomeres that serve in part to prevent the chromosome end from activating a DNA damage response. However, this important function for telomeres in chromosome end protection can be lost as telomeres shorten with cell division in culture or in self-renewing tissues with advancing age. Impaired telomere function leads to induction of a DNA damage response and activation of the tumor suppressor protein p53. p53 serves a critical role in enforcing both senescence and apoptotic responses to dysfunctional telomeres. Loss of p53 creates a permissive environment in which critically shortmore » telomeres are inappropriately joined to generate chromosomal end-to-end fusions. These fused chromosomes result in cycles of chromosome fusion-bridge-breakage, which can fuel cancer initiation, especially in epithelial tissues, by facilitating changes in gene copy number.« less

  16. p53-Mdm2 interaction inhibitors as novel nongenotoxic anticancer agents.

    PubMed

    Nayak, Surendra Kumar; Khatik, Gopal L; Narang, Rakesh; Monga, Vikramdeep; Chopra, Harish Kumar

    2017-06-23

    Cancer is a major global health problem with high mortality rate. Most of clinically used anticancer agents induce apoptosis through genotoxic stress at various stages of cell cycle and activation of p53. Acting as a tumor suppressor p53 plays a vital role in preventing tumor development. Tumor suppressor function of p53 is effectively antagonized by its direct interaction with murine double minute 2 (Mdm2) proteins via multiple mechanisms. Thus, p53-Mdm2 interaction has been found to be an important target for the development of novel anticancer agents. Currently, nutlin, spirooxindole, isoquilinone and piperidinone analogues inhibiting p53-Mdm2 interaction are found to be promising in the treatment of cancer. The current review focused to scrutinize the structural aspects of p53-Mdm2 interaction inhibitors. The present study provides a detailed collection of published information on different classes of inhibitors of p53-Mdm2 interaction as potential anticancer agents. The review highlighted the structural aspects of various reported p53-Mdm2 inhibitor for optimization. In the last few years, different classes of inhibitors of p53-Mdm2 have been designed and developed, and seven such compounds are being evaluated in clinical trials as new anticancer drugs. Further, to explore the role of p53 protein as a potential target for anticancer drug development, in this review, the mechanism of Mdm2 mediated inactivation of p53 and recent developments on p53-Mdm2 interactions inhibitors are discussed. Agents designed to block the p53-Mdm2 interaction may have a therapeutic potential for treatment of a subset of human cancers retaining wild-type p53. We review herein the recent advances in the design and development of potent small molecules as p53-Mdm2 inhibitors. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  17. Structure of the E6/E6AP/p53 complex required for HPV-mediated degradation of p53

    PubMed Central

    Martinez-Zapien, Denise; Ruiz, Francesc Xavier; Poirson, Juline; Mitschler, André; Ramirez-Ramos, Juan; Forster, Anne; Cousido-Siah, Alexandra; Masson, Murielle; Pol, Scott Vande; Podjarny, Alberto; Travé, Gilles; Zanier, Katia

    2015-01-01

    Summary The p53 pro-apoptotic tumor suppressor is mutated or functionally altered in most cancers. In epithelial tumors induced by “high-risk” mucosal Human Papillomaviruses (hrm-HPVs), including human cervical carcinoma and a growing number of head-and-neck cancers 1, p53 is degraded by the viral oncoprotein E6 2. In this process, E6 binds to a short LxxLL consensus sequence within the cellular ubiquitin ligase E6AP 3. Subsequently, the E6/E6AP heterodimer recruits and degrades p53 4. Neither E6 nor E6AP are separately able to recruit p53 3,5, and the precise mode of assembly of E6, E6AP and p53 is unknown. Here, we solved the crystal structure of a ternary complex comprising full-length HPV16 E6, the LxxLL motif of E6AP and the core domain of p53. The LxxLL motif of E6AP renders the conformation of E6 competent for interaction with p53 by structuring a p53-binding cleft on E6. Mutagenesis of critical positions at the E6-p53 interface disrupts p53 degradation. The E6-binding site of p53 is distal from previously described DNA- and protein-binding surfaces of the core domain. This suggests that, in principle, E6 may avoid competition with cellular factors by targeting both free and bound p53 molecules. The E6/E6AP/p53 complex represents a prototype of viral hijacking of both the ubiquitin-mediated protein degradation pathway and the p53 tumor suppressor pathway. The present structure provides a framework for the design of inhibitory therapeutic strategies against HPV-mediated oncogenesis. PMID:26789255

  18. p53-independent p21 induction by MELK inhibition.

    PubMed

    Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun

    2017-08-29

    MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated.

  19. p53-independent p21 induction by MELK inhibition

    PubMed Central

    Matsuda, Tatsuo; Kato, Taigo; Kiyotani, Kazuma; Tarhan, Yunus Emre; Saloura, Vassiliki; Chung, Suyoun; Ueda, Koji; Nakamura, Yusuke; Park, Jae-Hyun

    2017-01-01

    MELK play critical roles in human carcinogenesis through activation of cell proliferation, inhibition of apoptosis and maintenance of stemness. Therefore, MELK is a promising therapeutic target for a wide range of cancers. Although p21 is a well-known p53-downstream gene, we found that treatment with a potent MELK inhibitor, OTS167, could induce p21 protein expression in cancer cell lines harboring loss-of-function TP53 mutations. We also confirmed that MELK knockdown by siRNA induced the p21 expression in p53-deficient cancer cell lines and caused the cell cycle arrest at G1 phase. Further analysis indicated that FOXO1 and FOXO3, two known transcriptional regulators of p21, were phosphorylated by MELK and thus be involved in the induction of p21 after MELK inhibition. Collectively, our herein findings suggest that MELK inhibition may be effective for human cancers even if TP53 is mutated. PMID:28938528

  20. The expression of TP53 pathway-related proteins in ovarian carcinoma transplanted subcutaneously in nude mice.

    PubMed

    Zhang, S-R; Li, D-B; Xue, J-W

    2018-03-01

    Given the important functions of TP53 pathway in various biological processes, this study aimed to investigate the expression of TP53 pathway-related proteins in ovarian carcinoma transplanted subcutaneously in nude mice with and without the presence of p53 inhibitor and to explore possible roles of p53 in the development of ovarian cancer. Thirty BALB/c-nu female nude mice were randomly divided into model group, control group and p53 inhibitor group (Pftα group). There were 10 rats in each group. The nude mice were subcutaneously inoculated with human ovarian cancer cell line SKOV3, and the tumor growth was observed. Morphological changes of tumor tissue were observed by hematoxylin and eosin (HE) staining. The mRNA and protein levels of TP53 pathway related factors-p53, p21 and mouse double minute 2 homolog (MDM2) were detected by RT-PCR and Western blot. p53 inhibitor can increase the growth rate of subcutaneously transplanted tumor in nude mice. p53 inhibitor could decrease the expression of p53 and p21 at both mRNA and protein levels and increase the expression of MDM2 at both mRNA and protein levels in ovarian carcinoma transplanted subcutaneously in nude mice. TP53 pathway may play pivotal roles in the development of ovarian cancer and TP53 pathway may be a new target for the treatment of ovarian cancer.

  1. The Neuronal Ischemic Tolerance Is Conditioned by the Tp53 Arg72Pro Polymorphism.

    PubMed

    Ramos-Araque, Maria E; Rodriguez, Cristina; Vecino, Rebeca; Cortijo Garcia, Elisa; de Lera Alfonso, Mercedes; Sanchez Barba, Mercedes; Colàs-Campàs, Laura; Purroy, Francisco; Arenillas, Juan F; Almeida, Angeles; Delgado-Esteban, Maria

    2018-04-23

    Cerebral preconditioning (PC) confers endogenous brain protection after stroke. Ischemic stroke patients with a prior transient ischemic attack (TIA) may potentially be in a preconditioned state. Although PC has been associated with the activation of pro-survival signals, the mechanism by which preconditioning confers neuroprotection is not yet fully clarified. Recently, we have described that PC-mediated neuroprotection against ischemic insult is promoted by p53 destabilization, which is mediated by its main regulator MDM2. Moreover, we have previously described that the human Tp53 Arg72Pro single nucleotide polymorphism (SNP) controls susceptibility to ischemia-induced neuronal apoptosis and governs the functional outcome of patients after stroke. Here, we studied the contribution of the human Tp53 Arg72Pro SNP on PC-induced neuroprotection after ischemia. Our results showed that cortical neurons expressing the Pro72-p53 variant exhibited higher PC-mediated neuroprotection as compared with Arg72-p53 neurons. PC prevented ischemia-induced nuclear and cytosolic p53 stabilization in Pro72-p53 neurons. However, PC failed to prevent mitochondrial p53 stabilization, which occurs in Arg72-p53 neurons after ischemia. Furthermore, PC promoted neuroprotection against ischemia by controlling the p53/active caspase-3 pathway in Pro72-p53, but not in Arg72-p53 neurons. Finally, we found that good prognosis associated to TIA within 1 month prior to ischemic stroke was restricted to patients harboring the Pro72 allele. Our findings demonstrate that the Tp53 Arg72Pro SNP controls PC-promoted neuroprotection against a subsequent ischemic insult by modulating mitochondrial p53 stabilization and then modulates TIA-induced ischemic tolerance.

  2. Murine Gammaherpesvirus 68 LANA and SOX Homologs Counteract ATM-Driven p53 Activity during Lytic Viral Replication

    PubMed Central

    Sifford, Jeffrey M.; Stahl, James A.; Salinas, Eduardo

    2015-01-01

    ABSTRACT Tumor suppressor p53 is activated in response to numerous cellular stresses, including viral infection. However, whether murine gammaherpesvirus 68 (MHV68) provokes p53 during the lytic replication cycle has not been extensively evaluated. Here, we demonstrate that MHV68 lytic infection induces p53 phosphorylation and stabilization in a manner that is dependent on the DNA damage response (DDR) kinase ataxia telangiectasia mutated (ATM). The induction of p53 during MHV68 infection occurred in multiple cell types, including splenocytes of infected mice. ATM and p53 activation required early viral gene expression but occurred independently of viral DNA replication. At early time points during infection, p53-responsive cellular genes were induced, coinciding with p53 stabilization and phosphorylation. However, p53-related gene expression subsided as infection progressed, even though p53 remained stable and phosphorylated. Infected cells also failed to initiate p53-dependent gene expression and undergo apoptosis in response to treatment with exogenous p53 agonists. The inhibition of p53 responses during infection required the expression of the MHV68 homologs of the shutoff and exonuclease protein (muSOX) and latency-associated nuclear antigen (mLANA). Interestingly, mLANA, but not muSOX, was necessary to prevent p53-mediated death in MHV68-infected cells under the conditions tested. This suggests that muSOX and mLANA are differentially required for inhibiting p53 in specific settings. These data reveal that DDR responses triggered by MHV68 infection promote p53 activation. However, MHV68 encodes at least two proteins capable of limiting the potential consequences of p53 function. IMPORTANCE Gammaherpesviruses are oncogenic herpesviruses that establish lifelong chronic infections. Defining how gammaherpesviruses overcome host responses to infection is important for understanding how these viruses infect and cause disease. Here, we establish that murine gammaherpesvirus 68 induces the activation of tumor suppressor p53. p53 activation was dependent on the DNA damage response kinase ataxia telangiectasia mutated. Although active early after infection, p53 became dominantly inhibited as the infection cycle progressed. Viral inhibition of p53 was mediated by the murine gammaherpesvirus 68 homologs of muSOX and mLANA. The inhibition of the p53 pathway enabled infected cells to evade p53-mediated cell death responses. These data demonstrate that a gammaherpesvirus encodes multiple proteins to limit p53-mediated responses to productive viral infection, which likely benefits acute viral replication and the establishment of chronic infection. PMID:26676792

  3. CTCF regulates the human p53 gene through direct interaction with its natural antisense transcript, Wrap53

    PubMed Central

    Saldaña-Meyer, Ricardo; González-Buendía, Edgar; Guerrero, Georgina; Narendra, Varun; Bonasio, Roberto; Recillas-Targa, Félix; Reinberg, Danny

    2014-01-01

    The multifunctional CCCTC-binding factor (CTCF) protein exhibits a broad range of functions, including that of insulator and higher-order chromatin organizer. We found that CTCF comprises a previously unrecognized region that is necessary and sufficient to bind RNA (RNA-binding region [RBR]) and is distinct from its DNA-binding domain. Depletion of cellular CTCF led to a decrease in not only levels of p53 mRNA, as expected, but also those of Wrap53 RNA, an antisense transcript originated from the p53 locus. PAR-CLIP-seq (photoactivatable ribonucleoside-enhanced cross-linking and immunoprecipitation [PAR-CLIP] combined with deep sequencing) analyses indicate that CTCF binds a multitude of transcripts genome-wide as well as to Wrap53 RNA. Apart from its established role at the p53 promoter, CTCF regulates p53 expression through its physical interaction with Wrap53 RNA. Cells harboring a CTCF mutant in its RBR exhibit a defective p53 response to DNA damage. Moreover, the RBR facilitates CTCF multimerization in an RNA-dependent manner, which may bear directly on its role in establishing higher-order chromatin structures in vivo. PMID:24696455

  4. Structural studies of p53 inactivation by DNA-contact mutations and its rescue by suppressor mutations via alternative protein–DNA interactions

    PubMed Central

    Eldar, Amir; Rozenberg, Haim; Diskin-Posner, Yael; Rohs, Remo; Shakked, Zippora

    2013-01-01

    A p53 hot-spot mutation found frequently in human cancer is the replacement of R273 by histidine or cysteine residues resulting in p53 loss of function as a tumor suppressor. These mutants can be reactivated by the incorporation of second-site suppressor mutations. Here, we present high-resolution crystal structures of the p53 core domains of the cancer-related proteins, the rescued proteins and their complexes with DNA. The structures show that inactivation of p53 results from the incapacity of the mutated residues to form stabilizing interactions with the DNA backbone, and that reactivation is achieved through alternative interactions formed by the suppressor mutations. Detailed structural and computational analysis demonstrates that the rescued p53 complexes are not fully restored in terms of DNA structure and its interface with p53. Contrary to our previously studied wild-type (wt) p53-DNA complexes showing non-canonical Hoogsteen A/T base pairs of the DNA helix that lead to local minor-groove narrowing and enhanced electrostatic interactions with p53, the current structures display Watson–Crick base pairs associated with direct or water-mediated hydrogen bonds with p53 at the minor groove. These findings highlight the pivotal role played by R273 residues in supporting the unique geometry of the DNA target and its sequence-specific complex with p53. PMID:23863845

  5. HIPK2 modulates p53 activity towards pro-apoptotic transcription.

    PubMed

    Puca, Rosa; Nardinocchi, Lavinia; Sacchi, Ada; Rechavi, Gideon; Givol, David; D'Orazi, Gabriella

    2009-10-14

    Activation of p53-mediated gene transcription is a critical cellular response to DNA damage and involves a phosphorylation-acetylation cascade of p53. The discovery of differences in the response to different agents raises the question whether some of the p53 oncosuppressor functions might be exerted by different posttranslational modifications. Stress-induced homeodomain-interacting protein kinase-2 (HIPK2) phosphorylates p53 at serine-46 (Ser46) for p53 apoptotic activity; p53 acetylation at different C-terminus lysines including p300-mediated lysine-382 (Lys382) is also required for full activation of p53 transcriptional activity. The purpose of the current study was to evaluate the interplay among HIPK2, p300, and p53 in p53 acetylation and apoptotic transcriptional activity in response to drug by using siRNA interference, p300 overexpression or deacetylase inhibitors, in cancer cells. Knockdown of HIPK2 inhibited both adriamycin-induced Ser46 phosphorylation and Lys382 acetylation in p53 protein; however, while combination of ADR and zinc restored Ser46 phosphorylation it did not recover Lys382 acetylation. Chromatin immunoprecipitation studies showed that HIPK2 was required in vivo for efficient p300/p53 co-recruitment onto apoptotic promoters and that both p53 modifications at Ser46 and Lys382 were necessary for p53 apoptotic transcription. Thus, p53Lys382 acetylation in HIPK2 knockdown as well as p53 apoptotic activity in response to drug could be rescued by p300 overexpression. Similar effect was obtained with the Sirt1-inhibitor nicotinamide. Interestingly trichostatin A (TSA), the inhibitor of histone deacetylase complexes (HDAC) did not have effect, suggesting that Sirt1 was the deacetylase involved in p53 deacetylation in HIPK2 knockdown. These results reveal a novel role for HIPK2 in activating p53 apoptotic transcription. Our results indicate that HIPK2 may regulate the balance between p53 acetylation and deacetylation, by stimulating on one hand co-recruitment of p300 and p53Lys382 on apoptotic promoters and on the other hand by inhibiting Sirt1 deacetylase activity. We attempted to reactivate p53 apoptotic transcriptional activity by rescuing both Ser46 and Lys382 modification in response to drug. Our data propose combination strategies for the treatment of tumors with dysfunctional p53 and/or HIPK2 that include classical chemotherapy with pharmacological or natural agents such as Sirt1-deacetylase inhibitors or zinc, respectively.

  6. Interplay between PTB and miR-1285 at the p53 3′UTR modulates the levels of p53 and its isoform Δ40p53α

    PubMed Central

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit

    2017-01-01

    Abstract p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3′UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3′UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3′UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3′UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3′UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3′UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3′UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. PMID:28973454

  7. Inhibition of SIRT1 Catalytic Activity Increases p53 Acetylation but Does Not Alter Cell Survival following DNA Damage

    PubMed Central

    Solomon, Jonathan M.; Pasupuleti, Rao; Xu, Lei; McDonagh, Thomas; Curtis, Rory; DiStefano, Peter S.; Huber, L. Julie

    2006-01-01

    Human SIRT1 is an enzyme that deacetylates the p53 tumor suppressor protein and has been suggested to modulate p53-dependent functions including DNA damage-induced cell death. In this report, we used EX-527, a novel, potent, and specific small-molecule inhibitor of SIRT1 catalytic activity to examine the role of SIRT1 in p53 acetylation and cell survival after DNA damage. Treatment with EX-527 dramatically increased acetylation at lysine 382 of p53 after different types of DNA damage in primary human mammary epithelial cells and several cell lines. Significantly, inhibition of SIRT1 catalytic activity by EX-527 had no effect on cell growth, viability, or p53-controlled gene expression in cells treated with etoposide. Acetyl-p53 was also increased by the histone deacetylase (HDAC) class I/II inhibitor trichostatin A (TSA). EX-527 and TSA acted synergistically to increase acetyl-p53 levels, confirming that p53 acetylation is regulated by both SIRT1 and HDACs. While TSA alone reduced cell survival after DNA damage, the combination of EX-527 and TSA had no further effect on cell viability and growth. These results show that, although SIRT1 deacetylates p53, this does not play a role in cell survival following DNA damage in certain cell lines and primary human mammary epithelial cells. PMID:16354677

  8. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

    PubMed

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-07-26

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.

  9. Minnelide/Triptolide Impairs Mitochondrial Function by Regulating SIRT3 in P53-Dependent Manner in Non-Small Cell Lung Cancer.

    PubMed

    Kumar, Ajay; Corey, Catherine; Scott, Iain; Shiva, Sruti; D'Cunha, Jonathan

    2016-01-01

    Minnelide/Triptolide (TL) has recently emerged as a potent anticancer drug in non-small cell lung cancer (NSCLC). However, the precise mechanism of its action remains ambiguous. In this study, we elucidated the molecular basis for TL-induced cell death in context to p53 status. Cell death was attributed to dysfunction of mitochondrial bioenergetics in p53-deficient cells, which was characterized by decreased mitochondrial respiration, steady-state ATP level and membrane potential, but augmented reactive oxygen species (ROS). Increased ROS production resulted in oxidative stress in TL-treated cells. This was exhibited by elevated nuclear levels of a redox-sensitive transcriptional factor, NF-E2-related factor-2 (NRF2), along with diminished cellular glutathione (GSH) content. We further demonstrated that in the absence of p53, TL blunted the expression of mitochondrial SIRT3 triggering increased acetylation of NDUAF9 and succinate dehydrogenase, components of complexes I and II of the electron transport chain (ETC). TL-mediated hyperacetylation of complexes I and II proteins and these complexes displayed decreased enzymatic activities. We also provide the evidence that P53 regulate steady-state level of SIRT3 through Proteasome-Pathway. Finally, forced overexpression of Sirt3, but not deacetylase-deficient mutant of Sirt3 (H243Y), restored the deleterious effect of TL on p53-deficient cells by rescuing mitochondrial bioenergetics. On contrary, Sirt3 deficiency in the background of wild-type p53 triggered TL-induced mitochondrial impairment that echoed TL effect in p53-deficeint cells. These findings illustrate a novel mechanism by which TL exerts its potent effects on mitochondrial function and ultimately the viability of NSCLC tumor.

