Construction of new cloning, lacZ reporter and scarless-markerless suicide vectors for genetic studies in Aggregatibacter actinomycetemcomitans

PubMed Central

Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.

2013-01-01

To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051

confFuse: High-Confidence Fusion Gene Detection across Tumor Entities.

PubMed

Huang, Zhiqin; Jones, David T W; Wu, Yonghe; Lichter, Peter; Zapatka, Marc

2017-01-01

Background: Fusion genes play an important role in the tumorigenesis of many cancers. Next-generation sequencing (NGS) technologies have been successfully applied in fusion gene detection for the last several years, and a number of NGS-based tools have been developed for identifying fusion genes during this period. Most fusion gene detection tools based on RNA-seq data report a large number of candidates (mostly false positives), making it hard to prioritize candidates for experimental validation and further analysis. Selection of reliable fusion genes for downstream analysis becomes very important in cancer research. We therefore developed confFuse, a scoring algorithm to reliably select high-confidence fusion genes which are likely to be biologically relevant. Results: confFuse takes multiple parameters into account in order to assign each fusion candidate a confidence score, of which score ≥8 indicates high-confidence fusion gene predictions. These parameters were manually curated based on our experience and on certain structural motifs of fusion genes. Compared with alternative tools, based on 96 published RNA-seq samples from different tumor entities, our method can significantly reduce the number of fusion candidates (301 high-confidence from 8,083 total predicted fusion genes) and keep high detection accuracy (recovery rate 85.7%). Validation of 18 novel, high-confidence fusions detected in three breast tumor samples resulted in a 100% validation rate. Conclusions: confFuse is a novel downstream filtering method that allows selection of highly reliable fusion gene candidates for further downstream analysis and experimental validations. confFuse is available at https://github.com/Zhiqin-HUANG/confFuse.

Activation of a development-specific gene, dofA, by FruA, an essential transcription factor for development of Myxococcus xanthus.

PubMed

Ueki, Toshiyuki; Inouye, Sumiko

2005-12-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.

Discovering and understanding oncogenic gene fusions through data intensive computational approaches

PubMed Central

Latysheva, Natasha S.; Babu, M. Madan

2016-01-01

Abstract Although gene fusions have been recognized as important drivers of cancer for decades, our understanding of the prevalence and function of gene fusions has been revolutionized by the rise of next-generation sequencing, advances in bioinformatics theory and an increasing capacity for large-scale computational biology. The computational work on gene fusions has been vastly diverse, and the present state of the literature is fragmented. It will be fruitful to merge three camps of gene fusion bioinformatics that appear to rarely cross over: (i) data-intensive computational work characterizing the molecular biology of gene fusions; (ii) development research on fusion detection tools, candidate fusion prioritization algorithms and dedicated fusion databases and (iii) clinical research that seeks to either therapeutically target fusion transcripts and proteins or leverages advances in detection tools to perform large-scale surveys of gene fusion landscapes in specific cancer types. In this review, we unify these different—yet highly complementary and symbiotic—approaches with the view that increased synergy will catalyze advancements in gene fusion identification, characterization and significance evaluation. PMID:27105842

Gene Fusion: A Genome Wide Survey

NASA Technical Reports Server (NTRS)

Liang, Ping; Riley, Monica

2001-01-01

As a well known fact, organisms form larger and complex multimodular (composite or chimeric) and mostly multi-functional proteins through gene fusion of two or more individual genes which have independent evolution histories and functions. We call each of these components a module. The existence of multimodular proteins may improves the efficiency in gene regulation and in cellular functions, and thus may give the host organism advantages in adaptation to environments. Analysis of all gene fusions in present-day organisms should allow us to examine the patterns of gene fusion in context with cellular functions, to trace back the evolution processes from the ancient smaller and uni-functional proteins to the present-day larger and complex multi-functional proteins, and to estimate the minimal number of ancestor proteins that existed in the last common ancestor for all life on earth. Although many multimodular proteins have been experimentally known, identification of gene fusion events systematically at genome scale had not been possible until recently when large number of completed genome sequences have been becoming available. In addition, technical difficulties for such analysis also exist due to the complexity of this biological and evolutionary process. We report from this study a new strategy to computationally identify multimodular proteins using completed genome sequences and the results surveyed from 22 organisms with the data from over 40 organisms to be presented during the meeting. Additional information is contained in the original extended abstract.

Activation of a Development-Specific Gene, dofA, by FruA, an Essential Transcription Factor for Development of Myxococcus xanthus

PubMed Central

Ueki, Toshiyuki; Inouye, Sumiko

2005-01-01

FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956

The involvement of the nif-associated ferredoxin-like genes fdxA and fdxN of Herbaspirillum seropedicae in nitrogen fixation.

PubMed

Souza, André L F; Invitti, Adriana L; Rego, Fabiane G M; Monteiro, Rose A; Klassen, Giseli; Souza, Emanuel M; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2010-02-01

The pathway of electron transport to nitrogenase in the endophytic beta-Proteobacterium Herbaspirillum seropedicae has not been characterized. We have generated mutants in two nif-associated genes encoding putative ferredoxins, fdxA and fdxN. The fdxA gene is part of the operon nifHDKENXorf1orf2fdxAnifQmodABC and is transcribed from the nifH promoter, as revealed by lacZ gene fusion. The fdxN gene is probably cotranscribed with the nifB gene. Mutational analysis suggests that the FdxA protein is essential for maximum nitrogenase activity, since the nitrogenase activity of the fdxA mutant strain was reduced to about 30% of that of the wild-type strain. In addition, the fdxA mutation had no effect on the nitrogenase switch-off in response to ammonium. Nitrogenase activity of a mutant strain lacking the fdxN gene was completely abolished. This phenotype was reverted by complementation with fdxN expressed under lacZ promoter control. The results suggest that the products of both the fdxA and fdxN genes are probably involved in electron transfer during nitrogen fixation.

Investigation of fusion gene expression in HCT116 cells.

PubMed

Zhang, Yanmei; Ren, Juan; Fang, Mengdie; Wang, Xiaoju

2017-12-01

Colon cancer is the most common type of gastrointestinal cancer. A number of specific and sensitive biomarkers facilitate the diagnosis and monitoring of patients with colon cancer. Fusion genes are typically identified in cancer and a majority of the newly identified fusion genes are oncogenic in nature. Therefore, fusion genes are potential biomarkers and/or therapy targets in cancer. In the present study, the regulation of specific candidate fusion genes were investigated using Brother of the Regulator of Imprinted Sites (BORIS) in the HCT116 colon cancer cell line, which is a paralog of the fusion gene regulator CCCTC-binding factor (CTCF). The copy number of BORIS increased correspondingly to the progression of colorectal carcinoma from the M0 to the M1a stage. It was identified that EIF3E(e1)-RSPO2(e2) , EIF3E(e1)-RSPO2(e3) , PTPRK(e1)-RSPO3(e2) , PTPRK(e7)-RSPO3(e2), TADA2A-MEF2B and MED13L-CD4 are fusion transcripts present in the transcriptome of the HCT116 colon cancer cell line. CDC42SE2-KIAAO146 is a genomic fusion transcript, which originates from DNA arrangement in HCT116 cells. BORIS suppresses the expression of EIF3E , RSPO2 , PTPRK , RSPO3 , TADA2A and CD4 to inhibit the expression of fusion transcripts in HCT116 cells. It was hypothesized that the fusion transcripts investigated in the present study may not be oncogenic in HCT116 cells. As BORIS is not colorectal carcinoma-specific, the fusion genes investigated may be a biomarker assemblage for monitoring the progression of colorectal carcinoma.

Investigation of fusion gene expression in HCT116 cells

PubMed Central

Zhang, Yanmei; Ren, Juan; Fang, Mengdie; Wang, Xiaoju

2017-01-01

Colon cancer is the most common type of gastrointestinal cancer. A number of specific and sensitive biomarkers facilitate the diagnosis and monitoring of patients with colon cancer. Fusion genes are typically identified in cancer and a majority of the newly identified fusion genes are oncogenic in nature. Therefore, fusion genes are potential biomarkers and/or therapy targets in cancer. In the present study, the regulation of specific candidate fusion genes were investigated using Brother of the Regulator of Imprinted Sites (BORIS) in the HCT116 colon cancer cell line, which is a paralog of the fusion gene regulator CCCTC-binding factor (CTCF). The copy number of BORIS increased correspondingly to the progression of colorectal carcinoma from the M0 to the M1a stage. It was identified that EIF3E(e1)-RSPO2(e2), EIF3E(e1)-RSPO2(e3), PTPRK(e1)-RSPO3(e2), PTPRK(e7)-RSPO3(e2), TADA2A-MEF2B and MED13L-CD4 are fusion transcripts present in the transcriptome of the HCT116 colon cancer cell line. CDC42SE2-KIAAO146 is a genomic fusion transcript, which originates from DNA arrangement in HCT116 cells. BORIS suppresses the expression of EIF3E, RSPO2, PTPRK, RSPO3, TADA2A and CD4 to inhibit the expression of fusion transcripts in HCT116 cells. It was hypothesized that the fusion transcripts investigated in the present study may not be oncogenic in HCT116 cells. As BORIS is not colorectal carcinoma-specific, the fusion genes investigated may be a biomarker assemblage for monitoring the progression of colorectal carcinoma. PMID:29181107

[Construction and expression of the targeting super-antigen EGF-SEA fusion gene].

PubMed

Xie, Yang; Peng, Shaoping; Liao, Zhiying; Liu, Jiafeng; Liu, Xuemei; Chen, Weifeng

2014-05-01

To construct expression vector for the SEA-EGF fusion gene. Clone the SEA gene and the EGF gene segment with PCR and RT-PCR independently, and connect this two genes by the bridge PCR. Insert the fusion gene EGF-SEA into the expression vector PET-44. Induced the secretion of the fusion protein SEA-EGF by the antileptic. The gene fragment encoding EGF and SEA mature peptide was successfully cloned. The fusion gene EGF-SEA was successfully constructed and was inserted into expression vector. The new recombinant expression vector for fusion gene EGF-SEA is specific for head and neck cancer, laid the foundation for the further study of fusion protein SEA-EGF targeting immune therapy in head and neck tumors.

Genetics in methylotrophic bacteria: Appendix. Final report

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lidstrom, M.E.

This research has focused primarily on promoters in Methylobacterium extorquens AM1 and in methanotrophic bacteria. In Methylobacterium extorquens work continued on the moxF promoter. The author constructed chromosomal lacZ fusions of this promoter to avoid the regulation problems of plasmid-borne fragments and has shown that this is regulated normally in the chromosome. She has constructed lacZ fusions to some of the mox genes involved in the synthesis of the cofactor, PQQ, in order to carry out similar analysis of transcription of PQQ genes. The author has continued to isolate mox genes in methanotrophs for the purpose of studying their promotersmore » and transcriptional regulation.« less

Highly efficient gene transfer into adult ventricular myocytes by recombinant adenovirus.

PubMed Central

Kirshenbaum, L A; MacLellan, W R; Mazur, W; French, B A; Schneider, M D

1993-01-01

Molecular dissection of mechanisms that govern the differentiated cardiac phenotype has, for cogent technical reasons, largely been undertaken to date in neonatal ventricular myocytes. To circumvent expected limitations of other methods, the present study was initiated to determine whether replication-deficient adenovirus would enable efficient gene transfer to adult cardiac cells in culture. Adult rat ventricular myocytes were infected, 24 h after plating, with adenovirus type 5 containing a cytomegalovirus immediate-early promoter-driven lacZ reporter gene and were assayed for the presence of beta-galactosidase 48 h after infection. The frequency of lacZ+ rod-shaped myocytes was half-maximal at 4 x 10(5) plaque-forming units (PFU) and approached 90% at 1 x 10(8) PFU. Uninfected cells and cells infected with lacZ- virus remained colorless. Beta-galactosidase activity concurred with the proportion of lacZ+ cells and was contingent on the exogenous lacZ gene. At 10(8) PFU/dish, cell number, morphology, and viability each were comparable to uninfected cells. Thus, adult ventricular myocytes are amenable to efficient gene transfer with recombinant adenovirus. The relative uniformity for gene transfer by adenovirus should facilitate tests to determine the impact of putative regulators upon the endogenous genes and gene products of virally modified adult ventricular muscle cells. Images PMID:8326005

TMPRSS2-ERG gene fusion in small cell carcinoma of the prostate.

PubMed

Guo, Charles C; Dancer, Jane Y; Wang, Yan; Aparicio, Ana; Navone, Nora M; Troncoso, Patricia; Czerniak, Bogdan A

2011-01-01

Recent studies have shown that most prostate cancers carry the TMPRSS2-ERG gene fusion. Here we evaluated the TMPRSS2-ERG gene fusion in small cell carcinoma of the prostate (n = 12) in comparison with small cell carcinoma of the urinary bladder (n = 12) and lung (n = 11). Fluorescence in situ hybridization demonstrated rearrangement of the ERG gene in 8 cases of prostatic small cell carcinoma (67%), and the rearrangement was associated with deletion of the 5' ERG gene in 7 cases, but rearrangement of the ERG gene was not present in any small cell carcinoma of the urinary bladder or lung. Next we evaluated the TMPRSS2-ERG gene fusion in nude mouse xenografts that were derived from 2 prostatic small cell carcinomas carrying the TMPRSS2-ERG gene fusion. Two transcripts encoded by the TMPRSS2-ERG gene fusion were detected by reverse transcriptase polymerase chain reaction, and DNA sequencing demonstrated that the 2 transcripts were composed of fusions of exon 1 of the TMPRSS2 gene to exon 4 or 5 of the ERG gene. Our study demonstrates the specific presence of TMPRSS2-ERG gene fusion in prostatic small cell carcinoma, which may be helpful in distinguishing small cell carcinoma of prostatic origin from nonprostatic origins. The high prevalence of the TMPRSS2-ERG gene fusion in prostatic small cell carcinoma as well as adenocarcinoma implies that small cell carcinoma may share a common pathogenic pathway with adenocarcinoma in the prostate. Copyright © 2011 Elsevier Inc. All rights reserved.

A Multiplexed Amplicon Approach for Detecting Gene Fusions by Next-Generation Sequencing.

PubMed

Beadling, Carol; Wald, Abigail I; Warrick, Andrea; Neff, Tanaya L; Zhong, Shan; Nikiforov, Yuri E; Corless, Christopher L; Nikiforova, Marina N

2016-03-01

Chromosomal rearrangements that result in oncogenic gene fusions are clinically important drivers of many cancer types. Rapid and sensitive methods are therefore needed to detect a broad range of gene fusions in clinical specimens that are often of limited quantity and quality. We describe a next-generation sequencing approach that uses a multiplex PCR-based amplicon panel to interrogate fusion transcripts that involve 19 driver genes and 94 partners implicated in solid tumors. The panel also includes control assays that evaluate the 3'/5' expression ratios of 12 oncogenic kinases, which might be used to infer gene fusion events when the partner is unknown or not included on the panel. There was good concordance between the solid tumor fusion gene panel and other methods, including fluorescence in situ hybridization, real-time PCR, Sanger sequencing, and other next-generation sequencing panels, because 40 specimens known to harbor gene fusions were correctly identified. No specific fusion reads were observed in 59 fusion-negative specimens. The 3'/5' expression ratio was informative for fusions that involved ALK, RET, and NTRK1 but not for BRAF or ROS1 fusions. However, among 37 ALK or RET fusion-negative specimens, four exhibited elevated 3'/5' expression ratios, indicating that fusions predicted solely by 3'/5' read ratios require confirmatory testing. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Reanalysis of RNA-Sequencing Data Reveals Several Additional Fusion Genes with Multiple Isoforms

PubMed Central

Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

2012-01-01

RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts. PMID:23119097

Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

PubMed

Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

2012-01-01

RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

Direct adenovirus-mediated gene delivery to the temporomandibular joint in guinea-pigs.

PubMed

Kuboki, T; Nakanishi, T; Kanyama, M; Sonoyama, W; Fujisawa, T; Kobayashi, K; Ikeda, T; Kubo, T; Yamashita, A; Takigawa, M

1999-09-01

Adenovirus vector system is expected to be useful for direct gene therapy for joint disease. This study first sought to confirm that foreign genes can be transferred to articular chondrocytes in primary culture. Next, recombinant adenovirus vectors harbouring beta-galactosidase gene (LacZ) was injected directly into the temporomandibular joints of Hartley guinea-pigs to clarify the in vivo transfer availability of the adenovirus vectors. Specifically, recombinant adenovirus harbouring LacZ gene (AxlCALacZ) was injected into the upper joint cavities of both mandibular joints of four male 6-week-old Hartley guinea-pigs. Either the same amount of recombinant adenovirus without LacZ gene (Axlw) suspension (placebo) or the same amount of phosphate-buffered saline solution (control) were injected into the upper joint cavities of both joints of another four male guinea-pigs. At 1, 2, 3 and 4 weeks after injection, the joints were dissected and the expression of delivered LacZ was examined by 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-gal) staining and reverse transcriptase-polymerase chain reaction (RT-PCR). To investigate the expression of transferred gene in other organs, total RNA was extracted from liver, kidney, heart and brain and the expression of LacZ mRNA and 18 S ribosomal RNA were analysed by RT-PCR. Clear expression of LacZ was observed in the articular surfaces of the temporal tubercle, articular disc and synovium of the temporomandibular joints even 4 weeks after injection in the AxlCALacZ-injected group, while no expression was detected in placebo and control groups. Histological examination confirmed that LacZ activity was clearly detected in a few cell layers of the articular surface tissues, which is much more efficient than in a previously study of the knee joint. In the other organs, expression of the delivered transgene was not observed. Based on these findings, direct gene delivery into the articular surface of the temporomandibular joint

Complementation between avirulent Newcastle disease virus and a fusion protein gene expressed from a retrovirus vector: requirements for membrane fusion.

PubMed Central

Morrison, T; McQuain, C; McGinnes, L

1991-01-01

The cDNA derived from the fusion gene of the virulent AV strain of Newcastle disease virus (NDV) was expressed in chicken embryo cells by using a retrovirus vector. The fusion protein expressed in this system was transported to the cell surface and was efficiently cleaved into the disulfide-linked F1-F2 form found in infectious virions. The cells expressing the fusion gene grew normally and could be passaged many times. Monolayers of these cells would plaque, in the absence of trypsin, avirulent NDV strains (strains which encode a fusion protein which is not cleaved in tissue culture). Fusion protein-expressing cells would not fuse if mixed with uninfected cells or uninfected cells expressing the hemagglutinin-neuraminidase (HN) protein. However, the fusion protein-expressing cells, if infected with avirulent strains of NDV, would fuse with uninfected cells, suggesting that fusion requires both the fusion protein and another viral protein expressed in the same cell. Fusion was also seen after transfection of the HN protein gene into fusion protein-expressing cells. Thus, the expressed fusion protein gene is capable of complementing the virus infection, providing an active cleaved fusion protein required for the spread of infection. However, the fusion protein does not mediate cell fusion unless the cell also expresses the HN protein. Fusion protein-expressing cells would not plaque influenza virus in the absence of trypsin, nor would influenza virus-infected fusion protein-expressing cells fuse with uninfected cells. Thus, the influenza virus HA protein will not substitute for the NDV HN protein in cell-to-cell fusion. Images PMID:1987376

Insights into mutagenesis using Escherichia coli chromosomal lacZ strains that enable detection of a wide spectrum of mutational events.

PubMed

Seier, Tracey; Padgett, Dana R; Zilberberg, Gal; Sutera, Vincent A; Toha, Noor; Lovett, Susan T

2011-06-01

Strand misalignments at DNA repeats during replication are implicated in mutational hotspots. To study these events, we have generated strains carrying mutations in the Escherichia coli chromosomal lacZ gene that revert via deletion of a short duplicated sequence or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences. Using these strains, we demonstrate that mutation of the distal repeat of a quasipalindrome, with respect to replication fork movement, is about 10-fold higher than the proximal repeat, consistent with more common template switching on the leading strand. The leading strand bias was lost in the absence of exonucleases I and VII, suggesting that it results from more efficient suppression of template switching by 3' exonucleases targeted to the lagging strand. The loss of 3' exonucleases has no effect on strand misalignment at direct repeats to produce deletion. To compare these events to other mutations, we have reengineered reporters (designed by Cupples and Miller 1989) that detect specific base substitutions or frameshifts in lacZ with the reverting lacZ locus on the chromosome rather than an F' element. This set allows rapid screening of potential mutagens, environmental conditions, or genetic loci for effects on a broad set of mutational events. We found that hydroxyurea (HU), which depletes dNTP pools, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple frameshifts, or base substitutions. Mutations in nucleotide diphosphate kinase, ndk, significantly elevated simple mutations but had little effect on the templated class. Zebularine, a cytosine analog, elevated all classes.

Highly specific targeting of the TMPRSS2/ERG fusion gene using liposomal nanovectors

PubMed Central

Shao, Longjiang; Tekedereli, Ibrahim; Wang, Jianghua; Yuca, Erkan; Tsang, Susan; Sood, Anil; Lopez-Berestein, Gabriel; Ozpolat, Bulent; Ittmann, Michael

2012-01-01

Purpose The TMPRSS2/ERG (T/E) fusion gene is present in half of all prostate cancer (PCa) tumors. Fusion of the oncogenic ERG gene with the androgen-regulated TMPRSS2 gene promoter results in expression of fusion mRNAs in PCa cells. The junction of theTMPRSS2 and ERG derived portions of the fusion mRNA constitutes a cancer specific target in cells containing the T/E fusion gene. Targeting the most common alternatively spliced fusion gene mRNA junctional isoforms in vivo using siRNAs in liposomal nanovectors may potentially be a novel, low toxicity treatment for PCa. Experimental Design We designed and optimized siRNAs targeting the two most common T/E fusion gene mRNA junctional isoforms (Type III or Type VI). Specificity of siRNAs was assessed by transient co-transfection in vitro. To test their ability to inhibit growth of PCa cells expressing these fusion gene isoforms in vivo, specific siRNAs in liposomal nanovectors were used to treat mice bearing orthotopic or subcutaneous xenograft tumors expressing the targeted fusion isoforms. Results The targeting siRNAs were both potent and highly specific in vitro. In vivo they significantly inhibited tumor growth. The degree of growth inhibition was variable and was correlated with the extent of fusion gene knockdown. The growth inhibition was associated with marked inhibition of angiogenesis and, to a lesser degree, proliferation and a marked increase in apoptosis of tumor cells. No toxicity was observed. Conclusions Targeting the T/E fusion junction in vivo with specific siRNAs delivered via liposomal nanovectors is a promising therapy for men with PCa. PMID:23052253

Highly specific targeting of the TMPRSS2/ERG fusion gene using liposomal nanovectors.

PubMed

Shao, Longjiang; Tekedereli, Ibrahim; Wang, Jianghua; Yuca, Erkan; Tsang, Susan; Sood, Anil; Lopez-Berestein, Gabriel; Ozpolat, Bulent; Ittmann, Michael

2012-12-15

The TMPRSS2/ERG (T/E) fusion gene is present in half of all prostate cancer tumors. Fusion of the oncogenic ERG gene with the androgen-regulated TMPRSS2 gene promoter results in expression of fusion mRNAs in prostate cancer cells. The junction of theTMPRSS2- and ERG-derived portions of the fusion mRNA constitutes a cancer-specific target in cells containing the T/E fusion gene. Targeting the most common alternatively spliced fusion gene mRNA junctional isoforms in vivo using siRNAs in liposomal nanovectors may potentially be a novel, low-toxicity treatment for prostate cancer. We designed and optimized siRNAs targeting the two most common T/E fusion gene mRNA junctional isoforms (type III or type VI). Specificity of siRNAs was assessed by transient co-transfection in vitro. To test their ability to inhibit growth of prostate cancer cells expressing these fusion gene isoforms in vivo, specific siRNAs in liposomal nanovectors were used to treat mice bearing orthotopic or subcutaneous xenograft tumors expressing the targeted fusion isoforms. The targeting siRNAs were both potent and highly specific in vitro. In vivo they significantly inhibited tumor growth. The degree of growth inhibition was variable and was correlated with the extent of fusion gene knockdown. The growth inhibition was associated with marked inhibition of angiogenesis and, to a lesser degree, proliferation and a marked increase in apoptosis of tumor cells. No toxicity was observed. Targeting the T/E fusion junction in vivo with specific siRNAs delivered via liposomal nanovectors is a promising therapy for men with prostate cancer. ©2012 AACR.

Engineering and Functional Characterization of Fusion Genes Identifies Novel Oncogenic Drivers of Cancer.

PubMed

Lu, Hengyu; Villafane, Nicole; Dogruluk, Turgut; Grzeskowiak, Caitlin L; Kong, Kathleen; Tsang, Yiu Huen; Zagorodna, Oksana; Pantazi, Angeliki; Yang, Lixing; Neill, Nicholas J; Kim, Young Won; Creighton, Chad J; Verhaak, Roel G; Mills, Gordon B; Park, Peter J; Kucherlapati, Raju; Scott, Kenneth L

2017-07-01

Oncogenic gene fusions drive many human cancers, but tools to more quickly unravel their functional contributions are needed. Here we describe methodology permitting fusion gene construction for functional evaluation. Using this strategy, we engineered the known fusion oncogenes, BCR-ABL1, EML4-ALK , and ETV6-NTRK3, as well as 20 previously uncharacterized fusion genes identified in The Cancer Genome Atlas datasets. In addition to confirming oncogenic activity of the known fusion oncogenes engineered by our construction strategy, we validated five novel fusion genes involving MET, NTRK2 , and BRAF kinases that exhibited potent transforming activity and conferred sensitivity to FDA-approved kinase inhibitors. Our fusion construction strategy also enabled domain-function studies of BRAF fusion genes. Our results confirmed other reports that the transforming activity of BRAF fusions results from truncation-mediated loss of inhibitory domains within the N-terminus of the BRAF protein. BRAF mutations residing within this inhibitory region may provide a means for BRAF activation in cancer, therefore we leveraged the modular design of our fusion gene construction methodology to screen N-terminal domain mutations discovered in tumors that are wild-type at the BRAF mutation hotspot, V600. We identified an oncogenic mutation, F247L, whose expression robustly activated the MAPK pathway and sensitized cells to BRAF and MEK inhibitors. When applied broadly, these tools will facilitate rapid fusion gene construction for subsequent functional characterization and translation into personalized treatment strategies. Cancer Res; 77(13); 3502-12. ©2017 AACR . ©2017 American Association for Cancer Research.

Comparison between S+L- assay and LacZ marker rescue assay for detecting replication-competent gammaretroviruses.

PubMed

Hashimoto-Gotoh, A; Yoshikawa, R; Miyazawa, T

2015-09-01

To avoid contamination of adventitious gammaretroviruses in biological products such as vaccines, it is necessary to check the master seed cells for manufacturing. There are several assays to detect infectious gammaretroviruses. Among these, sarcoma-positive, leukemia-negative (S+L-) assay is a classical infectivity assay, which is often recommended in governmental guidelines. The S+L- cells used in S+L- assay generate unique focus upon the infection of replication-competent gammaretroviruses. Although S+L- assay is well recognized for the detection, their applicability is questionable in some cases. On the other hand, LacZ marker rescue (LMR) assay detects infectious gammaretroviruses by transducing LacZ marker gene to the target cells, which shows lacZ-positive foci if the infectious virus is present. In this study, we compared LMR and S+L- assays for detection of a variety of endogenous and exogenous gammaretroviruses. As results, LMR assay could detect all gammaretroviruses examined. On the other hand, S+L- assay using feline S+L- cells, termed QN10S, could not detect porcine endogenous retrovirus (PERV) subgroups A/B. Further, S+L- mink cells could not detect feline leukemia virus subgroups B in addition to PERV-A/B. These data indicate that LMR assay is better suited to detect wider range of gammaretroviruses. Copyright © 2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

Kinase Gene Fusions in Defined Subsets of Melanoma

PubMed Central

Turner, Jacqueline; Couts, Kasey; Sheren, Jamie; Saichaemchan, Siriwimon; Ariyawutyakorn, Witthawat; Avolio, Izabela; Cabral, Ethan; Glogowska, Magdelena; Amato, Carol; Robinson, Steven; Hintzsche, Jennifer; Applegate, Allison; Seelenfreund, Eric; Gonzalez, Rita; Wells, Keith; Bagby, Stacey; Tentler, John; Tan, Aik-Choon; Wisell, Joshua; Varella-Garcia, Marileila; Robinson, William

2017-01-01

Summary Genomic rearrangements resulting in activating kinase fusions have been increasingly described in a number of cancers including malignant melanoma, but their frequency in specific melanoma subtypes has not been reported. We used break-apart fluorescence in-situ hybridization (FISH) to identify genomic rearrangements in tissues from 59 patients with various types of malignant melanoma including acral lentiginous, mucosal, superficial spreading, and nodular. We identified four genomic rearrangements involving the genes BRAF, RET, and ROS1. Of these, three were confirmed by IHC or sequencing and one was found to be an ARMC10-BRAF fusion that has not been previously reported in melanoma. These fusions occurred in different subtypes of melanoma but all in tumors lacking known driver mutations. Our data suggest gene fusions are more common than previously thought-and should be further explored particularly in melanomas lacking known driver mutations. PMID:27864876

Pulmonary inflammatory myofibroblastic tumor harboring EML4-ALK fusion gene.

PubMed

Sokai, Akihiko; Enaka, Makiko; Sokai, Risa; Mori, Shoichi; Mori, Shunsuke; Gunji, Masaharu; Fujino, Masahiko; Ito, Masafumi

2014-01-01

Inflammatory myofibroblastic tumor is a rare tumor deriving from mesenchymal tissue. Approximately 50% of inflammatory myofibroblastic tumors harbor an anaplastic lymphoma kinase fusion gene. Pulmonary inflammatory myofibroblastic tumors harboring tropomyosin3-anaplastic lymphoma kinase or protein tyrosine phosphatase receptor-type F polypeptide-interacting protein-binding protein 1-anaplastic lymphoma kinase have been reported previously. However, it has not been reported that inflammatory myofibroblastic tumors harbor echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase fusion gene which is considered to be very specific to lung cancers. A few tumors harboring echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase fusion gene other than lung cancers have been reported and the tumors were all carcinomas. A 67-year-old man had been followed up for a benign tumor for approximately 3 years before the tumor demonstrated malignant transformation. Lobectomy and autopsy revealed that an inflammatory myofibroblastic tumor harboring echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase fusion gene had transformed into an undifferentiated sarcoma. This case suggests that echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase fusion is an oncogenic event in not only carcinomas but also sarcomas originating from stromal cells.

Kinase gene fusions in defined subsets of melanoma.

PubMed

Turner, Jacqueline; Couts, Kasey; Sheren, Jamie; Saichaemchan, Siriwimon; Ariyawutyakorn, Witthawat; Avolio, Izabela; Cabral, Ethan; Glogowska, Magdelena; Amato, Carol; Robinson, Steven; Hintzsche, Jennifer; Applegate, Allison; Seelenfreund, Eric; Gonzalez, Rita; Wells, Keith; Bagby, Stacey; Tentler, John; Tan, Aik-Choon; Wisell, Joshua; Varella-Garcia, Marileila; Robinson, William

2017-01-01

Genomic rearrangements resulting in activating kinase fusions have been increasingly described in a number of cancers including malignant melanoma, but their frequency in specific melanoma subtypes has not been reported. We used break-apart fluorescence in situ hybridization (FISH) to identify genomic rearrangements in tissues from 59 patients with various types of malignant melanoma including acral lentiginous, mucosal, superficial spreading, and nodular. We identified four genomic rearrangements involving the genes BRAF, RET, and ROS1. Of these, three were confirmed by Immunohistochemistry (IHC) or sequencing and one was found to be an ARMC10-BRAF fusion that has not been previously reported in melanoma. These fusions occurred in different subtypes of melanoma but all in tumors lacking known driver mutations. Our data suggest gene fusions are more common than previously thought and should be further explored particularly in melanomas lacking known driver mutations. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

[Mutations of EGFR gene and EML4-ALK fusion gene in superficial lymph node of non-small cell lung cancer].

PubMed

Wei, Lili; Li, Xingzhou; Yu, Zhonghe

2015-07-14

To explore the mutation status of epidermal growth factor receptor (EGFR) fusion gene and microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion gene in superficial lymph nodes of non-small cell lung cancer (NSCLC). The technique of fluorescent quantitative polymerase chain reaction (FQ-PCR) was employed for detecting the mutation rate of EGFR gene and EML4-ALK fusion gene for 40 cases of superficial lymph node tissue of NSCLC inpatients at General Military Hospital of Beijing PLA Command from February 2013 to November 2014. And then the correlations were analyzed between EMIA-ALK fusion gene and EGFR gene with clinical features and the clinical efficacies of targeted therapy. The mutation rate of EGFR gene was 35% (14/40) and 50% (10/20) in non-smokers and 46.7% (14/30) in adenocarcinoma patients. The mutation distribution was as follows: exon 18 (n = 1), exon 19 (n =8) and exon 21 (n =5). The mutation rate of EML4-ALK fusion gene was 2. 5% (1/40). EGFR gene mutation was predominantly present in non-smokers (P < 0. 05) and adenocarcinoma (P <0. 01) while no significant difference existed between gender, age or stage (P >0. 05). Those on a targeted therapy had a disease control rate of 93. 3%. Both EGFR gene and EMI4-ALK fusion gene may be detected in superficial lymph nodes of NSCLC patients. The mutation rate of EGFR gene is high in adenocarcinoma and non-smokers while EML4-ALK fusion gene has a low mutation rate.

Repeated evolution of chimeric fusion genes in the β-globin gene family of laurasiatherian mammals.

PubMed

Gaudry, Michael J; Storz, Jay F; Butts, Gary Tyler; Campbell, Kevin L; Hoffmann, Federico G

2014-05-09

The evolutionary fate of chimeric fusion genes may be strongly influenced by their recombinational mode of origin and the nature of functional divergence between the parental genes. In the β-globin gene family of placental mammals, the two postnatally expressed δ- and β-globin genes (HBD and HBB, respectively) have a propensity for recombinational exchange via gene conversion and unequal crossing-over. In the latter case, there are good reasons to expect differences in retention rates for the reciprocal HBB/HBD and HBD/HBB fusion genes due to thalassemia pathologies associated with the HBD/HBB "Lepore" deletion mutant in humans. Here, we report a comparative genomic analysis of the mammalian β-globin gene cluster, which revealed that chimeric HBB/HBD fusion genes originated independently in four separate lineages of laurasiatherian mammals: Eulipotyphlans (shrews, moles, and hedgehogs), carnivores, microchiropteran bats, and cetaceans. In cases where an independently derived "anti-Lepore" duplication mutant has become fixed, the parental HBD and/or HBB genes have typically been inactivated or deleted, so that the newly created HBB/HBD fusion gene is primarily responsible for synthesizing the β-type subunits of adult and fetal hemoglobin (Hb). Contrary to conventional wisdom that the HBD gene is a vestigial relict that is typically inactivated or expressed at negligible levels, we show that HBD-like genes often encode a substantial fraction (20-100%) of β-chain Hbs in laurasiatherian taxa. Our results indicate that the ascendancy or resuscitation of genes with HBD-like coding sequence requires the secondary acquisition of HBB-like promoter sequence via unequal crossing-over or interparalog gene conversion. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Fusion genes in solid tumors: an emerging target for cancer diagnosis and treatment.

PubMed

Parker, Brittany C; Zhang, Wei

2013-11-01

Studies over the past decades have uncovered fusion genes, a class of oncogenes that provide immense diagnostic and therapeutic advantages because of their tumor-specific expression. Originally associated with hemotologic cancers, fusion genes have recently been discovered in a wide array of solid tumors, including sarcomas, carcinomas, and tumors of the central nervous system. Fusion genes are attractive as both therapeutic targets and diagnostic tools due to their inherent expression in tumor tissue alone. Therefore, the discovery and elucidation of fusion genes in various cancer types may provide more effective therapies in the future for cancer patients.

Identification of a novel fusion gene HMGA2-EGFR in glioblastoma.

PubMed

Komuro, Akiyoshi; Raja, Erna; Iwata, Caname; Soda, Manabu; Isogaya, Kazunobu; Yuki, Keiko; Ino, Yasushi; Morikawa, Masato; Todo, Tomoki; Aburatani, Hiroyuki; Suzuki, Hiromichi; Ranjit, Melissa; Natsume, Atsushi; Mukasa, Akitake; Saito, Nobuhito; Okada, Hitoshi; Mano, Hiroyuki; Miyazono, Kohei; Koinuma, Daizo

2018-04-15

Glioblastoma is one of the most malignant forms of cancer, for which no effective targeted therapy has been found. Although The Cancer Genome Atlas has provided a list of fusion genes in glioblastoma, their role in progression of glioblastoma remains largely unknown. To search for novel fusion genes, we obtained RNA-seq data from TGS-01 human glioma-initiating cells, and identified a novel fusion gene (HMGA2-EGFR), encoding a protein comprising the N-terminal region of the high-mobility group AT-hook protein 2 (HMGA2) fused to the C-terminal region of epidermal growth factor receptor (EGFR), which retained the transmembrane and kinase domains of the EGFR. This fusion gene product showed transforming potential and a high tumor-forming capacity in cell culture and in vivo. Mechanistically, HMGA2-EGFR constitutively induced a higher level of phosphorylated STAT5B than EGFRvIII, an in-frame exon deletion product of the EGFR gene that is commonly found in primary glioblastoma. Forced expression of HMGA2-EGFR enhanced orthotopic tumor formation of the U87MG human glioma cell line. Furthermore, the EGFR kinase inhibitor erlotinib blocked sphere formation of TGS-01 cells in culture and inhibited tumor formation in vivo. These findings suggest that, in addition to gene amplification and in-frame exon deletion, EGFR signaling can also be activated by gene fusion, suggesting a possible avenue for treatment of glioblastoma. © 2017 UICC.

Systematic identification and analysis of frequent gene fusion events in metabolic pathways

DOE Office of Scientific and Technical Information (OSTI.GOV)

Henry, Christopher S.; Lerma-Ortiz, Claudia; Gerdes, Svetlana Y.

Here, gene fusions are the most powerful type of in silico-derived functional associations. However, many fusion compilations were made when <100 genomes were available, and algorithms for identifying fusions need updating to handle the current avalanche of sequenced genomes. The availability of a large fusion dataset would help probe functional associations and enable systematic analysis of where and why fusion events occur. As a result, here we present a systematic analysis of fusions in prokaryotes. We manually generated two training sets: (i) 121 fusions in the model organism Escherichia coli; (ii) 131 fusions found in B vitamin metabolism. These setsmore » were used to develop a fusion prediction algorithm that captured the training set fusions with only 7 % false negatives and 50 % false positives, a substantial improvement over existing approaches. This algorithm was then applied to identify 3.8 million potential fusions across 11,473 genomes. The results of the analysis are available in a searchable database. A functional analysis identified 3,000 reactions associated with frequent fusion events and revealed areas of metabolism where fusions are particularly prevalent. In conclusion, customary definitions of fusions were shown to be ambiguous, and a stricter one was proposed. Exploring the genes participating in fusion events showed that they most commonly encode transporters, regulators, and metabolic enzymes. The major rationales for fusions between metabolic genes appear to be overcoming pathway bottlenecks, avoiding toxicity, controlling competing pathways, and facilitating expression and assembly of protein complexes. Finally, our fusion dataset provides powerful clues to decipher the biological activities of domains of unknown function.« less

Systematic identification and analysis of frequent gene fusion events in metabolic pathways

DOE PAGES

Henry, Christopher S.; Lerma-Ortiz, Claudia; Gerdes, Svetlana Y.; ...

2016-06-24

Here, gene fusions are the most powerful type of in silico-derived functional associations. However, many fusion compilations were made when <100 genomes were available, and algorithms for identifying fusions need updating to handle the current avalanche of sequenced genomes. The availability of a large fusion dataset would help probe functional associations and enable systematic analysis of where and why fusion events occur. As a result, here we present a systematic analysis of fusions in prokaryotes. We manually generated two training sets: (i) 121 fusions in the model organism Escherichia coli; (ii) 131 fusions found in B vitamin metabolism. These setsmore » were used to develop a fusion prediction algorithm that captured the training set fusions with only 7 % false negatives and 50 % false positives, a substantial improvement over existing approaches. This algorithm was then applied to identify 3.8 million potential fusions across 11,473 genomes. The results of the analysis are available in a searchable database. A functional analysis identified 3,000 reactions associated with frequent fusion events and revealed areas of metabolism where fusions are particularly prevalent. In conclusion, customary definitions of fusions were shown to be ambiguous, and a stricter one was proposed. Exploring the genes participating in fusion events showed that they most commonly encode transporters, regulators, and metabolic enzymes. The major rationales for fusions between metabolic genes appear to be overcoming pathway bottlenecks, avoiding toxicity, controlling competing pathways, and facilitating expression and assembly of protein complexes. Finally, our fusion dataset provides powerful clues to decipher the biological activities of domains of unknown function.« less

TMPRSS2-ERG gene fusions are infrequent in prostatic ductal adenocarcinomas.

PubMed

Lotan, Tamara L; Toubaji, Antoun; Albadine, Roula; Latour, Mathieu; Herawi, Mehsati; Meeker, Alan K; DeMarzo, Angelo M; Platz, Elizabeth A; Epstein, Jonathan I; Netto, George J

2009-03-01

Ductal adenocarcinoma of the prostate is an unusual subtype that may be associated with a more aggressive clinical course, and is less responsive to conventional therapies than the more common prostatic acinar adenocarcinoma. However, given its frequent association with an acinar component at prostatectomy, some have challenged the concept of prostatic ductal adenocarcinoma as a distinct clinicopathologic entity. We studied the occurrence of the TMPRSS2-ERG gene fusion, in 40 surgically resected ductal adenocarcinoma cases, and in their associated acinar component using fluorescence in situ hybridization. A group of 38 'pure' acinar adenocarcinoma cases matched with the ductal adenocarcinoma group for pathological grade and stage was studied as a control. Compared with the matched acinar adenocarcinoma cases, the TMPRSS2-ERG gene fusion was significantly less frequently observed in ductal adenocarcinoma (45 vs 11% of cases, P=0.002, Fisher's exact test). Here, of the ductal adenocarcinoma cases with the gene fusion, 75% were fused through deletion, and the remaining case was fused through translocation. The TMPRSS2-ERG gene fusion was also rare in the acinar component of mixed ductal-acinar tumors when compared with the pure acinar adenocarcinoma controls (5 vs 45%, P=0.001, Fisher's exact test). In 95% of the ductal adenocarcinoma cases in which a concurrent acinar component was analyzed, there was concordance for presence/absence of the TMPRSS2-ERG gene fusion between the different histologic subtypes. In the control group of pure acinar adenocarcinoma cases, 59% were fused through deletion and 41% were fused through translocation. The presence of the TMPRSS2-ERG gene fusion in some cases of prostatic ductal adenocarcinoma supports the concept that ductal adenocarcinoma and acinar adenocarcinoma may be related genetically. However, the significantly lower rate of the gene fusion in pure ductal adenocarcinoma cases underscores the fact that genetic and biologic

Exploration of the gene fusion landscape of glioblastoma using transcriptome sequencing and copy number data.

PubMed

Shah, Nameeta; Lankerovich, Michael; Lee, Hwahyung; Yoon, Jae-Geun; Schroeder, Brett; Foltz, Greg

2013-11-22

RNA-seq has spurred important gene fusion discoveries in a number of different cancers, including lung, prostate, breast, brain, thyroid and bladder carcinomas. Gene fusion discovery can potentially lead to the development of novel treatments that target the underlying genetic abnormalities. In this study, we provide comprehensive view of gene fusion landscape in 185 glioblastoma multiforme patients from two independent cohorts. Fusions occur in approximately 30-50% of GBM patient samples. In the Ivy Center cohort of 24 patients, 33% of samples harbored fusions that were validated by qPCR and Sanger sequencing. We were able to identify high-confidence gene fusions from RNA-seq data in 53% of the samples in a TCGA cohort of 161 patients. We identified 13 cases (8%) with fusions retaining a tyrosine kinase domain in the TCGA cohort and one case in the Ivy Center cohort. Ours is the first study to describe recurrent fusions involving non-coding genes. Genomic locations 7p11 and 12q14-15 harbor majority of the fusions. Fusions on 7p11 are formed in focally amplified EGFR locus whereas 12q14-15 fusions are formed by complex genomic rearrangements. All the fusions detected in this study can be further visualized and analyzed using our website: http://ivygap.swedish.org/fusions. Our study highlights the prevalence of gene fusions as one of the major genomic abnormalities in GBM. The majority of the fusions are private fusions, and a minority of these recur with low frequency. A small subset of patients with fusions of receptor tyrosine kinases can benefit from existing FDA approved drugs and drugs available in various clinical trials. Due to the low frequency and rarity of clinically relevant fusions, RNA-seq of GBM patient samples will be a vital tool for the identification of patient-specific fusions that can drive personalized therapy.

Pleiotropic biological activities of alternatively spliced TMPRSS2/ERG fusion gene transcripts

PubMed Central

Wang, Jianghua; Cai, Yi; Yu, Wendong; Ren, Chengxi; Spencer, David M.; Ittmann, Michael

2008-01-01

TMPRSS2/ERG gene fusions are found in the majority of prostate cancers; however, there is significant heterogeneity in the 5′ region of the alternatively spliced fusion gene transcripts. We have found that there is also significant heterogeneity within the coding exons as well. There is variable inclusion of a 72-bp exon and other novel alternatively spliced isoforms. To assess the biological significance of these alternatively spliced transcripts, we expressed various transcripts in primary prostatic epithelial cells and in an immortalized prostatic epithelial cell line, PNT1a. The fusion gene transcripts promoted proliferation, invasion and motility with variable activities that depended on the structure of the 5′ region encoding the TMPRSS2/ERG fusion and the presence of the 72-bp exon. Cotransfection of different isoforms further enhanced biological activity, mimicking the situation in vivo, in which multiple isoforms are expressed. Finally, knockdown of the fusion gene in VCaP cells resulted in inhibition of proliferation in vitro and tumor progression in an in vivo orthotopic mice model. Our results indicate that TMPRSS2/ERG fusion isoforms have variable biological activities promoting tumor initiation and progression and are consistent with our previous clinical observations indicating that certain TMPRSS2/ERG fusion isoforms are significantly correlated with more aggressive disease. PMID:18922926

TMPRSS2-ERG gene fusion status in minute (minimal) prostatic adenocarcinoma.

PubMed

Albadine, Roula; Latour, Mathieu; Toubaji, Antoun; Haffner, Michael; Isaacs, William B; A Platz, Elizabeth; Meeker, Alan K; Demarzo, Angelo M; Epstein, Jonathan I; Netto, George J

2009-11-01

Minute prostatic adenocarcinomas are considered to be of insufficient virulence. Given recent suggestions of TMPRSS2-ERG gene fusion association with aggressive prostatic adenocarcinoma, we evaluated the incidence of TMPRSS2-ERG fusion in minute prostatic adenocarcinomas. A total of 45 consecutive prostatectomies with minute adenocarcinoma were used for tissue microarray construction. A total of 63 consecutive non-minimal, Gleason Score 6 tumors, from a separate PSA Era prostatectomy tissue microarray, were used for comparison. FISH was carried out using ERG break-apart probes. Tumors were assessed for fusion by deletion (Edel) or split (Esplit), duplicated fusions and low-level copy number gain in normal ERG gene locus. Minute adenocarcinomas: Fusion was evaluable in 32/45 tumors (71%). Fifteen out of 32 (47%) tumors were positive for fusion. Six (19%) were of the Edel class and 7 (22%) were classified as combined Edel+Esplit. Non-minute adenocarcinomas (pT2): Fusion was identified in 20/30 tumors (67%). Four (13%) were of Edel class and 5 (17%) were combined Edel+Esplit. Duplicated fusions were encountered in 5 (16%) tumors. Non-minute adenocarcinomas (pT3): Fusion was identified in 19/33 (58%). Fusion was due to a deletion in 6 (18%) tumors. Seven tumors (21%) were classified as combined Edel+Esplit. One tumor showed Esplit alone. Duplicated fusions were encountered in 3 (9%) cases. The incidence of duplicated fusions was higher in non-minute adenocarcinomas (13 vs 0%; P=0.03). A trend for higher incidence of low-level copy number gain in normal ERG gene locus without fusion was noted in non-minute adenocarcinomas (10 vs 0%; P=0.07). We found a TMPRSS2-ERG fusion rate of 47% in minute adenocarcinomas. The latter is not significantly different from that of grade matched non-minute adenocarcinomas. The incidence of duplicated fusion was higher in non-minute adenocarcinomas. Our finding of comparable rate of TMPRSS2-ERG fusion in minute adenocarcinomas may argue

The tumorigenic FGFR3-TACC3 gene fusion escapes miR-99a regulation in glioblastoma.

PubMed

Parker, Brittany C; Annala, Matti J; Cogdell, David E; Granberg, Kirsi J; Sun, Yan; Ji, Ping; Li, Xia; Gumin, Joy; Zheng, Hong; Hu, Limei; Yli-Harja, Olli; Haapasalo, Hannu; Visakorpi, Tapio; Liu, Xiuping; Liu, Chang-Gong; Sawaya, Raymond; Fuller, Gregory N; Chen, Kexin; Lang, Frederick F; Nykter, Matti; Zhang, Wei

2013-02-01

Fusion genes are chromosomal aberrations that are found in many cancers and can be used as prognostic markers and drug targets in clinical practice. Fusions can lead to production of oncogenic fusion proteins or to enhanced expression of oncogenes. Several recent studies have reported that some fusion genes can escape microRNA regulation via 3'-untranslated region (3'-UTR) deletion. We performed whole transcriptome sequencing to identify fusion genes in glioma and discovered FGFR3-TACC3 fusions in 4 of 48 glioblastoma samples from patients both of mixed European and of Asian descent, but not in any of 43 low-grade glioma samples tested. The fusion, caused by tandem duplication on 4p16.3, led to the loss of the 3'-UTR of FGFR3, blocking gene regulation of miR-99a and enhancing expression of the fusion gene. The fusion gene was mutually exclusive with EGFR, PDGFR, or MET amplification. Using cultured glioblastoma cells and a mouse xenograft model, we found that fusion protein expression promoted cell proliferation and tumor progression, while WT FGFR3 protein was not tumorigenic, even under forced overexpression. These results demonstrated that the FGFR3-TACC3 gene fusion is expressed in human cancer and generates an oncogenic protein that promotes tumorigenesis in glioblastoma.

A perspective of gene therapy in the glaucomas.

PubMed

Kaufman, P L; Jia, W W; Tan, J; Chen, Z; Gabelt, B T; Booth, V; Tufaro, F; Cynader, M

1999-06-01

Gene therapy in the anterior and posterior segment tissues may have the potential to favorably influence aqueous hydrodynamics and retinal ganglion cell biology, thereby preventing, delaying, or minimizing glaucomatous damage to the optic nerve. We demonstrated the feasibility of using a herpes viral vector (ribonucleotide reductase defective HSV-1, hrR3) to deliver the lacZ reporter gene to living cat and rat eyes. Cats received injections into the anterior chamber and rats into the vitreous cavity. In cats, lacZ expression was detectable at 1 to 2 days in the anterior outer portion of the ciliary muscle and the lining of the intertrabecular spaces of the corneoscleral and uveal meshwork. Rat eyes showed lacZ expression in the retinal pigment epithelium and photoreceptor outer segments 2 days after injection.

The tumorigenic FGFR3-TACC3 gene fusion escapes miR-99a regulation in glioblastoma

PubMed Central

Parker, Brittany C.; Annala, Matti J.; Cogdell, David E.; Granberg, Kirsi J.; Sun, Yan; Ji, Ping; Li, Xia; Gumin, Joy; Zheng, Hong; Hu, Limei; Yli-Harja, Olli; Haapasalo, Hannu; Visakorpi, Tapio; Liu, Xiuping; Liu, Chang-gong; Sawaya, Raymond; Fuller, Gregory N.; Chen, Kexin; Lang, Frederick F.; Nykter, Matti; Zhang, Wei

2013-01-01

Fusion genes are chromosomal aberrations that are found in many cancers and can be used as prognostic markers and drug targets in clinical practice. Fusions can lead to production of oncogenic fusion proteins or to enhanced expression of oncogenes. Several recent studies have reported that some fusion genes can escape microRNA regulation via 3′–untranslated region (3′-UTR) deletion. We performed whole transcriptome sequencing to identify fusion genes in glioma and discovered FGFR3-TACC3 fusions in 4 of 48 glioblastoma samples from patients both of mixed European and of Asian descent, but not in any of 43 low-grade glioma samples tested. The fusion, caused by tandem duplication on 4p16.3, led to the loss of the 3′-UTR of FGFR3, blocking gene regulation of miR-99a and enhancing expression of the fusion gene. The fusion gene was mutually exclusive with EGFR, PDGFR, or MET amplification. Using cultured glioblastoma cells and a mouse xenograft model, we found that fusion protein expression promoted cell proliferation and tumor progression, while WT FGFR3 protein was not tumorigenic, even under forced overexpression. These results demonstrated that the FGFR3-TACC3 gene fusion is expressed in human cancer and generates an oncogenic protein that promotes tumorigenesis in glioblastoma. PMID:23298836

A multicenter evaluation of comprehensive analysis of MLL translocations and fusion gene partners in acute leukemia using the MLL FusionChip device.

PubMed

Harrison, Christine J; Griffiths, Mike; Moorman, Fìona; Schnittger, Susanne; Cayuela, Jean-Michel; Shurtleff, Sheila; Gottardi, Enrico; Mitterbauer, Gerlinde; Colomer, Dolores; Delabesse, Eric; Castéras, Vincent; Maroc, Nicolas

2007-02-01

Rearrangements of the MLL gene are significant in acute leukemia. Among the most frequent translocations are t(4;11)(q21;q23) and t(9;11)(p22;q23), which give rise to the MLL-AFF1 and MLL-MLLT3 fusion genes (alias MLL-AF4 and MLL-AF9) in acute lymphoblastic and acute myeloid leukemia, respectively. Current evidence suggests that determining the MLL status of acute leukemia, including precise identification of the partner gene, is important in defining appropriate treatment. This underscores the need for accurate detection methods. A novel molecular diagnostic device, the MLL FusionChip, has been successfully used to identify MLL fusion gene translocations in acute leukemia, including the precise breakpoint location. This study evaluated the performance of the MLL FusionChip within a routine clinical environment, comprising nine centers worldwide, in the analysis of 21 control and 136 patient samples. It was shown that the assay allowed accurate detection of the MLL fusion gene, regardless of the breakpoint location, and confirmed that this multiplex approach was robust in a global multicenter trial. The MLL FusionChip was shown to be superior to other detection methods. The type of molecular information provided by MLL FusionChip gave an indication of the appropriate primers to design for disease monitoring of MLL patients following treatment.

Deletion of p66Shc in mice increases the frequency of size-change mutations in the lacZ transgene.

PubMed

Beltrami, Elena; Ruggiero, Antonella; Busuttil, Rita; Migliaccio, Enrica; Pelicci, Pier Giuseppe; Vijg, Jan; Giorgio, Marco

2013-04-01

Upon oxidative challenge the genome accumulates adducts and breaks that activate the DNA damage response to repair, arrest, or eliminate the damaged cell. Thus, reactive oxygen species (ROS) generated by endogenous oxygen metabolism are thought to affect mutation frequency. However, few studies determined the mutation frequency when oxidative stress is reduced. To test whether in vivo spontaneous mutation frequency is altered in mice with reduced oxidative stress and cell death rate, we crossed p66Shc knockout (p66KO) mice, characterized by reduced intracellular concentration of ROS and by impaired apoptosis, with a transgenic line harboring multiple copies of the lacZ mutation reporter gene as part of a plasmid that can be recovered from organs into Escherichia coli to measure mutation rate. Liver and small intestine from 2- to 24-month-old, lacZ (p66Shc+/+) and lacZp66KO mice, were investigated revealing no difference in overall mutation frequency but a significant increase in the frequency of size-change mutations in the intestine of lacZp66KO mice. This difference was further increased upon irradiation of mice with X-ray. In addition, we found that knocking down cyclophilin D, a gene that facilitates mitochondrial apoptosis acting downstream of p66Shc, increased the size-change mutation frequency in small intestine. Size-change mutations also accumulated in death-resistant embryonic fibroblasts from lacZp66KO mice treated with H2 O2 . These results indicate that p66Shc plays a role in the accumulation of DNA rearrangements and suggest that p66Shc functions to clear damaged cells rather than affect DNA metabolism. © 2012 The Authors Aging Cell © 2012 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.

ChimerDB 3.0: an enhanced database for fusion genes from cancer transcriptome and literature data mining.

PubMed

Lee, Myunggyo; Lee, Kyubum; Yu, Namhee; Jang, Insu; Choi, Ikjung; Kim, Pora; Jang, Ye Eun; Kim, Byounggun; Kim, Sunkyu; Lee, Byungwook; Kang, Jaewoo; Lee, Sanghyuk

2017-01-04

Fusion gene is an important class of therapeutic targets and prognostic markers in cancer. ChimerDB is a comprehensive database of fusion genes encompassing analysis of deep sequencing data and manual curations. In this update, the database coverage was enhanced considerably by adding two new modules of The Cancer Genome Atlas (TCGA) RNA-Seq analysis and PubMed abstract mining. ChimerDB 3.0 is composed of three modules of ChimerKB, ChimerPub and ChimerSeq. ChimerKB represents a knowledgebase including 1066 fusion genes with manual curation that were compiled from public resources of fusion genes with experimental evidences. ChimerPub includes 2767 fusion genes obtained from text mining of PubMed abstracts. ChimerSeq module is designed to archive the fusion candidates from deep sequencing data. Importantly, we have analyzed RNA-Seq data of the TCGA project covering 4569 patients in 23 cancer types using two reliable programs of FusionScan and TopHat-Fusion. The new user interface supports diverse search options and graphic representation of fusion gene structure. ChimerDB 3.0 is available at http://ercsb.ewha.ac.kr/fusiongene/. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

The EWS–Oct-4 fusion gene encodes a transforming gene

PubMed Central

Lee, Jungwoon; Kim, Ja Young; Kang, In Young; Kim, Hye Kyoung; Han, Yong-Mahn; Kim, Jungho

2007-01-01

The t(6;22)(p21;q12) translocation associated with human bone and soft-tissue tumours results in a chimaeric molecule fusing the NTD (N-terminal domain) of the EWS (Ewing's sarcoma) gene to the CTD (C-terminal domain) of the Oct-4 (octamer-4) embryonic gene. Since the N-terminal domains of EWS and Oct-4 are structurally different, in the present study we have assessed the functional consequences of the EWS–Oct-4 fusion. We find that this chimaeric gene encodes a nuclear protein which binds DNA with the same sequence specificity as the parental Oct-4 protein. Comparison of the transactivation properties of EWS–Oct-4 and Oct-4 indicates that the former has higher transactivation activity for a known target reporter gene containing Oct-4 binding. Deletion analysis of the functional domains of EWS–Oct-4 indicates that the EWS (NTD), the POU domain and the CTD of EWS–Oct-4 are necessary for full transactivation potential. EWS–Oct-4 induced the expression of fgf-4 (fibroblast growth factor 4) and nanog, which are potent mitogens as well as Oct-4 downstream target genes whose promoters contain potential Oct-4-binding sites. Finally, ectopic expression of EWS–Oct-4 in Oct-4-null ZHBTc4 ES (embryonic stem) cells resulted in increased tumorigenic growth potential in nude mice. These results suggest that the oncogenic effect of the t(6;22) translocation is due to the EWS–Oct-4 chimaeric protein and that fusion of the EWS NTD to the Oct-4 DNA-binding domain produces a transforming chimaeric product. PMID:17564582

Engineering and Functional Characterization of Fusion Genes Identifies Novel Oncogenic Drivers of Cancer. | Office of Cancer Genomics

Cancer.gov

Oncogenic gene fusions drive many human cancers, but tools to more quickly unravel their functional contributions are needed. Here we describe methodology permitting fusion gene construction for functional evaluation. Using this strategy, we engineered the known fusion oncogenes, BCR-ABL1, EML4-ALK, and ETV6-NTRK3, as well as 20 previously uncharacterized fusion genes identified in TCGA datasets.

Development and Verification of an RNA Sequencing (RNA-Seq) Assay for the Detection of Gene Fusions in Tumors.

