Lafuente, M J; Petit, T; Gancedo, C
1997-12-22
We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.
Reichel, J M; Bedenk, B T; Gassen, N C; Hafner, K; Bura, S A; Almeida-Correa, S; Genewsky, A; Dedic, N; Giesert, F; Agarwal, A; Nave, K-A; Rein, T; Czisch, M; Deussing, J M; Wotjak, C T
2016-10-01
Expression of the lacZ-sequence is a widely used reporter-tool to assess the transgenic and/or transfection efficacy of a target gene in mice. Once activated, lacZ is permanently expressed. However, protein accumulation is one of the hallmarks of neurodegenerative diseases. Furthermore, the protein product of the bacterial lacZ gene is ß-galactosidase, an analog to the mammalian senescence-associated ß-galactosidase, a molecular marker for aging. Therefore we studied the behavioral, structural and molecular consequences of lacZ expression in distinct neuronal sub-populations. lacZ expression in cortical glutamatergic neurons resulted in severe impairments in hippocampus-dependent memory accompanied by marked structural alterations throughout the CNS. In contrast, GFP expression or the expression of the ChR2/YFP fusion product in the same cell populations did not result in either cognitive or structural deficits. GABAergic lacZ expression caused significantly decreased hyper-arousal and mild cognitive deficits. Attenuated structural and behavioral consequences of lacZ expression could also be induced in adulthood, and lacZ transfection in neuronal cell cultures significantly decreased their viability. Our findings provide a strong caveat against the use of lacZ reporter mice for phenotyping studies and point to a particular sensitivity of the hippocampus formation to detrimental consequences of lacZ expression. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
An in vitro bioassay for xenobiotics using the SXR-driven human CYP3A4/lacZ reporter gene.
Lee, Mi R; Kim, Yeon J; Hwang, Dae Y; Kang, Tae S; Hwang, Jin H; Lim, Chae H; Kang, Hyung K; Goo, Jun S; Lim, Hwa J; Ahn, Kwang S; Cho, Jung S; Chae, Kap R; Kim, Yong K
2003-01-01
The dose and time effect of nine xenobiotics, including 17beta-estradiol, corticosterone, dexamethasone, progesterone, nifedipine, bisphenol A, rifampicin, methamphetamine, and nicotine were investigated, in vitro, using human steroid and xenobiotics receptor (SXR)-binding sites on the human CYP3A4 promoter, which can enhance the linked lacZ reporter gene transcription. To test this, liver-specific SAP (human serum amyloid P component)-SXR (SAP/SXR) and human CYP3A4 promoter-regulated lacZ (hCYP3A4/lacZ) constructs were transiently transfected into HepG2 and NIH3T3 cells to compare the xenobiotic responsiveness between human and nonhuman cell lines. In the HepG2 cells, rifampicin, followed by corticosterone, nicotine, methamphetamine, and dexamethasone, exhibited enhanced levels of the lacZ transcript, whereas those of bisphenol A and nifedipine were found to be reduced. No significant responses were observed with 17beta-estradiol or progesterone. In addition, 17beta-estradiol and progesterone did not change the levels of the lacZ transcripts in the HepG2 cells, but did induce significant increases in the transcripts of the NIH3T3 cells. Treatment with corticosterone and dexamethasone, which were highly expressed in the HepG2 cells, did not affect the levels of the lacZ transcript in NIH3T3 cells. These results show that lacZ transcripts can be measured, rapidly and reproducibly, using reverse transcriptase-polymerase chain reaction (RT-PCR) based on the expression of the hCYP3A4/lacZ reporter gene, and was mediated by the SXR. Thus, this in vitro reporter gene bioassay is useful for measuring xenobiotic activities, and is a means to a better relevant bioassay, using human cells, human genes and human promoters, in order to get a closer look at actual human exposure.
Wegener, Marius; Vogtmann, Kristina; Huber, Madeleine; Laass, Sebastian; Soppa, Jörg
2016-12-01
Reporter genes facilitate the characterization of promoter activities, transcript stabilities, translational efficiencies, or intracellular localization. Various reporter genes for Escherichia coli have been established, however, most of them have drawbacks like transcript instability or the inability to be used in genetic selections. Therefore, the glpD gene encoding glycerol-3-phosphate dehydrogenase was introduced as a novel reporter gene for E. coli. The enzymatic assay was optimized, and it was verified that growth on glycerol strictly depends on the presence of GlpD. The 5'-UTRs of three E. coli genes were chosen and cloned upstream of the new reporter gene glpD as well as the established reporter genes lacZ and gusA. Protein and transcript levels were quantified and translational efficiencies were calculated. The lacZ transcript was very unstable and its level highly depended on its translation, compromising its use as a reporter. The results obtained with gusA and glpD were similar, however, only glpD can be used for genetic selections. Therefore, glpD was found to be a superior novel reporter gene compared to the established reporter genes lacZ and gusA. Copyright © 2016 Elsevier B.V. All rights reserved.
NASA Technical Reports Server (NTRS)
Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.
2001-01-01
Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.
Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.
Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A
1996-01-01
We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.
Koponen, Jonna K; Turunen, Anna-Mari; Ylä-Herttuala, Seppo
2002-03-01
Real-time PCR is a powerful method for the quantification of gene expression in biological samples. This method uses TaqMan chemistry based on the 5' -exonuclease activity of the AmpliTaq Gold DNA polymerase which releases fluorescence from hybridized probes during synthesis of each new PCR product. Many gene therapy studies use lacZ, encoding Escherichia coli beta-galactosidase, as a marker gene. Our results demonstrate that E. coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ gene expression and decreases sensitivity of the method below the level required for biodistribution and long-term gene expression studies. In biodistribution analyses the contamination can lead to false-negative results by masking low-level lacZ expression in target and ectopic tissues, and false-positive results if sufficient controls are not used. We conclude that, to get reliable TaqMan results with lacZ, adequate controls should be included in each run to rule out contamination from AmpliTaq Gold polymerase.
Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.
2013-01-01
To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051
Genetics in methylotrophic bacteria: Appendix. Final report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lidstrom, M.E.
This research has focused primarily on promoters in Methylobacterium extorquens AM1 and in methanotrophic bacteria. In Methylobacterium extorquens work continued on the moxF promoter. The author constructed chromosomal lacZ fusions of this promoter to avoid the regulation problems of plasmid-borne fragments and has shown that this is regulated normally in the chromosome. She has constructed lacZ fusions to some of the mox genes involved in the synthesis of the cofactor, PQQ, in order to carry out similar analysis of transcription of PQQ genes. The author has continued to isolate mox genes in methanotrophs for the purpose of studying their promotersmore » and transcriptional regulation.« less
Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.
2016-01-01
The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924
Zabeau, M; Stanley, K K
1982-01-01
Hybrid plasmids carrying cro-lacZ gene fusions have been constructed by joining DNA segments carrying the PR promoter and the start of the cro gene of bacteriophage lambda to the lacZ gene fragment carried by plasmid pLG400 . Plasmids in which the translational reading frames of the cro and lacZ genes are joined in-register (type I) direct the synthesis of elevated levels of cro-beta-galactosidase fusion protein amounting to 30% of the total cellular protein, while plasmids in which the genes are fused out-of-register (type II) produce a low level of beta-galactosidase protein. Sequence rearrangements downstream of the cro initiator AUG were found to influence the efficiency of translation, and have been correlated with alterations in the RNA secondary structure of the ribosome-binding site. Plasmids which direct the synthesis of high levels of beta-galactosidase are conditionally lethal and can only be propagated when the PR promoter is repressed. Deletion of sequences downstream of the lacZ gene restored viability, indicating that this region of the plasmid encodes a function which inhibits the growth of the cells. The different applications of these plasmids for expression of cloned genes are discussed. Images Fig. 6. PMID:6327257
Fusion Simulation Project Workshop Report
NASA Astrophysics Data System (ADS)
Kritz, Arnold; Keyes, David
2009-03-01
The mission of the Fusion Simulation Project is to develop a predictive capability for the integrated modeling of magnetically confined plasmas. This FSP report adds to the previous activities that defined an approach to integrated modeling in magnetic fusion. These previous activities included a Fusion Energy Sciences Advisory Committee panel that was charged to study integrated simulation in 2002. The report of that panel [Journal of Fusion Energy 20, 135 (2001)] recommended the prompt initiation of a Fusion Simulation Project. In 2003, the Office of Fusion Energy Sciences formed a steering committee that developed a project vision, roadmap, and governance concepts [Journal of Fusion Energy 23, 1 (2004)]. The current FSP planning effort involved 46 physicists, applied mathematicians and computer scientists, from 21 institutions, formed into four panels and a coordinating committee. These panels were constituted to consider: Status of Physics Components, Required Computational and Applied Mathematics Tools, Integration and Management of Code Components, and Project Structure and Management. The ideas, reported here, are the products of these panels, working together over several months and culminating in a 3-day workshop in May 2007.
INTRODUCTION: Status report on fusion research
NASA Astrophysics Data System (ADS)
Burkart, Werner
2005-10-01
A major milestone on the path to fusion energy was reached in June 2005 on the occasion of the signing of the joint declaration of all parties to the ITER negotiations, agreeing on future arrangements and on the construction site at Cadarache in France. The International Atomic Energy Agency has been promoting fusion activities since the late 1950s; it took over the auspices of the ITER Conceptual Design Activities in 1988, and of the ITER Engineering and Design Activities in 1992. The Agency continues its support to Member States through the organization of consultancies, workshops and technical meetings, the most prominent being the series of International Fusion Energy Conferences (formerly called the International Conference on Plasma Physics and Controlled Nuclear Fusion Research). The meetings serve as a platform for experts from all Member States to have open discussions on their latest accomplishments as well as on their problems and eventual solutions. The papers presented at the meetings and conferences are routinely published, many being sent to the journal it Nuclear Fusion, co-published monthly by Institute of Physics Publishing, Bristol, UK. The journal's reputation is reflected in the fact that it is a world-renowned publication, and the International Fusion Research Council has used it for the publication of a Status Report on Controlled Thermonuclear Fusion in 1978 and 1990. This present report marks the conclusion of the preparatory phases of ITER activities. It provides background information on the progress of fusion research within the last 15 years. The International Fusion Research Council (IFRC), which initiated the report, was fully aware of the complexities of including all scientific results in just one paper, and so decided to provide an overview and extensive references for the interested reader who need not necessarily be a fusion specialist. Professor Predhiman K. Kaw, Chairman, prepared the report on behalf of the IFRC, reflecting
Seier, Tracey; Padgett, Dana R; Zilberberg, Gal; Sutera, Vincent A; Toha, Noor; Lovett, Susan T
2011-06-01
Strand misalignments at DNA repeats during replication are implicated in mutational hotspots. To study these events, we have generated strains carrying mutations in the Escherichia coli chromosomal lacZ gene that revert via deletion of a short duplicated sequence or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences. Using these strains, we demonstrate that mutation of the distal repeat of a quasipalindrome, with respect to replication fork movement, is about 10-fold higher than the proximal repeat, consistent with more common template switching on the leading strand. The leading strand bias was lost in the absence of exonucleases I and VII, suggesting that it results from more efficient suppression of template switching by 3' exonucleases targeted to the lagging strand. The loss of 3' exonucleases has no effect on strand misalignment at direct repeats to produce deletion. To compare these events to other mutations, we have reengineered reporters (designed by Cupples and Miller 1989) that detect specific base substitutions or frameshifts in lacZ with the reverting lacZ locus on the chromosome rather than an F' element. This set allows rapid screening of potential mutagens, environmental conditions, or genetic loci for effects on a broad set of mutational events. We found that hydroxyurea (HU), which depletes dNTP pools, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple frameshifts, or base substitutions. Mutations in nucleotide diphosphate kinase, ndk, significantly elevated simple mutations but had little effect on the templated class. Zebularine, a cytosine analog, elevated all classes.
Fusion Safety Program annual report, fiscal year 1994
NASA Astrophysics Data System (ADS)
Longhurst, Glen R.; Cadwallader, Lee C.; Dolan, Thomas J.; Herring, J. Stephen; McCarthy, Kathryn A.; Merrill, Brad J.; Motloch, Chester C.; Petti, David A.
1995-03-01
This report summarizes the major activities of the Fusion Safety Program in fiscal year 1994. The Idaho National Engineering Laboratory (INEL) is the designated lead laboratory and Lockheed Idaho Technologies Company is the prime contractor for this program. The Fusion Safety Program was initiated in 1979. Activities are conducted at the INEL, at other DOE laboratories, and at other institutions, including the University of Wisconsin. The technical areas covered in this report include tritium safety, beryllium safety, chemical reactions and activation product release, safety aspects of fusion magnet systems, plasma disruptions, risk assessment failure rate data base development, and thermalhydraulics code development and their application to fusion safety issues. Much of this work has been done in support of the International Thermonuclear Experimental Reactor (ITER). Also included in the report are summaries of the safety and environmental studies performed by the Fusion Safety Program for the Tokamak Physics Experiment and the Tokamak Fusion Test Reactor and of the technical support for commercial fusion facility conceptual design studies. A major activity this year has been work to develop a DOE Technical Standard for the safety of fusion test facilities.
Stefan, Alessandra; Schwarz, Flavio; Bressanin, Daniela; Hochkoeppler, Alejandro
2010-11-01
Silencing of the lacZ gene in Escherichia coli was attempted by means of the expression of antisense RNAs (asRNAs) in vivo. A short fragment of lacZ was cloned into the pBAD expression vector, in reverse orientation, using the EcoRI and PstI restriction sites. This construct (pBAD-Zcal1) was used to transform E. coli cells, and the antisense transcription was induced simply by adding arabinose to the culture medium. We demonstrated that the Zcal1 asRNA effectively silenced lacZ using β-galactosidase activity determinations, SDS-PAGE, and Western blotting. Because the concentration of the lac mRNA was always high in cells that expressed Zcal1, we hypothesize that this antisense acts by inhibiting messenger translation. Similar analyses, performed with a series of site-specific Zcal1 mutants, showed that the Shine-Dalgarno sequence, which is conferred by the pBAD vector, is an essential requisite for silencing competence. Indeed, the presence of the intact Shine-Dalgarno sequence positively affects asRNA stability and, hence, silencing effectiveness. Our observations will contribute to the understanding of the main determinants of silencing as exerted by asRNAs as well as provide useful support for the design of robust and efficient prokaryotic gene silencers. Copyright © 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Pichery, Mélanie; Mirey, Emilie; Mercier, Pascale; Lefrancais, Emma; Dujardin, Arnaud; Ortega, Nathalie; Girard, Jean-Philippe
2012-04-01
IL-33 (previously known as NF from high endothelial venules) is an IL-1 family cytokine that signals through the ST2 receptor and drives cytokine production in mast cells, basophils, eosinophils, invariant NKT and NK cells, Th2 lymphocytes, and type 2 innate immune cells (natural helper cells, nuocytes, and innate helper 2 cells). Little is known about endogenous IL-33; for instance, the cellular sources of IL-33 in mouse tissues have not yet been defined. In this study, we generated an Il-33-LacZ gene trap reporter strain (Il-33(Gt/Gt)) and used this novel tool to analyze expression of endogenous IL-33 in vivo. We found that the Il-33 promoter exhibits constitutive activity in mouse lymphoid organs, epithelial barrier tissues, brain, and embryos. Immunostaining with anti-IL-33 Abs, using Il-33(Gt/Gt) (Il-33-deficient) mice as control, revealed that endogenous IL-33 protein is highly expressed in mouse epithelial barrier tissues, including stratified squamous epithelia from vagina and skin, as well as cuboidal epithelium from lung, stomach, and salivary gland. Constitutive expression of IL-33 was not detected in blood vessels, revealing the existence of species-specific differences between humans and mice. Importantly, IL-33 protein was always localized in the nucleus of producing cells with no evidence for cytoplasmic localization. Finally, strong expression of the Il-33-LacZ reporter was also observed in inflamed tissues, in the liver during LPS-induced endotoxin shock, and in the lung alveoli during papain-induced allergic airway inflammation. Together, our findings support the possibility that IL-33 may function as a nuclear alarmin to alert the innate immune system after injury or infection in epithelial barrier tissues.
Chanda, Palas Kumar; Ganguly, Tridib; Das, Malabika; Lee, Chia Yen; Luong, Thanh T; Sau, Subrata
2007-11-30
Previously it was reported that promoter of groES-groEL operon of Staphylococcus aureus is induced by various cell-wall active antibiotics. In order to exploit the above promoter for identifying novel antistaphylococcal drugs, we have cloned the promoter containing region (P(g)) of groES-groEL operon of S. aureus Newman and found that the above promoter is induced by sublethal concentrations of many antibiotics including cell-wall active antibiotics. A reporter S. aureus RN4220 strain (designated SAU006) was constructed by inserting the P(g)-lacZ transcriptional fusion into its chromosome. Agarose-based assay developed with SAU006 shows that P(g) in single-copy is also induced distinctly by different classes of antibiotics. Data indicate that ciprofloxacin, rifampicin, ampicillin, and cephalothin are strong inducers, whereas, tetracycline, streptomycin and vancomycin induce the above promoter weakly. Sublethal concentrations of ciprofloxacin and ampicilin even have induced P(g) efficiently in microtiter plate grown SAU006. Additional studies show for the first time that above promoter is also induced weakly by arsenate salt and hydrogen peroxide. Taken together, we suggest that our simple and sensitive assay systems with SAU006 could be utilized for screening and detecting not only novel antistaphylococcal compounds but also different toxic chemicals.
Expression of the homeotic gene mab-5 during Caenorhabditis elegans embryogenesis.
Cowing, D W; Kenyon, C
1992-10-01
mab-5 is a member of a complex of homeobox-containing genes evolutionarily related to the Antennapedia and bithorax complexes of Drosophila melanogaster. Like the homeotic genes in Drosophila, mab-5 is required in a particular region along the anterior-posterior body axis, and acts during postembryonic development to give cells in this region their characteristic identities. We have used a mab-5-lacZ fusion integrated into the C. elegans genome to study the posterior-specific expression of mab-5 during embryogenesis. The mab-5-lacZ fusion was expressed in the posterior of the embryo by 180 minutes after the first cleavage, indicating that the mechanisms responsible for the position-specific expression of mab-5-lacZ act at a relatively early stage of embryogenesis. In embryos homozygous for mutations in the par genes, which disrupt segregation of factors during early cleavages, expression of mab-5-lacZ was no longer localized to the posterior. This suggests that posterior-specific expression of mab-5 depends on the appropriate segregation of developmental factors during early embryogenesis. After extrusion of any blastomere of the four-cell embryo, descendants of the remaining three cells could still express the mab-5-lacZ fusion. In these partial embryos, however, the fusion was often expressed in cells scattered throughout the embryo, suggesting that cell-cell interactions and/or proper positioning of early blastomeres are required for mab-5 expression to be localized to the posterior.
Hashimoto-Gotoh, A; Yoshikawa, R; Miyazawa, T
2015-09-01
To avoid contamination of adventitious gammaretroviruses in biological products such as vaccines, it is necessary to check the master seed cells for manufacturing. There are several assays to detect infectious gammaretroviruses. Among these, sarcoma-positive, leukemia-negative (S+L-) assay is a classical infectivity assay, which is often recommended in governmental guidelines. The S+L- cells used in S+L- assay generate unique focus upon the infection of replication-competent gammaretroviruses. Although S+L- assay is well recognized for the detection, their applicability is questionable in some cases. On the other hand, LacZ marker rescue (LMR) assay detects infectious gammaretroviruses by transducing LacZ marker gene to the target cells, which shows lacZ-positive foci if the infectious virus is present. In this study, we compared LMR and S+L- assays for detection of a variety of endogenous and exogenous gammaretroviruses. As results, LMR assay could detect all gammaretroviruses examined. On the other hand, S+L- assay using feline S+L- cells, termed QN10S, could not detect porcine endogenous retrovirus (PERV) subgroups A/B. Further, S+L- mink cells could not detect feline leukemia virus subgroups B in addition to PERV-A/B. These data indicate that LMR assay is better suited to detect wider range of gammaretroviruses. Copyright © 2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Fusion Energy Division progress report, 1 January 1990--31 December 1991
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheffield, J.; Baker, C.C.; Saltmarsh, M.J.
1994-03-01
The Fusion Program of the Oak Ridge National Laboratory (ORNL), a major part of the national fusion program, encompasses nearly all areas of magnetic fusion research. The program is directed toward the development of fusion as an economical and environmentally attractive energy source for the future. The program involves staff from ORNL, Martin Marietta Energy systems, Inc., private industry, the academic community, and other fusion laboratories, in the US and abroad. Achievements resulting from this collaboration are documented in this report, which is issued as the progress report of the ORNL Fusion Energy Division; it also contains information from componentsmore » for the Fusion Program that are external to the division (about 15% of the program effort). The areas addressed by the Fusion Program include the following: experimental and theoretical research on magnetic confinement concepts; engineering and physics of existing and planned devices, including remote handling; development and testing of diagnostic tools and techniques in support of experiments; assembly and distribution to the fusion community of databases on atomic physics and radiation effects; development and testing of technologies for heating and fueling fusion plasmas; development and testing of superconducting magnets for containing fusion plasmas; development and testing of materials for fusion devices; and exploration of opportunities to apply the unique skills, technology, and techniques developed in the course of this work to other areas (about 15% of the Division`s activities). Highlights from program activities during 1990 and 1991 are presented.« less
Deletion of p66Shc in mice increases the frequency of size-change mutations in the lacZ transgene.
Beltrami, Elena; Ruggiero, Antonella; Busuttil, Rita; Migliaccio, Enrica; Pelicci, Pier Giuseppe; Vijg, Jan; Giorgio, Marco
2013-04-01
Upon oxidative challenge the genome accumulates adducts and breaks that activate the DNA damage response to repair, arrest, or eliminate the damaged cell. Thus, reactive oxygen species (ROS) generated by endogenous oxygen metabolism are thought to affect mutation frequency. However, few studies determined the mutation frequency when oxidative stress is reduced. To test whether in vivo spontaneous mutation frequency is altered in mice with reduced oxidative stress and cell death rate, we crossed p66Shc knockout (p66KO) mice, characterized by reduced intracellular concentration of ROS and by impaired apoptosis, with a transgenic line harboring multiple copies of the lacZ mutation reporter gene as part of a plasmid that can be recovered from organs into Escherichia coli to measure mutation rate. Liver and small intestine from 2- to 24-month-old, lacZ (p66Shc+/+) and lacZp66KO mice, were investigated revealing no difference in overall mutation frequency but a significant increase in the frequency of size-change mutations in the intestine of lacZp66KO mice. This difference was further increased upon irradiation of mice with X-ray. In addition, we found that knocking down cyclophilin D, a gene that facilitates mitochondrial apoptosis acting downstream of p66Shc, increased the size-change mutation frequency in small intestine. Size-change mutations also accumulated in death-resistant embryonic fibroblasts from lacZp66KO mice treated with H2 O2 . These results indicate that p66Shc plays a role in the accumulation of DNA rearrangements and suggest that p66Shc functions to clear damaged cells rather than affect DNA metabolism. © 2012 The Authors Aging Cell © 2012 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.
Luo, Wangtai; Miao, Jing; Feng, Zhibin; Lu, Ruiyang; Sun, Xiaoqiang; Zhang, Baoshen; Ding, Weiqiu; Lu, Yang; Wang, Yanhua; Chi, Xiaoyan; Ge, Yihe
2018-05-28
In our recent work, we found that pyrrolnitrin, and not phenazines, pyrrolnitrin contributed to the suppression of the mycelia growth of Fusarium graminearum that causes heavy Fusarium head blight (FHB) disease in cereal crops. However, pyrrolnitrin production of Pseudomonas chlororaphis G05 in King's B medium was very low. Although a few regulatory genes mediating the prnABCD (the prn operon, pyrrolnitrin biosynthetic locus) expression have been identified, it is not enough for us to enhance pyrrolnitrin production by systematically constructing a genetically-engineered strain. To obtain new candidate genes involved in regulation of the prn operon expression, we successfully constructed a fusion mutant G05ΔphzΔprn::lacZ, in which most of the coding regions of the prn operon and the phzABCDEFG (the phz operon, phenazine biosynthetic locus) were deleted, and the promoter region plus the first thirty condons of the prnA was in-frame fused with the truncated lacZ gene on its chromosome. The expression of the fused lacZ reporter gene driven by the promoter of the prn operon made it easy for us to detect the level of the prn expression in terms of the color variation of colonies on LB agar plates supplemented with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal). With this fusion mutant as a recipient strain, mini-Tn5-based random insertional mutagenesis was then conducted. By picking up colonies with color change, it is possible for us to screen and identify new candidate genes involved in regulation of the prn expression. Identification of additional regulatory genes in further work could reasonably be expected to increase pyrrolnitrin production in G05 and to improve its biological control function.
Inertial Confinement Fusion Annual Report 1997
DOE Office of Scientific and Technical Information (OSTI.GOV)
Correll, D
The ICF Annual Report provides documentation of the achievements of the LLNL ICF Program during the fiscal year by the use of two formats: (1) an Overview that is a narrative summary of important results for the fiscal year and (2) a compilation of the articles that previously appeared in the ICF Quarterly Report that year. Both the Overview and Quarterly Report are also on the Web at http://lasers.llnl.gov/lasers/pubs/icfq.html. Beginning in Fiscal Year 1997, the fourth quarter issue of the ICF Quarterly was no longer printed as a separate document but rather included in the ICF Annual. This change providedmore » a more efficient process of documenting our accomplishments with-out unnecessary duplication of printing. In addition we introduced a new document, the ICF Program Monthly Highlights. Starting with the September 1997 issue and each month following, the Monthly Highlights will provide a brief description of noteworthy activities of interest to our DOE sponsors and our stakeholders. The underlying theme for LLNL's ICF Program research continues to be defined within DOE's Defense Programs missions and goals. In support of these missions and goals, the ICF Program advances research and technology development in major interrelated areas that include fusion target theory and design, target fabrication, target experiments, and laser and optical science and technology. While in pursuit of its goal of demonstrating thermonuclear fusion ignition and energy gain in the laboratory, the ICF Program provides research and development opportunities in fundamental high-energy-density physics and supports the necessary research base for the possible long-term application of inertial fusion energy for civilian power production. ICF technologies continue to have spin-off applications for additional government and industrial use. In addition to these topics, the ICF Annual Report covers non-ICF funded, but related, laser research and development and associated applications
A gene expression resource generated by genome-wide lacZ profiling in the mouse
Tuck, Elizabeth; Estabel, Jeanne; Oellrich, Anika; Maguire, Anna Karin; Adissu, Hibret A.; Souter, Luke; Siragher, Emma; Lillistone, Charlotte; Green, Angela L.; Wardle-Jones, Hannah; Carragher, Damian M.; Karp, Natasha A.; Smedley, Damian; Adams, Niels C.; Bussell, James N.; Adams, David J.; Ramírez-Solis, Ramiro; Steel, Karen P.; Galli, Antonella; White, Jacqueline K.
2015-01-01
ABSTRACT Knowledge of the expression profile of a gene is a critical piece of information required to build an understanding of the normal and essential functions of that gene and any role it may play in the development or progression of disease. High-throughput, large-scale efforts are on-going internationally to characterise reporter-tagged knockout mouse lines. As part of that effort, we report an open access adult mouse expression resource, in which the expression profile of 424 genes has been assessed in up to 47 different organs, tissues and sub-structures using a lacZ reporter gene. Many specific and informative expression patterns were noted. Expression was most commonly observed in the testis and brain and was most restricted in white adipose tissue and mammary gland. Over half of the assessed genes presented with an absent or localised expression pattern (categorised as 0-10 positive structures). A link between complexity of expression profile and viability of homozygous null animals was observed; inactivation of genes expressed in ≥21 structures was more likely to result in reduced viability by postnatal day 14 compared with more restricted expression profiles. For validation purposes, this mouse expression resource was compared with Bgee, a federated composite of RNA-based expression data sets. Strong agreement was observed, indicating a high degree of specificity in our data. Furthermore, there were 1207 observations of expression of a particular gene in an anatomical structure where Bgee had no data, indicating a large amount of novelty in our data set. Examples of expression data corroborating and extending genotype-phenotype associations and supporting disease gene candidacy are presented to demonstrate the potential of this powerful resource. PMID:26398943
Van Dyk, T K; Reed, T R; Vollmer, A C; LaRossa, R A
1995-01-01
Escherichia coli strains carrying transcriptional fusions of four sigma 32-controlled E. coli heat shock promoters to luxCDABE or lacZ reporter genes were stressed by chemicals added singly or in pairs. Much more than additive induction resulted from combinations of cadmium chloride, copper sulfate, ethanol, formamide, 4-nitrophenol, and pentachlorophenol. PMID:7592357
Report of the Integrated Program Planning Activity for the DOE Fusion Energy Sciences Program
DOE Office of Scientific and Technical Information (OSTI.GOV)
None
2000-12-01
This report of the Integrated Program Planning Activity (IPPA) has been prepared in response to a recommendation by the Secretary of Energy Advisory Board that, ''Given the complex nature of the fusion effort, an integrated program planning process is an absolute necessity.'' We, therefore, undertook this activity in order to integrate the various elements of the program, to improve communication and performance accountability across the program, and to show the inter-connectedness and inter-dependency of the diverse parts of the national fusion energy sciences program. This report is based on the September 1999 Fusion Energy Sciences Advisory Committee's (FESAC) report ''Prioritiesmore » and Balance within the Fusion Energy Sciences Program''. In its December 5,2000, letter to the Director of the Office of Science, the FESAC has reaffirmed the validity of the September 1999 report and stated that the IPPA presents a framework and process to guide the achievement of the 5-year goals listed in the 1999 report. The National Research Council's (NRC) Fusion Assessment Committee draft final report ''An Assessment of the Department of Energy's Office of Fusion Energy Sciences Program'', reviewing the quality of the science in the program, was made available after the IPPA report had been completed. The IPPA report is, nevertheless, consistent with the recommendations in the NRC report. In addition to program goals and the related 5-year, 10-year, and 15-year objectives, this report elaborates on the scientific issues associated with each of these objectives. The report also makes clear the relationships among the various program elements, and cites these relationships as the reason why integrated program planning is essential. In particular, while focusing on the science conducted by the program, the report addresses the important balances between the science and energy goals of the program, between the MFE and IFE approaches, and between the domestic and international
Magnetized Target Fusion Collaboration. Final report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Slough, John
Nuclear fusion has the potential to satisfy the prodigious power that the world will demand in the future, but it has yet to be harnessed as a practical energy source. The entry of fusion as a viable, competitive source of power has been stymied by the challenge of finding an economical way to provide for the confinement and heating of the plasma fuel. It is the contention here that a simpler path to fusion can be achieved by creating fusion conditions in a different regime at small scale (~ a few cm). One such program now under study, referred tomore » as Magnetized Target Fusion (MTF), is directed at obtaining fusion in this high energy density regime by rapidly compressing a compact toroidal plasmoid commonly referred to as a Field Reversed Configuration (FRC). To make fusion practical at this smaller scale, an efficient method for compressing the FRC to fusion gain conditions is required. In one variant of MTF a conducting metal shell is imploded electrically. This radially compresses and heats the FRC plasmoid to fusion conditions. The closed magnetic field in the target plasmoid suppresses the thermal transport to the confining shell, thus lowering the imploding power needed to compress the target. The undertaking described in this report was to provide a suitable target FRC, as well as a simple and robust method for inserting and stopping the FRC within the imploding liner. The FRC must also survive during the time it takes for the metal liner to compress the FRC target. The initial work at the UW was focused on developing adequate preionization and flux trapping that were found to be essential in past experiments for obtaining the density, flux and most critically, FRC lifetime required for MTF. The timescale for testing and development of such a source can be rapidly accelerated by taking advantage of a new facility funded by the Department of Energy. At this facility, two inductive plasma accelerators (IPA) were constructed and tested. Recent
Report of the Fusion Energy Sciences Advisory Committee Panel on Priorities and Balance
NASA Astrophysics Data System (ADS)
Baker, Charles; Davidson, Ronald; Dean, Stephen; Freidberg, Jeffrey; Sheffield, John
1999-06-01
This report presents the results and recommendations of the deliberations of the DOE Fusion Energy Sciences Advisory Committee (FESAC) Panel on Priorities and Balance, which met in Knoxville, TN, 18-21 August 1999. The Panel identified the achievement of a more integrated national program in magnetic fusion energy (MFE) and inertial fusion energy (IFE) as a major programmatic and policy goal for the years ahead.
Local bone graft harvesting and volumes in posterolateral lumbar fusion: a technical report.
Carragee, Eugene J; Comer, Garet C; Smith, Micah W
2011-06-01
In lumbar surgery, local bone graft is often harvested and used in posterolateral fusion procedures. The volume of local bone graft available for posterolateral fusion has not been determined in North American patients. Some authors have described this as minimal, but others have suggested the volume was sufficient to be reliably used as a stand-alone bone graft substitute for single-level fusion. To describe the technique used and determine the volume of local bone graft available in a cohort of patients undergoing single-level primary posterolateral fusion by the authors harvesting technique. Technical description and cohort report. Consecutive patients undergoing lumbar posterolateral fusion with or without instrumentation for degenerative processes. Local bone graft volume. Consecutive patients undergoing lumbar posterolateral fusion with or without instrumentation for degenerative processes of were studied. Local bone graft was harvested by a standard method in each patient and the volume measured by a standard procedure. Twenty-five patients were studied, and of these 11 (44%) had a previous decompression. The mean volume of local bone graft harvested was measured to be 25 cc (range, 12-36 cc). Local bone graft was augmented by iliac crest bone in six of 25 patients (24%) if the posterolateral fusion bed was not well packed with local bone alone. There was a trend to greater local bone graft volumes in men and in patients without previous decompression. Large volumes of local bone can be harvested during posterolateral lumbar fusion surgery. Even in patients with previous decompression the volume harvested is similar to that reported harvested from the posterior iliac crest for single-level fusion. Copyright © 2011 Elsevier Inc. All rights reserved.
Fusion Materials Semiannual Progress Report for Period Ending December 31, 1998
DOE Office of Scientific and Technical Information (OSTI.GOV)
Rowcliff, A.F.; Burn, G.
1999-04-01
This is the twenty-fifth in a series of semiannual technical progress reports on fusion materials. This report combines the full spectrum of research and development activities on both metallic and non-metallic materials with primary emphasis on the effects of the neutronic and chemical environment on the properties and performance of materials for in-vessel components. This effort forms one element of the materials program being conducted in support of the Fusion Energy Sciences Program of the U.S. Department of Energy. The other major element of the program is concerned with the interactions between reactor materials and the plasma and is reportedmore » separately.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gambhir, Sanjiv; Pritha, Ray
Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.
Gambhir, Sanjiv; Pritha, Ray
2015-07-14
Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.
Fusion materials semiannual progress report for the period ending June 30, 1998
DOE Office of Scientific and Technical Information (OSTI.GOV)
Burn, G.
1998-09-01
This is the twenty-fourth in a series of semiannual technical progress reports on fusion materials. This report combines the full spectrum of research and development activities on both metallic and non-metallic materials with primary emphasis on the effects of the neutronic and chemical environment on the properties and performance of materials for in-vessel components. This effort forms one element of the materials program being conducted in support of the Fusion Energy Sciences Program of the US Department of Energy. Selected papers have been indexed separately for inclusion in the Energy Science and Technology Database.
CONFERENCE REPORT: Summary of the 8th IAEA Technical Meeting on Fusion Power Plant Safety
NASA Astrophysics Data System (ADS)
Girard, J. Ph.; Gulden, W.; Kolbasov, B.; Louzeiro-Malaquias, A.-J.; Petti, D.; Rodriguez-Rodrigo, L.
2008-01-01
Reports were presented covering a selection of topics on the safety of fusion power plants. These included a review on licensing studies developed for ITER site preparation surveying common and non-common issues (i.e. site dependent) as lessons to a broader approach for fusion power plant safety. Several fusion power plant models, spanning from accessible technology to more advanced-materials based concepts, were discussed. On the topic related to fusion-specific technology, safety studies were reported on different concepts of breeding blanket modules, tritium handling and auxiliary systems under normal and accident scenarios' operation. The testing of power plant relevant technology in ITER was also assessed in terms of normal operation and accident scenarios, and occupational doses and radioactive releases under these testings have been determined. Other specific safety issues for fusion have also been discussed such as availability and reliability of fusion power plants, dust and tritium inventories and component failure databases. This study reveals that the environmental impact of fusion power plants can be minimized through a proper selection of low activation materials and using recycling technology helping to reduce waste volume and potentially open the route for its reutilization for the nuclear sector or even its clearance into the commercial circuit. Computational codes for fusion safety have been presented in support of the many studies reported. The on-going work on establishing validation approaches aiming at improving the prediction capability of fusion codes has been supported by experimental results and new directions for development have been identified. Fusion standards are not available and fission experience is mostly used as the framework basis for licensing and target design for safe operation and occupational and environmental constraints. It has been argued that fusion can benefit if a specific fusion approach is implemented, in particular
Villavicencio, Alan T; Burneikiene, Sigita; Babuska, Jason M; Nelson, Ewell L; Mason, Alexander; Rajpal, Sharad
2015-04-01
The purpose of this study was to evaluate potential technical advantages of the CO2 laser technology in mini-open transforaminal lumbar interbody fusion (TLIF) surgeries and report our preliminary clinical data on the safety and clinical outcomes. There is currently no literature discussing the recently redeveloped CO2 laser technology application for lumbar fusion. Safety and clinical outcomes were compared between two groups: 24 patients that underwent CO2 laser-assisted one-level TLIF surgeries and 30 patients that underwent standard one-level TLIF surgeries without the laser. There were no neural thermal injuries or other intraoperative laser-related complications encountered in this cohort of patients. At a mean follow-up of 17.4 months, significantly reduced lower back pain scores (P=0.013) were reported in the laser-assisted patient group compared to a standard fusion patient group. Lower extremity radicular pain intensity scores were similar in both groups. Laser-assisted TLIF surgeries showed a tendency (P = 0.07) of shorter operative times that was not statistically significant. Based on this preliminary clinical report, the safety of the CO2 laser device for lumbar fusion surgeries was assessed. There were no neural thermal injuries or other intraoperative laser-related complications encountered in this cohort of patients. Further investigation of CO2 laser-assisted lumbar fusion procedures is warranted in order to evaluate its effect on clinical outcomes.
A Cell-Cell Fusion Assay to Assess Arenavirus Envelope Glycoprotein Membrane-Fusion Activity.
York, Joanne; Nunberg, Jack H
2018-01-01
For many viruses that enter their target cells through pH-dependent fusion of the viral and endosomal membranes, cell-cell fusion assays can provide an experimental platform for investigating the structure-function relationships that promote envelope glycoprotein membrane-fusion activity. Typically, these assays employ effector cells expressing the recombinant envelope glycoprotein on the cell surface and target cells engineered to quantitatively report fusion with the effector cell. In the protocol described here, Vero cells are transfected with a plasmid encoding the arenavirus envelope glycoprotein complex GPC and infected with the vTF7-3 vaccinia virus expressing the bacteriophage T7 RNA polymerase. These effector cells are mixed with target cells infected with the vCB21R-lacZ vaccinia virus encoding a β-galactosidase reporter under the control of the T7 promoter. Cell-cell fusion is induced upon exposure to low-pH medium (pH 5.0), and the resultant expression of the β-galactosidase reporter is quantitated using a chemiluminescent substrate. We have utilized this robust microplate cell-cell fusion assay extensively to study arenavirus entry and its inhibition by small-molecule fusion inhibitors.
Patient-reported outcomes of occipitocervical and atlantoaxial fusions in children.
Vedantam, Aditya; Hansen, Daniel; Briceño, Valentina; Brayton, Alison; Jea, Andrew
2017-01-01
OBJECTIVE There is limited literature on patient-reported outcomes (PROs) and health-related quality of life (HRQOL) outcomes in pediatric patients undergoing surgery for craniovertebral junction pathology. The aim of the present study was to assess surgical and quality of life outcomes in children who had undergone occipitocervical or atlantoaxial fusion. METHODS The authors retrospectively reviewed the demographics, procedural data, and outcomes of 77 consecutive pediatric patients who underwent posterior occipitocervical or atlantoaxial fusion between 2008 and 2015 at Texas Children's Hospital. Outcome measures (collected at last follow-up) included mortality, neurological improvement, complications, Scoliosis Research Society Outcomes Measure-22 (SRS-22) score, SF-36 score, Neck Disability Index (NDI), and Pediatric Quality of Life Inventory (PedsQL). Multivariate linear regression analysis was performed to identify factors affecting PROs and HRQOL scores at follow-up. RESULTS The average age in this series was 10.6 ± 4.5 years. The median follow-up was 13.9 months (range 0.5-121.5 months). Sixty-three patients (81.8%) were treated with occipitocervical fusion, and 14 patients (18.1%) were treated with atlantoaxial fusion. The American Spinal Injury Association (ASIA) grade at discharge was unchanged in 73 patients (94.8%). The average PRO metrics at the time of last follow-up were as follows: SRS-22 score, 4.2 ± 0.8; NDI, 3.0 ± 2.6; the parent's PedsQL (ParentPedsQL) score, 69.6 ± 22.7, and child's PedsQL score, 75.5 ± 18.7. Multivariate linear regression analysis revealed that older age at surgery was significantly associated with lower SRS-22 scores at follow-up (B = -0.06, p = 0.03), and the presence of comorbidities was associated with poorer ParentPedsQL scores at follow-up (B = -19.68, p = 0.03). CONCLUSIONS This study indicates that occipitocervical and atlantoaxial fusions in children preserve neurological function and are associated with
Fusion materials semiannual progress report for the period ending December 31, 1996
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1997-04-01
This is the twenty-first in a series of semiannual technical progress reports on fusion materials. This report combines the full spectrum of research and development activities on both metallic and non-metallic materials with primary emphasis on the effects of the neutronic and chemical environment on the properties and performance of materials for in-vessel components. This effort forms one element of the materials program being conducted in support of the Fusion Energy Sciences Program of the US Department of Energy. The other major element of the program is concerned with the interactions between reactor materials and the plasma and is reportedmore » separately. The report covers the following topics: vanadium alloys; silicon carbide composite materials; ferritic/martensitic steels; copper alloys and high heat flux materials; austenitic stainless steels; insulating ceramics and optical materials; solid breeding materials; radiation effects, mechanistic studies and experimental methods; dosimetry, damage parameters, and activation calculations; materials engineering and design requirements; and irradiation facilities, test matrices, and experimental methods.« less
DOT National Transportation Integrated Search
1996-09-01
THIS PROJECT HAS ACCOMPLISHED THREE SIGNIFICANT TASKS. FIRST, A STATE-OF-THE-ART LITERATURE REVIEW HAS PROVIDED AN ORGANIZATIONAL FRAMEWORK FOR CATEGORIZING THE VARIOUS DATA FUSION PROJECTS THAT HAVE BEEN CONDUCTED TO DATE. A POPULAR TYPOLOGY WAS DIS...
Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.
Stone, D E; Craig, E A
1990-01-01
To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281
Chowdhury, Forhad H; Haque, Mohammod Raziul; Alam, Sarwar Murshed; Khaled Chowdhury, S M Noman; Khan, Shamsul Islam; Goel, Atul
2017-11-01
Nontraumatic spontaneous atlanto-occipital dislocation (AOD) is rare. In this report, we discuss the technical steps of condylar joint fusion and stabilization (by screws and plates) in nontraumatic AOD. To the best of our knowledge, it is the first report of such techniques. A young girl and a young man with progressive quadriparesis due to nontraumatic spontaneous atlanto-occipital dislocation were managed by microsurgical reduction, fusion, and stabilization of the joint by occipital condylar and C1 lateral mass screw and plate fixation after mobilization of vertebral artery. In both cases, condylar joints fixation and fusion were done successfully. Condylar joint stabilization and fusion may be a good or alternative option for AOD. Copyright © 2017 Elsevier Inc. All rights reserved.
Positional effects of fusion partners on the yield and solubility of MBP fusion proteins
Raran-Kurussi, Sreejith; Keefe, Karina; Waugh, David S.
2015-01-01
Escherichia coli maltose-binding protein (MBP) is exceptionally effective at promoting the solubility of its fusion partners. However, there are conflicting reports in the literature claiming that 1) MBP is an effective solubility enhancer only when it is joined to the N-terminus of an aggregation-prone passenger protein, and 2) MBP is equally effective when fused to either end of the passenger. Here, we endeavor to resolve this controversy by comparing the solubility of a diverse set of MBP fusion proteins that, unlike those analyzed in previous studies, are identical in every way except for the order of the two domains. The results indicate that fusion proteins with an N-terminal MBP provide an excellent solubility advantage along with more robust expression when compared to analogous fusions in which MBP is the C-terminal fusion partner. We find that only intrinsically soluble passenger proteins (i.e., those not requiring a solubility enhancer) are produced as soluble fusions when they precede MBP. We also report that even subtle differences in inter-domain linker sequences can influence the solubility of fusion proteins. PMID:25782741
A sensitive HIV-1 envelope induced fusion assay identifies fusion enhancement of thrombin
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cheng, De-Chun; Zhong, Guo-Cai; Su, Ju-Xiang
2010-01-22
To evaluate the interaction between HIV-1 envelope glycoprotein (Env) and target cell receptors, various cell-cell-fusion assays have been developed. In the present study, we established a novel fusion system. In this system, the expression of the sensitive reporter gene, firefly luciferase (FL) gene, in the target cells was used to evaluate cell fusion event. Simultaneously, constitutively expressed Renilla luciferase (RL) gene was used to monitor effector cell number and viability. FL gave a wider dynamic range than other known reporters and the introduction of RL made the assay accurate and reproducible. This system is especially beneficial for investigation of potentialmore » entry-influencing agents, for its power of ruling out the false inhibition or enhancement caused by the artificial cell-number variation. As a case study, we applied this fusion system to observe the effect of a serine protease, thrombin, on HIV Env-mediated cell-cell fusion and have found the fusion enhancement activity of thrombin over two R5-tropic HIV strains.« less
Final report on the Magnetized Target Fusion Collaboration
DOE Office of Scientific and Technical Information (OSTI.GOV)
John Slough
Nuclear fusion has the potential to satisfy the prodigious power that the world will demand in the future, but it has yet to be harnessed as a practical energy source. The entry of fusion as a viable, competitive source of power has been stymied by the challenge of finding an economical way to provide for the confinement and heating of the plasma fuel. It is the contention here that a simpler path to fusion can be achieved by creating fusion conditions in a different regime at small scale (~ a few cm). One such program now under study, referred tomore » as Magnetized Target Fusion (MTF), is directed at obtaining fusion in this high energy density regime by rapidly compressing a compact toroidal plasmoid commonly referred to as a Field Reversed Configuration (FRC). To make fusion practical at this smaller scale, an efficient method for compressing the FRC to fusion gain conditions is required. In one variant of MTF a conducting metal shell is imploded electrically. This radially compresses and heats the FRC plasmoid to fusion conditions. The closed magnetic field in the target plasmoid suppresses the thermal transport to the confining shell, thus lowering the imploding power needed to compress the target. The undertaking to be described in this proposal is to provide a suitable target FRC, as well as a simple and robust method for inserting and stopping the FRC within the imploding liner. The timescale for testing and development can be rapidly accelerated by taking advantage of a new facility funded by the Department of Energy. At this facility, two inductive plasma accelerators (IPA) were constructed and tested. Recent experiments with these IPAs have demonstrated the ability to rapidly form, accelerate and merge two hypervelocity FRCs into a compression chamber. The resultant FRC that was formed was hot (T&ion ~ 400 eV), stationary, and stable with a configuration lifetime several times that necessary for the MTF liner experiments. The accelerator length was
Rho GTPase activity modulates paramyxovirus fusion protein-mediated cell-cell fusion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Schowalter, Rachel M.; Wurth, Mark A.; Aguilar, Hector C.
2006-07-05
The paramyxovirus fusion protein (F) promotes fusion of the viral envelope with the plasma membrane of target cells as well as cell-cell fusion. The plasma membrane is closely associated with the actin cytoskeleton, but the role of actin dynamics in paramyxovirus F-mediated membrane fusion is unclear. We examined cell-cell fusion promoted by two different paramyxovirus F proteins in three cell types in the presence of constitutively active Rho family GTPases, major cellular coordinators of actin dynamics. Reporter gene and syncytia assays demonstrated that expression of either Rac1{sup V12} or Cdc42{sup V12} could increase cell-cell fusion promoted by the Hendra ormore » SV5 glycoproteins, though the effect was dependent on the cell type expressing the viral glycoproteins. In contrast, RhoA{sup L63} decreased cell-cell fusion promoted by Hendra glycoproteins but had little affect on SV5 F-mediated fusion. Also, data suggested that GTPase activation in the viral glycoprotein-containing cell was primarily responsible for changes in fusion. Additionally, we found that activated Cdc42 promoted nuclear rearrangement in syncytia.« less
Positional effects of fusion partners on the yield and solubility of MBP fusion proteins.
Raran-Kurussi, Sreejith; Keefe, Karina; Waugh, David S
2015-06-01
Escherichia coli maltose-binding protein (MBP) is exceptionally effective at promoting the solubility of its fusion partners. However, there are conflicting reports in the literature claiming that (1) MBP is an effective solubility enhancer only when it is joined to the N-terminus of an aggregation-prone passenger protein, and (2) MBP is equally effective when fused to either end of the passenger. Here, we endeavor to resolve this controversy by comparing the solubility of a diverse set of MBP fusion proteins that, unlike those analyzed in previous studies, are identical in every way except for the order of the two domains. The results indicate that fusion proteins with an N-terminal MBP provide an excellent solubility advantage along with more robust expression when compared to analogous fusions in which MBP is the C-terminal fusion partner. We find that only intrinsically soluble passenger proteins (i.e., those not requiring a solubility enhancer) are produced as soluble fusions when they precede MBP. We also report that even subtle differences in inter-domain linker sequences can influence the solubility of fusion proteins. Published by Elsevier Inc.
Beutler, William J; Peppelman, Walter C; DiMarco, Luciano A
2013-02-15
Technique development to use the da Vince Robotic Surgical System for anterior lumbar interbody fusion at L5-S1 is detailed. A case report is also presented. To evaluate and develop the da Vinci robotic assisted laparoscopic anterior lumbar stand-alone interbody fusion procedure. Anterior lumbar interbody fusion is a common procedure associated with potential morbidity related to the surgical approach. The da Vinci robot provides intra-abdominal dissection and visualization advantages compared with the traditional open and laparoscopic approach. The surgical techniques for approach to the anterior lumbar spine using the da Vinci robot were developed and modified progressively beginning with operative models followed by placement of an interbody fusion cage in the living porcine model. Development continued to progress with placement of fusion cage in a human cadaver, completed first in the laboratory setting and then in the operating room. Finally, the first patient with fusion completed using the da Vinci robot-assisted approach is presented. The anterior transperitoneal approach to the lumbar spine is accomplished with enhanced visualization and dissection capability, with maintenance of pneumoperitoneum using the da Vinci robot. Blood loss is minimal. The visualization inside the disc space and surrounding structures was considered better than current open and laparoscopic techniques. The da Vinci robot Surgical System technique continues to develop and is now described for the transperitoneal approach to the anterior lumbar spine. 4.
Fusion Rate and Clinical Outcomes in Two-Level Posterior Lumbar Interbody Fusion.
Aono, Hiroyuki; Takenaka, Shota; Nagamoto, Yukitaka; Tobimatsu, Hidekazu; Yamashita, Tomoya; Furuya, Masayuki; Iwasaki, Motoki
2018-04-01
Posterior lumbar interbody fusion (PLIF) has become a general surgical method for degenerative lumbar diseases. Although many reports have focused on single-level PLIF, few have focused on 2-level PLIF, and no report has covered the fusion status of 2-level PLIF. The purpose of this study is to investigate clinical outcomes and fusion for 2-level PLIF by using a combination of dynamic radiographs and multiplanar-reconstruction computed tomography scans. This study consisted of 48 consecutive patients who underwent 2-level PLIF for degenerative lumbar diseases. We assessed surgery duration, estimated blood loss, complications, clinical outcomes as measured by the Japanese Orthopaedic Association score, lumbar sagittal alignment as measured on standing lateral radiographs, and fusion status as measured by dynamic radiographs and multiplanar-reconstruction computed tomography. Patients were examined at a follow-up point of 4.8 ± 2.2 years after surgery. Thirty-eight patients who did not undergo lumbosacral fusion comprised the lumbolumbar group, and 10 patients who underwent lumbosacral fusion comprised the lumbosacral group. The mean Japanese Orthopaedic Association score improved from 12.1 to 22.4 points by the final follow-up examination. Sagittal alignment also was improved. All patients had fusion in the cranial level. Seven patients had nonunion in the caudal level, and the lumbosacral group (40%) had a significantly poorer fusion rate than the lumbolumbar group (97%) did. Surgical outcomes of 2-level PLIF were satisfactory. The fusion rate at both levels was 85%. All nonunion was observed at the caudal level and concentrated at L5-S level in L4-5-S PLIF. Copyright © 2018 Elsevier Inc. All rights reserved.
Inertial fusion program. Progress report, January 1-June 30, 1978
DOE Office of Scientific and Technical Information (OSTI.GOV)
Skoberne, F.
1980-05-01
Studies and experiments aimed at investigating the possibility of restoring wavefront quality in optical systems through phase conjugation are summarized, and work that could lead to the development of highly damage-resistant isolators is discussed. The effects of various parameters on pulse-energy uniformity and of multipass extraction on laser efficiency are reported. Results of equation-of-state, shock propagation, multiburst simulation, and opacity measurements are discussed. Target designs are described that should provide a smooth transition from the exploding-pusher regime of experiments to that of isentropic compression. Progress in target fabrication techniques toward creating a 20-times-liquid-density target are outlined, and efforts that ledmore » to the extension of our neutron detection capability to levels of less than 10/sup 3/ n are summarized. The results of various studies of laser fusion application, e.g., for producing ultrahigh-temperature process heat or hydrogen from water decomposition are presented, as well as investigations of fusion-fission hybrids for the production of /sup 233/U from /sup 232/Th.« less
The transition zone above a lumbosacral fusion.
Hambly, M F; Wiltse, L L; Raghavan, N; Schneiderman, G; Koenig, C
1998-08-15
The clinical and radiographic effect of a lumbar or lumbosacral fusion was studied in 42 patients who had undergone a posterolateral fusion with an average follow-up of 22.6 years. To examine the long-term effects of posterolateral lumbar or lumbosacral fusion on the cephalad two motion segments (transition zone). It is commonly held that accelerated degeneration occurs in the motion segments adjacent to a fusion. Most studies are of short-term, anecdotal, uncontrolled reports that pay particular attention only to the first motion segment immediately cephalad to the fusion. Forty-two patients who had previously undergone a posterolateral lumbar or lumbosacral fusion underwent radiographic and clinical evaluation. Rate of fusion, range of motion, osteophytes, degenerative spondylolisthesis, retrolisthesis, facet arthrosis, disc ossification, dynamic instability, and disc space height were all studied and statistically compared with an age- and gender-matched control group. The patient's self-reported clinical outcome was also recorded. Degenerative changes occurred at the second level above the fused levels with a frequency equal to those occurring in the first level. There was no statistical difference between the study group and the cohort group in the presence of radiographic changes within the transition zone. In those patients undergoing fusion for degenerative processes, 75% reported a good to excellent outcome, whereas 84% of those undergoing fusion for spondylolysis or spondylolisthesis reported a good to excellent outcome. Radiographic changes occur within the transition zone cephalad to a lumbar or lumbosacral fusion. However, these changes are also seen in control subjects who have had no surgery.
Alternative approaches to fusion. [reactor design and reactor physics for Tokamak fusion reactors
NASA Technical Reports Server (NTRS)
Roth, R. J.
1976-01-01
The limitations of the Tokamak fusion reactor concept are discussed and various other fusion reactor concepts are considered that employ the containment of thermonuclear plasmas by magnetic fields (i.e., stellarators). Progress made in the containment of plasmas in toroidal devices is reported. Reactor design concepts are illustrated. The possibility of using fusion reactors as a power source in interplanetary space travel and electric power plants is briefly examined.
The actin cytoskeleton inhibits pore expansion during PIV5 fusion protein-promoted cell-cell fusion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wurth, Mark A.; Schowalter, Rachel M.; Smith, Everett Clinton
2010-08-15
Paramyxovirus fusion (F) proteins promote both virus-cell fusion, required for viral entry, and cell-cell fusion, resulting in syncytia formation. We used the F-actin stabilizing drug, jasplakinolide, and the G-actin sequestrant, latrunculin A, to examine the role of actin dynamics in cell-cell fusion mediated by the parainfluenza virus 5 (PIV5) F protein. Jasplakinolide treatment caused a dose-dependent increase in cell-cell fusion as measured by both syncytia and reporter gene assays, and latrunculin A treatment also resulted in fusion stimulation. Treatment with jasplakinolide or latrunculin A partially rescued a fusion pore opening defect caused by deletion of the PIV5 F protein cytoplasmicmore » tail, but these drugs had no effect on fusion inhibited at earlier stages by either temperature arrest or by a PIV5 heptad repeat peptide. These data suggest that the cortical actin cytoskeleton is an important regulator of fusion pore enlargement, an energetically costly stage of viral fusion protein-mediated membrane merger.« less
The actin cytoskeleton inhibits pore expansion during PIV5 fusion protein-promoted cell-cell fusion
Wurth, Mark A.; Schowalter, Rachel M.; Smith, Everett Clinton; Moncman, Carole L.; Dutch, Rebecca Ellis; McCann, Richard O.
