Science.gov

Sample records for lacking wild-type p53

  1. Wild-Type p53 Binds to the TATA-Binding Protein and Represses Transcription

    NASA Astrophysics Data System (ADS)

    Seto, Edward; Usheva, Anny; Zambetti, Gerard P.; Momand, Jamil; Horikoshi, Nobuo; Weinmann, Roberto; Levine, Arnold J.; Shenk, Thomas

    1992-12-01

    p53 activates transcription of genes with a p53 response element, and it can repress genes lacking the element. Here we demonstrate that wild-type but not mutant p53 inhibits transcription in a HeLa nuclear extract from minimal promoters. Wild-type but not mutant p53 binds to human TATA-binding protein (TBP). p53 does not bind to yeast TBP, and it cannot inhibit transcription in a HeLa extract where yeast TBP substitutes for human TBP. These results suggest a model in which p53 binds to TBP and interferes with transcriptional initiation.

  2. Introduction of mutant p53 into a wild-type p53-expressing glioma cell line confers sensitivity to Ad-p53-induced apoptosis.

    PubMed Central

    Cerrato, J. A.; Yung, W. K.; Liu, T. J.

    2001-01-01

    Transient expression of the tumor suppressor gene p53 via adenoviral-mediated gene transfer induces apoptosis in glioma cells expressing mutant p53, while causing cell cycle arrest in cells with wild-type p53. To determine whether a change in p53 status of a wild-type p53-expressing cell line such as U-87 MG would alter its apoptotic resistant phenotype in response to Ad-p53 infection, we generated cell lines U-87-175.4 and U-87-175.13 via retroviral-mediated gene transfer of the p53 (175H) mutant into the U-87 MG parental line. Control cell lines U-87-Lux.6 and U-87-Lux.8 were also generated and express the reporter gene luciferase. Both U-87-175.4 and U-87-175.13, but not control cell lines, exhibited morphology characteristic of apoptosis after Ad-p53 infection. Furthermore, expression of other p53 mutants (248W, 273H) in U-87 MG also sensitized cells to Ad-p53-induced apoptosis. Apoptosis was confirmed by TUNEL and cell cycle analysis. Several p53 response genes were examined in cells infected with Ad-p53, and among these, BCL2, p21WAF1/CIP1, CPP32/caspase 3, and PARP showed differences in expression between U87-175 and U87-Lux cell lines. Taken together, our data demonstrate that the introduction of p53 mutants in U-87 MG promotes an apoptotic response in association with adenoviral-mediated wild-type p53 gene transfer. These results underscore the importance of glioma p53 genotype for predicting tumor response to p53-based gene therapy. PMID:11296482

  3. Endogenous p53 protein generated from wild-type alternatively spliced p53 RNA in mouse epidermal cells.

    PubMed Central

    Kulesz-Martin, M F; Lisafeld, B; Huang, H; Kisiel, N D; Lee, L

    1994-01-01

    We previously demonstrated that a wild-type alternatively spliced p53 (p53as) RNA exists in mouse cultured cells and normal mouse tissues at approximately 25 to 33% of the level of the major p53 RNA form. The alternative RNA transcript is 96 nucleotides longer than the major transcript as a result of alternative splicing of intron 10 sequences. The protein expected to be generated from the p53as transcript is 9 amino acids shorter than the major p53 protein and has 17 different amino acids at the carboxyl terminus. We report here that p53as protein exists in nontransformed and malignant epidermal cells and is localized to the nucleus. In addition, p53as protein is preferentially expressed during the G2 phase of the cell cycle and in cells with greater than G2 DNA content compared with the major p53 protein, which is preferentially expressed in G1. The p53as immunoreactivity is elevated and shifted to the G1 phase of the cell cycle following actinomycin D treatment of nontransformed cells but not malignant cells. In view of the dimerization and tetramerization of p53 protein which may be necessary for its DNA binding and transcriptional activation activities, the presence of p53as protein in cells has important implications for understanding the physiological function(s) of the p53 gene. Images PMID:8114705

  4. Wild-type human p53 transactivates the human proliferating cell nuclear antigen promoter

    SciTech Connect

    Shivakumar, C.V.; Brown, D.R.; Deb, S.; Deb, S.P.

    1995-12-01

    The p53 tumor suppressor protein negatively regulates cell growth and somatic mutations in the p53 gene lead to uncontrolled cell growth and oncogenesis. This report describes research which demonstrates, using a number of different cell lines, that at low levels, wild-type p53 transactivates the human proliferating cell nuclear antigen (PCNA) promoter. When expressed at similar levels, tumor-derived p53 mutants did not transactivate the PCNA promoter. It also reports the identification of a wild-type human p53-binding site on the human PCNA promote. 84 refs., 5 figs, 3 tabs.

  5. Resistance and gain-of-resistance phenotypes in cancers harboring wild-type p53

    PubMed Central

    Martinez-Rivera, Michelle; Siddik, Zahid H.

    2012-01-01

    Chemotherapy is the bedrock for the clinical management of cancer, and the tumor suppressor p53 has a central role in this therapeutic modality. This protein facilitates favorable antitumor drug response through a variety of key cellular functions, including cell cycle arrest, senescence, and apoptosis. These functions essentially cease once p53 becomes mutated, as occurs in ~50% of cancers, and some p53 mutants even exhibit gain-of-function effects, which lead to greater drug resistance. However, it is becoming increasingly evident that resistance is also seen in cancers harboring wild-type p53. In this review, we discuss how wild-type p53 is inactivated to render cells resistant to antitumor drugs. This may occur through various mechanisms, including an increase in proteasomal degradation, defects in post-translational modification, and downstream defects in p53 target genes. We also consider evidence that the resistance seen in wild-type p53 cancers can be substantially greater than that seen in mutant p53 cancers, and this poses a far greater challenge for efforts to design strategies that increase drug response in resistant cancers already primed with wild-type p53. Because the mechanisms contributing to this wild-type p53 “gain-of-resistance” phenotype are largely unknown, a concerted research effort is needed to identify the underlying basis for the occurrence of this phenotype and, in parallel, to explore the possibility that the phenotype may be a product of wild-type p53 gain-of-function effects. Such studies are essential to lay the foundation for a rational therapeutic approach in the treatment of resistant wild-type p53 cancers. PMID:22227014

  6. Transcriptional repression in normal human keratinocytes by wild-type and mutant p53.

    PubMed

    Alvarez-Salas, L M; Velazquez, A; Lopez-Bayghen, E; Woodworth, C D; Garrido, E; Gariglio, P; DiPaolo, J A

    1995-05-01

    Wild-type p53 is a nuclear phosphoprotein that inhibits cell proliferation and represses transcriptionally most TATA box-containing promoters in transformed or tumor-derived cell lines. This study demonstrates that p53 alters transcription of the long control region (LCR) of human papillomavirus type 18 (HPV-18). Wild-type and mutant p53 143Val to Ala repressed the HPV-18 LCR promoter in normal human keratinocytes, the natural host cell for HPV infections. Repression by wild-type p53 was also observed in C-33A cells and in an HPV-16-immortalized cell line with an inducible wild-type p53. However, when C-33A cells were cotransfected with the HPV-18 LCR and mutant 143Val to Ala, repression did not occur. Mutant p53 135Cys to Ser did not induce repression in either normal human keratinocytes or in the C-33A line; although like 143Val to Ala, it is thought to affect the DNA binding activity of the wild-type protein. The ability of mutant p53 143Val to Ala to inactivate the HPV early promoter in normal cells (by approximately 60% reduction) suggests that this mutant may be able to associate with wild-type p53 and interact with TATA box-binding proteins. Therefore, these results demonstrate that the transcriptional activities of p53 mutants may be dependent upon the cell type assayed and the form of its endogenous p53. Furthermore, normal human keratinocytes represent an alternative model for determining the activities of p53 mutants.

  7. Phosphorylation at Ser-15 and Ser-392 in mutant p53 molecules from tumors is altered compared to wild-type p53

    SciTech Connect

    Ullrich, S.J.; Sakaguchi, K.; Fiscella, M.; Appella, E. ); Lees-Miller, S.P.; Anderson, C.W. ); Mercer, W.E. )

    1993-07-01

    The product of the p53 gene suppresses cell growth and plays a critical role in suppressing development of human tumors. p53 protein binds DNA, activates transcription, and can be phosphorylated at N- and C-terminal sites. Previously, wild-type p53 was shown to be hyperphosphorylated compared to mutant p53 during p53-mediated growth arrest in vivo. Here we show that Ser-15 and Ser-9 in the N-terminal transactivation domain of wild-type human p53 are phosphorylated in vivo in cells derived from the human glioblastoma line T98G. In [IIe[sup 237

  8. Wild-type p53 controls cell motility and invasion by dual regulation of MET expression

    PubMed Central

    Hwang, Chang-Il; Matoso, Andres; Corney, David C.; Flesken-Nikitin, Andrea; Körner, Stefanie; Wang, Wei; Boccaccio, Carla; Thorgeirsson, Snorri S.; Comoglio, Paolo M.; Hermeking, Heiko; Nikitin, Alexander Yu.

    2011-01-01

    Recent observations suggest that p53 mutations are responsible not only for growth of primary tumors but also for their dissemination. However, mechanisms involved in p53-mediated control of cell motility and invasion remain poorly understood. By using the primary ovarian surface epithelium cell culture, we show that conditional inactivation of p53 or expression of its mutant forms results in overexpression of MET receptor tyrosine kinase, a crucial regulator of invasive growth. At the same time, cells acquire increased MET-dependent motility and invasion. Wild-type p53 negatively regulates MET expression by two mechanisms: (i) transactivation of MET-targeting miR-34, and (ii) inhibition of SP1 binding to MET promoter. Both mechanisms are not functional in p53 absence, but mutant p53 proteins retain partial MET promoter suppression. Accordingly, MET overexpression, cell motility, and invasion are particularly high in p53-null cells. These results identify MET as a critical effector of p53 and suggest that inhibition of MET may be an effective antimetastatic approach to treat cancers with p53 mutations. These results also show that the extent of advanced cancer traits, such as invasion, may be determined by alterations in individual components of p53/MET regulatory network. PMID:21831840

  9. Insights into wild-type and mutant p53 functions provided by genetically engineered mice.

    PubMed

    Donehower, Lawrence A

    2014-06-01

    Recent whole-exome sequencing studies of numerous human cancers have now conclusively shown that the TP53 tumor-suppressor gene is the most frequently mutated gene in human cancers. Despite extensive studies of the TP53 gene and its encoded protein (p53), our understanding of how TP53 mutations contribute to cancer initiation and progression remain incomplete. Genetically engineered mice with germline or inducible Trp53 somatic mutations have provided important insights into the mechanisms by which different types of p53 mutation influence cancer development. Trp53 germline mutations that alter specific p53 structural domains or posttranslation modification sites have benefitted our understanding of wild-type p53 functions in a whole organism context. Moreover, genetic approaches to reestablish functional wild-type p53 to p53-deficient tissues and tumors have increased our understanding of the therapeutic potential of restoring functional p53 signaling to cancers. This review outlines many of the key insights provided by the various categories of Trp53 mutant mice that have been generated by multiple genetic engineering approaches.

  10. Targeting Mdmx to treat breast cancers with wild-type p53

    PubMed Central

    Haupt, S; Buckley, D; Pang, J-MB; Panimaya, J; Paul, P J; Gamell, C; Takano, E A; Ying Lee, Y; Hiddingh, S; Rogers, T-M; Teunisse, A F A S; Herold, M J; Marine, J-C; Fox, S B; Jochemsen, A; Haupt, Y

    2015-01-01

    The function of the tumor suppressor p53 is universally compromised in cancers. It is the most frequently mutated gene in human cancers (reviewed). In cases where p53 is not mutated, alternative regulatory pathways inactivate its tumor suppressive functions. This is primarily achieved through elevation in the expression of the key inhibitors of p53: Mdm2 or Mdmx (also called Mdm4) (reviewed). In breast cancer (BrCa), the frequency of p53 mutations varies markedly between the different subtypes, with basal-like BrCas bearing a high frequency of p53 mutations, whereas luminal BrCas generally express wild-type (wt) p53. Here we show that Mdmx is unexpectedly highly expressed in normal breast epithelial cells and its expression is further elevated in most luminal BrCas, whereas p53 expression is generally low, consistent with wt p53 status. Inducible knockdown (KD) of Mdmx in luminal BrCa MCF-7 cells impedes the growth of these cells in culture, in a p53-dependent manner. Importantly, KD of Mdmx in orthotopic xenograft transplants resulted in growth inhibition associated with prolonged survival, both in a preventative model and also in a treatment model. Growth impediment in response to Mdmx KD was associated with cellular senescence. The growth inhibitory capacity of Mdmx KD was recapitulated in an additional luminal BrCa cell line MPE600, which expresses wt p53. Further, the growth inhibitory capacity of Mdmx KD was also demonstrated in the wt p53 basal-like cell line SKBR7 line. These results identify Mdmx growth dependency in wt p53 expressing BrCas, across a range of subtypes. Based on our findings, we propose that Mdmx targeting is an attractive strategy for treating BrCas harboring wt p53. PMID:26181202

  11. Potentiation of a tumor cell susceptibility to autologous CTL killing by restoration of wild-type p53 function.

    PubMed

    Thiery, Jérôme; Dorothée, Guillaume; Haddada, Hedi; Echchakir, Hamid; Richon, Catherine; Stancou, Rodica; Vergnon, Isabelle; Benard, Jean; Mami-Chouaib, Fathia; Chouaib, Salem

    2003-06-15

    Inactivation of p53 has been implicated in many types of tumors particularly in non-small cell lung carcinoma, one of the most common cancers in which p53 mutation has been frequently identified. The aim of this study was to investigate the influence of p53 status on the regulation of tumor susceptibility to specific CTL-mediated cell death. For this purpose, we used a cytotoxic T lymphocyte clone, Heu127, able to lyse the human autologous lung carcinoma cell line, IGR-Heu, in a HLA-A2-restricted manner. Direct genomic DNA sequencing revealed that IGR-Heu expresses a mutated p53 at codon 132 of the exon 5 which results in the loss of p53 capacity to induce the expression of the p53-regulated gene product p21(waf/CIP1). Initial experiments demonstrated that IGR-Heu was resistant to Fas, TNF, and TRAIL apoptotic pathways. This correlated with the lack of p55 TNFRI, Fas, DR4, and DR5 expression. The effect of wild-type (wt) p53 restoration on the sensitization of IGR-Heu to autologous CTL clone lysis was investigated following infection of the tumor cell line with a recombinant adenovirus encoding the wt p53 (Adwtp53). We demonstrate that the restoration of wt p53 expression and function resulted in a significant potentiation of target cell susceptibility to CTL-mediated lysis. The wt p53-induced optimization of tumor cell killing by specific CTL involves at least in part Fas-mediated pathway via induction of CD95 expression by tumor cells but does not appear to interfere with granzyme B cytotoxic pathway. PMID:12794118

  12. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53.

    PubMed

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P; Casanova, M Llanos; Paramio, Jesús M; Bravo, Ana; Ramirez, Angel

    2016-04-12

    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia. PMID:26959115

  13. Protective role of p53 in skin cancer: Carcinogenesis studies in mice lacking epidermal p53

    PubMed Central

    Page, Angustias; Navarro, Manuel; Suarez-Cabrera, Cristian; Alameda, Josefa P.; Casanova, M. Llanos; Paramio, Jesús M.; Bravo, Ana; Ramirez, Angel

    2016-01-01

    p53 is a protein that causes cell cycle arrest, apoptosis or senescence, being crucial in the process of tumor suppression in several cell types. Different in vitro and animal models have been designed for the study of p53 role in skin cancer. These models have revealed opposing results, as in some experimental settings it appears that p53 protects against skin cancer, but in others, the opposite conclusion emerges. We have generated cohorts of mice with efficient p53 deletion restricted to stratified epithelia and control littermates expressing wild type p53 and studied their sensitivity to both chemically-induced and spontaneous tumoral transformation, as well as the tumor types originated in each experimental group. Our results indicate that the absence of p53 in stratified epithelia leads to the appearance, in two-stage skin carcinogenesis experiments, of a higher number of tumors that grow faster and become malignant more frequently than tumors arisen in mice with wild type p53 genotype. In addition, the histological diversity of the tumor type is greater in mice with epidermal p53 loss, indicating the tumor suppressive role of p53 in different epidermal cell types. Aging mice with p53 inactivation in stratified epithelia developed spontaneous carcinomas in skin and other epithelia. Overall, these results highlight the truly protective nature of p53 functions in the development of cancer in skin and in other stratified epithelia. PMID:26959115

  14. Cytoplasmic localization of wild-type p53 in glioblastomas correlates with expression of vimentin and glial fibrillary acidic protein.

    PubMed Central

    Sembritzki, Olivier; Hagel, Christian; Lamszus, Katrin; Deppert, Wolfgang; Bohn, Wolfgang

    2002-01-01

    Cytoplasmic accumulation of wild-type p53 in tumor cells indicates that the tumor suppressor is inactive with regard to growth suppressive functions. Whether this occurs randomly during tumor development or characterizes a certain tumor cell subset is not known. Here we assayed primary glioblastomas for expression and subcellular localization of p53 and determined a correlation with expression of intermediate filament proteins characterizing glial cell development. Sixty-nine percent of the tumors were p53 positive in immunohistochemistry. A significant number of tumors (23%) accumulated wild-type p53 in the cytoplasm, which correlated with the presence of vimentin and glial fibrillary acidic protein, except for 1 case. Tumors with exclusive nuclear p53 contained none or only one of these intermediate filament proteins. In an alternative approach, tumors positive for glial fibrillary acidic protein were screened for expression of p53 and vimentin. Thirty-eight percent of these tumors showed cytoplasmic p53, and all of those also expressed vimentin. Tumors with only nuclear p53 were vimentin negative, except for 1 case. No mutation was detected in p53 exons 5 to 8 in tumors with cytoplasmic p53, suggesting that they express wild-type p53. The data indicate that a cytoplasmic accumulation of wild-type p53 in human primary glioblastomas correlates with a certain intermediate filament protein expression, suggesting that it identifies a certain subset of tumors. PMID:12084347

  15. Wild-type p53 binds to MYC promoter G-quadruplex

    PubMed Central

    Petr, Marek; Helma, Robert; Polášková, Alena; Krejčí, Aneta; Dvořáková, Zuzana; Kejnovská, Iva; Navrátilová, Lucie; Adámik, Matej; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    G-quadruplexes are four-stranded nucleic acid structures that are implicated in the regulation of transcription, translation and replication. Genome regions enriched in putative G-quadruplex motifs include telomeres and gene promoters. Tumour suppressor p53 plays a critical role in regulatory pathways leading to cell cycle arrest, DNA repair and apoptosis. In addition to transcriptional regulation mediated via sequence-specific DNA binding, p53 can selectively bind various non-B DNA structures. In the present study, wild-type p53 (wtp53) binding to G-quadruplex formed by MYC promoter nuclease hypersensitive element (NHE) III1 region was investigated. Wtp53 binding to MYC G-quadruplex is comparable to interaction with specific p53 consensus sequence (p53CON). Apart from the full-length wtp53, its isolated C-terminal region (aa 320–393) as well, is capable of high-affinity MYC G-quadruplex binding, suggesting its critical role in this type of interaction. Moreover, wtp53 binds to MYC promoter region containing putative G-quadruplex motif in two wtp53-expressing cell lines. The results suggest that wtp53 binding to G-quadruplexes can take part in transcriptional regulation of its target genes. PMID:27634752

  16. Role of p53β in the inhibition of proliferation of gastric cancer cells expressing wild-type or mutated p53.

    PubMed

    Ji, Wansheng; Ma, Jingrong; Zhang, Hongmei; Zhong, Hua; Li, Lei; Ding, Na; Jiao, Jianxin; Gao, Zhixing

    2015-07-01

    p53 is a tumor suppressor gene whose mutation is highly associated with tumorigenesis. The present study investigated the role of p53β in the inhibition of proliferation of gastric cancer cell lines expressing wild-type or mutated p53. Wild-type p53 is expressed in MKN45 cells, but deleted in KATOIII cells, whereas mutated p53 is expressed in SGC7901 cells. The mRNA expression levels of p53β and Δ133p53 were detected in MKN45, SGC-7901 and KATOIII gastric cancer cell lines using nested polymerase chain reaction (PCR). The mRNA expression levels of p53, p53β and B-cell lymphoma 2-associated X protein (Bax) were detected in the MKN45 and SGC-7901 cells following treatment with cisplatin by reverse transcription-PCR. The inhibition of cellular proliferation following treatment with cisplatin was measured by MTT assay. The results of the present study demonstrated that both p53β and Δ133p53 mRNA were expressed in the MKN45 cells, whereas only p53β mRNA was expressed in the SGC7901 cells. No expression of p53β or Δ133p53 mRNA was detected in the KATOIII cells. Following treatment with cisplatin, the number of both MKN45 and SGC-7901 cells was significantly reduced (P<0.001). In the MKN45 cells, p53β, p53 and Bax mRNA expression levels gradually increased with the dose of cisplatin, and the expression of p53β was positively correlated with the expression of p53 (tr=6.358, P<0.05) and Bax (tr=8.023, P<0.05). In the SGC-7901 cells, the expression levels of p53β, p53 and Bax mRNA did not alter with the dose of cisplatin, and the expression of p53β was positively correlated to the expression of p53 (tr=26.41, P<0.01) but not that of Bax. The present study identified the different roles of the p53β isoform in gastric cancer cells with different p53 backgrounds. Enhanced knowledge regarding the p53 status is required for the development of specific biological therapies against gastric cancer. PMID:25695150

  17. Mitochondrially targeted wild-type p53 induces apoptosis in a solid human tumor xenograft model

    PubMed Central

    Palacios, Gustavo; Crawford, Howard C.; Vaseva, Angelina; Moll, Ute M.

    2013-01-01

    Classic but also novel roles of p53 are becoming increasingly well characterized. We previously showed that ex vivo retroviral transfer of mitochondrially targeted wild type p53 (mitop53) in the Eμ-myc mouse lymphoma model efficiently induces tumor cell killing in vivo. In an effort to further explore the therapeutic potential of mitop53 for its pro-apoptotic effect in solid tumors, we generated replication-deficient recombinant human Adenovirus type 5 vectors. We show here that adenoviral delivery of mitop53 by intratumoral injection into HCT116 human colon carcinoma xenograft tumors in nude mice is surprisingly effective, resulting in tumor cell death of comparable potency to conventional p53. These apoptotic effects in vivo were confirmed by Ad5-mitop53 mediated cell death of HCT116 cells in culture. Together, these data provide encouragement to further explore the potential for novel mitop53 proteins in cancer therapy to execute the shortest known circuitry of p53 death signaling. PMID:18719383

  18. Wild-Type p53 Enhances Efficiency of Simian Virus 40 Large-T-Antigen-Induced Cellular Transformation▿

    PubMed Central

    Hermannstädter, Andrea; Ziegler, Christine; Kühl, Marion; Deppert, Wolfgang; Tolstonog, Genrich V.

    2009-01-01

    Abortive infection of BALB/c mouse embryo fibroblasts differing in p53 gene status (p53+/+ versus p53−/−) with simian virus 40 (SV40) revealed a quantitatively and qualitatively decreased transformation efficiency in p53−/− cells compared to p53+/+ cells, suggesting a supportive effect of wild-type (wt) p53 in the SV40 transformation process. SV40 transformation efficiency also was low in immortalized p53−/− BALB/c 10-1 cells but could be restored to approximately the level in immortalized p53+/+ BALB/c 3T3 cells by reconstituting wt p53, but not mutant p53 (mutp53), expression. Stable expression of large T antigen (LT) in p53+/+ 3T3 cells resulted in full transformation, while LT expression in p53−/− 10-1 cells could not promote growth in suspension or in soft agar to a significant extent. The helper effect of wt p53 is mediated by its cooperation with LT and resides in the p53 N terminus, as an N-terminally truncated p53 (ΔNp53) could not rescue the p53-null phenotype. The p53 N terminus serves as a scaffold for recruiting transcriptional regulators like p300/CBP and Mdm2 into the LT-p53 complex. Consequently, LT affected global and specific gene expression in p53+/+ cells significantly more than in p53−/− cells. Our data suggest that recruitment of transcriptional regulators into the LT-p53 complex may help to modify cellular gene expression in response to the needs of cellular transformation. PMID:19625393

  19. Adenoviral-E2F-1 radiosensitizes p53{sup wild-type} and p53{sup null} human prostate cancer cells

    SciTech Connect

    Nguyen, Khanh H.; Hachem, Paul; Khor, L.-Y.; Salem, Naji; Hunt, Kelly K.; Calkins, Peter R.; Pollack, Alan . E-mail: Alan.Pollack@fccc.edu

    2005-09-01

    Purpose: E2F-1 is a transcription factor that enhances the radiosensitivity of various cell lines by inducing apoptosis. However, there are conflicting data concerning whether this enhancement is mediated via p53 dependent pathways. Additionally, the role of E2F-1 in the response of human prostate cancer to radiation has not been well characterized. In this study, we investigated the effect of Adenoviral-E2F-1 (Ad-E2F-1) on the radiosensitivity of p53{sup wild-type} (LNCaP) and p53{sup null} (PC3) prostate cancer cell lines. Methods and Materials: LNCaP and PC3 cells were transduced with Ad-E2F-1, Adenoviral-Luciferase (Ad-Luc) control vector, or Adenoviral-p53 (Ad-p53). Expression of E2F-1 and p53 was examined by Western blot analysis. Annexin V and caspase 3 + 7 assays were performed to estimate the levels of apoptosis. Clonogenic survival assays were used to determine overall cell death. Statistical significance was determined by analysis of variance, using the Bonferroni method to correct for multiple comparisons. Results: Western blot analysis confirmed the efficacy of transductions with Ad-E2F-1 and Ad-p53. Ad-E2F-1 transduction significantly enhanced apoptosis and decreased clonogenic survival in both cell lines. These effects were compounded by the addition of RT. Although E2F-1-mediated radiosensitization was independent of p53 status, this effect was more pronounced in p53{sup wild-type} LNCaP cells. When PC3 cells were treated with Ad-p53 in combination with RT and Ad-E2F-1, there was at least an additive reduction in clonogenic survival. Conclusions: Our results suggest that Ad-E2F-1 significantly enhances the response of p53{sup wild-type} and p53{sup null} prostate cancer cells to radiation therapy, although radiosensitization is more pronounced in the presence of p53. Ad-E2F-1 may be a useful adjunct to radiation therapy in the treatment of prostate cancer.

  20. Isolation and characterization of DNA sequences that are specifically bound by wild-type p53 protein.

    PubMed Central

    Foord, O; Navot, N; Rotter, V

    1993-01-01

    Wild-type p53 was shown to function as a transcription factor. The N-terminal region of the protein contains the transcription activation domain, while the C terminus is responsible for DNA binding. Localization of the DNA-binding domain of the p53 protein to the highly conserved carboxy-terminal region suggests that the interaction of p53 with DNA is important for its function. We have developed a strategy for studying the DNA sequence specificity of p53-DNA binding that is based on random sequence selection. We report here on the isolation of murine genomic DNA clones that are specifically bound by the wild-type p53 protein but are not bound by mutant p53 protein forms. The isolated p53 target gene contains the unique DNA-binding sequence GACACTGGTCACACTTGGCTGCTTAGGAAT. This fragment exhibits promoter activity as measured by its capacity to activate transcription of the chloramphenicol acetyltransferase reporter gene. Our results suggest that p53 directly binds DNA and functions as a typical transcription factor. Images PMID:8441383

  1. Cellular oxidative stress and the control of apoptosis by wild-type p53, cytotoxic compounds, and cytokines.

    PubMed Central

    Lotem, J; Peled-Kamar, M; Groner, Y; Sachs, L

    1996-01-01

    Apoptosis induced by wild-type p53 or cytotoxic compounds in myeloid leukemic cells can be inhibited by the cytokines interleukin 6, interleukin 3, granulocyte-macrophage colony-stimulating factor, and interferon gamma and by antioxidants. The antioxidants and cytokines showed a cooperative protective effect against induction of apoptosis. Cells with a higher intrinsic level of peroxide production showed a higher sensitivity to induction of apoptosis and required a higher cytokine concentration to inhibit apoptosis. Decreasing the intrinsic oxidative stress in cells by antioxidants thus inhibited apoptosis, whereas increasing this intrinsic stress by adding H2O2 enhanced apoptosis. Induction of apoptosis by wild-type p53 was not preceded by increased peroxide production or lipid peroxidation and the protective effect of cytokines was not associated with a decrease in these properties. The results indicate that the intrinsic degree of oxidative stress can regulate cell susceptibility to wild-type p53-dependent and p53-independent induction of apoptosis and the ability of cytokines to protect cells against apoptosis. Images Fig. 1 Fig. 3 Fig. 4 PMID:8799172

  2. Cellular Oxidative Stress and the Control of Apoptosis by Wild-Type p53, Cytotoxic Compounds, and Cytokines

    NASA Astrophysics Data System (ADS)

    Lotem, Joseph; Peled-Kamar, Mira; Groner, Yoram; Sachs, Leo

    1996-08-01

    Apoptosis induced by wild-type p53 or cytotoxic compounds in myeloid leukemic cells can be inhibited by the cytokines interleukin 6, interleukin 3, granulocyte-macrophage colony-stimulating factor, and interferon γ and by antioxidants. The antioxidants and cytokines showed a cooperative protective effect against induction of apoptosis. Cells with a higher sensitivity to induction of apoptosis and required a higher cytokine concentration to inhibit apoptosis. Decreasing the intrinsic oxidative stress in cells by antioxidants thus inhibited apoptosis, whereas increasing this intrinsic stress by adding H2O2 enhanced apoptosis. Induction of apoptosis by wild-type p53 was not preceded by increased peroxide production or lipid peroxidation and the protective effect of cytokines was not associated with a decrease in these properties. The results indicate that the intrinsic degree of oxidative stress can regulate cell susceptibility to wild-type p53-dependent and p53-independent induction of apoptosis and the ability of cytokines to protect cells against apoptosis.

  3. Pharmacological activation of wild-type p53 in the therapy of leukemia.

    PubMed

    Kojima, Kensuke; Ishizawa, Jo; Andreeff, Michael

    2016-09-01

    The tumor suppressor p53 is inactivated by mutations in the majority of human solid tumors. Conversely, p53 mutations are rare in leukemias and are only observed in a small fraction of the patient population, predominately in patients with complex karyotype acute myeloid leukemia or hypodiploid acute lymphoblastic leukemia. However, the loss of p53 function in leukemic cells is often caused by abnormalities in p53-regulatory proteins, including overexpression of MDM2/MDMX, deletion of CDKN2A/ARF, and alterations in ATM. For example, MDM2 inhibits p53-mediated transcription, promotes its nuclear export, and induces proteasome-dependent degradation. The MDM2 homolog MDMX is another direct regulator of p53 that inhibits p53-mediated transcription. Several small-molecule inhibitors and stapled peptides targeting MDM2 and MDMX have been developed and have recently entered clinical trials. The clinical trial results of the first clinically used MDM2 inhibitor, RG7112, illustrated promising p53 activation and apoptosis induction in leukemia cells as proof of concept. Side effects of RG7112 were most prominent in suppression of thrombopoiesis and gastrointestinal symptoms in leukemia patients. Predictive biomarkers for response to MDM2 inhibitors have been proposed, but they require further validation both in vitro and in vivo so that the accumulated knowledge concerning pathological p53 dysregulation in leukemia and novel molecular-targeted strategies to overcome this dysregulation can be translated safely and efficiently into novel clinical therapeutics. PMID:27327543

  4. Pharmacological activation of wild-type p53 in the therapy of leukemia.

    PubMed

    Kojima, Kensuke; Ishizawa, Jo; Andreeff, Michael

    2016-09-01

    The tumor suppressor p53 is inactivated by mutations in the majority of human solid tumors. Conversely, p53 mutations are rare in leukemias and are only observed in a small fraction of the patient population, predominately in patients with complex karyotype acute myeloid leukemia or hypodiploid acute lymphoblastic leukemia. However, the loss of p53 function in leukemic cells is often caused by abnormalities in p53-regulatory proteins, including overexpression of MDM2/MDMX, deletion of CDKN2A/ARF, and alterations in ATM. For example, MDM2 inhibits p53-mediated transcription, promotes its nuclear export, and induces proteasome-dependent degradation. The MDM2 homolog MDMX is another direct regulator of p53 that inhibits p53-mediated transcription. Several small-molecule inhibitors and stapled peptides targeting MDM2 and MDMX have been developed and have recently entered clinical trials. The clinical trial results of the first clinically used MDM2 inhibitor, RG7112, illustrated promising p53 activation and apoptosis induction in leukemia cells as proof of concept. Side effects of RG7112 were most prominent in suppression of thrombopoiesis and gastrointestinal symptoms in leukemia patients. Predictive biomarkers for response to MDM2 inhibitors have been proposed, but they require further validation both in vitro and in vivo so that the accumulated knowledge concerning pathological p53 dysregulation in leukemia and novel molecular-targeted strategies to overcome this dysregulation can be translated safely and efficiently into novel clinical therapeutics.

  5. Negative growth regulation in a glioblastoma tumor cell line that conditionally expresses human wild-type p53

    SciTech Connect

    Mercer, W.E.; Shields, M.T.; Amin, M.; Sauve, G.J. ); Appella, E.; Romano, J.W.; Ullrich, S.J. )

    1990-08-01

    To investigate the effect that human wild-type p53 (wt-p53) expression has on cell proliferation the authors constructed a recombinant plasmid, pM47, in which wt-p53 cDNA is under transcriptional control of the hormone-inducible mouse mammary tumor virus promoter linked to the dominant biochemical selection marker gene Eco gpt. The pM47 plasmid was introduced into T98G cells derived from a human glioblastomas multiforme tumor, and a stable clonal cell line, GM47.23, was derived that conditionally expressed wt-p53 following exposure to dexamethasone. The authors show that induction of wt-p53 expression in exponentially growing cells inhibits cell cycle progression and that the inhibitory effect is reversible upon removal of the inducer or infection with simian virus 40. Moreover, when growth-arrested cells are stimulated to proliferate, induction of wt-p53 expression inhibits G{sub 0}/G{sub 1} progression into S phase and the cells accumulate with a DNA content equivalent to cells arrested in the G{sub 0}/G{sub 1} phase of the cell cycle. Taken together, these studies suggest that wt-p53 may play a negative role in growth regulation.

  6. MDM2 overexpression generates a skin phenotype in both wild type and p53 null mice.

    PubMed

    Alkhalaf, M; Ganguli, G; Messaddeq, N; Le Meur, M; Wasylyk, B

    1999-02-18

    The MDM2 proto-oncogene is overexpressed in human tumours and regulates the activities of the tumour suppressors p53 and pRB. We created mice that overexpress MDM2 under the control of the CMV promoter. These mice did not display an increased tumour incidence, but rather a specific skin phenotype, characterized by desquamation and hyperkeratosis. Transgenic MDM2 was found to be overexpressed in the epidermis, a tissue that normally expresses high levels of MDM2. The phenotype appeared during the first week after birth and then lessened with age, closely following the level of expression of the transgene. MDM2 overexpression was associated with an increase in proliferation in the basal layer, thickening of the epidermis, altered expression of the differentiation markers cytokeratin CK14, CK10 and CK1, and a decrease in the size and the number of granules that contain products of differentiation. Transgenic mice on a p53 null background displayed similar although not identical changes, showing that the effects of MDM2 are to a certain degree p53 independent. The skin is a major site of MDM2 expression in mice, raising the possibility that MDM2 overexpression perturbs the normal pattern of MDM2 expression and inhibits differentiation of the epidermis. PMID:10050879

  7. Liposome-mediated transfection of wild-type P53 DNA into human prostate cancer cells is improved by low-frequency ultrasound combined with microbubbles

    PubMed Central

    BAI, WEN-KUN; ZHANG, WEI; HU, BING; YING, TAO

    2016-01-01

    Prostate cancer is a common type of cancer in elderly men. The aim of the present study was to evaluate the effects of ultrasound exposure in combination with SonoVue microbubbles on liposome-mediated transfection of wild-type P53 genes into human prostate cancer cells. PC-3 human prostate cancer cells were exposed to ultrasound; duty cycle was controlled at 20% (2 sec on, 8 sec off) for 5 min with and without SonoVue microbubble echo-contrast agent using a digital sonifier (frequency, 21 kHz; intensity, 46 mW/cm2). The cells were divided into eight groups, as follows: Group A (SonoVue + wild-type P53), group B (ultrasound + wild-type P53), group C (SonoVue + ultrasound + wild-type P53), group D (liposome + wild-type P53), group E (liposome + SonoVue + wild-type P53), group F (liposome + wild-type P53 + ultrasound), group G (liposome + wild-type P53 + ultrasound + SonoVue) and the control group (wild-type P53). Following treatment, a hemocytometer was used to measure cell lysis, reverse transcription-quantitative polymerase chain reaction and western blotting were performed to detect P53 gene transfection efficiency, Cell Counting Kit-8 was employed to reveal cell proliferation and Annexin V/propidium iodide staining was used to determine cell apoptosis. Cell lysis was minimal in each group. Wild-type P53 gene and protein expression were significantly increased in the PC-3 cells in group G compared with the control and all other groups (P<0.01). Cell proliferation was significantly suppressed in group G compared with the control group and all other groups (P<0.01). Cell apoptosis levels in group G were significantly improved compared with the control group and all other groups (P<0.01). Thus, the results of the present study indicate that the use of low-frequency and low-energy ultrasound in combination with SonoVue microbubbles may be a potent physical method for increasing liposome gene delivery efficiency. PMID:27313702

  8. E2 Ubiquitin-conjugating Enzyme, UBE2C Gene, Is Reciprocally Regulated by Wild-type and Gain-of-Function Mutant p53.

    PubMed

    Bajaj, Swati; Alam, Sk Kayum; Roy, Kumar Singha; Datta, Arindam; Nath, Somsubhra; Roychoudhury, Susanta

    2016-07-01

    Spindle assembly checkpoint governs proper chromosomal segregation during mitosis to ensure genomic stability. At the cellular level, this event is tightly regulated by UBE2C, an E2 ubiquitin-conjugating enzyme that donates ubiquitin to the anaphase-promoting complex/cyclosome. This, in turn, facilitates anaphase-onset by ubiquitin-mediated degradation of mitotic substrates. UBE2C is an important marker of chromosomal instability and has been associated with malignant growth. However, the mechanism of its regulation is largely unexplored. In this study, we report that UBE2C is transcriptionally activated by the gain-of-function (GOF) mutant p53, although it is transcriptionally repressed by wild-type p53. We showed that wild-type p53-mediated inhibition of UBE2C is p21-E2F4-dependent and GOF mutant p53-mediated transactivation of UBE2C is NF-Y-dependent. We further explored that DNA damage-induced wild-type p53 leads to spindle assembly checkpoint arrest by repressing UBE2C, whereas mutant p53 causes premature anaphase exit by increasing UBE2C expression in the presence of 5-fluorouracil. Identification of UBE2C as a target of wild-type and GOF mutant p53 further highlights the contribution of p53 in regulation of spindle assembly checkpoint.

  9. Reactivation of wild-type and mutant p53 by tryptophanolderived oxazoloisoindolinone SLMP53-1, a novel anticancer small-molecule

    PubMed Central

    Soares, Joana; Raimundo, Liliana; Pereira, Nuno A.L.; Monteiro, Ângelo; Gomes, Sara; Bessa, Cláudia; Pereira, Clara; Queiroz, Glória; Bisio, Alessandra; Fernandes, João; Gomes, Célia; Reis, Flávio; Gonçalves, Jorge; Inga, Alberto; Santos, Maria M.M.; Saraiva, Lucília

    2016-01-01

    Restoration of the p53 pathway, namely by reactivation of mutant (mut) p53, represents a valuable anticancer strategy. Herein, we report the identification of the enantiopure tryptophanol-derived oxazoloisoindolinone SLMP53-1 as a novel reactivator of wild-type (wt) and mut p53, using a yeast-based screening strategy. SLMP53-1 has a p53-dependent anti-proliferative activity in human wt and mut p53R280K-expressing tumor cells. Additionally, SLMP53-1 enhances p53 transcriptional activity and restores wt-like DNA binding ability to mut p53R280K. In wt/mut p53-expressing tumor cells, SLMP53-1 triggers p53 transcription-dependent and mitochondrial apoptotic pathways involving BAX, and wt/mut p53 mitochondrial translocation. SLMP53-1 inhibits the migration of wt/mut p53-expressing tumor cells, and it shows promising p53-dependent synergistic effects with conventional chemotherapeutics. In xenograft mice models, SLMP53-1 inhibits the growth of wt/mut p53-expressing tumors, but not of p53-null tumors, without apparent toxicity. Collectively, besides the potential use of SLMP53-1 as anticancer drug, the tryptophanol-derived oxazoloisoindolinone scaffold represents a promissing starting point for the development of effective p53-reactivating drugs. PMID:26735173

  10. Induction of wild-type p53, Bax, and acidic endonuclease during somatostatin-signaled apoptosis in MCF-7 human breast cancer cells.

    PubMed

    Sharma, K; Srikant, C B

    1998-04-13

    Somatostatin (SST) analogs inhibit tumor cell growth by exerting direct anti-proliferative effects with cytostatic (growth arrest) or cytotoxic (apoptosis) consequences. The SST analog SMS 201-995 (octreotide, OCT) inhibits growth of MCF-7 human breast adenocarcinoma cells, which express multiple SSTRs. Its action has been reported to result in either apoptosis or growth arrest, but the underlying mechanisms have not been elucidated in this tumor cell model. Here, we report that OCT elicits cytotoxic response in these cells, leading to apoptosis, which is associated with a rapid, time-dependent induction of wild-type p53 and an increase in Bax. There was no G1 cell-cycle arrest in these cells during OCT treatment as suggested by the decrease in G1/S ratio and the lack of induction of pRb and p21. Additionally, we demonstrate that OCT-induced DNA fragmentation in this cell line is due to selective activation of a cation-insensitive acidic endonuclease. Our data provide a rationale for utilizing SST analogs to treat SSTR-positive breast cancer cells expressing wild-type p53.

  11. p53 Haploinsufficiency Profoundly Accelerates the Onset of Tongue Tumors in Mice Lacking the Xeroderma Pigmentosum Group A Gene

    PubMed Central

    Ide, Fumio; Kitada, Munenori; Sakashita, Hideaki; Kusama, Kaoru; Tanaka, Kiyoji; Ishikawa, Takatoshi

    2003-01-01

    Mice lacking the xeroderma pigmentosum group A gene (XPA−/− mice), which have a complete deficiency in nucleotide excision repair (NER), are highly predisposed to tongue squamous cell carcinoma (SCC) when exposed to 4-nitroquinoline 1-oxide (4NQO). To explore the effects of the interaction of the NER machinery with p53 in oral tumorigenesis, we generated an XPA−/− mouse strain carrying mutant alleles for p53. This mouse model of 4NQO carcinogenesis demonstrated that despite the same tumor frequency, XPA−/−p53+/− mice reached 100% SCC incidence at 25 weeks compared with 50 weeks for XPA−/−p53+/+ littermates. XPA−/−p53−/− mice succumbed to spontaneous thymic lymphomas before the development of tongue tumors (before 13 weeks of age). SCC originated in XPA−/−p53+/− mice maintained the p53+/− genotype and the retained wild-type p53 allele appeared to be structurally intact. Only one of 20 XPA−/−p53+/+ SCC showed a missense mutation of p53. Collectively, the accelerated tongue tumor growth may be a consequence of haploinsufficiency but not of mutation of p53 in the context of NER deficiency. PMID:14578172

  12. Single cell monitoring of growth arrest and morphological changes induced by transfer of wild-type p53 alleles to glioblastoma cells.

    PubMed Central

    Van Meir, E G; Roemer, K; Diserens, A C; Kikuchi, T; Rempel, S A; Haas, M; Huang, H J; Friedmann, T; de Tribolet, N; Cavenee, W K

    1995-01-01

    Mutation of the p53 tumor suppressor gene is one of the earliest identified genetic lesions during malignant progression of human astrocytomas. To assess the functional significance of these mutations, wild-type (WT) p53 genes were introduced into glioblastoma cell lines having mutant, WT, or null endogenous p53 alleles. Populations of cells with mutant or null endogenous p53 alleles and exogenous WT p53 were spontaneously selected in culture for cells expressing only mutant p53 or no p53, which then displayed a growth and tumorigenic phenotype identical to the parental cells. To determine the phenotypic consequences of WT p53 expression before the occurrence of mutations, we developed a single cell assay to monitor WT p53-dependent transcription activity. Transfer and expression of exogenous WT p53 genes to cells with endogenous mutant or deleted, but not WT, p53 alleles caused growth arrest and morphological changes, including increased cell size and acquisition of multiple nuclei. This supports the hypothesis that genetic lesions of the p53 gene play an important role in the genesis of astrocytomas. Furthermore, the high sensitivity of the episomal single cell reporter strategy developed here has potential clinical applications in the rapid screening of patients for germ-line mutations of the p53 gene or any other gene with known targets for transcriptional transactivation. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 PMID:7862624

  13. Benzo[a]pyrene (BP) DNA adduct formation in DNA repair–deficient p53 haploinsufficient [Xpa(−/−)p53(+/−)] and wild-type mice fed BP and BP plus chlorophyllin for 28 days

    PubMed Central

    Poirier, Miriam C.

    2012-01-01

    We have evaluated DNA damage (DNA adduct formation) after feeding benzo[a]pyrene (BP) to wild-type (WT) and cancer-susceptible Xpa(−/−)p53(+/−) mice deficient in nucleotide excision repair and haploinsufficient for the tumor suppressor p53. DNA damage was evaluated by high-performance liquid chromatography/electrospray ionization tandem mass spectrometry (HPLC/ES-MS/MS), which measures r7,t8,t9-trihydroxy-c-10-(N 2-deoxyguanosyl)-7,8,9,10-tetrahydrobenzo[a]pyrene (BPdG), and a chemiluminescence immunoassay (CIA), using anti-r7,t8-dihydroxy-t-9,10-epoxy-7,8,9,10-tetrahydrobenzo[a]pyrene (BPDE)–DNA antiserum, which measures both BPdG and the other stable BP-DNA adducts. When mice were fed 100 ppm BP for 28 days, BP-induced DNA damage measured in esophagus, liver and lung was typically higher in Xpa(−/−)p53(+/−) mice, compared with WT mice. This result is consistent with the previously observed tumor susceptibility of Xpa(−/−)p53(+/−) mice. BPdG, the major DNA adduct associated with tumorigenicity, was the primary DNA adduct formed in esophagus (a target tissue in the mouse), whereas total BP-DNA adducts predominated in higher levels in the liver (a non-target tissue in the mouse). In an attempt to lower BP-induced DNA damage, we fed the WT and Xpa(−/−)p53(+/−) mice 0.3% chlorophyllin (CHL) in the BP-containing diet for 28 days. The addition of CHL resulted in an increase of BP–DNA adducts in esophagus, liver and lung of WT mice, a lowering of BPdG in esophagi of WT mice and livers of Xpa(−/−)p53(+/−) mice and an increase of BPdG in livers of WT mice. Therefore, the addition of CHL to a BP-containing diet showed a lack of consistent chemoprotective effect, indicating that oral CHL administration may not reduce PAH–DNA adduct levels consistently in human organs. PMID:22828138

  14. PCR bias toward the wild-type k-ras and p53 sequences: implications for PCR detection of mutations and cancer diagnosis.

    PubMed

    Barnard, R; Futo, V; Pecheniuk, N; Slattery, M; Walsh, T

    1998-10-01

    PCR-based cancer diagnosis requires detection of rare mutations in k-ras, p53 or other genes. The assumption has been that mutant and wild-type sequences amplify with near equal efficiency, so that they are eventually present in proportions representative of the starting material. Work on factor IX suggests that this assumption is invalid for one case of near-sequence identity. To test the generality of this phenomenon and its relevance to cancer diagnosis, primers distant from point mutations in p53 and k-ras were used to amplify wild-type and mutant sequences from these genes. A substantial bias against PCR amplification of mutants was observed for two regions of the p53 gene and one region of k-ras. For k-ras and p53, bias was observed when the wild-type and mutant sequences were amplified separately or when mixed in equal proportions before PCR. Bias was present with proofreading and non-proofreading polymerases. Mutant and wild-type segments of the factor V, cystic fibrosis transmembrane conductance regulator and prothrombin genes were amplified and did not exhibit PCR bias. Therefore, the assumption of equal PCR efficiency for point mutant and wild-type sequences is invalid in several systems. Quantitative or diagnostic PCR will require validation for each locus, and enrichment strategies may be needed to optimize detection of mutants. PMID:9793653

  15. Spontaneous human squamous cell carcinomas are killed by a human cytotoxic T lymphocyte clone recognizing a wild-type p53-derived peptide.

    PubMed

    Röpke, M; Hald, J; Guldberg, P; Zeuthen, J; Nørgaard, L; Fugger, L; Svejgaard, A; Van der Burg, S; Nijman, H W; Melief, C J; Claesson, M H

    1996-12-10

    A cytotoxic T lymphocyte (CTL) clone generated in vitro from the peripheral blood of a healthy HLA-A2-positive individual against a synthetic p53 protein-derived wild-type peptide (L9V) was shown to kill squamous carcinoma cell lines derived from two head and neck carcinomas, which expressed mutant p53 genes, in a L9V/HLA-A2 specific and restricted fashion. Thus, the normal tolerance against endogenously processed p53 protein-derived self-epitopes can be broken by peptide-specific in vitro priming. p53 protein-derived wild-type peptides might thus represent tumor associated target molecules for immunotherapeutical approaches. PMID:8962118

  16. Experimental research on wild-type p53 plasmid transfected into retinoblastoma cells and tissues using an ultrasound microbubble intensifier.

    PubMed

    Luo, J; Zhou, X; Diao, L; Wang, Z

    2010-01-01

    The transfection efficiency of wild-type p53 (wtp53) was investigated in retinoblastoma (RB) Y79 cells using an ultrasound microbubble technique. A human RB nude mouse xenograft tumour model was also used to investigate whether this technique could deliver wtp53 into solid tumours. Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated that wtp53 was successfully transfected into Y79 cells in the plasmid with microbubbles and ultrasound group and in the plasmid with liposomes group, but not in the plasmid with ultrasound group or in the untreated control group. Flow cytometry showed that apoptosis was highest in the microbubbles and ultrasound group (25.58%) compared with the plasmid with liposomes group (19.50%), and the other two groups (< 10%). RT-PCR also showed that the wtp53 gene was successfully transfected into solid tumours in the plasmid with microbubbles and ultrasound group. This study provides preliminary evidence in support of a potential new approach to RB gene therapy. PMID:20819437

  17. Experimental research on wild-type p53 plasmid transfected into retinoblastoma cells and tissues using an ultrasound microbubble intensifier.

    PubMed

    Luo, J; Zhou, X; Diao, L; Wang, Z

    2010-01-01

    The transfection efficiency of wild-type p53 (wtp53) was investigated in retinoblastoma (RB) Y79 cells using an ultrasound microbubble technique. A human RB nude mouse xenograft tumour model was also used to investigate whether this technique could deliver wtp53 into solid tumours. Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated that wtp53 was successfully transfected into Y79 cells in the plasmid with microbubbles and ultrasound group and in the plasmid with liposomes group, but not in the plasmid with ultrasound group or in the untreated control group. Flow cytometry showed that apoptosis was highest in the microbubbles and ultrasound group (25.58%) compared with the plasmid with liposomes group (19.50%), and the other two groups (< 10%). RT-PCR also showed that the wtp53 gene was successfully transfected into solid tumours in the plasmid with microbubbles and ultrasound group. This study provides preliminary evidence in support of a potential new approach to RB gene therapy.

  18. Mice deficient for wild-type p53-induced phosphatase 1 display elevated anxiety- and depression-like behaviors.

    PubMed

    Ruan, C S; Zhou, F H; He, Z Y; Wang, S F; Yang, C R; Shen, Y J; Guo, Y; Zhao, H B; Chen, L; Liu, D; Liu, J; Baune, B T; Xiao, Z C; Zhou, X F

    2015-05-01

    Mood disorders are a severe health burden but molecular mechanisms underlying mood dysfunction remain poorly understood. Here, we show that wild-type p53-induced phosphatase 1 (Wip1) negatively responds to the stress-induced negative mood-related behaviors. Specifically, we show that Wip1 protein but not its mRNA level was downregulated in the hippocampus but not in the neocortex after 4 weeks of chronic unpredictable mild stress (CUMS) in mice. Moreover, the CUMS-responsive WIP1 downregulation in the hippocampus was restored by chronic treatment of fluoxetine (i.p. 20 mg/kg) along with the CUMS procedure. In addition, Wip1 knockout mice displayed decreased exploratory behaviors as well as increased anxiety-like and depression-like behaviors in mice without impaired motor activities under the non-CUMS condition. Furthermore, the Wip1 deficiency-responsive anxiety-like but not depression-like behaviors were further elevated in mice under CUMS. Although limitations like male-alone sampling and multiply behavioral testing exist, the present study suggests a potential protective function of Wip1 in mood stabilization. PMID:25732137

  19. Retention of the In Vitro Radiosensitizing Potential of Gemcitabine Under Anoxic Conditions, in p53 Wild-Type and p53-Deficient Non-Small-Cell Lung Carcinoma Cells

    SciTech Connect

    Wouters, An; Pauwels, Bea; Lambrechts, Hilde A.J.; Pattyn, Greet G.O.; Ides, Johan; Baay, Marc; Meijnders, Paul; Peeters, Marc; Vermorken, Jan B.; Lardon, Filip

    2011-06-01

    Purpose: Whereas radiosensitization by gemcitabine is well studied under normal oxygen conditions, little is known about its radiosensitizing potential under reduced oxygen conditions. Therefore, the present study evaluated the impact of anoxia on gemcitabine-mediated radiosensitization. Methods and Materials: The clonogenic assay was performed in three isogenic A549 cell lines differing in p53 status (24 h, 0-15 nM gemcitabine, 0-8 Gy irradiation, normoxia vs. anoxia). Using radiosensitizing conditions, cells were collected for cell cycle analysis and apoptosis detection. Results: Whereas wild-type p53 A549-LXSN cells were more sensitive to radiation than p53-deficient A549-E6 cells, both cell lines showed similar radiosensitization by gemcitabine under normoxia and anoxia. Independent of p53 functionality, gemcitabine was able to overcome anoxia-induced G{sub 0/1} arrest and established an (early) S phase block in normoxic and anoxic cells. The percentage early and late apoptotic/necrotic cells increased with the gemcitabine/radiation combination, with a significant difference between A549-LXSN and A549-E6. Conclusions: This study is the first to show that gemcitabine retains its radiosensitizing potential under low oxygen conditions. Although radiosensitization was observed in both p53 wild-type and p53-deficient cells, p53 status might influence induction of apoptosis after gemcitabine/radiation treatment, whereas no effect on cell cycle progression was noticed.

  20. Mutant, wild type, or overall p53 expression: freedom from clinical progression in tumours of astrocytic lineage.

    PubMed

    Pardo, F S; Hsu, D W; Zeheb, R; Efird, J T; Okunieff, P G; Malkin, D M

    2004-11-01

    Abnormalities of the p53 tumor-suppressor gene are found in a significant proportion of astrocytic brain tumours. We studied tumour specimens from 74 patients evaluated over 20 years at the Massachusetts General Hospital, where clinical outcome could be determined and sufficient pathologic material was available for immunostaining. p53 expression studies employed an affinity-purified p53 monoclonal antibody, whose specificity was verified in absorption studies and, in a minority of cases, a second antibody recognising a different epitope of p53. Significant overexpression of p53 protein was found in 48% of the 74 tumours included in this series and high levels of expression were associated with higher mortality from astrocytic tumours (P<0.001, log rank). Multivariate analyses revealed that immunohistochemically detected p53 was an independent marker of shortened progression-free and overall actuarial survival in patients with astrocytic tumours, suggesting that increased expression of p53 plays an important role in the pathobiology of these tumours. In a subset of 36 cases, coding regions of the p53 gene were completely sequenced via SSCP and direct DNA sequencing, revealing that overexpression of p53 protein is not always associated with point mutations in conserved exons of the p53 gene. Finally, we confirmed p53 protein expression in early-passage human glioma cell lines of known p53 mutational status and immunostaining scores. Although grade continues to be the strongest prognostic variable, the use of p53 staining as a prognostic indicator, in contrast to mutational DNA analyses, may be a useful adjunct in identifying patients at higher risk of treatment failure.

  1. Wild-type and mutated presenilins 2 trigger p53-dependent apoptosis and down-regulate presenilin 1 expression in HEK293 human cells and in murine neurons.

    PubMed

    Alves da Costa, Cristine; Paitel, Erwan; Mattson, Mark P; Amson, Robert; Telerman, Adam; Ancolio, Karine; Checler, Frédéric; Mattson, Marc P

    2002-03-19

    Presenilins 1 and 2 are two homologous proteins that, when mutated, account for most early onset Alzheimer's disease. Several lines of evidence suggest that, among various functions, presenilins could modulate cell apoptotic responses. Here we establish that the overexpression of presenilin 2 (PS2) and its mutated form Asn-141-Ile-PS2 alters the viability of human embryonic kidney (HEK)293 cells as established by combined trypan blue exclusion, sodium 3'-[1-(phenylamino-carbonyl)-3,4-tetrazolium]-bis(4-methoxy-6-nitro)benzene sulfonic acid hydrate assay, and propidium iodide incorporation FACS analyses. The two parent proteins increase the acetyl-DEVD-al-sensitive caspase-3-like activity in both HEK293 cells and Telencephalon specific murine neurons, modulate Bax and bcl-2 expressions, and enhance cytochrome C translocation into the cytosol. We show that overexpression of both wild-type and mutated PS2 increases p53-like immunoreactivity and transcriptional activity. We also establish that wild-type- and mutated PS2-induced caspase activation is reduced by p53 antisense approach and by pifithrin-alpha, a chemical inhibitor of p53. Furthermore, mouse fibroblasts in which the PS2 gene has been knocked out exhibited strongly reduced p53-transcriptional activity. Finally, we establish that the overexpression of both wild-type and mutated PS2 is accompanied by a drastic reduction of endogenous presenilin 1 (PS1) expression. Interestingly, pifithrin-alpha diminished endogenous PS2 immunoreactivity, whereas the inhibitor increases PS1 expression. Altogether, our data demonstrate that wild-type and familial Alzheimer's disease-linked PS2 trigger apoptosis and down-regulate PS1 expression through p53-dependent mechanisms. PMID:11904448

  2. Wild-type and mutant p53 differentially regulate NADPH oxidase 4 in TGF-β-mediated migration of human lung and breast epithelial cells

    PubMed Central

    Boudreau, H E; Casterline, B W; Burke, D J; Leto, T L

    2014-01-01

    Background: Transforming growth factor-beta (TGF-β) induces the epithelial-to-mesenchymal transition (EMT) leading to increased cell plasticity at the onset of cancer cell invasion and metastasis. Mechanisms involved in TGF-β-mediated EMT and cell motility are unclear. Recent studies showed that p53 affects TGF-β/SMAD3-mediated signalling, cell migration, and tumorigenesis. We previously demonstrated that Nox4, a Nox family NADPH oxidase, is a TGF-β/SMAD3-inducible source of reactive oxygen species (ROS) affecting cell migration and fibronectin expression, an EMT marker, in normal and metastatic breast epithelial cells. Our present study investigates the involvement of p53 in TGF-β-regulated Nox4 expression and cell migration. Methods: We investigated the effect of wild-type p53 (WT-p53) and mutant p53 proteins on TGF-β-regulated Nox4 expression and cell migration. Nox4 mRNA and protein, ROS production, cell migration, and focal adhesion kinase (FAK) activation were examined in three different cell models based on their p53 mutational status. H1299, a p53-null lung epithelial cell line, was used for heterologous expression of WT-p53 or mutant p53. In contrast, functional studies using siRNA-mediated knockdown of endogenous p53 were conducted in MDA-MB-231 metastatic breast epithelial cells that express p53-R280K and MCF-10A normal breast cells that have WT-p53. Results: We found that WT-p53 is a potent suppressor of TGF-β-induced Nox4, ROS production, and cell migration in p53-null lung epithelial (H1299) cells. In contrast, tumour-associated mutant p53 proteins (R175H or R280K) caused enhanced Nox4 expression and cell migration in both TGF-β-dependent and TGF-β-independent pathways. Moreover, knockdown of endogenous mutant p53 (R280K) in TGF-β-treated MDA-MB-231 metastatic breast epithelial cells resulted in decreased Nox4 protein and reduced phosphorylation of FAK, a key regulator of cell motility. Expression of WT-p53 or dominant-negative Nox4

  3. Subtype-selective induction of wild-type p53 and apoptosis, but not cell cycle arrest, by human somatostatin receptor 3.

    PubMed

    Sharma, K; Patel, Y C; Srikant, C B

    1996-12-01

    Somatostatin (SST) exerts direct antiproliferative effects in tumor cells, triggering either growth arrest or apoptosis. The cellular actions of SST are transduced through a family of five distinct somatostatin receptor subtypes (SSTR1-5). Whereas growth inhibition has been reported to follow stimulation of protein tyrosine phosphatase via SSTR2 or inhibition of Ca2+ channels via SSTR5 in heterologous expression systems, the subtype selectivity for signaling apoptosis has not been investigated. The tumor suppressor protein p53 and the protooncogene product c-Myc regulate cell cycle progression (growth factors present) or apoptosis (growth factors absent). The p53-induced G1 arrest requires induction of p21, an inhibitor of cyclin-dependent kinases, whereas apoptosis requires induction of Bax. c-Myc is capable of abrogating p53-induced G1 arrest by interfering with the inhibitory action of p21 on cyclin-dependent kinases. We have, therefore, investigated the regulation of p53, p21, c-Myc, and Bax and cellular apoptosis in relation to cell cycle progression in CHO-K1 cells stably expressing individual human SSTR1-5. We demonstrate that apoptosis is signaled uniquely through human SSTR3 and is associated with dephosphorylation-dependent conformational change in wild-type (wt) p53 as well as induction of Bax. The induction of wt p53 occurs rapidly and precedes the onset of apoptosis. We show that the increase in wt p53 is not associated with the induction of p21 or c-Myc when octreotide-induced apoptosis becomes evident, suggesting that such apoptosis does not require G1 arrest and is not c-Myc dependent. These findings provide the first evidence for hormonal induction of wt p53-associated apoptosis via G protein-coupled receptor in a subtype-selective manner.

  4. Wild Type p53 gene sensitizes rat C6 glioma cells to HSV-TK/ACV treatment in vitro and in vivo.

    PubMed

    Huang, Qiang; Xia, Zhibo; You, Yongping; Pu, Peiyu

    2010-12-01

    Suicide gene therapy using herpes simplex virus-thymidine kinase (HSV-TK)/ganciclovir (GCV), has been extensively tested for the treatment of glioma. Our previous study showed that exogenous wild type p53 (wt-p53) enhanced the anti-tumor effect of HSV-TK/GCV therapy. However, the use of GCV is hindered by its low penetration to the brain and its toxicity when used at higher dose. In the present study, we used another pro-drug, acyclovir (ACV), and examined the therapeutic efficacy of HSV-TK/ACV combining with wt-p53 in C6 glioma cells. We observed that wt-p53 combined with HSV-TK/ACV resulted in the super-additive anti-tumor effect in vitro. Exogenous wt-p53 significantly enhanced the sensitivity of TK positive C6 cells to ACV in vitro. Our in vivo experiment demonstrated that the effect of wt-p53 and HSV-TK/ACV combination therapy was better than that of HSV-TK/ACV alone. The survival time of tumor-bearing rats treated with wt-p53 in combination with HSV-TK/ACV was also significantly prolonged than those treated with HSV-TK/ACV alone. These results suggest that wt-p53 can enhance the therapeutic efficacy of HSV-TK/ACV both in vitro and in vivo. These findings are considerably valuable with the respect of using less toxic ACV as prodrug. This novel strategy could provide benefit to HSV-TK/prodrug gene therapy.

  5. Lack of Transcription Factor p53 Exacerbates Elastase-Induced Emphysema in Mice.

    PubMed

    Chrusciel, Sandra; Zysman, Maéva; Caramelle, Philippe; Tiendrebeogo, Arnaud; Baskara, Indoumady; Le Gouvello, Sabine; Chabot, François; Giraudier, Stéphane; Boczkowski, Jorge; Boyer, Laurent

    2016-02-01

    The transcription factor p53 is overexpressed in the lung of patients with emphysema, but it remains unclear if it has a deleterious or protective effect in disease progression. We investigated the role of p53 in the elastase-induced emphysema model and the molecular underlining mechanisms. Wild-type (WT) and p53(-/-) mice were instilled with pancreatic porcine elastase. We quantified emphysema (morphometric analysis), chemokine (C-C motif) ligand 2 (CCL2), and TNF-α in bronchoalveolar lavage (BAL) (ELISA), oxidative stress markers [heme oxygenase 1 (HO1), NAD(P)H dehydrogenase quinone 1 (NQO1), and quantitative RT-PCR], matrix metalloproteinase 12 (MMP12) expression, and macrophage apoptosis (cleaved caspase-3, immunofluorescence). p53 gene expression was up-regulated in the lung of elastase-instilled mice. p53 deletion aggravated elastase-induced emphysema severity, pulmonary inflammation (macrophage and neutrophil numbers and CCL2 and TNF-α levels in BAL), and lung oxidative stress. These findings, except for the increase in CCL2, were reproduced in WT mice transplanted with p53(-/-) bone marrow cells. The increased number of macrophages in p53(-/-) mice was not a consequence of reduced apoptosis or an excess of chemotaxis toward CCL2. Macrophage expression of MMP12 was higher in p53(-/-) mice compared with WT mice after elastase instillation. These findings provide evidence that p53(-/-) mice and WT mice grafted with p53(-/-) bone marrow cells are more prone to developing elastase-induced emphysema, supporting a protective role of p53, and more precisely p53 expressed in macrophages, against emphysema development. The pivotal role played by macrophages in this phenomenon may involve the MMP12-TNF-α pathway.

  6. Increased expression of SIRT2 is a novel marker of cellular senescence and is dependent on wild type p53 status.

    PubMed

    Anwar, Tarique; Khosla, Sanjeev; Ramakrishna, Gayatri

    2016-07-17

    Sirtuins (SIRT) belonging to the NAD+ dependent histone deacetylase III class of enzymes have emerged as master regulators of metabolism and longevity. However, their role in prevention of organismal aging and cellular senescence still remains controversial. In the present study, we now report upregulation of SIRT2 as a specific feature associated with stress induced premature senescence but not with either quiescence or cell death. Additionally, increase in SIRT2 expression was noted in different types of senescent conditions such as replicative and oncogene induced senescence using multiple cell lines. Induction of SIRT2 expression during senescence was dependent on p53 status as depletion of p53 by shRNA prevented its accumulation. Chromatin immunoprecipitation revealed the presence of p53 binding sites on the SIRT2 promoter suggesting its regulation by p53, which was also corroborated by the SEAP reporter assay. Overexpression or knockdown of SIRT2 had no effect on stress induced premature senescence, thereby indicating that SIRT2 increase is not a cause of senescence; rather it is an effect linked to senescence-associated changes. Overall, our results suggest SIRT2 as a promising marker of cellular senescence at least in cells with wild type p53 status. PMID:27229617

  7. Noscapine induced apoptosis via downregulation of survivin in human neuroblastoma cells having wild type or null p53.

    PubMed

    Li, Shiwang; He, Jing; Li, Shuai; Cao, Guoqing; Tang, Shaotao; Tong, Qiangsong; Joshi, Harish C

    2012-01-01

    Neuroblastoma is the most common extracranial solid tumor of childhood. It accounts for 15% of pediatric cancer deaths. Chemotherapy is the mainstay of treatment in children with advanced neuroblastoma. Noscapine, a nontoxic natural compound, can trigger apoptosis in many cancer types. We now show that p53 is dispensable for Noscapine-induced cell death in neuroblastoma cell lines, proapoptotic response to this promising chemopreventive agent is mediated by suppression of survivin protein expression. The Noscapine treatment increased levels of total and Ser(15)-phosphorylated p53 protein in SK-SY5Y cells, but the proapoptotic response to this agent was maintained even after knockdown of the p53 protein level. Exposure of SK-SY5Y and LA1-5S cells to Noscapine resulted in a marked decrease in protein and mRNA level of survivin as early as 12 hours after treatment. Ectopic expression of survivin conferred statistically significant protection against Noscapine-mediated cytoplasmic histone-associated apoptotic DNA fragmentation. Also, the Noscapine-induced apoptosis was modestly but statistically significantly augmented by RNA interference of survivin in both cell lines. Furthermore, Noscapine-induced apoptotic cell death was associated with activation of caspase-3 and cleavage of PARP. In conclusion, the present study provides novel insight into the molecular circuitry of Noscapine-induced apoptosis to indicate suppression of survivin expression as a critical mediator of this process.

  8. Noscapine Induced Apoptosis via Downregulation of Survivin in Human Neuroblastoma Cells Having Wild Type or Null p53

    PubMed Central

    Li, Shiwang; He, Jing; Li, Shuai; Cao, Guoqing; Tang, Shaotao; Tong, Qiangsong; Joshi, Harish C.

    2012-01-01

    Neuroblastoma is the most common extracranial solid tumor of childhood. It accounts for 15% of pediatric cancer deaths. Chemotherapy is the mainstay of treatment in children with advanced neuroblastoma. Noscapine, a nontoxic natural compound, can trigger apoptosis in many cancer types. We now show that p53 is dispensable for Noscapine-induced cell death in neuroblastoma cell lines, proapoptotic response to this promising chemopreventive agent is mediated by suppression of survivin protein expression. The Noscapine treatment increased levels of total and Ser15-phosphorylated p53 protein in SK-SY5Y cells, but the proapoptotic response to this agent was maintained even after knockdown of the p53 protein level. Exposure of SK-SY5Y and LA1-5S cells to Noscapine resulted in a marked decrease in protein and mRNA level of survivin as early as 12 hours after treatment. Ectopic expression of survivin conferred statistically significant protection against Noscapine-mediated cytoplasmic histone-associated apoptotic DNA fragmentation. Also, the Noscapine-induced apoptosis was modestly but statistically significantly augmented by RNA interference of survivin in both cell lines. Furthermore, Noscapine-induced apoptotic cell death was associated with activation of caspase-3 and cleavage of PARP. In conclusion, the present study provides novel insight into the molecular circuitry of Noscapine-induced apoptosis to indicate suppression of survivin expression as a critical mediator of this process. PMID:22848370

  9. Alpha-santalol, a chemopreventive agent against skin cancer, causes G2/M cell cycle arrest in both p53-mutated human epidermoid carcinoma A431 cells and p53 wild-type human melanoma UACC-62 cells

    PubMed Central

    2010-01-01

    Background α-Santalol, an active component of sandalwood oil, has shown chemopreventive effects on skin cancer in different murine models. However, effects of α-santalol on cell cycle have not been studied. Thus, the objective of this study was to investigate effects of α-santalol on cell cycle progression in both p53 mutated human epidermoid carcinoma A431 cells and p53 wild-type human melanoma UACC-62 cells to elucidate the mechanism(s) of action. Methods MTT assay was used to determine cell viability in A431 cells and UACC-62; fluorescence-activated cell sorting (FACS) analysis of propidium iodide staining was used for determining cell cycle distribution in A431 cells and UACC-62 cells; immunoblotting was used for determining the expression of various proteins and protein complexes involved in the cell cycle progression; siRNA were used to knockdown of p21 or p53 in A431 and UACC-62 cells and immunofluorescence microscopy was used to investigate microtubules in UACC-62 cells. Results α-Santalol at 50-100 μM decreased cell viability from 24 h treatment and α-santalol at 50 μM-75 μM induced G2/M phase cell cycle arrest from 6 h treatment in both A431 and UACC-62 cells. α-Santalol altered expressions of cell cycle proteins such as cyclin A, cyclin B1, Cdc2, Cdc25c, p-Cdc25c and Cdk2. All of these proteins are critical for G2/M transition. α-Santalol treatment up-regulated the expression of p21 and suppressed expressions of mutated p53 in A431 cells; whereas, α-santalol treatment increased expressions of wild-type p53 in UACC-62 cells. Knockdown of p21 in A431 cells, knockdown of p21 and p53 in UACC-62 cells did not affect cell cycle arrest caused by α-santalol. Furthermore, α-santalol caused depolymerization of microtubules similar to vinblastine in UACC-62 cells. Conclusions This study for the first time identifies effects of α-santalol in G2/M phase arrest and describes detailed mechanisms of G2/M phase arrest by this agent, which might be

  10. Dual-Targeting Nanovesicles for In Situ Intracellular Imaging of and Discrimination between Wild-type and Mutant p53.