  10. Genetic inactivation of the transcription factor TIF-IA leads to nucleolar disruption, cell cycle arrest, and p53-mediated apoptosis.

    PubMed

    Yuan, Xuejun; Zhou, Yonggang; Casanova, Emilio; Chai, Minqiang; Kiss, Eva; Gröne, Hermann-Josef; Schütz, Günter; Grummt, Ingrid

    2005-07-01

    Growth-dependent regulation of rRNA synthesis is mediated by TIF-IA, a basal transcription initiation factor for RNA polymerase I. We inactivated the murine TIF-IA gene by homologous recombination in mice and embryonic fibroblasts (MEFs). TIF-IA-/- embryos die before or at embryonic day 9.5 (E9.5), displaying retardation of growth and development. In MEFs, Cre-mediated depletion of TIF-IA leads to disruption of nucleoli, cell cycle arrest, upregulation of p53, and induction of apoptosis. Elevated levels of p53 after TIF-IA depletion are due to increased binding of ribosomal proteins, such as L11, to MDM2 and decreased interaction of MDM2 with p53 and p19(ARF). RNAi-induced loss of p53 overcomes proliferation arrest and apoptosis in response to TIF-IA ablation. The striking correlation between perturbation of nucleolar function, elevated levels of p53, and induction of cell suicide supports the view that the nucleolus is a stress sensor that regulates p53 activity.

  11. The nucleolus as a fundamental regulator of the p53 response and a new target for cancer therapy.

    PubMed

    Woods, Simone J; Hannan, Katherine M; Pearson, Richard B; Hannan, Ross D

    2015-07-01

    Recent studies have highlighted the fundamental role that key oncogenes such as MYC, RAS and PI3K occupy in driving RNA Polymerase I transcription in the nucleolus. In addition to maintaining essential levels of protein synthesis, hyperactivated ribosome biogenesis and nucleolar function plays a central role in suppressing p53 activation in response to oncogenic stress. Consequently, disruption of ribosome biogenesis by agents such as the small molecule inhibitor of RNA Polymerase I transcription, CX-5461, has shown unexpected, potent, and selective effects in killing tumour cells via disruption of nucleolar function leading to activation of p53, independent of DNA damage. This review will explore the mechanism of DNA damage-independent activation of p53 via the nucleolar surveillance pathway and how this can be utilised to design novel cancer therapies. Non-genotoxic targeting of nucleolar function may provide a new paradigm for treatment of a broad range of oncogene-driven malignancies with improved therapeutic windows. This article is part of a Special Issue entitled: Translation and Cancer. Copyright © 2014 Elsevier B.V. All rights reserved.

  12. Etoposide radiosensitizes p53-defective cholangiocarcinoma cell lines independent of their G2 checkpoint efficacies

    PubMed Central

    Hematulin, Arunee; Meethang, Sutiwan; Utapom, Kitsana; Wongkham, Sopit; Sagan, Daniel

    2018-01-01

    Radiotherapy has been accounted as the most comprehensive cancer treatment modality over the past few decades. However, failure of this treatment modality occurs in several malignancies due to the resistance of cancer cells to radiation. It was previously reported by the present authors that defective cell cycle checkpoints could be used as biomarkers for predicting the responsiveness to radiation in individual patients with cholangiocarcinoma (CCA). However, identification of functional defective cell cycle checkpoints from cells from a patient's tissues is cumbersome and not applicable in the clinic. The present study evaluated the radiosensitization potential of etoposide in p53-defective CCA KKU-M055 and KKU-M214 cell lines. Treatment with etoposide enhanced the responsiveness of two p53-defective CCA cell lines to radiation independent of G2 checkpoint function. In addition, etoposide treatment increased radiation-induced cell death without altering the dominant mode of cell death of the two cell lines. These findings indicate that etoposide could be used as a radiation sensitizer for p53-defective tumors, independent of the function of G2 checkpoint. PMID:29541168

  13. 14-3-3ζ turns TGF-β’s function from tumor suppressor to metastasis promoter in breast cancer by contextual changes of Smad partners from p53 to Gli2

    PubMed Central

    Xu, Jia; Acharya, Sunil; Sahin, Ozgur; Zhang, Qingling; Saito, Yohei; Yao, Jun; Wang, Hai; Li, Ping; Zhang, Lin; Lowery, Frank J; Kuo, Wen-Ling; Xiao, Yi; Ensor, Joe; Sahin, Aysegul A; Zhang, Xiang H.-F.; Hung, Mien-Chie; Zhang, Jitao David; Yu, Dihua

    2015-01-01

    Summary Transforming growth factor-β (TGF-β) functions as a tumor suppressor in pre-malignant cells but as a metastasis promoter in cancer cells. The dichotomous functions of TGF-β are proposed to be dictated by different partners of its downstream effectors Smads. However, the mechanism for the contextual changes of Smad partners remained undefined. Here, we demonstrate that 14-3-3ζ destabilizes p53, a Smad partner in pre-malignant mammary epithelial cells, by downregulating 14-3-3σ, thus turning off TGF-β’s tumor suppression function. Conversely, 14-3-3ζ stabilizes Gli2 in breast cancer cells, and Gli2 partners with Smads to activate PTHrP and promote TGF-β-induced bone metastasis. The 14-3-3ζ-driven contextual changes of Smad partners from p53 to Gli2 may serve as biomarkers and therapeutic targets of TGF-β-mediated cancer progression. PMID:25670079

  14. Activation of p53 Transcriptional Activity by SMRT: a Histone Deacetylase 3-Independent Function of a Transcriptional Corepressor

    PubMed Central

    Adikesavan, Anbu Karani; Karmakar, Sudipan; Pardo, Patricia; Wang, Liguo; Liu, Shuang; Li, Wei

    2014-01-01

    The silencing mediator of retinoic acid and thyroid hormone receptors (SMRT) is an established histone deacetylase 3 (HDAC3)-dependent transcriptional corepressor. Microarray analyses of MCF-7 cells transfected with control or SMRT small interfering RNA revealed SMRT regulation of genes involved in DNA damage responses, and the levels of the DNA damage marker γH2AX as well as poly(ADP-ribose) polymerase cleavage were elevated in SMRT-depleted cells treated with doxorubicin. A number of these genes are established p53 targets. SMRT knockdown decreased the activity of two p53-dependent reporter genes as well as the expression of p53 target genes, such as CDKN1A (which encodes p21). SMRT bound directly to p53 and was recruited to p53 binding sites within the p21 promoter. Depletion of GPS2 and TBL1, components of the SMRT corepressor complex, but not histone deacetylase 3 (HDAC3) decreased p21-luciferase activity. p53 bound to the SMRT deacetylase activation domain (DAD), which mediates HDAC3 binding and activation, and HDAC3 could attenuate p53 binding to the DAD region of SMRT. Moreover, an HDAC3 binding-deficient SMRT DAD mutant coactivated p53 transcriptional activity. Collectively, these data highlight a biological role for SMRT in mediating DNA damage responses and suggest a model where p53 binding to the DAD limits HDAC3 interaction with this coregulator, thereby facilitating SMRT coactivation of p53-dependent gene expression. PMID:24449765

  15. A characterization of low luminance static and dynamic modulation transfer function curves for P-1, P-43, and P-53 phosphorus

    NASA Astrophysics Data System (ADS)

    Beasley, Howard H.; Martin, John S.; Klymenko, Victor; Harding, Thomas H.; Verona, Robert W.; Rash, Clarence E.

    1995-07-01

    A counterphase modulation technique is used to measure the static and dynamic modulation transfer functions for three phosphorus of current interest to U.S. Army aviation helmet-mounted displays (P-1, P-43, and P-53). A family of modulation transfer curves, one for each temporal frequency, is presented for each phosphorus. The measured MFT curves generally support the supposition that phosphorus persistence is a critical parameter in the ability of a CRT display to accurately reproduce contrast modulation transfer in dynamic environments.

  16. p53 in breast cancer subtypes and new insights into response to chemotherapy.

    PubMed

    Bertheau, Philippe; Lehmann-Che, Jacqueline; Varna, Mariana; Dumay, Anne; Poirot, Brigitte; Porcher, Raphaël; Turpin, Elisabeth; Plassa, Louis-François; de Roquancourt, Anne; Bourstyn, Edwige; de Cremoux, Patricia; Janin, Anne; Giacchetti, Sylvie; Espié, Marc; de Thé, Hugues

    2013-08-01

    Despite an obvious central role of p53 in the hallmarks of cancer, TP53 status is not yet used for the management of breast cancer. Recent findings may lead to reconsider the role of p53 in breast cancer. TP53 mutations are the most frequent genetic alterations in breast cancer, observed in 30% of breast carcinomas. Their distribution is highly linked to molecular tumor subtypes found in 26% of luminal tumors (17% of luminal A, 41% of luminal B), in 50% of HER2 amplified tumors, in 69% of molecular apocrine breast carcinomas and in 88% of basal-like carcinomas. The type of mutation is linked to the tumor subtype with higher frequency of base-pair substitutions in luminal tumors, whereas molecular apocrine and basal-like tumors present much higher frequency of complex mutations (deletions/insertions). The timing of TP53 mutation also depends on the tumor subtype, being the first important event in luminal tumors but occurring after PTEN loss in basal-like tumors. Regarding response to cytotoxic chemotherapy, the situation is far from the p53-dependent apoptosis paradigm with subsequent clinical response. We reported that TP53 mutated non inflammatory locally advanced breast carcinomas had a high rate of complete pathological response to dose-dense doxorubicin-cyclophosphamide chemotherapy, while TP53 wild-type (WT) tumors never achieved complete response. Using human breast cancer xenograft models, we suggested that this could be due to the induction of senescence in TP53 WT tumor cells. A recent work confirmed these findings in MMTV-Wnt1 mammary tumors, showing that growth arrest and senescent phenotype, not apoptosis, were induced in TP53 WT tumors following doxorubicin treatment, while lack of arrest in mutant tumors resulted in aberrant mitoses, cell death and a superior clinical response. Furthermore, in ER positive (ER(+)) breast tumors, it has been recently reported that ER represses the p53-mediated apoptotic response induced by DNA damage. Taken together, these data can help to better understand p53-mediated response to doxorubicin-based chemotherapy in breast cancer: in ER(+) TP53 WT breast cancers, ER-induced inhibition of p53 apoptotic response would lead preferentially to tumor cell senescence and subsequent resistance to treatment. Conversely, in ER negative (ER(-)) TP53 mutated breast cancers, accumulation of genetic abnormalities would lead to mitotic catastrophe and subsequent better response. In view of these recent results, p53 impact in breast cancer should be reconsidered. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Crosstalk between mitochondrial stress signals regulates yeast chronological lifespan.

    PubMed

    Schroeder, Elizabeth A; Shadel, Gerald S

    2014-01-01

    Mitochondrial DNA (mtDNA) exists in multiple copies per cell and is essential for oxidative phosphorylation. Depleted or mutated mtDNA promotes numerous human diseases and may contribute to aging. Reduced TORC1 signaling in the budding yeast, Saccharomyces cerevisiae, extends chronological lifespan (CLS) in part by generating a mitochondrial ROS (mtROS) signal that epigenetically alters nuclear gene expression. To address the potential requirement for mtDNA maintenance in this response, we analyzed strains lacking the mitochondrial base-excision repair enzyme Ntg1p. Extension of CLS by mtROS signaling and reduced TORC1 activity, but not caloric restriction, was abrogated in ntg1Δ strains that exhibited mtDNA depletion without defects in respiration. The DNA damage response (DDR) kinase Rad53p, which transduces pro-longevity mtROS signals, is also activated in ntg1Δ strains. Restoring mtDNA copy number alleviated Rad53p activation and re-established CLS extension following mtROS signaling, indicating that Rad53p senses mtDNA depletion directly. Finally, DDR kinases regulate nucleus-mitochondria localization dynamics of Ntg1p. From these results, we conclude that the DDR pathway senses and may regulate Ntg1p-dependent mtDNA stability. Furthermore, Rad53p senses multiple mitochondrial stresses in a hierarchical manner to elicit specific physiological outcomes, exemplified by mtDNA depletion overriding the ability of Rad53p to transduce an adaptive mtROS longevity signal. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  18. Roles of p53, MYC and HIF-1 in regulating glycolysis - the seventh hallmark of cancer.

    PubMed

    Yeung, S J; Pan, J; Lee, M-H

    2008-12-01

    Despite diversity in genetic events in oncogenesis, cancer cells exhibit a common set of functional characteristics. Otto Warburg discovered that cancer cells have consistently higher rates of glycolysis than normal cells. The underlying mechanisms leading to the Warburg phenomenon include mitochondrial changes, upregulation of rate-limiting enzymes/proteins in glycolysis and intracellular pH regulation, hypoxia-induced switch to anaerobic metabolism, and metabolic reprogramming after loss of p53 function. The regulation of energy metabolism can be traced to a "triad" of transcription factors: c-MYC, HIF-1 and p53. Oncogenetic changes involve a nonrandom set of gene deletions, amplifications and mutations, and many oncogenes and tumor suppressor genes cluster along the signaling pathways that regulate c-MYC, HIF-1 and p53. Glycolysis in cancer cells has clinical implications in cancer diagnosis, treatment and interaction with diabetes mellitus. Many drugs targeting energy metabolism are in development. Future advances in technology may bring about transcriptome and metabolome-guided chemotherapy.

  19. Energy Levels and Oscillator Strengths for Ne-like Iron Ions

    NASA Astrophysics Data System (ADS)

    Zhong, J. Y.; Zhang, J.; Zhao, G.; Lu, X..

    2004-02-01

    Energy levels and oscillator strengths among the 27 fine-structure levels belonging to the (1s22s2)2p6, 2p53s, 2p53p and 2p53d configurations of neon-like iron ion have been calculated by using three atomic structure codes, RCN/RCG, AUTOSTRUCTURE (AS) and GRASP. The relativistic corrections of the wave functions are taken into account in RCN/RCG calculations. The results well agree with experimental and theoretical data wherever available. Finally the accuracy of three codes was analyzed.

  20. Osteoblast differentiation and skeletal development are regulated by Mdm2–p53 signaling

    PubMed Central

    Lengner, Christopher J.; Steinman, Heather A.; Gagnon, James; Smith, Thomas W.; Henderson, Janet E.; Kream, Barbara E.; Stein, Gary S.; Lian, Jane B.; Jones, Stephen N.

    2006-01-01

    Mdm2 is required to negatively regulate p53 activity at the peri-implantation stage of early mouse development. However, the absolute requirement for Mdm2 throughout embryogenesis and in organogenesis is unknown. To explore Mdm2–p53 signaling in osteogenesis, Mdm2-conditional mice were bred with Col3.6-Cre–transgenic mice that express Cre recombinase in osteoblast lineage cells. Mdm2-conditional Col3.6-Cre mice die at birth and display multiple skeletal defects. Osteoblast progenitor cells deleted for Mdm2 have elevated p53 activity, reduced proliferation, reduced levels of the master osteoblast transcriptional regulator Runx2, and reduced differentiation. In contrast, p53-null osteoprogenitor cells have increased proliferation, increased expression of Runx2, increased osteoblast maturation, and increased tumorigenic potential, as mice specifically deleted for p53 in osteoblasts develop osteosarcomas. These results demonstrate that p53 plays a critical role in bone organogenesis and homeostasis by negatively regulating bone development and growth and by suppressing bone neoplasia and that Mdm2-mediated inhibition of p53 function is a prerequisite for Runx2 activation, osteoblast differentiation, and proper skeletal formation. PMID:16533949

  1. TP53 Mutational Status Is a Potential Marker for Risk Stratification in Wilms Tumour with Diffuse Anaplasia

    PubMed Central

    Chagtai, Tasnim; Popov, Sergey D.; Sebire, Neil J.; Vujanic, Gordan; Perlman, Elizabeth; Anderson, James R.; Grundy, Paul; Dome, Jeffrey S.; Pritchard-Jones, Kathy

    2014-01-01

    Purpose The presence of diffuse anaplasia in Wilms tumours (DAWT) is associated with TP53 mutations and poor outcome. As patients receive intensified treatment, we sought to identify whether TP53 mutational status confers additional prognostic information. Patients and Methods We studied 40 patients with DAWT with anaplasia in the tissue from which DNA was extracted and analysed for TP53 mutations and 17p loss. The majority of cases were profiled by copy number (n = 32) and gene expression (n = 36) arrays. TP53 mutational status was correlated with patient event-free and overall survival, genomic copy number instability and gene expression profiling. Results From the 40 cases, 22 (55%) had TP53 mutations (2 detected only after deep-sequencing), 20 of which also had 17p loss (91%); 18 (45%) cases had no detectable mutation but three had 17p loss. Tumours with TP53 mutations and/or 17p loss (n = 25) had an increased risk of recurrence as a first event (p = 0.03, hazard ratio (HR), 3.89; 95% confidence interval (CI), 1.26–16.0) and death (p = 0.04, HR, 4.95; 95% CI, 1.36–31.7) compared to tumours lacking TP53 abnormalities. DAWT carrying TP53 mutations showed increased copy number alterations compared to those with wild-type, suggesting a more unstable genome (p = 0.03). These tumours showed deregulation of genes associated with cell cycle and DNA repair biological processes. Conclusion This study provides evidence that TP53 mutational analysis improves risk stratification in DAWT. This requires validation in an independent cohort before clinical use as a biomarker. PMID:25313908

  2. TP53 mutational status is a potential marker for risk stratification in Wilms tumour with diffuse anaplasia.

    PubMed

    Maschietto, Mariana; Williams, Richard D; Chagtai, Tasnim; Popov, Sergey D; Sebire, Neil J; Vujanic, Gordan; Perlman, Elizabeth; Anderson, James R; Grundy, Paul; Dome, Jeffrey S; Pritchard-Jones, Kathy

    2014-01-01

    The presence of diffuse anaplasia in Wilms tumours (DAWT) is associated with TP53 mutations and poor outcome. As patients receive intensified treatment, we sought to identify whether TP53 mutational status confers additional prognostic information. We studied 40 patients with DAWT with anaplasia in the tissue from which DNA was extracted and analysed for TP53 mutations and 17p loss. The majority of cases were profiled by copy number (n = 32) and gene expression (n = 36) arrays. TP53 mutational status was correlated with patient event-free and overall survival, genomic copy number instability and gene expression profiling. From the 40 cases, 22 (55%) had TP53 mutations (2 detected only after deep-sequencing), 20 of which also had 17p loss (91%); 18 (45%) cases had no detectable mutation but three had 17p loss. Tumours with TP53 mutations and/or 17p loss (n = 25) had an increased risk of recurrence as a first event (p = 0.03, hazard ratio (HR), 3.89; 95% confidence interval (CI), 1.26-16.0) and death (p = 0.04, HR, 4.95; 95% CI, 1.36-31.7) compared to tumours lacking TP53 abnormalities. DAWT carrying TP53 mutations showed increased copy number alterations compared to those with wild-type, suggesting a more unstable genome (p = 0.03). These tumours showed deregulation of genes associated with cell cycle and DNA repair biological processes. This study provides evidence that TP53 mutational analysis improves risk stratification in DAWT. This requires validation in an independent cohort before clinical use as a biomarker.

  3. Somatotropinomas, but not nonfunctioning pituitary adenomas, maintain a functional apoptotic RET/Pit1/ARF/p53 pathway that is blocked by excess GDNF.

    PubMed

    Diaz-Rodriguez, Esther; Garcia-Rendueles, Angela R; Ibáñez-Costa, Alejandro; Gutierrez-Pascual, Ester; Garcia-Lavandeira, Montserrat; Leal, Alfonso; Japon, Miguel A; Soto, Alfonso; Venegas, Eva; Tinahones, Francisco J; Garcia-Arnes, Juan A; Benito, Pedro; Angeles Galvez, Maria; Jimenez-Reina, Luis; Bernabeu, Ignacio; Dieguez, Carlos; Luque, Raul M; Castaño, Justo P; Alvarez, Clara V

    2014-11-01

    Acromegaly is caused by somatotroph cell adenomas (somatotropinomas [ACROs]), which secrete GH. Human and rodent somatotroph cells express the RET receptor. In rodents, when normal somatotrophs are deprived of the RET ligand, GDNF (Glial Cell Derived Neurotrophic Factor), RET is processed intracellularly to induce overexpression of Pit1 [Transcription factor (gene : POUF1) essential for transcription of Pituitary hormones GH, PRL and TSHb], which in turn leads to p19Arf/p53-dependent apoptosis. Our purpose was to ascertain whether human ACROs maintain the RET/Pit1/p14ARF/p53/apoptosis pathway, relative to nonfunctioning pituitary adenomas (NFPAs). Apoptosis in the absence and presence of GDNF was studied in primary cultures of 8 ACROs and 3 NFPAs. Parallel protein extracts were analyzed for expression of RET, Pit1, p19Arf, p53, and phospho-Akt. When GDNF deprived, ACRO cells, but not NFPAs, presented marked level of apoptosis that was prevented in the presence of GDNF. Apoptosis was accompanied by RET processing, Pit1 accumulation, and p14ARF and p53 induction. GDNF prevented all these effects via activation of phospho-AKT. Overexpression of human Pit1 (hPit1) directly induced p19Arf/p53 and apoptosis in a pituitary cell line. Using in silico studies, 2 CCAAT/enhancer binding protein alpha (cEBPα) consensus-binding sites were found to be 100% conserved in mouse, rat, and hPit1 promoters. Deletion of 1 cEBPα site prevented the RET-induced increase in hPit1 promoter expression. TaqMan qRT-PCR (real time RT-PCR) for RET, Pit1, Arf, TP53, GDNF, steroidogenic factor 1, and GH was performed in RNA from whole ACRO and NFPA tumors. ACRO but not NFPA adenomas express RET and Pit1. GDNF expression in the tumors was positively correlated with RET and negatively correlated with p53. In conclusion, ACROs maintain an active RET/Pit1/p14Arf/p53/apoptosis pathway that is inhibited by GDNF. Disruption of GDNF's survival function might constitute a new therapeutic route in acromegaly.