2010-01-01
Paramyxovirus fusion (F) proteins promote both virus-cell fusion, required for viral entry, and cell-cell fusion, resulting in syncytia formation. We used the F-actin stabilizing drug, jasplakinolide, and the G-actin sequestrant, latrunculin A, to examine the role of actin dynamics in cell-cell fusion mediated by the parainfluenza virus 5 (PIV5) F protein. Jasplakinolide treatment caused a dose-dependent increase in cell-cell fusion as measured by both syncytia and reporter gene assays, and latrunculin A treatment also resulted in fusion stimulation. Treatment with jasplakinolide or latrunculin A partially rescued a fusion pore opening defect caused by deletion of the PIV5 F protein cytoplasmic tail, but these drugs had no effect on fusion inhibited at earlier stages by either temperature arrest or by a PIV5 heptad repeat peptide. These data suggest that the cortical actin cytoskeleton is an important regulator of fusion pore enlargement, an energetically costly stage of viral fusion protein-mediated membrane merger. PMID:20537366
Progress in gene targeting and gene therapy for retinitis pigmentosa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farrar, G.J.; Humphries, M.M.; Erven, A.
1994-09-01
Previously, we localized disease genes involved in retinitis pigmentosa (RP), an inherited retinal degeneration, close to the rhodopsin and peripherin genes on 3q and 6p. Subsequently, we and others identified mutations in these genes in RP patients. Currently animal models for human retinopathies are being generated using gene targeting by homologous recombination in embryonic stem (ES) cells. Genomic clones for retinal genes including rhodopsin and peripherin have been obtained from a phage library carrying mouse DNA isogenic with the ES cell line (CC1.2). The peripherin clone has been sequenced to establish the genomic structure of the mouse gene. Targeting vectorsmore » for rhodopsin and peripherin including a neomycin cassette for positive selection and thymidine kinase genes enabling selection against random intergrants are under construction. Progress in vector construction will be presented. Simultaneously we are developing systems for delivery of gene therapies to retinal tissues utilizing replication-deficient adenovirus (Ad5). Efficacy of infection subsequent to various methods of intraocular injection and with varying viral titers is being assayed using an adenovirus construct containing a CMV promoter LacZ fusion as reporter and the range of tissues infected and the level of duration of LacZ expression monitored. Viral constructs with the LacZ reporter gene under the control of retinal specific promoters such as rhodopsin and IRBP cloned into pXCJL.1 are under construction. An update on developments in photoreceptor cell-directed expression of virally delivered genes will be presented.« less
Fusion Simulation Program Definition. Final report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cary, John R.
2012-09-05
We have completed our contributions to the Fusion Simulation Program Definition Project. Our contributions were in the overall planning with concentration in the definition of the area of Software Integration and Support. We contributed to the planning of multiple meetings, and we contributed to multiple planning documents.
Cluster-impact fusion, or beam-contaminant fusion? (abstract)a),b)
NASA Astrophysics Data System (ADS)
Lo, Daniel H.; Petrasso, Richard D.; Wenzel, Kevin W.
1992-10-01
Beuhler, Friedlander, and Friedman (BFF) reported anomalously huge D-D fusion rates while bombarding deuterated targets with (D2O)N+ clusters (N˜25-1000) accelerated to ≊325 keV [R. J. Beuhler et al., Phys. Rev. Lett. 63, 1292 (1989); R. J. Beuhler et al., J. Phys. Chem. 94, 7665 (1990)] [i.e., ≊0.3 keV lab energy for D in (D2O)100+]. However, from our analysis of BFF's fusion product spectra, we conclude that their D lab energy was ˜50 keV. Therefore, no gross anomalies exist. Also, from our analysis of the BFF beam-ranging experiments through 500 μg/cm2 of Au, we conclude that light-ion-beam contaminants (e.g., D+ of order 100 keV) have not been ruled out, and are the probable cause of their fusion reactions. This work was supported by LLNL Subcontract B116798, Department of Energy (DOE) Grant No. DE-FG02-91ER54109, DOE Magnetic Fusion Energy Technology Fellowship Program (D. H. Lo), and DOE Fusion Energy Postdoctoral Research Program (Kevin W. Wenzel).
McGirt, Matthew J; Parker, Scott L; Mummaneni, Praveen; Knightly, John; Pfortmiller, Deborah; Foley, Kevin; Asher, Anthony L
2017-07-01
Over the last decade, clinical investigators and biomedical industry groups have used significant resources to develop advanced technologies that enable less invasive spine fusions. These minimally invasive surgery (MIS) technologies often require increased expenditures by hospitals and payers. Although several small single center studies have suggested MIS technologies decrease surgical morbidity and reduce hospital stay, evidence documenting benefit from a patient perspective remains limited. Furthermore, MIS outcomes have yet to be evaluated from the perspective of multiple practice types representing the broad spectrum of US spine surgery. This study aimed to examine a population of patients who underwent one- or two-level interbody lumbar fusion diagnosed with lumbar stenosis or Grade 1 spondylolisthesis in an observational, prospective national registry for the purposes of determining how MIS and traditional open technologies affect postsurgical and patient-reported outcomes (PROs). This study used observational analysis of prospectively collected data. The sample consisted of cases from the National Neurosurgery Quality and Outcomes Database (N 2 QOD). Numeric rating scale for back and leg pain, Oswestry Disability Index, EuroQol-5D, return to work, and perioperative morbidity were the outcome measures. The N 2 QOD is a prospective PROs registry enrolling patients undergoing elective spine surgery from 60 hospitals in 27 US states via representative sampling. We analyzed the N 2 QOD aggregate dataset (2010-2014) to identify one- and two-level lumbar interbody fusion procedures performed for lumbar stenosis or Grade 1 spondylolisthesis with 12 months' follow-up where surgical instrumentation and implant types were clearly identified. Perioperative and 1-year outcomes were compared between cases performed with MIS enabling technologies versus traditional open technologies before and after propensity matching. There were 467 (24%) patients who underwent
Helium Find Thaws the Cold Fusion Trail.
ERIC Educational Resources Information Center
Pennisi, E.
1991-01-01
Reported is a study of cold fusion in which trace amounts of helium, possible evidence of an actual fusion reaction, were found. Research methodology is detailed. The controversy over the validity of experimental results with cold fusion are reviewed. (CW)
Panigrahi, Priyabrata; Jere, Abhay; Anamika, Krishanpal
2018-01-01
Gene fusion is a chromosomal rearrangement event which plays a significant role in cancer due to the oncogenic potential of the chimeric protein generated through fusions. At present many databases are available in public domain which provides detailed information about known gene fusion events and their functional role. Existing gene fusion detection tools, based on analysis of transcriptomics data usually report a large number of fusion genes as potential candidates, which could be either known or novel or false positives. Manual annotation of these putative genes is indeed time-consuming. We have developed a web platform FusionHub, which acts as integrated search engine interfacing various fusion gene databases and simplifies large scale annotation of fusion genes in a seamless way. In addition, FusionHub provides three ways of visualizing fusion events: circular view, domain architecture view and network view. Design of potential siRNA molecules through ensemble method is another utility integrated in FusionHub that could aid in siRNA-based targeted therapy. FusionHub is freely available at https://fusionhub.persistent.co.in.
Z-Pinch Fusion for Energy Applications
DOE Office of Scientific and Technical Information (OSTI.GOV)
SPIELMAN,RICK B.
2000-01-01
Z pinches, the oldest fusion concept, have recently been revisited in light of significant advances in the fields of plasma physics and pulsed power engineering. The possibility exists for z-pinch fusion to play a role in commercial energy applications. We report on work to develop z-pinch fusion concepts, the result of an extensive literature search, and the output for a congressionally-mandated workshop on fusion energy held in Snowmass, Co July 11-23,1999.
Dynamic Information Collection and Fusion
2015-12-02
AFRL-AFOSR-VA-TR-2016-0069 DYNAMIC INFORMATION COLLECTION AND FUSION Venugopal Veeravalli UNIVERSITY OF ILLINOIS CHAMPAIGN Final Report 12/02/2015...TITLE AND SUBTITLE Dynamic Information Collection and Fusion 5a. CONTRACT NUMBER FA9550-10-1-0458 5b. GRANT NUMBER AF FA9550-10-1-0458 5c. PROGRAM...information collection, fusion , and inference from diverse modalities Our research has been organized under three inter-related thrusts. The first thrust
Spencer, Hillard T; Hsu, Joyce T; McDonald, Douglas R; Karlin, Lawrence I
2012-08-01
The use of topical hemostatic agents is widespread and has been shown to reduce bleeding during a wide variety of surgical procedures. Nonetheless, as biologically active agents, there is potential for allergic reactions to these products. This is a report of intraoperative anaphylaxis to gelatin associated with the use of two topical hemostatic agents. Case report. There is no outside funding or potential conflict of interest. A patient with anaphylaxis during anterior spinal fusion. Laboratory assays for tryptase, gelatin-specific immunoglobulin E (IgE), and total IgE. A 14-year-old male with myelomeningocele and scoliosis was treated with anterior spinal fusion from T12 to L3. Gelfoam sponges were applied during the preparation of the disc spaces. Approximately 1 hour later, Floseal hemostatic matrix was applied to a briskly bleeding screw hole in the L3 vertebral body, and the patient experienced an abrupt onset of hypotension and ventilatory difficulty. Epinephrine, dexamethasone, and blood products were administered for hemodynamic support while the surgical site was closed. Removal of the drapes revealed a widespread erythematous rash, and the patient was then transferred to the intensive care unit. When stable 3 days later, he returned to the operating room for completion of the spinal fusion. Postoperative laboratory assays were sent that revealed elevated levels of tryptase, total IgE, porcine, and bovine gelatin-specific IgE. The patient was counseled to avoid gelatin-containing products. At 6-month follow-up, his instrumented spine was radiographically fused and he reported no further allergic issues. Anaphylaxis may occur because of animal gelatin components of topical hemostatic agents. Previous reports have focused on the thrombin components. Care should be taken in the administration of these products, particularly in the atopic individual. Copyright © 2012 Elsevier Inc. All rights reserved.
The dengue virus type 2 envelope protein fusion peptide is essential for membrane fusion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Huang, Claire Y.-H., E-mail: CHuang1@cdc.go; Butrapet, Siritorn; Moss, Kelly J.
The flaviviral envelope (E) protein directs virus-mediated membrane fusion. To investigate membrane fusion as a requirement for virus growth, we introduced 27 unique mutations into the fusion peptide of an infectious cDNA clone of dengue 2 virus and recovered seven stable mutant viruses. The fusion efficiency of the mutants was impaired, demonstrating for the first time the requirement for specific FP AAs in optimal fusion. Mutant viruses exhibited different growth kinetics and/or genetic stabilities in different cell types and adult mosquitoes. Virus particles could be recovered following RNA transfection of cells with four lethal mutants; however, recovered viruses could notmore » re-infect cells. These viruses could enter cells, but internalized virus appeared to be retained in endosomal compartments of infected cells, thus suggesting a fusion blockade. Mutations of the FP also resulted in reduced virus reactivity with flavivirus group-reactive antibodies, confirming earlier reports using virus-like particles.« less
Inertial confinement fusion quarterly report, October--December 1992. Volume 3, No. 1
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dixit, S.N.
1992-12-31
This report contains papers on the following topics: The Beamlet Front End: Prototype of a new pulse generation system;imaging biological objects with x-ray lasers; coherent XUV generation via high-order harmonic generation in rare gases; theory of high-order harmonic generation; two-dimensional computer simulations of ultra- intense, short-pulse laser-plasma interactions; neutron detectors for measuring the fusion burn history of ICF targets; the recirculator; and lasnex evolves to exploit computer industry advances.
Versatile fusion source integrator AFSI for fast ion and neutron studies in fusion devices
NASA Astrophysics Data System (ADS)
Sirén, Paula; Varje, Jari; Äkäslompolo, Simppa; Asunta, Otto; Giroud, Carine; Kurki-Suonio, Taina; Weisen, Henri; JET Contributors, The
2018-01-01
ASCOT Fusion Source Integrator AFSI, an efficient tool for calculating fusion reaction rates and characterizing the fusion products, based on arbitrary reactant distributions, has been developed and is reported in this paper. Calculation of reactor-relevant D-D, D-T and D-3He fusion reactions has been implemented based on the Bosch-Hale fusion cross sections. The reactions can be calculated between arbitrary particle populations, including Maxwellian thermal particles and minority energetic particles. Reaction rate profiles, energy spectra and full 4D phase space distributions can be calculated for the non-isotropic reaction products. The code is especially suitable for integrated modelling in self-consistent plasma physics simulations as well as in the Serpent neutronics calculation chain. Validation of the model has been performed for neutron measurements at the JET tokamak and the code has been applied to predictive simulations in ITER.
Xu, Kai; Chan, Yee-Peng; Bradel-Tretheway, Birgit; Akyol-Ataman, Zeynep; Zhu, Yongqun; Dutta, Somnath; Yan, Lianying; Feng, YanRu; Wang, Lin-Fa; Skiniotis, Georgios; Lee, Benhur; Zhou, Z Hong; Broder, Christopher C; Aguilar, Hector C; Nikolov, Dimitar B
2015-12-01
Nipah virus (NiV) is a paramyxovirus that infects host cells through the coordinated efforts of two envelope glycoproteins. The G glycoprotein attaches to cell receptors, triggering the fusion (F) glycoprotein to execute membrane fusion. Here we report the first crystal structure of the pre-fusion form of the NiV-F glycoprotein ectodomain. Interestingly this structure also revealed a hexamer-of-trimers encircling a central axis. Electron tomography of Nipah virus-like particles supported the hexameric pre-fusion model, and biochemical analyses supported the hexamer-of-trimers F assembly in solution. Importantly, structure-assisted site-directed mutagenesis of the interfaces between F trimers highlighted the functional relevance of the hexameric assembly. Shown here, in both cell-cell fusion and virus-cell fusion systems, our results suggested that this hexamer-of-trimers assembly was important during fusion pore formation. We propose that this assembly would stabilize the pre-fusion F conformation prior to cell attachment and facilitate the coordinated transition to a post-fusion conformation of all six F trimers upon triggering of a single trimer. Together, our data reveal a novel and functional pre-fusion architecture of a paramyxoviral fusion glycoprotein.
Magnetized Target Fusion: Prospects for Low-Cost Fusion Energy
NASA Technical Reports Server (NTRS)
Siemon, Richard E.; Turchi, Peter J.; Barnes, Daniel C.; Degnan, James; Parks, Paul; Ryutov, Dmitri D.; Thio, Y. C. Francis; Schafer, Charles (Technical Monitor)
2001-01-01
Magnetized Target Fusion (MTF) has attracted renewed interest in recent years because it has the potential to resolve one of the major problems with conventional fusion energy research - the high cost of facilities to do experiments and in general develop practical fusion energy. The requirement for costly facilities can be traced to fundamental constraints. The Lawson condition implies large system size in the case of conventional magnetic confinement, or large heating power in the case of conventional inertial confinement. The MTF approach is to use much higher fuel density than with conventional magnetic confinement (corresponding to megabar pressures), which results in a much-reduced system size to achieve Lawson conditions. Intrinsically the system must be pulsed because the pressures exceed the strength of any known material. To facilitate heating the fuel (or "target") to thermonuclear conditions with a high-power high-intensity source of energy, magnetic fields are used to insulate the high-pressure fuel from material surroundings (thus "magnetized target"). Because of magnetic insulation, the required heating power intensity is reduced by many orders of magnitude compared to conventional inertial fusion, even with relatively poor energy confinement in the magnetic field, such as that characterized by Bohm diffusion. In this paper we show semi-quantitatively why MTF-should allow fusion energy production without costly facilities within the same generally accepted physical constraints used for conventional magnetic and inertial fusion. We also briefly discuss potential applications of this technology ranging from nuclear rockets for space propulsion to a practical commercial energy system. Finally, we report on the exploratory research underway, and the interesting physics issues that arise in the MTF regime of parameters. Experiments at Los Alamos are focused on formation of a suitable plasma target for compression, utilizing the knowledge base for compact
Nuclear Fusion prize laudation Nuclear Fusion prize laudation
NASA Astrophysics Data System (ADS)
Burkart, W.
2011-01-01
Clean energy in abundance will be of critical importance to the pursuit of world peace and development. As part of the IAEA's activities to facilitate the dissemination of fusion related science and technology, the journal Nuclear Fusion is intended to contribute to the realization of such energy from fusion. In 2010, we celebrated the 50th anniversary of the IAEA journal. The excellence of research published in the journal is attested to by its high citation index. The IAEA recognizes excellence by means of an annual prize awarded to the authors of papers judged to have made the greatest impact. On the occasion of the 2010 IAEA Fusion Energy Conference in Daejeon, Republic of Korea at the welcome dinner hosted by the city of Daejeon, we celebrated the achievements of the 2009 and 2010 Nuclear Fusion prize winners. Steve Sabbagh, from the Department of Applied Physics and Applied Mathematics, Columbia University, New York is the winner of the 2009 award for his paper: 'Resistive wall stabilized operation in rotating high beta NSTX plasmas' [1]. This is a landmark paper which reports record parameters of beta in a large spherical torus plasma and presents a thorough investigation of the physics of resistive wall mode (RWM) instability. The paper makes a significant contribution to the critical topic of RWM stabilization. John Rice, from the Plasma Science and Fusion Center, MIT, Cambridge is the winner of the 2010 award for his paper: 'Inter-machine comparison of intrinsic toroidal rotation in tokamaks' [2]. The 2010 award is for a seminal paper that analyzes results across a range of machines in order to develop a universal scaling that can be used to predict intrinsic rotation. This paper has already triggered a wealth of experimental and theoretical work. I congratulate both authors and their colleagues on these exceptional papers. W. Burkart Deputy Director General Department of Nuclear Sciences and Applications International Atomic Energy Agency, Vienna
Fusion energy division annual progress report, period ending December 31, 1980
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1981-11-01
The ORNL Program encompasses most aspects of magnetic fusion research including research on two magnetic confinement programs (tokamaks and ELMO bumpy tori); the development of the essential technologies for plasma heating, fueling, superconducting magnets, and materials; the development of diagnostics; the development of atomic physics and radiation effect data bases; the assessment of the environmental impact of magnetic fusion; the physics and engineering of present-generation devices; and the design of future devices. The integration of all of these activities into one program is a major factor in the success of each activity. An excellent example of this integration is themore » extremely successful application of neutral injection heating systems developed at ORNL to tokamaks both in the Fusion Energy Division and at Princeton Plasma Physics Laboratory (PPPL). The goal of the ORNL Fusion Program is to maintain this balance between plasma confinement, technology, and engineering activities.« less
SNARE-mediated membrane fusion in autophagy
Wang, Yongyao; Li, Linsen; Hou, Chen; Lai, Ying; Long, Jiangang; Liu, Jiankang; Zhong, Qing; Diao, Jiajie
2016-01-01
Autophagy, a conserved self-eating process for the bulk degradation of cytoplasmic materials, involves double-membrane autophagosomes formed when an isolation membrane emerges and their direct fusion with lysosomes for degradation. For the early biogenesis of autophagosomes and their later degradation in lysosomes, membrane fusion is necessary, although different sets of genes and autophagy-related proteins involved in distinct fusion steps have been reported. To clarify the molecular mechanism of membrane fusion in autophagy, to not only expand current knowledge of autophagy, but also benefit human health, this review discusses key findings that elucidate the unique membrane dynamics of autophagy. PMID:27422330
Information Fusion for Situational Awareness
2003-01-01
UNCLASSIFIED Defense Technical Information Center Compilation Part Notice ADP021704 TITLE: Information Fusion for Situational Awareness DISTRIBUTION...component part numbers comprise the compilation report: ADP021634 thru ADP021736 UNCLASSIFIED Information Fusion for Situational Awareness Dr. John...Situation Assessment, or level 2 be applied to address Situational Awareness - the processing, the knowledge of objects, their goal of this paper
NASA Astrophysics Data System (ADS)
Storms, E.
This report attempts to update the status of the phenomenon of cold fusion. The new field is continuing to grow as a variety of nuclear reactions are discovered to occur in a variety of chemical environments at modest temperatures. However, it must be cautioned that most scientists consider cold fusion as something akin to UFO's, ESP, and numerology.
State-of-the-Art Fusion-Finder Algorithms Sensitivity and Specificity
Carrara, Matteo; Beccuti, Marco; Lazzarato, Fulvio; Cavallo, Federica; Cordero, Francesca; Donatelli, Susanna; Calogero, Raffaele A.
2013-01-01
Background. Gene fusions arising from chromosomal translocations have been implicated in cancer. RNA-seq has the potential to discover such rearrangements generating functional proteins (chimera/fusion). Recently, many methods for chimeras detection have been published. However, specificity and sensitivity of those tools were not extensively investigated in a comparative way. Results. We tested eight fusion-detection tools (FusionHunter, FusionMap, FusionFinder, MapSplice, deFuse, Bellerophontes, ChimeraScan, and TopHat-fusion) to detect fusion events using synthetic and real datasets encompassing chimeras. The comparison analysis run only on synthetic data could generate misleading results since we found no counterpart on real dataset. Furthermore, most tools report a very high number of false positive chimeras. In particular, the most sensitive tool, ChimeraScan, reports a large number of false positives that we were able to significantly reduce by devising and applying two filters to remove fusions not supported by fusion junction-spanning reads or encompassing large intronic regions. Conclusions. The discordant results obtained using synthetic and real datasets suggest that synthetic datasets encompassing fusion events may not fully catch the complexity of RNA-seq experiment. Moreover, fusion detection tools are still limited in sensitivity or specificity; thus, there is space for further improvement in the fusion-finder algorithms. PMID:23555082
Quaedvlieg, N E; Schlaman, H R; Admiraal, P C; Wijting, S E; Stougaard, J; Spaink, H P
1998-07-01
By fusing the genes encoding green fluorescent protein (GFP) and beta-glucuronidase (GUS) we have created a set of bifunctional reporter constructs which are optimized for use in transient and stable expression studies in plants. This approach makes it possible to combine the advantage of GUS, its high sensitivity in histochemical staining, with the advantages of GFP as a vital marker. The fusion proteins were functional in transient expression studies in tobacco using either DNA bombardment or potato virus X as a vector, and in stably transformed Arabidopsis thaliana and Lotus japonicus plants. The results show that high level of expression does not interfere with efficient stable transformation in A. thaliana and L. japonicus. Using confocal laser scanning microscopy we show that the fusion constructs are very suitable for promoter expression studies in all organs of living plants, including root nodules. The use of these reporter constructs in the model legume L. japonicus offers exciting new possibilities for the study of the root nodulation process.
Quaedvlieg, N E; Schlaman, H R; Admiraal, P C; Wijting, S E; Stougaard, J; Spaink, H P
1998-11-01
By fusing the genes encoding green fluorescent protein (GFP) and beta-glucuronidase (GUS) we have created a set of bifunctional reporter constructs which are optimized for use in transient and stable expression studies in plants. This approach makes it possible to combine the advantage of GUS, its high sensitivity in histochemical staining, with the advantages of GFP as a vital marker. The fusion proteins were functional in transient expression studies in tobacco using either DNA bombardment or potato virus X as a vector, and in stably transformed Arabidopsis thaliana and Lotus japonicus plants. The results show that high level of expression does not interfere with efficient stable transformation in A. thaliana and L. japonicus. Using confocal laser scanning microscopy we show that the fusion constructs are very suitable for promoter expression studies in all organs of living plants, including root nodules. The use of these reporter constructs in the model legume L. japonicus offers exciting new possibilities for the study of the root nodulation process.
Bakayan, Adil; Vaquero, Cecilia F.; Picazo, Fernando; Llopis, Juan
2011-01-01
Bioluminescence recording of Ca2+ signals with the photoprotein aequorin does not require radiative energy input and can be measured with a low background and good temporal resolution. Shifting aequorin emission to longer wavelengths occurs naturally in the jellyfish Aequorea victoria by bioluminescence resonance energy transfer (BRET) to the green fluorescent protein (GFP). This process has been reproduced in the molecular fusions GFP-aequorin and monomeric red fluorescent protein (mRFP)-aequorin, but the latter showed limited transfer efficiency. Fusions with strong red emission would facilitate the simultaneous imaging of Ca2+ in various cell compartments. In addition, they would also serve to monitor Ca2+ in living organisms since red light is able to cross animal tissues with less scattering. In this study, aequorin was fused to orange and various red fluorescent proteins to identify the best acceptor in red emission bands. Tandem-dimer Tomato-aequorin (tdTA) showed the highest BRET efficiency (largest energy transfer critical distance R0) and percentage of counts in the red band of all the fusions studied. In addition, red fluorophore maturation of tdTA within cells was faster than that of other fusions. Light output was sufficient to image ATP-induced Ca2+ oscillations in single HeLa cells expressing tdTA. Ca2+ rises caused by depolarization of mouse neuronal cells in primary culture were also recorded, and changes in fine neuronal projections were spatially resolved. Finally, it was also possible to visualize the Ca2+ activity of HeLa cells injected subcutaneously into mice, and Ca2+ signals after depositing recombinant tdTA in muscle or the peritoneal cavity. Here we report that tdTA is the brightest red bioluminescent Ca2+ sensor reported to date and is, therefore, a promising probe to study Ca2+ dynamics in whole organisms or tissues expressing the transgene. PMID:21589654
A source of artifact in the lacZ reversion assay in Escherichia coli.
Hoffmann, George R; Gray, Carol L; Lange, Paulina B; Marando, Christie I
2015-06-01
The lacZ reversion assay in Escherichia coli measures point mutations that occur by specific base substitutions and frameshift mutations. The tester strains cannot use lactose as a carbon source (Lac(-)), and revertants are easily detected by growth on lactose medium (Lac(+)). Six strains identify the six possible base substitutions, and five strains measure +G, -G, -CG, +A and -A frameshifts. Strong mutagens give dose-dependent increases in numbers of revertants per plate and revertant frequencies. Testing compounds that are arguably nonmutagens or weakly mutagenic, we often noted statistically significant dose-dependent increases in revertant frequency that were not accompanied by an absolute increase in numbers of revertants. The increase in frequency was wholly ascribable to a declining number of viable cells owing to toxicity. Analysis of the conditions revealed that the frequency of spontaneous revertants is higher when there are fewer viable cells per plate. The phenomenon resembles "adaptive" or "stress" mutagenesis, whereby lactose revertants accumulate in Lac(-) bacteria under starvation conditions in the absence of catabolite repression. Adaptive mutation is observed after long incubation and might be expected to be irrelevant in a standard assay using 48-h incubation. However, we found that elevated revertant frequencies occur under typical assay conditions when the bacterial lawn is thin, and this can cause increases in revertant frequency that mimic chemical mutagenesis when treatments are toxic but not mutagenic. Responses that resemble chemical mutagenesis were observed in the absence of mutagenic treatment in strains that revert by different frameshift mutations. The magnitude of the artifact is affected by cell density, dilution, culture age, incubation time, catabolite repression and the age and composition of media. Although the specific reversion assay is effective for quickly distinguishing classes of mutations induced by potent mutagens, its
Chimera: a Bioconductor package for secondary analysis of fusion products.
Beccuti, Marco; Carrara, Matteo; Cordero, Francesca; Lazzarato, Fulvio; Donatelli, Susanna; Nadalin, Francesca; Policriti, Alberto; Calogero, Raffaele A
2014-12-15
Chimera is a Bioconductor package that organizes, annotates, analyses and validates fusions reported by different fusion detection tools; current implementation can deal with output from bellerophontes, chimeraScan, deFuse, fusionCatcher, FusionFinder, FusionHunter, FusionMap, mapSplice, Rsubread, tophat-fusion and STAR. The core of Chimera is a fusion data structure that can store fusion events detected with any of the aforementioned tools. Fusions are then easily manipulated with standard R functions or through the set of functionalities specifically developed in Chimera with the aim of supporting the user in managing fusions and discriminating false-positive results. © The Author 2014. Published by Oxford University Press.
Laser-induced fusion of human embryonic stem cells with optical tweezers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen Shuxun; Wang Xiaolin; Sun Dong
2013-07-15
We report a study on the laser-induced fusion of human embryonic stem cells (hESCs) at the single-cell level. Cells were manipulated by optical tweezers and fused under irradiation with pulsed UV laser at 355 nm. Successful fusion was indicated by green fluorescence protein transfer. The influence of laser pulse energy on the fusion efficiency was investigated. The fused products were viable as gauged by live cell staining. Successful fusion of hESCs with somatic cells was also demonstrated. The reported fusion outcome may facilitate studies of cell differentiation, maturation, and reprogramming.
Porotto, Matteo; DeVito, Ilaria; Palmer, Samantha G.; Jurgens, Eric M.; Yee, Jia L.; Yokoyama, Christine C.; Pessi, Antonello; Moscona, Anne
2011-01-01
During paramyxovirus entry into a host cell, receptor engagement by a specialized binding protein triggers conformational changes in the adjacent fusion protein (F), leading to fusion between the viral and cell membranes. According to the existing paradigm of paramyxovirus membrane fusion, the initial activation of F by the receptor binding protein sets off a spring-loaded mechanism whereby the F protein progresses independently through the subsequent steps in the fusion process, ending in membrane merger. For human parainfluenza virus type 3 (HPIV3), the receptor binding protein (hemagglutinin-neuraminidase [HN]) has three functions: receptor binding, receptor cleaving, and activating F. We report that continuous receptor engagement by HN activates F to advance through the series of structural rearrangements required for fusion. In contrast to the prevailing model, the role of HN-receptor engagement in the fusion process is required beyond an initiating step, i.e., it is still required even after the insertion of the fusion peptide into the target cell membrane, enabling F to mediate membrane merger. We also report that for Nipah virus, whose receptor binding protein has no receptor-cleaving activity, the continuous stimulation of the F protein by a receptor-engaged binding protein is key for fusion. We suggest a general model for paramyxovirus fusion activation in which receptor engagement plays an active role in F activation, and the continued engagement of the receptor binding protein is essential to F protein function until the onset of membrane merger. This model has broad implications for the mechanism of paramyxovirus fusion and for strategies to prevent viral entry. PMID:21976650
Porotto, Matteo; Devito, Ilaria; Palmer, Samantha G; Jurgens, Eric M; Yee, Jia L; Yokoyama, Christine C; Pessi, Antonello; Moscona, Anne
2011-12-01
During paramyxovirus entry into a host cell, receptor engagement by a specialized binding protein triggers conformational changes in the adjacent fusion protein (F), leading to fusion between the viral and cell membranes. According to the existing paradigm of paramyxovirus membrane fusion, the initial activation of F by the receptor binding protein sets off a spring-loaded mechanism whereby the F protein progresses independently through the subsequent steps in the fusion process, ending in membrane merger. For human parainfluenza virus type 3 (HPIV3), the receptor binding protein (hemagglutinin-neuraminidase [HN]) has three functions: receptor binding, receptor cleaving, and activating F. We report that continuous receptor engagement by HN activates F to advance through the series of structural rearrangements required for fusion. In contrast to the prevailing model, the role of HN-receptor engagement in the fusion process is required beyond an initiating step, i.e., it is still required even after the insertion of the fusion peptide into the target cell membrane, enabling F to mediate membrane merger. We also report that for Nipah virus, whose receptor binding protein has no receptor-cleaving activity, the continuous stimulation of the F protein by a receptor-engaged binding protein is key for fusion. We suggest a general model for paramyxovirus fusion activation in which receptor engagement plays an active role in F activation, and the continued engagement of the receptor binding protein is essential to F protein function until the onset of membrane merger. This model has broad implications for the mechanism of paramyxovirus fusion and for strategies to prevent viral entry.
SNARE-mediated membrane fusion in autophagy.
Wang, Yongyao; Li, Linsen; Hou, Chen; Lai, Ying; Long, Jiangang; Liu, Jiankang; Zhong, Qing; Diao, Jiajie
2016-12-01
Autophagy, a conserved self-eating process for the bulk degradation of cytoplasmic materials, involves double-membrane autophagosomes formed when an isolation membrane emerges and their direct fusion with lysosomes for degradation. For the early biogenesis of autophagosomes and their later degradation in lysosomes, membrane fusion is necessary, although different sets of genes and autophagy-related proteins involved in distinct fusion steps have been reported. To clarify the molecular mechanism of membrane fusion in autophagy, to not only expand current knowledge of autophagy, but also benefit human health, this review discusses key findings that elucidate the unique membrane dynamics of autophagy. Copyright © 2016 Elsevier Ltd. All rights reserved.
Feasibility study on sensor data fusion for the CP-140 aircraft: fusion architecture analyses
NASA Astrophysics Data System (ADS)
Shahbazian, Elisa
1995-09-01
Loral Canada completed (May 1995) a Department of National Defense (DND) Chief of Research and Development (CRAD) contract, to study the feasibility of implementing a multi- sensor data fusion (MSDF) system onboard the CP-140 Aurora aircraft. This system is expected to fuse data from: (a) attributed measurement oriented sensors (ESM, IFF, etc.); (b) imaging sensors (FLIR, SAR, etc.); (c) tracking sensors (radar, acoustics, etc.); (d) data from remote platforms (data links); and (e) non-sensor data (intelligence reports, environmental data, visual sightings, encyclopedic data, etc.). Based on purely theoretical considerations a central-level fusion architecture will lead to a higher performance fusion system. However, there are a number of systems and fusion architecture issues involving fusion of such dissimilar data: (1) the currently existing sensors are not designed to provide the type of data required by a fusion system; (2) the different types (attribute, imaging, tracking, etc.) of data may require different degree of processing, before they can be used within a fusion system efficiently; (3) the data quality from different sensors, and more importantly from remote platforms via the data links must be taken into account before fusing; and (4) the non-sensor data may impose specific requirements on the fusion architecture (e.g. variable weight/priority for the data from different sensors). This paper presents the analyses performed for the selection of the fusion architecture for the enhanced sensor suite planned for the CP-140 aircraft in the context of the mission requirements and environmental conditions.
Endler, Peter; Ekman, Per; Möller, Hans; Gerdhem, Paul
2017-05-03
Various methods for the treatment of isthmic spondylolisthesis are available. The aim of this study was to compare outcomes after posterolateral fusion without instrumentation, posterolateral fusion with instrumentation, and interbody fusion. The Swedish Spine Register was used to identify 765 patients who had been operated on for isthmic spondylolisthesis and had at least preoperative and 2-year outcome data; 586 of them had longer follow-up (a mean of 6.9 years). The outcome measures were a global assessment of leg and back pain, the Oswestry Disability Index (ODI), the EuroQol-5 Dimensions (EQ-5D) Questionnaire, the Short Form-36 (SF-36), a visual analog scale (VAS) for back and leg pain, and satisfaction with treatment. Data on additional lumbar spine surgery was searched for in the register, with the mean duration of follow-up for this variable being 10.6 years after the index procedure. Statistical analyses were performed with analysis of covariance or competing-risks proportional hazards regression, adjusted for baseline differences in the studied variables, smoking, employment status, and level of fusion. Posterolateral fusion without instrumentation was performed in 102 patients; posterolateral fusion with instrumentation, in 452; and interbody fusion, in 211. At 1 year, improvement was reported in the global assessment for back pain by 54% of the patients who had posterolateral fusion without instrumentation, 68% of those treated with posterolateral fusion with instrumentation, and 70% of those treated with interbody fusion (p = 0.009). The VAS for back pain and reported satisfaction with treatment showed similar patterns (p = 0.003 and p = 0.017, respectively), whereas other outcomes did not differ among the treatment groups at 1 year. At 2 years, the global assessment for back pain indicated improvement in 57% of the patients who had undergone posterolateral fusion without instrumentation, 70% of those who had posterolateral fusion with instrumentation
C2-C3 Anterior Cervical Fusion: Technical Report.
Finn, Michael A; MacDonald, Joel D
2016-12-01
Retrospective review of patients at a university hospital. To describe the anterior approach for cervical discectomy and fusion (ACDF) at C2-C3 level and evaluate its suitability for treatment of instability and degenerative disease in this region. The anterior approach is commonly used for ACDF in the lower cervical spine but is used less often in the high cervical spine. We retrospectively reviewed a database of consecutive cervical spine surgeries performed at our institution to identify patients who underwent ACDF at the C2-C3 level during a 10-year period. Demographic data, clinical indications, surgical technique, complications, and immediate results were evaluated. Of the 11 patients (7 female, 4 male; mean age 46 y) identified, 7 were treated for traumatic fractures and 4 for degenerative disk disease. Three patients treated for myelopathy showed improvement in mean Nurick grade from 3.6 to 1.3. Pain was significantly improved in all patients who had preoperative pain. Solid bony fusion was achieved in 5 of 7 patients at 3-month follow-up. Complications included dysphagia in 4 patients (which resolved in 3), aspiration pneumonia, mild persistent dysphonia, and construct failure at C2 requiring posterior fusion. One patient died of a pulmonary embolism 2 weeks postoperatively. ACDF at the C2-C3 level is an option for the treatment of high cervical disease or trauma but is associated with a higher rate of approach-related morbidity. Familiarity with local anatomy may help to reduce complications. ACDF at C2-C3 appears to have a fusion rate similar to ACDF performed at other levels.
Kube, Richard A.; Muir, Jeffrey M.
2016-01-01
Background: Recalcitrant sacroiliac joint pain responds well to minimally-invasive surgical (MIS) techniques, although long-term radiographic and fusion data are limited. Objective: To evaluate the one-year clinical results from a cohort of patients with chronic sacroiliac (SI) joint pain unresponsive to conservative therapies who have undergone minimally invasive SI joint fusion. Methods: SI joint fusion was performed between May 2011 and January 2014. Outcomes included radiographic assessment of fusion status, leg and back pain severity via visual analog scale (VAS), disability via Oswestry Disability Index (ODI) and complication rate. Outcomes were measured at baseline and at follow-up appointments 6 months and 12 months post-procedure. Results: Twenty minimally invasive SI joint fusion procedures were performed on 18 patients (mean age: 47.2 (14.2), mean BMI: 29.4 (5.3), 56% female). At 12 months, the overall fusion rate was 88%. Back and leg pain improved from 81.7 to 44.1 points (p<0.001) and from 63.6 to 27.7 points (p=0.001), respectively. Disability scores improved from 61.0 to 40.5 (p=0.009). Despite a cohort containing patients with multiple comorbidities and work-related injuries, eight patients (50%) achieved the minimal clinically important difference (MCID) in back pain at 12 months, with 9 (69%) patients realizing this improvement in leg pain and 8 (57%) realizing the MCID in ODI scores at 12 months. No major complications were reported. Conclusion: Minimally invasive SI joint surgery is a safe and effective procedure, with a high fusion rate, a satisfactory safety profile and significant improvements in pain severity and disability reported through 12 months post-procedure. PMID:28144378
Kube, Richard A; Muir, Jeffrey M
2016-01-01
Recalcitrant sacroiliac joint pain responds well to minimally-invasive surgical (MIS) techniques, although long-term radiographic and fusion data are limited. To evaluate the one-year clinical results from a cohort of patients with chronic sacroiliac (SI) joint pain unresponsive to conservative therapies who have undergone minimally invasive SI joint fusion. SI joint fusion was performed between May 2011 and January 2014. Outcomes included radiographic assessment of fusion status, leg and back pain severity via visual analog scale (VAS), disability via Oswestry Disability Index (ODI) and complication rate. Outcomes were measured at baseline and at follow-up appointments 6 months and 12 months post-procedure. Twenty minimally invasive SI joint fusion procedures were performed on 18 patients (mean age: 47.2 (14.2), mean BMI: 29.4 (5.3), 56% female). At 12 months, the overall fusion rate was 88%. Back and leg pain improved from 81.7 to 44.1 points (p<0.001) and from 63.6 to 27.7 points (p=0.001), respectively. Disability scores improved from 61.0 to 40.5 (p=0.009). Despite a cohort containing patients with multiple comorbidities and work-related injuries, eight patients (50%) achieved the minimal clinically important difference (MCID) in back pain at 12 months, with 9 (69%) patients realizing this improvement in leg pain and 8 (57%) realizing the MCID in ODI scores at 12 months. No major complications were reported. Minimally invasive SI joint surgery is a safe and effective procedure, with a high fusion rate, a satisfactory safety profile and significant improvements in pain severity and disability reported through 12 months post-procedure.
Ueki, Toshiyuki; Inouye, Sumiko
2005-12-01
FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.
Salvage of infected total knee fusion: the last option.
Wiedel, Jerome D
2002-11-01
Currently the most common indication for an arthrodesis of the knee is a failed infected total knee prosthesis. Other causes of a failed total knee replacement that might necessitate a knee fusion include aseptic loosening, deficient extensor mechanism, poor soft tissues, and Charcot joint. Techniques available for achieving a knee fusion are external fixation and internal fixation methods. The external fixation compression devices have been the most widely used for knee fusion and have been successful until the indications for fusion changed to mostly failed prosthetic knee replacement. With failed total knee replacement, the problem of severe bone loss became an issue, and the external fixation compression devices, even including the biplane external fixators, have been the least successful method reported for gaining fusion. The Ilizarov technique has been shown to achieve rigid fixation despite this bone loss, and a review of reports are showing high fusion rates using this method. Internal fixation methods including plate fixation and intramedullary nails have had the best success in gaining fusion in the face of this bone loss and have replaced external fixation methods as the technique of choice for knee fusion when severe bone loss is present. A review of the literature and a discussion of different fusion techniques are presented including a discussion of the influence that infection has on the success of fusion.
Live imaging of mouse secondary palate fusion
Kim, Seungil; Prochazka, Jan; Bush, Jeffrey O.
2017-01-01
LONG ABSTRACT The fusion of the secondary palatal shelves to form the intact secondary palate is a key process in mammalian development and its disruption can lead to cleft secondary palate, a common congenital anomaly in humans. Secondary palate fusion has been extensively studied leading to several proposed cellular mechanisms that may mediate this process. However, these studies have been mostly performed on fixed embryonic tissues at progressive timepoints during development or in fixed explant cultures analyzed at static timepoints. Static analysis is limited for the analysis of dynamic morphogenetic processes such a palate fusion and what types of dynamic cellular behaviors mediate palatal fusion is incompletely understood. Here we describe a protocol for live imaging of ex vivo secondary palate fusion in mouse embryos. To examine cellular behaviors of palate fusion, epithelial-specific Keratin14-cre was used to label palate epithelial cells in ROSA26-mTmGflox reporter embryos. To visualize filamentous actin, Lifeact-mRFPruby reporter mice were used. Live imaging of secondary palate fusion was performed by dissecting recently-adhered secondary palatal shelves of embryonic day (E) 14.5 stage embryos and culturing in agarose-containing media on a glass bottom dish to enable imaging with an inverted confocal microscope. Using this method, we have detected a variety of novel cellular behaviors during secondary palate fusion. An appreciation of how distinct cell behaviors are coordinated in space and time greatly contributes to our understanding of this dynamic morphogenetic process. This protocol can be applied to mutant mouse lines, or cultures treated with pharmacological inhibitors to further advance understanding of how secondary palate fusion is controlled. PMID:28784960
Accelerator & Fusion Research Division 1991 summary of activities
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1991-12-01
This report discusses research projects in the following areas: Heavy-ion fusion accelerator research; magnetic fusion energy; advanced light source; center for x-ray optics; exploratory studies; superconducting magnets; and bevalac operations.
Accelerator Fusion Research Division 1991 summary of activities
DOE Office of Scientific and Technical Information (OSTI.GOV)
Berkner, Klaus H.
1991-12-01
This report discusses research projects in the following areas: Heavy-ion fusion accelerator research; magnetic fusion energy; advanced light source; center for x-ray optics; exploratory studies; superconducting magnets; and bevalac operations.
Report on the Installation and Preparedness of a Protochips Fusion in-situ Heating Holder for TEM
DOE Office of Scientific and Technical Information (OSTI.GOV)
Edmondson, Philip D.
2017-03-01
This brief report documents the procurement and installation of a Protochips Fusion (formerly Aduro) high-temperature, high stability transmission electron microscopy (TEM) specimen holder that allows for the high spatial resolution characterization of material specimens at high temperature in situ of an electron microscope. This specimen holder was specifically procured for use with The FEI Talos F200X Scanning/Transmission Electron Microscope (STEM) in Oak Ridge National Laboratory’s (ORNL’s) Low Activation Materials Development and Analysis (LAMDA) Laboratory. The Protochips Fusion holder will enable high-resolution structural and chemical analysis of irradiated materials at high temperature, becoming a unique capability worldwide, and would encourage high-qualitymore » in situ experiments to be conducted on irradiated materials.« less
Unified Research on Network-Based Hard/Soft Information Fusion
2016-02-02
types). There are a number of search tree run parameters which must be set depending on the experimental setting. A pilot study was run to identify...Unlimited Final Report: Unified Research on Network-Based Hard/Soft Information Fusion The views, opinions and/or findings contained in this report...Final Report: Unified Research on Network-Based Hard/Soft Information Fusion Report Title The University at Buffalo (UB) Center for Multisource
Gareton, Albane; Pierron, Gaëlle; Mokhtari, Karima; Tran, Suzanne; Tauziède-Espariat, Arnault; Pallud, Johan; Louvel, Guillaume; Meary, Eric; Capelle, Laurent; Chrétien, Fabrice; Varlet, Pascale
2018-05-19
Gene fusions of EWSR1 with members of the CREB family of transcription factors (CREB1, ATF1, and CREM) have recently been described in exceptional intracranial myxoid mesenchymal tumors. Although this is a known gene fusion found in various mesenchymal tumors, EWSR1 fusion with CREM has only been observed in 3 intracranial myxoid tumors. In this paper, we present 1 such tumor with in-depth histopathological description and long-term follow-up. There is controversy regarding whether these tumors represent a novel entity or simply an intracranial localization of the myxoid variant of angiomatoid fibrous histiocytoma, a rare soft tissue tumor of the extremities. Out of 11 cases mentioned in the literature, the 3 isolated case reports by Dunham et al, Ochalski et al, and Alshareef et al are designated as angiomatoid fibrous histiocytoma, whereas the others are defined as a novel tumoral entity called intracranial myxoid mesenchymal tumor with EWSR1-CREB fusion. We believe the vast morphological and immunohistochemical spectrum of angiomatoid fibrous histiocytoma makes it difficult to dismiss this diagnosis.
Liu, Yanjie; Pei, Jimin; Grishin, Nick; Snell, William J
2015-03-01
Cell-cell fusion between gametes is a defining step during development of eukaryotes, yet we know little about the cellular and molecular mechanisms of the gamete membrane fusion reaction. HAP2 is the sole gamete-specific protein in any system that is broadly conserved and shown by gene disruption to be essential for gamete fusion. The wide evolutionary distribution of HAP2 (also known as GCS1) indicates it was present in the last eukaryotic common ancestor and, therefore, dissecting its molecular properties should provide new insights into fundamental features of fertilization. HAP2 acts at a step after membrane adhesion, presumably directly in the merger of the lipid bilayers. Here, we use the unicellular alga Chlamydomonas to characterize contributions of key regions of HAP2 to protein location and function. We report that mutation of three strongly conserved residues in the ectodomain has no effect on targeting or fusion, although short deletions that include those residues block surface expression and fusion. Furthermore, HAP2 lacking a 237-residue segment of the cytoplasmic region is expressed at the cell surface, but fails to localize at the apical membrane patch specialized for fusion and fails to rescue fusion. Finally, we provide evidence that the ancient HAP2 contained a juxta-membrane, multi-cysteine motif in its cytoplasmic region, and that mutation of a cysteine dyad in this motif preserves protein localization, but substantially impairs HAP2 fusion activity. Thus, the ectodomain of HAP2 is essential for its surface expression, and the cytoplasmic region targets HAP2 to the site of fusion and regulates the fusion reaction. © 2015. Published by The Company of Biologists Ltd.
Subtalar fusion with iliac bone free flap after a recalcitrant nonunion: Report of two cases.
Roger, Ignacio; Worden, Alicia; Panattoni, Joao; Garcia, Ignacio; Aranda, Fernando; Delgado, Paula A
2016-09-01
Fractures of the calcaneus are associated with secondary osteoarthritis of the subtalar joint. In a persistent nonunion, vascularized bone flaps offer superior biologic and mechanical properties as well as accelerates joint fusion and decreases morbidity. In this report, we present results of the use of vascularized iliac bone free flap for treating subtalar failed fusions in two patients. Two patients sustained calcaneal fractures due to foot trauma, which were initially or subsequently treated with subtalar arthrodesis. Case one developed septic subtalar nonunion during treatment and case two failed three attempts at subtalar arthrodeses. The iliac crest bone flap harvested measured 4 × 4 cm (case one) and 3 × 3 cm (case two). The flap was pedicled by the deep circumflex iliac artery, which was anastomosed to the anterior tibial artery at the recipient site. No flap donor or recipient site complications occurred. Fusion was confirmed on CT scan and weight bearing was initiated at 5-6 months. At latest follow up (1-2 years), no complications occurred. Our results show that subtalar nonunion treatment with a vascularized iliac bone flap may be feasible and such a reconstruction could be clinically successful. © 2015 Wiley Periodicals, Inc. Microsurgery 36:501-506, 2016. © 2015 Wiley Periodicals, Inc.
Fusion 2.0: The Next Generation of Fusion in California: Aligning State and Regional Fusion Centers
2010-03-01
bible ” for fusion center management, as evidenced by the theme of the 2009 National Fusion Center Conference; appropriately called “Achieving Baseline...NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS FUSION 2.0: THE NEXT GENERATION OF FUSION IN CALIFORNIA: ALIGNING STATE AND...Master’s Thesis 4. TITLE AND SUBTITLE Fusion 2.0: The Next Generation of Fusion in California: Aligning State and Regional Fusion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wendt, Amy; Callis, Richard; Efthimion, Philip
Since the 1950s, scientists and engineers in the U.S. and around the world have worked hard to make an elusive goal to be achieved on Earth: harnessing the reaction that fuels the stars, namely fusion. Practical fusion would be a source of energy that is unlimited, safe, environmentally benign, available to all nations and not dependent on climate or the whims of the weather. Significant resources, most notably from the U.S. Department of Energy (DOE) Office of Fusion Energy Sciences (FES), have been devoted to pursuing that dream, and significant progress is being made in turning it into a reality.more » However, that is only part of the story. The process of creating a fusion-based energy supply on Earth has led to technological and scientific achievements of far-reaching impact that touch every aspect of our lives. Those largely unanticipated advances, spanning a wide variety of fields in science and technology, are the focus of this report. There are many synergies between research in plasma physics (the study of charged particles and fluids interacting with self-consistent electric and magnetic fields), high-energy physics, and condensed matter physics dating back many decades. For instance, the formulation of a mathematical theory of solitons, solitary waves which are seen in everything from plasmas to water waves to Bose-Einstein Condensates, has led to an equal span of applications, including the fields of optics, fluid mechanics and biophysics. Another example, the development of a precise criterion for transition to chaos in Hamiltonian systems, has offered insights into a range of phenomena including planetary orbits, two-person games and changes in the weather. Seven distinct areas of fusion energy sciences were identified and reviewed which have had a recent impact on fields of science, technology and engineering not directly associated with fusion energy: Basic plasma science; Low temperature plasmas; Space and astrophysical plasmas; High energy
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pszon-Bartosz, Kamila; Hansen, Jesper S.; Technical University of Denmark, Department of Micro- and Nanotechnology, DK-2800 Kongens Lyngby
2011-03-04
Research highlights: {yields} We have established a vesicle fusion efficacy assay based on the major non-specific porin of Fusobacterium nucleatum (FomA). {yields} Maximal fusion obtained was almost 150,000 porin insertions during 20 min. {yields} Incorporation can be either first order or exponential kinetics which has implications for establishing protein delivery to biomimetic membranes. -- Abstract: Reconstitution of functionally active membrane protein into artificially made lipid bilayers is a challenge that must be overcome to create a membrane-based biomimetic sensor and separation device. In this study we address the efficacy of proteoliposome fusion with planar membrane arrays. We establish a proteinmore » incorporation efficacy assay using the major non-specific porin of Fusobacterium nucleatum (FomA) as reporter. We use electrical conductance measurements and fluorescence microscopy to characterize proteoliposome fusion with an array of planar membranes. We show that protein reconstitution in biomimetic membrane arrays may be quantified using the developed FomA assay. Specifically, we show that FomA vesicles are inherently fusigenic. Optimal FomA incorporation is obtained with a proteoliposome lipid-to-protein molar ratio (LPR) = 50 more than 10{sup 5} FomA proteins could be incorporated in a bilayer array with a total membrane area of 2 mm{sup 2} within 20 min. This novel assay for quantifying protein delivery into lipid bilayers may be a useful tool in developing biomimetic membrane applications.« less
Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica.
Xuan, J W; Fournier, P; Declerck, N; Chasles, M; Gaillardin, C
1990-01-01
Mutants affected at the LYS5 locus of Yarrowia lipolytica lack detectable dehydrogenase (SDH) activity. The LYS5 gene has previously been cloned, and we present here the sequence of the 2.5-kilobase-pair (kb) DNA fragment complementing the lys5 mutation. Two large antiparallel open reading frames (ORF1 and ORF2) were observed, flanked by potential transcription signals. Both ORFs appear to be transcribed, but several lines of evidence suggest that only ORF2 is translated and encodes SDH. (i) The global amino acid compositions of Saccharomyces cerevisiae SDH and of the putative ORF2 product are similar and that of ORF1 is dissimilar. (ii) An in-frame translational fusion of ORF2 with the Escherichia coli lacZ gene was introduced into yeast cells and resulted in a beta-galactosidase activity regulated similarly to SDH; no beta-galactosidase activity was obtained with an in-frame fusion of ORF1 with lacZ. (iii) The introduction of a stop codon at the beginning of ORF2 prevented SDH expression in yeast cells, whereas no phenotypic effect was observed when ORF1 translation was blocked. Images PMID:2388625
Scientific and technological advancements in inertial fusion energy
Hinkel, D. E.
2013-09-26
Scientific advancements in inertial fusion energy (IFE) were reported on at the IAEA Fusion Energy Conference, October 2012. Results presented transect the different ways to assemble the fuel, different scenarios for igniting the fuel, and progress in IFE technologies. The achievements of the National Ignition Campaign within the USA, using the National Ignition Facility (NIF) to indirectly drive laser fusion, have found beneficial the achievements in other IFE arenas such as directly driven laser fusion and target fabrication. Moreover, the successes at NIF have pay-off to alternative scenarios such as fast ignition, shock ignition, and heavy-ion fusion as well asmore » to directly driven laser fusion. As a result, this synergy is summarized here, and future scientific studies are detailed.« less
Multisensor data fusion for integrated maritime surveillance
NASA Astrophysics Data System (ADS)
Premji, A.; Ponsford, A. M.
1995-01-01
A prototype Integrated Coastal Surveillance system has been developed on Canada's East Coast to provide effective surveillance out to and beyond the 200 nautical mile Exclusive Economic Zone. The system has been designed to protect Canada's natural resources, and to monitor and control the coastline for smuggling, drug trafficking, and similar illegal activity. This paper describes the Multiple Sensor - Multiple Target data fusion system that has been developed. The fusion processor has been developed around the celebrated Multiple Hypothesis Tracking algorithm which accommodates multiple targets, new targets, false alarms, and missed detections. This processor performs four major functions: plot-to-track association to form individual radar tracks; fusion of radar tracks with secondary sensor reports; track identification and tagging using secondary reports; and track level fusion to form common tracks. Radar data from coherent and non-coherent radars has been used to evaluate the performance of the processor. This paper presents preliminary results.
Lim, Joel Louis; Tan, Kimberly-Anne
2017-01-01
This case report describes the first case of a bone bridge formation across the left L5/S1 neuroforamen after instrumented posterolateral fusion for L5/S1 isthmic spondylolisthesis. Our patient was a 70-year-old lady who had grade 2, L5/S1 isthmic spondylolisthesis and bilateral S1 nerve root compression. She suffered from mechanical low back pain and neurogenic claudication, with radicular pain over both S1 dermatomes. She underwent in-situ, instrumented, posterolateral fusion and was asymptomatic for more than 13 years before developing progressive onset of left radicular pain over the L5 dermatome. Imaging revealed a bisected left L5/S1 neuroforamen secondary to a bone bridge formation resulting in stenosis. The pars defect in this case may have had sufficient osteogenic and osteoinductive factors to heal following spinal stabilization. Although in-situ posterolateral fusion is an accepted surgical treatment for isthmic spondylolisthesis, surgeons should consider reduction of the spondylolisthesis and excision of the pars defects to avoid this possible long-term complication. PMID:28435923
Lim, Joel Louis; Tan, Kimberly-Anne; Hey, Hwee Weng Dennis
2017-03-01
This case report describes the first case of a bone bridge formation across the left L5/S1 neuroforamen after instrumented posterolateral fusion for L5/S1 isthmic spondylolisthesis. Our patient was a 70-year-old lady who had grade 2, L5/S1 isthmic spondylolisthesis and bilateral S1 nerve root compression. She suffered from mechanical low back pain and neurogenic claudication, with radicular pain over both S1 dermatomes. She underwent in-situ, instrumented, posterolateral fusion and was asymptomatic for more than 13 years before developing progressive onset of left radicular pain over the L5 dermatome. Imaging revealed a bisected left L5/S1 neuroforamen secondary to a bone bridge formation resulting in stenosis. The pars defect in this case may have had sufficient osteogenic and osteoinductive factors to heal following spinal stabilization. Although in-situ posterolateral fusion is an accepted surgical treatment for isthmic spondylolisthesis, surgeons should consider reduction of the spondylolisthesis and excision of the pars defects to avoid this possible long-term complication.
Lang, Claus; Smith, Lucinda S.; Haney, Cara H.; Long, Sharon R.