    PubMed

    Qian, Ruocan; Cao, Yue; Long, Yi-Tao

    2016-01-11

    p53 is a tumor-suppressor protein related to the cell cycle and programmed cell apoptosis. Herein, dual-targeting nanovesicles are designed for in situ imaging of intracellular wild-type p53 (WTp53) and mutant p53 (MUp53). Nanovesicle-encapsulated plasmonic gold nanoparticles (AuNPs) were functionalized with consensus DNA duplexes, and a fluorescein isothiocyanate (FITC)-marked anti-MUp53 antibody was conjugated to the nanovesicle surface. After entering the cytoplasm, the released AuNPs aggregated through recognition of WTp53 and the double-stranded DNA. The color changes of AuNPs were observed using dark-field microscopy, which showed the intracellular WTp53 distribution. The MUp53 location was detected though the immunological recognition between FITC-labeled anti-MUp53 and MUp53. Thus, a one-step incubation method for the in situ imaging of intracellular WTp53 and MUp53 was obtained; this was used to monitor the p53 level under a drug treatment.

  11. Effects of Temperature on the p53-DNA Binding Interactions and Their Dynamical Behavior: Comparing the Wild Type to the R248Q Mutant

    PubMed Central

    Barakat, Khaled; Issack, Bilkiss B.; Stepanova, Maria; Tuszynski, Jack

    2011-01-01

    Background The protein p53 plays an active role in the regulation of cell cycle. In about half of human cancers, the protein is inactivated by mutations located primarily in its DNA-binding domain. Interestingly, a number of these mutations possess temperature-induced DNA-binding characteristics. A striking example is the mutation of Arg248 into glutamine or tryptophan. These mutants are defective for binding to DNA at 310 K although they have been shown to bind specifically to several p53 response elements at sub-physiological temperatures (298–306 K). Methodology/Principal Findings This important experimental finding motivated us to examine the effects of temperature on the structure and configuration of R248Q mutant and compare it to the wild type protein. Our aim is to determine how and where structural changes of mutant variants take place due to temperature changes. To answer these questions, we compared the mutant to the wild-type proteins from two different aspects. First, we investigated the systems at the atomistic level through their DNA-binding affinity, hydrogen bond networks and spatial distribution of water molecules. Next, we assessed changes in their long-lived conformational motions at the coarse-grained level through the collective dynamics of their side-chain and backbone atoms separately. Conclusions The experimentally observed effect of temperature on the DNA-binding properties of p53 is reproduced. Analysis of atomistic and coarse-grained data reveal that changes in binding are determined by a few key residues and provide a rationale for the mutant-loss of binding at physiological temperatures. The findings can potentially enable a rescue strategy for the mutant structure. PMID:22110706

  12. Lack of p53 Affects the Expression of Several Brain Mitochondrial Proteins: Insights from Proteomics into Important Pathways Regulated by p53

    PubMed Central

    Fiorini, Ada; Sultana, Rukhsana; Barone, Eugenio; Cenini, Giovanna; Perluigi, Marzia; Mancuso, Cesare; Cai, Jian; Klein, Jon B.; St. Clair, Daret; Butterfield, D. Allan

    2012-01-01

    The tumor suppressor protein p53 has been described “as the guardian of the genome” for its crucial role in regulating the transcription of numerous genes responsible for cells cycle arrest, senescence, or apoptosis in response to various stress signals. Although p53 promotes longevity by decreasing the risk of cancer through activation of apoptosis or cellular senescence, several findings suggest that an increase of its activity may have deleterious effects leading to selected aspects of the aging phenotype and neurodegenerative diseases. There is the link between p53 and oxidative stress, the latter a crucial factor that contributes to neurodegenerative processes like Alzheimer disease (AD). In the present study, using a proteomics approach, we analyzed the impact of lack of p53 on the expression of several brain mitochondrial proteins involved in different pathways, and how lack of p53 may present a target to restore neuronal impairments. Our investigation on isolated brain mitochondria from p53(−/−) mice also provides a better understanding of the p53-mitochondria relationship and its involvement in the development of many diseases. PMID:23209608

  13. Lack of dependence on p53 for DNA double strand break repair of episomal vectors in human lymphoblasts

    NASA Technical Reports Server (NTRS)

    Kohli, M.; Jorgensen, T. J.

    1999-01-01

    The p53 tumor suppressor gene has been shown to be involved in a variety of repair processes, and recent findings have suggested that p53 may be involved in DNA double strand break repair in irradiated cells. The role of p53 in DNA double strand break repair, however, has not been fully investigated. In this study, we have constructed a novel Epstein-Barr virus (EBV)-based shuttle vector, designated as pZEBNA, to explore the influence of p53 on DNA strand break repair in human lymphoblasts, since EBV-based vectors do not inactivate the p53 pathway. We have compared plasmid survival of irradiated, restriction enzyme linearized, and calf intestinal alkaline phosphatase (CIP)-treated pZEBNA with a Simian virus 40 (SV40)-based shuttle vector, pZ189, in TK6 (wild-type p53) and WTK1 (mutant p53) lymphoblasts and determined that p53 does not modulate DNA double strand break repair in these cell lines. Copyright 1999 Academic Press.

  14. Synergistic anticancer effect of exogenous wild-type p53 gene combined with 5-FU in human colon cancer resistant to 5-FU in vivo

    PubMed Central

    Xie, Qi; Wu, Min-Yi; Zhang, Ding-Xuan; Yang, Yi-Ming; Wang, Bao-Shuai; Zhang, Jing; Xu, Jin; Zhong, Wei-De; Hu, Jia-Ni

    2016-01-01

    AIM To investigate the anticancer effect of a recombinant adenovirus-mediated p53 (rAd-p53) combined with 5-fluorouracil (5-FU) in human colon cancer resistant to 5-FU in vivo and the mechanism of rAd-p53 in reversal of 5-FU resistance. METHODS Nude mice bearing human colon cancer SW480/5-FU (5-FU resistant) were randomly assigned to four groups (n = 25 each): control group, 5-FU group, rAd-p53 group, and rAd-p53 + 5-FU group. At 24 h, 48 h, 72 h, 120 h and 168 h after treatment, 5 mice were randomly selected from each group and sacrificed using an overdose of anesthetics. The tumors were removed and the protein expressions of p53, protein kinase C (PKC), permeability-glycoprotein (P-gp) and multidrug resistance-associated protein 1 (MRP1) (Western blot) and apoptosis (TUNEL) were determined. RESULTS The area ratios of tumor cell apoptosis were larger in the rAd/p53 + 5-FU group than that in the control, 5-FU and rAd/p53 groups (P < 0.05), and were larger in the rAd/p53 group than that of the control group (P < 0.05) and the 5-FU group at more than 48 h (P < 0.05). The p53 expression was higher in the rAd/p53 and the rAd/p53 + 5-FU groups than that of the control and 5-FU groups (P < 0.05), and were higher in the rAd/p53 + 5-FU group than that of the rAd/p53 group (P < 0.05). Overexpression of PKC, P-gp and MRP1 was observed in the 5-FU and control groups. In the rAd/p53 + 5-FU group, the expression of P-gp and MRP1 was lower that of the control and 5-FU groups (P < 0.05), and the expression of PKC was lower than that of the control, 5-FU and rAd/p53 groups at more than 48 h (P < 0.05). In the rAd/p53 group, the expression of P-gp and MRP1 was lower that of the control and 5-FU groups at more than 48 h (P < 0.05), and the expression of PKC was lower than that of the control and 5-FU groups at more than 120 h (P < 0.05). CONCLUSION 5-FU combined with rAd-p53 has a synergistic anticancer effect in SW480/5-FU (5-FU resistance), which contributes to reversal of 5-FU

  15. Synergistic anticancer effect of exogenous wild-type p53 gene combined with 5-FU in human colon cancer resistant to 5-FU in vivo

    PubMed Central

    Xie, Qi; Wu, Min-Yi; Zhang, Ding-Xuan; Yang, Yi-Ming; Wang, Bao-Shuai; Zhang, Jing; Xu, Jin; Zhong, Wei-De; Hu, Jia-Ni

    2016-01-01

    AIM To investigate the anticancer effect of a recombinant adenovirus-mediated p53 (rAd-p53) combined with 5-fluorouracil (5-FU) in human colon cancer resistant to 5-FU in vivo and the mechanism of rAd-p53 in reversal of 5-FU resistance. METHODS Nude mice bearing human colon cancer SW480/5-FU (5-FU resistant) were randomly assigned to four groups (n = 25 each): control group, 5-FU group, rAd-p53 group, and rAd-p53 + 5-FU group. At 24 h, 48 h, 72 h, 120 h and 168 h after treatment, 5 mice were randomly selected from each group and sacrificed using an overdose of anesthetics. The tumors were removed and the protein expressions of p53, protein kinase C (PKC), permeability-glycoprotein (P-gp) and multidrug resistance-associated protein 1 (MRP1) (Western blot) and apoptosis (TUNEL) were determined. RESULTS The area ratios of tumor cell apoptosis were larger in the rAd/p53 + 5-FU group than that in the control, 5-FU and rAd/p53 groups (P < 0.05), and were larger in the rAd/p53 group than that of the control group (P < 0.05) and the 5-FU group at more than 48 h (P < 0.05). The p53 expression was higher in the rAd/p53 and the rAd/p53 + 5-FU groups than that of the control and 5-FU groups (P < 0.05), and were higher in the rAd/p53 + 5-FU group than that of the rAd/p53 group (P < 0.05). Overexpression of PKC, P-gp and MRP1 was observed in the 5-FU and control groups. In the rAd/p53 + 5-FU group, the expression of P-gp and MRP1 was lower that of the control and 5-FU groups (P < 0.05), and the expression of PKC was lower than that of the control, 5-FU and rAd/p53 groups at more than 48 h (P < 0.05). In the rAd/p53 group, the expression of P-gp and MRP1 was lower that of the control and 5-FU groups at more than 48 h (P < 0.05), and the expression of PKC was lower than that of the control and 5-FU groups at more than 120 h (P < 0.05). CONCLUSION 5-FU combined with rAd-p53 has a synergistic anticancer effect in SW480/5-FU (5-FU resistance), which contributes to reversal of 5-FU

  16. Cisplatin-induced apoptosis in non-small-cell lung cancer cells is dependent on Bax- and Bak-induction pathway and synergistically activated by BH3-mimetic ABT-263 in p53 wild-type and mutant cells.

    PubMed

    Matsumoto, Masaru; Nakajima, Wataru; Seike, Masahiro; Gemma, Akihiko; Tanaka, Nobuyuki

    2016-04-29

    Cisplatin is a highly effective anticancer drug for treatment of various tumors including non-small-cell lung cancer (NSCLC), and is especially useful in cases nonresponsive to molecular-targeted drugs. Accumulating evidence has shown that cisplatin activates the p53-dependent apoptotic pathway, but it also induces apoptosis in p53-mutated cancer cells. Here we demonstrated that DNA-damage inducible proapoptotic BH3 (Bcl-2 homology region 3)-only Bcl-2 family members, Noxa, Puma, Bim and Bid, are not involved in cisplatin-induced apoptosis in human NSCLC cell lines. In contrast, the expression of proapoptotic multidomain Bcl-2-family members, Bak and Bax, was induced by cisplatin in p53-dependent and -independent manners, respectively. Moreover, in wild-type p53-expressing cells, cisplatin mainly used the Bak-dependent apoptotic pathway, but this apoptotic pathway shifted to the Bax-dependent pathway by loss-of-function of p53. Furthermore, both Bak- and Bax-induced apoptosis was enhanced by the antiapoptotic Bcl-2 family member, Bcl-XL knockdown, but not by Mcl-1 knockdown. From this result, we tested the effect of ABT-263 (Navitoclax), the specific inhibitor of Bcl-2 and Bcl-XL, but not Mcl-1, and found that ABT-263 synergistically enhanced cisplatin-induced apoptosis in NSCLC cells in the presence or absence of p53. These results indicate a novel regulatory system in cisplatin-induced NSCLC cell apoptosis, and a candidate efficient combination chemotherapy method against lung cancers.

  17. MicroRNA-34a induces a senescence-like change via the down-regulation of SIRT1 and up-regulation of p53 protein in human esophageal squamous cancer cells with a wild-type p53 gene background.

    PubMed

    Ye, Zhimin; Fang, Jun; Dai, Shujun; Wang, Yuezhen; Fu, Zhenfu; Feng, Wei; Wei, Qichun; Huang, Pintong

    2016-01-28

    MiR-34a has been reported as a non-coding RNA universally expressed in normal old cells and a probable suppressor of diverse cancer cells; however, this miRNA's expression and anti-tumor mechanism in esophageal squamous cancer cells (ESCC) remains unclear. We explored these questions in three human ESCC lines, KYSE-450, KYSE-410, and ECa-109, with wild-type p53 and mutant p53 backgrounds. Through a specific stem-loop RT primer for miR-34a, we examined the relevant expression level of miR-34a in these three cell lines using real-time reverse transcription PCR (qRT-PCR). We found that the expression level of miR-34a induced by the DNA damage agent adrmycin (ADR) was both p53- and time-dependent. Following incubation with miR-34a, cellular growth inhibition was exhibited differently in the three cell lines harbored with different p53 backgrounds. Furthermore, the MTT assay demonstrated an miR-34a-related cytotoxic effect in cell growth. Senescence-associated β-galactosidase (SA-β-Gal) staining was used to examine senescence-like phenotypes induced by miR-34a. Mechanistic investigation suggested that the down-regulation of Sirtuin1 (SIRT1) and up-regulation of p53/p21 contributed to the anti-tumor mechanism of miR-34a in wild-type p53 ECa-109 cells, while neither of the apoptosis-related proteins PARP and caspase-3 caused significant changes. In summary, our findings indicated that the intrinsic expression of miR-34a was relatively low and was expressed differently among different p53 backgrounds and ADR treatment times. The anti-tumor effect of miR-34a was primarily dependent on the regulation of SIRT1 and p53/p21 protein, not apoptosis-associated proteins.

  18. The enhancing effect of genistein on apoptosis induced by trichostatin A in lung cancer cells with wild type p53 genes is associated with upregulation of histone acetyltransferase.

    PubMed

    Wu, Tzu-Chin; Lin, Yi-Chin; Chen, Hsiao-Ling; Huang, Pei-Ru; Liu, Shang-Yu; Yeh, Shu-Lan

    2016-02-01

    Genistein has been shown to enhance the antitumor activity of trichostatin A (TSA) in human lung carcinoma A549 cells. However, whether the combined treatment exerts the same effect in other lung cancer cells is unclear. In the present study we first compared the enhancing effect of genistein on the antitumor effect of TSA in ABC-1, NCI-H460 (H460) and A549 cells. Second, we investigated whether the effects of genistein are associated with increased histone/non-histone protein acetylation. We found that the enhancing effect of genistein on cell-growth-arrest in ABC-1 cells (p53 mutant) was less than in A549 and H460 cells. Genistein enhanced TSA induced apoptosis in A549 and H460 cells rather than in ABC-1 cells. After silencing p53 expression in A549 and H460 cells, the enhancing effect of genistein was diminished. In addition, genistein increased TSA-induced histone H3/H4 acetylation in A549 and H460 cells. Genistein also increased p53 acetylation in H460 cells. The inhibitor of acetyltransferase, anacardic acid, diminished the enhancing effect of genistein on all TSA-induced histone/p53 acetylation and apoptosis. Genistein in combination with TSA increased the expression of p300 protein, an acetyltransferase, in A549 and NCI-H460 cells. Furthermore, we demonstrated that genistein also enhanced the antitumor effect of genistein in A549-tumor-bearing mice. Taken together, these results suggest that the enhancing effects of genistein on TSA-induced apoptosis in lung cancer cells were p53-dependent and were associated with histone/non-histone protein acetylation.

  19. Drug-induced apoptosis in hepatoma cells is mediated by the CD95 (APO-1/Fas) receptor/ligand system and involves activation of wild-type p53.

    PubMed Central

    Müller, M; Strand, S; Hug, H; Heinemann, E M; Walczak, H; Hofmann, W J; Stremmel, W; Krammer, P H; Galle, P R

    1997-01-01

    Chemotherapeutic drugs are cytotoxic by induction of apoptosis in drug-sensitive cells. We investigated the mechanism of bleomycin-induced cytotoxicity in hepatoma cells. At concentrations present in the sera of patients during therapy, bleomycin induced transient accumulation of nuclear wild-type (wt) p53 and upregulated expression of cell surface CD95 (APO-1/Fas) receptor in hepatoma cells carrying wt p53 (HepG2). Bleomycin did not increase CD95 in hepatoma cells with mutated p53 (Huh7) or in hepatoma cells which were p53-/- (Hep3B). In addition, sensitivity towards CD95-mediated apoptosis was also increased in wt p53 positive HepG2 cells. Microinjection of wt p53 cDNA into HepG2 cells had the same effect. In contrast, bleomycin did not enhance susceptibility towards CD95-mediated apoptosis in Huh7 and in Hep3B cells. Furthermore, bleomycin treatment of HepG2 cells increased CD95 ligand (CD95L) mRNA expression. Most notably, bleomycin-induced apoptosis in HepG2 cells was almost completely inhibited by antibodies which interfere with CD95 receptor/ligand interaction. These data suggest that apoptosis induced by bleomycin is mediated, at least in part, by p53-dependent stimulation of the CD95 receptor/ligand system. The same applies to other anti-cancer drugs such as cisplatin and methotrexate. These data may have major consequences for drug treatment of cancer and the explanation of drug sensitivity and resistance. PMID:9022073

  20. Regulation of Mutant p53 Protein Expression

    PubMed Central

    Vijayakumaran, Reshma; Tan, Kah Hin; Miranda, Panimaya Jeffreena; Haupt, Sue; Haupt, Ygal

    2015-01-01

    For several decades, p53 has been detected in cancer biopsies by virtue of its high protein expression level which is considered indicative of mutation. Surprisingly, however, mouse genetic studies revealed that mutant p53 is inherently labile, similar to its wild type (wt) counterpart. Consistently, in response to stress conditions, both wt and mutant p53 accumulate in cells. While wt p53 returns to basal level following recovery from stress, mutant p53 remains stable. In part, this can be explained in mutant p53-expressing cells by the lack of an auto-regulatory loop with Mdm2 and other negative regulators, which are pivotal for wt p53 regulation. Further, additional protective mechanisms are acquired by mutant p53, largely mediated by the co-chaperones and their paralogs, the stress-induced heat shock proteins. Consequently, mutant p53 is accumulated in cancer cells in response to chronic stress and this accumulation is critical for its oncogenic gain of functions (GOF). Building on the extensive knowledge regarding wt p53, the regulation of mutant p53 is unraveling. In this review, we describe the current understanding on the major levels at which mutant p53 is regulated. These include the regulation of p53 protein levels by microRNA and by enzymes controlling p53 proteasomal degradation. PMID:26734569

  1. The Human ARF Cell Cycle Regulatory Gene Promoter Is a CpG Island Which Can Be Silenced by DNA Methylation and Down-Regulated by Wild-Type p53

    PubMed Central

    Robertson, Keith D.; Jones, Peter A.

    1998-01-01

    The INK4a/ARF locus encodes two proteins involved in tumor suppression in a manner virtually unique in mammalian cells. Distinct first exons, driven from separate promoters, splice onto a common exon 2 and 3 but utilize different reading frames to produce two completely distinct proteins, both of which play roles in cell cycle control. INK4a, a critical element of the retinoblastoma gene pathway, binds to and inhibits the activities of CDK4 and CDK6, while ARF, a critical element of the p53 pathway, increases the level of functional p53 via interaction with MDM2. Here we clone and characterize the promoter of the human ARF gene and show that it is a CpG island characteristic of a housekeeping gene which contains numerous Sp1 sites. Both ARF and INK4a are coordinately expressed in cells except when their promoter regions become de novo methylated. In one of these situations, ARF transcription could be reactivated by treatment with the DNA methylation inhibitor 5-aza-2′-deoxycytidine, and the reactivation kinetics of ARF and INK4a were found to differ slightly in a cell line in which both genes were silenced by methylation. The ARF promoter was also found to be highly responsive to E2F1 expression, in keeping with previous results at the RNA level. Lastly, transcription from the ARF promoter was down-regulated by wild-type p53 expression, and the magnitude of the effect correlated with the status of the endogenous p53 gene. This finding points to the existence of an autoregulatory feedback loop between p53, MDM2, and ARF, aimed at keeping p53 levels in check. PMID:9774662

  2. Lack of Major Genome Instability in Tumors of p53 Null Rats

    PubMed Central

    Hermsen, Roel; Toonen, Pim; Kuijk, Ewart; Youssef, Sameh A.; Kuiper, Raoul; van Heesch, Sebastiaan; de Bruin, Alain; Cuppen, Edwin; Simonis, Marieke

    2015-01-01

    Tumorigenesis is often associated with loss of tumor suppressor genes (such as TP53), genomic instability and telomere lengthening. Previously, we generated and characterized a rat p53 knockout model in which the homozygous rats predominantly develop hemangiosarcomas whereas the heterozygous rats mainly develop osteosarcomas. Using genome-wide analyses, we find that the tumors that arise in the heterozygous and homozygous Tp53C273X mutant animals are also different in their genomic instability profiles. While p53 was fully inactivated in both heterozygous and homozygous knockout rats, tumors from homozygous animals show very limited aneuploidy and low degrees of somatic copy number variation as compared to the tumors from heterozygous animals. In addition, complex structural rearrangements such as chromothripsis and breakage-fusion-bridge cycles were never found in tumors from homozygous animals, while these were readily detectable in tumors from heterozygous animals. Finally, we measured telomere length and telomere lengthening pathway activity and found that tumors of homozygous animals have longer telomeres but do not show clear telomerase or alternative lengthening of telomeres (ALT) activity differences as compared to the tumors from heterozygous animals. Taken together, our results demonstrate that host p53 status in this rat p53 knockout model has a large effect on both tumor type and genomic instability characteristics, where full loss of functional p53 is not the main driver of large-scale structural variations. Our results also suggest that chromothripsis primarily occurs under p53 heterozygous rather than p53 null conditions. PMID:25811670

  3. Lack of p53 Augments Antitumor Functions in Cytolytic T Cells.

    PubMed

    Banerjee, Anirban; Thyagarajan, Krishnamurthy; Chatterjee, Shilpak; Chakraborty, Paramita; Kesarwani, Pravin; Soloshchenko, Myroslawa; Al-Hommrani, Mazen; Andrijauskaite, Kristina; Moxley, Kelly; Janakiraman, Harinarayanan; Scheffel, Matthew J; Helke, Kristi; Armenson, Kent; Palanisamy, Viswanathan; Rubinstein, Mark P; Mayer, Elizabeth-Garrett; Cole, David J; Paulos, Chrystal M; Voelkel-Johnson, Christina; Nishimura, Michael I; Mehrotra, Shikhar

    2016-09-15

    Repetitive stimulation of T-cell receptor (TCR) with cognate antigen results in robust proliferation and expansion of the T cells, and also imprints them with replicative senescence signatures. Our previous studies have shown that life-span and antitumor function of T cells can be enhanced by inhibiting reactive oxygen species (ROS) or intervening with ROS-dependent JNK activation that leads to its activation-induced cell death. Because tumor suppressor protein p53 is also a redox active transcription factor that regulates cellular ROS generation that triggers downstream factor-mediating apoptosis, we determined if p53 levels could influence persistence and function of tumor-reactive T cells. Using h3T TCR transgenic mice, with human tyrosinase epitope-reactive T cells developed on p53 knockout (KO) background, we determined its role in regulating antitumor T-cell function. Our data show that as compared with h3T cells, h3T-p53 KO T cells exhibited enhanced glycolytic commitment that correlated with increased proliferation, IFNγ secretion, cytolytic capacity, expression of stemness gene signature, and decreased TGF-β signaling. This increased effector function correlated to the improved control of subcutaneously established murine melanoma after adoptive transfer of p53-KO T cells. Pharmacological inhibition of human TCR-transduced T cells using a combination of p53 inhibitors also potentiated the T-cell effector function and improved persistence. Thus, our data highlight the key role of p53 in regulating the tumor-reactive T-cell response and that targeting this pathway could have potential translational significance in adoptive T-cell therapy. Cancer Res; 76(18); 5229-40. ©2016 AACR.

  4. Lack of p53 augments thymoquinone-induced apoptosis and caspase activation in human osteosarcoma cells.

    PubMed

    Roepke, Martin; Diestel, Antje; Bajbouj, Khuloud; Walluscheck, Diana; Schonfeld, Peter; Roessner, Albert; Schneider-Stock, Regine; Gali-Muhtasib, Hala

    2007-02-01

    We have recently shown that thymoquinone (TQ) is an antineoplastic drug that induces p53-dependent apoptosis in human colon cancer cells. This study evaluated the antiproliferative and pro-apoptotic effects of TQ in two human osteosarcoma cell lines with different p53 mutation status. TQ decreased cell survival dose-dependently and, more significantly, in p53-null MG63 cells (IC(50) = 17 muM) than in p53-mutant MNNG/HOS cells (IC(50) = 38 muM). Cell viability was reduced more selectively in MG63 tumor cells than in normal human osteoblasts. Flow cytometric analysis showed that TQ induced a much greater increase in the PreG(1) (apoptotic) cell population, but no cell cycle arrest in MG63. G(2)/M arrest in MNNG/HOS cells was associated with p21(WAF1) upregulation. Using three DNA damage assays, TQ was confirmed to result in a significantly greater extent of apoptosis in p53 null MG63 cells. Although the Bax/Bcl-2 ratios were not differentially modulated in both cell lines, the mitochondrial pathway appeared to be involved in TQ-induced apoptosis in MG63 by showing the cleavage of caspases-9 and -3. Oxidative stress and mitochondrial O(2)(*-) generation in isolated rat mitochondria were enhanced by TQ as measured by the dose-dependent reduction in aconitase enzyme activity and Amplex Red oxidation respectively. TQ-induced oxidative damage, reflected by an increase in gamma-H2AX foci and increased protein expression levels of gamma-H2AX and the DNA repair enzyme, NBS1, was more pronounced in MNNG/HOS than in MG63. We suggest that the resistance of MNNG/HOS cells to drug-induced apoptosis is caused by the up-regulation of p21(WAF1) by the mutant p53 (transcriptional activity was shown by p53 siRNA treatment) which induces cell cycle arrest and allows to repair DNA damage. Collectively, these findings show that TQ induces p53-independent apoptosis in human osteosarcoma cells. As the loss of p53 function is frequently observed in osteosarcoma patients, our data suggest

  5. p53 directly regulates the transcription of the human frataxin gene and its lack of regulation in tumor cells decreases the utilization of mitochondrial iron.

    PubMed

    Shimizu, Rina; Lan, Nguyen Ngoc; Tai, Tran Tien; Adachi, Yuka; Kawazoe, Asako; Mu, Anfeng; Taketani, Shigeru

    2014-11-01

    Mitochondrial frataxin functions in iron homeostasis, biogenesis of iron-sulfur clusters, protection from oxidative stress and apoptosis, and as a tumor suppressor protein. We examined regulation of the expression of the human frataxin by p53. Pifithrin-α, an inhibitor of p53 function, and knockdown of p53 decreased the level of frataxin mRNA in human kidney HEK 293T cells. The transcriptional activity of the human frataxin gene is enhanced by the proximal promoter containing the p53-responsive element (p53RE) on the gene. Chromatin immunoprecipitation assay and electrophoretic mobility shift assay confirmed the binding of p53 to the human frataxin p53RE. The expression of wild-type p53 in human cancer HeLa cells increased the reporter activity carrying p53RE at the region of -209 to -200bp of the frataxin promoter. Finally, when the HeLa cells overexpressing frataxin were treated with 5-aminolevulinic acid (ALA), there was less accumulation of protoporphyrin than HeLa control cells, and it was sharply decreased by the addition of iron citrate, suggesting that the utilization of mitochondrial iron for heme biosynthesis can be dependent on the level of frataxin. Alternatively, the low expression of frataxin not regulated by p53 in tumor cells lowers the utilization of iron in mitochondria, causing the tumor-specific ALA-induced accumulation of protoporphyrin.

  6. FGFR3b Extracellular Loop Mutation Lacks Tumorigenicity In Vivo but Collaborates with p53/pRB Deficiency to Induce High-grade Papillary Urothelial Carcinoma

    PubMed Central

    Zhou, Haiping; He, Feng; Mendelsohn, Cathy L.; Tang, Moon-shong; Huang, Chuanshu; Wu, Xue-Ru

    2016-01-01

    Missense mutations of fibroblast growth factor receptor 3 (FGFR3) occur in up to 80% of low-grade papillary urothelial carcinoma of the bladder (LGP-UCB) suggesting that these mutations are tumor drivers, although direct experimental evidence is lacking. Here we show that forced expression of FGFR3b-S249C, the most prevalent FGFR3 mutation in human LGP-UCB, in cultured urothelial cells resulted in slightly reduced surface translocation than wild-type FGFR3b, but nearly twice as much proliferation. When we expressed a mouse equivalent of this mutant (FGFR3b-S243C) in urothelia of adult transgenic mice in a tissue-specific and inducible manner, we observed significant activation of AKT and MAPK pathways. This was, however, not accompanied by urothelial proliferation or tumorigenesis over 12 months, due to compensatory tumor barriers in p16-pRB and p19-p53-p21 axes. Indeed, expressing FGFR3b-S249C in cultured human urothelial cells expressing SV40T, which functionally inactivates pRB/p53, markedly accelerated proliferation and cell-cycle progression. Furthermore, expressing FGFR3b-S243C in transgenic mouse urothelium expressing SV40T converted carcinoma-in-situ to high-grade papillary urothelial carcinoma. Together, our study provides new experimental evidence indicating that the FGFR3 mutations have very limited urothelial tumorigenicity and that these mutations must collaborate with other genetic events to drive urothelial tumorigenesis. PMID:27157475

  7. p73 Protein Expression Correlates With Radiation-Induced Apoptosis in the Lack of p53 Response to Radiation Therapy for Cervical Cancer

    SciTech Connect

    Wakatsuki, Masaru; Ohno, Tatsuya Iwakawa, Mayumi; Ishikawa, Hitoshi; Noda, Shuhei; Ohta, Toshie; Kato, Shingo; Tsujii, Hirohiko; Imai, Takashi; Nakano, Takashi

    2008-03-15

    Purpose: p73 belongs to the p53 tumor suppressor family of genes and can inhibit cell growth in a p53-like manner by inducing apoptosis or cell cycle arrest. Here, we investigated whether p73 could compensate for impaired p53 function in apoptosis induced by radiation therapy (RT) for cervical cancer. Methods and Materials: Sixty-eight patients with squamous cell carcinoma of the cervix who received definitive RT combined with (n = 37) or without (n = 31) cisplatin were investigated. Biopsy specimens were excised from the cervical tumor before RT and after 9 Gy. Results: Mean apoptosis index (AI) was 0.93% before RT and 1.97% after 9 Gy with a significant increase (p < 0.001). For all patients, there was a significant correlation between p73 expression positivity after 9 Gy and AI ratio (AI after 9 Gy/AI before RT) (p = 0.021). Forty-one patients were regarded as the p53-responding group according to the expression of p53 after 9 Gy, whereas the remaining 27 patients were regarded as the p53-nonresponding group. A significant correlation between p73 expression after 9 Gy and AI ratio was observed in the p53-non-responding group (p < 0.001) but not in the p53-responding group (p = 0.940). Conclusion: Our results suggest that p73 plays an important role in compensating for the lack of p53 function in radiation-induced apoptosis of cervical cancer.

  8. Effect of oxygen pressure during incubation with a (10)B-carrier on (10)B uptake capacity of cultured p53 wild-type and mutated tumor cells: dependency on p53 status of tumor cells and types of (10)B-carriers.

    PubMed

    Masunaga, Shin-ichiro; Tatebe, Hitoshi; Nishimura, Yasumasa; Tano, Keizo; Sanada, Yu; Moriwaki, Takahiro; Sakurai, Yoshinori; Tanaka, Hiroki; Suzuki, Minoru; Kondo, Natsuko; Maruhashi, Akira; Ono, Koji

    2016-01-01

    Purpose To evaluate the effect of oxygen pressure during incubation with a (10)B-carrier on (10)B uptake capacity of cultured p53 wild-type and mutated tumor cells. Materials and methods Cultured human head and neck squamous cell carcinoma cell line transfected with mutant TP53 (SAS/mp53), or with a neo vector as a control (SAS/neo) was incubated with L-para-boronophenylalanine-(10)B (BPA) or sodium mercaptoundecahydrododecaborate-(10)B (BSH) as a (10)B-carrier at the (10)B concentration of 60 ppm for 24 h under aerobic (20.7% of oxygen) or hypoxic (0.28% of oxygen) conditions. Immediately after incubation, cultured tumor cells received reactor thermal neutron beams, and a cell survival assay was performed. (10)B concentration of cultured SAS/neo or SAS/mp53 cells incubated under aerobic or hypoxic conditions was determined with a thermal neutron guide tube. Results Hypoxic incubation significantly decreased (10)B concentration of cultured cells with a clearer tendency observed following BPA than BSH treatment in both SAS/neo and SAS/mp53 cells. Following neutron beam irradiation, SAS/mp53 cells showed significantly higher relative biological effectiveness values than SAS/neo cells because of the significantly lower radiosensitivity of SAS/mp53 to γ-rays than SAS/neo cells. Conclusion Oxygen pressure during incubation with a (10)B-carrier had a critical impact on (10)B uptake of cultured tumor cells.

  9. Effect of oxygen pressure during incubation with a (10)B-carrier on (10)B uptake capacity of cultured p53 wild-type and mutated tumor cells: dependency on p53 status of tumor cells and types of (10)B-carriers.

    PubMed

    Masunaga, Shin-ichiro; Tatebe, Hitoshi; Nishimura, Yasumasa; Tano, Keizo; Sanada, Yu; Moriwaki, Takahiro; Sakurai, Yoshinori; Tanaka, Hiroki; Suzuki, Minoru; Kondo, Natsuko; Maruhashi, Akira; Ono, Koji

    2016-01-01

    Purpose To evaluate the effect of oxygen pressure during incubation with a (10)B-carrier on (10)B uptake capacity of cultured p53 wild-type and mutated tumor cells. Materials and methods Cultured human head and neck squamous cell carcinoma cell line transfected with mutant TP53 (SAS/mp53), or with a neo vector as a control (SAS/neo) was incubated with L-para-boronophenylalanine-(10)B (BPA) or sodium mercaptoundecahydrododecaborate-(10)B (BSH) as a (10)B-carrier at the (10)B concentration of 60 ppm for 24 h under aerobic (20.7% of oxygen) or hypoxic (0.28% of oxygen) conditions. Immediately after incubation, cultured tumor cells received reactor thermal neutron beams, and a cell survival assay was performed. (10)B concentration of cultured SAS/neo or SAS/mp53 cells incubated under aerobic or hypoxic conditions was determined with a thermal neutron guide tube. Results Hypoxic incubation significantly decreased (10)B concentration of cultured cells with a clearer tendency observed following BPA than BSH treatment in both SAS/neo and SAS/mp53 cells. Following neutron beam irradiation, SAS/mp53 cells showed significantly higher relative biological effectiveness values than SAS/neo cells because of the significantly lower radiosensitivity of SAS/mp53 to γ-rays than SAS/neo cells. Conclusion Oxygen pressure during incubation with a (10)B-carrier had a critical impact on (10)B uptake of cultured tumor cells. PMID:26887694

  10. Functional inactivation of endogenous MDM2 and CHIP by HSP90 causes aberrant stabilization of mutant p53 in human cancer cells.

    PubMed

    Li, Dun; Marchenko, Natalia D; Schulz, Ramona; Fischer, Victoria; Velasco-Hernandez, Talia; Talos, Flaminia; Moll, Ute M

    2011-05-01

    The tight control of wild-type p53 by mainly MDM2 in normal cells is permanently lost in tumors harboring mutant p53, which exhibit dramatic constitutive p53 hyperstabilization that far exceeds that of wild-type p53 tumors. Importantly, mutant p53 hyperstabilization is critical for oncogenic gain of function of mutant p53 in vivo. Current insight into the mechanism of this dysregulation is fragmentary and largely derived from ectopically constructed cell systems. Importantly, mutant p53 knock-in mice established that normal mutant p53 tissues have sufficient enzymatic reserves in MDM2 and other E3 ligases to maintain full control of mutant p53. We find that in human cancer cells, endogenous mutant p53, despite its ability to interact with MDM2, suffers from a profound lack of ubiquitination as the root of its degradation defect. In contrast to wild-type p53, the many mutant p53 proteins which are conformationally aberrant are engaged in complexes with the HSP90 chaperone machinery to prevent its aggregation. In contrast to wild-type p53 cancer cells, we show that in mutant p53 cancer cells, this HSP90 interaction blocks the endogenous MDM2 and CHIP (carboxy-terminus of Hsp70-interacting protein) E3 ligase activity. Interference with HSP90 either by RNA interference against HSF1, the transcriptional regulator of the HSP90 pathway, or by direct knockdown of Hsp90 protein or by pharmacologic inhibition of Hsp90 activity with 17AAG (17-allylamino-17-demethoxygeldanamycin) destroys the complex, liberates mutant p53, and reactivates endogenous MDM2 and CHIP to degrade mutant p53. Of note, 17AAG induces a stronger viability loss in mutant p53 than in wild-type p53 cancer cells. Our data support the rationale that suppression of mutant p53 levels in vivo in established cancers might achieve clinically significant effects.

  11. Lack of sequence variation in sporadic bovine leucosis in regions of tumour suppressor genes p53 and p16.

    PubMed

    Mayr, B; Grüneis, C; Brem, G; Reifinger, M; Schaffner, G; Hochsteiner, W

    2001-08-01

    Regions of the promoter and exons 5-8 of the tumour suppressor gene p53 were analysed in 25 cases of sporadic bovine leucosis. The study included 17 cases of juvenile leucosis, five cases of adult leucosis and three cases of skin leucosis. Exon 2 of tumour suppressor gene p16 was also investigated in the same samples. No sequence variations were present in the analysed areas of the genes. In p53, this fact represents a clear difference in comparison with enzootic bovine leucosis. In p16, no comparative data are available. PMID:11554494

  12. Upregulation of CYP2S1 by oxaliplatin is associated with p53 status in colorectal cancer cell lines.

    PubMed

    Yang, Chao; Zhou, Qian; Li, Minle; Tong, Xuemei; Sun, Jiayi; Qing, Yin; Sun, Liya; Yang, Xuhan; Hu, Xiaowen; Jiang, Jie; Yan, Xiaomei; He, Lin; Wan, Chunling

    2016-01-01

    Oxaliplatin displays a wide spectrum of antitumor activities and is widely used in the treatment of metastatic colorectal cancer (CRC). However, tumor responses to this agent are variable, and the underlying mechanisms are poorly understood. In the present study, oxaliplatin was found to strongly inhibit the growth of HCT116 cells harboring wild-type p53 but to only weakly inhibit SW480 cells, HT29 cells or p53-/- HCT116 cells, which all lack p53 expression. Administration of oxaliplatin significantly induced p53 accumulation and enhanced expression of CYP2S1 in HCT116 cells with wild-type p53. CYP2S1 knockdown conferred a cell survival advantage after oxaliplatin treatment to cells harboring wild-type p53 in vitro and in vivo. Interestingly, enzyme immunoassays, TOPFlash/FOPFlash reporter activity assays and western blotting analysis demonstrated oxaliplatin-mediated downregulation of PGE2 and Wnt/β-catenin signaling in a manner dependent on p53. Moreover, oxaliplatin treatment of mice with subcutaneous tumor xenografts drastically reduced the volume of wild-type p53 HCT116 tumors but had no effect on isogenic p53-/- HCT116 tumors. These results suggest that oxaliplatin exerts its inhibitory effects in human CRC cells via upregulation of CYP2S1 expression in a p53-dependent manner. PMID:27609465

  13. Upregulation of CYP2S1 by oxaliplatin is associated with p53 status in colorectal cancer cell lines

    PubMed Central

    Yang, Chao; Zhou, Qian; Li, Minle; Tong, Xuemei; Sun, Jiayi; Qing, Yin; Sun, Liya; Yang, Xuhan; Hu, Xiaowen; Jiang, Jie; Yan, Xiaomei; He, Lin; Wan, Chunling

    2016-01-01

    Oxaliplatin displays a wide spectrum of antitumor activities and is widely used in the treatment of metastatic colorectal cancer (CRC). However, tumor responses to this agent are variable, and the underlying mechanisms are poorly understood. In the present study, oxaliplatin was found to strongly inhibit the growth of HCT116 cells harboring wild-type p53 but to only weakly inhibit SW480 cells, HT29 cells or p53−/− HCT116 cells, which all lack p53 expression. Administration of oxaliplatin significantly induced p53 accumulation and enhanced expression of CYP2S1 in HCT116 cells with wild-type p53. CYP2S1 knockdown conferred a cell survival advantage after oxaliplatin treatment to cells harboring wild-type p53 in vitro and in vivo. Interestingly, enzyme immunoassays, TOPFlash/FOPFlash reporter activity assays and western blotting analysis demonstrated oxaliplatin-mediated downregulation of PGE2 and Wnt/β-catenin signaling in a manner dependent on p53. Moreover, oxaliplatin treatment of mice with subcutaneous tumor xenografts drastically reduced the volume of wild-type p53 HCT116 tumors but had no effect on isogenic p53−/− HCT116 tumors. These results suggest that oxaliplatin exerts its inhibitory effects in human CRC cells via upregulation of CYP2S1 expression in a p53-dependent manner. PMID:27609465

  14. Regulation of ES cell differentiation by functional and conformational modulation of p53.

    PubMed Central

    Sabapathy, K; Klemm, M; Jaenisch, R; Wagner, E F

    1997-01-01

    Embryonic stem (ES) cell lines were used to examine the role of p53 during in vitro differentiation. Undifferentiated ES cells express high levels of p53 exclusively in the wild-type conformation, immunoprecipitable by monoclonal antibody PAb246, and p53 was found to be functionally active as determined by its ability to bind DNA specifically and to activate transcription of target genes. Differentiation in vitro resulted in a decrease in the levels of p53 and in a shift in its conformational status to the mutant form, detectable by monoclonal antibody PAb240, with a concomitant loss of functional activity. The presence of functional p53 in the undifferentiated ES cells renders them hypersensitive to UV irradiation, whereas the differentiated cells were resistant to UV treatment. ES cells lacking p53 exhibit enhanced proliferation in both the undifferentiated and differentiated state, and apoptosis accompanying differentiation was found to be reduced. Furthermore, wild-type ES cells undergoing apoptosis expressed functional p53. Expression of the temperature-sensitive p53val135 mutant in wild-type ES cells resulted in a reduction of apoptosis accompanying differentiation when it adopted a mutant conformation at 39 degrees C. These data demonstrate that functional inactivation of p53 allows differentiating cells to escape from apoptosis, and suggest that the conformational switch could regulate the inactivation process. PMID:9321401

  15. Senescence, aging, and malignant transformation mediated by p53 in mice lacking the Brca1 full-length isoform.

    PubMed

    Cao, Liu; Li, Wenmei; Kim, Sangsoo; Brodie, Steven G; Deng, Chu-Xia

    2003-01-15

    Senescence may function as a two-edged sword that brings unexpected consequences to organisms. Here we provide evidence to support this theory by showing that the absence of the Brca1 full-length isoform causes senescence in mutant embryos and cultured cells as well as aging and tumorigenesis in adult mice. Haploid loss of p53 overcame embryonic senescence but failed to prevent the adult mutant mice from prematurely aging, which included decreased life span, reduced body fat deposition, osteoporosis, skin atrophy, and decreased wound healing. We further demonstrate that mutant cells that escaped senescence had undergone clonal selection for faster proliferation and extensive genetic/molecular alterations, including overexpression of cyclin D1 and cyclin A and loss of p53. These observations provide the first in vivo evidence that links cell senescence to aging due to impaired function of Brca1 at the expense of tumorigenesis.

  16. Human herpes virus 8 (HHV-8) in Kaposi's sarcoma: lack of association with Bcl-2 and p53 protein expression.

    PubMed Central

    Kennedy, M M; O'Leary, J J; Oates, J L; Lucas, S B; Howells, D D; Picton, S; McGee, J O

    1998-01-01

    AIMS: Human herpes virus 8 (HHV-8) is the infectious agent implicated in the pathogenesis of Kaposi's sarcoma, although its mode of action is unclear. Recent work indicates that the HHV-8 genome encodes a viral Bcl-2 homologue (v-Bcl-2). The aim of this study was to explore Bcl-2 expression in Kaposi's sarcoma using a unique set of HHV-8 positive and negative cases, and to determine whether there is a relation with p53 expression. METHODS: Up to 18 specimens from 17 patients were selected. HHV-8 status was determined using nested polymerase chain reaction (PCR) to the open reading frame (ORF) 26, with further confirmation by TaqMan PCR. In addition, Bcl-2 and p53 immunohistochemistry were performed using standard protocols. RESULTS: The results suggest that Bcl-2 and p53 expression is independent of HHV-8 status. In addition, there does not appear to be a direct correlation with disease stage. CONCLUSIONS: HHV8 histopathogenesis is likely to be a multifactorial complex process, which may be mediated in part by viral genes and apoptosis regulating homologues. PMID:9850339

  17. Radiation response and cell cycle regulation of p53 rescued malignant keratinocytes

    SciTech Connect

    Niemantsverdriet, Maarten; Jongmans, Wim; Backendorf, Claude . E-mail: backendo@chem.leidenuniv.nl

    2005-10-15

    Mutations in the tumor suppressor gene p53 were found in more than 90% of all human squamous cell carcinomas (SCC). To study the function of p53 in a keratinocyte background, a tetracycline-controlled p53 transgene was introduced into a human SCC cell line (SCC15), lacking endogenous p53. Conditional expression of wild-type p53 protein upon withdrawal of tetracycline was accompanied with increased expression of p21{sup WAF1/Cip1} resulting in reduced cell proliferation. Flow-cytometric analysis revealed that these cells were transiently arrested in the G1/S phase of the cell cycle. However, when SCC15 cells expressing p53 were exposed to ionizing radiation (IR), a clear shift from a G1/S to a G2/M cell cycle arrest was observed. This effect was greatly depending on the presence of wild-type p53, as it was not observed to the same extent in SCC15 cells lacking p53. Unexpectedly, the p53- and IR-dependent G2/M cell cycle arrest in the keratinocyte background was not depending on increased expression or stabilization of 14-3-3{sigma}, a p53-regulated effector of G2/M progression in colorectal cancer cells. In keratinocytes, 14-3-3{sigma} (stratifin) is involved in terminal differentiation and its cell cycle function in this cell type might diverge from the one it fulfills in other cellular backgrounds.

  18. Adenovirus-mediated wild-type p53 gene transfer in combination with bronchial arterial infusion for treatment of advanced non-small-cell lung cancer, one year follow-up

    PubMed Central

    Guan, Yong-song; Liu, Yuan; Zou, Qing; He, Qing; La, Zi; Yang, Lin; Hu, Ying

    2009-01-01

    Objective: In the present study, we have examined the safety and efficacy of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) injection in patients with advanced non-small-cell lung cancer (NSCLC) in the combination with the therapy of bronchial arterial infusion (BAI). Methods: A total of 58 patients with advanced NSCLC were enrolled in a non-randomized, two-armed clinical trial. Of which, 19 received a combination treatment of BAI and rAd-p53 (the combo group), while the remaining 39 were treated with only BAI (the control group). Patients were followed up for 12 months, with safety and local response evaluated by the National Cancer Institute’s Common Toxicity Criteria and response evaluation criteria in solid tumor (RECIST), respectively. Time to progression (TTP) and survival rates were also analyzed by Kaplan-Meier method. Results: In the combo group, 19 patients received a total of 49 injections of rAd-p53 and 46 times of BAI, respectively, while 39 patients in the control group received a total of 113 times of BAI. The combination treatment was found to have less adverse events such as anorexia, nausea and emesis, pain, and leucopenia (P<0.05) but more arthralgia, fever, influenza-like symptom, and myalgia (P<0.05), compared with the control group. The overall response rates (complete response (CR)+partial response (PR)) were 47.3% and 38.4% for the combo group and the control group, respectively (P>0.05). Patients in the combo group had a longer TTP than those in the control group (a median 7.75 vs 5.5 months, P=0.018). However, the combination treatment did not lead to better survival, with survival rates at 3, 6, and 12 months in the combo group being 94.74%, 89.47%, and 52.63%, respectively, compared with 92.31%, 69.23%, and 38.83% in the control group (P=0.224). Conclusion: Our results show that the combination of rAd-p53 and BAI was well tolerated in patients with NSCLC and may have improved the quality of life and delayed

  19. Transcriptional activation of the human epidermal growth factor receptor promoter by human p53.

    PubMed Central

    Ludes-Meyers, J H; Subler, M A; Shivakumar, C V; Munoz, R M; Jiang, P; Bigger, J E; Brown, D R; Deb, S P; Deb, S

    1996-01-01

    The human epidermal growth factor receptor (EGFR) promoter is activated by both wild-type and tumor-derived mutant p53. In this communication, we demonstrate that EGFR promoter sequence requirements for transactivation by wild-type and mutant p53 are different. Transient-expression assays with EGFR promoter deletions identified a wild-type human p53 response element, 5'-AGCTAGACGTCCGGGCAGCCCCCGGCG -3', from positions --265 to --239. Electrophoretic mobility shift analysis and DNase I footprinting assays indicated that wild-type p53 binds sequence specifically to the response element. Using circularly permuted DNA fragments containing the p53-binding site, we show that wild-type p53 binding induces DNA bending at this site. We further show that the EGFR promoter is also activated by tumor-derived p53 mutants p53-143A, p53-175H, p53-248W, p53-273H, and p53-281G. However, the transactivation by mutant p53 does not require the wild-type p53-binding site. The minimal EGFR promoter from positions --104 to --20 which does not contain the wild-type p53-binding site is transactivated by the p53 mutants but not by the wild-type protein, showing a difference in the mechanism of transactivation by wild-type and mutant p53. Transactivation of the EGFR promoter by p53 may represent a novel mechanism of cell growth regulation. PMID:8887630

  20. Analysis of p53 mutants for transcriptional activity.

    PubMed Central

    Raycroft, L; Schmidt, J R; Yoas, K; Hao, M M; Lozano, G

    1991-01-01

    The wild-type p53 protein functions to suppress transformation, but numerous mutant p53 proteins are transformation competent. To examine the role of p53 as a transcription factor, we made fusion proteins containing human or mouse p53 sequences fused to the DNA binding domain of a known transcription factor, GAL4. Human and mouse wild-type p53/GAL4 specifically transactivated expression of a chloramphenicol acetyltransferase reporter in HeLa, CHO, and NIH 3T3 cells. Several mutant p53 proteins, including a mouse p53 mutant which is temperature sensitive for suppression, were also analyzed. A p53/GAL4 fusion protein with this mutation was also transcriptionally active only at the permissive temperature. Another mutant p53/GAL4 fusion protein analyzed mimics the mutation inherited in Li-Fraumeni patients. This fusion protein was as active as wild-type p53/GAL4 in our assay. Two human p53 mutants that arose from alterations of the p53 gene in colorectal carcinomas were 30- to 40-fold less effective at activating transcription than wild-type p53/GAL4 fusion proteins. Thus, functional wild-type p53/GAL4 fusion proteins activate transcription, while several transformation competent mutants do so poorly or not at all. Only one mutant p53/GAL4 fusion protein remained transcriptionally active. Images PMID:1944276

  1. Regulatory role of rpL3 in cell response to nucleolar stress induced by Act D in tumor cells lacking functional p53.

    PubMed

    Russo, Annapina; Pagliara, Valentina; Albano, Francesco; Esposito, Davide; Sagar, Vinay; Loreni, Fabrizio; Irace, Carlo; Santamaria, Rita; Russo, Giulia

    2016-01-01

    Many chemotherapeutic drugs cause nucleolar stress and p53-independent pathways mediating the nucleolar stress response are emerging. Here, we demonstrate that ribosomal stress induced by Actinomycin D (Act D) is associated to the up-regulation of ribosomal protein L3 (rpL3) and its accumulation as ribosome-free form in lung and colon cancer cell lines devoid of p53. Free rpL3 regulates p21 expression at transcriptional and post-translational levels through a molecular mechanism involving extracellular-signal-regulated kinases1/2 (ERK1/2) and mouse double minute-2 homolog (MDM2). Our data reveal that rpL3 participates to cell response acting as a critical regulator of apoptosis and cell migration. It is noteworthy that silencing of rpL3 abolishes the cytotoxic effects of Act D suggesting that the loss of rpL3 makes chemotherapy drugs ineffective while rpL3 overexpression associates to a strong increase of Act D-mediated inhibition of cell migration. Taking together our results show that the efficacy of Act D chemotherapy depends on rpL3 status revealing new specific targets involved in the molecular pathways activated by Act D in cancers lacking of p53. Hence, the development of treatments aimed at upregulating rpL3 may be beneficial for the treatment of these cancers.

  2. USP10 regulates p53 localization and stability by deubiquitinating p53.

    PubMed

    Yuan, Jian; Luo, Kuntian; Zhang, Lizhi; Cheville, John C; Lou, Zhenkun

    2010-02-01

    Stability and localization of p53 is essential for its tumor suppressor function. Ubiquitination by the E3 ubiquitin ligase Mdm2 is the major regulatory mechanism of p53, which induces p53 nuclear export and degradation. However, it is unclear whether ubiquitinated cytoplasmic p53 can be recycled. Here, we report that USP10, a cytoplasmic ubiquitin-specific protease, deubiquitinates p53, reversing Mdm2-induced p53 nuclear export and degradation. After DNA damage, USP10 is stabilized, and a fraction of USP10 translocates to the nucleus to activate p53. The translocation and stabilization of USP10 is regulated by ATM -mediated phosphorylation of USP10 at Thr42 and Ser337. Finally, USP10 suppresses tumor cell growth in cells with wild-type p53, with USP10 expression downregulated in a high percentage of clear cell carcinomas, known to have few p53 mutations. These findings reveal USP10 to be a novel regulator of p53, providing an alternative mechanism of p53 inhibition in cancers with wild-type p53.

  3. The Corepressor mSin3a Interacts with the Proline-Rich Domain of p53 and Protects p53 from Proteasome-Mediated Degradation

    PubMed Central

    Zilfou, Jack T.; Hoffman, William H.; Sank, Michael; George, Donna L.; Murphy, Maureen

    2001-01-01

    While the transactivation function of the tumor suppressor p53 is well understood, less is known about the transrepression functions of this protein. We have previously shown that p53 interacts with the corepressor protein mSin3a (hereafter designated Sin3) in vivo and that this interaction is critical for the ability of p53 to repress gene expression. In the present study, we demonstrate that expression of Sin3 results in posttranslational stabilization of both exogenous and endogenous p53, due to an inhibition of proteasome-mediated degradation of this protein. Stabilization of p53 by Sin3 requires the Sin3-binding domain, determined here to map to the proline-rich region of p53, from amino acids 61 to 75. The correlation between Sin3 binding and stabilization supports the hypothesis that this domain of p53 may normally be subject to a destabilizing influence. The finding that a synthetic mutant of p53 lacking the Sin3-binding domain has an increased half-life in cells, compared to wild-type p53, supports this premise. Interestingly, unlike retinoblastoma tumor suppressor protein, MDMX, and p14ARF, Sin3 stabilizes p53 in an MDM2-independent manner. The ability of Sin3 to stabilize p53 is consistent with the model whereby these two proteins must exist on a promoter for extended periods, in order for repression to be an effective mechanism of gene regulation. This model is consistent with our data indicating that, unlike the p300-p53 complex, the p53-Sin3 complex is immunologically detectable for prolonged periods following exposure of cells to agents of DNA damage. PMID:11359905

  4. Lysosomal destabilization in p53-induced apoptosis

    PubMed Central

    Yuan, Xi-Ming; Li, Wei; Dalen, Helge; Lotem, Joseph; Kama, Rachel; Sachs, Leo; Brunk, Ulf T.

    2002-01-01

    The tumor suppressor wild-type p53 can induce apoptosis. M1-t-p53 myeloid leukemic cells have a temperature-sensitive p53 protein that changes its conformation to wild-type p53 after transfer from 37°C to 32°C. We have now found that these cells showed an early lysosomal rupture after transfer to 32°C. Mitochondrial damage, including decreased membrane potential and release of cytochrome c, and the appearance of apoptotic cells occurred later. Lysosomal rupture, mitochondrial damage, and apoptosis were all inhibited by the cytokine IL-6. Some other compounds can also inhibit apoptosis induced by p53. The protease inhibitor N-tosyl-l-phenylalanine chloromethyl ketone inhibited the decrease in mitochondrial membrane potential and cytochrome c release, the Ca2+-ATPase inhibitor thapsigargin inhibited only cytochrome c release, and the antioxidant butylated hydroxyanisole inhibited only the decrease in mitochondrial membrane potential. In contrast to IL-6, these other compounds that inhibited some of the later occurring mitochondrial damage did not inhibit the earlier p53-induced lysosomal damage. The results indicate that apoptosis is induced by p53 through a lysosomal-mitochondrial pathway that is initiated by lysosomal destabilization, and that this pathway can be dissected by using different apoptosis inhibitors. These findings on the induction of p53-induced lysosomal destabilization can also help to formulate new therapies for diseases with apoptotic disorders. PMID:11959917

  5. Resistance of mitochondrial p53 to dominant inhibition

    PubMed Central

    Heyne, Kristina; Schmitt, Katrin; Mueller, Daniel; Armbruester, Vivienne; Mestres, Pedro; Roemer, Klaus

    2008-01-01

    Background Mutation of a tumor suppressor allele leaves the second as backup. Not necessarily so with p53. This homo-tetrameric transcription factor can become contaminated with mutant p53 through hetero-tetramerization. In addition, it can be out-competed by the binding to p53 DNA recognition motifs of transactivation-incompetent isoforms (ΔN and ΔTA-isoforms) of the p53/p63/p73 family of proteins. Countermeasures against such dominant-negative or dominant-inhibitory action might include the evolutionary gain of novel, transactivation-independent tumor suppressor functions by the wild-type monomer. Results Here we have studied, mostly in human HCT116 colon adenocarcinoma cells with an intact p53 pathway, the effects of dominant-inhibitory p53 mutants and of Δex2/3p73, a tumor-associated ΔTA-competitor of wild-type p53, on the nuclear transactivation-dependent and extra-nuclear transactivation-independent functions of wild-type p53. We report that mutant p53 and Δex2/3p73, expressed from a single gene copy per cell, interfere with the stress-induced expression of p53-responsive genes but leave the extra-nuclear apoptosis by mitochondrial p53 largely unaffected, although both wild-type and mutant p53 associate with the mitochondria. In accord with these observations, we present evidence that in contrast to nuclear p53 the vast majority of mitochondrial p53, be it wild-type or mutant, is consisting of monomeric protein. Conclusion The extra-nuclear p53-dependent apoptosis may constitute a fail-safe mechanism against dominant inhibition. PMID:18547443

  6. p53 Cellular Localization and Function in Neuroblastoma

    PubMed Central

    Tweddle, Deborah A.; Malcolm, Archie J.; Cole, Michael; Pearson, Andrew D.J.; Lunec, John

    2001-01-01

    This study investigated the hypothesis that p53 accumulation in neuroblastoma, in the absence of mutation, is associated with functional inactivation, which interferes with downstream mediators of p53 function. To test this hypothesis, p53 expression, location, and functional integrity was examined in neuroblastoma by irradiating 6 neuroblastoma cell lines and studying the effects on p53 transcriptional function, cell cycle arrest, and induction of apoptosis, together with the transcriptional function of p53 after irradiation in three ex vivo primary, untreated neuroblastoma tumors. p53 sequencing showed five neuroblastoma cell lines, two of which were MYCN-amplified, and that all of the tumors were wild-type for p53. p53 was found to be predominantly nuclear before and after irradiation and to up-regulate the p53 responsive genes WAF1 and MDM2 in wild-type p53 cell lines and a poorly-differentiated neuroblastoma, but not a differentiating neuroblastoma or the ganglioneuroblastoma part of a nodular ganglioneuroblastoma in short term culture. This suggests intact p53 transcriptional activity in proliferating neuroblastoma. Irradiation of wild-type p53 neuroblastoma cell lines led to G1 cell cycle arrest in cell lines without MYCN amplification, but not in those with MYCN amplification, despite induction of WAF1. This suggests MYCN amplification may alter downstream mediators of p53 function in neuroblastoma. PMID:11395384

  7. Lysine methylation represses p53 activity in teratocarcinoma cancer cells.

    PubMed

    Zhu, Jiajun; Dou, Zhixun; Sammons, Morgan A; Levine, Arnold J; Berger, Shelley L

    2016-08-30

    TP53 (which encodes the p53 protein) is the most frequently mutated gene among all human cancers, whereas tumors that retain the wild-type TP53 gene often use alternative mechanisms to repress the p53 tumor-suppressive function. Testicular teratocarcinoma cells rarely contain mutations in TP53, yet the transcriptional activity of wild-type p53 is compromised, despite its high expression level. Here we report that in the teratocarcinoma cell line NTera2, p53 is subject to lysine methylation at its carboxyl terminus, which has been shown to repress p53's transcriptional activity. We show that reduction of the cognate methyltransferases reactivates p53 and promotes differentiation of the NTera2 cells. Furthermore, reconstitution of methylation-deficient p53 mutants into p53-depleted NTera2 cells results in elevated expression of p53 downstream targets and precocious loss of pluripotent gene expression compared with re-expression of wild-type p53. Our results provide evidence that lysine methylation of endogenous wild-type p53 represses its activity in cancer cells and suggest new therapeutic possibilities of targeting testicular teratocarcinoma. PMID:27535933

  8. Lysine methylation represses p53 activity in teratocarcinoma cancer cells.

    PubMed

    Zhu, Jiajun; Dou, Zhixun; Sammons, Morgan A; Levine, Arnold J; Berger, Shelley L

    2016-08-30

    TP53 (which encodes the p53 protein) is the most frequently mutated gene among all human cancers, whereas tumors that retain the wild-type TP53 gene often use alternative mechanisms to repress the p53 tumor-suppressive function. Testicular teratocarcinoma cells rarely contain mutations in TP53, yet the transcriptional activity of wild-type p53 is compromised, despite its high expression level. Here we report that in the teratocarcinoma cell line NTera2, p53 is subject to lysine methylation at its carboxyl terminus, which has been shown to repress p53's transcriptional activity. We show that reduction of the cognate methyltransferases reactivates p53 and promotes differentiation of the NTera2 cells. Furthermore, reconstitution of methylation-deficient p53 mutants into p53-depleted NTera2 cells results in elevated expression of p53 downstream targets and precocious loss of pluripotent gene expression compared with re-expression of wild-type p53. Our results provide evidence that lysine methylation of endogenous wild-type p53 represses its activity in cancer cells and suggest new therapeutic possibilities of targeting testicular teratocarcinoma.

  9. Functional characterization of a new p53 mutant generated by homozygous deletion in a neuroblastoma cell line

    SciTech Connect

    Nakamura, Yohko; Ozaki, Toshinori; Niizuma, Hidetaka; Ohira, Miki; Kamijo, Takehiko; Nakagawara, Akira . E-mail: akiranak@chiba-cc.jp

    2007-03-23

    p53 is a key modulator of a variety of cellular stresses. In human neuroblastomas, p53 is rarely mutated and aberrantly expressed in cytoplasm. In this study, we have identified a novel p53 mutant lacking its COOH-terminal region in neuroblastoma SK-N-AS cells. p53 accumulated in response to cisplatin (CDDP) and thereby promoting apoptosis in neuroblastoma SH-SY5Y cells bearing wild-type p53, whereas SK-N-AS cells did not undergo apoptosis. We found another p53 (p53{delta}C) lacking a part of oligomerization domain and nuclear localization signals in SK-N-AS cells. p53{delta}C was expressed largely in cytoplasm and lost the transactivation function. Furthermore, a 3'-part of the p53 locus was homozygously deleted in SK-N-AS cells. Thus, our present findings suggest that p53 plays an important role in the DNA-damage response in certain neuroblastoma cells and it seems to be important to search for p53 mutations outside DNA-binding domain.

  10. Targeting Oncogenic Mutant p53 for Cancer Therapy

    PubMed Central

    Parrales, Alejandro; Iwakuma, Tomoo

    2015-01-01

    Among genetic alterations in human cancers, mutations in the tumor suppressor p53 gene are the most common, occurring in over 50% of human cancers. The majority of p53 mutations are missense mutations and result in the accumulation of dysfunctional p53 protein in tumors. These mutants frequently have oncogenic gain-of-function activities and exacerbate malignant properties of cancer cells, such as metastasis and drug resistance. Increasing evidence reveals that stabilization of mutant p53 in tumors is crucial for its oncogenic activities, while depletion of mutant p53 attenuates malignant properties of cancer cells. Thus, mutant p53 is an attractive druggable target for cancer therapy. Different approaches have been taken to develop small-molecule compounds that specifically target mutant p53. These include compounds that restore wild-type conformation and transcriptional activity of mutant p53, induce depletion of mutant p53, inhibit downstream pathways of oncogenic mutant p53, and induce synthetic lethality to mutant p53. In this review article, we comprehensively discuss the current strategies targeting oncogenic mutant p53 in cancers, with special focus on compounds that restore wild-type p53 transcriptional activity of mutant p53 and those reducing mutant p53 levels. PMID:26732534

  11. Chemical Variations on the p53 Reactivation Theme

    PubMed Central

    Ribeiro, Carlos J. A.; Rodrigues, Cecília M. P.; Moreira, Rui; Santos, Maria M. M.

    2016-01-01

    Among the tumor suppressor genes, p53 is one of the most studied. It is widely regarded as the “guardian of the genome”, playing a major role in carcinogenesis. In fact, direct inactivation of the TP53 gene occurs in more than 50% of malignancies, and in tumors that retain wild-type p53 status, its function is usually inactivated by overexpression of negative regulators (e.g., MDM2 and MDMX). Hence, restoring p53 function in cancer cells represents a valuable anticancer approach. In this review, we will present an updated overview of the most relevant small molecules developed to restore p53 function in cancer cells through inhibition of the p53-MDMs interaction, or direct targeting of wild-type p53 or mutated p53. In addition, optimization approaches used for the development of small molecules that have entered clinical trials will be presented. PMID:27187415

  12. Impact of p53 status on heavy-ion radiation-induced micronuclei in circulating erythrocytes

    NASA Technical Reports Server (NTRS)

    Chang, P. Y.; Torous, D.; Lutze-Mann, L.; Winegar, R.

    2000-01-01

    Transgenic mice that differed in their p53 genetic status were exposed to an acute dose of highly charged and energetic (HZE) iron particle radiation. Micronuclei (MN) in two distinct populations of circulating peripheral blood erythrocytes, the immature reticulocytes (RETs) and the mature normochromatic erythrocytes (NCEs), were measured using a simple and efficient flow cytometric procedure. Our results show significant elevation in the frequency of micronucleated RETs (%MN-RETs) at 2 and 3 days post-radiation. At 3 days post-irradiation, the magnitude of the radiation-induced MN-RET was 2.3-fold higher in the irradiated p53 wild-type animals compared to the unirradiated controls, 2.5-fold higher in the p53 hemizygotes and 4.3-fold higher in the p53 nullizygotes. The persistence of this radiation-induced elevation of MN-RETs is dependent on the p53 genetic background of the animal. In the p53 wild-type and p53 hemizygotes, %MN-RETs returned to control levels by 9 days post-radiation. However, elevated levels of %MN-RETs in p53 nullizygous mice persisted beyond 56 days post-radiation. We also observed elevated MN-NCEs in the peripheral circulation after radiation, but the changes in radiation-induced levels of MN-NCEs appear dampened compared to those of the MN-RETs for all three strains of animals. These results suggest that the lack of p53 gene function may play a role in the iron particle radiation-induced genomic instability in stem cell populations in the hematopoietic system.

  13. Coexpression of p53 and Ki 67 and lack of c-erbB2 expression in oral leukoplakias in India.

    PubMed

    Kumar, Priya; Kane, Shubhada; Rathod, Govind Pomaji

    2012-01-01

    Oral cancer is commonly preceded by premalignant lesions and conditions. The clinician's ability to identify lesions at an increased risk of cancer development is critical for its control. The purpose of this study was to compare the expression of tumor suppressor gene p53, proliferation marker Ki-67, and oncogene c-erbB2 and to evaluate the relevance of their co-expression in the diagnosis of, and prognosis for, oral leukoplakia. In the present study, the expression of biomarkers was studied immunohistochemically in 55 cases of leukoplakia (26 without dysplasia, 29 with dysplasia) and 10 cases of normal epithelia. The Labeling Indices (LI) of p53 and Ki-67 were found to increase significantly with an increase in the grade of dysplasia. A significant correlation was also found between the LI of p53 and that of Ki-67. It was also observed that c-erbB2 expression was only cytoplasmic, indicating incomplete receptor degradation. Hence, it can be concluded from the present study that the increased expression of p53 and Ki-67 with an increase in the grade of dysplasia suggests that their co-expression may be used for the identification of high-risk lesions. Also, c-erbB2 has no pathogenetic role in early carcinogenesis in the studied population, although incomplete receptor degradation, as evidenced by cytoplasmic staining, may indicate an early change.

  14. p53 mutations increase resistance to ionizing radiation

    SciTech Connect

    Lee, J.M. ); Bernstein, A. Univ. of Toronto, Ontario )

    1993-06-15

    Mouse and human tumors of diverse origin frequently have somatically acquired mutations or rearrangements of the p53 gene, or they have lost one or both copies of the gene. Although wild-type p53 protein is believed to function as a tumor-suppressor gene, it is as yet unclear how p53 mutations lead to neoplastic development. Wild-type p53 has been postulated to play a role in DNA repair, suggesting that expression of mutant forms of p53 might alter cellular resistance to the DNA damage caused by [gamma] radiation. Moreover, p53 is thought to function as a cell cycle checkpoint after irradiation, also suggesting that mutant p53 might change the cellular proliferative response to radiation. The authors have used transgenic mice expressing one of two mutant alleles of p53 to test this prediction. Their results show that expression of both mutant variants of the mouse p53 gene significantly increases the cellular resistance of a variety of hematopoietic cell lineages to [gamma] radiation. These observations provide direct evidence that p53 mutations affect the cellular response to DNA damage, either by increasing DNA repair processes or, possibly, by increasing cellular tolerance to DNA damage. The association of p53 mutations with increased radioresistance suggests possible mechanisms through which alterations in the p53 gene might lead to oncogenic transformation. 53 refs., 5 figs.

  15. Mutant p53: One, No One, and One Hundred Thousand

    PubMed Central

    Walerych, Dawid; Lisek, Kamil; Del Sal, Giannino

    2015-01-01

    Encoded by the mutated variants of the TP53 tumor suppressor gene, mutant p53 proteins are getting an increased experimental support as active oncoproteins promoting tumor growth and metastasis. p53 missense mutant proteins are losing their wild-type tumor suppressor activity and acquire oncogenic potential, possessing diverse transforming abilities in cell and mouse models. Whether various mutant p53s differ in their oncogenic potential has been a matter of debate. Recent discoveries are starting to uncover the existence of mutant p53 downstream programs that are common to different mutant p53 variants. In this review, we discuss a number of studies on mutant p53, underlining the advantages and disadvantages of alternative experimental approaches that have been used to describe the numerous mutant p53 gain-of-function activities. Therapeutic possibilities are also discussed, taking into account targeting either individual or multiple mutant p53 proteins in human cancer. PMID:26734571

  16. p53 acetylation enhances Taxol-induced apoptosis in human cancer cells.