  4. Cytoplasmic sequestration of the tumor suppressor p53 by a heat shock protein 70 family member, mortalin, in human colorectal adenocarcinoma cell lines

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Gestl, Erin E., E-mail: egestl@wcupa.edu; Anne Boettger, S., E-mail: aboettger@wcupa.edu

    2012-06-29

    Highlights: Black-Right-Pointing-Pointer Eight human colorectal cell lines were evaluated for p53 and mortalin localization. Black-Right-Pointing-Pointer Six cell lines displayed cytoplasmic sequestration of the tumor suppressor p53. Black-Right-Pointing-Pointer Direct interaction between mortalin and p53 was shown in five cell lines. Black-Right-Pointing-Pointer Cell lines positive for p53 sequestration yielded elevated p53 expression levels. Black-Right-Pointing-Pointer This study yields the first evidence of cytoplasmic sequestration p53 by mortalin. -- Abstract: While it is known that cytoplasmic retention of p53 occurs in many solid tumors, the mechanisms responsible for this retention have not been positively identified. Since heatshock proteins like mortalin have been associated withmore » p53 inactivation in other tumors, the current study sought to characterize this potential interaction in never before examined colorectal adenocarcinoma cell lines. Six cell lines, one with 3 different fractions, were examined to determine expression of p53 and mortalin and characterize their cellular localization. Most of these cell lines displayed punctate p53 and mortalin localization in the cell cytoplasm with the exception of HCT-8 and HCT116 379.2 cells, where p53 was not detected. Nuclear p53 was only observed in HCT-116 40-16, LS123, and HT-29 cell lines. Mortalin was only localized in the cytoplasm in all cell lines. Co-immunoprecipitation and immunohistochemistry revealed that p53 and mortalin were bound and co-localized in the cytoplasmic fraction of four cell lines, HCT-116 (40-16 and 386; parental and heterozygous fractions respectively of the same cell line), HT-29, LS123 and LoVo, implying that p53 nuclear function is limited in those cell lines by being restricted to the cytoplasm. Mortalin gene expression levels were higher than gene expression levels of p53 in all cell lines. Cell lines with cytoplasmic sequestration of p53, however, also displayed elevated p53 gene expression levels compared to cell lines without p53 sequestration. Our data reveal the characteristic cytoplasmic sequestration of p53 by the heat shock protein mortalin in human colorectal adenocarcinoma cell lines, as is the case for other cancers, such as glioblastomas and hepatocellular carcinomas.« less

  5. Mechanisms of p53-Mediated Apoptosis

    DTIC Science & Technology

    2007-03-01

    Bonnet, P. Dikkes, A. Sharpe, F. McKeon, and D. Caput. 2000. p73-deficient mice have neurological, pheromonal and inflammatory defects but lack...TTT TTG GAA A-3’ and HDAC1-si- CR-R: 5’-AGC TTT TCC AAA AAG CAG ATG CAG AGA TTC AAC TCT CTT GAA GTT GAA TCT CTG CAT CTG CGG G-3’ with HDAC1 targeting

  6. Robustness of the p53 network and biological hackers.

    PubMed

    Dartnell, Lewis; Simeonidis, Evangelos; Hubank, Michael; Tsoka, Sophia; Bogle, I David L; Papageorgiou, Lazaros G

    2005-06-06

    The p53 protein interaction network is crucial in regulating the metazoan cell cycle and apoptosis. Here, the robustness of the p53 network is studied by analyzing its degeneration under two modes of attack. Linear Programming is used to calculate average path lengths among proteins and the network diameter as measures of functionality. The p53 network is found to be robust to random loss of nodes, but vulnerable to a targeted attack against its hubs, as a result of its architecture. The significance of the results is considered with respect to mutational knockouts of proteins and the directed attacks mounted by tumour inducing viruses.

  7. Altered S-nitrosylation of p53 is responsible for impaired antioxidant response in skeletal muscle during aging.

    PubMed

    Baldelli, Sara; Ciriolo, Maria Rosa

    2016-12-20

    p53 transcriptional activity has been proposed to regulate both homeostasis and sarcopenia of skeletal muscle during aging. However, the exact molecular function of p53 remains to be clearly defined. We demonstrated a requirement of nuclear p53 S-nitrosylation in inducing a nitric oxide/PGC-1α-mediated antioxidant pathway in skeletal muscle. Importantly, mutant form of p53-DNA binding domain (C124S) did not undergo nuclear S-nitrosylation and failed in inducing the expression of antioxidant genes (i.e. SOD2 and GCLC). Moreover, we found that during aging the nuclear S-nitrosylation of p53 significantly declines in gastrocnemius/soleus leading to an impairment of redox homeostasis of skeletal muscle. We suggested that decreased level of nuclear neuronal nitric oxide synthase (nNOS)/Syntrophin complex, which we observed during aging, could be responsible for impaired nuclear S-nitrosylation. Taken together, our data indicate that altered S-nitrosylation of p53 during aging could be a contributing factor of sarcopenia condition and of other skeletal muscle pathologies associated with oxidative/nitrosative stress.

  8. Altered S-nitrosylation of p53 is responsible for impaired antioxidant response in skeletal muscle during aging

    PubMed Central

    Baldelli, Sara; Ciriolo, Maria Rosa

    2016-01-01

    p53 transcriptional activity has been proposed to regulate both homeostasis and sarcopenia of skeletal muscle during aging. However, the exact molecular function of p53 remains to be clearly defined. We demonstrated a requirement of nuclear p53 S-nitrosylation in inducing a nitric oxide/PGC-1α-mediated antioxidant pathway in skeletal muscle. Importantly, mutant form of p53-DNA binding domain (C124S) did not undergo nuclear S-nitrosylation and failed in inducing the expression of antioxidant genes (i.e. SOD2 and GCLC). Moreover, we found that during aging the nuclear S-nitrosylation of p53 significantly declines in gastrocnemius/soleus leading to an impairment of redox homeostasis of skeletal muscle. We suggested that decreased level of nuclear neuronal nitric oxide synthase (nNOS)/Syntrophin complex, which we observed during aging, could be responsible for impaired nuclear S-nitrosylation. Taken together, our data indicate that altered S-nitrosylation of p53 during aging could be a contributing factor of sarcopenia condition and of other skeletal muscle pathologies associated with oxidative/nitrosative stress. PMID:28025407

  9. Tetraploidization or autophagy: The ultimate fate of senescent human endometrial stem cells under ATM or p53 inhibition.

    PubMed

    Borodkina, Aleksandra V; Shatrova, Alla N; Deryabin, Pavel I; Grukova, Anastasiya A; Nikolsky, Nikolay N; Burova, Elena B

    2016-01-01

    Previously we demonstrated that endometrium-derived human mesenchymal stem cells (hMESCs) via activation of the ATM/p53/p21/Rb pathway enter the premature senescence in response to oxidative stress. Down regulation effects of the key components of this signaling pathway, particularly ATM and p53, on a fate of stressed hMESCs have not yet been investigated. In the present study by using the specific inhibitors Ku55933 and Pifithrin-α, we confirmed implication of both ATM and p53 in H(2)O(2)-induced senescence of hMESCs. ATM or p53 down regulation was shown to modulate differently the cellular fate of H(2)O(2)-treated hMESCs. ATM inhibition allowed H(2)O(2)-stimulated hMESCs to escape the permanent cell cycle arrest due to loss of the functional ATM/p53/p21/Rb pathway, and induced bypass of mitosis and re-entry into S phase, resulting in tetraploid cells. On the contrary, suppression of the p53 transcriptional activity caused a pronounced cell death of H(2)O(2)-treated hMESCs via autophagy induction. The obtained data clearly demonstrate that down regulation of ATM or p53 shifts senescence of human endometrial stem cells toward tetraploidization or autophagy.

  10. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira

    2013-10-01

    X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutationmore » substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the β-sandwich scaffold. On the other hand, the substitution N239Y creates an advantageous hydrophobic contact between the aromatic ring of this tyrosine and the adjacent Leu137. Surprisingly, the rescued cancer mutant shows much larger structural deviations than the cancer mutant alone when compared with wild-type p53. These suppressor mutations appear to rescue p53 function by creating novel intradomain interactions that stabilize the core domain, allowing compensation for the destabilizing V157F mutation.« less

  11. Selective sensitization to DNA-damaging agents in a human rhabdomyosarcoma cell line with inducible wild-type p53 overexpression.

    PubMed

    Gibson, A A; Harwood, F G; Tillman, D M; Houghton, J A

    1998-01-01

    Drug-induced cytotoxicity or apoptosis may be influenced by the expression of the p53 tumor suppressor gene and by the specific oncogene expressed, which may dictate the threshold at which a cytotoxic response may by induced. The objective of the study was to elucidate how DNA-damaging agents with different mechanisms of action were sensitized in the context of expression of the Pax3/FKHR fusion protein, a transformation event unique to alveolar rhabdomyosarcomas (ARMSs), and wild-type p53 (wtp53). A wtp53 cDNA was subcloned into the pGRE5-2/EBV vector with dexamethasone-inducible overexpression and transfected into Rh30 ARMS cells that express Pax3/FKHR and a mutant p53 phenotype. Following dexamethasone induction of wtp53 overexpression in a derived clone (Cl.#27), growth was slowed, and cells accumulated in G1. Functional wtp53 activity was demonstrated by selective transactivation of p50-2, a wtp53 chloramphenicol acetyltransferase reporter construct, and by up-regulated expression of endogenous p21Waf1. Data demonstrated p53-dependent sensitization (> or = 4-fold) to bleomycin, actinomycin D, and 5-fluorouracil and considerably less p53-dependence (< or = 2-fold) for doxorubicin, topotecan, etoposide, and cisplatin in Cl.#27 compared to an equivalent clone containing the pGRE5-EBV vector alone (VC#3). Data demonstrate that ARMS cells show a selective sensitization to DNA-damaging agents when wtp53 is overexpressed. The cytotoxic activity of agents that are not potentiated substantially must, therefore, depend upon p53-independent factors that relate to the mechanism of drug action.

  12. PRL-3 promotes breast cancer progression by downregulating p14ARF-mediated p53 expression.

    PubMed

    Xie, Hua; Wang, Hao

    2018-03-01

    Prior studies have demonstrated that phosphatase of regenerating liver-3 (PRL-3) serves avital function in cell proliferation and metastasis in breast cancer. However, the molecular mechanisms underlying the function of PRL-3 in breast cancer remain unknown. PRL-3 expression was analyzed in 24 pairs of breast cancer and normal tissues using the reverse transcription-quantitative polymerase chain reaction assay. The results of the present study identified that the expression of PLR-3 in breast cancer tissues was increased 4.2-fold, compared with normal tissues. Notably, overexpression of PRL-3 significantly promoted the proliferation of cancer cells and inhibited endogenous p53 expression by downregulating the expression level of p14 alternate reading frame (p14 ARF ). In addition, decreased expression levels of PRL-3 resulted in decreased breast cancer cell proliferation and increased expression level of p14 ARF . These results suggested that PRL-3 enhances cell proliferation by downregulating p14 ARF expression, which results in decreased levels ofp53. The results of the present study demonstrated that PRL-3 promotes tumor proliferation by affecting the p14 ARF -p53 axis, and that it may serve as a prognostic marker for patients with breast cancer.

  13. The Roles of p53 in Mitochondrial Dynamics and Cancer Metabolism: The Pendulum between Survival and Death in Breast Cancer?

    PubMed

    Moulder, David E; Hatoum, Diana; Tay, Enoch; Lin, Yiguang; McGowan, Eileen M

    2018-06-08

    Cancer research has been heavily geared towards genomic events in the development and progression of cancer. In contrast, metabolic regulation, such as aberrant metabolism in cancer, is poorly understood. Alteration in cellular metabolism was once regarded simply as a consequence of cancer rather than as playing a primary role in cancer promotion and maintenance. Resurgence of cancer metabolism research has identified critical metabolic reprogramming events within biosynthetic and bioenergetic pathways needed to fulfill the requirements of cancer cell growth and maintenance. The tumor suppressor protein p53 is emerging as a key regulator of metabolic processes and metabolic reprogramming in cancer cells—balancing the pendulum between cell death and survival. This review provides an overview of the classical and emerging non-classical tumor suppressor roles of p53 in regulating mitochondrial dynamics: mitochondrial engagement in cell death processes in the prevention of cancer. On the other hand, we discuss p53 as a key metabolic switch in cellular function and survival. The focus is then on the conceivable roles of p53 in breast cancer metabolism. Understanding the metabolic functions of p53 within breast cancer metabolism will, in due course, reveal critical metabolic hotspots that cancers advantageously re-engineer for sustenance. Illustration of these events will pave the way for finding novel therapeutics that target cancer metabolism and serve to overcome the breast cancer burden.

  14. Pattern of Expression of p53, Its Family Members, and Regulators during Early Ocular Development and in the Post-Mitotic Retina

    PubMed Central

    Vuong, Linda; Brobst, Daniel E.; Saadi, Anisse; Ivanovic, Ivana; Al-Ubaidi, Muayyad R.

    2012-01-01

    Purpose. Because of its role in cell cycle regulation and apoptosis, p53 may be involved in maintaining the post-mitotic state of the adult eye. To shed light on the role of p53 in retinal development and maintenance, this study investigated the pattern of expression of p53, its family members, and its regulators during the development of the mouse eye. Methods. Relative quantitative real-time PCR (qRT-PCR) was used to determine the steady-state levels of target transcripts in RNA extracted from wild-type mouse whole eyes or retinas between embryonic day (E) 15 and post-natal day (P) 30. Immunoblotting was used to compare the steady-state levels of the protein to that of the transcript. Results. Transcript and protein levels for p53 in the eye were highest at E17 and E18, respectively. However, both p53 transcript and protein levels dropped precipitously thereafter, and no protein was detected on immunoblots after P3. Expression patterns of p63, p73, Mdm2, Mdm4, and Yy1 did not follow that of p53. Immunohistochemistry analysis of the developing eye showed that both p53 and Mdm2 are abundantly expressed at E18 in all layers of the retinal neuroblast. Conclusions. Downregulation of p53 in the post-mitotic retina suggests that, although p53 may be involved in ocular and retinal development, it may play a minimal role in healthy adult retinal function. PMID:22714890

  15. p53-Independent Roles of MDM2 in NF-κB Signaling: Implications for Cancer Therapy, Wound Healing, and Autoimmune Diseases1

    PubMed Central

    Thomasova, Dana; Mulay, Shrikant R; Bruns, Hauke; Anders, Hans-Joachim

    2012-01-01

    Murine double minute-2 (MDM2) is an intracellular molecule with multiple biologic functions. It serves as a negative regulator of p53 and thereby limits cell cycle arrest and apoptosis. Because MDM2 blockade suppresses tumor cell growth in vitro and in vivo, respective MDM2 inhibition is currently evaluated as anti-cancer therapy in clinical trials. However, the anti-proliferative effects of MDM2 inhibition also impair regenerative cell growth upon tissue injury. This was so far documented for tubular repair upon postischemic acute kidney injury and might apply to wound healing responses in general. Furthermore, MDM2 has numerous p53-independent effects. As a new entry, MDM2 was identified to act as a co-transcription factor for nuclear factor-kappa-light-enhancer of activated B cells (NF-κB) at cytokine promoters. This explains the potent anti-inflammatory effects of MDM2 inhibitors in vitro and in vivo. For example, the NF-κB-antagonistic and p53-agonistic activities of MDM2 inhibitors elicit potent therapeutic effects on experimental lymphoproliferative autoimmune disorders such as systemic lupus erythematosus. In this review, we discuss the classic p53-dependent, the recently discovered p53-independent, and the NF-κB-agonistic biologic functions of MDM2. We describe its complex regulatory role on p53 and NF-κB signaling and name areas of research that may help to foresee previously unexpected effects or potential alternative indications of therapeutic MDM2 blockade. PMID:23308042

  16. Two major pathways of penile carcinogenesis: HPV-induced penile cancers overexpress p16ink4a, HPV-negative cancers associated with dermatoses express p53, but lack p16ink4a overexpression.

    PubMed

    Mannweiler, Sebastian; Sygulla, Stephan; Winter, Elke; Regauer, Sigrid

    2013-07-01

    Penile squamous cell carcinomas (SCC) arise either through transforming infections with human papillomavirus (HPV) or independent of HPV, often in the background of lichen sclerosus (LS) and lichen planus (LP). Despite impact on therapy and prognosis, etiologic stratifications are missing in most histological diagnoses and publications about penile cancers/precursors. Classification of penile lesions into HPV-induced or HPV-negative via immunohistochemical demonstration of p16(ink4a) overexpression, a surrogate marker for transforming HPV-high-risk infections, and p53 expression in the absence of p16(ink4a) overexpression. Archival formalin-fixed material of 123 invasive penile cancers and 43 pre-invasive lesions was evaluated for the presence of LS, LP, 28 HPV genotypes, and expression of p53 and p16(ink4a). Seventy-two of 123 SCCs and 33 of 43 pre-invasive lesions showed p16(ink4a) overexpression independent of HPV-HR genotypes involved; 66 of 72 SCCs and 29 of 43 precursor lesions revealed a single HPV-high-risk-genotype (HPV-HR16 in 76% followed by HPV33, HPV31, HPV45, HPV18, HPV56); 5 of 72 SCCs and 4 of 43 precursor lesions revealed multiple HPV-HR-genotypes. One SCC revealed HPV-LR and HR-DNA. Fifty-one of 123 SCCs and 10 precursor lesions were p16(ink4a) negative, but showed nuclear p53 expression in tumor cells and basal keratinocytes. Forty-nine of 51 SCCs and 10 of 10 precursor lesions lacked HPV DNA. Two of 51 SCCs contained HPV18 and HPV45 DNA, respectively, but p16(ink4a) negativity classified them as non-HPV-induced. Twenty-seven of 51 SCCs showed peritumoral LS, 13 of 51 SCCs showed peritumoral LP, and 11 SCCs revealed no peritumoral tissue. Histologically, HPV-negative precursors showed hyperkeratotic, verrucous, atrophic, and basaloid differentiation. This was a retrospective study. p16(ink4a) overexpression identifies HPV-HR-induced penile carcinogenesis independent of HPV-HR genotype. p53 expression along with p16(ink4a) negativity identifies HPV-negative cancers. Correct etiologic classification of penile lesions during diagnostic work-up allows optimal therapy decisions. Copyright © 2013 American Academy of Dermatology, Inc. Published by Mosby, Inc. All rights reserved.