2018-01-01
The formation of nitrogen fixing root nodules by Medicago truncatula and Sinorhizobium meliloti requires communication between both organisms and coordinated differentiation of plant and bacterial cells. After an initial signal exchange, the bacteria invade the tissue of the growing nodule via plant-derived tubular structures, called infection threads. The bacteria are released from the infection threads into invasion-competent plant cells, where they differentiate into nitrogen-fixing bacteroids. Both organisms undergo dramatic transcriptional, metabolic and morphological changes during nodule development. To identify plant processes that are essential for the formation of nitrogen fixing nodules after nodule development has been initiated, large scale mutageneses have been conducted to discover underlying plant symbiosis genes. Such screens yield numerous uncharacterized plant lines with nitrogen fixation deficient nodules. In this study, we report construction of a S. meliloti strain carrying four distinct reporter constructs to reveal stages of root nodule development. The strain contains a constitutively expressed lacZ reporter construct; a PexoY-mTFP fusion that is expressed in infection threads but not in differentiated bacteroids; a PbacA-mcherry construct that is expressed in infection threads and during bacteroid differentiation; and a PnifH-uidA construct that is expressed during nitrogen fixation. We used this strain together with fluorescence microscopy to study nodule development over time in wild type nodules and to characterize eight plant mutants from a fast neutron bombardment screen. Based on the signal intensity and the localization patterns of the reporter genes, we grouped mutants with similar phenotypes and placed them in a developmental context. PMID:29467773
Lang, Claus; Smith, Lucinda S; Long, Sharon R
2018-01-01
The formation of nitrogen fixing root nodules by Medicago truncatula and Sinorhizobium meliloti requires communication between both organisms and coordinated differentiation of plant and bacterial cells. After an initial signal exchange, the bacteria invade the tissue of the growing nodule via plant-derived tubular structures, called infection threads. The bacteria are released from the infection threads into invasion-competent plant cells, where they differentiate into nitrogen-fixing bacteroids. Both organisms undergo dramatic transcriptional, metabolic and morphological changes during nodule development. To identify plant processes that are essential for the formation of nitrogen fixing nodules after nodule development has been initiated, large scale mutageneses have been conducted to discover underlying plant symbiosis genes. Such screens yield numerous uncharacterized plant lines with nitrogen fixation deficient nodules. In this study, we report construction of a S. meliloti strain carrying four distinct reporter constructs to reveal stages of root nodule development. The strain contains a constitutively expressed lacZ reporter construct; a P exoY -mTFP fusion that is expressed in infection threads but not in differentiated bacteroids; a P bacA -mcherry construct that is expressed in infection threads and during bacteroid differentiation; and a P nifH -uidA construct that is expressed during nitrogen fixation. We used this strain together with fluorescence microscopy to study nodule development over time in wild type nodules and to characterize eight plant mutants from a fast neutron bombardment screen. Based on the signal intensity and the localization patterns of the reporter genes, we grouped mutants with similar phenotypes and placed them in a developmental context.
Minigene-like inhibition of protein synthesis mediated by hungry codons near the start codon
Jacinto-Loeza, Eva; Vivanco-Domínguez, Serafín; Guarneros, Gabriel; Hernández-Sánchez, Javier
2008-01-01
Rare AGA or AGG codons close to the initiation codon inhibit protein synthesis by a tRNA-sequestering mechanism as toxic minigenes do. To further understand this mechanism, a parallel analysis of protein synthesis and peptidyl-tRNA accumulation was performed using both a set of lacZ constructs where AGAAGA codons were moved codon by codon from +2, +3 up to +7, +8 positions and a series of 3–8 codon minigenes containing AGAAGA codons before the stop codon. β-Galactosidase synthesis from the AGAAGA lacZ constructs (in a Pth defective in vitro system without exogenous tRNA) diminished as the AGAAGA codons were closer to AUG codon. Likewise, β-galactosidase expression from the reporter +7 AGA lacZ gene (plus tRNA, 0.25 μg/μl) waned as the AGAAGAUAA minigene shortened. Pth counteracted both the length-dependent minigene effect on the expression of β-galactosidase from the +7 AGA lacZ reporter gene and the positional effect from the AGAAGA lacZ constructs. The +2, +3 AGAAGA lacZ construct and the shortest +2, +3 AGAAGAUAA minigene accumulated the highest percentage of peptidyl-tRNAArg4. These observations lead us to propose that hungry codons at early positions, albeit with less strength, inhibit protein synthesis by a minigene-like mechanism involving accumulation of peptidyl-tRNA. PMID:18583364
Ueki, Toshiyuki; Inouye, Sumiko
2005-01-01
FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956
Soegaard, Rikke; Bünger, Cody E; Christiansen, Terkel; Høy, Kristian; Eiskjaer, Søren P; Christensen, Finn B
2007-10-15
Cost-utility evaluation of a randomized, controlled trial with a 4- to 8-year follow-up. To investigate the incremental cost per quality-adjusted-life-year (QALY) when comparing circumferential fusion to posterolateral fusion in a long-term, societal perspective. The cost-effectiveness of circumferential fusion in a long-term perspective is uncertain but nonetheless highly relevant as the ISSLS prize winner 2006 in clinical studies reported the effect of circumferential fusion superior to the effect of posterolateral fusion. A recent trial found no significant difference between posterolateral and circumferential fusion reporting cost-effectiveness from a 2-year viewpoint. A total of 146 patients were randomized to posterolateral or circumferential fusion and followed 4 to 8 years after surgery. The mean age of the cohort was 46 years (range, 20-65 years); 61% were females, 49% were smokers, 30% had primary diagnosis of isthmic spondylolisthesis, 35% had disc degeneration and no previous surgery, and 35% had disc degeneration and previous surgery. Eighty-two percent of patients have had symptoms for more than 2 years and 50% were out of the labor market due to sickness. The EQ-5D instrument was applied for the measurement of health-related quality of life and costs (2004 U.S. dollars) were measured in a full-scale societal perspective. Productivity costs were valued by the Friction Cost method, and both costs and effects were discounted. Arithmetic means and 95% bias-corrected, bootstrapped confidence intervals were reported. Nonparametric statistics were used for tests of statistical significance. Comprehensive sensitivity analysis was conducted and reported using cost-effectiveness acceptability curves. The circumferential group demonstrated clinical superiority over the posterolateral fusion group in functional outcome (P < 0.01), fusion rate (P < 0.04), and number of reoperations (P < 0.01) among others. Cost-utility analysis demonstrated circumferential fusion
Accelerator and fusion research division. 1992 Summary of activities
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1992-12-01
This report contains brief discussions on research topics in the following area: Heavy-Ion Fusion Accelerator Research; Magnetic Fusion Energy; Advanced Light Source; Center for Beam Physics; Superconducting Magnets; and Bevalac Operations.
Kinase Gene Fusions in Defined Subsets of Melanoma
Turner, Jacqueline; Couts, Kasey; Sheren, Jamie; Saichaemchan, Siriwimon; Ariyawutyakorn, Witthawat; Avolio, Izabela; Cabral, Ethan; Glogowska, Magdelena; Amato, Carol; Robinson, Steven; Hintzsche, Jennifer; Applegate, Allison; Seelenfreund, Eric; Gonzalez, Rita; Wells, Keith; Bagby, Stacey; Tentler, John; Tan, Aik-Choon; Wisell, Joshua; Varella-Garcia, Marileila; Robinson, William
2017-01-01
Summary Genomic rearrangements resulting in activating kinase fusions have been increasingly described in a number of cancers including malignant melanoma, but their frequency in specific melanoma subtypes has not been reported. We used break-apart fluorescence in-situ hybridization (FISH) to identify genomic rearrangements in tissues from 59 patients with various types of malignant melanoma including acral lentiginous, mucosal, superficial spreading, and nodular. We identified four genomic rearrangements involving the genes BRAF, RET, and ROS1. Of these, three were confirmed by IHC or sequencing and one was found to be an ARMC10-BRAF fusion that has not been previously reported in melanoma. These fusions occurred in different subtypes of melanoma but all in tumors lacking known driver mutations. Our data suggest gene fusions are more common than previously thought-and should be further explored particularly in melanomas lacking known driver mutations. PMID:27864876
Detecting protein-protein interactions using Renilla luciferase fusion proteins.
Burbelo, Peter D; Kisailus, Adam E; Peck, Jeremy W
2002-11-01
We have developed a novel system designated the luciferase assay for protein detection (LAPD) to study protein-protein interactions. This method involves two protein fusions, a soluble reporter fusion and a fusion for immobilizing the target protein. The soluble reporter is an N-terminal Renilla luciferase fusion protein that exhibits high Renilla luciferase activity. Crude cleared lysates from transfected Cos1 cells that express the Renilla luciferase fusion protein can be used in binding assays with immobilized target proteins. Following incubation and washing, target-bound Renilla luciferase fusion proteins produce light from the coelenterazine substrate, indicating an interaction between the two proteins of interest. As proof of the principle, we reproduced known, transient protein-protein interactions between the Cdc42 GTPase and its effector proteins. GTPase Renilla fusion proteins produced in Cos1 cells were tested with immobilized recombinant GST-N-WASP and CEP5 effector proteins. Using this assay, we could detect specific interactions of Cdc42 with these effector proteins in approximately 50 min. The specificity of these interactions was demonstrated by showing that they were GTPase-specific and GTP-dependent and not seen with other unrelated target proteins. These results suggest that the LAPD method, which is both rapid and sensitive, may have research and practical applications.
DOE Office of Scientific and Technical Information (OSTI.GOV)
NONE
1999-01-01
This report summarizes research at the Laboratory for Laser Energetics (LLE), the operation of the National Laser Users` Facility (NLUF), and programs involving the education of high school, undergraduate, and graduate students for FY98. Research summaries cover: progress in laser fusion; diagnostic development; laser and optical technology; and advanced technology for laser targets.
EDITORIAL: The Nuclear Fusion Award The Nuclear Fusion Award
NASA Astrophysics Data System (ADS)
Kikuchi, M.
2011-01-01
The Nuclear Fusion Award ceremony for 2009 and 2010 award winners was held during the 23rd IAEA Fusion Energy Conference in Daejeon. This time, both 2009 and 2010 award winners were celebrated by the IAEA and the participants of the 23rd IAEA Fusion Energy Conference. The Nuclear Fusion Award is a paper prize to acknowledge the best distinguished paper among the published papers in a particular volume of the Nuclear Fusion journal. Among the top-cited and highly-recommended papers chosen by the Editorial Board, excluding overview and review papers, and by analyzing self-citation and non-self-citation with an emphasis on non-self-citation, the Editorial Board confidentially selects ten distinguished papers as nominees for the Nuclear Fusion Award. Certificates are given to the leading authors of the Nuclear Fusion Award nominees. The final winner is selected among the ten nominees by the Nuclear Fusion Editorial Board voting confidentially. 2009 Nuclear Fusion Award nominees For the 2009 award, the papers published in the 2006 volume were assessed and the following papers were nominated, most of which are magnetic confinement experiments, theory and modeling, while one addresses inertial confinement. Sabbagh S.A. et al 2006 Resistive wall stabilized operation in rotating high beta NSTX plasmas Nucl. Fusion 46 635-44 La Haye R.J. et al 2006 Cross-machine benchmarking for ITER of neoclassical tearing mode stabilization by electron cyclotron current drive Nucl. Fusion 46 451-61 Honrubia J.J. et al 2006 Three-dimensional fast electron transport for ignition-scale inertial fusion capsules Nucl. Fusion 46 L25-8 Ido T. et al 2006 Observation of the interaction between the geodesic acoustic mode and ambient fluctuation in the JFT-2M tokamak Nucl. Fusion 46 512-20 Plyusnin V.V. et al 2006 Study of runaway electron generation during major disruptions in JET Nucl. Fusion 46 277-84 Pitts R.A. et al 2006 Far SOL ELM ion energies in JET Nucl. Fusion 46 82-98 Berk H.L. et al 2006
NASA Astrophysics Data System (ADS)
Herman, Robin
1990-10-01
The book abounds with fascinating anecdotes about fusion's rocky path: the spurious claim by Argentine dictator Juan Peron in 1951 that his country had built a working fusion reactor, the rush by the United States to drop secrecy and publicize its fusion work as a propaganda offensive after the Russian success with Sputnik; the fortune Penthouse magazine publisher Bob Guccione sank into an unconventional fusion device, the skepticism that met an assertion by two University of Utah chemists in 1989 that they had created "cold fusion" in a bottle. Aimed at a general audience, the book describes the scientific basis of controlled fusion--the fusing of atomic nuclei, under conditions hotter than the sun, to release energy. Using personal recollections of scientists involved, it traces the history of this little-known international race that began during the Cold War in secret laboratories in the United States, Great Britain and the Soviet Union, and evolved into an astonishingly open collaboration between East and West.
Kamm, Gretel B.; López-Leal, Rodrigo; Lorenzo, Juan R.; Franchini, Lucía F.
2013-01-01
The developmental brain gene NPAS3 stands out as a hot spot in human evolution because it contains the largest number of human-specific, fast-evolving, conserved, non-coding elements. In this paper we studied 2xHAR142, one of these elements that is located in the fifth intron of NPAS3. Using transgenic mice, we show that the mouse and chimp 2xHAR142 orthologues behave as transcriptional enhancers driving expression of the reporter gene lacZ to a similar NPAS3 expression subdomain in the mouse central nervous system. Interestingly, the human 2xHAR142 orthologue drives lacZ expression to an extended expression pattern in the nervous system. Thus, molecular evolution of 2xHAR142 provides the first documented example of human-specific heterotopy in the forebrain promoted by a transcriptional enhancer and suggests that it may have contributed to assemble the unique properties of the human brain. PMID:24218632
Runtime Simulation for Post-Disaster Data Fusion Visualization
2006-10-01
Center for Multisource Information Fusion ( CMIF ) The State University of New York at Buffalo Buffalo, NY 14260 USA kesh@eng.buffalo.edu ABSTRACT...Fusion ( CMIF ) The State University of New York at Buffalo Buffalo, NY 14260 USA 8. PERFORMING ORGANIZATION REPORT NUMBER 9. SPONSORING/MONITORING
Green fluorescence protein-based content-mixing assay of SNARE-driven membrane fusion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Heo, Paul; Kong, Byoungjae; Jung, Young-Hun
Soluble N-ethylmaleimide-sensitive factor attachment protein receptor (SNARE) proteins mediate intracellular membrane fusion by forming a ternary SNARE complex. A minimalist approach utilizing proteoliposomes with reconstituted SNARE proteins yielded a wealth of information pinpointing the molecular mechanism of SNARE-mediated fusion and its regulation by accessory proteins. Two important attributes of a membrane fusion are lipid-mixing and the formation of an aqueous passage between apposing membranes. These two attributes are typically observed by using various fluorescent dyes. Currently available in vitro assay systems for observing fusion pore opening have several weaknesses such as cargo-bleeding, incomplete removal of unencapsulated dyes, and inadequate information regardingmore » the size of the fusion pore, limiting measurements of the final stage of membrane fusion. In the present study, we used a biotinylated green fluorescence protein and streptavidin conjugated with Dylight 594 (DyStrp) as a Föster resonance energy transfer (FRET) donor and acceptor, respectively. This FRET pair encapsulated in each v-vesicle containing synaptobrevin and t-vesicle containing a binary acceptor complex of syntaxin 1a and synaptosomal-associated protein 25 revealed the opening of a large fusion pore of more than 5 nm, without the unwanted signals from unencapsulated dyes or leakage. This system enabled determination of the stoichiometry of the merging vesicles because the FRET efficiency of the FRET pair depended on the molar ratio between dyes. Here, we report a robust and informative assay for SNARE-mediated fusion pore opening. - Highlights: • SNARE proteins drive membrane fusion and open a pore for cargo release. • Biotinylated GFP and DyStrp was used as the reporter pair of fusion pore opening. • Procedure for efficient SNARE reconstitution and reporter encapsulation was established. • The FRET pair reported opening of a large fusion pore bigger than 5
Kinase gene fusions in defined subsets of melanoma.
Turner, Jacqueline; Couts, Kasey; Sheren, Jamie; Saichaemchan, Siriwimon; Ariyawutyakorn, Witthawat; Avolio, Izabela; Cabral, Ethan; Glogowska, Magdelena; Amato, Carol; Robinson, Steven; Hintzsche, Jennifer; Applegate, Allison; Seelenfreund, Eric; Gonzalez, Rita; Wells, Keith; Bagby, Stacey; Tentler, John; Tan, Aik-Choon; Wisell, Joshua; Varella-Garcia, Marileila; Robinson, William
2017-01-01
Genomic rearrangements resulting in activating kinase fusions have been increasingly described in a number of cancers including malignant melanoma, but their frequency in specific melanoma subtypes has not been reported. We used break-apart fluorescence in situ hybridization (FISH) to identify genomic rearrangements in tissues from 59 patients with various types of malignant melanoma including acral lentiginous, mucosal, superficial spreading, and nodular. We identified four genomic rearrangements involving the genes BRAF, RET, and ROS1. Of these, three were confirmed by Immunohistochemistry (IHC) or sequencing and one was found to be an ARMC10-BRAF fusion that has not been previously reported in melanoma. These fusions occurred in different subtypes of melanoma but all in tumors lacking known driver mutations. Our data suggest gene fusions are more common than previously thought and should be further explored particularly in melanomas lacking known driver mutations. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Ureter Injury as a Complication of Oblique Lumbar Interbody Fusion.
Lee, Hyeong-Jin; Kim, Jin-Sung; Ryu, Kyeong-Sik; Park, Choon Keun
2017-06-01
Oblique lumbar interbody fusion is a commonly used surgical method of achieving lumbar interbody fusion. There have been some reports about complications of oblique lumbar interbody fusion at the L2-L3 level. However, to our knowledge, there have been no reports about ureter injury during oblique lumbar interbody fusion. We report a case of ureter injury during oblique lumbar interbody fusion to share our experience. A 78-year-old male patient presented with a history of lower back pain and neurogenic intermittent claudication. He was diagnosed with spinal stenosis at L2-L3, L4-L5 level and spondylolisthesis at L4-L5 level. Symptoms were not improved after several months of medical treatments. Then, oblique lumbar interbody fusion was performed at L2-L3, L4-L5 level. During the surgery, anesthesiologist noticed hematuria. A retrourethrogram was performed immediately by urologist, and ureter injury was found. Ureteroureterostomy and double-J catheter insertion were performed. The patient was discharged 2 weeks after surgery without urologic or neurologic complications. At 2 months after surgery, an intravenous pyelogram was performed, which showed an intact ureter. Our study shows that a low threshold of suspicion of ureter injury and careful manipulation of retroperitoneal fat can be helpful to prevent ureter injury during oblique lumbar interbody fusion at the upper level. Copyright © 2017 Elsevier Inc. All rights reserved.
Nuclear Fusion Award 2009 speech Nuclear Fusion Award 2009 speech
NASA Astrophysics Data System (ADS)
Sabbagh, Steven Anthony
2011-01-01
of Dr Todd Evans, another significant mentor of mine, as winner of this prestigious award? Then, it happened. The paper covers several key topics related to high beta tokamak physics. For me, the greatest satisfaction in receiving this award is because it was the first Nuclear Fusion Award to recognize research on the National Spherical Torus Experiment (NSTX) located at the Princeton Plasma Physics Laboratory. The achievement of record stability parameters in a mega-Ampere class spherical torus (ST) device reported in the paper represents a multi-year effort, contributed to by the entire research team. Research to maintain such plasmas for an indefinite period continues today. Understanding RWM stabilization physics is crucial for this goal, and leveraging the high beta ST operating space uniquely tests theory for application to future STs and to tokamaks in general, including advanced operational scenarios of ITER. For instance, the RWM was found to have significant amplitude in components with the toroidal mode number greater than unity. This has important implications for general active RWM control. Evidence that the RWM passive stabilization physics and marginal stability criterion are indeed more complex than originally thought was shown in this paper. Present work shows the greater complexity has a direct impact on how we should extrapolate RWM stabilization to future devices. The paper also reported the qualitative observation of neoclassical toroidal viscosity (NTV), followed by a companion paper by our group in 2006 reporting the quantitative observation of this effect and comparison to theory. The physics of this interesting and important phenomenon was introduced to me by Professor J. Callen (who has given an overview talk at this conference including this subject) and Professor Kerchung Shaing of the University of Wisconsin, to whom I am quite indebted. The paper also reported the first measurement of resonant field amplification at high beta in the NSTX
Final Technical Report for "Nuclear Technologies for Near Term Fusion Devices"
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wilson, Paul P.H.; Sawan, Mohamed E.; Davis, Andrew
Over approximately 18 years, this project evolved to focus on a number of related topics, all tied to the nuclear analysis of fusion energy systems. For the earliest years, the University of Wisconsin (UW)’s effort was in support of the Advanced Power Extraction (APEX) study to investigate high power density first wall and blanket systems. A variety of design concepts were studied before this study gave way to a design effort for a US Test Blanket Module (TBM) to be installed in ITER. Simultaneous to this TBM project, nuclear analysis supported the conceptual design of a number of fusion nuclearmore » science facilities that might fill a role in the path to fusion energy. Beginning in approximately 2005, this project added a component focused on the development of novel radiation transport software capability in support of the above nuclear analysis needs. Specifically, a clear need was identified to support neutron and photon transport on the complex geometries associated with Computer-Aided Design (CAD). Following the initial development of the Direct Accelerated Geoemtry Monte Carlo (DAGMC) capability, additional features were added, including unstructured mesh tallies and multi-physics analysis such as the Rigorous 2-Step (R2S) methodology for Shutdown Dose Rate (SDR) prediction. Throughout the project, there were also smaller tasks in support of the fusion materials community and for the testing of changes to the nuclear data that is fundamental to this kind of nuclear analysis.« less
Export of the Virulence Factors from Shigella Flexneri and Characterization of the mxi loci
1992-07-20
steps in Shigella pathogenesis. To identify temperature-regulated virulence genes on the plasmid, lacZ protein fusions were randomly generated in S ...this locus conferred the Mxi- phenotype and was found to affect virulence of S . flexneri at the level of invasion, which correlated with reduced...excretion of IpaC. Protease protection experiments indicated the presence of high intracellular reservoirs of Ipa proteins in wild-type S . flexneri as
Krishnan, Kartik G; Müller, Adolf
2002-04-01
Reconstruction of the cervical spine using free vascularized bone flaps has been described in the literature. The reports involve either one level or, when multiple levels, they describe en bloc resection and reconstruction. Stabilization of different levels with a preserved intermediate segment with a single vascularized flap has not been described. We report on the case of a 55-year-old man, who had been operated several times using conventional techniques for cervical myelopathy and instability, who presented to us with severe neck pain. Diagnostic procedures showed pseudarthrosis of C3/4 and stress-overload of the C3/4 and C5/6 segments. The C4/5 fusion was adequately rigid, but avascular. We performed anterior cervical fusion at the C3/4 and C5/6 levels with a vascularized fibula flap modified as a double island. The rigidly fused C4/5 block was preserved and vascularized with the periosteum bridging the two fibular islands. The method and technique are described in detail. Fusion was adequate. Donor site morbidity was minimal and temporary. The patient is symptom free to date (25 months). The suggested method provides the possibility of vertebral fusion at different levels using a single vascularized flap. The indications for this procedure are (1) repeated failure of conventional methods, (2) established poor bone healing and bone non-union with avascular grafts and (3) a well-fused or preserved intermediate segment. The relevant literature is reviewed.
Lu, Yifei; Yan, Hongxiang; Deng, Jiezhong; Huang, Zhigang; Jin, Xurui; Yu, Yanlan; Hu, Qiwen; Hu, Fuquan; Wang, Jing
2017-09-18
Lactococcus lactis is a food grade probiotics and widely used to express heterologous proteins. Generally, target genes are knocked into the L. lactis genome through double-crossover recombination to express heterologous proteins stably. However, creating marker-less heterologous genes knocked-in clones is laborious. In this study, an efficient heterologous gene knock-in reporter system was developed in L. lactis NZ9000. Our knock-in reporter system consists of a temperature-sensitive plasmid pJW and a recombinant L. lactis strain named NZB. The pJW contains homologous arms, and was constructed to knock-in heterologous genes at a fixed locus of NZ9000 genome. lacZ (β-galactosidase) gene was knocked into the chromosome of NZ9000 as a counter-selective marker through the plasmid pJW to generate NZB. The engineered NZB strain formed blue colonies on X-Gal plate. The desired double-crossover mutants formed white colonies distinctive from the predominantly blue colonies (parental and plasmid-integrated clones) when the embedded lacZ was replaced with the target heterologous genes carried by pJW in NZB. By using the system, the heterologous gene knocked-in clones are screened by colony phenotype change rather than by checking colonies individually. Our new knock-in reporter system provides an efficient method to create heterologous genes knocked-in clones.
Pulmonary inflammatory myofibroblastic tumor harboring EML4-ALK fusion gene.
Sokai, Akihiko; Enaka, Makiko; Sokai, Risa; Mori, Shoichi; Mori, Shunsuke; Gunji, Masaharu; Fujino, Masahiko; Ito, Masafumi
2014-01-01
Inflammatory myofibroblastic tumor is a rare tumor deriving from mesenchymal tissue. Approximately 50% of inflammatory myofibroblastic tumors harbor an anaplastic lymphoma kinase fusion gene. Pulmonary inflammatory myofibroblastic tumors harboring tropomyosin3-anaplastic lymphoma kinase or protein tyrosine phosphatase receptor-type F polypeptide-interacting protein-binding protein 1-anaplastic lymphoma kinase have been reported previously. However, it has not been reported that inflammatory myofibroblastic tumors harbor echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase fusion gene which is considered to be very specific to lung cancers. A few tumors harboring echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase fusion gene other than lung cancers have been reported and the tumors were all carcinomas. A 67-year-old man had been followed up for a benign tumor for approximately 3 years before the tumor demonstrated malignant transformation. Lobectomy and autopsy revealed that an inflammatory myofibroblastic tumor harboring echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase fusion gene had transformed into an undifferentiated sarcoma. This case suggests that echinoderm microtubule-associated protein-like 4-anaplastic lymphoma kinase fusion is an oncogenic event in not only carcinomas but also sarcomas originating from stromal cells.
RET fusion as a novel driver of medullary thyroid carcinoma.
Grubbs, Elizabeth G; Ng, Patrick Kwok-Shing; Bui, Jacquelin; Busaidy, Naifa L; Chen, Ken; Lee, Jeffrey E; Lu, Xinyan; Lu, Hengyu; Meric-Bernstam, Funda; Mills, Gordon B; Palmer, Gary; Perrier, Nancy D; Scott, Kenneth L; Shaw, Kenna R; Waguespack, Steven G; Williams, Michelle D; Yelensky, Roman; Cote, Gilbert J
2015-03-01
Oncogenic RET tyrosine kinase gene fusions and activating mutations have recently been identified in lung cancers, prompting initiation of targeted therapy trials in this disease. Although RET point mutation has been identified as a driver of tumorigenesis in medullary thyroid carcinoma (MTC), no fusions have been described to date. We evaluated the role of RET fusion as an oncogenic driver in MTC. We describe a patient who died from aggressive sporadic MTC < 10 months after diagnosis. Her tumor was evaluated by means of next-generation sequencing, including an intronic capture strategy. A reciprocal translocation involving RET intron 12 was identified. The fusion was validated using a targeted break apart fluorescence in situ hybridization probe, and RNA sequencing confirmed the existence of an in-frame fusion transcript joining MYH13 exon 35 with RET exon 12. Ectopic expression of fusion product in a murine Ba/F3 cell reporter model established strong oncogenicity. Three tyrosine kinase inhibitors currently used to treat MTC in clinical practice blocked tumorigenic cell growth. This finding represents the report of a novel RET fusion, the first of its kind described in MTC. The finding of this potential novel oncogenic mechanism has clear implications for sporadic MTC, which in the majority of cases has no driver mutation identified. The presence of a RET fusion also provides a plausible target for RET tyrosine kinase inhibitor therapies.
Parajón, Avelino; Alimi, Marjan; Navarro-Ramirez, Rodrigo; Christos, Paul; Torres-Campa, Jose M; Moriguchi, Yu; Lang, Gernot; Härtl, Roger
2017-12-01
Minimally invasive transforaminal lumbar interbody fusion (MIS-TLIF) is an increasingly popular procedure with several potential advantages over traditional open TLIF. The current study aimed to compare fusion rates of different graft materials used in MIS-TLIF, via meta-analysis of the published literature. A Medline search was performed and a database was created including patient's type of graft, clinical outcome, fusion rate, fusion assessment modality, and duration of follow-up. Meta-analysis of the fusion rate was performed using StatsDirect software (StatsDirect Ltd, Cheshire, United Kingdom). A total of 1533 patients from 40 series were included. Fusion rates were high, ranging from 91.8% to 99%. The imaging modalities used to assess fusion were computed tomography scans (30%) and X-rays (70%). Comparison of all recombinant human bone morphogenetic protein (rhBMP) series with all non-rhBMP series showed fusion rates of 96.6% and 92.5%, respectively. The lowest fusion rate was seen with isolated use of autologous local bone (91.8%). The highest fusion rate was observed with combination of autologous local bone with bone extender and rhBMP (99.1%). The highest fusion rate without the use of BMP was seen with autologous local bone + bone extender (93.1%). The reported complication rate ranged from 0% to 35.71%. Clinical improvement was observed in all studies. Fusion rates are generally high with MIS-TLIF regardless of the graft material used. Given the potential complications of iliac bone harvesting and rhBMP, use of other bone graft options for MIS-TLIF is reasonable. The highest fusion rate without the use of rhBMP was seen with autologous local bone plus bone extender (93.1%). Published by Oxford University Press on behalf of Congress of Neurological Surgeons 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Bharatan, Shanti M; Reddy, Manjula; Gowrishankar, J
2004-01-01
A conditional lethal galE(Ts)-based strategy was employed in Escherichia coli, first to eliminate all growth-associated chromosomal reversions in lacZ or forward mutations in lacI/lacO by incubation at the restrictive temperature and subsequently to recover (as papillae) spontaneous mutations that had arisen in the population of nondividing cells after shift to the permissive temperature. Data from lacZ reversion studies in mutator strains indicated that the products of all genes for mismatch repair (mutHLS, dam, uvrD), of some for oxidative damage repair (mutMT), and of that for polymerase proofreading (dnaQ) are required in dividing cells; some others for oxidative damage repair (mutY, nth nei) are required in both dividing and nondividing cells; and those for alkylation damage repair (ada ogt) are required in nondividing cells. The spectrum of lacI/lacO mutations in nondividing cells was distinguished both by lower frequencies of deletions and IS1 insertions and by the unique occurrence of GC-to-AT transitions at lacO +5. In the second approach to study mutations that had occurred in nondividing cells, lacI/lacO mutants were selected as late-arising papillae from the lawn of a galE+ strain; once again, transitions at lacO +5 were detected among the mutants that had been obtained from populations initially grown on poor carbon sources such as acetate, palmitate, or succinate. Our results indicate that the lacO +5 site is mutable only in nondividing cells, one possible mechanism for which might be that random endogenous alkylation (or oxidative) damage to DNA in these cells is efficiently corrected by the Ada Ogt (or Nth Nei) repair enzymes at most sites but not at lacO +5. Furthermore, the late-arising papillae from the second approach were composed almost exclusively of dominant lacI/lacO mutants. This finding lends support to "instantaneous gratification" models in which a spontaneous lesion, occurring at a random site in DNA of a nondividing cell, is most
Painful lumbosacral melorheostosis treated by fusion.
Robertson, Peter A; Don, Angus S; Miller, Mary V
2003-06-15
A case report of low back pain associated with a diagnosis of melorheostosis of the lumbosacral spine. To describe a rare presentation of melorheostosis and subsequent successful surgical treatment. Melorheostosis is a rare condition and spinal pain has not been described in association with the condition. A patient with disabling low back pain and suspected melorheostosis of the lumbosacral spine responded favorably to diagnostic facet joint blocks. Treatment was lumbosacral fusion and biopsy of the abnormal bone. The densely sclerotic bone presented technical difficulties requiring modification of surgical technique. Dramatic pain and disability reduction occurred following lumbosacral fusion. Histologic examination was consistent with melorheostosis. Melorheostosis rarely causes severe low back pain that can respond favorably to fusion surgery.
High Level Information Fusion (HLIF) with nested fusion loops
NASA Astrophysics Data System (ADS)
Woodley, Robert; Gosnell, Michael; Fischer, Amber
2013-05-01
Situation modeling and threat prediction require higher levels of data fusion in order to provide actionable information. Beyond the sensor data and sources the analyst has access to, the use of out-sourced and re-sourced data is becoming common. Through the years, some common frameworks have emerged for dealing with information fusion—perhaps the most ubiquitous being the JDL Data Fusion Group and their initial 4-level data fusion model. Since these initial developments, numerous models of information fusion have emerged, hoping to better capture the human-centric process of data analyses within a machine-centric framework. 21st Century Systems, Inc. has developed Fusion with Uncertainty Reasoning using Nested Assessment Characterizer Elements (FURNACE) to address challenges of high level information fusion and handle bias, ambiguity, and uncertainty (BAU) for Situation Modeling, Threat Modeling, and Threat Prediction. It combines JDL fusion levels with nested fusion loops and state-of-the-art data reasoning. Initial research has shown that FURNACE is able to reduce BAU and improve the fusion process by allowing high level information fusion (HLIF) to affect lower levels without the double counting of information or other biasing issues. The initial FURNACE project was focused on the underlying algorithms to produce a fusion system able to handle BAU and repurposed data in a cohesive manner. FURNACE supports analyst's efforts to develop situation models, threat models, and threat predictions to increase situational awareness of the battlespace. FURNACE will not only revolutionize the military intelligence realm, but also benefit the larger homeland defense, law enforcement, and business intelligence markets.
Revisions to the JDL data fusion model
NASA Astrophysics Data System (ADS)
Steinberg, Alan N.; Bowman, Christopher L.; White, Franklin E.
1999-03-01
The Data Fusion Model maintained by the Joint Directors of Laboratories (JDL) Data Fusion Group is the most widely-used method for categorizing data fusion-related functions. This paper discusses the current effort to revise the expand this model to facilitate the cost-effective development, acquisition, integration and operation of multi- sensor/multi-source systems. Data fusion involves combining information - in the broadest sense - to estimate or predict the state of some aspect of the universe. These may be represented in terms of attributive and relational states. If the job is to estimate the state of a people, it can be useful to include consideration of informational and perceptual states in addition to the physical state. Developing cost-effective multi-source information systems requires a method for specifying data fusion processing and control functions, interfaces, and associate databases. The lack of common engineering standards for data fusion systems has been a major impediment to integration and re-use of available technology: current developments do not lend themselves to objective evaluation, comparison or re-use. This paper reports on proposed revisions and expansions of the JDL Data FUsion model to remedy some of these deficiencies. This involves broadening the functional model and related taxonomy beyond the original military focus, and integrating the Data Fusion Tree Architecture model for system description, design and development.
Di Silvestre, Mario; Lolli, Francesco; Bakaloudis, Georgios
2014-01-01
Posterolateral fusion with pedicle screw instrumentation is currently the most widely accepted technique for degenerative lumbar scoliosis in elderly patients. However, a high incidence of complications has been reported in most series. Dynamic stabilization without fusion in patients older than 60 years has not previously been compared with the use of posterior fusion in degenerative lumbar scoliosis. To compare dynamic stabilization without fusion and posterior instrumented fusion in the treatment of degenerative lumbar scoliosis in elderly patients, in terms of perioperative findings, clinical outcomes, and adverse events. A retrospective study. Fifty-seven elderly patients were included. There were 45 women (78%) and 12 men (22%) with a mean age of 68.1 years (range, 61-78 years). All patients had degenerative de novo lumbar scoliosis, associated with vertebral canal stenosis in 51 cases (89.4%) and degenerative spondylolisthesis in 24 patients (42.1%). Clinical (Oswestry Disability Index, visual analog scale, Roland-Morris Disability Questionnaire) and radiological (scoliosis and lordosis corrections) outcomes as well as incidence of complications. Patients were divided into two groups: 32 patients (dynamic group) had dynamic stabilization without fusion and 25 patients (fusion group) underwent posterior instrumented fusion. All the patients' medical records and X-rays were reviewed. Preoperative, postoperative, and follow-up questionnaires were obtained to evaluate clinical outcomes. At an average follow-up of 64 months (range, 42-90 months), clinical results improved similarly in both groups of patients. Statistically superior scoliosis and final lordosis corrections were achieved with posterior fusion (56.9% vs. 37.3% and -46.8° vs. -35.8°, respectively). However, in the dynamic group, incidence of overall complications was lower (25% vs. 44%), and fewer patients required revision surgery (6.2% vs. 16%). Furthermore, lower average values of operative
Improved Controls for Fusion RF Systems. Final technical report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Casey, Jeffrey A.
2011-11-08
We have addressed the specific requirements for the integrated systems controlling an array of klystrons used for Lower Hybrid Current Drive (LHCD). The immediate goal for our design was to modernize the transmitter protection system (TPS) for LHCD on the Alcator C-Mod tokamak at the MIT Plasma Science and Fusion Center (MIT-PSFC). Working with the Alcator C-Mod team, we have upgraded the design of these controls to retrofit for improvements in performance and safety, as well as to facilitate the upcoming expansion from 12 to 16 klystrons. The longer range goals to generalize the designs in such a way thatmore » they will be of benefit to other programs within the international fusion effort was met by designing a system which was flexible enough to address all the MIT system requirements, and modular enough to adapt to a large variety of other requirements with minimal reconfiguration.« less
Processing and Fusion of Electro-Optic Information
2001-04-01
UNCLASSIFIED Defense Technical Information Center Compilation Part Notice ADP010886 TITLE: Processing and Fusion of Electro - Optic Information...component part numbers comprise the compilation report: ADP010865 thru ADP010894 UNCLASSIFIED 21-1 Processing and Fusion of Electro - Optic Information I...additional electro - optic (EO) sensor model within OOPSDG. It describes TM IT TT T T T performance estimates found prior to producing the New Ne- New
Bubble fusion: Preliminary estimates
DOE Office of Scientific and Technical Information (OSTI.GOV)
Krakowski, R.A.
1995-02-01
The collapse of a gas-filled bubble in disequilibrium (i.e., internal pressure {much_lt} external pressure) can occur with a significant focusing of energy onto the entrapped gas in the form of pressure-volume work and/or acoustical shocks; the resulting heating can be sufficient to cause ionization and the emission of atomic radiations. The suggestion that extreme conditions necessary for thermonuclear fusion to occur may be possible has been examined parametrically in terms of the ratio of initial bubble pressure relative to that required for equilibrium. In this sense, the disequilibrium bubble is viewed as a three-dimensional ``sling shot`` that is ``loaded`` tomore » an extent allowed by the maximum level of disequilibrium that can stably be achieved. Values of this disequilibrium ratio in the range 10{sup {minus}5}--10{sup {minus}6} are predicted by an idealized bubble-dynamics model as necessary to achieve conditions where nuclear fusion of deuterium-tritium might be observed. Harmonic and aharmonic pressurizations/decompressions are examined as means to achieve the required levels of disequilibrium required to create fusion conditions. A number of phenomena not included in the analysis reported herein could enhance or reduce the small levels of nuclear fusions predicted.« less
A Summary of the NASA Fusion Propulsion Workshop 2000
NASA Technical Reports Server (NTRS)
Thio, Y. C. Francis; Turchi, Peter J.; Santarius, John F.; Schafer, Charles (Technical Monitor)
2001-01-01
A NASA Fusion Propulsion Workshop was held on Nov. 8 and 9, 2000 at Marshall Space Flight Center (MSFC) in Huntsville, Alabama. A total of 43 papers were presented at the Workshop orally or by posters, covering a broad spectrum of issues related to applying fusion to propulsion. The status of fusion research was reported at the Workshop showing the outstanding scientific research that has been accomplished worldwide in the fusion energy research program. The international fusion research community has demonstrated the scientific principles of fusion creating plasmas with conditions for fusion burn with a gain of order unity: 0.25 in Princeton TFTR, 0.65 in the Joint European Torus, and a Q-equivalent of 1.25 in Japan's JT-60. This research has developed an impressive range of physics and technological capabilities that may be applied effectively to the research of possibly new propulsion-oriented fusion schemes. The pertinent physics capabilities include the plasma computational tools, the experimental plasma facilities, the diagnostics techniques, and the theoretical understanding. The enabling technologies include the various plasma heating, acceleration, and the pulsed power technologies.
Onçag, Ozant; Candan, Umit; Arikan, Fatih
2005-08-01
The term fusion is used to define a developmental anomaly characterised by the union of two adjacent teeth. In the case reported here, clinical and radiographic examinations suggested a unilateral fusion between the mandibular left permanent incisor and a super-numerary tooth. Radiographs showed that the fused teeth had two distinct pulp chambers and canals. A diagnosis of chronic periapical abscess of the supernumerary tooth was made. Before root canal therapy, a periodontal surgical procedure was performed to section the central incisor and its fused supernumerary. Also, odontoplasty was performed on the roots, to establish an anatomy consistent with a normal central incisor. Later, the chronic apical abscess on the supernumerary tooth was instrumented chemo-mechanically, root canal filling was performed and an anterior composite resin restoration was placed. The patient was evaluated for one year after root canal therapy. The tooth was asymptomatic, not exhibiting any pathological root resorption or alveolar resorption, and the anterior composite restoration was intact. Instead of extracting the supernumerary tooth, the application of endodontic, periodontal, and restorative procedures proved to be an alternative treatment.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moir, R.W.
1982-02-22
The fusion breeder is a fusion reactor designed with special blankets to maximize the transmutation by 14 MeV neutrons of uranium-238 to plutonium or thorium to uranium-233 for use as a fuel for fission reactors. Breeding fissile fuels has not been a goal of the US fusion energy program. This paper suggests it is time for a policy change to make the fusion breeder a goal of the US fusion program and the US nuclear energy program. The purpose of this paper is to suggest this policy change be made and tell why it should be made, and to outlinemore » specific research and development goals so that the fusion breeder will be developed in time to meet fissile fuel needs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moir, R.W.
1982-04-20
The fusion breeder is a fusion reactor designed with special blankets to maximize the transmutation by 14 MeV neutrons of uranium-238 to plutonium or thorium to uranium-233 for use as a fuel for fission reactors. Breeding fissile fuels has not been a goal of the US fusion energy program. This paper suggests it is time for a policy change to make the fusion breeder a goal of the US fusion program and the US nuclear energy program. The purpose of this paper is to suggest this policy change be made and tell why it should be made, and to outlinemore » specific research and development goals so that the fusion breeder will be developed in time to meet fissile fuel needs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Harrison, Stephen C., E-mail: harrison@crystal.harvard.edu
2015-05-15
Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formedmore » draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism.« less
Tao, Youping; Wu, Jigong; Ma, Huasong; Zhang, Lele; Shao, Shuilin; Si, Zebing; Gao, Bo; Ji, Yong; Li, Haixia; Tao, Feifei
2015-07-01
Case report. To investigate the safety and efficacy of posterior vertebral column resection for severe and rigid spinal deformity associated with neurological deficit after implant removal following posterior instrumented fusion. Loss of correction after implant removal in patients with posterior instrumented fusion has been previously reported. However, to our knowledge, posterior vertebral column resection (PVCR) for severe and rigid spinal deformity associated with neurological deficit after implant removal following posterior instrumented fusion has not been reported. An 18-year-old female with severe and rigid spinal deformity associated with neurological deficit was classified as Frankel C, according to the Frankel grading system. She underwent posterior spinal fusion with pedicle screw fixation at 16 years, and her implants were removed after 1 year due to back pain. Seven months after removal of the implants, she began to experience weakness in her lower limbs but did not seek any treatment. She was unable to stand and had to use a wheelchair. The patient successfully underwent PVCR and posterior reinstrumentation. Within 3 months, her neurological status improved to Frankel E. The patient had no neurological deterioration and infections. There was no instrumentation failure and loosening correction at the 32 months follow-up. Our results suggest that PVCR and pedicle screw fixation is a safe and efficacious option for severe and rigid spinal deformity associated with neurological deficit after implant removal following posterior instrumented fusion. N/A.
Effects of ROCK inhibitor Y-27632 on cell fusion through a microslit.
Wada, Ken-Ichi; Hosokawa, Kazuo; Ito, Yoshihiro; Maeda, Mizuo
2015-11-01
We previously reported a direct cytoplasmic transfer method using a microfluidic device, in which cell fusion was induced through a microslit (slit-through-fusion) by the Sendai virus envelope (HVJ-E) to prevent nuclear mixing. However, the method was impractical due to low efficiency of slit-through-fusion formation and insufficient prevention of nuclear mixing. The purpose of this study was to establish an efficient method for inducing slit-through-fusion without nuclear mixing. We hypothesized that modulation of cytoskeletal component can decrease nuclear migration through the microslit considering its functions. Here we report that supplementation with Y-27632, a specific ROCK inhibitor, significantly enhances cell fusion induction and prevention of nuclear mixing. Supplementation with Y-27632 increased the formation of slit-through-fusion efficiency by more than twofold. Disruption of F-actin by Y-27632 prevented nuclear migration between fused cells through the microslit. These two effects of Y-27632 led to promotion of the slit-through-fusion without nuclear mixing with a 16.5-fold higher frequency compared to our previous method (i.e., cell fusion induction by HVJ-E without supplementation with Y-27632). We also confirmed that mitochondria were successfully transferred to the fusion partner under conditions of Y-27632 supplementation. These findings demonstrate the practicality of our cell fusion system in producing direct cytoplasmic transfer between live cells. © 2015 Wiley Periodicals, Inc.
Paramyxovirus fusion: Real-time measurement of parainfluenza virus 5 virus-cell fusion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Connolly, Sarah A.; Lamb, Robert A.
2006-11-25
Although cell-cell fusion assays are useful surrogate methods for studying virus fusion, differences between cell-cell and virus-cell fusion exist. To examine paramyxovirus fusion in real time, we labeled viruses with fluorescent lipid probes and monitored virus-cell fusion by fluorimetry. Two parainfluenza virus 5 (PIV5) isolates (W3A and SER) and PIV5 containing mutations within the fusion protein (F) were studied. Fusion was specific and temperature-dependent. Compared to many low pH-dependent viruses, the kinetics of PIV5 fusion was slow, approaching completion within several minutes. As predicted from cell-cell fusion assays, virus containing an F protein with an extended cytoplasmic tail (rSV5 F551)more » had reduced fusion compared to wild-type virus (W3A). In contrast, virus-cell fusion for SER occurred at near wild-type levels, despite the fact that this isolate exhibits a severely reduced cell-cell fusion phenotype. These results support the notion that virus-cell and cell-cell fusion have significant differences.« less
Gundanna, Mukund I.; Miller, Larry E.; Block, Jon E.
2011-01-01
Background Open and minimally invasive lumbar fusion procedures have inherent procedural risks, with posterior and transforaminal approaches resulting in significant soft-tissue injury and the anterior approach endangering organs and major blood vessels. An alternative lumbar fusion technique uses a small paracoccygeal incision and a presacral approach to the L5-S1 intervertebral space, which avoids critical structures and may result in a favorable safety profile versus open and other minimally invasive fusion techniques. The purpose of this study was to evaluate complications associated with axial interbody lumbar fusion procedures using the Axial Lumbar Interbody Fusion (AxiaLIF) System (TranS1, Wilmington, North Carolina) in the postmarketing period. Methods Between March 2005 and March 2010, 9,152 patients underwent interbody fusion with the AxiaLIF System through an axial presacral approach. A single-level L5-S1 fusion was performed in 8,034 patients (88%), and a 2-level (L4-S1) fusion was used in 1,118 (12%). A predefined database was designed to record device- or procedure-related complaints via spontaneous reporting. The complications that were recorded included bowel injury, superficial wound and systemic infections, transient intraoperative hypotension, migration, subsidence, presacral hematoma, sacral fracture, vascular injury, nerve injury, and ureter injury. Results Complications were reported in 120 of 9,152 patients (1.3%). The most commonly reported complications were bowel injury (n = 59, 0.6%) and transient intraoperative hypotension (n = 20, 0.2%). The overall complication rate was similar between single-level (n = 102, 1.3%) and 2-level (n = 18, 1.6%) fusion procedures, with no significant differences noted for any single complication. Conclusions The 5-year postmarketing surveillance experience with the AxiaLIF System suggests that axial interbody lumbar fusion through the presacral approach is associated with a low incidence of complications
Arnold, Michael A; Anderson, James R; Gastier-Foster, Julie M; Barr, Frederic G; Skapek, Stephen X; Hawkins, Douglas S; Raney, R Beverly; Parham, David M; Teot, Lisa A; Rudzinski, Erin R; Walterhouse, David O
2016-04-01
Distinguishing alveolar rhabdomyosarcoma (ARMS) from embryonal rhabdomyosarcoma (ERMS) is of prognostic and therapeutic importance. Criteria for classifying these entities evolved significantly from 1995 to 2013. ARMS is associated with inferior outcome; therefore, patients with alveolar histology have generally been excluded from low-risk therapy. However, patients with ARMS and low-risk stage and group (Stage 1, Group I/II/orbit III; or Stage 2/3, Group I/II) were eligible for the Children's Oncology Group (COG) low-risk rhabdomyosarcoma (RMS) study D9602 from 1997 to 1999. The characteristics and outcomes of these patients have not been previously reported, and the histology of these cases has not been reviewed using current criteria. We re-reviewed cases that were classified as ARMS on D9602 using current histologic criteria, determined PAX3/PAX7-FOXO1 fusion status, and compared these data with outcome for this unique group of patients. Thirty-eight patients with ARMS were enrolled onto D9602. Only one-third of cases with slides available for re-review (11/33) remained classified as ARMS by current histologic criteria. Most cases were reclassified as ERMS (17/33, 51.5%). Cases that remained classified as ARMS were typically fusion-positive (8/11, 73%), therefore current classification results in a similar rate of fusion-positive ARMS for all clinical risk groups. In conjunction with data from COG intermediate-risk treatment protocol D9803, our data demonstrate excellent outcomes for fusion-negative ARMS with otherwise low-risk clinical features. Patients with fusion-positive RMS with low-risk clinical features should be classified and treated as intermediate risk, while patients with fusion-negative ARMS could be appropriately treated with reduced intensity therapy. © 2016 Wiley Periodicals, Inc.
Pseudogout of the cervical and thoracic spine mimicking infection after lumbar fusion: case report.
Bridges, Kelly J; Bullis, Carli L; Wanchu, Ajay; Than, Khoi D
2017-08-01
Pseudogout is a form of acute calcium pyrophosphate deposition (CPPD) disease that typically afflicts the elderly. CPPD commonly involves larger joints, such as the knees, wrists, shoulders, and hips, and has been known to involve the spine. The authors report the case of a 66-year-old woman with a recent history of lumbar laminectomy and fusion who presented 5 weeks postprocedure with a clinical and radiographic picture consistent with multilevel skip lesions involving the cervical and thoracic spine, thoracic discitis, and epidural abscess. Serial blood cultures and repeat biopsy samples were sterile. Subsequent wrist and ankle erythema, pain, and swelling led to synovial fluid analysis, and pseudogout was diagnosed. She was treated with an interleukin-1 inhibitor with immediate symptom relief. To the authors' knowledge, this is only the second report of spinal pseudogout presenting with a clinical and radiographic picture consistent with discitis and epidural abscess. This report is the first to report skip lesions of pseudogout occurring throughout the spine that are uniquely remote from a recent lumbar surgery.
Barrett-Tuck, Rebecca; Del Monaco, Diana
2017-01-01
Background Surgical interventions such as posterior lumbar interbody fusion (PLIF) with and without posterior instrumentation are often employed in patients with degenerative spinal conditions that fail to respond to conservative medical management. The VariLift® Interbody Fusion System was developed as a stand-alone solution to provide the benefits of an intervertebral fusion device without the requirement of supplemental pedicle screw fixation. Methods In this retrospective case series, 25 patients underwent PLIF with a stand-alone VariLift® expandable interbody fusion device without adjunctive pedicle screw fixation. There were 12 men and 13 women, with a mean age of 57.2 years (range, 33–83 years); single level in 18 patients, 2 levels in 7 patients. Back pain severity was reported as none, mild, moderate, severe and worst imaginable at baseline, 6 and 12 months. Preoperatively, 88% (22 of 25) of patients reported severe back pain. Results All patients experienced symptomatic improvement and, by 12 months postoperatively, 71% (15 of 21) of patients reported only mild residual pain. Overall, pain scores improved significantly from baseline to 12 months (P=0.0002). There were no revision surgeries and fusion was achieved 12 of 13 patients (92%) who returned for a 12-month radiographic follow-up. There were three cases of intractable postsurgical pain which required extended hospitalization or pain management, one wound infection and one case of surgical site dehiscence, both treated and resolved during inpatient hospitalization. Conclusions In this single-physician case series, the VariLift® device used in single or two-level PLIF provided effective symptom relief and produced a high fusion rate without the need for supplemental fixation. PMID:28435912
Barrett-Tuck, Rebecca; Del Monaco, Diana; Block, Jon E
2017-03-01
Surgical interventions such as posterior lumbar interbody fusion (PLIF) with and without posterior instrumentation are often employed in patients with degenerative spinal conditions that fail to respond to conservative medical management. The VariLift ® Interbody Fusion System was developed as a stand-alone solution to provide the benefits of an intervertebral fusion device without the requirement of supplemental pedicle screw fixation. In this retrospective case series, 25 patients underwent PLIF with a stand-alone VariLift ® expandable interbody fusion device without adjunctive pedicle screw fixation. There were 12 men and 13 women, with a mean age of 57.2 years (range, 33-83 years); single level in 18 patients, 2 levels in 7 patients. Back pain severity was reported as none, mild, moderate, severe and worst imaginable at baseline, 6 and 12 months. Preoperatively, 88% (22 of 25) of patients reported severe back pain. All patients experienced symptomatic improvement and, by 12 months postoperatively, 71% (15 of 21) of patients reported only mild residual pain. Overall, pain scores improved significantly from baseline to 12 months (P=0.0002). There were no revision surgeries and fusion was achieved 12 of 13 patients (92%) who returned for a 12-month radiographic follow-up. There were three cases of intractable postsurgical pain which required extended hospitalization or pain management, one wound infection and one case of surgical site dehiscence, both treated and resolved during inpatient hospitalization. In this single-physician case series, the VariLift ® device used in single or two-level PLIF provided effective symptom relief and produced a high fusion rate without the need for supplemental fixation.
Marini, F C; Cannon, J P; Belmont, J W; Shillitoe, E J; Lapeyre, J N
1995-09-01
We evaluated the ability of a replication-deficient, recombinant adenoviral vector to transfer the bifunctional gene GAL-TEK, which expresses a marking/therapeutic gene product, to naturally occurring cat fibrosarcomas in situ. GAL-TEK contains an in-frame fusion of the bacterial LacZ gene for histochemical marking of tumors with beta-galactosidase (beta-Gal) and the HSV tk gene for enzyme-prodrug activation of the prodrug ganciclovir (GCV) to induce selective tumor cell killing. GAL-TEK bifunctional marking and cell killing activities were tested in vitro after adenoviral vector infection of HT1080 human fibrosarcoma cells. The tk activity of GAL-TEK is shown to be almost as potent as HSV tk to catalyze conversion of GCV to GCV nucleotides and promote selective cell killing. Using 8 cats with recurring 2.5-cm2 fibrosarcomas that either arose spontaneously or were induced by vaccine, we determined experimentally the administration routes and times required for optimum GAL-TEK gene transfer by beta-Gal histological staining and reverse transcriptase polymerase chain reaction to the multiple compartments of the growing fibrosarcomas consonant with minimizing collateral infection of neighboring tissues and other unwanted side effects.
Localization suppression and fusion measure of the precedence effect in young children
NASA Astrophysics Data System (ADS)
Litovsky, Ruth; Godar, Shelly; Yu, Gongqiang
2004-05-01
This study investigated aspects of the precedence effect (PE) known as fusion and localization dominance in children 4-5 years of age. Stimuli were three, 25-ms noise bursts (2-ms rise/fall times) with 250-ms ISI. On PE conditions the lead stimulus was presented from one of six locations in azimuth, and the lag was at 0 deg. Lead-lag delays varied from 5 to 100 ms. Localization was measured using an identification paradigm. Fusion was measured separately whereby subjects reported whether a single auditory event or two auditory events were perceived. Children reported two sounds on 75% of trials (fusion threshold) at delays ranging from 15 to 35 ms. Below fusion thresholds, the localization of the lead was similar to that of single-source stimuli. Above fusion thresholds lead localization was significantly degraded, persisting out to 100 ms. Localization of the lag was poor at all delays on which it was reported as being heard. According to these results localization dominance (difficulty localizing the lag) in children persists at greater delays than fusion, which is consistent with findings obtained in adult subjects. The range of delays over which these effects are robust in children is longer than the range observed in adults.
Knee arthrodesis with the Wichita Fusion Nail: an outcome comparison.
McQueen, D A; Cooke, F W; Hahn, D L
2006-05-01
The Wichita Fusion Nail (WFN) is a knee arthrodesis stabilization system that employs compression via an intramedullary rod. It was designed for use in the salvage of the irretrievably failed total knee arthroplasty and other severe knee pathologies. Questionnaires covering the fusion success rate, fusion time, and complication rate were obtained from 33 surgeons who were among the first to use the device. Data from these questionnaires were analyzed to determine if the rate of successful fusion was close to 100%, which was the primary hypothesis of this study. The average time required to achieve fusion and the rate of complications were also calculated and compared to similar results available in the literature. The results for 44 selected patients were included and it was determined that all achieved fusion for a success rate of 100%. This compared favorably with reported success rates in the range of 54% to 96%. The average fusion time was 15.5 weeks. Complications included: six delayed unions, three deep infections, and two periimplant fractures for a major complications rate of 20.4%. Both the fusion times and complication rate compared favorably with other reported results. Surgeons using the device for the first time had outcomes equal to those of more experienced users. Our results demonstrated that a rate of successful arthrodesis close to 100% could be consistently achieved with the WFN. Overall, the WFN facilitated an improved outcome for a previously difficult procedure. Therapeutic study, level IV (case series). See the Guidelines for Authors for a complete description of level of evidence.