    PubMed

    Kim, Jae Hyeong; Yoon, Eun-Kyung; Chung, Hye-Jin; Park, Seong-Yeol; Hong, Kyeong-Man; Lee, Chang-Hun; Lee, Yeon-Su; Choi, Kyungho; Yang, Young; Kim, Kyungtae; Kim, In-Hoo

    2013-01-01

    Microtubule inhibitors (MTIs) such as Taxol have been used for treating various malignant tumors. Although MTIs have been known to induce cell death through mitotic arrest, other mechanisms can operate in MTI-induced cell death. Especially, the role of p53 in this process has been controversial for a long time. Here we investigated the function of p53 in Taxol-induced apoptosis using p53 wild type and p53 null cancer cell lines. p53 was upregulated upon Taxol treatment in p53 wild type cells and deletion of p53 diminished Taxol-induced apoptosis. p53 target proteins including MDM2, p21, BAX, and β-isoform of PUMA were also upregulated by Taxol in p53 wild type cells. Conversely, when the wild type p53 was re-introduced into two different p53 null cancer cell lines, Taxol-induced apoptosis was enhanced. Among post-translational modifications that affect p53 stability and function, p53 acetylation, rather than phosphorylation, increased significantly in Taxol-treated cells. When acetylation was enhanced by anti-Sirt1 siRNA or an HDAC inhibitor, Taxol-induced apoptosis was enhanced, which was not observed in p53 null cells. When an acetylation-defective mutant of p53 was re-introduced to p53 null cells, apoptosis was partially reduced compared to the re-introduction of the wild type p53. Thus, p53 plays a pro-apoptotic role in Taxol-induced apoptosis and acetylation of p53 contributes to this pro-apoptotic function in response to Taxol in several human cancer cell lines, suggesting that enhancing acetylation of p53 could have potential implication for increasing the sensitivity of cancer cells to Taxol.

  17. Clonal dynamics following p53 loss of heterozygosity in Kras-driven cancers.

    PubMed

    Muzumdar, Mandar Deepak; Dorans, Kimberly Judith; Chung, Katherine Minjee; Robbins, Rebecca; Tammela, Tuomas; Gocheva, Vasilena; Li, Carman Man-Chung; Jacks, Tyler

    2016-01-01

    Although it has become increasingly clear that cancers display extensive cellular heterogeneity, the spatial growth dynamics of genetically distinct clones within developing solid tumours remain poorly understood. Here we leverage mosaic analysis with double markers (MADM) to trace subclonal populations retaining or lacking p53 within oncogenic Kras-initiated lung and pancreatic tumours. In both models, p53 constrains progression to advanced adenocarcinomas. Comparison of lineage-related p53 knockout and wild-type clones reveals a minor role of p53 in suppressing cell expansion in lung adenomas. In contrast, p53 loss promotes both the initiation and expansion of low-grade pancreatic intraepithelial neoplasia (PanINs), likely through differential expression of the p53 regulator p19ARF. Strikingly, lineage-related cells are often dispersed in lung adenomas and PanINs, contrasting with more contiguous growth of advanced subclones. Together, these results support cancer type-specific suppressive roles of p53 in early tumour progression and offer insights into clonal growth patterns during tumour development. PMID:27585860

  18. Clonal dynamics following p53 loss of heterozygosity in Kras-driven cancers

    PubMed Central

    Muzumdar, Mandar Deepak; Dorans, Kimberly Judith; Chung, Katherine Minjee; Robbins, Rebecca; Tammela, Tuomas; Gocheva, Vasilena; Li, Carman Man-Chung; Jacks, Tyler

    2016-01-01

    Although it has become increasingly clear that cancers display extensive cellular heterogeneity, the spatial growth dynamics of genetically distinct clones within developing solid tumours remain poorly understood. Here we leverage mosaic analysis with double markers (MADM) to trace subclonal populations retaining or lacking p53 within oncogenic Kras-initiated lung and pancreatic tumours. In both models, p53 constrains progression to advanced adenocarcinomas. Comparison of lineage-related p53 knockout and wild-type clones reveals a minor role of p53 in suppressing cell expansion in lung adenomas. In contrast, p53 loss promotes both the initiation and expansion of low-grade pancreatic intraepithelial neoplasia (PanINs), likely through differential expression of the p53 regulator p19ARF. Strikingly, lineage-related cells are often dispersed in lung adenomas and PanINs, contrasting with more contiguous growth of advanced subclones. Together, these results support cancer type-specific suppressive roles of p53 in early tumour progression and offer insights into clonal growth patterns during tumour development. PMID:27585860

  19. Encapsulated Brucella ovis Lacking a Putative ATP-Binding Cassette Transporter (ΔabcBA) Protects against Wild Type Brucella ovis in Rams.

    PubMed

    Silva, Ana Patrícia C; Macêdo, Auricélio A; Costa, Luciana F; Rocha, Cláudia E; Garcia, Luize N N; Farias, Jade R D; Gomes, Priscilla P R; Teixeira, Gustavo C; Fonseca, Kessler W J; Maia, Andréa R F; Neves, Gabriela G; Romão, Everton L; Silva, Teane M A; Mol, Juliana P S; Oliveira, Renata M; Araújo, Márcio S S; Nascimento, Ernane F; Martins-Filho, Olindo A; Brandão, Humberto M; Paixão, Tatiane A; Santos, Renato L

    2015-01-01

    This study aimed to evaluate protection induced by the vaccine candidate B. ovis ΔabcBA against experimental challenge with wild type B. ovis in rams. Rams were subcutaneously immunized with B. ovis ΔabcBA encapsulated with sterile alginate or with the non encapsulated vaccine strain. Serum, urine, and semen samples were collected during two months after immunization. The rams were then challenged with wild type B. ovis (ATCC25840), and the results were compared to non immunized and experimentally challenged rams. Immunization, particularly with encapsulated B. ovis ΔabcBA, prevented infection, secretion of wild type B. ovis in the semen and urine, shedding of neutrophils in the semen, and the development of clinical changes, gross and microscopic lesions induced by the wild type B. ovis reference strain. Collectively, our data indicates that the B. ovis ΔabcBA strain is an exceptionally good vaccine strain for preventing brucellosis caused by B. ovis infection in rams. PMID:26317399

  20. Encapsulated Brucella ovis Lacking a Putative ATP-Binding Cassette Transporter (ΔabcBA) Protects against Wild Type Brucella ovis in Rams

    PubMed Central

    Silva, Ana Patrícia C.; Macêdo, Auricélio A.; Costa, Luciana F.; Rocha, Cláudia E.; Garcia, Luize N. N.; Farias, Jade R. D.; Gomes, Priscilla P. R.; Teixeira, Gustavo C.; Fonseca, Kessler W. J.; Maia, Andréa R. F.; Neves, Gabriela G.; Romão, Everton L.; Silva, Teane M. A.; Mol, Juliana P. S.; Oliveira, Renata M.; Araújo, Márcio S. S.; Nascimento, Ernane F.; Martins-Filho, Olindo A.; Brandão, Humberto M.; Paixão, Tatiane A.; Santos, Renato L.

    2015-01-01

    This study aimed to evaluate protection induced by the vaccine candidate B. ovis ΔabcBA against experimental challenge with wild type B. ovis in rams. Rams were subcutaneously immunized with B. ovis ΔabcBA encapsulated with sterile alginate or with the non encapsulated vaccine strain. Serum, urine, and semen samples were collected during two months after immunization. The rams were then challenged with wild type B. ovis (ATCC25840), and the results were compared to non immunized and experimentally challenged rams. Immunization, particularly with encapsulated B. ovis ΔabcBA, prevented infection, secretion of wild type B. ovis in the semen and urine, shedding of neutrophils in the semen, and the development of clinical changes, gross and microscopic lesions induced by the wild type B. ovis reference strain. Collectively, our data indicates that the B. ovis ΔabcBA strain is an exceptionally good vaccine strain for preventing brucellosis caused by B. ovis infection in rams. PMID:26317399

  1. Targeting p53 Null Neuroblastomas through RLIP76**

    PubMed Central

    Singhal, Jyotsana; Yadav, Sushma; Nagaprashantha, Lokesh Dalasanur; Vatsyayan, Rit; Singhal, Sharad S; Awasthi, Sanjay

    2011-01-01

    The search for p53-independent mechanism of cancer cell killing is highly relevant to pediatric neuroblastomas, where successful therapy is limited by its transformation into p53 mutant and a highly drug-resistant neoplasm. Our studies on the drug-resistant p53 mutant as compared with drug-resistant p53 wild-type neuroblastoma revealed a novel mechanism for resistance to apoptosis: a direct role of p53 in regulating the cellular concentration of pro-apoptotic alkenals by functioning as a specific and saturable allosteric inhibitor of the alkenal-glutathione-conjugate transporter, RLIP76. The RLIP76-p53 complex was demonstrated both using immuno-precipitation analyses of purified proteins as well as by immuno-fluorescence analysis. Drug transport studies revealed that p53 inhibited both basal and PKCα stimulated transport of glutathione-conjugates of 4HNE (GS-HNE) and cisplatin. Drug resistance was significantly greater for p53 mutant as compared with p53 wild-type neuroblastoma cell lines, but both were susceptible to depletion of RLIP76 by antisense alone. In addition, inhibition of RLIP76 significantly enhanced the cytotoxicity of cisplatin. Taken together, these studies provide powerful evidence for a novel mechanism for drug and apoptosis resistance in p53 mutant neuroblastoma, based on a model of regulation of p53 induced apoptosis by RLIP76, where p53 is a saturable and specific allosteric inhibitor of RLIP76, and p53 loss results in over-expression of RLIP76; thus, in the absence of p53, the drug and glutathione-conjugate transport activities of RLIP76 are enhanced. Most importantly, our findings strongly indicate RLIP76 as a novel target for therapy of drug-resistant and p53 mutant neuroblastoma. PMID:21411502

  2. Targeting the p53 Pathway in Ewing Sarcoma

    PubMed Central

    Neilsen, Paul M.; Pishas, Kathleen I.; Callen, David F.; Thomas, David M.

    2011-01-01

    The p53 tumour suppressor plays a pivotal role in the prevention of oncogenic transformation. Cancers frequently evade the potent antitumour surveillance mechanisms of p53 through mutation of the TP53 gene, with approximately 50% of all human malignancies expressing dysfunctional, mutated p53 proteins. Interestingly, genetic lesions in the TP53 gene are only observed in 10% of Ewing Sarcomas, with the majority of these sarcomas expressing a functional wild-type p53. In addition, the p53 downstream signaling pathways and DNA-damage cell cycle checkpoints remain functionally intact in these sarcomas. This paper summarizes recent insights into the functional capabilities and regulation of p53 in Ewing Sarcoma, with a particular focus on the cross-talk between p53 and the EWS-FLI1 gene rearrangement frequently associated with this disease. The development of several activators of p53 is discussed, with recent evidence demonstrating the potential of small molecule p53 activators as a promising systemic therapeutic approach for the treatment of Ewing Sarcomas with wild-type p53. PMID:21197471

  3. p53 Loss in MYC-Driven Neuroblastoma Leads to Metabolic Adaptations Supporting Radioresistance.

    PubMed

    Yogev, Orli; Barker, Karen; Sikka, Arti; Almeida, Gilberto S; Hallsworth, Albert; Smith, Laura M; Jamin, Yann; Ruddle, Ruth; Koers, Alexander; Webber, Hannah T; Raynaud, Florence I; Popov, Sergey; Jones, Chris; Petrie, Kevin; Robinson, Simon P; Keun, Hector C; Chesler, Louis

    2016-05-15

    Neuroblastoma is the most common childhood extracranial solid tumor. In high-risk cases, many of which are characterized by amplification of MYCN, outcome remains poor. Mutations in the p53 (TP53) tumor suppressor are rare at diagnosis, but evidence suggests that p53 function is often impaired in relapsed, treatment-resistant disease. To address the role of p53 loss of function in the development and pathogenesis of high-risk neuroblastoma, we generated a MYCN-driven genetically engineered mouse model in which the tamoxifen-inducible p53ER(TAM) fusion protein was expressed from a knock-in allele (Th-MYCN/Trp53(KI)). We observed no significant differences in tumor-free survival between Th-MYCN mice heterozygous for Trp53(KI) (n = 188) and Th-MYCN mice with wild-type p53 (n = 101). Conversely, the survival of Th-MYCN/Trp53(KI/KI) mice lacking functional p53 (n = 60) was greatly reduced. We found that Th-MYCN/Trp53(KI/KI) tumors were resistant to ionizing radiation (IR), as expected. However, restoration of functional p53ER(TAM) reinstated sensitivity to IR in only 50% of Th-MYCN/Trp53(KI/KI) tumors, indicating the acquisition of additional resistance mechanisms. Gene expression and metabolic analyses indicated that the principal acquired mechanism of resistance to IR in the absence of functional p53 was metabolic adaptation in response to chronic oxidative stress. Tumors exhibited increased antioxidant metabolites and upregulation of glutathione S-transferase pathway genes, including Gstp1 and Gstz1, which are associated with poor outcome in human neuroblastoma. Accordingly, glutathione depletion by buthionine sulfoximine together with restoration of p53 activity resensitized tumors to IR. Our findings highlight the complex pathways operating in relapsed neuroblastomas and the need for combination therapies that target the diverse resistance mechanisms at play. Cancer Res; 76(10); 3025-35. ©2016 AACR.

  4. The state of the p53 and retinoblastoma genes in human cervical carcinoma cell lines

    SciTech Connect

    Scheffner, M.; Muenger, K.; Byrne, J.C.; Howley, P.M. )

    1991-07-01

    Human cervical carcinoma cell lines that were either positive or negative for human papillomavirus (HPV) DNA sequences were analyzed for evidence of mutation of the p53 and retinoblastoma genes. Each of five HPV-positive cervical cancer cell lines expressed normal pRB and low levels of wild-type p53 proteins, which are presumed to be altered in function as a consequence of association with HPV E7 and E6 oncoproteins, respectively. In contrast, mutations were identified in the p53 and RB genes expressed in the C-33A and HT-3 cervical cancer cell lines, which lack HPV DNA sequences. Mutations in the p53 genes mapped to codon 273 and codon 245 in the C33-A and HT-3 cell lines, respectively, located in the highly conserved regions of p53, where mutations appear in a variety of human cancers. Mutations in RB occurred at splice junctions, resulting in in-frame deletions, affecting exons 13 and 20 in the HT-3 and C-33A cell lines, respectively. These mutations resulted in aberrant proteins that were not phosphorylated and were unable to complex with the adenovirus E1A oncoprotein. These results support the hypothesis that the inactivation of the normal functions of the tumor-suppressor proteins pRB and p53 are important steps in human cervical carcinogenesis, either by mutation or from complex formation with the HPV E6 and E7 oncoproteins.

  5. Stochastic modelling of tumorigenesis in p53 deficient mice.

    PubMed Central

    Mao, J. H.; Lindsay, K. A.; Balmain, A.; Wheldon, T. E.

    1998-01-01

    Stochastic models of tumorigenesis have been developed to investigate the implications of experimental data on tumour induction in wild-type and p53-deficient mice for tumorigenesis mechanisms. Conventional multistage models in which inactivation of each p53 allele represents a distinct stage predict excessively large numbers of tumours in p53-deficient genotypes, allowing this category of model to be rejected. Multistage multipath models, in which a p53-mediated pathway co-exists with one or more p53-independent pathways, are consistent with the data, although these models require unknown pathways and do not enable age-specific curves of tumour appearance to be computed. An alternative model that fits the data is the 'multigate' model in which tumorigenesis results from a small number of gate-pass (enabling) events independently of p53 status. The role of p53 inactivation is as a rate modifier that accelerates the gate-pass events. This model implies that wild-type p53 acts as a 'caretaker' to maintain genetic uniformity in cell populations, and that p53 inactivation increases the probability of occurrence of a viable cellular mutant by a factor of about ten. The multigate model predicts a relationship between the time pattern of tumour occurrence and tumour genotype that should be experimentally testable. Stochastic modelling may help to distinguish 'gatekeeper' and 'caretaker' genes in other tumorigenic pathays. PMID:9460995

  6. Antifolates targeting purine synthesis allow entry of tumor cells into S phase regardless of p53 function.

    PubMed

    Bronder, Julie L; Moran, Richard G

    2002-09-15

    The class of folate antimetabolites typified by (6R)-dideazatetrahydrofolate (lometrexol, DDATHF) are specific inhibitors of de novo purine synthesis because of potent inhibition of glycinamide ribonucleotide formyltransferase (GART) but do not induce detectable levels of DNA strand breaks. As such, they are a test case of the concept that ribonucleotide depletion can be sensed by p53, resulting in a G(1) cell cycle block. The GART inhibitors have been proposed previously to be cytotoxic in tumor cells lacking p53 function but only cytostatic in p53 wild-type tumor cells. We have investigated this concept. Cell cycle progression into and through S phase was slowed by DDATHF, but both p53 +/+ and -/- human colon carcinoma cells entered and completed one S phase in the presence of drug. This inability of p53 to initiate a G(1) arrest after DDATHF treatment was mirrored by an independence of the cytotoxicity of DDATHF on p53 function. We conclude that carcinoma cells are killed equally well by DDATHF and related compounds whether or not the p53 pathway is intact and that the utility of GART inhibitors would not be limited to p53-negative tumors. PMID:12234990

  7. Expression of full-length p53 and its isoform Δp53 in breast carcinomas in relation to mutation status and clinical parameters

    PubMed Central

    Baumbusch, Lars O; Myhre, Simen; Langerød, Anita; Bergamaschi, Anna; Geisler, Stephanie B; Lønning, Per E; Deppert, Wolfgang; Dornreiter, Irene; Børresen-Dale, Anne-Lise

    2006-01-01

    Background The tumor suppressor gene p53 (TP53) controls numerous signaling pathways and is frequently mutated in human cancers. Novel p53 isoforms suggest alternative splicing as a regulatory feature of p53 activity. Results In this study we have analyzed mRNA expression of both wild-type and mutated p53 and its respective Δp53 isoform in 88 tumor samples from breast cancer in relation to clinical parameters and molecular subgroups. Three-dimensional structure differences for the novel internally deleted p53 isoform Δp53 have been predicted. We confirmed the expression of Δp53 mRNA in tumors using quantitative real-time PCR technique. The mRNA expression levels of the two isoforms were strongly correlated in both wild-type and p53-mutated tumors, with the level of the Δp53 isoform being approximately 1/3 of that of the full-length p53 mRNA. Patients expressing mutated full-length p53 and non-mutated (wild-type) Δp53, "mutational hybrids", showed a slightly higher frequency of patients with distant metastasis at time of diagnosis compared to other patients with p53 mutations, but otherwise did not differ significantly in any other clinical parameter. Interestingly, the p53 wild-type tumors showed a wide range of mRNA expression of both p53 isoforms. Tumors with mRNA expression levels in the upper or lower quartile were significantly associated with grade and molecular subtypes. In tumors with missense or in frame mutations the mRNA expression levels of both isoforms were significantly elevated, and in tumors with nonsense, frame shift or splice mutations the mRNA levels were significantly reduced compared to those expressing wild-type p53. Conclusion Expression of p53 is accompanied by the functionally different isoform Δp53 at the mRNA level in cell lines and human breast tumors. Investigations of "mutational hybrid" patients highlighted that wild-type Δp53 does not compensates for mutated p53, but rather may be associated with a worse prognosis. In tumors

  8. Ultrastructure - function relationship in Chlamydomonas reinhartii thylakoids, by means of a comparison between the wild type and the F34 mutant which lacks the photosystem II reaction center.

    PubMed

    Olive, J; Wollman, F A; Bennoun, P; Recouvreur, M

    1979-08-31

    The F34 mutant strain of Chlamydomonas reinhartii is deficient in photosystem II reaction centers. The E fracture faces of the thylakoid membranes of this mutant show a considerable reduction in the number of particles present ant in their size compared with the wild type. We conclude that the polypeptides associated with photosystem II reaction centers, which are missing in SDS polyacrylamide gel electrophoresis patterns of proteins from this mutant strain, are part of the EF particles and are required for assembly of these particles. PMID:492157

  9. Proteasome inhibitors suppress the protein expression of mutant p53.

    PubMed

    Halasi, Marianna; Pandit, Bulbul; Gartel, Andrei L

    2014-01-01

    Tumor suppressor p53 is one of the most frequently mutated genes in cancer, with almost 50% of all types of cancer expressing a mutant form of p53. p53 transactivates the expression of its primary negative regulator, HDM2. HDM2 is a ubiquitin ligase, which initiates the proteasomal degradation of p53 following ubiquitination. Proteasome inhibitors, by targeting the ubiquitin proteasome pathway inhibit the degradation of the majority of cellular proteins including wild-type p53. In contrast, in this study we found that the protein expression of mutant p53 was suppressed following treatment with established or novel proteasome inhibitors. Furthermore, for the first time we demonstrated that Arsenic trioxide, which was previously shown to suppress mutant p53 protein level, exhibits proteasome inhibitory activity. Proteasome inhibitor-mediated suppression of mutant p53 was partially rescued by the knockdown of HDM2, suggesting that the stabilization of HDM2 by proteasome inhibitors might be responsible for mutant p53 suppression to some extent. This study suggests that suppression of mutant p53 is a general property of proteasome inhibitors and it provides additional rationale to use proteasome inhibitors for the treatment of tumors with mutant p53.

  10. Proteasome inhibitors suppress the protein expression of mutant p53

    PubMed Central

    Halasi, Marianna; Pandit, Bulbul; Gartel, Andrei L

    2014-01-01

    Tumor suppressor p53 is one of the most frequently mutated genes in cancer, with almost 50% of all types of cancer expressing a mutant form of p53. p53 transactivates the expression of its primary negative regulator, HDM2. HDM2 is a ubiquitin ligase, which initiates the proteasomal degradation of p53 following ubiquitination. Proteasome inhibitors, by targeting the ubiquitin proteasome pathway inhibit the degradation of the majority of cellular proteins including wild-type p53. In contrast, in this study we found that the protein expression of mutant p53 was suppressed following treatment with established or novel proteasome inhibitors. Furthermore, for the first time we demonstrated that Arsenic trioxide, which was previously shown to suppress mutant p53 protein level, exhibits proteasome inhibitory activity. Proteasome inhibitor-mediated suppression of mutant p53 was partially rescued by the knockdown of HDM2, suggesting that the stabilization of HDM2 by proteasome inhibitors might be responsible for mutant p53 suppression to some extent. This study suggests that suppression of mutant p53 is a general property of proteasome inhibitors and it provides additional rationale to use proteasome inhibitors for the treatment of tumors with mutant p53. PMID:25485499

  11. Controlling the Mdm2-Mdmx-p53 Circuit

    PubMed Central

    Waning, David L.; Lehman, Jason A.; Batuello, Christopher N.; Mayo, Lindsey D.

    2010-01-01

    The p53 tumor suppressor is a key protein in maintaining the integrity of the genome by inducing either cell cycle arrest or apoptosis following cellular stress signals. Two human family members, Mdm2 and Mdmx, are primarily responsible for inactivating p53 transcription and targeting p53 protein for ubiquitin-mediated degradation. In response to genotoxic stress, post-translational modifications to p53, Mdm2 and Mdmx stabilize and activate p53. The role that phosphorylation of these molecules plays in the cellular response to genotoxic agents has been extensively studied with respect to cancer biology. In this review, we discuss the main phosphorylation events of p53, Mdm2 and Mdmx in response to DNA damage that are important for p53 stability and activity. In tumors that harbor wild-type p53, reactivation of p53 by modulating both Mdm2 and Mdmx signaling is well suited as a therapeutic strategy. However, the rationale for development of kinase inhibitors that target the Mdm2-Mdmx-p53 axis must be carefully considered since modulation of certain kinase signaling pathways has the potential to destabilize and inactivate p53. PMID:20651945

  12. Effects of chronic deoxynivalenol exposure on p53 heterozygous and p53 homozygous mice.

    PubMed

    Bondy, G S; Coady, L; Curran, I; Caldwell, D; Armstrong, C; Aziz, S A; Nunnikhoven, A; Gannon, A M; Liston, V; Shenton, J; Mehta, R

    2016-10-01

    Deoxynivalenol (DON) is a secondary metabolite associated with Fusarium species pathogenic to important food crops. A two-year feeding study reported that DON was non-carcinogenic in B6C3F1 mice. The present study was conducted to further characterize the chronic effects of DON by exposing cancer-prone transgenic p53 heterozygous (p53+/-) male mice and p53 homozygous (p53+/+) male mice to 0, 1, 5, or 10 mg DON/kg in diet for 26 weeks. Gross and microscopic organ-specific neoplastic and non-neoplastic changes and expression profiles of key hepatic and renal genes were assessed. Few toxicologic differences between p53+/+ and p53+/- mice were observed, and no tumours were observed due to DON. The results indicated that DON was non-carcinogenic and that reduced expression of the p53 gene did not play a key role in responses to DON toxicity. The lack of inflammatory and proliferative lesions in mice may be attributed to the anorectic effects of DON, which resulted in dose-dependent reductions in body weight in p53+/+ and p53+/- mice. Hepatic and renal gene expression analyses confirmed that chronic exposure to DON was noninflammatory. The effects of 26-week DON exposure on p53+/+ and p53+/-mice were consistent with those previously seen in B6C3F1 mice exposed to DON for two years.

  13. Guilty as CHARGED: p53's expanding role in disease

    PubMed Central

    Van Nostrand, Jeanine L; Attardi, Laura D

    2014-01-01

    Unrestrained p53 activity during development, as occurs upon loss of the p53 negative regulators Mdm2 or Mdmx, causes early embryonic lethality. Surprisingly, co-expression of wild-type p53 and a transcriptionally-dead variant of p53, with mutations in both transactivation domains (p53L25Q,W26S,F53Q,F54S), also causes lethality, but later in gestation and in association with a host of very specific phenotypes reminiscent of a syndrome known as CHARGE. Molecular analyses revealed that wild-type p53 is inappropriately activated in p535,26,53,54/+ embryos, triggering cell-cycle arrest or apoptosis during development to cause CHARGE phenotypes. In addition, CHARGE syndrome is typically caused by mutations in the CHD7 chromatin remodeler, and we have shown that activated p53 contributes to phenotypes caused by CHD7-deficiency. Together, these studies provide new insight into CHARGE syndrome and expand our understanding of the role of p53 in diseases other than cancer. PMID:25483057

  14. Pharmacological targeting of p53 through RITA is an effective antitumoral strategy for malignant pleural mesothelioma.

    PubMed

    Di Marzo, Domenico; Forte, Iris Maria; Indovina, Paola; Di Gennaro, Elena; Rizzo, Valeria; Giorgi, Francesca; Mattioli, Eliseo; Iannuzzi, Carmelina Antonella; Budillon, Alfredo; Giordano, Antonio; Pentimalli, Francesca

    2014-01-01

    Malignant mesothelioma, a very aggressive tumor associated to asbestos exposure, is expected to increase in incidence, and unfortunately, no curative modality exists. Reactivation of p53 is a new attractive antitumoral strategy. p53 is rarely mutated in mesothelioma, but it is inactivated in most tumors by the lack of p14(ARF). Here, we evaluated the feasibility of this approach in pleural mesothelioma by testing RITA and nutlin-3, two molecules able to restore p53 function through a different mechanism, on a panel of mesothelioma cell lines representing the epithelioid (NCI-H28, NCI-H2452, IST-MES 2), biphasic (MSTO-211H), and sarcomatoid (NCI-H2052) histotypes compared with the normal mesothelial HMC-hTERT. RITA triggered robust caspase-dependent apoptosis specifically in epithelioid and biphasic mesothelioma cell lines, both through wild-type and mutant p53, concomitant to p21 downregulation. Conversely, nutlin-3 induced a p21-dependent growth arrest, rather than apoptosis, and was slightly toxic on HMC-hTERT.   Interestingly, we identified a previously undetected point mutation of p53 (p.Arg249Ser) in IST-MES 2, and showed that RITA is also able to reactivate this p53 mutant protein and its apoptotic function. RITA reduced tumor growth in a MSTO-211H-derived xenograft model of mesothelioma and synergized with cisplatin, which is the mainstay of treatment for this tumor. Our data indicate that reactivation of p53 and concomitant p21 downregulation effectively induce cell death in mesothelioma, a tumor characterized by a high intrinsic resistance to apoptosis. Altogether, our findings provide the preclinical framework supporting the use of p53-reactivating agents alone, or in combination regimens, to improve the outcome of patients with mesothelioma.

  15. Hdm2 and Nitric Oxide Radicals Contribute to the P53-Dependent Radioadaptive Response

    SciTech Connect

    Takahashi, Akihisa; Matsumoto, Hideki; Ohnishi, Takeo

    2008-06-01

    Purpose: The aim of this work was to characterize the radioadaptive response at the molecular level. Methods and Materials: We used wild-type (wt) p53 and mutated (m) p53-containing cells derived from the human lung cancer H1299 cell line, which is p53-null. Cellular radiation sensitivities were determined with a colony-forming assay. The accumulations of p53, the human homolog of endogenous murine double minute 2 (Hdm2), and inducible nitric oxide synthase were analyzed with Western blotting. Quantification of chromosomal aberrations was estimated by scoring dicentrics per cell. Results: In wtp53 cells, it was demonstrated that the lack of p53 accumulation was coupled with the activation of Hdm2 after low-dose irradiation (0.02 Gy). Although NO radicals were only minimally induced in wtp53 cells irradiated with a challenging irradiation (6 Gy) alone, NO radicals were seen to increase about two- to fourfold after challenging irradiation subsequent to a priming irradiation (0.02 Gy). Under similar irradiation conditions with a priming and challenging irradiation in wtp53 cells, induction of radioresistance and a depression of chromosomal aberrations were observed only in the absence of 5, 5'-(2, 5-Furanidiyl)bis-2-thiophenemethanol (RITA) or Nutlin-3 (p53-Hdm2 interaction inhibitors), aminoguanidine (an inducible nitric oxide synthase inhibitor), and c-PTIO (an NO radical scavenger). On the other hand, in p53 dysfunctional cells, a radioadaptive response was not observed in the presence or absence of those inhibitors. Moreover radioresistance developed when wtp53 cells were treated with isosorbide dinitrate (an NO-generating agent) alone. Conclusions: These findings suggest that NO radicals are initiators of the radioadaptive response, acting through the activation of Hdm2 and the depression of p53 accumulations.

  16. USP11 regulates p53 stability by deubiquitinating p53*

    PubMed Central

    Ke, Jia-ying; Dai, Cong-jie; Wu, Wen-lin; Gao, Jin-hua; Xia, Ai-juan; Liu, Guang-ping; Lv, Kao-sheng; Wu, Chun-lin

    2014-01-01

    The p53 tumor suppressor protein coordinates the cellular responses to a broad range of cellular stresses, leading to DNA repair, cell cycle arrest or apoptosis. The stability of p53 is essential for its tumor suppressor function, which is tightly controlled by ubiquitin-dependent degradation primarily through its negative regulator murine double minute 2 (Mdm2). To better understand the regulation of p53, we tested the interaction between p53 and USP11 using co-immunoprecipitation. The results show that USP11, an ubiquitin-specific protease, forms specific complexes with p53 and stabilizes p53 by deubiquitinating it. Moreover, down-regulation of USP11 dramatically attenuated p53 induction in response to DNA damage stress. These findings reveal that USP11 is a novel regulator of p53, which is required for p53 activation in response to DNA damage. PMID:25471832

  17. Gastroenteritis in NF-κB-Deficient Mice Is Produced with Wild-Type Camplyobacter jejuni but Not with C. jejuni Lacking Cytolethal Distending Toxin despite Persistent Colonization with Both Strains

    PubMed Central

    Fox, James G.; Rogers, Arlin B.; Whary, Mark T.; Ge, Zhongming; Taylor, Nancy S.; Xu, Sandy; Horwitz, Bruce H.; Erdman, Susan E.

    2004-01-01

    Campylobacter jejuni continues to be a leading cause of bacterial enteritis in humans. However, because there are no readily available animal models to study the pathogenesis of C. jejuni-related diseases, the significance of potential virulence factors, such as cytolethal distending toxin (CDT), in vivo are poorly understood. Mice deficient in NF-κB subunits (p50−/− p65+/−) in a C57BL/129 background are particularly susceptible to colitis induced by another enterohepatic microaerobe, Helicobacter hepaticus, which, like C. jejuni, produces CDT. Wild-type C. jejuni 81-176 and an isogenic mutant lacking CDT activity (cdtB mutant) were inoculated into NF-κB-deficient (3X) and C57BL/129 mice. Wild-type C. jejuni colonized 29 and 50% of the C57BL/129 mice at 2 and 4 months postinfection (p.i.), respectively, whereas the C. jejuni cdtB mutant colonized 50% of the C57BL/129 mice at 2 p.i. but none of the mice at 4 months p.i. Although the C57BL/129 mice developed mild gastritis and typhlocolitis, they had robust immunoglobulin G (IgG) and Th1-promoted IgG2a humoral responses to both the wild-type strain and the C. jejuni cdtB mutant. In contrast, 75 to 100% of the 3X mice were colonized with both the wild type and the C. jejuni cdtB mutant at similar levels at all times examined. Wild-type C. jejuni caused moderately severe gastritis and proximal duodenitis in 3X mice that were more severe than the gastrointestinal lesions caused by the C. jejuni cdtB mutant. Persistent colonization of NF-κB-deficient mice with the wild type and the C. jejuni cdtB mutant was associated with significantly impaired IgG and IgG2a humoral responses (P < 0.001), which is consistent with an innate or adaptive immune system defect(s). These results suggest that the mechanism of clearance of C. jejuni is NF-κB dependent and that CDT may have proinflammatory activity in vivo, as well as a potential role in the ability of C. jejuni to escape immune surveillance. NF-κB-deficient mice

  18. The acetyltransferase p300/CBP-associated factor is a p53 target gene in breast tumor cells.

    PubMed

    Watts, George S; Oshiro, Marc M; Junk, Damian J; Wozniak, Ryan J; Watterson, Summer; Domann, Frederick E; Futscher, Bernard W

    2004-01-01

    p300/CBP-associated factor (PCAF) is a coactivator of the tumor suppressor, p53. PCAF participates in p53's transactivation of target genes through acetylation of both bound p53 and histones within p53 target promoters. Using microarrays, we discovered that PCAF itself is induced by p53 in a panel of breast tumor cell lines. Two p53 mutant breast tumor cell lines, BT-549 and UACC-1179, were chosen for further study of PCAF induction by wild-type p53. PCAF induction following adenoviral transduction of p53 expression was confirmed with real-time polymerase chain reaction in a time course experiment. Chromatin immunoprecipitation experiments then showed that PCAF induction was associated with increased p53 binding to the PCAF promoter, which contains p53 consensus-binding sites. PCAF induction by p53 activity was further demonstrated in wild-type p53 MCF10A cells when PCAF expression was induced following activation of endogenous wild-type p53 with doxorubicin in a dose- and time-dependent manner. Furthermore, the doxorubicin-induced increase in PCAF expression was blocked by pretreatment of the MCF10A cells with siRNA (small interfering RNA) targeted against p53 mRNA. Taken together, the results show that PCAF expression can be induced by wild-type p53.

  19. p19ARF-independent induction of p53 and cell cycle arrest by Raf in murine keratinocytes

    PubMed Central

    Roper, Elizabeth; Weinberg, Wendy; Watt, Fiona M.; Land, Hartmut

    2001-01-01

    In tumorigenesis of the skin, activated Ras co-operates with mutations that inactivate the tumour suppressor p53, but the molecular basis for this co-operation remains unresolved. Here we show that activation of the Raf/MAP kinase pathway in primary mouse keratinocytes leads to a p53 and p21Cip1-dependent cycle arrest and to terminal differentiation. Raf activation in keratinocytes lacking p53 or p21Cip1 genes leads to expression of differentiation markers, but the cells do not cease to proliferate. Thus, loss of p53 or p21Cip1 function is necessary to disable growth-inhibitory Raf/MAP kinase signalling. Activation of oncogenes, including Ras, has been reported to stabilize and activate p53 via induction of the tumour suppressor p19ARF. However, the response to Raf in p19ARF–/– keratinocytes was indistinguishable from wild-type controls. Thus, p19ARF is not essential for Raf-induced p53 induction and cell cycle arrest in keratinocytes, indicating that oncogenes engage p53 activity via multiple mechanisms. PMID:11258707

  20. Mitofusin-2 is a novel direct target of p53

    SciTech Connect

    Wang, Weilin; Cheng, Xiaofei; Lu, Jianju; Wei, Jianfeng; Fu, Guanghou; Zhu, Feng; Jia, Changku; Zhou, Lin; Xie, Haiyang; Zheng, Shusen

    2010-10-01

    Research highlights: {yields} Mfn2 is a novel target gene of p53. {yields} Mfn2 mRNA and protein levels can be up-regulated in a p53-dependent manner. {yields} Mfn2 promoter activity can be elevated by the p53 protein. {yields} P53 protein binds the Mfn2 promoter directly both in vitro and in vivo. -- Abstract: The tumor suppressor p53 modulates transcription of a number of target genes involved in cell cycle arrest, apoptosis, DNA repair, and other important cellular responses. Mitofusin-2 (Mfn2) is a novel suppressor of cell proliferation that may also exert apoptotic effects via the mitochondrial apoptotic pathway. Through bioinformatics analysis, we identified a p53 binding site in the Mfn2 promoter. Consistent with this, we showed that the p53 protein binds the Mfn2 promoter directly both in vitro and in vivo. Additionally, we found that Mfn2 mRNA and protein levels are up-regulated in a p53-dependent manner. Furthermore, luciferase assays revealed that the activity of the wild-type Mfn2 promoter, but not a mutated version of the promoter, was up-regulated by p53. These results indicate that Mfn2 is a novel p53-inducible target gene, which provides insight into the regulation of Mfn2 and its associated activities in the inhibition of cell proliferation, promotion of apoptosis, and modulation of tumor suppression.

  1. The isolation of an RNA aptamer targeting to p53 protein with single amino acid mutation

    PubMed Central

    Chen, Liang; Rashid, Farooq; Shah, Abdullah; Awan, Hassaan M.; Wu, Mingming; Liu, An; Wang, Jun; Zhu, Tao; Luo, Zhaofeng; Shan, Ge

    2015-01-01

    p53, known as a tumor suppressor, is a DNA binding protein that regulates cell cycle, activates DNA repair proteins, and triggers apoptosis in multicellular animals. More than 50% of human cancers contain a mutation or deletion of the p53 gene, and p53R175 is one of the hot spots of p53 mutation. Nucleic acid aptamers are short single-stranded oligonucleotides that are able to bind various targets, and they are typically isolated from an experimental procedure called systematic evolution of ligand exponential enrichment (SELEX). Using a previously unidentified strategy of contrast screening with SELEX, we have isolated an RNA aptamer targeting p53R175H. This RNA aptamer (p53R175H-APT) has a significantly stronger affinity to p53R175H than to the wild-type p53 in both in vitro and in vivo assays. p53R175H-APT decreased the growth rate, weakened the migration capability, and triggered apoptosis in human lung cancer cells harboring p53R175H. Further analysis actually indicated that p53R175H-APT might partially rescue or correct the p53R175H to function more like the wild-type p53. In situ injections of p53R175H-APT to the tumor xenografts confirmed the effects of this RNA aptamer on p53R175H mutation in mice. PMID:26216949

  2. Modeling the Etiology of p53-mutated Cancer Cells.

    PubMed

    Perez, Ricardo E; Shen, Hong; Duan, Lei; Kim, Reuben H; Kim, Terresa; Park, No-Hee; Maki, Carl G

    2016-05-01

    p53 gene mutations are among the most common alterations in cancer. In most cases, missense mutations in one TP53 allele are followed by loss-of-heterozygosity (LOH), so tumors express only mutant p53. TP53 mutations and LOH have been linked, in many cases, with poor therapy response and worse outcome. Despite this, remarkably little is known about how TP53 point mutations are acquired, how LOH occurs, or the cells involved. Nutlin-3a occupies the p53-binding site in MDM2 and blocks p53-MDM2 interaction, resulting in the stabilization and activation of p53 and subsequent growth arrest or apoptosis. We leveraged the powerful growth inhibitory activity of Nutlin-3a to select p53-mutated cells and examined how TP53 mutations arise and how the remaining wild-type allele is lost or inactivated. Mismatch repair (MMR)-deficient colorectal cancer cells formed heterozygote (p53 wild-type/mutant) colonies when cultured in low doses of Nutlin-3a, whereas MMR-corrected counterparts did not. Placing these heterozygotes in higher Nutlin-3a doses selected clones in which the remaining wild-type TP53 was silenced. Our data suggest silencing occurred through a novel mechanism that does not involve DNA methylation, histone methylation, or histone deacetylation. These data indicate MMR deficiency in colorectal cancer can give rise to initiating TP53 mutations and that TP53 silencing occurs via a copy-neutral mechanism. Moreover, the data highlight the use of MDM2 antagonists as tools to study mechanisms of TP53 mutation acquisition and wild-type allele loss or silencing in cells with defined genetic backgrounds.

  3. Necdin, a p53-Target Gene, Is an Inhibitor of p53-Mediated Growth Arrest

    PubMed Central

    Lafontaine, Julie; Rodier, Francis; Ouellet, Véronique; Mes-Masson, Anne-Marie

    2012-01-01

    In vitro, cellular immortalization and transformation define a model for multistep carcinogenesis and current ongoing challenges include the identification of specific molecular events associated with steps along this oncogenic pathway. Here, using NIH3T3 cells, we identified transcriptionally related events associated with the expression of Polyomavirus Large-T antigen (PyLT), a potent viral oncogene. We propose that a subset of these alterations in gene expression may be related to the early events that contribute to carcinogenesis. The proposed tumor suppressor Necdin, known to be regulated by p53, was within a group of genes that was consistently upregulated in the presence of PyLT. While Necdin is induced following p53 activation with different genotoxic stresses, Necdin induction by PyLT did not involve p53 activation or the Rb-binding site of PyLT. Necdin depletion by shRNA conferred a proliferative advantage to NIH3T3 and PyLT-expressing NIH3T3 (NIHLT) cells. In contrast, our results demonstrate that although overexpression of Necdin induced a growth arrest in NIH3T3 and NIHLT cells, a growing population rapidly emerged from these arrested cells. This population no longer showed significant proliferation defects despite high Necdin expression. Moreover, we established that Necdin is a negative regulator of p53-mediated growth arrest induced by nutlin-3, suggesting that Necdin upregulation could contribute to the bypass of a p53-response in p53 wild type tumors. To support this, we characterized Necdin expression in low malignant potential ovarian cancer (LMP) where p53 mutations rarely occur. Elevated levels of Necdin expression were observed in LMP when compared to aggressive serous ovarian cancers. We propose that in some contexts, the constitutive expression of Necdin could contribute to cancer promotion by delaying appropriate p53 responses and potentially promote genomic instability. PMID:22355404

  4. Four p53 DNA-binding domain peptides bind natural p53-response elements and bend the DNA.

    PubMed Central

    Balagurumoorthy, P; Sakamoto, H; Lewis, M S; Zambrano, N; Clore, G M; Gronenborn, A M; Appella, E; Harrington, R E

    1995-01-01

    Recent structural studies of the minimal core DNA-binding domain of p53 (p53DBD) complexed to a single consensus pentamer sequence and of the isolated p53 tetramerization domain have provided valuable insights into their functions, but many questions about their interacting roles and synergism remain unanswered. To better understand these relationships, we have examined the binding of the p53DBD to two biologically important full-response elements (the WAF1 and ribosomal gene cluster sites) by using DNA circularization and analytical ultracentrifugation. We show that the p53DBD binds DNA strongly and cooperatively with p53DBD to DNA binding stoichiometries of 4:1. For the WAF1 element, the mean apparent Kd is (8.3 +/- 1.4) x 10(-8) M, and no intermediate species of lower stoichiometries can be detected. We show further that complex formation induces an axial bend of at least 60 degrees in both response elements. These results, taken collectively, demonstrate that p53DBD possesses the ability to direct the formation of a tight nucleoprotein complex having the same 4:1 DNA-binding stoichiometry as wild-type p53 which is accompanied by a substantial conformational change in the response-element DNA. This suggests that the p53DBD may play a role in the tetramerization function of p53. A possible role in this regard is proposed. Images Fig. 2 Fig. 4 PMID:7567980

  5. Crosstalk between p53 and TGF-β Signalling

    PubMed Central

    Elston, Rebecca; Inman, Gareth J.

    2012-01-01

    Wild-type p53 and TGF-β are key tumour suppressors which regulate an array of cellular responses. TGF-β signals in part via the Smad signal transduction pathway. Wild-type p53 and Smads physically interact and coordinately induce transcription of a number of key tumour suppressive genes. Conversely mutant p53 generally subverts tumour suppressive TGF-β responses, diminishing transcriptional activation of key TGF-β target genes. Mutant p53 can also interact with Smads and this enables complex formation with the p53 family member p63 and blocks p63-mediated activation of metastasis suppressing genes to promote tumour progression. p53 and Smad function may also overlap during miRNA biogenesis as they can interact with the same components of the Drosha miRNA processing complex to promote maturation of specific subsets of miRNAs. This paper investigates the crosstalk between p53 and TGF-β signalling and the potential roles this plays in cancer biology. PMID:22545213

  6. Simulated sunlight and benzo[a]pyrene diol epoxide induced mutagenesis in the human p53 gene evaluated by the yeast functional assay: lack of correspondence to tumor mutation spectra.

    PubMed

    Yoon, Jung-Hoon; Lee, Chong-Soon; Pfeifer, Gerd P

    2003-01-01

    Many mutations in the p53 gene destroy the transcriptional transactivation function of the p53 protein. This function of p53 can be determined in a yeast assay using a p53 responsive reporter gene. The yeast assay could hold promise for the identification of mutagens implicated in human cancer if the p53 mutational spectra obtained with this assay would match human tumor mutation data. Ultraviolet (UV) light from the sun and polycyclic aromatic hydrocarbons, such as benzo[a]pyrene, are strongly implicated in the spectrum of p53 mutations found in human non-melanoma skin cancers and smoking-associated lung cancers, respectively. We have used these two model mutagens to assess the feasibility of using the p53 yeast assay in cancer epidemiology. After treatment of CpG methylated p53 DNA with a solar UV simulator or with benzo[a]pyrene diol epoxide (BPDE), the modified p53 sequences were assayed in yeast for mutational outcome. As expected, BPDE produced predominantly G to T transversions and simulated sunlight produced mostly C to T transitions at dipyrimidine sites in the p53 coding sequence. However, the preferentially mutated p53 sequences (hotspots) in the yeast assay were completely different from those in the mutational spectra found in human lung and skin cancers. The data indicate that this assay is not a reliable measurement of p53 mutagenesis in human tissues and that, perhaps, transcriptional activation is not the primary function of p53 in tumor suppression. PMID:12538356

  7. Change in oligomerization specificity of the p53 tetramerization domain by hydrophobic amino acid substitutions.

    PubMed Central

    Stavridi, E. S.; Chehab, N. H.; Caruso, L. C.; Halazonetis, T. D.

    1999-01-01

    The tumor suppressor function of the wild-type p53 protein is transdominantly inhibited by tumor-derived mutant p53 proteins. Such transdominant inhibition limits the prospects for gene therapy approaches that aim to introduce wild-type p53 into cancer cells. The molecular mechanism for transdominant inhibition involves sequestration of wild-type p53 subunits into inactive wild-type/mutant hetero-tetramers. Thus, p53 proteins, whose oligomerization specificity is altered so they cannot interact with tumor-derived mutant p53, would escape transdominant inhibition. Aided by the known three-dimensional structure of the p53 tetramerization domain and by trial and error we designed a novel domain with seven amino acid substitutions in the hydrophobic core. A full-length p53 protein bearing this novel domain formed homo-tetramers and had tumor suppressor function, but did not hetero-oligomerize with tumor-derived mutant p53 and resisted transdominant inhibition. Thus, hydrophobic core residues influence the oligomerization specificity of the p53 tetramerization domain. PMID:10493578

  8. Nucleolar stress with and without p53

    PubMed Central

    James, Allison; Wang, Yubo; Raje, Himanshu; Rosby, Raphyel; DiMario, Patrick

    2014-01-01

    A veritable explosion of primary research papers within the past 10 years focuses on nucleolar and ribosomal stress, and for good reason: with ribosome biosynthesis consuming ~80% of a cell’s energy, nearly all metabolic and signaling pathways lead ultimately to or from the nucleolus. We begin by describing p53 activation upon nucleolar stress resulting in cell cycle arrest or apoptosis. The significance of this mechanism cannot be understated, as oncologists are now inducing nucleolar stress strategically in cancer cells as a potential anti-cancer therapy. We also summarize the human ribosomopathies, syndromes in which ribosome biogenesis or function are impaired leading to birth defects or bone narrow failures; the perplexing problem in the ribosomopathies is why only certain cells are affected despite the fact that the causative mutation is systemic. We then describe p53-independent nucleolar stress, first in yeast which lacks p53, and then in other model metazoans that lack MDM2, the critical E3 ubiquitin ligase that normally inactivates p53. Do these presumably ancient p53-independent nucleolar stress pathways remain latent in human cells? If they still exist, can we use them to target >50% of known human cancers that lack functional p53? PMID:25482194

  9. Nucleolar stress with and without p53.

    PubMed

    James, Allison; Wang, Yubo; Raje, Himanshu; Rosby, Raphyel; DiMario, Patrick

    2014-01-01

    A veritable explosion of primary research papers within the past 10 years focuses on nucleolar and ribosomal stress, and for good reason: with ribosome biosynthesis consuming ~80% of a cell's energy, nearly all metabolic and signaling pathways lead ultimately to or from the nucleolus. We begin by describing p53 activation upon nucleolar stress resulting in cell cycle arrest or apoptosis. The significance of this mechanism cannot be understated, as oncologists are now inducing nucleolar stress strategically in cancer cells as a potential anti-cancer therapy. We also summarize the human ribosomopathies, syndromes in which ribosome biogenesis or function are impaired leading to birth defects or bone narrow failures; the perplexing problem in the ribosomopathies is why only certain cells are affected despite the fact that the causative mutation is systemic. We then describe p53-independent nucleolar stress, first in yeast which lacks p53, and then in other model metazoans that lack MDM2, the critical E3 ubiquitin ligase that normally inactivates p53. Do these presumably ancient p53-independent nucleolar stress pathways remain latent in human cells? If they still exist, can we use them to target >50% of known human cancers that lack functional p53? PMID:25482194

  10. The Wip1 Phosphatase acts as a gatekeeper in the p53-Mdm2 autoregulatory loop.

    PubMed

    Lu, Xiongbin; Ma, Ou; Nguyen, Thuy-Ai; Jones, Stephen N; Oren, Moshe; Donehower, Lawrence A

    2007-10-01

    The tumor suppressor p53 is a transcription factor that responds to cellular stresses by initiating cell cycle arrest or apoptosis. One transcriptional target of p53 is Mdm2, an E3 ubiquitin ligase that interacts with p53 to promote its proteasomal degradation in a negative feedback regulatory loop. Here we show that the wild-type p53-induced phosphatase 1 (Wip1), or PPM1D, downregulates p53 protein levels by stabilizing Mdm2 and facilitating its access to p53. Wip1 interacts with and dephosphorylates Mdm2 at serine 395, a site phosphorylated by the ATM kinase. Dephosphorylated Mdm2 has increased stability and affinity for p53, facilitating p53 ubiquitination and degradation. Thus, Wip1 acts as a gatekeeper in the Mdm2-p53 regulatory loop by stabilizing Mdm2 and promoting Mdm2-mediated proteolysis of p53.

  11. Activation of p53-dependent responses in tumor cells treated with a PARC-interacting peptide

    SciTech Connect

    Vitali, Roberta; Cesi, Vincenzo; Tanno, Barbara; Ferrari-Amorotti, Giovanna; Dominici, Carlo; Calabretta, Bruno; Raschella, Giuseppe

    2008-04-04

    We tested the activity of a p53 carboxy-terminal peptide containing the PARC-interacting region in cancer cells with wild type cytoplasmic p53. Peptide delivery was achieved by fusing it to the TAT transduction domain (TAT-p53-C-ter peptide). In a two-hybrid assay, the tetramerization domain (TD) of p53 was necessary and sufficient to bind PARC. The TAT-p53-C-ter peptide disrupted the PARC-p53 complex. Peptide treatment caused p53 nuclear relocation, p53-dependent changes in gene expression and enhancement of etoposide-induced apoptosis. These studies suggest that PARC-interacting peptides are promising candidates for the enhancement of p53-dependent apoptosis in tumors with wt cytoplasmic p53.

  12. Exclusive Association of p53 Mutation with Super-High Methylation of Tumor Suppressor Genes in the p53 Pathway in a Unique Gastric Cancer Phenotype

    PubMed Central

    Ema, Akira; Katada, Natsuya; Kikuchi, Shiro; Watanabe, Masahiko

    2015-01-01

    Background A comprehensive search for DNA methylated genes identified candidate tumor suppressor genes that have been proven to be involved in the apoptotic process of the p53 pathway. In this study, we investigated p53 mutation in relation to such epigenetic alteration in primary gastric cancer. Methods The methylation profiles of the 3 genes: PGP9.5, NMDAR2B, and CCNA1, which are involved in the p53 tumor suppressor pathway in combination with p53 mutation were examined in 163 primary gastric cancers. The effect of epigenetic reversion in combination with chemotherapeutic drugs on apoptosis was also assessed according to the tumor p53 mutation status. Results p53 gene mutations were found in 44 primary gastric tumors (27%), and super-high methylation of any of the 3 genes was only found in cases with wild type p53. Higher p53 pathway aberration was found in cases with male gender (p = 0.003), intestinal type (p = 0.005), and non-infiltrating type (p = 0.001). The p53 pathway aberration group exhibited less recurrence in lymph nodes, distant organs, and peritoneum than the p53 non-aberration group. In the NUGC4 gastric cancer cell line (p53 wild type), epigenetic treatment augmented apoptosis by chemotherapeutic drugs, partially through p53 transcription activity. On the other hand, in the KATO III cancer cell line (p53 mutant), epigenetic treatment alone induced robust apoptosis, with no trans-activation of p53. Conclusion In gastric cancer, p53 relevant and non-relevant pathways exist, and tumors with either pathway type exhibited unique clinical features. Epigenetic treatments can induce apoptosis partially through p53 activation, however their apoptotic effects may be explained largely by mechanism other than through p53 pathways. PMID:26447864

  13. Loss of interactions between p53 and survivin gene in mesenchymal stem cells after spontaneous transformation in vitro.

    PubMed

    He, Liu; Zhao, Fangyu; Zheng, Yong; Wan, Yu; Song, Jian

    2016-06-01

    Mesenchymal stem cells (MSC) from various animals undergo a spontaneous transformation in long-term culture. The transformed MSCs are highly tumorigenic and are likely to be the tumor-initiating cells of sarcoma. To explain why the transformed MSCs become tumorigenic, the present study investigated the characteristics of rat MSCs before and after spontaneous transformation. It was shown that although the transformed MSCs maintained typical surface markers of MSC, they exhibited some cancer stem cell-like characteristics such as loss of contact inhibition and multi-potency to mesenchymal lineages, and acquirement of ability of anchorage-independent growth. The expression of a key senescence regulator p16 almost disappeared, but the other one, p53 abnormally increased in the transformed MSCs. ChIP assay demonstrated that a normal negative regulation of p53 on survivin gene disappeared in the transformed cells due to a lack of p53 binding to the promoter of survivin gene. DNA sequencing revealed that the p53 gene in transformed MSCs was not a wild-type, but a 942C>T mutant with the mutation located in the sequence coding p53 protein's DNA-binding domain. These findings indicate that the transformed MSCs express high levels of a p53 mutant that loses the ability to bind survivin gene, leading to an abnormally upregulated expression of survivin, which is a key reason for the cell's unlimited proliferation.

  14. Oxazoloisoindolinones with in vitro antitumor activity selectively activate a p53-pathway through potential inhibition of the p53-MDM2 interaction.

    PubMed

    Soares, Joana; Pereira, Nuno A L; Monteiro, Ângelo; Leão, Mariana; Bessa, Cláudia; Dos Santos, Daniel J V A; Raimundo, Liliana; Queiroz, Glória; Bisio, Alessandra; Inga, Alberto; Pereira, Clara; Santos, Maria M M; Saraiva, Lucília

    2015-01-23

    One of the most appealing targets for anticancer treatment is the p53 tumor suppressor protein. In half of human cancers, this protein is inactivated due to endogenous negative regulators such as MDM2. Actually, restoring the p53 activity, particularly through the inhibition of its interaction with MDM2, is considered a valuable therapeutic strategy against cancers with a wild-type p53 status. In this work, we report the synthesis of nine enantiopure phenylalaninol-derived oxazolopyrrolidone lactams and the evaluation of their biological effects as p53-MDM2 interaction inhibitors. Using a yeast-based screening assay, two oxazoloisoindolinones, compounds 1b and 3a, were identified as potential p53-MDM2 interaction inhibitors. The molecular mechanism of oxazoloisoindolinone 3a was further validated in human colon adenocarcinoma HCT116 cells with wild-type p53 (HCT116 p53(+/+)) and in its isogenic derivative without p53 (HCT116 p53(-/-)). Indeed, using these cells, we demonstrated that oxazoloisoindolinone 3a exhibited a p53-dependent in vitro antitumor activity through induction of G0/G1-phase cell cycle arrest and apoptosis. The selective activation of a p53-apoptotic pathway by oxazoloisoindolinone 3a was further supported by the occurrence of PARP cleavage only in p53-expressing HCT116 cells. Moreover, oxazoloisoindolinone 3a led to p53 protein stabilization and to the up-regulation of p53 transcriptional activity with increased expression levels of several p53 target genes, as p21(WAF1/CIP1), MDM2, BAX and PUMA, in p53(+/+) but not in p53(-/-) HCT116 cells. Additionally, the ability of oxazoloisoindolinone 3a to block the p53-MDM2 interaction in HCT116 p53(+/+) cells was confirmed by co-immunoprecipitation. Finally, the molecular docking analysis of the interactions between the synthesized compounds and MDM2 revealed that oxazoloisoindolinone 3a binds to MDM2. Altogether, this work adds, for the first time, the oxazoloisoindolinone scaffold to the list of

  15. Oxazoloisoindolinones with in vitro antitumor activity selectively activate a p53-pathway through potential inhibition of the p53-MDM2 interaction.

    PubMed

    Soares, Joana; Pereira, Nuno A L; Monteiro, Ângelo; Leão, Mariana; Bessa, Cláudia; Dos Santos, Daniel J V A; Raimundo, Liliana; Queiroz, Glória; Bisio, Alessandra; Inga, Alberto; Pereira, Clara; Santos, Maria M M; Saraiva, Lucília

    2015-01-23

    One of the most appealing targets for anticancer treatment is the p53 tumor suppressor protein. In half of human cancers, this protein is inactivated due to endogenous negative regulators such as MDM2. Actually, restoring the p53 activity, particularly through the inhibition of its interaction with MDM2, is considered a valuable therapeutic strategy against cancers with a wild-type p53 status. In this work, we report the synthesis of nine enantiopure phenylalaninol-derived oxazolopyrrolidone lactams and the evaluation of their biological effects as p53-MDM2 interaction inhibitors. Using a yeast-based screening assay, two oxazoloisoindolinones, compounds 1b and 3a, were identified as potential p53-MDM2 interaction inhibitors. The molecular mechanism of oxazoloisoindolinone 3a was further validated in human colon adenocarcinoma HCT116 cells with wild-type p53 (HCT116 p53(+/+)) and in its isogenic derivative without p53 (HCT116 p53(-/-)). Indeed, using these cells, we demonstrated that oxazoloisoindolinone 3a exhibited a p53-dependent in vitro antitumor activity through induction of G0/G1-phase cell cycle arrest and apoptosis. The selective activation of a p53-apoptotic pathway by oxazoloisoindolinone 3a was further supported by the occurrence of PARP cleavage only in p53-expressing HCT116 cells. Moreover, oxazoloisoindolinone 3a led to p53 protein stabilization and to the up-regulation of p53 transcriptional activity with increased expression levels of several p53 target genes, as p21(WAF1/CIP1), MDM2, BAX and PUMA, in p53(+/+) but not in p53(-/-) HCT116 cells. Additionally, the ability of oxazoloisoindolinone 3a to block the p53-MDM2 interaction in HCT116 p53(+/+) cells was confirmed by co-immunoprecipitation. Finally, the molecular docking analysis of the interactions between the synthesized compounds and MDM2 revealed that oxazoloisoindolinone 3a binds to MDM2. Altogether, this work adds, for the first time, the oxazoloisoindolinone scaffold to the list of

  16. Proteasome inhibitors induce p53-independent apoptosis in human cancer cells.

    PubMed

    Pandit, Bulbul; Gartel, Andrei L

    2011-01-01

    Proteasome inhibitors are used against human cancer, but their mechanisms of action are not entirely understood. For example, the role of the tumor suppressor p53 is controversial. We reevaluated the role of p53 in proteasome inhibitor-induced apoptosis by using isogenic human cancer cell lines with different p53 status. We found that well-known proteasome inhibitors such as MG132 and bortezomib, as well as the recently discovered proteasome inhibitor thiostrepton, induced p53-independent apoptosis in human cancer cell lines that correlated with p53-independent induction of proapoptotic Noxa but not Puma protein. In addition, these drugs inhibited growth of several cancer cell lines independently of p53 status. Notably, thiostrepton induced more potent apoptosis in HepG2 cells with p53 knockdown than in parental cells with wild-type p53. Our data confirm that proteasome inhibitors generally induce p53-independent apoptosis in human cancer cells.

  17. An expression signature for p53 status in human breast cancer predicts mutation status, transcriptional effects, and patient survival.

    PubMed

    Miller, Lance D; Smeds, Johanna; George, Joshy; Vega, Vinsensius B; Vergara, Liza; Ploner, Alexander; Pawitan, Yudi; Hall, Per; Klaar, Sigrid; Liu, Edison T; Bergh, Jonas

    2005-09-20

    Perturbations of the p53 pathway are associated with more aggressive and therapeutically refractory tumors. However, molecular assessment of p53 status, by using sequence analysis and immunohistochemistry, are incomplete assessors of p53 functional effects. We posited that the transcriptional fingerprint is a more definitive downstream indicator of p53 function. Herein, we analyzed transcript profiles of 251 p53-sequenced primary breast tumors and identified a clinically embedded 32-gene expression signature that distinguishes p53-mutant and wild-type tumors of different histologies and outperforms sequence-based assessments of p53 in predicting prognosis and therapeutic response. Moreover, the p53 signature identified a subset of aggressive tumors absent of sequence mutations in p53 yet exhibiting expression characteristics consistent with p53 deficiency because of attenuated p53 transcript levels. Our results show the primary importance of p53 functional status in predicting clinical breast cancer behavior. PMID:16141321

  18. A Platform for Interrogating Cancer-Associated p53 Alleles

    PubMed Central

    D’Brot, Alejandro; Kurtz, Paula; Regan, Erin; Jakubowski, Brandon; Abrams, John M

    2016-01-01

    p53 is the most frequently mutated gene in human cancer. Compelling evidence argues that full transformation involves loss of growth suppression encoded by wild-type p53 together with poorly understood oncogenic activity encoded by missense mutations. Furthermore, distinguishing disease alleles from natural polymorphisms is an important clinical challenge. To interrogate the genetic activity of human p53 variants, we leveraged the Drosophila model as an in vivo platform. We engineered strains that replace the fly p53 gene with human alleles, producing a collection of stocks that are, in effect, ‘humanized’ for p53 variants. Like the fly counterpart, human p53 transcriptionally activated a biosensor and induced apoptosis after DNA damage. However, all humanized strains representing common alleles found in cancer patients failed to complement in these assays. Surprisingly, stimulus-dependent activation of hp53 occurred without stabilization, demonstrating that these two processes can be uncoupled. Like its fly counterpart, hp53 formed prominent nuclear foci in germline cells but cancer-associated p53 variants did not. Moreover, these same mutant alleles disrupted hp53 foci and inhibited biosensor activity, suggesting that these properties are functionally linked. Together these findings establish a functional platform for interrogating human p53 alleles and suggest that simple phenotypes could be used to stratify disease variants. PMID:26996664

  19. Cytoplasmic p53 and Activated Bax Regulate p53-dependent, Transcription-independent Neural Precursor Cell Apoptosis

    PubMed Central

    Geng, Ying; Walls, K.C.; Ghosh, Arindam P.; Akhtar, Rizwan S.; Klocke, Barbara J.; Roth, Kevin A.

    2010-01-01

    The prodeath effects of p53 are typically mediated via its transcriptional upregulation of proapoptotic Bcl-2 family members, including PUMA, Noxa, and/or Bax. We previously reported that staurosporine (STS), a broad-spectrum kinase inhibitor and prototypical apoptosis-inducing agent, produced p53-dependent, Bax-dependent, neural precursor cell (NPC) apoptosis, but that this effect occurred independently of new gene transcription and PUMA expression. To further characterize the mechanism by which p53 regulates NPC death, we used primary cerebellar NPCs derived from wild-type, p53-deficient, and Bax-deficient neonatal mice and the mouse cerebellar neural stem cell line, C17.2. We found that STS rapidly increased p53 cytoplasmic immunoreactivity in neuritic-like processes in C17.2 cells, which preceded Bax activation and caspase-3 cleavage. Confocal microscopy analysis of STS-treated cells revealed partial colocalization of p53 with the mitochondrial marker pyruvate dehydrogenase as well as with conformationally altered “activated” Bax, suggesting an interaction between these proapoptotic molecules in triggering apoptotic death. Nucleophosmin (NPM), a CRM1-dependent nuclear chaperone, also exhibited partial colocalization with both activated Bax and p53 following STS treatment. These observations suggest that cytoplasmic p53 can trigger transcription-independent NPC apoptosis through its potential interaction with NPM and activated Bax. (J Histochem Cytochem 58:265–275, 2010) PMID:19901272

  20. Aberrant splicing of the DMP1-ARF-MDM2-p53 pathway in cancer.

    PubMed

    Inoue, Kazushi; Fry, Elizabeth A

    2016-07-01

    Alternative splicing (AS) of mRNA precursors is a ubiquitous mechanism for generating numerous transcripts with different activities from one genomic locus in mammalian cells. The gene products from a single locus can thus have similar, dominant-negative or even opposing functions. Aberrant AS has been found in cancer to express proteins that promote cell growth, local invasion and metastasis. This review will focus on the aberrant splicing of tumor suppressor/oncogenes that belong to the DMP1-ARF-MDM2-p53 pathway. Our recent study shows that the DMP1 locus generates both tumor-suppressive DMP1α (p53-dependent) and oncogenic DMP1β (p53-independent) splice variants, and the DMP1β/α ratio increases with neoplastic transformation of breast epithelial cells. This process is associated with high DMP1β protein expression and shorter survival of breast cancer (BC) patients. Accumulating pieces of evidence show that ARF is frequently inactivated by aberrant splicing in human cancers, demonstrating its involvement in human malignancies. Splice variants from the MDM2 locus promote cell growth in culture and accelerate tumorigenesis in vivo. Human cancers expressing these splice variants are associated with advanced stage/metastasis, and thus have negative clinical impacts. Although they lack most of the p53-binding domain, their activities are mostly dependent on p53 since they bind to wild-type MDM2. The p53 locus produces splice isoforms that have either favorable (β/γ at the C-terminus) or negative impact (Δ40, Δ133 at the N-terminus) on patients' survival. As the oncogenic AS products from these loci are expressed only in cancer cells, they may eventually become targets for molecular therapies.

  1. Zn(II)-curc targets p53 in thyroid cancer cells

    PubMed Central

    GARUFI, ALESSIA; D'ORAZI, VALERIO; CRISPINI, ALESSANDRA; D'ORAZI, GABRIELLA

    2015-01-01

    TP53 mutation is a common event in many cancers, including thyroid carcinoma. Defective p53 activity promotes cancer resistance to therapies and a more malignant phenotype, acquiring oncogenic functions. Rescuing the function of mutant p53 (mutp53) protein is an attractive anticancer therapeutic strategy. Zn(II)-curc is a novel small molecule that has been shown to target mutp53 protein in several cancer cells, but its effect in thyroid cancer cells remains unclear. Here, we investigated whether Zn(II)-curc could affect p53 in thyroid cancer cells with both p53 mutation (R273H) and wild-type p53. Zn(II)-curc induced mutp53H273 downregulation and reactivation of wild-type functions, such as binding to canonical target promoters and target gene transactivation. This latter effect was similar to that induced by PRIMA-1. In addition, Zn(II)-curc triggered p53 target gene expression in wild-type p53-carrying cells. In combination treatments, Zn(II)-curc enhanced the antitumor activity of chemotherapeutic drugs, in both mutant and wild-type-carrying cancer cells. Taken together, our data indicate that Zn(II)-curc promotes the reactivation of p53 in thyroid cancer cells, providing in vitro evidence for a potential therapeutic approach in thyroid cancers. PMID:26314369

  2. Pharmacological and Genetic Manipulation of p53 in Brown Fat at Adult But Not Embryonic Stages Regulates Thermogenesis and Body Weight in Male Mice.

    PubMed

    Al-Massadi, Omar; Porteiro, Begoña; Kuhlow, Doreen; Köhler, Markus; Gonzalez-Rellan, María J; Garcia-Lavandeira, Montserrat; Díaz-Rodríguez, Esther; Quiñones, Mar; Senra, Ana; Alvarez, Clara V; López, Miguel; Diéguez, Carlos; Schulz, Tim J; Nogueiras, Rubén

    2016-07-01

    p53 is a well-known tumor suppressor that plays multiple biological roles, including the capacity to modulate metabolism at different levels. However, its metabolic role in brown adipose tissue (BAT) remains largely unknown. Herein we sought to investigate the physiological role of endogenous p53 in BAT and its implication on BAT thermogenic activity and energy balance. To this end, we generated and characterized global p53-null mice and mice lacking p53 specifically in BAT. Additionally we performed gain-and-loss-of-function experiments in the BAT of adult mice using virogenetic and pharmacological approaches. BAT was collected and analyzed by immunohistochemistry, thermography, real-time PCR, and Western blot. p53-deficient mice were resistant to diet-induced obesity due to increased energy expenditure and BAT activity. However, the deletion of p53 in BAT using a Myf5-Cre driven p53 knockout did not show any changes in body weight or the expression of thermogenic markers. The acute inhibition of p53 in the BAT of adult mice slightly increased body weight and inhibited BAT thermogenesis, whereas its overexpression in the BAT of diet-induced obese mice reduced body weight and increased thermogenesis. On the other hand, pharmacological activation of p53 improves body weight gain due to increased BAT thermogenesis by sympathetic nervous system in obese adult wild-type mice but not in p53(-/-) animals. These results reveal that p53 regulates BAT metabolism by coordinating body weight and thermogenesis, but these metabolic actions are tissue specific and also dependent on the developmental stage.

  3. Pharmacological and Genetic Manipulation of p53 in Brown Fat at Adult But Not Embryonic Stages Regulates Thermogenesis and Body Weight in Male Mice.

    PubMed

    Al-Massadi, Omar; Porteiro, Begoña; Kuhlow, Doreen; Köhler, Markus; Gonzalez-Rellan, María J; Garcia-Lavandeira, Montserrat; Díaz-Rodríguez, Esther; Quiñones, Mar; Senra, Ana; Alvarez, Clara V; López, Miguel; Diéguez, Carlos; Schulz, Tim J; Nogueiras, Rubén

    2016-07-01

    p53 is a well-known tumor suppressor that plays multiple biological roles, including the capacity to modulate metabolism at different levels. However, its metabolic role in brown adipose tissue (BAT) remains largely unknown. Herein we sought to investigate the physiological role of endogenous p53 in BAT and its implication on BAT thermogenic activity and energy balance. To this end, we generated and characterized global p53-null mice and mice lacking p53 specifically in BAT. Additionally we performed gain-and-loss-of-function experiments in the BAT of adult mice using virogenetic and pharmacological approaches. BAT was collected and analyzed by immunohistochemistry, thermography, real-time PCR, and Western blot. p53-deficient mice were resistant to diet-induced obesity due to increased energy expenditure and BAT activity. However, the deletion of p53 in BAT using a Myf5-Cre driven p53 knockout did not show any changes in body weight or the expression of thermogenic markers. The acute inhibition of p53 in the BAT of adult mice slightly increased body weight and inhibited BAT thermogenesis, whereas its overexpression in the BAT of diet-induced obese mice reduced body weight and increased thermogenesis. On the other hand, pharmacological activation of p53 improves body weight gain due to increased BAT thermogenesis by sympathetic nervous system in obese adult wild-type mice but not in p53(-/-) animals. These results reveal that p53 regulates BAT metabolism by coordinating body weight and thermogenesis, but these metabolic actions are tissue specific and also dependent on the developmental stage. PMID:27183316

  4. The p53 circuit board

    PubMed Central

    Sullivan, Kelly D.; Gallant-Behm, Corrie L.; Henry, Ryan E.; Fraikin, Jean-Luc; Espinosa, Joaquín M.