  17. Structure of p73 DNA-binding domain tetramer modulates p73 transactivation

    PubMed Central

    Ethayathulla, Abdul S.; Tse, Pui-Wah; Monti, Paola; Nguyen, Sonha; Inga, Alberto; Fronza, Gilberto; Viadiu, Hector

    2012-01-01

    The transcription factor p73 triggers developmental pathways and overlaps stress-induced p53 transcriptional pathways. How p53-family response elements determine and regulate transcriptional specificity remains an unsolved problem. In this work, we have determined the first crystal structures of p73 DNA-binding domain tetramer bound to response elements with spacers of different length. The structure and function of the adaptable tetramer are determined by the distance between two half-sites. The structures with zero and one base-pair spacers show compact p73 DNA-binding domain tetramers with large tetramerization interfaces; a two base-pair spacer results in DNA unwinding and a smaller tetramerization interface, whereas a four base-pair spacer hinders tetramerization. Functionally, p73 is more sensitive to spacer length than p53, with one base-pair spacer reducing 90% of transactivation activity and longer spacers reducing transactivation to basal levels. Our results establish the quaternary structure of the p73 DNA-binding domain required as a scaffold to promote transactivation. PMID:22474346

  18. Induction of KLF4 in basal keratinocytes blocks the proliferation-differentiation switch and initiates squamous epithelial dysplasia

    PubMed Central

    Foster, K. Wade; Liu, Zhaoli; Nail, Clinton D.; Li, Xingnan; Fitzgerald, Thomas J.; Bailey, Sarah K.; Frost, Andra R.; Louro, Iuri D.; Townes, Tim M.; Paterson, Andrew J.; Kudlow, Jeffrey E.; Lobo-Ruppert, Susan M.; Ruppert, J. Michael

    2006-01-01

    KLF4/GKLF normally functions in differentiating epithelial cells, but also acts as a transforming oncogene in vitro. To examine the role of this zinc finger protein in skin, we expressed the wild-type human allele from inducible and constitutive promoters. When induced in basal keratinocytes KLF4 rapidly abolished the distinctive properties of basal and parabasal epithelial cells. KLF4 caused a transitory apoptotic response and the skin progressed through phases of hyperplasia and dysplasia. By 6 weeks, lesions exhibited nuclear KLF4 and other morphologic and molecular similarities to squamous cell carcinoma in situ. p53 determined the patch size sufficient to establish lesions, as induction in a mosaic pattern produced skin lesions only when p53 was deficient. Compared with p53 wild-type animals, p53 hemizygous animals had early onset of lesions and a pronounced fibrovascular response that included outgrowth of subcutaneous sarcoma. A KLF4-estrogen receptor fusion protein showed tamoxifen-dependent nuclear localization and conditional transformation in vitro. The results suggest that KLF4 can function in the nucleus to induce squamous epithelial dysplasia, and indicate roles for p53 and epithelial-mesenchymal signaling in these early neoplastic lesions. PMID:15674344

  19. Induction of KLF4 in basal keratinocytes blocks the proliferation-differentiation switch and initiates squamous epithelial dysplasia.

    PubMed

    Foster, K Wade; Liu, Zhaoli; Nail, Clinton D; Li, Xingnan; Fitzgerald, Thomas J; Bailey, Sarah K; Frost, Andra R; Louro, Iuri D; Townes, Tim M; Paterson, Andrew J; Kudlow, Jeffrey E; Lobo-Ruppert, Susan M; Ruppert, J Michael

    2005-02-24

    KLF4/GKLF normally functions in differentiating epithelial cells, but also acts as a transforming oncogene in vitro. To examine the role of this zinc finger protein in skin, we expressed the wild-type human allele from inducible and constitutive promoters. When induced in basal keratinocytes, KLF4 rapidly abolished the distinctive properties of basal and parabasal epithelial cells. KLF4 caused a transitory apoptotic response and the skin progressed through phases of hyperplasia and dysplasia. By 6 weeks, lesions exhibited nuclear KLF4 and other morphologic and molecular similarities to squamous cell carcinoma in situ. p53 determined the patch size sufficient to establish lesions, as induction in a mosaic pattern produced skin lesions only when p53 was deficient. Compared with p53 wild-type animals, p53 hemizygous animals had early onset of lesions and a pronounced fibrovascular response that included outgrowth of subcutaneous sarcoma. A KLF4-estrogen receptor fusion protein showed tamoxifen-dependent nuclear localization and conditional transformation in vitro. The results suggest that KLF4 can function in the nucleus to induce squamous epithelial dysplasia, and indicate roles for p53 and epithelial-mesenchymal signaling in these early neoplastic lesions.

  20. Epstein-Barr virus nuclear antigen 3C targets p53 and modulates its transcriptional and apoptotic activities

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Yi Fuming; Saha, Abhik; Murakami, Masanao

    The p53 tumor suppressor gene is one of the most commonly mutated genes in human cancers and the corresponding encoded protein induces apoptosis or cell-cycle arrest at the G1/S checkpoint in response to DNA damage. To date, previous studies have shown that antigens encoded by human tumor viruses such as SV40 large T antigen, adenovirus E1A and HPV E6 interact with p53 and disrupt its functional activity. In a similar fashion, we now show that EBNA3C, one of the EBV latent antigens essential for the B-cell immortalization in vitro, interacts directly with p53. Additionally, we mapped the interaction of EBNA3Cmore » with p53 to the C-terminal DNA-binding and the tetramerization domain of p53, and the region of EBNA3C responsible for binding to p53 was mapped to the N-terminal domain of EBNA3C (residues 130-190), previously shown to interact with a number of important cell-cycle components, specifically SCF{sup Skp2}, cyclin A, and cMyc. Furthermore, we demonstrate that EBNA3C substantially represses the transcriptional activity of p53 in luciferase based reporter assays, and rescues apoptosis induced by ectopic p53 expression in SAOS-2 (p53{sup -/-}) cells. Interestingly, we also show that the DNA-binding ability of p53 is diminished in the presence of EBNA3C. Thus, the interaction between the p53 and EBNA3C provides new insights into the mechanism(s) by which the EBNA3C oncoprotein can alter cellular gene expression in EBV associated human cancers.« less

  1. Dual targeting of wild-type and mutant p53 by small molecule RITA results in the inhibition of N-Myc and key survival oncogenes and kills neuroblastoma cells in vivo and in vitro.

    PubMed

    Burmakin, Mikhail; Shi, Yao; Hedström, Elisabeth; Kogner, Per; Selivanova, Galina

    2013-09-15

    Restoration of the p53 function in tumors is a promising therapeutic strategy due to the high potential of p53 as tumor suppressor and the fact that established tumors depend on p53 inactivation for their survival. Here, we addressed the question whether small molecule RITA can reactivate p53 in neuroblastoma and suppress the growth of neuroblastoma cells in vitro and in vivo. The ability of RITA to inhibit growth and to induce apoptosis was shown in seven neuroblastoma cell lines. Mechanistic studies were carried out to determine the p53 dependence and the molecular mechanism of RITA-induced apoptosis in neuroblastoma, using cell viability assays, RNAi silencing, co-immunoprecipitation, qPCR, and Western blotting analysis. In vivo experiments were conducted to study the effect of RITA on human neuroblastoma xenografts in mice. RITA induced p53-dependent apoptosis in a set of seven neuroblastoma cell lines, carrying wild-type or mutant p53; it activated p53 and triggered the expression of proapoptotic p53 target genes. Importantly, p53 activated by RITA inhibited several key oncogenes that are high-priority targets for pharmacologic anticancer strategies in neuroblastoma, including N-Myc, Aurora kinase, Mcl-1, Bcl-2, Wip-1, MDM2, and MDMX. Moreover, RITA had a strong antitumor effect in vivo. Reactivation of wild-type and mutant p53 resulting in the induction of proapoptotic factors along with ablation of key oncogenes by compounds such as RITA may be a highly effective strategy to treat neuroblastoma. ©2013 AACR.

  2. The yeast p53 functional assay: a new tool for molecular epidemiology. Hopes and facts.

    PubMed

    Fronza, G; Inga, A; Monti, P; Scott, G; Campomenosi, P; Menichini, P; Ottaggio, L; Viaggi, S; Burns, P A; Gold, B; Abbondandolo, A

    2000-04-01

    The assumption of molecular epidemiology that carcinogens leave fingerprints has suggested that analysis of the frequency, type, and site of mutations in genes frequently altered in carcinogenesis may provide clues to the identification of the factors contributing to carcinogenesis. In this mini-review, we revise the development, and validation of the yeast-based p53 functional assay as a new tool for molecular epidemiology. We show that this assay has some very interesting virtues but also has some drawbacks. The yeast functional assay can be used to determine highly specific mutation fingerprints in the human p53 cDNA sequence. Discrimination is possible when comparing mutation spectra induced by sufficiently different mutagens. However, we also reported that the same carcinogen may induce distinguishable mutation spectra due to known influencing factors.

  3. Identification of p53 unbound to T-antigen in human cells transformed by simian virus 40 T-antigen.

    PubMed

    O'Neill, F J; Hu, Y; Chen, T; Carney, H

    1997-02-27

    In several clones of SV40-transformed human cells, we investigated the relative amounts of large T-Antigen (T-Ag) and p53 proteins, both unbound and associated within complexes, with the goal of identifying changes associated with transformation and immortalization. Cells were transformed by wild type (wt) T-Ag, a functionally temperature sensitive T-Ag (tsA58) and other T-Ag variants. Western analysis showed that while most of the T-Ag was ultimately bound by p53, most of the p53 remained unbound to T-Ag. Unbound p53 remained in the supernatant after a T-Ag immunoprecipitation and p53 was present in two to fourfold excess of T-Ag. In one transformant there was five to tenfold more p53 than T-Ag. p53 was present in transformants in amounts at least 200-fold greater than in untransformed human cells. In wt and variant T-Ag transformants, including those generated with tsA58 T-Ag, large amounts of unbound p53 were present in both pre-crisis and immortal cells and when the cells were grown at permissive or non-permissive temperatures. We also found that in transformants produced by tsA58, an SV40/JCV chimeric T-Ag and other variants, T-Ag appeared to form a complex with p53 slowly perhaps because one or both proteins matured slowly. The presence in transformed human cells of large amounts of unbound p53 and in excess of T-Ag suggests that sequestration of p53 by T-Ag, resulting from complex formation, is required neither for morphological transformation nor immortalization of human cells. Rather, these results support the proposal that high levels of p53, the T-Ag/p53 complexes, or other biochemical event(s), lead to transformation and immortalization of human cells by T-Ag.

  4. Adaptation of cancer cells from different entities to the MDM2 inhibitor nutlin-3 results in the emergence of p53-mutated multi-drug-resistant cancer cells

    PubMed Central

    Michaelis, M; Rothweiler, F; Barth, S; Cinatl, J; van Rikxoort, M; Löschmann, N; Voges, Y; Breitling, R; von Deimling, A; Rödel, F; Weber, K; Fehse, B; Mack, E; Stiewe, T; Doerr, H W; Speidel, D; Cinatl, J

    2011-01-01

    Six p53 wild-type cancer cell lines from infrequently p53-mutated entities (neuroblastoma, rhabdomyosarcoma, and melanoma) were continuously exposed to increasing concentrations of the murine double minute 2 inhibitor nutlin-3, resulting in the emergence of nutlin-3-resistant, p53-mutated sublines displaying a multi-drug resistance phenotype. Only 2 out of 28 sublines adapted to various cytotoxic drugs harboured p53 mutations. Nutlin-3-adapted UKF-NB-3 cells (UKF-NB-3rNutlin10 μM, harbouring a G245C mutation) were also radiation resistant. Analysis of UKF-NB-3 and UKF-NB-3rNutlin10 μM cells by RNA interference experiments and lentiviral transduction of wild-type p53 into p53-mutated UKF-NB-3rNutlin10 μM cells revealed that the loss of p53 function contributes to the multi-drug resistance of UKF-NB-3rNutlin10 μM cells. Bioinformatics PANTHER pathway analysis based on microarray measurements of mRNA abundance indicated a substantial overlap in the signalling pathways differentially regulated between UKF-NB-3rNutlin10 μM and UKF-NB-3 and between UKF-NB-3 and its cisplatin-, doxorubicin-, or vincristine-resistant sublines. Repeated nutlin-3 adaptation of neuroblastoma cells resulted in sublines harbouring various p53 mutations with high frequency. A p53 wild-type single cell-derived UKF-NB-3 clone was adapted to nutlin-3 in independent experiments. Eight out of ten resulting sublines were p53-mutated harbouring six different p53 mutations. This indicates that nutlin-3 induces de novo p53 mutations not initially present in the original cell population. Therefore, nutlin-3-treated cancer patients should be carefully monitored for the emergence of p53-mutated, multi-drug-resistant cells. PMID:22170099

  5. Role of p53–fibrinolytic system cross-talk in the regulation of quartz-induced lung injury

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Bhandary, Yashodhar P.; Shetty, Shwetha K.; Marudamuthu, Amarnath S.

    2015-03-01

    Silica is the major component of airborne dust generated by wind, manufacturing and/or demolition. Chronic occupational inhalation of silica dust containing crystalline quartz is by far the predominant form of silicosis in humans. Silicosis is a progressive lung disease that typically arises after a very long latency and is a major occupational concern with no known effective treatment. The mechanism of silicosis is not clearly understood. However, silicosis is associated with increased cell death, expression of redox enzymes and pro-fibrotic cytokines and chemokines. Since alveolar epithelial cell (AEC) death and disruption of alveolar fibrinolysis is often associated with both acutemore » and chronic lung injuries, we explored whether p53-mediated changes in the urokinase-type plasminogen activator (uPA) system contributes to silica-induced lung injury. We further sought to determine whether caveolin-1 scaffolding domain peptide (CSP), which inhibits p53 expression, mitigates lung injury associated with exposure to silica. Lung tissues and AECs isolated from wild-type (WT) mice exposed to silica exhibit increased apoptosis, p53 and PAI-1, and suppression of uPA expression. Treatment of WT mice with CSP inhibits PAI-1, restores uPA expression and prevents AEC apoptosis by suppressing p53, which is otherwise induced in mice exposed to silica. The process involves CSP-mediated inhibition of serine-15 phosphorylation of p53 by inhibition of protein phosphatase 2A-C (PP2A-C) interaction with silica-induced caveolin-1 in AECs. These observations suggest that changes in the p53–uPA fibrinolytic system cross-talk contribute to lung injury caused by inhalation of silica dust containing crystalline quartz and is protected by CSP by targeting this pathway. - Highlights: • Chronic exposure to quartz dusts is a major cause of lung injury and silicosis. • The survival of patients with silicosis is bleak due to lack of effective treatments. • This study defines a new role of p53–uPA cross-talk in quartz-induced lung injury. • Targeting the p53–uPA system inhibits ATII cell/lung injury due to quartz exposure.« less

  6. Ineffectiveness of the presence of H-ras/p53 combination of mutations in squamous cell carcinoma cells to induce a conversion of a nontumorigenic to a tumorigenic phenotype.

    PubMed

    Lee, H; Li, D; Prior, T; Casto, B C; Weghorst, C M; Shuler, C F; Milo, G E

    1997-10-01

    Human tumor cells have properties in vitro or in surrogate hosts that are distinct from those of normal cells, such as immortality, anchorage independence, and tumor formation in nude mice. However, different cells from individual tumors may exhibit some, but not all of these features. In previous years, human tumor cell lines derived from different tumor and tissue types have been studied to determine those molecular changes that are associated with the in vitro properties listed above and with tumorigenicity in nude mice. In the present study, seven cell lines derived from human tumors were characterized for p53 and ras mutations that may occur in SCC tumor phenotypes and for tumor formation in nude mice. This investigation was designed to examine whether co-occurrence of mutated ras and p53 lead to a malignant stage in the progression process. None of the seven cell lines contained mutations in the recognized "hot spots" of the p53 tumor suppressor gene, but four had a nonsense/splice mutation in codon 126 and a mutation in codon 12 of the H-ras gene. The remaining three cell lines had p53 mutations in intron 5, in codon 193, and a missense mutation in codon 126, respectively. Four of seven cell lines were nontumorigenic; two of these cell lines contained a nonsense p53-126 mutation and mutated ras; one had a missense mutation at codon 126 but no mutated ras; the the fourth had only a p53 mutation at codon 193. Two of the nontumorigenic cell lines were converted to tumorigenicity after treatment with methyl methanesulfonate or N-methyl-N'-nitro-N-nitrosoguanidine with no apparent additional mutations in either gene. Our analysis revealed that there was a high frequency of genetic diversity and mutations in both p53 and H-ras. There was also a lack of a causal relationship in the presence of mutations in p53 and the cells' ability to exhibit a malignant potential in nude mice.

  7. Interplay between PTB and miR-1285 at the p53 3'UTR modulates the levels of p53 and its isoform Δ40p53α.

    PubMed

    Katoch, Aanchal; George, Biju; Iyyappan, Amrutha; Khan, Debjit; Das, Saumitra

    2017-09-29

    p53 and its translational isoform Δ40p53 are involved in many important cellular functions like cell cycle, cell proliferation, differentiation and metabolism. Expression of both the isoforms can be regulated at different steps. In this study, we explored the role of 3'UTR in regulating the expression of these two translational isoforms. We report that the trans acting factor, Polypyrimidine Tract Binding protein (PTB), also interacts specifically with 3'UTR of p53 mRNA and positively regulates expression of p53 isoforms. Our results suggest that there is interplay between miRNAs and PTB at the 3'UTR under normal and stress conditions like DNA damage. Interestingly, PTB showed some overlapping binding regions in the p53 3'UTR with miR-1285. In fact, knockdown of miR-1285 as well as expression of p53 3'UTR with mutated miR-1285 binding sites resulted in enhanced association of PTB with the 3'UTR, which provides mechanistic insights of this interplay. Taken together, the results provide a plausible molecular basis of how the interplay between miRNAs and the PTB protein at the 3'UTR can play pivotal role in fine tuning the expression of the two p53 isoforms. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  8. Comparison of the protein-protein interfaces in the p53-DNA crystal structures: towards elucidation of the biological interface.

    PubMed

    Ma, Buyong; Pan, Yongping; Gunasekaran, K; Venkataraghavan, R Babu; Levine, Arnold J; Nussinov, Ruth

    2005-03-15

    p53, the tumor suppressor protein, functions as a dimer of dimers. However, how the tetramer binds to the DNA is still an open question. In the crystal structure, three copies of the p53 monomers (containing chains A, B, and C) were crystallized with the DNA-consensus element. Although the structure provides crucial data on the p53-DNA contacts, the active oligomeric state is unclear because the two dimeric (A-B and B-C) interfaces present in the crystal cannot both exist in the tetramer. Here, we address the question of which of these two dimeric interfaces may be more biologically relevant. We analyze the sequence and structural properties of the p53-p53 dimeric interfaces and carry out extensive molecular dynamics simulations of the crystal structures of the human and mouse p53 dimers. We find that the A-B interface residues are more conserved than those of the B-C. Molecular dynamics simulations show that the A-B interface can provide a stable DNA-binding motif in the dimeric state, unlike B-C. Our results indicate that the interface between chains A-B in the p53-DNA complex constitutes a better candidate for a stable biological interface, whereas the B-C interface is more likely to be due to crystal packing. Thus, they have significant implications toward our understanding of DNA binding by p53 as well as p53-mediated interactions with other proteins.

  9. Posttranslational Modifications of p53 in Replicative Senescence Overlapping but Distinct from Those Induced by DNA Damage

    PubMed Central

    Webley, Katherine; Bond, Jane A.; Jones, Christopher J.; Blaydes, Jeremy P.; Craig, Ashley; Hupp, Ted; Wynford-Thomas, David

    2000-01-01

    Replicative senescence in human fibroblasts is absolutely dependent on the function of the phosphoprotein p53 and correlates with activation of p53-dependent transcription. However, no evidence for posttranslational modification of p53 in senescence has been presented, raising the possibility that changes in transcriptional activity result from upregulation of a coactivator. Using a series of antibodies with phosphorylation-sensitive epitopes, we now show that senescence is associated with major changes at putative regulatory sites in the N and C termini of p53 consistent with increased phosphorylation at serine-15, threonine-18, and serine-376 and decreased phosphorylation at serine-392. Ionizing and UV radiation generated overlapping but distinct profiles of response, with increased serine-15 phosphorylation being the only common change. These results support a direct role for p53 in signaling replicative senescence and are consistent with the generation by telomere erosion of a signal which shares some but not all of the features of DNA double-strand breaks. PMID:10733583

  10. Functional kinomics identifies candidate therapeutic targets in head and neck cancer

    PubMed Central

    Moser, Russell; Xu, Chang; Kao, Michael; Annis, James; Lerma, Luisa Angelica; Schaupp, Christopher M.; Gurley, Kay E.; Jang, In Sock; Biktasova, Asel; Yarbrough, Wendell G.; Margolin, Adam A.; Grandori, Carla; Kemp, Christopher J.; Méndez, Eduardo

    2014-01-01

    Purpose To identify novel therapeutic drug targets for p53 mutant head and neck squamous cell carcinoma (HNSCC). Experimental Design RNAi kinome viability screens were performed on HNSCC cells including autologous pairs from primary tumor and recurrent/metastatic lesions, and in parallel on murine squamous cell carcinoma (MSCC) cells derived from tumors of inbred mice bearing germline mutations in Trp53, and p53 regulatory genes: Atm, Prkdc, and p19Arf. Cross-species analysis of cell lines stratified by p53 mutational status and metastatic phenotype was utilized to select 38 kinase targets. Both primary and secondary RNAi validation assays were performed on additional HNSCC cell lines to credential these kinase targets utilizing multiple phenotypic endpoints. Kinase targets were also examined via chemical inhibition utilizing a panel of kinase inhibitors. A preclinical study was conducted on the WEE1 kinase inhibitor, MK-1775. Results Our functional kinomics approach identified novel survival kinases in HNSCC involved in G2/M cell cycle checkpoint, SFK, PI3K and FAK pathways. RNAi mediated knockdown and chemical inhibition of the WEE1 kinase with a specific inhibitor, MK-1775, had a significant effect on both viability and apoptosis. Sensitivity to the MK-1775 kinase inhibitor is in part determined by p53 mutational status, and due to unscheduled mitotic entry. MK-1775 displays single-agent activity and potentiates the efficacy of cisplatin in a p53 mutant HNSCC xenograft model. Conclusions WEE1 kinase is a potential therapeutic drug target for HNSCC. This study supports the application of a functional kinomics strategy to identify novel therapeutic targets for cancer. PMID:25125259

  11. Functional kinomics identifies candidate therapeutic targets in head and neck cancer.

    PubMed

    Moser, Russell; Xu, Chang; Kao, Michael; Annis, James; Lerma, Luisa Angelica; Schaupp, Christopher M; Gurley, Kay E; Jang, In Sock; Biktasova, Asel; Yarbrough, Wendell G; Margolin, Adam A; Grandori, Carla; Kemp, Christopher J; Méndez, Eduardo

    2014-08-15

    To identify novel therapeutic drug targets for p53-mutant head and neck squamous cell carcinoma (HNSCC). RNAi kinome viability screens were performed on HNSCC cells, including autologous pairs from primary tumor and recurrent/metastatic lesions, and in parallel on murine squamous cell carcinoma (MSCC) cells derived from tumors of inbred mice bearing germline mutations in Trp53, and p53 regulatory genes: Atm, Prkdc, and p19(Arf). Cross-species analysis of cell lines stratified by p53 mutational status and metastatic phenotype was used to select 38 kinase targets. Both primary and secondary RNAi validation assays were performed on additional HNSCC cell lines to credential these kinase targets using multiple phenotypic endpoints. Kinase targets were also examined via chemical inhibition using a panel of kinase inhibitors. A preclinical study was conducted on the WEE1 kinase inhibitor, MK-1775. Our functional kinomics approach identified novel survival kinases in HNSCC involved in G2-M cell-cycle checkpoint, SFK, PI3K, and FAK pathways. RNAi-mediated knockdown and chemical inhibition of the WEE1 kinase with a specific inhibitor, MK-1775, had a significant effect on both viability and apoptosis. Sensitivity to the MK-1775 kinase inhibitor is in part determined by p53 mutational status, and due to unscheduled mitotic entry. MK-1775 displays single-agent activity and potentiates the efficacy of cisplatin in a p53-mutant HNSCC xenograft model. WEE1 kinase is a potential therapeutic drug target for HNSCC. This study supports the application of a functional kinomics strategy to identify novel therapeutic targets for cancer. ©2014 American Association for Cancer Research.