Optically-Induced Cell Fusion on Cell Pairing Microstructures
NASA Astrophysics Data System (ADS)
Yang, Po-Fu; Wang, Chih-Hung; Lee, Gwo-Bin
2016-02-01
Cell fusion is a critical operation for numerous biomedical applications including cell reprogramming, hybridoma formation, cancer immunotherapy, and tissue regeneration. However, unstable cell contact and random cell pairings have limited efficiency and yields when utilizing traditional methods. Furthermore, it is challenging to selectively perform cell fusion within a group of cells. This study reports a new approach called optically-induced cell fusion (OICF), which integrates cell-pairing microstructures with an optically-induced, localized electrical field. By projecting light patterns onto a photoconductive film (hydrogen-rich, amorphous silicon) coated on an indium-tin-oxide (ITO) glass while an alternating current electrical field was applied between two such ITO glass slides, “virtual” electrodes could be generated that could selectively fuse pairing cells. At 10 kHz, a 57% cell paring rate and an 87% fusion efficiency were successfully achieved at a driving voltage of 20 Vpp, suggesting that this new technology could be promising for selective cell fusion within a group of cells.
Ectocranial suture fusion in primates: pattern and phylogeny.
Cray, James; Cooper, Gregory M; Mooney, Mark P; Siegel, Michael I
2014-03-01
Patterns of ectocranial suture fusion among Primates are subject to species-specific variation. In this study, we used Guttman Scaling to compare modal progression of ectocranial suture fusion among Hominidae (Homo, Pan, Gorilla, and Pongo), Hylobates, and Cercopithecidae (Macaca and Papio) groups. Our hypothesis is that suture fusion patterns should reflect their evolutionary relationship. For the lateral-anterior suture sites there appear to be three major patterns of fusion, one shared by Homo-Pan-Gorilla, anterior to posterior; one shared by Pongo and Hylobates, superior to inferior; and one shared by Cercopithecidae, posterior to anterior. For the vault suture pattern, the Hominidae groups reflect the known phylogeny. The data for Hylobates and Cercopithecidae groups is less clear. The vault suture site termination pattern of Papio is similar to that reported for Gorilla and Pongo. Thus, it may be that some suture sites are under larger genetic influence for patterns of fusion, while others are influenced by environmental/biomechanic influences. Copyright © 2013 Wiley Periodicals, Inc.
Selwood, T; Sinnott, M L
1990-06-01
1. Michaelis-Menten parameters for the hydrolysis of 4-nitrophenyl beta-D-galactopyranoside and 3,4-dinitrophenyl beta-D-galactopyranoside Escherichia coli (lacZ) beta-galactosidase were measured as a function of pH or pD (pL) in both 1H2O and 2H2O. 2. For hydrolysis of 4-nitrophenyl beta-D-galactopyranoside by Mg2(+)-free enzyme, V is pL-independent below pL 9, but the V/Km-pL profile is sigmoid, the pK values shifting from 7.6 +/- 0.1 in 1H2O to 8.2 +/- 0.1 in 2H2O, and solvent kinetic isotope effects are negligible, in accord with the proposal [Sinnott, Withers & Viratelle (1978) Biochem. J. 175, 539-546] that glycone-aglycone fission without acid catalysis governs both V and V/Km. 3. V for hydrolysis of 4-nitrophenyl beta-D-galactopyranoside by Mg2(+)-enzyme varies sigmoidally with pL, the pK value shifting from 9.19 +/- 0.09 to 9.70 +/- 0.07; V/Km shows both a low-pL fall, probably due to competition between Mg2+ and protons [Tenu, Viratelle, Garnier & Yon (1971) Eur. J. Biochem. 20, 363-370], and a high-pL fall, governed by a pK that shifts from 8.33 +/- 0.08 to 8.83 +/- 0.08. There is a negligible solvent kinetic isotope effect on V/Km, but one of 1.7 on V, which a linear proton inventory shows to arise from one transferred proton. 4. The variation of V and V/Km with pL is sigmoid for hydrolysis of 3,4-dinitrophenyl beta-D-galactopyranoside by Mg2(+)-enzyme, with pK values showing small shifts, from 8.78 +/- 0.09 to 8.65 +/- 0.08 and from 8.7 +/- 0.1 to 8.9 +/- 0.1 respectively. There is no solvent isotope effect on V or V/Km for 3,4-dinitrophenyl beta-D-galactopyranoside, despite hydrolysis of the galactosyl-enzyme intermediate governing V. 5. Identification of the 'conformation change' in the hydrolysis of aryl galactosides proposed by Sinnott & Souchard [(1973) Biochem. J. 133, 89-98] with the protolysis of the magnesium phenoxide arising from the action of enzyme-bound Mg2+ as an electrophilic catalyst rationalizes these data and also resolves the
Minimally invasive surgery: lateral approach interbody fusion: results and review.
Youssef, Jim A; McAfee, Paul C; Patty, Catherine A; Raley, Erin; DeBauche, Spencer; Shucosky, Erin; Chotikul, Liana
2010-12-15
A retrospective review of patients treated at 2 institutions with anterior lumbar interbody fusion using a minimally invasive lateral retroperitoneal approach, and review of literature. To analyze the outcomes from historical literature and from a retrospectively compiled database of patients having undergone anterior interbody fusions performed through a lateral approach. A paucity of published literature exists describing outcomes following lateral approach fusion surgery. Patients treated with extreme lateral interbody fusion (XLIF) were identified through retrospective chart review. Treatment variables included operating room (OR) time, estimated blood loss (EBL), length of hospital stay (LOS), complications, and fusion rate. A literature review, using the National Center for Biotechnology Information databases PubMed/MEDLINE and Google Scholar, yielded 14 peer-reviewed articles reporting outcomes scoring, complications, fusion status, long-term follow-up, and radiographic assessments related to XLIF. Published XLIF results were summarized and evaluated with current study data. A total of 84 XLIF patients were included in the current cohort analysis. OR time, EBL, and length of hospital stay averaged 199 minutes, 155 mL, and 2.6 days, respectively, and perioperative and postoperative complication rates were 2.4% and 6.1%. Mean follow-up was 15.7 months. Sixty-eight patients showed evidence of solid arthrodesis and no subsidence on computed tomography and flexion/extension radiographs. Results were within the ranges of those in the literature. Literature review identified reports of significant improvements in clinical outcomes scores, radiographic measures, and cost effectiveness. Current data corroborates and contributes to the existing body of literature describing XLIF outcomes. Procedures are generally performed with short OR times, minimal EBL, and few complications. Patients recover quickly, requiring minimal hospital stay, although transient hip
Rudzinski, Erin R; Anderson, James R; Chi, Yueh-Yun; Gastier-Foster, Julie M; Astbury, Caroline; Barr, Frederic G; Skapek, Stephen X; Hawkins, Douglas S; Weigel, Brenda J; Pappo, Alberto; Meyer, William H; Arnold, Michael A; Teot, Lisa A; Parham, David M
2017-12-01
Distinguishing alveolar rhabdomyosarcoma (ARMS) from embryonal rhabdomyosarcoma (ERMS) has historically been of prognostic and therapeutic importance. However, classification has been complicated by shifting histologic criteria required for an ARMS diagnosis. Children's Oncology Group (COG) studies after IRS-IV, which included the height of this diagnostic shift, showed both an increased number of ARMS and an increase in the proportion of fusion-negative ARMS. Following diagnostic standardization and histologic re-review of ARMS cases enrolled during this era, analysis of low-risk (D9602) and intermediate-risk (D9803) rhabdomyosarcoma (RMS) studies showed that fusion status rather than histology best predicts prognosis for patients with RMS. This analysis remains to be completed for patients with high-risk RMS. We re-reviewed cases on high-risk COG studies D9802 and ARST0431 with an enrollment diagnosis of ARMS. We compared the event-free survival (EFS) and overall survival by histology, PAX-FOXO1 fusion, and clinical risk factors (Oberlin score) for patients with metastatic RMS using the log-rank test. Histology re-review resulted in reclassification as ERMS for 12% of D9802 cases and 5% of ARST0431 cases. Fusion-negative RMS had a superior EFS to fusion-positive RMS; however, poorer outcome for metastatic RMS was most related to clinical risk factors including age, primary site, and number of metastatic sites. In contrast to low- or intermediate-risk RMS, in metastatic RMS, clinical risk factors have the most impact on patient outcome. PAX-FOXO1 fusion is more common in patients with a high Oberlin score, but fusion status is not an independent biomarker of prognosis. © 2017 Wiley Periodicals, Inc.
Status report on the fusion breeder
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moir, R.W.
1980-12-12
The rationale for hybrid fusion-fission reactors is the production of fissile fuel for fission reactors. A new class of reactor, the fission-suppressed hybrid promises unusually good safety features as well as the ability to support 25 light-water reactors of the same nuclear power rating, or even more high-conversion-ratio reactors such as the heavy-water type. One 4000-MW nuclear hybrid can produce 7200 kg of /sup 233/U per year. To obtain good economics, injector efficiency times plasma gain (eta/sub i/Q) should be greater than 2, the wall load should be greater than 1 MW m/sup -2/, and the hybrid should cost lessmore » than 6 times the cost of a light-water reactor. Introduction rates for the fission-suppressed hybrid are unusually rapid.« less
Osteoclasts and giant cells: macrophage–macrophage fusion mechanism
Vignery, Agnès
2000-01-01
) C domains. Shortly after we cloned MFR, CD47 was reported to be a ligand for P84/SIRPα. We have since generated preliminary results which suggest that CD47 interacts with MFR during adhesion/fusion and is a member of the fusion machinery. We also identified CD44 as a plasma membrane protein which, like MFR, is highly expressed at the onset of fusion. The recombinant soluble extracellular domain of CD44 blocks fusion by interacting with a cell-surface binding site. We now propose a model in which both forms of MFR, CD44, and CD47 mediate macrophage adhesion/fusion and therefore the differentiation of osteoclasts and giant cells. PMID:11168677
2013-01-01
Background One of the main challenges for heterologous protein production by the methylotrophic yeast Pichia pastoris at large-scale is related to its high oxygen demand. A promising solution is a co-feeding strategy based on a methanol/sorbitol mixture during the induction phase. Nonetheless, a deep understanding of the cellular physiology and the regulation of the AOX1 promoter, used to govern heterologous protein production, during this co-feeding strategy is still scarce. Results Transient continuous cultures with a dilution rate of 0.023 h-1 at 25°C were performed to quantitatively assess the benefits of a methanol/sorbitol co-feeding process with a Mut+ strain in which the pAOX1-lacZ construct served as a reporter gene. Cell growth and metabolism, including O2 consumption together with CO2 and heat production were analyzed with regard to a linear change of methanol fraction in the mixed feeding media. In addition, the regulation of the promoter AOX1 was investigated by means of β-galactosidase measurements. Our results demonstrated that the cell-specific oxygen consumption (qO2) could be reduced by decreasing the methanol fraction in the feeding media. More interestingly, maximal β-galactosidase cell-specific activity (>7500 Miller unit) and thus, optimal pAOX1 induction, was achieved and maintained in the range of 0.45 ~ 0.75 C-mol/C-mol of methanol fraction. In addition, the qO2 was reduced by 30% at most in those conditions. Based on a simplified metabolic network, metabolic flux analysis (MFA) was performed to quantify intracellular metabolic flux distributions during the transient continuous cultures, which further shed light on the advantages of methanol/sorbitol co-feeding process. Finally, our observations were further validated in fed-batch cultures. Conclusion This study brings quantitative insight into the co-feeding process, which provides valuable data for the control of methanol/sorbitol co-feeding, aiming at enhancing biomass and
Occipitocervical fusions in children. Retrospective analysis and technical considerations.
Rodgers, W B; Coran, D L; Emans, J B; Hresko, M T; Hall, J E
1999-07-01
This report presents a retrospective analysis of the authors' experience with occipitocervical fusions in children and adolescents during the last 2 decades. A description of an operative technique devised by the senior author (JEH), and a comparison of the results using this and other methods of fusion are given. Twenty-three patients underwent occipitocervical fusion. Fifteen of the patients were operated on using the authors' technique. To achieve stable fixation of the distal cervical vertebra a threaded Kirschner wire was passed transversely through the spinous process; occipital fixation was achieved by the traditional method of wiring corticocancellous bone graft to the skull through burr holes. The occipital wires then were wrapped around the Kirschner wire and the graft was cradled in the resulting nest. Halo immobilization was used in 10 patients for an average of 12.5 weeks (range, 6-24 weeks). Twenty-two patients achieved successful fusion at an average followup of 5.8 years (range, 1-14.33 years). Several complications, including transient quadriplegia in one patient, pseudarthrosis in two (one of which persists), hardware fixation failure in one, unintended distal extension of the fusion, pneumonia, wound infection, halo pin infection, skin breakdown under the halo vest, hydrocephalus, cerebrospinal fluid leak, and traumatic fusion fracture were encountered. Results using the technique described herein are comparable with or better than the results reported in the previous literature, and the results of the patients in this series in whom the technique was not used.
Return to Golf After Lumbar Fusion.
Shifflett, Grant D; Hellman, Michael D; Louie, Philip K; Mikhail, Christopher; Park, Kevin U; Phillips, Frank M
Spinal fusion surgery is being increasingly performed, yet few studies have focused on return to recreational sports after lumbar fusion and none have specifically analyzed return to golf. Most golfers successfully return to sport after lumbar fusion surgery. Case series. Level 4. All patients who underwent 1- or 2-level primary lumbar fusion surgery for degenerative pathologies performed by a single surgeon between January 2008 and October 2012 and had at least 1-year follow-up were included. Patients completed a specifically designed golf survey. Surveys were mailed, given during follow-up clinic, or answered during telephone contact. A total of 353 patients met the inclusion and exclusion criteria, with 200 responses (57%) to the questionnaire producing 34 golfers. The average age of golfers was 57 years (range, 32-79 years). In 79% of golfers, preoperative back and/or leg pain significantly affected their ability to play golf. Within 1 year from surgery, 65% of patients returned to practice and 52% returned to course play. Only 29% of patients stated that continued back/leg pain limited their play. Twenty-five patients (77%) were able to play the same amount of golf or more than before fusion surgery. Of those providing handicaps, 12 (80%) reported the same or an improved handicap. More than 50% of golfers return to on-course play within 1 year of lumbar fusion surgery. The majority of golfers can return to preoperative levels in terms of performance (handicap) and frequency of play. This investigation offers insight into when golfers return to sport after lumbar fusion surgery and provides surgeons with information to set realistic expectations postoperatively.
Autograft versus Allograft for Cervical Spinal Fusion
Brodke, Darrel S.; Youssef, Jim A.; Meisel, Hans-Jörg; Dettori, Joseph R.; Park, Jong-Beom; Yoon, S. Tim; Wang, Jeffrey C.
2017-01-01
Study Design Systematic review. Objective To compare the effectiveness and safety between iliac crest bone graft (ICBG), non-ICBG autologous bone, and allograft in cervical spine fusion. To avoid problems at the donor site, various allograft materials have been used as a substitute for autograft. However, there are still questions as to the comparative effectiveness and safety of cadaver allograft compared with autologous ICBG. Methods A systematic search of multiple major medical reference databases was conducted to identify studies evaluating spinal fusion in patients with cervical degenerative disk disease using ICBG compared with non-ICBG autograft or allograft or non-ICBG autograft compared with allograft in the cervical spine. Radiographic fusion, patient-reported outcomes, and functional outcomes were the primary outcomes of interest. Adverse events were evaluated for safety. Results The search identified 13 comparative studies that met our inclusion criteria: 2 prospective cohort studies and 11 retrospective cohort studies. Twelve cohort studies compared allograft with ICBG autograft during anterior cervical fusion and demonstrated with a low evidence level of support that there are no differences in fusion percentages, pain scores, or functional results. There was insufficient evidence comparing patients receiving allograft with non-ICBG autograft for fusion, pain, revision, and functional and safety outcomes. No publications directly comparing non-ICBG autograft with ICBG were found. Conclusion Although the available literature suggests ICBG and allograft may have similar effectiveness in terms of fusion rates, pain scores, and functional outcomes following anterior cervical fusion, there are too many limitations in the available literature to draw any significant conclusions. No individual study provided greater than class III evidence, and when evaluating the overall body of literature, no conclusion had better than low evidence support. A prospective
Bydon, Mohamad; Macki, Mohamed; Abt, Nicholas B; Witham, Timothy F; Wolinsky, Jean-Paul; Gokaslan, Ziya L; Bydon, Ali; Sciubba, Daniel M
2015-03-01
Reimbursements for interbody fusions have declined recently because of their questionable cost-effectiveness. A Markov model was adopted to compare the cost-effectiveness of posterior lumbar interbody fusion (PLIF) or transforaminal lumbar interbody fusion (/TLIF) versus noninterbody fusion and posterolateral fusion (PLF) in patients with lumbar spondylolisthesis. Decision model analysis based on retrospective data from a single institutional series. One hundred thirty-seven patients underwent first-time instrumented lumbar fusions for degenerative or isthmic spondylolisthesis. Quality of life adjustments and expenditures were assigned to each short-term complication (durotomy, surgical site infection, and medical complication) and long-term outcome (bowel/bladder dysfunction and paraplegia, neurologic deficit, and chronic back pain). Patients were divided into a PLF cohort and a PLF plus PLIF/TLIF cohort. Anterior techniques and multilevel interbody fusions were excluded. Each short-term complication and long-term outcome was assigned a numerical quality-adjusted life-year (QALY), based on time trade-off values in the Beaver Dam Health Outcomes Study. The cost data for short-term complications were calculated from charges accrued by the institution's finance sector, and the cost data for long-term outcomes were estimated from the literature. The difference in cost of PLF plus PLIF/TLIF from the cost of PLF alone divided by the difference in QALY equals the cost-effectiveness ratio (CER). We do not report any study funding sources or any study-specific appraisal of potential conflict of interest-associated biases in this article. Of 137 first-time lumbar fusions for spondylolisthesis, 83 patients underwent PLF and 54 underwent PLIF/TLIF. The average time to reoperation was 3.5 years. The mean QALY over 3.5 years was 2.81 in the PLF cohort versus 2.66 in the PLIFo/TLIF cohort (p=.110). The mean 3.5-year costs of $54,827.05 after index interbody fusion were
Schmitt, Paul J; Kelleher, John P; Ailon, Tamir; Heller, Joshua E; Kasliwal, Manish K; Shaffrey, Christopher I; Smith, Justin S
2016-08-01
Although use of very high-dose recombinant human bone morphogenetic protein-2 (rhBMP-2) has been reported to markedly improve fusion rates in adult spinal deformity (ASD) surgery, most centers use much lower doses due to cost constraints. How effective these lower doses are for fusion enhancement remains unclear. To assess fusion rates using relatively low-dose rhBMP-2 for ASD surgery. This was a retrospective review of consecutive ASD patients that underwent thoracic to sacral fusion. Patients that achieved 2-year follow-up were analyzed. Impact of patient and surgical factors on fusion rate was assessed, and fusion rates were compared with historical cohorts. Of 219 patients, 172 (78.5%) achieved 2-year follow-up and were analyzed. Using an average rhBMP-2 dose of 3.1 mg/level (average total dose = 35.9 mg/case), the 2-year fusion rate was 73.8%. Cancellous allograft, local autograft, and very limited iliac crest bone graft (<20 mL, obtained during iliac bolt placement) were also used. On multivariate analysis, female sex was associated with a higher fusion rate, whereas age, comorbidity score, deformity type, and 3-column osteotomy were not. There were no complications directly attributable to rhBMP-2. Fusion rates for ASD using low-dose rhBMP-2 were comparable to those reported for iliac crest bone graft but lower than for high-dose rhBMP-2. Importantly, there were substantial differences between patients in the present series and those in the historical comparison groups that could not be fully adjusted for based on available data. Prospective evaluation of rhBMP-2 dosing for ASD surgery is warranted to define the most appropriate dose that balances benefits, risks, and costs. ASD, adult spinal deformityICBG, iliac crest bone graftOR, odds ratiorhBMP-2, recombinant human bone morphogenetic protein-2RR, risk ratioTCO, 3-column osteotomy.
Fusion Materials Research at Oak Ridge National Laboratory in Fiscal Year 2015
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wiffen, F. W.; Katoh, Yutai; Melton, Stephanie G.
The realization of fusion energy is a formidable challenge with significant achievements resulting from close integration of the plasma physics and applied technology disciplines. Presently, the most significant technological challenge for the near-term experiments such as ITER, and next generation fusion power systems, is the inability of current materials and components to withstand the harsh fusion nuclear environment. The overarching goal of the Oak Ridge National Laboratory (ORNL) fusion materials program is to provide the applied materials science support and understanding to underpin the ongoing Department of Energy (DOE) Office of Science fusion energy program while developing materials for fusionmore » power systems. In doing so the program continues to be integrated both with the larger United States (US) and international fusion materials communities, and with the international fusion design and technology communities.This document provides a summary of Fiscal Year (FY) 2015 activities supporting the Office of Science, Office of Fusion Energy Sciences Materials Research for Magnetic Fusion Energy (AT-60-20-10-0) carried out by ORNL. The organization of this report is mainly by material type, with sections on specific technical activities. Four projects selected in the Funding Opportunity Announcement (FOA) solicitation of late 2011 and funded in FY2012-FY2014 are identified by “FOA” in the titles. This report includes the final funded work of these projects, although ORNL plans to continue some of this work within the base program.« less
The Fusion Gain Analysis of the Inductively Driven Liner Compression Based Fusion
NASA Astrophysics Data System (ADS)
Shimazu, Akihisa; Slough, John
2016-10-01
An analytical analysis of the fusion gain expected in the inductively driven liner compression (IDLC) based fusion is conducted to identify the fusion gain scaling at various operating conditions. The fusion based on the IDLC is a magneto-inertial fusion concept, where a Field-Reversed Configuration (FRC) plasmoid is compressed via the inductively-driven metal liner to drive the FRC to fusion conditions. In the past, an approximate scaling law for the expected fusion gain for the IDLC based fusion was obtained under the key assumptions of (1) D-T fuel at 5-40 keV, (2) adiabatic scaling laws for the FRC dynamics, (3) FRC energy dominated by the pressure balance with the edge magnetic field at the peak compression, and (4) the liner dwell time being liner final diameter divided by the peak liner velocity. In this study, various assumptions made in the previous derivation is relaxed to study the change in the fusion gain scaling from the previous result of G ml1 / 2 El11 / 8 , where ml is the liner mass and El is the peak liner kinetic energy. The implication from the modified fusion gain scaling on the performance of the IDLC fusion reactor system is also explored.
Failure analysis of knee arthrodesis with the WichitaFusion Nail.
Parcel, Ted W; Levering, Melissa; Polikandriotis, John A; Gustke, Kenneth A; Bernasek, Thomas L
2013-11-01
Arthrodesis is a salvage procedure for failed total knee arthroplasty with the intent to create a stable, pain-free limb on which to ambulate or transfer. For many patients, the alternative to arthrodesis may be an above-knee amputation. Available techniques for knee arthrodesis include compression plating, external fixators, and intramedullary fixation. The purpose of this study was to report the knee fusion rate of consecutive patients at 1 institution using an intramedullary fusion nail and to identify patient risk factors for fusion failure. Between November 1998 and November 2008, twenty-eight patients undergoing knee arthrodesis with an average follow-up of 18 months (range, 3-64 months) were retrospectively studied. Demographic information, presence of fusion, clinical function, pain level, and bone defect data were collected and analyzed. Eighty-two percent (23/28) of patients had radiographic evidence of successful fusion with an average time to fusion of 21 weeks (range, 10-58 weeks). When examining patient variables that could correlate with fusion rates, patients with an Anderson Orthopaedic Research Institute type 3 femoral or type 3 tibial defect had a statistically significant lower fusion rate. The intramedullary fusion nail is an effective device for knee arthrodesis that offers ease of insertion through the knee wound with the advantages of initial bone compression and rigid fixation. Although the use of intramedullary fusion nails leads to a high fusion rate, significant bone deficiency limits successful fusion. Copyright 2013, SLACK Incorporated.
A major defect in mast cell effector functions in CRACM1-/- mice
Vig, Monika; Dehaven, Wayne I; Bird, Gary S; Billingsley, James M; Wang, Huiyun; Rao, Patricia E; Hutchings, Amy B; Jouvin, Marie-Hélène; Putney, James W; Kinet, Jean-Pierre
2008-01-01
CRACM1 (Orai1) constitutes the pore subunit of CRAC channels that are crucial for many physiological processes 1-6. A point mutation in CRACM1 has been associated with SCID disease in humans 2. We have generated CRACM1 deficient mice using gene trap, where β-galactosidase (LacZ) activity identifies CRACM1 expression in tissues. We show here that the homozygous CRACM1 deficient mice are considerably smaller in size and are grossly defective in mast cell degranulation and cytokine secretion. FcεRI-mediated in vivo allergic reactions were also inhibited in CRACM1-/- mice. Other tissues expressing truncated CRACM1-LacZ fusion protein include skeletal muscles, kidney and regions in the brain and heart. Surprisingly, no CRACM1 expression was seen in the lymphoid regions of thymus. Accordingly, we found no defect in T cell development. Thus, our data reveal novel crucial roles for CRAC channels including a putative role in excitable cells. PMID:18059270
Complexin and Ca2+ stimulate SNARE-mediated membrane fusion
Yoon, Tae-Young; Lu, Xiaobind; Diao, Jiajie; Lee, Soo-Min; Ha, Taekjip; Shin, Yeon-Kyun
2008-01-01
Ca2+-triggered, synchronized synaptic vesicle fusion underlies interneuronal communication. Complexin is a major binding partner of the SNARE complex, the core fusion machinery at the presynapse. The physiological data on complexin, however, have been at odds with each other, making delineation of its molecular function difficult. Here we report direct observation of two-faceted functions of complexin using the single-vesicle fluorescence fusion assay and EPR. We show that complexin I has two opposing effects on trans-SNARE assembly: inhibition of SNARE complex formation and stabilization of assembled SNARE complexes. Of note, SNARE-mediated fusion is markedly stimulated by complexin, and it is further accelerated by two orders of magnitude in response to an externally applied Ca2+ wave. We suggest that SNARE complexes, complexins and phospholipids collectively form a complex substrate for Ca2+ and Ca2+-sensing fusion effectors in neurotransmitter release. PMID:18552825
Conference Report on the 3rd International Symposium on Lithium Application for Fusion Devices
NASA Astrophysics Data System (ADS)
Mazzitelli, G.; Hirooka, Y.; Hu, J. S.; Mirnov, S. V.; Nygren, R.; Shimada, M.; Ono, M.; Tabares, F. L.
2015-02-01
The third International Symposium on Lithium Application for Fusion Device (ISLA-2013) was held on 9-11 October 2013 at ENEA Frascati Centre with growing participation and interest from the community working on more general aspect of liquid metal research for fusion energy development. ISLA-2013 has been confirmed to be the largest and the most important meeting dedicated to liquid metal application for the magnetic fusion research. Overall, 45 presentation plus 5 posters were given, representing 28 institutions from 11 countries. The latest experimental results from nine magnetic fusion devices were presented in 16 presentations from NSTX (PPPL, USA), FTU (ENEA, Italy), T-11M (Trinity, RF), T-10 (Kurchatov Institute, RF), TJ-II (CIEMAT, Spain), EAST(ASIPP, China), HT-7 (ASIPP, China), RFX (Padova, Italy), KTM (NNC RK, Kazakhstan). Sessions were devoted to the following: (I) lithium in magnetic confinement experiments (facility overviews), (II) lithium in magnetic confinement experiments (topical issues), (III) special session on liquid lithium technology, (IV) lithium laboratory test stands, (V) Lithium theory/modelling/comments, (VI) innovative lithium applications and (VII) special Session on lithium-safety and lithium handling. There was a wide participation from the fusion technology communities, including IFMIF and TBM communities providing productive exchange with the physics oriented magnetic confinement liquid metal research groups. This international workshop will continue on a biennial basis (alternating with the Plasma-Surface Interactions (PSI) Conference) and the next workshop will be held at CIEMAT, Madrid, Spain, in 2015.
confFuse: High-Confidence Fusion Gene Detection across Tumor Entities.
Huang, Zhiqin; Jones, David T W; Wu, Yonghe; Lichter, Peter; Zapatka, Marc
2017-01-01
Background: Fusion genes play an important role in the tumorigenesis of many cancers. Next-generation sequencing (NGS) technologies have been successfully applied in fusion gene detection for the last several years, and a number of NGS-based tools have been developed for identifying fusion genes during this period. Most fusion gene detection tools based on RNA-seq data report a large number of candidates (mostly false positives), making it hard to prioritize candidates for experimental validation and further analysis. Selection of reliable fusion genes for downstream analysis becomes very important in cancer research. We therefore developed confFuse, a scoring algorithm to reliably select high-confidence fusion genes which are likely to be biologically relevant. Results: confFuse takes multiple parameters into account in order to assign each fusion candidate a confidence score, of which score ≥8 indicates high-confidence fusion gene predictions. These parameters were manually curated based on our experience and on certain structural motifs of fusion genes. Compared with alternative tools, based on 96 published RNA-seq samples from different tumor entities, our method can significantly reduce the number of fusion candidates (301 high-confidence from 8,083 total predicted fusion genes) and keep high detection accuracy (recovery rate 85.7%). Validation of 18 novel, high-confidence fusions detected in three breast tumor samples resulted in a 100% validation rate. Conclusions: confFuse is a novel downstream filtering method that allows selection of highly reliable fusion gene candidates for further downstream analysis and experimental validations. confFuse is available at https://github.com/Zhiqin-HUANG/confFuse.
Novel cooperative neural fusion algorithms for image restoration and image fusion.
Xia, Youshen; Kamel, Mohamed S
2007-02-01
To deal with the problem of restoring degraded images with non-Gaussian noise, this paper proposes a novel cooperative neural fusion regularization (CNFR) algorithm for image restoration. Compared with conventional regularization algorithms for image restoration, the proposed CNFR algorithm can relax need of the optimal regularization parameter to be estimated. Furthermore, to enhance the quality of restored images, this paper presents a cooperative neural fusion (CNF) algorithm for image fusion. Compared with existing signal-level image fusion algorithms, the proposed CNF algorithm can greatly reduce the loss of contrast information under blind Gaussian noise environments. The performance analysis shows that the proposed two neural fusion algorithms can converge globally to the robust and optimal image estimate. Simulation results confirm that in different noise environments, the proposed two neural fusion algorithms can obtain a better image estimate than several well known image restoration and image fusion methods.
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Ogasawara, Shun; Shimada, Nao; Kawata, Takefumi
2009-02-01
Expansins are proteins involved in plant morphogenesis, exerting their effects on cellulose to extend cell walls. Dictyostelium is an organism that possesses expansin-like molecules, but their functions are not known. In this study, we analyzed the expL7 (expansin-like 7) gene, which has been identified as a putative target of Dd-STATa, a Dictyostelium homolog of the metazoan signal transducer and activator of transcription (STAT) proteins. Promoter fragments of the expL7 were fused to a lacZ reporter and the expression patterns determined. As expected from the behavior of the endogenous expL7 gene, the expL7/lacZ fusion gene was downregulated in Dd-STATa null slugs. In the parental strain, the expL7 promoter was activated in the anterior tip region. Mutational analysis of the promoter identified a sequence that was necessary for expression in tip cells. In addition, an activator sequence for pstAB cells was identified. These sequences act in combination with the repressor region to prevent ectopic expL7 expression in the prespore and prestalk regions of the slug and culminant. Although the expL7 null mutant showed no phenotypic change, the expL7 overexpressor showed aberrant stalk formation. These results indicate that the expansin-like molecule is important for morphogenesis in Dictyostelium.
NASA Astrophysics Data System (ADS)
Ongena, J.; Koch, R.; Wolf, R.; Zohm, H.
2016-05-01
Our modern society requires environmentally friendly solutions for energy production. Energy can be released not only from the fission of heavy nuclei but also from the fusion of light nuclei. Nuclear fusion is an important option for a clean and safe solution for our long-term energy needs. The extremely high temperatures required for the fusion reaction are routinely realized in several magnetic-fusion machines. Since the early 1990s, up to 16 MW of fusion power has been released in pulses of a few seconds, corresponding to a power multiplication close to break-even. Our understanding of the very complex behaviour of a magnetized plasma at temperatures between 150 and 200 million °C surrounded by cold walls has also advanced substantially. This steady progress has resulted in the construction of ITER, a fusion device with a planned fusion power output of 500 MW in pulses of 400 s. ITER should provide answers to remaining important questions on the integration of physics and technology, through a full-size demonstration of a tenfold power multiplication, and on nuclear safety aspects. Here we review the basic physics underlying magnetic fusion: past achievements, present efforts and the prospects for future production of electrical energy. We also discuss questions related to the safety, waste management and decommissioning of a future fusion power plant.
Return to Golf After Lumbar Fusion
Shifflett, Grant D.; Hellman, Michael D.; Louie, Philip K.; Mikhail, Christopher; Park, Kevin U.; Phillips, Frank M.
2016-01-01
Background: Spinal fusion surgery is being increasingly performed, yet few studies have focused on return to recreational sports after lumbar fusion and none have specifically analyzed return to golf. Hypothesis: Most golfers successfully return to sport after lumbar fusion surgery. Study Design: Case series. Level of Evidence: Level 4. Methods: All patients who underwent 1- or 2-level primary lumbar fusion surgery for degenerative pathologies performed by a single surgeon between January 2008 and October 2012 and had at least 1-year follow-up were included. Patients completed a specifically designed golf survey. Surveys were mailed, given during follow-up clinic, or answered during telephone contact. Results: A total of 353 patients met the inclusion and exclusion criteria, with 200 responses (57%) to the questionnaire producing 34 golfers. The average age of golfers was 57 years (range, 32-79 years). In 79% of golfers, preoperative back and/or leg pain significantly affected their ability to play golf. Within 1 year from surgery, 65% of patients returned to practice and 52% returned to course play. Only 29% of patients stated that continued back/leg pain limited their play. Twenty-five patients (77%) were able to play the same amount of golf or more than before fusion surgery. Of those providing handicaps, 12 (80%) reported the same or an improved handicap. Conclusion: More than 50% of golfers return to on-course play within 1 year of lumbar fusion surgery. The majority of golfers can return to preoperative levels in terms of performance (handicap) and frequency of play. Clinical Relevance: This investigation offers insight into when golfers return to sport after lumbar fusion surgery and provides surgeons with information to set realistic expectations postoperatively. PMID:27879299
Fuel gain exceeding unity in an inertially confined fusion implosion.
Hurricane, O A; Callahan, D A; Casey, D T; Celliers, P M; Cerjan, C; Dewald, E L; Dittrich, T R; Döppner, T; Hinkel, D E; Berzak Hopkins, L F; Kline, J L; Le Pape, S; Ma, T; MacPhee, A G; Milovich, J L; Pak, A; Park, H-S; Patel, P K; Remington, B A; Salmonson, J D; Springer, P T; Tommasini, R
2014-02-20
Ignition is needed to make fusion energy a viable alternative energy source, but has yet to be achieved. A key step on the way to ignition is to have the energy generated through fusion reactions in an inertially confined fusion plasma exceed the amount of energy deposited into the deuterium-tritium fusion fuel and hotspot during the implosion process, resulting in a fuel gain greater than unity. Here we report the achievement of fusion fuel gains exceeding unity on the US National Ignition Facility using a 'high-foot' implosion method, which is a manipulation of the laser pulse shape in a way that reduces instability in the implosion. These experiments show an order-of-magnitude improvement in yield performance over past deuterium-tritium implosion experiments. We also see a significant contribution to the yield from α-particle self-heating and evidence for the 'bootstrapping' required to accelerate the deuterium-tritium fusion burn to eventually 'run away' and ignite.
Gupta, S C; Siddique, H R; Saxena, D K; Chowdhuri, D Kar
2005-01-01
This study investigated the working hypothesis that two widely used organophosphate pesticides; Nuvan and Dimecron, exert toxic effects in Drosophila. Transgenic D. melanogaster (hsp70-lacZ) was used as a model for assaying stress gene expression and AchE activity as an endpoint for toxicity and also to evaluate whether stress gene expression is sufficient to protect against toxic insult of the chemicals and to prevent tissue damage. The study was extended to investigate the effect of the pesticides on the life cycle and reproduction of the organism. The study showed that Nuvan affected emergence of the exposed flies more drastically than Dimecron and the effect was lethal at the highest tested concentration (0.075 ppm). While Nuvan at 0.0075 and 0.015 ppm concentrations affected reproduction of the flies significantly, the effect of Dimecron was significant only at 0.015 and 0.075 ppm. Nuvan-exposed third-instar larvae exhibited a 1.2-fold to 1.5-fold greater hsp70 expression compared to Dimecron at concentrations ranging from 0.0075 to 0.075 ppm following 12 and 18 h exposure. While maximum expression of hsp70 was observed in Nuvan-exposed third-instar larval tissues following 18 h exposure at 0.075 ppm, Dimecron at the same dietary concentration induced a maximum expression of hsp70 following 24 h exposure. Further, concomitant with a significant induction of hsp70, significant inhibition of AchE was observed following chemical exposure and temperature shock. Concurrent with a significant decline in hsp70 expression in Nuvan-exposed larvae after 48 h at 0.075 ppm, tissue damage was evident. Dimecron-exposed larvae exhibited a plateau in hsp70 induction even after 48 h exposure and moderate tissue damage was observed in these larvae. The present study suggests that Nuvan is more cytotoxic than Dimecron in transgenic Drosophila melanogaster.
FuzzyFusion: an application architecture for multisource information fusion
NASA Astrophysics Data System (ADS)
Fox, Kevin L.; Henning, Ronda R.
2009-04-01
The correlation of information from disparate sources has long been an issue in data fusion research. Traditional data fusion addresses the correlation of information from sources as diverse as single-purpose sensors to all-source multi-media information. Information system vulnerability information is similar in its diversity of sources and content, and in the desire to draw a meaningful conclusion, namely, the security posture of the system under inspection. FuzzyFusionTM, A data fusion model that is being applied to the computer network operations domain is presented. This model has been successfully prototyped in an applied research environment and represents a next generation assurance tool for system and network security.
A survey of infrared and visual image fusion methods
NASA Astrophysics Data System (ADS)
Jin, Xin; Jiang, Qian; Yao, Shaowen; Zhou, Dongming; Nie, Rencan; Hai, Jinjin; He, Kangjian
2017-09-01
Infrared (IR) and visual (VI) image fusion is designed to fuse multiple source images into a comprehensive image to boost imaging quality and reduce redundancy information, which is widely used in various imaging equipment to improve the visual ability of human and robot. The accurate, reliable and complementary descriptions of the scene in fused images make these techniques be widely used in various fields. In recent years, a large number of fusion methods for IR and VI images have been proposed due to the ever-growing demands and the progress of image representation methods; however, there has not been published an integrated survey paper about this field in last several years. Therefore, we make a survey to report the algorithmic developments of IR and VI image fusion. In this paper, we first characterize the IR and VI image fusion based applications to represent an overview of the research status. Then we present a synthesize survey of the state of the art. Thirdly, the frequently-used image fusion quality measures are introduced. Fourthly, we perform some experiments of typical methods and make corresponding analysis. At last, we summarize the corresponding tendencies and challenges in IR and VI image fusion. This survey concludes that although various IR and VI image fusion methods have been proposed, there still exist further improvements or potential research directions in different applications of IR and VI image fusion.
Conference report on the 3rd International Symposium on Lithium Application for Fusion Devices
Mazzitelli, Guiseppe; Hirooka, Y.; Hu, J. S.; ...
2015-01-14
The third International Symposium on Lithium Application for Fusion Device (ISLA-2013) was held on 9-11 October 2013 at ENEA Frascati Centre with growing participation and interest from the community working on more general aspect of liquid metal research for fusion energy development. ISLA-2013 has been confirmed to be the largest and the most important meeting dedicated to liquid metal application for the magnetic fusion research. Overall, 45 presentation plus 5 posters were given, representing 28 institutions from 11 countries. The latest experimental results from nine magnetic fusion devices were presented in 16 presentations from NSTX (PPPL, USA), FTU (ENEA, Italy),more » T-11M (Trinity, RF), T-10 (Kurchatov Institute, RF), TJ-II (CIEMAT, Spain), EAST(ASIPP, China), HT-7 (ASIPP, China), RFX (Padova, Italy), KTM (NNC RK, Kazakhstan). Sessions were devoted to the following: (I) lithium in magnetic confinement experiments (facility overviews), (II) lithium in magnetic confinement experiments (topical issues), (III) special session on liquid lithium technology, (IV) lithium laboratory test stands, (V) Lithium theory/modelling/comments, (VI) innovative lithium applications and (VII) special Session on lithium-safety and lithium handling. There was a wide participation from the fusion technology communities, including IFMIF and TBM communities providing productive exchange with the physics oriented magnetic confinement liquid metal research groups. Furthermore, this international workshop will continue on a biennial basis (alternating with the Plasma-Surface Interactions (PSI) Conference) and the next workshop will be held at CIEMAT, Madrid, Spain, in 2015.« less
Hendra virus fusion protein transmembrane domain contributes to pre-fusion protein stability
Webb, Stacy; Nagy, Tamas; Moseley, Hunter; Fried, Michael; Dutch, Rebecca
2017-01-01
Enveloped viruses utilize fusion (F) proteins studding the surface of the virus to facilitate membrane fusion with a target cell membrane. Fusion of the viral envelope with a cellular membrane is required for release of viral genomic material, so the virus can ultimately reproduce and spread. To drive fusion, the F protein undergoes an irreversible conformational change, transitioning from a metastable pre-fusion conformation to a more thermodynamically stable post-fusion structure. Understanding the elements that control stability of the pre-fusion state and triggering to the post-fusion conformation is important for understanding F protein function. Mutations in F protein transmembrane (TM) domains implicated the TM domain in the fusion process, but the structural and molecular details in fusion remain unclear. Previously, analytical ultracentrifugation was utilized to demonstrate that isolated TM domains of Hendra virus F protein associate in a monomer-trimer equilibrium (Smith, E. C., Smith, S. E., Carter, J. R., Webb, S. R., Gibson, K. M., Hellman, L. M., Fried, M. G., and Dutch, R. E. (2013) J. Biol. Chem. 288, 35726–35735). To determine factors driving this association, 140 paramyxovirus F protein TM domain sequences were analyzed. A heptad repeat of β-branched residues was found, and analysis of the Hendra virus F TM domain revealed a heptad repeat leucine-isoleucine zipper motif (LIZ). Replacement of the LIZ with alanine resulted in dramatically reduced TM-TM association. Mutation of the LIZ in the whole protein resulted in decreased protein stability, including pre-fusion conformation stability. Together, our data suggest that the heptad repeat LIZ contributed to TM-TM association and is important for F protein function and pre-fusion stability. PMID:28213515
Weirather, Jason L.; Afshar, Pegah Tootoonchi; Clark, Tyson A.; Tseng, Elizabeth; Powers, Linda S.; Underwood, Jason G.; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai
2015-01-01
We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. PMID:26040699
Niu, Hongxing; Jost, Laurent; Pirlot, Nathalie; Sassi, Hosni; Daukandt, Marc; Rodriguez, Christian; Fickers, Patrick
2013-04-08
One of the main challenges for heterologous protein production by the methylotrophic yeast Pichia pastoris at large-scale is related to its high oxygen demand. A promising solution is a co-feeding strategy based on a methanol/sorbitol mixture during the induction phase. Nonetheless, a deep understanding of the cellular physiology and the regulation of the AOX1 promoter, used to govern heterologous protein production, during this co-feeding strategy is still scarce. Transient continuous cultures with a dilution rate of 0.023 h(-1) at 25°C were performed to quantitatively assess the benefits of a methanol/sorbitol co-feeding process with a Mut+ strain in which the pAOX1-lacZ construct served as a reporter gene. Cell growth and metabolism, including O2 consumption together with CO2 and heat production were analyzed with regard to a linear change of methanol fraction in the mixed feeding media. In addition, the regulation of the promoter AOX1 was investigated by means of β-galactosidase measurements. Our results demonstrated that the cell-specific oxygen consumption (qO2) could be reduced by decreasing the methanol fraction in the feeding media. More interestingly, maximal β-galactosidase cell-specific activity (>7500 Miller unit) and thus, optimal pAOX1 induction, was achieved and maintained in the range of 0.45 ~ 0.75 C-mol/C-mol of methanol fraction. In addition, the qO2 was reduced by 30% at most in those conditions. Based on a simplified metabolic network, metabolic flux analysis (MFA) was performed to quantify intracellular metabolic flux distributions during the transient continuous cultures, which further shed light on the advantages of methanol/sorbitol co-feeding process. Finally, our observations were further validated in fed-batch cultures. This study brings quantitative insight into the co-feeding process, which provides valuable data for the control of methanol/sorbitol co-feeding, aiming at enhancing biomass and heterologous protein productivities
Dacquin, Romain; Starbuck, Michael; Schinke, Thorsten; Karsenty, Gérard
2002-06-01
Cell- and time-specific gene inactivation should enhance our knowledge of bone biology. Implementation of this technique requires construction of transgenic mouse lines expressing Cre recombinase in osteoblasts, the bone forming cell. We tested several promoter fragments for their ability to drive efficient Cre expression in osteoblasts. In the first mouse transgenic line, the Cre gene was placed under the control of the 2.3-kb proximal fragment of the alpha1(I)-collagen promoter, which is expressed at high levels in osteoblasts throughout their differentiation. Transgenic mice expressing this transgene in bone were bred with the ROSA26 reporter (R26R) strain in which the ROSA26 locus is targeted with a conditional LacZ reporter cassette. In R26R mice, Cre expression and subsequent Cre-mediated recombination lead to expression of the LacZ reporter gene, an event that can be monitored by LacZ staining. LacZ staining was detected in virtually all osteoblasts of alpha1(I)-Cre;R26R mice indicating that homologous recombination occurred in these cells. No other cell type stained blue. In the second line studied, the 1.3-kb fragment of osteocalcin gene 2 (OG2) promoter, which is active in differentiated osteoblasts, was used to drive Cre expression. OG2-Cre mice expressed Cre specifically in bone. However, cross of OG2-Cre mice with R26R mice did not lead to any detectable LacZ staining in osteoblasts. Lastly, we tested a more active artificial promoter derived from the OG2 promoter. The artificial OG2-Cre transgene was expressed by reverse transcriptase-polymerase chain reaction in cartilage and bone samples. After cross of the artificial OG2-Cre mice with R26R mice, we detected a LacZ staining in articular chondrocytes but not in osteoblasts. Our data suggest that the only promoter able to drive Cre expression at a level sufficient to induce recombination in osteoblasts is the alpha1(I)-collagen promoter. Copyright 2002 Wiley-Liss, Inc.
NASA Astrophysics Data System (ADS)
Zein-Sabatto, Saleh; Mikhail, Maged; Bodruzzaman, Mohammad; DeSimio, Martin; Derriso, Mark; Behbahani, Alireza
2012-06-01
It has been widely accepted that data fusion and information fusion methods can improve the accuracy and robustness of decision-making in structural health monitoring systems. It is arguably true nonetheless, that decision-level is equally beneficial when applied to integrated health monitoring systems. Several decisions at low-levels of abstraction may be produced by different decision-makers; however, decision-level fusion is required at the final stage of the process to provide accurate assessment about the health of the monitored system as a whole. An example of such integrated systems with complex decision-making scenarios is the integrated health monitoring of aircraft. Thorough understanding of the characteristics of the decision-fusion methodologies is a crucial step for successful implementation of such decision-fusion systems. In this paper, we have presented the major information fusion methodologies reported in the literature, i.e., probabilistic, evidential, and artificial intelligent based methods. The theoretical basis and characteristics of these methodologies are explained and their performances are analyzed. Second, candidate methods from the above fusion methodologies, i.e., Bayesian, Dempster-Shafer, and fuzzy logic algorithms are selected and their applications are extended to decisions fusion. Finally, fusion algorithms are developed based on the selected fusion methods and their performance are tested on decisions generated from synthetic data and from experimental data. Also in this paper, a modeling methodology, i.e. cloud model, for generating synthetic decisions is presented and used. Using the cloud model, both types of uncertainties; randomness and fuzziness, involved in real decision-making are modeled. Synthetic decisions are generated with an unbiased process and varying interaction complexities among decisions to provide for fair performance comparison of the selected decision-fusion algorithms. For verification purposes
A pharmacological study of Arabidopsis cell fusion between the persistent synergid and endosperm.
Motomura, Kazuki; Kawashima, Tomokazu; Berger, Frédéric; Kinoshita, Tetsu; Higashiyama, Tetsuya; Maruyama, Daisuke
2018-01-29
Cell fusion is a pivotal process in fertilization and multinucleate cell formation. A plant cell is ubiquitously surrounded by a hard cell wall, and very few cell fusions have been observed except for gamete fusions. We recently reported that the fertilized central cell (the endosperm) absorbs the persistent synergid, a highly differentiated cell necessary for pollen tube attraction. The synergid-endosperm fusion (SE fusion) appears to eliminate the persistent synergid from fertilized ovule in Arabidopsis thaliana Here, we analyzed the effects of various inhibitors on SE fusion in an in vitro culture system. Different from other cell fusions, neither disruption of actin polymerization nor protein secretion impaired SE fusion. However, transcriptional and translational inhibitors decreased the SE fusion success rate and also inhibited endosperm division. Failures of SE fusion and endosperm nuclear proliferation were also induced by roscovitine, an inhibitor of cyclin-dependent kinases (CDK). These data indicate unique aspects of SE fusion such as independence of filamentous actin support and the importance of CDK-mediated mitotic control. © 2018. Published by The Company of Biologists Ltd.
NASA Technical Reports Server (NTRS)
Armour, Edward A.G.
2007-01-01
Muon catalyzed fusion is a process in which a negatively charged muon combines with two nuclei of isotopes of hydrogen, e.g, a proton and a deuteron or a deuteron and a triton, to form a muonic molecular ion in which the binding is so tight that nuclear fusion occurs. The muon is normally released after fusion has taken place and so can catalyze further fusions. As the muon has a mean lifetime of 2.2 microseconds, this is the maximum period over which a muon can participate in this process. This article gives an outline of the history of muon catalyzed fusion from 1947, when it was first realised that such a process might occur, to the present day. It includes a description of the contribution that Drachrnan has made to the theory of muon catalyzed fusion and the influence this has had on the author's research.
Hendra virus fusion protein transmembrane domain contributes to pre-fusion protein stability.
Webb, Stacy; Nagy, Tamas; Moseley, Hunter; Fried, Michael; Dutch, Rebecca
2017-04-07
Enveloped viruses utilize fusion (F) proteins studding the surface of the virus to facilitate membrane fusion with a target cell membrane. Fusion of the viral envelope with a cellular membrane is required for release of viral genomic material, so the virus can ultimately reproduce and spread. To drive fusion, the F protein undergoes an irreversible conformational change, transitioning from a metastable pre-fusion conformation to a more thermodynamically stable post-fusion structure. Understanding the elements that control stability of the pre-fusion state and triggering to the post-fusion conformation is important for understanding F protein function. Mutations in F protein transmembrane (TM) domains implicated the TM domain in the fusion process, but the structural and molecular details in fusion remain unclear. Previously, analytical ultracentrifugation was utilized to demonstrate that isolated TM domains of Hendra virus F protein associate in a monomer-trimer equilibrium (Smith, E. C., Smith, S. E., Carter, J. R., Webb, S. R., Gibson, K. M., Hellman, L. M., Fried, M. G., and Dutch, R. E. (2013) J. Biol. Chem. 288, 35726-35735). To determine factors driving this association, 140 paramyxovirus F protein TM domain sequences were analyzed. A heptad repeat of β-branched residues was found, and analysis of the Hendra virus F TM domain revealed a heptad repeat leucine-isoleucine zipper motif (LIZ). Replacement of the LIZ with alanine resulted in dramatically reduced TM-TM association. Mutation of the LIZ in the whole protein resulted in decreased protein stability, including pre-fusion conformation stability. Together, our data suggest that the heptad repeat LIZ contributed to TM-TM association and is important for F protein function and pre-fusion stability. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
FusionAnalyser: a new graphical, event-driven tool for fusion rearrangements discovery
Piazza, Rocco; Pirola, Alessandra; Spinelli, Roberta; Valletta, Simona; Redaelli, Sara; Magistroni, Vera; Gambacorti-Passerini, Carlo
2012-01-01
Gene fusions are common driver events in leukaemias and solid tumours; here we present FusionAnalyser, a tool dedicated to the identification of driver fusion rearrangements in human cancer through the analysis of paired-end high-throughput transcriptome sequencing data. We initially tested FusionAnalyser by using a set of in silico randomly generated sequencing data from 20 known human translocations occurring in cancer and subsequently using transcriptome data from three chronic and three acute myeloid leukaemia samples. in all the cases our tool was invariably able to detect the presence of the correct driver fusion event(s) with high specificity. In one of the acute myeloid leukaemia samples, FusionAnalyser identified a novel, cryptic, in-frame ETS2–ERG fusion. A fully event-driven graphical interface and a flexible filtering system allow complex analyses to be run in the absence of any a priori programming or scripting knowledge. Therefore, we propose FusionAnalyser as an efficient and robust graphical tool for the identification of functional rearrangements in the context of high-throughput transcriptome sequencing data. PMID:22570408
FusionAnalyser: a new graphical, event-driven tool for fusion rearrangements discovery.
Piazza, Rocco; Pirola, Alessandra; Spinelli, Roberta; Valletta, Simona; Redaelli, Sara; Magistroni, Vera; Gambacorti-Passerini, Carlo
2012-09-01
Gene fusions are common driver events in leukaemias and solid tumours; here we present FusionAnalyser, a tool dedicated to the identification of driver fusion rearrangements in human cancer through the analysis of paired-end high-throughput transcriptome sequencing data. We initially tested FusionAnalyser by using a set of in silico randomly generated sequencing data from 20 known human translocations occurring in cancer and subsequently using transcriptome data from three chronic and three acute myeloid leukaemia samples. in all the cases our tool was invariably able to detect the presence of the correct driver fusion event(s) with high specificity. In one of the acute myeloid leukaemia samples, FusionAnalyser identified a novel, cryptic, in-frame ETS2-ERG fusion. A fully event-driven graphical interface and a flexible filtering system allow complex analyses to be run in the absence of any a priori programming or scripting knowledge. Therefore, we propose FusionAnalyser as an efficient and robust graphical tool for the identification of functional rearrangements in the context of high-throughput transcriptome sequencing data.
Weirather, Jason L; Afshar, Pegah Tootoonchi; Clark, Tyson A; Tseng, Elizabeth; Powers, Linda S; Underwood, Jason G; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai
2015-10-15
We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Selwood, T; Sinnott, M L
1990-01-01
1. Michaelis-Menten parameters for the hydrolysis of 4-nitrophenyl beta-D-galactopyranoside and 3,4-dinitrophenyl beta-D-galactopyranoside Escherichia coli (lacZ) beta-galactosidase were measured as a function of pH or pD (pL) in both 1H2O and 2H2O. 2. For hydrolysis of 4-nitrophenyl beta-D-galactopyranoside by Mg2(+)-free enzyme, V is pL-independent below pL 9, but the V/Km-pL profile is sigmoid, the pK values shifting from 7.6 +/- 0.1 in 1H2O to 8.2 +/- 0.1 in 2H2O, and solvent kinetic isotope effects are negligible, in accord with the proposal [Sinnott, Withers & Viratelle (1978) Biochem. J. 175, 539-546] that glycone-aglycone fission without acid catalysis governs both V and V/Km. 3. V for hydrolysis of 4-nitrophenyl beta-D-galactopyranoside by Mg2(+)-enzyme varies sigmoidally with pL, the pK value shifting from 9.19 +/- 0.09 to 9.70 +/- 0.07; V/Km shows both a low-pL fall, probably due to competition between Mg2+ and protons [Tenu, Viratelle, Garnier & Yon (1971) Eur. J. Biochem. 20, 363-370], and a high-pL fall, governed by a pK that shifts from 8.33 +/- 0.08 to 8.83 +/- 0.08. There is a negligible solvent kinetic isotope effect on V/Km, but one of 1.7 on V, which a linear proton inventory shows to arise from one transferred proton. 4. The variation of V and V/Km with pL is sigmoid for hydrolysis of 3,4-dinitrophenyl beta-D-galactopyranoside by Mg2(+)-enzyme, with pK values showing small shifts, from 8.78 +/- 0.09 to 8.65 +/- 0.08 and from 8.7 +/- 0.1 to 8.9 +/- 0.1 respectively. There is no solvent isotope effect on V or V/Km for 3,4-dinitrophenyl beta-D-galactopyranoside, despite hydrolysis of the galactosyl-enzyme intermediate governing V. 5. Identification of the 'conformation change' in the hydrolysis of aryl galactosides proposed by Sinnott & Souchard [(1973) Biochem. J. 133, 89-98] with the protolysis of the magnesium phenoxide arising from the action of enzyme-bound Mg2+ as an electrophilic catalyst rationalizes these data and also resolves the
Faizan, Ahmad; Goel, Vijay K; Biyani, Ashok; Garfin, Steven R; Bono, Christopher M
2012-03-01
Studies delineating the adjacent level effect of single level disc replacement systems have been reported in literature. The aim of this study was to compare the adjacent level biomechanics of bi-level disc replacement, bi-level fusion and a construct having adjoining level disc replacement and fusion system. In total, biomechanics of four models- intact, bi level disc replacement, bi level fusion and fusion plus disc replacement at adjoining levels- was studied to gain insight into the effects of various instrumentation systems on cranial and caudal adjacent levels using finite element analysis (73.6N+varying moment). The bi-level fusion models are more than twice as stiff as compared to the intact model during flexion-extension, lateral bending and axial rotation. Bi-level disc replacement model required moments lower than intact model (1.5Nm). Fusion plus disc replacement model required moment 10-25% more than intact model, except in extension. Adjacent level motions, facet loads and endplate stresses increased substantially in the bi-level fusion model. On the other hand, adjacent level motions, facet loads and endplate stresses were similar to intact for the bi-level disc replacement model. For the fusion plus disc replacement model, adjacent level motions, facet loads and endplate stresses were closer to intact model rather than the bi-level fusion model, except in extension. Based on our finite element analysis, fusion plus disc replacement procedure has less severe biomechanical effects on adjacent levels when compared to bi-level fusion procedure. Bi-level disc replacement procedure did not have any adverse mechanical effects on adjacent levels. Copyright © 2011 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Donovan, D. C.; Boris, D. R.; Kulcinski, G. L.