PubMed

Winters, Jennifer L; Davila, Jaime I; McDonald, Amber M; Nair, Asha A; Fadra, Numrah; Wehrs, Rebecca N; Thomas, Brittany C; Balcom, Jessica R; Jin, Long; Wu, Xianglin; Voss, Jesse S; Klee, Eric W; Oliver, Gavin R; Graham, Rondell P; Neff, Jadee L; Rumilla, Kandelaria M; Aypar, Umut; Kipp, Benjamin R; Jenkins, Robert B; Jen, Jin; Halling, Kevin C

2018-06-13

We assessed the performance characteristics of an RNA sequencing (RNA-Seq) assay designed to detect gene fusions in 571 genes to help manage patients with cancer. Polyadenylated RNA was converted to cDNA, which was then used to prepare next-generation sequencing libraries that were sequenced on an Illumina HiSeq 2500 instrument and analyzed with an in-house developed bioinformatic pipeline. The assay identified 38 of 41 gene fusions detected by another method, such as fluorescence in situ hybridization or RT-PCR, for a sensitivity of 93%. No false-positive gene fusions were identified in 15 normal tissue specimens and 10 tumor specimens that were negative for fusions by RNA sequencing or Mate Pair NGS (100% specificity). The assay also identified 22 fusions in 17 tumor specimens that had not been detected by other methods. Eighteen of the 22 fusions had not previously been described. Good intra-assay and interassay reproducibility was observed with complete concordance for the presence or absence of gene fusions in replicates. The analytical sensitivity of the assay was tested by diluting RNA isolated from gene fusion-positive cases with fusion-negative RNA. Gene fusions were generally detectable down to 12.5% dilutions for most fusions and as little as 3% for some fusions. This assay can help identify fusions in patients with cancer; these patients may in turn benefit from both US Food and Drug Administration-approved and investigational targeted therapies. Copyright © 2018 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Investigation of PAX3/7-FKHR fusion genes and IGF2 gene expression in rhabdomyosarcoma tumors.

PubMed

de Souza, Robson Ramos; Oliveira, Indhira Dias; Caran, Eliana Maria Monteiro; Alves, Maria Teresa de Seixas; Abib, Simone; Toledo, Silvia Regina Caminada

2012-12-01

The purpose of our study was to investigate the prevalence of the PAX3/7-FKHR fusion genes and quantify the IGF2 gene expression in rhabdomyosarcoma (RMS) samples. Soft tissue sarcomas account 5% of childhood cancers and 50% of them are RMS. Morphological evaluation of pediatric RMS has defined two histological subtypes, embryonal (ERMS) and alveolar (ARMS). Chromosomal analyses have demonstrated two translocations associated with ARMS, resulting in the PAX3/7-FKHR rearrangements. Reverse transcriptase-polymerase chain reaction (RT-PCR) is extremely useful in the diagnosis of ARMS positive for these rearrangements. Additionally, several studies have shown a significant involvement of IGF pathway in the pathogenesis of RMS. The presence of PAX3/7-FKHR gene fusions was studied in 25 RMS samples from patients attending the IOP-GRAACC/UNIFESP and three RMS cell lines by RT-PCR. IGF2 gene expression was quantified by qPCR and related with clinic pathological parameters. Of the 25 samples, nine (36%) were ARMS and 16 (64%) were ERMS. PAX3/7-FKHR gene fusions expression was detected in 56% of ARMS tumor samples. IGF2 overexpression was observed in 80% of samples and could indicate an important role of this pathway in RMS biology. Copyright © 2012 Elsevier Ltd. All rights reserved.

Novel gene fusion of PRCC-MITF defines a new member of MiT family translocation renal cell carcinoma: clinicopathological analysis and detection of the gene fusion by RNA sequencing and FISH.

PubMed

Xia, Qiu-Yuan; Wang, Xiao-Tong; Ye, Sheng-Bing; Wang, Xuan; Li, Rui; Shi, Shan-Shan; Fang, Ru; Zhang, Ru-Song; Ma, Heng-Hui; Lu, Zhen-Feng; Shen, Qin; Bao, Wei; Zhou, Xiao-Jun; Rao, Qiu

2018-04-01

MITF, TFE3, TFEB and TFEC belong to the same microphthalmia-associated transcription factor family (MiT). Two transcription factors in this family have been identified in two unusual types of renal cell carcinoma (RCC): Xp11 translocation RCC harbouring TFE3 gene fusions and t(6;11) RCC harbouring a MALAT1-TFEB gene fusion. The 2016 World Health Organisation classification of renal neoplasia grouped these two neoplasms together under the category of MiT family translocation RCC. RCCs associated with the other two MiT family members, MITF and TFEC, have rarely been reported. Herein, we identify a case of MITF translocation RCC with the novel PRCC-MITF gene fusion by RNA sequencing. Histological examination of the present tumour showed typical features of MiT family translocation RCCs, overlapping with Xp11 translocation RCC and t(6;11) RCC. However, this tumour showed negative results in TFE3 and TFEB immunochemistry and split fluorescence in-situ hybridisation (FISH) assays. The other MiT family members, MITF and TFEC, were tested further immunochemically and also showed negative results. RNA sequencing and reverse transcription-polymerase chain reaction confirmed the presence of a PRCC-MITF gene fusion: a fusion of PRCC exon 5 to MITF exon 4. We then developed FISH assays covering MITF break-apart probes and PRCC-MITF fusion probes to detect the MITF gene rearrangement. This study both proves the recurring existence of MITF translocation RCC and expands the genotype spectrum of MiT family translocation RCCs. © 2017 John Wiley & Sons Ltd.

Molecular detection of BCR/ABL fusion gene in Saudi acute lymphoblastic leukemia patients.

PubMed

El-Sissy, Azza; El-Mashari, May; Bassuni, Wafaa; El-Swaayed, Aziza

2006-06-01

Molecular cytogenetics is becoming one of the most useful tools targeting some genes which are generally considered to lead to leukemic transformation (as well as for numerical abnormalities). A fraction of acute lymphoblastic leukemia (ALL) cases carry the translocation t(9;22) (q34;q11.2) which juxtaposes the ABL proto-oncogene to the BCR gene generating a chimeric gene, BCR/ABL. This aberration is more frequent in adult ALL (20%-40%) than in pediatric ALL (<5%), and predicts poor clinical outcome. AIM OF OUR WORK: Is to study BCR/ABL fusion gene in ALL cases using fluorescent in situ hybridization. Twenty newly diagnosed ALL patients, 16 adult and 4 paediatric cases, were included in the study, 11 cases (55%) were of precursor B phenotype, 8 cases (40%) belonged to T lineage, while one case was biphenotypic expressing mainly precursor B cell markers tether with CD13, CD33, CD117, Detection of BCR/ABL fusion gene was done using interphase FISH technique and was confirmed molecularly using the RT-PCR technique. BCR/ABL fusion gene was negative in all the examined cases, yet abnormality involving 9q34, ABL gene, either by addition or deletion was detected in three cases (15%). Two of these cases were associated with BCR gene extra copies (three and four copies, respectively). This may reflect the frequency of association of ABL gene and BCR gene abnormality in our cases, and that absence of fusion gene BCR/ABL does not exclude their role in the leukomogenic process, yet a larger study is required to confirm and detect the prevalence of these gene disturbances in ALL and their association.

Effective enrichment strategy for EML4-ALK fusion gene screening in patients with non-small cell lung cancer.

PubMed

Kobayashi, Makoto; Sakakibara, Tomohiro; Inoue, Akira; Fukuhara, Tatsuro; Sasano, Hironobu; Ichinose, Masakazu; Nukiwa, Toshihiro

2014-01-01

A novel fusion gene that comprises the echinoderm microtubule-associated protein-like 4 (EML4) and anaplastic lymphoma kinase (ALK) genes was recently identified in non-small cell lung cancer (NSCLC), particularly in adenocarcinoma. A specific ALK inhibitor has been shown to exert anti-tumor effects in NSCLC with the EML4-ALK fusion gene. Previous reports suggested an EML4-ALK incidence of approximately 5% in a pan-NSCLC population, with an increased frequency in younger patients, but an appropriate strategy for further selecting patients with the EML4-ALK fusion gene remains unknown. Patients, 55 years of age or younger, who were diagnosed with NSCLC without typical squamous cell carcinoma features at our institute were retrospectively evaluated. The tumor specimens were examined by immunohistochemistry for the EML4-ALK fusion gene and by polymerase chain reaction for epidermal growth factor receptor (EGFR) mutations. Between January 2004 and September 2011, the EML4-ALK fusion gene was detected in 19.6% (9/46) of patients. The fusion gene incidence increased to 31% (9/29) when patients with EGFR mutations were excluded. The EML4-ALK fusion gene was further detected in 2 cases of undifferentiated cell carcinoma. EML4-ALK fusion gene examinations could be more effectively performed by selecting young NSCLC patients without EGFR mutations, whereas selection on the basis of a non-smoking or adenocarcinoma history, as reported in previous studies, may not correctly identify the patient groups with potential EML4-ALK fusion gene. Copyright © 2013 The Japanese Respiratory Society. Published by Elsevier B.V. All rights reserved.

Massive NGS Data Analysis Reveals Hundreds Of Potential Novel Gene Fusions in Human Cell Lines.

PubMed

Gioiosa, Silvia; Bolis, Marco; Flati, Tiziano; Massini, Annalisa; Garattini, Enrico; Chillemi, Giovanni; Fratelli, Maddalena; Castrignanò, Tiziana

2018-06-01

Gene fusions derive from chromosomal rearrangements and the resulting chimeric transcripts are often endowed with oncogenic potential. Furthermore, they serve as diagnostic tools for the clinical classification of cancer subgroups with different prognosis and, in some cases, they can provide specific drug targets. So far, many efforts have been carried out to study gene fusion events occurring in tumor samples. In recent years, the availability of a comprehensive Next Generation Sequencing dataset for all the existing human tumor cell lines has provided the opportunity to further investigate these data in order to identify novel and still uncharacterized gene fusion events. In our work, we have extensively reanalyzed 935 paired-end RNA-seq experiments downloaded from "The Cancer Cell Line Encyclopedia" repository, aiming at addressing novel putative cell-line specific gene fusion events in human malignancies. The bioinformatics analysis has been performed by the execution of four different gene fusion detection algorithms. The results have been further prioritized by running a bayesian classifier which makes an in silico validation. The collection of fusion events supported by all of the predictive softwares results in a robust set of ∼ 1,700 in-silico predicted novel candidates suitable for downstream analyses. Given the huge amount of data and information produced, computational results have been systematized in a database named LiGeA. The database can be browsed through a dynamical and interactive web portal, further integrated with validated data from other well known repositories. Taking advantage of the intuitive query forms, the users can easily access, navigate, filter and select the putative gene fusions for further validations and studies. They can also find suitable experimental models for a given fusion of interest. We believe that the LiGeA resource can represent not only the first compendium of both known and putative novel gene fusion events in the

Molecular analysis of the ependymin gene and functional test of its promoter region by transient expression in Brachydanio rerio.

PubMed

Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W

1992-01-01

Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.

Tyrosine kinase fusion genes in pediatric BCR-ABL1-like acute lymphoblastic leukemia

PubMed Central

Boer, Judith M.; Steeghs, Elisabeth M.P.; Marchante, João R.M.; Boeree, Aurélie; Beaudoin, James J.; Berna Beverloo, H.; Kuiper, Roland P.; Escherich, Gabriele; van der Velden, Vincent H.J.; van der Schoot, C. Ellen; de Groot-Kruseman, Hester A.; Pieters, Rob; den Boer, Monique L.

2017-01-01

Approximately 15% of pediatric B cell precursor acute lymphoblastic leukemia (BCP-ALL) is characterized by gene expression similar to that of BCR-ABL1-positive disease and unfavorable prognosis. This BCR-ABL1-like subtype shows a high frequency of B-cell development gene aberrations and tyrosine kinase-activating lesions. To evaluate the clinical significance of tyrosine kinase gene fusions in children with BCP-ALL, we studied the frequency of recently identified tyrosine kinase fusions, associated genetic features, and prognosis in a representative Dutch/German cohort. We identified 14 tyrosine kinase fusions among 77 BCR-ABL1-like cases (18%) and none among 76 non-BCR-ABL1-like B-other cases. Novel exon fusions were identified for RCSD1-ABL2 and TERF2-JAK2. JAK2 mutation was mutually exclusive with tyrosine kinase fusions and only occurred in cases with high CRLF2 expression. The non/late response rate and levels of minimal residual disease in the fusion-positive BCR-ABL1-like group were higher than in the non-BCR-ABL1-like B-others (p<0.01), and also higher, albeit not statistically significant, compared with the fusion-negative BCR-ABL1-like group. The 8-year cumulative incidence of relapse in the fusion-positive BCR-ABL1-like group (35%) was comparable with that in the fusion-negative BCR-ABL1-like group (35%), and worse than in the non-BCR-ABL1-like B-other group (17%, p=0.07). IKZF1 deletions, predominantly other than the dominant-negative isoform and full deletion, co-occurred with tyrosine kinase fusions. This study shows that tyrosine kinase fusion-positive cases are a high-risk subtype of BCP-ALL, which warrants further studies with specific kinase inhibitors to improve outcome. PMID:27894077

Identification of EML4-ALK as an alternative fusion gene in epithelioid inflammatory myofibroblastic sarcoma.

PubMed

Jiang, Quan; Tong, Han-Xing; Hou, Ying-Yong; Zhang, Yong; Li, Jing-Lei; Zhou, Yu-Hong; Xu, Jing; Wang, Jiong-Yuan; Lu, Wei-Qi

2017-05-23

Known as solid tumors of intermediate malignant potential, most inflammatory myofibroblastic tumors (IMTs) are treatable as long as the tumor is en-bloc resected. However, in some cases, the tumors have recurred and grown rapidly after successful surgery. Some of these tumors were classified as an epithelioid inflammatory myofibroblastic sarcoma (EIMS). Most previously reported EIMSs have been caused by RANBP2-ALK fusion gene. We herein report an EIMS case caused by an EML4-ALK fusion gene. RNAseq was conducted to find out the new ALK fusion gene which could not be detected following previously reported RT-PCR methods for EIMS cases with RANBP2-ALK fusion gene. After that, RT-PCR was also conducted to further prove the newly found fusion gene. Immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) test were applied to find out the unique morphological characters compared with the previous reported EIMS cases. We found an EIMS case who was suffering from a rapid recurrence after cytoreducyive surgery was done to relieve the exacerbating symptoms. The patient finally died for tumor lysis syndrome after the application of crizotinib. Distinctive ALK staining under the membrane and relatively weak ALK staining in the cytoplasm could also be observed. RNAseq and RT-PCR further revealed that the tumor harbored an EML4-ALK fusion gene. In conclusion, this is the first EIMS demonstrated to have been caused by the formation of an EML4-ALK fusion gene. This enriches the spectrum of EIMS and enlarges the horizon for the study of EIMS. The experience we shared in managing this kind of disease by discussing aspects of its success and failure could be of great value for surgeons and pathologists.

Transduction of ferret airway epithelia using a pre-treatment and lentiviral gene vector.

PubMed

Cmielewski, Patricia; Farrow, Nigel; Donnelley, Martin; McIntyre, Chantelle; Penny-Dimri, Jahan; Kuchel, Tim; Parsons, David

2014-11-21

The safety and efficiency of gene therapies for cystic fibrosis (CF) need to be assessed in pre-clinical models. Using the normal ferret, this study sought to determine whether ferret airway epithelia could be transduced with a lysophosphatidylcholine (LPC) pre-treatment followed by a VSV-G pseudotyped HIV-1 based lentiviral (LV) vector, in preparation for future studies in CF ferrets. Six normal ferrets (7 -8 weeks old) were treated with a 150 μL LPC pre-treatment, followed one hour later by a 500 μL LV vector dose containing the LacZ transgene. LacZ gene expression in the conducting airways and lung was assessed by X-gal staining after 7 days. The presence of transduction in the lung, as well as off-target transduction in the liver, spleen and gonads, were assessed by qPCR. The levels of LV vector p24 protein bio-distribution in blood sera were assessed by ELISA at 0, 1, 3, 5 and 7 days. The dosing protocol was well tolerated. LacZ gene expression was observed en face in the trachea of all animals. Histology showed that ciliated and basal cells were transduced in the trachea, with rare LacZ transduced single cells noted in lung. p24 levels was not detectable in the sera of 5 of the 6 animals. The LacZ gene was not detected in the lung tissue and no off-target transduction was detected by qPCR. This study shows that ferret airway epithelia are transducible using our unique two-step pre-treatment and LV vector dosing protocol. We have identified a number of unusual anatomical factors that are likely to influence the level of transduction that can be achieved in ferret airways. The ability to transduce ferret airway epithelium is a promising step towards therapeutic LV-CFTR testing in a CF ferret model.

[Detection of ALK, ROS1 and RET fusion genes in non-small cell lung cancer patients and its clinicopathologic correlation].

PubMed

Zhong, Shan; Zhang, Haiping; Bai, Dongyu; Gao, Dehong; Zheng, Jie; Ding, Yi

2015-09-01

To study the prevalence of ALK, ROS1 and RET fusion genes in non-small cell lung cancer (NSCLC), and its correlation with clinicopathologic features. Formalin-fixed and paraffin-embedded tissue sections from samples of 302 patients with NSCLC were screened for ALK, ROS1, RET fusions by real-time polymerase chain reaction (PCR). All of the cases were validated by Sanger DNA sequencing. The relationship between ALK, ROS1, RET fusion genes and clinicopathologic features were analyzed. In the cohort of 302 NSCLC samples, 3.97% (12/302) were found to contain ALK fusion genes, including 3 cases with E13; A20 gene fusion, 3 cases with E6; A20 gene fusion and 3 cases with E20; A20 gene fusion. There was no statistically significant difference in patient's gender, age, smoking history and histologic type. Moreover, in the 302 NSCLC samples studied, 3.97% (12/302) were found to contain ROS1 fusion genes, with CD74-ROS1 fusion identified in 9 cases. There was no statistically significant difference in patients' gender, age, smoking history and histologic type. One non-smoking elderly female patient with pulmonary adenocarcinoma had RET gene fusion. None of the cases studied had concurrent ALK, ROS1 and RET mutations. The ALK, ROS1 and RET fusion gene mutation rates in NSCLC are low, they represent some specific molecular subtypes of NSCLC. Genetic testing has significant meaning to guide clinical targeted therapy.

Kinase impact assessment in the landscape of fusion genes that retain kinase domains: a pan-cancer study

PubMed Central

Kim, Pora; Jia, Peilin; Zhao, Zhongming

2018-01-01

Abstract Assessing the impact of kinase in gene fusion is essential for both identifying driver fusion genes (FGs) and developing molecular targeted therapies. Kinase domain retention is a crucial factor in kinase fusion genes (KFGs), but such a systematic investigation has not been done yet. To this end, we analyzed kinase domain retention (KDR) status in chimeric protein sequences of 914 KFGs covering 312 kinases across 13 major cancer types. Based on 171 kinase domain-retained KFGs including 101 kinases, we studied their recurrence, kinase groups, fusion partners, exon-based expression depth, short DNA motifs around the break points and networks. Our results, such as more KDR than 5′-kinase fusion genes, combinatorial effects between 3′-KDR kinases and their 5′-partners and a signal transduction-specific DNA sequence motif in the break point intronic sequences, supported positive selection on 3′-kinase fusion genes in cancer. We introduced a degree-of-frequency (DoF) score to measure the possible number of KFGs of a kinase. Interestingly, kinases with high DoF scores tended to undergo strong gene expression alteration at the break points. Furthermore, our KDR gene fusion network analysis revealed six of the seven kinases with the highest DoF scores (ALK, BRAF, MET, NTRK1, NTRK3 and RET) were all observed in thyroid carcinoma. Finally, we summarized common features of ‘effective’ (highly recurrent) kinases in gene fusions such as expression alteration at break point, redundant usage in multiple cancer types and 3′-location tendency. Collectively, our findings are useful for prioritizing driver kinases and FGs and provided insights into KFGs’ clinical implications. PMID:28013235

Frameshifting in the expression of the Escherichia coli trpR gene is modulated by translation initiation.

PubMed Central

Benhar, I; Miller, C; Engelberg-Kulka, H

1993-01-01

The Escherichia coli trpR gene encodes the 108-amino-acid-long Trp repressor. We have shown previously that a +1 frameshifting event occurs during the expression of trpR, resulting in the synthesis of an additional (+1 frame) polypeptide. Using trpR-lac'Z fusions, we have recently found that the transition from the 0 to the +1 frame occurs via the bypassing of a 55-nucleotide-long segment of the trpR+1-lac'Z mRNA (I. Benhar, and H. Engelberg-Kulka, Cell 72:121-130, 1993). Here we show that the frequency of trpR frameshifting (or bypassing) can be regulated both in vivo and in vitro. This frequency is inversely proportional to the rate of initiation of translation of the trpR gene. Hence, modulating the level of translation initiation affects the frequency of frameshifting. Images PMID:8491735

Role of an expansin-like molecule in Dictyostelium morphogenesis and regulation of its gene expression by the signal transducer and activator of transcription protein Dd-STATa.

PubMed

Ogasawara, Shun; Shimada, Nao; Kawata, Takefumi

2009-02-01

Expansins are proteins involved in plant morphogenesis, exerting their effects on cellulose to extend cell walls. Dictyostelium is an organism that possesses expansin-like molecules, but their functions are not known. In this study, we analyzed the expL7 (expansin-like 7) gene, which has been identified as a putative target of Dd-STATa, a Dictyostelium homolog of the metazoan signal transducer and activator of transcription (STAT) proteins. Promoter fragments of the expL7 were fused to a lacZ reporter and the expression patterns determined. As expected from the behavior of the endogenous expL7 gene, the expL7/lacZ fusion gene was downregulated in Dd-STATa null slugs. In the parental strain, the expL7 promoter was activated in the anterior tip region. Mutational analysis of the promoter identified a sequence that was necessary for expression in tip cells. In addition, an activator sequence for pstAB cells was identified. These sequences act in combination with the repressor region to prevent ectopic expL7 expression in the prespore and prestalk regions of the slug and culminant. Although the expL7 null mutant showed no phenotypic change, the expL7 overexpressor showed aberrant stalk formation. These results indicate that the expansin-like molecule is important for morphogenesis in Dictyostelium.

Structure and regulation of KGD1, the structural gene for yeast alpha-ketoglutarate dehydrogenase.

PubMed

Repetto, B; Tzagoloff, A

1989-06-01

Nuclear respiratory-defective mutants of Saccharomyces cerevisiae have been screened for lesions in the mitochondrial alpha-ketoglutarate dehydrogenase complex. Strains assigned to complementation group G70 were ascertained to be deficient in enzyme activity due to mutations in the KGD1 gene coding for the alpha-ketoglutarate dehydrogenase component of the complex. The KGD1 gene has been cloned by transformation of a representative kgd1 mutant, C225/U1, with a recombinant plasmid library of wild-type yeast nuclear DNA. Transformants containing the gene on a multicopy plasmid had three- to four-times-higher alpha-ketoglutarate dehydrogenase activity than did wild-type S. cerevisiae. Substitution of the chromosomal copy of KGD1 with a disrupted allele (kgd1::URA3) induced a deficiency in alpha-ketoglutarate dehydrogenase. The sequence of the cloned region of DNA which complements kgd1 mutants was found to have an open reading frame of 3,042 nucleotides capable of coding for a protein of Mw 114,470. The encoded protein had 38% identical residues with the reported sequence of alpha-ketoglutarate dehydrogenase from Escherichia coli. Two lines of evidence indicated that transcription of KGD1 is catabolite repressed. Higher steady-state levels of KGD1 mRNA were detected in wild-type yeast grown on the nonrepressible sugar galactose than in yeast grown on high glucose. Regulation of KGD1 was also studied by fusing different 5'-flanking regions of KGD1 to the lacZ gene of E. coli and measuring the expression of beta-galactosidase in yeast. Transformants harboring a fusion of 693 nucleotides of the 5'-flanking sequence expressed 10 times more beta-galactosidase activity when grown under derepressed conditions. The response to the carbon source was reduced dramatically when the same lacZ fusion was present in a hap2 or hap3 mutant. The promoter element(s) responsible for the regulated expression of KGD1 has been mapped to the -354 to -143 region. This region contained several

Co-fuse: a new class discovery analysis tool to identify and prioritize recurrent fusion genes from RNA-sequencing data.

PubMed

Paisitkriangkrai, Sakrapee; Quek, Kelly; Nievergall, Eva; Jabbour, Anissa; Zannettino, Andrew; Kok, Chung Hoow

2018-06-07

Recurrent oncogenic fusion genes play a critical role in the development of various cancers and diseases and provide, in some cases, excellent therapeutic targets. To date, analysis tools that can identify and compare recurrent fusion genes across multiple samples have not been available to researchers. To address this deficiency, we developed Co-occurrence Fusion (Co-fuse), a new and easy to use software tool that enables biologists to merge RNA-seq information, allowing them to identify recurrent fusion genes, without the need for exhaustive data processing. Notably, Co-fuse is based on pattern mining and statistical analysis which enables the identification of hidden patterns of recurrent fusion genes. In this report, we show that Co-fuse can be used to identify 2 distinct groups within a set of 49 leukemic cell lines based on their recurrent fusion genes: a multiple myeloma (MM) samples-enriched cluster and an acute myeloid leukemia (AML) samples-enriched cluster. Our experimental results further demonstrate that Co-fuse can identify known driver fusion genes (e.g., IGH-MYC, IGH-WHSC1) in MM, when compared to AML samples, indicating the potential of Co-fuse to aid the discovery of yet unknown driver fusion genes through cohort comparisons. Additionally, using a 272 primary glioma sample RNA-seq dataset, Co-fuse was able to validate recurrent fusion genes, further demonstrating the power of this analysis tool to identify recurrent fusion genes. Taken together, Co-fuse is a powerful new analysis tool that can be readily applied to large RNA-seq datasets, and may lead to the discovery of new disease subgroups and potentially new driver genes, for which, targeted therapies could be developed. The Co-fuse R source code is publicly available at https://github.com/sakrapee/co-fuse .

Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

PubMed

Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

2017-07-25

Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

Regulation of SNM1, an inducible Saccharomyces cerevisiae gene required for repair of DNA cross-links.

PubMed

Wolter, R; Siede, W; Brendel, M

1996-02-05

The interstrand cross-link repair gene SNM1 of Saccharomyces cerevisiae was examined for regulation in response to DNA-damaging agents. Induction of SNM1-lacZ fusions was detected in response to nitrogen mustard, cis-platinum (II) diamine dichloride, UV light, and 8-methoxypsoralen + UVA, but not after heat-shock treatment or incubation with 2-dimethylaminoethylchloride, methylmethane sulfonate or 4-nitroquinoline-N-oxide. The promoter of SNM1 contains a 15 bp motif, which shows homology to the DRE2 box of the RAD2 promoter. Similar motifs have been found in promoter regions of other damage-inducible DNA repair genes. Deletion of this motif results in loss of inducibility of SNM1. Also, a putative negative upstream regulation sequence was found to be responsible for repression of constitutive transcription of SNM1. Surprisingly, no inducibility of SNM1 was found after treatment with DNA-damaging agents in strains without an intact DUN1 gene, while regulation seems unchanged in sad1 mutants.

Matrix factorization-based data fusion for gene function prediction in baker's yeast and slime mold.

PubMed

Zitnik, Marinka; Zupan, Blaž

2014-01-01

The development of effective methods for the characterization of gene functions that are able to combine diverse data sources in a sound and easily-extendible way is an important goal in computational biology. We have previously developed a general matrix factorization-based data fusion approach for gene function prediction. In this manuscript, we show that this data fusion approach can be applied to gene function prediction and that it can fuse various heterogeneous data sources, such as gene expression profiles, known protein annotations, interaction and literature data. The fusion is achieved by simultaneous matrix tri-factorization that shares matrix factors between sources. We demonstrate the effectiveness of the approach by evaluating its performance on predicting ontological annotations in slime mold D. discoideum and on recognizing proteins of baker's yeast S. cerevisiae that participate in the ribosome or are located in the cell membrane. Our approach achieves predictive performance comparable to that of the state-of-the-art kernel-based data fusion, but requires fewer data preprocessing steps.

The strategy of fusion genes construction determines efficient expression of introduced transcription factors.

PubMed

Adamus, Tomasz; Konieczny, Paweł; Sekuła, Małgorzata; Sułkowski, Maciej; Majka, Marcin

2014-01-01

The main goal in gene therapy and biomedical research is an efficient transcription factors (TFs) delivery system. SNAIL, a zinc finger transcription factor, is strongly involved in tumor, what makes its signaling pathways an interesting research subject. The necessity of tracking activation of intracellular pathways has prompted fluorescent proteins usage as localization markers. Advanced molecular cloning techniques allow to generate fusion proteins from fluorescent markers and transcription factors. Depending on fusion strategy, the protein expression levels and nuclear transport ability are significantly different. The P2A self-cleavage motif through its cleavage ability allows two single proteins to be simultaneously expressed. The aim of this study was to compare two strategies for introducing a pair of genes using expression vector system. We have examined GFP and SNAI1 gene fusions by comprising common nucleotide polylinker (multiple cloning site) or P2A motif in between them, resulting in one fusion or two independent protein expressions respectively. In each case transgene expression levels and translation efficiency as well as nuclear localization of expressed protein have been analyzed. Our data showed that usage of P2A motif provides more effective nuclear transport of SNAIL transcription factor than conventional genes linker. At the same time the fluorescent marker spreads evenly in subcellular space.

Clinicopathological Characteristics of Patients with Non-Small-Cell Lung Cancer Who Harbor EML4-ALK Fusion Gene: A Meta-Analysis

PubMed Central

Zhao, Fengzhi; Xu, Meng; Lei, Honcho; Zhou, Ziqi; Wang, Liang; Li, Ping; Zhao, Jianfu; Hu, Penghui

2015-01-01

Background A novel fusion gene of echinoderm microtubule-associated protein-like 4 (EML4) and anaplastic lymphoma kinase (ALK) has been recently identified in non-small-cell lung cancers (NSCLCs). Patients with the EML4-ALK fusion gene demonstrate unique clinicopathological and physiological characteristics. Here we present a meta-analysis of large-scale studies to evaluate the clinicopathological characteristics of NSCLC patients harboring the EML4-ALK fusion gene. Methods Both English and Chinese databases were systematically used to search the materials of the clinicopathological characteristics of patients with NSCLC harboring the EML4-ALK fusion gene. Pooled relative risk (RR) estimates and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect model. Publication bias and chi-square test were also calculated. Results 27 retrospective studies were included in our meta-analysis. These studies included a total of 6950 patients. The incidence rate of EML4-ALK fusion in NSCLC patients was found to be 6.8% (472/6950). The correlation of the EML4-ALK fusion gene and clinicopathological characteristics of NSCLC patients demonstrated a significant difference in smoking status, histological types, stage, and ethnic characteristics. The positive rate of the EML4-ALK fusion gene expression in females were slightly higher than that in males, but not significantly (P = 0.52). In addition, the EML4-ALK fusion gene was mutually exclusive of the EGFR and KRAS mutation genes (P = 0.00). Conclusion Our pooled analysis revealed that the EML4-ALK fusion gene was observed predominantly in adenocarcinoma, non-smoking and NSCLC patients, especially those diagnosed in the advanced clinical stage of NSCLC. Additionally, the EML4-ALK fusion gene was exclusive of the EGFR and KRAS mutation genes. We surmise that IHC assay is a valuable tool for the prescreening of patients with ALK fusion gene in clinical practice, and FISH assay can be performed as a

Clinicopathological characteristics of patients with non-small-cell lung cancer who harbor EML4-ALK fusion gene: a meta-analysis.

PubMed

Zhao, Fengzhi; Xu, Meng; Lei, Honcho; Zhou, Ziqi; Wang, Liang; Li, Ping; Zhao, Jianfu; Hu, Penghui

2015-01-01

A novel fusion gene of echinoderm microtubule-associated protein-like 4 (EML4) and anaplastic lymphoma kinase (ALK) has been recently identified in non-small-cell lung cancers (NSCLCs). Patients with the EML4-ALK fusion gene demonstrate unique clinicopathological and physiological characteristics. Here we present a meta-analysis of large-scale studies to evaluate the clinicopathological characteristics of NSCLC patients harboring the EML4-ALK fusion gene. Both English and Chinese databases were systematically used to search the materials of the clinicopathological characteristics of patients with NSCLC harboring the EML4-ALK fusion gene. Pooled relative risk (RR) estimates and the 95% confidence intervals (95% CI) were calculated with the fixed or random effect model. Publication bias and chi-square test were also calculated. 27 retrospective studies were included in our meta-analysis. These studies included a total of 6950 patients. The incidence rate of EML4-ALK fusion in NSCLC patients was found to be 6.8% (472/6950). The correlation of the EML4-ALK fusion gene and clinicopathological characteristics of NSCLC patients demonstrated a significant difference in smoking status, histological types, stage, and ethnic characteristics. The positive rate of the EML4-ALK fusion gene expression in females were slightly higher than that in males, but not significantly (P = 0.52). In addition, the EML4-ALK fusion gene was mutually exclusive of the EGFR and KRAS mutation genes (P = 0.00). Our pooled analysis revealed that the EML4-ALK fusion gene was observed predominantly in adenocarcinoma, non-smoking and NSCLC patients, especially those diagnosed in the advanced clinical stage of NSCLC. Additionally, the EML4-ALK fusion gene was exclusive of the EGFR and KRAS mutation genes. We surmise that IHC assay is a valuable tool for the prescreening of patients with ALK fusion gene in clinical practice, and FISH assay can be performed as a confirmation method. These insights might

Endogenous IL-33 is highly expressed in mouse epithelial barrier tissues, lymphoid organs, brain, embryos, and inflamed tissues: in situ analysis using a novel Il-33-LacZ gene trap reporter strain.

PubMed

Pichery, Mélanie; Mirey, Emilie; Mercier, Pascale; Lefrancais, Emma; Dujardin, Arnaud; Ortega, Nathalie; Girard, Jean-Philippe

2012-04-01

IL-33 (previously known as NF from high endothelial venules) is an IL-1 family cytokine that signals through the ST2 receptor and drives cytokine production in mast cells, basophils, eosinophils, invariant NKT and NK cells, Th2 lymphocytes, and type 2 innate immune cells (natural helper cells, nuocytes, and innate helper 2 cells). Little is known about endogenous IL-33; for instance, the cellular sources of IL-33 in mouse tissues have not yet been defined. In this study, we generated an Il-33-LacZ gene trap reporter strain (Il-33(Gt/Gt)) and used this novel tool to analyze expression of endogenous IL-33 in vivo. We found that the Il-33 promoter exhibits constitutive activity in mouse lymphoid organs, epithelial barrier tissues, brain, and embryos. Immunostaining with anti-IL-33 Abs, using Il-33(Gt/Gt) (Il-33-deficient) mice as control, revealed that endogenous IL-33 protein is highly expressed in mouse epithelial barrier tissues, including stratified squamous epithelia from vagina and skin, as well as cuboidal epithelium from lung, stomach, and salivary gland. Constitutive expression of IL-33 was not detected in blood vessels, revealing the existence of species-specific differences between humans and mice. Importantly, IL-33 protein was always localized in the nucleus of producing cells with no evidence for cytoplasmic localization. Finally, strong expression of the Il-33-LacZ reporter was also observed in inflamed tissues, in the liver during LPS-induced endotoxin shock, and in the lung alveoli during papain-induced allergic airway inflammation. Together, our findings support the possibility that IL-33 may function as a nuclear alarmin to alert the innate immune system after injury or infection in epithelial barrier tissues.

Multimodality imaging of reporter gene expression using a novel fusion vector in living cells and animals

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gambhir, Sanjiv; Pritha, Ray

Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.

Multimodality imaging of reporter gene expression using a novel fusion vector in living cells and animals

DOEpatents

Gambhir, Sanjiv; Pritha, Ray

2015-07-14

Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.

Recurrent LRP1-SNRNP25 and KCNMB4-CCND3 fusion genes promote tumor cell motility in human osteosarcoma.

PubMed

Yang, Jilong; Annala, Matti; Ji, Ping; Wang, Guowen; Zheng, Hong; Codgell, David; Du, Xiaoling; Fang, Zhiwei; Sun, Baocun; Nykter, Matti; Chen, Kexin; Zhang, Wei

2014-10-10

The identification of fusion genes such as SYT-SSX1/SSX2, PAX3-FOXO1, TPM3/TPM4-ALK and EWS-FLI1 in human sarcomas has provided important insight into the diagnosis and targeted therapy of sarcomas. No recurrent fusion has been reported in human osteosarcoma. Transcriptome sequencing was used to characterize the gene fusions and mutations in 11 human osteosarcomas. Nine of 11 samples were found to harbor genetic inactivating alterations in the TP53 pathway. Two recurrent fusion genes associated with the 12q locus, LRP1-SNRNP25 and KCNMB4-CCND3, were identified and validated by RT-PCR, Sanger sequencing and fluorescence in situ hybridization, and were found to be osteosarcoma specific in a validation cohort of 240 other sarcomas. Expression of LRP1-SNRNP25 fusion gene promoted SAOS-2 osteosarcoma cell migration and invasion. Expression of KCNMB4-CCND3 fusion gene promoted SAOS-2 cell migration. Our study represents the first whole transcriptome analysis of untreated human osteosarcoma. Our discovery of two osteosarcoma specific fusion genes associated with osteosarcoma cellular motility highlights the heterogeneity of osteosarcoma and provides opportunities for new treatment modalities.

Intrafocal heterogeneity of ERG protein expression and gene fusion pattern in prostate cancer.

PubMed

Suh, Ja Hee; Park, Jeong Hwan; Lee, Cheol; Moon, Kyung Chul

2017-10-01

Prostate cancer is considered to be highly heterogeneous, with various morphologic features and biologic behaviors. The TMPRSS2-ERG gene fusion is the most frequently observed genetic aberration in prostate cancer. The aim of this study was to elucidate the intrafocal heterogeneity of ERG gene fusion status. ERG immunohistochemistry (IHC) was performed in samples from 168 prostate cancer patients who had undergone radical prostatectomy, and 40 cases showing ERG-positive IHC staining were selected for tissue microarray (TMA) construction. Two to six representative cores were selected from each tumor focus. In the cases with heterogeneous ERG IHC staining intensity, the areas showing different intensities were separately selected. Using the TMA blocks, IHC and fluorescence in situ hybridization (FISH) were conducted to evaluate the heterogeneity of ERG protein expression and ERG fusion gene patterns, respectively, in a single tumor focus. Heterogeneity of ERG IHC staining was defined as the simultaneous presence of negative and positive cores in the same tumor focus. Heterogeneity of ERG FISH was defined by the presence of cores with positive and negative FISH signals or cores with break-apart and interstitial deletion FISH signals in the same tumor focus. A total of 202 TMA cores were isolated from 40 ERG-positive cases. Of the 202 total cores, 19 were negative for ERG IHC staining, and 46 showed 1+, 52 showed 2+, and 85 showed 3+ ERG staining intensity. Eleven cores were negative for ERG FISH signal, 119 cores showed ERG break-apart FISH signals, and the remaining 72 cores revealed interstitial deletion. Intrafocal heterogeneity of ERG IHC staining was found in 20% (8/40) of cases, and intrafocal heterogeneity of ERG gene fusion pattern was found in 32.5% (13/40) of cases. In summary, this study showed significantly frequent intrafocal heterogeneity of ERG protein expression, gene fusion status and fusion pattern. This heterogeneity can be caused by the development

Expression of Chlamydophila psittaci MOMP heat-labile toxin B subunit fusion gene in transgenic rice.

PubMed

Zhang, Xiuxiang; Yuan, Ziguo; Guo, Xuejun; Li, Jingwen; Li, Zhaonan; Wang, Qingyu

2008-09-01

A DNA fragment encoding the MOMP gene of Chlamydophila psittaci was fused to the heat-labile toxin B subunit gene (LTB-MOMP) and transferred into rice callus by Agrobacterium tumefaciens-mediated transformation. The LTB-MOMP fusion gene was detected in genomic DNA from transformed rice leaves by Southern blot and RT-PCR amplification. Synthesis and assembly of the LTB-MOMP fusion protein into pentamers was detected in transformed leaf extracts by immunoblot analysis. Binding of the pentamers to intestinal epithelial cell membrane glycolipid receptors was quantified by GM1-ganglioside enzyme-linked immunosorbent assay (GM1-ELISA). The ELISA results indicated that LTB-MOMP fusion protein made up 0.0033-0.0054% of the total soluble leaf protein. Meanwhile, this suggested that the fusion protein retained both its native antigenicity and the ability to form pentamers.

Inversion-mediated gene fusions involving NAB2-STAT6 in an unusual malignant meningioma.

PubMed

Gao, F; Ling, C; Shi, L; Commins, D; Zada, G; Mack, W J; Wang, K

2013-08-20

Meningiomas are the most common primary intracranial tumours, with ∼3% meeting current histopathologic criteria for malignancy. In this study, we explored the transcriptome of meningiomas using RNA-Seq. Inversion-mediated fusions between two adjacent genes, NAB2 and STAT6, were detected in one malignant tumour, creating two novel in-frame transcripts that were validated by RT-PCR and Sanger sequencing. Gene fusions of NAB2-STAT6 were recently implicated in the pathogenesis of solitary fibrous tumours; our study suggested that similar fusions may also have a role in a malignant meningioma with unusual histopathologic features.

Factors affecting expression of the recF gene of Escherichia coli K-12.

PubMed

Sandler, S J; Clark, A J

1990-01-31

This report describes four factors which affect expression of the recF gene from strong upstream lambda promoters under temperature-sensitive cIAt2-encoded repressor control. The first factor was the long mRNA leader sequence consisting of the Escherichia coli dnaN gene and 95% of the dnaA gene and lambda bet, N (double amber) and 40% of the exo gene. When most of this DNA was deleted, RecF became detectable in maxicells. The second factor was the vector, pBEU28, a runaway replication plasmid. When we substituted pUC118 for pBEU28, RecF became detectable in whole cells by the Coomassie blue staining technique. The third factor was the efficiency of initiation of translation. We used site-directed mutagenesis to change the mRNA leader, ribosome-binding site and the 3 bp before and after the translational start codon. Monitoring the effect of these mutational changes by translational fusion to lacZ, we discovered that the efficiency of initiation of translation was increased 30-fold. Only an estimated two- or threefold increase in accumulated levels of RecF occurred, however. This led us to discover the fourth factor, namely sequences in the recF gene itself. These sequences reduce expression of the recF-lacZ fusion genes 100-fold. The sequences responsible for this decrease in expression occur in four regions in the N-terminal half of recF. Expression is reduced by some sequences at the transcriptional level and by others at the translational level.

Clinicopathological features of younger (aged ≤ 50 years) lung adenocarcinoma patients harboring the EML4-ALK fusion gene.

PubMed

Kometani, Takuro; Sugio, Kenji; Osoegawa, Atsushi; Seto, Takashi; Ichinose, Yukito

2018-05-01

The EML4-ALK fusion gene has recently been identified as a driver mutation in a subset of non-small cell lung cancers. In subsequent studies, EML4-ALK has been detected in a low percentage of patients, and was associated with a lack of EGFR or KRAS mutations, younger age, and adenocarcinoma with acinar histology. Cases with the EML4-ALK fusion gene were examined to clarify the clinicopathological characteristics of young adenocarcinoma patients. Between December 1998 and May 2009, 85 patients aged ≤ 50 with lung adenocarcinoma were treated at our hospital. We examined 49 samples from adenocarcinoma patients who underwent surgical resection, chemotherapy, and/or radiotherapy for the EML4-ALK gene. None of the patients received ALK inhibitors because these drugs had not been approved in Japan before 2012. EML4-ALK fusion genes were screened using multiplex reverse-transcription PCR assay, and were confirmed by direct sequencing. The EML4-ALK fusion gene was detected in five tumors (10.2%). One patient had stage IB disease, one had stage IIIA, and three had stage IV. Histologically, there was one solid adenocarcinoma, two acinar adenocarcinomas, and two papillary adenocarcinomas. EML4-ALK fusion genes were mutually exclusive to EGFR and KRAS mutations. The five-year survival rate was 59.4% in patients without EML4-ALK fusion and was not reached in patients with EML4-ALK fusion. The EML4-ALK fusion gene may be a strong oncogene in younger patients with lung adenocarcinoma. © 2018 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

Characterization of two trpE genes encoding anthranilate synthase {alpha}-subunit in Azospirillum brasilense

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ge Shimei; Xie Baoen; Chen Sanfeng

2006-03-10

The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not existmore » in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.« less

Clinicopathologic features of patients with non-small cell lung cancer harboring the EML4-ALK fusion gene: a meta-analysis.

PubMed

Wang, Ying; Wang, Shumin; Xu, Shiguang; Qu, Jiaqi; Liu, Bo

2014-01-01

The frequencies of EML4-ALK fusion gene in non-small cell lung cancer (NSCLC) with different clinicopathologic features described by previous studies are inconsistent. The key demographic and pathologic features associated with EML4-ALK fusion gene have not been definitively established. This meta-analysis was conducted to compare the frequency of the EML4-ALK fusion gene in patients with different clinicopathologic features and to identify an enriched population of patients with NSCLC harboring EML4-ALK fusion gene. The Pubmed and Embase databases for all studies on EML4-ALK fusion gene in NSCLC patients were searched up to July 2014. A criteria list and exclusion criteria were established to screen the studies. The frequency of the EML4-ALK fusion gene and the clinicopathologic features, including smoking status, pathologic type, gender, and EGFR status were abstracted. Seventeen articles consisting of 4511 NSCLC cases were included in this meta-analysis. A significant lower EML4-ALK fusion gene positive rate was associated with smokers (pooled OR = 0.40, 95% CI = 0.30-0.54, P<0.00001). A significantly higher EML4-ALK fusion gene positivity rate was associated with adenocarcinomas (pooled OR = 2.53, 95% CI = 1.66-3.86, P<0.0001) and female (pooled OR = 0.61, 95% CI = 0.41-0.90, P = 0.01). We found that a significantly lower EML4-ALK fusion gene positivity rate was associated with EGFR mutation (pooled OR = 0.07, 95% CI = 0.03-0.19, P<0.00001). No publication bias was observed in any meta-analysis (all P value of Egger's test >0.05); however, because of the small sample size, no results were in the meta-analysis regarding EGFR gene status. This meta-analysis revealed that the EML4-ALK fusion gene is highly correlated with a never/light smoking history, female and the pathologic type of adenocarcinoma, and is largely mutually exclusive of EGFR.

Clinicopathologic Features of Patients with Non-Small Cell Lung Cancer Harboring the EML4-ALK Fusion Gene: A Meta-Analysis

PubMed Central

Wang, Shumin; Xu, Shiguang; Qu, Jiaqi

2014-01-01

Background The frequencies of EML4-ALK fusion gene in non-small cell lung cancer (NSCLC) with different clinicopathologic features described by previous studies are inconsistent. The key demographic and pathologic features associated with EML4-ALK fusion gene have not been definitively established. This meta-analysis was conducted to compare the frequency of the EML4-ALK fusion gene in patients with different clinicopathologic features and to identify an enriched population of patients with NSCLC harboring EML4-ALK fusion gene. Methods The Pubmed and Embase databases for all studies on EML4-ALK fusion gene in NSCLC patients were searched up to July 2014. A criteria list and exclusion criteria were established to screen the studies. The frequency of the EML4-ALK fusion gene and the clinicopathologic features, including smoking status, pathologic type, gender, and EGFR status were abstracted. Results Seventeen articles consisting of 4511 NSCLC cases were included in this meta-analysis. A significant lower EML4-ALK fusion gene positive rate was associated with smokers (pooled OR = 0.40, 95% CI = 0.30–0.54, P<0.00001). A significantly higher EML4-ALK fusion gene positivity rate was associated with adenocarcinomas (pooled OR = 2.53, 95% CI = 1.66–3.86, P<0.0001) and female (pooled OR = 0.61, 95% CI = 0.41–0.90, P = 0.01). We found that a significantly lower EML4-ALK fusion gene positivity rate was associated with EGFR mutation (pooled OR = 0.07, 95% CI = 0.03–0.19, P<0.00001). No publication bias was observed in any meta-analysis (all P value of Egger's test >0.05); however, because of the small sample size, no results were in the meta-analysis regarding EGFR gene status. Conclusion This meta-analysis revealed that the EML4-ALK fusion gene is highly correlated with a never/light smoking history, female and the pathologic type of adenocarcinoma, and is largely mutually exclusive of EGFR. PMID:25360721

Differential Expression of Virulence Genes and Motility in Ralstonia (Pseudomonas) solanacearum during Exponential Growth.

PubMed

Clough, S J; Flavier, A B; Schell, M A; Denny, T P

1997-03-01

A complex network regulates virulence in Ralstonia solanacearum (formerly Pseudomonas solanacearum); central to this system is PhcA, a LysR-type transcriptional regulator. We report here that two PhcA-regulated virulence factors, endoglucanase (Egl) and acidic exopolysaccharide I (EPS I), and motility are expressed differentially during exponential growth in batch cultures. Tests with strains carrying lacZ fusions in a wild-type genetic background revealed that expression (on a per-cell basis) of phcA was constant but expression of egl and epsB increased 20- to 50-fold during multiplication from 1 x 10(sup7) to 5 x 10(sup8) CFU/ml. Expression of xpsR, an intermediate regulator downstream of PhcA in the regulatory cascade for eps expression, was similar to that of epsB and egl. Motility track photography revealed that all strains were essentially nonmotile at 10(sup6) CFU/ml. As cell density increased, 30 to 50% of wild-type cells were motile between 10(sup7) and 10(sup8) CFU/ml, but this population was again nonmotile at 10(sup9) CFU/ml. In contrast, about 60% of the cells of phcB and phcA mutants remained motile at 10(sup9) CFU/ml. Expression of phcB, which is not positively regulated by PhcA, was the inverse of epsB, egl, and xpsR (i.e., it decreased 20-fold at high cell density). PhcB is essential for production of an extracellular factor, tentatively identified as 3-hydroxypalmitic acid methyl ester (3-OH PAME), that might act as an exponential-phase signal to activate motility or expression of virulence genes. However, growth of the lacZ fusion strains in medium containing excess 3-OH PAME did not result in motility or expression of virulence genes at dramatically lower cell densities, suggesting that 3-OH PAME is not the only factor controlling these traits.

The mouse Gtl2 gene is differentially expressed during embryonic development, encodes multiple alternatively spliced transcripts, and may act as an RNA.

PubMed

Schuster-Gossler, K; Bilinski, P; Sado, T; Ferguson-Smith, A; Gossler, A

1998-06-01

We have isolated a novel mouse gene (Gtl2) from the site of a gene trap integration (Gtl2lacZ) that gave rise to developmentally regulated lacZ expression, and a dominant parental-origin-dependent phenotype. Heterozygous Gtl2lacZ mice that inherited the transgene from the father showed a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype was strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. Gtl2 expression is highly similar to the beta-galactosidase staining pattern, and is down-regulated but not abolished in mice carrying the Gtl2lacZ insertion. In early postimplantation embryos, Gtl2 is expressed in the visceral yolk sac and embryonic ectoderm. During subsequent development and organogenesis, Gtl2 transcripts are abundant in the paraxial mesoderm closely correlated with myogenic differentiation, in parts of the central nervous system, and in the epithelial ducts of developing excretory organs. The Gtl2 gene gives rise to various differentially spliced transcripts, which contain multiple small open reading frames (ORF). However, none of the ATG codons of these ORFs is in the context of a strong Kozak consensus sequence for initiation of translation, suggesting that Gtl2 might function as an RNA. Nuclear Gtl2 RNA was detected in a temporally and spatially regulated manner, and partially processed Gtl2 transcripts were readily detected in Northern blot hybridizations of polyadenylated RNA, suggesting that primary Gtl2 transcripts are differently processed in various cell types during development. Gtl2 transcript levels are present in parthenogenic embryos but may be reduced, consistent with the pattern of inheritance of the Gtl2lacZ phenotype.

The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.

PubMed

Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

2003-02-01

The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.

In vivo marking of spontaneous or vaccine-induced fibrosarcomas in the domestic house cat, using an adenoviral vector containing a bifunctional fusion protein, GAL-TEK.

PubMed

Marini, F C; Cannon, J P; Belmont, J W; Shillitoe, E J; Lapeyre, J N

1995-09-01

We evaluated the ability of a replication-deficient, recombinant adenoviral vector to transfer the bifunctional gene GAL-TEK, which expresses a marking/therapeutic gene product, to naturally occurring cat fibrosarcomas in situ. GAL-TEK contains an in-frame fusion of the bacterial LacZ gene for histochemical marking of tumors with beta-galactosidase (beta-Gal) and the HSV tk gene for enzyme-prodrug activation of the prodrug ganciclovir (GCV) to induce selective tumor cell killing. GAL-TEK bifunctional marking and cell killing activities were tested in vitro after adenoviral vector infection of HT1080 human fibrosarcoma cells. The tk activity of GAL-TEK is shown to be almost as potent as HSV tk to catalyze conversion of GCV to GCV nucleotides and promote selective cell killing. Using 8 cats with recurring 2.5-cm2 fibrosarcomas that either arose spontaneously or were induced by vaccine, we determined experimentally the administration routes and times required for optimum GAL-TEK gene transfer by beta-Gal histological staining and reverse transcriptase polymerase chain reaction to the multiple compartments of the growing fibrosarcomas consonant with minimizing collateral infection of neighboring tissues and other unwanted side effects.

[Analysis of EML4-ALK gene fusion mutation in patients 
with non-small cell lung cancer].

PubMed

Wang, Xuzhou; Chen, Weisheng; Yu, Yinghao

2015-02-01

Non-small cell lung cancer (NSCLC) is the main type of lung cancer, and the related locus mutation detection research has become a hot direction of molecular targeted therapy, studying on gene mutation status of echinodem microtubule associated protein like 4-Anaplastic lymphoma kinase (EML4-ALK) and epidermal growth factor receptor (EGFR), detecting the sensitivity of EML4-ALK gene fusion and gene mutation of EGFR. EML4-ALK gene fusion in 85 cases of paraffin embedded tumor tissue and adjacent lung tissue was detected with the application of immunohistochemistry (IHC), Scorpions amplification refractory mutation system (Scorpions ARMS) fluorescence quantitative PCR and fluorescence in situ hybridization (FISH) technology, and EGFR gene in 18, 19, 20 and 21 exon mutation status was detected with the application of ARMS method. In 115 cases of NSCLC, IHC showed 32 cases with ALK (D5F3) expression, the expression rate was 27.8%; ARMS showed 27 cases with EML4-ALK fusion gene mutation, the mutation detection rate was 23.5%; 53 cases were detected with EGFR mutation, the mutation rate was 46%. While FISH showed 23 cases with EML4-ALK fusion gene mutation, the detection rate was 20%, slightly lower than the ARMS detection results, suggesting that ARMS more sensitive. The application of IHC, ARMS fluorescence quantitative PCR and FISH technology can make a rapid and accurate evaluation of EML4-ALK gene fusion.

Synergistic induction of the heat shock response in Escherichia coli by simultaneous treatment with chemical inducers.

PubMed Central

Van Dyk, T K; Reed, T R; Vollmer, A C; LaRossa, R A

1995-01-01

Escherichia coli strains carrying transcriptional fusions of four sigma 32-controlled E. coli heat shock promoters to luxCDABE or lacZ reporter genes were stressed by chemicals added singly or in pairs. Much more than additive induction resulted from combinations of cadmium chloride, copper sulfate, ethanol, formamide, 4-nitrophenol, and pentachlorophenol. PMID:7592357

Evidence that the lung Adenocarcinoma EML4-ALK fusion gene is not caused by exposure to secondhand tobacco smoke during childhood.

PubMed

Ryan, Bríd M; Wang, Yi; Jen, Jin; Yi, Eunhee S; Olivo-Marston, Susan; Yang, Ping; Harris, Curtis C

2014-07-01

The EML4-ALK fusion gene is more frequently found in younger, never smoking patients with lung cancer. Meanwhile, never smokers exposed to secondhand tobacco smoke (SHS) during childhood are diagnosed at a younger age compared with never smoking patients with lung cancer who are not exposed. We, therefore, hypothesized that SHS, which can induce DNA damage, is associated with the EML4-ALK fusion gene. We compared the frequency of the EML4-ALK fusion gene among 197 never smoker patients with lung cancer with and without a history of exposure to SHS during childhood at Mayo Clinic. The EML4-ALK fusion gene was detected in 33% of cases from never smokers with a history of SHS exposure during childhood, whereas 47% of never smoking lung cancer cases without a history of childhood SHS exposure tested positive for the fusion gene. The EML4-ALK fusion gene is not enriched in tumors from individuals exposed to SHS during childhood. These data suggest that childhood exposure to SHS is not a significant etiologic cause of the EML4-ALK fusion gene in lung cancer. ©2014 American Association for Cancer Research.

Clinicopathological features of younger (aged ≤ 50 years) lung adenocarcinoma patients harboring the EML4‐ALK fusion gene

PubMed Central

Sugio, Kenji; Osoegawa, Atsushi; Seto, Takashi; Ichinose, Yukito

2018-01-01

Background The EML4‐ALK fusion gene has recently been identified as a driver mutation in a subset of non‐small cell lung cancers. In subsequent studies, EML4‐ALK has been detected in a low percentage of patients, and was associated with a lack of EGFR or KRAS mutations, younger age, and adenocarcinoma with acinar histology. Cases with the EML4‐ALK fusion gene were examined to clarify the clinicopathological characteristics of young adenocarcinoma patients. Methods Between December 1998 and May 2009, 85 patients aged ≤ 50 with lung adenocarcinoma were treated at our hospital. We examined 49 samples from adenocarcinoma patients who underwent surgical resection, chemotherapy, and/or radiotherapy for the EML4‐ALK gene. None of the patients received ALK inhibitors because these drugs had not been approved in Japan before 2012. EML4‐ALK fusion genes were screened using multiplex reverse‐transcription PCR assay, and were confirmed by direct sequencing. Results The EML4‐ALK fusion gene was detected in five tumors (10.2%). One patient had stage IB disease, one had stage IIIA, and three had stage IV. Histologically, there was one solid adenocarcinoma, two acinar adenocarcinomas, and two papillary adenocarcinomas. EML4‐ALK fusion genes were mutually exclusive to EGFR and KRAS mutations. The five‐year survival rate was 59.4% in patients without EML4‐ALK fusion and was not reached in patients with EML4‐ALK fusion. Conclusion The EML4‐ALK fusion gene may be a strong oncogene in younger patients with lung adenocarcinoma. PMID:29517858

Fusion gene profile of biphenotypic sinonasal sarcoma: an analysis of 44 cases.

PubMed

Fritchie, Karen J; Jin, Long; Wang, Xiaoke; Graham, Rondell P; Torbenson, Michael S; Lewis, Jean E; Rivera, Michael; Garcia, Joaquin J; Schembri-Wismayer, David J; Westendorf, Jennifer J; Chou, Margaret M; Dong, Jie; Oliveira, Andre M

2016-12-01

Biphenotypic sinonasal sarcoma (SNS) is a locally aggressive tumour that occurs in the sinonasal region. PAX3-MAML3 has recently been identified as a recurrent fusion gene event in this entity; however, a subset of tumours harbour alternative PAX3 rearrangement without the involvement of MAML3. In this study we sought to characterize the molecular profile of a large series of cases, with a special emphasis on tumours with alternative fusions. Forty-four examples of SNS were screened by fluorescence in-situ hybridization and reverse transcription polymerase chain reaction to better characterize its molecular profile and identify potential novel fusion genes. Twenty-four were positive for PAX3-MAML3 (55%), 15 showed rearrangements of PAX3 without MAML3 involvement (34%), one showed rearrangement of MAML3 without PAX3 involvement, and four were negative for the involvement of either gene (9%). Among 15 cases with PAX3 involvement only, three were found to harbour PAX3-FOXO1. Two of these cases arose in the nasal cavities of female patients (aged 31 and 47 years), and one showed bilateral involvement of the nasal cavities of a 35-year-old male. A fourth case involved the skull base of a 47-year-old male, and was positive for PAX3-NCOA1. Patients with fusion-negative tumours were slightly older. More than half of the SNSs in this series were positive for PAX3-MAML3. However, a subset of tumours may harbour alternative PAX3 fusion genes or show no involvement of PAX3. Except for a possible weak association between age and molecular profile, the overall morphological and immunophenotypic features of all cases seem to be similar. Because of the rarity of these tumours, the impact of the molecular profile on the clinical course of these tumours remains to be determined. © 2016 John Wiley & Sons Ltd.