    2012-01-01

    The p53 tumor suppressor is embedded in a large gene network controlling diverse cellular and organismal phenotypes. Multiple signaling pathways converge onto p53 activation, mostly by relieving the inhibitory effects of its repressors, MDM2 and MDM4. In turn, signals originating from increased p53 activity diverge into distinct effector pathways to deliver a specific cellular response to the activating stimuli. Much attention has been devoted to dissecting how the various input pathways trigger p53 activation and how the activity of the p53 protein itself can be modulated by a plethora of co-factors and post-translational modifications. In this review we will focus instead on the multiple configurations of the effector pathways. We will discuss how p53-generated signals are transmitted, amplified, resisted and eventually integrated by downstream gene circuits operating at the transcriptional, post-transcriptional and post-translational level. We will also discuss how context-dependent variations in these gene circuits define the cellular response to p53 activation and how they may impact the clinical efficacy of p53-based targeted therapies. PMID:22333261

  5. Translational approaches targeting the p53 pathway for anti-cancer therapy

    PubMed Central

    Essmann, Frank; Schulze-Osthoff, Klaus

    2012-01-01

    The p53 tumour suppressor blocks cancer development by triggering apoptosis or cellular senescence in response to oncogenic stress or DNA damage. Consequently, the p53 signalling pathway is virtually always inactivated in human cancer cells. This unifying feature has commenced tremendous efforts to develop p53-based anti-cancer therapies. Different strategies exist that are adapted to the mechanisms of p53 inactivation. In p53-mutated tumours, delivery of wild-type p53 by adenovirus-based gene therapy is now practised in China. Also, remarkable progress has been made in the development of p53-binding drugs that can rescue and reactivate the function of mutant or misfolded p53. Other biologic approaches include the development of oncolytic viruses that are designed to specifically replicate in and kill p53-defective cells. Inactivation of wt-p53 frequently results from dysregulation of MDM2, an E3 ligase that regulates p53 levels. Small-molecule drugs that inhibit the interaction of MDM2 and p53 and block p53 degradation are currently tested in clinical trials. This survey highlights the recent developments that attempt to modulate the function of p53 and outlines strategies that are being investigated for pharmacological intervention in the p53 pathway. PMID:21718309

  6. p53 Loss in MYC-Driven Neuroblastoma Leads to Metabolic Adaptations Supporting Radioresistance.

    PubMed

    Yogev, Orli; Barker, Karen; Sikka, Arti; Almeida, Gilberto S; Hallsworth, Albert; Smith, Laura M; Jamin, Yann; Ruddle, Ruth; Koers, Alexander; Webber, Hannah T; Raynaud, Florence I; Popov, Sergey; Jones, Chris; Petrie, Kevin; Robinson, Simon P; Keun, Hector C; Chesler, Louis

    2016-05-15

    Neuroblastoma is the most common childhood extracranial solid tumor. In high-risk cases, many of which are characterized by amplification of MYCN, outcome remains poor. Mutations in the p53 (TP53) tumor suppressor are rare at diagnosis, but evidence suggests that p53 function is often impaired in relapsed, treatment-resistant disease. To address the role of p53 loss of function in the development and pathogenesis of high-risk neuroblastoma, we generated a MYCN-driven genetically engineered mouse model in which the tamoxifen-inducible p53ER(TAM) fusion protein was expressed from a knock-in allele (Th-MYCN/Trp53(KI)). We observed no significant differences in tumor-free survival between Th-MYCN mice heterozygous for Trp53(KI) (n = 188) and Th-MYCN mice with wild-type p53 (n = 101). Conversely, the survival of Th-MYCN/Trp53(KI/KI) mice lacking functional p53 (n = 60) was greatly reduced. We found that Th-MYCN/Trp53(KI/KI) tumors were resistant to ionizing radiation (IR), as expected. However, restoration of functional p53ER(TAM) reinstated sensitivity to IR in only 50% of Th-MYCN/Trp53(KI/KI) tumors, indicating the acquisition of additional resistance mechanisms. Gene expression and metabolic analyses indicated that the principal acquired mechanism of resistance to IR in the absence of functional p53 was metabolic adaptation in response to chronic oxidative stress. Tumors exhibited increased antioxidant metabolites and upregulation of glutathione S-transferase pathway genes, including Gstp1 and Gstz1, which are associated with poor outcome in human neuroblastoma. Accordingly, glutathione depletion by buthionine sulfoximine together with restoration of p53 activity resensitized tumors to IR. Our findings highlight the complex pathways operating in relapsed neuroblastomas and the need for combination therapies that target the diverse resistance mechanisms at play. Cancer Res; 76(10); 3025-35. ©2016 AACR. PMID:27197232

  7. Effects of Chronic Ochratoxin A Exposure on p53 Heterozygous and p53 Homozygous Mice.

    PubMed

    Bondy, Genevieve S; Caldwell, Donald S; Aziz, Syed A; Coady, Laurie C; Armstrong, Cheryl L; Curran, Ivan H A; Koffman, Robyn L; Kapal, Kamla; Lefebvre, David E; Mehta, Rekha

    2015-07-01

    Exposure to the mycotoxin ochratoxin A (OTA) causes nephropathy in domestic animals and rodents and renal tumors in rodents and poultry. Humans are exposed to OTA by consuming foods made with contaminated cereal grains and other commodities. Management of human health risks due to OTA exposure depends, in part, on establishing a mode of action (MOA) for OTA carcinogenesis. To further investigate OTA's MOA, p53 heterozygous (p53+/-) and p53 homozygous (p53+/+) mice were exposed to OTA in diet for 26 weeks. The former are susceptible to tumorigenesis upon chronic exposure to genotoxic carcinogens. OTA-induced renal damage but no tumors were observed in either strain, indicating that p53 heterozygosity conferred little additional sensitivity to OTA. Renal changes included dose-dependent increases in cellular proliferation, apoptosis, karyomegaly, and tubular degeneration in proximal tubules, which were consistent with ochratoxicosis. The lowest observed effect level for renal changes in p53+/- and p53+/+ mice was 200 μg OTA/kg bw/day. Based on the lack of tumors and the severity of renal and body weight changes at a maximum tolerated dose, the results were interpreted as suggestive of a primarily nongenotoxic (epigenetic) MOA for OTA carcinogenesis in this mouse model.

  8. Nerve growth factor receptor negates the tumor suppressor p53 as a feedback regulator

    PubMed Central

    Zhou, Xiang; Hao, Qian; Liao, Peng; Luo, Shiwen; Zhang, Minhong; Hu, Guohui; Liu, Hongbing; Zhang, Yiwei; Cao, Bo; Baddoo, Melody; Flemington, Erik K; Zeng, Shelya X; Lu, Hua

    2016-01-01

    Cancer develops and progresses often by inactivating p53. Here, we unveil nerve growth factor receptor (NGFR, p75NTR or CD271) as a novel p53 inactivator. p53 activates NGFR transcription, whereas NGFR inactivates p53 by promoting its MDM2-mediated ubiquitin-dependent proteolysis and by directly binding to its central DNA binding domain and preventing its DNA-binding activity. Inversely, NGFR ablation activates p53, consequently inducing apoptosis, attenuating survival, and reducing clonogenic capability of cancer cells, as well as sensitizing human cancer cells to chemotherapeutic agents that induce p53 and suppressing mouse xenograft tumor growth. NGFR is highly expressed in human glioblastomas, and its gene is often amplified in breast cancers with wild type p53. Altogether, our results demonstrate that cancers hijack NGFR as an oncogenic inhibitor of p53. DOI: http://dx.doi.org/10.7554/eLife.15099.001 PMID:27282385

  9. p53 binds human telomeric G-quadruplex in vitro.

    PubMed

    Adámik, Matej; Kejnovská, Iva; Bažantová, Pavla; Petr, Marek; Renčiuk, Daniel; Vorlíčková, Michaela; Brázdová, Marie

    2016-01-01

    The tumor suppressor protein p53 is a key factor in genome stability and one of the most studied of DNA binding proteins. This is the first study on the interaction of wild-type p53 with guanine quadruplexes formed by the human telomere sequence. Using electromobility shift assay and ELISA, we show that p53 binding to telomeric G-quadruplexes increases with the number of telomeric repeats. Further, p53 strongly favors G-quadruplexes folded in potassium over those formed in sodium, thus indicating the telomeric G-quadruplex conformational selectivity of p53. The presence of the quadruplex-stabilizing ligand, N-methyl mesoporphyrin IX (NMM), increases p53 recognition of G-quadruplexes in potassium. Using deletion mutants and selective p53 core domain oxidation, both p53 DNA binding domains are shown to be crucial for telomeric G-quadruplex recognition.

  10. Reactivating mutant p53 using small molecules as zinc metallochaperones: awakening a sleeping giant in cancer

    PubMed Central

    Blanden, Adam R.; Yu, Xin; Loh, Stewart N.; Levine, Arnold J.; Carpizo, Darren R.

    2016-01-01

    Tumor protein p53 (TP53) is the most commonly mutated gene in human cancer. The majority of mutations are missense, and generate a defective protein that is druggable. Yet, for decades, the small-molecule restoration of wild-type (WT) p53 function in mutant p53 tumors (so-called p53 mutant ‘reactivation’) has been elusive to researchers. The p53 protein requires the binding of a single zinc ion for proper folding, and impairing zinc binding is a major mechanism for loss of function in missense mutant p53. Here, we describe recent work defining a new class of drugs termed zinc metallochaperones that restore WT p53 structure and function by restoring Zn2+ to Zn2+-deficient mutant p53. PMID:26205328

  11. Silver nanoparticles defeat p53-positive and p53-negative osteosarcoma cells by triggering mitochondrial stress and apoptosis

    PubMed Central

    Kovács, Dávid; Igaz, Nóra; Keskeny, Csilla; Bélteky, Péter; Tóth, Tímea; Gáspár, Renáta; Madarász, Dániel; Rázga, Zsolt; Kónya, Zoltán; Boros, Imre M.; Kiricsi, Mónika

    2016-01-01

    Loss of function of the tumour suppressor p53 observed frequently in human cancers challenges the drug-induced apoptotic elimination of cancer cells from the body. This phenomenon is a major concern and provides much of the impetus for current attempts to develop a new generation of anticancer drugs capable of provoking apoptosis in a p53-independent manner. Since silver nanoparticles (AgNPs) possess unique cytotoxic features, we examined, whether their activity could be exploited to kill tumour suppressor-deficient cancer cells. Therefore, we investigated the effects of AgNPs on osteosarcoma cells of different p53 genetic backgrounds. As particle diameters might influence the molecular mechanisms leading to AgNP-induced cell death we applied 5 nm and 35 nm sized citrate-coated AgNPs. We found that both sized AgNPs targeted mitochondria and induced apoptosis in wild-type p53-containing U2Os and p53-deficient Saos-2 cells. According to our findings AgNPs are able to kill osteosarcoma cells independently from their actual p53 status and induce p53-independent cancer cell apoptosis. This feature renders AgNPs attractive candidates for novel chemotherapeutic approaches. PMID:27291325

  12. Loss of p53 induces epidermal growth factor receptor promoter activity in normal human keratinocytes

    PubMed Central

    Bheda, A; Creek, KE; Pirisi, L

    2008-01-01

    Overexpression of the epidermal growth factor receptor (EGFR) in human papillomavirus type 16-immortalized human keratinocytes (HKc) is caused by the viral oncoprotein E6, which targets p53 for degradation. We have previously observed that expression of p53 RNAi in normal HKc is associated with an increase in EGFR mRNA and protein. We now report that p53 RNAi induces EGFR promoter activity up to approximately 10-fold in normal HKc, and this effect does not require intact p53 binding sites on the EGFR promoter. Exogenous wild-type p53 inhibits the EGFR promoter at low levels, and activates it at higher concentrations. Yin Yang 1 (YY1), which negatively regulates p53, induces EGFR promoter activity, and this effect is augmented by p53 RNAi. Intact p53 binding sites on the EGFR promoter are not required for activation by YY1. In addition, Sp1 and YY1 synergistically induce the EGFR promoter in normal HKc, indicating that Sp1 may recruit YY1 as a co-activator. Wild-type p53 suppressed Sp1- and YY1-mediated induction of the EGFR promoter. We conclude that acute loss of p53 in normal HKc induces EGFR expression bya mechanism that involves YY1 and Sp1 and does not require p53 binding to the EGFR promoter. PMID:18391986

  13. p53MVA therapy in patients with refractory gastrointestinal malignancies elevates p53-specific CD8+ T cell responses

    PubMed Central

    Hardwick, Nicola R; Carrol, Mary; Kaltcheva, Teodora; Qian, Dajun; Lim, Dean; Leong, Lucille; Chu, Peiguo; Kim, Joseph; Chao, Joseph; Fakih, Marwan; Yen, Yun; Espenschied, Jonathan; Ellenhorn, Joshua D I; Diamond, Don J; Chung, Vincent

    2014-01-01

    PURPOSE: To conduct a Phase I trial of a Modified Vaccinia Ankara vaccine delivering wild type human p53 (p53MVA) in patients with refractory gastrointestinal cancers. EXPERIMENTAL DESIGN: Three patients were vaccinated with 1.0 × 108 pfu p53MVA followed by nine patients at 5.6 × 108 pfu. Toxicity was classified using the NCI Common Toxicity Criteria and clinical responses were assessed by CT scan. Peripheral blood samples were collected pre- and post-immunization for immunophenotyping, monitoring of p53MVA induced immune response and examination of PD-1 checkpoint inhibition in vitro. RESULTS: p53MVA immunization was well tolerated at both doses, with no adverse events above grade 2. CD4+ and CD8+ T cells showing enhanced recognition of a p53 overlapping peptide library were detectable after the first immunization, particularly in the CD8+ T cell compartment (p=0.03). However in most patients this did not expand further with the second and third immunization. The frequency of PD-1+ T cells detectable in patients PBMC was significantly higher than in healthy controls. Furthermore, the frequency of PD-1+ CD8+ T cells showed an inverse correlation with the peak CD8+ p53 response (p=0.02) and antibody blockade of PD-1 in vitro increased the p53 immune responses detected after the second or third immunizations. Induction of strong T cell and antibody responses to the MVA backbone were also apparent. CONCLUSION: p53MVA was well tolerated and induced robust CD8+ T cell responses. Combination of p53MVA with immune checkpoint inhibition could help sustain immune responses and lead to enhanced clinical benefit. PMID:24987057

  14. Functional studies of a germ-line polymorphism at codon 47 within the p53 gene

    SciTech Connect

    Felley-Bosco, E.; Weston, A.; Cawley, H.M.; Bennett, W.P.; Harris, C.C.

    1993-09-01

    A rare germ-line polymorphism in codon 47 of the p53 gene replaces the wild-type proline (CCG) with a serine (TCG). Restriction analysis of 101 human samples revealed the frequency of the rare allele to be 0% (n = 69) in Causasians and 4.7% (3/64, n = 32) among African-Americans. To investigate the consequence of this amino acid substitution, a cDNA construct (p53 mut47ser) containing the mutation was introduced into a lung adenocarcinoma cell line (Calu-6) that does not express p53. A growth suppression similar to that obtained after introduction of a wild-type p53 cDNA construct was observed, in contrast to the result obtained by introduction of p53 mut143ala. Furthermore, expression of neither p53 mut47ser nor wild-type p53 was tolerated by growing cells. In transient expression assays, both mut47ser and wild-type p53 activated the expression of a reporter gene linked to a p53 binding sequence (PG13-CAT) and inhibited the expression of the luciferase gene under the control of the Rous sarcoma virus promoter (RSVluc). In the same assay, mut143ala did not activate the expression of PG13-CAT and produced only a slight inhibitory effect on RSVluc. These findings indicate that the p53 variant with a serine at codon 47 should be considered as a rare germ-line polymorphism that does not alter the growth-suppression activity of p53. 30 refs., 3 figs., 3 tabs.

  15. Immunohistochemical detection of p53 in Wilms' tumors correlates with unfavorable outcome.

    PubMed Central

    Lahoti, C.; Thorner, P.; Malkin, D.; Yeger, H.

    1996-01-01

    The role of p53 in the pathogenesis and progression of Wilms' tumors is only partly understood. Although p53 mutations were initially reported only in anaplastic Wilms' tumors, we had reported that, of two of twenty-one cases that had a p53 mutation, one tumor showed no evidence of anaplasia. To determine the significance of p53 expression in all clinical stages of Wilms' tumor, twenty-eight cases were analyzed for p53 immunoreactivity. Paraffin sections were immunolabeled with two different monoclonal antibodies, recognizing both mutant and wild-type p53. Fifteen of sixteen tumors in the recurrent/metastatic group and three of twelve tumors in the nonmetastatic/nonrecurrent group showed p53 immunopositivity. Only one of three positive tumors in the latter group showed moderate to strong positivity, whereas twelve of sixteen metastatic/recurrent tumors revealed a similar degree of p53 positivity. The positivity was stronger in the metastasis/recurrences as compared with the corresponding primary tumor. Western blot analysis revealed p53 expression in all of the Wilms' tumors tested, suggesting its involvement in the development of Wilms' tumors. Single-strand conformation polymorphism analysis performed on twenty-three of these tumors revealed p53 mutations in four of fourteen recurrent/metastatic tumors and none in the nonmetastatic/nonrecurrent group. Our results show that, whereas 60% of cases were immunopositive for p53 protein, mutations were detected in only 16% of tumors, indicating that wild-type p53 protein is retained in the other tumors. We conclude that p53 immunopositivity strongly correlates with recurrence/metastasis in Wilms' tumors. Furthermore, the accumulation of p53 in these tumors is not only due to mutations but may also involve stabilization of normal p53 with other proteins. Images Figure 1 Figure 2 Figure 3 PMID:8623926

  16. Both p53-PUMA/NOXA-Bax-mitochondrion and p53-p21cip1 pathways are involved in the CDglyTK-mediated tumor cell suppression

    SciTech Connect

    Yu, Zhendong; Wang, Hao; Zhang, Libin; Tang, Aifa; Zhai, Qinna; Wen, Jianxiang; Yao, Li; Li, Pengfei

    2009-09-04

    CDglyTK fusion suicide gene has been well characterized to effectively kill tumor cells. However, the exact mechanism and downstream target genes are not fully understood. In our study, we found that CDglyTK/prodrug treatment works more efficiently in p53 wild-type (HONE1) cells than in p53 mutant (CNE1) cells. We then used adenovirus-mediated gene delivery system to either knockdown or overexpress p53 and its target genes in these cells. Consistent results showed that both p53-PUMA/NOXA/Bcl2-Bax and p53-p21 pathways contribute to the CDglyTK induced tumor cell suppression. Our work for the first time addressed the role of p53 related genes in the CDglyTK/prodrug system.

  17. p53 E3 ubiquitin protein ligase homolog regulates p53 in vivo in the adult mouse eye lens

    PubMed Central

    Jaramillo-Rangel, Gilberto; Ortega-Martínez, Marta; Sepúlveda-Saavedra, Julio; Saucedo-Cárdenas, Odila; Montes-de-Oca-Luna, Roberto

    2013-01-01

    Purpose p53 is a transcription factor that plays an important role in preventing cancer development. p53 participates in relevant aspects of cell biology, including apoptosis and cell cycle control and must be strictly regulated to maintain normal tissue homeostasis. p53 E3 ubiquitin protein ligase homolog (Mdm2) is an important negative regulator of p53. The purpose of this study was to determine if Mdm2 regulates p53 in vivo in the adult lens. Methods We analyzed mice expressing human p53 transgene (Tgp53) selectively in the lens in the presence or absence of Mdm2. Mice with the required genotypes were obtained by crossing transgenic, mdm2+/−, and p53−/− mice. Eye phenotype and lens histology and ultrastructure were analyzed in adult mice. Results In a wild-type genetic background (mdm2+/+), lens damage and microphthalmia were observed only in mice homozygous for Tgp53 (t/t). However, in an mdm2 null background, just one allele of Tgp53 (mdm2−/−/Tgp53t/0 mice) was sufficient to cause lens damage and microphthalmia. Furthermore, Mdm2 in only one allele was sufficient to rescue these deleterious effects, since the mdm2+/−/Tgp53t/0 mice had eye size and lens morphology similar to the control mice. Conclusions Mdm2 regulates p53 in the adult lens in vivo. This information may have relevance for analyzing normal and pathological conditions of the lens, and designing cancer therapies targeting Mdm2–p53 interaction. PMID:24339722

  18. p53 Small Molecule Inhibitor Enhances Temozolomide Cytotoxic Activity against Intracranial Glioblastoma Xenografts

    PubMed Central

    Dinca, Eduard B.; Lu, Kan V.; Sarkaria, Jann N.; Pieper, Russell O.; Prados, Michael D.; Haas-Kogan, Daphne A.; VandenBerg, Scott R.; Berger, Mitchel S.; James, C. David

    2010-01-01

    In this study we investigated corresponding precursor and active forms of a p53 small molecule inhibitor for effect on temozolomide (TMZ) anti-tumor activity against glioblastoma (GBM), using both in vitro and in vivo experimental approaches. Results from in vitro cell viability analysis showed that the cytotoxic activity of TMZ was substantially increased when GBMs with wild-type p53 were co-treated with the active form of p53 inhibitor, and this heightened cytotoxic response was accompanied by increased PARP cleavage as well as elevated cellular phospho-H2AX. Analysis of the same series of GBMs, as intracranial xenografts in athymic mice, and administering corresponding p53 inhibitor precursor, that is converted to the active compound in vivo, yielded results consistent with the in vitro analyses: i.e., TMZ + p53 inhibitor precursor co-treatment, of three distinct wild-type p53 GBM xenografts, resulted in significant enhancement of TMZ anti-tumor effect relative to treatment with TMZ alone, as indicated by serial bioluminescence monitoring as well as survival analysis (p < 0.001 for co-treatment survival benefit in each case). Mice receiving intracranial injection with p53 null GBM showed similar survival benefit from TMZ treatment regardless of the presence or absence of p53 inhibitor precursor. In total, our results indicate that the p53 active and precursor inhibitor pair enhance TMZ cytotoxicity in vitro and in vivo, respectively, and do so in a p53-dependent manner. PMID:19074867

  19. Comparative study of p53 gene and protein alterations in human astrocytic tumors.

    PubMed

    Louis, D N; von Deimling, A; Chung, R Y; Rubio, M P; Whaley, J M; Eibl, R H; Ohgaki, H; Wiestler, O D; Thor, A D; Seizinger, B R

    1993-01-01

    The p53 gene is a tumor suppressor gene involved in many common malignancies, including astrocytomas. Genetic analysis of the p53 gene and immunohistochemistry of the p53 protein have each been used to screen astrocytomas. To compare these methods, we performed immunohistochemistry with the monoclonal antibody PAb 1801 and single-strand conformational polymorphism (SSCP) with sequence analysis on 34 astrocytic tumors (WHO grades II, III and IV). Seven cases had detectable p53 protein and gene mutations, while twelve cases had neither detectable protein nor gene mutations. Four tumors had frameshift mutations in the p53 gene that were not revealed by immunohistochemistry. One tumor had a genetic polymorphism and no detectable p53 protein. Ten tumors had p53 protein accumulation but no mutations by SSCP; these cases may represent p53 mutations outside of the conserved exons or elevated levels of wild-type p53 protein. Thus, some p53 mutations are missed with PAb 1801 immunohistochemistry alone. p53 immunohistochemistry, however, may reveal p53 accumulation independent of mutations in the conserved portions of the gene. Finally, we suggest that glioblastomas with p53 mutations in the conserved region of the gene may be a subset that are more common in women and in younger patients.

  20. The antagonism between MCT-1 and p53 affects the tumorigenic outcomes

    PubMed Central

    2010-01-01

    Background MCT-1 oncoprotein accelerates p53 protein degradation via a proteosome pathway. Synergistic promotion of the xenograft tumorigenicity has been demonstrated in circumstance of p53 loss alongside MCT-1 overexpression. However, the molecular regulation between MCT-1 and p53 in tumor development remains ambiguous. We speculate that MCT-1 may counteract p53 through the diverse mechanisms that determine the tumorigenic outcomes. Results MCT-1 has now identified as a novel target gene of p53 transcriptional regulation. MCT-1 promoter region contains the response elements reactive with wild-type p53 but not mutant p53. Functional p53 suppresses MCT-1 promoter activity and MCT-1 mRNA stability. In a negative feedback regulation, constitutively expressed MCT-1 decreases p53 promoter function and p53 mRNA stability. The apoptotic events are also significantly prevented by oncogenic MCT-1 in a p53-dependent or a p53-independent fashion, according to the genotoxic mechanism. Moreover, oncogenic MCT-1 promotes the tumorigenicity in mice xenografts of p53-null and p53-positive lung cancer cells. In support of the tumor growth are irrepressible by p53 reactivation in vivo, the inhibitors of p53 (MDM2, Pirh2, and Cop1) are constantly stimulated by MCT-1 oncoprotein. Conclusions The oppositions between MCT-1 and p53 are firstly confirmed at multistage processes that include transcription control, mRNA metabolism, and protein expression. MCT-1 oncogenicity can overcome p53 function that persistently advances the tumor development. PMID:21138557

  1. Enhanced radiosensitization of p53 mutant cells by oleamide

    SciTech Connect

    Lee, Yoon-Jin; Chung, Da Yeon; Lee, Su-Jae; Ja Jhon, Gil; Lee, Yun-Sil . E-mail: yslee@kcch.re.kr

    2006-04-01

    Purpose: Effect of oleamide, an endogenous fatty-acid primary amide, on tumor cells exposed to ionizing radiation (IR) has never before been explored. Methods and Materials: NCI H460, human lung cancer cells, and human astrocytoma cell lines, U87 and U251, were used. The cytotoxicity of oleamide alone or in combination with IR was determined by clonogenic survival assay, and induction of apoptosis was estimated by FACS analysis. Protein expressions were confirmed by Western blotting, and immunofluorescence analysis of Bax by use of confocal microscopy was also performed. The combined effect of IR and oleamide to suppress tumor growth was studied by use of xenografts in the thighs of nude mice. Results: Oleamide in combination with IR had a synergistic effect that decreased clonogenic survival of lung-carcinoma cell lines and also sensitized xenografts in nude mice. Enhanced induction of apoptosis of the cells by the combined treatment was mediated by loss of mitochondrial membrane potential, which resulted in the activation of caspase-8, caspase-9, and caspase-3 accompanied by cytochrome c release and Bid cleavage. The synergistic effects of the combined treatment were more enhanced in p53 mutant cells than in p53 wild-type cells. In p53 wild-type cells, both oleamide and radiation induced Bax translocation to mitochondria. On the other hand, in p53 mutant cells, radiation alone slightly induced Bax translocation to mitochondria, whereas oleamide induced a larger translocation. Conclusions: Oleamide may exhibit synergistic radiosensitization in p53 mutant cells through p53-independent Bax translocation to mitochondria.

  2. ROCK1 functions as a critical regulator of stress erythropoiesis and survival by regulating p53

    PubMed Central

    Vemula, Sasidhar; Shi, Jianjian; Mali, Raghuveer Singh; Ma, Peilin; Liu, Yan; Hanneman, Philip; Koehler, Karl R.; Hashino, Eri; Wei, Lei

    2012-01-01

    Erythropoiesis is a dynamic, multistep process whereby hematopoietic stem cells differentiate toward a progressively committed erythroid lineage through intermediate progenitors. Although several downstream signaling molecules have been identified that regulate steady-state erythropoiesis, the major regulators under conditions of stress remain poorly defined. Rho kinases (ROCKs) belong to a family of serine/threonine kinases. Using gene-targeted ROCK1-deficient mice, we show that lack of ROCK1 in phenylhydrazine-induced oxidative stress model results in enhanced recovery from hemolytic anemia as well as enhanced splenic stress erythropoiesis compared with control mice. Deficiency of ROCK1 also results in enhanced survival, whereas wild-type mice die rapidly in response to stress. Enhanced survivability of ROCK1-deficient mice is associated with reduced level of reactive oxygen species. BM transplantation studies revealed that enhanced stress erythropoiesis in ROCK1-deficient mice is stem cell autonomous. We show that ROCK1 binds to p53 and regulates its stability and expression. In the absence of ROCK1, p53 phosphorylation and expression is significantly reduced. Our findings reveal that ROCK1 functions as a physiologic regulator of p53 under conditions of erythroid stress. These findings are expected to offer new perspectives on stress erythropoiesis and may provide a potential therapeutic target in human disease characterized by anemia. PMID:22889758

  3. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue

    SciTech Connect

    Wallentine, Brad D.; Wang, Ying; Tretyachenko-Ladokhina, Vira; Tan, Martha; Senear, Donald F.; Luecke, Hartmut

    2013-10-01

    X-ray crystallographic structures of four p53 core-domain variants were determined in order to gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53. To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutation substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol{sup −1} (15.1 kJ mol{sup −1}). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the

  4. p53-Mediated Cellular Response to DNA Damage in Cells with Replicative Hepatitis B Virus

    NASA Astrophysics Data System (ADS)

    Puisieux, Alain; Ji, Jingwei; Guillot, Celine; Legros, Yann; Soussi, Thierry; Isselbacher, Kurt; Ozturk, Mehmet

    1995-02-01

    Wild-type p53 acts as a tumor suppressor gene by protecting cells from deleterious effects of genotoxic agents through the induction of a G_1/S arrest or apoptosis as a response to DNA damage. Transforming proteins of several oncogenic DNA viruses inactivate tumor suppressor activity of p53 by blocking this cellular response. To test whether hepatitis B virus displays a similar effect, we studied the p53-mediated cellular response to DNA damage in 2215 hepatoma cells with replicative hepatitis B virus. We demonstrate that hepatitis B virus replication does not interfere with known cellular functions of p53 protein.

  5. Quantitative assessment of the p53-Mdm2 feedback loop using protein lysate microarrays.

    PubMed

    Ramalingam, Sundhar; Honkanen, Peter; Young, Lynn; Shimura, Tsutomu; Austin, John; Steeg, Patricia S; Nishizuka, Satoshi

    2007-07-01

    Mathematical simulations of the p53-Mdm2 feedback loop suggest that both proteins will exhibit impulsive expression characteristics in response to high cellular stress levels. However, little quantitative experimental evaluation has been done, particularly of the phosphorylated forms. To evaluate the mathematical models experimentally, we used lysate microarrays from an isogenic pair of gamma-ray-irradiated cell lysates from HCT116 (p53(+/+) and p53(-/-)). Both p53 and Mdm2 proteins showed expected pulses in the wild type, whereas no pulses were seen in the knockout. Based on experimental observations, we determined model parameters and generated an in silico "knockout," reflecting the experimental data, including phosphorylated proteins.

  6. Mutant p53 Drives Cancer by Subverting Multiple Tumor Suppression Pathways

    PubMed Central

    Haupt, Sue; Raghu, Dinesh; Haupt, Ygal

    2016-01-01

    The tumor suppressor p53 normally acts as a brake to halt damaged cells from perpetrating their genetic errors into future generations. If p53 is disrupted by mutation, it may not only lose these corrective powers, but counterproductively acquire new capacities that drive cancer. A newly emerging manner in which mutant p53 executes its cancer promoting functions is by harnessing key proteins, which normally partner with its wild type, tumor-inhibiting counterpart. In association with the subverted activities of these protein partners, mutant p53 is empowered to act across multiple fundamental cellular pathways (regulating cell division and metabolism) and corrupt them to become cancer promoting. PMID:26858938

  7. p53 protein oxidation in cultured cells in response to pyrrolidine dithiocarbamate: a novel method for relating the amount of p53 oxidation in vivo to the regulation of p53-responsive genes.

    PubMed Central

    Wu, H H; Thomas, J A; Momand, J

    2000-01-01

    A novel method was developed to determine the oxidation status of proteins in cultured cells. Methoxy-polyethylene glycol-maleimide MW 2000 (MAL-PEG) was used to covalently tag p53 protein that was oxidized at cysteine residues in cultured cells. Treatment of MCF7 breast cancer cells with pyrrolidine dithiocarbamate (PDTC), a metal chelator, resulted in a minimum of 25% oxidation of p53. The oxidized p53 had an average of one cysteine residue oxidized per p53 protein molecule. The effect of PDTC treatment on downstream components of the p53 signal-transduction pathway was tested. PDTC treatment prevented actinomycin D-mediated up-regulation of two p53 effector gene products, murine double minute clone 2 oncoprotein and p21(WAF1/CIP1) (where WAF1 corresponds to wild-type p53-activated fragment 1 and CIP1 corresponds to cyclin-dependent kinase-interacting protein 1). Actinomycin D treatment led to accumulation of p53 protein in the nucleus. However, when cells were simultaneously treated with PDTC and actinomycin D, p53 accumulated in both the nucleus and the cytoplasm. The data indicate that an average of one cysteine residue per p53 protein molecule is highly sensitive to oxidation and that p53 can be efficiently oxidized by PDTC in cultured cells. PDTC-mediated oxidation of p53 correlates with altered p53 subcellular localization and reduced activation of p53 downstream effector genes. The novel method for detecting protein oxidation detailed in the present study may be used to determine the oxidation status of specific proteins in cells. PMID:10998350

  8. Complete reduction of p53 expression by RNA interference following heterozygous knockout in porcine fibroblasts.

    PubMed

    Kim, Young June; Kim, Tae-Hyun; Kim, Minjeong; Kim, Min Ju; Kim, Hae-Won; Shim, Hosup

    2016-08-01

    Tumor suppressor p53 plays a critical role in the regulation of cell cycle and apoptosis in mammals. Mutations of p53 often cause various cancers. Murine models have improved our understanding on tumorigenesis associated with p53 mutations. However, mice and humans are different in many ways. For example, the short lifespans of mice limit the clinical application of the data obtained from this species. Porcine model could be an alternative as pigs share many anatomical and physiological similarities with humans. Here, we modified the expression levels of p53 messenger RNA (mRNA) and protein in porcine fetal fibroblasts using a combination of gene targeting and RNA interference. First, we disrupted the p53 gene to produce p53 knockout (KO) cells. Second, the p53 shRNA expression vector was introduced into fibroblasts to isolate p53 knockdown (KD) cells. We obtained p53 KO, KD, and KO + KD fibroblasts which involve p53 KO and KD either separately or simultaneously. The mRNA expression of p53 in p53 KO fibroblasts was similar to that in the wild-type control. However, the mRNA expression levels of p53 in KD and KO + KD cells were significantly decreased. The p53 protein level significant reduced in p53 KD. Interestingly, no p53 protein was detected in KO + KD, suggesting a complete reduction of the protein by synergistic effect of KO and KD. This study demonstrated that various expression levels of p53 in porcine fibroblasts could be achieved by gene targeting and RNA interference. Moreover, complete abolishment of protein expression is feasible using a combination of gene targeting and RNA interference.

  9. Complete reduction of p53 expression by RNA interference following heterozygous knockout in porcine fibroblasts.

    PubMed

    Kim, Young June; Kim, Tae-Hyun; Kim, Minjeong; Kim, Min Ju; Kim, Hae-Won; Shim, Hosup

    2016-08-01

    Tumor suppressor p53 plays a critical role in the regulation of cell cycle and apoptosis in mammals. Mutations of p53 often cause various cancers. Murine models have improved our understanding on tumorigenesis associated with p53 mutations. However, mice and humans are different in many ways. For example, the short lifespans of mice limit the clinical application of the data obtained from this species. Porcine model could be an alternative as pigs share many anatomical and physiological similarities with humans. Here, we modified the expression levels of p53 messenger RNA (mRNA) and protein in porcine fetal fibroblasts using a combination of gene targeting and RNA interference. First, we disrupted the p53 gene to produce p53 knockout (KO) cells. Second, the p53 shRNA expression vector was introduced into fibroblasts to isolate p53 knockdown (KD) cells. We obtained p53 KO, KD, and KO + KD fibroblasts which involve p53 KO and KD either separately or simultaneously. The mRNA expression of p53 in p53 KO fibroblasts was similar to that in the wild-type control. However, the mRNA expression levels of p53 in KD and KO + KD cells were significantly decreased. The p53 protein level significant reduced in p53 KD. Interestingly, no p53 protein was detected in KO + KD, suggesting a complete reduction of the protein by synergistic effect of KO and KD. This study demonstrated that various expression levels of p53 in porcine fibroblasts could be achieved by gene targeting and RNA interference. Moreover, complete abolishment of protein expression is feasible using a combination of gene targeting and RNA interference. PMID:27142766

  10. Sam68 functions as a transcriptional coactivator of the p53 tumor suppressor

    PubMed Central

    Li, Naomi; Richard, Stéphane

    2016-01-01

    Sam68 is a known sequence-specific RNA binding protein that regulates alternative splicing events during the cell cycle and apoptosis. Sam68 has also been shown to influence transcription, but the molecular mechanism remains undefined. Herein we identify Sam68 as a transcriptional coactivator of the p53 tumor suppressor in response to DNA damage. Using CRISPR/Cas9 generated isogenic HCT116 Sam68−/− cell lines wild type or deficient for p53, we show that Sam68 is required for the efficient transactivation of p53 target genes. Consistently, Sam68 depletion caused defects in DNA damage-induced cell cycle arrest and apoptosis mediated by p53. Mechanistically, we demonstrate that Sam68 physically interacted with p53 in an RNA-dependent manner, and that this interaction was essential for the coactivator function of Sam68. Furthermore, we show that both Sam68 and p53 were recruited to promoters of p53-responsive genes, suggesting interdependence. Finally, Sam68 acted in concert with the p53 long noncoding RNA (lncRNA) target PR-lncRNA-1 for p53 recruitment, implicating a positive-feedback mechanism in which lncRNAs induced by the Sam68/p53 complex can enhance p53 transcriptional activity. These findings define a hitherto novel mechanism of action for Sam68 in governing p53 transcriptional activation, and represent the first report of Sam68 in the regulation of tumor suppressor activities. PMID:27365047

  11. An extra copy of p53 suppresses development of spontaneous Kras-driven but not radiation-induced cancer

    PubMed Central

    Moding, Everett J.; Min, Hooney D.; Castle, Katherine D.; Ali, Moiez; Woodlief, Loretta; Williams, Nerissa; Ma, Yan; Kim, Yongbaek; Lee, Chang-Lung

    2016-01-01

    The tumor suppressor p53 blocks tumor progression in multiple tumor types. Radiation-induced cancer following exposure to radiation therapy or space travel may also be regulated by p53 because p53 has been proposed to respond to DNA damage to suppress tumorigenesis. Here, we investigate the role of p53 in lung carcinogenesis and lymphomagenesis in LA-1 KrasG12D mice with wild-type p53 or an extra copy of p53 (super p53) exposed to fractionated total body irradiation with low linear energy transfer (low-LET) X-rays or high-LET iron ions and compared tumor formation in these mice with unirradiated controls. We found that an additional copy of p53 suppressed both Kras-driven lung tumor and lymphoma development in the absence of radiation. However, an additional copy of p53 did not affect lymphoma development following low- or high-LET radiation exposure and was unable to suppress radiation-induced expansion of thymocytes with mutated Kras. Moreover, radiation exposure increased lung tumor size in super p53 but not wild-type p53 mice. These results demonstrate that although p53 suppresses the development of spontaneous tumors expressing KrasG12D, in the context of exposure to ionizing radiation, an extra copy of p53 does not protect against radiation-induced lymphoma and may promote KrasG12D mutant lung cancer. PMID:27453951

  12. A spatiotemporal characterization of the effect of p53 phosphorylation on its interaction with MDM2

    PubMed Central

    ElSawy, Karim M; Sim, Adelene; Lane, David P; Verma, Chandra S; Caves, Leo SD

    2015-01-01

    The interaction of p53 and MDM2 is modulated by the phosphorylation of p53. This mechanism is key to activating p53, yet its molecular determinants are not fully understood. To study the spatiotemporal characteristics of this molecular process we carried out Brownian dynamics simulations of the interactions of the MDM2 protein with a p53 peptide in its wild type state and when phosphorylated at Thr18 (pThr18) and Ser20 (pSer20). We found that p53 phosphorylation results in concerted changes in the topology of the interaction landscape in the diffusively bound encounter complex domain. These changes hinder phosphorylated p53 peptides from binding to MDM2 well before reaching the binding site. The underlying mechanism appears to involve shift of the peptide away from the vicinity of the MDM2 protein, peptide reorientation, and reduction in peptide residence time relative to wild-type p53 peptide. pThr18 and pSr20 p53 peptides experience reduction in residence times by factors of 13.6 and 37.5 respectively relative to the wild-type p53 peptide, indicating a greater role for Ser20 phosphorylation in abrogating p53 MDM2 interactions. These detailed insights into the effect of phosphorylation on molecular interactions are not available from conventional experimental and theoretical approaches and open up new avenues that incorporate molecular interaction dynamics, for stabilizing p53 against MDM2, which is a major focus of anticancer drug lead development. PMID:25584963

  13. A spatiotemporal characterization of the effect of p53 phosphorylation on its interaction with MDM2.

    PubMed

    ElSawy, Karim M; Sim, Adelene; Lane, David P; Verma, Chandra S; Caves, Leo Sd

    2015-01-01

    The interaction of p53 and MDM2 is modulated by the phosphorylation of p53. This mechanism is key to activating p53, yet its molecular determinants are not fully understood. To study the spatiotemporal characteristics of this molecular process we carried out Brownian dynamics simulations of the interactions of the MDM2 protein with a p53 peptide in its wild type state and when phosphorylated at Thr18 (pThr18) and Ser20 (pSer20). We found that p53 phosphorylation results in concerted changes in the topology of the interaction landscape in the diffusively bound encounter complex domain. These changes hinder phosphorylated p53 peptides from binding to MDM2 well before reaching the binding site. The underlying mechanism appears to involve shift of the peptide away from the vicinity of the MDM2 protein, peptide reorientation, and reduction in peptide residence time relative to wild-type p53 peptide. pThr18 and pSr20 p53 peptides experience reduction in residence times by factors of 13.6 and 37.5 respectively relative to the wild-type p53 peptide, indicating a greater role for Ser20 phosphorylation in abrogating p53 MDM2 interactions. These detailed insights into the effect of phosphorylation on molecular interactions are not available from conventional experimental and theoretical approaches and open up new avenues that incorporate molecular interaction dynamics, for stabilizing p53 against MDM2, which is a major focus of anticancer drug lead development. PMID:25584963

  14. Autophagy induced by p53-reactivating molecules protects pancreatic cancer cells from apoptosis.

    PubMed

    Fiorini, Claudia; Menegazzi, Marta; Padroni, Chiara; Dando, Ilaria; Dalla Pozza, Elisa; Gregorelli, Alex; Costanzo, Chiara; Palmieri, Marta; Donadelli, Massimo

    2013-03-01

    TP53 mutations compromising p53 transcriptional function occur in more than 50 % of human cancers, including pancreatic adenocarcinoma, and render cancer cells more resistant to conventional therapy. In the last few years, many efforts have been addressed to identify p53-reactivating molecules able to restore the wild-type transcriptionally competent conformation of the mutated proteins. Here, we show that two of these compounds, CP-31398 and RITA, induce cell growth inhibition, apoptosis, and autophagy by activating p53/DNA binding and p53 phosphorylation (Ser15), without affecting the total p53 amount. These effects occur in both wild-type and mutant p53 pancreatic adenocarcinoma cell lines, whereas they are much less pronounced in normal human primary fibroblasts. Furthermore, CP-31398 and RITA regulate the axis SESN1-2/AMPK/mTOR by inducing AMPK phosphorylation on Thr172, which has a crucial role in the autophagic response. The protective role of autophagy in cell growth inhibition by CP-31398 and RITA is supported by the finding that the AMPK inhibitor compound C or the autophagy inhibitors chloroquine or 3-methyladenine sensitize both pancreatic adenocarcinoma cell lines to the apoptotic response induced by p53-reactivating molecules. Our results demonstrate for the first time a survival role for autophagy induced by p53-reactivating molecules, supporting the development of an anti-cancer therapy based on autophagy inhibition associated to p53 activation.

  15. P53 regulates disruption of neuronal development in the adult hippocampus after irradiation

    PubMed Central

    Li, Y-Q; Cheng, ZW-C; Liu, SK-W; Aubert, I; Wong, C S

    2016-01-01

    Inhibition of hippocampal neurogenesis is implicated in neurocognitive dysfunction after cranial irradiation for brain tumors. How irradiation results in impaired neuronal development remains poorly understood. The Trp53 (p53) gene is known to regulate cellular DNA damage response after irradiation. Whether it has a role in disruption of late neuronal development remains unknown. Here we characterized the effects of p53 on neuronal development in adult mouse hippocampus after irradiation. Different bromodeoxyuridine incorporation paradigms and a transplantation study were used for cell fate mapping. Compared with wild-type mice, we observed profound inhibition of hippocampal neurogenesis after irradiation in mice deficient in p53 despite the absence of acute apoptosis of neuroblasts. The putative neural stem cells were apoptosis resistant after irradiation regardless of p53 genotype. Cell fate mapping using different bromodeoxyuridine incorporation paradigms revealed enhanced activation of neural stem cells and their consequential exhaustion in the absence of p53 after irradiation. Both p53-knockout and wild-type mice demonstrated similar extent of microglial activation in the hippocampus after irradiation. Impairment of neuronal differentiation of neural progenitors transplanted in irradiated hippocampus was not altered by p53 genotype of the recipient mice. We conclude that by inhibiting neural progenitor activation, p53 serves to mitigate disruption of neuronal development after irradiation independent of apoptosis and perturbation of the neural stem cell niche. These findings suggest for the first time that p53 may have a key role in late effects in brain after irradiation. PMID:27752364

  16. p53 in breast cancer subtypes and new insights into response to chemotherapy.

    PubMed

    Bertheau, Philippe; Lehmann-Che, Jacqueline; Varna, Mariana; Dumay, Anne; Poirot, Brigitte; Porcher, Raphaël; Turpin, Elisabeth; Plassa, Louis-François; de Roquancourt, Anne; Bourstyn, Edwige; de Cremoux, Patricia; Janin, Anne; Giacchetti, Sylvie; Espié, Marc; de Thé, Hugues

    2013-08-01

    Despite an obvious central role of p53 in the hallmarks of cancer, TP53 status is not yet used for the management of breast cancer. Recent findings may lead to reconsider the role of p53 in breast cancer. TP53 mutations are the most frequent genetic alterations in breast cancer, observed in 30% of breast carcinomas. Their distribution is highly linked to molecular tumor subtypes found in 26% of luminal tumors (17% of luminal A, 41% of luminal B), in 50% of HER2 amplified tumors, in 69% of molecular apocrine breast carcinomas and in 88% of basal-like carcinomas. The type of mutation is linked to the tumor subtype with higher frequency of base-pair substitutions in luminal tumors, whereas molecular apocrine and basal-like tumors present much higher frequency of complex mutations (deletions/insertions). The timing of TP53 mutation also depends on the tumor subtype, being the first important event in luminal tumors but occurring after PTEN loss in basal-like tumors. Regarding response to cytotoxic chemotherapy, the situation is far from the p53-dependent apoptosis paradigm with subsequent clinical response. We reported that TP53 mutated non inflammatory locally advanced breast carcinomas had a high rate of complete pathological response to dose-dense doxorubicin-cyclophosphamide chemotherapy, while TP53 wild-type (WT) tumors never achieved complete response. Using human breast cancer xenograft models, we suggested that this could be due to the induction of senescence in TP53 WT tumor cells. A recent work confirmed these findings in MMTV-Wnt1 mammary tumors, showing that growth arrest and senescent phenotype, not apoptosis, were induced in TP53 WT tumors following doxorubicin treatment, while lack of arrest in mutant tumors resulted in aberrant mitoses, cell death and a superior clinical response. Furthermore, in ER positive (ER(+)) breast tumors, it has been recently reported that ER represses the p53-mediated apoptotic response induced by DNA damage. Taken together

  17. The evolution of thymic lymphomas in p53 knockout mice

    PubMed Central

    Dudgeon, Crissy; Chan, Chang; Kang, Wenfeng; Sun, Yvonne; Emerson, Ryan; Robins, Harlan

    2014-01-01

    Germline deletion of the p53 gene in mice gives rise to spontaneous thymic (T-cell) lymphomas. In this study, the p53 knockout mouse was employed as a model to study the mutational evolution of tumorigenesis. The clonality of the T-cell repertoire from p53 knockout and wild-type thymic cells was analyzed at various ages employing TCRβ sequencing. These data demonstrate that p53 knockout thymic lymphomas arose in an oligoclonal fashion, with tumors evolving dominant clones over time. Exon sequencing of tumor DNA revealed that all of the independently derived oligoclonal mouse tumors had a deletion in the Pten gene prior to the formation of the TCRβ rearrangement, produced early in development. This was followed in each independent clone of the thymic lymphoma by the amplification or overexpression of cyclin Ds and Cdk6. Alterations in the expression of Ikaros were common and blocked further development of CD-4/CD-8 T cells. While the frequency of point mutations in the genome of these lymphomas was one per megabase, there were a tremendous number of copy number variations producing the tumors’ driver mutations. The initial inherited loss of p53 functions appeared to delineate an order of genetic alterations selected for during the evolution of these thymic lymphomas. PMID:25452272

  18. Sodium Arsenite ± Hyperthermia Sensitizes p53-Expressing Human Ovarian Cancer Cells to Cisplatin by Modulating Platinum-DNA Damage Responses

    PubMed Central

    Muenyi, Clarisse S.; Pinhas, Allan R.; Fan, Teresa W.; Brock, Guy N.; Helm, C. William; States, J. Christopher

    2012-01-01

    Epithelial ovarian cancer (EOC) is the leading cause of gynecological cancer death in the United States. Cisplatin is a DNA damaging agent initially effective against EOC but limited by resistance. P53 plays a critical role in cellular response to DNA damage and has been implicated in EOC response to platinum chemotherapy. In this study, we examined the role of p53 status in EOC response to a novel combination of cisplatin, sodium arsenite, and hyperthermia. Human EOC cells were treated with cisplatin ± 20μM sodium arsenite at 37°C or 39°C for 1 h. Sodium arsenite ± hyperthermia sensitized wild-type p53-expressing (A2780, A2780/CP70, OVCA 420, OVCA 429, and OVCA 433) EOC cells to cisplatin. Hyperthermia sensitized p53-null SKOV-3 and p53-mutant (OVCA 432 and OVCAR-3) cells to cisplatin. P53 small interfering RNA (siRNA) transfection abrogated sodium arsenite sensitization effect. XPC, a critical DNA damage recognition protein in global genome repair pathway, was induced by cisplatin only in wild-type p53-expressing cells. Cotreatment with sodium arsenite ± hyperthermia attenuated cisplatin-induced XPC in wild-type p53-expressing cells. XPC siRNA transfection sensitized wild-type p53-expressing cells to cisplatin, suggesting that sodium arsenite ± hyperthermia attenuation of XPC is a mechanism by which wild-type p53-expressing cells are sensitized to cisplatin. Hyperthermia ± sodium arsenite enhanced cellular and DNA accumulation of platinum in wild-type p53-expressing cells. Only hyperthermia enhanced platinum accumulation in p53-null cells. In conclusion, sodium arsenite ± hyperthermia sensitizes wild-type p53-expressing EOC cells to cisplatin by suppressing DNA repair protein XPC and increasing cellular and DNA platinum accumulation. PMID:22331493

  19. Targeting the p53 signaling pathway in cancer therapy - The promises, challenges, and perils

    PubMed Central

    Stegh, Alexander H.

    2012-01-01

    Introduction Research over the past three decades has identified p53 as a multifunctional transcription factor, which regulates the expression of >2,500 target genes. p53 impacts myriad, highly diverse cellular processes, including the maintenance of genomic stability and fidelity, metabolism, longevity, and represents one of the most important and extensively studied tumor suppressors. Activated by various stresses, foremost genotoxic damage, hypoxia, heat shock and oncogenic assault, p53 blocks cancer progression by provoking transient or permanent growth arrest, by enabling DNA repair or by advancing cellular death programs. This potent and versatile anti-cancer activity profile, together with genomic and mutational analyses documenting inactivation of p53 in more than 50% of human cancers, motivated drug development efforts to (re-) activate p53 in established tumors. Areas covered In this review the complexities of p53 signaling in cancer are summarized. Current strategies and challenges to restore p53’s tumor suppressive function in established tumors, i.e. adenoviral gene transfer and small molecules to activate p53, to inactivate p53 inhibitors and to restore wild type function of p53 mutant proteins are discussed. Expert opinion It is indubitable that p53 represents an attractive target for the development of anti-cancer therapies. Whether p53 is ‘druggable’, however, remains an area of active research and discussion, as p53 has pro-survival functions and chronic p53 activation accelerates aging, which may compromise the long-term homeostasis of an organism. Thus, the complex biology and dual functions of p53 in cancer prevention and age-related cellular responses pose significant challenges on the development of p53-targeting cancer therapies. PMID:22239435

  20. Interaction between transactivation domain of p53 and middle part of TBP-like protein (TLP) is involved in TLP-stimulated and p53-activated transcription from the p21 upstream promoter.

    PubMed

    Maeda, Ryo; Suzuki, Hidefumi; Tanaka, Yuta; Tamura, Taka-aki

    2014-01-01

    TBP-like protein (TLP) is involved in transcriptional activation of an upstream promoter of the human p21 gene. TLP binds to p53 and facilitates p53-activated transcription from the upstream promoter. In this study, we clarified that in vitro affinity between TLP and p53 is about one-third of that between TBP and p53. Extensive mutation analyses revealed that the TLP-stimulated function resides in transcription activating domain 1 (TAD1) in the N-terminus of p53. Among the mutants, #22.23, which has two amino acid substitutions in TAD1, exhibited a typical mutant phenotype. Moreover, #22.23 exhibited the strongest mutant phenotype for TLP-binding ability. It is thus thought that TLP-stimulated and p53-dependent transcriptional activation is involved in TAD1 binding of TLP. #22.23 had a decreased transcriptional activation function, especially for the upstream promoter of the endogenous p21 gene, compared with wild-type p53. This mutant did not facilitate p53-dependent growth repression and etoposide-mediated cell-death as wild-type p53 does. Moreover, mutation analysis revealed that middle part of TLP, which is requited for p53 binding, is involved in TLP-stimulated and p53-dependent promoter activation and cell growth repression. These results suggest that activation of the p21 upstream promoter is mediated by interaction between specific regions of TLP and p53.

  1. Selective detection of inactivating mutations of the p53 tumour suppressor gene: Development of a new functional assay in yeast

    SciTech Connect

    Frebourg, T.; Flaman, J.M.; Iggo, R.

    1994-09-01

    Alterations of the p53 tumour suppressor gene in human cancer are mainly missense mutations. We have previously described a functional assay in Saccharomyces cerevisiae based on a HIS3 reporter system, which allows the selective detection of mutations which have inactivated the transcriptional activity of p53. We have now developed a simpler reporter system in which yeast change color according to their p53 status. We used an ade2-1 strain which contains an intergrated copy of the ADE2 open reading frame controlled by a p53-sensitive promoter. In the absence of wild-type p53, the strain is red due to the accumulation of an intermediate in adenine metabolism. As in the previous assay, we transform PCR-amplified p53 cDNA directly into the strain and clone them into a p53 expression vector by homologous recombination in vivo. Colonies that contain wild-type p53 overcome the block in adenine synthesis and become white. After two days, the white/red system allows to distinguish very easily wild-type and mutant p53 alleles. This new assay is a simple and rapid method to detect inactivating p53 mutations in clinical samples.

  2. Adenovirus type 5 early region 4 is responsible for E1A-induced p53-independent apoptosis.

    PubMed Central

    Marcellus, R C; Teodoro, J G; Wu, T; Brough, D E; Ketner, G; Shore, G C; Branton, P E

    1996-01-01

    In the absence of E1B, the 289- and 243-residue E1A products of human adenovirus type 5 induce p53-dependent apoptosis. However, our group has shown recently that the 289-residue E1A protein is also able to induce apoptosis by a p53-independent mechanism (J. G. Teodoro, G. C. Shore, and P. E. Branton, Oncogene 11:467-474, 1995). Preliminary results suggested that p53-independent cell death required expression of one or more additional adenovirus early gene products. Here we show that both the E1B 19-kDa protein and cellular Bcl-2 inhibit or significantly delay p53-independent apoptosis. Neither early region E2 or E3 appeared to be necessary for such cell death. Analysis of a series of E1A mutants indicated that mutations in the transactivation domain and other regions of E1A correlated with E1A-mediated transactivation of E4 gene expression. Furthermore, p53-deficient human SAOS-2 cells infected with a mutant which expresses E1B but none of the E4 gene products remained viable for considerably longer times than those infected with wild-type adenovirus type 5. In addition, an adenovirus vector lacking both E1 and E4 was unable to induce DNA degradation and cell killing in E1A-expressing cell lines. These data showed that an E4 product is essential for E1A-induced p53-independent apoptosis. PMID:8709247

  3. Characterization of a unique mutation of p53 in rat epithelial cell strain

    SciTech Connect

    Carpenter, T.R.; Swafford, D.S.; Hickman, A.W.; Johnson, N.F.

    1994-11-01

    The tumor suppressor gene p53 is the most commonly mutated gene known in human cancer. Mutational alteration of p53 function appears to be an important carcinogenic event in a wide variety of tumor types. Altered activity caused by mutation results in reduction of the following: transcriptional activity, nuclear localization, growth supression, and cell cycle inhibitory activities. Wild-type p53 protein has been shown to accumulate in cells exposed to a variety of DNA-damaging agents, including ionizing radiation, primarily through protein stabilization. Mutant forms of p53 fail to accumulate after irradiation indicating a failure to respond to upstream regulatory actions. The accumulation of p53 protein may serve as a sensitive biologic indicator of DNA damage. The purpose of these investigations was to establish the mutational state of the LEC p53 gene and to characterize some of the consequences of such a mutation.

  4. Alterations in Mitochondrial and Endoplasmic Reticulum Signaling by p53 Mutants

    PubMed Central

    Giorgi, Carlotta; Bonora, Massimo; Missiroli, Sonia; Morganti, Claudia; Morciano, Giampaolo; Wieckowski, Mariusz R.; Pinton, Paolo

    2016-01-01

    The p53 protein is probably the most important tumor suppressor, acting as a nuclear transcription factor primarily through the modulation of cell death. However, currently, it is well accepted that p53 can also exert important transcription-independent pro-cell death actions. Indeed, cytosolic localization of endogenous wild-type or transactivation-deficient p53 is necessary and sufficient for the induction of apoptosis and autophagy. Here, we present the extra-nuclear activities of p53 associated with the mitochondria and the endoplasmic reticulum, highlighting the activities of the p53 mutants on these compartments. These two intracellular organelles play crucial roles in the regulation of cell death, and it is now well established that they also represent sites where p53 can accumulate. PMID:26942128

  5. p53 Mutations in human adrenocortical neoplasms: Immunohistochemical and molecular studies

    SciTech Connect

    Reincke, M.; Allolio, B.; Travis, W.H.; Linehan, H.M.; Karl, M.; Mastorakos, G.; Chrousos, G.P.

    1994-03-01

    p53 is a recessive tumor suppressor gene located on chromosome 17p. Mutations in the p53 gene play an important role in the tumorigenesis of diverse types of human neoplasms including breast and colon cancers. More than 90% of all mutations discovered in such tumors have been detected in 4 hot spot areas that lie between exons 5 and 8. In contrast to wild-type p53, mutant p53 accumulates intracellularly and can be easily detected by immunohistochemistry. The authors therefore investigated the frequency of p53 mutations in human adrenocortical neoplasms using molecular biology and immunohistochemistry techniques. Five patients with adrenocortical adenomas (5 female; ages 39-72 yr), 11 patients with adrenocortical carcinomas (8 female, 3 male; ages 15-50 yr), and two adrenocortical tumor cell lines were studied. After DNA extraction from frozen tumor tissue or paraffin-embedded material, exons 5 through 8 were amplified using the polymerase chain reaction and directly sequenced by the dideoxy termination method. Immunohistochemistry was performed on paraffin-embedded tumor specimens obtained during adrenalectomy using a monoclonal antibody reacting with both wild-type and mutant p53. Prevalence of mutations was adenomas, 0/5, carcinomas, 3/11, and adrenocortical cell lines, 2/2. Single point mutations were detected in 3 cases (exons 5, 6, and 7, respectively), and rearrangements of exon 7/8 and 8 were found in 2 cases. Immunohistochemistry detected strong nuclear and/or cytoplasmic p53 immunoreactivity in all adrenocortical carcinomas with point mutations of the p53 gene but not in adenomas and carcinomas with the wild-type sequence or with deletion/rearrangement of the p53 gene. They conclude that p53 plays a role in the tumorigenesis of adrenocortical carcinomas but is of less importance to benign adenomas. 27 refs., 3 figs., 2 tabs.

  6. Binding sequence-dependent regulation of the human proliferating cell nuclear antigen promoter by p53

    SciTech Connect

    Shan Bin . E-mail: gmorris2@tulane.edu

    2005-04-15

    Exposure of a lung epithelial cell line to ionizing radiation (IR) arrests cell cycle progression through 48 h post-exposure. Coincidentally, IR differentially activates expression of the cell cycle inhibitor, p21/WAF1, and the DNA replication protein, proliferating cell nuclear antigen (PCNA). p21/WAF1 mRNA levels remain elevated through 48 h post-exposure to IR, while PCNA mRNA levels increase transiently at early times. Since p21/WAF1 inhibits DNA replication by directly binding PCNA, the relative levels of the two proteins can determine cell cycle progression. The PCNA p53-binding site displayed reduced p53 binding affinity in vitro relative to the distal p21/WAF1 p53-binding site. Substitution of the p21/WAF1 site for the resident p53-binding site in the PCNA promoter altered the responses to increasing amounts of p53 or IR in transient expression assays. The p21/WAF1 p53-binding site sustained activation of the chimeric PCNA promoter under conditions (high p53 levels or high dose IR) that the PCNA p53-binding site did not. Binding site-specific regulation by wild-type p53 was not observed with mutant p53 harboring a serine to alanine change at amino acid 46. Limited activation of the PCNA promoter by p53 and its modified forms would restrict the amount of PCNA made available for DNA repair.

  7. p53 Small-molecule inhibitor enhances temozolomide cytotoxic activity against intracranial glioblastoma xenografts.

    PubMed

    Dinca, Eduard B; Lu, Kan V; Sarkaria, Jann N; Pieper, Russell O; Prados, Michael D; Haas-Kogan, Daphne A; Vandenberg, Scott R; Berger, Mitchel S; James, C David

    2008-12-15

    In this study, we investigated the precursor and active forms of a p53 small-molecule inhibitor for their effects on temozolomide (TMZ) antitumor activity against glioblastoma (GBM), using both in vitro and in vivo experimental approaches. Results from in vitro cell viability analysis showed that the cytotoxic activity of TMZ was substantially increased when p53 wild-type (p53(wt)) GBMs were cotreated with the active form of p53 inhibitor, and this heightened cytotoxic response was accompanied by increased poly(ADP-ribose) polymerase cleavage as well as elevated cellular phospho-H2AX. Analysis of the same series of GBMs, as intracranial xenografts in athymic mice, and administering corresponding p53 inhibitor precursor, which is converted to the active compound in vivo, yielded results consistent with the in vitro analyses: TMZ + p53 inhibitor precursor cotreatment of three distinct p53(wt) GBM xenografts resulted in significant enhancement of TMZ antitumor effect relative to treatment with TMZ alone, as indicated by serial bioluminescence monitoring as well as survival analysis (P < 0.001 for cotreatment survival benefit in each case). Mice receiving intracranial injection with p53(null) GBM showed similar survival benefit from TMZ treatment regardless of the presence or absence of p53 inhibitor precursor. In total, our results indicate that the p53 active and precursor inhibitor pair enhances TMZ cytotoxicity in vitro and in vivo, respectively, and do so in a p53-dependent manner.

  8. The anti-leukemic activity of sodium dichloroacetate in p53mutated/null cells is mediated by a p53-independent ILF3/p21 pathway

    PubMed Central

    Agnoletto, Chiara; Brunelli, Laura; Melloni, Elisabetta; Pastorelli, Roberta; Casciano, Fabio; Rimondi, Erika; Rigolin, Gian Matteo; Cuneo, Antonio; Secchiero, Paola; Zauli, Giorgio

    2015-01-01

    B-chronic lymphocytic leukemia (B-CLL) patients harboring p53 mutations are invariably refractory to therapies based on purine analogues and have limited treatment options and poor survival. Having recently demonstrated that the mitochondria-targeting small molecule sodium dichloroacetate (DCA) exhibits anti-leukemic activity in p53wild-type B-CLL cells, the aim of this study was to evaluate the effect of DCA in p53mutated B-CLL cells and in p53mutated/null leukemic cell lines. DCA exhibited comparable cytotoxicity in p53wild-type and p53mutated B-CLL patient cell cultures, as well as in p53mutated B leukemic cell lines (MAVER, MEC-1, MEC-2). At the molecular level, DCA promoted the transcriptional induction of p21 in all leukemic cell types investigated, including p53null HL-60. By using a proteomic approach, we demonstrated that DCA up-regulated the ILF3 transcription factor, which is a known regulator of p21 expression. The role of the ILF3/p21 axis in mediating the DCA anti-leukemic activity was underscored by knocking-down experiments. Indeed, transfection with ILF3 and p21 siRNAs significantly decreased both the DCA-induced p21 expression and the DCA-mediated cytotoxicity. Taken together, our results emphasize that DCA is a small molecule that merits further evaluation as a therapeutic agent also for p53mutated leukemic cells, by acting through the induction of a p53-independent pathway. PMID:25544776

  9. In Vivo Mitochondrial p53 Translocation Triggers a Rapid First Wave of Cell Death in Response to DNA Damage That Can Precede p53 Target Gene Activation

    PubMed Central

    Erster, Susan; Mihara, Motohiro; Kim, Roger H.; Petrenko, Oleksi; Moll, Ute M.

    2004-01-01

    p53 promotes apoptosis in response to death stimuli by transactivation of target genes and by transcription-independent mechanisms. We recently showed that wild-type p53 rapidly translocates to mitochondria in response to multiple death stimuli in cultured cells. Mitochondrial p53 physically interacts with antiapoptotic Bcl proteins, induces Bak oligomerization, permeabilizes mitochondrial membranes, and rapidly induces cytochrome c release. Here we characterize the mitochondrial p53 response in vivo. Mice were subjected to γ irradiation or intravenous etoposide administration, followed by cell fractionation and immunofluorescence studies of various organs. Mitochondrial p53 accumulation occurred in radiosensitive organs like thymus, spleen, testis, and brain but not in liver and kidney. Of note, mitochondrial p53 translocation was rapid (detectable at 30 min in thymus and spleen) and triggered an early wave of marked caspase 3 activation and apoptosis. This caspase 3-mediated apoptosis was entirely p53 dependent, as shown by p53 null mice, and preceded p53 target gene activation. The transcriptional p53 program had a longer lag phase than the rapid mitochondrial p53 program. In thymus, the earliest apoptotic target gene products PUMA, Noxa, and Bax appeared at 2, 4, and 8 h, respectively, while Bid, Killer/DR5, and p53DinP1 remained uninduced even after 20 h. Target gene induction then led to further increase in active caspase 3. Similar biphasic kinetics was seen in cultured human cells. Our results suggest that in sensitive organs mitochondrial p53 accumulation in vivo occurs soon after a death stimulus, triggering a rapid first wave of apoptosis that is transcription independent and may precede a second slower wave that is transcription dependent. PMID:15254240

  10. Isolation, characterization and functional analysis of full length p53 cDNA from Bubalus bubalis.

    PubMed

    Singh, Minu; Aggarwal, Suruchi; Mohanty, Ashok K; Mukhopadhyay, Tapas

    2015-09-01

    p53 plays a pivotal role in maintaining the genomic integrity of the cell and has an important role in cellular transformation. We isolated and cloned a full length p53 cDNA (Bp53) from water buffalo in expression vectors designed to generate tagged proteins with FLAG or GFP. Bp53 was found to be 1161 nucleotide long and codes for 386 amino acid residues with 79% homology with human p53 containing 393 amino acids. Although Bp53 has some inherent differences in amino acid composition in different functional domains as compared to human p53 but the total electrostatic charge of amino acids has been maintained. Bp53 cDNA was transiently transfected in a p53 null human NSCLC cell line and as expected, it was predominantly localized in the nucleus. Besides, Bp53 effectively transactivates a number of target genes similar to human p53 and exerts most of its anti-tumorigenic potential in culture as observed in clonogenic and cell viability assays. Like human p53 mutants, core domain mutant version of Bp53 was found to be mis-localized to cytoplasm with diminished tumor suppressor activity. However, Bp53 appeared to be more sensitive to mdm2 mediated degradation and as a result, this protein was less stable as compared to human p53. For the first time we have characterized a functionally efficient wild-type p53 from buffalo having lower stability than human p53 and thus, buffalo p53 could be used as a model system for further insight to the molecular basis of wild-type p53 instability.

  11. Structures of oncogenic, suppressor and rescued p53 core-domain variants: mechanisms of mutant p53 rescue.

    PubMed

    Wallentine, Brad D; Wang, Ying; Tretyachenko-Ladokhina, Vira; Tan, Martha; Senear, Donald F; Luecke, Hartmut

    2013-10-01

    To gain insights into the mechanisms by which certain second-site suppressor mutations rescue the function of a significant number of cancer mutations of the tumor suppressor protein p53, X-ray crystallographic structures of four p53 core-domain variants were determined. These include an oncogenic mutant, V157F, two single-site suppressor mutants, N235K and N239Y, and the rescued cancer mutant V157F/N235K/N239Y. The V157F mutation substitutes a smaller hydrophobic valine with a larger hydrophobic phenylalanine within strand S4 of the hydrophobic core. The structure of this cancer mutant shows no gross structural changes in the overall fold of the p53 core domain, only minor rearrangements of side chains within the hydrophobic core of the protein. Based on biochemical analysis, these small local perturbations induce instability in the protein, increasing the free energy by 3.6 kcal mol(-1) (15.1 kJ mol(-1)). Further biochemical evidence shows that each suppressor mutation, N235K or N239Y, acts individually to restore thermodynamic stability to V157F and that both together are more effective than either alone. All rescued mutants were found to have wild-type DNA-binding activity when assessed at a permissive temperature, thus pointing to thermodynamic stability as the critical underlying variable. Interestingly, thermodynamic analysis shows that while N239Y demonstrates stabilization of the wild-type p53 core domain, N235K does not. These observations suggest distinct structural mechanisms of rescue. A new salt bridge between Lys235 and Glu198, found in both the N235K and rescued cancer mutant structures, suggests a rescue mechanism that relies on stabilizing the β-sandwich scaffold. On the other hand, the substitution N239Y creates an advantageous hydrophobic contact between the aromatic ring of this tyrosine and the adjacent Leu137. Surprisingly, the rescued cancer mutant shows much larger structural deviations than the cancer mutant alone when compared

  12. Mechanisms of p53-induced apoptosis.

    PubMed

    Bennett, M R

    1999-10-01

    The p53 tumour suppressor gene functions in both cell cycle arrest and apoptosis. Despite considerable advances in understanding as to how p53 regulates growth arrest, the mechanisms by which p53 regulates apoptosis are only just emerging. In particular, there appears to be a structural and functional separation between the ability of p53 to induce growth arrest and apoptosis. This review examines the interactions between p53-induced growth arrest and apoptosis, and the mechanisms of p53-induced apoptosis, both via induction of p53 transcriptional targets and via nontranscriptional mechanisms.