2013-03-15
A new diagnostic has been developed that uses the time of flight (TOF) of the products from a nuclear fusion reaction to determine the location where the fusion reaction occurred. The TOF diagnostic uses charged particle detectors on opposing sides of the inertial electrostatic confinement (IEC) device that are coupled to high resolution timing electronics to measure the spatial profile of fusion reactions occurring between the two charged particle detectors. This diagnostic was constructed and tested by the University of Wisconsin-Madison Inertial Electrostatic Confinement Fusion Group in the IEC device, HOMER, which accelerates deuterium ions to fusion relevant energies inmore » a high voltage ({approx}100 kV), spherically symmetric, electrostatic potential well [J. F. Santarius, G. L. Kulcinski, R. P. Ashley, D. R. Boris, B. B. Cipiti, S. K. Murali, G. R. Piefer, R. F. Radel, T. E. Radel, and A. L. Wehmeyer, Fusion Sci. Technol. 47, 1238 (2005)]. The TOF diagnostic detects the products of D(d,p)T reactions and determines where along a chord through the device the fusion event occurred. The diagnostic is also capable of using charged particle spectroscopy to determine the Doppler shift imparted to the fusion products by the center of mass energy of the fusion reactants. The TOF diagnostic is thus able to collect spatial profiles of the fusion reaction density along a chord through the device, coupled with the center of mass energy of the reactions occurring at each location. This provides levels of diagnostic detail never before achieved on an IEC device.« less
Fusion reactions initiated by laser-accelerated particle beams in a laser-produced plasma.
Labaune, C; Baccou, C; Depierreux, S; Goyon, C; Loisel, G; Yahia, V; Rafelski, J
2013-01-01
The advent of high-intensity-pulsed laser technology enables the generation of extreme states of matter under conditions that are far from thermal equilibrium. This in turn could enable different approaches to generating energy from nuclear fusion. Relaxing the equilibrium requirement could widen the range of isotopes used in fusion fuels permitting cleaner and less hazardous reactions that do not produce high-energy neutrons. Here we propose and implement a means to drive fusion reactions between protons and boron-11 nuclei by colliding a laser-accelerated proton beam with a laser-generated boron plasma. We report proton-boron reaction rates that are orders of magnitude higher than those reported previously. Beyond fusion, our approach demonstrates a new means for exploring low-energy nuclear reactions such as those that occur in astrophysical plasmas and related environments.
Hybrid Fixation for Ankle Fusion in Diabetic Charcot Arthropathy.
El-Mowafi, Hani; Abulsaad, Mazen; Kandil, Yasser; El-Hawary, Ahmed; Ali, Samer
2018-01-01
Ankle fusion is difficult to achieve in the diabetic Charcot ankle Brodsky type 3a because of the poor quality of the bone and the inability to achieve a stable biomechanical construct. The aim of this study was to report the outcome of ankle fusion using a combination of an intramedullary nail and a circular external fixator in patients with diabetic Charcot arthropathy. We prospectively studied 24 patients with diabetic Charcot arthropathy of the ankle who were treated by fusion of the tibiotalar joint using a combined retrograde intramedullary nail and Ilizarov external fixator. Their mean age was 50.7 ± 6.9 (range, 43-62) years. The mean follow-up after surgery was 36.4 ± 5.8 (range, 24-98) months. Twenty-two patients (92%) achieved clinical and radiographic solid bony fusion. No patients in this series needed amputation. All the patients were pain free, and the mean American Orthopaedic Foot & Ankle Society Score (AOFAS) improved significantly from 34.6 ± 6.8 to 66.4 ± 4.5 at the last follow-up. Two patients developed an ulcer over the heel due to a prominent nail. The ulcer healed after nail removal. Eight patients developed pin tract infection. We report a successful outcomes of ankle fusions using combined intramedullary nail locked only proximally and ring external fixator (hybrid fixation) in patients with diabetic Charcot arthropathy. Level IV, case series.
Comprehensive Analysis of CBFβ-MYH11 Fusion Transcripts in Acute Myeloid Leukemia by RT-PCR Analysis
Kadkol, ShriHari S.; Bruno, Annette; Dodge, Carol; Lindgren, Valerie; Ravandi, Farhad
2004-01-01
CBFβ-MYH11 fusion transcripts are expressed in acute myeloid leukemias of the M4Eo subtype. Patients who express CBFβ-MYH11 fusion transcripts respond favorably to high-dose chemotherapy and are generally spared allogeneic bone marrow transplantation. Hence it is important to identify this fusion in all patients with acute myeloid leukemia M4Eo leukemia. The fusion can be detected by cytogenetics, fluorescence in-situ hybridization (FISH), or by molecular analysis with RT-PCR. Multiple fusion transcripts arising as a result of various breakpoints in the CBFβ and MYH11 have been identified. In this report we describe a comprehensive RT-PCR assay to identify all known fusion transcripts and provide an algorithm for molecular analysis of CBFβ-MYH11 fusions from patient specimens. Further, identification of the fusion transcript by such an assay would help in the diagnosis and follow up of patients with cryptic inversion 16 translocations (such as patient 2 in this report) not detected by standard cytogenetics or FISH and for rational design of probes for quantitative analysis by real-time PCR. PMID:14736823
Park, Won Man; Choi, Dae Kyung; Kim, Kyungsoo; Kim, Yongjung J; Kim, Yoon Hyuk
2015-12-01
Spinal fusion surgery is a widely used surgical procedure for sagittal realignment. Clinical studies have reported that spinal fusion may cause proximal junctional kyphosis and failure with disc failure, vertebral fracture, and/or failure at the implant-bone interface. However, the biomechanical injury mechanisms of proximal junctional kyphosis and failure remain unclear. A finite element model of the thoracolumbar spine was used. Nine fusion models with pedicle screw systems implanted at the L2-L3, L3-L4, L4-L5, L5-S1, L2-L4, L3-L5, L4-S1, L2-L5, and L3-S1 levels were developed based on the respective surgical protocols. The developed models simulated flexion-extension using hybrid testing protocol. When spinal fusion was performed at more distal levels, particularly at the L5-S1 level, the following biomechanical properties increased during flexion-extension: range of motion, stress on the annulus fibrosus fibers and vertebra at the adjacent motion segment, and the magnitude of axial forces on the pedicle screw at the uppermost instrumented vertebra. The results of this study demonstrate that more distal fusion levels, particularly in spinal fusion including the L5-S1 level, lead to greater increases in the risk of proximal junctional kyphosis and failure, as evidenced by larger ranges of motion, higher stresses on fibers of the annulus fibrosus and vertebra at the adjacent segment, and higher axial forces on the screw at the uppermost instrumented vertebra in flexion-extension. Therefore, fusion levels should be carefully selected to avoid proximal junctional kyphosis and failure. Copyright © 2015 Elsevier Ltd. All rights reserved.
... concept of fusion is similar to that of welding in industry. Spinal fusion surgery, however, does not ... bone taken from the patient has a long history of use and results in predictable healing. Autograft ...
Moving toward a standard for spinal fusion outcomes assessment.
Blount, Kevin J; Krompinger, W Jay; Maljanian, Rose; Browner, Bruce D
2002-02-01
Previous spinal fusion outcomes assessment studies have been complicated by inconsistencies in evaluative criteria and consequent variations in results. As a result, a general consensus is lacking on how to achieve comprehensive outcomes assessment for spinal fusion surgeries. The purpose of this article is to report the most validated and frequently used assessment measures to facilitate comparable outcomes studies in the future. Twenty-seven spinal fusion outcomes studies published between 1990 and 2000 were retrospectively reviewed. Study characteristics such as design, evaluative measures, and assessment tools were recorded and analyzed. Based on the reviewed literature, an outcomes assessment model is proposed including the Short Form-36 Health Survey, the Oswestry Disability Questionnaire, the North American Spine Society Patient Satisfaction Index, the Prolo Economic Scale, a 0-10 analog pain scale, medication use, radiographically assessed fusion status, and a generalized complication rate.
Immunological Properties of Hepatitis B Core Antigen Fusion Proteins
NASA Astrophysics Data System (ADS)
Francis, Michael J.; Hastings, Gillian Z.; Brown, Alan L.; Grace, Ken G.; Rowlands, David J.; Brown, Fred; Clarke, Berwyn E.
1990-04-01
The immunogenicity of a 19 amino acid peptide from foot-and-mouth disease virus has previously been shown to approach that of the inactivated virus from which it was derived after multimeric particulate presentation as an N-terminal fusion with hepatitis B core antigen. In this report we demonstrate that rhinovirus peptide-hepatitis B core antigen fusion proteins are 10-fold more immunogenic than peptide coupled to keyhole limpet hemocyanin and 100-fold more immunogenic than uncoupled peptide with an added helper T-cell epitope. The fusion proteins can be readily administered without adjuvant or with adjuvants acceptable for human and veterinary application and can elicit a response after nasal or oral dosing. The fusion proteins can also act as T-cell-independent antigens. These properties provide further support for their suitability as presentation systems for "foreign" epitopes in the development of vaccines.
Alastrué Vidal, Antonio; Navinés López, Jordi; Julián Ibáñez, Juan Francisco; De la Ossa Merlano, Napoleón; Botey Fernandez, Mireia; Sampere Moragues, Jaume; Sánchez Torres, Maria Del Carmen; Barluenga Torres, Eva; Fernández-Llamazares Rodríguez, Jaime
2016-01-01
Adrenohepatic fusion means union between the adrenal gland and the liver, intermingling its parenchymas. It is not possible to identify this condition by image tests. Its presence implies radical and multidisciplinar approach. We report two female cases of 45 and 50 years old with clinical virilization and palpable mass on the abdominal right upper quadrant corresponding to adrenocortical carcinoma with hepatic fusion. The contrast-enhanced tomography showed an indistinguishable mass involving the liver and the right adrenal gland. In the first case, the patient had a two-time operation, the former removing only the adrenal carcinoma, and the second performing a radical surgery after an early relapse. In the second case, a radical right en bloc adrenohepatectomy was performed. Both cases were pathologically reported as liver-infiltrating adrenal carcinoma. Only in the second case the surgery was radical effective as first intention to treat, with 3 years of disease-free survival. ACC is a rare entity with poor prognosis. The major indicators of malignancy are tumour diameter over 6cm, local invasion or metastasis, secretion of corticosteroids, virilization and hypertension and hypokalaemia. The parenchymal fusion of the adrenal cortical layer can be misdiagnosed as hepatocellular carcinoma with adhesion with the Glisson capsule. AHF in such cases may be misinterpreted during surgery, what may impair its resectability, and therefore the survival. The surgical treatment must be performed en bloc, often using liver vascular control. Postoperative treatment must be offered immediately after surgery. We report two consecutive rare cases of adrenohepatic fusion in giant right adrenocortical carcinoma, not detectable by imaging, what has important implications for the surgical decision-making. As radical surgery is the best choice to offer a curative treatment, it has to be performed by a multidisciplinary well-assembled team, counting with endocrine and liver surgeons
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fillo, J.A.
1980-01-01
Thermonuclear fusion offers an inexhaustible source of energy for the production of hydrogen from water. Depending on design, electric generation efficiencies of approx. 40 to 60% and hydrogen production efficiencies by high-temperature electrolysis of approx. 50 to 65% are projected for fusion reactors using high-temperatures blankets. Fusion/coal symbiotic systems appear economically promising for the first generation of commercial fusion synfuels plants. Coal production requirements and the environmental effects of large-scale coal usage would be greatly reduced by a fusion/coal system. In the long term, there could be a gradual transition to an inexhaustible energy system based solely on fusion.
2009-10-01
NUMBER E -Mail: 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER...transcriptional activation, protein expression, and protein interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most...1) Cell preparation (a) Stably transfected PC3 cell line: E . coli lacZ gene (from pSV-β-gal vector, Promega, Madison,WI) was inserted into high
Arthroscopic partial wrist fusion.
Ho, Pak-Cheong
2008-12-01
The wide intraarticular exposure of the wrist joint under arthroscopic view provides an excellent ground for various forms of partial wrist fusion. Combining with percutaneous fixation technique, arthroscopic partial wrist fusion can potentially generate the best possible functional outcome by preserving the maximal motion pertained with each type of partial wrist fusion because the effect of extraarticular adhesion associated with open surgery can be minimized. From November 1997 to May 2008, the author had performed 12 cases of arthroscopic partial wrist fusion, including scaphotrapeziotrapezoid fusion in 3, scaphoidectomy and 4-corner fusion in 4, radioscapholunate fusion in 3, radiolunate fusion in 1, and lunotriquetral fusion in 1 case. Through the radiocarpal or midcarpal joint, the corresponding articular surfaces were denuded of cartilage using arthroscopic burr and curette. Carpal bones involved in the fusion process were then transfixed with K wires percutaneously after alignment corrected and confirmed under fluoroscopic control. Autogenous cancellous bone graft or bone substitute were inserted and impacted to the fusion site through cannula under direct arthroscopic view. Final fixation could be by multiple K wires or cannulated screw system. Early mobilization was encouraged. Surgical complications were minor, including pin tract infection, skin burn, and delay union in 1 case. Uneventful radiologic union was obtained in 9 cases, stable fibrous union in 2, and nonunion in 1. The average follow-up period was 70 months. Symptom was resolved or improved, and functional motion was gained in all cases. All surgical scars were almost invisible, and aesthetic outcome was excellent.
Fusion programs in applied plasma physics
NASA Astrophysics Data System (ADS)
1992-07-01
The Applied Plasma Physics (APP) program at General Atomics (GA) described here includes four major elements: (1) Applied Plasma Physics Theory Program, (2) Alpha Particle Diagnostic, (3) Edge and Current Density Diagnostic, and (4) Fusion User Service Center (USC). The objective of the APP theoretical plasma physics research at GA is to support the DIII-D and other tokamak experiments and to significantly advance our ability to design a commercially-attractive fusion reactor. We categorize our efforts in three areas: magnetohydrodynamic (MHD) equilibria and stability; plasma transport with emphasis on H-mode, divertor, and boundary physics; and radio frequency (RF). The objective of the APP alpha particle diagnostic is to develop diagnostics of fast confined alpha particles using the interactions with the ablation cloud surrounding injected pellets and to develop diagnostic systems for reacting and ignited plasmas. The objective of the APP edge and current density diagnostic is to first develop a lithium beam diagnostic system for edge fluctuation studies on the Texas Experimental Tokamak (TEXT). The objective of the Fusion USC is to continue to provide maintenance and programming support to computer users in the GA fusion community. The detailed progress of each separate program covered in this report period is described.
Fusion enhancement at near and sub-barrier energies in 19O + 12C
Singh, Varinderjit; Vadas, J.; Steinbach, T. K.; ...
2016-12-12
Measuring the fusion excitation function for an isotopic chain of projectile nuclei provides a stringent test of a microscopic description of fusion. We report the first measurement of the fusion excitation function at near-barrier energies for the 19O+ 12C system. The measured excitation function is compared with the fusion excitation function of 18O+ 12C. A significant enhancement in the fusion probability of 19O ions with a 12C target as compared to 18O ions is observed. As a result, the experimental cross-sections observed at near-barrier energies are compared with a state-of-the-art microscopic model.
Wurden, G. A.; Hsu, S. C.; Intrator, T. P.; ...
2015-11-17
In this community white paper, we describe an approach to achieving fusion which employs a hybrid of elements from the traditional magnetic and inertial fusion concepts, called magneto-inertial fusion (MIF). Furthermore, the status of MIF research in North America at multiple institutions is summarized including recent progress, research opportunities, and future plans.
Jain, Nickul S; Lopez, Gregory D; Bederman, S Samuel; Wirth, Garrett A; Scolaro, John A
2016-08-01
High-energy injuries can result in complete or partial loss of the talus. Ipsilateral fractures to the lower limb increase the complexity of surgical management, and treatment is guided by previous case reports of similar injuries. A case of complex lower-extremity trauma with extruded and missing talar body and ipsilateral type IIIB open tibia fracture is presented. Surgical limb reconstruction and salvage was performed successfully with a single orthopaedic implant in a manner not described previously in the literature. The purpose of this case report is to present the novel use of a single orthopaedic implant for treatment of a complex, open traumatic injury. Previous case reports in the literature have described the management of complete or partial talar loss. We describe the novel use of a long hindfoot fusion nail and staged bone grafting to achieve tibiocalcaneal arthrodesis for the treatment of complex lower-extremity trauma. Therapeutic, Level IV: Case study. © 2015 The Author(s).
Membrane fusion and exocytosis.
Jahn, R; Südhof, T C
1999-01-01
Membrane fusion involves the merger of two phospholipid bilayers in an aqueous environment. In artificial lipid bilayers, fusion proceeds by means of defined transition states, including hourglass-shaped intermediates in which the proximal leaflets of the fusing membranes are merged whereas the distal leaflets are separate (fusion stalk), followed by the reversible opening of small aqueous fusion pores. Fusion of biological membranes requires the action of specific fusion proteins. Best understood are the viral fusion proteins that are responsible for merging the viral with the host cell membrane during infection. These proteins undergo spontaneous and dramatic conformational changes upon activation. In the case of the paradigmatic fusion proteins of the influenza virus and of the human immunodeficiency virus, an amphiphilic fusion peptide is inserted into the target membrane. The protein then reorients itself, thus forcing the fusing membranes together and inducing lipid mixing. Fusion of intracellular membranes in eukaryotic cells involves several protein families including SNAREs, Rab proteins, and Sec1/Munc-18 related proteins (SM-proteins). SNAREs form a novel superfamily of small and mostly membrane-anchored proteins that share a common motif of about 60 amino acids (SNARE motif). SNAREs reversibly assemble into tightly packed helical bundles, the core complexes. Assembly is thought to pull the fusing membranes closely together, thus inducing fusion. SM-proteins comprise a family of soluble proteins that bind to certain types of SNAREs and prevent the formation of core complexes. Rab proteins are GTPases that undergo highly regulated GTP-GDP cycles. In their GTP form, they interact with specific proteins, the effector proteins. Recent evidence suggests that Rab proteins function in the initial membrane contact connecting the fusing membranes but are not involved in the fusion reaction itself.
Panagopoulos, Ioannis; Gorunova, Ludmila; Bjerkehagen, Bodil; Heim, Sverre
2014-01-01
Whole transcriptome sequencing was used to study a small round cell tumor in which a t(4;19)(q35;q13) was part of the complex karyotype but where the initial reverse transcriptase PCR (RT-PCR) examination did not detect a CIC-DUX4 fusion transcript previously described as the crucial gene-level outcome of this specific translocation. The RNA sequencing data were analysed using the FusionMap, FusionFinder, and ChimeraScan programs which are specifically designed to identify fusion genes. FusionMap, FusionFinder, and ChimeraScan identified 1017, 102, and 101 fusion transcripts, respectively, but CIC-DUX4 was not among them. Since the RNA sequencing data are in the fastq text-based format, we searched the files using the "grep" command-line utility. The "grep" command searches the text for specific expressions and displays, by default, the lines where matches occur. The "specific expression" was a sequence of 20 nucleotides from the coding part of the last exon 20 of CIC (Reference Sequence: NM_015125.3) chosen since all the so far reported CIC breakpoints have occurred here. Fifteen chimeric CIC-DUX4 cDNA sequences were captured and the fusion between the CIC and DUX4 genes was mapped precisely. New primer combinations were constructed based on these findings and were used together with a polymerase suitable for amplification of GC-rich DNA templates to amplify CIC-DUX4 cDNA fragments which had the same fusion point found with "grep". In conclusion, FusionMap, FusionFinder, and ChimeraScan generated a plethora of fusion transcripts but did not detect the biologically important CIC-DUX4 chimeric transcript; they are generally useful but evidently suffer from imperfect both sensitivity and specificity. The "grep" command is an excellent tool to capture chimeric transcripts from RNA sequencing data when the pathological and/or cytogenetic information strongly indicates the presence of a specific fusion gene.
HIP1-ALK, a novel fusion protein identified in lung adenocarcinoma.
Hong, Mineui; Kim, Ryong Nam; Song, Ji-Young; Choi, So-Jung; Oh, Ensel; Lira, Maruja E; Mao, Mao; Takeuchi, Kengo; Han, Joungho; Kim, Jhingook; Choi, Yoon-La
2014-03-01
The most common mechanism underlying overexpression and activation of anaplastic lymphoma kinase (ALK) in non-small-cell lung carcinoma could be attributed to the formation of a fusion protein. To date, five fusion partners of ALK have been reported, namely, echinoderm microtubule associated protein like 4, tropomyosin-related kinase-fused gene, kinesin family member 5B, kinesin light chain 1, and protein tyrosine phosphatase, nonreceptor type 3. In this article, we report a novel fusion gene huntingtin interacting protein 1 (HIP1)-ALK, which is conjoined between the huntingtin-interacting protein 1 gene HIP1 and ALK. Reverse-transcriptase polymerase chain reaction and immunohistochemical analysis were used to detect this fusion gene's transcript and protein expression, respectively. We had amplified the full-length cDNA sequence of this novel fusion gene by using 5'-rapid amplification of cDNA ends. The causative genomic translocation t(2;7)(p23;q11.23) for generating this novel fusion gene was verified by using genomic sequencing. The examined adenocarcinoma showed predominant acinar pattern, and ALK immunostaining was localized to the cytoplasm, with intense staining in the submembrane region. In break-apart, fluorescence in situ hybridization analysis for ALK, split of the 5' and 3' probe signals, and isolated 3' signals were observed. Reverse-transcriptase polymerase chain reaction revealed that the tumor harbored a novel fusion transcript in which exon 21 of HIP1 was fused to exon 20 of ALK in-frame. The novel fusion gene and its protein HIP1-ALK harboring epsin N-terminal homology, coiled-coil, juxtamembrane, and kinase domains, which could play a role in carcinogenesis, could become diagnostic and therapeutic target of the lung adenocarcinoma and deserve a further study in the future.
Reanalysis of RNA-Sequencing Data Reveals Several Additional Fusion Genes with Multiple Isoforms
Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli
2012-01-01
RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts. PMID:23119097
Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.
Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli
2012-01-01
RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.
A quantitative assay for mitochondrial fusion using Renilla luciferase complementation
Huang, Huiyan; Choi, Seok-Yong; Frohman, Michael A.
2010-01-01
Mitochondria continuously undergo fusion and fission, the relative rates of which define their morphology. Large mitochondria produce energy more efficiently, whereas small mitochondria translocate better to subcellular sites where local production of ATP is acutely required. Mitochondrial fusion is currently assayed by fusing together cells expressing GFP or RFP in their mitochondria and then scoring the frequency of cells with yellow mitochondria (representing fused green and red mitochondria). However, this assay is labor-intensive and only semi-quantitative. We describe here a reporter system consisting of split fragments of Renilla luciferase and YFP fused to mitochondrial matrix-targeting sequences and to leucine zippers to trigger dimerization. The assay enables fusion to be quantitated both visually for individual cells and on a population level using chemiluminescence, laying the foundation for high throughput small molecule and RNAi screens for modulators of mitochondrial fusion. We use the assay to examine cytoskeletal roles in fusion progression. PMID:20488258
A quantitative assay for mitochondrial fusion using Renilla luciferase complementation.
Huang, Huiyan; Choi, Seok-Yong; Frohman, Michael A
2010-08-01
Mitochondria continuously undergo fusion and fission, the relative rates of which define their morphology. Large mitochondria produce energy more efficiently, whereas small mitochondria translocate better to subcellular sites where local production of ATP is acutely required. Mitochondrial fusion is currently assayed by fusing together cells expressing GFP or RFP in their mitochondria and then scoring the frequency of cells with yellow mitochondria (representing fused green and red mitochondria). However, this assay is labor-intensive and only semi-quantitative. We describe here a reporter system consisting of split fragments of Renilla luciferase and YFP fused to mitochondrial matrix-targeting sequences and to leucine zippers to trigger dimerization. The assay enables fusion to be quantitated both visually for individual cells and on a population level using chemiluminescence, laying the foundation for high throughput small molecule and RNAi screens for modulators of mitochondrial fusion. We use the assay to examine cytoskeletal roles in fusion progression. (c) 2010 Mitochondria Research Society. Published by Elsevier B.V. All rights reserved.
Wichita fusion nail for patients with failed total knee arthroplasty and active infection.
Barsoum, Wael K; Hogg, Christopher; Krebs, Viktor; Klika, Alison K
2008-01-01
In the study reported here, we retrospectively evaluated short-term results of knee arthrodesis using the Wichita fusion nail (WFN) in patients with active infection. Clinical examinations, x-rays, time to union, knee pain after fusion, and ambulatory status were compared in 7 patients who received the WFN. Mean fusion rate was 86%, mean time to fusion was 9.8 months, and mean complication rate was 57%. Complication rates were high, but clinical outcomes were acceptable, supporting use of WFN as a reasonable way to salvage failed total knee arthroplasty in patients with active infection.
Fusion energy science: Clean, safe, and abundant energy through innovative science and technology
DOE Office of Scientific and Technical Information (OSTI.GOV)
None
Fusion energy science combines the study of the behavior of plasmas--the state of matter that forms 99% of the visible universe--with a vision of using fusion--the energy source of the stars--to create an affordable, plentiful, and environmentally benign energy source for humankind. The dual nature of fusion energy science provides an unfolding panorama of exciting intellectual challenge and a promise of an attractive energy source for generations to come. The goal of this report is a comprehensive understanding of plasma behavior leading to an affordable and attractive fusion energy source.
Review of the magnetic fusion program by the 1986 ERAB Fusion Panel
NASA Astrophysics Data System (ADS)
Davidson, Ronald C.
1987-09-01
The 1986 ERAB Fusion Panel finds that fusion energy continues to be an attractive energy source with great potential for the future, and that the magnetic fusion program continues to make substantial technical progress. In addition, fusion research advances plasma physics, a sophisticated and useful branch of applied science, as well as technologies important to industry and defense. These factors fully justify the substantial expenditures by the Department of Energy in fusion research and development (R&D). The Panel endorses the overall program direction, strategy, and plans, and recognizes the importance and timeliness of proceeding with a burning plasma experiment, such as the proposed Compact Ignition Tokamak (CIT) experiment.
Watterson, Daniel; Robinson, Jodie; Chappell, Keith J.; Butler, Mark S.; Edwards, David J.; Fry, Scott R.; Bermingham, Imogen M.; Cooper, Matthew A.; Young, Paul R.
2016-01-01
Fusion of the viral envelope with host cell membranes is an essential step in the life cycle of all enveloped viruses. Despite such a clear target for antiviral drug development, few anti-fusion drugs have progressed to market. One significant hurdle is the absence of a generic, high-throughput, reproducible fusion assay. Here we report that real time, label-free measurement of cellular electrical impedance can quantify cell-cell fusion mediated by either individually expressed recombinant viral fusion proteins, or native virus infection. We validated this approach for all three classes of viral fusion and demonstrated utility in quantifying fusion inhibition using antibodies and small molecule inhibitors specific for dengue virus and respiratory syncytial virus. PMID:26976324
Highly efficient gene transfer into adult ventricular myocytes by recombinant adenovirus.
Kirshenbaum, L A; MacLellan, W R; Mazur, W; French, B A; Schneider, M D
1993-01-01
Molecular dissection of mechanisms that govern the differentiated cardiac phenotype has, for cogent technical reasons, largely been undertaken to date in neonatal ventricular myocytes. To circumvent expected limitations of other methods, the present study was initiated to determine whether replication-deficient adenovirus would enable efficient gene transfer to adult cardiac cells in culture. Adult rat ventricular myocytes were infected, 24 h after plating, with adenovirus type 5 containing a cytomegalovirus immediate-early promoter-driven lacZ reporter gene and were assayed for the presence of beta-galactosidase 48 h after infection. The frequency of lacZ+ rod-shaped myocytes was half-maximal at 4 x 10(5) plaque-forming units (PFU) and approached 90% at 1 x 10(8) PFU. Uninfected cells and cells infected with lacZ- virus remained colorless. Beta-galactosidase activity concurred with the proportion of lacZ+ cells and was contingent on the exogenous lacZ gene. At 10(8) PFU/dish, cell number, morphology, and viability each were comparable to uninfected cells. Thus, adult ventricular myocytes are amenable to efficient gene transfer with recombinant adenovirus. The relative uniformity for gene transfer by adenovirus should facilitate tests to determine the impact of putative regulators upon the endogenous genes and gene products of virally modified adult ventricular muscle cells. Images PMID:8326005
Four-corner fusion of the wrist: clinical and radiographic outcome of 31 patients.
Mavrogenis, Andreas F; Flevas, Dimitrios A; Raptis, Konstantinos; Megaloikonomos, Panayiotis D; Igoumenou, Vasilios G; Antoniadou, Thekla; Dimopoulos, Leonidas; Antonopoulos, Dimitrios; Spyridonos, Sarantis G
2016-12-01
Four-corner fusion is a rational surgical option for the management of degenerative conditions of the wrist. Most related studies have compared four-corner fusion with scaphoid excision or proximal row carpectomy, with a variety of reported results. To enhance the literature, we performed this study to evaluate a series of patients with degenerative conditions of the wrist treated with four-corner fusion using 3 surgical techniques and to discuss the clinical and radiographic outcome of the patients. We retrospectively studied 31 patients (24 men, 7 women; mean age, 43 years; 9 heavy manual laborers) who underwent four-corner fusion of their wrists for degenerative conditions from 2005 to 2015. Internal fixation was done using multiple Kirschner wires (14 patients), headless compressive screws (8 patients), or a circular plate (9 patients). Mean follow-up was 4 years (1-11 years). We evaluated the clinical outcome with the Patient-Rated Wrist Evaluation (PRWE) score and fusion with radiographs. All patients experienced improvement of their pain, function, range of motion and grip strength (p < 0.05). Twenty-three patients (74 %) reported no pain, and eight patients reported mild, occasional pain. Twenty-one patients (68 %) were able to do usual and specific activities. Mean wrist motion improved to 70 % and mean grip strength improved to 85 % of opposite wrist. Two heavy manual labor patients requested a job modification because of wrist impairment. Radiographs of the wrist showed fusion of all fused joints in 28 (90.3 %) patients and partial fusion in three patients (9.7 %). No patient with partial fusion required a reoperation for symptomatic nonunion until the period of this study. Three patients experienced complications (10 %). Two patients treated with a circular plate experienced complex regional pain syndrome and painful implant impingement; another patient treated with Kirschner wires and headless compression screws experienced radiolunate
Bell, Diana; Holsinger, Christopher F; El-Naggar, Adel K
2010-12-01
Intraosseous salivary gland carcinomas are extremely rare, comprising only 2% to 3% of all mucoepidermoid carcinomas (MECs) reported. The t(11;19) translocation and its CRTC1/MAML1 fusion transcript have been identified in MEC at different sites and are believed to be associated with the development of a subset of these tumors. However, the status of the fusion transcript has not been reported in intraosseous MEC. Here, we report 3 examples of central MEC of the mandible, including a case with a history of primary retromolar MEC. Reverse transcriptase-polymerase chain reaction and DNA sequencing analyses of the microdissected components of these tumors were used for the detection and verification of the fusion transcript. We identified, for the first time, the t(11;19) fusion gene transcript in central MEC, including in the previous primary retromolar MEC. No fusion transcript was detected in the second primary noncentral MEC or in another central MEC. The results indicate that central MEC can manifest the fusion transcript. This finding may have diagnostic and histogenetic roles in the future analysis of this entity. Published by Elsevier Inc.
Ontological Issues in Higher Levels of Information Fusion: User Refinement of the Fusion Process
2003-01-01
fusion question, the thing that is separates the Greek We explore the higher-level purpose offusion systems by philosophical questions and modem day...the The Greeks focused on both data fusion and the Fusion02 conference there are common fusion questions philosophical questions of an ontology - the...data World of Visible Things Belief (pistis) fusion - user refinement. The rest of the paper is as Appearances follows: Section 2 details the Greek
Distinct Requirements for HIV-Cell Fusion and HIV-mediated Cell-Cell Fusion*
Kondo, Naoyuki; Marin, Mariana; Kim, Jeong Hwa; Desai, Tanay M.; Melikyan, Gregory B.
2015-01-01
Whether HIV-1 enters cells by fusing with the plasma membrane or with endosomes is a subject of active debate. The ability of HIV-1 to mediate fusion between adjacent cells, a process referred to as “fusion-from-without” (FFWO), shows that this virus can fuse with the plasma membrane. To compare FFWO occurring at the cell surface with HIV-cell fusion through a conventional entry route, we designed an experimental approach that enabled the measurements of both processes in the same sample. The following key differences were observed. First, a very small fraction of viruses fusing with target cells participated in FFWO. Second, whereas HIV-1 fusion with adherent cells was insensitive to actin inhibitors, post-CD4/coreceptor binding steps during FFWO were abrogated. A partial dependence of HIV-cell fusion on actin remodeling was observed in CD4+ T cells, but this effect appeared to be due to the actin dependence of virus uptake. Third, deletion of the cytoplasmic tail of HIV-1 gp41 dramatically enhanced the ability of the virus to promote FFWO, while having a modest effect on virus-cell fusion. Distinct efficiencies and actin dependences of FFWO versus HIV-cell fusion are consistent with the notion that, except for a minor fraction of particles that mediate fusion between the plasma membranes of adjacent cells, HIV-1 enters through an endocytic pathway. We surmise, however, that cell-cell contacts enabling HIV-1 fusion with the plasma membrane could be favored at the sites of high density of target cells, such as lymph nodes. PMID:25589785
Comparison of interbody fusion approaches for disabling low back pain.
Hacker, R J
1997-03-15
This is a study comparing two groups of patients surgically treated for disabling low back pain. One group was treated with lumbar anteroposterior fusion (360 degrees fusion), the other with posterior lumbar interbody fusion and an interbody fixation device. To determine which approach provided the best and most cost-effective outcome using similar patient selection criteria. Others have shown that certain patients with disabling low back pain benefit from lumbar fusion. Although rarely reported, the costs of different surgical treatments appear to vary significantly, whereas the patient outcome may vary little. Since 1991, 75 patients have been treated Starting in 1993, posterior lumbar interbody fusion BAK was offered to patients as an alternative to 360 degrees fusion. The treating surgeon reviewed the cases. The interbody fixation device used (BAK; Spine-Tech, Inc., Minneapolis, MN) was part of a Food and Drug Administration study. Patient selection criteria included examination, response to conservative therapy, imaging, psychological profile, and discography. North American Spine Society outcome questionnaires, BAK investigation data radiographs, chart entries, billing records and patient interviews were the basis for assessment. Age, sex compensable injury history and history of previous surgery were similar. Operative time; blood loss, hospitalization time, and total costs were significantly different. There was a quicker return to work and closure of workers compensation claims for the posterior lumbar interbody fusion-BAK group. Patient satisfaction was comparable at last follow-up. Posterior lumbar interbody fusion-BAK achieves equal patient satisfaction but fiscally surpasses the 360 degrees fusion approach. Today's environment of regulated medical practice requires the surgeon to consider cost effectiveness when performing fusion for low back pain.
Lateral Membrane Heterogeneity Regulates Viral-Induced Membrane Fusion during HIV Entry
Molotkovsky, Rodion J.; Alexandrova, Veronika V.; Galimzyanov, Timur R.; Jiménez-Munguía, Irene; Pavlov, Konstantin V.; Akimov, Sergey A.
2018-01-01
Sphingomyelin- and cholesterol- enriched membrane domains, commonly referred to as “rafts” play a crucial role in a large number of intra- and intercellular processes. Recent experiments suggest that not only the volumetric inhomogeneity of lipid distribution in rafts, but also the arrangement of the 1D boundary between the raft and the surrounding membrane is important for the membrane-associated processes. The reason is that the boundary preferentially recruits different peptides, such as HIV (human immunodeficiency virus) fusion peptide. In the present work, we report a theoretical investigation of mechanisms of influence of the raft boundary arrangement upon virus-induced membrane fusion. We theoretically predict that the raft boundary can act as an attractor for viral fusion peptides, which preferentially distribute into the vicinity of the boundary, playing the role of ‘line active components’ of the membrane (‘linactants’). We have calculated the height of the fusion energy barrier and demonstrated that, in the case of fusion between HIV membrane and the target cell, presence of the raft boundary in the vicinity of the fusion site facilitates fusion. The results we obtained can be further generalized to be applicable to other enveloped viruses. PMID:29772704
Lateral Membrane Heterogeneity Regulates Viral-Induced Membrane Fusion during HIV Entry.
Molotkovsky, Rodion J; Alexandrova, Veronika V; Galimzyanov, Timur R; Jiménez-Munguía, Irene; Pavlov, Konstantin V; Batishchev, Oleg V; Akimov, Sergey A
2018-05-16
Sphingomyelin- and cholesterol- enriched membrane domains, commonly referred to as "rafts" play a crucial role in a large number of intra- and intercellular processes. Recent experiments suggest that not only the volumetric inhomogeneity of lipid distribution in rafts, but also the arrangement of the 1D boundary between the raft and the surrounding membrane is important for the membrane-associated processes. The reason is that the boundary preferentially recruits different peptides, such as HIV (human immunodeficiency virus) fusion peptide. In the present work, we report a theoretical investigation of mechanisms of influence of the raft boundary arrangement upon virus-induced membrane fusion. We theoretically predict that the raft boundary can act as an attractor for viral fusion peptides, which preferentially distribute into the vicinity of the boundary, playing the role of 'line active components' of the membrane ('linactants'). We have calculated the height of the fusion energy barrier and demonstrated that, in the case of fusion between HIV membrane and the target cell, presence of the raft boundary in the vicinity of the fusion site facilitates fusion. The results we obtained can be further generalized to be applicable to other enveloped viruses.
Seaman, Scott; Kerezoudis, Panagiotis; Bydon, Mohamad; Torner, James C; Hitchon, Patrick W
2017-10-01
Spinal interbody fusion is a standard and accepted method for spinal fusion. Interbody fusion devices include titanium (Ti) and polyetheretherketone (PEEK) cages with distinct biomechanical properties. Titanium and PEEK cages have been evaluated in the cervical and lumbar spine, with conflicting results in bony fusion and subsidence. Using Preferred Reporting Items for Systematic reviews and Meta-analyses (PRISMA) guidelines, we reviewed the available literature evaluating Ti and PEEK cages to assess subsidence and fusion rates. Six studies were included in the analysis, 3 of which were class IV evidence, 2 were class III, and 1 was class II. A total of 410 patients (Ti-228, PEEK-182) and 587 levels (Ti-327, PEEK-260) were studied. Pooled mean age was 50.8years in the Ti group, and 53.1years in the PEEK group. Anterior cervical discectomy was performed in 4 studies (395 levels) and transforaminal interbody fusion in 2 studies (192 levels). No statistically significant difference was found between groups with fusion (OR 1.16, 95% C.I 0.59-2.89, p=0.686, I 2 =49.7%) but there was a statistically significant the rate of subsidence with titanium (OR 3.59, 95% C.I 1.28-10.07, p=0.015, I 2 =56.9%) at last follow-up. Titanium and PEEK cages are associated with a similar rate of fusion, but there is an increased rate of subsidence with titanium cage. Future prospective randomized controlled trials are needed to further evaluate these cages using surgical and patient-reported outcomes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Technologies for Army Knowledge Fusion
2004-09-01
interpret it in context and understand the implications (Alberts et al., 2002). Note that the knowledge / information fusion issue arises immediately here...Army Knowledge Fusion Richard Scherl Department of Computer Science Monmouth University Dana L. Ulery Computational and Information Sciences...civilian and military sources. Knowledge fusion, also called information fusion and multisensor data fusion, names the body of techniques needed to
Influence of incomplete fusion on complete fusion at energies above the Coulomb barrier
NASA Astrophysics Data System (ADS)
Shuaib, Mohd; Sharma, Vijay R.; Yadav, Abhishek; Sharma, Manoj Kumar; Singh, Pushpendra P.; Singh, Devendra P.; Kumar, R.; Singh, R. P.; Muralithar, S.; Singh, B. P.; Prasad, R.
2017-10-01
In the present work, excitation functions of several reaction residues in the system 19F+169Tm, populated via the complete and incomplete fusion processes, have been measured using off-line γ-ray spectroscopy. The analysis of excitation functions has been done within the framework of statistical model code pace4. The excitation functions of residues populated via xn and pxn channels are found to be in good agreement with those estimated by the theoretical model code, which confirms the production of these residues solely via complete fusion process. However, a significant enhancement has been observed in the cross-sections of residues involving α-emitting channels as compared to the theoretical predictions. The observed enhancement in the cross-sections has been attributed to the incomplete fusion processes. In order to have a better insight into the onset and strength of incomplete fusion, the incomplete fusion strength function has been deduced. At present, there is no theoretical model available which can satisfactorily explain the incomplete fusion reaction data at energies ≈4-6 MeV/nucleon. In the present work, the influence of incomplete fusion on complete fusion in the 19F+169Tm system has also been studied. The measured cross-section data may be important for the development of reactor technology as well. It has been found that the incomplete fusion strength function strongly depends on the α-Q value of the projectile, which is found to be in good agreement with the existing literature data. The analysis strongly supports the projectile-dependent mass-asymmetry systematics. In order to study the influence of Coulomb effect ({Z}{{P}}{Z}{{T}}) on incomplete fusion, the deduced strength function for the present work is compared with the nearby projectile-target combinations. The incomplete fusion strength function is found to increase linearly with {Z}{{P}}{Z}{{T}}, indicating a strong influence of Coulomb effect in the incomplete fusion reactions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zylstra, A. B.; Frenje, J. A.; Gatu Johnson, M.
Few-body nuclear physics often relies upon phenomenological models, with new efforts at the ab initio theory reported recently; both need high-quality benchmark data, particularly at low center-of-mass energies. We use high-energy-density plasmas to measure the proton spectra from 3He + T and 3He + 3He fusion. The data disagree with R -matrix predictions constrained by neutron spectra from T + T fusion. Here, we present a new analysis of the 3He + 3He proton spectrum; these benchmarked spectral shapes should be used for interpreting low-resolution data, such as solar fusion cross-section measurements.
NASA Astrophysics Data System (ADS)
Zylstra, A. B.; Frenje, J. A.; Gatu Johnson, M.; Hale, G. M.; Brune, C. R.; Bacher, A.; Casey, D. T.; Li, C. K.; McNabb, D.; Paris, M.; Petrasso, R. D.; Sangster, T. C.; Sayre, D. B.; Séguin, F. H.
2017-12-01
Few-body nuclear physics often relies upon phenomenological models, with new efforts at the ab initio theory reported recently; both need high-quality benchmark data, particularly at low center-of-mass energies. We use high-energy-density plasmas to measure the proton spectra from 3He +T and 3He + 3He fusion. The data disagree with R -matrix predictions constrained by neutron spectra from T +T fusion. We present a new analysis of the 3He + 3He 3 proton spectrum; these benchmarked spectral shapes should be used for interpreting low-resolution data, such as solar fusion cross-section measurements.
Zylstra, A. B.; Frenje, J. A.; Gatu Johnson, M.; ...
2017-11-29
Few-body nuclear physics often relies upon phenomenological models, with new efforts at the ab initio theory reported recently; both need high-quality benchmark data, particularly at low center-of-mass energies. We use high-energy-density plasmas to measure the proton spectra from 3He + T and 3He + 3He fusion. The data disagree with R -matrix predictions constrained by neutron spectra from T + T fusion. Here, we present a new analysis of the 3He + 3He proton spectrum; these benchmarked spectral shapes should be used for interpreting low-resolution data, such as solar fusion cross-section measurements.
Ahluwalia, Puneet; Nair, Balagopal; Kumar, Ginil
2013-01-01
Introduction. The recently recognized renal cell carcinomas associated with Xp11.2 translocations are rare tumors predominantly reported in children. Chromosome Xp11.2 translocation results in gene fusion related to transcription factor E3 (TFE3) that plays an important role in proliferation and survival. Case Report. Herein, we present two cases of a TFE3 translocation-associated RCC in young female adults, one detected incidentally and the other one presenting with gross hematuria. Tumor is characterized by immunohistochemistry and a literature review with optimal treatment regimen is presented. Discussion. Xp11.2 translocation RCCs in adult patients are associated with advanced stages, large tumors, and extracapsular disease and usually have an aggressive clinical course. Conclusion. In TFE3 RCC, the genetic background may not only contribute to tumorigenesis, but also determine the response to chemotherapy and targeted therapy. Therefore it is necessary to diagnose this tumor entity accurately. Because of the small number of TFE3 gene fusion-related renal tumors described in the literature, the exact biologic behavior and impact of current treatment modalities remain to be uncertain.
Ahluwalia, Puneet; Nair, Balagopal; Kumar, Ginil
2013-01-01
Introduction. The recently recognized renal cell carcinomas associated with Xp11.2 translocations are rare tumors predominantly reported in children. Chromosome Xp11.2 translocation results in gene fusion related to transcription factor E3 (TFE3) that plays an important role in proliferation and survival. Case Report. Herein, we present two cases of a TFE3 translocation-associated RCC in young female adults, one detected incidentally and the other one presenting with gross hematuria. Tumor is characterized by immunohistochemistry and a literature review with optimal treatment regimen is presented. Discussion. Xp11.2 translocation RCCs in adult patients are associated with advanced stages, large tumors, and extracapsular disease and usually have an aggressive clinical course. Conclusion. In TFE3 RCC, the genetic background may not only contribute to tumorigenesis, but also determine the response to chemotherapy and targeted therapy. Therefore it is necessary to diagnose this tumor entity accurately. Because of the small number of TFE3 gene fusion-related renal tumors described in the literature, the exact biologic behavior and impact of current treatment modalities remain to be uncertain. PMID:24455396
Local-global classifier fusion for screening chest radiographs
NASA Astrophysics Data System (ADS)
Ding, Meng; Antani, Sameer; Jaeger, Stefan; Xue, Zhiyun; Candemir, Sema; Kohli, Marc; Thoma, George
2017-03-01
Tuberculosis (TB) is a severe comorbidity of HIV and chest x-ray (CXR) analysis is a necessary step in screening for the infective disease. Automatic analysis of digital CXR images for detecting pulmonary abnormalities is critical for population screening, especially in medical resource constrained developing regions. In this article, we describe steps that improve previously reported performance of NLM's CXR screening algorithms and help advance the state of the art in the field. We propose a local-global classifier fusion method where two complementary classification systems are combined. The local classifier focuses on subtle and partial presentation of the disease leveraging information in radiology reports that roughly indicates locations of the abnormalities. In addition, the global classifier models the dominant spatial structure in the gestalt image using GIST descriptor for the semantic differentiation. Finally, the two complementary classifiers are combined using linear fusion, where the weight of each decision is calculated by the confidence probabilities from the two classifiers. We evaluated our method on three datasets in terms of the area under the Receiver Operating Characteristic (ROC) curve, sensitivity, specificity and accuracy. The evaluation demonstrates the superiority of our proposed local-global fusion method over any single classifier.
Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W
1992-01-01
Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.
Fusion Science Education Outreach
NASA Astrophysics Data System (ADS)
Danielson, C. A.; DIII-D Education Group
1996-11-01
This presentation will focus on education outreach activities at General Atomics that have been expanded to include the general population on science education with a focus on fusion energy. Outreach materials are distributed upon request both nationally and internationally. These materials include a notebook containing copies of DIII--D tour panels, fusion poster, new fusion energy video, new fusion energy brochure, and the electromagnetic spectrum curriculum. The 1996 Fusion Forum (held in the House Caucus Room) included a student/ teacher lunch with Energy Secretary Hazel O'Leary and a private visit to the Forum exhibits. The continuing partnership with Kearny High School includes lectures, job shadowing, internship, equipment donations and an award-winning electric car-racing program. Development of distribution by CD of the existing interactive fusion energy kiosk and a virtual reality tour of the DIII--D facility are underway. The DIII--D fusion education WWW site includes e-mail addresses to ``Ask the Wizard,'' and/or receive GA's outreach materials. Steve Rodecker, a local science teacher, aided by DIII--D fusion staff, won his second Tapestry Award; he also was named the ``1995 National Science Teacher of the Year'' and will be present to share his experiences with the DIII--D educational outreach program.
NASA Astrophysics Data System (ADS)
Ogawa, Yuichi
2016-05-01
A new strategic energy plan decided by the Japanese Cabinet in 2014 strongly supports the steady promotion of nuclear fusion development activities, including the ITER project and the Broader Approach activities from the long-term viewpoint. Atomic Energy Commission (AEC) in Japan formulated the Third Phase Basic Program so as to promote an experimental fusion reactor project. In 2005 AEC has reviewed this Program, and discussed on selection and concentration among many projects of fusion reactor development. In addition to the promotion of ITER project, advanced tokamak research by JT-60SA, helical plasma experiment by LHD, FIREX project in laser fusion research and fusion engineering by IFMIF were highly prioritized. Although the basic concept is quite different between tokamak, helical and laser fusion researches, there exist a lot of common features such as plasma physics on 3-D magnetic geometry, high power heat load on plasma facing component and so on. Therefore, a synergetic scenario on fusion reactor development among various plasma confinement concepts would be important.
Dual wavelength imaging allows analysis of membrane fusion of influenza virus inside cells.
Sakai, Tatsuya; Ohuchi, Masanobu; Imai, Masaki; Mizuno, Takafumi; Kawasaki, Kazunori; Kuroda, Kazumichi; Yamashina, Shohei
2006-02-01
Influenza virus hemagglutinin (HA) is a determinant of virus infectivity. Therefore, it is important to determine whether HA of a new influenza virus, which can potentially cause pandemics, is functional against human cells. The novel imaging technique reported here allows rapid analysis of HA function by visualizing viral fusion inside cells. This imaging was designed to detect fusion changing the spectrum of the fluorescence-labeled virus. Using this imaging, we detected the fusion between a virus and a very small endosome that could not be detected previously, indicating that the imaging allows highly sensitive detection of viral fusion.
Solid radiographic fusion with a nonconstrained device 5 years after cervical arthroplasty.
Heary, Robert F; Goldstein, Ira M; Getto, Katarzyna M; Agarwal, Nitin
2014-12-01
Cervical disc arthroplasty (CDA) has been gaining popularity as a surgical alternative to anterior cervical discectomy and fusion. Spontaneous fusion following a CDA is uncommon. A few anecdotal reports of heterotrophic ossification around the implant sites have been noted for the BRYAN, ProDisc-C, Mobi-C, PRESTIGE, and PCM devices. All CDA fusions reported to date have been in devices that are semiconstrained. The authors reported the case of a 56-year-old man who presented with left C-7 radiculopathy and neck pain for 10 weeks after an assault injury. There was evidence of disc herniation at the C6-7 level. He was otherwise healthy with functional scores on the visual analog scale (VAS, 4.2); neck disability index (NDI, 16); and the 36-item short form health survey (SF-36; physical component summary [PSC] score 43 and mental component summary [MCS] score 47). The patient underwent total disc replacement in which the DISCOVER Artificial Cervical Disc (DePuy Spine, Inc.) was used. The patient was seen at regular follow-up visits up to 60 months. At his 60-month follow-up visit, he had complete radiographic fusion at the C6-7 level with bridging trabecular bone and no motion at the index site on dynamic imaging. He was pain free, with a VAS score of 0, NDI score of 0, and SF-36 PCS and MCS scores of 61 and 55, respectively. Conclusions This is the first case report that identifies the phenomenon of fusion around a nonconstrained cervical prosthesis. Despite this unwanted radiographic outcome, the patient's clinical outcome was excellent.
AxiaLIF system: minimally invasive device for presacral lumbar interbody spinal fusion
Rapp, Steven M; Miller, Larry E; Block, Jon E
2011-01-01
Lumbar fusion is commonly performed to alleviate chronic low back and leg pain secondary to disc degeneration, spondylolisthesis with or without concomitant lumbar spinal stenosis, or chronic lumbar instability. However, the risk of iatrogenic injury during traditional anterior, posterior, and transforaminal open fusion surgery is significant. The axial lumbar interbody fusion (AxiaLIF) system is a minimally invasive fusion device that accesses the lumbar (L4–S1) intervertebral disc spaces via a reproducible presacral approach that avoids critical neurovascular and musculoligamentous structures. Since the AxiaLIF system received marketing clearance from the US Food and Drug Administration in 2004, clinical studies of this device have reported high fusion rates without implant subsidence, significant improvements in pain and function, and low complication rates. This paper describes the design and approach of this lumbar fusion system, details the indications for use, and summarizes the clinical experience with the AxiaLIF system to date. PMID:22915939
AxiaLIF system: minimally invasive device for presacral lumbar interbody spinal fusion.
Rapp, Steven M; Miller, Larry E; Block, Jon E
2011-01-01
Lumbar fusion is commonly performed to alleviate chronic low back and leg pain secondary to disc degeneration, spondylolisthesis with or without concomitant lumbar spinal stenosis, or chronic lumbar instability. However, the risk of iatrogenic injury during traditional anterior, posterior, and transforaminal open fusion surgery is significant. The axial lumbar interbody fusion (AxiaLIF) system is a minimally invasive fusion device that accesses the lumbar (L4-S1) intervertebral disc spaces via a reproducible presacral approach that avoids critical neurovascular and musculoligamentous structures. Since the AxiaLIF system received marketing clearance from the US Food and Drug Administration in 2004, clinical studies of this device have reported high fusion rates without implant subsidence, significant improvements in pain and function, and low complication rates. This paper describes the design and approach of this lumbar fusion system, details the indications for use, and summarizes the clinical experience with the AxiaLIF system to date.
Multispectral multisensor image fusion using wavelet transforms
Lemeshewsky, George P.
1999-01-01
Fusion techniques can be applied to multispectral and higher spatial resolution panchromatic images to create a composite image that is easier to interpret than the individual images. Wavelet transform-based multisensor, multiresolution fusion (a type of band sharpening) was applied to Landsat thematic mapper (TM) multispectral and coregistered higher resolution SPOT panchromatic images. The objective was to obtain increased spatial resolution, false color composite products to support the interpretation of land cover types wherein the spectral characteristics of the imagery are preserved to provide the spectral clues needed for interpretation. Since the fusion process should not introduce artifacts, a shift invariant implementation of the discrete wavelet transform (SIDWT) was used. These results were compared with those using the shift variant, discrete wavelet transform (DWT). Overall, the process includes a hue, saturation, and value color space transform to minimize color changes, and a reported point-wise maximum selection rule to combine transform coefficients. The performance of fusion based on the SIDWT and DWT was evaluated with a simulated TM 30-m spatial resolution test image and a higher resolution reference. Simulated imagery was made by blurring higher resolution color-infrared photography with the TM sensors' point spread function. The SIDWT based technique produced imagery with fewer artifacts and lower error between fused images and the full resolution reference. Image examples with TM and SPOT 10-m panchromatic illustrate the reduction in artifacts due to the SIDWT based fusion.
Control of mechanically activated polymersome fusion: Factors affecting fusion
Henderson, Ian M.; Paxton, Walter F.
2014-12-15
Previously we have studied the mechanically-activated fusion of extruded (200 nm) polymer vesicles into giant polymersomes using agitation in the presence of salt. In this study we have investigated several factors contributing to this phenomenon, including the effects of (i) polymer vesicle concentration, (ii) agitation speed and duration, and iii) variation of the salt and its concentration. It was found that increasing the concentration of the polymer dramatically increases the production of giant vesicles through the increased collisions of polymersomes. Our investigations also found that increasing the frequency of agitation increased the efficiency of fusion, though ultimately limited the sizemore » of vesicle which could be produced due to the high shear involved. Finally it was determined that salt-mediation of the fusion process was not limited to NaCl, but is instead a general effect facilitated by the presence of solvated ionic compounds, albeit with different salts initiating fusion at different concentration.« less
Repression of choline kinase by inositol and choline in Saccharomyces cerevisiae.
Hosaka, K; Murakami, T; Kodaki, T; Nikawa, J; Yamashita, S
1990-01-01
The regulation of choline kinase (EC 2.7.1.32), the initial enzyme in the CDP-choline pathway, was examined in Saccharomyces cerevisiae. The addition of myo-inositol to a culture of wild-type cells resulted in a significant decrease in choline kinase activity. Additional supplementation of choline caused a further reduction in the activity. The coding frame of the choline kinase gene, CK1, was joined to the carboxyl terminus of lacZ and expressed in Escherichia coli as a fusion protein, which was then used to prepare an anti-choline kinase antibody. Upon Western (immuno-) and Northern (RNA) blot analyses using the antibody and a CK1 probe, respectively, the decrease in the enzyme activity was found to be correlated with decreases in the enzyme amount and mRNA abundance. The molecular mass of the enzyme was estimated to be 66 kilodaltons, in agreement with the value predicted previously from the nucleotide sequence of the gene. The coding region of CK1 was replaced with that of lacZ, and CK1 expression was measured by assaying beta-galactosidase. The expression of beta-galactosidase from this fusion was repressed by myo-inositol and choline and derepressed in a time-dependent manner upon their removal. The present findings indicate that yeast choline kinase is regulated by myo-inositol and choline at the level of mRNA abundance. Images FIG. 3 FIG. 4 PMID:2156807
A Narrative Review of Lumbar Fusion Surgery With Relevance to Chiropractic Practice.