MATRIX FACTORIZATION-BASED DATA FUSION FOR GENE FUNCTION PREDICTION IN BAKER’S YEAST AND SLIME MOLD

PubMed Central

ŽITNIK, MARINKA; ZUPAN, BLAŽ

2014-01-01

The development of effective methods for the characterization of gene functions that are able to combine diverse data sources in a sound and easily-extendible way is an important goal in computational biology. We have previously developed a general matrix factorization-based data fusion approach for gene function prediction. In this manuscript, we show that this data fusion approach can be applied to gene function prediction and that it can fuse various heterogeneous data sources, such as gene expression profiles, known protein annotations, interaction and literature data. The fusion is achieved by simultaneous matrix tri-factorization that shares matrix factors between sources. We demonstrate the effectiveness of the approach by evaluating its performance on predicting ontological annotations in slime mold D. discoideum and on recognizing proteins of baker’s yeast S. cerevisiae that participate in the ribosome or are located in the cell membrane. Our approach achieves predictive performance comparable to that of the state-of-the-art kernel-based data fusion, but requires fewer data preprocessing steps. PMID:24297565

kdgREcc Negatively Regulates Genes for Pectinases, Cellulase, Protease, HarpinEcc, and a Global RNA Regulator in Erwinia carotovora subsp. carotovora†

PubMed Central

Liu, Yang; Jiang, Guoqiao; Cui, Yaya; Mukherjee, Asita; Ma, Wei Lei; Chatterjee, Arun K.

1999-01-01

Erwinia carotovora subsp. carotovora produces extracellular pectate lyase (Pel), polygalacturonase (Peh), cellulase (Cel), and protease (Prt). The concerted actions of these enzymes largely determine the virulence of this plant-pathogenic bacterium. E. carotovora subsp. carotovora also produces HarpinEcc, the elicitor of the hypersensitive reaction. We document here that KdgREcc (Kdg, 2-keto-3-deoxygluconate; KdgR, general repressor of genes involved in pectin and galacturonate catabolism), a homolog of the E. chrysanthemi repressor, KdgREch and the Escherichia coli repressor, KdgREco, negatively controls not only the pectinases, Pel and Peh, but also Cel, Prt, and HarpinEcc production in E. carotovora subsp. carotovora. The levels of pel-1, peh-1, celV, and hrpNEcc transcripts are markedly affected by KdgREcc. The KdgREcc− mutant is more virulent than the KdgREcc+ parent. Thus, our data for the first time establish a global regulatory role for KdgREcc in E. carotovora subsp. carotovora. Another novel observation is the negative effect of KdgREcc on the transcription of rsmB (previously aepH), which specifies an RNA regulator controlling exoenzyme and HarpinEcc production. The levels of rsmB RNA are higher in the KdgREcc− mutant than in the KdgREcc+ parent. Moreover, by DNase I protection assays we determined that purified KdgREcc protected three 25-bp regions within the transcriptional unit of rsmB. Alignment of the protected sequences revealed the 21-mer consensus sequence of the KdgREcc-binding site as 5′-G/AA/TA/TGAAA[N6]TTTCAG/TG/TA-3′. Two such KdgREcc-binding sites occur in rsmB DNA in a close proximity to each other within nucleotides +79 and +139 and the third KdgREcc-binding site within nucleotides +207 and +231. Analysis of lacZ transcriptional fusions shows that the KdgR-binding sites negatively affect the expression of rsmB. KdgREcc also binds the operator DNAs of pel-1 and peh-1 genes and represses expression of a pel1-lacZ and a peh1-lacZ

Fusion gene addiction: can tumours be forced to give up the habit?

PubMed

Selfe, Joanna L; Shipley, Janet

2017-07-01

Fusion of genes in tumours can have oncogenic roles in reprogramming cells through overexpression of oncogenes or the production of novel fusion proteins. A fundamental question in cancer biology is what genetic events are critical for initiation and whether these are also required for cancer progression. In recent work published in The Journal of Pathology, dependency on a fusion protein was addressed using a model of alveolar rhabdomyosarcomas - a sarcoma subtype with frequent fusion of PAX3 and FOXO1 genes that is associated with poor outcome. PAX3-FOXO1 encodes a potent transcription factor that together with MYCN alters the transcriptional landscape of cells. Building on previous work, an inducible model in human myoblast cells was used to show that PAX3-FOXO1 and MYCN can initiate rhabdomyosarcoma development but, contrary to current thinking, tumour recurrences occasionally arose independent of the fusion protein. Further work needs to identify the molecular nature of this independence and assess any relevance in human tumours. Such functional approaches are required together with computational modeling of molecular data to unravel spatial and temporal dependencies on specific genetic events. This may support molecular prognostic markers and therapeutic targets. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

The "grep" command but not FusionMap, FusionFinder or ChimeraScan captures the CIC-DUX4 fusion gene from whole transcriptome sequencing data on a small round cell tumor with t(4;19)(q35;q13).

PubMed

Panagopoulos, Ioannis; Gorunova, Ludmila; Bjerkehagen, Bodil; Heim, Sverre

2014-01-01

Whole transcriptome sequencing was used to study a small round cell tumor in which a t(4;19)(q35;q13) was part of the complex karyotype but where the initial reverse transcriptase PCR (RT-PCR) examination did not detect a CIC-DUX4 fusion transcript previously described as the crucial gene-level outcome of this specific translocation. The RNA sequencing data were analysed using the FusionMap, FusionFinder, and ChimeraScan programs which are specifically designed to identify fusion genes. FusionMap, FusionFinder, and ChimeraScan identified 1017, 102, and 101 fusion transcripts, respectively, but CIC-DUX4 was not among them. Since the RNA sequencing data are in the fastq text-based format, we searched the files using the "grep" command-line utility. The "grep" command searches the text for specific expressions and displays, by default, the lines where matches occur. The "specific expression" was a sequence of 20 nucleotides from the coding part of the last exon 20 of CIC (Reference Sequence: NM_015125.3) chosen since all the so far reported CIC breakpoints have occurred here. Fifteen chimeric CIC-DUX4 cDNA sequences were captured and the fusion between the CIC and DUX4 genes was mapped precisely. New primer combinations were constructed based on these findings and were used together with a polymerase suitable for amplification of GC-rich DNA templates to amplify CIC-DUX4 cDNA fragments which had the same fusion point found with "grep". In conclusion, FusionMap, FusionFinder, and ChimeraScan generated a plethora of fusion transcripts but did not detect the biologically important CIC-DUX4 chimeric transcript; they are generally useful but evidently suffer from imperfect both sensitivity and specificity. The "grep" command is an excellent tool to capture chimeric transcripts from RNA sequencing data when the pathological and/or cytogenetic information strongly indicates the presence of a specific fusion gene.

Drosophila and mammalian models uncover a role for the myoblast fusion gene TANC1 in rhabdomyosarcoma.

PubMed

Avirneni-Vadlamudi, Usha; Galindo, Kathleen A; Endicott, Tiana R; Paulson, Vera; Cameron, Scott; Galindo, Rene L

2012-01-01

Rhabdomyosarcoma (RMS) is a malignancy of muscle myoblasts, which fail to exit the cell cycle, resist terminal differentiation, and are blocked from fusing into syncytial skeletal muscle. In some patients, RMS is caused by a translocation that generates the fusion oncoprotein PAX-FOXO1, but the underlying RMS pathogenetic mechanisms that impede differentiation and promote neoplastic transformation remain unclear. Using a Drosophila model of PAX-FOXO1-mediated transformation, we show here that mutation in the myoblast fusion gene rolling pebbles (rols) dominantly suppresses PAX-FOXO1 lethality. Further analysis indicated that PAX-FOXO1 expression caused upregulation of rols, which suggests that Rols acts downstream of PAX-FOXO1. In mammalian myoblasts, gene silencing of Tanc1, an ortholog of rols, revealed that it is essential for myoblast fusion, but is dispensable for terminal differentiation. Misexpression of PAX-FOXO1 in myoblasts upregulated Tanc1 and blocked differentiation, whereas subsequent reduction of Tanc1 expression to native levels by RNAi restored both fusion and differentiation. Furthermore, decreasing human TANC1 gene expression caused RMS cancer cells to lose their neoplastic state, undergo fusion, and form differentiated syncytial muscle. Taken together, these findings identify misregulated myoblast fusion caused by ectopic TANC1 expression as a RMS neoplasia mechanism and suggest fusion molecules as candidates for targeted RMS therapy.

Association between EML4-ALK fusion gene and thymidylate synthase mRNA expression in non-small cell lung cancer tissues

PubMed Central

XU, CHUN-WEI; WANG, GANG; WANG, WU-LONG; GAO, WEN-BIN; HAN, CHUAN-JUN; GAO, JING-SHAN; ZHANG, LI-YING; LI, YANG; WANG, LIN; ZHANG, YU-PING; TIAN, YU-WANG; QI, DONG-DONG

2015-01-01

This study aimed to investigate the association of the mRNA expression of the echinoderm microtubule-associated protein-like 4 (EML4)-anaplastic lymphoma kinase (ALK) fusion gene with that of thymidylate synthase (TYMS) in non-small cell lung cancer (NSCLC) tissues. Quantitative polymerase chain reaction was used to detect the expression of EML4-ALK fusion gene and TYMS mRNA in 257 cases of NSCLC. The positive rate of EML4-ALK fusion gene was 4.28% in the NSCLC tissues (11/257), and was higher in nonsmokers than in smokers (P<0.05); TYMS mRNA expression was detected in 63.42% (163/257) of cases. An association of the EML4-ALK fusion gene with TYMS expression was detected; a low expression level of TYMS mRNA was observed more frequently when the EML4-ALK fusion gene was present than when it was not detected (P<0.05). In conclusion, patients positive for the EML4-ALK fusion gene in NSCLC tissues are likely to have a low expression level of TYMS, and may benefit from the first-line chemotherapy drug pemetrexed. PMID:26136951

Association between EML4-ALK fusion gene and thymidylate synthase mRNA expression in non-small cell lung cancer tissues.

PubMed

Xu, Chun-Wei; Wang, Gang; Wang, Wu-Long; Gao, Wen-Bin; Han, Chuan-Jun; Gao, Jing-Shan; Zhang, Li-Ying; Li, Yang; Wang, Lin; Zhang, Yu-Ping; Tian, Yu-Wang; Qi, Dong-Dong

2015-06-01

This study aimed to investigate the association of the mRNA expression of the echinoderm microtubule-associated protein-like 4 (EML4)-anaplastic lymphoma kinase (ALK) fusion gene with that of thymidylate synthase (TYMS) in non-small cell lung cancer (NSCLC) tissues. Quantitative polymerase chain reaction was used to detect the expression of EML4-ALK fusion gene and TYMS mRNA in 257 cases of NSCLC. The positive rate of EML4-ALK fusion gene was 4.28% in the NSCLC tissues (11/257), and was higher in nonsmokers than in smokers (P<0.05); TYMS mRNA expression was detected in 63.42% (163/257) of cases. An association of the EML4-ALK fusion gene with TYMS expression was detected; a low expression level of TYMS mRNA was observed more frequently when the EML4-ALK fusion gene was present than when it was not detected (P<0.05). In conclusion, patients positive for the EML4-ALK fusion gene in NSCLC tissues are likely to have a low expression level of TYMS, and may benefit from the first-line chemotherapy drug pemetrexed.

Detection of EML4-ALK fusion gene and features associated with EGFR mutations in Chinese patients with non-small-cell lung cancer.

PubMed

Wen, Miaomiao; Wang, Xuejiao; Sun, Ying; Xia, Jinghua; Fan, Liangbo; Xing, Hao; Zhang, Zhipei; Li, Xiaofei

2016-01-01

Echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK) and epidermal growth factor receptor (EGFR) define specific molecular subsets of lung cancer with distinct clinical features. We aimed at revealing the clinical features of EML4-ALK fusion gene and EGFR mutation in non-small-cell lung cancer (NSCLC). We enrolled 694 Chinese patients with NSCLC for analysis. EML4-ALK fusion gene was analyzed by real-time polymerase chain reaction, and EGFR mutations were analyzed by amplified refractory mutation system. Among the 694 patients, 60 (8.65%) patients had EML4-ALK fusions. In continuity correction χ (2) test analysis, EML4-ALK fusion gene was correlated with sex, age, smoking status, and histology, but no significant association was observed between EML4-ALK fusion gene and clinical stage. A total of 147 (21.18%) patients had EGFR mutations. In concordance with previous reports, EGFR mutation was correlated with age, smoking status, histology, and clinical stage, whereas patient age was not significantly associated with EGFR mutation. Meanwhile, to our surprise, six (0.86%) patients had coexisting EML4-ALK fusions and EGFR mutations. EML4-ALK fusion gene defines a new molecular subset in patients with NSCLC. Six patients who harbored both EML4-ALK fusion genes and EGFR mutations were identified in our study. The EGFR mutations and the EML4-ALK fusion genes are coexistent.

A metabolic function of FGFR3-TACC3 gene fusions in cancer.

PubMed

Frattini, Véronique; Pagnotta, Stefano M; Tala; Fan, Jerry J; Russo, Marco V; Lee, Sang Bae; Garofano, Luciano; Zhang, Jing; Shi, Peiguo; Lewis, Genevieve; Sanson, Heloise; Frederick, Vanessa; Castano, Angelica M; Cerulo, Luigi; Rolland, Delphine C M; Mall, Raghvendra; Mokhtari, Karima; Elenitoba-Johnson, Kojo S J; Sanson, Marc; Huang, Xi; Ceccarelli, Michele; Lasorella, Anna; Iavarone, Antonio

2018-01-11

Chromosomal translocations that generate in-frame oncogenic gene fusions are notable examples of the success of targeted cancer therapies. We have previously described gene fusions of FGFR3-TACC3 (F3-T3) in 3% of human glioblastoma cases. Subsequent studies have reported similar frequencies of F3-T3 in many other cancers, indicating that F3-T3 is a commonly occuring fusion across all tumour types. F3-T3 fusions are potent oncogenes that confer sensitivity to FGFR inhibitors, but the downstream oncogenic signalling pathways remain unknown. Here we show that human tumours with F3-T3 fusions cluster within transcriptional subgroups that are characterized by the activation of mitochondrial functions. F3-T3 activates oxidative phosphorylation and mitochondrial biogenesis and induces sensitivity to inhibitors of oxidative metabolism. Phosphorylation of the phosphopeptide PIN4 is an intermediate step in the signalling pathway of the activation of mitochondrial metabolism. The F3-T3-PIN4 axis triggers the biogenesis of peroxisomes and the synthesis of new proteins. The anabolic response converges on the PGC1α coactivator through the production of intracellular reactive oxygen species, which enables mitochondrial respiration and tumour growth. These data illustrate the oncogenic circuit engaged by F3-T3 and show that F3-T3-positive tumours rely on mitochondrial respiration, highlighting this pathway as a therapeutic opportunity for the treatment of tumours with F3-T3 fusions. We also provide insights into the genetic alterations that initiate the chain of metabolic responses that drive mitochondrial metabolism in cancer.

[Transformation of antimicrobial peptide fusion gene of cecropin B and rabbit NP-1 to Houttuynia cordata].

PubMed

Dong, Yan; Zhang, Ying; Yi, Lang; Lai, Huili; Zhang, Yaming; Zhou, Lian; Wang, Peixun

2010-07-01

To transform the antimicrobial peptide fusion gene of cecropin B and rabbit NP-1(CN) into Houttuynia cordata to improve its antimicrobic capability. The fusion gene of CN designed and synthesized artificially was recombined with expression vector pBI121. The recombined vector was transformed to Agrobacterium tumefaciens LBA4404, by which CN gene was transformed to the explants of H. cordata. The transgenic regeneration plantlets were selected by kanamycin and rapid screening PCR. The transgenic plants were identified by PCR-Southern of genomic DNA and RT-PCR. The disease resistances were detected by antibacterial zone trail of leaf extracts to E. coli K12 and infection by Rhizoctonia solani. Gene of interesting CN was inserted into genomic DNA and expressed in transformed H, cordata, whose resistance to E. coli K12 and Rh. solani was stronger than that of the non-transformed control. The fusion gene CN can improve antimicrobic capability of transformed H. cordata.

Phase I/II study of alectinib in lung cancer with RET fusion gene: study protocol.

PubMed

Takeuchi, Shinji; Murayama, Toshinori; Yoshimura, Kenichi; Kawakami, Takahiro; Takahara, Shizuko; Imai, Yasuhito; Kuribayashi, Yoshikazu; Nagase, Katsuhiko; Goto, Koichi; Nishio, Makoto; Hasegawa, Yoshinori; Satouchi, Miyako; Kiura, Katsuyuki; Seto, Takashi; Yano, Seiji

2017-01-01

The rearranged during transfection (RET) fusion gene was discovered as a driver oncogene in 1-2% of non-small cell lung cancers (NSCLCs). Alectinib is an approved anaplastic lymphoma kinase (ALK) inhibitor that may also be effective for RET fusion-positive NSCLC. RET fusion-positive NSCLC patients treated with at least one regimen of chemotherapy are being recruited. In step 1, alectinib (600 or 450 mg, twice daily) will be administered following a 3+3 design. The primary endpoint is safety. In step 2, alectinib will be administered at the recommended dose (RD) defined by step 1. The primary endpoint is the response rate of RET inhibitor treatment-naïve patients. This is the first study to investigate the safety and preliminary efficacy of alectinib in RET fusion-positive NSCLC patients. If successful, alectinib treatment may lead to substantial and important changes in the management of NSCLC with RET fusion genes. J. Med. Invest. 64: 317-320, August, 2017.

In vitro study for laser gene transfer in BHK-21 fibroblast cell line

NASA Astrophysics Data System (ADS)

Abdel Aziz, M.; Salem, D. S.; Salama, M. S.; Badr, Y.

2009-02-01

Modifications to our previously introduced system for laser microbeam cell surgery were carried out in the present work to match animal cells. These modifications included: 1- Using other laser system that used before, Excimer laser with 193 and 308 nm wavelengths. The used laser here, is He-Cd with low power and 441.5 nm wavelength in the visible region. 2- Instead of using pulsed laser, we used here CW He-Cd chopped by electrical chopper, which is synchronized with the mechanical motion of the mobile stage with step 40 microns, according to cell dimensions to avoid puncturing the same cell twice. The advantages of the modified here laser setup for gene transfer is: it is less damaging to the sensitive animal cell which has thin cell membrane. The present work aimed to: 1- Design a modified laser microbeam cell surgery, applicable to animal cells, such as fibroblast cells 2- To examine the efficiency of such system. 3- To assure gene transfer and its expression in the used cells. 4- To evaluate the ultra damages produced from using the laser beam as a modality for gene transfer. On the other wards, to introduce: safe, efficient and less damaging modality for gene transfer in animal cells. To achieve these goals, we applied the introduced here home-made laser setup with its synchronized parameters to introduce pBK-CMV phagemid, containing LacZ and neomycin resistance (neor )genes into BHK-21 fibroblast cell line. The results of the present work showed that: 1- Our modified laser microbeam cell surgery setup proved to be useful and efficient tool for gene transfer into fibroblast cells. 2- The presence and expression of LacZ gene was achieved using histochemical LacZ assay. 3- Selection of G418 antibiotic sensitivity assay confirmed the presence and expression towards stability of neor gene with time. 4- Presence of LacZ and neor genes in the genomic DNA of transfected fibroblast cells was indicated using PCR analysis. 5- Transmission electron microscopy indicated

Detection of EML4-ALK fusion gene and features associated with EGFR mutations in Chinese patients with non-small-cell lung cancer

PubMed Central

Wen, Miaomiao; Wang, Xuejiao; Sun, Ying; Xia, Jinghua; Fan, Liangbo; Xing, Hao; Zhang, Zhipei; Li, Xiaofei

2016-01-01

Purpose Echinoderm microtubule-associated protein-like 4–anaplastic lymphoma kinase (EML4-ALK) and epidermal growth factor receptor (EGFR) define specific molecular subsets of lung cancer with distinct clinical features. We aimed at revealing the clinical features of EML4-ALK fusion gene and EGFR mutation in non-small-cell lung cancer (NSCLC). Methods We enrolled 694 Chinese patients with NSCLC for analysis. EML4-ALK fusion gene was analyzed by real-time polymerase chain reaction, and EGFR mutations were analyzed by amplified refractory mutation system. Results Among the 694 patients, 60 (8.65%) patients had EML4-ALK fusions. In continuity correction χ2 test analysis, EML4-ALK fusion gene was correlated with sex, age, smoking status, and histology, but no significant association was observed between EML4-ALK fusion gene and clinical stage. A total of 147 (21.18%) patients had EGFR mutations. In concordance with previous reports, EGFR mutation was correlated with age, smoking status, histology, and clinical stage, whereas patient age was not significantly associated with EGFR mutation. Meanwhile, to our surprise, six (0.86%) patients had coexisting EML4-ALK fusions and EGFR mutations. Conclusion EML4-ALK fusion gene defines a new molecular subset in patients with NSCLC. Six patients who harbored both EML4-ALK fusion genes and EGFR mutations were identified in our study. The EGFR mutations and the EML4-ALK fusion genes are coexistent. PMID:27103824

Expression of Shigella flexneri gluQ-rs gene is linked to dksA and controlled by a transcriptional terminator

PubMed Central

2012-01-01

Background Glutamyl queuosine-tRNAAsp synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNAAsp. Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. Results The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. Conclusions The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri. PMID:23035718

Expression of Shigella flexneri gluQ-rs gene is linked to dksA and controlled by a transcriptional terminator.

PubMed

Caballero, Valeria C; Toledo, Viviana P; Maturana, Cristian; Fisher, Carolyn R; Payne, Shelley M; Salazar, Juan Carlos

2012-10-05

Glutamyl queuosine-tRNA(Asp) synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNA(Asp). Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri.

Dominant positive and negative selection using a hygromycin phosphotransferase-thymidine kinase fusion gene.

PubMed

Lupton, S D; Brunton, L L; Kalberg, V A; Overell, R W

1991-06-01

The hygromycin phosphotransferase gene was fused in-frame with the herpes simplex virus type 1 thymidine kinase gene. The resulting fusion gene (termed HyTK) confers hygromycin B resistance for dominant positive selection and ganciclovir sensitivity for negative selection and provides a means by which these selectable phenotypes may be expressed and regulated as a single genetic entity.

Transcriptional analysis of the multicopy hao gene coding for hydroxylamine oxidoreductase in Nitrosomonas sp. strain ENI-11.

PubMed

Hirota, Ryuichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao; Kato, Junichi

2006-08-01

The nitrifying bacterium Nitrosomonas sp. strain ENI-11 has three copies of the gene encoding hydroxylamine oxidoreductase (hao(1), hao(2), and hao(3)) on its genome. Broad-host-range reporter plasmids containing transcriptional fusion genes between hao copies and lacZ were constructed to analyze the expression of each hydroxylamine oxidoreductase gene (hao) copy individually and quantitatively. beta-Galactosidase assays of ENI-11 harboring reporter plasmids revealed that all hao copies were transcribed in the wild-type strain. Promoter analysis of hao copies revealed that transcription of hao(3) was highest among the hao copies. Expression levels of hao(1) and hao(2) were 40% and 62% of that of hao(3) respectively. Transcription of hao(1) was negatively regulated, whereas a portion of hao(3) transcription was read through transcription from the rpsT promoter. When energy-depleted cells were incubated in the growth medium, only hao(3) expression increased. This result suggests that it is hao(3) that is responsible for recovery from energy-depleted conditions in Nitrosomonas sp. strain ENI-11.

Multi-dimensional genomic analysis of myoepithelial carcinoma identifies prevalent oncogenic gene fusions.

PubMed

Dalin, Martin G; Katabi, Nora; Persson, Marta; Lee, Ken-Wing; Makarov, Vladimir; Desrichard, Alexis; Walsh, Logan A; West, Lyndsay; Nadeem, Zaineb; Ramaswami, Deepa; Havel, Jonathan J; Kuo, Fengshen; Chadalavada, Kalyani; Nanjangud, Gouri J; Ganly, Ian; Riaz, Nadeem; Ho, Alan L; Antonescu, Cristina R; Ghossein, Ronald; Stenman, Göran; Chan, Timothy A; Morris, Luc G T

2017-10-30

Myoepithelial carcinoma (MECA) is an aggressive salivary gland cancer with largely unknown genetic features. Here we comprehensively analyze molecular alterations in 40 MECAs using integrated genomic analyses. We identify a low mutational load, and high prevalence (70%) of oncogenic gene fusions. Most fusions involve the PLAG1 oncogene, which is associated with PLAG1 overexpression. We find FGFR1-PLAG1 in seven (18%) cases, and the novel TGFBR3-PLAG1 fusion in six (15%) cases. TGFBR3-PLAG1 promotes a tumorigenic phenotype in vitro, and is absent in 723 other salivary gland tumors. Other novel PLAG1 fusions include ND4-PLAG1; a fusion between mitochondrial and nuclear DNA. We also identify higher number of copy number alterations as a risk factor for recurrence, independent of tumor stage at diagnosis. Our findings indicate that MECA is a fusion-driven disease, nominate TGFBR3-PLAG1 as a hallmark of MECA, and provide a framework for future diagnostic and therapeutic research in this lethal cancer.

[Detection of EML4-ALK fusion gene in non-small cell lung cancer and its clinicopathologic correlation].

PubMed

Zhong, Shan; Zhang, Hai-ping; Zheng, Jie; Bai, Dong-yu; Fu, Li; Chen, Pei-qiong

2013-04-01

To investigate the frequency of EML4-ALK fusion gene in non-small-cell lung cancer (NSCLC) patients, and its correlation with clinicopathologic features. Real-time PCR was used to detect the presence of EML4-ALK fusion gene in 268 cases of NSCLCs using paraffin-embedded tissue samples(among which 164 samples were re-validated by Sanger sequencing). Related clinicopathological correlation was analyzed. EML4-ALK fusion gene was found in 4.1% (11/268) of the cases. One hundred and sixty four samples were verified by Sanger sequencing, and the overall coincidence of the results of two methods (Sanger sequencing and Real-time PCR) was 100%. Female patients (5.9%, 5/85), ≤ 60 years of age (4.3%, 6/140), non-smokers (6.8%, 8/118) and adenocarcinomas (7.6%, 10/132) had a higher mutation rate than that in male patients (3.3%, 6/183), > 60 years of age (4.0%, 5/124), smokers (1.6%, 2/132) and squamous cell carcinomas (1.3%, 1/79), although no statistical significance in age (P = 0.918), gender (P = 0.503), smoking history (P = 0.092) and histological type (P = 0.094). Chinese NSCLC patients have a 4.1% detection rate of EML4-ALK fusion gene in the tumor tissues. Female, non-smoker and adenocarcinoma histological subtype tend to be associated with a higher rate of EML4-ALK gene fusion.

Clinical Application of Prognostic Gene Expression Signature in Fusion Gene-Negative Rhabdomyosarcoma: A Report from the Children's Oncology Group.

PubMed

Hingorani, Pooja; Missiaglia, Edoardo; Shipley, Janet; Anderson, James R; Triche, Timothy J; Delorenzi, Mauro; Gastier-Foster, Julie; Wing, Michele; Hawkins, Douglas S; Skapek, Stephen X

2015-10-15

Pediatric rhabdomyosarcoma (RMS) has two common histologic subtypes: embryonal (ERMS) and alveolar (ARMS). PAX-FOXO1 fusion gene status is a more reliable prognostic marker than alveolar histology, whereas fusion gene-negative (FN) ARMS patients are clinically similar to ERMS patients. A five-gene expression signature (MG5) previously identified two diverse risk groups within the fusion gene-negative RMS (FN-RMS) patients, but this has not been independently validated. The goal of this study was to test whether expression of the MG5 metagene, measured using a technical platform that can be applied to routine pathology material, would correlate with outcome in a new cohort of patients with FN-RMS. Cases were taken from the Children's Oncology Group (COG) D9803 study of children with intermediate-risk RMS, and gene expression profiling for the MG5 genes was performed using the nCounter assay. The MG5 score was correlated with clinical and pathologic characteristics as well as overall and event-free survival. MG5 standardized score showed no significant association with any of the available clinicopathologic variables. The MG5 signature score showed a significant correlation with overall (N = 57; HR, 7.3; 95% CI, 1.9-27.0; P = 0.003) and failure-free survival (N = 57; HR, 6.1; 95% CI, 1.9-19.7; P = 0.002). This represents the first, validated molecular prognostic signature for children with FN-RMS who otherwise have intermediate-risk disease. The capacity to measure the expression of a small number of genes in routine pathology material and apply a simple mathematical formula to calculate the MG5 metagene score provides a clear path toward better risk stratification in future prospective clinical trials. ©2015 American Association for Cancer Research.

RELATIVE EXPRESSION AND STABILITY OF A CHROMOSOMALLY INTEGRATED AND PLASMID-BORNE MARKER GENE FUSION IN ENVIRONMENTALLY COMPETENT BACTERIA

EPA Science Inventory

A xyIE-iceC transcriptional fusion was created by ligating a DNA fragment harboring the cloned xyIE structural gene from the TOL plasmid of Pseudomonas putida mt-2 into the cloned iceC gene of Pseudomonas syringae Cit7. This fusion construct was integrated into chromosome of Pseu...

The relationship of TMPRSS2-ERG gene fusion between primary and metastatic prostate cancers.

PubMed

Guo, Charles C; Wang, Yan; Xiao, Li; Troncoso, Patricia; Czerniak, Bogdan A

2012-05-01

Recent studies have revealed the presence of TMPRSS2-ERG gene fusion in both primary and metastatic prostate cancers. However, the relationship between primary and corresponding metastatic prostate cancers with respect to the status of this gene fusion remains unclear. Using fluorescence in situ hybridization, we evaluated the rearrangement of the ERG gene in the radical prostatectomy specimens and corresponding lymph node metastases from 19 patients with prostate cancer. The mean age of the patients was 61 years, and the median Gleason score in the radical prostatectomy specimens was 7 (4 + 3). Prostate cancer was unifocal in 6 cases and multifocal in 13 cases, including 10 with 2 foci and 3 with 3 foci. In the primary prostate cancers, rearrangement of the ERG gene was observed in 13 cases and associated with deletion of the 5' ERG gene in 8 cases. In the metastases, the ERG rearrangement was present in 10 cases and associated with deletion of the 5' ERG gene in 6 cases. In unifocal prostate cancers, the status of the ERG rearrangement was concordant between the primary prostate cancer and metastasis in 5 of 6 cases. In multifocal prostate cancer, despite a significant interfocal discordance, the status of the ERG rearrangement was concordant between the index (largest) primary tumor focus and metastasis in all 13 cases. Our study demonstrates a close relationship of the TMPRSS2-ERG gene fusion status between primary and metastatic prostate cancer. The concordance of the ERG gene rearrangement status between the index primary tumor focus and metastasis suggests that metastasis most likely arises from the index tumor focus in multifocal prostate cancer. Copyright © 2012 Elsevier Inc. All rights reserved.

Brief Report: A mass spectrometry assay to simultaneously analyze ROS1 and RET fusion gene expression in non-small cell lung cancer

PubMed Central

Wijesinghe, Priyanga; Bepler, Gerold

2014-01-01

Introduction ROS1 and RET gene fusions were recently discovered in non-small cell lung cancer (NSCLC) as potential therapeutic targets with small molecule kinase inhibitors. The conventional screening methods of these fusions are time consuming and require samples of high quality and quantity. Here, we describe a novel and efficient method by coupling the power of multiplexing PCR and the sensitivity of mass spectrometry. Methods The multiplex mass spectrometry platform simultaneously tests samples for the expression of nine ROS1 and six RET fusion genes. The assay incorporates detection of wild-type exon junctions immediately upstream and downstream of the fusion junction to exclude false negative results. To flag false positives, the system also comprises two independent assays for each fusion gene junction. Results The characteristic mass spectrometric peaks of the gene fusions were obtained using engineered plasmid constructs. Specific assays targeting the wild-type gene exon junctions were validated using cDNA from lung tissue of healthy individuals. The system was further validated using cDNA derived from NSCLC cell lines that express endogenous fusion genes. The expressed ROS1-SLC34A2 and CCDC6-RET gene fusions from the NSCLC cell lines HCC78 and LC-2/ad, respectively, were accurately detected by the novel assay. The assay is extremely sensitive, capable of detecting an event in test specimens containing 0.5% positive tumors. Conclusion The novel multiplexed assay is robustly capable of detecting 15 different clinically relevant RET and ROS1 fusion variants. The benefits of this detection method include exceptionally low sample input, high cost efficiency, flexibility, and rapid turnover. PMID:25384172

Gene fusion analysis in the battle against the African endemic sleeping sickness.

PubMed

Trimpalis, Philip; Koumandou, Vassiliki Lila; Pliakou, Evangelia; Anagnou, Nicholas P; Kossida, Sophia

2013-01-01

The protozoan Trypanosoma brucei causes African Trypanosomiasis or sleeping sickness in humans, which can be lethal if untreated. Most available pharmacological treatments for the disease have severe side-effects. The purpose of this analysis was to detect novel protein-protein interactions (PPIs), vital for the parasite, which could lead to the development of drugs against this disease to block the specific interactions. In this work, the Domain Fusion Analysis (Rosetta Stone method) was used to identify novel PPIs, by comparing T. brucei to 19 organisms covering all major lineages of the tree of life. Overall, 49 possible protein-protein interactions were detected, and classified based on (a) statistical significance (BLAST e-value, domain length etc.), (b) their involvement in crucial metabolic pathways, and (c) their evolutionary history, particularly focusing on whether a protein pair is split in T. brucei and fused in the human host. We also evaluated fusion events including hypothetical proteins, and suggest a possible molecular function or involvement in a certain biological process. This work has produced valuable results which could be further studied through structural biology or other experimental approaches so as to validate the protein-protein interactions proposed here. The evolutionary analysis of the proteins involved showed that, gene fusion or gene fission events can happen in all organisms, while some protein domains are more prone to fusion and fission events and present complex evolutionary patterns.

Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica.

PubMed Central

Xuan, J W; Fournier, P; Declerck, N; Chasles, M; Gaillardin, C

1990-01-01

Mutants affected at the LYS5 locus of Yarrowia lipolytica lack detectable dehydrogenase (SDH) activity. The LYS5 gene has previously been cloned, and we present here the sequence of the 2.5-kilobase-pair (kb) DNA fragment complementing the lys5 mutation. Two large antiparallel open reading frames (ORF1 and ORF2) were observed, flanked by potential transcription signals. Both ORFs appear to be transcribed, but several lines of evidence suggest that only ORF2 is translated and encodes SDH. (i) The global amino acid compositions of Saccharomyces cerevisiae SDH and of the putative ORF2 product are similar and that of ORF1 is dissimilar. (ii) An in-frame translational fusion of ORF2 with the Escherichia coli lacZ gene was introduced into yeast cells and resulted in a beta-galactosidase activity regulated similarly to SDH; no beta-galactosidase activity was obtained with an in-frame fusion of ORF1 with lacZ. (iii) The introduction of a stop codon at the beginning of ORF2 prevented SDH expression in yeast cells, whereas no phenotypic effect was observed when ORF1 translation was blocked. Images PMID:2388625

[Prokaryotic expression of trigeminy artificial fusion gene of Leptospira interrogans and the immunogenicity of its products].

PubMed

Luo, Dong-jiao; Qiu, Xiao-feng; Wang, Jiang; Yan, Jin; Wang, Hai-bin; Zhou, Jin-cheng; Yan, Jie

2008-11-01

To construct lipL32/1-lipL21-OmpL1/2 fusion gene of Leptospira interrogans and its prokaryotic expression system, and to identify the immunogenicity of its products. PCR using linking primers was applied to construct lipL32/1-lipL21-OmpL1/2 fusion gene and a prokaryotic expression system of the fusion gene was then established using routine genetic engineering technique. SDS-PAGE was used to examine output of the target recombinant protein rLipL32/1-LipL21-OmpL1/2. Double immunodiffusion and Western Blot assay were applied to identify immunogenicity of rLipL32/1-LipL21-OmpL1/2. lipL32/1-lipL21-OmpL1/2 fusion gene with correct sequence and its prokaryotic expression system E.coli BL21DE3pET42a-lipL32/1-lipL21-ompL1/2 was obtained in this study. The output of rLipL32/1-LipL21- OmpL1/2 after optimisation was 37.78 mg/L. The immunodiffusion titer of rabbit antiserum against rLipL32/1-LipL21-OmpL1/2 was 1:4. The rLipL32/1-LipL21-OmpL1/2 antiserum was able to recognize rLipL32/1-LipL21-OmpL1/2, rLipL32/1, rLipL21 and rOmpL1/2. Positive Western hybridization signals were found among rLipL32/1-LipL21-OmpL1/2 and rabbit antiserum against whole cell of strain 56601 and serum from patients infected with L.interrogans serogroups Icterohaemorrhagiae, Grippotyphosa, Autumnalis and Pomona. The fusion gene lipL32/1-lipL21-OmpL1/2 and its prokaryotic expression system were successfully constructed in this study. The expressed fusion protein can be used as the antigen for developing universal genetic engineering vaccine and universal serological tests of leptospirosis.

[ALK gene fusion associated non-small cell lung cancer: automated immunostainer detection and clinicopathologic perspectives].

PubMed

Shen, Qin; Pan, Yi; Yu, Bo; Shi, Shanshan; Liu, Biao; Xu, Yan; Wang, Yanfen; Xia, Qiuyuan; Rao, Qiu; Lu, Zhenfeng; Shi, Qunli; Zhou, Xiaojun

2015-03-01

To explore the automated immunostainer screening anaplastic lymphoma kinase (ALK) gene fusion non-small cell lung cancer (NSCLC) and clinicopathological characteristics of the molecular subtype lung cancers. Methods Five hundred and sixty-six cases of NSCLC were collected over a 16 month period. The test for ALK was performed by Ventana automated immunostainer with anti-ALK D5F3. The histological features, treatment and outcome of patients were assessed. Results Thirty-eight cases (6.7%, 38/566) of NSCLC showed ALK gene fusion. The frequency of ALK gene fusion was higher in male (7.1%, 25/350) than that in female (6.0%, 13/216) patients, but not achieving statistical significance (chi2 = 0.270, P = 0.604). ALK + NSCLC was more significantly more frequent in patients < or = 60 years (9.9%, 28/282) than >60 years (3.5% , 10/284) of age. Histologically, the ALK + NSCLCs were mostly adenocarcinoma (81.6%, 31/38) , among which eighteen cases were solid predominant subtype with mucin production; nine cases were acinar predominant subtype; one case was papillary predominant subtype and three cases were invasive mucinous adenocarcinoma. The ALK + non-adenocarcinoma included three cases of squamous cell carcinoma, three cases of adenosquamous carcinoma and one case of pleomorphic carcinoma. Among the ALK + NSCLC patients, the number of non/light cigarette smokers (86. 8% , 33/38) was more than that of heavy smokers. Twenty-nine cases were stages III and IV; twenty-nine cases showed lymph node metastasis; twenty cases showed metastases mostly to brain and bone; and one case showed EGFR gene mutation coexisting with ALK gene fusion. Twelve of fifteen patients received crizotinib therapy and remained stable. Conclusions NSCLC with ALK gene rearrangement shows distinctive clinical and histological features. Ventana-IHC may he a feasible and valid technique for detection of ALK rearrangement in NSCLC.

Glioma stem cells targeted by oncolytic virus carrying endostatin-angiostatin fusion gene and the expression of its exogenous gene in vitro.

PubMed

Zhu, Guidong; Su, Wei; Jin, Guishan; Xu, Fujian; Hao, Shuyu; Guan, Fangxia; Jia, William; Liu, Fusheng

2011-05-16

The development of the cancer stem cell (CSCs) niche theory has provided a new target for the treatment of gliomas. Gene therapy using oncolytic viral vectors has shown great potential for the therapeutic targeting of CSCs. To explore whether a viral vector carrying an exogenous Endo-Angio fusion gene (VAE) can infect and kill glioma stem cells (GSCs), as well as inhibit their vascular niche in vitro, we have collected surgical specimens of human high-grade glioma (world health organization, WHO Classes III-VI) from which we isolated and cultured GSCs under conditions originally designed for the selective expansion of neural stem cells. Our results demonstrate the following: (1) Four lines of GSCs (isolated from 20 surgical specimens) could grow in suspension, were multipotent, had the ability to self-renew and expressed the neural stem cell markers, CD133 and nestin. (2) VAE could infect GSCs and significantly inhibit their viability. (3) The Endo-Angio fusion gene was expressed in GSCs 48 h after VAE infection and could inhibit the proliferation of human brain microvascular endothelial cells (HBMEC). (4) Residual viable cells lose the ability of self-renewal and adherent differentiation. In conclusion, VAE can significantly inhibit the activity of GSCs in vitro and the expression of exogenous Endo-Angio fusion gene can inhibit HBMEC proliferation. VAE can be used as a novel virus-gene therapy strategy for glioma. Copyright © 2011 Elsevier B.V. All rights reserved.

[Construction of eukaryotic recombinant vector and expression in COS7 cell of LipL32-HlyX fusion gene from Leptospira serovar Lai].

PubMed

Huang, Bi; Bao, Lang; Zhong, Qi; Zhang, Huidong; Zhang, Ying

2009-04-01

This study was conducted to construct eukaryotic recombinant vector of LipL32-HlyX fusion gene from Leptospira serovar Lai and express it in mammalian cell. Both of LipL32 gene and HlyX gene were amplified from Leptospira strain O17 genomic DNA by PCR. Then with the two genes as template, LipL32-HlyX fusion gene was obtained by SOE PCR (gene splicing by overlap extension PCR). The fusion gene was then cloned into pcDNA3.1 by restriction nuclease digestion. Having been transformed into E. coli DH5alpha, the recombiant plasmid was identified by restriction nuclease digestion, PCR analysis and sequencing. The recombinant plasmid was then transfected into COS7 cell whose expression was detected by RT-PCR and Western blotting analysis. RT-PCR amplified a fragment about 2000 bp and Western blotting analysis found a specific band about 75 KD which was consistent with the expected fusion protein size. In conclusion, the successful construction of eukaryotic recombinant vector containing LipL32-HlyX fusion gene and the effective expression in mammalian have laid a foundation for the application of Leptospira DNA vaccine.

Widespread and highly persistent gene transfer to the CNS by retrovirus vector in utero: implication for gene therapy to Krabbe disease.

PubMed

Shen, Jin-Song; Meng, Xing-Li; Yokoo, Takashi; Sakurai, Ken; Watabe, Kazuhiko; Ohashi, Toya; Eto, Yoshikatsu

2005-05-01

Brain-directed prenatal gene therapy may benefit some lysosomal storage diseases that affect the central nervous system (CNS) before birth. Our previous study showed that intrauterine introduction of recombinant adenoviruses into cerebral ventricles results in efficient gene transfer to the CNS in the mouse. However, transgene expression decreased with time due to the non-integrative property of adenoviral vectors. In this study, in order to obtain permanent gene transduction, we investigated the feasibility of retrovirus-mediated in utero gene transduction. Concentrated retrovirus encoding the LacZ gene was injected into the cerebral ventricles of the embryos of normal and twitcher mice (a murine model of Krabbe disease) at embryonic day 12. The distribution and maintenance of the transgene expression in the recipient brain were analyzed histochemically, biochemically and by the quantitative polymerase chain reaction method pre- and postnatally. Efficient and highly persistent gene transduction to the brain was achieved both in normal and the twitcher mouse. Transduced neurons, astrocytes and oligodendrocytes were distributed throughout the brain. The transduced LacZ gene, its transcript and protein expression in the brain were maintained for 14 months without decrement. In addition, gene transduction to multiple tissues other than the brain was also detected at low levels. This study suggests that brain-directed in utero gene transfer using retrovirus vector may be beneficial to the treatment of lysosomal storage diseases with severe brain damage early in life, such as Krabbe disease. Copyright (c) 2005 John Wiley & Sons, Ltd.

A new human lung adenocarcinoma cell line harboring the EML4-ALK fusion gene.

PubMed

Isozaki, Hideko; Yasugi, Masayuki; Takigawa, Nagio; Hotta, Katsuyuki; Ichihara, Eiki; Taniguchi, Akihiko; Toyooka, Shinichi; Hashida, Shinsuke; Sendo, Toshiaki; Tanimoto, Mitsune; Kiura, Katsuyuki

2014-10-01

The echinoderm microtubule associated protein-like 4 (EML4)-anaplastic lymphoma kinase (ALK) fusion gene was identified in patients with non-small cell lung cancer. To the best of our knowledge, there are only three cell lines harboring the EML4-ALK fusion gene, which have contributed to the development of therapeutic strategies. Therefore, we tried to establish a new lung cancer cell line harboring EML4-ALK. A 61-year-old Japanese female presented with chest discomfort. She was diagnosed with left lung adenocarcinoma with T4N3M1 Stage IV. Although she was treated with chemotherapy, her disease progressed with massive pleural effusion. Because the EML4-ALK rearrangement was found in a biopsied specimen using fluorescence in situ hybridization, she was treated with crizotinib. She did well for 3 months. Tumor cells were obtained from the malignant pleural effusion before treatment with crizotinib. Cells continued to proliferate substantially for several weeks. The cell line was designated ABC-11. The EML4-ALK fusion protein and genes were identified in ABC-11 cells using fluorescence in situ hybridization and immunohistochemistry, respectively. ABC-11 cells were sensitive to crizotinib and next-generation ALK inhibitors (ceritinib and AP26113), as determined by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide assay. Phosphorylated ALK protein and its downstream signaling were suppressed by treatment with crizotinib in western blotting. Furthermore, we could transplant ABC-11 cells subcutaneously into BALB/c nu/nu mice. We successfully established a new lung adenocarcinoma cell line harboring the EML4-ALK fusion gene. This cell line could contribute to future research of EML4-ALK-positive lung cancer both in vivo and in vitro. © The Author 2014. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

A PTEN-COL17A1 fusion gene and its novel regulatory role in Collagen XVII expression and GBM malignance.

PubMed

Yan, Xiaoyan; Zhang, Chuanbao; Liang, Tingyu; Yang, Fan; Wang, Haoyuan; Wu, Fan; Wang, Wen; Wang, Zheng; Cheng, Wen; Xu, Jiangnan; Jiang, Tao; Chen, Jing; Ding, Yaozhong

2017-10-17

Collagen XVII expression has recently been demonstrated to be correlated with the tumor malignance. While Collagen XVII is known to be widely distributed in neurons of the human brain, its precise role in pathogenesis of glioblastoma multiforme (GBM) is unknown. In this study, we identified and characterized a new PTEN-COL17A1 fusion gene in GMB using transcriptome sequencing. Although fusion gene did not result in measurable fusion protein production, its presence is accompanied with high levels of COL17A1 expression, revealed a novel regulatory mechanism of Collagen XVII expression by PTEN-COL17A1 gene fusion. Knocked down Collagen XVII expression in glioma cell lines resulted in decreased tumor invasiveness, along with significant reduction of MMP9 expression, while increased Collagen XVII expression promotes invasive activities of glioma cells and associated with GBM recurrences. Together, our results uncovered a new PTEN-COL17A1 fusion gene and its novel regulatory role in Collagen XVII expression and GBM malignance, and demonstrated that COL17A1 could serve as a useful prognostic biomarker and therapeutic targets for GBM.

Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.

PubMed

Koo, Kevin M; Wee, Eugene J H; Trau, Matt

2016-01-01

TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes.

Screening for diverse PDGFRA or PDGFRB fusion genes is facilitated by generic quantitative reverse transcriptase polymerase chain reaction analysis

PubMed Central

Erben, Philipp; Gosenca, Darko; Müller, Martin C.; Reinhard, Jelena; Score, Joannah; del Valle, Francesco; Walz, Christoph; Mix, Jürgen; Metzgeroth, Georgia; Ernst, Thomas; Haferlach, Claudia; Cross, Nicholas C.P.; Hochhaus, Andreas; Reiter, Andreas

2010-01-01

Background Rapid identification of diverse fusion genes with involvement of PDGFRA or PDGFRB in eosinophilia-associated myeloproliferative neoplasms is essential for adequate clinical management but is complicated by the multitude and heterogeneity of partner genes and breakpoints. Design and Methods We established a generic quantitative reverse transcriptase polymerase chain reaction to detect overexpression of the 3′-regions of PDGFRA or PDGFRB as a possible indicator of an underlying fusion. Results At diagnosis, all patients with known fusion genes involving PDGFRA (n=5; 51 patients) or PDGFRB (n=5; 7 patients) showed significantly increased normalized expression levels compared to 191 patients with fusion gene-negative eosinophilia or healthy individuals (PDGFRA/ABL: 0.73 versus 0.0066 versus 0.0064, P<0.0001; PDGFRB/ABL: 196 versus 3.8 versus 5.85, P<0.0001). The sensitivity and specificity of the activation screening test were, respectively, 100% and 88.4% for PDGFRA and 100% and 94% for PDGFRB. Furthermore, significant overexpression of PDGFRB was found in a patient with an eosinophilia-associated myeloproliferative neoplasm with uninformative cytogenetics and an excellent response to imatinib. Subsequently, a new SART3-PDGFRB fusion gene was identified by 5′-rapid amplification of cDNA ends polymerase chain reaction (5′-RACE-PCR). Conclusions Quantitative reverse transcriptase polymerase chain reaction analysis is a simple and useful adjunct to standard diagnostic assays to detect clinically significant overexpression of PDGFRA and PDGFRB in eosinophilia-associated myeloproliferative neoplasms or related disorders. PMID:20107158

Analysis of clinicopathological features of the echinoderm microtubule-associated protein-like-4-anaplastic lymphoma kinase fusion gene in Chinese patients with advanced non-small-cell lung cancer

PubMed Central

Liu, Yu-Tao; Shi, Yuan-Kai; Hao, Xue-Zhi; Wang, Lin; Li, Jun-Ling; Han, Xiao-Hong; Li, Dan; Zhou, Yu-Jie; Tang, Le

2014-01-01

Background The echinoderm microtubule-associated protein-like-4-anaplastic lymphoma kinase (EML4-ALK) fusion gene defines a novel molecular subset of non-small-cell lung cancer (NSCLC). However, the clinicopathological features of patients with the EML4-ALK fusion gene have not been defined completely. Methods Clinicopathological data of 200 Chinese patients with advanced NSCLC were analyzed retrospectively to explore their possible correlations with EML4-ALK fusions. Results The EML4-ALK fusion gene was detected in 56 (28.0%) of the 200 NSCLC patients, and undetected in 22 (11.0%) patients because of an insufficient amount of pathological tissue. The median age of the patients with positive and negative EML4-ALK was 48 and 55 years, respectively. Patients with the EML4-ALK fusion gene were significantly younger (P< 0.001). The detection rate of the EML4-ALK fusion gene in patients who received primary tumor or metastatic lymph node resection was significantly higher than in patients who received fine-needle biopsy (P= 0.003). The detection rate of the EML4-ALK fusion gene in patients with a time lag from obtainment of the pathological tissue to EML4-ALK fusion gene detection ≤48 months was significantly higher than in patients >48 months (P= 0.020). The occurrence of the EML4-ALK fusion gene in patients with wild-type epidermal growth factor receptor (EGFR) was significantly higher than in patients with mutant-type EGFR (42.5% [37/87] vs. 6.3% [1/16], P= 0.005). Conclusions Younger age and wild-type EGFR were identified as clinicopathological characteristics of patients with advanced NSCLC who harbored the EML4-ALK fusion gene. The optimal time lag from the obtainment of the pathological tissue to the time of EML4-ALK fusion gene detection is ≤48 months. PMID:26767009

Gene transfer as a strategy to achieve permanent cardioprotection I: rAAV-mediated gene therapy with inducible nitric oxide synthase limits infarct size 1 year later without adverse functional consequences.

PubMed

Li, Qianhong; Guo, Yiru; Wu, Wen-Jian; Ou, Qinghui; Zhu, Xiaoping; Tan, Wei; Yuan, Fangping; Chen, Ning; Dawn, Buddhadeb; Luo, Li; O'Brien, Erin; Bolli, Roberto

2011-11-01

The ultimate goal of prophylactic gene therapy is to confer permanent protection against ischemia. Although gene therapy with inducible nitric oxide synthase (iNOS) is known to protect against myocardial infarction at 3 days and up to 2 months, the long-term effects on myocardial ischemic injury and function are unknown. To address this issue, we created a recombinant adeno-associated viral vector carrying the iNOS gene (rAAV/iNOS), which enables long-lasting transgene expression. The ability of rAAV/iNOS to direct the expression of functional iNOS protein was confirmed in COS-7 cells before in vivo gene transfer. Mice received injections in the anterior LV wall of rAAV/LacZ or rAAV/iNOS; 1 year later, they underwent a 30-min coronary occlusion (O) and 4 h of reperfusion (R). iNOS gene transfer resulted in elevated iNOS protein expression (+3-fold vs. the LacZ group, n = 6; P < 0.05) and iNOS activity (+4.4-fold vs. the LacZ group, n = 6; P < 0.05) 1 year later. Infarct size (% of risk region) was dramatically reduced at 1 year after iNOS gene transfer (13.5 ± 2.2%, n = 12, vs. 41.7 ± 2.9%, n = 10, in the LacZ group; P < 0.05). The infarct-sparing effect of iNOS gene therapy at 1 year was as powerful as that observed 24 h after ischemic preconditioning (six 4-min O/4-min R cycles) (19.3 ± 2.3%, n = 11; P < 0.05). Importantly, compared with the LacZ group (n = 11), iNOS gene transfer (n = 10) had no effect on LV dimensions or function for up to 1 year (at 1 year: FS 34.5 ± 2.0 vs. 34.6 ± 2.6%, EF 57.0 ± 2.0 vs. 59.7 ± 2.9%, LVEDD 4.3 ± 0.1 vs. 4.2 ± 0.2 mm, LVESD 2.8 ± 0.1 vs. 2.9 ± 0.2 mm) (echocardiography). These data demonstrate, for the first time, that rAAV-mediated iNOS gene transfer affords long-term, probably permanent (1 year), cardioprotection without adverse functional consequences, providing a strong rationale for further preclinical testing of prophylactic gene therapy.

Export of the Virulence Factors from Shigella Flexneri and Characterization of the mxi loci

DTIC Science & Technology

1992-07-20

steps in Shigella pathogenesis. To identify temperature-regulated virulence genes on the plasmid, lacZ protein fusions were randomly generated in S ...this locus conferred the Mxi- phenotype and was found to affect virulence of S . flexneri at the level of invasion, which correlated with reduced...excretion of IpaC. Protease protection experiments indicated the presence of high intracellular reservoirs of Ipa proteins in wild-type S . flexneri as

SFM: A novel sequence-based fusion method for disease genes identification and prioritization.

PubMed

Yousef, Abdulaziz; Moghadam Charkari, Nasrollah

2015-10-21

The identification of disease genes from human genome is of great importance to improve diagnosis and treatment of disease. Several machine learning methods have been introduced to identify disease genes. However, these methods mostly differ in the prior knowledge used to construct the feature vector for each instance (gene), the ways of selecting negative data (non-disease genes) where there is no investigational approach to find them and the classification methods used to make the final decision. In this work, a novel Sequence-based fusion method (SFM) is proposed to identify disease genes. In this regard, unlike existing methods, instead of using a noisy and incomplete prior-knowledge, the amino acid sequence of the proteins which is universal data has been carried out to present the genes (proteins) into four different feature vectors. To select more likely negative data from candidate genes, the intersection set of four negative sets which are generated using distance approach is considered. Then, Decision Tree (C4.5) has been applied as a fusion method to combine the results of four independent state-of the-art predictors based on support vector machine (SVM) algorithm, and to make the final decision. The experimental results of the proposed method have been evaluated by some standard measures. The results indicate the precision, recall and F-measure of 82.6%, 85.6% and 84, respectively. These results confirm the efficiency and validity of the proposed method. Copyright © 2015 Elsevier Ltd. All rights reserved.

NAB2-STAT6 fusion gene analysis in two cases of meningeal solitary fibrous tumor/hemangiopericytoma with late distant metastases.

PubMed

Nakada, Satoko; Minato, Hiroshi; Takegami, Tsutomu; Kurose, Nozomu; Ikeda, Hiroko; Kobayashi, Masako; Sasagawa, Yasuo; Akai, Takuya; Kato, Takashi; Yamamoto, Norio; Nojima, Takayuki

2015-10-01

We present two cases of meningeal solitary fibrous tumor (SFT)/hemangiopericytoma (HPC) with immunohistochemistry of STAT6 and analysis of NAB2-STAT6 fusion genes. Case 1 was a 37-year-old male with a left middle fossa tumor; case 2 was a 68-year-old female with a cerebellar tumor. They showed late metastasis to the lung or bone 8 or 13 years, respectively, after the first surgery. Histology of both primary and metastatic tumors showed a cellular hemangiopericytomatous pattern with nuclear atypia. The primary tumors showed nuclear staining of STAT6, but both metastatic tumors showed nuclear and cytoplasmic STAT6. DNA sequencing revealed two kinds of NAB2-STAT6 fusion genes. One consisted of exon 6 of NAB2, intron 6 of NAB2, and the middle of exon 17 of STAT6 (observed in the primary and metastatic tumors of case 1); the other consisted of exon 6 of NAB2 and the beginning of exon 17 of STAT6 (observed in the metastatic tumor of case 2). The primary tumor of case 2 had both fusion genes. To the best of our knowledge, we are the first to report NAB2-STAT6 fusion gene analysis in primary and metastatic meningeal SFT/HPCs and a case showed different fusion gene status in the metastatic tumor.

Minimal phenotype of mice homozygous for a null mutation in the forkhead/winged helix gene, Mf2.

PubMed

Kume, T; Deng, K; Hogan, B L

2000-02-01

Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2(lacZ)) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes.

Fusion genes with ALK as recurrent partner in ependymoma-like gliomas: a new brain tumor entity?

PubMed Central

Olsen, Thale Kristin; Panagopoulos, Ioannis; Meling, Torstein R.; Micci, Francesca; Gorunova, Ludmila; Thorsen, Jim; Due-Tønnessen, Bernt; Scheie, David; Lund-Iversen, Marius; Krossnes, Bård; Saxhaug, Cathrine; Heim, Sverre; Brandal, Petter

2015-01-01

Background We have previously characterized 19 ependymal tumors using Giemsa banding and high-resolution comparative genomic hybridization. The aim of this study was to analyze these tumors searching for fusion genes. Methods RNA sequencing was performed in 12 samples. Potential fusion transcripts were assessed by seed count and structural chromosomal aberrations. Transcripts of interest were validated using fluorescence in situ hybridization and PCR followed by direct sequencing. Results RNA sequencing identified rearrangements of the anaplastic lymphoma kinase gene (ALK) in 2 samples. Both tumors harbored structural aberrations involving the ALK locus 2p23. Tumor 1 had an unbalanced t(2;14)(p23;q22) translocation which led to the fusion gene KTN1-ALK. Tumor 2 had an interstitial del(2)(p16p23) deletion causing the fusion of CCDC88A and ALK. In both samples, the breakpoint of ALK was located between exons 19 and 20. Both patients were infants and both tumors were supratentorial. The tumors were well demarcated from surrounding tissue and had both ependymal and astrocytic features but were diagnosed and treated as ependymomas. Conclusions By combining karyotyping and RNA sequencing, we identified the 2 first ever reported ALK rearrangements in CNS tumors. Such rearrangements may represent the hallmark of a new entity of pediatric glioma characterized by both ependymal and astrocytic features. Our findings are of particular importance because crizotinib, a selective ALK inhibitor, has demonstrated effect in patients with lung cancer harboring ALK rearrangements. Thus, ALK emerges as an interesting therapeutic target in patients with ependymal tumors carrying ALK fusions. PMID:25795305

Domain retention in transcription factor fusion genes and its biological and clinical implications: a pan-cancer study

PubMed Central

Kim, Pora; Ballester, Leomar Y.; Zhao, Zhongming

2017-01-01

Genomic rearrangements involving transcription factors (TFs) can form fusion proteins resulting in either enhanced, weakened, or even loss of TF activity. Functional domain (FD) retention is a critical factor in the activity of transcription factor fusion genes (TFFGs). A systematic investigation of FD retention in TFFGs and their outcome (e.g. expression changes) in a pan-cancer study has not yet been completed. Here, we examined the FD retention status in 386 TFFGs across 13 major cancer types and identified 83 TFFGs involving 67 TFs that retained FDs. To measure the potential biological relevance of TFs in TFFGs, we introduced a Major Active Isofusion Index (MAII) and built a prioritized TFFG network using MAII scores and the observed frequency of fusion positive samples. Interestingly, the four TFFGs (PML-RARA, RUNX1-RUNX1T1, TMPRSS2-ERG, and SFPQ-TFE3) with the highest MAII scores showed 50 differentially expressed target genes (DETGs) in fusion-positive versus fusion-negative cancer samples. DETG analysis revealed that they were involved in tumorigenesis-related processes in each cancer type. PLAU, which encodes plasminogen activator urokinase and serves as a biomarker for tumor invasion, was found to be consistently activated in the samples with the highest MAII scores. Among the 50 DETGs, 21 were drug targetable genes. Fourteen of these 21 DETGs were expressed in acute myeloid leukemia (AML) samples. Accordingly, we constructed an AML-specific TFFG network, which included 38 DETGs in RUNX1-RUNX1T1 or PML-RARA positive samples. In summary, this study revealed several TFFGs and their potential target genes, and provided insights into the clinical implications of TFFGs. PMID:29299133

Transcriptional analysis of the bglP gene from Streptococcus mutans.