  13. Inhibition of tumor angiogenesis and growth by nanoparticle-mediated p53 gene therapy in mice.

    PubMed

    Prabha, S; Sharma, B; Labhasetwar, V

    2012-08-01

    Mutation of the p53 tumor suppressor gene, the most common genetic alteration in human cancers, results in more aggressive disease and increased resistance to conventional therapies. Aggressiveness may be related to the increased angiogenic activity of cancer cells containing mutant p53. To restore wild-type p53 function in cancer cells, we developed polymeric nanoparticles (NPs) for p53 gene delivery. Previous in vitro and in vivo studies demonstrated the ability of these NPs to provide sustained intracellular release of DNA, thus sustained gene transfection and decreased tumor cell proliferation. We investigated in vivo mechanisms involved in NP-mediated p53 tumor inhibition, with focus on angiogenesis. We hypothesize that sustained p53 gene delivery will help decrease tumor angiogenic activity and thus reduce tumor growth and improve animal survival. Xenografts of p53 mutant tumors were treated with a single intratumoral injection of p53 gene-loaded NPs (p53NPs). We observed intratumoral p53 gene expression corresponding to tumor growth inhibition, over 5 weeks. Treated tumors showed upregulation of thrombospondin-1, a potent antiangiogenic factor, and a decrease in microvessel density vs controls (saline, p53 DNA alone, and control NPs). Greater levels of apoptosis were also observed in p53NP-treated tumors. Overall, this led to significantly improved survival in p53NP-treated animals. NP-mediated p53 gene delivery slowed cancer progression and improved survival in an in vivo cancer model. One mechanism by which this was accomplished was disruption of tumor angiogenesis. We conclude that the NP-mediated sustained tumor p53 gene therapy can effectively be used for tumor growth inhibition.

  14. Bcl-2/Bax protein ratio predicts 5-fluorouracil sensitivity independently of p53 status

    PubMed Central

    Mirjolet, J-F; Barberi-Heyob, M; Didelot, C; Peyrat, J-P; Abecassis, J; Millon, R; Merlin, J-L

    2000-01-01

    p53 tumour-suppressor gene is involved in cell growth control, arrest and apoptosis. Nevertheless cell cycle arrest and apoptosis induction can be observed in p53-defective cells after exposure to DNA-damaging agents such as 5-fluorouracil (5-FU) suggesting the importance of alternative pathways via p53-independent mechanisms. In order to establish relationship between p53 status, cell cycle arrest, Bcl-2/Bax regulation and 5-FU sensitivity, we examined p53 mRNA and protein expression and p53 protein functionality in wild-type (wt) and mutant (mt) p53 cell lines. p53 mRNA and p53 protein expression were determined before and after exposure to equitoxic 5-FU concentration in six human carcinoma cell lines differing in p53 status and displaying marked differences in 5-FU sensitivity, with IC 50 values ranging from 0.2–22.6 mM. 5-FU induced a rise in p53 mRNA expression in mt p53 cell lines and in human papilloma virus positive wt p53 cell line, whereas significant decrease in p53 mRNA expression was found in wt p53 cell line. Whatever p53 status, 5-FU altered p53 transcriptional and translational regulation leading to up-regulation of p53 protein. In relation with p53 functionality, but independently of p53 mutational status, after exposure to 5-FU equitoxic concentration, all cell lines were able to arrest in G1. No relationship was evidenced between G1 accumulation ability and 5-FU sensitivity. Moreover, after 5-FU exposure, Bax and Bcl-2 proteins regulation was under p53 protein control and a statistically significant relationship (r= 0.880,P= 0.0097) was observed between Bcl-2/Bax ratio and 5-FU sensitivity. In conclusion, whatever p53 status, Bcl-2 or Bax induction and Bcl-2/Bax protein ratio were correlated to 5-FU sensitivity. © 2000 Cancer Research Campaign PMID:11044365

  15. p53- and PAI-1-mediated induction of C-X-C chemokines and CXCR2: importance in pulmonary inflammation due to cigarette smoke exposure.

    PubMed

    Tiwari, Nivedita; Marudamuthu, Amarnath S; Tsukasaki, Yoshikazu; Ikebe, Mitsuo; Fu, Jian; Shetty, Sreerama

    2016-03-15

    We previously demonstrated that tumor suppressor protein p53 augments plasminogen activator inhibitor-1 (PAI-1) expression in alveolar epithelial cells (AECs) during chronic cigarette smoke (CS) exposure-induced lung injury. Chronic lung inflammation with elevated p53 and PAI-1 expression in AECs and increased susceptibility to and exacerbation of respiratory infections are all associated with chronic obstructive pulmonary disease (COPD). We recently demonstrated that preventing p53 from binding to the endogenous PAI-1 mRNA in AECs by either suppressing p53 expression or blockading p53 interactions with the PAI-1 mRNA mitigates apoptosis and lung injury. Within this context, we now show increased expression of the C-X-C chemokines (CXCL1 and CXCL2) and their receptor CXCR2, and the intercellular cellular adhesion molecule-1 (ICAM-1), in the lung tissues of patients with COPD. We also found a similar increase in lung tissues and AECs from wild-type (WT) mice exposed to passive CS for 20 wk and in primary AECs treated with CS extract in vitro. Interestingly, passive CS exposure of mice lacking either p53 or PAI-1 expression resisted an increase in CXCL1, CXCL2, CXCR2, and ICAM-1. Furthermore, inhibition of p53-mediated induction of PAI-1 expression by treatment of WT mice exposed to passive CS with caveolin-1 scaffolding domain peptide reduced CXCL1, CXCL2, and CXCR2 levels and lung inflammation. Our study reveals that p53-mediated induction of PAI-1 expression due to chronic CS exposure exacerbates lung inflammation through elaboration of CXCL1, CXCL2, and CXCR2. We further provide evidence that targeting this pathway mitigates lung injury associated with chronic CS exposure.

  16. p53 and mitochondrial dysfunction: novel insight of neurodegenerative diseases.

    PubMed

    Dai, Chun-Qiu; Luo, Ting-Ting; Luo, Shi-Cheng; Wang, Jia-Qi; Wang, Sheng-Ming; Bai, Yun-Hu; Yang, Yan-Ling; Wang, Ya-Yun

    2016-08-01

    Mitochondria are organelles responsible for vital cell functions. p53 is a transcription factor that regulates the DNA stability and cell growth normality. Recent studies revealed that p53 can influence mitochondrial function changing from normal condition to abnormal condition under different stress levels. In normal state, p53 can maintain mitochondrial respiration through transactivation of SCO2. When stress stimuli presents, SCO2 overexpresses and leads to ROS generation. ROS promotes p53 inducing MALM (Mieap-induced accumulation of lysosome-like organelles within mitochondria) to repair dysfunctional mitochondria and MIV (Mieap-induced vacuole) to accomplish damaged mitochondria degradation. If stress or damage is irreversible, p53 will translocate to mitochondria, leading into apoptosis or necrosis. Neurodegenerative diseases including Parkinson's disease, Huntington's disease and Alzheimer's disease are still lack of clear explanations of mechanisms, but more studies have revealed the functional relationship between mitochondria and p53 towards the pathological development of these diseases. In this review, we discuss that p53 plays the vital role in the function of mitochondria in the aspect of pathological change metabolism. We also analyze these diseases with novel targeted treating molecules which are related to p53 and mitochondria, hoping to present novel therapies in future clinic.

  17. p53 and mitochondrial dysfunction: novel insight of neurodegenerative diseases.

    PubMed

    Dai, Chun-Qiu; Luo, Ting-Ting; Luo, Shi-Cheng; Wang, Jia-Qi; Wang, Sheng-Ming; Bai, Yun-Hu; Yang, Yan-Ling; Wang, Ya-Yun

    2016-08-01

    Mitochondria are organelles responsible for vital cell functions. p53 is a transcription factor that regulates the DNA stability and cell growth normality. Recent studies revealed that p53 can influence mitochondrial function changing from normal condition to abnormal condition under different stress levels. In normal state, p53 can maintain mitochondrial respiration through transactivation of SCO2. When stress stimuli presents, SCO2 overexpresses and leads to ROS generation. ROS promotes p53 inducing MALM (Mieap-induced accumulation of lysosome-like organelles within mitochondria) to repair dysfunctional mitochondria and MIV (Mieap-induced vacuole) to accomplish damaged mitochondria degradation. If stress or damage is irreversible, p53 will translocate to mitochondria, leading into apoptosis or necrosis. Neurodegenerative diseases including Parkinson's disease, Huntington's disease and Alzheimer's disease are still lack of clear explanations of mechanisms, but more studies have revealed the functional relationship between mitochondria and p53 towards the pathological development of these diseases. In this review, we discuss that p53 plays the vital role in the function of mitochondria in the aspect of pathological change metabolism. We also analyze these diseases with novel targeted treating molecules which are related to p53 and mitochondria, hoping to present novel therapies in future clinic. PMID:27422544

  18. p53 downregulates the Fanconi anaemia DNA repair pathway

    PubMed Central

    Jaber, Sara; Toufektchan, Eléonore; Lejour, Vincent; Bardot, Boris; Toledo, Franck

    2016-01-01

    Germline mutations affecting telomere maintenance or DNA repair may, respectively, cause dyskeratosis congenita or Fanconi anaemia, two clinically related bone marrow failure syndromes. Mice expressing p53Δ31, a mutant p53 lacking the C terminus, model dyskeratosis congenita. Accordingly, the increased p53 activity in p53Δ31/Δ31 fibroblasts correlated with a decreased expression of 4 genes implicated in telomere syndromes. Here we show that these cells exhibit decreased mRNA levels for additional genes contributing to telomere metabolism, but also, surprisingly, for 12 genes mutated in Fanconi anaemia. Furthermore, p53Δ31/Δ31 fibroblasts exhibit a reduced capacity to repair DNA interstrand crosslinks, a typical feature of Fanconi anaemia cells. Importantly, the p53-dependent downregulation of Fanc genes is largely conserved in human cells. Defective DNA repair is known to activate p53, but our results indicate that, conversely, an increased p53 activity may attenuate the Fanconi anaemia DNA repair pathway, defining a positive regulatory feedback loop. PMID:27033104

  19. Assessing mutant p53 in primary high-grade serous ovarian cancer using immunohistochemistry and massively parallel sequencing

    PubMed Central

    Cole, Alexander J.; Dwight, Trisha; Gill, Anthony J.; Dickson, Kristie-Ann; Zhu, Ying; Clarkson, Adele; Gard, Gregory B.; Maidens, Jayne; Valmadre, Susan; Clifton-Bligh, Roderick; Marsh, Deborah J.

    2016-01-01

    The tumour suppressor p53 is mutated in cancer, including over 96% of high-grade serous ovarian cancer (HGSOC). Mutations cause loss of wild-type p53 function due to either gain of abnormal function of mutant p53 (mutp53), or absent to low mutp53. Massively parallel sequencing (MPS) enables increased accuracy of detection of somatic variants in heterogeneous tumours. We used MPS and immunohistochemistry (IHC) to characterise HGSOCs for TP53 mutation and p53 expression. TP53 mutation was identified in 94% (68/72) of HGSOCs, 62% of which were missense. Missense mutations demonstrated high p53 by IHC, as did 35% (9/26) of non-missense mutations. Low p53 was seen by IHC in 62% of HGSOC associated with non-missense mutations. Most wild-type TP53 tumours (75%, 6/8) displayed intermediate p53 levels. The overall sensitivity of detecting a TP53 mutation based on classification as ‘Low’, ‘Intermediate’ or ‘High’ for p53 IHC was 99%, with a specificity of 75%. We suggest p53 IHC can be used as a surrogate marker of TP53 mutation in HGSOC; however, this will result in misclassification of a proportion of TP53 wild-type and mutant tumours. Therapeutic targeting of mutp53 will require knowledge of both TP53 mutations and mutp53 expression. PMID:27189670

  20. Cancer therapeutic approach based on conformational stabilization of mutant p53 protein by small peptides

    PubMed Central

    Tal, Perry; Eizenberger, Shay; Cohen, Elad; Goldfinger, Naomi; Pietrokovski, Shmuel; Oren, Moshe; Rotter, Varda

    2016-01-01

    The p53 tumor suppressor serves as a major barrier against malignant transformation. Over 50% of tumors inactivate p53 by point mutations in its DNA binding domain. Most mutations destabilize p53 protein folding, causing its partial denaturation at physiological temperature. Thus a high proportion of human tumors overexpress a potential potent tumor suppressor in a non-functional, misfolded form. The equilibrium between the properly folded and misfolded states of p53 may be affected by molecules that interact with p53, stabilizing its native folding and restoring wild type p53 activity to cancer cells. To select for mutant p53 (mutp53) reactivating peptides, we adopted the phage display technology, allowing interactions between mutp53 and random peptide libraries presented on phages and enriching for phage that favor the correctly folded p53 conformation. We obtained a large database of potential reactivating peptides. Lead peptides were synthesized and analyzed for their ability to restore proper p53 folding and activity. Remarkably, many enriched peptides corresponded to known p53-binding proteins, including RAD9. Importantly, lead peptides elicited dramatic regression of aggressive tumors in mouse xenograft models. Such peptides might serve as novel agents for human cancer therapy. PMID:26943582

  1. EBNA3C regulates p53 through induction of Aurora kinase B.

    PubMed

    Jha, Hem C; Yang, Karren; El-Naccache, Darine W; Sun, Zhiguo; Robertson, Erle S

    2015-03-20

    In multicellular organisms p53 maintains genomic integrity through activation of DNA repair, and apoptosis. EBNA3C can down regulate p53 transcriptional activity. Aurora kinase (AK) B phosphorylates p53, which leads to degradation of p53. Aberrant expression of AK-B is a hallmark of numerous human cancers. Therefore changes in the activities of p53 due to AK-B and EBNA3C expression is important for understanding EBV-mediated cell transformation. Here we show that the activities of p53 and its homolog p73 are dysregulated in EBV infected primary cells which can contribute to increased cell transformation. Further, we showed that the ETS-1 binding site is crucial for EBNA3C-mediated up-regulation of AK-B transcription. Further, we determined the Ser 215 residue of p53 is critical for functional regulation by AK-B and EBNA3C and that the kinase domain of AK-B which includes amino acid residues 106, 111 and 205 was important for p53 regulation. AK-B with a mutation at residue 207 was functionally similar to wild type AK-B in terms of its kinase activities and knockdown of AK-B led to enhanced p73 expression independent of p53. This study explores an additional mechanism by which p53 is regulated by AK-B and EBNA3C contributing to EBV-induced B-cell transformation.

  2. Pathologies Associated with the p53 Response

    PubMed Central

    Gudkov, Andrei V.; Komarova, Elena A.

    2010-01-01

    Although p53 is a major cancer preventive factor, under certain extreme stress conditions it may induce severe pathologies. Analyses of animal models indicate that p53 is largely responsible for the toxicity of ionizing radiation or DNA damaging drugs contributing to hematopoietic component of acute radiation syndrome and largely determining severe adverse effects of cancer treatment. p53-mediated damage is strictly tissue specific and occurs in tissues prone to p53-dependent apoptosis (e.g., hematopoietic system and hair follicles); on the contrary, p53 can serve as a survival factor in tissues that respond to p53 activation by cell cycle arrest (e.g., endothelium of small intestine). There are multiple experimental indications that p53 contributes to pathogenicity of acute ischemic diseases. Temporary reversible suppression of p53 by small molecules can be an effective and safe approach to reduce severity of p53-associated pathologies. PMID:20595398

  3. PPM1D phosphatase, a target of p53 and RBM38 RNA-binding protein, inhibits p53 mRNA translation via dephosphorylation of RBM38.

    PubMed

    Zhang, M; Xu, E; Zhang, J; Chen, X

    2015-11-26

    PPM1D phosphatase, also called wild-type p53-induced phosphatase 1, promotes tumor development by inactivating the p53 tumor suppressor pathway. RBM38 RNA-binding protein, also called RNPC1 and a target of p53, inhibits p53 messenger RNA (mRNA) translation, which can be reversed by GSK3 protein kinase via phosphorylation of RBM38 at serine 195. Here we showed that ectopic expression of RBM38 increases, whereas knockdown of RBM38 inhibits, PPM1D mRNA translation. Consistent with this, we found that RBM38 directly binds to PPM1D 3'-untranslated region (3'-UTR) and promotes expression of a heterologous reporter gene that carries PPM1D 3'-UTR in a dose-dependent manner. Interestingly, we showed that PPM1D directly interacts with and dephosphorylates RBM38 at serine 195. Furthermore, we showed that PPM1D modulates p53 mRNA translation and p53-dependent growth suppression through dephosphorylation of RBM38. These findings provide evidence that the crosstalk between PPM1D and RBM38, both of which are targets and modulators of p53, has a critical role in p53 expression and activity.

  4. p53 status dictates responses of B lymphomas to monotherapy with proteasome inhibitors

    PubMed Central

    Yu, Duonan; Carroll, Martin

    2007-01-01

    The proapoptotic function of p53 is thought to underlie most anticancer modalities and is also activated in response to oncogenic insults, such as overexpression of the Myc oncoprotein. Here we generated tractable B lymphomas using retroviral transduction of the MYC oncogene into hematopoietic cells with 2 knock-in alleles encoding a fusion between p53 and 4-hydroxytamoxifen (4OHT) receptor (p53ERTAM). In these polyclonal tumors, Myc is the only oncogenic lesion, and p53ERTAM status can be rapidly toggled between “off” and “on” with 4OHT, provided that the Trp53 promoter has been independently activated. Although 4OHT can trigger widespread apoptosis and overt tumor regression even in the absence of DNA-damaging agents, in tumors with high levels of Mdm2 these responses are blunted. However, cotreatment with proteasome inhibitors fully restores therapeutic effects in vivo. Similarly, human Burkitt lymphomas with wild-type p53 and overexpression of Hdm2 are highly sensitive to proteasome inhibitors, unless p53 levels are reduced using the HPV-E6 ubiquitin ligase. Therefore, proteasome inhibitors could be highly effective as a monotherapy against Myc-induced lymphomas, with no need for adjuvant chemotherapy or radiation therapy. On the other hand, their efficacy is crucially dependent on the wild-type p53 status of the tumor, placing important restrictions on patient selection. PMID:17284530

  5. Mutant p53 proteins bind DNA in a DNA structure-selective mode

    PubMed Central

    Göhler, Thomas; Jäger, Stefan; Warnecke, Gabriele; Yasuda, Hideyo; Kim, Ella; Deppert, Wolfgang

    2005-01-01

    Despite the loss of sequence-specific DNA binding, mutant p53 (mutp53) proteins can induce or repress transcription of mutp53-specific target genes. To date, the molecular basis for transcriptional modulation by mutp53 is not understood, but increasing evidence points to the possibility that specific interactions of mutp53 with DNA play an important role. So far, the lack of a common denominator for mutp53 DNA binding, i.e. the existence of common sequence elements, has hampered further characterization of mutp53 DNA binding. Emanating from our previous discovery that DNA structure is an important determinant of wild-type p53 (wtp53) DNA binding, we analyzed the binding of various mutp53 proteins to oligonucleotides mimicking non-B DNA structures. Using various DNA-binding assays we show that mutp53 proteins bind selectively and with high affinity to non-B DNA. In contrast to sequence-specific and DNA structure-dependent binding of wtp53, mutp53 DNA binding to non-B DNA is solely dependent on the stereo-specific configuration of the DNA, and not on DNA sequence. We propose that DNA structure-selective binding of mutp53 proteins is the basis for the well-documented interaction of mutp53 with MAR elements and for transcriptional activities mediates by mutp53. PMID:15722483

  6. PTEN deficiency and mutant p53 confer glucose-addiction to thyroid cancer cells: impact of glucose depletion on cell proliferation, cell survival, autophagy and cell migration.

    PubMed

    Morani, Federica; Phadngam, Suratchanee; Follo, Carlo; Titone, Rossella; Thongrakard, Visa; Galetto, Alessandra; Alabiso, Oscar; Isidoro, Ciro

    2014-07-01

    Proliferating cancer cells oxidize glucose through the glycolytic pathway. Since this metabolism is less profitable in terms of ATP production, cancer cells consume large quantity of glucose, and those that experience insufficient blood supply become glucose-addicted. We have analyzed the response to glucose depletion in WRO and FTC133 follicular thyroid cancer cells, which differ in the expression of two key regulators of the glucose metabolism. WRO cells, which express wild type p53 and PTEN, showed a higher rate of cell proliferation and were much less sensitive to glucose-depletion than FTC133 cells, which are PTEN null and express mutant p53. Glucose depletion slowed-down the autophagy flux in FTC133 cells, not in WRO cells. In a wound-healing assay, WRO cells were shown to migrate faster than FTC133 cells. Glucose depletion slowed down the cell migration rate, and these effects were more evident in FTC133 cells. Genetic silencing of either wild-type PTEN or p53 in WRO cells resulted in increased uptake of glucose, whereas the ectopic expression of PTEN in FTC133 cells resulted in diminished glucose uptake. In conclusion, compared to WRO, FTC133 cells were higher glucose up-taker and consumer. These data do not support the general contention that cancer cells lacking PTEN or expressing the mutant p53R273H are more aggressive and prone to better face glucose depletion. We propose that concurrent PTEN deficiency and mutant p53 leads to a glucose-addiction state that renders the cancer cell more sensitive to glucose restriction. The present observation substantiates the view that glucose-restriction may be an adjuvant strategy to combat these tumours. PMID:25221641

  7. Role of p53–fibrinolytic system cross-talk in the regulation of quartz-induced lung injury

    SciTech Connect

    Bhandary, Yashodhar P.; Shetty, Shwetha K.; Marudamuthu, Amarnath S.; Fu, Jian; Pinson, Barbara M.; Levin, Jeffrey; Shetty, Sreerama

    2015-03-01

    Silica is the major component of airborne dust generated by wind, manufacturing and/or demolition. Chronic occupational inhalation of silica dust containing crystalline quartz is by far the predominant form of silicosis in humans. Silicosis is a progressive lung disease that typically arises after a very long latency and is a major occupational concern with no known effective treatment. The mechanism of silicosis is not clearly understood. However, silicosis is associated with increased cell death, expression of redox enzymes and pro-fibrotic cytokines and chemokines. Since alveolar epithelial cell (AEC) death and disruption of alveolar fibrinolysis is often associated with both acute and chronic lung injuries, we explored whether p53-mediated changes in the urokinase-type plasminogen activator (uPA) system contributes to silica-induced lung injury. We further sought to determine whether caveolin-1 scaffolding domain peptide (CSP), which inhibits p53 expression, mitigates lung injury associated with exposure to silica. Lung tissues and AECs isolated from wild-type (WT) mice exposed to silica exhibit increased apoptosis, p53 and PAI-1, and suppression of uPA expression. Treatment of WT mice with CSP inhibits PAI-1, restores uPA expression and prevents AEC apoptosis by suppressing p53, which is otherwise induced in mice exposed to silica. The process involves CSP-mediated inhibition of serine-15 phosphorylation of p53 by inhibition of protein phosphatase 2A-C (PP2A-C) interaction with silica-induced caveolin-1 in AECs. These observations suggest that changes in the p53–uPA fibrinolytic system cross-talk contribute to lung injury caused by inhalation of silica dust containing crystalline quartz and is protected by CSP by targeting this pathway. - Highlights: • Chronic exposure to quartz dusts is a major cause of lung injury and silicosis. • The survival of patients with silicosis is bleak due to lack of effective treatments. • This study defines a new role of

  8. Prospective therapeutic applications of p53 inhibitors

    SciTech Connect

    Gudkov, Andrei V. . E-mail: gudkov@ccf.org; Komarova, Elena A.

    2005-06-10

    p53, in addition to being a key cancer preventive factor, is also a determinant of cancer treatment side effects causing excessive apoptotic death in several normal tissues during cancer therapy. p53 inhibitory strategy has been suggested to protect normal tissues from chemo- and radiotherapy, and to treat other pathologies associated with stress-mediated activation of p53. This strategy was validated by isolation and testing of small molecule p53 inhibitor pifithrin-{alpha} that demonstrated broad tissue protecting capacity. However, in some normal tissues and tumors p53 plays protective role by inducing growth arrest and preventing cells from premature entrance into mitosis and death from mitotic catastrophe. Inhibition of this function of p53 can sensitize tumor cells to chemo- and radiotherapy, thus opening new potential application of p53 inhibitors and justifying the need in pharmacological agents targeting specifically either pro-apoptotic or growth arrest functions of p53.

  9. Defective Autophagosome Formation in p53-Null Colorectal Cancer Reinforces Crocin-Induced Apoptosis

    PubMed Central

    Amin, Amr; Bajbouj, Khuloud; Koch, Adrian; Gandesiri, Muktheshwar; Schneider-Stock, Regine

    2015-01-01

    Crocin, a bioactive molecule of saffron, inhibited proliferation of both HCT116 wild-type and HCT116 p53−/− cell lines at a concentration of 10 mM. Flow cytometric analysis of cell cycle distribution revealed that there was an accumulation of HCT116 wild-type cells in G1 (55.9%, 56.1%) compared to the control (30.4%) after 24 and 48 h of crocin treatment, respectively. However, crocin induced only mild G2 arrest in HCT116 p53−/− after 24 h. Crocin induced inefficient autophagy in HCT116 p53−/− cells, where crocin induced the formation of LC3-II, which was combined with a decrease in the protein levels of Beclin 1 and Atg7 and no clear p62 degradation. Autophagosome formation was not detected in HCT116 p53−/− after crocin treatment predicting a nonfunctional autophagosome formation. There was a significant increase of p62 after treating the cells with Bafilomycin A1 (Baf) and crocin compared to crocin exposure alone. Annexin V staining showed that Baf-pretreatment enhanced the induction of apoptosis in HCT116 wild-type cells. Baf-exposed HCT116 p53−/− cells did not, however, show any enhancement of apoptosis induction despite an increase in the DNA damage-sensor accumulation, γH2AX indicating that crocin induced an autophagy-independent classical programmed cell death. PMID:25584615

  10. p53 negatively regulates transcription of the pyruvate dehydrogenase kinase Pdk2.

    PubMed

    Contractor, Tanupriya; Harris, Chris R

    2012-01-15

    In cancer cells, the aberrant conversion of pyruvate into lactate instead of acetyl-CoA in the presence of oxygen is known as the Warburg effect. The consequences and mechanisms of this metabolic peculiarity are incompletely understood. Here we report that p53 status is a key determinant of the Warburg effect. Wild-type p53 expression decreased levels of pyruvate dehydrogenase kinase-2 (Pdk2) and the product of its activity, the inactive form of the pyruvate dehydrogenase complex (P-Pdc), both of which are key regulators of pyruvate metabolism. Decreased levels of Pdk2 and P-Pdc in turn promoted conversion of pyruvate into acetyl-CoA instead of lactate. Thus, wild-type p53 limited lactate production in cancer cells unless Pdk2 could be elevated. Together, our results established that wild-type p53 prevents manifestation of the Warburg effect by controlling Pdk2. These findings elucidate a new mechanism by which p53 suppresses tumorigenesis acting at the level of cancer cell metabolism. PMID:22123926

  11. Oncomir miR-125b Suppresses p14ARF to Modulate p53-Dependent and p53-Independent Apoptosis in Prostate Cancer

    PubMed Central

    Amir, Sumaira; Ma, Ai-Hong; Shi, Xu-Bao; Xue, Lingru; Kung, Hsing-Jien; deVere White, Ralph W.

    2013-01-01

    MicroRNAs are a class of naturally occurring small non-coding RNAs that target protein-coding mRNAs at the post-transcriptional level and regulate complex patterns of gene expression. Our previous studies demonstrated that in human prostate cancer the miRNA miR-125b is highly expressed, leading to a negative regulation of some tumor suppressor genes. In this study, we further extend our studies by showing that miR-125b represses the protein product of the ink4a/ARF locus, p14ARF, in two prostate cancer cell lines, LNCaP (wild type-p53) and 22Rv1 (both wild type and mutant p53), as well as in the PC-346C prostate cancer xenograft model that lentivirally overexpressed miR-125b. Our results highlight that miR-125b modulates the p53 network by hindering the down-regulation of Mdm2, thereby affecting p53 and its target genes p21 and Puma to a degree sufficient to inhibit apoptosis. Conversely, treatment of prostate cancer cells with an inhibitor of miR-125b (anti-miR-125b) resulted in increased expression of p14ARF, decreased level of Mdm2, and induction of apoptosis. In addition, overexpression of miR-125b in p53-deficient PC3 cells induced down-regulation of p14ARF, which leads to increased cell proliferation through a p53-independent manner. Thus, we conclude that miR-125b acts as an oncogene which regulates p14ARF/Mdm2 signaling, stimulating proliferation of prostate cancer cells through a p53-dependent or p53-independent function. This reinforces our belief that miR-125b has potential as a therapeutic target for the management of patients with metastatic prostate cancer. PMID:23585871

  12. Positive regulation of p53 stability and activity by the deubiquitinating enzyme Otubain 1.

    PubMed

    Sun, Xiao-Xin; Challagundla, Kishore B; Dai, Mu-Shui

    2012-02-01

    The ubiquitin (Ub)-proteasome system plays a pivotal role in the regulation of p53 protein stability and activity. p53 is ubiquitinated and destabilized by MDM2 and several other Ub E3s, whereas it is deubiquitinated and stabilized by Ub-specific protease (USP)7 and USP10. Here we show that the ovarian tumour domain-containing Ub aldehyde-binding protein 1 (Otub1) is a novel p53 regulator. Otub1 directly suppresses MDM2-mediated p53 ubiquitination in cells and in vitro. Overexpression of Otub1 drastically stabilizes and activates p53, leading to apoptosis and marked inhibition of cell proliferation in a p53-dependent manner. These effects are independent of its catalytic activity but require residue Asp88. Mutation of Asp88 to Ala (Otub1(D88A)) abolishes activity of Otub1 to suppress p53 ubiquitination. Further, wild-type Otub1 and its catalytic mutant (Otub1(C91S)), but not Otub1(D88A), bind to the MDM2 cognate E2, UbcH5, and suppress its Ub-conjugating activity in vitro. Overexpression of Otub1(D88A) or ablation of endogenous Otub1 by siRNA markedly impaired p53 stabilization and activation in response to DNA damage. Together, these results reveal a novel function for Otub1 in regulating p53 stability and activity.

  13. Escape, or Vanish: Control the Fate of p53 through MDM2-Mediated Ubiquitination.

    PubMed

    Wei, Jinlian; Yang, Yingrui; Lu, Mengchen; Xu, Lili; Liu, Fang; Yuan, Zhenwei; Bao, Qichao; Jiang, Zhengyu; Xu, Xiaoli; Guo, Xiaoke; Zhang, Xiaojin; You, Qidong; Sun, Haopeng

    2015-01-01

    p53 protein is a prominent tumor suppressor to induce cell cycle arrest, apoptosis and senescence, which attracts significant interest to cancer treatment. Therefore, it would be particularly important to restore the wild-type p53 that retains latent functions in the approximately 50% of tumors. MDM2 (murine double minute 2), the principal cellular antagonist of p53, has long been believed to suppress p53 activity through two main mechanisms: promoting degradation via its E3 ligase activity and masking p53 transcriptional activation by direct binding. Targeting MDM2 E3 ligase activity is becoming a potential antitumor strategy resulting from MDM2's decisive role in controlling the fate of p53: p53 is going to degradation when entrapped into MDM2-mediated ubiquitination, where p53 can escape by abrogating MDM2 E3 ligase activity using regulators. The intensive focus on regulating MDM2 ubiquitin E3 ligase activity has led to the rapid progress of its inhibitors, which may be possible to help p53 escape from degradation and restore its function to control tumor growth. This review summarizes the current inhibitors of MDM2 E3 ligase in cancer therapy based on the understanding the regulation of MDM2 E3 ubiquitin ligase activity, including post-translational modification, interactions between MDM2 and its cofactors, and regulation of MDM2 stability. PMID:26343143

  14. p53 Protein-mediated regulation of phosphoglycerate dehydrogenase (PHGDH) is crucial for the apoptotic response upon serine starvation.

    PubMed

    Ou, Yang; Wang, Shang-Jui; Jiang, Le; Zheng, Bin; Gu, Wei

    2015-01-01

    Although p53 is frequently mutated in human cancers, about 80% of human melanomas retain wild-type p53. Here we report that PHGDH, the key metabolic enzyme that catalyzes the rate-limiting step of the serine biosynthesis pathway, is a target of p53 in human melanoma cells. p53 suppresses PHGDH expression and inhibits de novo serine biosynthesis. Notably, upon serine starvation, p53-mediated cell death is enhanced dramatically in response to Nutlin-3 treatment. Moreover, PHGDH has been found recently to be amplified frequently in human melanomas. We found that PHGDH overexpression significantly suppresses the apoptotic response, whereas RNAi-mediated knockdown of endogenous PHGDH promotes apoptosis under the same treatment. These results demonstrate an important role of p53 in regulating the serine biosynthesis pathway through suppressing PHGDH expression and reveal serine deprivation as a novel approach to sensitize p53-mediated apoptotic responses in human melanoma cells. PMID:25404730

  15. Preferential Binding of Hot Spot Mutant p53 Proteins to Supercoiled DNA In Vitro and in Cells

    PubMed Central

    Brázdová, Marie; Navrátilová, Lucie; Tichý, Vlastimil; Němcová, Kateřina; Lexa, Matej; Hrstka, Roman; Pečinka, Petr; Adámik, Matej; Vojtesek, Borivoj; Paleček, Emil; Deppert, Wolfgang; Fojta, Miroslav

    2013-01-01

    Hot spot mutant p53 (mutp53) proteins exert oncogenic gain-of-function activities. Binding of mutp53 to DNA is assumed to be involved in mutp53-mediated repression or activation of several mutp53 target genes. To investigate the importance of DNA topology on mutp53-DNA recognition in vitro and in cells, we analyzed the interaction of seven hot spot mutp53 proteins with topologically different DNA substrates (supercoiled, linear and relaxed) containing and/or lacking mutp53 binding sites (mutp53BS) using a variety of electrophoresis and immunoprecipitation based techniques. All seven hot spot mutp53 proteins (R175H, G245S, R248W, R249S, R273C, R273H and R282W) were found to have retained the ability of wild-type p53 to preferentially bind circular DNA at native negative superhelix density, while linear or relaxed circular DNA was a poor substrate. The preference of mutp53 proteins for supercoiled DNA (supercoil-selective binding) was further substantiated by competition experiments with linear DNA or relaxed DNA in vitro and ex vivo. Using chromatin immunoprecipitation, the preferential binding of mutp53 to a sc mutp53BS was detected also in cells. Furthermore, we have shown by luciferase reporter assay that the DNA topology influences p53 regulation of BAX and MSP/MST1 promoters. Possible modes of mutp53 binding to topologically constrained DNA substrates and their biological consequences are discussed. PMID:23555710

  16. NF-Y transcriptionally regulates the Drosophila p53 gene.

    PubMed

    Tue, Nguyen Trong; Yoshioka, Yasuhide; Yamaguchi, Masamitsu

    2011-02-15

    The p53 protein is important in multicellular organisms, where it regulates the cell cycle and thus functions as a tumor suppressor that contributes to preventing cancer. However, molecular regulation of p53 gene expression is not fully understood. NF-YA is a subunit of the NF-Y trimeric complex, a transcription factor that binds to CCAAT motifs in the promoter regions of a variety of genes playing key roles in cell cycle regulation. We have identified four potential Drosophila NF-Y (dNF-Y)-binding sites located in the 5'-flanking region of the Drosophila p53 (dmp53) gene. Chromatin immunoprecipitation analyses using anti-dNF-YA antibodies confirmed that dNF-YA binds specifically to the genomic region containing CCAAT boxes in the dmp53 gene promoter in vivo. Furthermore, the thorax disclosed phenotype of dNF-YA knockdown flies can be enhanced by dmp53 mutation. In addition, the level of dmp53 mRNA was found to be decreased in the dNF-YA knockdown cells and transient expression of the luciferase gene revealed that wild-type dmp53 gene promoter activity is much stronger than mutated promoter activity in S2 cells. The requirement of CCAAT boxes for dmp53 promoter activity was further confirmed by expression of EGFP in various tissues from transgenic flies carrying wild-type and CCAAT box-mutated versions of dmp53 promoter-GFP fusion genes. These results taken together indicate that dNF-Y is necessary for dmp53 gene promoter activity.

  17. Molecular dynamics of the full-length p53 monomer

    PubMed Central

    Chillemi, Giovanni; Davidovich, Pavel; D’Abramo, Marco; Mametnabiev, Tazhir; Garabadzhiu, Alexander Vasilievich; Desideri, Alessandro; Melino, Gerry

    2013-01-01

    The p53 protein is frequently mutated in a very large proportion of human tumors, where it seems to acquire gain-of-function activity that facilitates tumor onset and progression. A possible mechanism is the ability of mutant p53 proteins to physically interact with other proteins, including members of the same family, namely p63 and p73, inactivating their function. Assuming that this interaction might occurs at the level of the monomer, to investigate the molecular basis for this interaction, here, we sample the structural flexibility of the wild-type p53 monomeric protein. The results show a strong stability up to 850 ns in the DNA binding domain, with major flexibility in the N-terminal transactivations domains (TAD1 and TAD2) as well as in the C-terminal region (tetramerization domain). Several stable hydrogen bonds have been detected between N-terminal or C-terminal and DNA binding domain, and also between N-terminal and C-terminal. Essential dynamics analysis highlights strongly correlated movements involving TAD1 and the proline-rich region in the N-terminal domain, the tetramerization region in the C-terminal domain; Lys120 in the DNA binding region. The herein presented model is a starting point for further investigation of the whole protein tetramer as well as of its mutants. PMID:23974096

  18. DNA–protein crosslinks and p53 protein expression in relation to occupational exposure to formaldehyde

    PubMed Central

    Shaham, J; Bomstein, Y; Gurvich, R; Rashkovsky, M; Kaufman, Z

    2003-01-01

    Background: Formaldehyde (FA) is classified as a probable human carcinogen. Aims: To examine DNA protein crosslinks (DPC) and p53, which are generally known to be involved in carcinogenesis, in peripheral blood lymphocytes of workers exposed to FA. Methods: DPC and p53 ("wild type" and mutant) were examined in peripheral blood lymphocytes of 186 workers exposed to FA (mean years of exposure = 16) and 213 unexposed workers. Every worker completed a questionnaire on demographic data, occupational and medical history, smoking, and hygiene. Results: The adjusted mean level of DPC in the exposed and the unexposed workers differed significantly. Adjustment was made for age, sex, years of education, smoking, and origin. Exposure to FA increased the risk of having a higher level of pantropic p53 above 150 pg/ml (OR 1.6, 95% CI 0.8 to 3.1). A significant positive correlation was found between the increase of pantropic p53 protein and mutant p53 protein, as well as between pantropic p53 >150 pg/ml and mutant p53 protein. In the exposed group a significantly higher proportion of p53 >150 pg/ml was found among workers with DPC >0.187 (55.7%) (0.187 = median level of DPC) than among workers with DPC ⩽0.187 (33.3%). The risk of having pantropic p53 protein >150 pg/ml was determined mainly by levels of DPC. Workers with DPC above the median level had a significantly higher risk of having pantropic p53 >150 pg/ml (adjusted OR 2.5, 95% CI 1.2 to 5.4). Conclusions: Results suggest that DPC and mutation in p53 may represent steps in FA carcinogenesis and a possible causal relation between DPC and mutation in p53. These biomarkers can be applied in the assessment of the development of cancer due to FA exposure. PMID:12771391

  19. In vivo activation of the p53 tumor suppressor pathway by an engineered cyclotide.

    PubMed

    Ji, Yanbin; Majumder, Subhabrata; Millard, Melissa; Borra, Radhika; Bi, Tao; Elnagar, Ahmed Y; Neamati, Nouri; Shekhtman, Alexander; Camarero, Julio A

    2013-08-01

    The overexpression of Hdm2 and HdmX is a common mechanism used by many tumor cells to inactive the p53 tumor suppressor pathway promoting cell survival. Targeting Hdm2 and HdmX has emerged as a validated therapeutic strategy for treating cancers with wild-type p53. Small linear peptides mimicking the N-terminal fragment of p53 have been shown to be potent Hdm2/HdmX antagonists. The potential therapeutic use of these peptides, however, is limited by their poor stability and bioavailability. Here, we report the engineering of the cyclotide MCoTI-I to efficiently antagonize intracellular p53 degradation. The resulting cyclotide MCo-PMI was able to bind with low nanomolar affinity to both Hdm2 and HdmX, showed high stability in human serum, and was cytotoxic to wild-type p53 cancer cell lines by activating the p53 tumor suppressor pathway both in vitro and in vivo. These features make the cyclotide MCoTI-I an optimal scaffold for targeting intracellular protein-protein interactions.

  20. In vivo activation of the p53 tumor suppressor pathway by an engineered cyclotide

    PubMed Central

    Neamati, Nouri; Shekhtman, Alexander; Camarero, Julio A.

    2013-01-01

    The overexpression of Hdm2 and HdmX is a common mechanism used by many tumor cells to inactive the p53 tumor suppressor pathway promoting cell survival. Targeting Hdm2 and HdmX has emerged as a validated therapeutic strategy for treating cancers with wild-type p53. Small linear peptides mimicking the N-terminal fragment of p53 have been shown to be potent Hdm2/HdmX antagonists. The potential therapeutic use of these peptides, however, is limited by their poor stability and bioavailability. Here, we report the engineering of the cyclotide MCoTI-I to efficiently antagonize intracellular p53 degradation. The resulting cyclotide MCo-PMI was able to bind with low nanomolar affinity to both Hdm2 and HdmX, showed high stability in human serum and was cytotoxic to wild-type p53 cancer cell lines by activating the p53 tumor suppressor pathway both in vitro and in vivo. These features make the cyclotide MCoTI-I an optimal scaffold for targeting intracellular protein-protein interactions. PMID:23848581

  1. Differential regulation of plasminogen activator and inhibitor gene transcription by the tumor suppressor p53.

    PubMed Central

    Kunz, C; Pebler, S; Otte, J; von der Ahe, D

    1995-01-01

    The ability of p53 to activate or repress transcription suggests that its biological function as tumor suppressor is in part accomplished by regulating a number of genes including such required for inhibition of cell growth. We here give evidence that p53 also may regulate genes responsible for the proteolytic degradation of the extracellular matrix, which is considered a crucial feature for local invasion and metastasis of neoplastic cells. An important and highly regulated cascade of such proteolytic events involves the plasminogen activator system. We show that wild-type p53 represses transcription from the enhancer and promoter of the human urokinase-type (u-PA) and the tissue-type plasminogen activator (t-PA) gene through a non-DNA binding mechanism. Oncogenic mutants lost the repressing activity. In contrast, wild-type but not mutant p53 specifically binds to and activates the promoter of the plasminogen activator inhibitor type-1 (PAI-1) gene. Interestingly, one of the p53 mutants (273his) inhibited PAI-1 promoter activity. Our results suggest that altered function of oncogenic forms of p53 may lead to altered expression of the plasminogen activators and their inhibitor(s) and thus to altered activation of the plasminogen/plasmin system during tumor progression. Images PMID:7479001

  2. MIF Maintains the Tumorigenic Capacity of Brain Tumor-Initiating Cells by Directly Inhibiting p53.

    PubMed

    Fukaya, Raita; Ohta, Shigeki; Yaguchi, Tomonori; Matsuzaki, Yumi; Sugihara, Eiji; Okano, Hideyuki; Saya, Hideyuki; Kawakami, Yutaka; Kawase, Takeshi; Yoshida, Kazunari; Toda, Masahiro

    2016-05-01

    Tumor-initiating cells thought to drive brain cancer are embedded in a complex heterogeneous histology. In this study, we isolated primary cells from 21 human brain tumor specimens to establish cell lines with high tumorigenic potential and to identify the molecules enabling this capability. The morphology, sphere-forming ability upon expansion, and differentiation potential of all cell lines were indistinguishable in vitro However, testing for tumorigenicity revealed two distinct cell types, brain tumor-initiating cells (BTIC) and non-BTIC. We found that macrophage migration inhibitory factor (MIF) was highly expressed in BTIC compared with non-BTIC. MIF bound directly to both wild-type and mutant p53 but regulated p53-dependent cell growth by different mechanisms, depending on glioma cell line and p53 status. MIF physically interacted with wild-type p53 in the nucleus and inhibited its transcription-dependent functions. In contrast, MIF bound to mutant p53 in the cytoplasm and abrogated transcription-independent induction of apoptosis. Furthermore, MIF knockdown inhibited BTIC-induced tumor formation in a mouse xenograft model, leading to increased overall survival. Collectively, our findings suggest that MIF regulates BTIC function through direct, intracellular inhibition of p53, shedding light on the molecular mechanisms underlying the tumorigenicity of certain malignant brain cells. Cancer Res; 76(9); 2813-23. ©2016 AACR. PMID:26980763

  3. Modeling the effect of p53 on tumor heterogeneity and the mutator phenotype

    NASA Astrophysics Data System (ADS)

    Ryan, Melissa; Berryman, Matthew J.; Abbott, Derek

    2005-02-01

    p53 is an important gene, involved in apoptosis (programmed cell death), DNA repair, and cell cycle progression. We explore the selective advantages and disadvantages of mutations in the p53 gene on tumor cells, and the heterogeneity of tumor cell populations. Based on an evolutionary computational approach, our model considers changes in mutation rate caused by lack of DNA repair processes, and the lack of apoptosis caused by mutations in p53. We find that the degree of robustness of p53 to mutations has a significant effect on the tumor heterogeneity and "fitness", with clinical consequences for people who inherit p53 mutations.

  4. Mutations in the p53 gene occur in diverse human tumour types.

    PubMed

    Nigro, J M; Baker, S J; Preisinger, A C; Jessup, J M; Hostetter, R; Cleary, K; Bigner, S H; Davidson, N; Baylin, S; Devilee, P

    1989-12-01

    The p53 gene has been a constant source of fascination since its discovery nearly a decade ago. Originally considered to be an oncogene, several convergent lines of research have indicated that the wild-type gene product actually functions as a tumour suppressor gene. For example, expression of the neoplastic phenotype is inhibited, rather than promoted, when rat cells are transfected with the murine wild-type p53 gene together with mutant p53 genes and/or other oncogenes. Moreover, in human tumours, the short arm of chromosome 17 is often deleted. In colorectal cancers, the smallest common region of deletion is centred at 17p13.1; this region harbours the p53 gene, and in two tumours examined in detail, the remaining (non-deleted) p53 alleles were found to contain mutations. This result was provocative because allelic deletion coupled with mutation of the remaining allele is a theoretical hallmark of tumour-suppressor genes. In the present report, we have attempted to determine the generality of this observation; that is, whether tumours with allelic deletions of chromosome 17p contain mutant p53 genes in the allele that is retained. Our results suggest that (1) most tumours with such allelic deletions contain p53 point mutations resulting in amino-acid substitutions, (2) such mutations are not confined to tumours with allelic deletion, but also occur in at least some tumours that have retained both parental 17p alleles, and (3) p53 gene mutations are clustered in four 'hot-spots' which exactly coincide with the four most highly conserved regions of the gene. These results suggest that p53 mutations play a role in the development of many common human malignancies.

  5. Expanding the prion concept to cancer biology: dominant-negative effect of aggregates of mutant p53 tumour suppressor

    PubMed Central

    Silva, Jerson L.; Rangel, Luciana P.; Costa, Danielly C. F.; Cordeiro, Yraima; De Moura Gallo, Claudia V.

    2013-01-01

    p53 is a key protein that participates in cell-cycle control, and its malfunction can lead to cancer. This tumour suppressor protein has three main domains; the N-terminal transactivation domain, the CTD (C-terminal domain) and the core domain (p53C) that constitutes the sequence-specific DBD (DNA-binding region). Most p53 mutations related to cancer development are found in the DBD. Aggregation of p53 into amyloid oligomers and fibrils has been shown. Moreover, amyloid aggregates of both the mutant and WT (wild-type) forms of p53 were detected in tumour tissues. We propose that if p53 aggregation occurred, it would be a crucial aspect of cancer development, as p53 would lose its WT functions in an aggregated state. Mutant p53 can also exert a dominant-negative regulatory effect on WT p53. Herein, we discuss the dominant-negative effect in light of p53 aggregation and the fact that amyloid-like mutant p53 can convert WT p53 into more aggregated species, leading into gain of function in addition to the loss of tumour suppressor function. In summary, the results obtained in the last decade indicate that cancer may have characteristics in common with amyloidogenic and prion diseases. PMID:24003888

  6. p53 Mutations in Nasal Natural Killer/T-Cell Lymphoma from Mexico

    PubMed Central

    Quintanilla-Martinez, Leticia; Kremer, Marcus; Keller, Gisela; Nathrath, Michaela; Gamboa-Dominguez, Armando; Meneses, Abelardo; Luna-Contreras, Lourdes; Cabras, Antonello; Hoefler, Heinz; Mohar, Alejandro; Fend, Falko

    2001-01-01

    Nasal NK/T-cell lymphoma is a unique form of lymphoma highly associated with Epstein-Barr virus, and with a characteristic geographic distribution. Recently, we showed that p53 is overexpressed in a high percentage of nasal NK/T-cell lymphomas. The aim of this study was to analyze the status of the p53 gene, and correlate it with the expression of p53 protein and its downstream target, the cyclin-dependent kinase inhibitor p21, in a series of 25 cases of well-characterized nasal NK/T-cell lymphoma from Mexico. The highly conserved exons 5 to 8 of the p53 gene were amplified by polymerase chain reaction and screened for mutations by denaturing high-pressure liquid chromatography. Abnormal polymerase chain reaction products detected by denaturing high-pressure liquid chromatography and additional selected cases were sequenced. In addition, the incidence of loss of heterozygosity at the p53 locus was analyzed in 12 cases. Of the 25 patients, 17 were male and 8 female (M:F ratio, 2.1:1), with a median age of 43 years (range, 21 to 93 years). Morphologically, most of the cases were composed of a mixture of medium-sized cells and large transformed cells (21 cases), and four cases were composed exclusively of large transformed cells. Three different groups determined by p53 gene status and expression of p53 protein were identified: group 1 was p53 +/p53 mutated (five cases, all with p53 missense mutations). Morphologically, three of the five cases were composed of large cells. All five cases revealed overexpression of p53 in the majority of the tumor cells with a mean of 86%. Unexpectedly, three of these cases also showed overexpression of p21. Four of the five patients presented with clinical stage IVB and died with disease. Group 2 was p53+/p53 wild-type (10 cases). Histologically, nine cases were of the mixed type, and one of the large cell type. The percentage of p53 overexpressing cells was lower than in the previous group with a mean of 23%. p21 was positive in 7 of

  7. p53-Dependent activation of a molecular beacon in tumor cells following exposure to doxorubicin chemotherapy.

    PubMed

    Shah, Rishita; El-Deiry, Wafik S

    2004-09-01

    In an effort to begin developing a non-invasive strategy for in-vivo detection of the cellular DNA damage response, we engineered a molecular beacon to detect expression of p21(WAF1/CIP1), a gene whose transcription is directly activated by the p53 tumor suppressor protein. Introduction of a phosphorothioate-modified p21-beacon by transfection in human tumor cells led to a slight background signal that increased in a dose dependent manner between 50 and 400 nM beacon. Strong nuclear signal was observed following treatment of wild-type p53-expressing human H460 lung cancer cells for 8 hours with the chemotherapeutic agent doxorubicin (adriamycin). Similar induction was observed in wild-type p53-expressing HCT116 cells. Interestingly, following doxorubicin exposure, there was activation of the p21-beacon in p21-null HCT116 cells, which was not observed in p53-null HCT116, or mutant p53-expressing DLD1 cells that are either wild-type or p21-null. Increased signal from the phosphorothioate-modified p21-beacon in doxorubicin-treated cells likely resulted from sequence-specific hybridization as well as sequence-independent cleavage that may occur due to p53-dependent activation of endonucleases during apoptosis. We conclude that activation of p53 by chemotherapy leads to a strong signal from a p21-beacon that may be useful in further testing both in vitro and in vivo. Strategies need to be developed to optimize the gene or damage specificity as well as the sensitivity to therapeutic response of this non-invasive imaging approach.

  8. Mouse models of p53 functions.

    PubMed

    Lozano, Guillermina

    2010-04-01

    Studies in mice have yielded invaluable insight into our understanding of the p53 pathway. Mouse models with activated p53, no p53, and mutant p53 have queried the role of p53 in development and tumorigenesis. In these models, p53 is activated and stabilized via redundant posttranslational modifications. On activation, p53 initiates two major responses: inhibition of proliferation (via cell-cycle arrest, quiescence, senescence, and differentiation) and induction of apoptosis. Importantly, these responses are cell-type and tumor-type-specific. The analysis of mutant p53 alleles has established a gain-of-function role for p53 mutants in metastasis. The development of additional models that can precisely time the oncogenic events in single cells will provide further insight into the evolution of tumors, the importance of the stroma, and the cooperating events that lead to disruption of the p53 pathway. Ultimately, these models should serve to study the effects of novel drugs on tumor response as well as normal homeostasis.

  9. New Insights into p53 Signaling and Cancer Cell Response to DNA Damage: Implications for Cancer Therapy

    PubMed Central

    Mirzayans, Razmik; Andrais, Bonnie; Scott, April; Murray, David

    2012-01-01

    Activation of the p53 signaling pathway by DNA-damaging agents was originally proposed to result either in cell cycle checkpoint activation to promote survival or in apoptotic cell death. This model provided the impetus for numerous studies focusing on the development of p53-based cancer therapies. According to recent evidence, however, most p53 wild-type human cell types respond to ionizing radiation by undergoing stress-induced premature senescence (SIPS) and not apoptosis. SIPS is a sustained growth-arrested state in which cells remain viable and secrete factors that may promote cancer growth and progression. The p21WAF1 (hereafter p21) protein has emerged as a key player in the p53 pathway. In addition to its well-studied role in cell cycle checkpoints, p21 regulates p53 and its upstream kinase (ATM), controls gene expression, suppresses apoptosis, and induces SIPS. Herein, we review these and related findings with human solid tumor-derived cell lines, report new data demonstrating dynamic behaviors of p53 and p21 in the DNA damage response, and examine the gain-of-function properties of cancer-associated p53 mutations. We point out obstacles in cancer-therapeutic strategies that are aimed at reactivating the wild-type p53 function and highlight some alternative approaches that target the apoptotic threshold in cancer cells with differing p53 status. PMID:22911014

  10. [Suppressive effect of protein kinase C inhibitors on tumor cell function via phosphorylation of p53 protein in mice].

    PubMed

    Nakamura, K; Shinozuka, K; Kunitomo, M

    2000-12-01

    We examined the role of protein kinase C (PKC) in the phosphorylation of a p53 protein. Exposure to a protein kinase inhibitor, 1-(5-isoquinolinesulfonyl)-2-methylpiperazine dihydrochloride (H7), increased the phosphorylation of the wild type p53 protein, whereas exposure to a tumor promoter phorbol ester, 12-O-tetradecanoyl-phorbol-13-acetate (TPA), decreased it in vivo after incubation with mouse epidermal JB6 cells for 3 h. Exposure to a cAMP dependent protein kinase (PKA) activator, forskolin, did not decrease the phosphorylation of p53 protein. In the transient transfection/luciferase reporter transactivation assay, H7 slightly increased the mouse double minute (MDM) 2 reporter transactivation activity of the p53 protein after treatment for 24 h, whereas TPA completely blocked it. Exposure to H7 and a specific PKC inhibitor, bisindolylmaleimide (bis), dose-dependently reduced the lung-colonizing potential of highly metastatic B16-F10 mouse melanoma cells in syngeneic mice. These results suggest that the phosphorylation of the wild type p53 protein is inversely related to PKC activation, and also suggest that the phosphorylation of the p53 protein is involved in the function of its transcription factor. The PKC inhibitor may exhibit a potent anti-metastatic effect through the phosphorylation of wild type p53 protein and the activation of its function. PMID:11193387

  11. p53 is important for the anti-proliferative effect of ibuprofen in colon carcinoma cells

    SciTech Connect

    Janssen, Astrid; Schiffmann, Susanne; Birod, Kerstin; Maier, Thorsten J.; Wobst, Ivonne; Geisslinger, Gerd

    2008-01-25

    S-ibuprofen which inhibits the cyclooxygenase-1/-2 and R-ibuprofen which shows no COX-inhibition at therapeutic concentrations have anti-carcinogenic effects in human colon cancer cells; however, the molecular mechanisms for these effects are still unknown. Using HCT-116 colon carcinoma cell lines, expressing either the wild-type form of p53 (HCT-116 p53{sup wt}) or being p(HCT-116 p53{sup -/-}), we demonstrated that both induction of a cell cycle block and apoptosis after S- and R-ibuprofen treatment is in part dependent on p53. Also in the in vivo nude mice model HCT-116 p53{sup -/-} xenografts were less sensitive for S- and R-ibuprofen treatment than HCT-116 p53{sup wt} cells. Furthermore, results indicate that induction of apoptosis in HCT-116 p53{sup wt} cells after ibuprofen treatment is in part dependent on a signalling pathway including the neutrophin receptor p75{sup NTR}, p53 and Bax.

  12. Gain-of-function p53 mutants co-opt chromatin pathways to drive cancer growth.

    PubMed

    Zhu, Jiajun; Sammons, Morgan A; Donahue, Greg; Dou, Zhixun; Vedadi, Masoud; Getlik, Matthäus; Barsyte-Lovejoy, Dalia; Al-awar, Rima; Katona, Bryson W; Shilatifard, Ali; Huang, Jing; Hua, Xianxin; Arrowsmith, Cheryl H; Berger, Shelley L

    2015-09-10

    TP53 (which encodes p53 protein) is the most frequently mutated gene among all human cancers. Prevalent p53 missense mutations abrogate its tumour suppressive function and lead to a 'gain-of-function' (GOF) that promotes cancer. Here we show that p53 GOF mutants bind to and upregulate chromatin regulatory genes, including the methyltransferases MLL1 (also known as KMT2A), MLL2 (also known as KMT2D), and acetyltransferase MOZ (also known as KAT6A or MYST3), resulting in genome-wide increases of histone methylation and acetylation. Analysis of The Cancer Genome Atlas shows specific upregulation of MLL1, MLL2, and MOZ in p53 GOF patient-derived tumours, but not in wild-type p53 or p53 null tumours. Cancer cell proliferation is markedly lowered by genetic knockdown of MLL1 or by pharmacological inhibition of the MLL1 methyltransferase complex. Our study reveals a novel chromatin mechanism underlying the progression of tumours with GOF p53, and suggests new possibilities for designing combinatorial chromatin-based therapies for treating individual cancers driven by prevalent GOF p53 mutations. PMID:26331536

  13. p53-independent anti-tumor effects of the nitrogen-containing bisphosphonate zoledronic acid.

    PubMed

    Kuroda, Junya; Kimura, Shinya; Segawa, Hidekazu; Sato, Kiyoshi; Matsumoto, Seiji; Nogawa, Masaki; Yuasa, Takeshi; Kobayashi, Yutaka; Yoshikawa, Toshikazu; Ottmann, Oliver G; Maekawa, Taira

    2004-02-01

    Zoledronic acid (ZOL), a nitrogen-containing bisphosphonate, exerts anti-tumor effects by inhibiting the prenylation of small GTPases. We have also reported that ZOL shows an anti-leukemic effect by inducing apoptosis throughout the S phase to the G(2) / M boundary. Here, we studied the effects of ZOL on various cell cycle regulators, including p53, cyclin-dependent kinases (CDKs), CDK inhibitors and cyclins, using BV173 leukemia and HCT116 colorectal carcinoma cell lines, harboring wild-type (wt-) p53. ZOL induced the accumulation of neither p53 nor p21(WAF1/CIP1) during the execution of apoptosis in BV173 cells. Therefore, we investigated the dependence of ZOL-induced apoptosis on intact p53 by using wt-p53 HCT116 and a p53-degraded HCT116 subline, and observed no significant difference. p57(KIP2) was upregulated by ZOL in BV173 cells, but not in HCT116 cells. Flow cytometric analyses showed that ZOL also impaired the cell cycle-dependent expression patterns of cyclins A, B and D3 in BV173. In conclusion, the p53-independent anti-tumor activities of ZOL suggest that it may be an attractive agent for treating cancers, including those with chemoresistance resulting from the loss of p53 function. ZOL also affected the coordinate expression patterns of several cell cycle regulators during the execution of anti-tumor activity.

  14. RAG-induced DNA lesions activate proapoptotic BIM to suppress lymphomagenesis in p53-deficient mice.

    PubMed

    Delbridge, Alex R D; Pang, Swee Heng Milon; Vandenberg, Cassandra J; Grabow, Stephanie; Aubrey, Brandon J; Tai, Lin; Herold, Marco J; Strasser, Andreas

    2016-09-19

    Neoplastic transformation is driven by oncogenic lesions that facilitate unrestrained cell expansion and resistance to antiproliferative signals. These oncogenic DNA lesions, acquired through errors in DNA replication, gene recombination, or extrinsically imposed damage, are thought to activate multiple tumor suppressive pathways, particularly apoptotic cell death. DNA damage induces apoptosis through well-described p53-mediated induction of PUMA and NOXA. However, loss of both these mediators (even together with defects in p53-mediated induction of cell cycle arrest and cell senescence) does not recapitulate the tumor susceptibility observed in p53(-/-) mice. Thus, potentially oncogenic DNA lesions are likely to also trigger apoptosis through additional, p53-independent processes. We found that loss of the BH3-only protein BIM accelerated lymphoma development in p53-deficient mice. This process was negated by concomitant loss of RAG1/2-mediated antigen receptor gene rearrangement. This demonstrates that BIM is critical for the induction of apoptosis caused by potentially oncogenic DNA lesions elicited by RAG1/2-induced gene rearrangement. Furthermore, this highlights the role of a BIM-mediated tumor suppressor pathway that acts in parallel to the p53 pathway and remains active even in the absence of wild-type p53 function, suggesting this may be exploited in the treatment of p53-deficient cancers. PMID:27621418

  15. Reactivation of mutant p53 by a dietary-related compound phenethyl isothiocyanate inhibits tumor growth.

    PubMed

    Aggarwal, M; Saxena, R; Sinclair, E; Fu, Y; Jacobs, A; Dyba, M; Wang, X; Cruz, I; Berry, D; Kallakury, B; Mueller, S C; Agostino, S D; Blandino, G; Avantaggiati, M L; Chung, F-L

    2016-10-01

    Mutations in the p53 tumor-suppressor gene are prevalent in human cancers. The majority of p53 mutations are missense, which can be classified into contact mutations (that directly disrupts the DNA-binding activity of p53) and structural mutations (that disrupts the conformation of p53). Both of the mutations can disable the normal wild-type (WT) p53 activities. Nevertheless, it has been amply documented that small molecules can rescue activity from mutant p53 by restoring WT tumor-suppressive functions. These compounds hold promise for cancer therapy and have now entered clinical trials. In this study, we show that cruciferous-vegetable-derived phenethyl isothiocyanate (PEITC) can reactivate p53 mutant under in vitro and in vivo conditions, revealing a new mechanism of action for a dietary-related compound. PEITC exhibits growth-inhibitory activity in cells expressing p53 mutants with preferential activity toward p53(R175), one of the most frequent 'hotspot' mutations within the p53 sequence. Mechanistic studies revealed that PEITC induces apoptosis in a p53(R175) mutant-dependent manner by restoring p53 WT conformation and transactivation functions. Accordingly, in PEITC-treated cells the reactivated p53(R175) mutant induces apoptosis by activating canonical WT p53 targets, inducing a delay in S and G2/M phase, and by phosphorylating ATM/CHK2. Interestingly, the growth-inhibitory effects of PEITC depend on the redox state of the cell. Further, PEITC treatments render the p53(R175) mutant sensitive to degradation by the proteasome and autophagy in a concentration-dependent manner. PEITC-induced reactivation of p53(R175) and its subsequent sensitivity to the degradation pathways likely contribute to its anticancer activities. We further show that dietary supplementation of PEITC is able to reactivate WT activity in vivo as well, inhibiting tumor growth in xenograft mouse model. These findings provide the first example of mutant p53 reactivation by a dietary

  16. Reactivation of mutant p53 by a dietary-related compound phenethyl isothiocyanate inhibits tumor growth

    PubMed Central

    Aggarwal, M; Saxena, R; Sinclair, E; Fu, Y; Jacobs, A; Dyba, M; Wang, X; Cruz, I; Berry, D; Kallakury, B; Mueller, S C; Agostino, S D; Blandino, G; Avantaggiati, M L; Chung, F-L

    2016-01-01

    Mutations in the p53 tumor-suppressor gene are prevalent in human cancers. The majority of p53 mutations are missense, which can be classified into contact mutations (that directly disrupts the DNA-binding activity of p53) and structural mutations (that disrupts the conformation of p53). Both of the mutations can disable the normal wild-type (WT) p53 activities. Nevertheless, it has been amply documented that small molecules can rescue activity from mutant p53 by restoring WT tumor-suppressive functions. These compounds hold promise for cancer therapy and have now entered clinical trials. In this study, we show that cruciferous-vegetable-derived phenethyl isothiocyanate (PEITC) can reactivate p53 mutant under in vitro and in vivo conditions, revealing a new mechanism of action for a dietary-related compound. PEITC exhibits growth-inhibitory activity in cells expressing p53 mutants with preferential activity toward p53R175, one of the most frequent ‘hotspot' mutations within the p53 sequence. Mechanistic studies revealed that PEITC induces apoptosis in a p53R175 mutant-dependent manner by restoring p53 WT conformation and transactivation functions. Accordingly, in PEITC-treated cells the reactivated p53R175 mutant induces apoptosis by activating canonical WT p53 targets, inducing a delay in S and G2/M phase, and by phosphorylating ATM/CHK2. Interestingly, the growth-inhibitory effects of PEITC depend on the redox state of the cell. Further, PEITC treatments render the p53R175 mutant sensitive to degradation by the proteasome and autophagy in a concentration-dependent manner. PEITC-induced reactivation of p53R175 and its subsequent sensitivity to the degradation pathways likely contribute to its anticancer activities. We further show that dietary supplementation of PEITC is able to reactivate WT activity in vivo as well, inhibiting tumor growth in xenograft mouse model. These findings provide the first example of mutant p53 reactivation by a dietary compound and

  17. The expanding universe of p53 targets.

    PubMed

    Menendez, Daniel; Inga, Alberto; Resnick, Michael A

    2009-10-01

    The p53 tumour suppressor is modified through mutation or changes in expression in most cancers, leading to the altered regulation of hundreds of genes that are directly influenced by this sequence-specific transcription factor. Central to the p53 master regulatory network are the target response element (RE) sequences. The extent of p53 transactivation and transcriptional repression is influenced by many factors, including p53 levels, cofactors and the specific RE sequences, all of which contribute to the role that p53 has in the aetiology of cancer. This Review describes the identification and functionality of REs and highlights the inclusion of non-canonical REs that expand the universe of genes and regulation mechanisms in the p53 tumour suppressor network.

  18. p53 mutation heterogeneity in cancer

    SciTech Connect

    Soussi, T. . E-mail: thierry.soussi@free.fr; Lozano, G.

    2005-06-10

    The p53 gene is inactivated in about 50% of human cancers and the p53 protein is an essential component of the cell response induced by genotoxic stresses such as those generated by radiotherapy or chemotherapy. It is therefore highly likely that these alterations are an important component in tumor resistance to therapy. The particular characteristics of these alterations, 80% of which are missense mutations leading to functionally heterogeneous proteins, make p53 a unique gene in the class of tumor suppressor genes. A considerable number of mutant p53 proteins probably have an oncogenic activity per se and therefore actively participate in cell transformation. The fact that the apoptotic and antiproliferative functions of p53 can be dissociated in certain mutants also suggests another level of complexity in the relationships between p53 inactivation and neoplasia.

  19. Fluorescence polarization assay and inhibitor design for MDM2/p53 interaction.

    PubMed

    Zhang, Rumin; Mayhood, Todd; Lipari, Philip; Wang, Yaolin; Durkin, James; Syto, Rosalinda; Gesell, Jennifer; McNemar, Charles; Windsor, William

    2004-08-01

    MDM2 is an important negative regulator of the tumor suppressor protein p53 which regulates the expression of many genes including MDM2. The delicate balance of this autoregulatory loop is crucial for the maintenance of the genome and control of the cell cycle and apoptosis. MDM2 hyperactivity, due to amplification/overexpression or mutational inactivation of the ARF locus, inhibits the function of wild-type p53 and can lead to the development of a wide variety of cancers. Thus, the development of anti-MDM2 therapies may restore normal p53 function in tumor cells and induce growth suppression and apoptosis. We report here a novel high-throughput fluorescence polarization binding assay and its application in rank ordering small-molecule inhibitors that block the binding of MDM2 to a p53-derived fluorescent peptide.

  20. Jasmonates induce nonapoptotic death in high-resistance mutant p53-expressing B-lymphoma cells.

    PubMed

    Fingrut, Orit; Reischer, Dorit; Rotem, Ronit; Goldin, Natalia; Altboum, Irit; Zan-Bar, Israel; Flescher, Eliezer

    2005-11-01

    Mutations in p53, a tumor suppressor gene, occur in more than half of human cancers. Therefore, we tested the hypothesis that jasmonates (novel anticancer agents) can induce death in mutated p53-expressing cells. Two clones of B-lymphoma cells were studied, one expressing wild-type (wt) p53 and the other expressing mutated p53. Jasmonic acid and methyl jasmonate (0.25-3 mM) were each equally cytotoxic to both clones, whereas mutant p53-expressing cells were resistant to treatment with the radiomimetic agent neocarzinostatin and the chemotherapeutic agent bleomycin. Neocarzinostatin and bleomycin induced an elevation in the p53 levels in wt p53-expressing cells, whereas methyl jasmonate did not. Methyl jasmonate induced mostly apoptotic death in the wt p53-expressing cells, while no signs of early apoptosis were detected in mutant p53-expressing cells. In contrast, neocarzinostatin and bleomycin induced death only in wt p53-expressing cells, in an apoptotic mode. Methyl jasmonate induced a rapid depletion of ATP in both clones. In both clones, oligomycin (a mitochondrial ATP synthase inhibitor) did not increase ATP depletion induced by methyl jasmonate, whereas inhibition of glycolysis with 2-deoxyglucose did. High glucose levels protected both clones from methyl jasmonate-induced ATP depletion (and reduced methyl jasmonate-induced cytotoxicity), whereas high levels of pyruvate did not. These results suggest that methyl jasmonate induces ATP depletion mostly by compromising oxidative phosphorylation in the mitochondria. In conclusion, jasmonates can circumvent the resistance of mutant p53-expressing cells towards chemotherapy by inducing a nonapoptotic cell death.

  1. Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats

    SciTech Connect

    Botcheva, Krassimira; McCorkle, Sean R.

    2014-11-21

    The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We report distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.

  2. p53 enables metabolic fitness and self-renewal of nephron progenitor cells

    PubMed Central

    Li, Yuwen; Liu, Jiao; Li, Wencheng; Brown, Aaron; Baddoo, Melody; Li, Marilyn; Carroll, Thomas; Oxburgh, Leif; Feng, Yumei; Saifudeen, Zubaida

    2015-01-01

    Contrary to its classic role in restraining cell proliferation, we demonstrate here a divergent function of p53 in the maintenance of self-renewal of the nephron progenitor pool in the embryonic mouse kidney. Nephron endowment is regulated by progenitor availability and differentiation potential. Conditional deletion of p53 in nephron progenitor cells (Six2Cre+;p53fl/fl) induces progressive depletion of Cited1+/Six2+ self-renewing progenitors and loss of cap mesenchyme (CM) integrity. The Six2(p53-null) CM is disorganized, with interspersed stromal cells and an absence of a distinct CM-epithelia and CM-stroma interface. Impaired cell adhesion and epithelialization are indicated by decreased E-cadherin and NCAM expression and by ineffective differentiation in response to Wnt induction. The Six2Cre+;p53fl/fl cap has 30% fewer Six2(GFP+) cells. Apoptotic index is unchanged, whereas proliferation index is significantly reduced in accordance with cell cycle analysis showing disproportionately fewer Six2Cre+;p53fl/fl cells in the S and G2/M phases compared with Six2Cre+;p53+/+ cells. Mutant kidneys are hypoplastic with fewer generations of nascent nephrons. A significant increase in mean arterial pressure is observed in early adulthood in both germline and conditional Six2(p53-null) mice, linking p53-mediated defects in kidney development to hypertension. RNA-Seq analyses of FACS-isolated wild-type and Six2(GFP+) CM cells revealed that the top downregulated genes in Six2Cre+;p53fl/fl CM belong to glucose metabolism and adhesion and/or migration pathways. Mutant cells exhibit a ∼50% decrease in ATP levels and a 30% decrease in levels of reactive oxygen species, indicating energy metabolism dysfunction. In summary, our data indicate a novel role for p53 in enabling the metabolic fitness and self-renewal of nephron progenitors. PMID:25804735

  3. p53 Enables metabolic fitness and self-renewal of nephron progenitor cells.