  12. Increased nuclear factor-κB and loss of p53 are key mechanisms in Myalgic Encephalomyelitis/chronic fatigue syndrome (ME/CFS).

    PubMed

    Morris, Gerwyn; Maes, Michael

    2012-11-01

    Fukuda's criteria are adequate to make a distinction between Myalgic Encephalomyelitis/chronic fatigue syndrome (ME/CFS) and chronic fatigue (CF), but ME/CFS patients should be subdivided into those with (termed ME) and without (termed CFS) post exertional malaise [Maes et al. 2012]. ME/CFS is considered to be a neuro-immune disease. ME/CFS is characterized by activated immuno-inflammatory pathways, including increased levels of pro-inflammatory cytokines, nuclear factor κB (NF-κB) and aberrations in mitochondrial functions, including lowered ATP. These processes may explain typical symptoms of ME/CFS, e.g. fatigue, malaise, hyperalgesia, and neurologic and autonomic symptoms. Here we hypothesize that increased NF-κB together with a loss of p53 are key phenomena in ME/CFS that further explain ME/CFS symptoms, such as fatigue and neurocognitive dysfunction, and explain ME symptoms, such as post-exertional malaise following mental and physical activities. Inactivation of p53 impairs aerobic mitochondrial functions and causes greater dependence on anaerobic glycolysis, elevates lactate levels, reduces mitochondrial density in skeletal muscle and reduces endurance during physical exercise. Lowered p53 and increased NF-κB are associated with elevated reactive oxygen species. Increased NF-κB induces the production of pro-inflammatory cytokines, which increase glycolysis and further compromise mitochondrial functions. All these factors together may contribute to mitochondrial exhaustion and indicate that the demand for extra ATP upon the commencement of increased activity cannot be met. In conditions of chronic inflammation and oxidative stress, high NF-κB and low p53 may conspire to promote neuron and glial cell survival at a price of severely compromised metabolic brain function. Future research should examine p53 signaling in ME/CFS. Copyright © 2012. Published by Elsevier Ltd.

  13. MicroRNA501-5p induces p53 proteasome degradation through the activation of the mTOR/MDM2 pathway in ADPKD cells.

    PubMed

    de Stephanis, Lucia; Mangolini, Alessandra; Servello, Miriam; Harris, Peter C; Dell'Atti, Lucio; Pinton, Paolo; Aguiari, Gianluca

    2018-09-01

    Cell proliferation and apoptosis are typical hallmarks of autosomal dominant polycystic kidney disease (ADPKD) and cause the development of kidney cysts that lead to end-stage renal disease (ESRD). Many factors, impaired by polycystin complex loss of function, may promote these biological processes, including cAMP, mTOR, and EGFR signaling pathways. In addition, microRNAs (miRs) may also regulate the ADPKD related signaling network and their dysregulation contributes to disease progression. However, the role of miRs in ADPKD pathogenesis has not been fully understood, but also the function of p53 is quite obscure, especially its regulatory contribution on cell proliferation and apoptosis. Here, we describe for the first time that miR501-5p, upregulated in ADPKD cells and tissues, induces the activation of mTOR kinase by PTEN and TSC1 gene repression. The increased activity of mTOR kinase enhances the expression of E3 ubiquitin ligase MDM2 that in turn promotes p53 ubiquitination, leading to its degradation by proteasome machinery in a network involving p70S6K. Moreover, the overexpression of miR501-5p stimulates cell proliferation in kidney cells by the inhibition of p53 function in a mechanism driven by mTOR signaling. In fact, the downregulation of this miR as well as the pharmacological treatment with proteasome and mTOR inhibitors in ADPKD cells reduces cell growth by the activation of apoptosis. Consequently, the stimulation of cell death in ADPKD cells may occur through the inhibition of mTOR/MDM2 signaling and the restoring of p53 function. The data presented here confirm that the impaired mTOR signaling plays an important role in ADPKD. © 2018 Wiley Periodicals, Inc.

  14. Regulation of monocarboxylate transporter MCT1 expression by p53 mediates inward and outward lactate fluxes in tumors.

    PubMed

    Boidot, Romain; Végran, Frédérique; Meulle, Aline; Le Breton, Aude; Dessy, Chantal; Sonveaux, Pierre; Lizard-Nacol, Sarab; Feron, Olivier

    2012-02-15

    The monocarboxylate transporter (MCT) family member MCT1 can transport lactate into and out of tumor cells. Whereas most oxidative cancer cells import lactate through MCT1 to fuel mitochondrial respiration, the role of MCT1 in glycolysis-derived lactate efflux remains less clear. In this study, we identified a direct link between p53 function and MCT1 expression. Under hypoxic conditions, p53 loss promoted MCT1 expression and lactate export produced by elevated glycolytic flux, both in vitro and in vivo. p53 interacted directly with the MCT1 gene promoter and altered MCT1 mRNA stabilization. In hypoxic p53(-/-) tumor cells, NF-κB further supported expression of MCT1 to elevate its levels. Following glucose deprivation, upregulated MCT1 in p53(-/-) cells promoted lactate import and favored cell proliferation by fuelling mitochondrial respiration. We also found that MCT1 expression was increased in human breast tumors harboring p53 mutations and coincident features of hypoxia, with higher MCT1 levels associated with poorer clinical outcomes. Together, our findings identify MCT1 as a target for p53 repression and they suggest that MCT1 elevation in p53-deficient tumors allows them to adapt to metabolic needs by facilitating lactate export or import depending on the glucose availability.

  15. RAG-induced DNA lesions activate proapoptotic BIM to suppress lymphomagenesis in p53-deficient mice

    PubMed Central

    Herold, Marco J.

    2016-01-01

    Neoplastic transformation is driven by oncogenic lesions that facilitate unrestrained cell expansion and resistance to antiproliferative signals. These oncogenic DNA lesions, acquired through errors in DNA replication, gene recombination, or extrinsically imposed damage, are thought to activate multiple tumor suppressive pathways, particularly apoptotic cell death. DNA damage induces apoptosis through well-described p53-mediated induction of PUMA and NOXA. However, loss of both these mediators (even together with defects in p53-mediated induction of cell cycle arrest and cell senescence) does not recapitulate the tumor susceptibility observed in p53−/− mice. Thus, potentially oncogenic DNA lesions are likely to also trigger apoptosis through additional, p53-independent processes. We found that loss of the BH3-only protein BIM accelerated lymphoma development in p53-deficient mice. This process was negated by concomitant loss of RAG1/2-mediated antigen receptor gene rearrangement. This demonstrates that BIM is critical for the induction of apoptosis caused by potentially oncogenic DNA lesions elicited by RAG1/2-induced gene rearrangement. Furthermore, this highlights the role of a BIM-mediated tumor suppressor pathway that acts in parallel to the p53 pathway and remains active even in the absence of wild-type p53 function, suggesting this may be exploited in the treatment of p53-deficient cancers. PMID:27621418

  16. Interleukin-6 increases matrix metalloproteinase-14 (MMP-14) levels via down-regulation of p53 to drive cancer progression.

    PubMed

    Cathcart, Jillian M; Banach, Anna; Liu, Alice; Chen, Jun; Goligorsky, Michael; Cao, Jian

    2016-09-20

    Matrix metalloproteinases (MMPs) play critical roles in cancer invasion and metastasis by digesting basement membrane and extracellular matrix (ECM). Much attention has focused on the enzymatic activities of MMPs; however, the regulatory mechanism of MMP expression remains elusive. By employing bioinformatics analysis, we identified a potential p53 response element within the MMP-14 promoter. Experimentally, we found that p53 can repress MMP-14 promoter activity, whereas deletion of this p53 response element abrogated this effect. Furthermore, we found that p53 expression decreases MMP-14 mRNA and protein levels and attenuates MMP-14-mediated cellular functions. Additional promoter analysis and chromatin immunoprecipitation studies identified a mechanism of regulation of MMP-14 expression by which p53 and transcription factor Sp1 competitively bind to the promoter. As the correlation between inflammation and cancer aggressiveness is well described, we next sought to evaluate if inflammatory cytokines could differentially affect p53 and MMP-14 levels. We demonstrate that interleukin-6 (IL-6) down-regulates p53 protein levels and thus results in a concomitant increase in MMP-14 expression, leading to enhanced cancer cell invasion and metastasis. Our data collectively indicate a novel mechanism of regulation of MMP-14 by a cascade of IL-6 and p53, demonstrating that the tumor microenvironment directly stimulates molecular changes in cancer cells to drive an invasive phenotype.

  17. S-Nitrosylation of parkin as a novel regulator of p53-mediated neuronal cell death in sporadic Parkinson’s disease

    PubMed Central

    2013-01-01

    Background Mutations in the gene encoding parkin, a neuroprotective protein with dual functions as an E3 ubiquitin ligase and transcriptional repressor of p53, are linked to familial forms of Parkinson’s disease (PD). We hypothesized that oxidative posttranslational modification of parkin by environmental toxins may contribute to sporadic PD. Results We first demonstrated that S-nitrosylation of parkin decreased its activity as a repressor of p53 gene expression, leading to upregulation of p53. Chromatin immunoprecipitation as well as gel-shift assays showed that parkin bound to the p53 promoter, and this binding was inhibited by S-nitrosylation of parkin. Additionally, nitrosative stress induced apoptosis in cells expressing parkin, and this death was, at least in part, dependent upon p53. In primary mesencephalic cultures, pesticide-induced apoptosis was prevented by inhibition of nitric oxide synthase (NOS). In a mouse model of pesticide-induced PD, both S-nitrosylated (SNO-)parkin and p53 protein levels were increased, while administration of a NOS inhibitor mitigated neuronal death in these mice. Moreover, the levels of SNO-parkin and p53 were simultaneously elevated in postmortem human PD brain compared to controls. Conclusions Taken together, our data indicate that S-nitrosylation of parkin, leading to p53-mediated neuronal cell death, contributes to the pathophysiology of sporadic PD. PMID:23985028

  18. Uterine deletion of Trp53 compromises antioxidant responses in mouse decidua

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Burnum, Kristin E.; Hirota, Yasushi; Baker, Erin Shammel

    2012-09-01

    Preterm birth is a global health issue impacting both mothers and children. However, the etiology of preterm birth is not clearly understood. From our recent finding that premature decidual senescence with terminal differentiation is a cause of preterm birth in mice with uterine Trp53 deletion, encoding p53 protein, led us to explore other potential factors that are related to preterm birth. Utilizing proteomics approaches, here we show that 183 candidate proteins cause significant changes in decidua with Trp53 deletion as compared to normal decidua. Functional categorization of these proteins unveiled new pathways that are influenced by p53. In particular, downregulationmore » of a cluster of antioxidant proteins in p53 deficient decidua suggests that increased oxidative stress could be one cause of preterm birth in mice with uterine deletion of Trp53.« less

  19. Uterine Deletion of Trp53 Compromises Antioxidant Responses in the Mouse Decidua

    PubMed Central

    Burnum, Kristin E.; Hirota, Yasushi; Baker, Erin S.; Yoshie, Mikihiro; Ibrahim, Yehia M.; Monroe, Matthew E.; Anderson, Gordon A.; Smith, Richard D.; Daikoku, Takiko

    2012-01-01

    Preterm birth is a global health issue impacting millions of mothers and babies. However, the etiology of preterm birth is not clearly understood. Our recent finding that premature decidual senescence with terminal differentiation is a cause of preterm birth in mice with uterine Trp53 deletion, encoding p53 protein, led us to explore other potential factors that are related to preterm birth. Using proteomics approaches, here, we show that 183 candidate proteins show significant changes in deciduae with Trp53 deletion as compared with normal deciduae. Functional categorization of these proteins unveiled new pathways that are influenced by p53. In particular, down-regulation of a cluster of antioxidant enzymes in p53-deficient deciduae suggests that increased oxidative stress could be one cause of preterm birth in mice harboring uterine deletion of Trp53. PMID:22759378

  20. Mutant p53 proteins counteract autophagic mechanism sensitizing cancer cells to mTOR inhibition.

    PubMed

    Cordani, Marco; Oppici, Elisa; Dando, Ilaria; Butturini, Elena; Dalla Pozza, Elisa; Nadal-Serrano, Mercedes; Oliver, Jordi; Roca, Pilar; Mariotto, Sofia; Cellini, Barbara; Blandino, Giovanni; Palmieri, Marta; Di Agostino, Silvia; Donadelli, Massimo

    2016-08-01

    Mutations in TP53 gene play a pivotal role in tumorigenesis and cancer development. Here, we report that gain-of-function mutant p53 proteins inhibit the autophagic pathway favoring antiapoptotic effects as well as proliferation of pancreas and breast cancer cells. We found that mutant p53 significantly counteracts the formation of autophagic vesicles and their fusion with lysosomes throughout the repression of some key autophagy-related proteins and enzymes as BECN1 (and P-BECN1), DRAM1, ATG12, SESN1/2 and P-AMPK with the concomitant stimulation of mTOR signaling. As a paradigm of this mechanism, we show that atg12 gene repression was mediated by the recruitment of the p50 NF-κB/mutant p53 protein complex onto the atg12 promoter. Either mutant p53 or p50 NF-κB depletion downregulates atg12 gene expression. We further correlated the low expression levels of autophagic genes (atg12, becn1, sesn1, and dram1) with a reduced relapse free survival (RFS) and distant metastasis free survival (DMFS) of breast cancer patients carrying TP53 gene mutations conferring a prognostic value to this mutant p53-and autophagy-related signature. Interestingly, the mutant p53-driven mTOR stimulation sensitized cancer cells to the treatment with the mTOR inhibitor everolimus. All these results reveal a novel mechanism through which mutant p53 proteins promote cancer cell proliferation with the concomitant inhibition of autophagy. Copyright © 2016 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  1. KDM4B/JMJD2B is a p53 target gene that modulates the amplitude of p53 response after DNA damage

    PubMed Central

    Moon, Eui Jung; Razorenova, Olga V.; Krieg, Adam J.; von Eyben, Rie

    2017-01-01

    Abstract The p53 tumor suppressor protein plays a critical role in orchestrating the genomic response to various stress signals by acting as a master transcriptional regulator. Differential gene activity is controlled by transcription factors but also dependent on the underlying chromatin structure, especially on covalent histone modifications. After screening different histone lysine methyltransferases and demethylases, we identified JMJD2B/KDM4B as a p53-inducible gene in response to DNA damage. p53 directly regulates JMJD2B gene expression by binding to a canonical p53-consensus motif in the JMJD2B promoter. JMJD2B induction attenuates the transcription of key p53 transcriptional targets including p21, PIG3 and PUMA, and this modulation is dependent on the catalytic capacity of JMJD2B. Conversely, JMJD2B silencing led to an enhancement of the DNA-damage driven induction of p21 and PIG3. These findings indicate that JMJD2B acts in an auto-regulatory loop by which p53, through JMJD2B activation, is able to influence its own transcriptional program. Functionally, exogenous expression of JMJD2B enhanced subcutaneous tumor growth of colon cancer cells in a p53-dependent manner, and genetic inhibition of JMJD2B impaired tumor growth in vivo. These studies provide new insights into the regulatory effect exerted by JMJD2B on tumor growth through the modulation of p53 target genes. PMID:28073943

  2. Calculations of the energy levels and oscillator strengths of the Ne-like Fe Ion (Fe XVII)

    NASA Astrophysics Data System (ADS)

    Zhong, Jia-yong; Zhang, Jie; Zhao, Gang; Lu, Xin

    Energy levels and oscillator strengths among the 27 fine-structure levels belonging to the (ls 22s 2)2p 6, 2p 53s, 2p 53p and 2p 53d configurations of the neon-like iron ion have been calculated using three atomic structure codes RCN/RCG, AUTOSTRUCTURE (AS) and GRASP. Relativistic corrections of the wave functions are taken into account in the RCN/RCG calculation. The results agree well with the available experimental and theoretical data. The accuracy of the three codes is analysed.

  3. MDM2 is an important prognostic and predictive factor for platin-pemetrexed therapy in malignant pleural mesotheliomas and deregulation of P14/ARF (encoded by CDKN2A) seems to contribute to an MDM2-driven inactivation of P53.

    PubMed

    Walter, R F H; Mairinger, F D; Ting, S; Vollbrecht, C; Mairinger, T; Theegarten, D; Christoph, D C; Schmid, K W; Wohlschlaeger, J

    2015-03-03

    Malignant pleural mesothelioma (MPM) is a highly aggressive tumour that is first-line treated with a combination of cisplatin and pemetrexed. Until now, predictive and prognostic biomarkers are lacking, making it a non-tailored therapy regimen with unknown outcome. P53 is frequently inactivated in MPM, but mutations are extremely rare. MDM2 and P14/ARF are upstream regulators of P53 that may contribute to P53 inactivation. A total of 72 MPM patients were investigated. MDM2 immunoexpression was assessed in 65 patients. MDM2 and P14/ARF mRNA expression was analysed in 48 patients of the overall collective. The expression results were correlated to overall survival (OS) and progression-free survival (PFS). OS and PFS correlated highly significantly with MDM2 mRNA and protein expression, showing a dismal prognosis for patients with elevated MDM2 expression (for OS: Score (logrank) test: P⩽0.002, and for PFS: Score (logrank) test; P<0.007). MDM2 was identified as robust prognostic and predictive biomarker for MPM on the mRNA and protein level. P14/ARF mRNA expression reached no statistical significance, but Kaplan-Meier curves distinguished patients with low P14/ARF expression and hence shorter survival from patients with higher expression and prolonged survival. MDM2 is a prognostic and predictive marker for a platin-pemetrexed therapy of patients with MPMs. Downregulation of P14/ARF expression seems to contribute to MDM2-overexpression-mediated P53 inactivation in MPM patients.

  4. Crosstalk between the IGF-1R/AKT/mTORC1 pathway and the tumor suppressors p53 and p27 determines cisplatin sensitivity and limits the effectiveness of an IGF-1R pathway inhibitor

    PubMed Central

    Davaadelger, Batzaya; Duan, Lei; Perez, Ricardo E.; Gitelis, Steven; Maki, Carl G.