PubMed

Cote, Christopher K; Honeyman, Allen L

2006-04-21

An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript.

Transcriptional analysis of the bglP gene from Streptococcus mutans

PubMed Central

Cote, Christopher K; Honeyman, Allen L

2006-01-01

Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript. PMID:16630357

Gene trapping in differentiating cell lines: regulation of the lysosomal protease cathepsin B in skeletal myoblast growth and fusion.

PubMed

Gogos, J A; Thompson, R; Lowry, W; Sloane, B F; Weintraub, H; Horwitz, M

1996-08-01

To identify genes regulated during skeletal muscle differentiation, we have infected mouse C2C12 myoblasts with retroviral gene trap vectors, containing a promoterless marker gene with a 5' splice acceptor signal. Integration of the vector adjacent to an actively transcribed gene places the marker under the transcriptional control of the endogenous gene, while the adjacent vector sequences facilitate cloning. The vector insertionally mutates the trapped locus and may also form fusion proteins with the endogenous gene product. We have screened several hundred clones, each containing a trapping vector integrated into a different endogenous gene. In agreement with previous estimates based on hybridization kinetics, we find that a large proportion of all genes expressed in myoblasts are regulated during differentiation. Many of these genes undergo unique temporal patterns of activation or repression during cell growth and myotube formation, and some show specific patterns of subcellular localization. The first gene we have identified with this strategy is the lysosomal cysteine protease cathepsin B. Expression from the trapped allele is upregulated during early myoblast fusion and downregulated in myotubes. A direct role for cathepsin B in myoblast growth and fusion is suggested by the observation that the trapped cells deficient in cathepsin B activity have an unusual morphology and reduced survival in low-serum media and undergo differentiation with impaired cellular fusion. The phenotype is reproduced by antisense cathepsin B expression in parental C2C12 myoblasts. The cellular phenotype is similar to that observed in cultured myoblasts from patients with I cell disease, in which there is diminished accumulation of lysosomal enzymes. This suggests that a specific deficiency of cathepsin B could contribute to the myopathic component of this illness.

Studies on the Nucleotide Sequence, Transcription and Deletion Analysis of the BmNPV Protein Kinase Gene.

PubMed

Zhang, Chuan-Xi; Hu, Cui; Wu, Xiang-Fu

1998-01-01

The coding region of BmvPK-1 gene of Bombyx mori NPV (Strain ZJ8) is 828 nt long and encodes a 276 aa polypeptide with predicted molecular mass of 32 kD. Dot blot analysis showed its mRNA to be gene is first detectable at 18 h p.i. and reaching the highest transcriptional level at 48 h p.i. The result suggested that BmvPK-1 gene is a late or very late gene. The most conserved 365 bp of the BmvPK-1 gene was deleted in a transfer vector (pUCPK-lac), and a report gene (lacZ) was inserted in the deleted position. Cotransfection of BmN cells with pUCPK-lac DNA and BmNPV DNA resulted in the recombinant virus which expressed detectable product of lacZ gene. But the virus with the deleted BmvPK-1 gene could not be isolated from the wild BmNPV by plaque purification method. The result showed that the BmvPK-1 gene deleted virus can multiply only with the help of the product of this gene from the wild type virus, and the gene is necessary for the virus to finish its life cycle in the cultured cells.

TMPRSS2:ERG Gene Fusions in Prostate Cancer of West African Men and a Meta-Analysis of Racial Differences

PubMed Central

Zhou, Cindy Ke; Young, Denise; Yeboah, Edward D; Coburn, Sally B; Tettey, Yao; Biritwum, Richard B; Adjei, Andrew A; Tay, Evelyn; Niwa, Shelley; Truelove, Ann; Welsh, Judith; Mensah, James E; Hoover, Robert N; Sesterhenn, Isabell A; Hsing, Ann W; Srivastava, Shiv; Cook, Michael B

2017-01-01

Abstract The prevalence of fusions of the transmembrane protease, serine 2, gene (TMPRSS2) with the erythroblast transformation-specific–related gene (ERG), or TMPRSS2:ERG, in prostate cancer varies by race. However, such somatic aberration and its association with prognostic factors have neither been studied in a West African population nor been systematically reviewed in the context of racial differences. We used immunohistochemistry to assess oncoprotein encoded by the ERG gene as the established surrogate of ERG fusion genes among 262 prostate cancer biopsies from the Ghana Prostate Study (2004–2006). Poisson regression with robust variance estimation provided prevalence ratios and 95% confidence intervals of ERG expression in relation to patient characteristics. We found that 47 of 262 (18%) prostate cancers were ERG-positive, and being negative for ERG staining was associated with higher Gleason score. We further conducted a systematic review and meta-analysis of TMPRSS2:ERG fusions in relation to race, Gleason score, and tumor stage, combining results from Ghana with 40 additional studies. Meta-analysis showed the prevalence of TMPRSS2:ERG fusions in prostate cancer to be highest in men of European descent (49%), followed by men of Asian (27%) and then African (25%) descent. The lower prevalence of TMPRSS2:ERG fusions in men of African descent implies that alternative genomic mechanisms might explain the disproportionately high prostate cancer burden in such populations. PMID:28633309

Minimal Phenotype of Mice Homozygous for a Null Mutation in the Forkhead/Winged Helix Gene, Mf2

PubMed Central

Kume, Tsutomu; Deng, Keyu; Hogan, Brigid L. M.

2000-01-01

Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2lacZ) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes. PMID:10648626

[Construction and application of prokaryotic expression system of Leptospira interrogans lipL32/1-lipL41/1 fusion gene].

PubMed

Luo, Dong-jiao; Yan, Jie; Mao, Ya-fei; Li, Shu-ping; Luo, Yi-hui; Li, Li-wei

2005-01-01

To construct lipL32/1-lipL41/1 fusion gene and its prokaryotic expression system and to determine frequencies of carrying and expression of lipL32 and lipL41 genes in L.interrogans wild strains and specific antibody levels in sera from leptospirosis patients. lipL32/1-lipL41/1 fusion gene was constructed using linking primer PCR method and the prokaryotic expression system of the fusion gene done with routine techniques. SDS-PAGE was used to examine expression of the target recombinant protein rLipL32/1-rLipL41/1. Immunogenicity of rLipL32/1-rLipL41/1 was identified by Western blot. PCR and MAT were performed to detect carrying and expression of lipL32 and lipL41 genes in 97 wild L.interrogans strains. Antibodies against products of lipL32 and lipL41 genes in serum samples from 228 leptospirosis patients were detected by ELISA method. The homogeneity of nucleotide and putative amino acid sequence of lipL32/1-lipL41/1 fusion gene were 99.9 % and 99.8 % in comparison with the reported sequences. Expression output of the target recombinant protein rLipL32/1-rLipL41/1, mainly present in inclusion body, accounted for 10 % of the total bacterial proteins. Both the rabbit antisera against rLipL32/1 and rLipL41/1 could combine to rLipL32/1-rLipL41/1. 97.9 % and 87.6 % of the L.interrogans wild strains had lipL32 and lipL41 genes, respectively. 95.9 % and 84.5 % of the wild strains were positive for MAT with titers of 1:4 - 1:128 using rabbit anti-rLipL32s or anti-rLipL41s sera, respectively. 94.7 % - 97.4 % of the patients'serum samples were positive for rLipL32s antibodies, while 78.5 % - 84.6 % of them were rLipL41s antibodies detectable. lipL32/1-jlipL41/1 fusion gene and its prokaryotic expression system were successfully constructed. The expressed fusion protein had qualified immunogenicity. Both the lipL32 and lipL41 genes are extensively carried and frequently expressed by different serogroups of L.interrogans, and their expression products exhibit cross-antigenicity.

Clinicopathological differences between variants of the NAB2-STAT6 fusion gene in solitary fibrous tumors of the meninges and extra-central nervous system.

PubMed

Nakada, Satoko; Minato, Hiroshi; Nojima, Takayuki

2016-07-01

Investigations on the NAB2-STAT6 fusion gene in solitary fibrous tumors (SFTs) and hemangiopericytomas (HPCs) have increased since its discovery in 2013. Although several SFTs reported without NAB2-STAT6 fusion gene analysis, we reviewed 546 SFTs/HPCs with NAB2-STAT6 fusion gene analysis in this study and investigated differences between the gene variants. In total, 452 cases tested positive for the NAB2-STAT6 fusion gene, with more than 40 variants being detected. The most frequent of these were NAB2 exon 6-STAT6 exon 16/17/18 and NAB2 exon 4-STAT6 exon 2/3, with the former occurring most frequently in SFTs in meninges, soft tissues, and head and neck; the latter predominated in SFTs in the pleura and lung. There was no difference between the histology of SFTs and fusion gene variants. A follow-up analysis of SFTs showed that 51 of 202 cases had a recurrence, with 18 of 53 meningeal SFTs having a local recurrence and/or metastasis within 0-19 years. In meninges and soft tissue, SFTs with the NAB2 exon 6-STAT6 exon 16/17/18 tended to recur more frequently than SFTs with the NAB2 exon 4-STAT6 exon 2/3. Clinicopathological data, including yearly follow-ups, are required for meningeal SFTs/HPCs to define the correlation of variants of NAB2-STAT6 fusion gene.

Gene transfer as a strategy to achieve permanent cardioprotection II: rAAV-mediated gene therapy with heme oxygenase-1 limits infarct size 1 year later without adverse functional consequences.

PubMed

Li, Qianhong; Guo, Yiru; Ou, Qinghui; Wu, Wen-Jian; Chen, Ning; Zhu, Xiaoping; Tan, Wei; Yuan, Fangping; Dawn, Buddhadeb; Luo, Li; Hunt, Gregory N; Bolli, Roberto

2011-11-01

Extensive evidence indicates that heme oxygenase-1 (HO-1) exerts potent cytoprotective effects in response to stress. Previous studies have shown that gene therapy with HO-1 protects against myocardial ischemia/reperfusion injury for up to 8 weeks after gene transfer. However, the long-term effects of HO-1 gene therapy on myocardial ischemic injury and function are unknown. To address this issue, we created a recombinant adeno-associated viral vector carrying the HO-1 gene (rAAV/HO-1) that enables long-lasting transgene expression. Mice received injections in the anterior LV wall of rAAV/LacZ (LacZ group) or rAAV/HO-1 (HO-1 group); 1 year later, they were subjected to a 30-min coronary occlusion (O) and 4 h of reperfusion (R). Cardiac HO-1 gene expression was confirmed at 1 month and 1 year after gene transfer by immunoblotting and immunohistochemistry analyses. In the HO-1 group, infarct size (% of risk region) was dramatically reduced at 1 year after gene transfer (11.2 ± 2.1%, n = 12, vs. 44.7 ± 3.6%, n = 8, in the LacZ group; P < 0.05). The infarct-sparing effects of HO-1 gene therapy at 1 year were as powerful as those observed 24 h after ischemic PC (six 4-min O/4-min R cycles) (15.0 ± 1.7%, n = 10). There were no appreciable changes in LV fractional shortening, LV ejection fraction, or LV end-diastolic or end-systolic diameter at 1 year after HO-1 gene transfer as compared to the age-matched controls or with the LacZ group. Histology showed no inflammation in the myocardium 1 year after rAAV/HO-1-mediated gene transfer. These results demonstrate, for the first time, that rAAV-mediated HO-1 gene transfer confers long-term (1 year), possibly permanent, cardioprotection without adverse functional consequences, providing proof of principle for the concept of achieving prophylactic cardioprotection (i.e., "immunization against infarction").

Adenoviral-Mediated Imaging of Gene Transfer Using a Somatostatin Receptor-Cytosine Deaminase Fusion Protein

PubMed Central

Lears, Kimberly A.; Parry, Jesse J.; Andrews, Rebecca; Nguyen, Kim; Wadas, Thaddeus J.; Rogers, Buck E.

2015-01-01

Suicide gene therapy is a process by which cells are administered a gene that encodes a protein capable of converting a nontoxic prodrug into an active toxin. Cytosine deaminase (CD) has been widely investigated as a means of suicide gene therapy due to the enzyme’s ability to convert the prodrug 5-fluorocytosine (5-FC) into the toxic compound 5-fluorouracil (5-FU). However, the extent of gene transfer is a limiting factor in predicting therapeutic outcome. The ability to monitor gene transfer, non-invasively, would strengthen the efficiency of therapy. In this regard, we have constructed and evaluated a replication-deficient adenovirus (Ad) containing the human somatostatin receptor subtype 2 (SSTR2) fused with a C-terminal yeast CD gene for the non-invasive monitoring of gene transfer and therapy. The resulting Ad (AdSSTR2-yCD) was evaluated in vitro in breast cancer cells to determine the function of the fusion protein. These studies demonstrated that the both the SSTR2 and yCD were functional in binding assays, conversion assays, and cytotoxicity assays. In vivo studies similarly demonstrated the functionality using conversion assays, biodistribution studies, and small animal positron-emission tomography (PET) imaging studies. In conclusion, the fusion protein has been validated as useful for the non-invasive imaging of yCD expression and will be evaluated in the future for monitoring yCD-based therapy. PMID:25837665

A Search for Gene Fusions/Translocations in Breast Cancer

DTIC Science & Technology

2012-10-01

specific pseudogenes. 15. SUBJECT TERMS Gene fusions, sequencing, MAST,Notch 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18 ...Figure 5B) as well as in in vivo intravasation and metastasis in chicken chorioallantoic mem- brane xenograft assay (Figure 5C). In contrast...m p h o b la st o id (n = 8) Pa n cr ea ti c B en ig n (n = 3) Pr o st at e B en ig n (n = 18 ) C an ce r S p ec ifi c Sample Frequency (%)0 100

Msx genes define a population of mural cell precursors required for head blood vessel maturation.

PubMed

Lopes, Miguel; Goupille, Olivier; Saint Cloment, Cécile; Lallemand, Yvan; Cumano, Ana; Robert, Benoît

2011-07-01

Vessels are primarily formed from an inner endothelial layer that is secondarily covered by mural cells, namely vascular smooth muscle cells (VSMCs) in arteries and veins and pericytes in capillaries and veinules. We previously showed that, in the mouse embryo, Msx1(lacZ) and Msx2(lacZ) are expressed in mural cells and in a few endothelial cells. To unravel the role of Msx genes in vascular development, we have inactivated the two Msx genes specifically in mural cells by combining the Msx1(lacZ), Msx2(lox) and Sm22α-Cre alleles. Optical projection tomography demonstrated abnormal branching of the cephalic vessels in E11.5 mutant embryos. The carotid and vertebral arteries showed an increase in caliber that was related to reduced vascular smooth muscle coverage. Taking advantage of a newly constructed Msx1(CreERT2) allele, we demonstrated by lineage tracing that the primary defect lies in a population of VSMC precursors. The abnormal phenotype that ensues is a consequence of impaired BMP signaling in the VSMC precursors that leads to downregulation of the metalloprotease 2 (Mmp2) and Mmp9 genes, which are essential for cell migration and integration into the mural layer. Improper coverage by VSMCs secondarily leads to incomplete maturation of the endothelial layer. Our results demonstrate that both Msx1 and Msx2 are required for the recruitment of a population of neural crest-derived VSMCs.

A sensitive HIV-1 envelope induced fusion assay identifies fusion enhancement of thrombin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, De-Chun; Zhong, Guo-Cai; Su, Ju-Xiang

2010-01-22

To evaluate the interaction between HIV-1 envelope glycoprotein (Env) and target cell receptors, various cell-cell-fusion assays have been developed. In the present study, we established a novel fusion system. In this system, the expression of the sensitive reporter gene, firefly luciferase (FL) gene, in the target cells was used to evaluate cell fusion event. Simultaneously, constitutively expressed Renilla luciferase (RL) gene was used to monitor effector cell number and viability. FL gave a wider dynamic range than other known reporters and the introduction of RL made the assay accurate and reproducible. This system is especially beneficial for investigation of potentialmore » entry-influencing agents, for its power of ruling out the false inhibition or enhancement caused by the artificial cell-number variation. As a case study, we applied this fusion system to observe the effect of a serine protease, thrombin, on HIV Env-mediated cell-cell fusion and have found the fusion enhancement activity of thrombin over two R5-tropic HIV strains.« less

Molecular Evolution of Respiratory Syncytial Virus Fusion Gene, Canada, 2006–2010

PubMed Central

Papenburg, Jesse; Carbonneau, Julie; Hamelin, Marie-Ève; Isabel, Sandra; Bouhy, Xavier; Ohoumanne, Najwa; Déry, Pierre; Paes, Bosco A.; Corbeil, Jacques; Bergeron, Michel G.; De Serres, Gaston

2012-01-01

To assess molecular evolution of the respiratory syncytial virus (RSV) fusion gene, we analyzed RSV-positive specimens from 123 children in Canada who did or did not receive RSV immunoprophylaxis (palivizumab) during 2006–2010. Resistance-conferring mutations within the palivizumab binding site occurred in 8.7% of palivizumab recipients and none of the nonrecipients. PMID:22264682

The Bradyrhizobium japonicum nolA gene and its involvement in the genotype-specific nodulation of soybeans.

PubMed Central

Sadowsky, M J; Cregan, P B; Gottfert, M; Sharma, A; Gerhold, D; Rodriguez-Quinones, F; Keyser, H H; Hennecke, H; Stacey, G

1991-01-01

Several soybean genotypes have been identified which specifically exclude nodulation by members of Bradyrhizobium japonicum serocluster 123. We have identified and sequenced a DNA region from B. japonicum strain USDA 110 which is involved in genotype-specific nodulation of soybeans. This 2.3-kilobase region, cloned in pMJS12, allows B. japonicum serocluster 123 isolates to form nodules on plants of serogroup 123-restricting genotypes. The nodules, however, were ineffective for symbiotic nitrogen fixation. The nodulation-complementing region is located approximately 590 base pairs transcriptionally downstream from nodD2. The 5' end of pMJS12 contains a putative open reading frame (ORF) of 710 base pairs, termed nolA. Transposon Tn3-HoHo mutations only within the ORF abolished nodulation complementation. The N terminus of the predicted nolA gene product has strong similarity with the N terminus of MerR, the regulator of mercury resistance genes. Translational lacZ fusion experiments indicated that nolA was moderately induced by soybean seed extract and the isoflavone genistein. Restriction fragments that hybridize to pMJS12 were detected in genomic DNAs from both nodulation-restricted and -unrestricted strains. PMID:1988958

Gene expression profiling and candidate gene resequencing identifies pathways and mutations important for malignant transformation caused by leukemogenic fusion genes.

PubMed

Novak, Rachel L; Harper, David P; Caudell, David; Slape, Christopher; Beachy, Sarah H; Aplan, Peter D

2012-12-01

NUP98-HOXD13 (NHD13) and CALM-AF10 (CA10) are oncogenic fusion proteins produced by recurrent chromosomal translocations in patients with acute myeloid leukemia (AML). Transgenic mice that express these fusions develop AML with a long latency and incomplete penetrance, suggesting that collaborating genetic events are required for leukemic transformation. We employed genetic techniques to identify both preleukemic abnormalities in healthy transgenic mice as well as collaborating events leading to leukemic transformation. Candidate gene resequencing revealed that 6 of 27 (22%) CA10 AMLs spontaneously acquired a Ras pathway mutation and 8 of 27 (30%) acquired an Flt3 mutation. Two CA10 AMLs acquired an Flt3 internal-tandem duplication, demonstrating that these mutations can be acquired in murine as well as human AML. Gene expression profiles revealed a marked upregulation of Hox genes, particularly Hoxa5, Hoxa9, and Hoxa10 in both NHD13 and CA10 mice. Furthermore, mir196b, which is embedded within the Hoxa locus, was overexpressed in both CA10 and NHD13 samples. In contrast, the Hox cofactors Meis1 and Pbx3 were differentially expressed; Meis1 was increased in CA10 AMLs but not NHD13 AMLs, whereas Pbx3 was consistently increased in NHD13 but not CA10 AMLs. Silencing of Pbx3 in NHD13 cells led to decreased proliferation, increased apoptosis, and decreased colony formation in vitro, suggesting a previously unexpected role for Pbx3 in leukemic transformation. Published by Elsevier Inc.

The oncogenic gene fusion TMPRSS2: ERG is not a diagnostic or prognostic marker for ovarian cancer

PubMed Central

Huang, Lillian; Schauer, Isaiah G; Zhang, Jing; Mercado-Uribe, Imelda; Deavers, Michael T; Huang, Jiaoti; Liu, Jinsong

2011-01-01

TMPRSS2:ERG is a gene fusion resulting from the chromosomal rearrangement of the androgen-regulated TMPRSS2 gene and the ETS transcription factor ERG, leading to the over-expression of the oncogenic molecule ERG. This gene rearrangement has been found in approximately half of all prostate cancers and ERG overexpression is considered as a novel diagnostic marker for prostate carcinoma. However, little is known about the role of the TMPRSS2:ERG gene fusion in ovarian cancer. The purpose of this study was to test ERG expression in ovarian cancer and its potential as a diagnostic marker for ovarian carcinoma progression. A tissue microarray containing 180 ovarian cancer tissues of various pathological types and grades were examined by immunohistochemical analysis for expression of ERG. We also used 40 prostate carcinoma tissues and 40 normal tissues for comparison in parallel experiments. ERG-positive expression was detected in 40% of the prostate tumor cancer, as well as in internal positive control endothelial cells, confirming over-expression of ERG in prostate cancer at relatively the same rate observed by others. In contrast, all of the ovarian tumor patient tissues of varying histologic types were ERG-negative, despite some positivity in endothelial cells. These results suggest that the oncogenic gene fusion TMPRSS2:ERG does not occur in ovarian cancer relative to prostate cancer. Therefore, development of ERG expression profile would not be a useful diagnostic or prognostic marker for ovarian cancer patient screening. PMID:22076164

The oncogenic gene fusion TMPRSS2: ERG is not a diagnostic or prognostic marker for ovarian cancer.

PubMed

Huang, Lillian; Schauer, Isaiah G; Zhang, Jing; Mercado-Uribe, Imelda; Deavers, Michael T; Huang, Jiaoti; Liu, Jinsong

2011-01-01

TMPRSS2:ERG is a gene fusion resulting from the chromosomal rearrangement of the androgen-regulated TMPRSS2 gene and the ETS transcription factor ERG, leading to the over-expression of the oncogenic molecule ERG. This gene rearrangement has been found in approximately half of all prostate cancers and ERG overexpression is considered as a novel diagnostic marker for prostate carcinoma. However, little is known about the role of the TMPRSS2:ERG gene fusion in ovarian cancer. The purpose of this study was to test ERG expression in ovarian cancer and its potential as a diagnostic marker for ovarian carcinoma progression. A tissue microarray containing 180 ovarian cancer tissues of various pathological types and grades were examined by immunohistochemical analysis for expression of ERG. We also used 40 prostate carcinoma tissues and 40 normal tissues for comparison in parallel experiments. ERG-positive expression was detected in 40% of the prostate tumor cancer, as well as in internal positive control endothelial cells, confirming over-expression of ERG in prostate cancer at relatively the same rate observed by others. In contrast, all of the ovarian tumor patient tissues of varying histologic types were ERG-negative, despite some positivity in endothelial cells. These results suggest that the oncogenic gene fusion TMPRSS2:ERG does not occur in ovarian cancer relative to prostate cancer. Therefore, development of ERG expression profile would not be a useful diagnostic or prognostic marker for ovarian cancer patient screening.

Protection against California 2002 NDV strain afforded by adenovirus vectored vaccine expressing Fusion or Hemagglutination-neuraminidase genes

USDA-ARS?s Scientific Manuscript database

Vectored vaccines expressing the combination of the hemagglutinin-neuraminidase (HN) and fusion (F) genes generally have better clinical protection against Newcastle disease virus (NDV) than when either the F and HN genes are expressed alone. Interestingly, the protection induced by F is usually bet...

A protein disulfide isomerase gene fusion expression system that increases the extracellular productivity of Bacillus brevis.

PubMed

Kajino, T; Ohto, C; Muramatsu, M; Obata, S; Udaka, S; Yamada, Y; Takahashi, H

2000-02-01

We have developed a versatile Bacillus brevis expression and secretion system based on the use of fungal protein disulfide isomerase (PDI) as a gene fusion partner. Fusion with PDI increased the extracellular production of heterologous proteins (light chain of immunoglobulin G, 8-fold; geranylgeranyl pyrophosphate synthase, 12-fold). Linkage to PDI prevented the aggregation of the secreted proteins, resulting in high-level accumulation of fusion proteins in soluble and biologically active forms. We also show that the disulfide isomerase activity of PDI in a fusion protein is responsible for the suppression of the aggregation of the protein with intradisulfide, whereas aggregation of the protein without intradisulfide was prevented even when the protein was fused to a mutant PDI whose two active sites were disrupted, suggesting that another PDI function, such as chaperone-like activity, synergistically prevented the aggregation of heterologous proteins in the PDI fusion expression system.

A Protein Disulfide Isomerase Gene Fusion Expression System That Increases the Extracellular Productivity of Bacillus brevis

PubMed Central

Kajino, Tsutomu; Ohto, Chikara; Muramatsu, Masayoshi; Obata, Shusei; Udaka, Shigezo; Yamada, Yukio; Takahashi, Haruo

2000-01-01

We have developed a versatile Bacillus brevis expression and secretion system based on the use of fungal protein disulfide isomerase (PDI) as a gene fusion partner. Fusion with PDI increased the extracellular production of heterologous proteins (light chain of immunoglobulin G, 8-fold; geranylgeranyl pyrophosphate synthase, 12-fold). Linkage to PDI prevented the aggregation of the secreted proteins, resulting in high-level accumulation of fusion proteins in soluble and biologically active forms. We also show that the disulfide isomerase activity of PDI in a fusion protein is responsible for the suppression of the aggregation of the protein with intradisulfide, whereas aggregation of the protein without intradisulfide was prevented even when the protein was fused to a mutant PDI whose two active sites were disrupted, suggesting that another PDI function, such as chaperone-like activity, synergistically prevented the aggregation of heterologous proteins in the PDI fusion expression system. PMID:10653729

Expanding the Molecular Signature of Ossifying Fibromyxoid Tumors with 2 Novel Gene Fusions: CREBBP-BCORL1 and KDM2A-WWTR1

PubMed Central

Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Chen, Chun-Liang; Huang, Shih-Chiang; Antonescu, Cristina R.

2017-01-01

Ossifying fibromyxoid tumor (OFMT) is an uncommon mesenchymal neoplasm of uncertain differentiation and intermediate malignant potential. Recurrent gene fusions involving either PHF1 or BCOR have been found in 85% of OFMT, including typical and malignant examples. As a subset of OFMT still lack known genetic abnormalities, we identified two OFMTs negative for PHF1 and BCOR rearrangements, which were subjected to transcriptome analysis for fusion discovery. The RNA sequencing found a novel CREBBP-BCORL1 fusion candidate in an axillary mass of a 51 year-old male and a KDM2A-WWTR1 in a thigh mass of a 36 year-old male. The gene fusions were validated by RT-PCR and FISH in the index cases and then screened by FISH on 4 additional OFMTs lacking known fusions. An identical CREBBP-BCORL1 fusion was found in an elbow tumor from a 30 year-old male. Both OFMTs with CREBBP-BCORL1 fusions had areas of typical OFMT morphology, exhibiting uniform round to epithelioid cells arranged in cords or nesting pattern in a fibromyxoid stroma. The OFMT with KDM2A-WWTR1 fusion involved dermis and superficial subcutis, being composed of ovoid cells in a fibromyxoid background with hyalinized giant rosettes. The S100 immunoreactivity ranged from very focal to absent. Similar to other known fusion genes in OFMT, BCORL1, CREBBP and KDM2A are also involved in histone modification. In summary, we expand the spectrum of molecular abnormalities in OFMT with 2 novel fusions, CREBBP-BCORL1 and KDM2A-WWTR1, further implicating the epigenetic deregulation as the leading pathogenetic mechanism in OFMT. PMID:27537276

Clinical and epidemiological study of EGFR mutations and EML4-ALK fusion genes among Indian patients with adenocarcinoma of the lung.

PubMed

Doval, Dc; Prabhash, K; Patil, S; Chaturvedi, H; Goswami, C; Vaid, Ak; Desai, S; Dutt, S; Veldore, Vh; Jambhekar, N; Mehta, A; Hazarika, D; Azam, S; Gawande, S; Gupta, S

2015-01-01

Mutation in the tyrosine kinase domain of epidermal growth factor receptor (EGFR) is a common feature observed in lung adenocarcinoma. A fusion gene between echinoderm microtubule-associated protein-like 4 (EML4) and the intracellular domain of anaplastic lymphoma kinase (ALK), named EML4-ALK, has been identified in a subset of non-small-cell lung cancer (NSCLC) tumors. The objective of this study was to determine the prevalence of EGFR mutations and EML4-ALK fusions in Indian patients with NSCLC (adenocarcinoma) as well as evaluate their clinical characteristics. Patients with NSCLC, adenocarcinoma histology, whose tumors had been tested for EGFR mutational status, were considered for this study. ALK gene rearrangement was detected by fluorescence in situ hybridization using the Vysis ALK Break Apart Rearrangement Probe Kit. ALK mutation was tested in samples that were negative for EGFR mutation. A total of 500 NSCLC adenocarcinoma patients were enrolled across six centers. There were 337 (67.4%) men and 163 (32.6%) women with a median age of 58 years. One hundred and sixty-four (32.8%) blocks were positive for EGFR mutations, whereas 336 (67.2%) were EGFR wild-type. Of the 336 EGFR-negative blocks, EML4-ALK fusion gene was present in 15 (4.5%) patients, whereas 321 (95.5%) tumors were EML4-ALK negative. The overall incidence of EML4-ALK fusion gene was 3% (15/500). The incidence of EGFR mutations (33%) in this Indian population is close to the reported incidence in Asian patients. EML4-ALK gene fusions are present in lung adenocarcinomas from Indian patients, and the 3% incidence of EML4-ALK gene fusion in EGFR mutation-negative cases is similar to what has been observed in other Western and Asian populations. The mutual exclusivity of EML4-ALK and EGFR mutations suggests implementation of biomarker testing for tumors harboring ALK rearrangements in order to identify patients that can benefit from newer targeted therapies.

The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.

PubMed Central

Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H

1988-01-01

We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795

Deep RNA sequencing analysis of readthrough gene fusions in human prostate adenocarcinoma and reference samples

PubMed Central

2011-01-01

Background Readthrough fusions across adjacent genes in the genome, or transcription-induced chimeras (TICs), have been estimated using expressed sequence tag (EST) libraries to involve 4-6% of all genes. Deep transcriptional sequencing (RNA-Seq) now makes it possible to study the occurrence and expression levels of TICs in individual samples across the genome. Methods We performed single-end RNA-Seq on three human prostate adenocarcinoma samples and their corresponding normal tissues, as well as brain and universal reference samples. We developed two bioinformatics methods to specifically identify TIC events: a targeted alignment method using artificial exon-exon junctions within 200,000 bp from adjacent genes, and genomic alignment allowing splicing within individual reads. We performed further experimental verification and characterization of selected TIC and fusion events using quantitative RT-PCR and comparative genomic hybridization microarrays. Results Targeted alignment against artificial exon-exon junctions yielded 339 distinct TIC events, including 32 gene pairs with multiple isoforms. The false discovery rate was estimated to be 1.5%. Spliced alignment to the genome was less sensitive, finding only 18% of those found by targeted alignment in 33-nt reads and 59% of those in 50-nt reads. However, spliced alignment revealed 30 cases of TICs with intervening exons, in addition to distant inversions, scrambled genes, and translocations. Our findings increase the catalog of observed TIC gene pairs by 66%. We verified 6 of 6 predicted TICs in all prostate samples, and 2 of 5 predicted novel distant gene fusions, both private events among 54 prostate tumor samples tested. Expression of TICs correlates with that of the upstream gene, which can explain the prostate-specific pattern of some TIC events and the restriction of the SLC45A3-ELK4 e4-e2 TIC to ERG-negative prostate samples, as confirmed in 20 matched prostate tumor and normal samples and 9 lung cancer

Development and evaluation of an efficient heterologous gene knock-in reporter system in Lactococcus lactis.

PubMed

Lu, Yifei; Yan, Hongxiang; Deng, Jiezhong; Huang, Zhigang; Jin, Xurui; Yu, Yanlan; Hu, Qiwen; Hu, Fuquan; Wang, Jing

2017-09-18

Lactococcus lactis is a food grade probiotics and widely used to express heterologous proteins. Generally, target genes are knocked into the L. lactis genome through double-crossover recombination to express heterologous proteins stably. However, creating marker-less heterologous genes knocked-in clones is laborious. In this study, an efficient heterologous gene knock-in reporter system was developed in L. lactis NZ9000. Our knock-in reporter system consists of a temperature-sensitive plasmid pJW and a recombinant L. lactis strain named NZB. The pJW contains homologous arms, and was constructed to knock-in heterologous genes at a fixed locus of NZ9000 genome. lacZ (β-galactosidase) gene was knocked into the chromosome of NZ9000 as a counter-selective marker through the plasmid pJW to generate NZB. The engineered NZB strain formed blue colonies on X-Gal plate. The desired double-crossover mutants formed white colonies distinctive from the predominantly blue colonies (parental and plasmid-integrated clones) when the embedded lacZ was replaced with the target heterologous genes carried by pJW in NZB. By using the system, the heterologous gene knocked-in clones are screened by colony phenotype change rather than by checking colonies individually. Our new knock-in reporter system provides an efficient method to create heterologous genes knocked-in clones.

A novel CIC-FOXO4 gene fusion in undifferentiated small round cell sarcoma: a genetically distinct variant of Ewing-like sarcoma.

PubMed

Sugita, Shintaro; Arai, Yasuhito; Tonooka, Akiko; Hama, Natsuko; Totoki, Yasushi; Fujii, Tomoki; Aoyama, Tomoyuki; Asanuma, Hiroko; Tsukahara, Tomohide; Kaya, Mitsunori; Shibata, Tatsuhiro; Hasegawa, Tadashi

2014-11-01

Differential diagnosis of small round cell sarcomas (SRCSs) grouped under the Ewing sarcoma family of tumors (ESFT) can be a challenging situation for pathologists. Recent studies have revealed that some groups of Ewing-like sarcoma show typical ESFT morphology but lack any EWSR1-ETS gene fusions. Here we identified a novel gene fusion, CIC-FOXO4, in a case of Ewing-like sarcoma with a t(X;19)(q13;q13.3) translocation. The patient was a 63-year-old man who had an asymptomatic, 30-mm, well-demarcated, intramuscular mass in his right posterior neck, and imaging findings suggested a diagnosis of high-grade sarcoma. He was treated with complete resection and subsequent radiotherapy and chemotherapy. He was alive without local recurrence or distant metastasis 6 months after the operation. Histologic examination revealed SRCS with abundant desmoplastic fibrous stroma suggesting a desmoplastic small round cell tumor. Immunohistochemical analysis showed weak to moderate and partial staining for MIC2 (CD99) and WT1, respectively. High-throughput transcriptome sequencing revealed a gene fusion, and the genomic rearrangement between the CIC and FOXO4 genes was identified by fluorescence in situ hybridization. Aside from the desmoplastic stroma, the CIC-FOXO4 fusion sarcoma showed morphologic and immunohistochemical similarity to ESFT and Ewing-like sarcomas, including the recently described CIC-DUX4 fusion sarcoma. Although clinicopathologic analysis with additional cases is necessary, we conclude that CIC-FOXO4 fusion sarcoma is a new type of Ewing-like sarcoma that has a specific genetic signature. These findings have important implications for the differential diagnosis of SRCS.

Expanding the molecular signature of ossifying fibromyxoid tumors with two novel gene fusions: CREBBP-BCORL1 and KDM2A-WWTR1.

PubMed

Kao, Yu-Chien; Sung, Yun-Shao; Zhang, Lei; Chen, Chun-Liang; Huang, Shih-Chiang; Antonescu, Cristina R

2017-01-01

Ossifying fibromyxoid tumor (OFMT) is an uncommon mesenchymal neoplasm of uncertain differentiation and intermediate malignant potential. Recurrent gene fusions involving either PHF1 or BCOR have been found in 85% of OFMT, including typical and malignant examples. As a subset of OFMT still lack known genetic abnormalities, we identified two OFMTs negative for PHF1 and BCOR rearrangements, which were subjected to transcriptome analysis for fusion discovery. The RNA sequencing found a novel CREBBP-BCORL1 fusion candidate in an axillary mass of a 51 year-old male and a KDM2A-WWTR1 in a thigh mass of a 36 year-old male. The gene fusions were validated by RT-PCR and FISH in the index cases and then screened by FISH on 4 additional OFMTs lacking known fusions. An identical CREBBP-BCORL1 fusion was found in an elbow tumor from a 30 year-old male. Both OFMTs with CREBBP-BCORL1 fusions had areas of typical OFMT morphology, exhibiting uniform round to epithelioid cells arranged in cords or nesting pattern in a fibromyxoid stroma. The OFMT with KDM2A-WWTR1 fusion involved dermis and superficial subcutis, being composed of ovoid cells in a fibromyxoid background with hyalinized giant rosettes. The S100 immunoreactivity ranged from very focal to absent. Similar to other known fusion genes in OFMT, BCORL1, CREBBP and KDM2A are also involved in histone modification. In summary, we expand the spectrum of molecular abnormalities in OFMT with 2 novel fusions, CREBBP-BCORL1 and KDM2A-WWTR1, further implicating the epigenetic deregulation as the leading pathogenetic mechanism in OFMT. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

[Construction and prokaryotic expression of recombinant gene EGFRvIII HBcAg and immunogenicity analysis of the fusion protein].

PubMed

Duan, Xiao-yi; Wang, Jian-sheng; Guo, You-min; Han, Jun-li; Wang, Quan-ying; Yang, Guang-xiao

2007-01-01

To construct recombinant prokaryotic expression plasmid pET28a(+)/c-PEP-3-c and evaluate the immunogenicity of the fusion protein. cDNA fragment encoding PEP-3 was obtained from pGEM-T Easy/PEP-3 and inserted into recombinant plasmid pGEMEX/HBcAg. Then it was subcloned in prokaryotic expression vector and transformed into E.coli BL21(DE3). The fusion protein was expressed by inducing IPTG and purified by Ni(2+)-NTA affinity chromatography. BALB/c mice were immunized with fusion protein and the antibody titre was determined by indirect ELISA. The recombinant gene was confirmed to be correct by restriction enzyme digestion and DNA sequencing. After prokaryotic expression, fusion protein existed in sediment and accounted for 56% of all bacterial lysate. The purified product accounted for 92% of all protein and its concentration was 8 g/L. The antibody titre in blood serum reached 1:16 000 after the fourth immunization and reached 1:2.56x10(5) after the sixth immunization. The titre of anti-PEP-3 antibody reached 1:1.28x10(5) and the titre of anti-HBcAg antibody was less than 1:4x10(3). Fusion gene PEP-3-HBcAg is highly expressed in E.coli BL21. The expressed fusion protein can induce neutralizing antibody with high titer and specificity, which lays a foundation for the study of genetically engineering vaccine for malignant tumors with the high expression of EGFRvIII.

An extremely rare case of small-cell lung cancer harboring variant 2 of the EML4-ALK fusion gene.

PubMed

Toyokawa, Gouji; Takenoyama, Mitsuhiro; Taguchi, Kenichi; Toyozawa, Ryo; Inamasu, Eiko; Kojo, Miyako; Shiraishi, Yoshimasa; Morodomi, Yosuke; Takenaka, Tomoyoshi; Hirai, Fumihiko; Yamaguchi, Masafumi; Seto, Takashi; Shimokawa, Mototsugu; Ichinose, Yukito

2013-09-01

Anaplastic lymphoma kinase (ALK) fuses echinoderm microtubule-associated protein-like 4 (EML4) to acquire a transforming activity in lung adenocarcinomas. However, the presence of an EML4-ALK fusion gene in other lung cancer histologies is an extremely rare phenomenon. A 43-year-old female was referred to our department due to dyspnea on effort and left back pain. Computed tomography (CT) showed a large mass in the upper lobe of the left lung and a massive left pleural effusion, while a CT-guided needle biopsy confirmed a diagnosis of small-cell lung cancer (SCLC). Surprisingly, the tumor was genetically considered to harbor the EML4-ALK fusion gene (variant 2). Although the patient underwent two regimens of cytotoxic chemotherapy for SCLC, she died approximately seven months after the administration of first-line chemotherapy. Our analysis of 30 consecutive patients with SCLC for EML4-ALK revealed that two patients, including the current patient and a patient we previously reported, harbored the EML4-ALK fusion gene. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Serum carcinoembryonic antigen levels before initial treatment are associated with EGFR mutations and EML4- ALK fusion gene in lung adenocarcinoma patients.

PubMed

Wang, Wen-Tao; Li, Yin; Ma, Jie; Chen, Xiao-Bing; Qin, Jian-Jun

2014-01-01

Epidermal growth factor receptor (EGFR) mutations and echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) define specific molecular subsets of lung adenocarcinomas with distinct clinical features. Our purpose was to analyze clinical features and prognostic value of EGFR gene mutations and the EML4-ALK fusion gene in lung adenocarcinoma. EGFR gene mutations and the EML4-ALK fusion gene were detected in 92 lung adenocarcinoma patients in China. Tumor marker levels before first treatment were measured by electrochemiluminescence immunoassay. EGFR mutations were found in 40.2% (37/92) of lung adenocarcinoma patients, being identified at high frequencies in never-smokers (48.3% vs. 26.5% in smokers; P=0.040) and in patients with abnormal serum carcinoembryonic antigen (CEA) levels before the initial treatment (58.3% vs. 28.6%, P=0.004). Multivariate analysis revealed that a higher serum CEA level before the initial treatment was independently associated with EGFR gene mutations (95%CI: 1.476~11.343, P=0.007). We also identified 8 patients who harbored the EML4-ALK fusion gene (8.7%, 8/92). In concordance with previous reports, younger age was a clinical feature for these (P=0.008). Seven of the positive cases were never smokers, and no coexistence with EGFR mutation was discovered. In addition, the frequency of the EML4-ALK fusion gene among patients with a serum CEA concentration below 5 ng/ml seemed to be higher than patients with a concentration over 5 ng/ml (P=0.021). No significant difference was observed for time to progression and overall survival between EML4-ALK-positive group and EML4-ALK-negative group or between patients with and without an EGFR mutation. The serum CEA level before the initial treatment may be helpful in screening population for EGFR mutations or EML4-ALK fusion gene presence in lung adenocarcinoma patients.

N-acetylcysteine augments adenovirus-mediated gene expression in human endothelial cells by enhancing transgene transcription and virus entry.

PubMed

Jornot, L; Morris, M A; Petersen, H; Moix, I; Rochat, T

2002-01-01

It has previously been shown that oxidants reduce the efficiency of adenoviral transduction in human umbilical vein endothelial cells (HUVECs). In this study, the effect of the antioxidant N-acetylcysteine (NAC) in adenovirus-mediated gene transfer has been investigated. HUVECs were pretreated or not with NAC, and infected with E1E3-deleted adenovirus (Ad) containing the LacZ gene expressed from the RSV-LTR promoter/enhancer in the presence and absence of NAC. Transgene expression was assessed at the protein level (histochemical staining, measurement of beta-Gal activity, and western blot), mRNA level (real-time RT-PCR) and gene level (nuclear run on) 24 h and 48 h after infection. Adenoviral DNA was quantitated by real-time PCR, and cell surface expression of Coxsackie/adenovirus receptors (CAR) was determined by FACS analysis. Pretreatment of cells with NAC prior to Ad infection enhanced beta-Gal activity by two-fold due to an increase in viral DNA, which was related to increased CAR expression. When NAC was present only during the post-infection period, a five-fold increase in beta-Gal activity and LacZ gene transcriptional activity was observed. When NAC was present during both the pretreatment and the post-infection period, beta-Gal activity was further enhanced, by 15-fold. Augmentation of beta-Gal activity was paralleled by an increase in beta-Gal protein and mRNA levels. NAC did not affect the half-life of LacZ mRNA. Pretreatment with NAC prior to Ad infection enhances virus entry, while treatment with NAC post-infection increases transgene transcription. This strategy permits the use of lower adenoviral loads and thus might be helpful for gene therapy of vascular diseases. Copyright 2001 John Wiley & Sons, Ltd.

Angioimmunoblastic T-cell lymphoma and hypereosinophilic syndrome with FIP1L1/PDGFRA fusion gene effectively treated with imatinib: A case report.

PubMed

Yamamoto, Masayo; Ikuta, Katsuya; Toki, Yasumichi; Hatayama, Mayumi; Shindo, Motohiro; Torimoto, Yoshihiro; Okumura, Toshikatsu

2017-09-01

Hypereosinophilic syndrome (HES) is a rare disorder characterized by hypereosinophilia and organ damage. Some cases of HES are caused by the FIP1L1/PDGFRA fusion gene and respond to imatinib. FIP1L1/PDGFRA-positive HES occasionally evolves into chronic eosinophilic leukemia or into another form of myeloproliferative neoplasm; however, the development of a malignant lymphoma is very rare. We present a rare case of angioimmunoblastic T-cell lymphoma (AITL) and HES with the FIP1L1/PDGFRA gene rearrangement. A man in his 30s presented to our hospital with fever, hypereosinophilia, widespread lymphadenopathy, and splenomegaly. Laboratory tests showed hypereosinophilia, increased soluble interleukin-2 receptor, and increased vitamin B12. Positron-emission tomography with F fluorodeoxyglucose (FDG) showed positive FDG uptake in multiple enlarged lymph nodes throughout the body and the red bone marrow. A bone-marrow biopsy showed hypereosinophilia without dysplasia and an increased number of blasts. The FIP1L1/PDGFRA fusion gene was positive upon fluorescence in situ hybridization (FISH) analysis of the peripheral blood. Furthermore, biopsy of a lymph node from the neck revealed restiform hyperplasia of capillary vessels, with small lymphoma cells arranged around the capillaries. Lymphoma cells were positive for CD3, CD4, and CD10, and negative for CD20. Lymphoma cells were also positive for the FIP1L1/PDGFRA fusion gene by FISH analysis. From these findings, the patient was diagnosed with HES and AITL with FIP1L1/PDGFRA. After the diagnosis, corticosteroid was administered but was ineffective. Imatinib was then administered. Imatinib was very effective for treating HES and AITL, and complete remission was achieved in both. This report presents the first case in which the FIP1L1/PDGFRA fusion gene was positive both in peripheral blood and lymph nodes, implying the possibility that the tumor cells acquired the FIP1L1/PDGFRA fusion gene in the early stage of hematopoietic

Xp11.2 translocation renal cell carcinoma with TFE3 gene fusion: A case report

PubMed Central

Pan, Xiang; Quan, Jing; Zhao, Liwen; Li, Wenhua; Wei, Benlin; Yang, Shangqi; Lai, Yongqing

2018-01-01

Xp11.2 translocation renal cell carcinoma (RCC) with transcription factor E3 (TFE3) gene fusion is a rare tumor, and the prognosis of this tumor is poorer compared with that of other subtypes of RCC. The patient presented herein was a 70-year-old man who presented with a solid mass sized ~8.2×6.1 cm in the right kidney and underwent radical right nephrectomy. Following pathological and immunohistochemical (IHC) examination and fluorescent in situ hybridization (FISH), the patient was diagnosed with Xp11.2 translocation RCC with TFE3 gene fusion. These tumors are more commonly encountered in children rather than in adults, and adult Xp11.2 translocation RCC is associated with a poorer prognosis compared with its pediatric counterpart. IHC assay and FISH are important diagnostic methods. However, there is currently no established effective treatment for Xp11.2 RCC. PMID:29399348

Xp11.2 translocation renal cell carcinoma with TFE3 gene fusion: A case report.

PubMed

Pan, Xiang; Quan, Jing; Zhao, Liwen; Li, Wenhua; Wei, Benlin; Yang, Shangqi; Lai, Yongqing

2018-01-01

Xp11.2 translocation renal cell carcinoma (RCC) with transcription factor E3 (TFE3) gene fusion is a rare tumor, and the prognosis of this tumor is poorer compared with that of other subtypes of RCC. The patient presented herein was a 70-year-old man who presented with a solid mass sized ~8.2×6.1 cm in the right kidney and underwent radical right nephrectomy. Following pathological and immunohistochemical (IHC) examination and fluorescent in situ hybridization (FISH), the patient was diagnosed with Xp11.2 translocation RCC with TFE3 gene fusion. These tumors are more commonly encountered in children rather than in adults, and adult Xp11.2 translocation RCC is associated with a poorer prognosis compared with its pediatric counterpart. IHC assay and FISH are important diagnostic methods. However, there is currently no established effective treatment for Xp11.2 RCC.

Non-small cell lung cancer patients with EML4-ALK fusion gene are insensitive to cytotoxic chemotherapy.

PubMed

Morodomi, Yosuke; Takenoyama, Mitsuhiro; Inamasu, Eiko; Toyozawa, Ryo; Kojo, Miyako; Toyokawa, Gouji; Shiraishi, Yoshimasa; Takenaka, Tomoyoshi; Hirai, Fumihiko; Yamaguchi, Masafumi; Taguchi, Kenichi; Seto, Takashi; Sugio, Kenji; Ichinose, Yukito

2014-07-01

Although patients with the echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase gene (EML4-ALK) re-arrangement and epidermal growth factor gene EGFR mutations have proven sensitive to specific inhibitors, there is currently no consensus regarding the sensitivity of non-small cell lung cancer (NSCLC) patients with such mutations to cytotoxic chemotherapy. The responses to first-line cytotoxic chemotherapy were retrospectively compared between advanced or postoperative recurrent patients with non-squamous NSCLC who harbor the EML4-ALK fusion gene (ALK+), EGFR mutation (EGFR+), or neither abnormality (wild-type). Data for 22 ALK+, 30 EGFR+, and 60 wild-type patients were analyzed. The ALK+ group had a significantly lower response rate than the other two groups. Progression-free survival was significantly shorter in the ALK+ cohort compared to the EGFR+ (p<0.001) and wild-type cohorts (p=0.0121). NSCLC patients with the EML4-ALK fusion gene might be relatively insensitivite to cytotoxic chemotherapy. Copyright© 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Gfi1-Cre knock-in mouse line: A tool for inner ear hair cell-specific gene deletion

PubMed Central

Yang, Hua; Gan, Jean; Xie, Xiaoling; Deng, Min; Feng, Liang; Chen, Xiaowei; Gao, Zhiqiang; Gan, Lin

2010-01-01

Summary Gfi1encodes a zinc-finger transcription factor essential for the development and maintenance of haematopoiesis and the inner ear. In mouse inner ear, Gfi1 expression is confined to hair cells during development and in adulthood. To construct a genetic tool for inner ear hair cell-specific gene deletion, we generated a Gfi1-Cre mouse line by knocking-in Cre coding sequences into the Gfi1 locus and inactivating the endogenous Gfi1. The specificity and efficiency of Gfi1-Cre recombinase-mediated recombination in the developing inner ear was revealed through the expression of the conditional R26R-lacZ reporter gene. The onset of lacZ expression in the Gfi1Cre/+ inner ear was first detected at E13.5 in the vestibule and at E15.5 in the cochlea, coinciding with the generation of hair cells. Throughout inner ear development, lacZ expression was detected only in hair cells. Thus, Gfi1-Cre knock-in mouse line provides a useful tool for gene manipulations specifically in inner ear hair cells. PMID:20533399

Xp11.2 translocation renal cell carcinoma with NONO-TFE3 gene fusion: morphology, prognosis, and potential pitfall in detecting TFE3 gene rearrangement.

PubMed

Xia, Qiu-Yuan; Wang, Zhe; Chen, Ni; Gan, Hua-Lei; Teng, Xiao-Dong; Shi, Shan-Shan; Wang, Xuan; Wei, Xue; Ye, Sheng-Bing; Li, Rui; Ma, Heng-Hui; Lu, Zhen-Feng; Zhou, Xiao-Jun; Rao, Qiu

2017-03-01

Xp11 translocation renal cell carcinomas are characterized by several different translocations involving the TFE3 gene. Tumors with different specific gene fusions may have different clinicopathological manifestations. Fewer than 10 renal cell carcinoma cases with NONO-TFE3 have been described. Here we examined eight additional cases of this rare tumor using clinicopathological, immunohistochemical, and molecular analyses. The male-to-female ratio of our study cohort was 1:1, and the median age was 30 years. The most distinctive feature of the tumors was that they exhibited glandular/tubular or papillary architecture that was lined with small-to-medium cuboidal to high columnar cells with indistinct cell borders and an abundantly clear or flocculent eosinophilic cytoplasm. The nuclei were oriented toward the luminal surface and were round and uniform in shape, which resulted in the appearance of secretory endometrioid subnuclear vacuolization. The distinct glandular/tubular or papillary architecture was often accompanied by sheets of epithelial cells that presented a biphasic pattern. Immunohistochemically, all eight cases demonstrated moderate (2+) or strong (3+) positive staining for TFE3, CD10, RCC marker, and PAX-8. None of the tumors were immunoreactive for CK7, Cathepsin K, Melan-A, HMB45, Ksp-cadherin, Vimentin, CA9, 34βE12 or CD117. NONO-TFE3 fusion transcripts were identified in six cases by RT-PCR. All eight cases showed equivocal split signals with a distance of nearly 2 signal diameters and sometimes had false-negative results. Furthermore, we developed a fluorescence in situ hybridization (FISH) assay to serve as an adjunct diagnostic tool for the detection of the NONO-TFE3 fusion gene and used this method to detect the fusion gene in all eight cases. Long-term follow-up (range, 10-102 months) was available for 7 patients. All 7 patients were alive with no evidence of recurrent disease or disease progression after their initial resection. This report

Recurrent NTRK1 Gene Fusions Define a Novel Subset of Locally Aggressive Lipofibromatosis-like Neural Tumors.

PubMed

Agaram, Narasimhan P; Zhang, Lei; Sung, Yun-Shao; Chen, Chun-Liang; Chung, Catherine T; Antonescu, Cristina R; Fletcher, Christopher Dm

2016-10-01

The family of pediatric fibroblastic and myofibroblastic proliferations encompasses a wide spectrum of pathologic entities with overlapping morphologies and ill-defined genetic abnormalities. Among the superficial lesions, lipofibromatosis (LPF), composed of an admixture of adipose tissue and fibroblastic elements, in the past has been variously classified as infantile fibromatosis or fibrous hamartoma of infancy. In this regard, we have encountered a group of superficial soft tissue tumors occurring in children and young adults, with a notably infiltrative growth pattern reminiscent of LPF, variable cytologic atypia, and a distinct immunoprofile of S100 protein and CD34 reactivity, suggestive of neural differentiation. SOX10 and melanocytic markers were negative in all cases tested. In contrast, a control group of classic LPF displayed bland, monomorphic histology and lacked S100 protein immunoreactivity. To define the pathogenetic abnormalities in these seemingly distinctive groups, we performed RNA sequencing for fusion gene discovery in 2 cases each, followed by screening for any novel alterations identified in a larger cohort representing both entities. The 2 index LPF-like neural tumors (LPF-NT) showed TPR-NTRK1 and TPM3-NTRK1 gene fusions, which were further validated by fluorescence in situ hybridization (FISH) and reverse transcription polymerase chain reaction. Subsequent FISH screening of 14 LPF-NT identified recurrent NTRK1 gene rearrangements in 10 (71%) cases. Of the NTRK1-negative LPF-NT cases, 1 case each showed ROS1 and ALK gene rearrangements. In contrast, none of the 25 classic LPFs showed NTRK1 gene rearrangements, although regional abnormalities were noted in the 1q21-22 region by FISH in a majority of cases. Furthermore, NTRK1 immunostaining was positive only in NTRK1-rearranged S100-positive LPF-NT but negative in classic LPF. These results suggest that NTRK1 oncogenic activation through gene fusion defines a novel and distinct subset of soft

Abh and AbrB Control of Bacillus subtilis Antimicrobial Gene Expression▿

PubMed Central

Strauch, Mark A.; Bobay, Benjamin G.; Cavanagh, John; Yao, Fude; Wilson, Angelo; Le Breton, Yoann

2007-01-01

The Bacillus subtilis abh gene encodes a protein whose N-terminal domain has 74% identity to the DNA-binding domain of the global regulatory protein AbrB. Strains with a mutation in abh showed alterations in the production of antimicrobial compounds directed against some other Bacillus species and gram-positive microbes. Relative to its wild-type parental strain, the abh mutant was found deficient, enhanced, or unaffected for the production of antimicrobial activity. Using lacZ fusions, we examined the effects of abh upon the expression of 10 promoters known to be regulated by AbrB, including five that transcribe well-characterized antimicrobial functions (SdpC, SkfA, TasA, sublancin, and subtilosin). For an otherwise wild-type background, the results show that Abh plays a negative regulatory role in the expression of four of the promoters, a positive role for the expression of three, and no apparent regulatory role in the expression of the other three promoters. Binding of AbrB and Abh to the promoter regions was examined using DNase I footprinting, and the results revealed significant differences. The transcription of abh is not autoregulated, but it is subject to a degree of AbrB-afforded negative regulation. The results indicate that Abh is part of the complex interconnected regulatory system that controls gene expression during the transition from active growth to stationary phase. PMID:17720793

The Myxococcus xanthus two-component system CorSR regulates expression of a gene cluster involved in maintaining copper tolerance during growth and development.

PubMed

Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

2013-01-01

Myxococcus xanthus is a soil-dwelling member of the δ-Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains.

TBL1XR1/TP63: a novel recurrent gene fusion in B-cell non-Hodgkin lymphoma | Office of Cancer Genomics

Cancer.gov

Recently, the landscape of single base mutations in diffuse large B-cell lymphoma (DLBCL) was described. Here we report the discovery of a gene fusion between TBL1XR1 and TP63, the only recurrent somatic novel gene fusion identified in our analysis of transcriptome data from 96 DLBCL cases. Based on this cohort and a further 157 DLBCL cases analyzed by FISH, the incidence in de novo germinal center B cell-like (GCB) DLBCL is 5% (6 of 115).

The pnk/pnl gene (ORF 86) of Autographa californica nucleopolyhedrovirus is a non-essential, immediate early gene.

PubMed

Durantel, D; Croizier, L; Ayres, M D; Croizier, G; Possee, R D; López-Ferber, M

1998-03-01

Autographa californica nucleopolyhedrovirus (AcMNPV) ORF 86, located within the HindIII C fragment, potentially encodes a protein which shares sequence similarity with two T4 bacteriophage gene products, RNA ligase and polynucleotide kinase. This AcMNPV gene has been designated pnk/pnl but has yet to be assigned a function in virus replication. It has been classified as an immediate early virus gene, since the promoter was active in uninfected insect cells and mRNA transcripts were detectable from 4 to 48 h post-infection and in the presence of cycloheximide or aphidicolin in virus-infected cells. The extremities of the transcript have been mapped by primer extension and 3' RACE-PCR to positions -18 from the translational start codon and +15 downstream of the stop codon. The function of pnk/pnl was investigated by producing a recombinant virus (Acdel86lacZ) with the coding region replaced with that of lacZ. This virus replicated normally in Spodoptera frugiperda (Sf 21) cells, indicating that pnk/pnl is not essential for propagation in these cells. Virus protein production in Acdel86lacZ-infected Sf 21 cells also appeared to be unaffected, with normal synthesis of the IE-1, GP64, VP39 and polyhedrin proteins. Shut-down of host protein synthesis was not abolished in recombinant infection. When other baculovirus genomes were examined for the presence of pnk/pnl by restriction enzyme digestion and PCR, a deletion was found in AcMNPV 1.2, Galleria mellonella NPV (GmMNPV) and Bombyx mori NPV (BmNPV), suggesting that in many isolates this gene has either never been acquired or has been lost during genome evolution. This is one of the first baculovirus immediate early genes that appears to be nonessential for virus survival.