    PubMed

    Li, Yuwen; Liu, Jiao; Li, Wencheng; Brown, Aaron; Baddoo, Melody; Li, Marilyn; Carroll, Thomas; Oxburgh, Leif; Feng, Yumei; Saifudeen, Zubaida

    2015-04-01

    Contrary to its classic role in restraining cell proliferation, we demonstrate here a divergent function of p53 in the maintenance of self-renewal of the nephron progenitor pool in the embryonic mouse kidney. Nephron endowment is regulated by progenitor availability and differentiation potential. Conditional deletion of p53 in nephron progenitor cells (Six2Cre(+);p53(fl/fl)) induces progressive depletion of Cited1(+)/Six2(+) self-renewing progenitors and loss of cap mesenchyme (CM) integrity. The Six2(p53-null) CM is disorganized, with interspersed stromal cells and an absence of a distinct CM-epithelia and CM-stroma interface. Impaired cell adhesion and epithelialization are indicated by decreased E-cadherin and NCAM expression and by ineffective differentiation in response to Wnt induction. The Six2Cre(+);p53(fl/fl) cap has 30% fewer Six2(GFP(+)) cells. Apoptotic index is unchanged, whereas proliferation index is significantly reduced in accordance with cell cycle analysis showing disproportionately fewer Six2Cre(+);p53(fl/fl) cells in the S and G2/M phases compared with Six2Cre(+);p53(+/+) cells. Mutant kidneys are hypoplastic with fewer generations of nascent nephrons. A significant increase in mean arterial pressure is observed in early adulthood in both germline and conditional Six2(p53-null) mice, linking p53-mediated defects in kidney development to hypertension. RNA-Seq analyses of FACS-isolated wild-type and Six2(GFP(+)) CM cells revealed that the top downregulated genes in Six2Cre(+);p53(fl/fl) CM belong to glucose metabolism and adhesion and/or migration pathways. Mutant cells exhibit a ∼ 50% decrease in ATP levels and a 30% decrease in levels of reactive oxygen species, indicating energy metabolism dysfunction. In summary, our data indicate a novel role for p53 in enabling the metabolic fitness and self-renewal of nephron progenitors.

  4. Oncogenic Intra-p53 Family Member Interactions in Human Cancers

    PubMed Central

    Ferraiuolo, Maria; Di Agostino, Silvia; Blandino, Giovanni; Strano, Sabrina

    2016-01-01

    The p53 gene family members p53, p73, and p63 display several isoforms derived from the presence of internal promoters and alternative splicing events. They are structural homologs but hold peculiar functional properties. p53, p73, and p63 are tumor suppressor genes that promote differentiation, senescence, and apoptosis. p53, unlike p73 and p63, is frequently mutated in cancer often displaying oncogenic “gain of function” activities correlated with the induction of proliferation, invasion, chemoresistance, and genomic instability in cancer cells. These oncogenic functions are promoted either by the aberrant transcriptional cooperation of mutant p53 (mutp53) with transcription cofactors (e.g., NF-Y, E2F1, Vitamin D Receptor, Ets-1, NF-kB and YAP) or by the interaction with the p53 family members, p73 and p63, determining their functional inactivation. The instauration of these aberrant transcriptional networks leads to increased cell growth, low activation of DNA damage response pathways (DNA damage response and DNA double-strand breaks response), enhanced invasion, and high chemoresistance to different conventional chemotherapeutic treatments. Several studies have clearly shown that different cancers harboring mutant p53 proteins exhibit a poor prognosis when compared to those carrying wild-type p53 (wt-p53) protein. The interference of mutantp53/p73 and/or mutantp53/p63 interactions, thereby restoring p53, p73, and p63 tumor suppression functions, could be among the potential therapeutic strategies for the treatment of mutant p53 human cancers. PMID:27066457

  5. Cell Context Dependent p53 Genome-Wide Binding Patterns and Enrichment at Repeats

    DOE PAGES

    Botcheva, Krassimira; McCorkle, Sean R.

    2014-11-21

    The p53 ability to elicit stress specific and cell type specific responses is well recognized, but how that specificity is established remains to be defined. Whether upon activation p53 binds to its genomic targets in a cell type and stress type dependent manner is still an open question. Here we show that the p53 binding to the human genome is selective and cell context-dependent. We mapped the genomic binding sites for the endogenous wild type p53 protein in the human cancer cell line HCT116 and compared them to those we previously determined in the normal cell line IMR90. We reportmore » distinct p53 genome-wide binding landscapes in two different cell lines, analyzed under the same treatment and experimental conditions, using the same ChIP-seq approach. This is evidence for cell context dependent p53 genomic binding. The observed differences affect the p53 binding sites distribution with respect to major genomic and epigenomic elements (promoter regions, CpG islands and repeats). We correlated the high-confidence p53 ChIP-seq peaks positions with the annotated human repeats (UCSC Human Genome Browser) and observed both common and cell line specific trends. In HCT116, the p53 binding was specifically enriched at LINE repeats, compared to IMR90 cells. The p53 genome-wide binding patterns in HCT116 and IMR90 likely reflect the different epigenetic landscapes in these two cell lines, resulting from cancer-associated changes (accumulated in HCT116) superimposed on tissue specific differences (HCT116 has epithelial, while IMR90 has mesenchymal origin). In conclusion, our data support the model for p53 binding to the human genome in a highly selective manner, mobilizing distinct sets of genes, contributing to distinct pathways.« less

  6. Homozygous mdm2 SNP309 cancer cells with compromised transcriptional elongation at p53 target genes are sensitive to induction of p53-independent cell death.

    PubMed

    Rosso, Melissa; Polotskaia, Alla; Bargonetti, Jill

    2015-10-27

    A single nucleotide polymorphism (T to G) in the mdm2 P2 promoter, mdm2 SNP309, leads to MDM2 overexpression promoting chemotherapy resistant cancers. Two mdm2 G/G SNP309 cancer cell lines, MANCA and A875, have compromised wild-type p53 that co-localizes with MDM2 on chromatin. We hypothesized that MDM2 in these cells inhibited transcription initiation at the p53 target genes p21 and puma. Surprisingly, following etoposide treatment transcription initiation occurred at the compromised target genes in MANCA and A875 cells similar to the T/T ML-1 cell line. In all cell lines tested there was equally robust recruitment of total and initiated RNA polymerase II (Pol II). We found that knockdown of MDM2 in G/G cells moderately increased expression of subsets of p53 target genes without increasing p53 stability. Importantly, etoposide and actinomycin D treatments increased histone H3K36 trimethylation in T/T, but not G/G cells, suggesting a G/G correlated inhibition of transcription elongation. We therefore tested a chemotherapeutic agent (8-amino-adenosine) that induces p53-independent cell death for higher clinically relevant cytotoxicity. We demonstrated that T/T and G/G mdm2 SNP309 cells were equally sensitive to 8-amino-adenosine induced cell death. In conclusion for cancer cells overexpressing MDM2, targeting MDM2 may be less effective than inducing p53-independent cell death.

  7. Generation and immunosuppressive functions of p53-induced human adaptive regulatory T cells

    PubMed Central

    Mandapathil, Magis; Visus, Carmen; Finn, Olivera J; Lang, Stephan; Whiteside, Theresa L

    2013-01-01

    Inducible regulatory T cells (iTregs, also called Tr1 cells) are generated in the periphery (circulation or tissue) of cancer patients upon the encounter of naïve CD4+ T cells with tumor-associated antigens. As p53 is often inactivated by genetic or epigenetic events during oncogenesis, p53-induced Tr1 cells might play a key role in establishing immunosuppressive networks in cancer patients. Tr1 cells were generated by co-culturing circulating CD4+CD25− T cells with autologous immature dendritic cells pulsed with a wild-type (WT) p53-derived peptide or an unrelated peptide derived from mucin 1 (MUC1). The Tr1 phenotype and the specificity for p53 of these cells were confirmed by multicolor flow cytometry. Moreover, the Tr1 cell-mediated suppression of T-cell proliferation was evaluated by CFSE-based flow cytometry, while their ability to alter the T-cell cytokine profile by ELISA and Luminex assays. The capacity of p53-induced Tr1 cells to suppress the generation and function of cytotoxic T lymphcoytes (CTLs) was assessed by flow cytometry and ELISPOT. Of note, low doses of the p53-derived peptide (p53low) induced greater numbers of Tr1 cells than the same peptide employed at high doses (p53high). Moreover, Tr1/p53low cells not secreted higher levels of interleukin-10 and transforming growth factor β1, but also mediated more robust suppressive effects on CTL proliferation than Tr1/p53high cells. Tr1/p53low cells, Tr1/p53high cells, as well as Tr1 cells generated with low doses of an unrelated MUC1-derived peptide were equally effective in suppressing the expansion and antitumor activity of p53-reactive CTLs. p53low induced the expansion of highly suppressive p53-reactive Tr1 cells. However, the capacity of these Tr1 cells to suppress the generation and function of p53-reactive CTLs was independent of their antigen-specificity. PMID:24073385

  8. Selective induction of apoptosis through the FADD/caspase-8 pathway by a p53 c-terminal peptide in human pre-malignant and malignant cells.

    PubMed

    Li, Yin; Mao, Yuehua; Rosal, Ramon V; Dinnen, Richard D; Williams, Ann C; Brandt-Rauf, Paul W; Fine, Robert L

    2005-05-20

    A p53 C-terminal peptide (aa 361-382, p53p), fused at its C-terminus to the minimal carrier peptide of antennapedia (17 aa, Ant; p53p-Ant), induced rapid apoptosis in human cancer cells, via activation of the Fas pathway. We examined p53p-Ant mechanism of action, toxicity in various human normal, non-malignant, pre-malignant and malignant cancer cells and investigated its biophysical characteristics. p53p-Ant selectively induced cell death in only pre-malignant or malignant cells in a p53-dependent manner and was not toxic to normal and non-malignant cells. p53p-Ant was more toxic to the mutant p53 than wild-type p53 phenotype in H1299 lung cancer cells stably expressing human temperature-sensitive p53 mutant 143Ala. Surface plasmon resonance (BIACORE) analysis demonstrated that this peptide had higher binding affinity to mutant p53 as compared to wild-type p53. p53p-Ant induced-cell death had the classical morphological characteristics of apoptosis and had no features of necrosis. The mechanism of cell death by p53p-Ant was through the FADD/caspase-8-dependent pathway without the involvement of the TRAIL pathway, Bcl-2 family and cell cycle changes. Blocking Fas with antibody did not alter the peptide's effect, suggesting that Fas itself did not interact with the peptide. Transfection with a dominant-negative FADD with a deleted N-terminus inhibited p53p-Ant-induced apoptosis. Its mechanism of action is related to the FADD-induced pathway without restoration of other p53 functions. p53p-Ant is a novel anticancer agent with unique selectivity for human cancer cells and could be useful as a prototype for the development of new anti-cancer agents. PMID:15645452

  9. Experimental test of specific predictions of a model for the oscillatory response of p53 to DNA damage.

    NASA Astrophysics Data System (ADS)

    Stolovitzky, Gustavo; Wagner, John; Rice, J. Jeremy; Ma, Lan; Hu, Wenwei; Feng, Zhaohui; Levine, Arnold

    2007-03-01

    We have proposed a model for radiation-induced oscillations of the p53-mdm2 system that makes specific predictions about the range of both p53 and mdm2 transcription rates that support oscillation. Our model predicts that in cells with a polymorphism in the mdm2 gene (SNP309) that enhances mdm2 transcription levels, oscillations disappear. The kinetics of the p53 and Mdm2 levels measured in cells with different genotype at the SNP309 locus show that oscillations of p53 and Mdm2 are observed in the cells wild type for mdm2 SNP309 but not in cells homozygous for mdm2 SNP309. By using H1299 cell line expressing wild-type p53 under a tetracycline-regulated promoter we found that only when p53 levels are in a certain range, oscillation can be observed after stress. This study provides evidence that proper range of the p53 and Mdm2 levels are required for the coordinated p53-Mdm2 oscillation upon stress.

  10. Biological and genetic properties of the p53 null preneoplastic mammary epithelium

    NASA Technical Reports Server (NTRS)

    Medina, Daniel; Kittrell, Frances S.; Shepard, Anne; Stephens, L. Clifton; Jiang, Cheng; Lu, Junxuan; Allred, D. Craig; McCarthy, Maureen; Ullrich, Robert L.

    2002-01-01

    The absence of the tumor suppressor gene p53 confers an increased tumorigenic risk for mammary epithelial cells. In this report, we describe the biological and genetic properties of the p53 null preneoplastic mouse mammary epithelium in a p53 wild-type environment. Mammary epithelium from p53 null mice was transplanted serially into the cleared mammary fat pads of p53 wild-type BALB/c female to develop stable outgrowth lines. The outgrowth lines were transplanted for 10 generations. The outgrowths were ductal in morphology and progressed through ductal hyperplasia and ductal carcinoma in situ before invasive cancer. The preneoplastic outgrowth lines were immortal and exhibited activated telomerase activity. They are estrogen and progesterone receptor-positive, and aneuploid, and had various levels of tumorigenic potential. The biological and genetic properties of these lines are distinct from those found in most hyperplastic alveolar outgrowth lines, the form of mammary preneoplasia occurring in most traditional models of murine mammary tumorigenesis. These results indicate that the preneoplastic cell populations found in this genetically engineered model are similar in biological properties to a subset of precurser lesions found in human breast cancer and provide a unique model to identify secondary events critical for tumorigenicity and invasiveness.

  11. [Synthetic lethal genes to mutant p53].

    PubMed

    Tongyang, Liu; Haiqiang, Guo; Meiyan, Zhu; Yingze, Huang; Shuting, Jia; Ying, Luo; Jihong, Zhang

    2015-04-01

    Targeted therapy has become a powerful approach for cancer treatment. Better understanding of oncogenes as well as synthetic lethal interactions with oncogenes will lead to new strategies for tumor-specific treatment. It is well known that mutant p53 plays an important role in tumorigenesis and tumor development. Thus, understanding the synthetic lethal relationship between p53 mutations and interacting genes in tumor is critical for the personalized treatments of p53 mutant tumors. Synthetic lethal genes to mutant p53 can be divided into cell cycle regulators and non-cell cycle regulators. This paper review show these two types of target genes contribute to synthetic lethal interactions with p53 mutations and potential applications of these interactions in anticancer therapy.

  12. New Plays in the p53 Theater

    PubMed Central

    Aylon, Yael; Oren, Moshe

    2010-01-01

    Summary The p53 tumor suppressor and its paralogs p63 and p73 are at the crux of a network modulating cellular responses against potentially tumorigenic events. p53 acts primarily as a transcription factor, regulating the expression of both coding and non-coding RNAs, as well as the activity of RNA processing complexes. In line with their anti-tumorigenic function, p53 and p63 have recently been implicated in restricting tumor cell invasion. In parallel, a growing number of non-canonical target genes have been added to the p53 repertoire. These include genes encoding for proteins that impinge on a broad spectrum of cellular functions, from cell metabolism to stem cell renewal. The p53 story is still far from being fully told. PMID:21317061

  13. SUMOylation of p53 mediates interferon activities

    PubMed Central

    Marcos-Villar, Laura; Pérez-Girón, José V; Vilas, Jéssica M; Soto, Atenea; de la Cruz-Hererra, Carlos F; Lang, Valerie; Collado, Manuel; Vidal, Anxo; Rodríguez, Manuel S; Muñoz-Fontela, César; Rivas, Carmen

    2013-01-01

    There is growing evidence that many host proteins involved in innate and intrinsic immunity are regulated by SUMOylation, and that SUMO contributes to the regulatory process that governs the initiation of the type I interferon (IFN) response. The tumor suppressor p53 is a modulator of the IFN response that plays a role in virus-induced apoptosis and in IFN-induced senescence. Here we demonstrate that IFN treatment increases the levels of SUMOylated p53 and induces cellular senescence through a process that is partially dependent upon SUMOylation of p53. Similarly, we show that vesicular stomatitis virus (VSV) infection induces p53 SUMOylation, and that this modification favors the control of VSV replication. Thus, our study provides evidence that IFN signaling induces p53 SUMOylation, which results in the activation of a cellular senescence program and contributes to the antiviral functions of interferon. PMID:23966171

  14. SUMOylation of p53 mediates interferon activities.

    PubMed

    Marcos-Villar, Laura; Pérez-Girón, José V; Vilas, Jéssica M; Soto, Atenea; de la Cruz-Hererra, Carlos F; Lang, Valerie; Collado, Manuel; Vidal, Anxo; Rodríguez, Manuel S; Muñoz-Fontela, César; Rivas, Carmen

    2013-09-01

    There is growing evidence that many host proteins involved in innate and intrinsic immunity are regulated by SUMOylation, and that SUMO contributes to the regulatory process that governs the initiation of the type I interferon (IFN) response. The tumor suppressor p53 is a modulator of the IFN response that plays a role in virus-induced apoptosis and in IFN-induced senescence. Here we demonstrate that IFN treatment increases the levels of SUMOylated p53 and induces cellular senescence through a process that is partially dependent upon SUMOylation of p53. Similarly, we show that vesicular stomatitis virus (VSV) infection induces p53 SUMOylation, and that this modification favors the control of VSV replication. Thus, our study provides evidence that IFN signaling induces p53 SUMOylation, which results in the activation of a cellular senescence program and contributes to the antiviral functions of interferon.

  15. Mutation of p53 in Recurrent Hepatocellular Carcinoma and Its Association with the Expression of ZBP-89

    PubMed Central

    Chen, George G.; Merchant, Juanita L.; Lai, Paul B. S.; Ho, Rocky L. K.; Hu, Xu; Okada, Morihiro; Huang, Sheng F.; Chui, Albert K. K.; Law, David J.; Li, Yong G.; Lau, Wan Y.; Li, Arthur K. C.

    2003-01-01

    p53 has recently been identified as a downstream target of ZBP-89, a zinc finger transcription factor. ZBP-89 promotes growth arrest through stabilization of the p53 protein. The aim of this study is to determine the status of the p53 gene in recurrent human hepatocellular carcinoma (HCC) and test the link between the expression of ZBP-89 and the p53 gene. The results showed that mutations in the p53 gene were frequently detected in recurrent HCC. The interval between surgical resection and the recurrence of HCC was significantly longer in patients with the wild-type p53 gene than those with mutations, strongly suggesting a pathological role for the mutant p53 gene in HCC recurrence. Among those positive for the p53 protein, nearly 85% (18 of 21) showed nuclear localization of the p53 protein while only about 14% (3 of 21) were positive for the p53 protein in the cytoplasm. ZBP-89 co-localized with p53 in the nucleus in about 67% (12 of 18) of all cases positive for the nuclear p53 protein, suggesting that ZBP-89 may play a role in the nuclear accumulation of the p53 protein in a subset of recurrent HCC. With accumulation of p53 protein in the nucleus, tumor cells undergo apoptosis and thus are more susceptible to radiotherapy and chemotherapy. Therefore, co-localization of p53 protein with ZBP-89 may define a subgroup of recurrent HCC that is more sensitive to treatment. PMID:12759240

  16. Up-regulation of inducible nitric oxide synthase expression in cancer-prone p53 knockout mice.

    PubMed

    Ambs, S; Ogunfusika, M O; Merriam, W G; Bennett, W P; Billiar, T R; Harris, C C

    1998-07-21

    High concentrations of nitric oxide (NO) cause DNA damage and apoptosis in many cell types. Thus, regulation of NO synthase (NOS) activity is essential for minimizing effects of cytotoxic and genotoxic nitrogen oxide species. We have shown previously that NO-induced p53 protein accumulation down-regulates basal and cytokine-modulated inducible NOS (NOS2) expression in human cells in vitro. To further characterize the feedback loop between NOS2 and p53, we have investigated NO production, i.e., urinary nitrate plus nitrite excretion, and NOS2 expression in homozygous p53 knockout (KO) mice. We report here that untreated p53 KO mice excreted 70% more nitrite plus nitrate than mice with wild-type (wt) p53. NOS2 protein expression was constitutively detected in the spleen of untreated p53 KO mice, whereas it was undetectable in the spleen of wt p53 controls. Upon treatment with heat-inactivated Corynebacterium parvum, urinary nitrite plus nitrate excretion of p53 KO mice exceeded that of wt controls by approximately 200%. C. parvum treatment also induced p53 accumulation in the liver. Splenectomy reduced the NO output of C. parvum-treated p53 KO mice but not of wt p53 controls. Although NO production and NOS2 protein expression were increased similarly in KO and wt p53 mice 10 days after injection of C. parvum, NOS2 expression returned to baseline levels only in wt p53 controls while remaining up-regulated in p53 KO mice. These genetic and functional data indicate that p53 is an important transrepressor of NOS2 expression in vivo and attenuates excessive NO production in a regulatory negative feedback loop. PMID:9671763

  17. Critical roles of DMP1 in HER2/neu-Arf-p53 signaling and breast cancer development

    PubMed Central

    Taneja, Pankaj; Maglic, Dejan; Kai, Fumitake; Sugiyama, Takayuki; Kendig, Robert D.; Frazier, Donna P.; Willingham, Mark C.; Inoue, Kazushi

    2010-01-01

    HER2 overexpression stimulates cell growth in p53-mutated cells while it inhibits cell proliferation in those with wild-type p53, but the molecular mechanism is unknown. The Dmp1 promoter was activated by HER2/neu through the PI3K-Akt-NF-κB pathway, which in turn stimulated Arf transcription. Binding of p65 and p52 subunits of NF-κB was demonstrated to the Dmp1 promoter and that of Dmp1 to the Arf promoter upon HER2/neu overexpression. Both Dmp1 and p53 were induced in pre-malignant lesions from MMTV-neu mice and mammary tumorigenesis was significantly accelerated in both Dmp1+/− and Dmp1−/− mice. Selective deletion of Dmp1 and/or overexpression of Tbx2/Pokemon was found in >50 % of wild-type HER2/neu carcinomas while the involvement of Arf, Mdm2, or p53 was rare. Tumors from Dmp1+/−, Dmp1−/−, and wild-type neu mice with hemizygous Dmp1 deletion showed significant downregulation of Arf and p21Cip1/WAF1, showing p53 inactivity and more aggressive phenotypes than tumors without Dmp1 deletion. Notably, endogenous hDMP1 mRNA decreased when HER2 was depleted in human breast cancer cells. Our study demonstrates the pivotal roles of Dmp1 in HER2/neu-p53 signaling and breast carcinogenesis. PMID:21062982

  18. Mutant p53 regulates ovarian cancer transformed phenotypes through autocrine matrix deposition

    PubMed Central

    Iwanicki, Marcin P.; Chen, Hsing-Yu; Iavarone, Claudia; Zervantonakis, Ioannis K.; Muranen, Taru; Novak, Marián; Ince, Tan A.; Brugge, Joan S.

    2016-01-01

    High-grade serous ovarian carcinoma (HGS-OvCa) harbors p53 mutations and can originate from the epithelial cell compartment of the fallopian tube fimbriae. From this site, neoplastic cells detach, survive in the peritoneal cavity, and form cellular clusters that intercalate into the mesothelium to form ovarian and peritoneal masses. To examine the contribution of mutant p53 to phenotypic alterations associated with HGS-OvCA, we developed live-cell microscopy assays that recapitulate these early events in cultured fallopian tube nonciliated epithelial (FNE) cells. Expression of stabilizing mutant variants of p53, but not depletion of endogenous wild-type p53, in FNE cells promoted survival and cell-cell aggregation under conditions of cell detachment, leading to the formation of cell clusters with mesothelium-intercalation capacity. Mutant p53R175H-induced phenotypes were dependent on fibronectin production, α5β1 fibronectin receptor engagement, and TWIST1 expression. These results indicate that FNE cells expressing stabilizing p53 mutants acquire anchorage independence and subsequent mesothelial intercalation capacity through a mechanism involving mesenchymal transition and matrix production. These findings provide important new insights into activities of mutant p53 in the cells of origin of HGS-OvCa. PMID:27482544

  19. p53 regulates the proliferation, differentiation and spontaneous transformation of mesenchymal stem cells

    SciTech Connect

    Armesilla-Diaz, Alejandro; Elvira, Gema; Silva, Augusto

    2009-12-10

    Mesenchymal stem cells (MSC) have been extensively studied and gained wide popularity due to their therapeutic potential. Spontaneous transformation of MSC, from both human and murine origin, has been reported in many studies. MSC transformation depends on the culture conditions, the origin of the cells and the time on culture; however, the precise biological characteristics involved in this process have not been fully defined yet. In this study, we investigated the role of p53 in the biology and transformation of murine bone marrow (BM)-derived MSC. We demonstrate that the MSC derived from p53KO mice showed an augmented proliferation rate, a shorter doubling time and also morphologic and phenotypic changes, as compared to MSC derived from wild-type animals. Furthermore, the MSC devoid of p53 had an increased number of cells able to generate colonies. In addition, not only proliferation but also MSC differentiation is controlled by p53 since its absence modifies the speed of the process. Moreover, genomic instability, changes in the expression of c-myc and anchorage independent growth were also observed in p53KO MSC. In addition, the absence of p53 implicates the spontaneous transformation of MSC in long-term cultures. Our results reveal that p53 plays a central role in the biology of MSC.

  20. High frequency of p53/MDM2/p14ARF pathway abnormalities in relapsed neuroblastoma

    PubMed Central

    Carr-Wilkinson, Jane; O' Toole, Kieran; Wood, Katrina M.; Challen, Christine C.; Baker, Angela G.; Board, Julian R.; Evans, Laura; Cole, Michael; Cheung, Nai-Kong V.; Boos, Joachim; Köhler, Gabriele; Leuschner, Ivo; Pearson, Andrew D.J.; Lunec, John; Tweddle, Deborah A.

    2010-01-01

    Purpose: Most neuroblastomas initially respond to therapy but many relapse with chemoresistant disease. p53 mutations are rare in diagnostic neuroblastomas, but we have previously reported inactivation of the p53/MDM2/p14ARF pathway in 9/17 (53%) neuroblastoma cell lines established at relapse. Hypothesis: Inactivation of the p53/MDM2/p14ARF pathway develops during treatment and contributes to neuroblastoma relapse. Methods: Eighty-four neuroblastomas were studied from 41 patients with relapsed neuroblastoma including 38 paired neuroblastomas at different stages of therapy. p53 mutations were detected by automated sequencing, p14ARF methylation and deletion by methylation-specific PCR and duplex PCR respectively, and MDM2 amplification by fluorescent in-situ hybridisation. Results: Abnormalities in the p53 pathway were identified in 20/41(49%) cases. Downstream defects due to inactivating missense p53 mutations were identified in 6/41 (15%) cases, 5 following chemotherapy and/or at relapse and 1 at diagnosis, post chemotherapy and relapse. The presence of a p53 mutation was independently prognostic for overall survival (hazard ratio 3.4, 95% confidence interval 1.2, 9.9; p = 0.02). Upstream defects were present in 35% cases: MDM2 amplification in 3 cases, all at diagnosis & relapse and p14ARF inactivation in 12/41 (29%) cases: 3 had p14ARF methylation, 2 after chemotherapy, and 9 had homozygous deletions, 8 at diagnosis and relapse. Conclusions: These results show that a high proportion of neuroblastomas which relapse have an abnormality in the p53 pathway. The majority have upstream defects suggesting that agents which reactivate wild-type p53 would be beneficial, in contrast to those with downstream defects where p53 independent therapies are indicated. PMID:20145180

  1. Ribosomal Protein Mutations Result in Constitutive p53 Protein Degradation through Impairment of the AKT Pathway

    PubMed Central

    Hermkens, Dorien; Wlodarski, Marcin W.; Da Costa, Lydie; MacInnes, Alyson W.

    2015-01-01

    Mutations in ribosomal protein (RP) genes can result in the loss of erythrocyte progenitor cells and cause severe anemia. This is seen in patients with Diamond-Blackfan anemia (DBA), a pure red cell aplasia and bone marrow failure syndrome that is almost exclusively linked to RP gene haploinsufficiency. While the mechanisms underlying the cytopenia phenotype of patients with these mutations are not completely understood, it is believed that stabilization of the p53 tumor suppressor protein may induce apoptosis in the progenitor cells. In stark contrast, tumor cells from zebrafish with RP gene haploinsufficiency are unable to stabilize p53 even when exposed to acute DNA damage despite transcribing wild type p53 normally. In this work we demonstrate that p53 has a limited role in eliciting the anemia phenotype of zebrafish models of DBA. In fact, we find that RP-deficient embryos exhibit the same normal p53 transcription, absence of p53 protein, and impaired p53 response to DNA damage as RP haploinsufficient tumor cells. Recently we reported that RP mutations suppress activity of the AKT pathway, and we show here that this suppression results in proteasomal degradation of p53. By re-activating the AKT pathway or by inhibiting GSK-3, a downstream modifier that normally represses AKT signaling, we are able to restore the stabilization of p53. Our work indicates that the anemia phenotype of zebrafish models of DBA is dependent on factors other than p53, and may hold clinical significance for both DBA and the increasing number of cancers revealing spontaneous mutations in RP genes. PMID:26132763

  2. PNAS-4 expression and its relationship to p53 in colorectal cancer.

    PubMed

    Zhou, Bin; Yan, Hui; Li, Yuan; Wang, Rong; Chen, Keling; Zhou, Zongguang; Sun, Xiaofeng

    2012-01-01

    PNAS-4 is a novel pro-apoptotic protein activated during the early response to DNA damage; however, the molecular mechanisms and pathways regulating PNAS-4 expression in tumors are not well understood. We hypothesized that PNAS-4 is a p53 down-stream target gene and designed this study. We searched online for putative p53-binding sites in the entire PNAS-4 gene and did not find any corresponding information. In HCT116 colon cancer cells, after being transfected with small interfering RNA to silence p53, the expressions of PNAS-4 and other known p53 target gene (Apaf1, Bax, Fas and Dr5) were determined by real-time PCR. We found that PNAS-4 was up-regulated while Apaf1, Bax, Fas and Dr5 were down-regulated. We then examined the expression of PNAS-4 and p53 mutation in colorectal cancer patients. PNAS-4 expressed both in colorectal cancers and normal tissues, but compared with paired control, PNAS-4 was up-regulated in cancers (P=0.018). PNAS-4 overexpression ratios were correlated to the p53 mutant status (P=0.001). The mean PNAS-4 expression levels of p53 mutant homozygote group and heterozygote group were higher than that of p53 wild type group (P=0.013). The expression ratios of PNAS-4 (every sample in relative to its paired normal mucosa) were different between negative lymph node metastasis (66% up-regulated, 34% down-regulated) and positive metastasis (42% up-regulated, 58% down-regulated). Taken together, these findings suggested that PNAS-4 was not a p53 target, but overexpression of PNAS-4 was correlated to p53 inactivity in colorectal cancer.

  3. P53 mutations in Ewing's sarcoma.

    PubMed

    Park, Y K; Chi, S G; Kim, Y W; Park, H R; Unni, K K

    2001-01-01

    The p53 tumor suppressor gene is one of the most frequently altered genes in human malignancies. To explore the implication of p53 alteration in Ewing's sarcoma, we analyzed the deletion and sequence alterations of p53 and abnormal amplification of MDM2, which acts as a functional inhibitor of p53, in 35 tissue specimens. Quantitative genomic PCR analysis showed that 2 of 35 tumors have extremely low levels of the p53 gene, indicating a homozygous deletion of the gene. Mutational analysis of exons 4 to 9 of p53 by PCR-SSCP revealed that 3 of 35 tumors carry sequence alterations in exons 5 or 8, and DNA sequencing analysis identified missense point mutations at codon 132 (AAG-->ATG, lysine-->methionine) and codon 135 (TGC-->TCC, cystein-->serine) in exon 5, and codon 287 (GAG-->GTG, glutamic acid-->valine) in exon 8 from these tumors. No abnormal amplification of the MDM2 gene was recognized. Taken together, our data demonstrate that p53 is genetically altered in a small fraction of Ewing's sarcoma.

  4. Accumulation of tissue factor in endothelial cells induces cell apoptosis, mediated through p38 and p53 activation.

    PubMed

    ElKeeb, A M; Collier, M E W; Maraveyas, A; Ettelaie, C

    2015-08-01

    We previously reported that high levels of tissue factor (TF) can induce cellular apoptosis in endothelial cells. In this study, TF-mediated mechanisms of induction of apoptosis were explored. Endothelial cells were transfected to express wild-type TF. Additionally, cells were transfected to express Asp253-substituted, or Ala253-substitued TF to enhance or prevent TF release, respectively. Alternatively, cells were pre-incubated with TF-rich and TF-poor microvesicles. Cell proliferation, apoptosis and the expression of cyclin D1, p53, bax and p21 were measured following activation of cells with PAR2-agonist peptide. Greatest levels of cell proliferation and cyclin D1 expression were observed in cells expressing wild-type or Asp253-substituted TF. In contrast, increased cellular apoptosis was observed in cells expressing Ala253-substituted TF, or cells pre-incubated with TF-rich microvesicles. The level of p53 protein, p53-phosphorylation at ser33, p53 nuclear localisation and transcriptional activity, but not p53 mRNA, were increased in cells expressing wild-type and Ala253-substituted TF, or in cells pre-incubated with TF-rich microvesicles. However, the expression of bax and p21 mRNA, and Bax protein were only increased in cells pre-incubated with TF-rich microvesicle and in cells expressing Ala253-substituted TF. Inhibition of the transcriptional activity of p53 using pifithrin-α suppressed the expression of Bax. Finally, siRNA-mediated suppression of p38α, or inhibition using SB202190 significantly reduced the p53 protein levels, p53 nuclear localisation and transcriptional activity, suppressed Bax expression and prevented cellular apoptosis. In conclusion, accumulation of TF within endothelial cells, or sequestered from the surrounding can induce cellular apoptosis through mechanisms mediated by p38, and involves the stabilisation of p53. PMID:25903973

  5. New insight on the biological role of p53 protein as a tumor suppressor: re-evaluation of its clinical significance in triple-negative breast cancer.

    PubMed

    Jin, Min-Sun; Park, In Ae; Kim, Ji Young; Chung, Yul Ri; Im, Seock-Ah; Lee, Kyung-Hun; Moon, Hyeong-Gon; Han, Wonshik; Noh, Dong-Young; Ryu, Han Suk

    2016-08-01

    While p53 mutation is found in the majority of triple-negative breast cancer (TNBC) and despite recent developments in p53-targeting agents, their therapeutic application is still limited by the absence of standard biomarkers and ambiguousness of its essential biological role in cancer. Whole sections from 305 TNBC cases were stained for p53 to determine the correlation with lymph node metastasis and clinical outcomes in the whole cohort as well as in stratified patient groups according to AJCC stage and the use of adjuvant chemotherapy. Reduced immunohistochemical expression of p53 was an independent risk factor for lymph node metastasis. p53 overexpression was predictive of better clinical outcome in all patients (P = 0.012, disease-free survival and P = 0.008, overall survival) and the stratified cohorts of those who had early breast cancer and received adjuvant chemotherapy. Suppression of endogenous mutant p53 by siRNA and induction of wild-type p53 repressed TNBC cell invasion in vitro. In TNBC, increased immunohistochemical expression of p53 may reflect the accumulation of wild-type p53 rather than the mutant form. Strong p53 protein expression may serve as a favorable prognostic indicator and provide evidence for the use of specific agents targeting p53.

  6. Loss of Atrx sensitizes cells to DNA damaging agents through p53-mediated death pathways.

    PubMed

    Conte, Damiano; Huh, Michael; Goodall, Emma; Delorme, Marilyne; Parks, Robin J; Picketts, David J

    2012-01-01

    Prevalent cell death in forebrain- and Sertoli cell-specific Atrx knockout mice suggest that Atrx is important for cell survival. However, conditional ablation in other tissues is not associated with increased death indicating that diverse cell types respond differently to the loss of this chromatin remodeling protein. Here, primary macrophages isolated from Atrx(f/f) mice were infected with adenovirus expressing Cre recombinase or β-galactosidase, and assayed for cell survival under different experimental conditions. Macrophages survive without Atrx but undergo rapid apoptosis upon lipopolysaccharide (LPS) activation suggesting that chromatin reorganization in response to external stimuli is compromised. Using this system we next tested the effect of different apoptotic stimuli on cell survival. We observed that survival of Atrx-null cells were similar to wild type cells in response to serum withdrawal, anti-Fas antibody, C2 ceramide or dexamethasone treatment but were more sensitive to 5-fluorouracil (5-FU). Cell survival could be rescued by re-introducing Atrx or by removal of p53 demonstrating the cell autonomous nature of the effect and its p53-dependence. Finally, we demonstrate that multiple primary cell types (myoblasts, embryonic fibroblasts and neurospheres) were sensitive to 5-FU, cisplatin, and UV light treatment. Together, our results suggest that cells lacking Atrx are more sensitive to DNA damaging agents and that this may result in enhanced death during development when cells are at their proliferative peak. Moreover, it identifies potential treatment options for cancers associated with ATRX mutations, including glioblastoma and pancreatic neuroendocrine tumors. PMID:23284920

  7. Simian virus 40 T antigen can regulate p53-mediated transcription independent of binding p53.

    PubMed Central

    Rushton, J J; Jiang, D; Srinivasan, A; Pipas, J M; Robbins, P D

    1997-01-01

    A simian virus 40 (SV40) T-antigen mutant containing only the N-terminal 136 amino acids, able to bind to Rb and p300 but not p53, partially inhibited p53-mediated transcription without affecting the ability of p53 to bind DNA. These results suggest that SV40 T antigen can regulate p53-mediated transcription either directly through protein-protein association or indirectly through interaction with factors which may function to confer p53-mediated transcription. PMID:9188637

  8. Nontoxic virus nanofibers improve the detection sensitivity for the anti-p53 antibody, a biomarker in cancer patients

    PubMed Central

    Pan, Pengtao; Wang, Yicun; Zhu, Ye; Gao, Xiang; Ju, Zhigang; Qiu, Penghe; Wang, Li; Mao, Chuanbin

    2016-01-01

    The presence of anti-p53 antibody in serum is a biomarker for cancer. However, its high sensitivity detection is still an issue in cancer diagnosis. To tackle this challenge, we used fd phage, a human-safe bacteria-specific virus nanofiber that can be mass-produced by infecting host bacteria in an error-free manner, and genetically engineered it to display a peptide capable of recognizing and capturing anti-p53 antibody on its side wall. We employed the resultant phage nanofibers as a capture probe to develop a modified version of the enzyme-linked immunosorbent assay (ELISA) method, termed phage-ELISA. We compared it to the traditional ELISA method for the detection of anti-p53 antibody, p53-ELISA, which uses recombinant wild-type p53 protein to capture anti-p53 antibody. We applied phage-ELISA to detect anti-p53 antibody in an experimental group of 316 patients with various types of malignant tumors. We found that a detection rate of 17.7% (56 positive cases) was achieved by phage-ELISA, which was comparable to the detection rate of 20.6% for p53-ELISA (65 positive cases). However, when both phage and p53 were combined to form antibody-capturing probes for phage/p53-ELISA, a detection rate of 30.4% (96 positive cases) was achieved. Our work showed that owing to the combined capture of the anti-p53 antibody by both phage nanofibers and p53, the phage/p53-ELISA achieved the highest diagnostic accuracy and detection efficiency for the anti-p53 antibody in patients with various types of cancers. Our work suggests that a combination of nanofibers and antigens, both of which capture antibody, could lead to increased detection sensitivity, which is useful for applications in the life sciences, clinical medicine, and environmental sciences.

  9. CP-31398 inhibits the growth of p53-mutated liver cancer cells in vitro and in vivo.

    PubMed

    He, Xing-Xing; Zhang, Yu-Nan; Yan, Jun-Wei; Yan, Jing-Jun; Wu, Qian; Song, Yu-Hu

    2016-01-01

    The tumor suppressor p53 is one of the most frequently mutated genes in hepatocellular carcinoma (HCC). Previous studies demonstrated that CP-31398 restored the native conformation of mutant p53 and trans-activated p53 downstream genes in tumor cells. However, the research on the application of CP-31398 to liver cancer has not been reported. Here, we investigated the effects of CP-31398 on the phenotype of HCC cells carrying p53 mutation. The effects of CP-31398 on the characteristic of p53-mutated HCC cells were evaluated through analyzing cell cycle, cell apoptosis, cell proliferation, and the expression of p53 downstream genes. In tumor xenografts developed by PLC/PRF/5 cells, the inhibition of tumor growth by CP-31398 was analyzed through gross morphology, growth curve, and the expression of p53-related genes. Firstly, we demonstrated that CP-31398 inhibited the growth of p53-mutated liver cancer cells in a dose-dependent and p53-dependent manner. Then, further study showed that CP-31398 re-activated wild-type p53 function in p53-mutated HCC cells, which resulted in inhibitive response of cell proliferation and an induction of cell-cycle arrest and apoptosis. Finally, in vivo data confirmed that CP-31398 blocked the growth of xenografts tumors through transactivation of p53-responsive downstream molecules. Our results demonstrated that CP-31398 induced desired phenotypic change of p53-mutated HCC cells in vitro and in vivo, which revealed that CP-31398 would be developed as a therapeutic candidate for HCC carrying p53 mutation.

  10. p53-mediated control of gene expression via mRNA translation during Endoplasmic Reticulum stress.

    PubMed

    López, Ignacio; Tournillon, Anne-Sophie; Nylander, Karin; Fåhraeus, Robin

    2015-01-01

    p53 is activated by different stress and damage pathways and regulates cell biological responses including cell cycle arrest, repair pathways, apoptosis and senescence. Following DNA damage, the levels of p53 increase and via binding to target gene promoters, p53 induces expression of multiple genes including p21(CDKN1A) and mdm2. The effects of p53 on gene expression during the DNA damage response are well mimicked by overexpressing p53 under normal conditions. However, stress to the Endoplasmic Reticulum (ER) and the consequent Unfolded Protein Response (UPR) leads to the induction of the p53/47 isoform that lacks the first 40 aa of p53 and to an active suppression of p21(CDKN1A) transcription and mRNA translation. We now show that during ER stress p53 also suppresses MDM2 protein levels via a similar mechanism. These observations not only raise questions about the physiological role of MDM2 during ER stress but it also reveals a new facet of p53 as a repressor toward 2 of its major target genes during the UPR. As suppression of p21(CDKN1A) and MDM2 protein synthesis is mediated via their coding sequences, it raises the possibility that p53 controls mRNA translation via a common mechanism that might play an important role in how p53 regulates gene expression during the UPR, as compared to the transcription-dependent gene regulation taking place during the DNA damage response.

  11. A distinct p53 target gene set predicts for response to the selective p53-HDM2 inhibitor NVP-CGM097.

    PubMed

    Jeay, Sébastien; Gaulis, Swann; Ferretti, Stéphane; Bitter, Hans; Ito, Moriko; Valat, Thérèse; Murakami, Masato; Ruetz, Stephan; Guthy, Daniel A; Rynn, Caroline; Jensen, Michael R; Wiesmann, Marion; Kallen, Joerg; Furet, Pascal; Gessier, François; Holzer, Philipp; Masuya, Keiichi; Würthner, Jens; Halilovic, Ensar; Hofmann, Francesco; Sellers, William R; Graus Porta, Diana

    2015-01-01

    Biomarkers for patient selection are essential for the successful and rapid development of emerging targeted anti-cancer therapeutics. In this study, we report the discovery of a novel patient selection strategy for the p53-HDM2 inhibitor NVP-CGM097, currently under evaluation in clinical trials. By intersecting high-throughput cell line sensitivity data with genomic data, we have identified a gene expression signature consisting of 13 up-regulated genes that predicts for sensitivity to NVP-CGM097 in both cell lines and in patient-derived tumor xenograft models. Interestingly, these 13 genes are known p53 downstream target genes, suggesting that the identified gene signature reflects the presence of at least a partially activated p53 pathway in NVP-CGM097-sensitive tumors. Together, our findings provide evidence for the use of this newly identified predictive gene signature to refine the selection of patients with wild-type p53 tumors and increase the likelihood of response to treatment with p53-HDM2 inhibitors, such as NVP-CGM097.

  12. A distinct p53 target gene set predicts for response to the selective p53–HDM2 inhibitor NVP-CGM097

    PubMed Central

    Jeay, Sébastien; Gaulis, Swann; Ferretti, Stéphane; Bitter, Hans; Ito, Moriko; Valat, Thérèse; Murakami, Masato; Ruetz, Stephan; Guthy, Daniel A; Rynn, Caroline; Jensen, Michael R; Wiesmann, Marion; Kallen, Joerg; Furet, Pascal; Gessier, François; Holzer, Philipp; Masuya, Keiichi; Würthner, Jens; Halilovic, Ensar; Hofmann, Francesco; Sellers, William R; Graus Porta, Diana

    2015-01-01

    Biomarkers for patient selection are essential for the successful and rapid development of emerging targeted anti-cancer therapeutics. In this study, we report the discovery of a novel patient selection strategy for the p53–HDM2 inhibitor NVP-CGM097, currently under evaluation in clinical trials. By intersecting high-throughput cell line sensitivity data with genomic data, we have identified a gene expression signature consisting of 13 up-regulated genes that predicts for sensitivity to NVP-CGM097 in both cell lines and in patient-derived tumor xenograft models. Interestingly, these 13 genes are known p53 downstream target genes, suggesting that the identified gene signature reflects the presence of at least a partially activated p53 pathway in NVP-CGM097-sensitive tumors. Together, our findings provide evidence for the use of this newly identified predictive gene signature to refine the selection of patients with wild-type p53 tumors and increase the likelihood of response to treatment with p53–HDM2 inhibitors, such as NVP-CGM097. DOI: http://dx.doi.org/10.7554/eLife.06498.001 PMID:25965177

  13. Expression of p53 in endometrial polyps with special reference to the p53 signature.

    PubMed

    Sho, Tomoko; Hachisuga, Toru; Kawagoe, Toshinori; Urabe, Rie; Kurita, Tomoko; Kagami, Seiji; Shimajiri, Shohei; Fujino, Yoshihisa

    2016-07-01

    We herein examined the significance of the p53 expression in endometrial polyps (EMPs). A total of 133 EMPs, including 62 premenopausal and 71 postmenopausal women with EMP, were immunohistochemically studied for the expression of estrogen receptor (ER)-alpha, Ki-67 and p53. Apoptotic cells were identified using a TUNEL assay. A DNA sequence analysis of TP53 exons 5 to 9 was performed. Among the premenopausal EMPs, a multivariate analysis showed the labeling index (LI) for Ki-67 to correlate significantly with that for p53 (P<0.001), but not that for apoptosis. On the contrary, among the postmenopausal EMPs, the LI for Ki-67 correlated significantly with that for apoptosis (P<0.001). The p53 signature (p53S) was defined by endometrial epithelial cells, which are morphologically benign in appearance but display 12 or more consecutive epithelial cell nuclei with strong p53 immunostaining. The p53S was found in nine (12.7%) postmenopausal EMPs (mean age: 70.2 years). The median Ki-67 index for the p53S was 7%, with no significant difference from that of the glands of the postmenopausal EMPs without the p53S (P=0.058). The median apoptotic index for the p53S was 0%, which was significantly lower than that of the postmenopausal EMPs without the p53S (P=0.002). Two of four p53Ss showed TP53 mutations according to the DNA sequence analysis. The presence of the p53S is not rare in postmenopausal EMPs with an advanced age. Among postmenopausal EMPs, the LI of Ki-67 significantly correlates with that of apoptosis. However, such a positive correlation between the LI of Ki-67 and apoptosis is not observed in p53S. PMID:26727623

  14. The Expression Levels of XLF and Mutant P53 Are Inversely Correlated in Head and Neck Cancer Cells.

    PubMed

    Feng, Sizhe; Rabii, Ramin; Liang, Guobiao; Song, Chenxi; Chen, Wei; Guo, Mian; Wei, Xuezhong; Messadi, Diana; Hu, Shen

    2016-01-01

    XRCC4-like factor (XLF), also known as Cernunnos, is a protein encoded by the human NHEJ1 gene and an important repair factor for DNA double-strand breaks. In this study, we have found that XLF is over-expressed in HPV(+) versus HPV(-) head and neck squamous cell carcinoma (HNSCC) and significantly down-regulated in the HNSCC cell lines expressing high level of mutant p53 protein versus those cell lines harboring wild-type TP53 gene with low p53 protein expression. We have also demonstrated that Werner syndrome protein (WRN), a member of the NHEJ repair pathway, binds to both mutant p53 protein and NHEJ1 gene promoter, and siRNA knockdown of WRN leads to the inhibition of XLF expression in the HNSCC cells. Collectively, these findings suggest that WRN and p53 are involved in the regulation of XLF expression and the activity of WRN might be affected by mutant p53 protein in the HNSCC cells with aberrant TP53 gene mutations, due to the interaction of mutant p53 with WRN. As a result, the expression of XLF in these cancer cells is significantly suppressed. Our study also suggests that XLF is over-expressed in HPV(+) HNSCC with low expression of wild type p53, and might serve as a potential biomarker for HPV(+) HNSCC. Further studies are warranted to investigate the mechanisms underlying the interactive role of WRN and XLF in NHEJ repair pathway. PMID:27471552

  15. The Expression Levels of XLF and Mutant P53 Are Inversely Correlated in Head and Neck Cancer Cells

    PubMed Central

    Feng, Sizhe; Rabii, Ramin; Liang, Guobiao; Song, Chenxi; Chen, Wei; Guo, Mian; Wei, Xuezhong; Messadi, Diana; Hu, Shen

    2016-01-01

    XRCC4-like factor (XLF), also known as Cernunnos, is a protein encoded by the human NHEJ1 gene and an important repair factor for DNA double-strand breaks. In this study, we have found that XLF is over-expressed in HPV(+) versus HPV(-) head and neck squamous cell carcinoma (HNSCC) and significantly down-regulated in the HNSCC cell lines expressing high level of mutant p53 protein versus those cell lines harboring wild-type TP53 gene with low p53 protein expression. We have also demonstrated that Werner syndrome protein (WRN), a member of the NHEJ repair pathway, binds to both mutant p53 protein and NHEJ1 gene promoter, and siRNA knockdown of WRN leads to the inhibition of XLF expression in the HNSCC cells. Collectively, these findings suggest that WRN and p53 are involved in the regulation of XLF expression and the activity of WRN might be affected by mutant p53 protein in the HNSCC cells with aberrant TP53 gene mutations, due to the interaction of mutant p53 with WRN. As a result, the expression of XLF in these cancer cells is significantly suppressed. Our study also suggests that XLF is over-expressed in HPV(+) HNSCC with low expression of wild type p53, and might serve as a potential biomarker for HPV(+) HNSCC. Further studies are warranted to investigate the mechanisms underlying the interactive role of WRN and XLF in NHEJ repair pathway. PMID:27471552

  16. Downregulation of GLS2 in glioblastoma cells is related to DNA hypermethylation but not to the p53 status.

    PubMed

    Szeliga, Monika; Bogacińska-Karaś, Małgorzata; Kuźmicz, Katarzyna; Rola, Radosław; Albrecht, Jan

    2016-09-01

    Human phosphate-activated glutaminase (GA) is encoded by two genes: GLS and GLS2. Glioblastomas (GB) usually lack GLS2 transcripts, and their reintroduction inhibits GB growth. The GLS2 gene in peripheral tumors may be i) methylation- controlled and ii) a target of tumor suppressor p53 often mutated in gliomas. Here we assessed the relation of GLS2 downregulation in GB to its methylation and TP53 status. DNA demethylation with 5-aza-2'-deoxycytidine restored GLS2 mRNA and protein content in human GB cell lines with both mutated (T98G) and wild-type (U87MG) p53 and reduced the methylation of CpG1 (promoter region island), and CpG2 (first intron island) in both cell lines. In cell lines and clinical GB samples alike, methylated CpG islands were detected both in the GLS2 promoter (as reported earlier) and in the first intron of this gene. CpG methylation of either island was absent in GLS2-expressing non-tumoros brain tissues. Screening for mutation in the exons 5-8 of TP53 revealed a point mutation in only one out of seven GB examined. In conclusion, aberrant methylation of CpG islands, appear to contribute to silencing of GLS2 in GB by a mechanism bypassing TP53 mutations. © 2015 Wiley Periodicals, Inc. PMID:26258493

  17. Structural proteins of Kaposi's sarcoma-associated herpesvirus antagonize p53-mediated apoptosis.

    PubMed

    Chudasama, P; Konrad, A; Jochmann, R; Lausen, B; Holz, P; Naschberger, E; Neipel, F; Britzen-Laurent, N; Stürzl, M

    2015-01-29

    The tumor suppressor p53 is a central regulatory molecule of apoptosis and is commonly mutated in tumors. Kaposi's sarcoma-associated herpesvirus (KSHV)-related malignancies express wild-type p53. Accordingly, KSHV encodes proteins that counteract the cell death-inducing effects of p53. Here, the effects of all KSHV genes on the p53 signaling pathway were systematically analyzed using the reversely transfected cell microarray technology. With this approach we detected eight KSHV-encoded genes with potent p53 inhibiting activity in addition to the previously described inhibitory effects of KSHV genes ORF50, K10 and K10.5. Interestingly, the three most potent newly identified inhibitors were KSHV structural proteins, namely ORF22 (glycoprotein H), ORF25 (major capsid protein) and ORF64 (tegument protein). Validation of these results with a classical transfection approach showed that these proteins inhibited p53 signaling in a dose-dependent manner and that this effect could be reversed by small interfering RNA-mediated knockdown of the respective viral gene. All three genes inhibited p53-mediated apoptosis in response to Nutlin-3 treatment in non-infected and KSHV-infected cells. Addressing putative mechanisms, we could show that these proteins could also inhibit the transactivation of the promoters of apoptotic mediators of p53 such as BAX and PIG3. Altogether, we demonstrate for the first time that structural proteins of KSHV can counteract p53-induced apoptosis. These proteins are expressed in the late lytic phase of the viral life cycle and are incorporated into the KSHV virion. Accordingly, these genes may inhibit cell death in the productive and in the early entrance phase of KSHV infection. PMID:24469037

  18. p53 Mutation suppresses adult neurogenesis in medaka fish (Oryzias latipes)

    SciTech Connect

    Isoe, Yasuko; Okuyama, Teruhiro; Taniguchi, Yoshihito; Kubo, Takeo; Takeuchi, Hideaki

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer Progenitor migration is accompanied by an increase in their numbers in the adult brain. Black-Right-Pointing-Pointer p53 Mutation suppressed an increase in the number of the migrated progenitors. Black-Right-Pointing-Pointer The decreased progenitor number is not due to enhanced cell death. Black-Right-Pointing-Pointer p53 Mutation did not affect proliferation of stem cells. -- Abstract: Tumor suppressor p53 negatively regulates self-renewal of neural stem cells in the adult murine brain. Here, we report that the p53 null mutation in medaka fish (Oryzias latipes) suppressed neurogenesis in the telencephalon, independent of cell death. By using 5-bromo-29-deoxyuridine (BrdU) immunohistochemistry, we identified 18 proliferation zones in the brains of young medaka fish; in situ hybridization showed that p53 was expressed selectively in at least 12 proliferation zones. We also compared the number of BrdU-positive cells present in the whole telencephalon of wild-type (WT) and p53 mutant fish. Immediately after BrdU exposure, the number of BrdU-positive cells did not differ significantly between them. One week after BrdU-exposure, the BrdU-positive cells migrated from the proliferation zone, which was accompanied by an increased number in the WT brain. In contrast, no significant increase was observed in the p53 mutant brain. Terminal deoxynucleotidyl transferase (dUTP) nick end-labeling revealed that there was no significant difference in the number of apoptotic cells in the telencephalon of p53 mutant and WT medaka, suggesting that the decreased number of BrdU-positive cells in the mutant may be due to the suppression of proliferation rather than the enhancement of neural cell death. These results suggest that p53 positively regulates neurogenesis via cell proliferation.

  19. Role of Peroxiredoxin I in Rectal Cancer and Related to p53 Status

    SciTech Connect

    Chen, Miao-Fen; Lee, Kuan-Der; Yeh, Chung-Hung; Chen, Wen-Cheng; Huang, Wen-Shih; Chin, Chih-Chien; Lin, Paul- Yang; Wang, Jeng-Yi

    2010-11-01

    Background: Neoadjuvant chemoradiotherapy is widely accepted for the treatment of localized rectal cancer. Although peroxiredoxin I (PrxI) and p53 have been implicated in carcinogenesis and cancer treatment, the role of PrxI and its interaction with p53 in the prognosis and treatment response of rectal cancer remain relatively unstudied. Methods and Materials: In the present study, we examined the levels of PrxI and p53 in rectal cancer patients using membrane arrays and compared them with normal population samples. To demonstrate the biologic changes after manipulation of PrxI expression, we established stable transfectants of HCT-116 (wild-type p53) and HT-29 (mutant p53) cells with a PrxI silencing vector. The predictive capacities of PrxI and p53 were also assessed by relating the immunohistochemical staining of a retrospective series of rectal cancer cases to the clinical outcome. Results: The membrane array and immunochemical staining data showed that PrxI, but not p53, was significantly associated with the tumor burden. Our immunochemistry findings further indicated that PrxI positivity was linked to a poor response to neoadjuvant therapy and worse survival. In cellular and animal experiments, the inhibition of PrxI significantly decreased tumor growth and sensitized the tumor to irradiation, as indicated by a lower capacity to scavenge reactive oxygen species and more extensive DNA damage. The p53 status might have contributed to the difference between HCT-116 and HT-29 after knockdown of PrxI. Conclusion: According to our data, the level of PrxI combined with the p53 status is relevant to the prognosis and the treatment response. We suggested that PrxI might be a new biomarker for rectal cancer.

  20. USP7 inhibitor P22077 inhibits neuroblastoma growth via inducing p53-mediated apoptosis.

    PubMed

    Fan, Y-H; Cheng, J; Vasudevan, S A; Dou, J; Zhang, H; Patel, R H; Ma, I T; Rojas, Y; Zhao, Y; Yu, Y; Zhang, H; Shohet, J M; Nuchtern, J G; Kim, E S; Yang, J

    2013-10-17

    Neuroblastoma (NB) is a common pediatric cancer and contributes to more than 15% of all pediatric cancer-related deaths. Unlike adult tumors, recurrent somatic mutations in NB, such as tumor protein 53 (p53) mutations, occur with relative paucity. In addition, p53 downstream function is intact in NB cells with wild-type p53, suggesting that reactivation of p53 may be a viable therapeutic strategy for NB treatment. Herein, we report that the ubiquitin-specific protease 7 (USP7) inhibitor, P22077, potently induces apoptosis in NB cells with an intact USP7-HDM2-p53 axis but not in NB cells with mutant p53 or without human homolog of MDM2 (HDM2) expression. In this study, we found that P22077 stabilized p53 by inducing HDM2 protein degradation in NB cells. P22077 also significantly augmented the cytotoxic effects of doxorubicin (Dox) and etoposide (VP-16) in NB cells with an intact USP7-HDM2-p53 axis. Moreover, P22077 was found to be able to sensitize chemoresistant LA-N-6 NB cells to chemotherapy. In an in vivo orthotopic NB mouse model, P22077 significantly inhibited the xenograft growth of three NB cell lines. Database analysis of NB patients shows that high expression of USP7 significantly predicts poor outcomes. Together, our data strongly suggest that targeting USP7 is a novel concept in the treatment of NB. USP7-specific inhibitors like P22077 may serve not only as a stand-alone therapy but also as an effective adjunct to current chemotherapeutic regimens for treating NB with an intact USP7-HDM2-p53 axis.

  1. Rational Tuning of the Electrocatalytic Nanobiointerface for a "Turn-Off" Biofuel-Cell-Based Self-Powered Biosensor for p53 Protein.

    PubMed

    Han, Yajing; Chabu, Johnny Muya; Hu, Shengqiang; Deng, Liu; Liu, You-Nian; Guo, Shaojun

    2015-09-01

    Herein, a novel tunable electrocatalytic nanobiointerface for the construction of a high-sensitivity and high-selectivity biofuel-cell (BFC)-based self-powered biosensor for the detection of transcription factor protein p53 is reported, in which bilirubin oxidase (BOD)/DNA supramolecular modified graphene/platinum nanoparticles hybrid nanosheet (GPNHN) works as a new enhanced material of biocathode to control the attachment of target, and thus tune the electron-transfer process of oxygen reduction for transducing signaling magnification. It is found that in the presence of p53, the strong interaction between the wild-type p53 and its consensus DNA sequence on the electrode surface can block the electron transfer from the BOD to the electrode, thus providing a good opportunity for reducing the electrocatalytic activity of oxygen reduction in the biocathode. This in combination with the glucose oxidation at the carbon nanotube/Meldola's blue/glucose dehydrogenase bioanode can result in a current/or power decrease of BFC in the presence of wild-type p53. The specially designed BFC-based self-powered p53 sensor shows a wide linear range from 1 pM to 1 μM with a detection limit of 1 pM for analyzing wild-type p53. Most importantly, our BFC-based self-powered sensors can detect the concentrations of wild-type p53 in normal and cancer cell lysates without any extensive sample pretreatment/separation or specialized instruments. The present BFC-based self-powered sensor can provide a simple, economical, sensitive, and rapid way for analyzing p53 protein in normal and cancer cells at clinical level, which shows great potential for creating the treatment modalities that capitalize on the concentration variation of the wild-type p53. PMID:26211519

  2. Rational Tuning of the Electrocatalytic Nanobiointerface for a "Turn-Off" Biofuel-Cell-Based Self-Powered Biosensor for p53 Protein.

    PubMed

    Han, Yajing; Chabu, Johnny Muya; Hu, Shengqiang; Deng, Liu; Liu, You-Nian; Guo, Shaojun

    2015-09-01

    Herein, a novel tunable electrocatalytic nanobiointerface for the construction of a high-sensitivity and high-selectivity biofuel-cell (BFC)-based self-powered biosensor for the detection of transcription factor protein p53 is reported, in which bilirubin oxidase (BOD)/DNA supramolecular modified graphene/platinum nanoparticles hybrid nanosheet (GPNHN) works as a new enhanced material of biocathode to control the attachment of target, and thus tune the electron-transfer process of oxygen reduction for transducing signaling magnification. It is found that in the presence of p53, the strong interaction between the wild-type p53 and its consensus DNA sequence on the electrode surface can block the electron transfer from the BOD to the electrode, thus providing a good opportunity for reducing the electrocatalytic activity of oxygen reduction in the biocathode. This in combination with the glucose oxidation at the carbon nanotube/Meldola's blue/glucose dehydrogenase bioanode can result in a current/or power decrease of BFC in the presence of wild-type p53. The specially designed BFC-based self-powered p53 sensor shows a wide linear range from 1 pM to 1 μM with a detection limit of 1 pM for analyzing wild-type p53. Most importantly, our BFC-based self-powered sensors can detect the concentrations of wild-type p53 in normal and cancer cell lysates without any extensive sample pretreatment/separation or specialized instruments. The present BFC-based self-powered sensor can provide a simple, economical, sensitive, and rapid way for analyzing p53 protein in normal and cancer cells at clinical level, which shows great potential for creating the treatment modalities that capitalize on the concentration variation of the wild-type p53.

  3. Radiosensitization of Non-Small Cell Lung Cancer Cells by Inhibition of TGF-β1 Signaling With SB431542 Is Dependent on p53 Status.

    PubMed

    Zhao, Yifan; Wang, Longxiao; Huang, Qianyi; Jiang, Youqin; Wang, Jingdong; Zhang, Liyuan; Tian, Ye; Yang, Hongying

    2016-01-01

    Although medically inoperable patients with stage I non-small cell lung cancer cells (NSCLC) are often treated with stereotactic body radiation therapy, its efficacy can be compromised due to poor radiosensitivity of cancer cells. Inhibition of transforming growth factor-β1 (TGF-β1) using LY364947 and LY2109761 has been demonstrated to radiosensitize cancer cells such as breast cancer, glioblastoma, and lung cancer. Our previous results have demonstrated that another potent and selective inhibitor of TGF-β1 receptor kinases, SB431542, could radiosensitize H460 cells both in vitro and in vivo. In the present study, we investigated whether SB431542 could radiosensitize other NSCLC cell lines, trying to explore the potential implication of this TGF-β1 inhibitor in radiotherapy for NSCLC patients. The results showed that A549 cells were significantly radiosensitized by SB431542, whereas no radiosensitizing effect was observed in H1299 cells. Interestingly, both H460 and A549 cells have wild-type p53, while H1299 cells have deficient p53. To study whether the radiosensitizing effect of SB431542 was associated with p53 status of cancer cells, the p53 of H460 cells was silenced using shRNA transfection. Then it was found that the radiosensitizing effect of SB431542 on H460 cells was not observed in H460 cells with silenced p53. Moreover, X-irradiation caused rapid Smad2 activation in H460 and A549 cells but not in H1299 and H460 cells with silenced p53. The Smad2 activation postirradiation could be abolished by SB431542. This may explain the lack of radiosensitizing effect of SB431542 in H1299 and H460 cells with silenced p53. Thus, we concluded that the radiosensitizing effect of inhibition of TGF-β1 signaling in NSCLC cells by SB431542 was p53 dependent, suggesting that using TGF-β1 inhibitor in radiotherapy may be more complicated than previously thought and may need further investigation. PMID:27178816

  4. Wt p53 impairs response to chemotherapy: make lemonade to spare normal cells

    PubMed Central

    Blagosklonny, Mikhail V.

    2012-01-01

    As published recently in Cancer Cell, p53 impairs the apoptotic response to chemotherapy and clinical outcome in breast cancer. I discuss that, while treating tumors lacking wt p53, this phenomenon can be exploited to protect normal cells from chemotherapy because all normal cells have wt p53. Also, several therapeutic paradigms can be reassessed, including the role of cellular senescence in cancer therapy. PMID:22802145

  5. Insulin-like Growth Factor 1 Signaling Axis Meets p53 Genome Protection Pathways

    PubMed Central

    Werner, Haim; Sarfstein, Rive; LeRoith, Derek; Bruchim, Ilan

    2016-01-01

    Clinical, epidemiological, and experimental evidence indicate that the insulin-like growth factors (IGFs) are important mediators in the biochemical chain of events that lead from a phenotypically normal to a neoplastic cell. The IGF1 receptor (IGF1R), which mediates the biological actions of IGF1 and IGF2, exhibits potent pro-survival and antiapoptotic activities. The IGF1R is highly expressed in most types of cancer and is regarded as a promising therapeutic target in oncology. p53 is a transcription factor with tumor suppressor activity that is usually activated in response to DNA damage and other forms of cellular stress. On the basis of its protective activities, p53 is commonly regarded as the guardian of the genome. We provide evidence that the IGF signaling axis and p53 genome protection pathways are tightly interconnected. Wild-type, but not mutant, p53 suppresses IGF1R gene transcription, leading to abrogation of the IGF signaling network, with ensuing cell cycle arrest. Gain-of-function, or loss-of-function, mutations of p53 in tumor cells may disrupt its inhibitory activity, thus generating oncogenic molecules capable of transactivating the IGF1R gene. The interplay between the IGF1 and p53 pathways is also of major relevance in terms of metabolic regulation, including glucose transport and glycolysis. A better understanding of the complex physical and functional interactions between these important signaling pathways will have major basic and translational relevance. PMID:27446805

  6. Free Radicals Generated by Ionizing Radiation Signal Nuclear Translocation of p53

    NASA Technical Reports Server (NTRS)

    Martinez, J. D.; Pennington, M. E.; Craven, M. T.; Warters, R. L.

    1997-01-01

    The p53 tumor suppressor is a transcription factor that regulates several pathways, which function collectively to maintain the integrity of the genome. Nuclear localization is critical for wild-type function. However, the signals that regulate subcellular localization of p53 have not been identified. Here, we examine the effect of ionizing radiation on the subcellular localization of p53 in two cell lines in which p63 is normally sequestered in the cytoplasm and found that ionizing radiation caused a biphasic translocation response. p53 entered the nucleus 1-2 hours postirradiation (early response), subsequently emerged from the nucleus, and then again entered the nucleus 12-24 hours after the cells had been irradiated (delayed response). These changes in subcellular localization could be completely blocked by the free radical scavenger, WR1065. By comparison, two DNA-damaging agents that do not generate free radicals, mitomycin C and doxorubicin, caused translocation only after 12-24 h of exposure to the drugs, and this effect could not be inhibited by WR1065. Hence, although all three DNA-damaging agents induced relocalization of p53 to the nucleus, only the translocation caused by radiation was sensitive to free radical scavenging. We suggest that the free radicals generated by ionizing radiation can signal p53 translocation to the nucleus.

  7. Chloroquine activates the p53 pathway and induces apoptosis in human glioma cells

    PubMed Central

    Kim, Ella L.; Wüstenberg, Robin; Rübsam, Anne; Schmitz-Salue, Christoph; Warnecke, Gabriele; Bücker, Eva-Maria; Pettkus, Nadine; Speidel, Daniel; Rohde, Veit; Schulz-Schaeffer, Walter; Deppert, Wolfgang; Giese, Alf

    2010-01-01

    Glioblastoma is the most common malignant brain tumor in adults. The currently available treatments offer only a palliative survival advantage and the need for effective treatments remains an urgent priority. Activation of the p53 growth suppression/apoptotic pathway is one of the promising strategies in targeting glioma cells. We show that the quinoline derivative chloroquine activates the p53 pathway and suppresses growth of glioma cells in vitro and in vivo in an orthotopic (U87MG) human glioblastoma mouse model. Induction of apoptosis is one of the mechanisms underlying the effects of chloroquine on suppressing glioma cell growth and viability. siRNA-mediated downregulation of p53 in wild-type but not mutant p53 glioblastoma cells substantially impaired chloroquine-induced apoptosis. In addition to its p53-activating effects, chloroquine may also inhibit glioma cell growth via p53-independent mechanisms. Our results clarify the mechanistic basis underlying the antineoplastic effect of chloroquine and reveal its therapeutic potential as an adjunct to glioma chemotherapy. PMID:20308316

  8. p53 activates G₁ checkpoint following DNA damage by doxorubicin during transient mitotic arrest.

    PubMed

    Hyun, Sun-Yi; Jang, Young-Joo

    2015-03-10

    Recovery from DNA damage is critical for cell survival. The serious damage is not able to be repaired during checkpoint and finally induces cell death to prevent abnormal cell growth. In this study, we demonstrated that 8N-DNA contents are accumulated via re-replication during prolonged recovery period containing serious DNA damage in mitotic cells. During the incubation for recovery, a mitotic delay and initiation of an abnormal interphase without cytokinesis were detected. Whereas a failure of cytokinesis occurred in cells with no relation with p53/p21, re-replication is an anomalous phenomenon in the mitotic DNA damage response in p53/p21 negative cells. Cells with wild-type p53 are accumulated just prior to the initiation of DNA replication through a G₁ checkpoint after mitotic DNA damage, even though p53 does not interrupt pre-RC assembly. Finally, these cells undergo cell death by apoptosis. These data suggest that p53 activates G₁ checkpoint in response to mitotic DNA damage. Without p53, cells with mitotic DNA damage undergo re-replication leading to accumulation of damage.

  9. Mutant p53 and mTOR/PKM2 regulation in cancer cells.

    PubMed

    Dando, Ilaria; Cordani, Marco; Donadelli, Massimo

    2016-09-01

    Mutations of TP53 gene are the most common feature in aggressive malignant cells. In addition to the loss of the tumor suppressive role of wild-type p53, hotspot mutant p53 isoforms display oncogenic proprieties notoriously referred as gain of functions (GOFs) which result in chemoresistance to therapies, genomic instability, aberrant deregulation of cell cycle progression, invasiveness and enhanced metastatic potential, and finally, in patient poor survival rate. The identification of novel functional oncogenic pathways regulated by mutant p53 represent and intriguing topic for emerging therapies against a broad spectrum of cancer types bearing mutant TP53 gene. Mammalian target of rapamycin (mTOR), as well as pyruvate kinase isoform M2 (PKM2) are master regulators of cancer growth, metabolism, and cell proliferation. Herein, we report that GOF mutant R175H and R273H p53 proteins trigger PKM2 phosphorylation on Tyr 105 through the involvement of mTOR signaling. Our data, together with the newly discovered connection between mutant p53 and mTOR stimulation, raise important implications for the potential therapeutic use of synthetic drugs inhibiting mTOR/PKM2 axis in cancer cells bearing mutant TP53 gene. We further hypothesize that mTOR/PKM2 pathway stimulation serves to sustain the oncogenic activity of mutant p53 through both the enhancement of chemoresistance and of aerobic glycolysis of cancer cells. © 2016 IUBMB Life, 68(9):722-726, 2016.