    2016-01-01

    The insulin-like growth factor-1 receptor (IGF-1R) signaling pathway is aberrantly activated in multiple cancers and can promote proliferation and chemotherapy resistance. Multiple IGF-1R inhibitors have been developed as potential therapeutics. However, these inhibitors have failed to increase patient survival when given alone or in combination with chemotherapy agents. The reason(s) for the disappointing clinical effect of these inhibitors is not fully understood. Cisplatin (CP) activated the IGF-1R/AKT/mTORC1 pathway and stabilized p53 in osteosarcoma (OS) cells. p53 knockdown reduced IGF-1R/AKT/mTORC1 activation by CP, and IGF-1R inhibition reduced the accumulation of p53. These data demonstrate positive crosstalk between p53 and the IGF-1R/AKT/mTORC1 pathway in response to CP. Further studies showed the effect of IGF-1R inhibition on CP response is dependent on p53 status. In p53 wild-type cells treated with CP, IGF-1R inhibition increased p53s apoptotic function but reduced p53-dependent senescence, and had no effect on long term survival. In contrast, in p53-null/knockdown cells, IGF-1R inhibition reduced apoptosis in response to CP and increased long term survival. These effects were due to p27 since IGF-1R inhibition stabilized p27 in CP-treated cells, and p27 depletion restored apoptosis and reduced long term survival. Together, the results demonstrate 1) p53 expression determines the effect of IGF-1R inhibition on cancer cell CP response, and 2) crosstalk between the IGF-1R/AKT/mTORC1 pathway and p53 and p27 can reduce cancer cell responsiveness to chemotherapy and may ultimately limit the effectiveness of IGF-1R pathway inhibitors in the clinic. PMID:27050276

  5. A high-throughput cellular assay to quantify the p53-degradation activity of E6 from different human papillomavirus types.

    PubMed

    Gagnon, David; Archambault, Jacques

    2015-01-01

    A subset of human papillomaviruses (HPVs), known as the high-risk types, are the causative agents of cervical cancer and other malignancies of the anogenital region and oral mucosa. The capacity of these viruses to induce cancer and to immortalize cells in culture relies in part on a critical function of their E6 oncoprotein, that of promoting the poly-ubiquitination of the cellular tumor suppressor protein p53 and its subsequent degradation by the proteasome. Here, we describe a cellular assay to measure the p53-degradation activity of E6 from different HPV types. This assay is based on a translational fusion of p53 to Renilla luciferase (Rluc-p53) that remains sensitive to degradation by high-risk E6 and whose steady-state levels can be accurately measured in standard luciferase assays. The p53-degradation activity of any E6 protein can be tested and quantified in transiently transfected cells by determining the amount of E6-expression vector required to reduce by half the levels of RLuc-p53 luciferase activity (50 % effective concentration [EC50]). The high-throughput and quantitative nature of this assay makes it particularly useful to compare the p53-degradation activities of E6 from several HPV types in parallel.

  6. p53 targets chromatin structure alteration to repress alpha-fetoprotein gene expression.

    PubMed

    Ogden, S K; Lee, K C; Wernke-Dollries, K; Stratton, S A; Aronow, B; Barton, M C

    2001-11-09

    Many of the functions ascribed to p53 tumor suppressor protein are mediated through transcription regulation. We have shown that p53 represses hepatic-specific alpha-fetoprotein (AFP) gene expression by direct interaction with a composite HNF-3/p53 DNA binding element. Using solid-phase, chromatin-assembled AFP DNA templates and analysis of chromatin structure and transcription in vitro, we find that p53 binds DNA and alters chromatin structure at the AFP core promoter to regulate transcription. Chromatin assembled in the presence of hepatoma extracts is activated for AFP transcription with an open, accessible core promoter structure. Distal (-850) binding of p53 during chromatin assembly, but not post-assembly, reverses transcription activation concomitant with promoter inaccessibility to restriction enzyme digestion. Inhibition of histone deacetylase activity by trichostatin-A (TSA) addition, prior to and during chromatin assembly, activated chromatin transcription in parallel with increased core promoter accessibility. Chromatin immunoprecipitation analyses showed increased H3 and H4 acetylated histones at the core promoter in the presence of TSA, while histone acetylation remained unchanged at the site of distal p53 binding. Our data reveal that p53 targets chromatin structure alteration at the core promoter, independently of effects on histone acetylation, to establish repressed AFP gene expression.

  7. BclxL changes conformation upon binding to wild-type but not mutant p53 DNA binding domain.

    PubMed

    Hagn, Franz; Klein, Christian; Demmer, Oliver; Marchenko, Natasha; Vaseva, Angelina; Moll, Ute M; Kessler, Horst

    2010-01-29

    p53 can induce apoptosis through mitochondrial membrane permeabilization by interaction of its DNA binding region with the anti-apoptotic proteins BclxL and Bcl2. However, little is known about the action of p53 at the mitochondria in molecular detail. By using NMR spectroscopy and fluorescence polarization we characterized the binding of wild-type and mutant p53 DNA binding domains to BclxL and show that the wild-type p53 DNA binding domain leads to structural changes in the BH3 binding region of BclxL, whereas mutants fail to induce such effects due to reduced affinity. This was probed by induced chemical shift and residual dipolar coupling data. These data imply that p53 partly achieves its pro-apoptotic function at the mitochondria by facilitating interaction between BclxL and BH3-only proteins in an allosteric mode of action. Furthermore, we characterize for the first time the binding behavior of Pifithrin-mu, a specific small molecule inhibitor of the p53-BclxL interaction, and present a structural model of the protein-ligand complex. A rather unusual behavior is revealed whereby Pifithrin-mu binds to both sides of the protein-protein complex. These data should facilitate the rational design of more potent specific BclxL-p53 inhibitors.

  8. A p53-inducible microRNA-34a downregulates Ras signaling by targeting IMPDH

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Hwa-Ryeon; Roe, Jae-Seok; Lee, Ji-Eun

    2012-02-24

    Highlights: Black-Right-Pointing-Pointer p53 downregulates IMPDH. Black-Right-Pointing-Pointer p53-dependent miR-34a transactivation inhibits IMPDH transcription. Black-Right-Pointing-Pointer miR-34a-mediated inhibition of IMPDH downregulates GTP-dependent Ras signal. -- Abstract: p53 is a well-known transcription factor that controls cell cycle arrest and cell death in response to a wide range of stresses. Moreover, p53 regulates glucose metabolism and its mutation results in the metabolic switch to the Warburg effect found in cancer cells. Nucleotide biosynthesis is also critical for cell proliferation and the cell division cycle. Nonetheless, little is known about whether p53 regulates nucleotide biosynthesis. Here we demonstrated that p53-inducible microRNA-34a (miR-34a) repressed inosine 5 Primemore » -monophosphate dehydrogenase (IMPDH), a rate-limiting enzyme of de novo GTP biosynthesis. Treatment with anti-miR-34a inhibitor relieved the expression of IMPDH upon DNA damage. Ultimately, miR-34a-mediated inhibition of IMPDH resulted in repressed activation of the GTP-dependent Ras signaling pathway. In summary, we suggest that p53 has a novel function in regulating purine biosynthesis, aided by miR-34a-dependent IMPDH repression.« less

  9. Drug resistance to inhibitors of the human double minute-2 E3 ligase is mediated by point mutations of p53, but can be overcome with the p53 targeting agent RITA.

    PubMed

    Jones, Richard J; Bjorklund, Chad C; Baladandayuthapani, Veerabhadran; Kuhn, Deborah J; Orlowski, Robert Z

    2012-10-01

    The human double minute (HDM)-2 E3 ubiquitin ligase plays a key role in p53 turnover and has been validated preclinically as a target in multiple myeloma (MM) and mantle cell lymphoma (MCL). HDM-2 inhibitors are entering clinical trials, and we therefore sought to understand potential mechanisms of resistance in lymphoid models. Wild-type p53 H929 MM and Granta-519 MCL cells resistant to MI-63 or Nutlin were generated by exposing them to increasing drug concentrations. MI-63-resistant H929 and Granta-519 cells were resistant to Nutlin, whereas Nutlin-resistant cells displayed cross-resistance to MI-63. These cells also showed cross-resistance to bortezomib, doxorubicin, cisplatin, and melphalan, but remained sensitive to the small molecule inhibitor RITA (reactivation of p53 and induction of tumor cell apoptosis). HDM-2 inhibitor-resistant cells harbored increased p53 levels, but neither genotoxic nor nongenotoxic approaches to activate p53 induced HDM-2 or p21. Resequencing revealed wild-type HDM-2, but mutations were found in the p53 DNA binding and dimerization domains. In resistant cells, RITA induced a G(2)-M arrest, upregulation of p53 targets HDM-2, PUMA, and NOXA, and PARP cleavage. Combination regimens with RITA and MI-63 resulted in enhanced cell death compared with RITA alone. These findings support the possibility that p53 mutation could be a primary mechanism of acquired resistance to HDM-2 inhibitors in MCL and MM. Furthermore, they suggest that simultaneous restoration of p53 function and HDM-2 inhibition is a rational strategy for clinical translation.

  10. The immunoexpression of p53 and Snail in endometrioid endometrial carcinomas.

    PubMed

    Dragomirescu, Mihaela; Stepan, Alex Emilian; Mărgăritescu, Claudiu; Simionescu, Cristiana Eugenia

    2018-01-01

    Endometrial cancer is one of the most common tumors in women worldwide. P53 has a well-known function as tumor suppressor, but it can also regulate the tissues metabolism, differentiation and development. Snail is a zinc-finger transcription factor, involved in the cell differentiation and survival. We analyzed the immunoexpression of p53 and Snail in 55 cases of endometrioid endometrial carcinoma (EEC), in relation with the histopathological prognosis parameters and tumoral compartments, respectively intratumoral and advancing edge areas. For both markers, we found a statistically significant association with histological grade, in relation with tumoral compartments. P53 and Snail can be used in developing EEC targeted treatment.

  11. Hemodynamic and tissue oxygenation responses to exercise and beta-adrenergic blockade in patients with hyperthyroidism.

    PubMed

    Monachini, Maristela C; Lage, Silvia G; Ran, Miguel A N; Cardoso, Rita H A; Medeiros, Caio; Caramelli, Bruno; Sposito, Andrei C; Ramires, José A F

    2004-07-01

    Exercise-induced dyspnea is a frequent feature in patients with hyperthyroidism. Data from clinical studies to elucidate the origin of this symptom are lacking. In the current study, we examined the hemodynamic and oxygenation responses to exercise and beta-adrenergic blockade in patients with hyperthyroidism and their relationship with dyspnea. Hemodynamic studies were performed under resting conditions and after isotonic exercise in 15 patients with hyperthyroidism and 11 control subjects. Exercise was applied using a bicycle ergometer, with progressive loads. In the hyperthyroid group, measurements were repeated at rest and during supine exercise after administering 15 mg of intravenous metoprolol. End-diastolic pulmonary artery pressure and cardiac index were higher in the hyperthyroid group than in controls (18.6 +/- 5.3 vs. 11.2 +/- 4.9 mmHg; p = 0.02, and 6.0 +/- 1.7 vs. 2.8 +/- 0.5 l/min/m2; p = 0.0001, respectively). After exercise, there was an increase in end-diastolic pulmonary artery pressure in the hyperthyroid group (18.6 +/- 5.3 to 25.5 +/- 9.9 mmHg; p = 0.02), revealing impaired cardiocirculatory reserve. Pulmonary arteriolar resistance increased significantly in parallel with end-diastolic pulmonary artery pressure after drug administration, suggesting an inadequate cardiovascular response after beta blockade in patients with hyperthyroidism. We observed that functional left ventricular reserve is impaired in patients with hyperthyroidism, suggesting an explanation for the frequent symptom of dyspnea and impaired exercise tolerance. Moreover, we also suggest that beta-adrenergic blockade may adversely affect cardiovascular function in patients with hyperthyroidism.

  12. Significance of AZD1152 as a potential treatment against Aurora B overexpression in acute promyelocytic leukemia.

    PubMed

    Ghanizadeh-Vesali, Samad; Zekri, Ali; Zaker, Farhad; Zaghal, Azam; Yousefi, Meysam; Alimoghaddam, Kamran; Ghavamzadeh, Ardeshir; Ghaffari, Seyed H

    2016-06-01

    Aurora B kinase as a chromosomal passenger protein plays multiple roles in regulating mitosis and cytokinesis. The function of Aurora B in leukemic cells has made it an important treatment target. In this study, we explored the expressions of Aurora (A, B, and C) kinases in newly diagnosed acute promyelocytic leukemia (APL) patients. In addition, we investigated the effects of AZD1152 as a specific inhibitor of Aurora B on cell survival, DNA synthesis, nuclear morphology, apoptosis induction, cell cycle distribution, and gene expression in an APL-derived NB4 cell line. Our results showed that Aurora B was overexpressed in 88 % of APL patients. AZD1152 treatment of NB4 cells led to viability reduction and G2/M arrest followed by an increase in cell size and polyploidy induction. These giant cells showed morphological evidence of mitotic catastrophe. AZD1152 treatment induced activation of G2/M checkpoint which in turn led to transient G2/M arrest in a p21-independent manner. Lack of functional p53 in NB4 cells might provide an opportunity to escape from G2/M block and to endure repeated rounds of replication and polyploidy. Treated cells were probably eliminated via p73-mediated overexpression of BAX, PUMA, and APAF1 and downregulation of survivin and MCL-1. In summary, AZD1152 treatment led to endomitosis and polyploidy in TP53-mutated NB4 cells. These giant polyploid cells might undergo mitotic catastrophe and p73-mediated apoptosis. It seems that induction of polyploidy via AZD1152 could be a novel form of anti-cancer therapy for APL that may be clinically accessible in the near future.

  13. Decreased Virus Population Diversity in p53-Null Mice Infected with Weakly Oncogenic Abelson Virus

    PubMed Central

    Marchlik, Erica; Kalman, Richard; Rosenberg, Naomi

    2005-01-01

    The Abelson murine leukemia virus (Ab-MLV), like other retroviruses that contain v-onc genes, arose following a recombination event between a replicating retrovirus and a cellular oncogene. Although experimentally validated models have been presented to address the mechanism by which oncogene capture occurs, very little is known about the events that influence emerging viruses following the recombination event that incorporates the cellular sequences. One feature that may play a role is the genetic makeup of the host in which the virus arises; a number of host genes, including oncogenes and tumor suppressor genes, have been shown to affect the pathogenesis of many murine leukemia viruses. To examine how a host gene might affect an emerging v-onc gene-containing retrovirus, we studied the weakly oncogenic Ab-MLV-P90A strain, a mutant that generates highly oncogenic variants in vivo, and compared the viral populations in normal mice and mice lacking the p53 tumor suppressor gene. While variants arose in both p53+/+ and p53−/− tumors, the samples from the wild-type animals contained a more diverse virus population. Differences in virus population diversity were not observed when wild-type and null animals were infected with a highly oncogenic wild-type strain of Ab-MLV. These results indicate that p53, and presumably other host genes, affects the selective forces that operate on virus populations in vivo and likely influences the evolution of oncogenic retroviruses such as Ab-MLV. PMID:16140739

  14. Met synergizes with p53 loss to induce mammary tumors that possess features of claudin-low breast cancer

    PubMed Central

    Knight, Jennifer F.; Lesurf, Robert; Zhao, Hong; Pinnaduwage, Dushanthi; Davis, Ryan R.; Saleh, Sadiq M. I.; Zuo, Dongmei; Naujokas, Monica A.; Chughtai, Naila; Herschkowitz, Jason I.; Prat, Aleix; Mulligan, Anna Marie; Muller, William J.; Cardiff, Robert D.; Gregg, Jeff P.; Andrulis, Irene L.; Hallett, Michael T.; Park, Morag

    2013-01-01

    Triple-negative breast cancer (TNBC) accounts for ∼20% of cases and contributes to basal and claudin-low molecular subclasses of the disease. TNBCs have poor prognosis, display frequent mutations in tumor suppressor gene p53 (TP53), and lack targeted therapies. The MET receptor tyrosine kinase is elevated in TNBC and transgenic Met models (Metmt) develop basal-like tumors. To investigate collaborating events in the genesis of TNBC, we generated Metmt mice with conditional loss of murine p53 (Trp53) in mammary epithelia. Somatic Trp53 loss, in combination with Metmt, significantly increased tumor penetrance over Metmt or Trp53 loss alone. Unlike Metmt tumors, which are histologically diverse and enriched in a basal-like molecular signature, the majority of Metmt tumors with Trp53 loss displayed a spindloid pathology with a distinct molecular signature that resembles the human claudin-low subtype of TNBC, including diminished claudins, an epithelial-to-mesenchymal transition signature, and decreased expression of the microRNA-200 family. Moreover, although mammary specific loss of Trp53 promotes tumors with diverse pathologies, those with spindloid pathology and claudin-low signature display genomic Met amplification. In both models, MET activity is required for maintenance of the claudin-low morphological phenotype, in which MET inhibitors restore cell-cell junctions, rescue claudin 1 expression, and abrogate growth and dissemination of cells in vivo. Among human breast cancers, elevated levels of MET and stabilized TP53, indicative of mutation, correlate with highly proliferative TNBCs of poor outcome. This work shows synergy between MET and TP53 loss for claudin-low breast cancer, identifies a restricted claudin-low gene signature, and provides a rationale for anti-MET therapies in TNBC. PMID:23509284

  15. Transduction of Recombinant M3-p53-R12 Protein Enhances Human Leukemia Cell Apoptosis

    PubMed Central

    Lu, Tsung Chi; Zhao, Guan- Hao; Chen, Yao Yun; Chien, Chia-Ying; Huang, Chi-Hung; Lin, Kwang Hui; Chen, Shen Liang

    2016-01-01

    Tumor suppressor protein p53 plays important roles in initiating cell cycle arrest and promoting tumor cell apoptosis. Previous studies have shown that p53 is either mutated or defective in approximately 50% of human cancers; therefore restoring normal p53 activity in cancer cells might be an effective anticancer therapeutic approach. Herein, we designed a chimeric p53 protein flanked with the MyoD N-terminal transcriptional activation domain (amino acids 1-62, called M3) and a poly-arginine (R12) cell penetrating signal in its N-and C-termini respectively. This chimeric protein, M3-p53-R12, can be expressed in E. coli and purified using immobilized metal ion chromatography followed by serial refolding dialysis. The purified M3-p53-R12 protein retains DNA-binding activity and gains of cell penetrating ability. Using MTT assay, we demonstrated that M3-p53-R12 inhibited the growth of K562, Jurkat as well as HL-60 leukemia cells carrying mutant p53 genes. Results from FACS analysis also demonstrated that transduction of M3-p53-R12 protein induced cell cycle arrest of these leukemia cells. Of special note, M3-p53-R12 has no apoptotic effect on normal mesenchymal stem cells (MSC) and leukocytes, highlighting its differential effects on normal and tumor cells. To sum up, our results reveal that purified recombinant M3-p53-R12 protein has functions of suppressing the leukemia cell lines' proliferation and launching cell apoptosis, suggesting the feasibility of using M3-p53-R12 protein as an anticancer drug. In the future we will test whether this chimeric protein can preferentially trigger the death of malignant cancer cells without affecting normal cells in animals carrying endogenous or xenographic tumors. PMID:27390612

  16. Human rpL3 induces G₁/S arrest or apoptosis by modulating p21waf1/cip1 levels in a p53-independent manner

    PubMed Central

    Russo, Annapina; Esposito, Davide; Catillo, Morena; Pietropaolo, Concetta; Crescenzi, Elvira; Russo, Giulia

    2013-01-01

    It is now largely accepted that ribosomal proteins may be implicated in a variety of biological functions besides that of components of the translation machinery. Many evidences show that a subset of ribosomal proteins are involved in the regulation of the cell cycle and apoptosis through modulation of p53 activity. In addition, p53-independent mechanisms of cell cycle arrest in response to alterations of ribosomal proteins availability have been described. Here, we identify human rpL3 as a new regulator of cell cycle and apoptosis through positive regulation of p21 expression in a p53-independent system. We demonstrate that the rpL3-mediated p21 upregulation requires the specific interaction between rpL3 and Sp1. Furthermore, in our experimental system, p21 overexpression leads to a dual outcome, activating the G₁/S arrest of the cell cycle or the apoptotic pathway through mitochondria, depending on its intracellular levels. It is noteworthy that depletion of p21 abrogates both effects. Taken together, our findings unravel a novel extraribosomal function of rpL3 and reinforce the proapoptotic role of p21 in addition to its widely reported ability as an inhibitor of cell proliferation. PMID:23255119

  17. [Application of PLA Method for Detection of p53/p63/p73 Complexes in Situ in Tumour Cells and Tumour Tissue].