Novel BCOR-MAML3 and ZC3H7B-BCOR Gene Fusions in Undifferentiated Small Blue Round Cell Sarcomas

PubMed Central

Specht, Katja; Zhang, Lei; Sung, Yun-Shao; Nucci, Marisa; Dry, Sarah; Vaiyapuri, Sumathi; Richter, Gunther HS; Fletcher, Christopher DM; Antonescu, Cristina R

2015-01-01

Small blue round cell tumors (SBRCTs) are a heterogenous group of tumors that are difficult to diagnose due to overlapping morphologic, immunohistochemical and clinical features. About two-thirds of EWSR1-negative SBRCTs are associated with CIC-DUX4 related fusions, while another small subset shows BCOR-CCNB3 X-chromosomal paracentric inversion. Applying paired-end RNA sequencing to an SBRCT index case of a 44 year-old male, we identified a novel BCOR-MAML3 chimeric fusion, which was validated by RT-PCR and FISH techniques. We then screened a total of 75 SBRCTs lacking EWSR1, FUS, SYT, CIC and BCOR-CCNB3 abnormalities, for BCOR break-apart probes by FISH to detect potential recurrent BCOR gene rearrangements, outside the typical X-chromosomal inversion. Indeed, 8/75 (11%) SBRCTs showed distinct BCOR gene rearrangements, with 2 cases each showing either a BCOR-MAML3 or the alternative ZC3H7B-BCOR fusion, while no fusion partner was detected in the remaining 4 cases. Gene expression of the BCOR-MAML3 positive index case showed a distinct transcriptional profile with upregulation of HOX-gene signature, compared to classic Ewing sarcoma or CIC-DUX4-positive SBRCTs. The clinicopathologic features of the SRBCTs with alternative BCOR rearrangements were also compared with a group of BCOR-CCNB3 inversion positive cases, combining 11 from our files with a meta-analysis of 42 published cases. The BCOR-CCNB3-positive tumors occurred preferentially in children and in bone, in contrast to alternative BCOR-rearranged SBRCTs which presented in young adults, with a variable anatomic distribution. Furthermore BCOR-rearranged tumors often displayed spindle cell areas, either well-defined in intersecting fascicles or blending with the round cell component, which appears distinct from most other fusion-positive SBRCTs and shares histologic overlap with poorly differentiated synovial sarcoma. PMID:26752546

[Eukaryotic expression of Leptospira interrogans lipL32/1-ompL1/1 fusion gene encoding genus-specific protein antigens and the immunoreactivity of expression products].

PubMed

Yan, Jie; Zhao, Shou-feng; Mao, Ya-fei; Ruan, Ping; Luo, Yi-hui; Li, Shu-ping; Li, Li-wei

2005-01-01

To construct the eukaryotic expression system of L.interrogans lipL32/1-ompL1/1 fusion gene and to identify the immunoreactivity of expression products. PCR with linking primer was used to construct the fusion gene lipL32/1-ompL1/1. The P.pastoris eukaryotic expression system of the fusion gene, pPIC9K-lipL32/1-ompL1/1-P. pastorisGS115, was constructed after the fusion gene was cloned and sequenced. Colony with phenotype His(+)Mut(+) was isolated by using MD and MM plates and His(+) Mut(+) transformant with high resistance to G418 was screened out by using YPD plate. Using lysate of His(+) Mut(+) colony with high copies of the target gene digested with yeast lyase as the template and 5'AOX1 and 3'AOX1 as the primers, the target fusion gene in chromosome DNA of the constructed P. pastoris engineering strain was detected by PCR. Methanol in BMMY medium was used to induce the target recombinant protein rLipL32/1-rOmpL1/1 expression. rLipL32/1-rOmpL1/1 in the medium supernatant was extracted by using ammonium sulfate precipitation and Ni-NTA affinity chromatography. Output and immunoreactivity of rLipL32/1-rOmpL1/1 were measured by SDS-PAGE and Western blot methods, respectively. Amplification fragments of the obtained fusion gene lipL32/1-ompL1/1 was 1794 bp in size. The homogeneity of nucleotide and putative amino acid sequences of the fusion gene were as high as 99.94 % and 100 %, respectively, compared with the sequences of original lipL32/1 and ompL1/1 genotypes. The constructed eukaryotic expression system was able to secrete rLipL32/1-rOmpL1/1 with an output of 10 % of the total proteins in the supernatant, which located the expected position after SDS-PAGE. The rabbit anti-rLipL32/1 and anti-rOmpL1/1 sera could combine the expressed rLipL32/1-rOmpL1/1. An eukaryotic expression system with high efficiency in P.pastoris of L.interrogans lipL32/1-ompL1/1 fusion gene was successfully constructed in this study. The expressed fusion protein shows specific

Fetal origins of the TEL-AML1 fusion gene in identical twins with leukemia

PubMed Central

Ford, Anthony M.; Bennett, Caroline A.; Price, Cathy M.; Bruin, M. C. A.; Van Wering, Elisabeth R.; Greaves, Mel

1998-01-01

The TEL (ETV6)−AML1 (CBFA2) gene fusion is the most common reciprocal chromosomal rearrangement in childhood cancer occurring in ≈25% of the most predominant subtype of leukemia— common acute lymphoblastic leukemia. The TEL-AML1 genomic sequence has been characterized in a pair of monozygotic twins diagnosed at ages 3 years, 6 months and 4 years, 10 months with common acute lymphoblastic leukemia. The twin leukemic DNA shared the same unique (or clonotypic) but nonconstitutive TEL-AML1 fusion sequence. The most plausible explanation for this finding is a single cell origin of the TEL-AML fusion in one fetus in utero, probably as a leukemia-initiating mutation, followed by intraplacental metastasis of clonal progeny to the other twin. Clonal identity is further supported by the finding that the leukemic cells in the two twins shared an identical rearranged IGH allele. These data have implications for the etiology and natural history of childhood leukemia. PMID:9539781

The occlusion-derived virus envelope protein ODV-E56 is required for optimal oral infectivity but is not essential for virus binding and fusion

USDA-ARS?s Scientific Manuscript database

The Autographa californica multiple nucleopolyhedrovirus (AcMNPV) odv-e56 gene encodes an occlusion-derived virus (ODV)-specific envelope protein, ODV-E56. To determine the role of ODV-E56 in oral infectivity, we produced recombinant EGFP-expressing AcMNPV clones (Ac69GFP-e56lacZ and AcIEGFP-e56lac...

Comparative toxic potential of market formulation of two organophosphate pesticides in transgenic Drosophila melanogaster (hsp70-lacZ).

PubMed

Gupta, S C; Siddique, H R; Saxena, D K; Chowdhuri, D Kar

2005-01-01

This study investigated the working hypothesis that two widely used organophosphate pesticides; Nuvan and Dimecron, exert toxic effects in Drosophila. Transgenic D. melanogaster (hsp70-lacZ) was used as a model for assaying stress gene expression and AchE activity as an endpoint for toxicity and also to evaluate whether stress gene expression is sufficient to protect against toxic insult of the chemicals and to prevent tissue damage. The study was extended to investigate the effect of the pesticides on the life cycle and reproduction of the organism. The study showed that Nuvan affected emergence of the exposed flies more drastically than Dimecron and the effect was lethal at the highest tested concentration (0.075 ppm). While Nuvan at 0.0075 and 0.015 ppm concentrations affected reproduction of the flies significantly, the effect of Dimecron was significant only at 0.015 and 0.075 ppm. Nuvan-exposed third-instar larvae exhibited a 1.2-fold to 1.5-fold greater hsp70 expression compared to Dimecron at concentrations ranging from 0.0075 to 0.075 ppm following 12 and 18 h exposure. While maximum expression of hsp70 was observed in Nuvan-exposed third-instar larval tissues following 18 h exposure at 0.075 ppm, Dimecron at the same dietary concentration induced a maximum expression of hsp70 following 24 h exposure. Further, concomitant with a significant induction of hsp70, significant inhibition of AchE was observed following chemical exposure and temperature shock. Concurrent with a significant decline in hsp70 expression in Nuvan-exposed larvae after 48 h at 0.075 ppm, tissue damage was evident. Dimecron-exposed larvae exhibited a plateau in hsp70 induction even after 48 h exposure and moderate tissue damage was observed in these larvae. The present study suggests that Nuvan is more cytotoxic than Dimecron in transgenic Drosophila melanogaster.

[Detection of bcr/abl fusion gene and its derivative chromosome 9 deletions in CML by using home-made bcr/abl extra-signal probe].

PubMed

Lai, Yue-Yun; Feng, Lin; Wang, Zheng; Lü, Shan; Dang, Hui; Shi, Yan; He, Qi; Huang, Xiao-Jun

2010-02-01

This study was aimed to verify the efficacy of home-made LSI bcr/abl ES probe for detection of bcr/abl fusion gene and derivative chromosome 9 deletions in chronic myeloid leukemia (CML). Fluorescence in situ hybridization (FISH) was carried out with dual color bcr/abl extra signal (ES) probe in 97 cases of CML based on morphology and cytogenetic karyotype and 129 cases of non-hematological malignancies/non-myeloproliferative diseases with normal cytogenetic karyotype. For the patients with signals of 1R1G1F indicating der(9) deletions, FISH were done using ASS DNA probe. The results showed that 91 cases with standard t(9;22) and 6 cases with variant translocation of t(9;22) were detected by conventional G banding technique. All of the 97 patients displayed bcr/abl fusion gene by ES-FISH, including 16 cases with signal patterns of 1R1G1F showing der(9) deletions. Among the 16 cases with der(9) deletions, 13 cases were detected to have deletions of ASS gene. Meanwhile, none of the 129 cases of negative control showed bcr/abl fusion gene by ES-FISH. It is concluded that home-made LSI bcr/abl ES probe is effective to identify the bcr/abl fusion gene and der(9) deletions in CML, and the ES-FISH results are consistent with conventional cytogenetic karyotype.

[The Influence of New Medium with RGD on Cell Growth,Cell Fusion and Expression of Exogenous Gene].

PubMed

Wang, Pei-Pei; Wei, Da-Peng; Zhu, Tong-Bo

2018-03-01

To investigate the influence of a new culture medium added with RGD on cell growth,cell fusion and expression of exogenous gene. A new medium was prepared by adding different concentrations of RGD to ordinary culture medium. The optimum concentration of RGD was determined by observation of the growth of human pancreatic epithelial cell line HPDE6-C7. After determining the optimum concentration of RGD,different concentrations of cells HPDE6-C7 (5×10 4 ,10 5 ,5×10 5 mL －1 ) were inoculated in the two mediums. The morphology,adherence,growth and density of the cells were observed by inverted microscope; The ratio of clone formation and the positive rate of cloning were compared between the two cultures after fusion; The fluorescence intensity after the transfection of plasmid with green fluorescent protein ( GFP ) and the protein expression after transfection of plasmid with KRAS were observed to campare the expression of exogenous genes between the new medium with ordinary medium. Firstly,the optimal concentration of RGD was 10 ng/mL. Compared with the normal medium,the cultured cells with RGD had better morphology,adhesion and faster proliferation. In addition,both of the number and positive rate of clones formed in the new medium were significantly higher than that in the ordinary medium ( P <0.05);The fluorescence intensity after transfection of exogenous gene GFP in the new medium was significantly higher than that in normal medium ( P <0.05); Expression level of exogenous gene KRAS of the new medium was also significantly higher than that in normal medium. The new culture medium has highlighted advantages in cell growth,cell fusion and expression of exogenous genes. RGD peptide has widely prospect and potential value in the cell culture. Copyright© by Editorial Board of Journal of Sichuan University (Medical Science Edition).

Renilla luciferase- Aequorea GFP (Ruc-GFP) fusion protein, a novel dual reporter for real-time imaging of gene expression in cell cultures and in live animals.

PubMed

Wang, Y; Yu, Y A; Shabahang, S; Wang, G; Szalay, A A

2002-10-01

Light-emitting reporter proteins play an increasing role in the study of gene expression in vitro and in vivo. Here we present a ruc-gfp fusion gene construct generated by fusing a cDNA for Renilla luciferase (ruc) in-frame with a cDNA encoding the "humanized" GFP (gfp) from Aequorea. A plasmid containing the fusion gene construct was successfully transformed into, and expressed in, mammalian cells. The transformed cells exhibited both Renilla luciferase activity in the presence of coelenterazine and GFP fluorescence upon excitation with UV light. Spectrofluorometry of cells containing the Ruc-GFP fusion protein, in the absence of wavelengths capable of exciting GFP fluorescence but in the presence of the luciferase substrate, coelenterazine, showed an emission spectrum with two peaks at 475 nm and 508 nm. These two peaks correspond to the emission maximum of Renilla luciferase at 475 nm and that of GFP at 508 nm. The peak at 508 nm generated in the presence of coelenterazine alone (without UV excitation) is the result of intramolecular energy transfer from Renilla luciferase to Aequorea GFP. Southern analysis of genomic DNA purified from transformed Chinese hamster ovary (CHO) cells and fluorescence in situ hybridization (FISH) to metaphase chromosomes confirmed the integration of the ruc-gfp fusion gene on a single chromosome. The bifunctional Ruc-GFP fusion protein allows the detection of gene expression at the single-cell level based on green fluorescence, and in a group of cells based on luminescence emission. Furthermore, animal experiments revealed that light emission from the Ruc-GFP fusion protein can be detected externally in the organs or tissues of live animals bearing the gene construct.

A Bacillus subtilis Gene Induced by Cold Shock Encodes a Membrane Phospholipid Desaturase

PubMed Central

Aguilar, Pablo S.; Cronan, John E.; de Mendoza, Diego

1998-01-01

Bacillus subtilis grown at 37°C synthesizes saturated fatty acids with only traces of unsaturated fatty acids (UFAs). However, when cultures growing at 37°C are transferred to 20°C, UFA synthesis is induced. We report the identification and characterization of the gene encoding the fatty acid desaturase of B. subtilis. This gene, called des, was isolated by complementation of Escherichia coli strains with mutations in either of two different genes of UFA synthesis. The des gene encodes a polypeptide of 352 amino acid residues containing the three conserved histidine cluster motifs and two putative membrane-spanning domains characteristic of the membrane-bound desaturases of plants and cyanobacteria. Expression of the des gene in E. coli resulted in desaturation of palmitic acid moieties of the membrane phospholipids to give the novel mono-UFA cis-5-hexadecenoic acid, indicating that the B. subtilis des gene product is a Δ5 acyl-lipid desaturase. The des gene was disrupted, and the resulting null mutant strains were unable to synthesize UFAs upon a shift to low growth temperatures. The des null mutant strain grew as well as its congenic parent at 20 or 37°C but showed severely reduced survival during stationary phase. Analysis of operon fusions in which the des promoter directed the synthesis of a lacZ reporter gene showed that des expression is repressed at 37°C, but a shift of cultures from 37 to 20°C resulted in a 10- to 15-fold increase in transcription. This is the first report of a membrane phospholipid desaturase in a nonphotosynthetic organism and the first direct evidence for cold induction of a desaturase. PMID:9555904

Classical non-homologous end-joining pathway utilizes nascent RNA for error-free double-strand break repair of transcribed genes

PubMed Central

Chakraborty, Anirban; Tapryal, Nisha; Venkova, Tatiana; Horikoshi, Nobuo; Pandita, Raj K.; Sarker, Altaf H.; Sarkar, Partha S.; Pandita, Tej K.; Hazra, Tapas K.

2016-01-01

DNA double-strand breaks (DSBs) leading to loss of nucleotides in the transcribed region can be lethal. Classical non-homologous end-joining (C-NHEJ) is the dominant pathway for DSB repair (DSBR) in adult mammalian cells. Here we report that during such DSBR, mammalian C-NHEJ proteins form a multiprotein complex with RNA polymerase II and preferentially associate with the transcribed genes after DSB induction. Depletion of C-NHEJ factors significantly abrogates DSBR in transcribed but not in non-transcribed genes. We hypothesized that nascent RNA can serve as a template for restoring the missing sequences, thus allowing error-free DSBR. We indeed found pre-mRNA in the C-NHEJ complex. Finally, when a DSB-containing plasmid with several nucleotides deleted within the E. coli lacZ gene was allowed time to repair in lacZ-expressing mammalian cells, a functional lacZ plasmid could be recovered from control but not C-NHEJ factor-depleted cells, providing important mechanistic insights into C-NHEJ-mediated error-free DSBR of the transcribed genome. PMID:27703167

Novel kinase fusion transcripts found in endometrial cancer

PubMed Central

Tamura, Ryo; Yoshihara, Kosuke; Yamawaki, Kaoru; Suda, Kazuaki; Ishiguro, Tatsuya; Adachi, Sosuke; Okuda, Shujiro; Inoue, Ituro; Verhaak, Roel G. W.; Enomoto, Takayuki

2015-01-01

Recent advances in RNA-sequencing technology have enabled the discovery of gene fusion transcripts in the transcriptome of cancer cells. However, it remains difficult to differentiate the therapeutically targetable fusions from passenger events. We have analyzed RNA-sequencing data and DNA copy number data from 25 endometrial cancer cell lines to identify potential therapeutically targetable fusion transcripts, and have identified 124 high-confidence fusion transcripts, of which 69% are associated with gene amplifications. As targetable fusion candidates, we focused on three in-frame kinase fusion transcripts that retain a kinase domain (CPQ-PRKDC, CAPZA2-MET, and VGLL4-PRKG1). We detected only CPQ-PRKDC fusion transcript in three of 122 primary endometrial cancer tissues. Cell proliferation of the fusion-positive cell line was inhibited by knocking down the expression of wild-type PRKDC but not by blocking the CPQ-PRKDC fusion transcript expression. Quantitative real-time RT-PCR demonstrated that the expression of the CPQ-PRKDC fusion transcript was significantly lower than that of wild-type PRKDC, corresponding to a low transcript allele fraction of this fusion, based on RNA-sequencing read counts. In endometrial cancers, the CPQ-PRKDC fusion transcript may be a passenger aberration related to gene amplification. Our findings suggest that transcript allele fraction is a useful predictor to find bona-fide therapeutic-targetable fusion transcripts. PMID:26689674

Novel kinase fusion transcripts found in endometrial cancer.

PubMed

Tamura, Ryo; Yoshihara, Kosuke; Yamawaki, Kaoru; Suda, Kazuaki; Ishiguro, Tatsuya; Adachi, Sosuke; Okuda, Shujiro; Inoue, Ituro; Verhaak, Roel G W; Enomoto, Takayuki

2015-12-22

Recent advances in RNA-sequencing technology have enabled the discovery of gene fusion transcripts in the transcriptome of cancer cells. However, it remains difficult to differentiate the therapeutically targetable fusions from passenger events. We have analyzed RNA-sequencing data and DNA copy number data from 25 endometrial cancer cell lines to identify potential therapeutically targetable fusion transcripts, and have identified 124 high-confidence fusion transcripts, of which 69% are associated with gene amplifications. As targetable fusion candidates, we focused on three in-frame kinase fusion transcripts that retain a kinase domain (CPQ-PRKDC, CAPZA2-MET, and VGLL4-PRKG1). We detected only CPQ-PRKDC fusion transcript in three of 122 primary endometrial cancer tissues. Cell proliferation of the fusion-positive cell line was inhibited by knocking down the expression of wild-type PRKDC but not by blocking the CPQ-PRKDC fusion transcript expression. Quantitative real-time RT-PCR demonstrated that the expression of the CPQ-PRKDC fusion transcript was significantly lower than that of wild-type PRKDC, corresponding to a low transcript allele fraction of this fusion, based on RNA-sequencing read counts. In endometrial cancers, the CPQ-PRKDC fusion transcript may be a passenger aberration related to gene amplification. Our findings suggest that transcript allele fraction is a useful predictor to find bona-fide therapeutic-targetable fusion transcripts.

Preemptive heme oxygenase-1 gene delivery reveals reduced mortality and preservation of left ventricular function 1 yr after acute myocardial infarction.

PubMed

Liu, Xiaoli; Simpson, Jeremy A; Brunt, Keith R; Ward, Christopher A; Hall, Sean R R; Kinobe, Robert T; Barrette, Valerie; Tse, M Yat; Pang, Stephen C; Pachori, Alok S; Dzau, Victor J; Ogunyankin, Kofo O; Melo, Luis G

2007-07-01

We reported previously that predelivery of heme oxygenase-1 (HO-1) gene to the heart by adeno-associated virus-2 (AAV-2) markedly reduces ischemia and reperfusion (I/R)-induced myocardial injury. However, the effect of preemptive HO-1 gene delivery on long-term survival and prevention of postinfarction heart failure has not been determined. We assessed the effect of HO-1 gene delivery on long-term survival, myocardial function, and left ventricular (LV) remodeling 1 yr after myocardial infarction (MI) using echocardiographic imaging, pressure-volume (PV) analysis, and histomorphometric approaches. Two groups of Lewis rats were injected with 2 x 10(11) particles of AAV-LacZ (control) or AAV-human HO-1 (hHO-1) in the anterior-posterior apical region of the LV wall. Six weeks after gene transfer, animals were subjected to 30 min of ischemia by ligation of the left anterior descending artery followed by reperfusion. Echocardiographic measurements and PV analysis of LV function were obtained at 2 wk and 12 mo after I/R. One year after acute MI, mortality was markedly reduced in the HO-1-treated animals compared with the LacZ-treated animals. PV analysis demonstrated significantly enhanced LV developed pressure, elevated maximal dP/dt, and lower end-diastolic volume in the HO-1 animals compared with the LacZ animals. Echocardiography showed a larger apical anterior-to-posterior wall ratio in HO-1 animals compared with LacZ animals. Morphometric analysis revealed extensive myocardial scarring and fibrosis in the infarcted LV area of LacZ animals, which was reduced by 62% in HO-1 animals. These results suggest that preemptive HO-1 gene delivery may be useful as a therapeutic strategy to reduce post-MI LV remodeling and heart failure.

Identification of target genes of synovial sarcoma-associated fusion oncoprotein using human pluripotent stem cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hayakawa, Kazuo; Department of Cell Growth and Differentiation, Center for iPS Cell Research and Application, Kyoto University, Kyoto; Department of Orthopaedic Surgery, Graduate School of Medical Sciences, Nagoya City University, Nagoya

2013-03-22

Highlights: ► We tried to identify targets of synovial sarcoma (SS)-associated SYT–SSX fusion gene. ► We established pluripotent stem cell (PSC) lines with inducible SYT–SSX gene. ► SYT–SSX responsive genes were identified by the induction of SYT–SSX in PSC. ► SS-related genes were selected from database by in silico analyses. ► 51 genes were finally identified among SS-related genes as targets of SYT–SSX in PSC. -- Abstract: Synovial sarcoma (SS) is a malignant soft tissue tumor harboring chromosomal translocation t(X; 18)(p11.2; q11.2), which produces SS-specific fusion gene, SYT–SSX. Although precise function of SYT–SSX remains to be investigated, accumulating evidences suggestmore » its role in gene regulation via epigenetic mechanisms, and the product of SYT–SSX target genes may serve as biomarkers of SS. Lack of knowledge about the cell-of-origin of SS, however, has placed obstacle in the way of target identification. Here we report a novel approach to identify SYT–SSX2 target genes using human pluripotent stem cells (hPSCs) containing a doxycycline-inducible SYT–SSX2 gene. SYT–SSX2 was efficiently induced both at mRNA and protein levels within three hours after doxycycline administration, while no morphological change of hPSCs was observed until 24 h. Serial microarray analyses identified genes of which the expression level changed more than twofold within 24 h. Surprisingly, the majority (297/312, 95.2%) were up-regulated genes and a result inconsistent with the current concept of SYT–SSX as a transcriptional repressor. Comparing these genes with SS-related genes which were selected by a series of in silico analyses, 49 and 2 genes were finally identified as candidates of up- and down-regulated target of SYT–SSX, respectively. Association of these genes with SYT–SSX in SS cells was confirmed by knockdown experiments. Expression profiles of SS-related genes in hPSCs and human mesenchymal stem cells (hMSCs) were

Vibrio parahaemolyticus CalR down regulates the thermostable direct hemolysin (TDH) gene transcription and thereby inhibits hemolytic activity.

PubMed

Zhang, Yiquan; Zhang, Ying; Gao, He; Zhang, Lingyu; Yin, Zhe; Huang, Xinxiang; Zhou, Dongsheng; Yang, Huiying; Yang, Wenhui; Wang, Li

2017-05-20

TDH, encoded by tdh gene, is a major virulent determinant of V. parahaemolyticus that controls various biological activities, such as hemolytic activity, cytotoxicity, and enterotoxicity. The hemolytic activity on Wagatsuma agar ascribed to TDH is called Kanagawa phenomenon (KP). All KP positive strains contain tdh1 and tdh2 genes, but tdh2 is predominantly responsible for KP. CalR is a regulatory protein that was originally identified as a repressor of swarming motility and T3SS1 gene expression in V. parahaemolyticus. In the present study, the regulation of tdh2 by CalR was investigated using a set of experiments including qRT-PCR, primer extension, LacZ fusion, hemolytic phenotype, EMSA, and DNase I footprinting assays. The results showed that His-CalR protected a single region from 224bp to 318bp upstream of tdh2 against DNase I digestion, and a transcriptional start site located at 42bp upstream of tdh2 was detected and its transcribed activity was inhibited by CalR. Moreover, the KP test results showed that the hemolytic activity of V. parahaemolyticus is also under negative control of CalR. The data demonstrated that CalR is a repressor of the tdh2 transcription and thereby inhibits the hemolytic activity of V. parahaemolyticus. Copyright © 2017. Published by Elsevier B.V.

Superficial EWSR1-negative undifferentiated small round cell sarcoma with CIC/DUX4 gene fusion: a new variant of Ewing-like tumors with locoregional lymph node metastasis.

PubMed

Machado, Isidro; Cruz, Julia; Lavernia, Javier; Rubio, Luis; Campos, Jorge; Barrios, María; Grison, Camille; Chene, Virginie; Pierron, Gaelle; Delattre, Olivier; Llombart-Bosch, Antonio

2013-12-01

The present study describes a new case of EWSR1-negative undifferentiated sarcoma with CIC/DUX4 gene fusion. This case is similar to tumors described as primitive undifferentiated round cell sarcomas that occur mainly in the trunk and display an aggressive behavior. To our knowledge, this is the first report of such a tumor presenting locoregional lymph node metastasis. In view of previous studies that prove the existence of a particular variant of undifferentiated sarcoma with Ewing-like morphology and CIC/DUX-4 gene fusion, a search for this gene fusion in all undifferentiated round cell sarcomas should be considered if a conclusive diagnosis cannot be reached following other conventional studies. Although additional cases with more extensive follow-up studies are needed, we believe that EWSR1-negative undifferentiated small round cell sarcoma with CIC/DUX4 gene fusion should be added to the list of new sarcoma variants with the possibility of lymph node metastasis.

Repression of choline kinase by inositol and choline in Saccharomyces cerevisiae.

PubMed Central

Hosaka, K; Murakami, T; Kodaki, T; Nikawa, J; Yamashita, S

1990-01-01

The regulation of choline kinase (EC 2.7.1.32), the initial enzyme in the CDP-choline pathway, was examined in Saccharomyces cerevisiae. The addition of myo-inositol to a culture of wild-type cells resulted in a significant decrease in choline kinase activity. Additional supplementation of choline caused a further reduction in the activity. The coding frame of the choline kinase gene, CK1, was joined to the carboxyl terminus of lacZ and expressed in Escherichia coli as a fusion protein, which was then used to prepare an anti-choline kinase antibody. Upon Western (immuno-) and Northern (RNA) blot analyses using the antibody and a CK1 probe, respectively, the decrease in the enzyme activity was found to be correlated with decreases in the enzyme amount and mRNA abundance. The molecular mass of the enzyme was estimated to be 66 kilodaltons, in agreement with the value predicted previously from the nucleotide sequence of the gene. The coding region of CK1 was replaced with that of lacZ, and CK1 expression was measured by assaying beta-galactosidase. The expression of beta-galactosidase from this fusion was repressed by myo-inositol and choline and derepressed in a time-dependent manner upon their removal. The present findings indicate that yeast choline kinase is regulated by myo-inositol and choline at the level of mRNA abundance. Images FIG. 3 FIG. 4 PMID:2156807

Decoding of exon splicing patterns in the human RUNX1-RUNX1T1 fusion gene.

PubMed

Grinev, Vasily V; Migas, Alexandr A; Kirsanava, Aksana D; Mishkova, Olga A; Siomava, Natalia; Ramanouskaya, Tatiana V; Vaitsiankova, Alina V; Ilyushonak, Ilia M; Nazarov, Petr V; Vallar, Laurent; Aleinikova, Olga V

2015-11-01

The t(8;21) translocation is the most widespread genetic defect found in human acute myeloid leukemia. This translocation results in the RUNX1-RUNX1T1 fusion gene that produces a wide variety of alternative transcripts and influences the course of the disease. The rules of combinatorics and splicing of exons in the RUNX1-RUNX1T1 transcripts are not known. To address this issue, we developed an exon graph model of the fusion gene organization and evaluated its local exon combinatorics by the exon combinatorial index (ECI). Here we show that the local exon combinatorics of the RUNX1-RUNX1T1 gene follows a power-law behavior and (i) the vast majority of exons has a low ECI, (ii) only a small part is represented by "exons-hubs" of splicing with very high ECI values, and (iii) it is scale-free and very sensitive to targeted skipping of "exons-hubs". Stochasticity of the splicing machinery and preferred usage of exons in alternative splicing can explain such behavior of the system. Stochasticity may explain up to 12% of the ECI variance and results in a number of non-coding and unproductive transcripts that can be considered as a noise. Half-life of these transcripts is increased due to the deregulation of some key genes of the nonsense-mediated decay system in leukemia cells. On the other hand, preferred usage of exons may explain up to 75% of the ECI variability. Our analysis revealed a set of splicing-related cis-regulatory motifs that can explain "attractiveness" of exons in alternative splicing but only when they are considered together. Cis-regulatory motifs are guides for splicing trans-factors and we observed a leukemia-specific profile of expression of the splicing genes in t(8;21)-positive blasts. Altogether, our results show that alternative splicing of the RUNX1-RUNX1T1 transcripts follows strict rules and that the power-law component of the fusion gene organization confers a high flexibility to this process. Copyright © 2015 Elsevier Ltd. All rights

CRISPR/Cas9 Engineering of Adult Mouse Liver Demonstrates That the Dnajb1-Prkaca Gene Fusion Is Sufficient to Induce Tumors Resembling Fibrolamellar Hepatocellular Carcinoma.

PubMed

Engelholm, Lars H; Riaz, Anjum; Serra, Denise; Dagnæs-Hansen, Frederik; Johansen, Jens V; Santoni-Rugiu, Eric; Hansen, Steen H; Niola, Francesco; Frödin, Morten

2017-12-01

Fibrolamellar hepatocellular carcinoma (FL-HCC) is a primary liver cancer that predominantly affects children and young adults with no underlying liver disease. A somatic, 400 Kb deletion on chromosome 19 that fuses part of the DnaJ heat shock protein family (Hsp40) member B1 gene (DNAJB1) to the protein kinase cAMP-activated catalytic subunit alpha gene (PRKACA) has been repeatedly identified in patients with FL-HCC. However, the DNAJB1-PRKACA gene fusion has not been shown to induce liver tumorigenesis. We used the CRISPR/Cas9 technique to delete in mice the syntenic region on chromosome 8 to create a Dnajb1-Prkaca fusion and monitored the mice for liver tumor development. We delivered CRISPR/Cas9 vectors designed to juxtapose exon 1 of Dnajb1 with exon 2 of Prkaca to create the Dnajb1-Prkaca gene fusion associated with FL-HCC, or control Cas9 vector, via hydrodynamic tail vein injection to livers of 8-week-old female FVB/N mice. These mice did not have any other engineered genetic alterations and were not exposed to liver toxins or carcinogens. Liver tissues were collected 14 months after delivery; genomic DNA was analyzed by PCR to detect the Dnajb1-Prkaca fusion, and tissues were characterized by histology, immunohistochemistry, RNA sequencing, and whole-exome sequencing. Livers from 12 of the 15 mice given the vectors to induce the Dnajb1-Prkaca gene fusion, but none of the 11 mice given the control vector, developed neoplasms. The tumors contained the Dnajb1-Prkaca gene fusion and had histologic and cytologic features of human FL-HCCs: large polygonal cells with granular, eosinophilic, and mitochondria-rich cytoplasm, prominent nucleoli, and markers of hepatocytes and cholangiocytes. In comparing expression levels of genes between the mouse tumor and non-tumor liver cells, we identified changes similar to those detected in human FL-HCC, which included genes that affect cell cycle and mitosis regulation. Genomic analysis of mouse neoplasms induced by

Combining Random Gene Fission and Rational Gene Fusion To Discover Near-Infrared Fluorescent Protein Fragments That Report on Protein–Protein Interactions

PubMed Central

2015-01-01

Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein–protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein–protein interactions within whole animals. PMID:25265085

Combining random gene fission and rational gene fusion to discover near-infrared fluorescent protein fragments that report on protein-protein interactions.

PubMed

Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J

2015-05-15

Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.

Recurrent R-spondin fusions in colon cancer.

PubMed

Seshagiri, Somasekar; Stawiski, Eric W; Durinck, Steffen; Modrusan, Zora; Storm, Elaine E; Conboy, Caitlin B; Chaudhuri, Subhra; Guan, Yinghui; Janakiraman, Vasantharajan; Jaiswal, Bijay S; Guillory, Joseph; Ha, Connie; Dijkgraaf, Gerrit J P; Stinson, Jeremy; Gnad, Florian; Huntley, Melanie A; Degenhardt, Jeremiah D; Haverty, Peter M; Bourgon, Richard; Wang, Weiru; Koeppen, Hartmut; Gentleman, Robert; Starr, Timothy K; Zhang, Zemin; Largaespada, David A; Wu, Thomas D; de Sauvage, Frederic J

2012-08-30

Identifying and understanding changes in cancer genomes is essential for the development of targeted therapeutics. Here we analyse systematically more than 70 pairs of primary human colon tumours by applying next-generation sequencing to characterize their exomes, transcriptomes and copy-number alterations. We have identified 36,303 protein-altering somatic changes that include several new recurrent mutations in the Wnt pathway gene TCF7L2, chromatin-remodelling genes such as TET2 and TET3 and receptor tyrosine kinases including ERBB3. Our analysis for significantly mutated cancer genes identified 23 candidates, including the cell cycle checkpoint kinase ATM. Copy-number and RNA-seq data analysis identified amplifications and corresponding overexpression of IGF2 in a subset of colon tumours. Furthermore, using RNA-seq data we identified multiple fusion transcripts including recurrent gene fusions involving R-spondin family members RSPO2 and RSPO3 that together occur in 10% of colon tumours. The RSPO fusions were mutually exclusive with APC mutations, indicating that they probably have a role in the activation of Wnt signalling and tumorigenesis. Consistent with this we show that the RSPO fusion proteins were capable of potentiating Wnt signalling. The R-spondin gene fusions and several other gene mutations identified in this study provide new potential opportunities for therapeutic intervention in colon cancer.

Recurrent R-spondin fusions in colon cancer

PubMed Central

Seshagiri, Somasekar; Stawiski, Eric W.; Durinck, Steffen; Modrusan, Zora; Storm, Elaine E.; Conboy, Caitlin B.; Chaudhuri, Subhra; Guan, Yinghui; Janakiraman, Vasantharajan; Jaiswal, Bijay S.; Guillory, Joseph; Ha, Connie; Dijkgraaf, Gerrit J. P.; Stinson, Jeremy; Gnad, Florian; Huntley, Melanie A.; Degenhardt, Jeremiah D.; Haverty, Peter M.; Bourgon, Richard; Wang, Weiru; Koeppen, Hartmut; Gentleman, Robert; Starr, Timothy K.; Zhang, Zemin; Largaespada, David A.; Wu, Thomas D.; de Sauvage, Frederic J

2013-01-01

Identifying and understanding changes in cancer genomes is essential for the development of targeted therapeutics1. Here we analyse systematically more than 70 pairs of primary human colon tumours by applying next-generation sequencing to characterize their exomes, transcriptomes and copy-number alterations. We have identified 36,303 protein-altering somatic changes that include several new recurrent mutations in the Wnt pathway gene TCF7L2, chromatin-remodelling genes such as TET2 and TET3 and receptor tyrosine kinases including ERBB3. Our analysis for significantly mutated cancer genes identified 23 candidates, including the cell cycle checkpoint kinase ATM. Copy-number and RNA-seq data analysis identified amplifications and corresponding overexpression of IGF2 in a subset of colon tumours. Furthermore, using RNA-seq data we identified multiple fusion transcripts including recurrent gene fusions involving R-spondin family members RSPO2 and RSPO3 that together occur in 10% of colon tumours. The RSPO fusions were mutually exclusive with APC mutations, indicating that they probably have a role in the activation of Wnt signalling and tumorigenesis. Consistent with this we show that the RSPO fusion proteins were capable of potentiating Wnt signalling. The R-spondin gene fusions and several other gene mutations identified in this study provide new potential opportunities for therapeutic intervention in colon cancer. PMID:22895193

CDKN2D-WDFY2 is a cancer-specific fusion gene recurrent in high-grade serous ovarian carcinoma.

PubMed

Kannan, Kalpana; Coarfa, Cristian; Rajapakshe, Kimal; Hawkins, Shannon M; Matzuk, Martin M; Milosavljevic, Aleksandar; Yen, Laising

2014-03-01

Ovarian cancer is the fifth leading cause of cancer death in women. Almost 70% of ovarian cancer deaths are due to the high-grade serous subtype, which is typically detected only after it has metastasized. Characterization of high-grade serous cancer is further complicated by the significant heterogeneity and genome instability displayed by this cancer. Other than mutations in TP53, which is common to many cancers, highly recurrent recombinant events specific to this cancer have yet to be identified. Using high-throughput transcriptome sequencing of seven patient samples combined with experimental validation at DNA, RNA and protein levels, we identified a cancer-specific and inter-chromosomal fusion gene CDKN2D-WDFY2 that occurs at a frequency of 20% among sixty high-grade serous cancer samples but is absent in non-cancerous ovary and fallopian tube samples. This is the most frequent recombinant event identified so far in high-grade serous cancer implying a major cellular lineage in this highly heterogeneous cancer. In addition, the same fusion transcript was also detected in OV-90, an established high-grade serous type cell line. The genomic breakpoint was identified in intron 1 of CDKN2D and intron 2 of WDFY2 in patient tumor, providing direct evidence that this is a fusion gene. The parental gene, CDKN2D, is a cell-cycle modulator that is also involved in DNA repair, while WDFY2 is known to modulate AKT interactions with its substrates. Transfection of cloned fusion construct led to loss of wildtype CDKN2D and wildtype WDFY2 protein expression, and a gain of a short WDFY2 protein isoform that is presumably under the control of the CDKN2D promoter. The expression of short WDFY2 protein in transfected cells appears to alter the PI3K/AKT pathway that is known to play a role in oncogenesis. CDKN2D-WDFY2 fusion could be an important molecular signature for understanding and classifying sub-lineages among heterogeneous high-grade serous ovarian carcinomas.

Novel BCOR-MAML3 and ZC3H7B-BCOR Gene Fusions in Undifferentiated Small Blue Round Cell Sarcomas.

PubMed

Specht, Katja; Zhang, Lei; Sung, Yun-Shao; Nucci, Marisa; Dry, Sarah; Vaiyapuri, Sumathi; Richter, Gunther H S; Fletcher, Christopher D M; Antonescu, Cristina R

2016-04-01

Small blue round cell tumors (SBRCTs) are a heterogenous group of tumors that are difficult to diagnose because of overlapping morphologic, immunohistochemical, and clinical features. About two-thirds of EWSR1-negative SBRCTs are associated with CIC-DUX4-related fusions, whereas another small subset shows BCOR-CCNB3 X-chromosomal paracentric inversion. Applying paired-end RNA sequencing to an SBRCT index case of a 44-year-old man, we identified a novel BCOR-MAML3 chimeric fusion, which was validated by reverse transcription polymerase chain reaction and fluorescence in situ hybridization techniques. We then screened a total of 75 SBRCTs lacking EWSR1, FUS, SYT, CIC, and BCOR-CCNB3 abnormalities for BCOR break-apart probes by fluorescence in situ hybridization to detect potential recurrent BCOR gene rearrangements outside the typical X-chromosomal inversion. Indeed, 8/75 (11%) SBRCTs showed distinct BCOR gene rearrangements, with 2 cases each showing either a BCOR-MAML3 or the alternative ZC3H7B-BCOR fusion, whereas no fusion partner was detected in the remaining 4 cases. Gene expression of the BCOR-MAML3-positive index case showed a distinct transcriptional profile with upregulation of HOX-gene signature, compared with classic Ewing's sarcoma or CIC-DUX4-positive SBRCTs. The clinicopathologic features of the SBRCTs with alternative BCOR rearrangements were also compared with a group of BCOR-CCNB3 inversion-positive cases, combining 11 from our files with a meta-analysis of 42 published cases. The BCOR-CCNB3-positive tumors occurred preferentially in children and in bone, in contrast to alternative BCOR-rearranged SBRCTs, which presented in young adults, with a variable anatomic distribution. Furthermore, BCOR-rearranged tumors often displayed spindle cell areas, either well defined in intersecting fascicles or blending with the round cell component, which appears distinct from most other fusion-positive SBRCTs and shares histologic overlap with poorly

[Construction and expression of HSV-2gD-Hsp70 fusion protein gene].

PubMed

Fan, Jian-Yong; Yang, Hui-Lan; Wang, Ying; Guan, Lei

2006-11-01

To construct and express Hsp70-HSV2gD fusion protein. Genes of Hsp70 and HSV-2gD were subcloned into vectors pGEX-4T-1 respectively. After confirmed by DNA sequence analysis, the recombinant plasmids pGEX-4T-HSP-gD was transformed into E. coli DH5alpha and induced to express with IPTG. The expressed protein was characterized by SDS-PAGE and Western blot after purified. BALB/c mice were immunized with fusion proteins respectively via intra-m uscular injection. The proliferation of spleen lymphocytes, the level of y-IFN in culture and anti-HSV-2gD IgG antibody in serum was detected was detected. The expressed protein was analyzed by SDS-PAGE after induced with IPTG, which showed a new band with an apparent molecular mass corresponding to the predicted size (118 kD). Western Blotting analysis demonstrates that the purified Hsp70-HSV2gD fusion protein had specific binding activity. The stimulation indexes of spleen lymphocytes, the level of gamma-IFN in culture and anti-HSV-2gD IgG antibody in serum of GST-Hsp70-gD group was obviously higher than that of other groups (P < 0.05 respectively). The successful expression of the Hsp70-HSV2gD fusion protein, which can induce immune responses, laid a solid foundation for its further research.

Biosensing of BCR/ABL fusion gene using an intensity-interrogation surface plasmon resonance imaging system

NASA Astrophysics Data System (ADS)

Wu, Jiangling; Huang, Yu; Bian, Xintong; Li, DanDan; Cheng, Quan; Ding, Shijia

2016-10-01

In this work, a custom-made intensity-interrogation surface plasmon resonance imaging (SPRi) system has been developed to directly detect a specific sequence of BCR/ABL fusion gene in chronic myelogenous leukemia (CML). The variation in the reflected light intensity detected from the sensor chip composed of gold islands array is proportional to the change of refractive index due to the selective hybridization of surface-bound DNA probes with target ssDNA. SPRi measurements were performed with different concentrations of synthetic target DNA sequence. The calibration curve of synthetic target sequence shows a good relationship between the concentration of synthetic target and the change of reflected light intensity. The detection limit of this SPRi measurement could approach 10.29 nM. By comparing SPRi images, the target ssDNA and non-complementary DNA sequence are able to be distinguished. This SPRi system has been applied for assay of BCR/ABL fusion gene extracted from real samples. This nucleic acid-based SPRi biosensor therefore offers an alternative high-effective, high-throughput label-free tool for DNA detection in biomedical research and molecular diagnosis.

A major defect in mast cell effector functions in CRACM1-/- mice

PubMed Central

Vig, Monika; Dehaven, Wayne I; Bird, Gary S; Billingsley, James M; Wang, Huiyun; Rao, Patricia E; Hutchings, Amy B; Jouvin, Marie-Hélène; Putney, James W; Kinet, Jean-Pierre

2008-01-01

CRACM1 (Orai1) constitutes the pore subunit of CRAC channels that are crucial for many physiological processes 1-6. A point mutation in CRACM1 has been associated with SCID disease in humans 2. We have generated CRACM1 deficient mice using gene trap, where β-galactosidase (LacZ) activity identifies CRACM1 expression in tissues. We show here that the homozygous CRACM1 deficient mice are considerably smaller in size and are grossly defective in mast cell degranulation and cytokine secretion. FcεRI-mediated in vivo allergic reactions were also inhibited in CRACM1-/- mice. Other tissues expressing truncated CRACM1-LacZ fusion protein include skeletal muscles, kidney and regions in the brain and heart. Surprisingly, no CRACM1 expression was seen in the lymphoid regions of thymus. Accordingly, we found no defect in T cell development. Thus, our data reveal novel crucial roles for CRAC channels including a putative role in excitable cells. PMID:18059270

Comprehensive analysis of the MYB-NFIB gene fusion in salivary adenoid cystic carcinoma: Incidence, variability, and clinicopathologic significance.

PubMed

Mitani, Yoshitsugu; Li, Jie; Rao, Pulivarthi H; Zhao, Yi-Jue; Bell, Diana; Lippman, Scott M; Weber, Randal S; Caulin, Carlos; El-Naggar, Adel K

2010-10-01

The objectives of this study were to determine the incidence of the MYB-NFIB fusion in salivary adenoid cystic carcinoma (ACC), to establish the clinicopathologic significance of the fusion, and to analyze the expression of MYB in ACCs in the context of the MYB-NFIB fusion. We did an extensive analysis involving 123 cancers of the salivary gland, including primary and metastatic ACCs, and non-ACC salivary carcinomas. MYB-NFIB fusions were identified by reverse transcriptase-PCR (RT-PCR) and sequencing of the RT-PCR products, and confirmed by fluorescence in situ hybridization. MYB RNA expression was determined by quantitative RT-PCR and protein expression was analyzed by immunohistochemistry. The MYB-NFIB fusion was detected in 28% primary and 35% metastatic ACCs, but not in any of the non-ACC salivary carcinomas analyzed. Different exons in both the MYB and NFIB genes were involved in the fusions, resulting in expression of multiple chimeric variants. Notably, MYB was overexpressed in the vast majority of the ACCs, although MYB expression was significantly higher in tumors carrying the MYB-NFIB fusion. The presence of the MYB-NFIB fusion was significantly associated (P = 0.03) with patients older than 50 years of age. No correlation with other clinicopathologic markers, factors, and survival was found. We conclude that the MYB-NFIB fusion characterizes a subset of ACCs and contributes to MYB overexpression. Additional mechanisms may be involved in MYB overexpression in ACCs lacking the MYB-NFIB fusion. These findings suggest that MYB may be a specific novel target for tumor intervention in patients with ACC. ©2010 AACR.

Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

PubMed Central

Stone, D E; Craig, E A

1990-01-01

To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

The Myxococcus xanthus Two-Component System CorSR Regulates Expression of a Gene Cluster Involved in Maintaining Copper Tolerance during Growth and Development

PubMed Central

Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J.; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

2013-01-01

Myxococcus xanthus is a soil-dwelling member of the δ–Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains. PMID:23874560

A system for the measurement of gene targeting efficiency in human cell lines using an antibiotic resistance-GFP fusion gene.

PubMed

Konishi, Yuko; Karnan, Sivasundaram; Takahashi, Miyuki; Ota, Akinobu; Damdindorj, Lkhagvasuren; Hosokawa, Yoshitaka; Konishi, Hiroyuki

2012-09-01

Gene targeting in a broad range of human somatic cell lines has been hampered by inefficient homologous recombination. To improve this technology and facilitate its widespread application, it is critical to first have a robust and efficient research system for measuring gene targeting efficiency. Here, using a fusion gene consisting of hygromycin B phosphotransferase and 3'-truncated enhanced GFP (HygR-5' EGFP) as a reporter gene, we created a molecular system monitoring the ratio of homologous to random integration (H/R ratio) of targeting vectors into the genome. Cell clones transduced with a reporter vector containing HygR-5' EGFP were efficiently established from two human somatic cell lines. Established HygR-5' EGFP reporter clones retained their capacity to monitor gene targeting efficiency for a longer duration than a conventional reporter system using an unfused 5' EGFP gene. With the HygR-5' EGFP reporter system, we reproduced previous findings of gene targeting frequency being up-regulated by the use of an adeno-associated viral (AAV) backbone, a promoter-trap system, or a longer homology arm in a targeting vector, suggesting that this system accurately monitors H/R ratio. Thus, our HygR-5' EGFP reporter system will assist in the development of an efficient AAV-based gene targeting technology.

Comparative Assessment of Induced Immune Responses Following Intramuscular Immunization with Fusion and Cocktail of LeIF, LACK and TSA Genes Against Cutaneous Leishmaniasis in BALB/c Mice.

PubMed

Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid

2018-02-01

In the present study, we evaluated induced immune responses following DNA vaccine containing cocktail or fusion of LeIF, LACK and TSA genes or each gene alone. Mice were injected with 100 µg of each plasmid containing the gene of insert, plasmid DNA alone as the first control group or phosphate buffer saline as the second control group. Then, cellular and humoral responses, lesion size were measured for all groups. All vaccinated mice induced Th1 immune responses against Leishmania characterized by higher IFN-γ and IgG2a levels compared with control groups (p < 0.05). In addition, IFN-γ levels increased in groups immunized with fusion and cocktail vaccines in comparison with LACK (p < 0.001) and LeIF (p < 0.01) groups after challenge. In addition, fusion and cocktail groups produced higher IgG2a values than groups vaccinated with a gene alone (p < 0.05). Lesion progression delayed for all immunized groups compared with control groups from 5th week post-infection (p < 0.05). Mean lesion size decreased in immunized mice with fusion DNA than three groups vaccinated with one gene alone (p < 0.05). While, lesion size decreased significantly in cocktail recipient group than LeIF recipient group (p < 0.05). There was no difference in lesion size between fusion and cocktail groups. Overall, immunized mice with cocktail and fusion vaccines showed stronger Th1 response by production of higher IFN-γ and IgG2a and showed smaller mean lesion size. Therefore, use of multiple antigens can improve induced immune responses by DNA vaccination.

Bone marrow mesenchymal stem cells from infants with MLL-AF4+ acute leukemia harbor and express the MLL-AF4 fusion gene

PubMed Central

Catalina, Purificación; Rodríguez, René; Melen, Gustavo J.; Bueno, Clara; Arriero, Mar; García-Sánchez, Félix; Lassaletta, Alvaro; García-Sanz, Ramón

2009-01-01

MLL-AF4 fusion is a hallmark genetic abnormality in infant B-acute lymphoblastic leukemia (B-ALL) known to arise in utero. The cellular origin of leukemic fusion genes during human development is difficult to ascertain. The bone marrow (BM) microenvironment plays an important role in the pathogenesis of several hematological malignances. BM mesenchymal stem cells (BM-MSC) from 38 children diagnosed with cytogenetically different acute leukemias were screened for leukemic fusion genes. Fusion genes were absent in BM-MSCs of childhood leukemias carrying TEL-AML1, BCR-ABL, AML1-ETO, MLL-AF9, MLL-AF10, MLL-ENL or hyperdiploidy. However, MLL-AF4 was detected and expressed in BM-MSCs from all cases of MLL-AF4+ B-ALL. Unlike leukemic blasts, MLL-AF4+ BM-MSCs did not display monoclonal Ig gene rearrangements. Endogenous or ectopic expression of MLL-AF4 exerted no effect on MSC culture homeostasis. These findings suggest that MSCs may be in part tumor-related, highlighting an unrecognized role of the BM milieu on the pathogenesis of MLL-AF4+ B-ALL. MLL-AF4 itself is not sufficient for MSC transformation and the expression of MLL-AF4 in MSCs is compatible with a mesenchymal phenotype, suggesting a differential impact in the hematopoietic system and mesenchyme. The absence of monoclonal rearrangements in MLL-AF4+ BM-MSCs precludes the possibility of cellular plasticity or de-differentiation of B-ALL blasts and suggests that MLL-AF4 might arise in a population of prehematopoietic precursors. PMID:19995953

Rho GTPase activity modulates paramyxovirus fusion protein-mediated cell-cell fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schowalter, Rachel M.; Wurth, Mark A.; Aguilar, Hector C.

2006-07-05

The paramyxovirus fusion protein (F) promotes fusion of the viral envelope with the plasma membrane of target cells as well as cell-cell fusion. The plasma membrane is closely associated with the actin cytoskeleton, but the role of actin dynamics in paramyxovirus F-mediated membrane fusion is unclear. We examined cell-cell fusion promoted by two different paramyxovirus F proteins in three cell types in the presence of constitutively active Rho family GTPases, major cellular coordinators of actin dynamics. Reporter gene and syncytia assays demonstrated that expression of either Rac1{sup V12} or Cdc42{sup V12} could increase cell-cell fusion promoted by the Hendra ormore » SV5 glycoproteins, though the effect was dependent on the cell type expressing the viral glycoproteins. In contrast, RhoA{sup L63} decreased cell-cell fusion promoted by Hendra glycoproteins but had little affect on SV5 F-mediated fusion. Also, data suggested that GTPase activation in the viral glycoprotein-containing cell was primarily responsible for changes in fusion. Additionally, we found that activated Cdc42 promoted nuclear rearrangement in syncytia.« less

Cytotoxicity and gene induction by some essential oils in the yeast Saccharomyces cerevisiae.

PubMed

Bakkali, F; Averbeck, S; Averbeck, D; Zhiri, A; Idaomar, M

2005-08-01

In order to get an insight into the possible genotoxicity of essential oils (EOs) used in traditional pharmacological applications we tested five different oils extracted from the medicinal plants Origanum compactum, Coriandrum sativum, Artemisia herba alba, Cinnamomum camphora (Ravintsara aromatica) and Helichrysum italicum (Calendula officinalis) for genotoxic effects using the yeast Saccharomyces cerevisiae. Clear cytotoxic effects were observed in the diploid yeast strain D7, with the cells being more sensitive to EOs in exponential than in stationary growth phase. The cytotoxicity decreased in the following order: Origanum compactum>Coriandrum sativum>Artemisia herba alba>Cinnamomum camphora>Helichrysum italicum. In the same order, all EOs, except that derived from Helichrysum italicum, clearly induced cytoplasmic petite mutations indicating damage to mitochondrial DNA. However, no nuclear genetic events such as point mutations or mitotic intragenic or intergenic recombination were induced. The capacity of EOs to induce nuclear DNA damage-responsive genes was tested using suitable Lac-Z fusion strains for RNR3 and RAD51, which are genes involved in DNA metabolism and DNA repair, respectively. At equitoxic doses, all EOs demonstrated significant gene induction, approximately the same as that caused by hydrogen peroxide, but much lower than that caused by methyl methanesulfonate (MMS). EOs affect mitochondrial structure and function and can stimulate the transcriptional expression of DNA damage-responsive genes. The induction of mitochondrial damage by EOs appears to be closely linked to overall cellular cytotoxicity and appears to mask the occurrence of nuclear genetic events. EO-induced cytotoxicity involves oxidative stress, as is evident from the protection observed in the presence of ROS inhibitors such as glutathione, catalase or the iron-chelating agent deferoxamine.

Shh pathway in wounds in non-diabetic Shh-Cre-eGFP/Ptch1-LacZ mice treated with MAA beads.

PubMed

Lisovsky, Alexandra; Sefton, Michael V

2016-09-01

Previously, poly(methacrylic acid-co-methyl methacrylate) (MAA) beads were shown to improve vessel formation with a concomitant increase in the expression of the sonic hedgehog (Shh) gene, a pleiotropic factor implicated in vascularization. The aim of this study was to follow up on this observation in the absence of the confounding factors of diabetes in non-diabetic Shh-Cre-eGFP/Ptch1-LacZ mice; in this mouse, expression of GFP and β-Gal is consistent with the transcription patterns of Shh and its receptor patched 1 (Ptch1), respectively. In agreement with studies in diabetic males, MAA beads improved vascularization in large (15 mm × 15 mm) wounds in non-diabetic males at day 7. Shh pathway activation was suggested, as the numbers of GFP+ (Shh) and β-Gal+ (Ptch1, a target of the pathway) cells increased in the granulation tissue. Shh signaling pathway modulation was also suggested in the healthy skin surrounding the wound bed, as evidenced by an increase in the number of GFP+ and β-Gal+ cells in males at day 4. Gene expression analysis of the wounds confirmed increase in Ptch1 and showed the upregulation of a downstream transcription factor Gli3, involved in the vascular effect of the Shh pathway, implicating the pathway in the effect of MAA beads. The efficacy of MAA beads was also investigated in females; MAA beads modulated the Shh pathway within granulation tissue similarly as in males, but had no enhancement effect on the healthy skin and on vascularization. We believe that understanding the molecular and cellular mechanisms of MAA-based biomaterials and testing the efficacy of therapeutics in both sexes will inform the development of novel therapeutic biomaterials. Copyright © 2016 Elsevier Ltd. All rights reserved.

Celastrol suppresses tumor cell growth through targeting an AR-ERG-NF-κB pathway in TMPRSS2/ERG fusion gene expressing prostate cancer.

PubMed

Shao, Longjiang; Zhou, Zhansong; Cai, Yi; Castro, Patricia; Dakhov, Olga; Shi, Ping; Bai, Yaoxia; Ji, Huixiang; Shen, Wenhao; Wang, Jianghua

2013-01-01

The TMPRSS2/ERG (T/E) fusion gene is present in the majority of all prostate cancers (PCa). We have shown previously that NF-kB signaling is highly activated in these T/E fusion expressing cells via phosphorylation of NF-kB p65 Ser536 (p536). We therefore hypothesize that targeting NF-kB signaling may be an efficacious approach for the subgroup of PCas that carry T/E fusions. Celastrol is a well known NF-kB inhibitor, and thus may inhibit T/E fusion expressing PCa cell growth. We therefore evaluated Celastrol's effects in vitro and in vivo in VCaP cells, which express the T/E fusion gene. VCaP cells were treated with different concentrations of Celastrol and growth inhibition and target expression were evaluated. To test its ability to inhibit growth in vivo, 0.5 mg/kg Celastrol was used to treat mice bearing subcutaneous VCaP xenograft tumors. Our results show Celastrol can significantly inhibit the growth of T/E fusion expressing PCa cells both in vitro and in vivo through targeting three critical signaling pathways: AR, ERG and NF-kB in these cells. When mice received 0.5 mg/kg Celastrol for 4 times/week, significant growth inhibition was seen with no obvious toxicity or significant weight loss. Therefore, Celastrol is a promising candidate drug for T/E fusion expressing PCa. Our findings provide a novel strategy for the targeted therapy which may benefit the more than half of PCa patients who have T/E fusion expressing PCas.

Identification of a novel fusion gene, IRF2BP2-RARA, in acute promyelocytic leukemia.

PubMed

Yin, C Cameron; Jain, Nitin; Mehrotra, Meenakshi; Zhagn, Jianhua; Protopopov, Alexei; Zuo, Zhuang; Pemmaraju, Naveen; DiNardo, Courtney; Hirsch-Ginsberg, Cheryl; Wang, Sa A; Medeiros, L Jeffrey; Chin, Lynda; Patel, Keyur P; Ravandi, Farhad; Futreal, Andrew; Bueso-Ramos, Carlos E

2015-01-01

Acute promyelocytic leukemia (APL) is characterized by the fusion of retinoic acid receptor alpha (RARA) with promyelocytic leukemia (PML) or, rarely, other gene partners. This report presents a patient with APL with a novel fusion between RARA and the interferon regulatory factor 2 binding protein 2 (IRF2BP2) genes. A bone marrow examination in a 19-year-old woman who presented with ecchymoses and epistaxis showed morphologic and immunophenotypic features consistent with APL. PML oncogenic domain antibody was positive. Results of fluorescence in situ hybridization, conventional cytogenetics, reverse transcription-polymerase chain reaction (RT-PCR), and oligonucleotide microarray for PML-RARA and common APL variant translocations were negative. Next-generation RNA-sequencing analysis followed by RT-PCR and direct sequencing revealed distinct breakpoints within IRF2BP2 exon 2 and RARA intron 2. The patient received all-trans retinoic acid, arsenic, and gemtuzumab ozogamicin, and achieved complete remission. However, the disease relapsed 10 months later, 2 months after consolidation therapy. This is the first report showing involvement of IRF2BP2 in APL, and it expands the list of novel RARA partners identified in APL. Copyright © 2015 by the National Comprehensive Cancer Network.

[Cloning and sequence analysis of recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit and Actinobacillus actinomycetemcomitans fimbria associative protein].