  10. The p53-mediated cytotoxicity of photodynamic therapy of cancer: Recent advances

    SciTech Connect

    Zawacka-Pankau, Joanna Krachulec, Justyna Grulkowski, Ireneusz Bielawski, Krzysztof P. Selivanova, Galina

    2008-11-01

    Photodynamic therapy (PDT) is a promising modality for the treatment of both pre-malignant and malignant lesions. The mechanism of action converges mainly on the generation of reactive oxygen species which damage cancer cells directly as well as indirectly acting on tumor vasculature. The exact mechanism of PDT action is not fully understood, which is a formidable barrier to its successful clinical application. Elucidation of the mechanisms of cancer cell elimination by PDT might help in establishing highly specific, non-genotoxic anti-cancer treatment of tomorrow. One of the candidate PDT targets is the well-known tumor suppressor p53 protein recognized as the guardian of the genome. Together with its family members, p73 and p63 proteins, p53 is involved in apoptosis induction upon stress stimuli. The wild-type and mutant p53-targeting chemotherapeutics are currently extensively investigated as a promising strategy for highly specific anti-cancer therapy. In photodynamic therapy porphyrinogenic sensitizers are the most widely used compounds due to their potent biophysical and biochemical properties. Recent data suggest that the p53 tumor suppressor protein might play a significant role in porphyrin-PDT-mediated cell death by direct interaction with the drug which leads to its accumulation and induction of p53-dependent cell death both in the dark and upon irradiation. In this review we describe the available evidence on the role of p53 in PDT.

  11. Repression of the interleukin 6 gene promoter by p53 and the retinoblastoma susceptibility gene product

    SciTech Connect

    Santhanam, U.; Ray, A.; Sehgal, P.B. )

    1991-09-01

    The aberrant overexpression of interleukin 6 (IL-6) is implicated as an autocrine mechanism in the enhanced proliferation of the neoplastic cell elements in various B- and T-cell malignancies and in some carcinomas and sarcomas; many of these neoplasms have been shown to be associated with a mutated p53 gene. The possibility that wild-type (wt) p53, a nuclear tumor-suppressor protein, but not its transforming mutants might serve to repress IL-6 gene expression was investigated in HeLa cells. The authors transiently cotransfected these cells with constitutive cytomegalovirus (CMV) enhancer/promoter expression plasmids overproducing wt or mutant human or murine p53 and with appropriate chloramphenicol acetyltransferase (CAT) reporter plasmids containing the promoter elements of human IL-6, c-fos, or {beta}-actin genes or of porcine major histocompatibility complex (MHC) class I gene in pN-38 to evaluate the effect of the various p53 species on these promoters. These observations identify transcriptional repression as a property of p53 and suggest that p53 and RB may be involved as transcriptional repressors in modulating IL-6 gene expression during cellular differentiation and oncogenesis.

  12. Activation of p53-regulated pro-apoptotic signaling pathways in PrP-mediated myopathy

    PubMed Central

    Liang, Jingjing; Parchaliuk, Debra; Medina, Sarah; Sorensen, Garrett; Landry, Laura; Huang, Shenghai; Wang, Meiling; Kong, Qingzhong; Booth, Stephanie A

    2009-01-01

    Background We have reported that doxycycline-induced over-expression of wild type prion protein (PrP) in skeletal muscles of Tg(HQK) mice is sufficient to cause a primary myopathy with no signs of peripheral neuropathy. The preferential accumulation of the truncated PrP C1 fragment was closely correlated with these myopathic changes. In this study we use gene expression profiling to explore the temporal program of molecular changes underlying the PrP-mediated myopathy. Results We used DNA microarrays, and confirmatory real-time PCR and Western blot analysis to demonstrate deregulation of a large number of genes in the course of the progressive myopathy in the skeletal muscles of doxycycline-treated Tg(HQK) mice. These include the down-regulation of genes coding for the myofibrillar proteins and transcription factor MEF2c, and up-regulation of genes for lysosomal proteins that is concomitant with increased lysosomal activity in the skeletal muscles. Significantly, there was prominent up-regulation of p53 and p53-regulated genes involved in cell cycle arrest and promotion of apoptosis that paralleled the initiation and progression of the muscle pathology. Conclusion The data provides the first in vivo evidence that directly links p53 to a wild type PrP-mediated disease. It is evident that several mechanistic features contribute to the myopathy observed in PrP over-expressing mice and that p53-related apoptotic pathways appear to play a major role. PMID:19400950

  13. Hepatitis B virus X protein inhibits p53 sequence-specific DNA binding, transcriptional activity, and association with transcription factor ERCC3.

    PubMed Central

    Wang, X W; Forrester, K; Yeh, H; Feitelson, M A; Gu, J R; Harris, C C

    1994-01-01

    Chronic active hepatitis caused by infection with hepatitis B virus, a DNA virus, is a major risk factor for human hepatocellular carcinoma. Since the oncogenicity of several DNA viruses is dependent on the interaction of their viral oncoproteins with cellular tumor-suppressor gene products, we investigated the interaction between hepatitis B virus X protein (HBX) and human wild-type p53 protein. HBX complexes with the wild-type p53 protein and inhibits its sequence-specific DNA binding in vitro. HBX expression also inhibits p53-mediated transcriptional activation in vivo and the in vitro association of p53 and ERCC3, a general transcription factor involved in nucleotide excision repair. Therefore, HBX may affect a wide range of p53 functions and contribute to the molecular pathogenesis of human hepatocellular carcinoma. Images PMID:8134379

  14. p53 Regulates the neuronal intrinsic and extrinsic responses affecting the recovery of motor function following spinal cord injury.

    PubMed

    Floriddia, Elisa M; Rathore, Khizr I; Tedeschi, Andrea; Quadrato, Giorgia; Wuttke, Anja; Lueckmann, Jan-Matthis; Kigerl, Kristina A; Popovich, Phillip G; Di Giovanni, Simone

    2012-10-01

    Following spinal trauma, the limited physiological axonal sprouting that contributes to partial recovery of function is dependent upon the intrinsic properties of neurons as well as the inhibitory glial environment. The transcription factor p53 is involved in DNA repair, cell cycle, cell survival, and axonal outgrowth, suggesting p53 as key modifier of axonal and glial responses influencing functional recovery following spinal injury. Indeed, in a spinal cord dorsal hemisection injury model, we observed a significant impairment in locomotor recovery in p53(-/-) versus wild-type mice. p53(-/-) spinal cords showed an increased number of activated microglia/macrophages and a larger scar at the lesion site. Loss- and gain-of-function experiments suggested p53 as a direct regulator of microglia/macrophages proliferation. At the axonal level, p53(-/-) mice showed a more pronounced dieback of the corticospinal tract (CST) and a decreased sprouting capacity of both CST and spinal serotoninergic fibers. In vivo expression of p53 in the sensorimotor cortex rescued and enhanced the sprouting potential of the CST in p53(-/-) mice, while, similarly, p53 expression in p53(-/-) cultured cortical neurons rescued a defect in neurite outgrowth, suggesting a direct role for p53 in regulating the intrinsic sprouting ability of CNS neurons. In conclusion, we show that p53 plays an important regulatory role at both extrinsic and intrinsic levels affecting the recovery of motor function following spinal cord injury. Therefore, we propose p53 as a novel potential multilevel therapeutic target for spinal cord injury.

  15. Crocetin exploits p53-induced death domain (PIDD) and FAS-associated death domain (FADD) proteins to induce apoptosis in colorectal cancer

    PubMed Central

    Ray, Pallab; Guha, Deblina; Chakraborty, Juni; Banerjee, Shuvomoy; Adhikary, Arghya; Chakraborty, Samik; Das, Tanya; Sa, Gaurisankar

    2016-01-01

    Tumor suppressor p53 preserves the genomic integrity by restricting anomaly at the gene level. The hotspots for mutation in half of all colon cancers reside in p53. Hence, in a p53-mutated cellular milieu targeting cancer cells may be achievable by targeting the paralogue(s) of p53. Here we have shown the effectiveness of crocetin, a dietary component, in inducing apoptosis of colon cancer cells with varying p53 status. In wild-type p53-expressing cancer cells, p53 in one hand transactivates BAX and in parallel up-regulates p53-induced death domain protein (PIDD) that in turn cleaves and activates BID through caspase-2. Both BAX and t-BID converge at mitochondria to alter the transmembrane potential thereby leading to caspase-9 and caspase-3-mediated apoptosis. In contrast, in functional p53-impaired cells, this phytochemical exploits p53-paralogue p73, which up-regulates FAS to cleave BID through FAS-FADD-caspase-8-pathway. These findings not only underline the phenomenon of functional switch-over from p53 to p73 in p53-impaired condition, but also validate p73 as a promising and potential target for cancer therapy in absence of functional p53. PMID:27622714

  16. Crocetin exploits p53-induced death domain (PIDD) and FAS-associated death domain (FADD) proteins to induce apoptosis in colorectal cancer.

    PubMed

    Ray, Pallab; Guha, Deblina; Chakraborty, Juni; Banerjee, Shuvomoy; Adhikary, Arghya; Chakraborty, Samik; Das, Tanya; Sa, Gaurisankar

    2016-01-01

    Tumor suppressor p53 preserves the genomic integrity by restricting anomaly at the gene level. The hotspots for mutation in half of all colon cancers reside in p53. Hence, in a p53-mutated cellular milieu targeting cancer cells may be achievable by targeting the paralogue(s) of p53. Here we have shown the effectiveness of crocetin, a dietary component, in inducing apoptosis of colon cancer cells with varying p53 status. In wild-type p53-expressing cancer cells, p53 in one hand transactivates BAX and in parallel up-regulates p53-induced death domain protein (PIDD) that in turn cleaves and activates BID through caspase-2. Both BAX and t-BID converge at mitochondria to alter the transmembrane potential thereby leading to caspase-9 and caspase-3-mediated apoptosis. In contrast, in functional p53-impaired cells, this phytochemical exploits p53-paralogue p73, which up-regulates FAS to cleave BID through FAS-FADD-caspase-8-pathway. These findings not only underline the phenomenon of functional switch-over from p53 to p73 in p53-impaired condition, but also validate p73 as a promising and potential target for cancer therapy in absence of functional p53. PMID:27622714

  17. Transcriptional regulation of the human glycoprotein hormone common alpha subunit gene by cAMP-response-element-binding protein (CREB)-binding protein (CBP)/p300 and p53.

    PubMed Central

    Zhang, Xian; Grand, Roger J A; McCabe, Christopher J; Franklyn, Jayne A; Gallimore, Phillip H; Turnell, Andrew S

    2002-01-01

    We have investigated the functional interactions between adenovirus early region 1A (AdE1A) protein, the co-activators cAMP-response-element-binding protein (CREB)-binding protein (CBP)/p300 and SUG1, and the transcriptional repressor retinoblastoma (Rb) in mediating T3-dependent repression. Utilizing the human glycoprotein hormone common alpha-subunit (alpha-subunit) promoter and AdE1A mutants with selective binding capacity to these molecules we have determined an essential role for CBP/p300. In normal circumstances, wild-type 12 S AdE1A inhibited alpha-subunit activity. In contrast, adenovirus mutants that retain both the SUG1- and Rb-binding sites, but lack the CBP/p300-binding site, were unable to repress promoter activity. We have also identified a role for the tumour-suppressor gene product p53 in regulation of the alpha-subunit promoter. Akin to 12 S AdE1A, exogenous p53 expression repressed alpha-subunit activity. This function resided in the ability of p53 to interact with CBP/p300; an N-terminal mutant incapable of interacting with CBP/p300 did not inhibit alpha-subunit activity. Stabilization of endogenous p53 by UV irradiation also correlated positively with reduced alpha-subunit activity. Intriguingly, T3 stimulated endogenous p53 transcriptional activity, implicating p53 in T3-dependent signalling pathways. These data indicate that CBP/p300 and p53 are key regulators of alpha-subunit activity. PMID:12164786

  18. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

    PubMed

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-07-26

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress. PMID:27407148

  19. Acetylation of p53 Protein at Lysine 120 Up-regulates Apaf-1 Protein and Sensitizes the Mitochondrial Apoptotic Pathway.

    PubMed

    Yun, Tao; Yu, Kaiwen; Yang, ShuangShuang; Cui, Yifan; Wang, Zixi; Ren, Huiyu; Chen, She; Li, Lin; Liu, Xiaoyun; Fang, Min; Jiang, Xuejun

    2016-04-01

    The p53 tumor suppressor controls cell growth, metabolism, and death by regulating the transcription of various target genes. The target-specific transcriptional activity of p53 is highly regulated. Here we demonstrate that acetylation of p53 at Lys-120 up-regulates its transcriptional activity toward Apaf-1, a core component in the mitochondrial apoptotic pathway, and thus sensitizes caspase activation and apoptosis. We found that histone deacetylase (HDAC) inhibitors, including butyrate, augment Lys-120 acetylation of p53 and thus Apaf-1 expression by inhibiting HDAC1. In p53-null cells, transfection of wild-type but not K120R mutant p53 can restore the p53-dependent sensitivity to butyrate. Strikingly, transfection of acetylation-mimicking K120Q mutant p53 is sufficient to up-regulates Apaf-1 in a manner independent of butyrate treatment. Therefore, HDAC inhibitors can induce p53 acetylation at lysine 120, which in turn enhances mitochondrion-mediated apoptosis through transcriptional up-regulation of Apaf-1. PMID:26851285

  20. The physical interaction of p53 and plakoglobin is necessary for their synergistic inhibition of migration and invasion

    PubMed Central

    Mehrabani, Vahedah; Churchill, Lucas; Pasdar, Manijeh

    2016-01-01

    Plakoglobin (PG) is a paralog of β-catenin with similar adhesive, but contrasting signalling functions. Although β-catenin has well-known oncogenic function, PG generally acts as a tumor/metastasis suppressor by mechanisms that are just beginning to be deciphered. Previously, we showed that PG interacted with wild type (WT) and a number of mutant p53s, and that its tumor/metastasis suppressor activity may be mediated, at least partially, by this interaction. Here, carcinoma cell lines deficient in both p53 and PG (H1299), or expressing mutant p53 in the absence of PG (SCC9), were transfected with expression constructs encoding WT and different fragments and deletions of p53 and PG, individually or in pairs. Transfectants were characterized for their in vitro growth, migratory and invasive properties and for mapping the interacting domain of p53 and PG. We showed that when coexpressed, p53-WT and PG-WT cooperated to decrease growth, and acted synergistically to significantly reduce cell migration and invasion. The DNA-binding domain of p53 and C-terminal domain of PG mediated p53/PG interaction, and furthermore, the C-terminus of PG played a central role in the inhibition of invasion in association with p53. PMID:27058623

  1. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression

    PubMed Central

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F.; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-01-01

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker–induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress. PMID:27407148

  2. The physical interaction of p53 and plakoglobin is necessary for their synergistic inhibition of migration and invasion.

    PubMed

    Alaee, Mahsa; Padda, Amarjot; Mehrabani, Vahedah; Churchill, Lucas; Pasdar, Manijeh

    2016-05-01

    Plakoglobin (PG) is a paralog of β-catenin with similar adhesive, but contrasting signalling functions. Although β-catenin has well-known oncogenic function, PG generally acts as a tumor/metastasis suppressor by mechanisms that are just beginning to be deciphered. Previously, we showed that PG interacted with wild type (WT) and a number of mutant p53s, and that its tumor/metastasis suppressor activity may be mediated, at least partially, by this interaction. Here, carcinoma cell lines deficient in both p53 and PG (H1299), or expressing mutant p53 in the absence of PG (SCC9), were transfected with expression constructs encoding WT and different fragments and deletions of p53 and PG, individually or in pairs. Transfectants were characterized for their in vitro growth, migratory and invasive properties and for mapping the interacting domain of p53 and PG. We showed that when coexpressed, p53-WT and PG-WT cooperated to decrease growth, and acted synergistically to significantly reduce cell migration and invasion. The DNA-binding domain of p53 and C-terminal domain of PG mediated p53/PG interaction, and furthermore, the C-terminus of PG played a central role in the inhibition of invasion in association with p53.

  3. DNA damage tolerance pathway involving DNA polymerase ι and the tumor suppressor p53 regulates DNA replication fork progression.

    PubMed

    Hampp, Stephanie; Kiessling, Tina; Buechle, Kerstin; Mansilla, Sabrina F; Thomale, Jürgen; Rall, Melanie; Ahn, Jinwoo; Pospiech, Helmut; Gottifredi, Vanesa; Wiesmüller, Lisa

    2016-07-26

    DNA damage tolerance facilitates the progression of replication forks that have encountered obstacles on the template strands. It involves either translesion DNA synthesis initiated by proliferating cell nuclear antigen monoubiquitination or less well-characterized fork reversal and template switch mechanisms. Herein, we characterize a novel tolerance pathway requiring the tumor suppressor p53, the translesion polymerase ι (POLι), the ubiquitin ligase Rad5-related helicase-like transcription factor (HLTF), and the SWI/SNF catalytic subunit (SNF2) translocase zinc finger ran-binding domain containing 3 (ZRANB3). This novel p53 activity is lost in the exonuclease-deficient but transcriptionally active p53(H115N) mutant. Wild-type p53, but not p53(H115N), associates with POLι in vivo. Strikingly, the concerted action of p53 and POLι decelerates nascent DNA elongation and promotes HLTF/ZRANB3-dependent recombination during unperturbed DNA replication. Particularly after cross-linker-induced replication stress, p53 and POLι also act together to promote meiotic recombination enzyme 11 (MRE11)-dependent accumulation of (phospho-)replication protein A (RPA)-coated ssDNA. These results implicate a direct role of p53 in the processing of replication forks encountering obstacles on the template strand. Our findings define an unprecedented function of p53 and POLι in the DNA damage response to endogenous or exogenous replication stress.

  4. Correlation between p53 immunostaining patterns and gene sequence mutations in breast carcinoma.

    PubMed

    Visscher, D W; Sarkar, F H; Shimoyama, R K; Crissman, J D

    1996-09-01

    , p = 0.01; and PAb1801 p = 0.002, chi-squared test). We conclude that a variety of factors may account for discrepancies when immunohistology is used to evaluate p53 status. These include fixation artifacts, differing epitope specificities of monoclonal reagents, presence of immunohistologically "silent" mutations and, possibly, aberrant overexpression of wild-type protein.

  5. The role of p53 in ribosomopathies.

    PubMed

    Fumagalli, Stefano; Thomas, George

    2011-04-01

    Impaired ribosome biogenesis is the underlying cause of the pathological conditions collectively known as ribosomopathies. Several hypotheses have been advanced to explain the mechanisms by which deficiencies in ribosome biogenesis interfere with developmental processes leading eventually to the emergence of these diseases. In recent years it has become clear that perturbation of this process triggers a cell-cycle checkpoint that, through activation of the tumor-suppressor p53, leads to cell-cycle arrest and apoptosis. Indeed, evidence is accumulating from studies in animal models that the unscheduled activation of p53 is responsible for perturbations in tissue homeostasis that cause the development of ribosomopathies such as Treacher-Collins syndrome (TCS) and 5q(-) syndrome. These findings imply that inhibition of p53, or better, of mechanisms that specifically lead to p53 activation in response to inhibition of ribosome biogenesis, could be targeted in the treatment of ribosomopathies where activation of p53 is shown to play a pathogenic role. PMID:21435506

  6. Whole chromosome instability resulting from the synergistic effects of pRB and p53 inactivation

    PubMed Central

    Manning, Amity L.; Benes, Cyril; Dyson, Nicholas J.

    2013-01-01

    Whole chromosome instability (CIN) is a common feature of cancer cells and has been linked to increased tumor evolution and metastasis. Several studies have shown that the loss of the pRB tumor suppressor causes mitotic defects and chromosome missegregation. pRB is inactivated in many types of cancer and this raises rhe possibility that the ;loss of pRB may be ageneral cause of ICN in tumors. Paradoxically, retinoblastoma tumor cells have a relatively stable karyotype and currently the circumstances in which pRB inactivation causes CIN in human cancers are unclear. Here we utilize a FISH-based approach to score numerical heterogenity in chromosome copy number as a readout of CIN. Using this technique, we show that combined high levels of CIN correlate with the combined inactivation of pRB and p53 and that this association is evident in two independent panels of cancer cell lines. Retinoblastoma cell lines characteristically retain a wild-type p53 gene, providing an opportunity to test the relevance of this functional relationship. We show that retinoblastoma cell lines display the mitotic defects seen when pRB is depleted from non-transformed cells but that the presence of wild type p53 suppresses the accumulation of aneuploid cells. A similar synergy between pRB and p53 inactivation was observed in HCT116 cells. These results suggest that the loss of pRB promotes segregation errors while loss of p53 allows tolerance and continued proliferation of the resulting, genomically unstable cancer cells. Hence it is the cooperative effect of inactivation both pRB and p53 tumor suppressor pathways that promotes CIN. PMID:23792446

  7. p53-directed translational control can shape and expand the universe of p53 target genes.

    PubMed

    Zaccara, S; Tebaldi, T; Pederiva, C; Ciribilli, Y; Bisio, A; Inga, A

    2014-10-01

    The increasing number of genome-wide transcriptome analyses focusing on p53-induced cellular responses in many cellular contexts keeps adding to the already numerous p53-regulated transcriptional networks. To investigate post-transcriptional controls as an additional dimension of p53-directed gene expression responses, we performed a translatome analysis through polysomal profiling on MCF7 cells upon 16 hours of doxorubicin or nutlin-3a treatment. The comparison between the transcriptome and the translatome revealed a considerable level of uncoupling, characterized by genes whose transcription variations did not correlate with translation variations. Interestingly, uncoupled genes were associated with apoptosis, DNA and RNA metabolism and cell cycle functions, suggesting that post-transcriptional control can modulate classical p53-regulated responses. Furthermore, even for well-established p53 targets that were differentially expressed both at the transcriptional and translational levels, quantitative differences between the transcriptome, subpolysomal and polysomal RNAs were evident. As we searched mechanisms underlying gene expression uncoupling, we identified the p53-dependent modulation of six RNA-binding proteins, where hnRNPD (AUF1) and CPEB4 are direct p53 transcriptional targets, whereas SRSF1, DDX17, YBX1 and TARDBP are indirect targets (genes modulated preferentially in the subpolysomal or polysomal mRNA level) modulated at the translational level in a p53-dependent manner. In particular, YBX1 translation appeared to be reduced by p53 via two different mechanisms, one related to mTOR inhibition and the other to miR-34a expression. Overall, we established p53 as a master regulator of translational control and identified new p53-regulated genes affecting translation that can contribute to p53-dependent cellular responses.

  8. P53 Binding Protein 1 (53bp1) Is an Early Participant in the Cellular Response to DNA Double-Strand Breaks

    PubMed Central

    Schultz, Linda B.; Chehab, Nabil H.; Malikzay, Asra; Halazonetis, Thanos D.

    2000-01-01

    p53 binding protein 1 (53BP1), a protein proposed to function as a transcriptional coactivator of the p53 tumor suppressor, has BRCT domains with high homology to the Saccharomyces cerevisiae Rad9p DNA damage checkpoint protein. To examine whether 53BP1 has a role in the cellular response to DNA damage, we probed its intracellular localization by immunofluorescence. In untreated primary cells and U2OS osteosarcoma cells, 53BP1 exhibited diffuse nuclear staining; whereas, within 5–15 min after exposure to ionizing radiation (IR), 53BP1 localized at discreet nuclear foci. We propose that these foci represent sites of processing of DNA double-strand breaks (DSBs), because they were induced by IR and chemicals that cause DSBs, but not by ultraviolet light; their peak number approximated the number of DSBs induced by IR and decreased over time with kinetics that parallel the rate of DNA repair; and they colocalized with IR-induced Mre11/NBS and γ-H2AX foci, which have been previously shown to localize at sites of DSBs. Formation of 53BP1 foci after irradiation was not dependent on ataxia-telangiectasia mutated (ATM), Nijmegen breakage syndrome (NBS1), or wild-type p53. Thus, the fast kinetics of 53BP1 focus formation after irradiation and the lack of dependency on ATM and NBS1 suggest that 53BP1 functions early in the cellular response to DNA DSBs. PMID:11134068

  9. Identification of the p53 protein domain involved in formation of the simian virus 40 large T-antigen-p53 protein complex.

    PubMed Central

    Tan, T H; Wallis, J; Levine, A J

    1986-01-01

    An expression vector utilizing the enhancer and promoter region of the simian virus 40 (SV40) DNA regulating a murine p53 cDNA clone was constructed. The vector produced murine p53 protein in monkey cells identified by five different monoclonal antibodies, three of which were specific for the murine form of p53. The murine p53 produced in monkey cells formed an oligomeric protein complex with the SV40 large tumor antigen. A large number of deletion mutations, in-frame linker insertion mutations, and linker insertion mutations resulting in a frameshift mutation were constructed in the cDNA coding portion of the p53 protein expression vector. The wild-type and mutant p53 cDNA vectors were expressed in monkey cells producing the SV40 large T antigen. The conformation and levels of p53 protein and its ability to form protein complexes with the SV40 T antigen were determined by using five different monoclonal antibodies with quite distinct epitope recognition sites. Insertion mutations between amino acid residues 123 and 215 (of a total of 390 amino acids) eliminated the ability of murine p53 to bind to the SV40 large T antigen. Deletion (at amino acids 11 through 33) and insertion mutations (amino acids 222 through 344) located on either side of this T-antigen-binding protein domain produced a murine p53 protein that bound to the SV40 large T antigen. The same five insertion mutations that failed to bind with the SV40 large T antigen also failed to react with a specific monoclonal antibody, PAb246. In contrast, six additional deletion and insertion mutations that produced p53 protein that did bind with T antigen were each recognized by PAb246. The proposed epitope for PAb246 has been mapped adjacent (amino acids 88 through 109) to the T-antigen-binding domain (amino acids 123 through 215) localized by the mutations mapped in this study. Finally, some insertion mutations that produced a protein that failed to bind to the SV40 T antigen appeared to have an enhanced

  10. p53 protects against genome instability following centriole duplication failure.

    PubMed

    Lambrus, Bramwell G; Uetake, Yumi; Clutario, Kevin M; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield; Holland, Andrew J

    2015-07-01

    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure.

  11. Identification of a p53-response element in the promoter of the proline oxidase gene

    SciTech Connect

    Maxwell, Steve A. Kochevar, Gerald J.

    2008-05-02

    Proline oxidase (POX) is a p53-induced proapoptotic gene. We investigated whether p53 could bind directly to the POX gene promoter. Chromatin immunoprecipitation (ChIP) assays detected p53 bound to POX upstream gene sequences. In support of the ChIP results, sequence analysis of the POX gene and its 5' flanking sequences revealed a potential p53-binding site, GGGCTTGTCTTCGTGTGACTTCTGTCT, located at 1161 base pairs (bp) upstream of the transcriptional start site. A 711-bp DNA fragment containing the candidate p53-binding site exhibited reporter gene activity that was induced by p53. In contrast, the same DNA region lacking the candidate p53-binding site did not show significant p53-response activity. Electrophoretic mobility shift assay (EMSA) in ACHN renal carcinoma cell nuclear lysates confirmed that p53 could bind to the 711-bp POX DNA fragment. We concluded from these experiments that a p53-binding site is positioned at -1161 to -1188 bp upstream of the POX transcriptional start site.

  12. β-Catenin C-terminal signals suppress p53 and are essential for artery formation

    PubMed Central

    Riascos-Bernal, Dario F.; Chinnasamy, Prameladevi; Cao, Longyue (Lily); Dunaway, Charlene M.; Valenta, Tomas; Basler, Konrad; Sibinga, Nicholas E. S.

    2016-01-01

    Increased activity of the tumour suppressor p53 is incompatible with embryogenesis, but how p53 is controlled is not fully understood. Differential requirements for p53 inhibitors Mdm2 and Mdm4 during development suggest that these control mechanisms are context-dependent. Artery formation requires investment of nascent endothelial tubes by smooth muscle cells (SMCs). Here, we find that embryos lacking SMC β-catenin suffer impaired arterial maturation and die by E12.5, with increased vascular wall p53 activity. β-Catenin-deficient SMCs show no change in p53 levels, but greater p53 acetylation and activity, plus impaired growth and survival. In vivo, SMC p53 inactivation suppresses phenotypes caused by loss of β-catenin. Mechanistically, β-catenin C-terminal interactions inhibit Creb-binding protein-dependent p53 acetylation and p53 transcriptional activity, and are required for artery formation. Thus in SMCs, the β-catenin C-terminus indirectly represses p53, and this function is essential for embryogenesis. These findings have implications for angiogenesis, tissue engineering and vascular disease. PMID:27499244

  13. p53 and rapamycin are additive

    PubMed Central

    Campisi, Judith; Huang, Jing; Jones, Diane; Dodds, Sherry G.; Williams, Charnae; Hubbard, Gene; Livi, Carolina B.; Gao, Xiaoli; Weintraub, Susan; Curiel, Tyler; Sharp, Z. Dave; Hasty, Paul

    2015-01-01

    Mechanistic target of rapamycin (mTOR) is a kinase found in a complex (mTORC1) that enables macromolecular synthesis and cell growth and is implicated in cancer etiology. The rapamycin-FK506 binding protein 12 (FKBP12) complex allosterically inhibits mTORC1. In response to stress, p53 inhibits mTORC1 through a separate pathway involving cell signaling and amino acid sensing. Thus, these different mechanisms could be additive. Here we show that p53 improved the ability of rapamycin to: 1) extend mouse life span, 2) suppress ionizing radiation (IR)-induced senescence-associated secretory phenotype (SASP) and 3) increase the levels of amino acids and citric acid in mouse embryonic stem (ES) cells. This additive effect could have implications for cancer treatment since rapamycin and p53 are anti-oncogenic. PMID:26158292

  14. Rapamycin extends lifespan and delays tumorigenesis in heterozygous p53+/- mice.

    PubMed

    Komarova, Elena A; Antoch, Marina P; Novototskaya, Liliya R; Chernova, Olga B; Paszkiewicz, Geraldine; Leontieva, Olga V; Blagosklonny, Mikhail V; Gudkov, Andrei V

    2012-10-01

    TOR (Target of Rapamycin) pathway accelerates cellular and organismal aging. Similar to rapamycin, p53 can inhibit the mTOR pathway in some mammalian cells. Mice lacking one copy of p53 (p53+/- mice) have an increased cancer incidence and a shorter lifespan. We hypothesize that rapamycin can delay cancer in heterozygous p53+/- mice. Here we show that rapamycin (given in a drinking water) extended the mean lifespan of p53+/- mice by 10% and when treatment started early in life (at the age less than 5 months) by 28%. In addition, rapamycin decreased the incidence of spontaneous tumors. This observation may have applications in management of Li-Fraumeni syndrome patients characterized by heterozygous mutations in the p53 gene.

  15. “Super p53” Mice Display Retinal Astroglial Changes

    PubMed Central

    Salazar, Juan J.; Gallego-Pinazo, Roberto; de Hoz, Rosa; Pinazo-Durán, Maria D.; Rojas, Blanca; Ramírez, Ana I.; Serrano, Manuel; Ramírez, José M.

    2013-01-01

    Tumour-suppressor genes, such as the p53 gene, produce proteins that inhibit cell division under adverse conditions, as in the case of DNA damage, radiation, hypoxia, or oxidative stress (OS). The p53 gene can arrest proliferation and trigger death by apoptosis subsequent to several factors. In astrocytes, p53 promotes cell-cycle arrest and is involved in oxidative stress-mediated astrocyte cell death. Increasingly, astrocytic p53 is proving fundamental in orchestrating neurodegenerative disease pathogenesis. In terms of ocular disease, p53 may play a role in hypoxia due to ischaemia and may be involved in the retinal response to oxidative stress (OS). We studied the influence of the p53 gene in the structural and quantitative characteristics of astrocytes in the retina. Adult mice of the C57BL/6 strain (12 months old) were distributed into two groups: 1) mice with two extra copies of p53 (“super p53”; n = 6) and 2) wild-type p53 age-matched control, as the control group (WT; n = 6). Retinas from each group were immunohistochemically processed to locate the glial fibrillary acidic protein (GFAP). GFAP+ astrocytes were manually counted and the mean area occupied for one astrocyte was quantified. Retinal-astrocyte distribution followed established patterns; however, morphological changes were seen through the retinas in relation to p53 availability. The mean GFAP+ area occupied by one astrocyte in “super p53” eyes was significantly higher (p<0.05; Student’s t-test) than in the WT. In addition, astroglial density was significantly higher in the “super p53” retinas than in the WT ones, both in the whole-retina (p<0,01 Student’s t-test) and in the intermediate and peripheral concentric areas of the retina (p<0.05 Student’s t-test). This fact might improve the resistance of the retinal cells against OS and its downstream signalling pathways. PMID:23762373

  16. Constitutive activation of gene expression by thyroid hormone receptor results from reversal of p53-mediated repression.

    PubMed Central

    Qi, J S; Desai-Yajnik, V; Yuan, Y; Samuels, H H

    1997-01-01

    Thyroid hormone receptor (T3R) is a member of the steroid hormone receptor gene family of nuclear hormone receptors. In most cells T3R activates gene expression only in the presence of its ligand, L-triiodothyronine (T3). However, in certain cell types (e.g., GH4C1 cells) expression of T3R leads to hormone-independent constitutive activation. This activation by unliganded T3R occurs with a variety of gene promoters and appears to be independent of the binding of T3R to specific thyroid hormone response elements (TREs). Previous studies indicate that this constitutive activation results from the titration of an inhibitor of transcription. Since the tumor suppresser p53 is capable of repressing a wide variety of gene promoters, we considered the possibility that the inhibitor is p53. Evidence to support this comes from studies indicating that expression of p53 blocks T3R-mediated constitutive activation in GH4C1 cells. In contrast with hormone-independent activation by T3R, p53 had little or no effect on T3-dependent stimulation which requires TREs. In addition, p53 mutants which oligomerize with wild-type p53 and interfere with its function also increase promoter activity. This enhancement is of similar magnitude to but is not additive with the stimulation mediated by unliganded T3R, suggesting that they target the same factor. Since p53 mutants are known to target wild-type p53 in the cell, this suggests that T3R also interacts with p53 in vivo and that endogenous levels of p53 act to suppress promoter activity. Evidence supporting both functional and physical interactions of T3R and p53 in the cell is presented. The DNA binding domain (DBD) of T3R is important in mediating constitutive activation, and the receptor DBD appears to functionally interact with the N terminus of p53 in the cell. In vitro binding studies indicate that the T3R DBD is important for interaction of T3R with p53 and that this interaction is reduced by T3. These findings are consistent with

  17. Detection of genotoxic and non-genotoxic carcinogens in Xpc{sup −/−}p53{sup +/−} mice

    SciTech Connect

    Melis, Joost P.M.; Speksnijder, Ewoud N.; Kuiper, Raoul V.; Salvatori, Daniela C.F.; Schaap, Mirjam M.; Maas, Saskia; Robinson, Joke; Verhoef, Aart; Benthem, Jan van; Luijten, Mirjam; Steeg, Harry van

    2013-01-15

    An accurate assessment of the carcinogenic potential of chemicals and pharmaceutical drugs is essential to protect humans and the environment. Therefore, substances are extensively tested before they are marketed to the public. Currently, the rodent two-year bioassay is still routinely used to assess the carcinogenic potential of substances. However, over time it has become clear that this assay yields false positive results and also has several economic and ethical drawbacks including the use of large numbers of animals, the long duration, and the high cost. The need for a suitable alternative assay is therefore high. Previously, we have proposed the Xpa*p53 mouse model as a very suitable alternative to the two-year bioassay. We now show that the Xpc*p53 mouse model preserves all the beneficial traits of the Xpa*p53 model for sub-chronic carcinogen identification and can identify both genotoxic and non-genotoxic carcinogens. Moreover, Xpc*p53 mice appear to be more responsive than Xpa*p53 mice towards several genotoxic and non-genotoxic carcinogens. Furthermore, Xpc*p53 mice are far less sensitive than Xpa*p53 mice for the toxic activity of DNA damaging agents and as such clearly respond in a similar way as wild type mice do. These advantageous traits of the Xpc*p53 model make it a better alternative for in vivo carcinogen testing than Xpa*p53. This pilot study suggests that Xpc*p53 mice are suited for routine sub-chronic testing of both genotoxic and non-genotoxic carcinogens and as such represent a suitable alternative to possibly replace the murine life time cancer bioassay. Highlights: ► The Xpc*p53 mouse model is able to identify genotoxic and non-genotoxic carcinogens. ► Time, animals and cost can be significantly reduced compared to the 2-year bioassay. ► Xpc*p53 mice are more advantageous for carcinogen identification than Xpa*p53 mice. ► Xpc*p53 mice exhibit a wild type response upon exposure to genotoxicants.

  18. Autoantibody recognition mechanisms of p53 epitopes

    NASA Astrophysics Data System (ADS)

    Phillips, J. C.

    2016-06-01

    There is an urgent need for economical blood based, noninvasive molecular biomarkers to assist in the detection and diagnosis of cancers in a cost-effective manner at an early stage, when curative interventions are still possible. Serum autoantibodies are attractive biomarkers for early cancer detection, but their development has been hindered by the punctuated genetic nature of the ten million known cancer mutations. A landmark study of 50,000 patients (Pedersen et al., 2013) showed that a few p53 15-mer epitopes are much more sensitive colon cancer biomarkers than p53, which in turn is a more sensitive cancer biomarker than any other protein. The function of p53 as a nearly universal "tumor suppressor" is well established, because of its strong immunogenicity in terms of not only antibody recruitment, but also stimulation of autoantibodies. Here we examine dimensionally compressed bioinformatic fractal scaling analysis for identifying the few sensitive epitopes from the p53 amino acid sequence, and show how it could be used for early cancer detection (ECD). We trim 15-mers to 7-mers, and identify specific 7-mers from other species that could be more sensitive to aggressive human cancers, such as liver cancer. Our results could provide a roadmap for ECD.

  19. Papillomavirus, p53 alteration, and primary carcinoma of the vulva.

    PubMed

    Pilotti, S; D'Amato, L; Della Torre, G; Donghi, R; Longoni, A; Giarola, M; Sampietro, G; De Palo, G; Pierotti, M A; Rilke, F

    1995-12-01

    Twenty-nine samples from 28 cases of vulvar squamous cell carcinoma, of which 13 fulfilled the criteria of the bowenoid subtype (mean age 45 years, range 31-68) and 16 of the usual subtype of invasive squamous cell carcinoma (ISCC) (mean age 67.5 years, range 34-83) were investigated for human papillomavirus (HPV) DNA, TP53 alterations, and mdm2 and bcl-2 gene product deregulation. Microscopically all the bowenoid subtype cases (group I) showed a high-grade intraepithelial (VIN 3, carcinoma in situ) lesion associated with early invasive carcinoma in six cases and overt invasive carcinoma in one. By contrast, no evidence of early carcinoma was present in the ISCCs (group II). By in situ hybridization and/or Southern blot hybridization or polymerase chain reaction (PCR), HPV DNA was detected in all cases of group I and in four of 16 cases (25%) of group II, two only by Southern blot after PCR. By single-strand conformation polymorphism and immunocytochemistry only wild-type TP53 and absence of detectable p53 product, respectively, were found in all cases of group I, i.e., in high-risk HPV-positive carcinomas, whereas mutations and/or p53 overexpression accounted for 75% in group II, i.e., in mainly HPV-negative carcinomas. The TP53 gene mutations observed in invasive carcinomas were significantly related to node-positive cases (p = 0.04). Taken together and in agreement with in vitro data, these results support the view that an alteration of TP53, gained either by interaction with viral oncoproteins or by somatic mutations, is a crucial event in the pathogenesis of vulvar carcinomas, but that TP53 mutations are mainly associated with disease progression. Finally, a preliminary immunocytochemical analysis seems to speak against the possible involvement of both MDM2 and BCL-2 gene products in the development of vulvar carcinoma.

  20. Targeting the MDM2/MDM4 interaction interface as a promising approach for p53 reactivation therapy.

    PubMed

    Pellegrino, Marsha; Mancini, Francesca; Lucà, Rossella; Coletti, Alice; Giacchè, Nicola; Manni, Isabella; Arisi, Ivan; Florenzano, Fulvio; Teveroni, Emanuela; Buttarelli, Marianna; Fici, Laura; Brandi, Rossella; Bruno, Tiziana; Fanciulli, Maurizio; D'Onofrio, Mara; Piaggio, Giulia; Pellicciari, Roberto; Pontecorvi, Alfredo; Marine, Jean Christophe; Macchiarulo, Antonio; Moretti, Fabiola

    2015-11-01

    Restoration of wild-type p53 tumor suppressor function has emerged as an attractive anticancer strategy. Therapeutics targeting the two p53-negative regulators, MDM2 and MDM4, have been developed, but most agents selectively target the ability of only one of these molecules to interact with p53, leaving the other free to operate. Therefore, we developed a method that targets the activity of MDM2 and MDM4 simultaneously based on recent studies indicating that formation of MDM2/MDM4 heterodimer complexes are required for efficient inactivation of p53 function. Using computational and mutagenesis analyses of the heterodimer binding interface, we identified a peptide that mimics the MDM4 C-terminus, competes with endogenous MDM4 for MDM2 binding, and activates p53 function. This peptide induces p53-dependent apoptosis in vitro and reduces tumor growth in vivo. Interestingly, interfering with the MDM2/MDM4 heterodimer specifically activates a p53-dependent oxidative stress response. Consistently, distinct subcellular pools of MDM2/MDM4 complexes were differentially sensitive to the peptide; nuclear MDM2/MDM4 complexes were particularly highly susceptible to the peptide-displacement activity. Taken together, these data identify the MDM2/MDM4 interaction interface as a valuable molecular target for therapeutic reactivation of p53 oncosuppressive function. PMID:26359458

  1. Transcriptional regulation of basic fibroblast growth factor gene by p53 in human glioblastoma and hepatocellular carcinoma cells.

    PubMed Central

    Ueba, T; Nosaka, T; Takahashi, J A; Shibata, F; Florkiewicz, R Z; Vogelstein, B; Oda, Y; Kikuchi, H; Hatanaka, M

    1994-01-01

    Mutations of the p53 gene are found in various human cancers. The frequency of its mutation is reported to increase during tumor progression in most tumors. In human gliomas, mutations of the p53 gene are found in about one-third of the malignant forms and in few of the benign ones, indicating their possible involvement in tumor progression. On the other hand, we have recently shown that basic fibroblast growth factor (basic FGF) plays a crucial role in tumor progression as an autocrine growth factor in tissues of human gliomas. Therefore, we hypothesized that p53 might regulate the promoter activity of the basic FGF gene, which has several GC boxes and no typical TATA box. In this study, cotransfection assays using human glioblastoma and hepatocellular carcinoma cells and establishment of stable cell lines expressing mutant-type p53 were performed. The basic FGF gene promoter was demonstrated to be regulated by p53 at the transcriptional level and its basal core promoter was found to be responsive to p53. Expression of endogenous basic FGF was also demonstrated to be activated by mutant type p53. Wild-type p53 repressed gene expression of the basic FGF and its mutant activated it in vitro, implying one of the possible pathways in tumor progression. Images PMID:8090761

  2. Direct involvement of p53 in programmed cell death of oligodendrocytes.

    PubMed Central

    Eizenberg, O; Faber-Elman, A; Gottlieb, E; Oren, M; Rotter, V; Schwartz, M

    1995-01-01

    A covalent dimer of interleukin (IL)-2, produced in vitro by the action of a nerve-derived transglutaminase, has been shown previously to be cytotoxic to mature rat brain oligodendrocytes. Here we report that this cytotoxic effect operates via programmed cell death (apoptosis) and that the p53 tumor suppressor gene is involved directly in the process. The apoptotic death of mature rat brain oligodendrocytes in culture following treatment with dimeric IL-2 was demonstrated by chromatin condensation and internucleosomal DNA fragmentation. The peak of apoptosis was observed 16-24 h after treatment, while the commitment to death was already observed after 3-4 h. An involvement of p53 in this process was indicated by the shift in location of constitutively expressed endogenous p53 from the cytoplasm to the nucleus, as early as 15 min after exposure to dimeric IL-2. Moreover, infection with a recombinant retrovirus encoding a C-terminal p53 miniprotein, shown previously to act as a dominant negative inhibitor of endogenous wild-type p53 activity, protected these cells from apoptosis. Images PMID:7720704

  3. Oncogenomic Approaches in Exploring Gain of Function of Mutant p53

    PubMed Central

    Donzelli, Sara; Biagioni, Francesca; Fausti, Francesca; Strano, Sabrina; Fontemaggi, Giulia; Blandino, Giovanni

    2008-01-01

    Cancer is caused by the spatial and temporal accumulation of alterations in the genome of a given cell. This leads to the deregulation of key signalling pathways that play a pivotal role in the control of cell proliferation and cell fate. The p53 tumor suppressor gene is the most frequent target in genetic alterations in human cancers. The primary selective advantage of such mutations is the elimination of cellular wild type p53 activity. In addition, many evidences in vitro and in vivo have demonstrated that at least certain mutant forms of p53 may possess a gain of function, whereby they contribute positively to cancer progression. The fine mapping and deciphering of specific cancer phenotypes is taking advantage of molecular-profiling studies based on genome-wide approaches. Currently, high-throughput methods such as array-based comparative genomic hybridization (CGH array), single nucleotide polymorphism array (SNP array), expression arrays and ChIP-on-chip arrays are available to study mutant p53-associated alterations in human cancers. Here we will mainly focus on the integration of the results raised through oncogenomic platforms that aim to shed light on the molecular mechanisms underlying mutant p53 gain of function activities and to provide useful information on the molecular stratification of tumor patients. PMID:19440517

  4. FHL2 mediates p53-induced transcriptional activation through a direct association with HIPK2

    SciTech Connect

    Lee, Sang-Wang . E-mail: umsj@sejong.ac.kr

    2006-01-27

    To understand the molecular mechanism underlying HIPK2 regulation of the transcriptional activation by p53, we sought to identify the protein that interacts with HIPK2. From our yeast two-hybrid screen, we found that four and a half LIM domains 2 (FHL2) could bind to the C-terminal half of HIPK2. Further assays in yeast mapped the minimal interaction domain to amino acids 812-907 in HIPK2. The interaction was confirmed using a GST pull-down assay in vitro, and an immunoprecipitation (IP) assay and fluorescence microscopy in vivo. FHL2 alone spread throughout both the cytoplasm and nucleus but was redistributed to dot-like structures in the nucleus when HIPK2 was coexpressed in HEK293 cells. When tethered to the Gal4-responsive promoter through the Gal4 DBD fusion, FHL2 showed autonomous transcriptional activity that was enhanced by wild-type HIPK2, but not by the kinase-defective mutant. In addition, FHL2 increased the p53-dependent transcriptional activation and had an additive effect on the activation when coexpressed with HIPK2, which was again not observed with the kinase-defective mutant of HIPK2. Finally, we found a ternary complex of p53, HIPK2, and FHL2 using IP, and their recruitment to the p53-responsive p21Waf1 promoter in chromatin IP assays. Overall, our findings indicate that FHL2 can also regulate p53 via a direct association with HIPK2.

  5. p53 loss promotes acute myeloid leukemia by enabling aberrant self-renewal

    PubMed Central

    Zhao, Zhen; Zuber, Johannes; Diaz-Flores, Ernesto; Lintault, Laura; Kogan, Scott C.; Shannon, Kevin; Lowe, Scott W.

    2010-01-01

    The p53 tumor suppressor limits proliferation in response to cellular stress through several mechanisms. Here, we test whether the recently described ability of p53 to limit stem cell self-renewal suppresses tumorigenesis in acute myeloid leukemia (AML), an aggressive cancer in which p53 mutations are associated with drug resistance and adverse outcome. Our approach combined mosaic mouse models, Cre-lox technology, and in vivo RNAi to disable p53 and simultaneously activate endogenous KrasG12D—a common AML lesion that promotes proliferation but not self-renewal. We show that p53 inactivation strongly cooperates with oncogenic KrasG12D to induce aggressive AML, while both lesions on their own induce T-cell malignancies with long latency. This synergy is based on a pivotal role of p53 in limiting aberrant self-renewal of myeloid progenitor cells, such that loss of p53 counters the deleterious effects of oncogenic Kras on these cells and enables them to self-renew indefinitely. Consequently, myeloid progenitor cells expressing oncogenic Kras and lacking p53 become leukemia-initiating cells, resembling cancer stem cells capable of maintaining AML in vivo. Our results establish an efficient new strategy for interrogating oncogene cooperation, and provide strong evidence that the ability of p53 to limit aberrant self-renewal contributes to its tumor suppressor activity. PMID:20595231

  6. Whole chromosome instability resulting from the synergistic effects of pRB and p53 inactivation.

    PubMed

    Manning, A L; Benes, C; Dyson, N J

    2014-05-01

    Whole chromosome instability (CIN) is a common feature of cancer cells and has been linked to increased tumor evolution and metastasis. Several studies have shown that the loss of the pRB tumor suppressor causes mitotic defects and chromosome mis-segregation. pRB is inactivated in many types of cancer and this raises the possibility that the loss of pRB may be a general cause of CIN in tumors. Paradoxically, retinoblastoma tumor cells have a relatively stable karyotype and currently the circumstances in which pRB inactivation causes CIN in human cancers are unclear. Here we utilize a fluorescence in situ hybridization-based approach to score numerical heterogeneity in chromosome copy number as a readout of CIN. Using this technique, we show that high levels of CIN correlate with the combined inactivation of pRB and p53 and that this association is evident in two independent panels of cancer cell lines. Retinoblastoma cell lines characteristically retain a wild-type TP53 gene, providing an opportunity to test the relevance of this functional relationship. We show that retinoblastoma cell lines display mitotic defects similar to those seen when pRB is depleted from non-transformed cells, but that the presence of wild-type p53 suppresses the accumulation of aneuploid cells. A similar synergy between pRB and p53 inactivation was observed in HCT116 cells. These results suggest that the loss of pRB promotes segregation errors, whereas loss of p53 allows tolerance and continued proliferation of the resulting, genomically unstable cancer cells. Hence, it is the cooperative effect of inactivation of both pRB and p53 tumor suppressor pathways that promotes CIN.

  7. p53 Requires the Stress Sensor USF1 to Direct Appropriate Cell Fate Decision

    PubMed Central

    Bouafia, Amine; Corre, Sébastien; Gilot, David; Mouchet, Nicolas; Prince, Sharon; Galibert, Marie-Dominique

    2014-01-01

    Genomic instability is a major hallmark of cancer. To maintain genomic integrity, cells are equipped with dedicated sensors to monitor DNA repair or to force damaged cells into death programs. The tumor suppressor p53 is central in this process. Here, we report that the ubiquitous transcription factor Upstream Stimulatory factor 1 (USF1) coordinates p53 function in making proper cell fate decisions. USF1 stabilizes the p53 protein and promotes a transient cell cycle arrest, in the presence of DNA damage. Thus, cell proliferation is maintained inappropriately in Usf1 KO mice and in USF1-deficient melanoma cells challenged by genotoxic stress. We further demonstrate that the loss of USF1 compromises p53 stability by enhancing p53-MDM2 complex formation and MDM2-mediated degradation of p53. In USF1-deficient cells, the level of p53 can be restored by the re-expression of full-length USF1 protein similarly to what is observed using Nutlin-3, a specific inhibitor that prevents p53-MDM2 interaction. Consistent with a new function for USF1, a USF1 truncated protein lacking its DNA-binding and transactivation domains can also restore the induction and activity of p53. These findings establish that p53 function requires the ubiquitous stress sensor USF1 for appropriate cell fate decisions in response to DNA-damage. They underscore the new role of USF1 and give new clues of how p53 loss of function can occur in any cell type. Finally, these findings are of clinical relevance because they provide new therapeutic prospects in stabilizing and reactivating the p53 pathway. PMID:24831529

  8. Glycogen synthase kinase 3 promotes p53 mRNA translation via phosphorylation of RNPC1

    PubMed Central

    Zhang, Min; Zhang, Jin; Chen, Xiangling; Cho, Seong-Jun; Chen, Xinbin

    2013-01-01

    The RNPC1 RNA-binding protein, also called Rbm38, is a target of p53 and a repressor of p53 mRNA translation. Thus, the p53–RNPC1 loop is critical for modulating p53 tumor suppression, but it is not clear how the loop is regulated. Here, we showed that RNPC1 is phosphorylated at Ser195 by glycogen synthase kinase 3 (GSK3). We also showed that GSK3 promotes p53 mRNA translation through phosphorylation of RNPC1. Interestingly, we found that the phosphor-mimetic mutant S195D and the deletion mutant Δ189–204, which lacks the GSK3 phosphorylation site, are unable to repress p53 mRNA translation due to loss of interaction with eukaryotic translation factor eIF4E on p53 mRNA. Additionally, we found that phosphorylated RNPC1, RNPC1-S195D, and RNPC1(Δ189–204) promote p53 mRNA translation through interaction with eukaryotic translation factor eIF4G, which then facilitates the assembly of the eIF4F complex on p53 mRNA. Furthermore, we showed that upon inhibition of the phosphatidylinositol 3-kinase (PI3K)–Akt pathway, GSK3 is activated, leading to increased RNPC1 phosphorylation and increased p53 expression in a RNPC1-dependent manner. Together, we postulate that the p53–RNPC1 loop can be explored to increase or decrease p53 activity for cancer therapy. PMID:24142875

  9. The p53 inhibitor MDM2 facilitates Sonic Hedgehog-mediated tumorigenesis and influences cerebellar foliation.

    PubMed

    Malek, Reem; Matta, Jennifer; Taylor, Natalie; Perry, Mary Ellen; Mendrysa, Susan M

    2011-01-01

    Disruption of cerebellar granular neuronal precursor (GNP) maturation can result in defects in motor coordination and learning, or in medulloblastoma, the most common childhood brain tumor. The Sonic Hedgehog (Shh) pathway is important for GNP proliferation; however, the factors regulating the extent and timing of GNP proliferation, as well as GNP differentiation and migration are poorly understood. The p53 tumor suppressor has been shown to negatively regulate the activity of the Shh effector, Gli1, in neural stem cells; however, the contribution of p53 to the regulation of Shh signaling in GNPs during cerebellar development has not been determined. Here, we exploited a hypomorphic allele of Mdm2 (Mdm2(puro)), which encodes a critical negative regulator of p53, to alter the level of wild-type MDM2 and p53 in vivo. We report that mice with reduced levels of MDM2 and increased levels of p53 have small cerebella with shortened folia, reminiscent of deficient Shh signaling. Indeed, Shh signaling in Mdm2-deficient GNPs is attenuated, concomitant with decreased expression of the Shh transducers, Gli1 and Gli2. We also find that Shh stimulation of GNPs promotes MDM2 accumulation and enhances phosphorylation at serine 166, a modification known to increase MDM2-p53 binding. Significantly, loss of MDM2 in Ptch1(+/-) mice, a model for Shh-mediated human medulloblastoma, impedes cerebellar tumorigenesis. Together, these results place MDM2 at a major nexus between the p53 and Shh signaling pathways in GNPs, with key roles in cerebellar development, GNP survival, cerebellar foliation, and MB tumorigenesis. PMID:21437245

  10. ERβ decreases the invasiveness of triple-negative breast cancer cells by regulating mutant p53 oncogenic function

    PubMed Central

    Bado, Igor; Nikolos, Fotis; Rajapaksa, Gayani; Gustafsson, Jan-Åke; Thomas, Christoforos

    2016-01-01

    Most (80%) of the triple-negative breast cancers (TNBCs) express mutant p53 proteins that acquire oncogenic activities including promoting metastasis. We previously showed that wild-type ERβ (ERβ1) impedes epithelial to mesenchymal transition (EMT) and decreases the invasiveness of TNBC cells. In the present study we searched for signaling pathways that ERβ1 uses to inhibit EMT and invasion in TNBC cells. We show that ERβ1 binds to and opposes the transcriptional activity of mutant p53 at the promoters of genes that regulate metastasis. p63 that transcriptionally cooperates with mutant p53 also binds to ERβ1. Downregulation of p63 represses the epithelial phenotype of ERβ1-expressing cells and alters the expression of mutant p53 target genes. These results describe a novel mechanism through which ERβ1 can disturb oncogenic signals to inhibit aggressiveness in TNBCs. PMID:26871946

  11. Novel p53 target genes secreted by the liver are involved in non-cell-autonomous regulation.

    PubMed

    Charni, M; Molchadsky, A; Goldstein, I; Solomon, H; Tal, P; Goldfinger, N; Yang, P; Porat, Z; Lozano, G; Rotter, V

    2016-03-01

    The tumor-suppressor p53 is a transcription factor that prevents cancer development and is involved in regulation of various physiological processes. This is mediated both by induction of cell cycle arrest and apoptosis and by controlling the expression of a plethora of target genes, including secreted proteins. It has been demonstrated that p53 may exert its effect in non-cell-autonomous manner by modulating the expression of genes that encode for secreted factors. In this study, we utilized our microarray data to identify and characterize novel p53 target genes expressed in human liver cells and associated with steroid hormones processing and transfer. We identified the steroid hormones binding factors, sex hormone-binding globulin (SHBG), corticosteroid-binding globulin (CBG) and cytochrome P450 family 21 subfamily A polypeptide 2, as novel p53 target genes. Their expression and secretion was increased following p53 activation in various hepatic cells. We observed that p53 wild-type mice exhibited higher levels of CBG compared with their p53 null counterparts. We demonstrated that the induction of the steroid hormones binding factors can be mediated by binding to specific p53 responsive elements within their promoters. In addition, utilizing conditioned medium experiments we have shown that p53-dependent induction of SHBG secretion from liver cells enhances apoptosis of breast cancer cells. Moreover, depletion of SHBG abolished the induction of breast cancer cells death. The newly identified p53 target genes suggest a novel non-cell-autonomous tumor-suppressive regulation mediated by p53 that is central for maintaining organism homeostasis.

  12. Novel p53 target genes secreted by the liver are involved in non-cell-autonomous regulation

    PubMed Central

    Charni, M; Molchadsky, A; Goldstein, I; Solomon, H; Tal, P; Goldfinger, N; Yang, P; Porat, Z; Lozano, G; Rotter, V

    2016-01-01

    The tumor-suppressor p53 is a transcription factor that prevents cancer development and is involved in regulation of various physiological processes. This is mediated both by induction of cell cycle arrest and apoptosis and by controlling the expression of a plethora of target genes, including secreted proteins. It has been demonstrated that p53 may exert its effect in non-cell-autonomous manner by modulating the expression of genes that encode for secreted factors. In this study, we utilized our microarray data to identify and characterize novel p53 target genes expressed in human liver cells and associated with steroid hormones processing and transfer. We identified the steroid hormones binding factors, sex hormone-binding globulin (SHBG), corticosteroid-binding globulin (CBG) and cytochrome P450 family 21 subfamily A polypeptide 2, as novel p53 target genes. Their expression and secretion was increased following p53 activation in various hepatic cells. We observed that p53 wild-type mice exhibited higher levels of CBG compared with their p53 null counterparts. We demonstrated that the induction of the steroid hormones binding factors can be mediated by binding to specific p53 responsive elements within their promoters. In addition, utilizing conditioned medium experiments we have shown that p53-dependent induction of SHBG secretion from liver cells enhances apoptosis of breast cancer cells. Moreover, depletion of SHBG abolished the induction of breast cancer cells death. The newly identified p53 target genes suggest a novel non-cell-autonomous tumor-suppressive regulation mediated by p53 that is central for maintaining organism homeostasis. PMID:26358154

  13. Status quo of p53 in the treatment of tumors.

    PubMed

    Guan, Yong-Song; He, Qing; Zou, Qing

    2016-10-01

    The p53 gene is pivotal for oncogenesis in a combination of mutations in oncogenes and antioncogenes. The ubiquitous loss of the p53 pathway in human cancers has generated considerable interest in developing p53-targeted cancer therapies, but current ideas and approaches targeting p53 are conflicting. Current researches focus on cancer-selective drugs with therapeutic strategies that both activate and inhibit p53. As p53 is ubiquitously lost in human cancers, the strategy of exogenous p53 addition is reasonable. However, p53 acts not equally in all cell types; thus, individualized p53 therapy is the direction of future research. To clarify the controversies on p53 for improvement of future antitumor studies, the review focuses on the available technological protocols, including their advantages and limitations in terms of future therapeutic use of p53 in the management of tumors.

  14. The Hippo pathway, p53 and cholesterol.

    PubMed

    Aylon, Yael; Oren, Moshe

    2016-09-01

    ASBTRACT Increased rates of cholesterol and lipid synthesis have long been recognized as important aspects of the metabolic rewiring that occurs during cancerous transformation. Many genes encoding enzymes involved in cholesterol and fatty acid biogenesis are transcriptional targets of the sterol regulatory element-binding proteins (SREBPs). The SREBPs act as a hub for metabolic and proliferation-related signals; their activity is the focus of a tug-of-war between tumor suppressors, who generally inhibit SREBP function, and oncogenes, who often promote, and rely on, SREBP activity. The Hippo pathway plays a central role in coordinating cell proliferation and organ size, whereas p53 is a crucial tumor suppressor that maintains metabolic homeostasis and orchestrates cellular stress responses. Together, the Hippo and p53 signaling pathways cooperate on multiple levels to fine-tune SREPB activity and regulate cholesterol/lipid levels. Cholesterol biosynthesis inhibitors such as statins are appealing conceptually, but have yet to show an indisputable effect on cancer development. Fortunately, the complex regulation surrounding the Hippo-p53-SREBP network potentially provides a broad interface for additional novel cancer-targeting interventions. PMID:27419353

  15. A Direct Intersection between p53 and Transforming Growth Factor β Pathways Targets Chromatin Modification and Transcription Repression of the α-Fetoprotein Gene†

    PubMed Central

    Wilkinson, Deepti S.; Ogden, Stacey K.; Stratton, Sabrina A.; Piechan, Julie L.; Nguyen, Thi T.; Smulian, George A.; Barton, Michelle Craig

    2005-01-01

    We purified the oncoprotein SnoN and found that it functions as a corepressor of the tumor suppressor p53 in the regulation of the hepatic α-fetoprotein (AFP) tumor marker gene. p53 promotes SnoN and histone deacetylase interaction at an overlapping Smad binding, p53 regulatory element (SBE/p53RE) in AFP. Comparison of wild-type and p53-null mouse liver tissue by using chromatin immunoprecipitation (ChIP) reveals that the absence of p53 protein correlates with the disappearance of SnoN at the SBE/p53RE and loss of AFP developmental repression. Treatment of AFP-expressing hepatoma cells with transforming growth factor-β1 (TGF-β1) induced SnoN transcription and Smad2 activation, concomitant with AFP repression. ChIP assays show that TGF-β1 stimulates p53, Smad4, P-Smad2 binding, and histone H3K9 deacetylation and methylation, at the SBE/p53RE. Depletion, by small interfering RNA, of SnoN and/or p53 in hepatoma cells disrupted repression of AFP transcription. These findings support a model of cooperativity between p53 and TGF-β effectors in chromatin modification and transcription repression of an oncodevelopmental tumor marker gene. PMID:15657445

  16. Ling Zhi-8 mediates p53-dependent growth arrest of lung cancer cells proliferation via the ribosomal protein S7-MDM2-p53 pathway.

    PubMed

    Wu, Chien-Ting; Lin, Tung-Yi; Hsu, Hsien-Yeh; Sheu, Fuu; Ho, Chau-Mei; Chen, Edmund I-T

    2011-12-01

    Ling Zhi-8 (LZ-8), an immunomodulatory protein, is derived from and has been cloned from the medicinal mushroom Ganoderma lucidum (Reishi or Ling Zhi); this protein exhibits immunomodulating and antitumor properties. We investigated the effects of recombinant LZ-8 protein (rLZ-8) on the proliferation of A549 human lung cancer cells. Here, we showed that rLZ-8 inhibits cell growth and that this is correlated with increased G(1) arrest. The treatment of A549 cells with rLZ-8 activated p53 and p21 expression, and both the G(1) arrest and the antigrowth effect were found to be p53 dependent. It was further demonstrated that rLZ-8 inhibited tumor growth in mice transplanted with Lewis lung carcinoma cells. Interestingly, rLZ-8 treatment was found to lead to nucleolar stress (or ribosomal stress) as evidenced by inhibition of precursor ribosomal RNA synthesis and reduced polysome formation in A549 cells. These changes resulted in an increasing binding of ribosomal protein S7 to MDM2 and a decreased interaction between MDM2 and p53. Taking these results together, we have identified a novel rLZ-8 antitumor function that positively modulates p53 via ribosomal stress and inhibits lung cancer cell growth in vitro and in vivo. Our current results suggest that rLZ-8 may have potential as a therapeutic intervention for the treatment of cancers that contain wild-type p53 and high expression of MDM2.

  17. Neoangiogenesis and p53 protein in lung cancer: their prognostic role and their relation with vascular endothelial growth factor (VEGF) expression.

    PubMed

    Fontanini, G; Vignati, S; Lucchi, M; Mussi, A; Calcinai, A; Boldrini, L; Chiné, S; Silvestri, V; Angeletti, C A; Basolo, F; Bevilacqua, G

    1997-01-01

    Following up-regulation of an angiogenesis inhibitor by the wild-type p53 protein proven recently, we have analysed on the one hand the prognostic impact of microvessel count (MC) and p53 protein overexpression in non-small-cell lung carcinoma (NSCLC) progression and, on the other hand, the inter-relation between the microvascular pattern and the p53 protein expression. Moreover, we assessed the expression of vascular endothelial growth factor (VEGF), one of the pivotal mediators of tumour angiogenesis, in order to investigate its relation to p53 protein expression and MC. Tumours from 73 patients resected for NSCLC between March 1991 and April 1992 (median follow-up 47 months, range 32-51 months) were analysed using an immunohistochemical method. In univariate analysis, MC and p53 accumulation were shown to affect metastatic nodal involvement, recurrence and death significantly. Multiple logistic regression analysis showed an important prognostic influence of MC and nodal status on overall (P = 0.0009; P = 0.01) and disease-free survival (P = 0.0001; P = 0.03). Interestingly, a strong statistical association was observed between p53 nuclear accumulation and MC (P = 0.0003). The same inter-relationship was found in non-squamous histotype (P = 0.002). When we analysed the concomitant influence of MC and p53 expression on overall survival, we were able to confirm a real predominant role of MC in comparison with p53. With regard to VEGF expression, p53-negative and lowly vascularized tumours showed a mean VEGF expression significantly lower than p53-positive and highly vascularized cancers (P = 0.02). These results underline the prognostic impact of MC and p53 protein accumulation in NSCLC and their reciprocal inter-relationship, supporting the hypothesis of a wild-type p53 regulation on the angiogenetic process through a VEGF up-regulation.

  18. A nanotechnological, molecular-modeling, and immunological approach to study the interaction of the anti-tumorigenic peptide p28 with the p53 family of proteins.

    PubMed

    Coppari, Emilia; Yamada, Tohru; Bizzarri, Anna Rita; Beattie, Craig W; Cannistraro, Salvatore

    2014-01-01

    p28 is an anionic, amphipathic, cell-penetrating peptide derived from the cupredoxin azurin that binds to the DNA-binding domain (DBD) of the tumor suppressor protein, p53, and induces a post-translational increase in the level of wild type and mutated p53 in a wide variety of human cancer cells. As p63 and p73, additional members of the p53 superfamily of proteins, also appear to be involved in the cellular response to cancer therapy and are reportedly required for p53-induced apoptosis, we asked whether p28 also binds to p63 and p73. Atomic force spectroscopy demonstrates that p28 forms a stable, high-affinity complex with full-length p63, the DBD of p63, and full-length p73. Exposure to p28 decreased the level of TAp63α and ΔNp63α, the truncated form of p63, in p53 wild type and mutated human breast cancer cells, respectively. p28 increased the level of TAp73α, but not ΔNp73α, in the same breast cancer cell lines. In contrast, p28 increased the level of the TA and ΔN isoforms of p63 in p53 wild type, but not in p53 mutated melanoma cells, while decreasing TA p73α in p53 wild type and mutated human melanoma cells. All changes were mirrored by an associated change in the expression of the HECT E3 ligases Itch/AIP4, AIP5, and the RING E3 ligase Pirh2, but not in the receptor for activated C kinase or the RING E3 ligases Mdm2 and Cop1. Collectively, the data suggest that molecules such as p28 bind with high affinity to the DBD of p63 and p73 and alter their expression independent of the Mdm2 and Cop1 pathways.

  19. Drosophila foxo acts in males to cause sexual-dimorphism in tissue-specific p53 life span effects

    PubMed Central

    Shen, Jie; Tower, John

    2009-01-01

    Sex-specific selective pressures are hypothesized to lead to sexually antagonistic gene functions that contribute to phenotypes such as aging and cancer. However, relatively little is known about the identity of such genes and possible mechanisms. Here we report that nervous system-specific over-expression of wild-type p53 in Drosophila caused decreased life span in males and increased life span in females. In contrast, tissue-general over-expression produced the opposite pattern: increased life span in males and decreased life span in females. In a foxo null background, p53 life span effects in males were reversed, becoming similar to the effects in females. In contrast, a Sir2 null background tended to reduce the magnitude of p53 effects. The data demonstrate that wild-type p53 over-expression can regulate life span independent of foxo, and suggest that foxo acts in males to produce sexually antagonistic life span effects of p53. PMID:19840842

  20. EDD induces cell cycle arrest by increasing p53 levels.

    PubMed

    Smits, Veronique A J

    2012-02-15

    Tight regulation of p53 is essential for its central role in maintaining genome stability and tumor prevention. Here, EDD/ UBR5/hHyd, hereafter called EDD, is identified as a novel regulator of p53. Downregulation of EDD results in elevated p53 protein levels both in transformed and untransformed cells. Concomitant with a rise in p53, the levels of p21, a critical p53 target, are also elevated in these conditions. Surprisingly, EDD knockdown does not affect p53 protein stability, and p53 mRNA levels do not increase significantly upon EDD depletion. Consistent with the function of p53, EDD downregulation triggers a senescent phenotype in fibroblasts at later time points. In addition, the increased p53 levels upon EDD depletion cause a G(1) arrest, as co-depletion of EDD and p53 completely rescues this effect on cell cycle progression. PMID:22374670

  1. A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53.

    PubMed

    Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena; Spiotto, Michael T

    2016-01-01

    p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways.

  2. A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53

    PubMed Central

    Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena

    2016-01-01

    p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407

  3. A High-Throughput Cell-Based Screen Identified a 2-[(E)-2-Phenylvinyl]-8-Quinolinol Core Structure That Activates p53.

    PubMed

    Bechill, John; Zhong, Rong; Zhang, Chen; Solomaha, Elena; Spiotto, Michael T

    2016-01-01

    p53 function is frequently inhibited in cancer either through mutations or by increased degradation via MDM2 and/or E6AP E3-ubiquitin ligases. Most agents that restore p53 expression act by binding MDM2 or E6AP to prevent p53 degradation. However, fewer compounds directly bind to and activate p53. Here, we identified compounds that shared a core structure that bound p53, caused nuclear localization of p53 and caused cell death. To identify these compounds, we developed a novel cell-based screen to redirect p53 degradation to the Skip-Cullin-F-box (SCF) ubiquitin ligase complex in cells expressing high levels of p53. In a multiplexed assay, we coupled p53 targeted degradation with Rb1 targeted degradation in order to identify compounds that prevented p53 degradation while not inhibiting degradation through the SCF complex or other proteolytic machinery. High-throughput screening identified several leads that shared a common 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that stabilized p53. Surface plasmon resonance analysis indicated that these compounds bound p53 with a KD of 200 ± 52 nM. Furthermore, these compounds increased p53 nuclear localization and transcription of the p53 target genes PUMA, BAX, p21 and FAS in cancer cells. Although p53-null cells had a 2.5±0.5-fold greater viability compared to p53 wild type cells after treatment with core compounds, loss of p53 did not completely rescue cell viability suggesting that compounds may target both p53-dependent and p53-independent pathways to inhibit cell proliferation. Thus, we present a novel, cell-based high-throughput screen to identify a 2-[(E)-2-phenylvinyl]-8-quinolinol core structure that bound to p53 and increased p53 activity in cancer cells. These compounds may serve as anti-neoplastic agents in part by targeting p53 as well as other potential pathways. PMID:27124407

  4. The combination of 5-fluorouracil plus p53 pathway restoration is associated with depletion of p53-deficient or mutant p53-expressing putative colon cancer stem cells.