    PubMed

    Hrabal, V; Nekulová, M; Nenutil, R; Holčaková, J; Coates, P J; Vojtěšek, B

    2017-01-01

    PLA (proximity ligation assay) can be used for detection of protein-protein interactions in situ directly in cells and tissues. Due to its high sensitivity and specificity it is useful for detection, localization and quantification of protein complexes with single molecule resolution. One of the mechanisms of mutated p53 gain of function is formation of proten-protein complexes with other members of p53 family - p63 and p73. These interactions influences chemosensitivity and invasivity of cancer cells and this is why these complexes are potential targets of anti-cancer therapy. The aim of this work is to detect p53/p63/p73 interactions in situ in tumour cells and tumour tissue using PLA method. Unique in-house antibodies for specific detection of p63 and p73 isoforms were developed and characterized. Potein complexes were detected using PLA in established cell lines SVK14, HCC1806 and FaDu and in paraffin sections of colorectal carcinoma tissue. Cell lines were also processed to paraffin blocks. p53/T-antigen and ΔNp63/T-antigen protein complexes were detected in SVK14 cells using PLA. Interactions of ΔNp63 and TAp73 isoforms were found in HCC1806 cell line with endogenous expression of these proteins. In FaDu cell line mut-p53/TAp73 complex was localized but not mut-p53/ΔNp63 complex. p53 tetramer was detected directly in colorectal cancer tissue. During development of PLA method for detection of protein complexes between p53 family members we detected interactions of p53 and p63 with T-antigen and mut-p53 and ΔNp63 with TAp73 tumour suppressor in tumour cell lines and p53 tetramers in paraffin sections of colorectal cancer tissue. PLA will be further used for detection of p53/p63, p53/p73 and p63/p73 interactions in tumour tissues and it could be also used for screening of compounds that can block formation of p53/p63/p73 protein complexes.Key words: p53 protein family - protein interaction mapping - immunofluorescence This work was supported by MEYS - NPS I - LO1413. The authors declare they have no potential conflicts of interest concerning drugs, products, or services used in the study. The Editorial Board declares that the manuscript met the ICMJE recommendation for biomedical papers.Submitted: 13. 3. 2017Accepted: 26. 3. 2017.

  18. 14-3-3ζ turns TGF-β's function from tumor suppressor to metastasis promoter in breast cancer by contextual changes of Smad partners from p53 to Gli2.

    PubMed

    Xu, Jia; Acharya, Sunil; Sahin, Ozgur; Zhang, Qingling; Saito, Yohei; Yao, Jun; Wang, Hai; Li, Ping; Zhang, Lin; Lowery, Frank J; Kuo, Wen-Ling; Xiao, Yi; Ensor, Joe; Sahin, Aysegul A; Zhang, Xiang H-F; Hung, Mien-Chie; Zhang, Jitao David; Yu, Dihua

    2015-02-09

    Transforming growth factor β (TGF-β) functions as a tumor suppressor in premalignant cells but as a metastasis promoter in cancer cells. The dichotomous functions of TGF-β are proposed to be dictated by different partners of its downstream effector Smads. However, the mechanism for the contextual changes of Smad partners remained undefined. Here, we demonstrate that 14-3-3ζ destabilizes p53, a Smad partner in premalignant mammary epithelial cells, by downregulating 14-3-3σ, thus turning off TGF-β's tumor suppression function. Conversely, 14-3-3ζ stabilizes Gli2 in breast cancer cells, and Gli2 partners with Smads to activate PTHrP and promote TGF-β-induced bone metastasis. The 14-3-3ζ-driven contextual changes of Smad partners from p53 to Gli2 may serve as biomarkers and therapeutic targets of TGF-β-mediated cancer progression. Copyright © 2015 Elsevier Inc. All rights reserved.

  19. Statins in Acute Ischemic Stroke: A Systematic Review

    PubMed Central

    Hong, Keun-Sik; Lee, Ji Sung

    2015-01-01

    Background and Purpose Statins have pleiotropic effects of potential neuroprotection. However, because of lack of large randomized clinical trials, current guidelines do not provide specific recommendations on statin initiation in acute ischemic stroke (AIS). The current study aims to systematically review the statin effect in AIS. Methods From literature review, we identified articles exploring prestroke and immediate post-stroke statin effect on imaging surrogate markers, initial stroke severity, functional outcome, and short-term mortality in human AIS. We summarized descriptive overview. In addition, for subjects with available data from publications, we conducted meta-analysis to provide pooled estimates. Results In total, we identified 70 relevant articles including 6 meta-analyses. Surrogate imaging marker studies suggested that statin might enhance collaterals and reperfusion. Our updated meta-analysis indicated that prestroke statin use was associated with milder initial stroke severity (odds ratio [OR] [95% confidence interval], 1.24 [1.05-1.48]; P=0.013), good functional outcome (1.50 [1.29-1.75]; P<0.001), and lower mortality (0.42 [0.21-0.82]; P=0.0108). In-hospital statin use was associated with good functional outcome (1.31 [1.12-1.53]; P=0.001), and lower mortality (0.41 [0.29-0.58]; P<0.001). In contrast, statin withdrawal was associated with poor functional outcome (1.83 [1.01-3.30]; P=0.045). In patients treated with thrombolysis, statin was associated with good functional outcome (1.44 [1.10-1.89]; P=0.001), despite an increased risk of symptomatic hemorrhagic transformation (1.63 [1.04-2.56]; P=0.035). Conclusions The current study findings support the use of statin in AIS. However, the findings were mostly driven by observational studies at risk of bias, and thereby large randomized clinical trials would provide confirmatory evidence. PMID:26437994

  20. Silencing of p53 RNA through transarterial delivery ameliorates renal tubular injury and downregulates GSK-3β expression after ischemia-reperfusion injury.

    PubMed

    Fujino, Takayuki; Muhib, Sharifi; Sato, Nobuyuki; Hasebe, Naoyuki

    2013-12-01

    p53, a pivotal protein in the apoptotic pathway, has been identified as a mediator of transcriptional responses to ischemia-reperfusion (IR) injury. The characteristics and functional significance of the p53 response in vivo are largely unknown in IR-induced kidney injury. Therapeutic opportunities of delivering small interfering RNA (siRNA) via venous injection have gained recognition; however, systemic adverse effects of siRNA therapy should be considered. To prevent IR-induced kidney injury, we tested the efficacy of transarterial administration of siRNA targeting p53 (p53 siRNA). Female C57BL/6 mice underwent unilateral renal artery ischemia for 30 min, followed by reperfusion. siRNA experiments utilized short hairpin (sh) RNA plasmid-based approaches. Transfection of shRNA was performed using cationic polymer transfection reagent. Injection of synthetic p53 shRNA into the left renal artery just after ischemia improved tubular injury, apoptosis, and the swelling of mitochondria in cells of the thick ascending limb of Henle (mTALH) at the outer medullary regions. Staining of upregulated p53 was colocalized with the inducible expression of glycogen synthase kinase-3β (GSK-3β) at mTALH after IR injury. p53 shRNA inhibited GSK-3β expression and restored β-catenin expression at mTALH. For IR-induced kidney injury, transarterial delivery of p53 siRNA is an effective pharmacological intervention. Targeting siRNA to p53 leads to an attenuation of apoptosis and mitochondrial damage through the downregulation of GSK-3β expression and upregulation of β-catenin. Local delivery of vectors such as p53 siRNA through a transaortic catheter is clinically useful in reducing the adverse effect of siRNA-related therapy.

  1. Telomeres and Mitochondria in the Aging Heart

    PubMed Central

    Moslehi, Javid; DePinho, Ronald A.; Sahin, Ergün

    2013-01-01

    Studies in humans and in mice have highlighted the importance of short telomeres and impaired mitochondrial function in driving age-related functional decline in the heart. Although telomere and mitochondrial dysfunction have been viewed mainly in isolation, recent studies in telomerase-deficient mice have provided evidence for an intimate link between these two processes. Telomere dysfunction induces a profound p53-dependent repression of the master regulators of mitochondrial biogenesis and function, peroxisome proliferator-activated receptor gamma coactivator (PGC)-1α and PGC-1β in the heart, which leads to bioenergetic compromise due to impaired oxidative phosphorylation and ATP generation. This telomere-p53-PGC mitochondrial/metabolic axis integrates many factors linked to heart aging including increased DNA damage, p53 activation, mitochondrial, and metabolic dysfunction and provides a molecular basis of how dysfunctional telomeres can compromise cardiomyocytes and stem cell compartments in the heart to precipitate cardiac aging. PMID:22539756

  2. Smoking, p53 Mutation, and Lung Cancer

    PubMed Central

    Gibbons, Don L.; Byers, Lauren A.; Kurie, Jonathan M.

    2014-01-01

    This issue marks the 50th Anniversary of the release of the U.S. Surgeon General’s Report on Smoking and Health. Perhaps no other singular event has done more to highlight the effects of smoking on the development of cancer. Tobacco exposure is the leading cause of cancers involving the oral cavity, conductive airways and the lung. Owing to the many carcinogens in tobacco smoke, smoking-related malignancies have a high genome-wide burden of mutations, including in the gene encoding for p53. The p53 protein is the most frequently mutated tumor suppressor in cancer, responsible for a range of critical cellular functions that are compromised by the presence of a mutation. Herein we review the epidemiologic connection between tobacco exposure and cancer, the molecular basis of p53 mutation in lung cancer, and the normal molecular and cellular roles of p53 that are abrogated during lung tumor development and progression as defined by in vitro and in vivo studies. We also consider the therapeutic potential of targeting mutant p53 in a clinical setting based upon the cellular role of mutant p53 and data from genetic murine models. PMID:24442106

  3. Identification of herpesvirus proteins that contribute to G1/S arrest.

    PubMed

    Paladino, Patrick; Marcon, Edyta; Greenblatt, Jack; Frappier, Lori

    2014-04-01

    Lytic infection by herpesviruses induces cell cycle arrest at the G1/S transition. This appears to be a function of multiple herpesvirus proteins, but only a minority of herpesvirus proteins have been examined for cell cycle effects. To gain a more comprehensive understanding of the viral proteins that contribute to G1/S arrest, we screened a library of over 200 proteins from herpes simplex virus type 1, human cytomegalovirus, and Epstein-Barr virus (EBV) for effects on the G1/S interface, using HeLa fluorescent, ubiquitination-based cell cycle indicator (Fucci) cells in which G1/S can be detected colorimetrically. Proteins from each virus were identified that induce accumulation of G1/S cells, predominantly tegument, early, and capsid proteins. The identification of several capsid proteins in this screen suggests that incoming viral capsids may function to modulate cellular processes. The cell cycle effects of selected EBV proteins were further verified and examined for effects on p53 and p21 as regulators of the G1/S transition. Two EBV replication proteins (BORF2 and BMRF1) were found to induce p53 but not p21, while a previously uncharacterized tegument protein (BGLF2) was found to induce p21 protein levels in a p53-independent manner. Proteomic analyses of BGLF2-interacting proteins identified interactions with the NIMA-related protein kinase (NEK9) and GEM-interacting protein (GMIP). Silencing of either NEK9 or GMIP induced p21 without affecting p53 and abrogated the ability of BGLF2 to further induce p21. Collectively, these results suggest multiple viral proteins contribute to G1/S arrest, including BGLF2, which induces p21 levels likely by interfering with the functions of NEK9 and GMIP. Most people are infected with multiple herpesviruses, whose proteins alter the infected cells in several ways. During lytic infection, the viral proteins block cell proliferation just before the cellular DNA replicates. We used a novel screening method to identify proteins from three different herpesviruses that contribute to this block. Several of the proteins we identified had previously unknown functions or were structural components of the virion. Subsets of these proteins from Epstein-Barr virus were studied for their effects on the cell cycle regulatory proteins p53 and p21, thereby identifying two proteins that induce p53 and one that induces p21 (BGLF2). We identified interactions of BGLF2 with two human proteins, both of which regulate p21, suggesting that BGLF2 induces p21 by interfering with the functions of these two host proteins. Our study indicates that multiple herpesvirus proteins contribute to the cell proliferation block, including components of the incoming virions.

  4. O6-methylguanine-DNA methyltransferase activity in human buccal mucosal tissue and cell cultures. Complex mixtures related to habitual use of tobacco and betel quid inhibit the activity in vitro.

    PubMed

    Liu, Y; Egyhazi, S; Hansson, J; Bhide, S V; Kulkarni, P S; Grafström, R C

    1997-10-01

    Extracts prepared from tissue specimens of normal, non-tumourous human buccal mucosa, and cultured buccal epithelial cells and fibroblasts, exhibited O6-methylguanine-DNA methyltransferase (MGMT) activity by catalysing the repair of the premutagenic O6-methylguanine lesion in isolated DNA with rates of 0.2 to 0.3 pmol/mg protein. An SV40 T antigen-immortalized buccal epithelial cell line termed SVpgC2a and a buccal squamous carcinoma line termed SqCC/Y1, both of which lack normal tumour suppressor gene p53 function, exhibited about 50 and 10% of the MGMT activity of normal cells, respectively. The normal, experimentally transformed and tumourous buccal cell types showed MGMT mRNA levels which correlated with their respective levels of MGMT activity. Exposure of buccal cell cultures to various organic or water-based extracts of products related to the use of tobacco and betel quid, decreased both cell survival (measured by reduction of tetrazolium dye) and MGMT activity (measured subsequently to the exposures in cellular extracts). Organic extracts of bidi smoke condensate and betel leaf showed higher potency than those of tobacco and snuff. An aqueous snuff extract also decreased both parameters, whereas an aqueous areca nut extract was without effect. The well-established sulph-hydryl-reactive agent Hg2+, a corrosion product of dental amalgam, served as a positive control and decreased MGMT activity following treatment of cells within a range of 1-10 microM. Taken together, significant MGMT activities were demonstrated in buccal tissue specimens and in the major buccal mucosal cell types in vitro. Lower than normal MGMT activity in two transformed buccal epithelial cell lines correlated with decreased MGMT mRNA and lack of functional p53. Finally, in vitro experiments suggested the potential inhibition of buccal mucosal MGMT activity by complex mixtures present in the saliva of tobacco and betel nut chewers.

  5. Atmospheric Oxygen Inhibits Growth and Differentiation of Marrow-Derived Mouse Mesenchymal Stem Cells via a p53 Dependent Mechanism: Implications for Long-Term Culture Expansion

    PubMed Central

    Boregowda, Siddaraju; Krishnappa, Veena; Chambers, Jeremy; LoGrasso, Phillip V.; Lai, Wen-Tzu; Ortiz, Luis A.; Phinney, Donald G.

    2013-01-01

    Large scale expansion of human mesenchymal stem cells (MSCs) is routinely performed for clinical therapy. In contrast, developing protocols for large scale expansion of primary mouse MSCs has been more difficult due to unique aspects of rodent biology. Currently, established methods to isolate mouse MSCs select for rapidly dividing subpopulations that emerge from bone marrow cultures following long-term (months) expansion in atmospheric oxygen. Herein, we demonstrate that exposure to atmospheric oxygen rapidly induced p53, TOP2A and BAX expression and mitochondrial ROS generation in primary mouse MSCs resulting in oxidative stress, reduced cell viability and inhibition of cell proliferation. Alternatively, procurement and culture in 5% oxygen supported more prolific expansion of the CD45−ve/CD44+ve cell fraction in marrow, produced increased MSC yields following immuno-depletion, and supported sustained MSC growth resulting in a 2300-fold increase in cumulative cell yield by 4th passage. MSCs cultured in 5% oxygen also exhibited enhanced tri-lineage differentiation. The oxygen-induced stress response was dependent upon p53 since siRNA mediated knockdown of p53 in wild type cells or exposure of p53−/− MSCs to atmospheric oxygen failed to induce ROS generation, reduce viability, or arrest cell growth. These data indicate that long-term culture expansion of mouse MSCs in atmospheric oxygen selects for clones with absent or impaired p53 function, which allows cells to escape oxygen-induced growth inhibition. In contrast, expansion in 5% oxygen generates large numbers of primary mouse MSCs that retain sensitivity to atmospheric oxygen, and therefore a functional p53 protein, even after long-term expansion in vitro. PMID:22367737

  6. p53 is a major component of the transcriptional and apoptotic program regulated by PI 3-kinase/Akt/GSK3 signaling.

    PubMed

    Nayak, G; Cooper, G M

    2012-10-11

    The phosphatidylinositol (PI) 3-kinase/Akt signaling pathway has a prominent role in cell survival and proliferation, in part, by regulating gene expression at the transcriptional level. Previous work using global expression profiling identified FOXOs and the E-box-binding transcription factors MITF and USF1 as key targets of PI 3-kinase signaling that lead to the induction of proapoptotic and cell cycle arrest genes in response to inhibition of PI 3-kinase. In this study, we investigated the role of p53 downstream of PI 3-kinase signaling by analyzing the effects of inhibition of PI 3-kinase in Rat-1 cells, which have wild-type p53, compared with Rat-1 cells expressing a dominant-negative p53 mutant. Expression of dominant-negative p53 conferred partial resistance to apoptosis induced by inhibition of PI 3-kinase. Global gene expression profiling combined with computational and experimental analysis of transcription factor binding sites demonstrated that p53, along with FOXO, MITF and USF1, contributed to gene induction in response to PI 3-kinase inhibition. Activation of p53 was mediated by phosphorylation of the histone acetyltransferase Tip60 by glycogen synthase kinase (GSK) 3, leading to activation of p53 by acetylation. Many of the genes targeted by p53 were also targeted by FOXO and E-box-binding transcription factors, indicating that p53 functions coordinately with these factors to regulate gene expression downstream of PI 3-kinase/Akt/GSK3 signaling.

  7. A Designed Peptide Targets Two Types of Modifications of p53 with Anti-cancer Activity.

    PubMed

    Liang, Lunxi; Wang, Huanbin; Shi, Hubing; Li, Zhaoli; Yao, Han; Bu, Zhigao; Song, Ningning; Li, Chushu; Xiang, Dabin; Zhang, Yao; Wang, Jilin; Hu, Ye; Xu, Qi; Ma, Yanlei; Cheng, Zhongyi; Wang, Yingchao; Zhao, Shuliang; Qian, Jin; Chen, Yingxuan; Fang, Jing-Yuan; Xu, Jie

    2018-06-21

    Many cancer-related proteins are controlled by composite post-translational modifications (PTMs), but prevalent strategies only target one type of modification. Here we describe a designed peptide that controls two types of modifications of the p53 tumor suppressor, based on the discovery of a protein complex that suppresses p53 (suppresome). We found that Morn3, a cancer-testis antigen, recruits different PTM enzymes, such as sirtuin deacetylase and ubiquitin ligase, to confer composite modifications on p53. The molecular functions of Morn3 were validated through in vivo assays and chemico-biological intervention. A rationally designed Morn3-targeting peptide (Morncide) successfully activated p53 and suppressed tumor growth. These findings shed light on the regulation of protein PTMs and present a strategy for targeting two modifications with one molecule. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. Frequent mutations in the p53 tumor suppressor gene in human leukemia T-cell lines.