PubMed

Li, Yi; Sun, Hong-chen; Guo, Xue-jun; Feng, Shu-zhang

2005-02-01

To clone the recombinant fusion gene of Escherichia coli heat-liable enterotoxin B subunit (Ltb) and Actinobacillus actinomycetemcomitans fimbria associative protein (Fap). Two couples of primers were designed for PCR according to the known sequence of ltb and fap. The ltb and fap gene were obtained by amplification PCR technique from plasmid EWD299 of Escherichia coli and Actinobacillus actinomycetemcomitans 310 DNA respectively, and fused them by PCR. The fusion gene ltb-fap were cloning into plasmid pET28a(+). The recombined plasmid pET28a ltb-fap was transformed into Escherichia coli DH5alpha. The recombinant was screened and identified by restriction enzyme and PCR. The cloned gene was sequenced. The ltb-fap about 531bp in size was obtained successfully, and identified by PCR, restrictive enzyme and sequence analysis. The vector of pET28a ltb-fap was obtained.

Obesity and Prostate Cancer Risk According to Tumor TMPRSS2:ERG Gene Fusion Status

PubMed Central

Egbers, Lieke; Luedeke, Manuel; Rinckleb, Antje; Kolb, Suzanne; Wright, Jonathan L.; Maier, Christiane; Neuhouser, Marian L.; Stanford, Janet L.

2015-01-01

The T2E gene fusion, formed by fusion of the transmembrane protease, serine 2, gene (TMPRSS2) with the erythroblast transformation-specific (ETS)-related gene (ERG), is found in approximately 50% of prostate cancers and may characterize distinct molecular subtypes of prostate cancer with different etiologies. We investigated the relationship between body mass index (BMI; weight (kg)/height (m)2) and prostate cancer risk by T2E status. Study participants were residents of King County, Washington, recruited for 2 population-based case-control studies conducted in 1993–1996 and 2002–2005. Tumor T2E status was determined for 563 prostate cancer patients who underwent radical prostatectomy. Information on weight, height, and covariables was obtained through in-person interviews. We performed polytomous logistic regression to calculate odds ratios and 95% confidence intervals for T2E-positive and -negative prostate cancer. Comparing the highest BMI quartile with the lowest, inverse associations were observed between recent (≥29.7 vs. <24.5: odds ratio = 0.66, 95% confidence interval: 0.45, 0.97) and maximum (≥31.8 vs. <25.9: odds ratio = 0.69, 95% confidence interval: 0.47, 1.02) BMI and the risk of T2E-positive prostate cancer. No significant associations were seen for men with T2E-negative tumors. This study provides evidence that obesity is specifically associated with reduced risk of developing androgen-responsive T2E fusion–positive tumors. The altered steroid hormone profile in obese men may contribute to this inverse association. PMID:25852077

Adenoid cystic carcinoma: emerging role of translocations and gene fusions

PubMed Central

Wysocki, Piotr T.; Izumchenko, Evgeny; Meir, Juliet; Ha, Patrick K.; Sidransky, David; Brait, Mariana

2016-01-01

Adenoid cystic carcinoma (ACC), the second most common salivary gland malignancy, is notorious for poor prognosis, which reflects the propensity of ACC to progress to clinically advanced metastatic disease. Due to high long-term mortality and lack of effective systemic treatment, the slow-growing but aggressive ACC poses a particular challenge in head and neck oncology. Despite the advancements in cancer genomics, up until recently relatively few genetic alterations critical to the ACC development have been recognized. Although the specific chromosomal translocations resulting in MYB-NFIB fusions provide insight into the ACC pathogenesis and represent attractive diagnostic and therapeutic targets, their clinical significance is unclear, and a substantial subset of ACCs do not harbor the MYB-NFIB translocation. Strategies based on detection of newly described genetic events (such as MYB activating super-enhancer translocations and alterations affecting another member of MYB transcription factor family-MYBL1) offer new hope for improved risk assessment, therapeutic intervention and tumor surveillance. However, the impact of these approaches is still limited by an incomplete understanding of the ACC biology, and the manner by which these alterations initiate and drive ACC remains to be delineated. This manuscript summarizes the current status of gene fusions and other driver genetic alterations in ACC pathogenesis and discusses new therapeutic strategies stemming from the current research. PMID:27533466

FusionAnalyser: a new graphical, event-driven tool for fusion rearrangements discovery

PubMed Central

Piazza, Rocco; Pirola, Alessandra; Spinelli, Roberta; Valletta, Simona; Redaelli, Sara; Magistroni, Vera; Gambacorti-Passerini, Carlo

2012-01-01

Gene fusions are common driver events in leukaemias and solid tumours; here we present FusionAnalyser, a tool dedicated to the identification of driver fusion rearrangements in human cancer through the analysis of paired-end high-throughput transcriptome sequencing data. We initially tested FusionAnalyser by using a set of in silico randomly generated sequencing data from 20 known human translocations occurring in cancer and subsequently using transcriptome data from three chronic and three acute myeloid leukaemia samples. in all the cases our tool was invariably able to detect the presence of the correct driver fusion event(s) with high specificity. In one of the acute myeloid leukaemia samples, FusionAnalyser identified a novel, cryptic, in-frame ETS2–ERG fusion. A fully event-driven graphical interface and a flexible filtering system allow complex analyses to be run in the absence of any a priori programming or scripting knowledge. Therefore, we propose FusionAnalyser as an efficient and robust graphical tool for the identification of functional rearrangements in the context of high-throughput transcriptome sequencing data. PMID:22570408

FusionAnalyser: a new graphical, event-driven tool for fusion rearrangements discovery.

PubMed

Piazza, Rocco; Pirola, Alessandra; Spinelli, Roberta; Valletta, Simona; Redaelli, Sara; Magistroni, Vera; Gambacorti-Passerini, Carlo

2012-09-01

Gene fusions are common driver events in leukaemias and solid tumours; here we present FusionAnalyser, a tool dedicated to the identification of driver fusion rearrangements in human cancer through the analysis of paired-end high-throughput transcriptome sequencing data. We initially tested FusionAnalyser by using a set of in silico randomly generated sequencing data from 20 known human translocations occurring in cancer and subsequently using transcriptome data from three chronic and three acute myeloid leukaemia samples. in all the cases our tool was invariably able to detect the presence of the correct driver fusion event(s) with high specificity. In one of the acute myeloid leukaemia samples, FusionAnalyser identified a novel, cryptic, in-frame ETS2-ERG fusion. A fully event-driven graphical interface and a flexible filtering system allow complex analyses to be run in the absence of any a priori programming or scripting knowledge. Therefore, we propose FusionAnalyser as an efficient and robust graphical tool for the identification of functional rearrangements in the context of high-throughput transcriptome sequencing data.

NUTM1 Gene Fusions Characterize a Subset of Undifferentiated Soft Tissue and Visceral Tumors.

PubMed

Dickson, Brendan C; Sung, Yun-Shao; Rosenblum, Marc K; Reuter, Victor E; Harb, Mohammed; Wunder, Jay S; Swanson, David; Antonescu, Cristina R

2018-05-01

NUT midline carcinoma is an aggressive tumor that occurs mainly in the head and neck and, less frequently, the mediastinum and lung. Following identification of an index case of a NUTM1 fusion positive undifferentiated soft tissue tumor, we interrogated additional cases of primary undifferentiated soft tissue and visceral tumors for NUTM1 abnormalities. Targeted next-generation sequencing was performed on RNA extracted from formalin-fixed paraffin-embedded tissue, and results validated by fluorescence in situ hybridization using custom bacterial artificial chromosome probes. Six patients were identified: mean age of 42 years (range, 3 to 71 y); equal sex distribution; and, tumors involved the extremity soft tissues (N=2), kidney (N=2), stomach, and brain. On systemic work-up at presentation all patients lacked a distant primary tumor. Morphologically, the tumors were heterogenous, with undifferentiated round-epithelioid-rhabdoid cells arranged in solid sheets, nests, and cords. Mitotic activity was generally brisk. Four cases expressed pancytokeratin, but in only 2 cases was this diffuse. Next-generation sequencing demonstrated the following fusions: BRD4-NUTM1 (3 cases), BRD3-NUTM1, MXD1-NUTM1, and BCORL1-NUTM1. Independent testing by fluorescence in situ hybridization confirmed the presence of NUTM1 and partner gene rearrangement. This study establishes that NUT-associated tumors transgress the midline and account for a subset of primitive neoplasms occurring in soft tissue and viscera. Tumors harboring NUTM1 gene fusions are presumably underrecognized, and the extent to which they account for undifferentiated mesenchymal, neuroendocrine, and/or epithelial neoplasms is unclear. Moreover, the relationship, if any, between NUT-associated tumors in soft tissue and/or viscera, and conventional NUT carcinoma, remains to be elucidated.

Effects of heme oxygenase-1 gene modulated mesenchymal stem cells on vasculogenesis in ischemic swine hearts.

PubMed

Jiang, Yi-Bo; Zhang, Xiao-Li; Tang, Yao-Liang; Ma, Gen-Shan; Shen, Cheng-Xing; Wei, Qin; Zhu, Qi; Yao, Yu-Yu; Liu, Nai-Feng

2011-02-01

Mesenchymal stem cells (MSCs) transplantation may partially restore heart function in the treatment of acute myocardial infarction (AMI). The aim of this study was to explore the beneficial effects of MSCs modified with heme xygenase-1 (HO-1) on post-infarct swine hearts to determine whether the induction of therapeutic angiogenesis is modified by the angiogenic cytokines released from the implanted cells. In vitro, MSCs were divided into four groups: (1) non-transfected MSCs (MSCs group), (2) MSCs transfected with the pcDNA3.1-Lacz plasmid (Lacz-MSCs group), (3) MSCs transfected with pcDNA3.1-hHO-1 (HO-1-MSCs group), and (4) MSCs transfected with pcDNA3.1-hHO-1 and pretreatment with an HO inhibitor, tin protoporphyrin (SnPP) (HO-1-MSCs + SnPP group). Cells were cultured in an airtight incubation bottle for 24 hours, in which the oxygen concentration was maintained at < 1%, followed by 12 hours of reoxygenation. After hypoxia/reoxygen treatment, ELISA was used to measure transforming growth factor (TGF-β) and fibroblast growth factor (FGF-2) in the supernatant. In vivo, 28 Chinese mini-pigs were randomly allocated to the following treatment groups: (1) control group (saline), (2) Lacz-MSCs group, (3) HO-1-MSCs group, and (4) HO-1-MSCs + SnPP group. About 1 × 10(7) of autologous stem cells or an identical volume of saline was injected intracoronary into porcine hearts 1 hour after MI. Magnetic resonance imaging (MRI) assay and postmortem analysis were assessed four weeks after stem cell transplantation. Post hypoxia/reoxygenation in vitro, TGF-β in the supernatant was significantly increased in the HO-1-MSCs ((874.88 ± 68.23) pg/ml) compared with Lacz-MSCs ((687.81 ± 57.64) pg/ml, P < 0.001). FGF-2 was also significantly increased in the HO-1-MSCs ((1106.48 ± 107.06) pg/ml) compared with the Lacz-MSCs ((853.85 ± 74.44) pg/ml, P < 0.001). In vivo, at four weeks after transplantation, HO-1 gene transfer increased the capillary density in the peri-infarct area

Adult-onset renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusion with smooth muscle stroma and abnormal vessels.

PubMed

Kuroda, Naoto; Tamura, Masato; Tanaka, Yukichi; Hes, Ondrej; Michal, Michal; Inoue, Kaori; Ohara, Masahiko; Mizuno, Keiko; Lee, Gang-Hong

2009-07-01

Renal cell carcinoma (RCC) associated with Xp11.2 translocation/TFE3 gene fusion has been recently identified. Herein is presented a case of RCC with Xp11.2 translocations/TFE3 gene fusions with unusual histological findings. A 68-year-old Japanese woman was incidentally found to have a renal mass on CT. Histological examination showed clear cell neoplasm with alveolar and papillary growth patterns. The nuclear atypia corresponded to Fuhrman grade 3. Additionally, smooth muscle stroma was observed and abnormal vessels showing a heterogeniety in thickness were also identified. On immunohistochemistry, neoplastic cells were diffusely positive for transcription factor E3 (TFE3) and Melan A, and focally positive for CD10 and RCC marker. The smooth muscle stroma was positive for alpha-smooth muscle actin and h-caldesmon, but reverse transcription-polymerase chain reaction of the tumor using frozen material could not detect any previously reported chimeric transcripts including ASPL-TFE3, PRCC-TFE3, CLTC-TFE3, PSF-TFE3 or NoNo-TFE3. G-band karyotype was unsuccessful. Pathologists should pay attention to the afore-described unusual stromal reaction of adult-onset RCC associated with Xp11.2 translocations/TFE3 gene fusions.

The actin cytoskeleton inhibits pore expansion during PIV5 fusion protein-promoted cell-cell fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wurth, Mark A.; Schowalter, Rachel M.; Smith, Everett Clinton

2010-08-15

Paramyxovirus fusion (F) proteins promote both virus-cell fusion, required for viral entry, and cell-cell fusion, resulting in syncytia formation. We used the F-actin stabilizing drug, jasplakinolide, and the G-actin sequestrant, latrunculin A, to examine the role of actin dynamics in cell-cell fusion mediated by the parainfluenza virus 5 (PIV5) F protein. Jasplakinolide treatment caused a dose-dependent increase in cell-cell fusion as measured by both syncytia and reporter gene assays, and latrunculin A treatment also resulted in fusion stimulation. Treatment with jasplakinolide or latrunculin A partially rescued a fusion pore opening defect caused by deletion of the PIV5 F protein cytoplasmicmore » tail, but these drugs had no effect on fusion inhibited at earlier stages by either temperature arrest or by a PIV5 heptad repeat peptide. These data suggest that the cortical actin cytoskeleton is an important regulator of fusion pore enlargement, an energetically costly stage of viral fusion protein-mediated membrane merger.« less

The actin cytoskeleton inhibits pore expansion during PIV5 fusion protein-promoted cell-cell fusion

PubMed Central

Wurth, Mark A.; Schowalter, Rachel M.; Smith, Everett Clinton; Moncman, Carole L.; Dutch, Rebecca Ellis; McCann, Richard O.

2010-01-01

Paramyxovirus fusion (F) proteins promote both virus-cell fusion, required for viral entry, and cell-cell fusion, resulting in syncytia formation. We used the F-actin stabilizing drug, jasplakinolide, and the G-actin sequestrant, latrunculin A, to examine the role of actin dynamics in cell-cell fusion mediated by the parainfluenza virus 5 (PIV5) F protein. Jasplakinolide treatment caused a dose-dependent increase in cell-cell fusion as measured by both syncytia and reporter gene assays, and latrunculin A treatment also resulted in fusion stimulation. Treatment with jasplakinolide or latrunculin A partially rescued a fusion pore opening defect caused by deletion of the PIV5 F protein cytoplasmic tail, but these drugs had no effect on fusion inhibited at earlier stages by either temperature arrest or by a PIV5 heptad repeat peptide. These data suggest that the cortical actin cytoskeleton is an important regulator of fusion pore enlargement, an energetically costly stage of viral fusion protein-mediated membrane merger. PMID:20537366

Diagnostic pitfall on the histological spectrum of adult-onset renal carcinoma associated with Xp11.2 translocations/TFE3 gene fusions.

PubMed

Kuroda, Naoto; Katto, Kazunobu; Tanaka, Yukichi; Yamaguchi, Tadanori; Inoue, Kaori; Ohara, Masahiko; Mizuno, Keiko; Hes, Ondrej; Michal, Michal; Lee, Gang-Hong

2010-06-01

Renal cell carcinoma (RCC) associated with Xp11.2 translocation/TFE3 gene fusion recently has been found. In this article, we demonstrate an unusual features of such a case. A 73-year-old Japanese woman presented with macroscopic hematuria. The imaging examinations disclosed the renal tumor. Histological examination showed the finding of ASPL-TFE3 RCC, which was characterized by papillary, alveolar, or solid growth of voluminous cell with clear and eosinophilic cells, and stromal psammoma body and hyaline nodules. Additionally, shrunken nuclei, thick cell border, and perinuclear clearing characteristic of chromophobe renal cell carcinoma were observed in the alveolar growth area and the transitional zone between stromal hyalinization, and osseous metaplasia was identified. Immunohistochemically, nuclei of tumorous cell were diffusely positive for TFE3. A RT-PCR study revealed the ASPL-TFE3 chimeric transcript. Finally, pathologists should recognize that the histology of RCC associated with Xp11.2 translocation/TFE3 gene fusion may focally resemble that of chromophobe RCC, but TFE3 immunohistochemistry and molecular genetic study may be helpful in the differential diagnosis. Moreover, osseous metaplasia as well as psammoma bodies should be added to the histological spectrum of the stromal change in RCC associated with Xp11.2 translocations/TFE3 gene fusions.

Naringenin Regulates Expression of Genes Involved in Cell Wall Synthesis in Herbaspirillum seropedicae▿

PubMed Central

Tadra-Sfeir, M. Z.; Souza, E. M.; Faoro, H.; Müller-Santos, M.; Baura, V. A.; Tuleski, T. R.; Rigo, L. U.; Yates, M. G.; Wassem, R.; Pedrosa, F. O.; Monteiro, R. A.

2011-01-01

Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants. PMID:21257805

Naringenin regulates expression of genes involved in cell wall synthesis in Herbaspirillum seropedicae.

PubMed

Tadra-Sfeir, M Z; Souza, E M; Faoro, H; Müller-Santos, M; Baura, V A; Tuleski, T R; Rigo, L U; Yates, M G; Wassem, R; Pedrosa, F O; Monteiro, R A

2011-03-01

Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants.

A cryptic translocation leading to NUP98-PHF23 fusion in AML.

PubMed

Ning, Yi

2016-12-01

Chromosome translocations leading to gene fusions have emerged as important oncogenic drivers of various types of malignancies. Detection and characterization of these fusion genes not only help diagnosis and management of specific malignancies, but also contribute to our understanding of the genetic basis and pathogenesis of these diseases. NUP98 gene encodes a 98 kDa nucleoporin, which is a component of the nuclear pore complex that mediates transport of mRNA and proteins between the nucleus and the cytoplasm. Due to its participation in translocations leading to the formation of fusion with at least 29 different partner genes, NUP98 is considered one of the most promiscuous fusion genes in hematologic malignancies. We discuss our identification and characterization of a NUP98-PHF23 fusion from a cryptic translocation in patients with acute myeloid leukemia (AML). Copyright © 2016 Elsevier Ltd. All rights reserved.

VanT, a Homologue of Vibrio harveyi LuxR, Regulates Serine, Metalloprotease, Pigment, and Biofilm Production in Vibrio anguillarum

PubMed Central

Croxatto, Antony; Chalker, Victoria J.; Lauritz, Johan; Jass, Jana; Hardman, Andrea; Williams, Paul; Cámara, Miguel; Milton, Debra L.

2002-01-01

Vibrio anguillarum possesses at least two N-acylhomoserine lactone (AHL) quorum-sensing circuits, one of which is related to the luxMN system of Vibrio harveyi. In this study, we have cloned an additional gene of this circuit, vanT, encoding a V. harveyi LuxR-like transcriptional regulator. A V. anguillarum ΔvanT null mutation resulted in a significant decrease in total protease activity due to loss of expression of the metalloprotease EmpA, but no changes in either AHL production or virulence. Additional genes positively regulated by VanT were identified from a plasmid-based gene library fused to a promoterless lacZ. Three lacZ fusions (serA::lacZ, hpdA-hgdA::lacZ, and sat-vps73::lacZ) were identified which exhibited decreased expression in the ΔvanT strain. SerA is similar to 3-phosphoglycerate dehydrogenases and catalyzes the first step in the serine-glycine biosynthesis pathway. HgdA has identity with homogentisate dioxygenases, and HpdA is homologous to 4-hydroxyphenylpyruvate dioxygenases (HPPDs) involved in pigment production. V. anguillarum strains require an active VanT to produce high levels of an l-tyrosine-induced brown color via HPPD, suggesting that VanT controls pigment production. Vps73 and Sat are related to Vibrio cholerae proteins encoded within a DNA locus required for biofilm formation. A V. anguillarum ΔvanT mutant and a mutant carrying a polar mutation in the sat-vps73 DNA locus were shown to produce defective biofilms. Hence, a new member of the V. harveyi LuxR transcriptional activator family has been characterized in V. anguillarum that positively regulates serine, metalloprotease, pigment, and biofilm production. PMID:11872713

VanT, a homologue of Vibrio harveyi LuxR, regulates serine, metalloprotease, pigment, and biofilm production in Vibrio anguillarum.

PubMed

Croxatto, Antony; Chalker, Victoria J; Lauritz, Johan; Jass, Jana; Hardman, Andrea; Williams, Paul; Cámara, Miguel; Milton, Debra L

2002-03-01

Vibrio anguillarum possesses at least two N-acylhomoserine lactone (AHL) quorum-sensing circuits, one of which is related to the luxMN system of Vibrio harveyi. In this study, we have cloned an additional gene of this circuit, vanT, encoding a V. harveyi LuxR-like transcriptional regulator. A V. anguillarum Delta vanT null mutation resulted in a significant decrease in total protease activity due to loss of expression of the metalloprotease EmpA, but no changes in either AHL production or virulence. Additional genes positively regulated by VanT were identified from a plasmid-based gene library fused to a promoterless lacZ. Three lacZ fusions (serA::lacZ, hpdA-hgdA::lacZ, and sat-vps73::lacZ) were identified which exhibited decreased expression in the Delta vanT strain. SerA is similar to 3-phosphoglycerate dehydrogenases and catalyzes the first step in the serine-glycine biosynthesis pathway. HgdA has identity with homogentisate dioxygenases, and HpdA is homologous to 4-hydroxyphenylpyruvate dioxygenases (HPPDs) involved in pigment production. V. anguillarum strains require an active VanT to produce high levels of an L-tyrosine-induced brown color via HPPD, suggesting that VanT controls pigment production. Vps73 and Sat are related to Vibrio cholerae proteins encoded within a DNA locus required for biofilm formation. A V. anguillarum Delta vanT mutant and a mutant carrying a polar mutation in the sat-vps73 DNA locus were shown to produce defective biofilms. Hence, a new member of the V. harveyi LuxR transcriptional activator family has been characterized in V. anguillarum that positively regulates serine, metalloprotease, pigment, and biofilm production.

Detection of Echinoderm Microtubule Associated Protein Like 4-Anaplastic Lymphoma Kinase Fusion Genes in Non-small Cell Lung Cancer Clinical Samples by a Real-time Quantitative Reverse Transcription Polymerase Chain Reaction Method.

PubMed

Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao

2016-12-20

Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.

HIP1-ALK, a novel fusion protein identified in lung adenocarcinoma.

PubMed

Hong, Mineui; Kim, Ryong Nam; Song, Ji-Young; Choi, So-Jung; Oh, Ensel; Lira, Maruja E; Mao, Mao; Takeuchi, Kengo; Han, Joungho; Kim, Jhingook; Choi, Yoon-La

2014-03-01

The most common mechanism underlying overexpression and activation of anaplastic lymphoma kinase (ALK) in non-small-cell lung carcinoma could be attributed to the formation of a fusion protein. To date, five fusion partners of ALK have been reported, namely, echinoderm microtubule associated protein like 4, tropomyosin-related kinase-fused gene, kinesin family member 5B, kinesin light chain 1, and protein tyrosine phosphatase, nonreceptor type 3. In this article, we report a novel fusion gene huntingtin interacting protein 1 (HIP1)-ALK, which is conjoined between the huntingtin-interacting protein 1 gene HIP1 and ALK. Reverse-transcriptase polymerase chain reaction and immunohistochemical analysis were used to detect this fusion gene's transcript and protein expression, respectively. We had amplified the full-length cDNA sequence of this novel fusion gene by using 5'-rapid amplification of cDNA ends. The causative genomic translocation t(2;7)(p23;q11.23) for generating this novel fusion gene was verified by using genomic sequencing. The examined adenocarcinoma showed predominant acinar pattern, and ALK immunostaining was localized to the cytoplasm, with intense staining in the submembrane region. In break-apart, fluorescence in situ hybridization analysis for ALK, split of the 5' and 3' probe signals, and isolated 3' signals were observed. Reverse-transcriptase polymerase chain reaction revealed that the tumor harbored a novel fusion transcript in which exon 21 of HIP1 was fused to exon 20 of ALK in-frame. The novel fusion gene and its protein HIP1-ALK harboring epsin N-terminal homology, coiled-coil, juxtamembrane, and kinase domains, which could play a role in carcinogenesis, could become diagnostic and therapeutic target of the lung adenocarcinoma and deserve a further study in the future.

MYBL1 rearrangements and MYB amplification in breast adenoid cystic carcinomas lacking the MYB-NFIB fusion gene.

PubMed

Kim, Jisun; Geyer, Felipe C; Martelotto, Luciano G; Ng, Charlotte Ky; Lim, Raymond S; Selenica, Pier; Li, Anqi; Pareja, Fresia; Fusco, Nicola; Edelweiss, Marcia; Kumar, Rahul; Gularte-Merida, Rodrigo; Forbes, Andre N; Khurana, Ekta; Mariani, Odette; Badve, Sunil; Vincent-Salomon, Anne; Norton, Larry; Reis-Filho, Jorge S; Weigelt, Britta

2018-02-01

Breast adenoid cystic carcinoma (AdCC), a rare type of triple-negative breast cancer, has been shown to be driven by MYB pathway activation, most often underpinned by the MYB-NFIB fusion gene. Alternative genetic mechanisms, such as MYBL1 rearrangements, have been reported in MYB-NFIB-negative salivary gland AdCCs. Here we report on the molecular characterization by massively parallel sequencing of four breast AdCCs lacking the MYB-NFIB fusion gene. In two cases, we identified MYBL1 rearrangements (MYBL1-ACTN1 and MYBL1-NFIB), which were associated with MYBL1 overexpression. A third AdCC harboured a high-level MYB amplification, which resulted in MYB overexpression at the mRNA and protein levels. RNA-sequencing and whole-genome sequencing revealed no definite alternative driver in the fourth AdCC studied, despite high levels of MYB expression and the activation of pathways similar to those activated in MYB-NFIB-positive AdCCs. In this case, a deletion encompassing the last intron and part of exon 15 of MYB, including the binding site of ERG-1, a transcription factor that may downregulate MYB, and the exon 15 splice site, was detected. In conclusion, we demonstrate that MYBL1 rearrangements and MYB amplification probably constitute alternative genetic drivers of breast AdCCs, functioning through MYBL1 or MYB overexpression. These observations emphasize that breast AdCCs probably constitute a convergent phenotype, whereby activation of MYB and MYBL1 and their downstream targets can be driven by the MYB-NFIB fusion gene, MYBL1 rearrangements, MYB amplification, or other yet to be identified mechanisms. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Melanotic Translocation Renal Cell Carcinoma With a Novel ARID1B-TFE3 Gene Fusion.

PubMed

Antic, Tatjana; Taxy, Jerome B; Alikhan, Mir; Segal, Jeremy

2017-11-01

A 36-year-old male was found to have a 7.0 cm left upper pole renal mass on renal ultrasound. Following nephrectomy, the mass was grossly ill-demarcated, friable and red-brown, invading renal parenchyma, hilar fat and the renal vein. Microscopically, the tumor had a nested and papillary architecture. The cells demonstrated abundant clear and eosinophilic cytoplasm and focal intracytoplasmic melanin pigment. Nucleoli were prominent. By immunohistochemistry, the tumor was positive for TFE3; HMB-45 stained approximately 5% of tumor cells corresponding to the histologic melanin pigment, which was confirmed with Fontana-Masson stain with bleach. Immunostains for PAX8, CD10, MiTF, and CAIX were negative; keratins Cam 5.2 and AE1/AE3 were focally positive. Targeted next-generation sequencing revealed an ARID1B-TFE3 gene fusion. Melanotic Xp11 renal cell carcinoma is a rare, pigment containing translocation variant demonstrating overlapping features with melanoma and is usually associated with an SFPQ-TFE3 gene fusion. The patient is alive and without evidence of disease 7 years after his diagnosis. The combination of high grade histopathology, the presence of melanin, absent PAX8, keratin positivity, and relatively indolent clinical behavior with a unique translocation may warrant recognition as a distinct renal cell carcinoma translocation subtype.

Clinical framework for next generation sequencing based analysis of treatment predictive mutations and multiplexed gene fusion detection in non-small cell lung cancer

PubMed Central

Levéen, Per; Brunnström, Hans; Reuterswärd, Christel; Holm, Karolina; Jönsson, Mats; Annersten, Karin; Rosengren, Frida; Jirström, Karin; Kosieradzki, Jaroslaw; Ek, Lars; Borg, Åke; Planck, Maria; Jönsson, Göran; Staaf, Johan

2017-01-01

Precision medicine requires accurate multi-gene clinical diagnostics. We describe the implementation of an Illumina TruSight Tumor (TST) clinical NGS diagnostic framework and parallel validation of a NanoString RNA-based ALK, RET, and ROS1 gene fusion assay for combined analysis of treatment predictive alterations in non-small cell lung cancer (NSCLC) in a regional healthcare region of Sweden (Scandinavia). The TST panel was clinically validated in 81 tumors (99% hotspot mutation concordance), after which 533 consecutive NSCLCs were collected during one-year of routine clinical analysis in the healthcare region (˜90% advanced stage patients). The NanoString assay was evaluated in 169 of 533 cases. In the 533-sample cohort 79% had 1-2 variants, 12% >2 variants and 9% no detected variants. Ten gene fusions (five ALK, three RET, two ROS1) were detected in 135 successfully analyzed cases (80% analysis success rate). No ALK or ROS1 FISH fusion positive case was missed by the NanoString assay. Stratification of the 533-sample cohort based on actionable alterations in 11 oncogenes revealed that 66% of adenocarcinomas, 13% of squamous carcinoma (SqCC) and 56% of NSCLC not otherwise specified harbored ≥1 alteration. In adenocarcinoma, 10.6% of patients (50.3% if including KRAS) could potentially be eligible for emerging therapeutics, in addition to the 15.3% of patients eligible for standard EGFR or ALK inhibitors. For squamous carcinoma corresponding proportions were 4.4% (11.1% with KRAS) vs 2.2%. In conclusion, multiplexed NGS and gene fusion analyses are feasible in NSCLC for clinical diagnostics, identifying notable proportions of patients potentially eligible for emerging molecular therapeutics. PMID:28415793

Driver Fusions and Their Implications in the Development and Treatment of Human Cancers.

PubMed

Gao, Qingsong; Liang, Wen-Wei; Foltz, Steven M; Mutharasu, Gnanavel; Jayasinghe, Reyka G; Cao, Song; Liao, Wen-Wei; Reynolds, Sheila M; Wyczalkowski, Matthew A; Yao, Lijun; Yu, Lihua; Sun, Sam Q; Chen, Ken; Lazar, Alexander J; Fields, Ryan C; Wendl, Michael C; Van Tine, Brian A; Vij, Ravi; Chen, Feng; Nykter, Matti; Shmulevich, Ilya; Ding, Li

2018-04-03

Gene fusions represent an important class of somatic alterations in cancer. We systematically investigated fusions in 9,624 tumors across 33 cancer types using multiple fusion calling tools. We identified a total of 25,664 fusions, with a 63% validation rate. Integration of gene expression, copy number, and fusion annotation data revealed that fusions involving oncogenes tend to exhibit increased expression, whereas fusions involving tumor suppressors have the opposite effect. For fusions involving kinases, we found 1,275 with an intact kinase domain, the proportion of which varied significantly across cancer types. Our study suggests that fusions drive the development of 16.5% of cancer cases and function as the sole driver in more than 1% of them. Finally, we identified druggable fusions involving genes such as TMPRSS2, RET, FGFR3, ALK, and ESR1 in 6.0% of cases, and we predicted immunogenic peptides, suggesting that fusions may provide leads for targeted drug and immune therapy. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

A new microcolumn-type microchip for examining the expression of chimeric fusion genes using a nucleic acid sandwich hybridization technique.

PubMed

Ohnishi, Michihiro; Sasaki, Naoyuki; Kishimoto, Takuya; Watanabe, Hidetoshi; Takagi, Masatoshi; Mizutani, Shuki; Kishii, Noriyuki; Yasuda, Akio

2014-11-01

We report a new type of microcolumn installed in a microchip. The architecture allows use of a nucleic acid sandwich hybridization technique to detect a messenger RNA (mRNA) chain as a target. Data are presented that demonstrate that the expression of a chimeric fusion gene can be detected. The microcolumn was filled with semi-transparent microbeads made of agarose gel that acted as carriers, allowing increased efficiency of the optical detection of fluorescence from the microcolumn. The hybrid between the target trapped on the microbeads and a probe DNA labeled with a fluorescent dye was detected by measuring the intensity of the fluorescence from the microcolumn directly. These results demonstrate an easy and simple method for determining the expression of chimeric fusion genes with no preamplification. Copyright © 2014 Elsevier B.V. All rights reserved.

Distinct signatures for mutator sensitivity of lacZ reversions and for the spectrum of lacI/lacO forward mutations on the chromosome of nondividing Escherichia coli.

PubMed Central

Bharatan, Shanti M; Reddy, Manjula; Gowrishankar, J

2004-01-01

A conditional lethal galE(Ts)-based strategy was employed in Escherichia coli, first to eliminate all growth-associated chromosomal reversions in lacZ or forward mutations in lacI/lacO by incubation at the restrictive temperature and subsequently to recover (as papillae) spontaneous mutations that had arisen in the population of nondividing cells after shift to the permissive temperature. Data from lacZ reversion studies in mutator strains indicated that the products of all genes for mismatch repair (mutHLS, dam, uvrD), of some for oxidative damage repair (mutMT), and of that for polymerase proofreading (dnaQ) are required in dividing cells; some others for oxidative damage repair (mutY, nth nei) are required in both dividing and nondividing cells; and those for alkylation damage repair (ada ogt) are required in nondividing cells. The spectrum of lacI/lacO mutations in nondividing cells was distinguished both by lower frequencies of deletions and IS1 insertions and by the unique occurrence of GC-to-AT transitions at lacO +5. In the second approach to study mutations that had occurred in nondividing cells, lacI/lacO mutants were selected as late-arising papillae from the lawn of a galE+ strain; once again, transitions at lacO +5 were detected among the mutants that had been obtained from populations initially grown on poor carbon sources such as acetate, palmitate, or succinate. Our results indicate that the lacO +5 site is mutable only in nondividing cells, one possible mechanism for which might be that random endogenous alkylation (or oxidative) damage to DNA in these cells is efficiently corrected by the Ada Ogt (or Nth Nei) repair enzymes at most sites but not at lacO +5. Furthermore, the late-arising papillae from the second approach were composed almost exclusively of dominant lacI/lacO mutants. This finding lends support to "instantaneous gratification" models in which a spontaneous lesion, occurring at a random site in DNA of a nondividing cell, is most

RegA, an AraC-like protein, is a global transcriptional regulator that controls virulence gene expression in Citrobacter rodentium.

PubMed

Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J; Frankel, Gad; Hartland, Elizabeth L; Robins-Browne, Roy M

2008-11-01

Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5alpha, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization.

RegA, an AraC-Like Protein, Is a Global Transcriptional Regulator That Controls Virulence Gene Expression in Citrobacter rodentium▿

PubMed Central

Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J.; Frankel, Gad; Hartland, Elizabeth L.; Robins-Browne, Roy M.

2008-01-01

Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5α, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization. PMID:18765720

Baculovirus-mediated vascular endothelial growth factor-D(ΔNΔC) gene transfer induces angiogenesis in rabbit skeletal muscle.

PubMed

Heikura, Tommi; Nieminen, Tiina; Roschier, Miia M; Karvinen, Henna; Kaikkonen, Minna U; Mähönen, Anssi J; Lesch, Hanna P; Rissanen, Tuomas T; Laitinen, Olli H; Airenne, Kari J; Ylä-Herttuala, Seppo

2012-01-01

Occluded arteries and ischemic tissues cannot always be treated by angioplasty, stenting or by-pass-surgery. Under such circumstances, viral gene therapy may be useful in inducing increased blood supply to ischemic area. There is evidence of improved blood flow in ischemic skeletal muscle and myocardium in both animal and human studies using adenoviral vascular endothelial growth factor (VEGF) gene therapy. However, the expression is transient and repeated gene transfers with the same vector are inefficient due to immune responses. Different baculoviral vectors pseudotyped with or without vesicular stomatitis virus glycoprotein (VSV-G) and/or carrying woodchuck hepatitis virus post-transcriptional regulatory element (Wpre) were tested both in vitro and in vivo. VEGF-D(ΔNΔC) was used as therapeutic transgene and lacZ as a control. In vivo efficacy was evaluated as capillary enlargement and transgene expression in New Zealand White (NZW) rabbit skeletal muscle. A statistically significant capillary enlargement was detected 6 days after gene transfer in transduced areas compared to the control gene transfers with baculovirus and adenovirus encoding β-galactosidase (lacZ). Substantially improved gene transfer efficiency was achieved with a modified baculovirus pseudotyped with VSV-G and carrying Wpre. Dose escalation experiments revealed that either too large volume or too many virus particles caused inflammation and necrosis in the target tissue, whereas 10(9) plaque forming units injected in multiple aliquots resulted in transgene expression with only mild immune reactions. We show the first evidence of biologically significant baculoviral gene transfer in skeletal muscle of NZW rabbits using VEGF-D(ΔNΔC) as a therapeutic transgene. Copyright © 2012 John Wiley & Sons, Ltd.

SNARE-mediated membrane fusion in autophagy

PubMed Central

Wang, Yongyao; Li, Linsen; Hou, Chen; Lai, Ying; Long, Jiangang; Liu, Jiankang; Zhong, Qing; Diao, Jiajie

2016-01-01

Autophagy, a conserved self-eating process for the bulk degradation of cytoplasmic materials, involves double-membrane autophagosomes formed when an isolation membrane emerges and their direct fusion with lysosomes for degradation. For the early biogenesis of autophagosomes and their later degradation in lysosomes, membrane fusion is necessary, although different sets of genes and autophagy-related proteins involved in distinct fusion steps have been reported. To clarify the molecular mechanism of membrane fusion in autophagy, to not only expand current knowledge of autophagy, but also benefit human health, this review discusses key findings that elucidate the unique membrane dynamics of autophagy. PMID:27422330

Multiple environmental factors regulate the expression of the carbohydrate-selective OprB porin of Pseudomonas aeruginosa.

PubMed

Adewoye, L O; Worobec, E A

1999-12-01

In response to low extracellular glucose concentration, Pseudomonas aeruginosa induces the expression of the outer membrane carbohydrate-selective OprB porin. The promoter region of the oprB gene was cloned into a lacZ transcriptional fusion vector, and the construct was mobilized into P. aeruginosa OprB-deficient strain, WW100, to evaluate additional environmental factors that influence OprB porin gene expression. Growth temperature, pH of the growth medium, salicylate concentration, and carbohydrate source were found to differentially influence porin expression. This expression pattern was compared to those of whole-cell [14C]glucose uptake under conditions of high osmolarity, ionicity, variable pH, growth temperatures, and carbohydrate source. These studies revealed that the high-affinity glucose transport genes are down-regulated by salicylic acid, differentially regulated by pH and temperature, and are specifically responsive to exogenous glucose induction.

Adenylyl cyclase A expression is tip-specific in Dictyostelium slugs and directs StatA nuclear translocation and CudA gene expression.

PubMed

Verkerke-van Wijk, I; Fukuzawa, M; Devreotes, P N; Schaap, P

2001-06-01

cAMP oscillations, generated by adenylyl cyclase A (ACA), coordinate cell aggregation in Dictyostelium and have also been implicated in organizer function during multicellular development. We used a gene fusion of the ACA promoter with a labile lacZ derivative to study the expression pattern of ACA. During aggregation, most cells expressed ACA, but thereafter expression was lost in all cells except those of the anterior tip. Before aggregation, ACA transcription was strongly upregulated by nanomolar cAMP pulses. Postaggregative transcription was sustained by nanomolar cAMP pulses, but downregulated by a continuous micromolar cAMP stimulus and by the stalk-cell-inducing factor DIF. Earlier work showed that the transcription factor StatA displays tip-specific nuclear translocation and directs tip-specific expression of the nuclear protein CudA, which is essential for culmination. Both StatA and CudA were present in nuclei throughout the entire slug in an aca null mutant that expresses ACA from the constitutive actin15 promoter. This suggests that the tip-specific expression of ACA directs tip-specific nuclear translocation of StatA and tip-specific expression of CudA. Copyright 2001 Academic Press.

[Retroviral-mediated transfer of a hygromycin phosphotransferase-thymidine kinase fusion gene into human bladder carcinoma cell].

PubMed

Ye, C; Chen, S; Pei, X; Li, L; Feng, K

1999-08-01

To evaluate the therapeutic efficacy of retroviral-mediated hygromycin phosphotransferase-thymidine kinase fusion gene (HyTK)/GCV on human bladder carcinoma cell. A retroviral expression vector pL (HyTK) SN was constructed. By using FuGENE 6-mediated transfection and "ping-pong effect" technique, high-titer of retroviral supernatant was obtained and HyTK gene was transferred into EJ cells. A retroviral vector encoding, enhanced green fluorescent protein, EGFP was used to rapidly detect the transduction efficiency. Antitumor effects were observed after GCV treatment. In vitro experiments demonstrated the EJ cells transferred by HyTK gene were killed in the GCV treatment. Non-transduced parental cells were not sensitive to GCV, but they were dead by the bystander killing of neighboring cells when mixed with EJ/HyTK cells at various ratios. In addition, this not only affect wild-type EJ cells but also cells from different bladder carcinoma cell lines. Retroviral-mediated HyTK/GCV systems were a promising suicide gene therapy for bladder carcinoma. EGFP may act as a convenient and rapid reporter to monitor retroviral-mediated gene transfer and expression in bladder carcinoma cells.

Beyond ALK-RET, ROS1 and other oncogene fusions in lung cancer

PubMed Central

Nakaoku, Takashi; Tsuta, Koji; Tsuchihara, Katsuya; Matsumoto, Shingo; Yoh, Kiyotaka; Goto, Koichi

2015-01-01

Fusions of the RET and ROS1 protein tyrosine kinase oncogenes with several partner genes were recently identified as new targetable genetic aberrations in cases of non-small cell lung cancer (NSCLC) lacking activating EGFR, KRAS, ALK, BRAF, or HER2 oncogene aberrations. RET and ROS1 fusion-positive tumors are mainly observed in young, female, and/or never smoking patients. Studies based on in vitro and in vivo (i.e., mouse) models and studies of several fusion-positive patients indicate that inhibiting the kinase activity of the RET and ROS1 fusion proteins is a promising therapeutic strategy. Accordingly, there are several ongoing clinical trials aimed at examining the efficacy of tyrosine kinase inhibitors (TKIs) against RET and ROS1 proteins in patients with fusion-positive lung cancer. Other gene fusions (NTRK1, NRG1, and FGFR1/2/3) that are targetable by existing TKIs have also been identified in NSCLCs. Options for personalized lung cancer therapy will be increased with the help of multiplex diagnosis systems able to detect multiple druggable gene fusions. PMID:25870798

Independent evolutionary origins of functional polyamine biosynthetic enzyme fusions catalyzing de novo diamine to triamine formation

PubMed Central

Green, Robert; Hanfrey, Colin C.; Elliott, Katherine A.; McCloskey, Diane E.; Wang, Xiaojing; Kanugula, Sreenivas; Pegg, Anthony E.; Michael, Anthony J.

2011-01-01

Summary We have identified gene fusions of polyamine biosynthetic enzymes S-adenosylmethionine decarboxylase (AdoMetDC, speD) and aminopropyltransferase (speE) orthologues in diverse bacterial phyla. Both domains are functionally active and we demonstrate the novel de novo synthesis of the triamine spermidine from the diamine putrescine by fusion enzymes from β-proteobacterium Delftia acidovorans and δ-proteobacterium Syntrophus aciditrophicus, in a ΔspeDE gene deletion strain of Salmonella enterica sv. Typhimurium. Fusion proteins from marine α-proteobacterium Candidatus Pelagibacter ubique, actinobacterium Nocardia farcinica, chlorobi species Chloroherpeton thalassium, and β-proteobacterium Delftia acidovorans each produce a different profile of non-native polyamines including sym-norspermidine when expressed in Escherichia coli. The different aminopropyltransferase activities together with phylogenetic analysis confirm independent evolutionary origins for some fusions. Comparative genomic analysis strongly indicates that gene fusions arose by merger of adjacent open reading frames. Independent fusion events, and horizontal and vertical gene transfer contributed to the scattered phyletic distribution of the gene fusions. Surprisingly, expression of fusion genes in E. coli and S. Typhimurium revealed novel latent spermidine catabolic activity producing non-native 1,3-diaminopropane in these species. We have also identified fusions of polyamine biosynthetic enzymes agmatine deiminase and N-carbamoylputrescine amidohydrolase in archaea, and of S-adenosylmethionine decarboxylase and ornithine decarboxylase in the single-celled green alga Micromonas. PMID:21762220

Electrotransformation and expression of bacterial genes encoding hygromycin phosphotransferase and beta-galactosidase in the pathogenic fungus Histoplasma capsulatum.

PubMed

Woods, J P; Heinecke, E L; Goldman, W E

1998-04-01

We developed an efficient electrotransformation system for the pathogenic fungus Histoplasma capsulatum and used it to examine the effects of features of the transforming DNA on transformation efficiency and fate of the transforming DNA and to demonstrate fungal expression of two recombinant Escherichia coli genes, hph and lacZ. Linearized DNA and plasmids containing Histoplasma telomeric sequences showed the greatest transformation efficiencies, while the plasmid vector had no significant effect, nor did the derivation of the selectable URA5 marker (native Histoplasma gene or a heterologous Podospora anserina gene). Electrotransformation resulted in more frequent multimerization, other modification, or possibly chromosomal integration of transforming telomeric plasmids when saturating amounts of DNA were used, but this effect was not observed with smaller amounts of transforming DNA. We developed another selection system using a hygromycin B resistance marker from plasmid pAN7-1, consisting of the E. coli hph gene flanked by Aspergillus nidulans promoter and terminator sequences. Much of the heterologous fungal sequences could be removed without compromising function in H. capsulatum, allowing construction of a substantially smaller effective marker fragment. Transformation efficiency increased when nonselective conditions were maintained for a time after electrotransformation before selection with the protein synthesis inhibitor hygromycin B was imposed. Finally, we constructed a readily detectable and quantifiable reporter gene by fusing Histoplasma URA5 with E. coli lacZ, resulting in expression of functional beta-galactosidase in H. capsulatum. Demonstration of expression of bacterial genes as effective selectable markers and reporters, together with a highly efficient electrotransformation system, provide valuable approaches for molecular genetic analysis and manipulation of H. capsulatum, which have proven useful for examination of targeted gene disruption

Regulation of the cnr Cobalt and Nickel Resistance Determinant from Ralstonia sp. Strain CH34†

PubMed Central

Grass, Gregor; Große, Cornelia; Nies, Dietrich H.

2000-01-01

Ralstonia sp. strain CH34 is resistant to nickel and cobalt cations. Resistance is mediated by the cnr determinant located on plasmid pMOL28. The cnr genes are organized in two clusters, cnrYXH and cnrCBA. As revealed by reverse transcriptase PCR and primer extension, transcription from these operons is initiated from promoters located upstream of the cnrY and cnrC genes. These two promoters exhibit conserved sequences at the −10 (CCGTATA) and −35 (CRAGGGGRAG) regions. The CnrH gene product, which is required for expression of both operons, is a sigma factor belonging to the sigma L family, whose activity seems to be governed by the membrane-bound CnrY and CnrX gene products in response to Ni2+. Half-maximal activation from the cnrCBA operon was determined by using appropriate lacZ gene fusions and was shown to occur at an Ni2+ concentration of about 50 μM. PMID:10671463

SNARE-mediated membrane fusion in autophagy.

PubMed

Wang, Yongyao; Li, Linsen; Hou, Chen; Lai, Ying; Long, Jiangang; Liu, Jiankang; Zhong, Qing; Diao, Jiajie

2016-12-01

Autophagy, a conserved self-eating process for the bulk degradation of cytoplasmic materials, involves double-membrane autophagosomes formed when an isolation membrane emerges and their direct fusion with lysosomes for degradation. For the early biogenesis of autophagosomes and their later degradation in lysosomes, membrane fusion is necessary, although different sets of genes and autophagy-related proteins involved in distinct fusion steps have been reported. To clarify the molecular mechanism of membrane fusion in autophagy, to not only expand current knowledge of autophagy, but also benefit human health, this review discusses key findings that elucidate the unique membrane dynamics of autophagy. Copyright © 2016 Elsevier Ltd. All rights reserved.

The MARVEL domain protein, Singles Bar, is required for progression past the pre-fusion complex stage of myoblast fusion.

PubMed

Estrada, Beatriz; Maeland, Anne D; Gisselbrecht, Stephen S; Bloor, James W; Brown, Nicholas H; Michelson, Alan M

2007-07-15

Multinucleated myotubes develop by the sequential fusion of individual myoblasts. Using a convergence of genomic and classical genetic approaches, we have discovered a novel gene, singles bar (sing), that is essential for myoblast fusion. sing encodes a small multipass transmembrane protein containing a MARVEL domain, which is found in vertebrate proteins involved in processes such as tight junction formation and vesicle trafficking where--as in myoblast fusion--membrane apposition occurs. sing is expressed in both founder cells and fusion competent myoblasts preceding and during myoblast fusion. Examination of embryos injected with double-stranded sing RNA or embryos homozygous for ethane methyl sulfonate-induced sing alleles revealed an identical phenotype: replacement of multinucleated myofibers by groups of single, myosin-expressing myoblasts at a stage when formation of the mature muscle pattern is complete in wild-type embryos. Unfused sing mutant myoblasts form clusters, suggesting that early recognition and adhesion of these cells are unimpaired. To further investigate this phenotype, we undertook electron microscopic ultrastructural studies of fusing myoblasts in both sing and wild-type embryos. These experiments revealed that more sing mutant myoblasts than wild-type contain pre-fusion complexes, which are characterized by electron-dense vesicles paired on either side of the fusing plasma membranes. In contrast, embryos mutant for another muscle fusion gene, blown fuse (blow), have a normal number of such complexes. Together, these results lead to the hypothesis that sing acts at a step distinct from that of blow, and that sing is required on both founder cell and fusion-competent myoblast membranes to allow progression past the pre-fusion complex stage of myoblast fusion, possibly by mediating fusion of the electron-dense vesicles to the plasma membrane.

Paediatric and adult soft tissue sarcomas with NTRK1 gene fusions: a subset of spindle cell sarcomas unified by a prominent myopericytic/haemangiopericytic pattern.

PubMed

Haller, Florian; Knopf, Jasmin; Ackermann, Anne; Bieg, Matthias; Kleinheinz, Kortine; Schlesner, Matthias; Moskalev, Evgeny A; Will, Rainer; Satir, Ali Abdel; Abdelmagid, Ibtihalat E; Giedl, Johannes; Carbon, Roman; Rompel, Oliver; Hartmann, Arndt; Wiemann, Stefan; Metzler, Markus; Agaimy, Abbas

2016-04-01

Neoplasms with a myopericytomatous pattern represent a morphological spectrum of lesions encompassing myopericytoma of the skin and soft tissue, angioleiomyoma, myofibromatosis/infantile haemangiopericytoma and putative neoplasms reported as malignant myopericytoma. Lack of reproducible phenotypic and genetic features of malignant myopericytic neoplasms have prevented the establishment of myopericytic sarcoma as an acceptable diagnostic category. Following detection of a LMNA-NTRK1 gene fusion in an index case of paediatric haemangiopericytoma-like sarcoma by combined whole-genome and RNA sequencing, we identified three additional sarcomas harbouring NTRK1 gene fusions, termed 'spindle cell sarcoma, NOS with myo/haemangiopericytic growth pattern'. The patients were two children aged 11 months and 2 years and two adults aged 51 and 80 years. While the tumours of the adults were strikingly myopericytoma-like, but with clear-cut atypical features, the paediatric cases were more akin to infantile myofibromatosis/haemangiopericytoma. All cases contained numerous thick-walled dysplastic-like vessels with segmental or diffuse nodular myxohyaline myo-intimal proliferations of smooth muscle actin-positive cells, occasionally associated with thrombosis. Immunohistochemistry showed variable expression of smooth muscle actin and CD34, but other mesenchymal markers, including STAT6, were negative. This study showed a novel variant of myo/haemangiopericytic sarcoma with recurrent NTRK1 gene fusions. Given the recent introduction of a novel therapeutic approach targeting NTRK fusion-positive neoplasms, recognition of this rare but likely under-reported sarcoma variant is strongly encouraged. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Dramatic response to alectinib in inflammatory myofibroblastic tumor with anaplastic lymphoma kinase fusion gene.

PubMed

Saiki, Masafumi; Ohyanagi, Fumiyoshi; Ariyasu, Ryo; Koyama, Junji; Sonoda, Tomoaki; Nishikawa, Shingo; Kitazono, Satoru; Yanagitani, Noriko; Horiike, Atsushi; Ninomiya, Hironori; Ishikawa, Yuichi; Nishio, Makoto

2017-12-01

Inflammatory myofibroblastic tumor (IMT) is a neoplasm characterized by the proliferaton of myofibroblasts with the infiltration of inflammatory cells. There is no standard treatment for patients with recurrent or metastatic IMT. We describe here a patient with hyper-progressive IMT with an anaplastic lymphoma kinase (ALK) fusion gene that dramatically responded to alectinib without adverse events. His dramatic and enduring response supports the observation that alectinib may be considered a good treatment option for rare aggressive ALK-positive tumors. © The Author 2017. Published by Oxford University Press. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Identification of Alternative Splicing and Fusion Transcripts in Non-Small Cell Lung Cancer by RNA Sequencing.

PubMed

Hong, Yoonki; Kim, Woo Jin; Bang, Chi Young; Lee, Jae Cheol; Oh, Yeon-Mok

2016-04-01

Lung cancer is the most common cause of cancer related death. Alterations in gene sequence, structure, and expression have an important role in the pathogenesis of lung cancer. Fusion genes and alternative splicing of cancer-related genes have the potential to be oncogenic. In the current study, we performed RNA-sequencing (RNA-seq) to investigate potential fusion genes and alternative splicing in non-small cell lung cancer. RNA was isolated from lung tissues obtained from 86 subjects with lung cancer. The RNA samples from lung cancer and normal tissues were processed with RNA-seq using the HiSeq 2000 system. Fusion genes were evaluated using Defuse and ChimeraScan. Candidate fusion transcripts were validated by Sanger sequencing. Alternative splicing was analyzed using multivariate analysis of transcript sequencing and validated using quantitative real time polymerase chain reaction. RNA-seq data identified oncogenic fusion genes EML4-ALK and SLC34A2-ROS1 in three of 86 normal-cancer paired samples. Nine distinct fusion transcripts were selected using DeFuse and ChimeraScan; of which, four fusion transcripts were validated by Sanger sequencing. In 33 squamous cell carcinoma, 29 tumor specific skipped exon events and six mutually exclusive exon events were identified. ITGB4 and PYCR1 were top genes that showed significant tumor specific splice variants. In conclusion, RNA-seq data identified novel potential fusion transcripts and splice variants. Further evaluation of their functional significance in the pathogenesis of lung cancer is required.

Pulmonary lymphoepithelioma-like carcinoma with echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK) fusion gene.

PubMed

Ose, Naoko; Kawai, Teruka; Ishida, Daisuke; Kobori, Yuko; Takeuchi, Yukiyasu; Senba, Hidetoshi

2016-11-01

A pulmonary lymphoepithelioma-like carcinoma (PLELC) is similar to a lymphoepithelioma, a subtype of nasopharyngeal carcinoma and commonly associated with Epstein-Barr virus infection which is a rare tumour and classified in the group of "other and unclassified carcinoma" in the latest 2015 World Health Organization (WHO) classification. Some reports of lymphoepithelioma-like carcinoma (LELC) have noted an epidermal growth factor receptor (EGFR) mutation, whereas none have noted a mutation of the echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase (EML4-ALK) fusion gene. This is the first reported case of PLELC with ALK rearrangement. A 76-year-old woman underwent a right lower lobectomy and complicated partial resection of the upper lobe with lymph node dissection under complete thoracoscopic approach. A histopathological diagnosis of PLELC was made and the stage was classified as T1aN1(#12l) M0, pl0, G2, Ly1, V1. The results of both ALK immunohistochemistry and EML4-ALK fusion gene on fluorescence in situ hybridization (FISH) examinations were positive; however, EGFR mutational analysis results showed wild-type mutation.

Regulation of glutamine synthetase II activity in Rhizobium meliloti 104A14.

PubMed Central

Shatters, R G; Somerville, J E; Kahn, M L

1989-01-01

Most rhizobia contain two glutamine synthetase (GS) enzymes: GSI, encoded by glnA, and GSII, encoded by glnII. We have found that WSU414, a Rhizobium meliloti 104A14 glutamine auxotroph derived from a glnA parental strain, is an ntrA mutant. The R. meliloti glnII promoter region contains DNA sequences similar to those found in front of other genes that require ntrA for their transcription. No GSII was found in the glnA ntrA mutant, and when a translational fusion of glnII to the Escherichia coli lacZ gene was introduced into WSU414, no beta-galactosidase was expressed. These results indicate that ntrA is required for glnII expression. The ntrA mutation did not prevent the expression of GSI. In free-living culture, the level of GSII and of the glnII-lacZ fusion protein was regulated by altering transcription in response to available nitrogen. No GSII protein was detected in alfalfa, pea, or soybean nodules when anti-GSII-specific antiserum was used. Images PMID:2570059

SFPQ/PSF-TFE3 renal cell carcinoma: a clinicopathologic study emphasizing extended morphology and reviewing the differences between SFPQ-TFE3 RCC and the corresponding mesenchymal neoplasm despite an identical gene fusion.

PubMed

Wang, Xiao-Tong; Xia, Qiu-Yuan; Ni, Hao; Ye, Sheng-Bing; Li, Rui; Wang, Xuan; Shi, Shan-Shan; Zhou, Xiao-Jun; Rao, Qiu

2017-05-01

Xp11 translocation renal cell carcinoma (RCC) with SFPQ/PSF-TFE3 gene fusion is a rare epithelial tumor. Of note, the appearance of the gene fusion does not necessarily mean that it is renal cell carcinoma. The corresponding mesenchymal neoplasms, including Xp11 neoplasm with melanocytic differentiation, TFE3 rearrangement-associated perivascular epithelioid cell tumor (PEComa) and melanotic Xp11 translocation renal cancer, can also harbor the identical gene fusion. However, the differences between Xp11 translocation RCC and the corresponding mesenchymal neoplasm have only recently been described. Herein, we examined 5 additional cases of SFPQ-TFE3 RCCs using clinicopathologic, immunohistochemical, and molecular analyses. One tumor had the typical morphologic features of SFPQ-TFE3 RCC, whereas other 3 cases demonstrated the unusual morphologic features associated with pseudorosettes formation or clusters of smaller cells, mimicking TFEB RCC. The remaining one showed branching tubules and papillary structure composed of clear and eosinophilic tumor cells. Immunohistochemically, all 5 cases demonstrated moderate (2+) or strong (3+) positive staining for TFE3, PAX-8 and CD10, whereas no cases demonstrated TFEB, Cathepsin K, CA-IX, CK7, Melan-A, or HMB-45 expression. Genetically, the fusion transcripts were identified in 3 cases by reverse-transcription polymerase chain reaction (RT-PCR). On the basis of fluorescence in situ hybridization (FISH) analysis, all the cases were detected with SFPQ-TFE3 gene fusion. Clinical follow-up data were available for all the patients, and no one developed tumor recurrence, progression, or metastasis. We also review the differences between SFPQ-TFE3 RCC and the corresponding mesenchymal neoplasm despite the identical gene fusion. The presence of pseudorosettes also expands the known histological features of SFPQ-TFE3 RCC. Copyright © 2017 Elsevier Inc. All rights reserved.

FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events.

PubMed

Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J P; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok

2015-01-01

Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain-domain interactions, protein-protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist's mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop 'novel' therapeutic approaches. Database URL: http://ppi.bioinfo.asia.edu.tw/FARE-CAFE. © The Author(s) 2015. Published by Oxford University Press.

FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events

PubMed Central

Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J. P.; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok

2015-01-01

Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain–domain interactions, protein–protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist’s mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop ‘novel’ therapeutic approaches. Database URL: http://ppi.bioinfo.asia.edu.tw/FARE-CAFE PMID:26384373

A rapid and efficient newly established method to detect COL1A1-PDGFB gene fusion in dermatofibrosarcoma protuberans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yokoyama, Yoko; Shimizu, Akira; Okada, Etsuko

Highlights: Black-Right-Pointing-Pointer We developed new method to rapidly identify COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer New PCR method using a single primer pair detected COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer This is the first report of DFSP with a novel COL1A1 breakpoint in exon 5. -- Abstract: The detection of fusion transcripts of the collagen type 1{alpha}1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes by genetic analysis has recognized as a reliable and valuable molecular tool for the diagnosis of dermatofibrosarcoma protuberans (DFSP). To detect the COL1A1-PDGFB fusion, almost previous reports performed reverse transcription polymerase chain reaction (RT-PCR) using multiplex forward primersmore » from COL1A1. However, it has possible technical difficulties with respect to the handling of multiple primers and reagents in the procedure. The objective of this study is to establish a rapid, easy, and efficient one-step method of PCR using only a single primer pair to detect the fusion transcripts of the COL1A1 and PDGFB in DFSP. To validate new method, we compared the results of RT-PCR in five patients of DFSP between the previous method using multiplex primers and our established one-step RT-PCR using a single primer pair. In all cases of DFSP, the COL1A1-PDGFB fusion was detected by both previous method and newly established one-step PCR. Importantly, we detected a novel COL1A1 breakpoint in exon 5. The newly developed method is valuable to rapidly identify COL1A1-PDGFB fusion transcripts in DFSP.« less

Prostate Cancer Evaluation: Design, Synthesis and Evaluation of Novel Enzyme-Activated Proton MRI Contrast Agents

DTIC Science & Technology

2009-10-01

NUMBER E -Mail: 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER...transcriptional activation, protein expression, and protein interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most...1) Cell preparation (a) Stably transfected PC3 cell line: E . coli lacZ gene (from pSV-β-gal vector, Promega, Madison,WI) was inserted into high

Liposomal gene transfer of keratinocyte growth factor improves wound healing by altering growth factor and collagen expression.

PubMed

Pereira, Clifford T; Herndon, David N; Rocker, Roland; Jeschke, Marc G

2007-05-15

Growth factors affect the complex cascade of wound healing; however, interaction between different growth factors during dermal and epidermal regeneration are still not entirely defined. In the present study, we thought to determine the interaction between keratinocyte growth factor (KGF) administered as liposomal cDNA with other dermal and epidermal growth factors and collagen synthesis in an acute wound. Rats received an acute wound and were divided into two groups to receive weekly subcutaneous injections of liposomes plus the Lac-Z gene (0.22 microg, vehicle), or liposomes plus the KGF cDNA (2.2 microg) and Lac-Z gene (0.22 microg). Histological and immunohistochemical techniques were used to determine growth factor, collagen expression, and dermal and epidermal structure. KGF cDNA increased insulin-like growth factor-I (IGF-I), insulin-like growth factor binding protein-3 (IGFBP-3), and fibroblast growth factor (FGF), decreased transforming growth factor-beta (TGF-beta), while it had no effect on platelet-derived growth factor (PDGF) levels in the wound. KGF cDNA significantly increased collagen Type IV at both the wound edge as well as the wound bed, while it had no effect on collagen Type I and III. KGF cDNA increased re-epithelialization, improved dermal regeneration, and increased neovascularization. Exogenous administered KGF cDNA causes increases in IGF-I, IGF-BP3, FGF, and collagen IV and decreases TGF-beta concentration. KGF gene transfer accelerates wound healing without causing an increase in collagen I or III.

KIAA1549-BRAF fusions and IDH mutations can coexist in diffuse gliomas of adults.

PubMed

Badiali, Manuela; Gleize, Vincent; Paris, Sophie; Moi, Loredana; Elhouadani, Selma; Arcella, Antonietta; Morace, Roberta; Antonelli, Manila; Buttarelli, Francesca Romana; Figarella-Branger, Dominique; Kim, Young-Ho; Ohgaki, Hiroko; Mokhtari, Karima; Sanson, Marc; Giangaspero, Felice

2012-11-01

KIAA1549-BRAF fusion gene and isocitrate dehydrogenase (IDH) mutations are considered two mutually exclusive genetic events in pilocytic astrocytomas and diffuse gliomas, respectively. We investigated the presence of the KIAA1549-BRAF fusion gene in conjunction with IDH mutations and 1p/19q loss in 185 adult diffuse gliomas. Moreover BRAF(v600E) mutation was also screened. The KIAA1549-BRAF fusion gene was evaluated by reverse-transcription polymerase chain reaction (RT-PCR) and sequencing. We found IDH mutations in 125 out 175 cases (71.4%). There were KIAA1549-BRAF fusion gene in 17 out of 180 (9.4%) cases and BRAF(v600E) in 2 out of 133 (1.5%) cases. In 11 of these 17 cases, both IDH mutations and the KIAA1549-BRAF fusion were present, as independent molecular events. Moreover, 6 of 17 cases showed co-presence of 1p/19q loss, IDH mutations and KIAA1549-BRAF fusion. Among the 17 cases with KIAA1549-BRAF fusion gene 15 (88.2%) were oligodendroglial neoplasms. Similarly, the two cases with BRAF(v600E) mutation were both oligodendroglioma and one had IDH mutations and 1p/19q co-deletion. Our results suggest that in a small fraction of diffuse gliomas, KIAA1549-BRAF fusion gene and BRAF(v600E) mutation may be responsible for deregulation of the Ras-RAF-ERK signaling pathway. Such alterations are more frequent in oligodendroglial neoplasm and may be co-present with IDH mutations and 1p/19q loss. © 2012 The Authors; Brain Pathology © 2012 International Society of Neuropathology.

Antibody-independent Targeted Quantification of TMPRSS2-ERG Fusion Protein Products in Prostate Cancer

DOE Office of Scientific and Technical Information (OSTI.GOV)

He, Jintang; Sun, Xuefei; Shi, Tujin

2014-10-01

Fusions between the transmembrane protease serine 2 (TMPRSS2) and ETS related gene (ERG) represent one of the most specific biomarkers that define a distinct molecular subtype of prostate cancer. The studies on TMPRSS2-ERG gene fusions have seldom been performed at the protein level, primarily due to the lack of high-quality antibodies or an antibody-independent method that is sufficiently sensitive for detecting the truncated ERG protein products resulting from TMPRSS2-ERG gene fusions and alternative splicing. Herein, we applied a recently developed PRISM (high-pressure high-resolution separations with intelligent selection and multiplexing)-SRM (selected reaction monitoring) strategy for quantifying ERG protein in prostate cancermore » cell lines and tumors. The highly sensitive PRISM-SRM assays led to confident detection of 6 unique ERG peptides in either the TMPRSS2-ERG positive cell lines or tissues but not in the negative controls, indicating that ERG protein expression is highly correlated with TMPRSS2-ERG gene rearrangements. Significantly, our results demonstrated for the first time that at least two groups of ERG protein isoforms were simultaneously expressed at variable levels in TMPRSS2-ERG positive samples as evidenced by concomitant detection of two mutually exclusive peptides. Three peptides shared across almost all fusion protein products were determined to be the most abundant peptides, and hence can be used as “signature” peptides for detecting ERG overexpression resulting from TMPRSS2-ERG gene fusion. These PRISM-SRM assays provide valuable tools for studying TMPRSS2-ERG gene fusion protein products, thus improving our understanding of the role of TMPRSS2-ERG gene fusion in the biology of prostate cancer.« less

Menin-MLL inhibitors reverse oncogenic activity of MLL fusion proteins in leukemia.

PubMed

Grembecka, Jolanta; He, Shihan; Shi, Aibin; Purohit, Trupta; Muntean, Andrew G; Sorenson, Roderick J; Showalter, Hollis D; Murai, Marcelo J; Belcher, Amalia M; Hartley, Thomas; Hess, Jay L; Cierpicki, Tomasz

2012-01-29

Translocations involving the mixed lineage leukemia (MLL) gene result in human acute leukemias with very poor prognosis. The leukemogenic activity of MLL fusion proteins is critically dependent on their direct interaction with menin, a product of the multiple endocrine neoplasia (MEN1) gene. Here we present what are to our knowledge the first small-molecule inhibitors of the menin-MLL fusion protein interaction that specifically bind menin with nanomolar affinities. These compounds effectively reverse MLL fusion protein-mediated leukemic transformation by downregulating the expression of target genes required for MLL fusion protein oncogenic activity. They also selectively block proliferation and induce both apoptosis and differentiation of leukemia cells harboring MLL translocations. Identification of these compounds provides a new tool for better understanding MLL-mediated leukemogenesis and represents a new approach for studying the role of menin as an oncogenic cofactor of MLL fusion proteins. Our findings also highlight a new therapeutic strategy for aggressive leukemias with MLL rearrangements.

Targeted Deletion of the Antisilencer/Enhancer (ASE) Element from Intron 1 of the Myelin Proteolipid Protein Gene (Plp1) in Mouse Reveals that the Element Is Dispensable for Plp1 Expression in Brain during Development and Remyelination

PubMed Central

Pereira, Glauber B.; Meng, Fanxue; Kockara, Neriman T.; Yang, Baoli; Wight, Patricia A.

2012-01-01

Myelin proteolipid protein gene (Plp1) expression is temporally regulated in brain, which peaks during the active myelination period of CNS development. Previous studies with Plp1-lacZ transgenic mice demonstrated that (mouse) Plp1 intron 1 DNA is required for high levels of expression in oligodendrocytes. Deletion-transfection analysis revealed the intron contains a single positive regulatory element operative in the N20.1 oligodendroglial cell line, which was named ASE (antisilencer/enhancer) based on its functional properties in these cells. To investigate the role of the ASE in vivo, the element was deleted from the native gene in mouse using a Cre/lox strategy. While removal of the ASE from Plp1-lacZ constructs profoundly decreased expression in transfected oligodendroglial cell lines (N20.1 and Oli-neu), the element was dispensable to achieve normal levels of Plp1 gene expression in mouse during development (except perhaps at postnatal day 15) and throughout the remyelination period following cuprizone-induced (acute) demyelination. Thus, it is possible that the ASE is nonfunctional in vivo, or that loss of the ASE from the native gene in mouse can be compensated for by the presence of other regulatory elements within the Plp1 gene. PMID:23157328

Targeted deletion of the antisilencer/enhancer (ASE) element from intron 1 of the myelin proteolipid protein gene (Plp1) in mouse reveals that the element is dispensable for Plp1 expression in brain during development and remyelination.

PubMed

Pereira, Glauber B; Meng, Fanxue; Kockara, Neriman T; Yang, Baoli; Wight, Patricia A

2013-02-01

Myelin proteolipid protein gene (Plp1) expression is temporally regulated in brain, which peaks during the active myelination period of CNS development. Previous studies with Plp1-lacZ transgenic mice demonstrated that (mouse) Plp1 intron 1 DNA is required for high levels of expression in oligodendrocytes. Deletion-transfection analysis revealed the intron contains a single positive regulatory element operative in the N20.1 oligodendroglial cell line, which was named ASE (antisilencer/enhancer) based on its functional properties in these cells. To investigate the role of the ASE in vivo, the element was deleted from the native gene in mouse using a Cre/lox strategy. Although removal of the ASE from Plp1-lacZ constructs profoundly decreased expression in transfected oligodendroglial cell lines (N20.1 and Oli-neu), the element was dispensable to achieve normal levels of Plp1 gene expression in mouse during development (except perhaps at postnatal day 15) and throughout the remyelination period following cuprizone-induced (acute) demyelination. Thus, it is possible that the ASE is non-functional in vivo, or that loss of the ASE from the native gene in mouse can be compensated for by the presence of other regulatory elements within the Plp1 gene. © 2012 International Society for Neurochemistry.

Establishment of cells to monitor Microprocessor through fusion genes of microRNA and GFP

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tsutsui, Motomu; Hasegawa, Hitoki; Adachi, Koichi

Microprocessor, the complex of Drosha and DGCR8, promotes the processing of primary microRNA to precursor microRNA, which is a crucial step for microRNA maturation. So far, no convenient assay systems have been developed for observing this step in vivo. Here we report the establishment of highly sensitive cellular systems where we can visually monitor the function of Microprocessor. During a series of screening of transfectants with fusion genes of the EGFP cDNA and primary microRNA genes, we have obtained certain cell lines where introduction of siRNA against DGCR8 or Drosha strikingly augments GFP signals. In contrast, these cells have notmore » responded to Dicer siRNA; thus they have a unique character that GFP signals should be negatively and specifically correlated to the action of Microprocessor among biogenesis of microRNA. These cell lines can be useful tools for real-time analysis of Microprocessor action in vivo and identifying its novel modulators.« less

Minigene-like inhibition of protein synthesis mediated by hungry codons near the start codon

PubMed Central

Jacinto-Loeza, Eva; Vivanco-Domínguez, Serafín; Guarneros, Gabriel; Hernández-Sánchez, Javier

2008-01-01

Rare AGA or AGG codons close to the initiation codon inhibit protein synthesis by a tRNA-sequestering mechanism as toxic minigenes do. To further understand this mechanism, a parallel analysis of protein synthesis and peptidyl-tRNA accumulation was performed using both a set of lacZ constructs where AGAAGA codons were moved codon by codon from +2, +3 up to +7, +8 positions and a series of 3–8 codon minigenes containing AGAAGA codons before the stop codon. β-Galactosidase synthesis from the AGAAGA lacZ constructs (in a Pth defective in vitro system without exogenous tRNA) diminished as the AGAAGA codons were closer to AUG codon. Likewise, β-galactosidase expression from the reporter +7 AGA lacZ gene (plus tRNA, 0.25 μg/μl) waned as the AGAAGAUAA minigene shortened. Pth counteracted both the length-dependent minigene effect on the expression of β-galactosidase from the +7 AGA lacZ reporter gene and the positional effect from the AGAAGA lacZ constructs. The +2, +3 AGAAGA lacZ construct and the shortest +2, +3 AGAAGAUAA minigene accumulated the highest percentage of peptidyl-tRNAArg4. These observations lead us to propose that hungry codons at early positions, albeit with less strength, inhibit protein synthesis by a minigene-like mechanism involving accumulation of peptidyl-tRNA. PMID:18583364

[Construction and expression of recombinant human serum albumin-EPO fusion protein].

PubMed

Huang, Ying-Chun; Gou, Xing-Hua; Han, Lei; Li, De-Hua; Zhao, Lan-Ying; Wu, Qia-Qing

2011-05-01

OBJECTIVE To construct the recombinant plasmid pCI-HLE encoding human serum album-EPO (HSA-EPO) fusion protein and to express it in CHO cell. The cDNA encoding human serum album and EPO were amplified by PCR, and then spliced with the synsitic DNA fragment encoding GS (GGGGS), by overlap PCR extension to form LEPO. After BamH I digestion, the HSA and LEPO was ligated to generate the fusion HSA-EPO gene and was then cloned into the expression vector pCI-neo to generate the recombinant plasmid pCI-HLE. The plasmid pCI-HLE was transfected into CHO cell by liposome protocol. Then, the recombinant cells were screened by G418 and identified by PCR and Western blot. Expression of fusion protein was evaluated by Enzyme Linked Immunosorbent Assay (ELISA). Restrictive enzymes digestion and DNA sequencing revealed that HSA-EPO fusion gene was cloned into expression vector pCI-neo successfully. PCR and Western blot analysis confirmed that the fusion gene was integrated in the genome of CHO cells and expressed successfully. The HSA-EPO production varied from 86 Iu/(mL x 10(6) x 72 h) to 637 IU/(mLx 10(6) x 72 h). The results confirmed that HSA-EPO fusion gene can be expressed in the CHO cells, with EPO immunogenicity, which could serve as foundation for the development of long-lasting recombinant HSA-EPO protein.

ETS Gene Fusions as Predictive Biomarkers of Resistance to Radiation Therapy for Prostate Cancer

DTIC Science & Technology

2016-05-01

science   seminars,   hosted   by   the   Departments   Medicine,   and  Molecular   and  Cellular  Biology,  which  have  broadened  by   scientific... knowledge   within   my   field.   I   have   also   regularly   attended   Gene   Fusion   and   Cancer   Biology   Research   Meetings,  run  by...the  ASTRO  annual   meeting.    Finally,   I  have  met   regularly  with  my  mentors,  Drs.  Arul  Chinnaiyan,  Ted  Lawrence,   and  Tom   Carey

A dual function fusion protein of Herpes simplex virus type 1 thymidine kinase and firefly luciferase for noninvasive in vivo imaging of gene therapy in malignant glioma.

PubMed

Söling, Ariane; Theiss, Christian; Jungmichel, Stephanie; Rainov, Nikolai G

2004-08-04

BACKGROUND: Suicide gene therapy employing the prodrug activating system Herpes simplex virus type 1 thymidine kinase (HSV-TK)/ ganciclovir (GCV) has proven to be effective in killing experimental brain tumors. In contrast, glioma patients treated with HSV-TK/ GCV did not show significant treatment benefit, most likely due to insufficient transgene delivery to tumor cells. Therefore, this study aimed at developing a strategy for real-time noninvasive in vivo monitoring of the activity of a therapeutic gene in brain tumor cells. METHODS: The HSV-TK gene was fused to the firefly luciferase (Luc) gene and the fusion construct HSV-TK-Luc was expressed in U87MG human malignant glioma cells. Nude mice with subcutaneous gliomas stably expressing HSV-TK-Luc were subjected to GCV treatment and tumor response to therapy was monitored in vivo by serial bioluminescence imaging. Bioluminescent signals over time were compared with tumor volumes determined by caliper. RESULTS: Transient and stable expression of the HSV-TK-Luc fusion protein in U87MG glioma cells demonstrated close correlation of both enzyme activities. Serial optical imaging of tumor bearing mice detected in all cases GCV induced death of tumor cells expressing the fusion protein and proved that bioluminescence can be reliably used for repetitive and noninvasive quantification of HSV-TK/ GCV mediated cell kill in vivo. CONCLUSION: This approach may represent a valuable tool for the in vivo evaluation of gene therapy strategies for treatment of malignant disease.

Detection of osteoclastic cell-cell fusion through retroviral vector packaging.

PubMed

Kondo, Takako; Ikeda, Kyoji; Matsuo, Koichi

2004-11-01

Cell-cell fusion generates multinucleated cells such as osteoclasts in bone, myotubes in muscle, and trophoblasts in placenta. Molecular details governing these fusion processes are still largely unknown. As a step toward identification of fusogenic genes, we tested the concept that retroviral vectors can be packaged as a result of cell-cell fusion. First, we introduced replication-deficient retroviral vectors expressing mCAT-1, which mediates fusogenic interaction with the retroviral envelope protein Env, into Chinese hamster ovary (CHO) cells to generate vector cells. Plasmids expressing virion proteins Gag, Pol, and Env were introduced into a separate culture of CHO cells to generate packaging cells. Co-culturing vector and packaging cells resulted in production of infectious retroviruses carrying the mCAT-1 gene as a consequence of cell-cell fusion. Second, we introduced a retroviral vector into primary osteoclast precursors and co-cultured them with established osteoclast precursor RAW264.7 cells, which turned out to harbor packaging activity. Packaged retroviral vector was detected in culture supernatants only where the osteoclast differentiation factor receptor activator for NF-kappaB ligand (RANKL) induced fusion between these two cell types. These data suggest that retrovirus production can occur as a result of cell-cell fusion. This provides a novel approach for isolating and characterizing fusogenic genes using retroviral expression vectors.

[Renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusions: a study of 11 cases and review of literature].

PubMed

Rao, Qiu; Zhou, Xiao-jun; Wu, Bo; Ma, Heng-hui; Zhou, Hang-bo; Liu, Xiao-hong; Chen, Jie-yu

2007-04-01

To study the clinicopathologic features, differential diagnosis and prognosis of renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusions. The histopathologic findings and immunophenotype of 11 cases of renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusions were studied. Follow-up data (ranged from 10 to 112 months) were also analyzed. There were a total of 7 females and 4 males. The age of patients ranged from 8 to 26 years (mean = 16.3 years). The diameter of the tumors varied from 2.5 to 6.0 cm. Histologically, two morphologic patterns were seen. The first pattern consisted of alveolar, papillary or nested architecture. The tumor cells contained voluminous, clear to eosinophilic cytoplasm, distinct cell borders, vesicular chromatin, and prominent nucleoli. Psammoma bodies were frequently found and could be abundant. In contrast, the second pattern was composed of nested and compact architecture. The tumor cells possessed less abundant cytoplasm and inconspicuous nucleoli. Few psammoma bodies were detected. Immunohistochemical study showed that all cases strongly expressed TFE3, CD10 and P504s. Variable positivity for pan-cytokeratin, epithelial membrane antigen and vimentin was also noted. None of them expressed CK7, Ksp-cadherin and CD117. Renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusions is a newly described but rarely encountered subtype of renal cell carcinoma. Pathologic diagnosis can be established when taken age of the patients, histopathologic findings and immunoreactivity for TFE3 protein into consideration.

Characterization of Novel Plant Symbiosis Mutants Using a New Multiple Gene-Expression Reporter Sinorhizobium meliloti Strain

PubMed Central

Lang, Claus; Smith, Lucinda S.; Haney, Cara H.; Long, Sharon R.

2018-01-01

The formation of nitrogen fixing root nodules by Medicago truncatula and Sinorhizobium meliloti requires communication between both organisms and coordinated differentiation of plant and bacterial cells. After an initial signal exchange, the bacteria invade the tissue of the growing nodule via plant-derived tubular structures, called infection threads. The bacteria are released from the infection threads into invasion-competent plant cells, where they differentiate into nitrogen-fixing bacteroids. Both organisms undergo dramatic transcriptional, metabolic and morphological changes during nodule development. To identify plant processes that are essential for the formation of nitrogen fixing nodules after nodule development has been initiated, large scale mutageneses have been conducted to discover underlying plant symbiosis genes. Such screens yield numerous uncharacterized plant lines with nitrogen fixation deficient nodules. In this study, we report construction of a S. meliloti strain carrying four distinct reporter constructs to reveal stages of root nodule development. The strain contains a constitutively expressed lacZ reporter construct; a PexoY-mTFP fusion that is expressed in infection threads but not in differentiated bacteroids; a PbacA-mcherry construct that is expressed in infection threads and during bacteroid differentiation; and a PnifH-uidA construct that is expressed during nitrogen fixation. We used this strain together with fluorescence microscopy to study nodule development over time in wild type nodules and to characterize eight plant mutants from a fast neutron bombardment screen. Based on the signal intensity and the localization patterns of the reporter genes, we grouped mutants with similar phenotypes and placed them in a developmental context. PMID:29467773

Characterization of Novel Plant Symbiosis Mutants Using a New Multiple Gene-Expression Reporter Sinorhizobium meliloti Strain.

PubMed

Lang, Claus; Smith, Lucinda S; Long, Sharon R

2018-01-01

The formation of nitrogen fixing root nodules by Medicago truncatula and Sinorhizobium meliloti requires communication between both organisms and coordinated differentiation of plant and bacterial cells. After an initial signal exchange, the bacteria invade the tissue of the growing nodule via plant-derived tubular structures, called infection threads. The bacteria are released from the infection threads into invasion-competent plant cells, where they differentiate into nitrogen-fixing bacteroids. Both organisms undergo dramatic transcriptional, metabolic and morphological changes during nodule development. To identify plant processes that are essential for the formation of nitrogen fixing nodules after nodule development has been initiated, large scale mutageneses have been conducted to discover underlying plant symbiosis genes. Such screens yield numerous uncharacterized plant lines with nitrogen fixation deficient nodules. In this study, we report construction of a S. meliloti strain carrying four distinct reporter constructs to reveal stages of root nodule development. The strain contains a constitutively expressed lacZ reporter construct; a P exoY -mTFP fusion that is expressed in infection threads but not in differentiated bacteroids; a P bacA -mcherry construct that is expressed in infection threads and during bacteroid differentiation; and a P nifH -uidA construct that is expressed during nitrogen fixation. We used this strain together with fluorescence microscopy to study nodule development over time in wild type nodules and to characterize eight plant mutants from a fast neutron bombardment screen. Based on the signal intensity and the localization patterns of the reporter genes, we grouped mutants with similar phenotypes and placed them in a developmental context.

Nodular fasciitis: a novel model of transient neoplasia induced by MYH9-USP6 gene fusion.

PubMed

Erickson-Johnson, Michele R; Chou, Margaret M; Evers, Barbara R; Roth, Christopher W; Seys, Amber R; Jin, Long; Ye, Ying; Lau, Alan W; Wang, Xiaoke; Oliveira, Andre M

2011-10-01

Nodular fasciitis (NF) is a relatively common mass-forming and self-limited subcutaneous pseudosarcomatous myofibroblastic proliferation of unknown pathogenesis. Due to its rapid growth and high mitotic activity, NF is often misdiagnosed as a sarcoma. While studying the USP6 biology in aneurysmal bone cyst and other mesenchymal tumors, we identified high expression levels of USP6 mRNA in two examples of NF. This finding led us to further examine the mechanisms underlying USP6 overexpression in these lesions. Upon subsequent investigation, genomic rearrangements of the USP6 locus were found in 92% (44 of 48) of NF. Rapid amplification of 5'-cDNA ends identified MYH9 as the translocation partner. RT-PCR and direct sequencing revealed the fusion of the MYH9 promoter region to the entire coding region of USP6. Control tumors and tissues were negative for this fusion. Xenografts of cells overexpressing USP6 in nude mice exhibited clinical and histological features similar to human NF. The identification of a sensitive and specific abnormality in NF holds the potential to be used diagnostically. Considering the self-limited nature of the lesion, NF may represent a model of 'transient neoplasia', as it is, to our knowledge, the first example of a self-limited human disease characterized by a recurrent somatic gene fusion event. © 2011 USCAP, Inc All rights reserved

Telomeres and mechanisms of Robertsonian fusion.

PubMed

Slijepcevic, P

1998-05-01

The Robertsonian (Rb) fusion, a chromosome rearrangement involving centric fusion of two acro-(telo)centric chromosomes to form a single metacentric, is one of the most frequent events in mammalian karyotype evolution. Since one of the functions of telomeres is to preserve chromosome integrity, a prerequisite for the formation of Rb fusions should be either telomere loss or telomere inactivation. Possible mechanisms underlying the formation of various types of Rb fusion are discussed here. For example, Rb fusion in wild mice involves complete loss of p-arm telomeres by chromosome breakage within minor satellite sequences. By contrast, interstitial telomeric sites are found in the pericentromeric regions of chromosomes originating from a number of vertebrate species, suggesting the occurrence of Rb-like fusion without loss of telomeres, a possibility consistent with some form of telomere inactivation. Finally, a recent study suggests that telomere shortening induced by the deletion of the telomerase RNA gene in the mouse germ-line leads to telomere loss and high frequencies of Rb fusion in mouse somatic cells. Thus, at least three mechanisms in mammalian cells lead to the formation of Rb fusions.

Construction of fusion vectors of corynebacteria: expression of glutathione-S-transferase fusion protein in Corynebacterium acetoacidophilum ATCC 21476.

PubMed

Srivastava, Preeti; Deb, J K

2002-07-02

A series of fusion vectors containing glutathione-S-transferase (GST) were constructed by inserting GST fusion cassette of Escherichia coli vectors pGEX4T-1, -2 and -3 in corynebacterial vector pBK2. Efficient expression of GST driven by inducible tac promoter of E. coli was observed in Corynebacterium acetoacidophilum. Fusion of enhanced green fluorescent protein (EGFP) and streptokinase genes in this vector resulted in the synthesis of both the fusion proteins. The ability of this recombinant organism to produce several-fold more of the product in the extracellular medium than in the intracellular space would make this system quite attractive as far as the downstream processing of the product is concerned.

Temsirolimus in the treatment of renal cell carcinoma associated with Xp11.2 translocation/TFE gene fusion proteins: a case report and review of literature.

PubMed

Parikh, Jigarkumar; Coleman, Teresa; Messias, Nidia; Brown, James

2009-12-28

Xp11.2 translocation renal cell carcinomas (TRCCs) are a rare family of tumors newly recognized by the World Health Organization (WHO) in 2004. These tumors result in the fusion of partner genes to the TFE3 gene located on Xp11.2. They are most common in the pediatric population, but have been recently implicated in adult renal cell carcinoma (RCC) presenting at an early age. TFE3-mediated direct transcriptional upregulation of the Met tyrosine kinase receptor triggers dramatic activation of downstream signaling pathways including the protein kinase B (Akt)/phosphatidylinositol-3 kinase (PI3K) and mammalian target of rapamycin (mTOR) pathways. Temsirolimus is an inhibitor of mammalian target of rapamycin (mTOR) kinase, a component of intracellular signaling pathways involved in the growth and proliferation of malignant cells. Here we present a case of a 22-year old female who has been treated with temsirolimus for her Xp11.2/TFE3 gene fusion RCC.

Temsirolimus in the treatment of renal cell carcinoma associated with Xp11.2 translocation/TFE gene fusion proteins: a case report and review of literature

PubMed Central

Parikh, Jigarkumar; Coleman, Teresa; Messias, Nidia; Brown, James

2009-01-01

Xp11.2 translocation renal cell carcinomas (TRCCs) are a rare family of tumors newly recognized by the World Health Organization (WHO) in 2004. These tumors result in the fusion of partner genes to the TFE3 gene located on Xp11.2. They are most common in the pediatric population, but have been recently implicated in adult renal cell carcinoma (RCC) presenting at an early age. TFE3-mediated direct transcriptional upregulation of the Met tyrosine kinase receptor triggers dramatic activation of downstream signaling pathways including the protein kinase B (Akt)/phosphatidylinositol-3 kinase (PI3K) and mammalian target of rapamycin (mTOR) pathways. Temsirolimus is an inhibitor of mammalian target of rapamycin (mTOR) kinase, a component of intracellular signaling pathways involved in the growth and proliferation of malignant cells. Here we present a case of a 22-year old female who has been treated with temsirolimus for her Xp11.2/TFE3 gene fusion RCC. PMID:21139932

Recurrent hyperactive ESR1 fusion proteins in endocrine therapy-resistant breast cancer

PubMed Central

Trabucco, S E; Priedigkeit, N; Parachoniak, C A; Vanden Borre, P; Morley, S; Rosenzweig, M; Gay, L M; Goldberg, M E; Suh, J; Ali, S M; Ross, J; Leyland-Jones, B; Young, B; Williams, C; Park, B; Tsai, M; Haley, B; Peguero, J; Callahan, R D; Sachelarie, I; Cho, J; Atkinson, J M; Bahreini, A; Nagle, A M; Puhalla, S L; Watters, R J; Erdogan-Yildirim, Z; Cao, L; Oesterreich, S; Mathew, A; Lucas, P C; Davidson, N E; Brufsky, A M; Frampton, G M; Stephens, P J; Chmielecki, J; Lee, A V

2018-01-01

Abstract Background Estrogen receptor-positive (ER-positive) metastatic breast cancer is often intractable due to endocrine therapy resistance. Although ESR1 promoter switching events have been associated with endocrine-therapy resistance, recurrent ESR1 fusion proteins have yet to be identified in advanced breast cancer. Patients and methods To identify genomic structural rearrangements (REs) including gene fusions in acquired resistance, we undertook a multimodal sequencing effort in three breast cancer patient cohorts: (i) mate-pair and/or RNAseq in 6 patient-matched primary-metastatic tumors and 51 metastases, (ii) high coverage (>500×) comprehensive genomic profiling of 287–395 cancer-related genes across 9542 solid tumors (5216 from metastatic disease), and (iii) ultra-high coverage (>5000×) genomic profiling of 62 cancer-related genes in 254 ctDNA samples. In addition to traditional gene fusion detection methods (i.e. discordant reads, split reads), ESR1 REs were detected from targeted sequencing data by applying a novel algorithm (copyshift) that identifies major copy number shifts at rearrangement hotspots. Results We identify 88 ESR1 REs across 83 unique patients with direct confirmation of 9 ESR1 fusion proteins (including 2 via immunoblot). ESR1 REs are highly enriched in ER-positive, metastatic disease and co-occur with known ESR1 missense alterations, suggestive of polyclonal resistance. Importantly, all fusions result from a breakpoint in or near ESR1 intron 6 and therefore lack an intact ligand binding domain (LBD). In vitro characterization of three fusions reveals ligand-independence and hyperactivity dependent upon the 3′ partner gene. Our lower-bound estimate of ESR1 fusions is at least 1% of metastatic solid breast cancers, the prevalence in ctDNA is at least 10× enriched. We postulate this enrichment may represent secondary resistance to more aggressive endocrine therapies applied to patients with ESR1 LBD missense alterations

Recurrent hyperactive ESR1 fusion proteins in endocrine therapy-resistant breast cancer.

PubMed

Hartmaier, R J; Trabucco, S E; Priedigkeit, N; Chung, J H; Parachoniak, C A; Vanden Borre, P; Morley, S; Rosenzweig, M; Gay, L M; Goldberg, M E; Suh, J; Ali, S M; Ross, J; Leyland-Jones, B; Young, B; Williams, C; Park, B; Tsai, M; Haley, B; Peguero, J; Callahan, R D; Sachelarie, I; Cho, J; Atkinson, J M; Bahreini, A; Nagle, A M; Puhalla, S L; Watters, R J; Erdogan-Yildirim, Z; Cao, L; Oesterreich, S; Mathew, A; Lucas, P C; Davidson, N E; Brufsky, A M; Frampton, G M; Stephens, P J; Chmielecki, J; Lee, A V

2018-04-01

Estrogen receptor-positive (ER-positive) metastatic breast cancer is often intractable due to endocrine therapy resistance. Although ESR1 promoter switching events have been associated with endocrine-therapy resistance, recurrent ESR1 fusion proteins have yet to be identified in advanced breast cancer. To identify genomic structural rearrangements (REs) including gene fusions in acquired resistance, we undertook a multimodal sequencing effort in three breast cancer patient cohorts: (i) mate-pair and/or RNAseq in 6 patient-matched primary-metastatic tumors and 51 metastases, (ii) high coverage (>500×) comprehensive genomic profiling of 287-395 cancer-related genes across 9542 solid tumors (5216 from metastatic disease), and (iii) ultra-high coverage (>5000×) genomic profiling of 62 cancer-related genes in 254 ctDNA samples. In addition to traditional gene fusion detection methods (i.e. discordant reads, split reads), ESR1 REs were detected from targeted sequencing data by applying a novel algorithm (copyshift) that identifies major copy number shifts at rearrangement hotspots. We identify 88 ESR1 REs across 83 unique patients with direct confirmation of 9 ESR1 fusion proteins (including 2 via immunoblot). ESR1 REs are highly enriched in ER-positive, metastatic disease and co-occur with known ESR1 missense alterations, suggestive of polyclonal resistance. Importantly, all fusions result from a breakpoint in or near ESR1 intron 6 and therefore lack an intact ligand binding domain (LBD). In vitro characterization of three fusions reveals ligand-independence and hyperactivity dependent upon the 3' partner gene. Our lower-bound estimate of ESR1 fusions is at least 1% of metastatic solid breast cancers, the prevalence in ctDNA is at least 10× enriched. We postulate this enrichment may represent secondary resistance to more aggressive endocrine therapies applied to patients with ESR1 LBD missense alterations. Collectively, these data indicate that N-terminal ESR1

PAX3/7-FOXO1 fusion status in older rhabdomyosarcoma patient population by fluorescent in situ hybridization.

PubMed

Dumont, Sarah N; Lazar, Alexander J; Bridge, Julia A; Benjamin, Robert S; Trent, Jonathan C

2012-02-01

In pediatric alveolar rhabdomyosarcoma, the PAX3-FOXO1 and PAX7-FOXO1 gene fusions are prognostic indicators, while little is known concerning this disease in older patients. To determine whether PAX3/7-FOXO1 fusion gene status correlates with outcome in adolescent, young adult, and adult rhabdomyosarcoma patients, the histological, immunohistochemical, and clinical characteristics of 105 patients followed at The University of Texas MD Anderson Cancer Center from 1957 to 2001 were evaluated. The samples were assembled into a tissue microarray, and fusion gene status was determined by fluorescence in situ hybridization using PAX3, PAX7, and FOXO1 loci-specific probes. The disease characteristics and specific gene fusion were correlated with patient outcomes using the log-rank test. Fifty-two percent of the samples exhibited a PAX3-FOXO1 fusion, 15% the PAX7-FOXO1 fusion, and 33% were negative for a rearrangement of these loci. The presence of PAX3/7-FOXO1 translocation was significantly associated with a higher frequency of metastatic disease. Although a statistically significant correlation between the PAX3/7-FOXO1 fusion gene status and overall survival was not identified, there was a trend toward better outcomes for patients with fusion-negative RMS. Therefore, identification of a FOXO1 fusion appears to be an interesting tool for predicting outcomes in older rhabdomyosarcoma patients and is worth further investigations in this rare subgroup of RMS population.

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

PubMed

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

TFE3-Fusion Variant Analysis Defines Specific Clinicopathologic Associations Among Xp11 Translocation Cancers

PubMed Central

Argani, Pedram; Zhong, Minghao; Reuter, Victor E.; Fallon, John T.; Epstein, Jonathan I.; Netto, George J.; Antonescu, Cristina R.

2016-01-01

Xp11 translocation cancers include Xp11 translocation renal cell carcinoma (RCC), Xp11 translocation perivascular epithelioid cell tumor (PEComa), and melanotic Xp11 translocation renal cancer. In Xp11 translocation cancers, oncogenic activation of TFE3 is driven by the fusion of TFE3 with a number of different gene partners, however, the impact of individual fusion variant on specific clinicopathologic features of Xp11 translocation cancers has not been well defined. In this study, we analyze 60 Xp11 translocation cancers by fluorescence in situ hybridization (FISH) using custom BAC probes to establish their TFE3 fusion gene partner. In 5 cases RNA sequencing (RNA-seq) was also used to further characterize the fusion transcripts. The 60 Xp11 translocation cancers included 47 Xp11 translocation RCC, 8 Xp11 translocation PEComas, and 5 melanotic Xp11 translocation renal cancers. A fusion partner was identified in 53/60 (88%) cases, including 18 SFPQ (PSF), 16 PRCC, 12 ASPSCR1 (ASPL), 6 NONO, and 1 DVL2. We provide the first morphologic description of the NONO-TFE3 RCC, which frequently demonstrates sub-nuclear vacuoles leading to distinctive suprabasal nuclear palisading. Similar sub-nuclear vacuolization was also characteristic of SFPQ-TFE3 RCC, creating overlapping features with clear cell papillary RCC. We also describe the first RCC with a DVL2-TFE3 gene fusion, in addition to an extrarenal pigmented PEComa with a NONO-TFE3 gene fusion. Furthermore, among neoplasms with the SFPQ-TFE3, NONO-TFE3, DVL2-TFE3 and ASPL-TFE3 gene fusions, the RCC are almost always PAX8-positive, cathepsin K-negative by immunohistochemistry, whereas the mesenchymal counterparts (Xp11 translocation PEComas, melanotic Xp11 translocation renal cancers, and alveolar soft part sarcoma) are PAX8-negative, cathepsin K-positive. These findings support the concept that despite an identical gene fusion, the RCCs are distinct from the corresponding mesenchymal neoplasms, perhaps due to the

Adenovirus-mediated in utero gene transfer in mice and guinea pigs: tissue distribution of recombinant adenovirus determined by quantitative TaqMan-polymerase chain reaction assay.

PubMed

Senoo, M; Matsubara, Y; Fujii, K; Nagasaki, Y; Hiratsuka, M; Kure, S; Uehara, S; Okamura, K; Yajima, A; Narisawa, K

2000-04-01

Fetal somatic cell gene therapy could become an attractive solution for some congenital genetic diseases or the disorders which manifest themselves during the fetal period. We performed adenovirus-mediated gene transfer to mice and guinea pig fetuses in utero and evaluated the efficiency of gene transfer by histochemical analysis and a quantitative TaqMan-polymerase chain reaction (TaqMan-PCR) assay. We first injected a replication-deficient recombinant adenovirus containing the Escherichia coli LacZ gene driven by a CAG promoter (AxCALacZ) into pregnant mice through the amniotic space, placenta, or intraperitoneal space of the fetus. Histochemical analysis showed limited transgene expression in fetal tissues. We then administered AxCALacZ to guinea pig fetuses in the late stage of pregnancy through the umbilical vein. The highest beta-galactosidase expression was observed in liver followed by moderate expression in heart, spleen, and adrenal gland. The transgene expression was also present in kidney, intestine, and placenta to a lesser degree. No positively stained cells were observed in lung, muscle, or pancreas except in the vascular endothelium of these organs. Quantitative measurement of recombinant adenoviral DNA by the TaqMan-PCR assay showed that the vast majority of the injected viruses was present in liver. The current study indicated that adenovirus-mediated gene transfer into guinea pig fetus through the umbilical vein is feasible and results in efficient transgene expression in fetal tissues. The experimental procedures using pregnant guinea pigs might serve as a good experimental model for in utero gene transfer. Since our TaqMan-PCR assay detects the LacZ gene, one of the most widely used reporter genes, it may be generally applicable to adenovirus quantification in various gene transfer experiments.

Prostate Cancer Evaluation: Design, Synthesis, and Evaluation of Novel Enzyme-Activated Proton MRI Contrast Agents

DTIC Science & Technology

2006-10-01

colored plates: ALL DTIC reproductions will be in black and white. 14. ABSTRACT The lacZ gene encoding E . coli beta-gal has already been...transcriptional activation, protein expression, and protein interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most commonly...Cancer Facts and Figures, 2004. (www.cancer.org). 2. Jemal A, Thomas A, Murray T, Thun M, 2002 Cancer statistics, 2002, CA Cancer J. Clin., 52, 23-47

Genetic Requirements for the Single-Strand Annealing Pathway of Double-Strand Break Repair in Saccharomyces Cerevisiae

PubMed Central

Ivanov, E. L.; Sugawara, N.; Fishman-Lobell, J.; Haber, J. E.

1996-01-01

HO endonuclease-induced double-strand breaks (DSBs) within a direct duplication of Escherichia coli lacZ genes are repaired either by gene conversion or by single-strand annealing (SSA), with >80% being SSA. Previously it was demonstrated that the RAD52 gene is required for DSB-induced SSA. In the present study, the effects of other genes belonging to the RAD52 epistasis group were analyzed. We show that RAD51, RAD54, RAD55, and RAD57 genes are not required for SSA irrespective of whether recombination occurred in plasmid or chromosomal DNA. In both plasmid and chromosomal constructs with homologous sequences in direct orientation, the proportion of SSA events over gene conversion was significantly elevated in the mutant strains. However, gene conversion was not affected when the two lacZ sequences were in inverted orientation. These results suggest that there is a competition between SSA and gene conversion processes that favors SSA in the absence of RAD51, RAD54, RAD55 and RAD57. Mutations in RAD50 and XRS2 genes do not prevent the completion, but markedly retard the kinetics, of DSB repair by both mechanisms in the lacZ direct repeat plasmid, a result resembling the effects of these genes during mating-type (MAT) switching. PMID:8849880

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

Clinical Significance of EML4-ALK Fusion Gene and Association with EGFR and KRAS Gene Mutations in 208 Chinese Patients with Non-Small Cell Lung Cancer

PubMed Central

Wei, Sen; Wang, Jing; Wang, Min; Wang, Yuli; Zhou, Qinghua; Liu, Hongyu; Chen, Jun

2013-01-01

The EML4-ALK fusion gene has been recently identified in a small subset of non-small cell lung cancer (NSCLC) patients who respond positively to ALK inhibitors. The characteristics of the EML4-ALK fusion gene in Chinese patients with NSCLC are poorly understood. Here, we report on the prevalence of EML4-ALK, EGFR status and KRAS mutations in 208 Chinese patients with NSCLC. EGFR mutations were found in 24.5% (51/208) of patients. In concordance with previous reports, these mutations were identified at high frequencies in females (47.5% vs 15.0% in males; P<0.05); never-smokers (42.3% vs 13.9% in smokers; P<0.05), and adenocarcinoma patients (44.2% vs 8.0% in non-adenocarcinoma patients; P<0.05). There were only 2.88% (6/208) patients with KRAS mutations in our study group. We identified 7 patients who harbored the EML4-ALK fusion gene (3.37%, 7/208), including 4 cases with variant 3 (57.1%), 2 with variant 1, and 1 with variant 2. All positive cases corresponded to female patients (11.5%, 7/61). Six of the positive cases were non-smokers (7.69%, 6/78). The incidence of EML4-ALK translocation in female, non-smoking adenocarcinoma patients was as high as 15.2% (5/33). No EGFR/KRAS mutations were detected among the EML4-ALK positive patients. Pathological analysis showed no difference between solid signet-ring cell pattern (4/7) and mucinous cribriform pattern (3/7) in ALK-positive patients. Immunostaining showed intratumor heterogeneity of ALK rearrangement in primary carcinomas and 50% (3/6) of metastatic tumors with ALK-negative staining. Meta-analysis demonstrated that EML4-ALK translocation occurred in 4.84% (125/2580) of unselected patients with NSCLC, and was also predominant in non-smoking patients with adenocarcinoma. Taken together, EML4-ALK translocations were infrequent in the entire NSCLC patient population, but were frequent in the NSCLC subgroup of female, non-smoker, adenocarcinoma patients. There was intratumor heterogeneity of ALK rearrangement in

Comprehensive characterization of RSPO fusions in colorectal traditional serrated adenomas.

PubMed

Sekine, Shigeki; Ogawa, Reiko; Hashimoto, Taiki; Motohiro, Kojima; Yoshida, Hiroshi; Taniguchi, Hirokazu; Saito, Yutaka; Yasuhiro, Ohno; Ochiai, Atsushi; Hiraoka, Nobuyoshi

2017-10-01

Traditional serrated adenoma (TSA) is a rare but distinct type of colorectal polyp. Our previous study showed that PTPRK-RSPO3 fusions are frequent and characteristic genetic alterations in TSAs. This study aimed to characterize comprehensively the prevalence and variability of RSPO fusions in colorectal TSAs. We examined RSPO expression and explored novel RSPO fusions in 129 TSAs, including 66 lesions analysed previously for WNT pathway gene mutations. Quantitative polymerase chain reaction (qPCR) analyses identified three and 43 TSAs overexpressing RSPO2 and RSPO3, respectively, whereas the expression of RSPO1 and RSPO4 was marginal or undetectable in all cases. RSPO overexpression was always mutually exclusive with other WNT pathway gene mutations. Known PTPRK-RSPO3 fusions were detected in 37 TSAs, all but one of which overexpressed RSPO3. In addition, rapid amplification of cDNA ends revealed three novel RSPO fusion transcripts, an NRIP1-RSPO2 fusion and two PTPRK-RSPO3 fusion isoforms, in six TSAs. Overall, 43 TSAs had RSPO fusions (33%), whereas four TSAs (3%) overexpressed RSPO in the absence of RSPO fusions. TSAs with RSPO fusions showed several clinicopathological features, including distal localization (P = 0.0063), larger size (P = 0.0055), prominent ectopic crypt foci (P = 8.4 × 10 -4 ), association of a high-grade component (P = 1.1 × 10 -4 ), and the presence of KRAS mutations (P = 4.5 × 10 -5 ). The present study identified RSPO fusion transcripts, including three novel transcripts, in one-third of colorectal TSAs and showed that PTPRK-RSPO3 fusions were the predominant cause of RSPO overexpression in colorectal TSA. © 2017 John Wiley & Sons Ltd.

Identification of novel recurrent ETV6-IGH fusions in primary central nervous system lymphoma.

PubMed

Bruno, Aurélie; Labreche, Karim; Daniau, Maïlys; Boisselier, Blandine; Gauchotte, Guillaume; Royer-Perron, Louis; Rahimian, Amithys; Lemoine, Frédéric; de la Grange, Pierre; Guégan, Justine; Bielle, Franck; Polivka, Marc; Adam, Clovis; Meyronet, David; Figarella-Branger, Dominique; Villa, Chiara; Chrétien, Fabrice; Eimer, Sandrine; Davi, Frédéric; Rousseau, Audrey; Houillier, Caroline; Soussain, Carole; Mokhtari, Karima; Hoang-Xuan, Khê; Alentorn, Agusti

2018-02-08

Primary central nervous system lymphoma (PCNSL) represents a particular entity within non-Hodgkin lymphomas and is associated with poor outcome. The present study addresses the potential clinical relevance of chimeric transcripts in PCSNL discovered by using RNA-sequencing (RNA-Seq). Seventy-two immunocompetent and newly diagnosed PCNSL cases were included in the present study. Among them, six were analyzed by RNA-seq to detect new potential fusion transcripts. We confirmed the results in the remaining 66 PCNSL. The gene fusion was validated by fluorescence in situ hybridization (FISH) using formalin-fixed paraffin-embedded (FFPE) samples. We assessed the biological and clinical impact of one new gene fusion. We identified a novel recurrent gene fusion ETV6-IgH. Overall, ETV6-IgH was found in 13 out of 72 PCNSL (18%). No fusion conserved an intact functional domain of ETV6 and ETV6 was significantly underexpressed at gene level, suggesting an ETV6 haploinsufficiency mechanism. The presence of the gene fusion was also validated by FISH in FFPE samples. Finally, PCNSL samples harboring ETV6-IgH showed a better prognosis in multivariate analysis, p-value=0.03, HR=0.33, 95% interval confidence (IC95) [0.12-0.88]. The overall survival at 5 years was of 69% for PCNSL harboring ETV6-IgH vs 29% for samples without this gene fusion. ETV6-IgH is a new potential surrogate marker of PCNSL with favorable prognosis with ETV6 haploinsuffiency as a possible mechanism. The potential clinical impact of ETV6-IgH should be validated in larger prospective studies. © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

In vivo retroviral gene transfer into human bronchial epithelia of xenografts.

PubMed

Engelhardt, J F; Yankaskas, J R; Wilson, J M

1992-12-01

Cystic fibrosis (CF) is the most common lethal inherited disease in the Caucasian population with an incidence of approximately 1 in 2,500 live births. Pulmonary complications of CF, which are the most morbid aspects of the disease, are caused by primary abnormalities in epithelial cells that lead to impaired mucociliary clearance. One potential therapeutic strategy is to reconstitute expression of the CF gene in airway epithelia by somatic gene transfer. To this end, we have developed an animal model of the human airway using bronchial xenografts and have tested the efficiency of in vivo retroviral gene transfer. Using the LacZ reporter gene, we find the efficiency of in vivo retroviral gene transfer to be dramatically dependent on the regenerative and mitotic state of the epithelium. Within an undifferentiated regenerating epithelium in which 40% of nuclei labeled with BrdU, 5-10% retroviral gene transfer was obtained. In contrast, no gene transfer was noted in a fully differentiated epithelium in which 1% of nuclei labeled with BrdU. These findings suggest that retroviral mediated gene transfer to the airway in vivo may be feasible if the proper regenerative state can be induced.

Production of geranylgeraniol on overexpression of a prenyl diphosphate synthase fusion gene in Saccharomyces cerevisiae.

PubMed

Ohto, Chikara; Muramatsu, Masayoshi; Obata, Shusei; Sakuradani, Eiji; Shimizu, Sakayu

2010-07-01

An acyclic diterpene alcohol, (E,E,E)-geranylgeraniol (GGOH), is one of the important compounds used as perfume and pharmacological agents. A deficiency of squalene (SQ) synthase activity allows yeasts to accumulate an acyclic sesquiterpene alcohol, (E,E)-farnesol, in their cells. Since sterols are essential for the growth of yeasts, a deficiency of SQ synthase activity makes the addition of supplemental sterols to the culture media necessary. To develop a GGOH production method not requiring any supplemental sterols, we overexpressed HMG1 encoding hydroxymethylglutaryl-CoA reductase and the genes of two prenyl diphosphate synthases, ERG20 and BTS1, in Saccharomyces cerevisiae. A prototrophic diploid coexpressing HMG1 and the ERG20-BTS1 fusion accumulated GGOH with neither disruption of the SQ synthase gene nor the addition of any supplemental sterols. The GGOH content on the diploid cultivation in a 5-l jar fermenter reached 138.8 mg/l under optimal conditions.

Secondary RNA structure and its role in RNA interference to silence the respiratory syncytial virus fusion protein gene.

PubMed

Vig, Komal; Lewis, Nuruddeen; Moore, Eddie G; Pillai, Shreekumar; Dennis, Vida A; Singh, Shree R

2009-11-01

RNA interference (RNAi) is a post-transcriptional, gene silencing mechanism which uses small interfering RNA molecules (siRNA) for gene silencing. Respiratory Syncytial Virus (RSV) is an important respiratory pathogen of medical significance that causes high mortality in infants. The fusion (F) protein of RSV is a good target for therapeutic purposes as it is primarily responsible for penetration of the virus into host cells and subsequent syncytium formation during infection. In the present study, four siRNAs were designed and used individually as well as a mixture, to silence the RSV F gene. The relationship between siRNA design, target RNA structure, and their thermodynamics was also investigated. Silencing of F gene was observed using indirect immunofluorescence, western blot, reverse transcription PCR, and progeny viral titers. Our results show F gene silencing by all the four siRNAs individually and collectively. RT-PCR analysis revealed a decrease in mRNA level which corresponded to decreased F protein expression. siRNAs also inhibited RSV progeny as shown by viral titer estimation on infected HEp-2 cells. The present study demonstrates the silencing of the F gene using siRNA. Thermodynamic characteristics of the target RSV mRNA and siRNA seem to play an important role in siRNA gene silencing efficiency.

Inferences on the evolutionary history of the Drosophila americana polymorphic X/4 fusion from patterns of polymorphism at the X-linked paralytic and elav genes.

PubMed Central

Vieira, Cristina P; Coelho, Paula A; Vieira, Jorge

2003-01-01

In Drosophila there is limited evidence on the nature of evolutionary forces affecting chromosomal arrangements other than inversions. The study of the X/4 fusion polymorphism of Drosophila americana is thus of interest. Polymorphism patterns at the paralytic (para) gene, located at the base of the X chromosome, suggest that there is suppressed crossing over in this region between fusion and nonfusion chromosomes but not within fusion and nonfusion chromosomes. These data are thus compatible with previous claims that within fusion chromosomes the amino acid clines found at fused1 (also located at the base of the X chromosome) are likely maintained by local selection. The para data set also suggests a young age of the X/4 fusion. Polymorphism data on para and elav (located at the middle region of the X chromosome) suggest that there is no population structure other than that caused by the X/4 fusion itself. These findings are therefore compatible with previous claims that selection maintains the strong association observed between the methionine/threonine variants at fused1 and the status of the X chromosome as fused or unfused to the fourth chromosome. PMID:12930752

Development of Peptidomimetic Inhibitors of the ERG Gene Fusion Product in Prostate Cancer.

PubMed

Wang, Xiaoju; Qiao, Yuanyuan; Asangani, Irfan A; Ateeq, Bushra; Poliakov, Anton; Cieślik, Marcin; Pitchiaya, Sethuramasundaram; Chakravarthi, Balabhadrapatruni V S K; Cao, Xuhong; Jing, Xiaojun; Wang, Cynthia X; Apel, Ingrid J; Wang, Rui; Tien, Jean Ching-Yi; Juckette, Kristin M; Yan, Wei; Jiang, Hui; Wang, Shaomeng; Varambally, Sooryanarayana; Chinnaiyan, Arul M

2017-04-10

Transcription factors play a key role in the development of diverse cancers, and therapeutically targeting them has remained a challenge. In prostate cancer, the gene encoding the transcription factor ERG is recurrently rearranged and plays a critical role in prostate oncogenesis. Here, we identified a series of peptides that interact specifically with the DNA binding domain of ERG. ERG inhibitory peptides (EIPs) and derived peptidomimetics bound ERG with high affinity and specificity, leading to proteolytic degradation of the ERG protein. The EIPs attenuated ERG-mediated transcription, chromatin recruitment, protein-protein interactions, cell invasion and proliferation, and tumor growth. Thus, peptidomimetic targeting of transcription factor fusion products may provide a promising therapeutic strategy for prostate cancer as well as other malignancies. Copyright © 2017 Elsevier Inc. All rights reserved.

Mouse alpha1(I)-collagen promoter is the best known promoter to drive efficient Cre recombinase expression in osteoblast.

PubMed

Dacquin, Romain; Starbuck, Michael; Schinke, Thorsten; Karsenty, Gérard

2002-06-01

Cell- and time-specific gene inactivation should enhance our knowledge of bone biology. Implementation of this technique requires construction of transgenic mouse lines expressing Cre recombinase in osteoblasts, the bone forming cell. We tested several promoter fragments for their ability to drive efficient Cre expression in osteoblasts. In the first mouse transgenic line, the Cre gene was placed under the control of the 2.3-kb proximal fragment of the alpha1(I)-collagen promoter, which is expressed at high levels in osteoblasts throughout their differentiation. Transgenic mice expressing this transgene in bone were bred with the ROSA26 reporter (R26R) strain in which the ROSA26 locus is targeted with a conditional LacZ reporter cassette. In R26R mice, Cre expression and subsequent Cre-mediated recombination lead to expression of the LacZ reporter gene, an event that can be monitored by LacZ staining. LacZ staining was detected in virtually all osteoblasts of alpha1(I)-Cre;R26R mice indicating that homologous recombination occurred in these cells. No other cell type stained blue. In the second line studied, the 1.3-kb fragment of osteocalcin gene 2 (OG2) promoter, which is active in differentiated osteoblasts, was used to drive Cre expression. OG2-Cre mice expressed Cre specifically in bone. However, cross of OG2-Cre mice with R26R mice did not lead to any detectable LacZ staining in osteoblasts. Lastly, we tested a more active artificial promoter derived from the OG2 promoter. The artificial OG2-Cre transgene was expressed by reverse transcriptase-polymerase chain reaction in cartilage and bone samples. After cross of the artificial OG2-Cre mice with R26R mice, we detected a LacZ staining in articular chondrocytes but not in osteoblasts. Our data suggest that the only promoter able to drive Cre expression at a level sufficient to induce recombination in osteoblasts is the alpha1(I)-collagen promoter. Copyright 2002 Wiley-Liss, Inc.

Prostate Cancer Evaluation: Design, Synthesis, and Evaluation of Novel Enzyme-Activated Proton MRI Contrast Agents

DTIC Science & Technology

2007-10-01

colored plates: ALL DTIC reproductions will be in black and white. 14. ABSTRACT The lacZ gene encoding E . coli beta-gal has already been...interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most commonly used reporter system.[34] However, the well-established...Figure 7 Moreover, we are deeply encouraged by the success on the synthesis of the target molecule M7, as shown in Figure 8. f e d cba OH N

Heterogeneous patterns of amplification of the NUP214-ABL1 fusion gene in T-cell acute lymphoblastic leukemia.

PubMed

Graux, C; Stevens-Kroef, M; Lafage, M; Dastugue, N; Harrison, C J; Mugneret, F; Bahloula, K; Struski, S; Grégoire, M J; Nadal, N; Lippert, E; Taviaux, S; Simons, A; Kuiper, R P; Moorman, A V; Barber, K; Bosly, A; Michaux, L; Vandenberghe, P; Lahortiga, I; De Keersmaecker, K; Wlodarska, I; Cools, J; Hagemeijer, A; Poirel, H A

2009-01-01

Episomes with the NUP214-ABL1 fusion gene have been observed in 6% of T-ALL. In this multicentric study we collected 27 cases of NUP214-ABL1-positive T-ALL. Median age was 15 years with male predominance. Outcome was poor in 12 patients. An associated abnormality involving TLX1 or TLX3 was found in all investigated cases. Fluorescent in situ hybridization revealed a heterogeneous pattern of NUP214-ABL1 amplification. Multiple episomes carrying the fusion were detected in 24 patients. Episomes were observed in a significant number of nuclei in 18 cases, but in only 1-5% of nuclei in 6. In addition, intrachromosomal amplification (small hsr) was identified either as the only change or in association with episomes in four cases and two T-ALL cell lines (PEER and ALL-SIL). One case showed insertion of apparently non-amplified NUP214-ABL1 sequences at 14q12. The amplified sequences were analyzed using array-based CGH.These findings confirm that the NUP214-ABL1 gene requires amplification for oncogenicity; it is part of a multistep process of leukemogenesis; and it can be a late event present only in subpopulations. Data also provide in vivo evidence for a model of episome formation, amplification and optional reintegration into the genome. Implications for the use of kinase inhibitors are discussed.

The cytoplasmic domain of the gamete membrane fusion protein HAP2 targets the protein to the fusion site in Chlamydomonas and regulates the fusion reaction.