Daniels, Clinton J; Wakefield, Pamela J; Bub, Glenn A; Toombs, James D
2016-12-01
The purpose of this narrative review was to describe the most common spinal fusion surgical procedures, address the clinical indications for lumbar fusion in degeneration cases, identify potential complications, and discuss their relevance to chiropractic management of patients after surgical fusion. The PubMed database was searched from the beginning of the record through March 31, 2015, for English language articles related to lumbar fusion or arthrodesis or both and their incidence, procedures, complications, and postoperative chiropractic cases. Articles were retrieved and evaluated for relevance. The bibliographies of selected articles were also reviewed. The most typical lumbar fusion procedures are posterior lumbar interbody fusion, anterior lumbar interbody fusion, transforaminal interbody fusion, and lateral lumbar interbody fusion. Fair level evidence supports lumbar fusion procedures for degenerative spondylolisthesis with instability and for intractable low back pain that has failed conservative care. Complications and development of chronic pain after surgery is common, and these patients frequently present to chiropractic physicians. Several reports describe the potential benefit of chiropractic management with spinal manipulation, flexion-distraction manipulation, and manipulation under anesthesia for postfusion low back pain. There are no published experimental studies related specifically to chiropractic care of postfusion low back pain. This article describes the indications for fusion, common surgical practice, potential complications, and relevant published chiropractic literature. This review includes 10 cases that showed positive benefits from chiropractic manipulation, flexion-distraction, and/or manipulation under anesthesia for postfusion lumbar pain. Chiropractic care may have a role in helping patients in pain who have undergone lumbar fusion surgery.
Near-real-time data fusion, phase 2
DOT National Transportation Integrated Search
1999-10-01
Report developed under SBIR contract for topic N93-084. In Phase I of this project, we explored several different approaches to Near-Real-Time Data Fusion (NRTDF), and in Phase II we developed the most promising architecture into a prototype NRTDF sy...
NASA Technical Reports Server (NTRS)
Pavel, M.
1993-01-01
The topics covered include the following: a system overview of the basic components of a system designed to improve the ability of a pilot to fly through low-visibility conditions such as fog; the role of visual sciences; fusion issues; sensor characterization; sources of information; image processing; and image fusion.
NASA Astrophysics Data System (ADS)
Meade, Dale
2010-01-01
Fusion energy research began in the early 1950s as scientists worked to harness the awesome power of the atom for peaceful purposes. There was early optimism for a quick solution for fusion energy as there had been for fission. However, this was soon tempered by reality as the difficulty of producing and confining fusion fuel at temperatures of 100 million °C in the laboratory was appreciated. Fusion research has followed two main paths—inertial confinement fusion and magnetic confinement fusion. Over the past 50 years, there has been remarkable progress with both approaches, and now each has a solid technical foundation that has led to the construction of major facilities that are aimed at demonstrating fusion energy producing plasmas.
Entropic forces drive self-organization and membrane fusion by SNARE proteins
Stratton, Benjamin S.; Warner, Jason M.; Rothman, James E.; O’Shaughnessy, Ben
2017-01-01
SNARE proteins are the core of the cell’s fusion machinery and mediate virtually all known intracellular membrane fusion reactions on which exocytosis and trafficking depend. Fusion is catalyzed when vesicle-associated v-SNAREs form trans-SNARE complexes (“SNAREpins”) with target membrane-associated t-SNAREs, a zippering-like process releasing ∼65 kT per SNAREpin. Fusion requires several SNAREpins, but how they cooperate is unknown and reports of the number required vary widely. To capture the collective behavior on the long timescales of fusion, we developed a highly coarse-grained model that retains key biophysical SNARE properties such as the zippering energy landscape and the surface charge distribution. In simulations the ∼65-kT zippering energy was almost entirely dissipated, with fully assembled SNARE motifs but uncomplexed linker domains. The SNAREpins self-organized into a circular cluster at the fusion site, driven by entropic forces that originate in steric–electrostatic interactions among SNAREpins and membranes. Cooperative entropic forces expanded the cluster and pulled the membranes together at the center point with high force. We find that there is no critical number of SNAREs required for fusion, but instead the fusion rate increases rapidly with the number of SNAREpins due to increasing entropic forces. We hypothesize that this principle finds physiological use to boost fusion rates to meet the demanding timescales of neurotransmission, exploiting the large number of v-SNAREs available in synaptic vesicles. Once in an unfettered cluster, we estimate ≥15 SNAREpins are required for fusion within the ∼1-ms timescale of neurotransmitter release. PMID:28490503
Anterior lumbar fusion with titanium threaded and mesh interbody cages.
Rauzzino, M J; Shaffrey, C I; Nockels, R P; Wiggins, G C; Rock, J; Wagner, J
1999-12-15
The authors report their experience with 42 patients in whom anterior lumbar fusion was performed using titanium cages as a versatile adjunct to treat a wide variety of spinal deformity and pathological conditions. These conditions included congenital, degenerative, iatrogenic, infectious, traumatic, and malignant disorders of the thoracolumbar spine. Fusion rates and complications are compared with data previously reported in the literature. Between July 1996 and July 1999 the senior authors (C.I.S., R.P.N., and M.J.R.) treated 42 patients by means of a transabdominal extraperitoneal (13 cases) or an anterolateral extraperitoneal approach (29 cases), 51 vertebral levels were fused using titanium cages packed with autologous bone. All vertebrectomies (27 cases) were reconstructed using a Miami Moss titanium mesh cage and Kaneda instrumentation. Interbody fusion (15 cases) was performed with either the BAK titanium threaded interbody cage (in 13 patients) or a Miami Moss titanium mesh cage (in two patients). The average follow-up period was 14.3 months. Seventeen patients had sustained a thoracolumbar burst fracture, 12 patients presented with degenerative spinal disorders, six with metastatic tumor, four with spinal deformity (one congenital and three iatrogenic), and three patients presented with spinal infections. In five patients anterior lumbar interbody fusion (ALIF) was supplemented with posterior segmental fixation at the time of the initial procedure. Of the 51 vertebral levels treated, solid arthrodesis was achieved in 49, a 96% fusion rate. One case of pseudarthrosis occurred in the group treated with BAK cages; the diagnosis was made based on the patient's continued mechanical back pain after undergoing L4-5 ALIF. The patient was treated with supplemental posterior fixation, and successful fusion occurred uneventfully with resolution of her back pain. In the group in which vertebrectomy was performed there was one case of fusion failure in a patient with
Condorcet and borda count fusion method for ligand-based virtual screening.
Ahmed, Ali; Saeed, Faisal; Salim, Naomie; Abdo, Ammar
2014-01-01
It is known that any individual similarity measure will not always give the best recall of active molecule structure for all types of activity classes. Recently, the effectiveness of ligand-based virtual screening approaches can be enhanced by using data fusion. Data fusion can be implemented using two different approaches: group fusion and similarity fusion. Similarity fusion involves searching using multiple similarity measures. The similarity scores, or ranking, for each similarity measure are combined to obtain the final ranking of the compounds in the database. The Condorcet fusion method was examined. This approach combines the outputs of similarity searches from eleven association and distance similarity coefficients, and then the winner measure for each class of molecules, based on Condorcet fusion, was chosen to be the best method of searching. The recall of retrieved active molecules at top 5% and significant test are used to evaluate our proposed method. The MDL drug data report (MDDR), maximum unbiased validation (MUV) and Directory of Useful Decoys (DUD) data sets were used for experiments and were represented by 2D fingerprints. Simulated virtual screening experiments with the standard two data sets show that the use of Condorcet fusion provides a very simple way of improving the ligand-based virtual screening, especially when the active molecules being sought have a lowest degree of structural heterogeneity. However, the effectiveness of the Condorcet fusion was increased slightly when structural sets of high diversity activities were being sought.
Condorcet and borda count fusion method for ligand-based virtual screening
2014-01-01
Background It is known that any individual similarity measure will not always give the best recall of active molecule structure for all types of activity classes. Recently, the effectiveness of ligand-based virtual screening approaches can be enhanced by using data fusion. Data fusion can be implemented using two different approaches: group fusion and similarity fusion. Similarity fusion involves searching using multiple similarity measures. The similarity scores, or ranking, for each similarity measure are combined to obtain the final ranking of the compounds in the database. Results The Condorcet fusion method was examined. This approach combines the outputs of similarity searches from eleven association and distance similarity coefficients, and then the winner measure for each class of molecules, based on Condorcet fusion, was chosen to be the best method of searching. The recall of retrieved active molecules at top 5% and significant test are used to evaluate our proposed method. The MDL drug data report (MDDR), maximum unbiased validation (MUV) and Directory of Useful Decoys (DUD) data sets were used for experiments and were represented by 2D fingerprints. Conclusions Simulated virtual screening experiments with the standard two data sets show that the use of Condorcet fusion provides a very simple way of improving the ligand-based virtual screening, especially when the active molecules being sought have a lowest degree of structural heterogeneity. However, the effectiveness of the Condorcet fusion was increased slightly when structural sets of high diversity activities were being sought. PMID:24883114
Ellisor, Debra; Koveal, Dorothy; Hagan, Nellwyn; Brown, Ashly; Zervas, Mark
2009-10-01
A long-standing problem in development is understanding how progenitor cells transiently expressing genes contribute to complex anatomical and functional structures. In the developing nervous system an additional level of complexity arises when considering how cells of distinct lineages relate to newly established neural circuits. To address these problems, we used both cumulative marking with Cre/loxP and Genetic Inducible Fate Mapping (GIFM), which permanently and heritably marks small populations of progenitors and their descendants with fine temporal control using CreER/loxP. A key component used in both approaches is a conditional phenotyping allele that has the potential to be expressed in all cell types, but is quiescent because of a loxP flanked Stop sequence, which precedes a reporter allele. Upon recombination, the resulting phenotyping allele is 'turned on' and then constitutively expressed. Thus, the reporter functions as a high fidelity genetic lineage tracer in vivo. Currently there is an array of reporter alleles that can be used in marking strategies, but their recombination efficiency and applicability to a wide array of tissues has not been thoroughly described. To assess the recombination/marking potential of the reporters, we utilized CreER(T) under the control of a Wnt1 transgene (Wnt1-CreER(T)) as well as a cumulative, non-inducible En1(Cre) knock-in line in combination with three different reporters: R26R (LacZ reporter), Z/EG (EGFP reporter), and Tau-Lox-STOP-Lox-mGFP-IRES-NLS-LacZ (membrane-targeted GFP/nuclear LacZ reporter). We marked the Wnt1 lineage using each of the three reporters at embryonic day (E) 8.5 followed by analysis at E10.0, E12.5, and in the adult. We also compared cumulative marking of cells with a history of En1 expression at the same stages. We evaluated the reporters by whole-mount and section analysis and ascertained the strengths and weaknesses of each of the reporters. Comparative analysis with the reporters
Jiang, Quan; Tong, Han-Xing; Hou, Ying-Yong; Zhang, Yong; Li, Jing-Lei; Zhou, Yu-Hong; Xu, Jing; Wang, Jiong-Yuan; Lu, Wei-Qi
2017-05-23
Known as solid tumors of intermediate malignant potential, most inflammatory myofibroblastic tumors (IMTs) are treatable as long as the tumor is en-bloc resected. However, in some cases, the tumors have recurred and grown rapidly after successful surgery. Some of these tumors were classified as an epithelioid inflammatory myofibroblastic sarcoma (EIMS). Most previously reported EIMSs have been caused by RANBP2-ALK fusion gene. We herein report an EIMS case caused by an EML4-ALK fusion gene. RNAseq was conducted to find out the new ALK fusion gene which could not be detected following previously reported RT-PCR methods for EIMS cases with RANBP2-ALK fusion gene. After that, RT-PCR was also conducted to further prove the newly found fusion gene. Immunohistochemistry (IHC) and fluorescence in situ hybridization (FISH) test were applied to find out the unique morphological characters compared with the previous reported EIMS cases. We found an EIMS case who was suffering from a rapid recurrence after cytoreducyive surgery was done to relieve the exacerbating symptoms. The patient finally died for tumor lysis syndrome after the application of crizotinib. Distinctive ALK staining under the membrane and relatively weak ALK staining in the cytoplasm could also be observed. RNAseq and RT-PCR further revealed that the tumor harbored an EML4-ALK fusion gene. In conclusion, this is the first EIMS demonstrated to have been caused by the formation of an EML4-ALK fusion gene. This enriches the spectrum of EIMS and enlarges the horizon for the study of EIMS. The experience we shared in managing this kind of disease by discussing aspects of its success and failure could be of great value for surgeons and pathologists.
NASA Technical Reports Server (NTRS)
Thio, Y. C. Francis; Schafer, Charles (Technical Monitor)
2001-01-01
There is little doubt that humans will attempt to explore and develop the solar system in this century. A large amount of energy will be required for accomplishing this. The need for fusion propulsion is discussed. For a propulsion system, there are three important thermodynamical attributes: (1) The absolute amount of energy available, (2) the propellant exhaust velocity, and (3) the jet power per unit mass of the propulsion system (specific power). For human exploration and development of the solar system, propellant exhaust velocity in excess of 100 km/s and specific power in excess of 10 kW/kg are required. Chemical combustion can produce exhaust velocity up to about 5 km/s. Nuclear fission processes typically result in producing energy in the form of heat that needs to be manipulated at temperatures limited by materials to about 2,800 K. Using the energy to heat a hydrogen propellant increases the exhaust velocity by only a factor of about two. Alternatively the energy can be converted into electricity which is then used to accelerate particles to high exhaust velocity. The necessary power conversion and conditioning equipment, however, increases the mass of the propulsion system for the same jet power by more than two orders of magnitude over chemical system, thus greatly limits the thrust-to-weight ratio attainable. The principal advantage of the fission process is that its development is relatively mature and is available right now. If fusion can be developed, fusion appears to have the best of all worlds in terms of propulsion - it can provide the absolute amount, the propellant exhaust velocity, and the high specific jet power. An intermediate step towards pure fusion propulsion is a bimodal system in which a fission reactor is used to provide some of the energy to drive a fusion propulsion unit. The technical issues related to fusion for space propulsion are discussed. The technical priorities for developing and applying fusion for propulsion are
C-terminal tyrosine residues modulate the fusion activity of the Hendra virus fusion protein
Popa, Andreea; Pager, Cara Teresia; Dutch, Rebecca Ellis
2011-01-01
The paramyxovirus family includes important human pathogens such as measles, mumps, respiratory syncytial virus and the recently emerged, highly pathogenic Hendra and Nipah viruses. The viral fusion (F) protein plays critical roles in infection, promoting both the viral-cell membrane fusion events needed for viral entry as well as cell-cell fusion events leading to syncytia formation. We describe the surprising finding that addition of the short epitope HA tag to the cytoplasmic tail (CT) of the Hendra virus F protein leads to a significant increase in cell-cell membrane fusion. This increase was not due to alterations in surface expression, cleavage state, or association with lipid microdomains. Addition of a Myc tag of similar length did not alter Hendra F fusion activity, indicating that the observed stimulation was not solely a result of lengthening the CT. Three tyrosine residues within the HA tag were critical for the increase in fusion, suggesting C-terminal tyrosines may modulate Hendra fusion activity. The effects of HA tag addition varied with other fusion proteins, as parainfluenza virus 5 F-HA showed decreased surface expression and no stimulation in fusion. These results indicate that additions to the C-terminal end of the F protein CT can modulate protein function in a sequence specific manner, reinforcing the need for careful analysis of epitope tagged glycoproteins. In addition, our results implicate C-terminal tyrosine residues in modulation of the membrane fusion reaction promoted by these viral glycoproteins. PMID:21175223
Paramyxovirus membrane fusion: Lessons from the F and HN atomic structures
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lamb, Robert A.; Paterson, Reay G.; Jardetzky, Theodore S.
2006-01-05
Paramyxoviruses enter cells by fusion of their lipid envelope with the target cell plasma membrane. Fusion of the viral membrane with the plasma membrane allows entry of the viral genome into the cytoplasm. For paramyxoviruses, membrane fusion occurs at neutral pH, but the trigger mechanism that controls the viral entry machinery such that it occurs at the right time and in the right place remains to be elucidated. Two viral glycoproteins are key to the infection process-an attachment protein that varies among different paramyxoviruses and the fusion (F) protein, which is found in all paramyxoviruses. For many of the paramyxovirusesmore » (parainfluenza viruses 1-5, mumps virus, Newcastle disease virus and others), the attachment protein is the hemagglutinin/neuraminidase (HN) protein. In the last 5 years, atomic structures of paramyxovirus F and HN proteins have been reported. The knowledge gained from these structures towards understanding the mechanism of viral membrane fusion is described.« less
Opioids delay healing of spinal fusion: a rabbit posterolateral lumbar fusion model.
Jain, Nikhil; Himed, Khaled; Toth, Jeffrey M; Briley, Karen C; Phillips, Frank M; Khan, Safdar N
2018-04-19
Opioid use is prevalent for management of pre- and post-operative pain in patients undergoing spinal fusion. There is evidence that opioids downregulate osteoblasts in-vitro, and one previous study found that morphine delays the maturation and remodeling of callus in a rat femur fracture model. However, the effect of opioids on healing of spinal fusion has not been investigated before. Isolating the effect of opioid exposure in humans would be limited by the numerous confounding factors that affect fusion healing. Therefore, we have used a well-established rabbit model to study the process of spinal fusion healing that closely mimics humans. To study the effect of systemic opioids on the process of healing of spinal fusion in a rabbit posterolateral spinal fusion model. Pre-clinical animal study. 24 adult New Zealand white rabbits were studied in two groups after approval from the Institutional Animal Care and Use Committee (IACUC). The opioid group (n=12) received four-weeks pre-operative and six-weeks post-operative transdermal fentanyl. Serum fentanyl levels were measured just before surgery and four-weeks post-operatively to ensure adequate levels. The control group (n=12) received only peri-operative pain control as necessary. All animals received a bilateral L5-L6 posterolateral spinal fusion using iliac crest autograft. Animals were euthanized at the six-week post-operative time point, and assessment of fusion was done by manual palpation, plain radiographs, micro-computed tomography (microCT), and histology. 12 animals in control group and 11 animals in the opioid group were available for analysis at the end of six weeks. The fusion scores on manual palpation, radiographs, and microCT were not statistically different. Three-dimensional microCT morphometry found that the fusion mass in the opioid group had a lower bone volume (p=0.09), lower trabecular number (p=0.02) and higher trabecular separation (p=0.02) as compared to control. Histological analysis
Inertial Confinement Fusion quarterly report, January-March 1998, volume 8, number 2
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kruer, W
1998-03-31
The coupling of laser light with plasmas is one of the key physics issues for the use of high-power lasers for inertial fusion, high-energy-density physics, and scientific stockpile stewardship. The coupling physics is extremely rich and challenging, particularly in the large plasmas to be accessed on the National Ignition Facility (NIF). The coupling mechanisms span the gamut from classical inverse bremsstrahlung absorption to a variety of nonlinear optical processes. These include stimulated Raman scattering (SRS) from electron plasma waves, stimulated Brillouin scattering (SBS) from ion sound waves, resonant decay into electron plasma and ion sound waves, and laser beam filamentation.more » These processes depend on laser intensity and produce effects such as changes in the efficiency and location of the energy deposition or generation of a component of very energetic electrons, which can preheat capsules. Coupling physics issues have an extremely high leverage. The coupling models are clearly very important ingredients for detailed calculations of laser-irradiated target behavior. Improved understanding and models enable a more efficient use of laser facilities, which becomes even more important as these facilities become larger and more expensive. Advances in the understanding also allow a more timely and cost-effective identification of new applications of high-power lasers, such as for generation of high-temperature hohlraums and compact x-ray sources, or for discovery of advanced fusion schemes. Finally, the interaction of intense electromagnetic waves with ionized media is a fundamental topic of interest to numerous areas of applied science and is an excellent test bed for advancing plasma science and computational modeling of complex phenomena. This issue of the ICF Quarterly Report is dedicated to laser--plasma interactions. The eight articles present a cross section of the broad progress in understanding the key interaction issues, such as laser beam
The impact of preoperative epidural injections on postoperative infection in lumbar fusion surgery.
Singla, Anuj; Yang, Scott; Werner, Brian C; Cancienne, Jourdan M; Nourbakhsh, Ali; Shimer, Adam L; Hassanzadeh, Hamid; Shen, Francis H
2017-05-01
OBJECTIVE Lumbar epidural steroid injections (LESIs) are performed for both diagnostic and therapeutic purposes for a variety of indications, including low-back pain, the leading cause of disability and expense due to work-related conditions in the US. The steroid agent used in epidural injections is reported to relieve nerve root inflammation, local ischemia, and resultant pain, but the injection may also have an adverse impact on spinal surgery performed thereafter. In particular, the possibility that preoperative epidural injections may increase the risk of surgical site infection after lumbar spinal fusion has been reported but has not been studied in detail. The goal of the present study was to use a large national insurance database to analyze the association of preoperative LESIs with surgical site infection after lumbar spinal fusion. METHODS A nationwide insurance database of patient records was used for this retrospective analysis. Current Procedural Terminology codes were used to query the database for patients who had undergone LESI and 1- or 2-level lumbar posterior spinal fusion procedures. The rate of postoperative infection after 1- or 2-level posterior spinal fusion was analyzed. These study patients were then divided into 3 separate cohorts: 1) lumbar spinal fusion performed within 1 month after LESI, 2) fusion performed between 1 and 3 months after LESI, and 3) fusion performed between 3 and 6 months after LESI. The study patients were compared with a control cohort of patients who underwent lumbar fusion without previous LESI. RESULTS The overall 3-month infection rate after lumbar spinal fusion procedure was 1.6% (1411 of 88,540 patients). The infection risk increased in patients who received LESI within 1 month (OR 2.6, p < 0.0001) or 1-3 months (OR 1.4, p = 0.0002) prior to surgery compared with controls. The infection risk was not significantly different from controls in patients who underwent lumbar fusion more than 3 months after LESI
Systematic analysis of advanced fusion fuel in inertial fusion energy
NASA Astrophysics Data System (ADS)
Velarde, G.; Eliezer, S.; Henis, Z.; Piera, M.; Martinez-Val, J. M.
1997-04-01
Aneutronic fusion reactions can be considered as the cleanest way to exploit nuclear energy. However, these reactions present in general two main drawbacks.—very high temperatures are needed to reach relevant values of their cross sections—Moderate (and even low) energy yield per reaction. This value is still lower if measured in relation to the Z number of the reacting particles. It is already known that bremsstrahlung overruns the plasma reheating by fusion born charged-particles in most of the advanced fuels. This is for instance the case for proton-boron-11 fusion in a stoichiometric plasma and is also so in lithium isotopes fusion reactions. In this paper, the use of deuterium-tritium seeding is suggested to allow to reach higher burnup fractions of advanced fuels, starting at a lower ignition temperature. Of course, neutron production increases as DT contents does. Nevertheless, the ratio of neutron production to energy generation is much lower in DT-advanced fuel mixtures than in pure DT plasmas. One of the main findings of this work is that some natural resources (as D and Li-7) can be burned-up in a catalytic regime for tritium. In this case, neither external tritium breeding nor tritium storage are needed, because the tritium inventory after the fusion burst is the same as before it. The fusion reactor can thus operate on a pure recycling of a small tritium inventory.
Effects of magnetization on fusion product trapping and secondary neutron spectraa)
NASA Astrophysics Data System (ADS)
Knapp, P. F.; Schmit, P. F.; Hansen, S. B.; Gomez, M. R.; Hahn, K. D.; Sinars, D. B.; Peterson, K. J.; Slutz, S. A.; Sefkow, A. B.; Awe, T. J.; Harding, E.; Jennings, C. A.; Desjarlais, M. P.; Chandler, G. A.; Cooper, G. W.; Cuneo, M. E.; Geissel, M.; Harvey-Thompson, A. J.; Porter, J. L.; Rochau, G. A.; Rovang, D. C.; Ruiz, C. L.; Savage, M. E.; Smith, I. C.; Stygar, W. A.; Herrmann, M. C.
2015-05-01
By magnetizing the fusion fuel in inertial confinement fusion (ICF) systems, the required stagnation pressure and density can be relaxed dramatically. This happens because the magnetic field insulates the hot fuel from the cold pusher and traps the charged fusion burn products. This trapping allows the burn products to deposit their energy in the fuel, facilitating plasma self-heating. Here, we report on a comprehensive theory of this trapping in a cylindrical DD plasma magnetized with a purely axial magnetic field. Using this theory, we are able to show that the secondary fusion reactions can be used to infer the magnetic field-radius product, BR, during fusion burn. This parameter, not ρR, is the primary confinement parameter in magnetized ICF. Using this method, we analyze data from recent Magnetized Liner Inertial Fusion experiments conducted on the Z machine at Sandia National Laboratories. We show that in these experiments BR ≈ 0.34(+0.14/-0.06) MG . cm, a ˜ 14× increase in BR from the initial value, and confirming that the DD-fusion tritons are magnetized at stagnation. This is the first experimental verification of charged burn product magnetization facilitated by compression of an initial seed magnetic flux.
Effects of magnetization on fusion product trapping and secondary neutron spectra
Knapp, Patrick F.; Schmit, Paul F.; Hansen, Stephanie B.; ...
2015-05-14
In magnetizing the fusion fuel in inertial confinement fusion (ICF) systems, we found that the required stagnation pressure and density can be relaxed dramatically. This happens because the magnetic field insulates the hot fuel from the cold pusher and traps the charged fusion burn products. This trapping allows the burn products to deposit their energy in the fuel, facilitating plasma self-heating. Here, we report on a comprehensive theory of this trapping in a cylindrical DD plasma magnetized with a purely axial magnetic field. Using this theory, we are able to show that the secondary fusion reactions can be used tomore » infer the magnetic field-radius product, BR, during fusion burn. This parameter, not ρR, is the primary confinement parameter in magnetized ICF. Using this method, we analyze data from recent Magnetized Liner InertialFusion experiments conducted on the Z machine at Sandia National Laboratories. Furthermore, we show that in these experiments BR ≈ 0.34(+0.14/-0.06) MG · cm, a ~ 14× increase in BR from the initial value, and confirming that the DD-fusion tritons are magnetized at stagnation. Lastly, this is the first experimental verification of charged burn product magnetization facilitated by compression of an initial seed magnetic flux.« less
Gene Fusion Markup Language: a prototype for exchanging gene fusion data.
Kalyana-Sundaram, Shanker; Shanmugam, Achiraman; Chinnaiyan, Arul M
2012-10-16
An avalanche of next generation sequencing (NGS) studies has generated an unprecedented amount of genomic structural variation data. These studies have also identified many novel gene fusion candidates with more detailed resolution than previously achieved. However, in the excitement and necessity of publishing the observations from this recently developed cutting-edge technology, no community standardization approach has arisen to organize and represent the data with the essential attributes in an interchangeable manner. As transcriptome studies have been widely used for gene fusion discoveries, the current non-standard mode of data representation could potentially impede data accessibility, critical analyses, and further discoveries in the near future. Here we propose a prototype, Gene Fusion Markup Language (GFML) as an initiative to provide a standard format for organizing and representing the significant features of gene fusion data. GFML will offer the advantage of representing the data in a machine-readable format to enable data exchange, automated analysis interpretation, and independent verification. As this database-independent exchange initiative evolves it will further facilitate the formation of related databases, repositories, and analysis tools. The GFML prototype is made available at http://code.google.com/p/gfml-prototype/. The Gene Fusion Markup Language (GFML) presented here could facilitate the development of a standard format for organizing, integrating and representing the significant features of gene fusion data in an inter-operable and query-able fashion that will enable biologically intuitive access to gene fusion findings and expedite functional characterization. A similar model is envisaged for other NGS data analyses.
Gene Fusion Markup Language: a prototype for exchanging gene fusion data
2012-01-01
Background An avalanche of next generation sequencing (NGS) studies has generated an unprecedented amount of genomic structural variation data. These studies have also identified many novel gene fusion candidates with more detailed resolution than previously achieved. However, in the excitement and necessity of publishing the observations from this recently developed cutting-edge technology, no community standardization approach has arisen to organize and represent the data with the essential attributes in an interchangeable manner. As transcriptome studies have been widely used for gene fusion discoveries, the current non-standard mode of data representation could potentially impede data accessibility, critical analyses, and further discoveries in the near future. Results Here we propose a prototype, Gene Fusion Markup Language (GFML) as an initiative to provide a standard format for organizing and representing the significant features of gene fusion data. GFML will offer the advantage of representing the data in a machine-readable format to enable data exchange, automated analysis interpretation, and independent verification. As this database-independent exchange initiative evolves it will further facilitate the formation of related databases, repositories, and analysis tools. The GFML prototype is made available at http://code.google.com/p/gfml-prototype/. Conclusion The Gene Fusion Markup Language (GFML) presented here could facilitate the development of a standard format for organizing, integrating and representing the significant features of gene fusion data in an inter-operable and query-able fashion that will enable biologically intuitive access to gene fusion findings and expedite functional characterization. A similar model is envisaged for other NGS data analyses. PMID:23072312
Line tension at lipid phase boundaries as driving force for HIV fusion peptide-mediated fusion
NASA Astrophysics Data System (ADS)
Yang, Sung-Tae; Kiessling, Volker; Tamm, Lukas K.
2016-04-01
Lipids and proteins are organized in cellular membranes in clusters, often called `lipid rafts'. Although raft-constituent ordered lipid domains are thought to be energetically unfavourable for membrane fusion, rafts have long been implicated in many biological fusion processes. For the case of HIV gp41-mediated membrane fusion, this apparent contradiction can be resolved by recognizing that the interfaces between ordered and disordered lipid domains are the predominant sites of fusion. Here we show that line tension at lipid domain boundaries contributes significant energy to drive gp41-fusion peptide-mediated fusion. This energy, which depends on the hydrophobic mismatch between ordered and disordered lipid domains, may contribute tens of kBT to fusion, that is, it is comparable to the energy required to form a lipid stalk intermediate. Line-active compounds such as vitamin E lower line tension in inhomogeneous membranes, thereby inhibit membrane fusion, and thus may be useful natural viral entry inhibitors.
Impact of fluorescent protein fusions on the bacterial flagellar motor.
Heo, M; Nord, A L; Chamousset, D; van Rijn, E; Beaumont, H J E; Pedaci, F
2017-10-03
Fluorescent fusion proteins open a direct and unique window onto protein function. However, they also introduce the risk of perturbation of the function of the native protein. Successful applications of fluorescent fusions therefore rely on a careful assessment and minimization of the side effects, but such insight is still lacking for many applications. This is particularly relevant in the study of the internal dynamics of motor proteins, where both the chemical and mechanical reaction coordinates can be affected. Fluorescent proteins fused to the stator of the Bacterial Flagellar Motor (BFM) have previously been used to unveil the motor subunit dynamics. Here we report the effects on single motors of three fluorescent proteins fused to the stators, all of which altered BFM behavior. The torque generated by individual stators was reduced while their stoichiometry remained unaffected. MotB fusions decreased the switching frequency and induced a novel bias-dependent asymmetry in the speed in the two directions. These effects could be mitigated by inserting a linker at the fusion point. These findings provide a quantitative account of the effects of fluorescent fusions to the stator on BFM dynamics and their alleviation- new insights that advance the use of fluorescent fusions to probe the dynamics of protein complexes.
Shh pathway in wounds in non-diabetic Shh-Cre-eGFP/Ptch1-LacZ mice treated with MAA beads.
Lisovsky, Alexandra; Sefton, Michael V
2016-09-01
Previously, poly(methacrylic acid-co-methyl methacrylate) (MAA) beads were shown to improve vessel formation with a concomitant increase in the expression of the sonic hedgehog (Shh) gene, a pleiotropic factor implicated in vascularization. The aim of this study was to follow up on this observation in the absence of the confounding factors of diabetes in non-diabetic Shh-Cre-eGFP/Ptch1-LacZ mice; in this mouse, expression of GFP and β-Gal is consistent with the transcription patterns of Shh and its receptor patched 1 (Ptch1), respectively. In agreement with studies in diabetic males, MAA beads improved vascularization in large (15 mm × 15 mm) wounds in non-diabetic males at day 7. Shh pathway activation was suggested, as the numbers of GFP+ (Shh) and β-Gal+ (Ptch1, a target of the pathway) cells increased in the granulation tissue. Shh signaling pathway modulation was also suggested in the healthy skin surrounding the wound bed, as evidenced by an increase in the number of GFP+ and β-Gal+ cells in males at day 4. Gene expression analysis of the wounds confirmed increase in Ptch1 and showed the upregulation of a downstream transcription factor Gli3, involved in the vascular effect of the Shh pathway, implicating the pathway in the effect of MAA beads. The efficacy of MAA beads was also investigated in females; MAA beads modulated the Shh pathway within granulation tissue similarly as in males, but had no enhancement effect on the healthy skin and on vascularization. We believe that understanding the molecular and cellular mechanisms of MAA-based biomaterials and testing the efficacy of therapeutics in both sexes will inform the development of novel therapeutic biomaterials. Copyright © 2016 Elsevier Ltd. All rights reserved.
Gradient-based multiresolution image fusion.
Petrović, Valdimir S; Xydeas, Costas S
2004-02-01
A novel approach to multiresolution signal-level image fusion is presented for accurately transferring visual information from any number of input image signals, into a single fused image without loss of information or the introduction of distortion. The proposed system uses a "fuse-then-decompose" technique realized through a novel, fusion/decomposition system architecture. In particular, information fusion is performed on a multiresolution gradient map representation domain of image signal information. At each resolution, input images are represented as gradient maps and combined to produce new, fused gradient maps. Fused gradient map signals are processed, using gradient filters derived from high-pass quadrature mirror filters to yield a fused multiresolution pyramid representation. The fused output image is obtained by applying, on the fused pyramid, a reconstruction process that is analogous to that of conventional discrete wavelet transform. This new gradient fusion significantly reduces the amount of distortion artefacts and the loss of contrast information usually observed in fused images obtained from conventional multiresolution fusion schemes. This is because fusion in the gradient map domain significantly improves the reliability of the feature selection and information fusion processes. Fusion performance is evaluated through informal visual inspection and subjective psychometric preference tests, as well as objective fusion performance measurements. Results clearly demonstrate the superiority of this new approach when compared to conventional fusion systems.
Comparative Analysis of Fusion Center Outreach to Fire and EMS Agencies
2015-12-01
ANALYSIS OF FUSION CENTER OUTREACH TO FIRE AND EMS AGENCIES by Scott E. Goldstein December 2015 Thesis Advisor: Fathali Moghaddam Second...REPORT TYPE AND DATES COVERED Master’s thesis 4. TITLE AND SUBTITLE COMPARATIVE ANALYSIS OF FUSION CENTER OUTREACH TO FIRE AND EMS AGENCIES 5...public release; distribution is unlimited 12b. DISTRIBUTION CODE A 13. ABSTRACT (maximum 200 words) Fire and EMS responders have had little
Holtkamp, Norbert
2018-01-09
ITER (in Latin âthe wayâ) is designed to demonstrate the scientific and technological feasibility of fusion energy. Fusion is the process by which two light atomic nuclei combine to form a heavier over one and thus release energy. In the fusion process two isotopes of hydrogen â deuterium and tritium â fuse together to form a helium atom and a neutron. Thus fusion could provide large scale energy production without greenhouse effects; essentially limitless fuel would be available all over the world. The principal goals of ITER are to generate 500 megawatts of fusion power for periods of 300 to 500 seconds with a fusion power multiplication factor, Q, of at least 10. Q ? 10 (input power 50 MW / output power 500 MW). The ITER Organization was officially established in Cadarache, France, on 24 October 2007. The seven members engaged in the project â China, the European Union, India, Japan, Korea, Russia and the United States â represent more than half the worldâs population. The costs for ITER are shared by the seven members. The cost for the construction will be approximately 5.5 billion Euros, a similar amount is foreseen for the twenty-year phase of operation and the subsequent decommissioning.
Paramyxovirus F1 protein has two fusion peptides: implications for the mechanism of membrane fusion.
Peisajovich, S G; Samuel, O; Shai, Y
2000-03-10
Viral fusion proteins contain a highly hydrophobic segment, named the fusion peptide, which is thought to be responsible for the merging of the cellular and viral membranes. Paramyxoviruses are believed to contain a single fusion peptide at the N terminus of the F1 protein. However, here we identified an additional internal segment in the Sendai virus F1 protein (amino acids 214-226) highly homologous to the fusion peptides of HIV-1 and RSV. A synthetic peptide, which includes this region, was found to induce membrane fusion of large unilamellar vesicles, at concentrations where the known N-terminal fusion peptide is not effective. A scrambled peptide as well as several peptides from other regions of the F1 protein, which strongly bind to membranes, are not fusogenic. The functional and structural characterization of this active segment suggest that the F1 protein has an additional internal fusion peptide that could participate in the actual fusion event. The presence of homologous regions in other members of the same family suggests that the concerted action of two fusion peptides, one N-terminal and the other internal, is a general feature of paramyxoviruses. Copyright 2000 Academic Press.
Cell fusion and nuclear fusion in plants.
Maruyama, Daisuke; Ohtsu, Mina; Higashiyama, Tetsuya
2016-12-01
Eukaryotic cells are surrounded by a plasma membrane and have a large nucleus containing the genomic DNA, which is enclosed by a nuclear envelope consisting of the outer and inner nuclear membranes. Although these membranes maintain the identity of cells, they sometimes fuse to each other, such as to produce a zygote during sexual reproduction or to give rise to other characteristically polyploid tissues. Recent studies have demonstrated that the mechanisms of plasma membrane or nuclear membrane fusion in plants are shared to some extent with those of yeasts and animals, despite the unique features of plant cells including thick cell walls and intercellular connections. Here, we summarize the key factors in the fusion of these membranes during plant reproduction, and also focus on "non-gametic cell fusion," which was thought to be rare in plant tissue, in which each cell is separated by a cell wall. Copyright © 2016 Elsevier Ltd. All rights reserved.
A perspective of gene therapy in the glaucomas.
Kaufman, P L; Jia, W W; Tan, J; Chen, Z; Gabelt, B T; Booth, V; Tufaro, F; Cynader, M
1999-06-01
Gene therapy in the anterior and posterior segment tissues may have the potential to favorably influence aqueous hydrodynamics and retinal ganglion cell biology, thereby preventing, delaying, or minimizing glaucomatous damage to the optic nerve. We demonstrated the feasibility of using a herpes viral vector (ribonucleotide reductase defective HSV-1, hrR3) to deliver the lacZ reporter gene to living cat and rat eyes. Cats received injections into the anterior chamber and rats into the vitreous cavity. In cats, lacZ expression was detectable at 1 to 2 days in the anterior outer portion of the ciliary muscle and the lining of the intertrabecular spaces of the corneoscleral and uveal meshwork. Rat eyes showed lacZ expression in the retinal pigment epithelium and photoreceptor outer segments 2 days after injection.
Bone Morphogenetic Proteins in Anterior Cervical Fusion: A Systematic Review and Meta-Analysis.
Zadegan, Shayan Abdollah; Abedi, Aidin; Jazayeri, Seyed Behnam; Nasiri Bonaki, Hirbod; Jazayeri, Seyed Behzad; Vaccaro, Alexander R; Rahimi-Movaghar, Vafa
2017-08-01
Bone morphogenetic proteins (BMPs) have been commonly used as a graft substitute in spinal fusion. Although the U.S. Food and Drug Administration issued a warning on life-threatening complications of recombinant human BMPs (rhBMPs) in cervical spine fusion in 2008, their off-label use has been continued. This investigation aimed to review the evidence for the use of rhBMP-2 and rhBMP-7 in anterior cervical spine fusions. A comprehensive search was performed through Ovid (MEDLINE), PubMed, and Embase. The risk of bias assessment was according to the recommended criteria by the Cochrane Back and Neck group and MINORS (Methodological Index for Non-Randomized Studies). A wide array of radiographic and clinical outcomes including the adverse events were collated. Eighteen articles (1 randomized and 17 nonrandomized) were eligible for inclusion. The fusion rate was higher with use of rhBMP in most studies and our meta-analysis of the pooled data from 4782 patients confirmed this finding (odds ratio, 5.45; P < 0.00001). Altogether, the rhBMP and control groups were comparable in patient-reported outcomes. However, most studies tended to show a significantly higher incidence of overall complication rate, dysphagia/dysphonia, cervical swelling, readmission, wound complications, neurologic complications, and ossification. Application of rhBMPs in cervical spine fusion yields a significantly higher fusion rate with similar patient-reported outcomes, yet increased risk of life-threatening complications. Thus, we do not recommend the use of rhBMP in anterior cervical fusions. Copyright © 2017 Elsevier Inc. All rights reserved.
Gene Fusion: A Genome Wide Survey
NASA Technical Reports Server (NTRS)
Liang, Ping; Riley, Monica
2001-01-01
As a well known fact, organisms form larger and complex multimodular (composite or chimeric) and mostly multi-functional proteins through gene fusion of two or more individual genes which have independent evolution histories and functions. We call each of these components a module. The existence of multimodular proteins may improves the efficiency in gene regulation and in cellular functions, and thus may give the host organism advantages in adaptation to environments. Analysis of all gene fusions in present-day organisms should allow us to examine the patterns of gene fusion in context with cellular functions, to trace back the evolution processes from the ancient smaller and uni-functional proteins to the present-day larger and complex multi-functional proteins, and to estimate the minimal number of ancestor proteins that existed in the last common ancestor for all life on earth. Although many multimodular proteins have been experimentally known, identification of gene fusion events systematically at genome scale had not been possible until recently when large number of completed genome sequences have been becoming available. In addition, technical difficulties for such analysis also exist due to the complexity of this biological and evolutionary process. We report from this study a new strategy to computationally identify multimodular proteins using completed genome sequences and the results surveyed from 22 organisms with the data from over 40 organisms to be presented during the meeting. Additional information is contained in the original extended abstract.
Investigations of image fusion
NASA Astrophysics Data System (ADS)
Zhang, Zhong
1999-12-01
The objective of image fusion is to combine information from multiple images of the same scene. The result of image fusion is a single image which is more suitable for the purpose of human visual perception or further image processing tasks. In this thesis, a region-based fusion algorithm using the wavelet transform is proposed. The identification of important features in each image, such as edges and regions of interest, are used to guide the fusion process. The idea of multiscale grouping is also introduced and a generic image fusion framework based on multiscale decomposition is studied. The framework includes all of the existing multiscale-decomposition- based fusion approaches we found in the literature which did not assume a statistical model for the source images. Comparisons indicate that our framework includes some new approaches which outperform the existing approaches for the cases we consider. Registration must precede our fusion algorithms. So we proposed a hybrid scheme which uses both feature-based and intensity-based methods. The idea of robust estimation of optical flow from time- varying images is employed with a coarse-to-fine multi- resolution approach and feature-based registration to overcome some of the limitations of the intensity-based schemes. Experiments show that this approach is robust and efficient. Assessing image fusion performance in a real application is a complicated issue. In this dissertation, a mixture probability density function model is used in conjunction with the Expectation- Maximization algorithm to model histograms of edge intensity. Some new techniques are proposed for estimating the quality of a noisy image of a natural scene. Such quality measures can be used to guide the fusion. Finally, we study fusion of images obtained from several copies of a new type of camera developed for video surveillance. Our techniques increase the capability and reliability of the surveillance system and provide an easy way to obtain 3-D
Swer, Pynskhem Bok; Bhadoriya, Pooja; Saran, Shweta
2014-03-01
Dictyostelium discoideum encodes a single Rheb protein showing sequence similarity to human homologues of Rheb. The DdRheb protein shares 52 percent identity and 100 percent similarity with the human Rheb1 protein. Fluorescence of Rheb yellow fluorescent protein fusion was detected in the D. discoideum cytoplasm. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that rheb is expressed at all stages of development and in prestalk cells in the multicellular structures developed. When the expression of rheb as a fusion with lacZ was driven under its own promoter, the beta-galactosidase activity was seen in the prestalk cells. D. discoideum overexpressing Rheb shows an increase in the size of the cell. Treatment of the overexpressing Rheb cells with rapamycin confirms its involvement in the TOR signalling pathway.
Yamamoto, Masayo; Ikuta, Katsuya; Toki, Yasumichi; Hatayama, Mayumi; Shindo, Motohiro; Torimoto, Yoshihiro; Okumura, Toshikatsu
2017-09-01
Hypereosinophilic syndrome (HES) is a rare disorder characterized by hypereosinophilia and organ damage. Some cases of HES are caused by the FIP1L1/PDGFRA fusion gene and respond to imatinib. FIP1L1/PDGFRA-positive HES occasionally evolves into chronic eosinophilic leukemia or into another form of myeloproliferative neoplasm; however, the development of a malignant lymphoma is very rare. We present a rare case of angioimmunoblastic T-cell lymphoma (AITL) and HES with the FIP1L1/PDGFRA gene rearrangement. A man in his 30s presented to our hospital with fever, hypereosinophilia, widespread lymphadenopathy, and splenomegaly. Laboratory tests showed hypereosinophilia, increased soluble interleukin-2 receptor, and increased vitamin B12. Positron-emission tomography with F fluorodeoxyglucose (FDG) showed positive FDG uptake in multiple enlarged lymph nodes throughout the body and the red bone marrow. A bone-marrow biopsy showed hypereosinophilia without dysplasia and an increased number of blasts. The FIP1L1/PDGFRA fusion gene was positive upon fluorescence in situ hybridization (FISH) analysis of the peripheral blood. Furthermore, biopsy of a lymph node from the neck revealed restiform hyperplasia of capillary vessels, with small lymphoma cells arranged around the capillaries. Lymphoma cells were positive for CD3, CD4, and CD10, and negative for CD20. Lymphoma cells were also positive for the FIP1L1/PDGFRA fusion gene by FISH analysis. From these findings, the patient was diagnosed with HES and AITL with FIP1L1/PDGFRA. After the diagnosis, corticosteroid was administered but was ineffective. Imatinib was then administered. Imatinib was very effective for treating HES and AITL, and complete remission was achieved in both. This report presents the first case in which the FIP1L1/PDGFRA fusion gene was positive both in peripheral blood and lymph nodes, implying the possibility that the tumor cells acquired the FIP1L1/PDGFRA fusion gene in the early stage of hematopoietic
Murphy, Samantha; Martin, Sally; Parton, Robert G.
2010-01-01
Lipid droplets (LDs) are dynamic cytoplasmic organelles containing neutral lipids and bounded by a phospholipid monolayer. Previous studies have suggested that LDs can undergo constitutive homotypic fusion, a process linked to the inhibitory effects of fatty acids on glucose transporter trafficking. Using strict quantitative criteria for LD fusion together with refined light microscopic methods and real-time analysis, we now show that LDs in diverse cell types show low constitutive fusogenic activity under normal growth conditions. To investigate the possible modulation of LD fusion, we screened for agents that can trigger fusion. A number of pharmacological agents caused homotypic fusion of lipid droplets in a variety of cell types. This provided a novel cell system to study rapid regulated fusion between homotypic phospholipid monolayers. LD fusion involved an initial step in which the two adjacent membranes became continuous (<10 s), followed by the slower merging (100 s) of the neutral lipid cores to produce a single spherical LD. These fusion events were accompanied by changes to the LD surface organization. Measurements of LDs undergoing homotypic fusion showed that fused LDs maintained their initial volume, with a corresponding decrease in surface area suggesting rapid removal of membrane from the fused LD. This study provides estimates for the level of constitutive LD fusion in cells and questions the role of LD fusion in vivo. In addition, it highlights the extent of LD restructuring which occurs when homotypic LD fusion is triggered in a variety of cell types. PMID:21203462
Antwi, Prince; Grant, Ryan; Kuzmik, Gregory; Abbed, Khalid
2018-05-01
"White cord syndrome" is a very rare condition thought to be due to acute reperfusion of chronically ischemic areas of the spinal cord. Its hallmark is the presence of intramedullary hyperintense signal on T2-weighted magnetic resonance imaging sequences in a patient with unexplained neurologic deficits following spinal cord decompression surgery. The syndrome is rare and has been reported previously in 2 patients following anterior cervical decompression and fusion. We report an additional case of this complication. A 68-year-old man developed acute left-sided hemiparesis after posterior cervical decompression and fusion for cervical spondylotic myelopathy. The patient improved with high-dose steroid therapy. The rare white cord syndrome following either anterior cervical decompression and fusion or posterior cervical decompression and fusion may be due to ischemic-reperfusion injury sustained by chronically compressed parts of the spinal cord. In previous reports, patients have improved following steroid therapy and acute rehabilitation. Copyright © 2018 Elsevier Inc. All rights reserved.
Fusion peptide of HIV-1 as a site of vulnerability to neutralizing antibody
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kong, Rui; Xu, Kai; Zhou, Tongqing
The HIV-1 fusion peptide, comprising 15 to 20 hydrophobic residues at the N terminus of the Env-gp41 subunit, is a critical component of the virus-cell entry machinery. In this paper, we report the identification of a neutralizing antibody, N123-VRC34.01, which targets the fusion peptide and blocks viral entry by inhibiting conformational changes in gp120 and gp41 subunits of Env required for entry. Crystal structures of N123-VRC34.01 liganded to the fusion peptide, and to the full Env trimer, revealed an epitope consisting of the N-terminal eight residues of the gp41 fusion peptide and glycan N88 of gp120, and molecular dynamics showedmore » that the N-terminal portion of the fusion peptide can be solvent-exposed. Finally, these results reveal the fusion peptide to be a neutralizing antibody epitope and thus a target for vaccine design.« less
Fusion peptide of HIV-1 as a site of vulnerability to neutralizing antibody
Kong, Rui; Xu, Kai; Zhou, Tongqing; ...
2016-05-13
The HIV-1 fusion peptide, comprising 15 to 20 hydrophobic residues at the N terminus of the Env-gp41 subunit, is a critical component of the virus-cell entry machinery. In this paper, we report the identification of a neutralizing antibody, N123-VRC34.01, which targets the fusion peptide and blocks viral entry by inhibiting conformational changes in gp120 and gp41 subunits of Env required for entry. Crystal structures of N123-VRC34.01 liganded to the fusion peptide, and to the full Env trimer, revealed an epitope consisting of the N-terminal eight residues of the gp41 fusion peptide and glycan N88 of gp120, and molecular dynamics showedmore » that the N-terminal portion of the fusion peptide can be solvent-exposed. Finally, these results reveal the fusion peptide to be a neutralizing antibody epitope and thus a target for vaccine design.« less
Enhanced image capture through fusion
NASA Technical Reports Server (NTRS)
Burt, Peter J.; Hanna, Keith; Kolczynski, Raymond J.
1993-01-01
Image fusion may be used to combine images from different sensors, such as IR and visible cameras, to obtain a single composite with extended information content. Fusion may also be used to combine multiple images from a given sensor to form a composite image in which information of interest is enhanced. We present a general method for performing image fusion and show that this method is effective for diverse fusion applications. We suggest that fusion may provide a powerful tool for enhanced image capture with broad utility in image processing and computer vision.
Autograft versus Allograft for Cervical Spinal Fusion: A Systematic Review.
Tuchman, Alexander; Brodke, Darrel S; Youssef, Jim A; Meisel, Hans-Jörg; Dettori, Joseph R; Park, Jong-Beom; Yoon, S Tim; Wang, Jeffrey C
2017-02-01
Systematic review. To compare the effectiveness and safety between iliac crest bone graft (ICBG), non-ICBG autologous bone, and allograft in cervical spine fusion. To avoid problems at the donor site, various allograft materials have been used as a substitute for autograft. However, there are still questions as to the comparative effectiveness and safety of cadaver allograft compared with autologous ICBG. A systematic search of multiple major medical reference databases was conducted to identify studies evaluating spinal fusion in patients with cervical degenerative disk disease using ICBG compared with non-ICBG autograft or allograft or non-ICBG autograft compared with allograft in the cervical spine. Radiographic fusion, patient-reported outcomes, and functional outcomes were the primary outcomes of interest. Adverse events were evaluated for safety. The search identified 13 comparative studies that met our inclusion criteria: 2 prospective cohort studies and 11 retrospective cohort studies. Twelve cohort studies compared allograft with ICBG autograft during anterior cervical fusion and demonstrated with a low evidence level of support that there are no differences in fusion percentages, pain scores, or functional results. There was insufficient evidence comparing patients receiving allograft with non-ICBG autograft for fusion, pain, revision, and functional and safety outcomes. No publications directly comparing non-ICBG autograft with ICBG were found. Although the available literature suggests ICBG and allograft may have similar effectiveness in terms of fusion rates, pain scores, and functional outcomes following anterior cervical fusion, there are too many limitations in the available literature to draw any significant conclusions. No individual study provided greater than class III evidence, and when evaluating the overall body of literature, no conclusion had better than low evidence support. A prospective randomized trial with adequate sample size to
The microprotein Minion controls cell fusion and muscle formation
Zhang, Qiao; Vashisht, Ajay A.; O'Rourke, Jason; Corbel, Stéphane Y; Moran, Rita; Romero, Angelica; Miraglia, Loren; Zhang, Jia; Durrant, Eric; Schmedt, Christian; Sampath, Srinath C.; Sampath, Srihari C.
2017-01-01
Although recent evidence has pointed to the existence of small open reading frame (smORF)-encoded microproteins in mammals, their function remains to be determined. Skeletal muscle development requires fusion of mononuclear progenitors to form multinucleated myotubes, a critical but poorly understood process. Here we report the identification of Minion (microprotein inducer of fusion), a smORF encoding an essential skeletal muscle specific microprotein. Myogenic progenitors lacking Minion differentiate normally but fail to form syncytial myotubes, and Minion-deficient mice die perinatally and demonstrate a marked reduction in fused muscle fibres. The fusogenic activity of Minion is conserved in the human orthologue, and co-expression of Minion and the transmembrane protein Myomaker is sufficient to induce cellular fusion accompanied by rapid cytoskeletal rearrangement, even in non-muscle cells. These findings establish Minion as a novel microprotein required for muscle development, and define a two-component programme for the induction of mammalian cell fusion. Moreover, these data also significantly expand the known functions of smORF-encoded microproteins. PMID:28569745
Fusion or confusion: knowledge or nonsense?
NASA Astrophysics Data System (ADS)
Rothman, Peter L.; Denton, Richard V.
1991-08-01
The terms 'data fusion,' 'sensor fusion,' multi-sensor integration,' and 'multi-source integration' have been used widely in the technical literature to refer to a variety of techniques, technologies, systems, and applications which employ and/or combine data derived from multiple information sources. Applications of data fusion range from real-time fusion of sensor information for the navigation of mobile robots to the off-line fusion of both human and technical strategic intelligence data. The Department of Defense Critical Technologies Plan lists data fusion in the highest priority group of critical technologies, but just what is data fusion? The DoD Critical Technologies Plan states that data fusion involves 'the acquisition, integration, filtering, correlation, and synthesis of useful data from diverse sources for the purposes of situation/environment assessment, planning, detecting, verifying, diagnosing problems, aiding tactical and strategic decisions, and improving system performance and utility.' More simply states, sensor fusion refers to the combination of data from multiple sources to provide enhanced information quality and availability over that which is available from any individual source alone. This paper presents a survey of the state-of-the- art in data fusion technologies, system components, and applications. A set of characteristics which can be utilized to classify data fusion systems is presented. Additionally, a unifying mathematical and conceptual framework within which to understand and organize fusion technologies is described. A discussion of often overlooked issues in the development of sensor fusion systems is also presented.
Dicentric breakage at telomere fusions
Pobiega, Sabrina; Marcand, Stéphane
2010-01-01
Nonhomologous end-joining (NHEJ) inhibition at telomeres ensures that native chromosome ends do not fuse together. But the occurrence and consequences of rare telomere fusions are not well understood. It is notably unclear whether a telomere fusion could be processed to restore telomere ends. Here we address the behavior of individual dicentrics formed by telomere fusion in the yeast Saccharomyces cerevisiae. Our approach was to first stabilize and amplify fusions between two chromosomes by temporarily inactivating one centromere. Next we analyzed dicentric breakage following centromere reactivation. Unexpectedly, dicentrics often break at the telomere fusions during progression through mitosis, a process that restores the parental chromosomes. This unforeseen result suggests a rescue pathway able to process telomere fusions and to back up NHEJ inhibition at telomeres. PMID:20360388
Application of Recommended Design Practices for Conceptual Nuclear Fusion Space Propulsion Systems
NASA Technical Reports Server (NTRS)
Williams, Craig H.
2004-01-01
An AIAA Special Project Report was recently produced by AIAA's Nuclear and Future Flight Propulsion Technical Committee and is currently in peer review. The Report provides recommended design practices for conceptual engineering studies of nuclear fusion space propulsion systems. Discussion and recommendations are made on key topics including design reference missions, degree of technological extrapolation and concomitant risk, thoroughness in calculating mass properties (nominal mass properties, weight-growth contingency and propellant margins, and specific impulse), and thoroughness in calculating power generation and usage (power-flow, power contingencies, specific power). The report represents a general consensus of the nuclear fusion space propulsion system conceptual design community and proposes 15 recommendations. This paper expands on the Report by providing specific examples illustrating how to apply each of the recommendations.