    PubMed Central

    Cheng, J; Haas, M

    1990-01-01

    Human T-cell leukemia and T-cell acute lymphoblastic leukemia cell lines were studied for alterations in the p53 tumor suppressor gene. Southern blot analysis of 10 leukemic T-cell lines revealed no gross genomic deletions or rearrangements. Reverse transcription-polymerase chain reaction analysis of p53 mRNA indicated that all 10 lines produced p53 mRNA of normal size. By direct sequencing of polymerase chain reaction-amplified cDNA, we detected 11 missense and nonsense point mutations in 5 of the 10 leukemic T-cell lines studied. The mutations are primarily located in the evolutionarily highly conserved regions of the p53 gene. One of the five cell lines in which a mutation was detected possesses a homozygous point mutation in both p53 alleles, while the other four cell lines harbor from two to four different point mutations. An allelic study of two of the lines (CEM, A3/Kawa) shows that the two missense mutations found in each line are located on separate alleles, thus both alleles of the p53 gene may have been functionally inactivated by two different point mutations. Since cultured leukemic T-cell lines represent a late, fully tumorigenic stage of leukemic T cells, mutation of both (or more) alleles of the p53 gene may reflect the selection of cells possessing an increasingly tumorigenic phenotype, whether the selection took place in vivo or in vitro. Previously, we have shown that the HSB-2 T-cell acute lymphoblastic leukemia cell line had lost both alleles of the retinoblastoma tumor suppressor gene. Taken together, our data show that at least 6 of 10 leukemic T-cell lines examined may have lost the normal function of a known tumor suppressor gene, suggesting that this class of genes serves a critical role in the generation of fully tumorigenic leukemic T cells. Images PMID:2144611

  9. A Model System to Investigate the Effect of BRCA1 and/or p53 Inactivation in the Ovarian Stroma on Growth and Transformation Potential of the Ovarian Epithelium

    DTIC Science & Technology

    2009-10-01

    Effect of BRCA1 and/or p53 Inactivation in the Ovarian Stroma on Growth and Transformation Potential of the Ovarian Epithelium PRINCIPAL...AND SUBTITLE 5a. CONTRACT NUMBER A Model System To Investigate the Effect of BRCA1 and/or p53 Inactivation in the Ovarian Stroma on Growth and... effects of loss of function of BRCA1 or BRCA1 and Trp53 in the stroma on the growth and neoplastic transformation of epithelial cells using 2D and 3D in

  10. Does a p53 "Wild-type" Immunophenotype Exclude a Diagnosis of Endometrial Serous Carcinoma?

    PubMed

    Fadare, Oluwole; Roma, Andres A; Parkash, Vinita; Zheng, Wenxin; Walavalkar, Vighnesh

    2018-01-01

    An aberrant p53 immunophenotype may be identified in several histotypes of endometrial carcinoma, and is accordingly recognized to lack diagnostic specificity in and of itself. However, based on the high frequency with which p53 aberrations have historically been identified in endometrial serous carcinoma, a mutation-type immunophenotype is considered to be highly sensitive for the histotype. Using an illustrative case study and a review of the literature, we explore a relatively routine diagnostic question: whether the negative predictive value of a wild-type p53 immunophenotype for serous carcinoma is absolute, that is, whether a p53-wild type immunophenotype is absolutely incompatible with a diagnosis of serous carcinoma. The case is an advanced stage endometrial carcinoma that was reproducibly classified by pathologists from 3 institutions as serous carcinoma based on its morphologic features. By immunohistochemistry, the tumor was p53-wild type (DO-7 clone), diffusely positive for p16 (block positivity), and showed retained expression of PTEN, MSH2, MSH6, MLH1, and PMS2. Next generation sequencing showed that there indeed was an underlying mutation in TP53 (D393fs*78, R213*). The tumor was microsatellite stable, had a low mutational burden (4 mutations per MB), and displayed no mutations in the exonuclease domain of DNA polymerase epsilon (POLE) gene. Other genomic alterations included RB1 mutation (R46fs*19), amplifications in MYST3 and CRKL, and ARID1A deletion (splice site 5125-94_5138del108). A review of the recent literature identified 5 studies in which a total of 259 cases of serous carcinoma were whole-exome sequenced. The average TP53 mutational rate in endometrial serous carcinoma was only 75% (range, 60 to 88). A total of 12 (33%) of 36 immunohistochemical studies reported a p53-aberrant rate of <80% in endometrial serous carcinoma. We discuss in detail several potential explanations that may underlie the scenario of serous carcinoma-like morphology combined with p53-wild-type immunophenotype, including analytic limitations, a nonserous histotype displaying morphologic mimicry of serous carcinoma, and true biological phenomena (including the possibility of a TP53-independent pathway of endometrial serous carcinogenesis). Ultimately, our central thematic question is provisionally answered in the negative. At present, the available data would not support a categorical conclusion that a p53 alteration is a necessary and obligate component in the genesis and/or diagnosis of endometrial serous carcinoma. On the basis of their collective experience, the authors proffer some recommendations on the use of p53 immunohistochemistry in the histotyping of endometrial carcinomas.

  11. Memantine for the prevention of cognitive dysfunction in patients receiving whole-brain radiotherapy: a randomized, double-blind, placebo-controlled trial

    PubMed Central

    Brown, Paul D.; Pugh, Stephanie; Laack, Nadia N.; Wefel, Jeffrey S.; Khuntia, Deepak; Meyers, Christina; Choucair, Ali; Fox, Sherry; Suh, John H.; Roberge, David; Kavadi, Vivek; Bentzen, Soren M.; Mehta, Minesh P.; Watkins-Bruner, Deborah

    2013-01-01

    Background To determine the protective effects of memantine on cognitive function in patients receiving whole-brain radiotherapy (WBRT). Methods Adult patients with brain metastases received WBRT and were randomized to receive placebo or memantine (20 mg/d), within 3 days of initiating radiotherapy for 24 weeks. Serial standardized tests of cognitive function were performed. Results Of 554 patients who were accrued, 508 were eligible. Grade 3 or 4 toxicities and study compliance were similar in the 2 arms. There was less decline in delayed recall in the memantine arm at 24 weeks (P = .059), but the difference was not statistically significant, possibly because there were only 149 analyzable patients at 24 weeks, resulting in only 35% statistical power. The memantine arm had significantly longer time to cognitive decline (hazard ratio 0.78, 95% confidence interval 0.62–0.99, P = .01); the probability of cognitive function failure at 24 weeks was 53.8% in the memantine arm and 64.9% in the placebo arm. Superior results were seen in the memantine arm for executive function at 8 (P = .008) and 16 weeks (P = .0041) and for processing speed (P = .0137) and delayed recognition (P = .0149) at 24 weeks. Conclusions Memantine was well tolerated and had a toxicity profile very similar to placebo. Although there was less decline in the primary endpoint of delayed recall at 24 weeks, this lacked statistical significance possibly due to significant patient loss. Overall, patients treated with memantine had better cognitive function over time; specifically, memantine delayed time to cognitive decline and reduced the rate of decline in memory, executive function, and processing speed in patients receiving WBRT. RTOG 0614, ClinicalTrials.gov number CT00566852. PMID:23956241

  12. Memantine for the prevention of cognitive dysfunction in patients receiving whole-brain radiotherapy: a randomized, double-blind, placebo-controlled trial.

    PubMed

    Brown, Paul D; Pugh, Stephanie; Laack, Nadia N; Wefel, Jeffrey S; Khuntia, Deepak; Meyers, Christina; Choucair, Ali; Fox, Sherry; Suh, John H; Roberge, David; Kavadi, Vivek; Bentzen, Soren M; Mehta, Minesh P; Watkins-Bruner, Deborah

    2013-10-01

    To determine the protective effects of memantine on cognitive function in patients receiving whole-brain radiotherapy (WBRT). Adult patients with brain metastases received WBRT and were randomized to receive placebo or memantine (20 mg/d), within 3 days of initiating radiotherapy for 24 weeks. Serial standardized tests of cognitive function were performed. Of 554 patients who were accrued, 508 were eligible. Grade 3 or 4 toxicities and study compliance were similar in the 2 arms. There was less decline in delayed recall in the memantine arm at 24 weeks (P = .059), but the difference was not statistically significant, possibly because there were only 149 analyzable patients at 24 weeks, resulting in only 35% statistical power. The memantine arm had significantly longer time to cognitive decline (hazard ratio 0.78, 95% confidence interval 0.62-0.99, P = .01); the probability of cognitive function failure at 24 weeks was 53.8% in the memantine arm and 64.9% in the placebo arm. Superior results were seen in the memantine arm for executive function at 8 (P = .008) and 16 weeks (P = .0041) and for processing speed (P = .0137) and delayed recognition (P = .0149) at 24 weeks. Memantine was well tolerated and had a toxicity profile very similar to placebo. Although there was less decline in the primary endpoint of delayed recall at 24 weeks, this lacked statistical significance possibly due to significant patient loss. Overall, patients treated with memantine had better cognitive function over time; specifically, memantine delayed time to cognitive decline and reduced the rate of decline in memory, executive function, and processing speed in patients receiving WBRT. RTOG 0614, ClinicalTrials.gov number CT00566852.

  13. Interleukin-6 increases matrix metalloproteinase-14 (MMP-14) levels via down-regulation of p53 to drive cancer progression

    PubMed Central

    Cathcart, Jillian M.; Banach, Anna; Liu, Alice; Chen, Jun; Goligorsky, Michael; Cao, Jian

    2016-01-01

    Matrix metalloproteinases (MMPs) play critical roles in cancer invasion and metastasis by digesting basement membrane and extracellular matrix (ECM). Much attention has focused on the enzymatic activities of MMPs; however, the regulatory mechanism of MMP expression remains elusive. By employing bioinformatics analysis, we identified a potential p53 response element within the MMP-14 promoter. Experimentally, we found that p53 can repress MMP-14 promoter activity, whereas deletion of this p53 response element abrogated this effect. Furthermore, we found that p53 expression decreases MMP-14 mRNA and protein levels and attenuates MMP-14-mediated cellular functions. Additional promoter analysis and chromatin immunoprecipitation studies identified a mechanism of regulation of MMP-14 expression by which p53 and transcription factor Sp1 competitively bind to the promoter. As the correlation between inflammation and cancer aggressiveness is well described, we next sought to evaluate if inflammatory cytokines could differentially affect p53 and MMP-14 levels. We demonstrate that interleukin-6 (IL-6) down-regulates p53 protein levels and thus results in a concomitant increase in MMP-14 expression, leading to enhanced cancer cell invasion and metastasis. Our data collectively indicate a novel mechanism of regulation of MMP-14 by a cascade of IL-6 and p53, demonstrating that the tumor microenvironment directly stimulates molecular changes in cancer cells to drive an invasive phenotype. PMID:27531896

  14. Treatment of acute lung injury by targeting MG53-mediated cell membrane repair

    PubMed Central

    Lieber, Gissela; Nishi, Miyuki; Yan, Rosalie; Wang, Zhen; Yao, Yonggang; Li, Yu; Whitson, Bryan A.; Duann, Pu; Li, Haichang; Zhou, Xinyu; Zhu, Hua; Takeshima, Hiroshi; Hunter, John C.; McLeod, Robbie L.; Weisleder, Noah; Zeng, Chunyu; Ma, Jianjie

    2014-01-01

    Injury to lung epithelial cells has a role in multiple lung diseases. We previously identified mitsugumin 53 (MG53) as a component of the cell membrane repair machinery in striated muscle cells. Here we show that MG53 also has a physiological role in the lung and may be used as a treatment in animal models of acute lung injury. Mice lacking MG53 show increased susceptibility to ischemia-reperfusion and over-ventilation induced injury to the lung when compared with wild type mice. Extracellular application of recombinant human MG53 (rhMG53) protein protects cultured lung epithelial cells against anoxia/reoxygenation-induced injuries. Intravenous delivery or inhalation of rhMG53 reduces symptoms in rodent models of acute lung injury and emphysema. Repetitive administration of rhMG53 improves pulmonary structure associated with chronic lung injury in mice. Our data indicate a physiological function for MG53 in the lung and suggest that targeting membrane repair may be an effective means for treatment or prevention of lung diseases. PMID:25034454

  15. Expression of p27 and its ubiquitin ligase subunit Skp2 in upper urinary tract transitional cell carcinoma.

    PubMed

    Langner, Cord; von Wasielewski, Reinhard; Ratschek, Manfred; Rehak, Peter; Zigeuner, Richard

    2004-09-01

    To analyze p27 and S-phase kinase-associated protein 2 (Skp2) expression in upper urinary tract transitional cell carcinoma (TCC) with respect to biologic significance. p27 (p27/kip1) is involved in cell cycle control, and loss of p27 protein expression may result in tumor development and/or progression. The association of p27 with the ubiquitin ligase subunit Skp2 targets p27 for degradation. A total of 53 upper urinary tract TCC specimens were investigated immunohistochemically using a tissue microarray technique. The immunoreactivity of p27 and Skp2 was analyzed with respect to associations with pT stage, grade, and prognosis. Non-neoplastic renal tissue showed p27 immunoreactivity in tubule epithelium and pelvic urothelium, but lacked immunoreactivity for Skp2. In the TCC specimens, p27 immunoreactivity was noted in 47 (89%) of 53 cases. High p27 expression (50% or greater of tumor cell nuclei) tended to decrease with rising tumor stage (14 [45%] of 31 with pT1-pT2 versus 4 [18%] of 22 with pT3; P = 0.076), but was independent of tumor grade (11 [39%] of 28 grade 2 versus 7 [28%] of 25 grade 3-4; P = 0.56). Skp2 immunoreactivity was noted in 32 (60%) of 53 tumors. Skp2 expression increased with rising tumor stage (9 [41%] of 22 pT1 versus 23 [74%] of 31 pT2-pT3; P = 0.023) and tumor grade (12 [43%] of 28 grade 2 versus 20 [80%] of 25 grade 3; P = 0.043) and was associated with angioinvasion (P = 0.017). In multivariate analysis, tumor stage proved to be the only independent prognostic factor regarding disease-free survival. p27 and Skp2 are additional biomarkers in urogenital pathologic findings. The statistically significant association of Skp2 expression with high-grade TCC, as well as the lack of expression in non-neoplastic tissue, suggests that Skp2 could be a promising target for future cancer therapy strategies.

  16. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Das, Amitabh, E-mail: amitabhdas.kn@gmail.com; Chai, Jin Choul, E-mail: jincchai@gmail.com; Jung, Kyoung Hwa, E-mail: khjung2@gmail.com

    JMJD2A is a lysine trimethyl-specific histone demethylase that is highly expressed in a variety of tumours. The role of JMJD2A in tumour progression remains unclear. The objectives of this study were to identify JMJD2A-regulated genes and understand the function of JMJD2A in p53-null neuroectodermal stem cells (p53{sup −/−} NE-4Cs). We determined the effect of LPS as a model of inflammation in p53{sup −/−} NE-4Cs and investigated whether the epigenetic modifier JMJD2A alter the expression of tumourigenic inflammatory genes. Global gene expression was measured in JMJD2A knockdown (kd) p53{sup −/−} NE-4Cs and in LPS-stimulated JMJD2A-kd p53{sup −/−} NE-4C cells. JMJD2A attenuationmore » significantly down-regulated genes were Cdca2, Ccnd2, Ccnd1, Crebbp, IL6rα, and Stat3 related with cell cycle, proliferation, and inflammatory-disease responses. Importantly, some tumour-suppressor genes including Dapk3, Timp2 and TFPI were significantly up-regulated but were not affected by silencing of the JMJD2B. Furthermore, we confirmed the attenuation of JMJD2A also down-regulated Cdca2, Ccnd2, Crebbp, and Rest in primary NSCs isolated from the forebrains of E15 embryos of C57/BL6J mice with effective p53 inhibitor pifithrin-α (PFT-α). Transcription factor (TF) motif analysis revealed known binding patterns for CDC5, MYC, and CREB, as well as three novel motifs in JMJD2A-regulated genes. IPA established molecular networks. The molecular network signatures and functional gene-expression profiling data from this study warrants further investigation as an effective therapeutic target, and studies to elucidate the molecular mechanism of JMJD2A-kd-dependent effects in neuroectodermal stem cells should be performed. - Highlights: • Significant up-regulation of epigenetic modifier JMJD2A mRNA upon LPS treatment. • Inhibition of JMJD2A attenuated key inflammatory and tumourigenic genes. • Establishing IPA based functional genomics in JMJD2A-attenuated p53{sup −/−} NE4C cells. • Finding JMJD2A-based molecular targets and crucial pathways in p53{sup −/−} NE4C cells.« less

  17. THE EFFECT OF PENTACHLOROPHENOL ON DNA ADDUCT FORMATION IN C57B1/6 TRP53 +/+ AND C57B16 TRP53 -/- MICE EXPOSED TO BENZO[A]PYRENE MAY BE ASSOCIATED WITH P53 FUNCTION.

    EPA Science Inventory

    Abstract

    Previous studies have shown that pentachlorophenol (PCP) has both potentiative and antagonistic effects on the genotoxicity of benzo[a]pyrene (B[a]P). It has been suggested that these effects are due to inhibition and/or induction of enzymes involved in the biotr...

  18. Novel application of complementary imaging techniques to examine in vivo glucose metabolism in the kidney

    PubMed Central

    Hato, Takashi; Friedman, Allon N.; Mang, Henry; Plotkin, Zoya; Dube, Shataakshi; Hutchins, Gary D.; Territo, Paul R.; McCarthy, Brian P.; Riley, Amanda A.; Pichumani, Kumar; Malloy, Craig R.; Harris, Robert A.; Dagher, Pierre C.

    2016-01-01

    The metabolic status of the kidney is a determinant of injury susceptibility and a measure of progression for many disease processes; however, noninvasive modalities to assess kidney metabolism are lacking. In this study, we employed positron emission tomography (PET) and intravital multiphoton microscopy (MPM) to assess cortical and proximal tubule glucose tracer uptake, respectively, following experimental perturbations of kidney metabolism. Applying dynamic image acquisition PET with 2-18fluoro-2-deoxyglucose (18F-FDG) and tracer kinetic modeling, we found that an intracellular compartment in the cortex of the kidney could be distinguished from the blood and urine compartments in animals. Given emerging literature that the tumor suppressor protein p53 is an important regulator of cellular metabolism, we demonstrated that PET imaging was able to discern a threefold increase in cortical 18F-FDG uptake following the pharmacological inhibition of p53 in animals. Intravital MPM with the fluorescent glucose analog 2-[N-(7-nitrobenz-2-oxa-1,3-diazol-4-yl)amino]-2-deoxyglucose (2-NBDG) provided increased resolution and corroborated these findings at the level of the proximal tubule. Extending our observation of p53 inhibition on proximal tubule glucose tracer uptake, we demonstrated by intravital MPM that pharmacological inhibition of p53 diminishes mitochondrial potential difference. We provide additional evidence that inhibition of p53 alters key metabolic enzymes regulating glycolysis and increases intermediates of glycolysis. In summary, we provide evidence that PET is a valuable tool for examining kidney metabolism in preclinical and clinical studies, intravital MPM is a powerful adjunct to PET in preclinical studies of metabolism, and p53 inhibition alters basal kidney metabolism. PMID:26764206

  19. MDM2 promoter polymorphism and p53 codon 72 polymorphism in chronic myeloid leukemia: the association between MDM2 promoter genotype and disease susceptibility, age of onset, and blast-free survival in chronic phase patients receiving imatinib.

    PubMed

    Liu, Yi-Chang; Hsiao, Hui-Hua; Yang, Wen-Chi; Liu, Ta-Chih; Chang, Chao-Sung; Yang, Ming-Yu; Lin, Pai-Mei; Hsu, Jui-Feng; Lee, Ching-Ping; Lin, Sheng-Fung

    2014-12-01

    The genetic or functional inactivation of the p53 pathway plays an important role with regards to disease progression from the chronic phase (CP) to blast phase (BP) and imatinib treatment response in chronic myeloid leukemia (CML). Two functional single nucleotide polymorphisms (SNPs), p53 R72P and MDM2 SNP309, are associated with alternation of p53 activity, however the association regarding CML susceptibility and BP transformation under imatinib treatment is unclear. The MDM2 SNP309 genotype was determined by polymerase chain reaction-restriction fragment length polymorphism and confirmed by direct sequencing from 116 CML patients, including 104 in the CP at diagnosis, and 162 healthy Taiwanese controls. The p53 R72P polymorphism was examined in all CML patients. The SNP309 G/G genotype was associated with an increased risk of CML susceptibility (OR: 1.82, 95% CI: 1.03-3.22, P = 0.037), and an earlier age of disease onset (log-rank P = 0.005) compared with the T/T + T/G genotypes. Higher MDM2 mRNA expression was found in G/G genotype compared with T/T (P = 0.034) and T/T + T/G (P = 0.056) genotypes. No associations were found between the p53 R72P genotypes and clinical parameters and survival outcomes. Among 62 CP patients receiving imatinib as first-line therapy, the G/G genotype was associated with a shorter blast-free survival (log-rank P = 0.048) and more clonal evolution compared with the T/T + T/G genotypes. In patients with advanced diseases at diagnosis, the G/G genotype was associated with a poor overall survival (log-rank P = 0.006). Closely monitoring CML patients harboring the G/G genotype and further large-scale studies are warranted. © 2013 Wiley Periodicals, Inc.

  20. Heterologous expression of pyrroloquinoline quinone (pqq) gene cluster confers mineral phosphate solubilization ability to Herbaspirillum seropedicae Z67.

    PubMed

    Wagh, Jitendra; Shah, Sonal; Bhandari, Praveena; Archana, G; Kumar, G Naresh

    2014-06-01

    Gluconic acid secretion mediated by the direct oxidation of glucose by pyrroloquinoline quinone (PQQ)-dependent glucose dehydrogenase (GDH) is responsible for mineral phosphate solubilization in Gram-negative bacteria. Herbaspirillum seropedicae Z67 (ATCC 35892) genome encodes GDH apoprotein but lacks genes for the biosynthesis of its cofactor PQQ. In this study, pqqE of Erwinia herbicola (in plasmid pJNK1) and pqq gene clusters of Pseudomonas fluorescens B16 (pOK53) and Acinetobacter calcoaceticus (pSS2) were over-expressed in H. seropedicae Z67. Transformants Hs (pSS2) and Hs (pOK53) secreted micromolar levels of PQQ and attained high GDH activity leading to secretion of 33.46 mM gluconic acid when grown on 50 mM glucose while Hs (pJNK1) was ineffective. Hs (pJNK1) failed to solubilize rock phosphate, while Hs (pSS2) and Hs (pOK53) liberated 125.47 μM and 168.07 μM P, respectively, in minimal medium containing 50 mM glucose under aerobic conditions. Moreover, under N-free minimal medium, Hs (pSS2) and Hs (pOK53) not only released significant P but also showed enhanced growth, biofilm formation, and exopolysaccharide (EPS) secretion. However, indole acetic acid (IAA) production was suppressed. Thus, the addition of the pqq gene cluster, but not pqqE alone, is sufficient for engineering phosphate solubilization in H. seropedicae Z67 without compromising growth under nitrogen-fixing conditions.

Top