PubMed

Liu, Yanjie; Pei, Jimin; Grishin, Nick; Snell, William J

2015-03-01

Cell-cell fusion between gametes is a defining step during development of eukaryotes, yet we know little about the cellular and molecular mechanisms of the gamete membrane fusion reaction. HAP2 is the sole gamete-specific protein in any system that is broadly conserved and shown by gene disruption to be essential for gamete fusion. The wide evolutionary distribution of HAP2 (also known as GCS1) indicates it was present in the last eukaryotic common ancestor and, therefore, dissecting its molecular properties should provide new insights into fundamental features of fertilization. HAP2 acts at a step after membrane adhesion, presumably directly in the merger of the lipid bilayers. Here, we use the unicellular alga Chlamydomonas to characterize contributions of key regions of HAP2 to protein location and function. We report that mutation of three strongly conserved residues in the ectodomain has no effect on targeting or fusion, although short deletions that include those residues block surface expression and fusion. Furthermore, HAP2 lacking a 237-residue segment of the cytoplasmic region is expressed at the cell surface, but fails to localize at the apical membrane patch specialized for fusion and fails to rescue fusion. Finally, we provide evidence that the ancient HAP2 contained a juxta-membrane, multi-cysteine motif in its cytoplasmic region, and that mutation of a cysteine dyad in this motif preserves protein localization, but substantially impairs HAP2 fusion activity. Thus, the ectodomain of HAP2 is essential for its surface expression, and the cytoplasmic region targets HAP2 to the site of fusion and regulates the fusion reaction. © 2015. Published by The Company of Biologists Ltd.

Non-Canonical Thinking for Targeting ALK-Fusion Onco-Proteins in Lung Cancer

PubMed Central

Wu, Wei; Haderk, Franziska; Bivona, Trever G.

2017-01-01

Anaplastic lymphoma kinase (ALK) gene rearrangements have been identified in lung cancer at 3–7% frequency, thus representing an important subset of genetic lesions that drive oncogenesis in this disease. Despite the availability of multiple FDA-approved small molecule inhibitors targeting ALK fusion proteins, drug resistance to ALK kinase inhibitors is a common problem in clinic. Thus, there is an unmet need to deepen the current understanding of genomic characteristics of ALK rearrangements and to develop novel therapeutic strategies that can overcome ALK inhibitor resistance. In this review, we present the genomic landscape of ALK fusions in the context of co-occurring mutations with other cancer-related genes, pointing to the central role of genetic epistasis (gene-gene interactions) in ALK-driven advanced-stage lung cancer. We discuss the possibility of targeting druggable domains within ALK fusion partners in addition to available strategies inhibiting the ALK kinase domain directly. Finally, we examine the potential of targeting ALK fusion-specific neoantigens in combination with other treatments, a strategy that could open a new avenue for the improved treatment of ALK positive lung cancer patients. PMID:29189709

Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

PubMed Central

Kyöstiö, S R; Cramer, C L; Lacy, G H

1991-01-01

The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

Cardiopulmonary bypass-assisted surgery for the treatment of Xp11.2 translocation/TFE3 gene fusion renal cell carcinoma with a tumor thrombus within the inferior vena cava: A case report.

PubMed

Zhu, Guanchen; Qiu, Xuefeng; Chen, Xianchen; Liu, Guangxiang; Zhang, Gutian; Gan, Weidong; Guo, Hongqian

2015-12-01

Renal cell carcinoma (RCC) accounts for 85-90% of kidney cancers, which in turn account for 2-3% of all malignant tumors in adults. Xp11.2 translocation/TFE3 gene fusion RCC is currently classified as a distinct type of RCC. RCC is capable of invading the renal vein and inferior vena cava to form a tumor thrombus. The incidence of RCC with tumor thrombi within the renal vein or inferior vena cava is 7-10% in China. In the present case report, the patient underwent radical resection of the renal tumor and removal of the tumor thrombus, assisted by cardiopulmonary bypass, for the treatment of Xp11.2 translocation/TFE3 gene fusion RCC. The patient was followed-up for 12 months subsequent to treatment. The patient's renal function remained within the normal range, and computed tomography examination revealed no evidence of disease recurrence or metastases. The present case report aimed to provide a reference for the development of guidelines for the diagnosis and treatment of Xp11.2 translocation/TFE3 gene fusion RCC.

Cardiopulmonary bypass-assisted surgery for the treatment of Xp11.2 translocation/TFE3 gene fusion renal cell carcinoma with a tumor thrombus within the inferior vena cava: A case report

PubMed Central

ZHU, GUANCHEN; QIU, XUEFENG; CHEN, XIANCHEN; LIU, GUANGXIANG; ZHANG, GUTIAN; GAN, WEIDONG; GUO, HONGQIAN

2015-01-01

Renal cell carcinoma (RCC) accounts for 85–90% of kidney cancers, which in turn account for 2–3% of all malignant tumors in adults. Xp11.2 translocation/TFE3 gene fusion RCC is currently classified as a distinct type of RCC. RCC is capable of invading the renal vein and inferior vena cava to form a tumor thrombus. The incidence of RCC with tumor thrombi within the renal vein or inferior vena cava is 7–10% in China. In the present case report, the patient underwent radical resection of the renal tumor and removal of the tumor thrombus, assisted by cardiopulmonary bypass, for the treatment of Xp11.2 translocation/TFE3 gene fusion RCC. The patient was followed-up for 12 months subsequent to treatment. The patient's renal function remained within the normal range, and computed tomography examination revealed no evidence of disease recurrence or metastases. The present case report aimed to provide a reference for the development of guidelines for the diagnosis and treatment of Xp11.2 translocation/TFE3 gene fusion RCC. PMID:26788164

Studies on the expression of an H-2K/human growth hormone fusion gene in giant transgenic mice.

PubMed Central

Morello, D; Moore, G; Salmon, A M; Yaniv, M; Babinet, C

1986-01-01

Transgenic mice carrying the H-2K/human growth hormone (hGH) fusion gene were produced by microinjecting into the pronucleus of fertilized eggs DNA molecules containing 2 kb of the 5' flanking sequences (including promoter) of the class I H-2Kb gene joined to the coding sequences of the hGH gene. Thirteen transgenic mice were obtained which all contained detectable levels of hGH hormone in their blood. Nine grew larger than their control litter-mates. Endogenous H-2Kb and exogenous hGH mRNA levels were analysed by S1 nuclease digestion experiments. hGH transcripts were found in all the tissues examined and the pattern of expression paralleled that of endogenous H-2K gene expression, being high in liver and lymphoid organs and low in muscle and brain. Thus 2 kb of the 5' promoter/regulatory region of the H-2K gene are sufficient to ensure regulated expression of hGH in transgenic mice. This promoter may therefore be of use to target the expression of different exogenous genes in most tissues of transgenic mice and to study the biological role of the corresponding proteins in different cellular environments. Images Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:3019667

Recurrence of lung adenocarcinoma after an interval of 15 years revealed by demonstration of the same type of EML4-ALK fusion gene.

PubMed

Tsukamoto, Yoshitane; Kanamori, Kiyonobu; Watanabe, Takahiro; Mikami, Koji; Ieki, Ryuji; Nakano, Takashi; Kajimoto, Kazuyoshi; Hirota, Seiichi

2014-12-01

We carried out an experiment on a 58-year-old man with multiple left lung tumors and swelling of multiple lymph nodes. For clinical staging and therapeutic purposes, bronchoalveolar lavage (BAL) cytology and lung biopsy were performed. The biopsy specimen revealed the left lower lung mass to be immunohistochemically ALK (anaplastic lymphoma kinase)-positive adenocarcinoma. Using the BAL specimen from the left lower lung, EML4 (echinoderm microtubule-associated protein-like 4)-ALK variant 1 fusion gene was detected by reverse transcription-polymerase chain reaction (RT-PCR). His past history showed that he had undergone an operation for lung adenocarcinoma of the right lower lobe 15 years before, and the pathological specimen at that time revealed that the lung adenocarcinoma with pleural invasion and single metastasis of mediastinal lymph node showed a mucinous cribriform pattern and/or signet-ring cell pattern. The typical histology led us to examine the ALK rearrangement in the primary lung cancer and mediastinal metastatic tumor. Immunohistochemistry (IHC) for ALK was positive, and ALK break apart fluorescence in situ hybridization (FISH) showed a positive result. Moreover, RT-PCR using formalin-fixed, paraffin-embedded tissue from the right lung cancer also demonstrated EML4-ALK variant 1 fusion gene. Although there is a possibility that the left lung cancer is de novo one with multiple metastases, detection of the same fusion gene of the very rare EML4-ALK variant 1 in both tumors suggests that the left cancer is a recurrence of the right lung cancer after an interval of 15 years. Copyright © 2014 Elsevier GmbH. All rights reserved.

PAX3/7–FOXO1 fusion status in older rhabdomyosarcoma patient population by fluorescent in situ hybridization

PubMed Central

Lazar, Alexander J.; Bridge, Julia A.; Benjamin, Robert S.; Trent, Jonathan C.

2014-01-01

Purpose In pediatric alveolar rhabdomyosarcoma, the PAX3–FOXO1 and PAX7–FOXO1 gene fusions are prognostic indicators, while little is known concerning this disease in older patients. To determine whether PAX3/7–FOXO1 fusion gene status correlates with outcome in adolescent, young adult, and adult rhabdomyosarcoma patients, the histological, immunohistochemical, and clinical characteristics of 105 patients followed at The University of Texas MD Anderson Cancer Center from 1957 to 2001 were evaluated. Methods The samples were assembled into a tissue microarray, and fusion gene status was determined by fluorescence in situ hybridization using PAX3, PAX7, and FOXO1 loci-specific probes. The disease characteristics and specific gene fusion were correlated with patient outcomes using the log-rank test. Results Fifty-two percent of the samples exhibited a PAX3–FOXO1 fusion, 15% the PAX7–FOXO1 fusion, and 33% were negative for a rearrangement of these loci. The presence of PAX3/7–FOXO1 translocation was significantly associated with a higher frequency of metastatic disease. Although a statistically significant correlation between the PAX3/7–FOXO1 fusion gene status and overall survival was not identified, there was a trend toward better outcomes for patients with fusion-negative RMS. Conclusions Therefore, identification of a FOXO1 fusion appears to be an interesting tool for predicting outcomes in older rhabdomyosarcoma patients and is worth further investigations in this rare subgroup of RMS population. PMID:22089931

SAFE Software and FED Database to Uncover Protein-Protein Interactions using Gene Fusion Analysis.

PubMed

Tsagrasoulis, Dimosthenis; Danos, Vasilis; Kissa, Maria; Trimpalis, Philip; Koumandou, V Lila; Karagouni, Amalia D; Tsakalidis, Athanasios; Kossida, Sophia

2012-01-01

Domain Fusion Analysis takes advantage of the fact that certain proteins in a given proteome A, are found to have statistically significant similarity with two separate proteins in another proteome B. In other words, the result of a fusion event between two separate proteins in proteome B is a specific full-length protein in proteome A. In such a case, it can be safely concluded that the protein pair has a common biological function or even interacts physically. In this paper, we present the Fusion Events Database (FED), a database for the maintenance and retrieval of fusion data both in prokaryotic and eukaryotic organisms and the Software for the Analysis of Fusion Events (SAFE), a computational platform implemented for the automated detection, filtering and visualization of fusion events (both available at: http://www.bioacademy.gr/bioinformatics/projects/ProteinFusion/index.htm). Finally, we analyze the proteomes of three microorganisms using these tools in order to demonstrate their functionality.

SAFE Software and FED Database to Uncover Protein-Protein Interactions using Gene Fusion Analysis

PubMed Central

Tsagrasoulis, Dimosthenis; Danos, Vasilis; Kissa, Maria; Trimpalis, Philip; Koumandou, V. Lila; Karagouni, Amalia D.; Tsakalidis, Athanasios; Kossida, Sophia

2012-01-01

Domain Fusion Analysis takes advantage of the fact that certain proteins in a given proteome A, are found to have statistically significant similarity with two separate proteins in another proteome B. In other words, the result of a fusion event between two separate proteins in proteome B is a specific full-length protein in proteome A. In such a case, it can be safely concluded that the protein pair has a common biological function or even interacts physically. In this paper, we present the Fusion Events Database (FED), a database for the maintenance and retrieval of fusion data both in prokaryotic and eukaryotic organisms and the Software for the Analysis of Fusion Events (SAFE), a computational platform implemented for the automated detection, filtering and visualization of fusion events (both available at: http://www.bioacademy.gr/bioinformatics/projects/ProteinFusion/index.htm). Finally, we analyze the proteomes of three microorganisms using these tools in order to demonstrate their functionality. PMID:22267904

Renal Cell Carcinoma Associated with Xp11.2 Translocation/TFE3 Gene Fusion: A Rare Case Report with Review of the Literature.

PubMed

Ahluwalia, Puneet; Nair, Balagopal; Kumar, Ginil

2013-01-01

Introduction. The recently recognized renal cell carcinomas associated with Xp11.2 translocations are rare tumors predominantly reported in children. Chromosome Xp11.2 translocation results in gene fusion related to transcription factor E3 (TFE3) that plays an important role in proliferation and survival. Case Report. Herein, we present two cases of a TFE3 translocation-associated RCC in young female adults, one detected incidentally and the other one presenting with gross hematuria. Tumor is characterized by immunohistochemistry and a literature review with optimal treatment regimen is presented. Discussion. Xp11.2 translocation RCCs in adult patients are associated with advanced stages, large tumors, and extracapsular disease and usually have an aggressive clinical course. Conclusion. In TFE3 RCC, the genetic background may not only contribute to tumorigenesis, but also determine the response to chemotherapy and targeted therapy. Therefore it is necessary to diagnose this tumor entity accurately. Because of the small number of TFE3 gene fusion-related renal tumors described in the literature, the exact biologic behavior and impact of current treatment modalities remain to be uncertain.

Renal Cell Carcinoma Associated with Xp11.2 Translocation/TFE3 Gene Fusion: A Rare Case Report with Review of the Literature

PubMed Central

Ahluwalia, Puneet; Nair, Balagopal; Kumar, Ginil

2013-01-01

Introduction. The recently recognized renal cell carcinomas associated with Xp11.2 translocations are rare tumors predominantly reported in children. Chromosome Xp11.2 translocation results in gene fusion related to transcription factor E3 (TFE3) that plays an important role in proliferation and survival. Case Report. Herein, we present two cases of a TFE3 translocation-associated RCC in young female adults, one detected incidentally and the other one presenting with gross hematuria. Tumor is characterized by immunohistochemistry and a literature review with optimal treatment regimen is presented. Discussion. Xp11.2 translocation RCCs in adult patients are associated with advanced stages, large tumors, and extracapsular disease and usually have an aggressive clinical course. Conclusion. In TFE3 RCC, the genetic background may not only contribute to tumorigenesis, but also determine the response to chemotherapy and targeted therapy. Therefore it is necessary to diagnose this tumor entity accurately. Because of the small number of TFE3 gene fusion-related renal tumors described in the literature, the exact biologic behavior and impact of current treatment modalities remain to be uncertain. PMID:24455396

Overcoming resistance to single-agent therapy for oncogenic BRAF gene fusions via combinatorial targeting of MAPK and PI3K/mTOR signaling pathways

PubMed Central

Jain, Payal; Silva, Amanda; Han, Harry J.; Lang, Shih-Shan; Zhu, Yuankun; Boucher, Katie; Smith, Tiffany E.; Vakil, Aesha; Diviney, Patrick; Choudhari, Namrata; Raman, Pichai; Busch, Christine M.; Delaney, Tim; Yang, Xiaodong; Olow, Aleksandra K.; Mueller, Sabine; Haas-Kogan, Daphne; Fox, Elizabeth; Storm, Phillip B.; Resnick, Adam C.; Waanders, Angela J.

2017-01-01

Pediatric low-grade gliomas (PLGGs) are frequently associated with activating BRAF gene fusions, such as KIAA1549-BRAF, that aberrantly drive the mitogen activated protein kinase (MAPK) pathway. Although RAF inhibitors (RAFi) have been proven effective in BRAF-V600E mutant tumors, we have previously shown how the KIAA1549-BRAF fusion can be paradoxically activated by RAFi. While newer classes of RAFi, such as PLX8394, have now been shown to inhibit MAPK activation by KIAA1549-BRAF, we sought to identify alternative MAPK pathway targeting strategies using clinically relevant MEK inhibitors (MEKi), along with potential escape mechanisms of acquired resistance to single-agent MAPK pathway therapies. We demonstrate effectiveness of multiple MEKi against diverse BRAF-fusions with novel N-terminal partners, with trametinib being the most potent. However, resistance to MEKi or PLX8394 develops via increased RTK expression causing activation of PI3K/mTOR pathway in BRAF-fusion expressing resistant clones. To circumvent acquired resistance, we show potency of combinatorial targeting with trametinib and everolimus, an mTOR inhibitor (mTORi) against multiple BRAF-fusions. While single-agent mTORi and MEKi PLGG clinical trials are underway, our study provides preclinical rationales for using MEKi and mTORi combinatorial therapy to stave off or prevent emergent drug-resistance in BRAF-fusion driven PLGGs. PMID:29156677

Myoblast fusion in Drosophila

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haralalka, Shruti; Abmayr, Susan M., E-mail: sma@stowers.org; Department of Anatomy and Cell Biology, University of Kansas Medical Center, Kansas City, MO 66160

2010-11-01

The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral sidemore » of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.« less

Renal Cell Carcinoma Associated With Xp11.2 Translocation/TFE3 Gene-fusion: A Long Response to mammalian target of rapamycin (mTOR) Inhibitors.

PubMed

Rua Fernández, Oliver R; Escala Cornejo, Roberto; Navarro Martín, Miguel; García Muñoz, María; Antunez Plaza, Patricia; García Dominguez, Aracely Rocío; Cruz Hernández, Juan J

2018-04-24

To demonstrate that patients with Xp11.2/TFE3 gene-fusion translocation renal cell carcinoma (RCC), despite having an aggressive course in young adults, could have valid treatment options such as mammalian target of rapamycin (mTOR) inhibitors with good outcomes. Furthermore, to explain possible mechanisms of action of mTOR inhibitors in this type of RCC. We report a case of a 44-year-old man who has been treated with everolimus for a Xp11.2 translocation/TFE3 gene-fusion RCC after 2 previous failed treatments with tyrosine kinase inhibitor. During the follow-up, we evaluated type and duration of response with everolimus. The patient obtained a long-lasting response of disease of 25 months with everolimus without any symptom. We believe that mTOR inhibitors could be a good line option treatment to consider for this type of patients. Copyright © 2018 Elsevier Inc. All rights reserved.

Identification of atypical ATRNL1 insertion to EML4-ALK fusion gene in NSCLC.

PubMed

Robesova, Blanka; Bajerova, Monika; Hausnerova, Jitka; Skrickova, Jana; Tomiskova, Marcela; Dvorakova, Dana

2015-03-01

We herein present a rare case of an EML4-ALK positive patient. A 61-year-old man was diagnosed with locoregional non-small cell lung cancer (NSCLC). No EGFR mutations were detected, and therefore the ALK rearrangement was evaluated using immunohistochemistry (IHC), fluorescence in situ hybridization (FISH) and the reverse transcription PCR (RT-PCR) method for EML4-ALK. All methods showed a positive result and, therefore, the patient was treated with crizotinib with a good therapeutic response. However, a detailed RT-PCR analysis and sequencing revealed an unexpected 138 bp insertion of attractin-like 1 (ATRNL1) gene into the EML4-ALK fusion gene. In our case, the positive therapeutic response suggests that ATRNL1 insertion does not affect EML4-ALK's sensitivity to crizotinib. This case shows great EML4-ALK heterogeneity and also that basic detection methods (IHC, FISH) cannot fully specify ALK rearrangement but in many cases a full specification seems to be important for an effective TKI indication, and sequencing ALK variants might contribute to optimized patient selection. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Species Based Synonymous Codon Usage in Fusion Protein Gene of Newcastle Disease Virus

PubMed Central

Kumar, Chandra Shekhar; Kumar, Sachin

2014-01-01

Newcastle disease is highly pathogenic to poultry and many other avian species. However, the Newcastle disease virus (NDV) has also been reported from many non-avian species. The NDV fusion protein (F) is a major determinant of its pathogenicity and virulence. The functionalities of F gene have been explored for the development of vaccine and diagnostics against NDV. Although the F protein is well studied but the codon usage and its nucleotide composition from NDV isolated from different species have not yet been explored. In present study, we have analyzed the factors responsible for the determination of codon usage in NDV isolated from four major avian host species. The F gene of NDV is analyzed for its base composition and its correlation with the bias in codon usage. Our result showed that random mutational pressure is responsible for codon usage bias in F protein of NDV isolates. Aromaticity, GC3s, and aliphatic index were not found responsible for species based synonymous codon usage bias in F gene of NDV. Moreover, the low amount of codon usage bias and expression level was further confirmed by a low CAI value. The phylogenetic analysis of isolates was found in corroboration with the relatedness of species based on codon usage bias. The relationship between the host species and the NDV isolates from the host does not represent a significant correlation in our study. The present study provides a basic understanding of the mechanism involved in codon usage among species. PMID:25479071

Reprogramming of somatic cells induced by fusion of embryonic stem cells using hemagglutinating virus of Japan envelope (HVJ-E)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yue, Xiao-shan; Department of Biomolecular Engineering, Graduate School of Bioscience and Technology, Tokyo Institute of Technology, Nagatsuta-cho, Midori-ku, Yokohama-shi, Kanagawa 226-8501; Fujishiro, Masako

In this research, hemagglutinating virus of Japan envelope (HVJ-E) was used to reprogram somatic cells by fusion with mouse embryonic stem (ES) cells. Neomycin-resistant mouse embryonic fibroblasts (MEFs) were used as somatic cells. Nanog-overexpressing puromycin-resistant EB3 cells were used as mouse ES cells. These two cells were fused by exposing to HVJ-E and the generated fusion cells were selected by puromycin and G418 to get the stable fusion cell line. The fusion cells form colonies in feeder-free culture system. Microsatellite analysis of the fusion cells showed that they possessed genes from both ES cells and fibroblasts. The fusion cells weremore » tetraploid, had alkali phosphatase activity, and expressed stem cell marker genes such as Pou5f1, Nanog, and Sox2, but not the fibroblast cell marker genes such as Col1a1 and Col1a2. The pluripotency of fusion cells was confirmed by their expression of marker genes for all the three germ layers after differentiation induction, and by their ability to form teratoma which contained all the three primary layers. Our results show that HVJ-E can be used as a fusion reagent for reprogramming of somatic cells.« less

RNA-seq of 272 gliomas revealed a novel, recurrent PTPRZ1-MET fusion transcript in secondary glioblastomas

PubMed Central

Bao, Zhao-Shi; Yang, Ming-Yu; Zhang, Chuan-Bao; Yu, Kai; Ye, Wan-Lu; Hu, Bo-Qiang; Yan, Wei; Zhang, Wei; Akers, Johnny; Ramakrishnan, Valya; Li, Jie; Carter, Bob; Liu, Yan-Wei; Hu, Hui-Min; Wang, Zheng; Li, Ming-Yang; Yao, Kun; Qiu, Xiao-Guang; Kang, Chun-Sheng; You, Yong-Ping; Fan, Xiao-Long; Song, Wei Sonya; Li, Rui-Qiang

2014-01-01

Studies of gene rearrangements and the consequent oncogenic fusion proteins have laid the foundation for targeted cancer therapy. To identify oncogenic fusions associated with glioma progression, we catalogued fusion transcripts by RNA-seq of 272 gliomas. Fusion transcripts were more frequently found in high-grade gliomas, in the classical subtype of gliomas, and in gliomas treated with radiation/temozolomide. Sixty-seven in-frame fusion transcripts were identified, including three recurrent fusion transcripts: FGFR3-TACC3, RNF213-SLC26A11, and PTPRZ1-MET (ZM). Interestingly, the ZM fusion was found only in grade III astrocytomas (1/13; 7.7%) or secondary GBMs (sGBMs, 3/20; 15.0%). In an independent cohort of sGBMs, the ZM fusion was found in three of 20 (15%) specimens. Genomic analysis revealed that the fusion arose from translocation events involving introns 3 or 8 of PTPRZ and intron 1 of MET. ZM fusion transcripts were found in GBMs irrespective of isocitrate dehydrogenase 1 (IDH1) mutation status. sGBMs harboring ZM fusion showed higher expression of genes required for PIK3CA signaling and lowered expression of genes that suppressed RB1 or TP53 function. Expression of the ZM fusion was mutually exclusive with EGFR overexpression in sGBMs. Exogenous expression of the ZM fusion in the U87MG glioblastoma line enhanced cell migration and invasion. Clinically, patients afflicted with ZM fusion harboring glioblastomas survived poorly relative to those afflicted with non-ZM-harboring sGBMs (P < 0.001). Our study profiles the shifting RNA landscape of gliomas during progression and reveled ZM as a novel, recurrent fusion transcript in sGBMs. PMID:25135958

Marek's disease virus protein kinase gene identified within the short unique region of the viral genome is not essential for viral replication in cell culture and vaccine-induced immunity in chickens.

PubMed

Sakaguchi, M; Urakawa, T; Hirayama, Y; Miki, N; Yamamoto, M; Zhu, G S; Hirai, K

1993-07-01

The open reading frame (ORF) of 1206 bp within the short unique region (Us) of Marek's disease virus type 1 (MDV1) shows significant homology with the herpes simplex virus type 1 US3 gene encoding protein kinase (PK). The lacZ gene of Escherichia coli was inserted within the ORF, designated MDV1-US3, of MDV1 K544 strain DNA by homologous recombination. The plaque-purified recombinant MDV1 stably expressed the beta-galactosidase encoded by the inserted lacZ gene in infected cells and replicated well as the parental K544 strain. Antibodies against both MDV1 antigen and beta-galactosidase were detected in the sera of chickens immunized with recombinant MDV1. Chickens vaccinated with the recombinant MDV1 were protected from challenge with virulent MDV1. The MDV1 US3 gene expressed by a baculovirus vector encoded a 44-kDa protein. Mouse antisera against the 44-kDa protein reacted with two proteins of 44 and 45 kDa in extracts of cells infected with MDV1 but not with MDV types 2 or 3. The PK activity was detected in immune complexes of the anti-44-kDa sera with extracts of cells infected with MDV1 but not with the recombinant MDV1. Thus, PK encoded from the MDV1-US3 is not essential for virus replication in cell culture and vaccine-induced immunity.

Retrovirus-mediated transfer of a hygromycin phosphotransferase-thymidine kinase fusion gene into human CD34+ bone marrow cells.

PubMed

Akatsuka, Y; Emi, N; Kato, H; Abe, A; Tanimoto, M; Lupton, S D; Saito, H

1994-12-01

Retrovirus-mediated gene transfer into human hematopoietic stem cells has been proposed as a means of therapy for various inherited diseases and as a method of gene marking. The transduction efficiency of an amphotropic retroviral vector (PA317/HyTK) containing a hygromycin phosphotransferase-thymidine kinase fusion gene was examined with human CD34+ bone marrow cells in the presence of interleukin-3 (IL-3), interleukin-6 (IL-6), and stem cell factor. Transduction efficiencies determined from the ability of transduced granulocyte-macrophage colony forming units (CFU-GM) to grow in hygromycin B and from polymerase chain reaction analysis of individual transduced CFU-GM growing in the presence of hygromycin B were 0.3-3.0% (mean +/- S.D., 1.1 +/- 0.9%) and 0.1-1.2% (mean +/- S.D., 0.5 +/- 0.4%), respectively. Ganciclovir at a dose of approximately 1 microM reduced the number of CFU-GM derived from vector-infected CD34+ cells by 50%. These findings demonstrate that human hematopoietic stem cells infected with this retroviral vector are susceptible to ganciclovir, offering the potential to control transduced gene expression in vivo.

RET fusions define a unique molecular and clinicopathologic subtype of non-small-cell lung cancer.

PubMed

Wang, Rui; Hu, Haichuan; Pan, Yunjian; Li, Yuan; Ye, Ting; Li, Chenguang; Luo, Xiaoyang; Wang, Lei; Li, Hang; Zhang, Yang; Li, Fei; Lu, Yongming; Lu, Qiong; Xu, Jie; Garfield, David; Shen, Lei; Ji, Hongbin; Pao, William; Sun, Yihua; Chen, Haiquan

2012-12-10

The RET fusion gene has been recently described in a subset of non-small-cell lung cancers (NSCLCs). Because we have limited knowledge about these tumors, this study was aimed at determining the clinicopathologic characteristics of patients with NSCLC harboring the RET fusion gene. We examined the RET fusion gene in 936 patients with surgically resected NSCLC using a reverse transcriptase polymerase chain reaction (PCR) plus quantitative real-time PCR strategy, with validation using immunohistochemical and fluorescent in situ hybridization assays. A subset of 633 lung adenocarcinomas was also studied for EGFR, KRAS, HER2, and BRAF mutations, as well as ALK rearrangements. Patient characteristics, including age, sex, smoking history, stage, grade, International Association for the Study of Lung Cancer/American Thoracic Society/European Respiratory Society classification of subtypes of lung adenocarcinoma, and relapse-free survival, were collected. Of 936 patients with NSCLC, the RET fusion gene was exclusively detected in 13 patients (11 of 633 patients with adenocarcinomas and two of 24 patients with adenosquamous cell carcinomas). Of the 13 patients, nine patients had KIF5B-RET, three patients had CCDC6-RET, and one patient had a novel NCOA4-RET fusion. Patients with lung adenocarcinomas with RET fusion gene had more poorly differentiated tumors (63.6%; P = .029 for RET v ALK, P = .007 for RET v EGFR), with a tendency to be younger (≤ 60 years; 72.7%) and never-smokers (81.8%) and to have solid subtype (63.6%) and a smaller tumor (≤ 3 cm) with N2 disease (54.4%). The median relapse-free survival was 20.9 months. RET fusion occurs in 1.4% of NSCLCs and 1.7% of lung adenocarcinomas and has identifiable clinicopathologic characteristics, warranting further clinical consideration and targeted therapy investigation.

Essential Role of DAP12 Signaling in Macrophage Programming into a Fusion-Competent State

PubMed Central

Helming, Laura; Tomasello, Elena; Kyriakides, Themis R.; Martinez, Fernando O.; Takai, Toshiyuki; Gordon, Siamon; Vivier, Eric

2009-01-01

Multinucleated giant cells, formed by fusion of macrophages, are a hallmark of granulomatous inflammation. With a genetic approach, we show that signaling through the adaptor protein DAP12 (DNAX activating protein of 12 kD), its associated receptor triggering receptor expressed by myeloid cells 2 (TREM-2), and the downstream protein tyrosine kinase Syk is required for the cytokine-induced formation of giant cells and that overexpression of DAP12 potentiates macrophage fusion. We also present evidence that DAP12 is a general macrophage fusion regulator and is involved in modulating the expression of several macrophage-associated genes, including those encoding known mediators of macrophage fusion, such as DC-STAMP and Cadherin 1. Thus, DAP12 is involved in programming of macrophages through the regulation of gene and protein expression to induce a fusion-competent state. PMID:18957693

Gene silencing in Escherichia coli using antisense RNAs expressed from doxycycline-inducible vectors.

PubMed

Nakashima, N; Tamura, T

2013-06-01

Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.

Adenoviral vector gene delivery via the round window membrane in guinea pigs.

PubMed

Suzuki, Mitsuya; Yamasoba, Tatsuya; Suzukawa, Keigo; Kaga, Kimitaka

2003-10-27

We have found that damage from a local anesthetic solution containing phenol permitted beta-galactosidase (beta-gal) gene delivery to the guinea pig inner ear via the round window membrane (RWM). RWM damage was evident as degeneration of the outer epithelium. After adenovirus lacZ vector was applied to the damaged RWM, immunohistochemistry showed strong beta-gal expression in the RWM, mesothelial cells, organ of Corti, spiral limbus, spiral ligament and spiral ganglion. In the vestibular labyrinth, expression was seen in the sensory and supporting cells, transitional cells, and the dark-cell area. Thus, adenovirus can transfect a variety of inner ear cells in the guinea pig through a damaged RWM.

Lister vaccine strain of vaccinia virus armed with the endostatin-angiostatin fusion gene: an oncolytic virus superior to dl1520 (ONYX-015) for human head and neck cancer.

PubMed

Tysome, James R; Wang, Pengju; Alusi, Ghassan; Briat, Arnaud; Gangeswaran, Rathi; Wang, Jiwei; Bhakta, Vipul; Fodor, Istvan; Lemoine, Nick R; Wang, Yaohe

2011-09-01

Oncolytic viral therapy represents a promising strategy for the treatment of head and neck squamous cell carcinoma (HNSCC), with dl1520 (ONYX-015) the most widely used oncolytic adenovirus in clinical trials. This study aimed to determine the effectiveness of the Lister vaccine strain of vaccinia virus as well as a vaccinia virus armed with the endostatin-angiostatin fusion gene (VVhEA) as a novel therapy for HNSCC and to compare them with dl1520. The potency and replication of the Lister strain and VVhEA and the expression and function of the fusion protein were determined in human HNSCC cells in vitro and in vivo. Finally, the efficacy of VVhEA was compared with dl1520 in vivo in a human HNSCC model. The Lister vaccine strain of vaccinia virus was more effective than the adenovirus against all HNSCC cell lines tested in vitro. Although the potency of VVhEA was attenuated in vitro, the expression and function of the endostatin-angiostatin fusion protein was confirmed in HNSCC models both in vitro and in vivo. This novel vaccinia virus (VVhEA) demonstrated superior antitumor potency in vivo compared with both dl1520 and the control vaccinia virus. This study suggests that the Lister strain vaccinia virus armed with an endostatin-angiostatin fusion gene may be a potential therapeutic agent for HNSCC.

Hazardous effects of effluent from the chrome plating industry: 70 kDa heat shock protein expression as a marker of cellular damage in transgenic Drosophila melanogaster (hsp70-lacZ).

PubMed Central

Mukhopadhyay, Indranil; Saxena, Daya Krishna; Chowdhuri, Debapratim Kar

2003-01-01

Hazardous effects of an effluent from the chrome plating industry were examined by exposing transgenic Drosophila melanogaster (hsp70-lacZ) to various concentrations (0.05, 0.1, 1.0, 10.0, and 100.0 micro L/mL) of the effluent through diet. The emergence pattern of adult flies was affected, along with impaired reproductive performance at the higher dietary concentrations of the effluent. Interestingly, the effect of the effluent was more pronounced in male than in female flies. The effect of the effluent on development of adult flies was concurrent with the expression pattern of the heat shock protein 70 gene (hsp70), both in larval tissues and in the reproductive organs of adult flies. We observed a dose- and time-dependent expression of hsp70 in third instar larvae exposed for different time intervals. Absence of hsp70 expression in larvae exposed to 0.1 micro L/mL of the effluent indicated that this is the highest nontoxic concentration for Drosophila. The stress gene assay in the reproductive organs of adult flies revealed hsp70 expression in the testis of male flies only. However, trypan blue dye exclusion tests in these tissues indicate tissue damage in the male accessory gland of adult flies, which was further confirmed by ultrastructural observations. In the present study we demonstrate the utility of transgenic Drosophila as an alternative animal model for evaluating hazardous effects of the effluent from the chrome plating industry and further reveal the cytoprotective role of hsp70 and its expression as an early marker in environmental risk assessment. PMID:14644668

RNA-seq of 272 gliomas revealed a novel, recurrent PTPRZ1-MET fusion transcript in secondary glioblastomas.

PubMed

Bao, Zhao-Shi; Chen, Hui-Min; Yang, Ming-Yu; Zhang, Chuan-Bao; Yu, Kai; Ye, Wan-Lu; Hu, Bo-Qiang; Yan, Wei; Zhang, Wei; Akers, Johnny; Ramakrishnan, Valya; Li, Jie; Carter, Bob; Liu, Yan-Wei; Hu, Hui-Min; Wang, Zheng; Li, Ming-Yang; Yao, Kun; Qiu, Xiao-Guang; Kang, Chun-Sheng; You, Yong-Ping; Fan, Xiao-Long; Song, Wei Sonya; Li, Rui-Qiang; Su, Xiao-Dong; Chen, Clark C; Jiang, Tao

2014-11-01

Studies of gene rearrangements and the consequent oncogenic fusion proteins have laid the foundation for targeted cancer therapy. To identify oncogenic fusions associated with glioma progression, we catalogued fusion transcripts by RNA-seq of 272 gliomas. Fusion transcripts were more frequently found in high-grade gliomas, in the classical subtype of gliomas, and in gliomas treated with radiation/temozolomide. Sixty-seven in-frame fusion transcripts were identified, including three recurrent fusion transcripts: FGFR3-TACC3, RNF213-SLC26A11, and PTPRZ1-MET (ZM). Interestingly, the ZM fusion was found only in grade III astrocytomas (1/13; 7.7%) or secondary GBMs (sGBMs, 3/20; 15.0%). In an independent cohort of sGBMs, the ZM fusion was found in three of 20 (15%) specimens. Genomic analysis revealed that the fusion arose from translocation events involving introns 3 or 8 of PTPRZ and intron 1 of MET. ZM fusion transcripts were found in GBMs irrespective of isocitrate dehydrogenase 1 (IDH1) mutation status. sGBMs harboring ZM fusion showed higher expression of genes required for PIK3CA signaling and lowered expression of genes that suppressed RB1 or TP53 function. Expression of the ZM fusion was mutually exclusive with EGFR overexpression in sGBMs. Exogenous expression of the ZM fusion in the U87MG glioblastoma line enhanced cell migration and invasion. Clinically, patients afflicted with ZM fusion harboring glioblastomas survived poorly relative to those afflicted with non-ZM-harboring sGBMs (P < 0.001). Our study profiles the shifting RNA landscape of gliomas during progression and reveled ZM as a novel, recurrent fusion transcript in sGBMs. © 2014 Bao et al.; Published by Cold Spring Harbor Laboratory Press.

Diagnosis of extraskeletal myxoid chondrosarcoma in the thigh using EWSR1-NR4A3 gene fusion: a case report.

PubMed

Kobayashi, Hiroki; Kikuta, Kazutaka; Sekita, Tetsuya; Susa, Michiro; Nishimoto, Kazumasa; Sasaki, Aya; Kameyama, Kaori; Sugita, Shintaro; Hasegawa, Tadashi; Nakamura, Masaya; Matsumoto, Morio; Morioka, Hideo

2016-11-10

Extraskeletal myxoid chondrosarcoma is a rare soft tissue sarcoma that has unusual ultrastructural and molecular features. However, unlike other soft tissue sarcomas, it does not have specific clinical symptoms or radiological features, which can make its diagnosis difficult. Nevertheless, extraskeletal myxoid chondrosarcoma has a rare gene fusion (EWSR1-NR4A3) that is useful for making a differential diagnosis. A 43-year-old Japanese man presented with a soft tissue mass in his right thigh. A physical examination and radiography revealed a large soft tissue mass. During magnetic resonance imaging, the mass exhibited isointensity on T1-weighted images and high intensity on T2-weighted images, as well as gadolinium enhancement at the side edge of the partition structure. Thus, we considered a possible diagnosis of a malignant myxoid soft tissue tumor, such as myxoid liposarcoma, myxofibrosarcoma, or metastatic carcinomas, including myoepithelial tumor and neuroendocrine tumor, and performed an incisional biopsy to make a definitive diagnosis. The pathological findings revealed a lobulated tumor with a myxoid structure and atypical spindle-shaped cells that created eosinophilic cord-like forms. Immunohistochemistry revealed that the tumor was positive for S-100 and negative for synaptophysin, chromogranin A, and pan keratin (AE1/AE3). The percentage of Ki-67 was 10 % in the hot spot area. Based on these clinicopathological findings, we initially considered the possibility of a myxoid liposarcoma, although we did not observe any lipoblasts. Therefore, we considered the possibility of an extraskeletal myxoid chondrosarcoma. As this tumor is very rare, we searched for the EWSR1-NR4A3 gene fusion using fluorescence in situ hybridization, which confirmed the diagnosis of extraskeletal myxoid chondrosarcoma. Positron emission tomography-computed tomography did not identify any obvious metastases, and we performed radical resection of our patient's vastus medialis and

NUP160-SLC43A3 is a novel recurrent fusion oncogene in angiosarcoma.

PubMed

Shimozono, Naoki; Jinnin, Masatoshi; Masuzawa, Mamiko; Masuzawa, Mikio; Wang, Zhongzhi; Hirano, Ayaka; Tomizawa, Yukiko; Etoh-Kira, Tomomi; Kajihara, Ikko; Harada, Miho; Fukushima, Satoshi; Ihn, Hironobu

2015-11-01

Angiosarcoma is a malignant vascular tumor originating from endothelial cells of blood vessels or lymphatic vessels. The specific driver mutations in angiosarcoma remain unknown. In this study, we investigated this issue by transcriptome sequencing of patient-derived angiosarcoma cells (ISO-HAS), identifying a novel fusion gene NUP160-SLC43A3 found to be expressed in 9 of 25 human angiosarcoma specimens that were examined. In tumors harboring the fusion gene, the duration between the onset of symptoms and the first hospital visit was significantly shorter, suggesting more rapid tumor progression. Stable expression of the fusion gene in nontransformed human dermal microvascular endothelial cells elicited a gene-expression pattern mimicking ISO-HAS cells and increased cell proliferation, an effect traced in part to NUP160 truncation. Conversely, RNAi-mediated attenuation of NUP160 in ISO-HAS cells decreased cell number. Confirming the oncogenic effects of the fusion protein, subcutaneous implantation of NUP160-SLC43A3-expressing fibroblasts induced tumors resembling human angiosarcoma. Collectively, our findings advance knowledge concerning the genetic causes of angiosarcoma, with potential implications for new diagnostic and therapeutic approaches. ©2015 American Association for Cancer Research.

Epithelioid fibrous histiocytoma: molecular characterization of ALK fusion partners in 23 cases.

PubMed

Dickson, Brendan C; Swanson, David; Charames, George S; Fletcher, Christopher Dm; Hornick, Jason L

2018-05-01

Epithelioid fibrous histiocytoma is a rare and distinctive cutaneous neoplasm. Most cases harbor ALK rearrangement and show ALK overexpression, which distinguish this neoplasm from conventional cutaneous fibrous histiocytoma and variants. SQSTM1 and VCL have previously been shown to partner with ALK in one case each of epithelioid fibrous histiocytoma. The purpose of this study was to examine a large cohort of epithelioid fibrous histiocytomas by next-generation sequencing to characterize the nature and prevalence of ALK fusion partners. A retrospective archival review was performed to identify cases of epithelioid fibrous histiocytoma (2012-2016). Immunohistochemistry was performed to confirm ALK expression. Targeted next-generation sequencing was applied on RNA extracted from formalin-fixed paraffin-embedded tissue to identify the fusion partners. Twenty-three cases fulfilled inclusion criteria. The mean patient age was 39 years (range, 8-74), there was no sex predilection, and >75% of cases involved the lower extremities. The most common gene fusions were SQSTM1-ALK (N=12; 52%) and VCL-ALK (N=7; 30%); the other four cases harbored novel fusion partners (DCTN1, ETV6, PPFIBP1, and SPECC1L). The pattern of ALK immunoreactivity was usually granular cytoplasmic (N=12; 52%) or granular cytoplasmic and nuclear (N=10; 43%); the case containing an ETV6 fusion partner showed nuclear staining alone. There was no apparent relationship between tumor morphology and the ALK fusion partner. In summary, SQSTM1 and VCL are the most common ALK fusion partners in epithelioid fibrous histiocytoma; DCTN1, ETV6, PPFIBP1, and SPECC1L represent rare fusion partners. The proteins encoded by these genes play diverse roles in scaffolding, cell adhesion, signaling, and transcription (among others) without clear commonalities. These findings expand the oncogenic promiscuity of many of these ALK fusion genes, which drive neoplasia in tumors of diverse lineages with widely varied clinical

State-of-the-Art Fusion-Finder Algorithms Sensitivity and Specificity

PubMed Central

Carrara, Matteo; Beccuti, Marco; Lazzarato, Fulvio; Cavallo, Federica; Cordero, Francesca; Donatelli, Susanna; Calogero, Raffaele A.

2013-01-01

Background. Gene fusions arising from chromosomal translocations have been implicated in cancer. RNA-seq has the potential to discover such rearrangements generating functional proteins (chimera/fusion). Recently, many methods for chimeras detection have been published. However, specificity and sensitivity of those tools were not extensively investigated in a comparative way. Results. We tested eight fusion-detection tools (FusionHunter, FusionMap, FusionFinder, MapSplice, deFuse, Bellerophontes, ChimeraScan, and TopHat-fusion) to detect fusion events using synthetic and real datasets encompassing chimeras. The comparison analysis run only on synthetic data could generate misleading results since we found no counterpart on real dataset. Furthermore, most tools report a very high number of false positive chimeras. In particular, the most sensitive tool, ChimeraScan, reports a large number of false positives that we were able to significantly reduce by devising and applying two filters to remove fusions not supported by fusion junction-spanning reads or encompassing large intronic regions. Conclusions. The discordant results obtained using synthetic and real datasets suggest that synthetic datasets encompassing fusion events may not fully catch the complexity of RNA-seq experiment. Moreover, fusion detection tools are still limited in sensitivity or specificity; thus, there is space for further improvement in the fusion-finder algorithms. PMID:23555082

Expression, purification and characterization of a phyAm-phyCs fusion phytase*

PubMed Central

Zou, Li-kou; Wang, Hong-ning; Pan, Xin; Tian, Guo-bao; Xie, Zi-wen; Wu, Qi; Chen, Hui; Xie, Tao; Yang, Zhi-rong

2008-01-01

The phyAm gene encoding acid phytase and optimized neutral phytase phyCs gene were inserted into expression vector pPIC9K in correct orientation and transformed into Pichia pastoris in order to expand the pH profile of phytase and decrease the cost of production. The fusion phytase phyAm-phyCs gene was successfully overexpressed in P. pastoris as an active and extracellular phytase. The yield of total extracellular fusion phytase activity is (25.4±0.53) U/ml at the flask scale and (159.1±2.92) U/ml for high cell-density fermentation, respectively. Purified fusion phytase exhibits an optimal temperature at 55 °C and an optimal pH at 5.5~6.0 and its relative activity remains at a relatively high level of above 70% in the range of pH 2.0 to 7.0. About 51% to 63% of its original activity remains after incubation at 75 °C to 95 °C for 10 min. Due to heavy glycosylation, the expressed fusion phytase shows a broad and diffuse band in SDS-PAGE (sodium dodecyl sulfate-polyacrylamide gel electrophoresis). After deglycosylation by endoglycosidase H (EndoHf), the enzyme has an apparent molecular size of 95 kDa. The characterization of the fusion phytase was compared with those of phyCs and phyAm. PMID:18600783

Regulation of notochord-specific expression of Ci-Bra downstream genes in Ciona intestinalis embryos.

PubMed

Takahashi, Hiroki; Hotta, Kohji; Takagi, Chiyo; Ueno, Naoto; Satoh, Nori; Shoguchi, Eiichi

2010-02-01

Brachyury, a T-box transcription factor, is expressed in ascidian embryos exclusively in primordial notochord cells and plays a pivotal role in differentiation of notochord cells. Previously, we identified approximately 450 genes downstream of Ciona intestinalis Brachyury (Ci-Bra), and characterized the expression profiles of 45 of these in differentiating notochord cells. In this study, we looked for cisregulatory sequences in minimal enhancers of 20 Ci-Bra downstream genes by electroporating region within approximately 3 kb upstream of each gene fused with lacZ. Eight of the 20 reporters were expressed in notochord cells. The minimal enchancer for each of these eight genes was narrowed to a region approximately 0.5-1.0-kb long. We also explored the genome-wide and coordinate regulation of 43 Ci-Bra-downstream genes. When we determined their chromosomal localization, it became evident that they are not clustered in a given region of the genome, but rather distributed evenly over 13 of the 14 pairs of chromosomes, suggesting that gene clustering does not contribute to coordinate control of the Ci-Bra downstream gene expression. Our results might provide Insights Into the molecular mechanisms underlying notochord formation in chordates.

Histological and immunohistochemical characteristics of undifferentiated small round cell sarcomas associated with CIC-DUX4 and BCOR-CCNB3 fusion genes.

PubMed

Yamada, Yuichi; Kuda, Masaaki; Kohashi, Kenichi; Yamamoto, Hidetaka; Takemoto, Junkichi; Ishii, Takeaki; Iura, Kunio; Maekawa, Akira; Bekki, Hirofumi; Ito, Takamichi; Otsuka, Hiroshi; Kuroda, Makoto; Honda, Yumi; Sumiyoshi, Shinji; Inoue, Takeshi; Kinoshita, Naoe; Nishida, Atsushi; Yamashita, Kyoko; Ito, Ichiro; Komune, Shizuo; Taguchi, Tomoaki; Iwamoto, Yukihide; Oda, Yoshinao

2017-04-01

CIC-DUX4 and BCOR-CCNB3 fusion-gene-associated small round cell sarcomas account for a proportion of pediatric small round cell sarcomas, but their pathological features have not been sufficiently clarified. We reviewed a large number of soft tissue tumors registered at our institution, retrieved the cases of unclassified tumors with a small round cell component, and subjected them to histopathological, immunohistochemical, and gene profile analysis. We reviewed 164 cases of unclassified tumors with a small round cell component and analyzed them by RT-PCR and FISH. Tumors positive for a specific fusion-gene were also subjected to histopathological and immunohistochemical examinations. We identified 16 cases of BCOR-CCNB3/CIC-associated (CIC-DUX4 or CIC gene rearrangement-positive) sarcomas. These included seven BCOR-CCNB3 sarcomas and nine CIC-associated sarcomas. Heterogeneous elements included a myxoid spindle cell component in three BCOR-CCNB3 sarcomas and an epithelioid cell component in two CIC-associated sarcomas (one CIC-DUX4-positive and one CIC-DUX4-negative sarcomas). Mitotic activity was low in both heterogeneous components. By immunohistochemistry, in seven BCOR-CCNB3 sarcomas expression of EMA was positive in two cases, of p63 in three, of CD56 in six, of TLE1 in seven, of NKX2.2 in two, of CCNB3 in seven, and of BCOR in six cases (one case could not be tested for BCOR). In nine cases of CIC-associated sarcoma, CD56 was expressed in five, alpha-smooth muscle actin in one, ERG in three, and CD99, WT1 and TLE1 each in eight cases. Both sarcoma types showed not only a small round cell component, but also a myxoid/epithelioid component with low mitotic activity.

CNVs leading to fusion transcripts in individuals with autism spectrum disorder

PubMed Central

Holt, Richard; Sykes, Nuala H; Conceição, Inês C; Cazier, Jean-Baptiste; Anney, Richard JL; Oliveira, Guiomar; Gallagher, Louise; Vicente, Astrid; Monaco, Anthony P; Pagnamenta, Alistair T

2012-01-01

There is strong evidence that rare copy number variants (CNVs) have a role in susceptibility to autism spectrum disorders (ASDs). Much research has focused on how CNVs mediate a phenotypic effect by altering gene expression levels. We investigated an alternative mechanism whereby CNVs combine the 5′ and 3′ ends of two genes, creating a ‘fusion gene'. Any resulting mRNA with an open reading frame could potentially alter the phenotype via a gain-of-function mechanism. We examined 2382 and 3096 rare CNVs from 996 individuals with ASD and 1287 controls, respectively, for potential to generate fusion transcripts. There was no increased burden in individuals with ASD; 122/996 cases harbored at least one rare CNV of this type, compared with 179/1287 controls (P=0.89). There was also no difference in the overall frequency distribution between cases and controls. We examined specific examples of such CNVs nominated by case–control analysis and a candidate approach. Accordingly, a duplication involving REEP1-POLR1A (found in 3/996 cases and 0/1287 controls) and a single occurrence CNV involving KIAA0319-TDP2 were tested. However, no fusion transcripts were detected by RT-PCR. Analysis of additional samples based on cell line availability resulted in validation of a MAPKAPK5-ACAD10 fusion transcript in two probands. However, this variant was present in controls at a similar rate and is unlikely to influence ASD susceptibility. In summary, although we find no evidence that fusion-gene generating CNVs lead to ASD susceptibility, discovery of a MAPKAPK5-ACAD10 transcript with an estimated frequency of ∼1/200 suggests that gain-of-function mechanisms should be considered in future CNVs studies. PMID:22549408

Amplification of the BCR/ABL fusion gene clustered on a masked Philadelphia chromosome in a patient with myeloblastic crisis of chronic myelocytic leukemia.

PubMed

Gargallo, Patricia M; Cuello, Maria Teresa; Aranguren, Pedro Negri; Larripa, Irene B

2003-06-01

Although the chronic phase of chronic myelocytic leukemia (CML) is characterized by the Philadelphia (Ph) chromosome creating a hybrid BCR/ABL gene, additional genetic changes involved in blast crisis are poorly understood. We report a 4-8-fold amplification by tandem duplication of the BCR/ABL fusion gene clustered on a masked Ph chromosome in a 61-year-old male patient with CML in myeloblastic crisis. Our finding suggests that the BCR/ABL amplification may play a role as a novel mechanism in the progression to an aggressive blast transformation in some cases of Ph-positive CML.

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

New methods for tightly regulated gene expression and highly efficient chromosomal integration of cloned genes for Methanosarcina species

DOE PAGES

Guss, Adam M.; Rother, Michael; Zhang, Jun Kai; ...

2008-01-01

A highly efficient method for chromosomal integration of cloned DNA into Methanosarcina spp. was developed utilizing the site-specific recombination system from the Streptomyces phage φC31. Host strains expressing the φC31 integrase gene and carrying an appropriate recombination site can be transformed with non-replicating plasmids carrying the complementary recombination site at efficiencies similar to those obtained with self-replicating vectors. We have also constructed a series of hybrid promoters that combine the highly expressed M. barkeri P mcrB promoter with binding sites for the tetracycline-responsive, bacterial TetR protein. These promoters are tightly regulated by the presence or absence of tetracycline in strainsmore » that express the tetR gene. The hybrid promoters can be used in genetic experiments to test gene essentiality by placing a gene of interest under their control. Thus, growth of strains with tetR -regulated essential genes becomes tetracycline-dependent. A series of plasmid vectors that utilize the site-specific recombination system for construction of reporter gene fusions and for tetracycline regulated expression of cloned genes are reported. These vectors were used to test the efficiency of translation at a variety of start codons. Fusions using an ATG start site were the most active, whereas those using GTG and TTG were approximately one half or one fourth as active, respectively. The CTG fusion was 95% less active than the ATG fusion.« less

Gene amplification during myogenic differentiation

PubMed Central

Fischer, Ulrike; Ludwig, Nicole; Raslan, Abdulrahman; Meier, Carola; Meese, Eckart

2016-01-01

Gene amplifications are mostly an attribute of tumor cells and drug resistant cells. Recently, we provided evidence for gene amplifications during differentiation of human and mouse neural progenitor cells. Here, we report gene amplifications in differentiating mouse myoblasts (C2C12 cells) covering a period of 7 days including pre-fusion, fusion and post-fusion stages. After differentiation induction we found an increase in copy numbers of CDK4 gene at day 3, of NUP133 at days 4 and 7, and of MYO18B at day 4. The amplification process was accompanied by gamma-H2AX foci that are indicative of double stand breaks. Amplifications during the differentiating process were also found in primary human myoblasts with the gene CDK4 and NUP133 amplified both in human and mouse myoblasts. Amplifications of NUP133 and CDK4 were also identified in vivo on mouse transversal cryosections at stage E11.5. In the course of myoblast differentiation, we found amplifications in cytoplasm indicative of removal of amplified sequences from the nucleus. The data provide further evidence that amplification is a fundamental mechanism contributing to the differentiation process in mammalians. PMID:26760505

Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

PubMed Central

2010-01-01

Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

Detection of coliform bacteria and Escherichia coli by multiplex polymerase chain reaction: comparison with defined substrate and plating methods for water quality monitoring.

PubMed Central

Bej, A K; McCarty, S C; Atlas, R M

1991-01-01

Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116

Gene transfer and gene mapping in mammalian cells in culture.

PubMed

Shows, T B; Sakaguchi, A Y

1980-01-01

The ability to transfer mammalian genes parasexually has opened new possibilities for gene mapping and fine structure mapping and offers great potential for contributing to several aspects of mammalian biology, including gene expression and genetic engineering. The DNA transferred has ranged from whole genomes to single genes and smaller segments of DNA. The transfer of whole genomes by cell fusion forms cell hybrids, which has promoted the extensive mapping of human and mouse genes. Transfer, by cell fusion, of rearranged chromosomes has contributed significantly to determining close linkage and the assignment of genes to specific chromosomal regions. Transfer of single chromosomes has been achieved utilizing microcells fused to recipient cells. Metaphase chromosomes have been isolated and used to transfer single-to-multigenic DNA segments. DNA-mediated gene transfer, simulating bacterial transformation, has achieved transfer of single-copy genes. By utilizing DNA cleaved with restriction endonucleases, gene transfer is being empolyed as a bioassay for the purification of genes. Gene mapping and the fate of transferred genes can be examined now at the molecular level using sequence-specific probles. Recently, single genes have been cloned into eucaryotic and procaryotic vectors for transfer into mammalian cells. Moreover, recombinant libraries in which entire mammalian genomes are represented collectively are a rich new source of transferable genes. Methodology for transferring mammalian genetic information and applications for mapping mammalian genes is presented and prospects for the future discussed.

TFG-MET fusion in an infantile spindle cell sarcoma with neural features.

PubMed

Flucke, Uta; van Noesel, Max M; Wijnen, Marc; Zhang, Lei; Chen, Chun-Liang; Sung, Yun-Shao; Antonescu, Cristina R

2017-09-01

An increasing number of congenital and infantile sarcomas displaying a primitive, monomorphic spindle cell phenotype have been characterized to harbor recurrent gene fusions, including infantile fibrosarcoma and congenital spindle cell rhabdomyosarcoma. Here, we report an unusual spindle cell sarcoma presenting as a large and infiltrative pelvic soft tissue mass in a 4-month-old girl, which revealed a novel TFG-MET gene fusion by whole transcriptome RNA sequencing. The tumor resembled the morphology of an infantile fibrosarcoma with both fascicular and patternless growth, however, it expressed strong S100 protein immunoreactivity, while lacking SOX10 staining and retaining H3K27me3 expression. Although this immunoprofile suggested partial neural/neuroectodermal differentiation, overall features were unusual and did not fit into any known tumor types (cellular schwannoma, MPNST), raising the possibility of a novel pathologic entity. The TFG-MET gene fusion expands the genetic spectrum implicated in the pathogenesis of congenital spindle cell sarcomas, with yet another example of kinase oncogenic activation through chromosomal translocation. The discovery of this new fusion is significant since the resulting MET activation can potentially be inhibited by targeted therapy, as MET inhibitors are presently available in clinical trials. © 2017 Wiley Periodicals, Inc.

Sequence motifs and prokaryotic expression of the reptilian paramyxovirus fusion protein

USGS Publications Warehouse

Franke, J.; Batts, W.N.; Ahne, W.; Kurath, G.; Winton, J.R.

2006-01-01

Fourteen reptilian paramyxovirus isolates were chosen to represent the known extent of genetic diversity among this novel group of viruses. Selected regions of the fusion (F) gene were sequenced, analyzed and compared. The F gene of all isolates contained conserved motifs homologous to those described for other members of the family Paramyxoviridae including: signal peptide, transmembrane domain, furin cleavage site, fusion peptide, N-linked glycosylation sites, and two heptad repeats, the second of which (HRB-LZ) had the characteristics of a leucine zipper. Selected regions of the fusion gene of isolate Gono-GER85 were inserted into a prokaryotic expression system to generate three recombinant protein fragments of various sizes. The longest recombinant protein was cleaved by furin into two fragments of predicted length. Western blot analysis with virus-neutralizing rabbit-antiserum against this isolate demonstrated that only the longest construct reacted with the antiserum. This construct was unique in containing 30 additional C-terminal amino acids that included most of the HRB-LZ. These results indicate that the F genes of reptilian paramyxoviruses contain highly conserved motifs typical of other members of the family and suggest that the HRB-LZ domain of the reptilian paramyxovirus F protein contains a linear antigenic epitope. ?? Springer-Verlag 2005.

Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia

PubMed Central

2010-01-01

Background Newcastle disease (ND), caused by Newcastle disease virus (NDV), is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. Results The coding region of eleven NDV isolates fusion (F) gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN) gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia), Ch/2000 (China), local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. Conclusions The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases. PMID:20691110

Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia.

PubMed

Berhanu, Ayalew; Ideris, Aini; Omar, Abdul R; Bejo, Mohd Hair

2010-08-08

Newcastle disease (ND), caused by Newcastle disease virus (NDV), is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. The coding region of eleven NDV isolates fusion (F) gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN) gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia), Ch/2000 (China), local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.