    PubMed

    Huang, Catherine; Zhang, Xiang M; Tavaluc, Raluca T; Hart, Lori S; Dicker, David T; Wang, Wenge; El-Deiry, Wafik S

    2009-11-01

    The cancer stem cell hypothesis suggests that rare populations of tumor-initiating cells may be resistant to therapy, lead to tumor relapse and contribute to poor prognosis for cancer patients. We previously demonstrated the feasibility of p53 pathway restoration in p53-deficient tumor cell populations using small molecules including ellipticine or its derivatives. We now establish a single cell p53-regulated green fluorescent protein (EGFP)-reporter system in human DLD1 colon tumor cells expressing mutant p53 protein. We use these p53-EGFP reporter DLD1 cells to investigate the status of p53 transcriptional activity in putative colon cancer stem cell populations following exposure to p53 pathway-restoring drugs and/or classical chemotherapy. We demonstrate induction of p53-specific EGFP reporter fluorescence following overexpression of p53 family member p73 by an Adenovirus vector. We further show that p53-reporter activity is induced in DLD1 putative cancer stem cell side-populations analyzed by their Hoechst dye efflux properties following treatment with the p53 pathway restoring drug ellipticine. Combination of ellipticine with the cytotoxic agent 5-fluorouracil resulted in increased cytotoxicity as compared to either agent alone and this was associated with depletion of putative cancer stem cell populations as compared with 5-FU alone treatment. Our results support the feasibility of therapeutic targeting of mutant p53 in putative cancer stem cells as well as the potential to enhance cytotoxic chemotherapy. PMID:19923910

  5. Ferroptosis: A missing puzzle piece in the p53 blueprint?

    PubMed

    Wang, Shang-Jui; Ou, Yang; Jiang, Le; Gu, Wei

    2016-05-01

    Recent evidence indicates that canonical functions of p53 (i.e., apoptosis and growth arrest) are dispensable for p53-mediated tumor suppression. We have uncovered a novel function of p53 that contributes to tumor suppression through regulation of cystine metabolism, reactive oxygen species responses, and ferroptosis. The p53-mediated ferroptotic response via SLC7A11 denotes an extra layer of defense against tumorigenesis in conjunction with other p53 functions. PMID:27314071

  6. Critical roles of DMP1 in human epidermal growth factor receptor 2/neu-Arf-p53 signaling and breast cancer development.

    PubMed

    Taneja, Pankaj; Maglic, Dejan; Kai, Fumitake; Sugiyama, Takayuki; Kendig, Robert D; Frazier, Donna P; Willingham, Mark C; Inoue, Kazushi

    2010-11-15

    Human epidermal growth factor receptor 2 (HER2) overexpression stimulates cell growth in p53-mutated cells while it inhibits cell proliferation in those with wild-type p53, but the molecular mechanism is unknown. The Dmp1 promoter was activated by HER2/neu through the phosphatidylinositol-3'-kinase-Akt-NF-κB pathway, which in turn stimulated Arf transcription. Binding of p65 and p52 subunits of NF-κB was shown to the Dmp1 promoter and that of Dmp1 to the Arf promoter on HER2/neu overexpression. Both Dmp1 and p53 were induced in premalignant lesions from mouse mammary tumor virus-neu mice, and mammary tumorigenesis was significantly accelerated in both Dmp1+/- and Dmp1-/- mice. Selective deletion of Dmp1 and/or overexpression of Tbx2/Pokemon was found in >50% of wild-type HER2/neu carcinomas, although the involvement of Arf, Mdm2, or p53 was rare. Tumors from Dmp1+/-, Dmp1-/-, and wild-type neu mice with hemizygous Dmp1 deletion showed significant downregulation of Arf and p21Cip1/WAF1, showing p53 inactivity and more aggressive phenotypes than tumors without Dmp1 deletion. Notably, endogenous hDMP1 mRNA decreased when HER2 was depleted in human breast cancer cells. Our study shows the pivotal roles of Dmp1 in HER2/neu-p53 signaling and breast carcinogenesis. PMID:21062982

  7. Critical roles of DMP1 in human epidermal growth factor receptor 2/neu-Arf-p53 signaling and breast cancer development.

    PubMed

    Taneja, Pankaj; Maglic, Dejan; Kai, Fumitake; Sugiyama, Takayuki; Kendig, Robert D; Frazier, Donna P; Willingham, Mark C; Inoue, Kazushi

    2010-11-15

    Human epidermal growth factor receptor 2 (HER2) overexpression stimulates cell growth in p53-mutated cells while it inhibits cell proliferation in those with wild-type p53, but the molecular mechanism is unknown. The Dmp1 promoter was activated by HER2/neu through the phosphatidylinositol-3'-kinase-Akt-NF-κB pathway, which in turn stimulated Arf transcription. Binding of p65 and p52 subunits of NF-κB was shown to the Dmp1 promoter and that of Dmp1 to the Arf promoter on HER2/neu overexpression. Both Dmp1 and p53 were induced in premalignant lesions from mouse mammary tumor virus-neu mice, and mammary tumorigenesis was significantly accelerated in both Dmp1+/- and Dmp1-/- mice. Selective deletion of Dmp1 and/or overexpression of Tbx2/Pokemon was found in >50% of wild-type HER2/neu carcinomas, although the involvement of Arf, Mdm2, or p53 was rare. Tumors from Dmp1+/-, Dmp1-/-, and wild-type neu mice with hemizygous Dmp1 deletion showed significant downregulation of Arf and p21Cip1/WAF1, showing p53 inactivity and more aggressive phenotypes than tumors without Dmp1 deletion. Notably, endogenous hDMP1 mRNA decreased when HER2 was depleted in human breast cancer cells. Our study shows the pivotal roles of Dmp1 in HER2/neu-p53 signaling and breast carcinogenesis.

  8. Induction of PPM1D following DNA-damaging treatments through a conserved p53 response element coincides with a shift in the use of transcription initiation sites

    SciTech Connect

    Rossi, M.; Anderson, C.; Demidov, O. N.; Appella, E.; Mazur, S. J.

    2008-12-01

    PPM1D (Wip1), a type PP2C phosphatase, is expressed at low levels in most normal tissues but is overexpressed in several types of cancers. In cells containing wild-type p53, the levels of PPM1D mRNA and protein increase following exposure to genotoxic stress, but the mechanism of regulation by p53 was unknown. PPM1D also has been identified as a CREB-regulated gene due to the presence of a cyclic AMP response element (CRE) in the promoter. Transient transfection and chromatin immunoprecipitation experiments in HCT116 cells were used to characterize a conserved p53 response element located in the 5' untranslated region (UTR) of the PPM1D gene that is required for the p53-dependent induction of transcription from the human PPM1D promoter. CREB binding to the CRE contributes to the regulation of basal expression of PPM1D and directs transcription initiation at upstream sites. Following exposure to ultraviolet (UV) or ionizing radiation, the abundance of transcripts with short 5' UTRs increased in cells containing wild-type p53, indicating increased utilization of downstream transcription initiation sites. In cells containing wild-type p53, exposure to UV resulted in increased PPM1D protein levels even when PPM1D mRNA levels remained constant, indicating post-transcriptional regulation of PPM1D protein levels.

  9. Discovery of Highly Potent p53-MDM2 Antagonists and Structural Basis for Anti-Acute Myeloid Leukemia Activities

    PubMed Central

    2015-01-01

    The inhibition of p53-MDM2 interaction is a promising new approach to non-genotoxic cancer treatment. A potential application for drugs blocking the p53-MDM2 interaction is acute myeloid leukemia (AML) due to the occurrence of wild type p53 (wt p53) in the majority of patients. Although there are very promising preclinical results of several p53-MDM2 antagonists in early development, none of the compounds have yet proven the utility as a next generation anticancer agent. Herein we report the design, synthesis and optimization of YH239-EE (ethyl ester of the free carboxylic acid compound YH239), a potent p53-MDM2 antagonizing and apoptosis-inducing agent characterized by a number of leukemia cell lines as well as patient-derived AML blast samples. The structural basis of the interaction between MDM2 (the p53 receptor) and YH239 is elucidated by a co-crystal structure. YH239-EE acts as a prodrug and is the most potent compound that induces apoptosis in AML cells and patient samples. The observed superior activity compared to reference compounds provides the preclinical basis for further investigation and progression of YH239-EE. PMID:24405416

  10. New insights into the anticancer activity of carnosol: p53 reactivation in the U87MG human glioblastoma cell line.

    PubMed

    Giacomelli, Chiara; Natali, Letizia; Trincavelli, Maria Letizia; Daniele, Simona; Bertoli, Alessandra; Flamini, Guido; Braca, Alessandra; Martini, Claudia

    2016-05-01

    Glioblastoma multiforme (GBM) is an aggressive brain tumour with high resistance to radio- and chemotherapy. As such, increasing attention has focused on developing new therapeutic strategies to improve treatment responses. Recently, attention has been shifted to natural compounds that are able to halt tumour development. Among them, carnosol (CAR), a phenolic diterpene present in rosemary, has become a promising molecule that is able to prevent certain types of solid cancer. However, no data are available on the effects of CAR in GBM. Here, CAR activity decreased the proliferation of different human glioblastoma cell lines, particularly cells that express wild type p53. The p53 pathway is involved in the control of apoptosis and is often impaired in GBM. Notably, CAR, through the dissociation of p53 from its endogenous inhibitor MDM2, was able to increase the intracellular p53 levels in GBM cells. Accordingly, functional reactivation of p53 was demonstrated by the stimulation of p53 target genes' transcription, the induction of apoptosis and cell cycle blockade. Most importantly, CAR produced synergistic effects with temozolomide (TMZ) and reduced the restoration of the tumour cells' proliferation after drug removal. Thus, for the first time, these data highlighted the potential use of the diterpene in the sensitization of GBM cells to chemotherapy through a direct re-activation of p53 pathway. Furthermore, progress has been made in delineating the biochemical mechanisms underlying the pro-apoptotic effects of this molecule. PMID:26939786

  11. Paclitaxel/Taxol sensitivity in human renal cell carcinoma is not determined by the p53 status.

    PubMed

    Reinecke, Petra; Kalinski, Thomas; Mahotka, Csaba; Schmitz, Michael; Déjosez, Marion; Gabbert, Helmut Erich; Gerharz, Claus Dieter

    2005-05-26

    In this study, we analyzed the role of the p53 status for paclitaxel/Taxol sensitivity in renal cell carcinomas (RCCs) of the clear cell type. Using immunohistochemistry, nuclear p53 accumulation could not be correlated to the paclitaxel/Taxol sensitivity. DNA sequencing detected a p53 gene mutation in two out of eight RCC cell lines, i.e. in exon 8 (cell line clearCa-6), and in exon 9 (cell line clearCa-5). No correlation, however, was found between the p53 status of our RCC cell lines and their paclitaxel/Taxol sensitivity as indicated by the IC50 values. However, paclitaxel-induced growth inhibition in paclitaxel-sensitive RCC cell lines was accompanied by an increase in apoptosis, irrespective of their p53 status. Although CD95 up-regulation was observed in renal cell carcinoma with wild-type p53 upon paclitaxel treatment, paclitaxel-induced apoptosis itself is triggered independently from the CD95 system. In conclusion, the p53 status cannot predict paclitaxel/Taxol sensitivity in RCC cell lines of the clear cell type.

  12. p53 and ATF4 mediate distinct and additive pathways to skeletal muscle atrophy during limb immobilization.

    PubMed

    Fox, Daniel K; Ebert, Scott M; Bongers, Kale S; Dyle, Michael C; Bullard, Steven A; Dierdorff, Jason M; Kunkel, Steven D; Adams, Christopher M

    2014-08-01

    Immobilization causes skeletal muscle atrophy via complex signaling pathways that are not well understood. To better understand these pathways, we investigated the roles of p53 and ATF4, two transcription factors that mediate adaptations to a variety of cellular stresses. Using mouse models, we demonstrate that 3 days of muscle immobilization induces muscle atrophy and increases expression of p53 and ATF4. Furthermore, muscle fibers lacking p53 or ATF4 are partially resistant to immobilization-induced muscle atrophy, and forced expression of p53 or ATF4 induces muscle fiber atrophy in the absence of immobilization. Importantly, however, p53 and ATF4 do not require each other to promote atrophy, and coexpression of p53 and ATF4 induces more atrophy than either transcription factor alone. Moreover, muscle fibers lacking both p53 and ATF4 are more resistant to immobilization-induced atrophy than fibers lacking only p53 or ATF4. Interestingly, the independent and additive nature of the p53 and ATF4 pathways allows for combinatorial control of at least one downstream effector, p21. Using genome-wide mRNA expression arrays, we identified p21 mRNA as a skeletal muscle transcript that is highly induced in immobilized muscle via the combined actions of p53 and ATF4. Additionally, in mouse muscle, p21 induces atrophy in a manner that does not require immobilization, p53 or ATF4, and p21 is required for atrophy induced by immobilization, p53, and ATF4. Collectively, these results identify p53 and ATF4 as essential and complementary mediators of immobilization-induced muscle atrophy and discover p21 as a critical downstream effector of the p53 and ATF4 pathways.

  13. Mutant p53 promotes ovarian cancer cell adhesion to mesothelial cells via integrin β4 and Akt signals

    PubMed Central

    Lee, Jong-Gyu; Ahn, Ji-Hye; Jin Kim, Tae; Ho Lee, Jae; Choi, Jung-Hye

    2015-01-01

    Missense mutations in the TP53 gene resulting in the accumulation of mutant proteins are extremely common in advanced ovarian cancer, which is characterised by peritoneal metastasis. Attachment of cancer cells to the peritoneal mesothelium is regarded as an initial, key step for the metastatic spread of ovarian cancer. In the present study, we investigated the possible role of a p53 mutant in the mesothelial adhesion of ovarian cancer cells. We found that OVCAR-3 cells with the R248 TP53 mutation (p53R248) were more adhesive to mesothelial Met5A cells than were A2780 cells expressing wild-type p53. In addition, ectopic expression of p53R248 in p53-null SKOV-3 cells significantly increased adhesion to Met5A cells. Knockdown of mutant p53 significantly compromised p53R248-induced cell adhesion to Met5A cells. Microarray analysis revealed that several adhesion-related genes, including integrin β4, were markedly up-regulated, and certain signalling pathways, including PI3K/Akt, were activated in p53R248 transfectants of SKOV-3 cells. Inhibition of integrin β4 and Akt signalling using blocking antibody and the inhibitor LY294002, respectively, significantly attenuated p53R248-mediated ovarian cancer-mesothelial adhesion. These data suggest that the p53R248 mutant endows ovarian cancer cells with increased adhesiveness and that integrin β4 and Akt signalling are associated with the mutation-enhanced ovarian cancer-mesothelial cell adhesion. PMID:26223322

  14. A limited role for p53 in modulating the immediate phenotype of Apc loss in the intestine

    PubMed Central

    Reed, Karen R; Meniel, Valerie S; Marsh, Victoria; Cole, Alicia; Sansom, Owen J; Clarke, Alan R

    2008-01-01

    Background p53 is an important tumour suppressor with a known role in the later stages of colorectal cancer, but its relevance to the early stages of neoplastic initiation remains somewhat unclear. Although p53-dependent regulation of Wnt signalling activity is known to occur, the importance of these regulatory mechanisms during the early stages of intestinal neoplasia has not been demonstrated. Methods We have conditionally deleted the Adenomatous Polyposis coli gene (Apc) from the adult murine intestine in wild type and p53 deficient environments and subsequently compared the phenotype and transcriptome profiles in both genotypes. Results Expression of p53 was shown to be elevated following the conditional deletion of Apc in the adult small intestine. Furthermore, p53 status was shown to impact on the transcription profile observed following Apc loss. A number of key Wnt pathway components and targets were altered in the p53 deficient environment. However, the aberrant phenotype observed following loss of Apc (rapid nuclear localisation of β-catenin, increased levels of DNA damage, nuclear atypia, perturbed cell death, proliferation, differentiation and migration) was not significantly altered by the absence of p53. Conclusion p53 related feedback mechanisms regulating Wnt signalling activity are present in the intestine, and become activated following loss of Apc. However, the physiological Wnt pathway regulation by p53 appears to be overwhelmed by Apc loss and consequently the activity of these regulatory mechanisms is not sufficient to modulate the immediate phenotypes seen following Apc loss. Thus we are able to provide an explanation to the apparent contradiction that, despite having a Wnt regulatory capacity, p53 loss is not associated with early lesion development. PMID:18533991

  15. p53 contributes to T cell homeostasis through the induction of pro-apoptotic SAP.

    PubMed

    Madapura, Harsha S; Salamon, Daniel; Wiman, Klas G; Lain, Sonia; Klein, George; Klein, Eva; Nagy, Noémi

    2012-12-15

    Lack of functional SAP protein, due to gene deletion or mutation, is the cause of X-linked lymphoproliferative disease (XLP), characterized by functionally impaired T and NK cells and a high risk of lymphoma development. We have demonstrated earlier that SAP has a pro-apoptotic function in T and B cells. Deficiency of this function might contribute to the pathogenesis of XLP. We have also shown that SAP is a target of p53 in B cell lines. In the present study, we show that activated primary T cells express p53, which induces SAP expression. p53 is functional as a transcription factor in activated T cells and induces the expression of p21, PUMA and MDM2. PARP cleavage in the late phase of activation indicates that T cells expressing high levels of SAP undergo apoptosis. Modifying p53 levels using Nutlin-3, which specifically dissociates the MDM2-p53 interaction, was sufficient to upregulate SAP expression, indicating that SAP is a target of p53 in T cells. We also demonstrated p53's role as a transcription factor for SAP in activated T cells by ChIP assays. Our result suggests that p53 contributes to T cell homeostasis through the induction of the pro-apoptotic SAP. A high level of SAP is necessary for the activation-induced cell death that is pivotal in termination of the T cell response.

  16. Peroxiredoxin 2 battles PARP1- and p53-dependent pro-death pathways following ischemic injury

    PubMed Central

    Leak, Rehana K.; Zhang, Lili; Luo, Yumin; Li, Peiying; Zhao, Haiping; Liu, Xiangrong; Ling, Feng; Jia, Jianping; Chen, Jun; Ji, Xunming

    2013-01-01

    Background and Purpose Ischemic/reperfusion neuronal injury is characterized by accumulation of reactive oxygen species (ROS) and oxidative DNA damage, which can trigger cell death by various signaling pathways. Two of these modes of death include poly(ADP-ribose) polymerase 1 (PARP1)-mediated death or p53- and Bax-mediated apoptosis. The present study tested the hypothesis that peroxiredoxin2 (PRX2) attenuates DNA damage-mediated pro-death signaling using in vitro and in vivo models of ischemic injury. The impact of this peroxide scavenger on p53- and PARP1-mediated ischemic death is unknown. Methods Neuronal PRX2 overexpression in primary cortical cultures and transgenic mice was combined with the PARP1 inhibitor AG14361. AG14361 was also applied to p53 and Bax knockout cultures and mice and combined with the JNK inhibitor SP600125. DCF fluorescence, AP sites, single-strand breaks, Comet tail-length, NAD+ depletion, and viability were assessed in response to oxygen-glucose deprivation in cultures or transient focal cerebral ischemia in mice. Results PRX2 attenuated ROS, DNA damage, NAD+ depletion, and cell death. PRX2 knockdown exacerbated neuronal death following OGD. PRX2 ameliorated PARP1, p53, Bax, and caspase activation following ischemia. AG14361 reduced ischemic cell death in wild-type and p53 or Bax knockout cultures and animals but had no additional effect in PRX2-overexpressing mice. AG14361 and p53 knockout elicited additive effects with SP600125 on viability in vitro. Our findings support the existence of multiple parallel pro-death pathways with some crosstalk. Conclusions The promising therapeutic candidate PRX2 can clamp upstream DNA damage and efficiently inhibit multiple pro-death cascades operating in both parallel and interactive fashions. PMID:23429506

  17. Requirement of p53 targets in chemosensitization of colonic carcinoma to death ligand therapy.

    PubMed

    Wang, Shulin; El-Deiry, Wafik S

    2003-12-01

    Tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) exhibits specific tumoricidal activity and is under development for cancer therapy. Mismatch-repair-deficient colonic tumors evade TRAIL-induced apoptosis through mutational inactivation of Bax, but chemotherapeutics including Camptosar (CPT-11) restore TRAIL sensitivity. However, the signaling pathways in restoring TRAIL sensitivity remain to be elucidated. Here, we imaged p53 transcriptional activity in Bax-/- carcinomas by using bioluminescence, in vivo, and find that p53 is required for sensitization to TRAIL by CPT-11. Small interfering RNAs directed at proapoptotic p53 targets reveal TRAIL receptor KILLER/DR5 contributes significantly to TRAIL sensitization, whereas Bak plays a minor role. Caspase 8 inhibition protects both CPT-11 pretreated wild-type and Bax-/- HCT116 cells from TRAIL-induced apoptosis, whereas caspase 9 inhibition only rescued the wild-type HCT116 cells from death induced by TRAIL. The results suggest a conversion in the apoptotic mechanism in HCT116 colon carcinoma from a type II pathway involving Bax and the mitochondria to a type I pathway involving efficient extrinsic pathway caspase activation. In contrast to Bax-/- cells, Bak-deficient human cancers undergo apoptosis in response to TRAIL or CPT-11, implying that these proteins have nonoverlapping functions. Our studies elucidate a mechanism for restoration of TRAIL sensitivity in MMR-deficient Bax-/- human cancers through p53-dependent activation of KILLER/DR5 and reconstitution of a type I death pathway. Efforts to identify agents that up-regulate DR5 may be useful in cancer therapies restoring TRAIL sensitivity. PMID:14645705

  18. Harnessing the p53-PUMA Axis to Overcome DNA Damage Resistance in Renal Cell Carcinoma1

    PubMed Central

    Zhou, Xiaoguang; Tolstov, Yanis; Arslan, Aysenur; Roth, Wilfried; Grüllich, Carsten; Pahernik, Sascha; Hohenfellner, Markus; Duensing, Stefan

    2014-01-01

    Resistance to DNA damage–induced apoptosis is a hallmark of cancer and a major cause of treatment failure and lethal disease outcome. A tumor entity that is largely resistant to DNA-damaging therapies including chemo- or radiotherapy is renal cell carcinoma (RCC). This study was designed to explore the underlying molecular mechanisms of DNA damage resistance in RCC to develop strategies to resensitize tumor cells to DNA damage–induced apoptosis. Here, we show that apoptosis-resistant RCC cells have a disconnect between activation of p53 and upregulation of the downstream proapoptotic protein p53 upregulated modulator of apoptosis (PUMA). We demonstrate that this disconnect is not caused by gene-specific repression through CCCTC-binding factor (CTCF) but instead by aberrant chromatin compaction. Treatment with an HDAC inhibitor was found to effectively reactivate PUMA expression on the mRNA and protein level and to revert resistance to DNA damage–induced cell death. Ectopic expression of PUMA was found to resensitize a panel of RCC cell lines to four different DNA-damaging agents tested. Remarkably, all RCC cell lines analyzed were wild-type for p53, and a knockdown was likewise able to sensitize RCC cells to acute genotoxic stress. Taken together, our results indicate that DNA damage resistance in RCC is reversible, involves the p53-PUMA axis, and is potentially targetable to improve the oncological outcomes of RCC patients. PMID:25499216

  19. {sub p}53-Dependent Adaptive Responses in Human Cells Exposed to Space Radiations

    SciTech Connect

    Takahashi, Akihisa; Su Xiaoming; Suzuki, Hiromi; Omori, Katsunori; Seki, Masaya; Hashizume, Toko; Shimazu, Toru; Ishioka, Noriaki; Iwasaki, Toshiyasu; Ohnishi, Takeo

    2010-11-15

    Purpose: It has been reported that priming irradiation or conditioning irradiation with a low dose of X-rays in the range of 0.02-0.1 Gy induces a p53-dependent adaptive response in mammalian cells. The aim of the present study was to clarify the effect of space radiations on the adaptive response. Methods and Materials: Two human lymphoblastoid cell lines were used; one cell line bears a wild-type p53 (wtp53) gene, and another cell line bears a mutated p53 (mp53) gene. The cells were frozen during transportation on the space shuttle and while in orbit in the International Space Station freezer for 133 days between November 15, 2008 and March 29, 2009. After the frozen samples were returned to Earth, the cells were cultured for 6 h and then exposed to a challenging X-ray-irradiation (2 Gy). Cellular sensitivity, apoptosis, and chromosome aberrations were scored using dye-exclusion assays, Hoechst33342 staining assays, and chromosomal banding techniques, respectively. Results: In cells exposed to space radiations, adaptive responses such as the induction of radioresistance and the depression of radiation-induced apoptosis and chromosome aberrations were observed in wtp53 cells but not in mp53 cells. Conclusion: These results have confirmed the hypothesis that p53-dependent adaptive responses are apparently induced by space radiations within a specific range of low doses. The cells exhibited this effect owing to space radiations exposure, even though the doses in space were very low.

  20. Activation of p53 Facilitates the Target Search in DNA by Enhancing the Target Recognition Probability.

    PubMed

    Itoh, Yuji; Murata, Agato; Sakamoto, Seiji; Nanatani, Kei; Wada, Takehiko; Takahashi, Satoshi; Kamagata, Kiyoto

    2016-07-17

    Tumor suppressor p53 binds to the target in a genome and regulates the expression of downstream genes. p53 searches for the target by combining three-dimensional diffusion and one-dimensional sliding along the DNA. To examine the regulation mechanism of the target binding, we constructed the pseudo-wild type (pseudo-WT), activated (S392E), and inactive (R248Q) mutants of p53 and observed their target binding in long DNA using single-molecule fluorescence imaging. The pseudo-WT sliding along the DNA showed many pass events over the target and possessed target recognition probability (TRP) of 7±2%. The TRP increased to 18±2% for the activated mutant but decreased to 0% for the inactive mutant. Furthermore, the fraction of the target binding by the one-dimensional sliding among the total binding events increased from 63±9% for the pseudo-WT to 87±2% for the activated mutant. Control of TRP upon activation, as demonstrated here for p53, might be a general activation mechanism of transcription factors.

  1. A rare DNA contact mutation in cancer confers p53 gain-of-function and tumor cell survival via TNFAIP8 induction.

    PubMed

    Monteith, Jessica A; Mellert, Hestia; Sammons, Morgan A; Kuswanto, Laudita A; Sykes, Stephen M; Resnick-Silverman, Lois; Manfredi, James J; Berger, Shelley L; McMahon, Steven B

    2016-10-01

    The p53 tumor suppressor gene encodes a sequence-specific transcription factor. Mutations in the coding sequence of p53 occur frequently in human cancer and often result in single amino acid substitutions (missense mutations) in the DNA binding domain (DBD), blocking normal tumor suppressive functions. In addition to the loss of canonical functions, some missense mutations in p53 confer gain-of-function (GOF) activities to tumor cells. While many missense mutations in p53 cluster at six "hotspot" amino acids, the majority of mutations in human cancer occur elsewhere in the DBD and at a much lower frequency. We report here that mutations at K120, a non-hotspot DNA contact residue, confer p53 with the previously unrecognized ability to bind and activate the transcription of the pro-survival TNFAIP8 gene. Mutant K120 p53 binds the TNFAIP8 locus at a cryptic p53 response element that is not occupied by wild-type p53. Furthermore, induction of TNFAIP8 is critical for the evasion of apoptosis by tumor cells expressing the K120R variant of p53. These findings identify induction of pro-survival targets as a mechanism of gain-of-function activity for mutant p53 and will likely broaden our understanding of this phenomenon beyond the limited number of GOF activities currently reported for hotspot mutants.

  2. Changes in O-Linked N-Acetylglucosamine (O-GlcNAc) Homeostasis Activate the p53 Pathway in Ovarian Cancer Cells.

    PubMed

    de Queiroz, Rafaela Muniz; Madan, Rashna; Chien, Jeremy; Dias, Wagner Barbosa; Slawson, Chad

    2016-09-01

    O-GlcNAcylation is a dynamic post-translational modification consisting of the addition of a single N-acetylglucosamine sugar to serine and threonine residues in proteins by the enzyme O-linked β-N-acetylglucosamine transferase (OGT), whereas the enzyme O-GlcNAcase (OGA) removes the modification. In cancer, tumor samples present with altered O-GlcNAcylation; however, changes in O-GlcNAcylation are not consistent between tumor types. Interestingly, the tumor suppressor p53 is modified by O-GlcNAc, and most solid tumors contain mutations in p53 leading to the loss of p53 function. Because ovarian cancer has a high frequency of p53 mutation rates, we decided to investigate the relationship between O-GlcNAcylation and p53 function in ovarian cancer. We measured a significant decrease in O-GlcNAcylation of tumor tissue in an ovarian tumor microarray. Furthermore, O-GlcNAcylation was increased, and OGA protein and mRNA levels were decreased in ovarian tumor cell lines not expressing the protein p53. Treatment with the OGA inhibitor Thiamet-G (TMG), silencing of OGA, or overexpression of OGA and OGT led to p53 stabilization, increased nuclear localization, and increased protein and mRNA levels of p53 target genes. These data suggest that changes in O-GlcNAc homeostasis activate the p53 pathway. Combination treatment of the chemotherapeutic cisplatin with TMG decreased tumor cell growth and enhanced cell cycle arrest without impairing cytotoxicity. The effects of TMG on tumor cell growth were partially dependent on wild type p53 activation. In conclusion, changes in O-GlcNAc homeostasis activate the wild type p53 pathway in ovarian cancer cells, and OGA inhibition has the potential as an adjuvant treatment for ovarian carcinoma. PMID:27402830

  3. Changes in O-Linked N-Acetylglucosamine (O-GlcNAc) Homeostasis Activate the p53 Pathway in Ovarian Cancer Cells.

    PubMed

    de Queiroz, Rafaela Muniz; Madan, Rashna; Chien, Jeremy; Dias, Wagner Barbosa; Slawson, Chad

    2016-09-01

    O-GlcNAcylation is a dynamic post-translational modification consisting of the addition of a single N-acetylglucosamine sugar to serine and threonine residues in proteins by the enzyme O-linked β-N-acetylglucosamine transferase (OGT), whereas the enzyme O-GlcNAcase (OGA) removes the modification. In cancer, tumor samples present with altered O-GlcNAcylation; however, changes in O-GlcNAcylation are not consistent between tumor types. Interestingly, the tumor suppressor p53 is modified by O-GlcNAc, and most solid tumors contain mutations in p53 leading to the loss of p53 function. Because ovarian cancer has a high frequency of p53 mutation rates, we decided to investigate the relationship between O-GlcNAcylation and p53 function in ovarian cancer. We measured a significant decrease in O-GlcNAcylation of tumor tissue in an ovarian tumor microarray. Furthermore, O-GlcNAcylation was increased, and OGA protein and mRNA levels were decreased in ovarian tumor cell lines not expressing the protein p53. Treatment with the OGA inhibitor Thiamet-G (TMG), silencing of OGA, or overexpression of OGA and OGT led to p53 stabilization, increased nuclear localization, and increased protein and mRNA levels of p53 target genes. These data suggest that changes in O-GlcNAc homeostasis activate the p53 pathway. Combination treatment of the chemotherapeutic cisplatin with TMG decreased tumor cell growth and enhanced cell cycle arrest without impairing cytotoxicity. The effects of TMG on tumor cell growth were partially dependent on wild type p53 activation. In conclusion, changes in O-GlcNAc homeostasis activate the wild type p53 pathway in ovarian cancer cells, and OGA inhibition has the potential as an adjuvant treatment for ovarian carcinoma.

  4. P53 licensed to kill? Operating the assassin.

    PubMed

    Haupt, Susan; Louria-Hayon, Igal; Haupt, Ygal

    2003-01-01

    The p53 protein is a key player in the cellular response to stress. Proper regulation of p53 is imperative for the suppression of tumor development. This regulation is largely governed by its master inhibitor, Mdm2, which both blocks p53 activities and promotes its destabilization. This tight regulation of p53 by Mdm2 must be interrupted under stress conditions in order for p53 to be stabilized in an active form. A combined action of partner proteins and modifying enzymes is essential for the relief of p53 from Mdm2. The recent revelation of p53 association with the PML-nuclear bodies provides one explanation of how this regulatory network is coordinated within the nucleus in response to certain stress conditions. Thus, it is not only the nature of the p53 regulatory complex but also the spatial and temporal context of this association that governs the output inhibitory signals mediated by p53. PMID:12461776

  5. The dichotomy of p53 regulation by noncoding RNAs.

    PubMed

    Deng, Qipan; Becker, Lindsey; Ma, Xiaodong; Zhong, Xiaoming; Young, Ken; Ramos, Kenneth; Li, Yong

    2014-06-01

    The p53 tumor suppressor gene is the most frequently mutated gene in cancer. Significant progress has been made to discern the importance of p53 in coordinating cellular responses to DNA damage, oncogene activation, and other stresses. Noncoding RNAs are RNA molecules functioning without being translated into proteins. In this work, we discuss the dichotomy of p53 regulation by noncoding RNAs with four unconventional questions. First, is overexpression of microRNAs responsible for p53 inactivation in the absence of p53 mutation? Second, are there somatic mutations in the noncoding regions of the p53 gene? Third, is there a germline mutant in the noncoding regions of the p53 gene that predisposes carriers to cancer? Fourth, can p53 activation mediated by a noncoding RNA mutation cause cancer? This work highlights the prominence of noncoding RNAs in p53 dysregulation and tumorigenesis. PMID:24706938

  6. Unfolding, aggregation, and amyloid formation by the tetramerization domain from mutant p53 associated with lung cancer†

    PubMed Central

    Higashimoto, Yuichiro; Asanomi, Yuya; Takakusagi, Satoru; Lewis, Marc S.; Uosaki, Kohei; Durell, Stewart R.; Anderson, Carl W.; Appella, Ettore; Sakaguchi, Kazuyasu

    2008-01-01

    The p53 tumor suppressor is a tetrameric transcriptional enhancer, and its activity is compromised by mutations that cause amino acid substitutions in its tetramerization domain. Here we analyze the biochemical and biophysical properties of peptides corresponding to amino acids 319 to 358 of wild-type human p53, which includes the tetramerization domain, and that of a cancer-derived mutant with valine substituted for glycine 334. Unlike the wild-type peptide, the G334V peptide forms amyloid fibrils by a two step process under physiological conditions of temperature and pH. Nevertheless, the G334V peptide is capable of forming hetero-oligomers with a wild-type peptide. Computational modeling of the G334V peptide structure suggests that substitution of valine for glycine 334 causes a local distortion that contributes to a β-dominated structural transition leading to amyloid formation. Since the distortion is mostly on the surface, the mutant peptide is still able to form a pseudo-native tetramer complex at higher concentrations and/or lower temperatures. Our study suggests a new potential mechanism by which mutations that compromise tetramer formation inactivate p53 as a tumor suppressor. PMID:16460008

  7. Volatile Oil of Acori Graminei Rhizoma-Induced Apoptosis and Autophagy are dependent on p53 Status in Human Glioma Cells

    PubMed Central

    Chen, Lu; Jiang, Zhuyun; Ma, Hui; Ning, Ling; Chen, Hongdan; Li, Li; Qi, Hongyi

    2016-01-01

    Acori Graminei Rhizoma is well known for the beneficial effects on CNS disorders in traditional medicine. Though it is frequently prescribed in formulations for brain tumors, the anti-glioma effect has not been examined. We used volatile oil of Acori Graminei Rhizoma (VOA) and human glioblastoma multiforme (GBM) cells in this study. We found that VOA exhibited greater growth suppression in p53 wild-type cells than p53 mutant cells and very low effect on fibroblasts and human glial HEB cells. Apoptosis was triggered by VOA with a caspase-dependent way in p53 wild-type A172 cells, while a caspase-independent way in p53 mutant U251 cells. Meanwhile, both A172 and U251 cells treated by VOA displayed autophagic features. Furthermore, p53 decrease was observed along with VOA-induced apoptosis and autophagy in A172 cells. VOA-induced autophagy was mediated through a p53/AMPK/mTOR signaling pathway in A172 cells, while an mTOR-independent signaling pathway in U251 cells. Finally, blockage of autophagy potentiated the proapoptotic effect in both A172 and U251 cells, indicating a protective role of autophagy in VOA-induced cell death. Together, VOA exhibited anti-tumor activity in human GBM cells and induced apoptotic cell death and protective autophagy, which is cell type specific and dependent on p53 status. PMID:26892186

  8. The multiple levels of regulation by p53 ubiquitination

    PubMed Central

    Lee, JT; Gu, W

    2013-01-01

    p53 is a central integrator of a plethora of signals and outputs these signals in the form of tumor suppression. It is well accepted that ubiquitination plays a major part in p53 regulation. Nonetheless, the molecular mechanisms by which p53 activity is controlled by ubiquitination are complex. Mdm2, a RING oncoprotein, was once thought to be the sole E3 ubiquitin ligase for p53, however recent studies have shown that p53 is stabilized but still degraded in the cells of Mdm2-null mice. Although the essential role of Mdm2 in p53 regulation is well established, there are an increasing number of other E3 ligases implicated in Mdm2-independent regulation of p53 by ubiquitination. The different types of ubiquitination on p53 by various E3 ligases have been linked to its differential effects on p53-mediated stress responses. In addition to proteasome-mediated degradation, ubiquitination of p53 acts as signals for degradation-independent functions, such as nuclear export. The function of ubiquitinated p53 varies in the nucleus and cytosol underlying the many potential contributions ubiquitinated p53 may have in promoting cell proliferation or death. Thus, p53 requires multiple layers of regulatory control to ensure correct temporal and spatial functions. PMID:19543236

  9. Watching the watcher: regulation of p53 by mitochondria

    PubMed Central

    Holley, Aaron K; St Clair, Daret K

    2009-01-01

    p53 has been referred to as the ‘guardian of the genome’ because of its role in protecting the cell from DNA damage. p53 performs its duties by regulating cell-cycle progression and DNA repair and, in cases of irreparable DNA damage, by executing programmed cell death. Mitochondria are an important target of transcription-dependent and -independent actions of p53 to carry out the apoptotic function. However, increasing evidence suggests that p53 activity is regulated by mitochondria. Cellular insults that alter mitochondrial function can have important consequences on p53 activity. In light of these new findings, the following review focuses on p53/mitochondria connections, in particular how reactive oxygen species generated at mitochondria regulate p53 activity. A better understanding of the mechanisms by which mitochondria regulate p53 may have an impact on our understanding of the development and progression of many diseases, especially cancer. PMID:19243304

  10. Expression and mutations of p53 in salivary gland tumours.

    PubMed

    Kärjä, V J; Syrjänen, K J; Kurvinen, A K; Syrjänen, S M

    1997-05-01

    A series of 219 salivary gland tumours (103 carcinomas and 116 benign tumours) were analysed for p53 protein expression using immunohistochemistry, and for mutations in p53 gene using non-radioactive single strand conformation polymorphism (SSCP). p53 expression was present in 36% (42/116) of the benign tumours and in 54% (56/103) of the carcinomas. The highest prevalence of p53 expression was found in adenoid cystic carcinomas (69%), followed by mucoepidermoid carcinomas (67%). Of the benign tumours, pleomorphic adenomas showed the highest prevalence of p53 positivity (41%). In malignant tumours, expression of p53 bore no correlation to local recurrence, metastatic disease or survival of the patients. Exons 5 through 9 were analysed and four mutations were found in 20 cases of p53-immunopositive tumours and two in 20 p53-negative tumours. Each of the exons 5, 6 and 8/9 had two mutations, whereas no mutations were detected in exon 7.

  11. First Demonstration of Positive Allosteric-like Modulation at the Human Wild Type Translocator Protein (TSPO).

    PubMed

    Narlawar, Rajeshwar; Werry, Eryn L; Scarf, Alana M; Hanani, Raphy; Chua, Sook Wern; King, Victoria A; Barron, Melissa L; Martins, Ralph N; Ittner, Lars M; Rendina, Louis M; Kassiou, Michael

    2015-11-12

    We show that changing the number and position of nitrogen atoms in the heteroatomic core of a pyrazolopyrimidine acetamide is sufficient to induce complex binding to wild type human TSPO. Only compounds with this complex binding profile lacked intrinsic effect on glioblastoma proliferation but positively modulated the antiproliferative effects of a synthetic TSPO ligand. To the best of our knowledge this is the first demonstration of allosteric-like interaction at the wild type human TSPO.

  12. Necdin, a p53 target gene, regulates the quiescence and response to genotoxic stress of hematopoietic stem/progenitor cells.

    PubMed

    Asai, Takashi; Liu, Yan; Di Giandomenico, Silvana; Bae, Narae; Ndiaye-Lobry, Delphine; Deblasio, Anthony; Menendez, Silvia; Antipin, Yevgeniy; Reva, Boris; Wevrick, Rachel; Nimer, Stephen D

    2012-08-23

    We recently defined a critical role for p53 in regulating the quiescence of adult hematopoietic stem cells (HSCs) and identified necdin as a candidate p53 target gene. Necdin is a growth-suppressing protein and the gene encoding it is one of several that are deleted in patients with Prader-Willi syndrome. To define the intrinsic role of necdin in adult hematopoiesis, in the present study, we transplanted necdin-null fetal liver cells into lethally irradiated recipients. We show that necdin-null adult HSCs are less quiescent and more proliferative than normal HSCs, demonstrating the similar role of necdin and p53 in promoting HSC quiescence during steady-state conditions. However, wild-type recipients repopulated with necdin-null hematopoietic stem/progenitor cells show enhanced sensitivity to irradiation and chemotherapy, with increased p53-dependent apoptosis, myelosuppression, and mortality. Necdin controls the HSC response to genotoxic stress via both cell-cycle-dependent and cell-cycle-independent mechanisms, with the latter occurring in a Gas2L3-dependent manner. We conclude that necdin functions as a molecular switch in adult hematopoiesis, acting in a p53-like manner to promote HSC quiescence in the steady state, but suppressing p53-dependent apoptosis in response to genotoxic stress.

  13. Profilin potentiates chemotherapeutic agents mediated cell death via suppression of NF-κB and upregulation of p53.

    PubMed

    Zaidi, Adeel H; Raviprakash, Nune; Mokhamatam, Raveendra B; Gupta, Pankaj; Manna, Sunil K

    2016-04-01

    The molecular mechanism by which Profilin acts as a tumor suppressor is still unclear. Several chemotherapeutic agents, used till date either have unfavorable side effects or acquired resistance in tumor cells. Our findings show that Profilin enhances cell death mediated by several chemotherapeutic-agents. The activation of NF-κB and its dependent genes, mediated by paclitaxel and vinblastine, was completely inhibited in Profilin overexpressing cells. This inhibition was due to the Profilin mediated attenuation of IκBα degradation, thereby preventing p65 nuclear translocation and low NF-κB DNA binding activity.Moreover, Profilin increases level of p53 in the presence of known inducers, such as doxorubicin, vinblastine, and benzofuran. This increased p53 level leads to enhanced cell death as indicated by activation of caspases 3, 8, 9, which results in cleavage of PARP.Furthermore, knocking down of p53 in Profilin overexpressing cells leads to decreased cell death. Ectopic expression of Profilin in HCT116 p53 knock out cells showed lesser cell death as compared to the HCT116 p53 wild type cells. For the first time, we provide evidences, which suggest that Profilin synergizes with chemotherapeutic drugs to induce tumor cell death by regulating NF-κB and p53. Thus, modulation of Profilin may be a useful strategy for effective combination therapy. PMID:26842845

  14. Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction

    PubMed Central

    Pettersson, Mariell; Quant, Maria; Min, Jaeki; Iconaru, Luigi; Kriwacki, Richard W.; Waddell, M. Brett; Guy, R. Kiplin; Luthman, Kristina; Grøtli, Morten

    2015-01-01

    The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2) via a direct protein—protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay. PMID:26427060

  15. Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction.

    PubMed

    Pettersson, Mariell; Quant, Maria; Min, Jaeki; Iconaru, Luigi; Kriwacki, Richard W; Waddell, M Brett; Guy, R Kiplin; Luthman, Kristina; Grøtli, Morten

    2015-01-01

    The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2) via a direct protein-protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay.

  16. Mechanism of rescue of common p53 cancer mutations by second-site suppressor mutations

    PubMed Central

    Nikolova, Penka V.; Wong, Kam-Bo; DeDecker, Brian; Henckel, Julia; Fersht, Alan R.

    2000-01-01

    The core domain of p53 is extremely susceptible to mutations that lead to loss of function. We analysed the stability and DNA-binding activity of such mutants to understand the mechanism of second-site suppressor mutations. Double-mutant cycles show that N239Y and N268D act as ‘global stability’ suppressors by increasing the stability of the cancer mutants G245S and V143A—the free energy changes are additive. Conversely, the suppressor H168R is specific for the R249S mutation: despite destabilizing wild type, H168R has virtually no effect on the stability of R249S, but restores its binding affinity for the gadd45 promoter. NMR structural comparisons of R249S/H168R and R249S/T123A/H168R with wild type and R249S show that H168R reverts some of the structural changes induced by R249S. These results have implications for possible drug therapy to restore the function of tumorigenic mutants of p53: the function of mutants such as V143A and G245S is theoretically possible to restore by small molecules that simply bind to and hence stabilize the native structure, whereas R249S requires alteration of its mutant native structure. PMID:10654936

  17. p63 is required beside p53 for PERP-mediated apoptosis in uveal melanoma

    PubMed Central

    Awais, Raheela; Spiller, David G; White, Michael R H; Paraoan, Luminita

    2016-01-01

    Background: PERP (p53 apoptosis effector related to PMP-22), a transcriptional target of p53, is downregulated and contributes to the impairment of apoptosis in uveal melanoma (UM). Intriguingly, PERP is not induced in UM despite functional p53. p63, located on chromosome 3, which is characteristically altered in high-risk UM, can transactivate PERP. Here, we determine the functional role of p63 expression in the initiation of p53/PERP-mediated apoptosis in UM. Methods: PERP expression was monitored by quantitative PCR (qPCR) and immunoblotting in UM cell lines treated with DNA-damaging agents. The functional role of p63 was assessed by transient expression of p63-turbo GFP (p63-tGFP) in the apoptosis- resistant, 3q-deficient OCM-1 cells. Expression and localisation of p63, PERP and p53, and induction of apoptosis were characterised by qPCR, immunoblotting and live cell confocal microscopy. Results: PERP expression was significantly downregulated in all UM cell lines. DNA-damaging treatments failed to induce apoptosis and activate PERP in OCM-1 cells, which displayed non-functional levels of p63. Expression of p63-tGFP induced apoptosis with marked increase in PERP expression and associated p53 accumulation. Conclusions: Lack of p63 contributes to reduced PERP levels and impaired p53-mediated apoptosis in UM. p63 expression is required for PERP-mediated apoptosis in UM. PMID:27584665

  18. An African-specific polymorphism in the TP53 gene impairs p53 tumor suppressor function in a mouse model.

    PubMed

    Jennis, Matthew; Kung, Che-Pei; Basu, Subhasree; Budina-Kolomets, Anna; Leu, Julia I-Ju; Khaku, Sakina; Scott, Jeremy P; Cai, Kathy Q; Campbell, Michelle R; Porter, Devin K; Wang, Xuting; Bell, Douglas A; Li, Xiaoxian; Garlick, David S; Liu, Qin; Hollstein, Monica; George, Donna L; Murphy, Maureen E

    2016-04-15

    A nonsynonymous single-nucleotide polymorphism at codon 47 in TP53 exists in African-descent populations (P47S, rs1800371; referred to here as S47). Here we report that, in human cell lines and a mouse model, the S47 variant exhibits a modest decrease in apoptosis in response to most genotoxic stresses compared with wild-type p53 but exhibits a significant defect in cell death induced by cisplatin. We show that, compared with wild-type p53, S47 has nearly indistinguishable transcriptional function but shows impaired ability to transactivate a subset of p53 target genes, including two involved in metabolism:Gls2(glutaminase 2) and Sco2 We also show that human and mouse cells expressing the S47 variant are markedly resistant to cell death by agents that induce ferroptosis (iron-mediated nonapoptotic cell death). We show that mice expressing S47 in homozygous or heterozygous form are susceptible to spontaneous cancers of diverse histological types. Our data suggest that the S47 variant may contribute to increased cancer risk in individuals of African descent, and our findings highlight the need to assess the contribution of this variant to cancer risk in these populations. These data also confirm the potential relevance of metabolism and ferroptosis to tumor suppression by p53.

  19. An African-specific polymorphism in the TP53 gene impairs p53 tumor suppressor function in a mouse model.

    PubMed

    Jennis, Matthew; Kung, Che-Pei; Basu, Subhasree; Budina-Kolomets, Anna; Leu, Julia I-Ju; Khaku, Sakina; Scott, Jeremy P; Cai, Kathy Q; Campbell, Michelle R; Porter, Devin K; Wang, Xuting; Bell, Douglas A; Li, Xiaoxian; Garlick, David S; Liu, Qin; Hollstein, Monica; George, Donna L; Murphy, Maureen E

    2016-04-15

    A nonsynonymous single-nucleotide polymorphism at codon 47 in TP53 exists in African-descent populations (P47S, rs1800371; referred to here as S47). Here we report that, in human cell lines and a mouse model, the S47 variant exhibits a modest decrease in apoptosis in response to most genotoxic stresses compared with wild-type p53 but exhibits a significant defect in cell death induced by cisplatin. We show that, compared with wild-type p53, S47 has nearly indistinguishable transcriptional function but shows impaired ability to transactivate a subset of p53 target genes, including two involved in metabolism:Gls2(glutaminase 2) and Sco2 We also show that human and mouse cells expressing the S47 variant are markedly resistant to cell death by agents that induce ferroptosis (iron-mediated nonapoptotic cell death). We show that mice expressing S47 in homozygous or heterozygous form are susceptible to spontaneous cancers of diverse histological types. Our data suggest that the S47 variant may contribute to increased cancer risk in individuals of African descent, and our findings highlight the need to assess the contribution of this variant to cancer risk in these populations. These data also confirm the potential relevance of metabolism and ferroptosis to tumor suppression by p53. PMID:27034505

  20. G-actin guides p53 nuclear transport: potential contribution of monomeric actin in altered localization of mutant p53.

    PubMed

    Saha, Taniya; Guha, Deblina; Manna, Argha; Panda, Abir Kumar; Bhat, Jyotsna; Chatterjee, Subhrangsu; Sa, Gaurisankar

    2016-01-01

    p53 preserves genomic integrity by restricting anomaly at the gene level. Till date, limited information is available for cytosol to nuclear shuttling of p53; except microtubule-based trafficking route, which utilizes minus-end directed motor dynein. The present study suggests that monomeric actin (G-actin) guides p53 traffic towards the nucleus. Histidine-tag pull-down assay using purified p53(1-393)-His and G-actin confirms direct physical association between p53 and monomeric G-actin. Co-immunoprecipitation data supports the same. Confocal imaging explores intense perinuclear colocalization between p53 and G-actin. To address atomistic details of the complex, constraint-based docked model of p53:G-actin complex was generated based on crystal structures. MD simulation reveals that p53 DNA-binding domain arrests very well the G-actin protein. Docking benchmark studies have been carried out for a known crystal structure, 1YCS (complex between p53DBD and BP2), which validates the docking protocol we adopted. Co-immunoprecipitation study using "hot-spot" p53 mutants suggested reduced G-actin association with cancer-associated p53 conformational mutants (R175H and R249S). Considering these findings, we hypothesized that point mutation in p53 structure, which diminishes p53:G-actin complexation results in mutant p53 altered subcellular localization. Our model suggests p53Arg249 form polar-contact with Arg357 of G-actin, which upon mutation, destabilizes p53:G-actin interaction and results in cytoplasmic retention of p53R249S. PMID:27601274

  1. G-actin guides p53 nuclear transport: potential contribution of monomeric actin in altered localization of mutant p53

    PubMed Central

    Saha, Taniya; Guha, Deblina; Manna, Argha; Panda, Abir Kumar; Bhat, Jyotsna; Chatterjee, Subhrangsu; Sa, Gaurisankar

    2016-01-01

    p53 preserves genomic integrity by restricting anomaly at the gene level. Till date, limited information is available for cytosol to nuclear shuttling of p53; except microtubule-based trafficking route, which utilizes minus-end directed motor dynein. The present study suggests that monomeric actin (G-actin) guides p53 traffic towards the nucleus. Histidine-tag pull-down assay using purified p53(1–393)-His and G-actin confirms direct physical association between p53 and monomeric G-actin. Co-immunoprecipitation data supports the same. Confocal imaging explores intense perinuclear colocalization between p53 and G-actin. To address atomistic details of the complex, constraint-based docked model of p53:G-actin complex was generated based on crystal structures. MD simulation reveals that p53 DNA-binding domain arrests very well the G-actin protein. Docking benchmark studies have been carried out for a known crystal structure, 1YCS (complex between p53DBD and BP2), which validates the docking protocol we adopted. Co-immunoprecipitation study using “hot-spot” p53 mutants suggested reduced G-actin association with cancer-associated p53 conformational mutants (R175H and R249S). Considering these findings, we hypothesized that point mutation in p53 structure, which diminishes p53:G-actin complexation results in mutant p53 altered subcellular localization. Our model suggests p53Arg249 form polar-contact with Arg357 of G-actin, which upon mutation, destabilizes p53:G-actin interaction and results in cytoplasmic retention of p53R249S. PMID:27601274

  2. A Small Ras-like protein Ray/Rab1c modulates the p53-regulating activity of PRPK

    SciTech Connect

    Abe, Yasuhito . E-mail: yasuhito@m.ehime-u.ac.jp; Takeuchi, Takashi; Imai, Yoshinori; Murase, Ryuichi; Kamei, Yoshiaki; Fujibuchi, Taketsugu; Matsumoto, Suguru; Ueda, Norifumi; Kito, Katsumi; Ogasawara, Masahito; Shigemoto, Kazuhiro

    2006-05-26

    PRPK phosphorylates serine-15 residue of p53 and enhances transcriptional activity. PRPK possesses a bipartite nuclear localization signal and localizes in nucleus when over-expressed in cells. However, intrinsic PRPK localizes mainly in the cytosol in situ. While studying the mechanisms in the distribution of intrinsic PRPK, we identified a PRPK binding protein, an ubiquitously expressed Small Ras-like GTPase, Rab1c, also named Ray or Rab35. The over-expressed Ray was distributed in the nucleus, cytosol, and cell membrane. Both Ray wild type and GTP-restrictively binding mutant Ray-Q67L, but not guanine nucleotide unstable binding mutant Ray-N120I, partially distributed the over-expressed PRPK to the cytosol and also suppressed the PRPK-induced p53-transcriptional activity profoundly. A Small Ras-like GTPase protein Ray was thus indicated to modulate p53 transcriptional activity of PRPK.

  3. Expression of p53-regulated genes in human cultured lymphoblastoid TSCE5 and WTK1 cell lines after spaceflight in a frozen state

    NASA Astrophysics Data System (ADS)

    Takahashi, A.; Suzuki, H.; Omori, K.; Seki, M.; Hashizume, T.; Shimazu, T.; Ishioka, N.; Ohnishi, T.

    2011-03-01

    The 53 kDa tumor suppressor protein p53 is generally thought to contribute to the genetic stability of cells and to protect cells from DNA damage through the activity of p53-centered signal transduction pathways. To clarify the effect of space radiation on the expression of p53-dependent regulated genes, gene expression profiles were compared between two human cultured lymphoblastoid cell lines: one line (TSCE5) has a wild-type p53 gene status, and the other line (WTK1) has a mutated p53 gene status. Frozen human lymphoblastoid cells were stored in a freezer in the International Space Station (ISS) for 133 days. Gene expression was analyzed using DNA chips after culturing the space samples for 6 h on the ground after their return from space. Ground control samples were also cultured for 6 h after being stored in a frozen state on the ground for the same time period that the frozen cells were in space. p53-Dependent gene expression was calculated from the ratio of the gene expression values in wild-type p53 cells and in mutated p53 cells. The expression of 50 p53-dependent genes was up-regulated, and the expression of 94 p53-dependent genes was down-regulated after spaceflight. These expression data identified genes which could be useful in advancing studies in basic space radiation biology. The biological meaning of these results is discussed from the aspect of gene functions in the up- and down-regulated genes after exposure to low doses of space radiation.

  4. Abrogation of p53 by its antisense in MCF-7 breast carcinoma cells increases cyclin D1 via activation of Akt and promotion of cell proliferation

    SciTech Connect

    Chhipa, Rishi Raj; Kumari, Ratna; Upadhyay, Ankur Kumar; Bhat, Manoj Kumar

    2007-11-15

    The p53 protein has been a subject of intense research interest since its discovery as about 50% of human cancers carry p53 mutations. Mutations in the p53 gene are the most frequent genetic lesions in breast cancers suggesting a critical role of p53 in breast cancer development, growth and chemosensitivity. This report describes the derivation and characterization of MCF-7As53, an isogenic cell line derived from MCF-7 breast carcinoma cells in which p53 was abrogated by antisense p53 cDNA. Similar to MCF-7 and simultaneously selected hygromycin resistant MCF-7H cells, MCF-7As53 cells have consistent basal epithelial phenotype, morphology, and estrogen receptor expression levels at normal growth conditions. Present work documents investigation of molecular variations, growth kinetics, and cell cycle related studies in relation to absence of wild-type p53 protein and its transactivation potential as well. Even though wild-type tumor suppressor p53 is an activator of cell growth arrest and apoptosis-mediator genes such as p21, Bax, and GADD45 in MCF-7As53 cells, no alterations in expression levels of these genes were detected. The doubling time of these cells decreased due to depletion of G0/G1 cell phase because of constitutive activation of Akt and increase in cyclin D1 protein levels. This proliferative property was abrogated by wortmannin, an inhibitor of PI3-K/Akt signaling pathway. Therefore this p53 null cell line indicates that p53 is an indispensable component of cellular signaling system which is regulated by caveolin-1 expression, involving Akt activation and increase in cyclin D1, thereby promoting proliferation of breast cancer cells.

  5. Different Regulation of the p53 Core Domain Activities 3′-to-5′ Exonuclease and Sequence-Specific DNA Binding

    PubMed Central

    Janus, Friedemann; Albrechtsen, Nils; Knippschild, Uwe; Wiesmüller, Lisa; Grosse, Frank; Deppert, Wolfgang

    1999-01-01

    In this study we further characterized the 3′-5′ exonuclease activity intrinsic to wild-type p53. We showed that this activity, like sequence-specific DNA binding, is mediated by the p53 core domain. Truncation of the C-terminal 30 amino acids of the p53 molecule enhanced the p53 exonuclease activity by at least 10-fold, indicating that this activity, like sequence-specific DNA binding, is negatively regulated by the C-terminal basic regulatory domain of p53. However, treatments which activated sequence-specific DNA binding of p53, like binding of the monoclonal antibody PAb421, which recognizes a C-terminal epitope on p53, or a higher phosphorylation status, strongly inhibited the p53 exonuclease activity. This suggests that at least on full-length p53, sequence-specific DNA binding and exonuclease activities are subject to different and seemingly opposing regulatory mechanisms. Following up the recent discovery in our laboratory that p53 recognizes and binds with high affinity to three-stranded DNA substrates mimicking early recombination intermediates (C. Dudenhoeffer, G. Rohaly, K. Will, W. Deppert, and L. Wiesmueller, Mol. Cell. Biol. 18:5332–5342), we asked whether such substrates might be degraded by the p53 exonuclease. Addition of Mg2+ ions to the binding assay indeed started the p53 exonuclease and promoted rapid degradation of the bound, but not of the unbound, substrate, indicating that specifically recognized targets can be subjected to exonucleolytic degradation by p53 under defined conditions. PMID:10022902

  6. Identification of p53-target genes in Danio rerio.

    PubMed

    Mandriani, Barbara; Castellana, Stefano; Rinaldi, Carmela; Manzoni, Marta; Venuto, Santina; Rodriguez-Aznar, Eva; Galceran, Juan; Nieto, M Angela; Borsani, Giuseppe; Monti, Eugenio; Mazza, Tommaso; Merla, Giuseppe; Micale, Lucia

    2016-01-01

    To orchestrate the genomic response to cellular stress signals, p53 recognizes and binds to DNA containing specific and well-characterized p53-responsive elements (REs). Differences in RE sequences can strongly affect the p53 transactivation capacity and occur even between closely related species. Therefore, the identification and characterization of a species-specific p53 Binding sistes (BS) consensus sequence and of the associated target genes may help to provide new insights into the evolution of the p53 regulatory networks across different species. Although p53 functions were studied in a wide range of species, little is known about the p53-mediated transcriptional signature in Danio rerio. Here, we designed and biochemically validated a computational approach to identify novel p53 target genes in Danio rerio genome. Screening all the Danio rerio genome by pattern-matching-based analysis, we found p53 RE-like patterns proximal to 979 annotated Danio rerio genes. Prioritization analysis identified a subset of 134 candidate pattern-related genes, 31 of which have been investigated in further biochemical assays. Our study identified runx1, axin1, traf4a, hspa8, col4a5, necab2, and dnajc9 genes as novel direct p53 targets and 12 additional p53-controlled genes in Danio rerio genome. The proposed combinatorial approach resulted to be highly sensitive and robust for identifying new p53 target genes also in additional animal species. PMID:27581768

  7. Identification of p53-target genes in Danio rerio

    PubMed Central

    Mandriani, Barbara; Castellana, Stefano; Rinaldi, Carmela; Manzoni, Marta; Venuto, Santina; Rodriguez-Aznar, Eva; Galceran, Juan; Nieto, M. Angela; Borsani, Giuseppe; Monti, Eugenio; Mazza, Tommaso; Merla, Giuseppe; Micale, Lucia

    2016-01-01

    To orchestrate the genomic response to cellular stress signals, p53 recognizes and binds to DNA containing specific and well-characterized p53-responsive elements (REs). Differences in RE sequences can strongly affect the p53 transactivation capacity and occur even between closely related species. Therefore, the identification and characterization of a species-specific p53 Binding sistes (BS) consensus sequence and of the associated target genes may help to provide new insights into the evolution of the p53 regulatory networks across different species. Although p53 functions were studied in a wide range of species, little is known about the p53-mediated transcriptional signature in Danio rerio. Here, we designed and biochemically validated a computational approach to identify novel p53 target genes in Danio rerio genome. Screening all the Danio rerio genome by pattern-matching-based analysis, we found p53 RE-like patterns proximal to 979 annotated Danio rerio genes. Prioritization analysis identified a subset of 134 candidate pattern-related genes, 31 of which have been investigated in further biochemical assays. Our study identified runx1, axin1, traf4a, hspa8, col4a5, necab2, and dnajc9 genes as novel direct p53 targets and 12 additional p53-controlled genes in Danio rerio genome. The proposed combinatorial approach resulted to be highly sensitive and robust for identifying new p53 target genes also in additional animal species. PMID:27581768

  8. Identification of p53-target genes in Danio rerio.

    PubMed

    Mandriani, Barbara; Castellana, Stefano; Rinaldi, Carmela; Manzoni, Marta; Venuto, Santina; Rodriguez-Aznar, Eva; Galceran, Juan; Nieto, M Angela; Borsani, Giuseppe; Monti, Eugenio; Mazza, Tommaso; Merla, Giuseppe; Micale, Lucia

    2016-01-01

    To orchestrate the genomic response to cellular stress signals, p53 recognizes and binds to DNA containing specific and well-characterized p53-responsive elements (REs). Differences in RE sequences can strongly affect the p53 transactivation capacity and occur even between closely related species. Therefore, the identification and characterization of a species-specific p53 Binding sistes (BS) consensus sequence and of the associated target genes may help to provide new insights into the evolution of the p53 regulatory networks across different species. Although p53 functions were studied in a wide range of species, little is known about the p53-mediated transcriptional signature in Danio rerio. Here, we designed and biochemically validated a computational approach to identify novel p53 target genes in Danio rerio genome. Screening all the Danio rerio genome by pattern-matching-based analysis, we found p53 RE-like patterns proximal to 979 annotated Danio rerio genes. Prioritization analysis identified a subset of 134 candidate pattern-related genes, 31 of which have been investigated in further biochemical assays. Our study identified runx1, axin1, traf4a, hspa8, col4a5, necab2, and dnajc9 genes as novel direct p53 targets and 12 additional p53-controlled genes in Danio rerio genome. The proposed combinatorial approach resulted to be highly sensitive and robust for identifying new p53 target genes also in additional animal species.

  9. Tumor suppressor p53 protects mice against Listeria monocytogenes infection.

    PubMed

    Wang, Shaohui; Liu, Pingping; Wei, Jianchao; Zhu, Zixiang; Shi, Zixue; Shao, Donghua; Ma, Zhiyong

    2016-01-01

    Tumor suppressor p53 is involved in regulating immune responses, which contribute to antitumor and antiviral activity. However, whether p53 has anti-bacterial functions remains unclear. Listeria monocytogenes (LM) causes listeriosis in humans and animals, and it is a powerful model for studying innate and adaptive immunity. In the present study, we illustrate an important regulatory role of p53 during LM infection. p53 knockout (p53KO) mice were more susceptible to LM infection, which was manifested by a shorter survival time and lower survival rate. p53KO mice showed significant impairments in LM eradication. Knockdown of p53 in RAW264.7 and HeLa cells resulted in increased invasion and intracellular survival of LM. Furthermore, the invasion and intracellular survival of LM was inhibited in p53-overexpressing RAW264.7 and HeLa cells. LM-infected p53KO mice exhibited severe clinical symptoms and organ injury, presumably because of the abnormal production of the pro-inflammatory cytokines TNF-α, IL-6, IL-12, and IL-18. Decreased IFN-γ and GBP1 productions were observed in LM-infected p53-deficient mice or cells. The combination of these defects likely resulted in the overwhelming LM infection in the p53KO mice. These observations indicate that p53 serves as an important regulator of the host innate immune that protects against LM infection. PMID:27644341

  10. Tumor suppressor p53 protects mice against Listeria monocytogenes infection

    PubMed Central

    Wang, Shaohui; Liu, Pingping; Wei, Jianchao; Zhu, Zixiang; Shi, Zixue; Shao, Donghua; Ma, Zhiyong

    2016-01-01

    Tumor suppressor p53 is involved in regulating immune responses, which contribute to antitumor and antiviral activity. However, whether p53 has anti-bacterial functions remains unclear. Listeria monocytogenes (LM) causes listeriosis in humans and animals, and it is a powerful model for studying innate and adaptive immunity. In the present study, we illustrate an important regulatory role of p53 during LM infection. p53 knockout (p53KO) mice were more susceptible to LM infection, which was manifested by a shorter survival time and lower survival rate. p53KO mice showed significant impairments in LM eradication. Knockdown of p53 in RAW264.7 and HeLa cells resulted in increased invasion and intracellular survival of LM. Furthermore, the invasion and intracellular survival of LM was inhibited in p53-overexpressing RAW264.7 and HeLa cells. LM-infected p53KO mice exhibited severe clinical symptoms and organ injury, presumably because of the abnormal production of the pro-inflammatory cytokines TNF-α, IL-6, IL-12, and IL-18. Decreased IFN-γ and GBP1 productions were observed in LM-infected p53-deficient mice or cells. The combination of these defects likely resulted in the overwhelming LM infection in the p53KO mice. These observations indicate that p53 serves as an important regulator of the host innate immune that protects against LM infection. PMID:27644341

  11. Tumor suppressor p53 protects mice against Listeria monocytogenes infection.

    PubMed

    Wang, Shaohui; Liu, Pingping; Wei, Jianchao; Zhu, Zixiang; Shi, Zixue; Shao, Donghua; Ma, Zhiyong

    2016-01-01

    Tumor suppressor p53 is involved in regulating immune responses, which contribute to antitumor and antiviral activity. However, whether p53 has anti-bacterial functions remains unclear. Listeria monocytogenes (LM) causes listeriosis in humans and animals, and it is a powerful model for studying innate and adaptive immunity. In the present study, we illustrate an important regulatory role of p53 during LM infection. p53 knockout (p53KO) mice were more susceptible to LM infection, which was manifested by a shorter survival time and lower survival rate. p53KO mice showed significant impairments in LM eradication. Knockdown of p53 in RAW264.7 and HeLa cells resulted in increased invasion and intracellular survival of LM. Furthermore, the invasion and intracellular survival of LM was inhibited in p53-overexpressing RAW264.7 and HeLa cells. LM-infected p53KO mice exhibited severe clinical symptoms and organ injury, presumably because of the abnormal production of the pro-inflammatory cytokines TNF-α, IL-6, IL-12, and IL-18. Decreased IFN-γ and GBP1 productions were observed in LM-infected p53-deficient mice or cells. The combination of these defects likely resulted in the overwhelming LM infection in the p53KO mice. These observations indicate that p53 serves as an important regulator of the host innate immune that protects against LM infection.

  12. Signal transduction through p53-dependent pathway after low-dose ionizing radiation

    SciTech Connect

    Ohnishi, T.; Matsumoto, H.; Wang Xinjiang

    1995-12-31

    In the study of cell-cycle events, recent attention has focused on the signal transduction pathway in which a tumor-suppressor protein, wild-type (wt) p53 protein, acts as the key protein. A major advance in recent years has been the partial elucidation of the G{sub 1}-arrest mechanism. However, the transcriptional regulation mechanisms of components of the cell-cycle machinery remain unknown. We have investigated the induction of p53, WAF1, and cdk2 after gamma-ray irradiation using two human glioblastoma cell lines, U-87MG bearing the wt p53 gene and the other, T98G, a mutant gene. After the cells have been irradiated with gamma rays at 3 Gy, the level of p53 and WAF1 mRNAs in U-87MG increased gradually for up to 10 h, whereas these mRNAs were overexpressed in T98G, and these levels remained relatively stable after irradiation. In an attempt to examine the induction of cdk2 after gamma-ray irradiation, we analyzed the level of cdk2 mRNA using the reverse transcriptase-polymerase chain reaction (RT-PCR) technique. We calculated the amounts of cdk2 mRNA relative to that of b-actin mRNA in both cell lines, then plotted them against those in nonirradiated cells. After irradiation, the level of cdk2 mRNA in U-87MG gradually increased more than twofold by 10 h after gamma-ray irradiation, whereas the level of the mRNA in T98G remained relatively stable after irradiation. This result demonstrates that wtp53 induces the expression of not only WAF1 but also cdk2. The induction of wt p53 protein accumulation in rats exposed to x radiation is also discussed.

  13. Human Cytomegalovirus nuclear egress and secondary envelopment are negatively affected in the absence of cellular p53.

    PubMed

    Kuan, Man I; O'Dowd, John M; Chughtai, Kamila; Hayman, Ian; Brown, Celeste J; Fortunato, Elizabeth A

    2016-10-01

    Human Cytomegalovirus (HCMV) infection is compromised in cells lacking p53, a transcription factor that mediates cellular stress responses. In this study we have investigated compromised functional virion production in cells with p53 knocked out (p53KOs). Infectious center assays found most p53KOs released functional virions. Analysis of electron micrographs revealed modestly decreased capsid production in infected p53KOs compared to wt. Substantially fewer p53KOs displayed HCMV-induced infoldings of the inner nuclear membrane (IINMs). In p53KOs, fewer capsids were found in IINMs and in the cytoplasm. The deficit in virus-induced membrane remodeling within the nucleus of p53KOs was mirrored in the cytoplasm, with a disproportionately smaller number of capsids re-enveloped. Reintroduction of p53 substantially recovered these deficits. Overall, the absence of p53 contributed to inhibition of the formation and function of IINMs and re-envelopment of the reduced number of capsids able to reach the cytoplasm.

  14. Mdm2-p53 signaling regulates epidermal stem cell senescence and premature aging phenotypes in mouse skin.

    PubMed

    Gannon, Hugh S; Donehower, Lawrence A; Lyle, Stephen; Jones, Stephen N

    2011-05-01

    The p53 transcription factor is activated by various types of cell stress or DNA damage and induces the expression of genes that control cell growth and inhibit tumor formation. Analysis of mice that express mutant forms of p53 suggest that inappropriate p53 activation can alter tissue homeostasis and life span, connecting