Wang, Y; Yu, Y A; Shabahang, S; Wang, G; Szalay, A A
2002-10-01
Light-emitting reporter proteins play an increasing role in the study of gene expression in vitro and in vivo. Here we present a ruc-gfp fusion gene construct generated by fusing a cDNA for Renilla luciferase (ruc) in-frame with a cDNA encoding the "humanized" GFP (gfp) from Aequorea. A plasmid containing the fusion gene construct was successfully transformed into, and expressed in, mammalian cells. The transformed cells exhibited both Renilla luciferase activity in the presence of coelenterazine and GFP fluorescence upon excitation with UV light. Spectrofluorometry of cells containing the Ruc-GFP fusion protein, in the absence of wavelengths capable of exciting GFP fluorescence but in the presence of the luciferase substrate, coelenterazine, showed an emission spectrum with two peaks at 475 nm and 508 nm. These two peaks correspond to the emission maximum of Renilla luciferase at 475 nm and that of GFP at 508 nm. The peak at 508 nm generated in the presence of coelenterazine alone (without UV excitation) is the result of intramolecular energy transfer from Renilla luciferase to Aequorea GFP. Southern analysis of genomic DNA purified from transformed Chinese hamster ovary (CHO) cells and fluorescence in situ hybridization (FISH) to metaphase chromosomes confirmed the integration of the ruc-gfp fusion gene on a single chromosome. The bifunctional Ruc-GFP fusion protein allows the detection of gene expression at the single-cell level based on green fluorescence, and in a group of cells based on luminescence emission. Furthermore, animal experiments revealed that light emission from the Ruc-GFP fusion protein can be detected externally in the organs or tissues of live animals bearing the gene construct.
Advances in Multi-Sensor Information Fusion: Theory and Applications 2017.
Jin, Xue-Bo; Sun, Shuli; Wei, Hong; Yang, Feng-Bao
2018-04-11
The information fusion technique can integrate a large amount of data and knowledge representing the same real-world object and obtain a consistent, accurate, and useful representation of that object. The data may be independent or redundant, and can be obtained by different sensors at the same time or at different times. A suitable combination of investigative methods can substantially increase the profit of information in comparison with that from a single sensor. Multi-sensor information fusion has been a key issue in sensor research since the 1970s, and it has been applied in many fields. For example, manufacturing and process control industries can generate a lot of data, which have real, actionable business value. The fusion of these data can greatly improve productivity through digitization. The goal of this special issue is to report innovative ideas and solutions for multi-sensor information fusion in the emerging applications era, focusing on development, adoption, and applications.
NASA Technical Reports Server (NTRS)
Griffin, Steven T.
2002-01-01
Magnetized target fusion (MTF) is under consideration as a means of building a low mass, high specific impulse, and high thrust propulsion system for interplanetary travel. This unique combination is the result of the generation of a high temperature plasma by the nuclear fusion process. This plasma can then be deflected by magnetic fields to provide thrust. Fusion is initiated by a small traction of the energy generated in the magnetic coils due to the plasma's compression of the magnetic field. The power gain from a fusion reaction is such that inefficiencies due to thermal neutrons and coil losses can be overcome. Since the fusion reaction products are directly used for propulsion and the power to initiate the reaction is directly obtained from the thrust generation, no massive power supply for energy conversion is required. The result should be a low engine mass, high specific impulse and high thrust system. The key is to successfully initiate fusion as a proof-of-principle for this application. Currently MSFC is implementing MTF proof-of-principle experiments. This involves many technical details and ancillary investigations. Of these, selected pertinent issues include the properties, orientation and timing of the plasma guns and the convergence and interface development of the "pusher" plasma. Computer simulations of the target plasma's behavior under compression and the convergence and mixing of the gun plasma are under investigation. This work is to focus on the gun characterization and development as it relates to plasma initiation and repeatability.
Fluid mechanics of fusion lasers. Final report, September 11, 1978-June 5, 1980
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shwartz, J; Kulkarny, V A; Ausherman, D A
1980-01-01
Flow loop components required to operate continuous-flow, repetitively-pulsed CO/sub 2/ and KrF laser drivers for ICF were identified and their performance requirements were specified. It was found that the laser flow loops can have a major effect on the laser beam quality and overall efficiency. The pressure wave suppressor was identified as the most critical flow loop component. The performance of vented side-wall suppressors was evaluated both analytically and experimentally and found capable of meeting the performance requirements of the CO/sub 2/ and KrF fusion lasers. All other laser flow loop components are essentially similar to those used in conventional,more » low speed wind tunnels and are therefore well characterized and can be readily incorporated into fusion laser flow systems designs.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dr. Tarasankar DebRoy
In recent years, applications of numerical heat transfer and fluid flow models of fusion welding have resulted in improved understanding of both the welding processes and welded materials. They have been used to accurately calculate thermal cycles and fusion zone geometry in many cases. Here we report the following three major advancements from this project. First, we show how microstructures, grain size distribution and topology of welds of several important engineering alloys can be computed starting from better understanding of the fusion welding process through numerical heat transfer and fluid flow calculations. Second, we provide a conclusive proof that themore » reliability of numerical heat transfer and fluid flow calculations can be significantly improved by optimizing several uncertain model parameters. Third, we demonstrate how the numerical heat transfer and fluid flow models can be combined with a suitable global optimization program such as a genetic algorithm for the tailoring of weld attributes such as attaining a specified weld geometry or a weld thermal cycle. The results of the project have been published in many papers and a listing of these are included together with a list of the graduate thesis that resulted from this project. The work supported by the DOE award has resulted in several important national and international awards. A listing of these awards and the status of the graduate students are also presented in this report.« less
2007-10-01
colored plates: ALL DTIC reproductions will be in black and white. 14. ABSTRACT The lacZ gene encoding E . coli beta-gal has already been...interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most commonly used reporter system.[34] However, the well-established...Figure 7 Moreover, we are deeply encouraged by the success on the synthesis of the target molecule M7, as shown in Figure 8. f e d cba OH N
Fusion Power measurement at ITER
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bertalot, L.; Barnsley, R.; Krasilnikov, V.
2015-07-01
Nuclear fusion research aims to provide energy for the future in a sustainable way and the ITER project scope is to demonstrate the feasibility of nuclear fusion energy. ITER is a nuclear experimental reactor based on a large scale fusion plasma (tokamak type) device generating Deuterium - Tritium (DT) fusion reactions with emission of 14 MeV neutrons producing up to 700 MW fusion power. The measurement of fusion power, i.e. total neutron emissivity, will play an important role for achieving ITER goals, in particular the fusion gain factor Q related to the reactor performance. Particular attention is given also tomore » the development of the neutron calibration strategy whose main scope is to achieve the required accuracy of 10% for the measurement of fusion power. Neutron Flux Monitors located in diagnostic ports and inside the vacuum vessel will measure ITER total neutron emissivity, expected to range from 1014 n/s in Deuterium - Deuterium (DD) plasmas up to almost 10{sup 21} n/s in DT plasmas. The neutron detection systems as well all other ITER diagnostics have to withstand high nuclear radiation and electromagnetic fields as well ultrahigh vacuum and thermal loads. (authors)« less
Balasubramanian, Vijay Anand; Douraiswami, Balaji; Subramani, Suresh
2018-06-01
Lumbar spondylolisthesis is a common cause of morbidity in middle aged individuals. Spinal fusion with instrumentation has become the gold standard for lumbar segmental instability. Studies which correlate the improvement in radiology postoperatively with functional outcome show contrasting reports. This study is aimed at finding the correlation between clinical and radiological outcomes after surgery with transforaminal lumbar interbody fusion. A retrospective study in 35 patients who underwent transforaminal lumbar interbody fusion in a period of 1 year was done. Preoperative pain (VAS Score), functional ability (ODI), radiological parameters (slip angle, slip grade, disc height, foraminal height, lumbar lordosis) were compared with postoperative recordings at the last followup. Functional improvement (Macnab's criteria) and fusion (Lee's fusion criteria) were assessed. Statistical analysis was done with student's paired t -test and Pearson's correlation coefficient. VAS score, ODI improved from 8 to 2 and 70 to 15 respectively. Slip angle improved from 23°to 5° on an average. 80% patients showed fusion and 85% showed good clinical outcome at 1 year followup. Analyzing with Pearson correlation coefficient showed no significant relation between pain scores and radiological parameters. But there was statistically significant relation between radiological fusion and the final clinical outcome. TLIF produces spinal fusion in most individuals. Strong spinal fusion is essential for good clinical outcome in spondylolisthesis patients who undergo TLIF. Reduction in slip is not necessary for all patients with listhesis.
Probing the fusion of neutron-rich nuclei with re-accelerated radioactive beams
Vadas, J.; Singh, Varinderjit; Wiggins, B. B.; ...
2018-03-27
Here, we report the first measurement of the fusion excitation functions for 39,47K + 28Si at near-barrier energies. Evaporation residues resulting from the fusion process were identified by direct measurement of their energy and time-of-flight with high geometric efficiency. At the lowest incident energy, the cross section measured for the neutron-rich 47K-induced reaction is ≈6 times larger than that of the β-stable system. This experimental approach, both in measurement and in analysis, demonstrates how to efficiently measure fusion with low-intensity re-accelerated radioactive beams, establishing the framework for future studies.
Probing the fusion of neutron-rich nuclei with re-accelerated radioactive beams
NASA Astrophysics Data System (ADS)
Vadas, J.; Singh, Varinderjit; Wiggins, B. B.; Huston, J.; Hudan, S.; deSouza, R. T.; Lin, Z.; Horowitz, C. J.; Chbihi, A.; Ackermann, D.; Famiano, M.; Brown, K. W.
2018-03-01
We report the first measurement of the fusion excitation functions for K,4739+28Si at near-barrier energies. Evaporation residues resulting from the fusion process were identified by direct measurement of their energy and time of flight with high geometric efficiency. At the lowest incident energy, the cross section measured for the neutron-rich 47K-induced reaction is ≈6 times larger than that of the β -stable system. This experimental approach, both in measurement and in analysis, demonstrates how to efficiently measure fusion with low-intensity re-accelerated radioactive beams, establishing the framework for future studies.
Probing the fusion of neutron-rich nuclei with re-accelerated radioactive beams
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vadas, J.; Singh, Varinderjit; Wiggins, B. B.
Here, we report the first measurement of the fusion excitation functions for 39,47K + 28Si at near-barrier energies. Evaporation residues resulting from the fusion process were identified by direct measurement of their energy and time-of-flight with high geometric efficiency. At the lowest incident energy, the cross section measured for the neutron-rich 47K-induced reaction is ≈6 times larger than that of the β-stable system. This experimental approach, both in measurement and in analysis, demonstrates how to efficiently measure fusion with low-intensity re-accelerated radioactive beams, establishing the framework for future studies.
Shirogane, Yuta; Suzuki, Satoshi O.; Ikegame, Satoshi; Koga, Ritsuko
2013-01-01
Subacute sclerosing panencephalitis (SSPE) is a fatal degenerative disease caused by persistent measles virus (MV) infection in the central nervous system (CNS). From the genetic study of MV isolates obtained from SSPE patients, it is thought that defects of the matrix (M) protein play a crucial role in MV pathogenicity in the CNS. In this study, we report several notable mutations in the extracellular domain of the MV fusion (F) protein, including those found in multiple SSPE strains. The F proteins with these mutations induced syncytium formation in cells lacking SLAM and nectin 4 (receptors used by wild-type MV), including human neuronal cell lines, when expressed together with the attachment protein hemagglutinin. Moreover, recombinant viruses with these mutations exhibited neurovirulence in suckling hamsters, unlike the parental wild-type MV, and the mortality correlated with their fusion activity. In contrast, the recombinant MV lacking the M protein did not induce syncytia in cells lacking SLAM and nectin 4, although it formed larger syncytia in cells with either of the receptors. Since human neuronal cells are mainly SLAM and nectin 4 negative, fusion-enhancing mutations in the extracellular domain of the F protein may greatly contribute to MV spread via cell-to-cell fusion in the CNS, regardless of defects of the M protein. PMID:23255801
Fusion of Enveloped Viruses in Endosomes
White, Judith M.; Whittaker, Gary R.
2016-01-01
Ari Helenius launched the field of enveloped virus fusion in endosomes with a seminal paper in the Journal of Cell Biology in 1980. In the intervening years a great deal has been learned about the structures and mechanisms of viral membrane fusion proteins as well as about the endosomes in which different enveloped viruses fuse and the endosomal cues that trigger fusion. We now recognize three classes of viral membrane fusion proteins based on structural criteria and four mechanisms of fusion triggering. After reviewing general features of viral membrane fusion proteins and viral fusion in endosomes, we delve into three characterized mechanisms for viral fusion triggering in endosomes: by low pH, by receptor binding plus low pH, and by receptor binding plus the action of a protease. We end with a discussion of viruses that may employ novel endosomal fusion triggering mechanisms. A key take home message is that enveloped viruses that enter cells by fusing in endosomes traverse the endocytic pathway until they reach an endosome that has all of the environmental conditions (pH, proteases, ions, intracellular receptors, and lipid composition) to (if needed) prime and (in all cases) trigger the fusion protein and to support membrane fusion. PMID:26935856
USDA-ARS?s Scientific Manuscript database
The Autographa californica multiple nucleopolyhedrovirus (AcMNPV) odv-e56 gene encodes an occlusion-derived virus (ODV)-specific envelope protein, ODV-E56. To determine the role of ODV-E56 in oral infectivity, we produced recombinant EGFP-expressing AcMNPV clones (Ac69GFP-e56lacZ and AcIEGFP-e56lac...
Developmental validation of the PowerPlex(®) Fusion 6C System.
Ensenberger, Martin G; Lenz, Kristy A; Matthies, Learden K; Hadinoto, Gregory M; Schienman, John E; Przech, Angela J; Morganti, Michael W; Renstrom, Daniel T; Baker, Victoria M; Gawrys, Kori M; Hoogendoorn, Marlijn; Steffen, Carolyn R; Martín, Pablo; Alonso, Antonio; Olson, Hope R; Sprecher, Cynthia J; Storts, Douglas R
2016-03-01
The PowerPlex(®) Fusion 6C System is a 27-locus, six-dye, multiplex that includes all markers in the expanded CODIS core loci and increases overlap with STR database standards throughout the world. Additionally, it contains two, rapidly mutating, Y-STRs and is capable of both casework and database workflows, including direct amplification. A multi-laboratory developmental validation study was performed on the PowerPlex(®) Fusion 6C System. Here, we report the results of that study which followed SWGDAM guidelines and includes data for: species specificity, sensitivity, stability, precision, reproducibility and repeatability, case-type samples, concordance, stutter, DNA mixtures, and PCR-based procedures. Where appropriate we report data from both extracted DNA samples and direct amplification samples from various substrates and collection devices. Samples from all studies were separated on both Applied Biosystems 3500 series and 6-dye capable 3130 series Genetic Analyzers and data is reported for each. Together, the data validate the design and demonstrate the performance of the PowerPlex(®) Fusion 6C System. Copyright © 2015 The Authors. Published by Elsevier Ireland Ltd.. All rights reserved.
Kibsgård, Thomas J; Røise, Olav; Stuge, Britt
2014-03-15
The fusion of the pelvic joints in patients with severe pelvic girdle pain (PGP) is a controversial and insufficiently studied procedure. The aims of this study were to evaluate physical function and pain after sacroiliac joint (SIJ) fusion. A single-subject research design study with repeated measurements was conducted; pre-operatively and at 3, 6 and 12 months post-operatively. The outcome measures considered were the Oswestry disability index (ODI), visual analogue scale (VAS), and SF-36. Eight patients with severe PGP received open-accessed unilateral anterior SIJ fusion and fusion of the pubic symphysis. Seven patients reported positive results from the surgery. At 1 year post-operation, significant (p < 0.001) reductions in ODI (54 to 37) and VAS (82 to 57) were reported. The physical functioning, bodily pain, and social functioning scores in the SF-36 were also improved. Positive and significant changes in disability and pain at 1 year after SIJ fusion were observed. Despite these positive results, open accessed anterior fusion of the SIJ was associated with adverse events and complications such as infection and nerve damage.
Mahajan, Mukesh; Chatterjee, Deepak; Bhuvaneswari, Kannaian; Pillay, Shubhadra; Bhattacharjya, Surajit
2018-02-01
The lethal Coronaviruses (CoVs), Severe Acute Respiratory Syndrome-associated Coronavirus (SARS-CoV) and most recently Middle East Respiratory Syndrome Coronavirus, (MERS-CoV) are serious human health hazard. A successful viral infection requires fusion between virus and host cells carried out by the surface spike glycoprotein or S protein of CoV. Current models propose that the S2 subunit of S protein assembled into a hexameric helical bundle exposing hydrophobic fusogenic peptides or fusion peptides (FPs) for membrane insertion. The N-terminus of S2 subunit of SARS-CoV reported to be active in cell fusion whereby FPs have been identified. Atomic-resolution structure of FPs derived either in model membranes or in membrane mimic environment would glean insights toward viral cell fusion mechanism. Here, we have solved 3D structure, dynamics and micelle localization of a 64-residue long fusion peptide or LFP in DPC detergent micelles by NMR methods. Micelle bound structure of LFP is elucidated by the presence of discretely folded helical and intervening loops. The C-terminus region, residues F42-Y62, displays a long hydrophobic helix, whereas the N-terminus is defined by a short amphipathic helix, residues R4-Q12. The intervening residues of LFP assume stretches of loops and helical turns. The N-terminal helix is sustained by close aromatic and aliphatic sidechain packing interactions at the non-polar face. 15 N{ 1 H}NOE studies indicated dynamical motion, at ps-ns timescale, of the helices of LFP in DPC micelles. PRE NMR showed that insertion of several regions of LFP into DPC micelle core. Together, the current study provides insights toward fusion mechanism of SARS-CoV. Copyright © 2017 Elsevier B.V. All rights reserved.
Exo-endo cellulase fusion protein
Bower, Benjamin S [Palo Alto, CA; Larenas, Edmund A [Palo Alto, CA; Mitchinson, Colin [Palo Alto, CA
2012-01-17
The present invention relates to a heterologous exo-endo cellulase fusion construct, which encodes a fusion protein having cellulolytic activity comprising a catalytic domain derived from a fungal exo-cellobiohydrolase and a catalytic domain derived from an endoglucanase. The invention also relates to vectors and fungal host cells comprising the heterologous exo-endo cellulase fusion construct as well as methods for producing a cellulase fusion protein and enzymatic cellulase compositions.
Two Strategic Decisions Facing Fusion
NASA Astrophysics Data System (ADS)
Baldwin, D. E.
1998-06-01
Two strategic decisions facing the U.S. fusion program are described. The first decision deals with the role and rationale of the tokamak within the U. S. fusion program, and it underlies the debate over our continuing role in the evolving ITER collaboration (mid-1998). The second decision concerns how to include Inertial Fusion Energy (IFE) as a viable part of the national effort to harness fusion energy.
Clough, S J; Flavier, A B; Schell, M A; Denny, T P
1997-03-01
A complex network regulates virulence in Ralstonia solanacearum (formerly Pseudomonas solanacearum); central to this system is PhcA, a LysR-type transcriptional regulator. We report here that two PhcA-regulated virulence factors, endoglucanase (Egl) and acidic exopolysaccharide I (EPS I), and motility are expressed differentially during exponential growth in batch cultures. Tests with strains carrying lacZ fusions in a wild-type genetic background revealed that expression (on a per-cell basis) of phcA was constant but expression of egl and epsB increased 20- to 50-fold during multiplication from 1 x 10(sup7) to 5 x 10(sup8) CFU/ml. Expression of xpsR, an intermediate regulator downstream of PhcA in the regulatory cascade for eps expression, was similar to that of epsB and egl. Motility track photography revealed that all strains were essentially nonmotile at 10(sup6) CFU/ml. As cell density increased, 30 to 50% of wild-type cells were motile between 10(sup7) and 10(sup8) CFU/ml, but this population was again nonmotile at 10(sup9) CFU/ml. In contrast, about 60% of the cells of phcB and phcA mutants remained motile at 10(sup9) CFU/ml. Expression of phcB, which is not positively regulated by PhcA, was the inverse of epsB, egl, and xpsR (i.e., it decreased 20-fold at high cell density). PhcB is essential for production of an extracellular factor, tentatively identified as 3-hydroxypalmitic acid methyl ester (3-OH PAME), that might act as an exponential-phase signal to activate motility or expression of virulence genes. However, growth of the lacZ fusion strains in medium containing excess 3-OH PAME did not result in motility or expression of virulence genes at dramatically lower cell densities, suggesting that 3-OH PAME is not the only factor controlling these traits.
Frontier of Fusion Research: Path to the Steady State Fusion Reactor by Large Helical Device
NASA Astrophysics Data System (ADS)
Motojima, Osamu
2006-12-01
The ITER, the International Thermonuclear Experimental Reactor, which will be built in Cadarache in France, has finally started this year, 2006. Since the thermal energy produced by fusion reactions divided by the external heating power, i.e., the Q value, will be larger than 10, this is a big step of the fusion research for half a century trying to tame the nuclear fusion for the 6.5 Billion people on the Earth. The source of the Sun's power is lasting steadily and safely for 8 Billion years. As a potentially safe environmentally friendly and economically competitive energy source, fusion should provide a sustainable future energy supply for all mankind for ten thousands of years. At the frontier of fusion research important milestones are recently marked on a long road toward a true prototype fusion reactor. In its own merits, research into harnessing turbulent burning plasmas and thereby controlling fusion reaction, is one of the grand challenges of complex systems science. After a brief overview of a status of world fusion projects, a focus is given on fusion research at the National Institute for Fusion Science (NIFS) in Japan, which is playing a role of the Inter University Institute, the coordinating Center of Excellence for academic fusion research and by the Large Helical Device (LHD), the world's largest superconducting heliotron device, as a National Users' facility. The current status of LHD project is presented focusing on the experimental program and the recent achievements in basic parameters and in steady state operations. Since, its start in a year 1998, a remarkable progress has presently resulted in the temperature of 140 Million degree, the highest density of 500 Thousand Billion/cc with the internal density barrier (IDB) and the highest steady average beta of 4.5% in helical plasma devices and the largest total input energy of 1.6 GJ, in all magnetic confinement fusion devices. Finally, a perspective is given of the ITER Broad Approach program
Nighttime images fusion based on Laplacian pyramid
NASA Astrophysics Data System (ADS)
Wu, Cong; Zhan, Jinhao; Jin, Jicheng
2018-02-01
This paper expounds method of the average weighted fusion, image pyramid fusion, the wavelet transform and apply these methods on the fusion of multiple exposures nighttime images. Through calculating information entropy and cross entropy of fusion images, we can evaluate the effect of different fusion. Experiments showed that Laplacian pyramid image fusion algorithm is suitable for processing nighttime images fusion, it can reduce the halo while preserving image details.
Anterior interbody fusion for cervical osteomyelitis
Bartal, A. D.; Schiffer, J.; Heilbronn, Y. D.; Yahel, M.
1972-01-01
Interbody fusion for stabilization of the cervical spine after osteomyelitic destruction of the body of C5 vertebra is reported in a patient with quadriplegia and sphincter disturbances secondary to an epidural abscess. The successful union of the bone graft along with complete neurological recovery after anterior decompression and evacuation of the epidural mass seem to justify the procedure. Images PMID:4554587
Fusion of disubstituted benzenes.
Martin, E; Yalkowsky, S H; Wells, J E
1979-05-01
The entropy of fusion of 84 disubstituted benzenes was essentially constant and independent of the participation of the compounds in intramolecular or intermolecular hydrogen bonding. It was also independent of the shapes, sizes, and dipole moments of the rigid molecules studied. While the entropy of fusion was independent of these parameters, the melting point and the heat of fusion showed a direct dependence on molecular properties.
Madan, S S; Boeree, N R
2003-12-01
Posterior lumbar interbody fusion (PLIF) restores disc height, the load bearing ability of anterior ligaments and muscles, root canal dimensions, and spinal balance. It immobilizes the painful degenerate spinal segment and decompresses the nerve roots. Anterior lumbar interbody fusion (ALIF) does the same, but could have complications of graft extrusion, compression and instability contributing to pseudarthrosis in the absence of instrumentation. The purpose of this study was to assess and compare the outcome of instrumented circumferential fusion through a posterior approach [PLIF and posterolateral fusion (PLF)] with instrumented ALIF using the Hartshill horseshoe cage, for comparable degrees of internal disc disruption and clinical disability. It was designed as a prospective study, comparing the outcome of two methods of instrumented interbody fusion for internal disc disruption. Between April 1994 and June 1998, the senior author (N.R.B.) performed 39 instrumented ALIF procedures and 35 instrumented circumferential fusion with PLIF procedures. The second author, an independent assessor (S.M.), performed the entire review. Preoperative radiographic assessment included plain radiographs, magnetic resonance imaging (MRI) and provocative discography in all the patients. The outcome in the two groups was compared in terms of radiological improvement and clinical improvement, measured on the basis of improvement of back pain and work capacity. Preoperatively, patients were asked to fill out a questionnaire giving their demographic details, maximum walking distance and current employment status in order to establish the comparability of the two groups. Patient assessment was with the Oswestry Disability Index, quality of life questionnaire (subjective), pain drawing, visual analogue scale, disability benefit, compensation status, and psychological profile. The results of the study showed a satisfactory outcome (score< or =30) on the subjective (quality of life
Lu, Hengyu; Villafane, Nicole; Dogruluk, Turgut; Grzeskowiak, Caitlin L; Kong, Kathleen; Tsang, Yiu Huen; Zagorodna, Oksana; Pantazi, Angeliki; Yang, Lixing; Neill, Nicholas J; Kim, Young Won; Creighton, Chad J; Verhaak, Roel G; Mills, Gordon B; Park, Peter J; Kucherlapati, Raju; Scott, Kenneth L
2017-07-01
Oncogenic gene fusions drive many human cancers, but tools to more quickly unravel their functional contributions are needed. Here we describe methodology permitting fusion gene construction for functional evaluation. Using this strategy, we engineered the known fusion oncogenes, BCR-ABL1, EML4-ALK , and ETV6-NTRK3, as well as 20 previously uncharacterized fusion genes identified in The Cancer Genome Atlas datasets. In addition to confirming oncogenic activity of the known fusion oncogenes engineered by our construction strategy, we validated five novel fusion genes involving MET, NTRK2 , and BRAF kinases that exhibited potent transforming activity and conferred sensitivity to FDA-approved kinase inhibitors. Our fusion construction strategy also enabled domain-function studies of BRAF fusion genes. Our results confirmed other reports that the transforming activity of BRAF fusions results from truncation-mediated loss of inhibitory domains within the N-terminus of the BRAF protein. BRAF mutations residing within this inhibitory region may provide a means for BRAF activation in cancer, therefore we leveraged the modular design of our fusion gene construction methodology to screen N-terminal domain mutations discovered in tumors that are wild-type at the BRAF mutation hotspot, V600. We identified an oncogenic mutation, F247L, whose expression robustly activated the MAPK pathway and sensitized cells to BRAF and MEK inhibitors. When applied broadly, these tools will facilitate rapid fusion gene construction for subsequent functional characterization and translation into personalized treatment strategies. Cancer Res; 77(13); 3502-12. ©2017 AACR . ©2017 American Association for Cancer Research.
Direct Visualization of Wide Fusion-Fission Pores and Their Highly Varied Dynamics.
Eyring, Katherine W; Tsien, Richard W
2018-05-03
In this issue of Cell, Shin et al. report the first live-cell imaging of a fusion pore. Directly visualized pores in neuroendocrine cells can be much larger than expected yet not require vesicular full-collapse. These fusion-fission pores have diverse fates arising from opposing dynamin-driven pore constriction and F-actin-mediated pore expansion. Copyright © 2018. Published by Elsevier Inc.
Preparation of GST Fusion Proteins.
Einarson, Margret B; Pugacheva, Elena N; Orlinick, Jason R
2007-04-01
INTRODUCTIONThis protocol describes the preparation of glutathione-S-transferase (GST) fusion proteins, which have had a wide range of applications since their introduction as tools for synthesis of recombinant proteins in bacteria. GST was originally selected as a fusion moiety because of several desirable properties. First and foremost, when expressed in bacteria alone, or as a fusion, GST is not sequestered in inclusion bodies (in contrast to previous fusion protein systems). Second, GST can be affinity-purified without denaturation because it binds to immobilized glutathione, which provides the basis for simple purification. Consequently, GST fusion proteins are routinely used for antibody generation and purification, protein-protein interaction studies, and biochemical analysis.
Gibbons, Don L.; Reilly, Brigid; Ahn, Anna; Vaney, Marie-Christine; Vigouroux, Armelle; Rey, Felix A.; Kielian, Margaret
2004-01-01
The fusion proteins of the alphaviruses and flaviviruses have a similar native structure and convert to a highly stable homotrimer conformation during the fusion of the viral and target membranes. The properties of the alpha- and flavivirus fusion proteins distinguish them from the class I viral fusion proteins, such as influenza virus hemagglutinin, and establish them as the first members of the class II fusion proteins. Understanding how this new class carries out membrane fusion will require analysis of the structural basis for both the interaction of the protein subunits within the homotrimer and their interaction with the viral and target membranes. To this end we report a purification method for the E1 ectodomain homotrimer from the alphavirus Semliki Forest virus. The purified protein is trimeric, detergent soluble, retains the characteristic stability of the starting homotrimer, and is free of lipid and other contaminants. In contrast to the postfusion structures that have been determined for the class I proteins, the E1 homotrimer contains the fusion peptide region responsible for interaction with target membranes. This E1 trimer preparation is an excellent candidate for structural studies of the class II viral fusion proteins, and we report conditions that generate three-dimensional crystals suitable for analysis by X-ray diffraction. Determination of the structure will provide our first high-resolution views of both the low-pH-induced trimeric conformation and the target membrane-interacting region of the alphavirus fusion protein. PMID:15016874
Multi-scale pixel-based image fusion using multivariate empirical mode decomposition.
Rehman, Naveed ur; Ehsan, Shoaib; Abdullah, Syed Muhammad Umer; Akhtar, Muhammad Jehanzaib; Mandic, Danilo P; McDonald-Maier, Klaus D
2015-05-08
A novel scheme to perform the fusion of multiple images using the multivariate empirical mode decomposition (MEMD) algorithm is proposed. Standard multi-scale fusion techniques make a priori assumptions regarding input data, whereas standard univariate empirical mode decomposition (EMD)-based fusion techniques suffer from inherent mode mixing and mode misalignment issues, characterized respectively by either a single intrinsic mode function (IMF) containing multiple scales or the same indexed IMFs corresponding to multiple input images carrying different frequency information. We show that MEMD overcomes these problems by being fully data adaptive and by aligning common frequency scales from multiple channels, thus enabling their comparison at a pixel level and subsequent fusion at multiple data scales. We then demonstrate the potential of the proposed scheme on a large dataset of real-world multi-exposure and multi-focus images and compare the results against those obtained from standard fusion algorithms, including the principal component analysis (PCA), discrete wavelet transform (DWT) and non-subsampled contourlet transform (NCT). A variety of image fusion quality measures are employed for the objective evaluation of the proposed method. We also report the results of a hypothesis testing approach on our large image dataset to identify statistically-significant performance differences.
Multi-Scale Pixel-Based Image Fusion Using Multivariate Empirical Mode Decomposition
Rehman, Naveed ur; Ehsan, Shoaib; Abdullah, Syed Muhammad Umer; Akhtar, Muhammad Jehanzaib; Mandic, Danilo P.; McDonald-Maier, Klaus D.
2015-01-01
A novel scheme to perform the fusion of multiple images using the multivariate empirical mode decomposition (MEMD) algorithm is proposed. Standard multi-scale fusion techniques make a priori assumptions regarding input data, whereas standard univariate empirical mode decomposition (EMD)-based fusion techniques suffer from inherent mode mixing and mode misalignment issues, characterized respectively by either a single intrinsic mode function (IMF) containing multiple scales or the same indexed IMFs corresponding to multiple input images carrying different frequency information. We show that MEMD overcomes these problems by being fully data adaptive and by aligning common frequency scales from multiple channels, thus enabling their comparison at a pixel level and subsequent fusion at multiple data scales. We then demonstrate the potential of the proposed scheme on a large dataset of real-world multi-exposure and multi-focus images and compare the results against those obtained from standard fusion algorithms, including the principal component analysis (PCA), discrete wavelet transform (DWT) and non-subsampled contourlet transform (NCT). A variety of image fusion quality measures are employed for the objective evaluation of the proposed method. We also report the results of a hypothesis testing approach on our large image dataset to identify statistically-significant performance differences. PMID:26007714
Whiteside, T S; Hilal, S H; Brenner, A; Carreira, L A
2016-08-01
The entropy of fusion, enthalpy of fusion, and melting point of organic compounds can be estimated through three models developed using the SPARC (SPARC Performs Automated Reasoning in Chemistry) platform. The entropy of fusion is modelled through a combination of interaction terms and physical descriptors. The enthalpy of fusion is modelled as a function of the entropy of fusion, boiling point, and flexibility of the molecule. The melting point model is the enthalpy of fusion divided by the entropy of fusion. These models were developed in part to improve SPARC's vapour pressure and solubility models. These models have been tested on 904 unique compounds. The entropy model has a RMS of 12.5 J mol(-1) K(-1). The enthalpy model has a RMS of 4.87 kJ mol(-1). The melting point model has a RMS of 54.4°C.
Neuronal activity-dependent membrane traffic at the neuromuscular junction
Miana-Mena, Francisco Javier; Roux, Sylvie; Benichou, Jean-Claude; Osta, Rosario; Brûlet, Philippe
2002-01-01
During development and also in adulthood, synaptic connections are modulated by neuronal activity. To follow such modifications in vivo, new genetic tools are designed. The nontoxic C-terminal fragment of tetanus toxin (TTC) fused to a reporter gene such as LacZ retains the retrograde and transsynaptic transport abilities of the holotoxin itself. In this work, the hybrid protein is injected intramuscularly to analyze in vivo the mechanisms of intracellular and transneuronal traffics at the neuromuscular junction (NMJ). Traffic on both sides of the synapse are strongly dependent on presynaptic neural cell activity. In muscle, a directional membrane traffic concentrates β-galactosidase-TTC hybrid protein into the NMJ postsynaptic side. In neurons, the probe is sorted across the cell to dendrites and subsequently to an interconnected neuron. Such fusion protein, sensitive to presynaptic neuronal activity, would be extremely useful to analyze morphological changes and plasticity at the NMJ. PMID:11880654
Kinetic advantage of controlled intermediate nuclear fusion
NASA Astrophysics Data System (ADS)
Guo, Xiaoming
2012-09-01
The dominated process of controlled fusion is to let nuclei gain enough kinetic energy to overcome Coulomb barrier. As a result, a fusion scheme can consider two factors in its design: to increase kinetic energy of nuclei and to alter the Coulomb barrier. Cold Fusion and Hot fusion are all one-factor schemes while Intermediate Fusion is a twofactors scheme. This made CINF kinetically superior. Cold Fusion reduces deuteron-deuteron distance, addressing Coulomb barrier, and Hot Fusion heat up plasma into extreme high temperature, addressing kinetic energy. Without enough kinetic energy made Cold Fusion skeptical. Extreme high temperature made Hot Fusion very difficult to engineer. Because CIFN addresses both factors, CIFN is a more promising technique to be industrialized.
NASA Astrophysics Data System (ADS)
Patel, Umang; Joshipura, K. N.
2017-04-01
Plasma-wall interaction (PWI) is one of the key issues in nuclear fusion research. In nuclear fusion devices, such as the JET tokamak or the ITER, first-wall materials will be directly exposed to plasma components. Erosion of first-wall materials is a consequence of the impact of hydrogen and its isotopes as main constituents of the hot plasma. Besides the formation of gas-phase atomic species in various charge states, di- and polyatomic molecular species are expected to be formed via PWI processes. These compounds may profoundly disturb the fusion plasma, may lead to unfavorable re-deposition of materials and composites in other areas of the vessel. Interaction between atoms, molecules as well transport of impurities are of interest for modelling of fusion plasma. Qion by electron impact are such process also important in low temperature plasma processing, astrophysics etc. We reported electron impact Qionfor iron hydrogen clusters, FeHn (n = 1 to 10) from ionization threshold to 2000 eV. A semi empirical approach called Complex Scattering Potential - Ionization Contribution (CSP-ic) has been employed for the reported calculation. In context of fusion relevant species Qion were reported for beryllium and its hydrides, tungsten and its oxides and cluster of beryllium-tungsten by Huber et al.. Iron hydrogen clusters are another such species whose Qion were calculated through DM and BEB formalisms, same has been compared with present calculations.
NASA Astrophysics Data System (ADS)
Emmerman, Philip J.
2005-05-01
Teams of robots or mixed teams of warfighters and robots on reconnaissance and other missions can benefit greatly from a local fusion station. A local fusion station is defined here as a small mobile processor with interfaces to enable the ingestion of multiple heterogeneous sensor data and information streams, including blue force tracking data. These data streams are fused and integrated with contextual information (terrain features, weather, maps, dynamic background features, etc.), and displayed or processed to provide real time situational awareness to the robot controller or to the robots themselves. These blue and red force fusion applications remove redundancies, lessen ambiguities, correlate, aggregate, and integrate sensor information with context such as high resolution terrain. Applications such as safety, team behavior, asset control, training, pattern analysis, etc. can be generated or enhanced by these fusion stations. This local fusion station should also enable the interaction between these local units and a global information world.
NASA Astrophysics Data System (ADS)
Medley, S. S.; Cecil, F. E.; Cole, D.; Conway, M. A.; Wilkinson, F. J., III
1985-05-01
Nuclear reactions of interest in fusion research often possess a branch yielding prompt emission of gamma radiation in excess of 15 MeV which can be exploited to provide a new fusion reaction diagnostic having applications similar to conventional neutron emission measurements. Conceptual aspects of fusion gamma diagnostics are discussed with emphasis on application to the Tokamak Fusion Test Reactor (TFTR) during deuterium neutral beam heating of D-T and D-3He plasmas. Recent measurements of the D (T, γ)5He, D(3He, γ)5Li, and D(D, γ)4He branching ratios at low center-of-mass energy (30-100 keV) and of the response of a large volume Ne226 detector for gamma detection in high neutron backgrounds are presented. Using a well-shielded Ne226 detector during 20 MW-120 kV deuterium beam heating of a tritium plasma in TFTR, the D(T, γ)5He gamma signal level is estimated to be 3.5×105 cps.
Inertial-confinement fusion with lasers
NASA Astrophysics Data System (ADS)
Betti, R.; Hurricane, O. A.
2016-05-01
The quest for controlled fusion energy has been ongoing for over a half century. The demonstration of ignition and energy gain from thermonuclear fuels in the laboratory has been a major goal of fusion research for decades. Thermonuclear ignition is widely considered a milestone in the development of fusion energy, as well as a major scientific achievement with important applications in national security and basic sciences. The US is arguably the world leader in the inertial confinement approach to fusion and has invested in large facilities to pursue it, with the objective of establishing the science related to the safety and reliability of the stockpile of nuclear weapons. Although significant progress has been made in recent years, major challenges still remain in the quest for thermonuclear ignition via laser fusion. Here, we review the current state of the art in inertial confinement fusion research and describe the underlying physical principles.
The Ancient Gamete Fusogen HAP2 Is a Eukaryotic Class II Fusion Protein.
Fédry, Juliette; Liu, Yanjie; Péhau-Arnaudet, Gérard; Pei, Jimin; Li, Wenhao; Tortorici, M Alejandra; Traincard, François; Meola, Annalisa; Bricogne, Gérard; Grishin, Nick V; Snell, William J; Rey, Félix A; Krey, Thomas
2017-02-23
Sexual reproduction is almost universal in eukaryotic life and involves the fusion of male and female haploid gametes into a diploid cell. The sperm-restricted single-pass transmembrane protein HAP2-GCS1 has been postulated to function in membrane merger. Its presence in the major eukaryotic taxa-animals, plants, and protists (including important human pathogens like Plasmodium)-suggests that many eukaryotic organisms share a common gamete fusion mechanism. Here, we report combined bioinformatic, biochemical, mutational, and X-ray crystallographic studies on the unicellular alga Chlamydomonas reinhardtii HAP2 that reveal homology to class II viral membrane fusion proteins. We further show that targeting the segment corresponding to the fusion loop by mutagenesis or by antibodies blocks gamete fusion. These results demonstrate that HAP2 is the gamete fusogen and suggest a mechanism of action akin to viral fusion, indicating a way to block Plasmodium transmission and highlighting the impact of virus-cell genetic exchanges on the evolution of eukaryotic life. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
La Rosa, Giovanni; Conti, Alfredo; Cacciola, Fabio; Cardali, Salvatore; La Torre, Domenico; Gambadauro, Nicola Maria; Tomasello, Francesco
2003-09-01
Posterolateral fusion involving instrumentation-assisted segmental fixation represents a valid procedure in the treatment of lumbar instability. In cases of anterior column failure, such as in isthmic spondylolisthesis, supplemental posterior lumbar interbody fusion (PLIF) may improve the fusion rate and endurance of the construct. Posterior lumbar interbody fusion is, however, a more demanding procedure and increases costs and risks of the intervention. The advantages of this technique must, therefore, be weighed against those of a simple posterior lumbar fusion. Thirty-five consecutive patients underwent pedicle screw fixation for isthmic spondylolisthesis. In 18 patients posterior lumbar fusion was performed, and in 17 patients PLIF was added. Clinical, economic, functional, and radiographic data were assessed to determine differences in clinical and functional results and biomechanical properties. At 2-year follow-up examination, the correction of subluxation, disc height, and foraminal area were maintained in the group in which a PLIF procedure was performed, but not in the posterolateral fusion-only group (p < 0.05). Nevertheless, no statistical intergroup differences were demonstrated in terms of neurological improvement (p = 1), economic (p = 0.43), or functional (p = 0.95) outcome, nor in terms of fusion rate (p = 0.49). The authors' findings support the view that an interbody fusion confers superior mechanical strength to the spinal construct; when posterolateral fusion is the sole intervention, progressive loss of the extreme correction can be expected. Such mechanical insufficiency, however, did not influence clinical outcome.
Lee, Michael J; Dumonski, Mark; Phillips, Frank M; Voronov, Leonard I; Renner, Susan M; Carandang, Gerard; Havey, Robert M; Patwardhan, Avinash G
2011-11-01
A cadaveric biomechanical study. To investigate the biomechanical behavior of the cervical spine after cervical total disc replacement (TDR) adjacent to a fusion as compared to a two-level fusion. There are concerns regarding the biomechanical effects of cervical fusion on the mobile motion segments. Although previous biomechanical studies have demonstrated that cervical disc replacement normalizes adjacent segment motion, there is a little information regarding the function of a cervical disc replacement adjacent to an anterior cervical decompression and fusion, a potentially common clinical application. Nine cadaveric cervical spines (C3-T1, age: 60.2 ± 3.5 years) were tested under load- and displacement-control testing. After intact testing, a simulated fusion was performed at C4-C5, followed by C6-C7. The simulated fusion was then reversed, and the response of TDR at C5-C6 was measured. A hybrid construct was then tested with the TDR either below or above a single-level fusion and contrasted with a simulated two-level fusion (C4-C6 and C5-C7). The external fixator device used to simulate fusion significantly reduced range of motion (ROM) at C4-C5 and C6-C7 by 74.7 ± 8.1% and 78.1 ± 11.5%, respectively (P < 0.05). Removal of the fusion construct restored the motion response of the spinal segments to their intact state. Arthroplasty performed at C5-C6 using the porous-coated motion disc prosthesis maintained the total flexion-extension ROM to the level of the intact controls when used as a stand-alone procedure or when implanted adjacent to a single-level fusion (P > 0.05). The location of the single-level fusion, whether above or below the arthroplasty, did not significantly affect the motion response of the arthroplasty in the hybrid construct. Performing a two-level fusion significantly increased the motion demands on the nonoperated segments as compared to a hybrid TDR-plus fusion construct when the spine was required to reach the same motion end points
ERIC Educational Resources Information Center
Glasstone, Samuel
This publication is one of a series of information booklets for the general public published by The United States Atomic Energy Commission. Among the topics discussed are: Importance of Fusion Energy; Conditions for Nuclear Fusion; Thermonuclear Reactions in Plasmas; Plasma Confinement by Magnetic Fields; Experiments With Plasmas; High-Temperature…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chang, Choong-Seock; Greenwald, Martin; Riley, Katherine
The additional computing power offered by the planned exascale facilities could be transformational across the spectrum of plasma and fusion research — provided that the new architectures can be efficiently applied to our problem space. The collaboration that will be required to succeed should be viewed as an opportunity to identify and exploit cross-disciplinary synergies. To assess the opportunities and requirements as part of the development of an overall strategy for computing in the exascale era, the Exascale Requirements Review meeting of the Fusion Energy Sciences (FES) community was convened January 27–29, 2016, with participation from a broad range ofmore » fusion and plasma scientists, specialists in applied mathematics and computer science, and representatives from the U.S. Department of Energy (DOE) and its major computing facilities. This report is a summary of that meeting and the preparatory activities for it and includes a wealth of detail to support the findings. Technical opportunities, requirements, and challenges are detailed in this report (and in the recent report on the Workshop on Integrated Simulation). Science applications are described, along with mathematical and computational enabling technologies. Also see http://exascaleage.org/fes/ for more information.« less
Measles virus fusion machinery activated by sialic acid binding globular domain.
Talekar, Aparna; Moscona, Anne; Porotto, Matteo
2013-12-01
Paramyxoviruses, including the human pathogen measles virus (MV) and the avian Newcastle disease virus (NDV), enter host cells through fusion of the viral envelope with the target cell membrane. This fusion is driven by the concerted action of two viral envelope glycoproteins: the receptor binding protein and the fusion protein (F). The MV receptor binding protein (hemagglutinin [H]) attaches to proteinaceous receptors on host cells, while the receptor binding protein of NDV (hemagglutinin-neuraminidase [HN]) interacts with sialic acid-containing receptors. The receptor-bound HN/H triggers F to undergo conformational changes that render it competent to mediate fusion of the viral and cellular membranes. The mechanism of fusion activation has been proposed to be different for sialic acid-binding viruses and proteinaceous receptor-binding viruses. We report that a chimeric protein containing the NDV HN receptor binding region and the MV H stalk domain can activate MV F to fuse, suggesting that the signal to the stalk of a protein-binding receptor binding molecule can be transmitted from a sialic acid binding domain. By engineering the NDV HN globular domain to interact with a proteinaceous receptor, the fusion activation signal was preserved. Our findings are consistent with a unified mechanism of fusion activation, at least for the Paramyxovirinae subfamily, in which the receptor binding domains of the receptor binding proteins are interchangeable and the stalk determines the specificity of F activation.
Rhee, Wootack; Ha, Seongil; Lim, Jae Hyeon; Jang, Il Tae
2014-01-01
Objective Using alendronate after spinal fusion is a controversial issue due to the inhibition of osteoclast mediated bone resorption. In addition, there are an increasing number of reports that the endplate degeneration influences the lumbar spinal fusion. The object of this retrospective controlled study was to evaluate how the endplate degeneration and the bisphosphonate medication influence the spinal fusion through radiographic evaluation. Methods In this study, 44 patients who underwent single-level posterior lumbar interbody fusion (PLIF) using cage were examined from April 2007 to March 2009. All patients had been diagnosed as osteoporosis and would be recommended for alendronate medication. Endplate degeneration is categorized by the Modic changes. The solid fusion is defined if there was bridging bone between the vertebral bodies, either within or external to the cage on the plain X-ray and if there is less than 5° of angular difference in dynamic X-ray. Results In alendronate group, fusion was achieved in 66.7% compared to 73.9% in control group (no medication). Alendronate did not influence the fusion rate of PLIF. However, there was the statistical difference of fusion rate between the endplate degeneration group and the group without endplate degeneration. A total of 52.4% of fusion rate was seen in the endplate degeneration group compared to 91.3% in the group without endplate degeneration. The endplate degeneration suppresses the fusion process of PLIF. Conclusion Alendronate does not influence the fusion process in osteoporotic patients. The endplate degeneration decreases the fusion rate. PMID:25620981
Nam, Woo Dong; Cho, Jae Hwan
2015-03-01
There are few studies about risk factors for poor outcomes from multi-level lumbar posterolateral fusion limited to three or four level lumbar posterolateral fusions. The purpose of this study was to analyze the outcomes of multi-level lumbar posterolateral fusion and to search for possible risk factors for poor surgical outcomes. We retrospectively analyzed 37 consecutive patients who underwent multi-level lumbar or lumbosacral posterolateral fusion with posterior instrumentation. The outcomes were deemed either 'good' or 'bad' based on clinical and radiological results. Many demographic and radiological factors were analyzed to examine potential risk factors for poor outcomes. Student t-test, Fisher exact test, and the chi-square test were used based on the nature of the variables. Multiple logistic regression analysis was used to exclude confounding factors. Twenty cases showed a good outcome (group A, 54.1%) and 17 cases showed a bad outcome (group B, 45.9%). The overall fusion rate was 70.3%. The revision procedures (group A: 1/20, 5.0%; group B: 4/17, 23.5%), proximal fusion to L2 (group A: 5/20, 25.0%; group B: 10/17, 58.8%), and severity of stenosis (group A: 12/19, 63.3%; group B: 3/11, 27.3%) were adopted as possible related factors to the outcome in univariate analysis. Multiple logistic regression analysis revealed that only the proximal fusion level (superior instrumented vertebra, SIV) was a significant risk factor. The cases in which SIV was L2 showed inferior outcomes than those in which SIV was L3. The odds ratio was 6.562 (95% confidence interval, 1.259 to 34.203). The overall outcome of multi-level lumbar or lumbosacral posterolateral fusion was not as high as we had hoped it would be. Whether the SIV was L2 or L3 was the only significant risk factor identified for poor outcomes in multi-level lumbar or lumbosacral posterolateral fusion in the current study. Thus, the authors recommend that proximal fusion levels be carefully determined when
EDITORIAL: Safety aspects of fusion power plants
NASA Astrophysics Data System (ADS)
Kolbasov, B. N.
2007-07-01
This special issue of Nuclear Fusion contains 13 informative papers that were initially presented at the 8th IAEA Technical Meeting on Fusion Power Plant Safety held in Vienna, Austria, 10-13 July 2006. Following recommendation from the International Fusion Research Council, the IAEA organizes Technical Meetings on Fusion Safety with the aim to bring together experts to discuss the ongoing work, share new ideas and outline general guidance and recommendations on different issues related to safety and environmental (S&E) aspects of fusion research and power facilities. Previous meetings in this series were held in Vienna, Austria (1980), Ispra, Italy (1983), Culham, UK (1986), Jackson Hole, USA (1989), Toronto, Canada (1993), Naka, Japan (1996) and Cannes, France (2000). The recognized progress in fusion research and technology over the last quarter of a century has boosted the awareness of the potential of fusion to be a practically inexhaustible and clean source of energy. The decision to construct the International Thermonuclear Experimental Reactor (ITER) represents a landmark in the path to fusion power engineering. Ongoing activities to license ITER in France look for an adequate balance between technological and scientific deliverables and complying with safety requirements. Actually, this is the first instance of licensing a representative fusion machine, and it will very likely shape the way in which a more common basis for establishing safety standards and policies for licensing future fusion power plants will be developed. Now that ITER licensing activities are underway, it is becoming clear that the international fusion community should strengthen its efforts in the area of designing the next generations of fusion power plants—demonstrational and commercial. Therefore, the 8th IAEA Technical Meeting on Fusion Safety focused on the safety aspects of power facilities. Some ITER-related safety issues were reported and discussed owing to their potential
Heiney, Jake; Capobianco, Robyn; Cher, Daniel
2015-01-01
A number of studies have been published regarding minimally invasive surgical (MIS) fusion of the sacroiliac (SI) joint using a lateral transarticular approach. Herein we report a systematic review and meta-analysis to summarize operative measures and clinical outcomes reported in published studies of MIS SI joint fusion. The systematic review was done according to PRISMA standards. PubMed and EMBASE were searched using the terms sacroiliac joint AND fusion. Original peer-reviewed articles in the English language that reported clinical outcomes on at least 5 cases of MIS SI joint fusion using a lateral transarticular approach were included. Random effects meta-analysis (RMA) was performed on selected variables using the DerSimonian and Laird method, including operative measures, VAS SI joint pain ratings (0-10 scale) and Oswestry Disability Index (ODI). Mean and 95% confidence intervals (CI) were calculated and heterogeneity was assessed. Other findings were summarized qualitatively. A total of 18 articles met the inclusion criteria. After accounting for overlapping cohorts, 12 unique cohorts from 4 countries were extracted for a total of 432 subjects. The RMA mean (range) was 59 minutes (27-78) for procedure time, 36.9cc (10-70) for estimated blood loss and 1.7 days (range 0-7) for length of stay (LOS). The RMA mean [95% CI] pain score dropped by 5.2 points at 6 months and 5.3 points at 12 months (baseline score of 8.1 [7.8-8.4], 12-month score of 2.7 [2.1-3.3]), and a 24-month score of 2.0(1.4-2.5). ODI decreased by 31 points at 12 months (baseline score of 56.2 [51.0-61.5], 6-month score of 30.7 [21.8-39.6], and 12-month score of 25.1 [12.3-37.9]). Some estimates showed significant variation across studies and between the types of implants used. Other reported outcomes were supportive of the positive effects of SI joint fusion. Published studies of MIS SI joint fusion using a lateral transarticular approach confirm its minimally invasive characteristics with
Zhu, Guanchen; Qiu, Xuefeng; Chen, Xianchen; Liu, Guangxiang; Zhang, Gutian; Gan, Weidong; Guo, Hongqian
2015-12-01
Renal cell carcinoma (RCC) accounts for 85-90% of kidney cancers, which in turn account for 2-3% of all malignant tumors in adults. Xp11.2 translocation/TFE3 gene fusion RCC is currently classified as a distinct type of RCC. RCC is capable of invading the renal vein and inferior vena cava to form a tumor thrombus. The incidence of RCC with tumor thrombi within the renal vein or inferior vena cava is 7-10% in China. In the present case report, the patient underwent radical resection of the renal tumor and removal of the tumor thrombus, assisted by cardiopulmonary bypass, for the treatment of Xp11.2 translocation/TFE3 gene fusion RCC. The patient was followed-up for 12 months subsequent to treatment. The patient's renal function remained within the normal range, and computed tomography examination revealed no evidence of disease recurrence or metastases. The present case report aimed to provide a reference for the development of guidelines for the diagnosis and treatment of Xp11.2 translocation/TFE3 gene fusion RCC.
ZHU, GUANCHEN; QIU, XUEFENG; CHEN, XIANCHEN; LIU, GUANGXIANG; ZHANG, GUTIAN; GAN, WEIDONG; GUO, HONGQIAN
2015-01-01
Renal cell carcinoma (RCC) accounts for 85–90% of kidney cancers, which in turn account for 2–3% of all malignant tumors in adults. Xp11.2 translocation/TFE3 gene fusion RCC is currently classified as a distinct type of RCC. RCC is capable of invading the renal vein and inferior vena cava to form a tumor thrombus. The incidence of RCC with tumor thrombi within the renal vein or inferior vena cava is 7–10% in China. In the present case report, the patient underwent radical resection of the renal tumor and removal of the tumor thrombus, assisted by cardiopulmonary bypass, for the treatment of Xp11.2 translocation/TFE3 gene fusion RCC. The patient was followed-up for 12 months subsequent to treatment. The patient's renal function remained within the normal range, and computed tomography examination revealed no evidence of disease recurrence or metastases. The present case report aimed to provide a reference for the development of guidelines for the diagnosis and treatment of Xp11.2 translocation/TFE3 gene fusion RCC. PMID:26788164
Novel Fe3+-Based 1H MRI β-Galactosidase Reporter Molecules**
Yu, Jian-Xin; Gulaka, Praveen K.; Liu, Li; Kodibagkar, Vikram D.; Mason, Ralph P.
2012-01-01
There is increasing interest in the development of reporter agents to reveal enzyme activity in vivo using small animal imaging. We have previously demonstrated the feasibility of detecting lacZ gene activity using the commercially available 3,4-cyclohexenoesculetin-β-D-galactopyranoside (S-Gal™) as a 1H MRI reporter. Specifically, β-galactosidase (β-gal) releases the aglycone, which forms an MR contrast-inducing paramagnetic precipitate in the presence of Fe3+. Contrast was primarily T2-weighted signal loss, but T1 effects were also observed. Since T1-contrast generally provides signal enhancement as opposed to loss, it appeared attractive to explore whether analogues could be generated with enhanced characteristics. We now report the design and successful synthesis of novel analogues together with characterization of 1H MRI contrast based on both T1 and T2 response to β-gal activity in vitro for the lead agent. PMID:23807909
Park, JungEun; Oh, HyunJu; Hong, SoGun; Kim, MinJung; Kim, GeonA; Koo, OkJae; Kang, SungKeun; Jang, Goo; Lee, ByeongChun
2011-03-01
As shown by the birth of the first cloned dog 'Snuppy', a protocol to produce viable cloned dogs has been reported. In order to evaluate optimum fusion conditions for improving dog cloning efficiency, in vivo matured oocytes were reconstructed with adult somatic cells from a female Pekingese using different fusion conditions. Fusion with needle vs chamber methods, and with low vs high pulse strength was compared by evaluating fusion rate and in vivo development of canine cloned embryos. The fusion rates in the high voltage groups were significantly higher than in the low voltage groups regardless of fusion method (83.5 vs 66.1% for the needle fusion method, 67.4 vs 37.9% for the fusion chamber method). After embryo transfer, one each pregnancy was detected after using the needle fusion method with high and low voltage and in the chamber fusion method with high voltage, whereas no pregnancy was detected using the chamber method with low voltage. However, only the pregnancy from the needle fusion method with high voltage was maintained to term and one healthy puppy was delivered. The results of the present study demonstrated that two DC pulses of 3.8 to 4.0 kV/cm for 15 μsec using the needle fusion method were the most effective method for the production of cloned dogs under the conditions of this experiment. Copyright © 2011 Elsevier Inc. All rights reserved.
One decade of the Data Fusion Information Group (DFIG) model
NASA Astrophysics Data System (ADS)
Blasch, Erik
2015-05-01
The revision of the Joint Directors of the Laboratories (JDL) Information Fusion model in 2004 discussed information processing, incorporated the analyst, and was coined the Data Fusion Information Group (DFIG) model. Since that time, developments in information technology (e.g., cloud computing, applications, and multimedia) have altered the role of the analyst. Data production has outpaced the analyst; however the analyst still has the role of data refinement and information reporting. In this paper, we highlight three examples being addressed by the DFIG model. One example is the role of the analyst to provide semantic queries (through an ontology) so that vast amount of data available can be indexed, accessed, retrieved, and processed. The second idea is reporting which requires the analyst to collect the data into a condensed and meaningful form through information management. The last example is the interpretation of the resolved information from data that must include contextual information not inherent in the data itself. Through a literature review, the DFIG developments in the last decade demonstrate the usability of the DFIG model to bring together the user (analyst or operator) and the machine (information fusion or manager) in a systems design.
The tumorigenic FGFR3-TACC3 gene fusion escapes miR-99a regulation in glioblastoma.
Parker, Brittany C; Annala, Matti J; Cogdell, David E; Granberg, Kirsi J; Sun, Yan; Ji, Ping; Li, Xia; Gumin, Joy; Zheng, Hong; Hu, Limei; Yli-Harja, Olli; Haapasalo, Hannu; Visakorpi, Tapio; Liu, Xiuping; Liu, Chang-Gong; Sawaya, Raymond; Fuller, Gregory N; Chen, Kexin; Lang, Frederick F; Nykter, Matti; Zhang, Wei
2013-02-01
Fusion genes are chromosomal aberrations that are found in many cancers and can be used as prognostic markers and drug targets in clinical practice. Fusions can lead to production of oncogenic fusion proteins or to enhanced expression of oncogenes. Several recent studies have reported that some fusion genes can escape microRNA regulation via 3'-untranslated region (3'-UTR) deletion. We performed whole transcriptome sequencing to identify fusion genes in glioma and discovered FGFR3-TACC3 fusions in 4 of 48 glioblastoma samples from patients both of mixed European and of Asian descent, but not in any of 43 low-grade glioma samples tested. The fusion, caused by tandem duplication on 4p16.3, led to the loss of the 3'-UTR of FGFR3, blocking gene regulation of miR-99a and enhancing expression of the fusion gene. The fusion gene was mutually exclusive with EGFR, PDGFR, or MET amplification. Using cultured glioblastoma cells and a mouse xenograft model, we found that fusion protein expression promoted cell proliferation and tumor progression, while WT FGFR3 protein was not tumorigenic, even under forced overexpression. These results demonstrated that the FGFR3-TACC3 gene fusion is expressed in human cancer and generates an oncogenic protein that promotes tumorigenesis in glioblastoma.
ATG14 promotes membrane tethering and fusion of autophagosomes to endolysosomes.
Diao, Jiajie; Liu, Rong; Rong, Yueguang; Zhao, Minglei; Zhang, Jing; Lai, Ying; Zhou, Qiangjun; Wilz, Livia M; Li, Jianxu; Vivona, Sandro; Pfuetzner, Richard A; Brunger, Axel T; Zhong, Qing
2015-04-23
Autophagy, an important catabolic pathway implicated in a broad spectrum of human diseases, begins by forming double membrane autophagosomes that engulf cytosolic cargo and ends by fusing autophagosomes with lysosomes for degradation. Membrane fusion activity is required for early biogenesis of autophagosomes and late degradation in lysosomes. However, the key regulatory mechanisms of autophagic membrane tethering and fusion remain largely unknown. Here we report that ATG14 (also known as beclin-1-associated autophagy-related key regulator (Barkor) or ATG14L), an essential autophagy-specific regulator of the class III phosphatidylinositol 3-kinase complex, promotes membrane tethering of protein-free liposomes, and enhances hemifusion and full fusion of proteoliposomes reconstituted with the target (t)-SNAREs (soluble N-ethylmaleimide-sensitive factor attachment protein receptors) syntaxin 17 (STX17) and SNAP29, and the vesicle (v)-SNARE VAMP8 (vesicle-associated membrane protein 8). ATG14 binds to the SNARE core domain of STX17 through its coiled-coil domain, and stabilizes the STX17-SNAP29 binary t-SNARE complex on autophagosomes. The STX17 binding, membrane tethering and fusion-enhancing activities of ATG14 require its homo-oligomerization by cysteine repeats. In ATG14 homo-oligomerization-defective cells, autophagosomes still efficiently form but their fusion with endolysosomes is blocked. Recombinant ATG14 homo-oligomerization mutants also completely lose their ability to promote membrane tethering and to enhance SNARE-mediated fusion in vitro. Taken together, our data suggest an autophagy-specific membrane fusion mechanism in which oligomeric ATG14 directly binds to STX17-SNAP29 binary t-SNARE complex on autophagosomes and primes it for VAMP8 interaction to promote autophagosome-endolysosome fusion.
Goreczny, Sebastian; Dryzek, Pawel; Morgan, Gareth J; Lukaszewski, Maciej; Moll, Jadwiga A; Moszura, Tomasz
2017-08-01
We report initial experience with novel three-dimensional (3D) image fusion software for guidance of transcatheter interventions in congenital heart disease. Developments in fusion imaging have facilitated the integration of 3D roadmaps from computed tomography or magnetic resonance imaging datasets. The latest software allows live fusion of two-dimensional (2D) fluoroscopy with pre-registered 3D roadmaps. We reviewed all cardiac catheterizations guided with this software (Philips VesselNavigator). Pre-catheterization imaging and catheterization data were collected focusing on fusion of 3D roadmap, intervention guidance, contrast and radiation exposure. From 09/2015 until 06/2016, VesselNavigator was applied in 34 patients for guidance (n = 28) or planning (n = 6) of cardiac catheterization. In all 28 patients successful 2D-3D registration was performed. Bony structures combined with the cardiovascular silhouette were used for fusion in 26 patients (93%), calcifications in 9 (32%), previously implanted devices in 8 (29%) and low-volume contrast injection in 7 patients (25%). Accurate initial 3D roadmap alignment was achieved in 25 patients (89%). Six patients (22%) required realignment during the procedure due to distortion of the anatomy after introduction of stiff equipment. Overall, VesselNavigator was applied successfully in 27 patients (96%) without any complications related to 3D image overlay. VesselNavigator was useful in guidance of nearly all of cardiac catheterizations. The combination of anatomical markers and low-volume contrast injections allowed reliable 2D-3D registration in the vast majority of patients.
Lian, Hua-Yu; Jiao, Guang-Zhong; Wang, Hui-Li; Tan, Xiu-Wen; Wang, Tian-Yang; Zheng, Liang-Liang; Kong, Qiao-Qiao; Tan, Jing-He
2014-09-01
Although fusion of nucleoli was observed during pronuclear development of zygotes and the behavior of nucleoli in pronuclei has been suggested as an indicator of embryonic developmental potential, the mechanism for nucleolar fusion is unclear. Although both cytoskeleton and the nucleolus are important cellular entities, there are no special reports on the relationship between the two. Role of cytoskeleton in regulating fusion of nucleoli was studied using the activated mouse oocyte model. Mouse oocytes were cultured for 6 h in activating medium (Ca²⁺-free CZB medium containing 10 mM SrCl₂) supplemented with or without inhibitors for cytoskeleton or protein synthesis before pronuclear formation, nucleolar fusion, and the activity of maturation-promoting factor (MPF) were examined. Whereas treatment with microfilament inhibitor cytochalasin D or B or intermediate filament inhibitor acrylamide suppressed nucleolar fusion efficiently, treatment with microtubule inhibitor demecolcine or nocodazole or protein synthesis inhibitor cycloheximide had no effect. The cytochalasin D- or acrylamide-sensitive temporal window coincided well with the reported temporal window for nucleolar fusion in activated oocytes. Whereas a continuous incubation with demecolcine prevented pronuclear formation, pronuclei formed normally when demecolcine was excluded during the first hour of activation treatment when the MPF activity dropped dramatically. The results suggest that 1) microfilaments and intermediate filaments but not microtubules support nucleolar fusion, 2) proteins required for nucleolar fusion including microfilaments and intermediate filaments are not de novo synthesized, and 3) microtubule disruption prevents pronuclear formation by activating MPF. © 2014 by the Society for the Study of Reproduction, Inc.
Occipital Neuralgia after Occipital Cervical Fusion to Treat an Unstable Jefferson Fracture
Kong, Seong Ju; Park, Jin Hoon
2012-01-01
In this report we describe a patient with an unstable Jefferson fracture who was treated by occipitocervical fusion and later reported sustained postoperative occipital neuralgia. A 70-year-old male was admitted to our center with a Jefferson fracture induced by a car accident. Preoperative lateral X-ray revealed an atlanto-dens interval of 4.8mm and a C1 canal anterior-posterior diameter of 19.94mm. We performed fusion surgery from the occiput to C5 without decompression of C1. The patient reported sustained continuous pain throughout the following year despite strong analgesics. The pain dermatome was located mainly in the great occipital nerve territory and posterior neck. Magnetic resonance images revealed no evidence of cord compression, however a C1 lamina compressed dural sac and C2 root compression could not be excluded. We performed bilateral C2 root decompression via a C1 laminectomy. After decompression, bilateral C2 root redundancy was identified by palpation. After decompression surgery, pain was reduced. This case indicates that occipital neuralgia, suggesting the need for diagnostic block, should be considered in the differential diagnosis of patients with sustained occipital headache after occipitocervical fusion surgery. PMID:25983846
Morrison, T; McQuain, C; McGinnes, L
1991-01-01
The cDNA derived from the fusion gene of the virulent AV strain of Newcastle disease virus (NDV) was expressed in chicken embryo cells by using a retrovirus vector. The fusion protein expressed in this system was transported to the cell surface and was efficiently cleaved into the disulfide-linked F1-F2 form found in infectious virions. The cells expressing the fusion gene grew normally and could be passaged many times. Monolayers of these cells would plaque, in the absence of trypsin, avirulent NDV strains (strains which encode a fusion protein which is not cleaved in tissue culture). Fusion protein-expressing cells would not fuse if mixed with uninfected cells or uninfected cells expressing the hemagglutinin-neuraminidase (HN) protein. However, the fusion protein-expressing cells, if infected with avirulent strains of NDV, would fuse with uninfected cells, suggesting that fusion requires both the fusion protein and another viral protein expressed in the same cell. Fusion was also seen after transfection of the HN protein gene into fusion protein-expressing cells. Thus, the expressed fusion protein gene is capable of complementing the virus infection, providing an active cleaved fusion protein required for the spread of infection. However, the fusion protein does not mediate cell fusion unless the cell also expresses the HN protein. Fusion protein-expressing cells would not plaque influenza virus in the absence of trypsin, nor would influenza virus-infected fusion protein-expressing cells fuse with uninfected cells. Thus, the influenza virus HA protein will not substitute for the NDV HN protein in cell-to-cell fusion. Images PMID:1987376
Lappala, Anna; Nishima, Wataru; Miner, Jacob; Fenimore, Paul; Fischer, Will; Hraber, Peter; Zhang, Ming; McMahon, Benjamin; Tung, Chang-Shung
2018-05-10
Membrane fusion proteins are responsible for viral entry into host cells—a crucial first step in viral infection. These proteins undergo large conformational changes from pre-fusion to fusion-initiation structures, and, despite differences in viral genomes and disease etiology, many fusion proteins are arranged as trimers. Structural information for both pre-fusion and fusion-initiation states is critical for understanding virus neutralization by the host immune system. In the case of Ebola virus glycoprotein (EBOV GP) and Zika virus envelope protein (ZIKV E), pre-fusion state structures have been identified experimentally, but only partial structures of fusion-initiation states have been described. While the fusion-initiation structure is in an energetically unfavorable state that is difficult to solve experimentally, the existing structural information combined with computational approaches enabled the modeling of fusion-initiation state structures of both proteins. These structural models provide an improved understanding of four different neutralizing antibodies in the prevention of viral host entry.
2015-01-01
Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein–protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein–protein interactions within whole animals. PMID:25265085
Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J
2015-05-15
Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.
Miyamoto, Takeshi
2013-07-01
Macrophages play a pivotal role in host defense against multiple foreign materials such as bacteria, parasites and artificial devices. Some macrophage lineage cells, namely osteoclasts and foreign body giant cells (FBGCs), form multi-nuclear giant cells by the cell-cell fusion of mono-nuclear cells. Osteoclasts are bone-resorbing cells, and are formed in the presence of RANKL on the surface of bones, while FBGCs are formed in the presence of IL-4 or IL-13 on foreign materials such as artificial joints, catheters and parasites. Recently, fusiogenic mechanisms and the molecules required for the cell-cell fusion of these macrophage lineage cells were, at least in part, clarified. Dendritic cell specific transmembrane protein (DC-STAMP) and osteoclast stimulatory transmembrane protein (OC-STAMP), both of which comprise seven transmembrane domains, are required for both osteoclast and FBGC cell-cell fusion. STAT6 was demonstrated to be required for the cell-cell fusion of FBGCs but not osteoclasts. In this review, advances in macrophage cell-cell fusion are discussed.
Genetic analysis of Bacillus stearothermophilus by protoplast fusion
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chen, Z.; Wojcik, S.F.; Welker, N.E.
1986-03-01
Efficient and reliable protoplasting, regeneration, and fusion techniques were established for the prototrophic strain Bacillus stearothermophilus NUB36. Auxotrophic mutants were isolated, and protoplast fusion was used to construct isogenic mutant strains and for chromosomal mapping. Markers were mapped using two-, three-, and four-factor crosses. The order of the markers was hom-1-thr-1-his-1-(gly-1 or gly-2)-pur-1-pur-2. These markers may be analogous to hom, thrA, hisA, glyC, and purA markers on the Bacillus subtilis chromosome. No analogous pur-1 marker has been reported in B. subtilis. The relative order of three of the markers (hom-1-thr-1-gly-1) was independently confirmed by transduction.
Liu, Yanjie; Misamore, Michael J; Snell, William J
2010-05-01
The plasma membranes of gametes are specialized for fusion, yet, once fusion occurs, in many organisms the new zygote becomes incapable of further membrane fusion reactions. The molecular mechanisms that underlie this loss of fusion capacity (block to polygamy) remain unknown. During fertilization in the green alga Chlamydomonas, the plus gamete-specific membrane protein FUS1 is required for adhesion between the apically localized sites on the plasma membranes of plus and minus gametes that are specialized for fusion, and the minus-specific membrane protein HAP2 is essential for completion of the membrane fusion reaction. HAP2 (GCS1) family members are also required for fertilization in Arabidopsis, and for the membrane fusion reaction in the malaria organism Plasmodium berghei. Here, we tested whether Chlamydomonas gamete fusion triggers alterations in FUS1 and HAP2 and renders the plasma membranes of the cells incapable of subsequent fusion. We find that, even though the fusogenic sites support multi-cell adhesions, triploid zygotes are rare, indicating a fusion-triggered block to the membrane fusion reaction. Consistent with the extinction of fusogenic capacity, both FUS1 and HAP2 are degraded upon fusion. The rapid, fusion-triggered cleavage of HAP2 in zygotes is distinct from degradation occurring during constitutive turnover in gametes. Thus, gamete fusion triggers specific degradation of fusion-essential proteins and renders the zygote incapable of fusion. Our results provide the first molecular explanation for a membrane block to polygamy in any organism.
Nuclear Fusion Award 2010 speech Nuclear Fusion Award 2010 speech
NASA Astrophysics Data System (ADS)
Rice, John
2011-01-01
Following the suggestion of Earl Marmar in 1995, I installed a compact von Hamos type x-ray spectrometer (originally built with Elisabeth Rachlew and Jan Kallne) on a tangentially viewing port on the Alcator C-Mod tokamak. The spectrometer views the plasma through a 2 cm diameter hole, and is tuned to H-like argon, suitable for passive measurement of the core toroidal rotation velocity from the Doppler shift. It soon became evident that the rotation in Ohmic L-mode discharges, while for the most part directed counter-current, depends in a very complicated fashion on plasma parameters, notably the electron density, current and magnetic configuration. The rotation can even flip sign for almost no apparent reason! In Ohmic and ion cyclotron range of frequencies (ICRF) heated H-mode plasmas the rotation is in the co-current direction and has a relatively simple dependence on plasma parameters, proportional to the stored energy normalized to the current. Rotation velocities as high as 130 km s-1 have been observed without external momentum input. In dimensionless terms this intrinsic (or spontaneous rotation) depends on the normalized plasma pressure. The association of toroidal rotation with plasma pressure in ICRF H-modes was first observed by Lars-Goran Eriksson in JET discharges. Similar results were subsequently reported for Tore Supra enhanced confinement plasmas. In the early 2000s concerns began to surface about the lack of substantial neutral beam driven rotation in ITER, and intrinsic rotation became a topic of interest in the ITPA Transport Group. Through that connection, similar observations from DIII-D, TCV and JT-60U were added to the growing list. A database of intrinsic rotation observations was assembled with the goal of extrapolating to the expected values for ITER. Both dimensional and dimensionless scalings were developed and formed the backbone of the 2007 Nuclear Fusion paper. I gratefully acknowledge the important contributions to this paper from
Is the aligning prism measured with the Mallett unit correlated with fusional vergence reserves?
Conway, Miriam L; Thomas, Jennifer; Subramanian, Ahalya
2012-01-01
The Mallett Unit is a clinical test designed to detect the fixation disparity that is most likely to occur in the presence of a decompensated heterophoria. It measures the associated phoria, which is the "aligning prism" needed to nullify the subjective disparity. The technique has gained widespread acceptance within professions such as optometry, for investigating suspected cases of decompensating heterophoria; it is, however, rarely used by orthoptists and ophthalmologists. The aim of this study was to investigate whether fusional vergence reserves, measured routinely by both orthoptists and ophthalmologists to detect heterophoria decompensation, were correlated with aligning prism (associated phoria) in a normal clinical population. Aligning prism (using the Mallett Unit) and fusional vergence reserves (using a prism bar) were measured in 500 participants (mean 41.63 years; standard deviation 11.86 years) at 40 cm and 6 m. At 40 cm a strong correlation (p<0.001) between base in aligning prism (Exo FD) and positive fusional reserves was found. Of the participants with zero aligning prism 30% had reduced fusional reserves. At 6 m a weak correlation between base out aligning prism (Eso FD) and negative fusional reserves was found to break (p = 0.01) and to recovery (p = 0.048). Of the participants with zero aligning prism 12% reported reduced fusional reserves. For near vision testing, the strong inverse correlation between base in aligning prism (Exo FD) and fusional vergence reserves supports the notion that both measures are indicators of decompensation of heterophoria. For distance vision testing and for those patients reporting zero aligning prism further research is required to determine why the relationship appears to be weak/non-existent?
Fusion materials high energy-neutron studies. A status report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Doran, D.G.; Guinan, M.W.
1980-01-01
The objectives of this paper are (1) to provide background information on the US Magnetic Fusion Reactor Materials Program, (2) to provide a framework for evaluating nuclear data needs associated with high energy neutron irradiations, and (3) to show the current status of relevant high energy neutron studies. Since the last symposium, the greatest strides in cross section development have been taken in those areas providing FMIT design data, e.g., source description, shielding, and activation. In addition, many dosimetry cross sections have been tentatively extrapolated to 40 MeV and integral testing begun. Extensive total helium measurements have been made inmore » a variety of neutron spectra. Additional calculations are needed to assist in determining energy dependent cross sections.« less
Structure and immune recognition of trimeric pre-fusion HIV-1 Env
Pancera, Marie; Zhou, Tongqing; Druz, Aliaksandr; ...
2014-10-08
The human immunodeficiency virus type 1 (HIV-1) envelope (Env) spike, comprising three gp120 and three gp41 subunits, is a conformational machine that facilitates HIV-1 entry by rearranging from a mature unliganded state, through receptor-bound intermediates, to a post-fusion state. As the sole viral antigen on the HIV-1 virion surface, Env is both the target of neutralizing antibodies and a focus of vaccine efforts. Here we report the structure at 3.5 Å resolution for an HIV-1 Env trimer captured in a mature closed state by antibodies PGT122 and 35O22. This structure reveals the pre-fusion conformation of gp41, indicates rearrangements needed formore » fusion activation, and defines parameters of immune evasion and immune recognition. Pre-fusion gp41 encircles amino- and carboxy-terminal strands of gp120 with four helices that form a membrane-proximal collar, fastened by insertion of a fusion peptide-proximal methionine into a gp41-tryptophan clasp. Spike rearrangements required for entry involve opening the clasp and expelling the termini. In conclusion, N-linked glycosylation and sequence-variable regions cover the pre-fusion closed spike; we used chronic cohorts to map the prevalence and location of effective HIV-1-neutralizing responses, which were distinguished by their recognition of N-linked glycan and tolerance for epitope-sequence variation.« less
Structure and immune recognition of trimeric pre-fusion HIV-1 Env
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pancera, Marie; Zhou, Tongqing; Druz, Aliaksandr
The human immunodeficiency virus type 1 (HIV-1) envelope (Env) spike, comprising three gp120 and three gp41 subunits, is a conformational machine that facilitates HIV-1 entry by rearranging from a mature unliganded state, through receptor-bound intermediates, to a post-fusion state. As the sole viral antigen on the HIV-1 virion surface, Env is both the target of neutralizing antibodies and a focus of vaccine efforts. Here we report the structure at 3.5 Å resolution for an HIV-1 Env trimer captured in a mature closed state by antibodies PGT122 and 35O22. This structure reveals the pre-fusion conformation of gp41, indicates rearrangements needed formore » fusion activation, and defines parameters of immune evasion and immune recognition. Pre-fusion gp41 encircles amino- and carboxy-terminal strands of gp120 with four helices that form a membrane-proximal collar, fastened by insertion of a fusion peptide-proximal methionine into a gp41-tryptophan clasp. Spike rearrangements required for entry involve opening the clasp and expelling the termini. In conclusion, N-linked glycosylation and sequence-variable regions cover the pre-fusion closed spike; we used chronic cohorts to map the prevalence and location of effective HIV-1-neutralizing responses, which were distinguished by their recognition of N-linked glycan and tolerance for epitope-sequence variation.« less
Haudenschild, Dominik R.; Wegner, Adam M.; Klineberg, Eric O.
2017-01-01
Study Design: Review of literature. Objectives: This review of literature investigates the application of mesenchymal stem cells (MSCs) in spinal fusion, highlights potential uses in the development of bone grafts, and discusses limitations based on both preclinical and clinical models. Methods: A review of literature was conducted looking at current studies using stem cells for augmentation of spinal fusion in both animal and human models. Results: Eleven preclinical studies were found that used various animal models. Average fusion rates across studies were 59.8% for autograft and 73.7% for stem cell–based grafts. Outcomes included manual palpation and stressing of the fusion, radiography, micro–computed tomography (μCT), and histological analysis. Fifteen clinical studies, 7 prospective and 8 retrospective, were found. Fusion rates ranged from 60% to 100%, averaging 87.1% in experimental groups and 87.2% in autograft control groups. Conclusions: It appears that there is minimal clinical difference between commercially available stem cells and bone marrow aspirates indicating that MSCs may be a good choice in a patient with poor marrow quality. Overcoming morbidity and limitations of autograft for spinal fusion, remains a significant problem for spinal surgeons and further studies are needed to determine the efficacy of stem cells in augmenting spinal fusion. PMID:29238646
Induction of cell-cell fusion by ectromelia virus is not inhibited by its fusion inhibitory complex.
Erez, Noam; Paran, Nir; Maik-Rachline, Galia; Politi, Boaz; Israely, Tomer; Schnider, Paula; Fuchs, Pinhas; Melamed, Sharon; Lustig, Shlomo
2009-09-29
Ectromelia virus, a member of the Orthopox genus, is the causative agent of the highly infectious mousepox disease. Previous studies have shown that different poxviruses induce cell-cell fusion which is manifested by the formation of multinucleated-giant cells (polykaryocytes). This phenomenon has been widely studied with vaccinia virus in conditions which require artificial acidification of the medium. We show that Ectromelia virus induces cell-cell fusion under neutral pH conditions and requires the presence of a sufficient amount of viral particles on the plasma membrane of infected cells. This could be achieved by infection with a replicating virus and its propagation in infected cells (fusion "from within") or by infection with a high amount of virus particles per cell (fusion "from without"). Inhibition of virus maturation or inhibition of virus transport on microtubules towards the plasma membrane resulted in a complete inhibition of syncytia formation. We show that in contrast to vaccinia virus, Ectromelia virus induces cell-cell fusion irrespectively of its hemagglutination properties and cell-surface expression of the orthologs of the fusion inhibitory complex, A56 and K2. Additionally, cell-cell fusion was also detected in mice lungs following lethal respiratory infection. Ectromelia virus induces spontaneous cell-cell fusion in-vitro and in-vivo although expressing an A56/K2 fusion inhibitory complex. This syncytia formation property cannot be attributed to the 37 amino acid deletion in ECTV A56.
The continuum fusion theory of signal detection applied to a bi-modal fusion problem
NASA Astrophysics Data System (ADS)
Schaum, A.
2011-05-01
A new formalism has been developed that produces detection algorithms for model-based problems, in which one or more parameter values is unknown. Continuum Fusion can be used to generate different flavors of algorithm for any composite hypothesis testing problem. The methodology is defined by a fusion logic that can be translated into max/min conditions. Here it is applied to a simple sensor fusion model, but one for which the generalized likelihood ratio test is intractable. By contrast, a fusion-based response to the same problem can be devised that is solvable in closed form and represents a good approximation to the GLR test.
Souza, André L F; Invitti, Adriana L; Rego, Fabiane G M; Monteiro, Rose A; Klassen, Giseli; Souza, Emanuel M; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U
2010-02-01
The pathway of electron transport to nitrogenase in the endophytic beta-Proteobacterium Herbaspirillum seropedicae has not been characterized. We have generated mutants in two nif-associated genes encoding putative ferredoxins, fdxA and fdxN. The fdxA gene is part of the operon nifHDKENXorf1orf2fdxAnifQmodABC and is transcribed from the nifH promoter, as revealed by lacZ gene fusion. The fdxN gene is probably cotranscribed with the nifB gene. Mutational analysis suggests that the FdxA protein is essential for maximum nitrogenase activity, since the nitrogenase activity of the fdxA mutant strain was reduced to about 30% of that of the wild-type strain. In addition, the fdxA mutation had no effect on the nitrogenase switch-off in response to ammonium. Nitrogenase activity of a mutant strain lacking the fdxN gene was completely abolished. This phenotype was reverted by complementation with fdxN expressed under lacZ promoter control. The results suggest that the products of both the fdxA and fdxN genes are probably involved in electron transfer during nitrogen fixation.
Line-Tension Controlled Mechanism for Influenza Fusion
Risselada, Herre Jelger; Smirnova, Yuliya G.; Grubmüller, Helmut; Marrink, Siewert Jan; Müller, Marcus
2012-01-01
Our molecular simulations reveal that wild-type influenza fusion peptides are able to stabilize a highly fusogenic pre-fusion structure, i.e. a peptide bundle formed by four or more trans-membrane arranged fusion peptides. We rationalize that the lipid rim around such bundle has a non-vanishing rim energy (line-tension), which is essential to (i) stabilize the initial contact point between the fusing bilayers, i.e. the stalk, and (ii) drive its subsequent evolution. Such line-tension controlled fusion event does not proceed along the hypothesized standard stalk-hemifusion pathway. In modeled influenza fusion, single point mutations in the influenza fusion peptide either completely inhibit fusion (mutants G1V and W14A) or, intriguingly, specifically arrest fusion at a hemifusion state (mutant G1S). Our simulations demonstrate that, within a line-tension controlled fusion mechanism, these known point mutations either completely inhibit fusion by impairing the peptide’s ability to stabilize the required peptide bundle (G1V and W14A) or stabilize a persistent bundle that leads to a kinetically trapped hemifusion state (G1S). In addition, our results further suggest that the recently discovered leaky fusion mutant G13A, which is known to facilitate a pronounced leakage of the target membrane prior to lipid mixing, reduces the membrane integrity by forming a ‘super’ bundle. Our simulations offer a new interpretation for a number of experimentally observed features of the fusion reaction mediated by the prototypical fusion protein, influenza hemagglutinin, and might bring new insights into mechanisms of other viral fusion reactions. PMID:22761674
Nam, Woo Dong
2015-01-01
Background There are few studies about risk factors for poor outcomes from multi-level lumbar posterolateral fusion limited to three or four level lumbar posterolateral fusions. The purpose of this study was to analyze the outcomes of multi-level lumbar posterolateral fusion and to search for possible risk factors for poor surgical outcomes. Methods We retrospectively analyzed 37 consecutive patients who underwent multi-level lumbar or lumbosacral posterolateral fusion with posterior instrumentation. The outcomes were deemed either 'good' or 'bad' based on clinical and radiological results. Many demographic and radiological factors were analyzed to examine potential risk factors for poor outcomes. Student t-test, Fisher exact test, and the chi-square test were used based on the nature of the variables. Multiple logistic regression analysis was used to exclude confounding factors. Results Twenty cases showed a good outcome (group A, 54.1%) and 17 cases showed a bad outcome (group B, 45.9%). The overall fusion rate was 70.3%. The revision procedures (group A: 1/20, 5.0%; group B: 4/17, 23.5%), proximal fusion to L2 (group A: 5/20, 25.0%; group B: 10/17, 58.8%), and severity of stenosis (group A: 12/19, 63.3%; group B: 3/11, 27.3%) were adopted as possible related factors to the outcome in univariate analysis. Multiple logistic regression analysis revealed that only the proximal fusion level (superior instrumented vertebra, SIV) was a significant risk factor. The cases in which SIV was L2 showed inferior outcomes than those in which SIV was L3. The odds ratio was 6.562 (95% confidence interval, 1.259 to 34.203). Conclusions The overall outcome of multi-level lumbar or lumbosacral posterolateral fusion was not as high as we had hoped it would be. Whether the SIV was L2 or L3 was the only significant risk factor identified for poor outcomes in multi-level lumbar or lumbosacral posterolateral fusion in the current study. Thus, the authors recommend that proximal fusion
Digital holographic microtomography of fusion spliced optical fibers
NASA Astrophysics Data System (ADS)
Deng, Yating; Xiao, Wen; Ma, Xichao; Pan, Feng
2017-03-01
In this paper, we report three-dimensional(3D) measurement results of structural parameters of fusion spliced optical fibers using digital holographic microtomography. A holographic setup in microscopy configuration with the sample-fixed and setup-rotating scheme is established. A series of holograms is recorded from various incident angles. Then the filtered backprojection algorithm is applied to reconstruct the 3D refractive index (RI) distributions of the fusion spliced optical fibers inserted in the index-matching liquid. Experimental results exhibit the internal and external shapes of three kinds of fusion splices between different fibers, including a single-mode fiber(SMF) and a multimode fiber, an SMF and a panda polarization maintaining fiber (Panda PMF), and an SMF and a bow-tie polarization maintaining fiber (Bow-Tie PMF). With 3D maps of RI, it is intuitive to observe internal structural details of fused fibers and evaluate the splicing quality. This paper describes a powerful method for non-invasive microscopic measurement of fiber splicing. Furthermore, it provides the possibility of detecting fiber splicing loss by 3D structures.
Tracking fusion of human mesenchymal stem cells after transplantation to the heart.
Freeman, Brian T; Kouris, Nicholas A; Ogle, Brenda M
2015-06-01
Evidence suggests that transplanted mesenchymal stem cells (MSCs) can aid recovery of damaged myocardium caused by myocardial infarction. One possible mechanism for MSC-mediated recovery is reprogramming after cell fusion between transplanted MSCs and recipient cardiac cells. We used a Cre/LoxP-based luciferase reporter system coupled to biophotonic imaging to detect fusion of transplanted human pluripotent stem cell-derived MSCs to cells of organs of living mice. Human MSCs, with transient expression of a viral fusogen, were delivered to the murine heart via a collagen patch. At 2 days and 1 week later, living mice were probed for bioluminescence indicative of cell fusion. Cell fusion was detected at the site of delivery (heart) and in distal tissues (i.e., stomach, small intestine, liver). Fusion was confirmed at the cellular scale via fluorescence in situ hybridization for human-specific and mouse-specific centromeres. Human cells in organs distal to the heart were typically located near the vasculature, suggesting MSCs and perhaps MSC fusion products have the ability to migrate via the circulatory system to distal organs and engraft with local cells. The present study reveals previously unknown migratory patterns of delivered human MSCs and associated fusion products in the healthy murine heart. The study also sets the stage for follow-on studies to determine the functional effects of cell fusion in a model of myocardial damage or disease. Mesenchymal stem cells (MSCs) are transplanted to the heart, cartilage, and other tissues to recover lost function or at least limit overactive immune responses. Analysis of tissues after MSC transplantation shows evidence of fusion between MSCs and the cells of the recipient. To date, the biologic implications of cell fusion remain unclear. A newly developed in vivo tracking system was used to identify MSC fusion products in living mice. The migratory patterns of fusion products were determined both in the target organ (i
The entropies of fusion, enthalies of fusion, and melting points of organic compounds can be estimated through three models developed using the SPARC (SPARC Performs Automated Reasoning in Chemistry) platform. The entropy of fusion is modeled through a combination of interaction ...
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pimputkar, S.M.; McCoy, J.K.; Stets, J.A.
1991-03-01
The integrity of a pipeline system is determined by its weakest links which may be the joints. Heat fusion is the most common method for joining gas distribution polyethylene (PE) piping. There are procedural, thermal, and mechanical aspects of making fusion joints. Acceptable procedural aspects, such as heater calibration and cleanliness, can be assured by rigorous training and certification of the operators. Thermal and mechanical aspects consist of specifying joining conditions such as the heater temperature, heating time, and joining pressure. In the absence of procedural errors, the strength of a fusion joint should depend on the pipe material, pipemore » dimensions, and the thermal and mechanical joining conditions. Socket heat fusion was studied both experimentally and analytically to determine how the strength of the joint varied with the conditions under which it was made. The standard tensile impact test was modified to test socket fusion joint samples in shear. The developed shear impact energy test data were found to be reliable measures of strength if the setup conditions were meticulously identical. A parameter, termed the socket joining parameter, was found to characterize the joining conditions. It is a strong function of melt volume at the end of the heating phase, and, physically, it is polyethylene transported parallel to the axis during insertion. The results for three resins are presented in the form of three nomographs. The nomographs may be used to select the required heater temperature or the heating time, for a given ambient temperature and a PE resin, to ensure a structurally sound socket heat fusion joint.« less
Telomeres and mechanisms of Robertsonian fusion.
Slijepcevic, P
1998-05-01
The Robertsonian (Rb) fusion, a chromosome rearrangement involving centric fusion of two acro-(telo)centric chromosomes to form a single metacentric, is one of the most frequent events in mammalian karyotype evolution. Since one of the functions of telomeres is to preserve chromosome integrity, a prerequisite for the formation of Rb fusions should be either telomere loss or telomere inactivation. Possible mechanisms underlying the formation of various types of Rb fusion are discussed here. For example, Rb fusion in wild mice involves complete loss of p-arm telomeres by chromosome breakage within minor satellite sequences. By contrast, interstitial telomeric sites are found in the pericentromeric regions of chromosomes originating from a number of vertebrate species, suggesting the occurrence of Rb-like fusion without loss of telomeres, a possibility consistent with some form of telomere inactivation. Finally, a recent study suggests that telomere shortening induced by the deletion of the telomerase RNA gene in the mouse germ-line leads to telomere loss and high frequencies of Rb fusion in mouse somatic cells. Thus, at least three mechanisms in mammalian cells lead to the formation of Rb fusions.
Hirota, Ryuichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao; Kato, Junichi
2006-08-01
The nitrifying bacterium Nitrosomonas sp. strain ENI-11 has three copies of the gene encoding hydroxylamine oxidoreductase (hao(1), hao(2), and hao(3)) on its genome. Broad-host-range reporter plasmids containing transcriptional fusion genes between hao copies and lacZ were constructed to analyze the expression of each hydroxylamine oxidoreductase gene (hao) copy individually and quantitatively. beta-Galactosidase assays of ENI-11 harboring reporter plasmids revealed that all hao copies were transcribed in the wild-type strain. Promoter analysis of hao copies revealed that transcription of hao(3) was highest among the hao copies. Expression levels of hao(1) and hao(2) were 40% and 62% of that of hao(3) respectively. Transcription of hao(1) was negatively regulated, whereas a portion of hao(3) transcription was read through transcription from the rpsT promoter. When energy-depleted cells were incubated in the growth medium, only hao(3) expression increased. This result suggests that it is hao(3) that is responsible for recovery from energy-depleted conditions in Nitrosomonas sp. strain ENI-11.
The Human Factors of Sensor Fusion
2008-05-01
tool in future military operations. 23 7. References Abdi, H. Neural Networks. In M. Lewis-Beck, A . Bryman , T. Futing (Eds), Encyclopedia for... a collection of information if it does not display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1...This report discusses select, cognitively based principles associated with the sensor fusion process. A review is made of the standard
Cell fusion in the liver, revisited
Lizier, Michela; Castelli, Alessandra; Montagna, Cristina; Lucchini, Franco; Vezzoni, Paolo; Faggioli, Francesca
2018-01-01
There is wide agreement that cell fusion is a physiological process in cells in mammalian bone, muscle and placenta. In other organs, such as the cerebellum, cell fusion is controversial. The liver contains a considerable number of polyploid cells: They are commonly believed to originate by genome endoreplication, although the contribution of cell fusion to polyploidization has not been excluded. Here, we address the topic of cell fusion in the liver from a historical point of view. We discuss experimental evidence clearly supporting the hypothesis that cell fusion occurs in the liver, specifically when bone marrow cells were injected into mice and shown to rescue genetic hepatic degenerative defects. Those experiments-carried out in the latter half of the last century-were initially interpreted to show “transdifferentiation”, but are now believed to demonstrate fusion between donor macrophages and host hepatocytes, raising the possibility that physiologically polyploid cells, such as hepatocytes, could originate, at least partially, through homotypic cell fusion. In support of the homotypic cell fusion hypothesis, we present new data generated using a chimera-based model, a much simpler model than those previously used. Cell fusion as a road to polyploidization in the liver has not been extensively investigated, and its contribution to a variety of conditions, such as viral infections, carcinogenesis and aging, remains unclear. PMID:29527257
2012-01-01
Background Glutamyl queuosine-tRNAAsp synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNAAsp. Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. Results The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. Conclusions The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri. PMID:23035718
Caballero, Valeria C; Toledo, Viviana P; Maturana, Cristian; Fisher, Carolyn R; Payne, Shelley M; Salazar, Juan Carlos
2012-10-05
Glutamyl queuosine-tRNA(Asp) synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNA(Asp). Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri.
Introduction to Nuclear Fusion Power and the Design of Fusion Reactors. An Issue-Oriented Module.
ERIC Educational Resources Information Center
Fillo, J. A.
This three-part module focuses on the principles of nuclear fusion and on the likely nature and components of a controlled-fusion power reactor. The physical conditions for a net energy release from fusion and two approaches (magnetic and inertial confinement) which are being developed to achieve this goal are described. Safety issues associated…
Kim, Dae Hwan; Lee, Nam; Shin, Dong Ah; Yi, Seong; Kim, Keung Nyun; Ha, Yoon
2016-07-01
To compare the fusion rate of a hydroxyapatite demineralized bone matrix (DBM) with post-laminectomy acquired autograft in lumbar interbody fusion surgery and to evaluate the correlation between fusion rate and clinical outcome. From January 2013 to April 2014, 98 patients underwent lumbar interbody fusion surgery with hydroxyapatite DBM (HA-DBM group) in our institute. Of those patients, 65 received complete CT scans for 12 months postoperatively in order to evaluate fusion status. For comparison with autograft, we selected another 65 patients who underwent lumbar interbody fusion surgery with post-laminectomy acquired autograft (Autograft group) during the same period. Both fusion material groups were matched in terms of age, sex, body mass index (BMI), and bone mineral density (BMD). To evaluate the clinical outcomes, we analyzed the results of visual analogue scale (VAS), Oswestry Disability Index (ODI), and Short Form Health Survey (SF-36). We reviewed the CT scans of 149 fusion levels in 130 patients (HA-DBM group, 75 levels/65 patients; Autograft group, 74 levels/65 patients). Age, sex, BMI, and BMD were not significantly different between the groups (p=0.528, p=0.848, p=0.527, and p=0.610, respectively). The HA-DBM group showed 39 of 75 fused levels (52%), and the Autograft group showed 46 of 74 fused levels (62.2%). This difference was not statistically significant (p=0.21). In the HA-DBM group, older age and low BMD were significantly associated with non-fusion (61.24 vs. 66.68, p=0.027; -1.63 vs. -2.29, p=0.015, respectively). VAS and ODI showed significant improvement after surgery when fusion was successfully achieved in both groups (p=0.004, p=0.002, HA-DBM group; p=0.012, p=0.03, Autograft group). The fusion rates of the hydroxyapatite DBM and Autograft groups were not significantly different. In addition, clinical outcomes were similar between the groups. However, older age and low BMD are risk factors that might induce non-union after surgery with
Kim, Dae Hwan; Lee, Nam; Shin, Dong Ah; Yi, Seong; Kim, Keung Nyun
2016-01-01
Objective To compare the fusion rate of a hydroxyapatite demineralized bone matrix (DBM) with post-laminectomy acquired autograft in lumbar interbody fusion surgery and to evaluate the correlation between fusion rate and clinical outcome. Methods From January 2013 to April 2014, 98 patients underwent lumbar interbody fusion surgery with hydroxyapatite DBM (HA-DBM group) in our institute. Of those patients, 65 received complete CT scans for 12 months postoperatively in order to evaluate fusion status. For comparison with autograft, we selected another 65 patients who underwent lumbar interbody fusion surgery with post-laminectomy acquired autograft (Autograft group) during the same period. Both fusion material groups were matched in terms of age, sex, body mass index (BMI), and bone mineral density (BMD). To evaluate the clinical outcomes, we analyzed the results of visual analogue scale (VAS), Oswestry Disability Index (ODI), and Short Form Health Survey (SF-36). Results We reviewed the CT scans of 149 fusion levels in 130 patients (HA-DBM group, 75 levels/65 patients; Autograft group, 74 levels/65 patients). Age, sex, BMI, and BMD were not significantly different between the groups (p=0.528, p=0.848, p=0.527, and p=0.610, respectively). The HA-DBM group showed 39 of 75 fused levels (52%), and the Autograft group showed 46 of 74 fused levels (62.2%). This difference was not statistically significant (p=0.21). In the HA-DBM group, older age and low BMD were significantly associated with non-fusion (61.24 vs. 66.68, p=0.027; -1.63 vs. -2.29, p=0.015, respectively). VAS and ODI showed significant improvement after surgery when fusion was successfully achieved in both groups (p=0.004, p=0.002, HA-DBM group; p=0.012, p=0.03, Autograft group). Conclusion The fusion rates of the hydroxyapatite DBM and Autograft groups were not significantly different. In addition, clinical outcomes were similar between the groups. However, older age and low BMD are risk factors that might
DOE Office of Scientific and Technical Information (OSTI.GOV)
Soldan, Samantha S., E-mail: sssoldan@mail.med.upenn.ed; Hollidge, Bradley S.; Department of Neuroscience Graduate Group, University of Pennsylvania School of Medicine, Philadelphia, PA 19104-4283
La Crosse virus is a leading cause of pediatric encephalitis in the Midwestern United States and an emerging pathogen in the American South. The LACV glycoprotein Gc plays a critical role in entry as the virus attachment protein. A 22 amino acid hydrophobic region within Gc (1066-1087) was recently identified as the LACV fusion peptide. To further define the role of Gc (1066-1087) in virus entry, fusion, and neuropathogenesis, a panel of recombinant LACV (rLACV) fusion peptide mutant viruses was generated. Replication of mutant rLACVs was significantly reduced. In addition, the fusion peptide mutants demonstrated decreased fusion phenotypes relative tomore » LACV-WT. Interestingly, these viruses maintained their ability to cause neuronal loss in culture, suggesting that the fusion peptide of LACV Gc is a determinant of properties associated with neuroinvasion (growth to high titer in muscle cells and a robust fusion phenotype), but not necessarily of neurovirulence.« less
Inertial-confinement fusion with lasers
Betti, R.; Hurricane, O. A.
2016-05-03
The quest for controlled fusion energy has been ongoing for over a half century. The demonstration of ignition and energy gain from thermonuclear fuels in the laboratory has been a major goal of fusion research for decades. Thermonuclear ignition is widely considered a milestone in the development of fusion energy, as well as a major scientific achievement with important applications to national security and basic sciences. The U.S. is arguably the world leader in the inertial con fment approach to fusion and has invested in large facilities to pursue it with the objective of establishing the science related to themore » safety and reliability of the stockpile of nuclear weapons. Even though significant progress has been made in recent years, major challenges still remain in the quest for thermonuclear ignition via laser fusion.« less
Adjoint affine fusion and tadpoles
DOE Office of Scientific and Technical Information (OSTI.GOV)
Urichuk, Andrew, E-mail: andrew.urichuk@uleth.ca; Walton, Mark A., E-mail: walton@uleth.ca; International School for Advanced Studies
2016-06-15
We study affine fusion with the adjoint representation. For simple Lie algebras, elementary and universal formulas determine the decomposition of a tensor product of an integrable highest-weight representation with the adjoint representation. Using the (refined) affine depth rule, we prove that equally striking results apply to adjoint affine fusion. For diagonal fusion, a coefficient equals the number of nonzero Dynkin labels of the relevant affine highest weight, minus 1. A nice lattice-polytope interpretation follows and allows the straightforward calculation of the genus-1 1-point adjoint Verlinde dimension, the adjoint affine fusion tadpole. Explicit formulas, (piecewise) polynomial in the level, are writtenmore » for the adjoint tadpoles of all classical Lie algebras. We show that off-diagonal adjoint affine fusion is obtained from the corresponding tensor product by simply dropping non-dominant representations.« less
Glycoprotein interactions in paramyxovirus fusion
Iorio, Ronald M; Melanson, Vanessa R; Mahon, Paul J
2009-01-01
The Paramyxoviridae are enveloped, negative-stranded RNA viruses, some of which recognize sialic acid-containing receptors, while others recognize specific proteinaceous receptors. The major cytopathic effect of paramyxovirus infection is membrane fusion-induced syncytium formation. Paramyxoviruses are unusual in that the receptor-binding and fusion-promoting activities reside on two different spike structures, the attachment and fusion glycoproteins, respectively. For most paramyxoviruses, this distribution of functions requires a mechanism by which the two processes can be linked for the promotion of fusion. This is accomplished by a virus-specific interaction between the two proteins. An increasing body of evidence supports the notion that members of this family of viruses utilize this glycoprotein interaction in different ways in order to mediate the regulation of the fusion protein activation, depending on the type of receptor utilized by the virus. PMID:20161127
Multiscale Medical Image Fusion in Wavelet Domain
Khare, Ashish
2013-01-01
Wavelet transforms have emerged as a powerful tool in image fusion. However, the study and analysis of medical image fusion is still a challenging area of research. Therefore, in this paper, we propose a multiscale fusion of multimodal medical images in wavelet domain. Fusion of medical images has been performed at multiple scales varying from minimum to maximum level using maximum selection rule which provides more flexibility and choice to select the relevant fused images. The experimental analysis of the proposed method has been performed with several sets of medical images. Fusion results have been evaluated subjectively and objectively with existing state-of-the-art fusion methods which include several pyramid- and wavelet-transform-based fusion methods and principal component analysis (PCA) fusion method. The comparative analysis of the fusion results has been performed with edge strength (Q), mutual information (MI), entropy (E), standard deviation (SD), blind structural similarity index metric (BSSIM), spatial frequency (SF), and average gradient (AG) metrics. The combined subjective and objective evaluations of the proposed fusion method at multiple scales showed the effectiveness and goodness of the proposed approach. PMID:24453868
The tumorigenic FGFR3-TACC3 gene fusion escapes miR-99a regulation in glioblastoma
Parker, Brittany C.; Annala, Matti J.; Cogdell, David E.; Granberg, Kirsi J.; Sun, Yan; Ji, Ping; Li, Xia; Gumin, Joy; Zheng, Hong; Hu, Limei; Yli-Harja, Olli; Haapasalo, Hannu; Visakorpi, Tapio; Liu, Xiuping; Liu, Chang-gong; Sawaya, Raymond; Fuller, Gregory N.; Chen, Kexin; Lang, Frederick F.; Nykter, Matti; Zhang, Wei
2013-01-01
Fusion genes are chromosomal aberrations that are found in many cancers and can be used as prognostic markers and drug targets in clinical practice. Fusions can lead to production of oncogenic fusion proteins or to enhanced expression of oncogenes. Several recent studies have reported that some fusion genes can escape microRNA regulation via 3′–untranslated region (3′-UTR) deletion. We performed whole transcriptome sequencing to identify fusion genes in glioma and discovered FGFR3-TACC3 fusions in 4 of 48 glioblastoma samples from patients both of mixed European and of Asian descent, but not in any of 43 low-grade glioma samples tested. The fusion, caused by tandem duplication on 4p16.3, led to the loss of the 3′-UTR of FGFR3, blocking gene regulation of miR-99a and enhancing expression of the fusion gene. The fusion gene was mutually exclusive with EGFR, PDGFR, or MET amplification. Using cultured glioblastoma cells and a mouse xenograft model, we found that fusion protein expression promoted cell proliferation and tumor progression, while WT FGFR3 protein was not tumorigenic, even under forced overexpression. These results demonstrated that the FGFR3-TACC3 gene fusion is expressed in human cancer and generates an oncogenic protein that promotes tumorigenesis in glioblastoma. PMID:23298836
Two-year outcomes of transforaminal lumbar interbody fusion.
Poh, Seng Yew; Yue, Wai Mun; Chen, Li-Tat John; Guo, Chang-Ming; Yeo, William; Tan, Seang-Beng
2011-08-01
To evaluate the outcomes, fusion rates, complications, and adjacent segment degeneration associated with transforaminal lumbar interbody fusion (TLIF). 32 men and 80 women aged 15 to 85 (mean, 57) years underwent 141 fusions (84 one-level, 27 2-level, and one 3-level) and were followed up for 24 to 76 (mean, 33) months. 92% of the patients had degenerative lumbar disease, 15 of whom had had previous lumbar surgery. Radiographic and clinical outcomes were assessed at 2 years. The short-form 36 (SF-36) health survey, visual analogue scale (VAS) for pain, and the modified North American Spine Society (NASS) Low Back Pain Outcome Instrument were used. Of the 141 levels fused, 110 (78%) were fused with remodelling and trabeculae (grade I), and 31 (22%) had intact grafts but were not fully incorporated (grade II). No patient had pseudoarthroses (grade III or IV). For one-level fusions, poorer radiological fusion grades correlated with higher VAS scores for pain (p<0.01). All components of the SF-36, the VAS scores for pain, and the NASS scores improved significantly after TLIF (p<0.01), except for general health in the SF-36 (p=0.59). Improvement from postoperative 6 months to 2 years was not significant, except for physical function (p<0.01) and role function (physical) [p=0.01] in the SF-36. Two years after TLIF, 50% of the patients reported returning to full function, whereas 72% were satisfied. 26 (23%) of the patients had adjacent segment degeneration, but only 4 of them were symptomatic. TLIF is a safe and effective treatment for degenerative lumbar diseases.
Return to Work After Diskogenic Fusion in Workers' Compensation Subjects.
Anderson, Joshua T; Haas, Arnold R; Percy, Rick; Woods, Stephen T; Ahn, Uri M; Ahn, Nicholas U
2015-12-01
Lumbar fusion for degenerative disk disease (DDD) is associated with variable clinical outcomes. Patients with workers' compensation claims often have worse fusion outcomes than the general population. Few studies have evaluated the risk factors for poor outcomes within this clinically distinct population. The goal of this study was to identify preoperative predictors of return to work status after fusion for DDD in a workers' compensation setting. The authors used International Classification of Diseases, Ninth Revision (ICD-9), diagnosis and Current Procedural Terminology (CPT) procedural codes to identify 1037 subjects from the Ohio Bureau of Workers' Compensation database who underwent fusion for DDD between 1993 and 2013. Of these subjects, 23.2% (n=241) made a sustained return to work within 2 years after fusion. To identify preoperative predictors of postoperative return to work status, the authors used multivariate logistic regression analysis, adjusting for many important covariates. These included prolonged time out of work (P<.001; odds ratio [OR], 0.24), psychiatric history (P<.001; OR, 0.14), prolonged use of opioid analgesics (P<.001; OR, 0.46), male sex (P=.014; OR, 0.65), and legal representation (P=.042; OR, 0.67). The return to work rates associated with these risk factors were 10.4%, 2.0%, 11.9%, 21.1%, and 20.7%, respectively. Of the study subjects, 76.8% (n=796) did not return to work and had considerably worse postoperative outcomes, highlighted by chronic opioid dependence and high rates of failed back syndrome, additional surgery, and new psychiatric comorbidity. The low return to work rates and other generally poor outcomes reported in this study may indicate a more limited role for lumbar fusion among patients with DDD who have workers' compensation claims. More studies are needed to determine whether fusion for DDD can improve function and quality of life in these patients. Copyright 2015, SLACK Incorporated.
2014-01-01
Background The fusion of the pelvic joints in patients with severe pelvic girdle pain (PGP) is a controversial and insufficiently studied procedure. The aims of this study were to evaluate physical function and pain after sacroiliac joint (SIJ) fusion. Methods A single-subject research design study with repeated measurements was conducted; pre-operatively and at 3, 6 and 12 months post-operatively. The outcome measures considered were the Oswestry disability index (ODI), visual analogue scale (VAS), and SF-36. Eight patients with severe PGP received open-accessed unilateral anterior SIJ fusion and fusion of the pubic symphysis. Results Seven patients reported positive results from the surgery. At 1 year post-operation, significant (p < 0.001) reductions in ODI (54 to 37) and VAS (82 to 57) were reported. The physical functioning, bodily pain, and social functioning scores in the SF-36 were also improved. Conclusion Positive and significant changes in disability and pain at 1 year after SIJ fusion were observed. Despite these positive results, open accessed anterior fusion of the SIJ was associated with adverse events and complications such as infection and nerve damage. PMID:24629145
Passman, Dina B.
2013-01-01
Objective The objective of this demonstration is to show conference attendees how they can integrate, analyze, and visualize diverse data type data from across a variety of systems by leveraging an off-the-shelf enterprise business intelligence (EBI) solution to support decision-making in disasters. Introduction Fusion Analytics is the data integration system developed by the Fusion Cell at the U.S. Department of Health and Human Services (HHS), Office of the Assistant Secretary for Preparedness and Response (ASPR). Fusion Analytics meaningfully augments traditional public and population health surveillance reporting by providing web-based data analysis and visualization tools. Methods Fusion Analytics serves as a one-stop-shop for the web-based data visualizations of multiple real-time data sources within ASPR. The 24-7 web availability makes it an ideal analytic tool for situational awareness and response allowing stakeholders to access the portal from any internet-enabled device without installing any software. The Fusion Analytics data integration system was built using off-the-shelf EBI software. Fusion Analytics leverages the full power of statistical analysis software and delivers reports to users in a secure web-based environment. Fusion Analytics provides an example of how public health staff can develop and deploy a robust public health informatics solution using an off-the shelf product and with limited development funding. It also provides the unique example of a public health information system that combines patient data for traditional disease surveillance with manpower and resource data to provide overall decision support for federal public health and medical disaster response operations. Conclusions We are currently in a unique position within public health. One the one hand, we have been gaining greater and greater access to electronic data of all kinds over the last few years. On the other, we are working in a time of reduced government spending
Hamilton, Brian S.; Whittaker, Gary R.; Daniel, Susan
2012-01-01
Hemagglutinin (HA) is the viral protein that facilitates the entry of influenza viruses into host cells. This protein controls two critical aspects of entry: virus binding and membrane fusion. In order for HA to carry out these functions, it must first undergo a priming step, proteolytic cleavage, which renders it fusion competent. Membrane fusion commences from inside the endosome after a drop in lumenal pH and an ensuing conformational change in HA that leads to the hemifusion of the outer membrane leaflets of the virus and endosome, the formation of a stalk between them, followed by pore formation. Thus, the fusion machinery is an excellent target for antiviral compounds, especially those that target the conserved stem region of the protein. However, traditional ensemble fusion assays provide a somewhat limited ability to directly quantify fusion partly due to the inherent averaging of individual fusion events resulting from experimental constraints. Inspired by the gains achieved by single molecule experiments and analysis of stochastic events, recently-developed individual virion imaging techniques and analysis of single fusion events has provided critical information about individual virion behavior, discriminated intermediate fusion steps within a single virion, and allowed the study of the overall population dynamics without the loss of discrete, individual information. In this article, we first start by reviewing the determinants of HA fusogenic activity and the viral entry process, highlight some open questions, and then describe the experimental approaches for assaying fusion that will be useful in developing the most effective therapies in the future. PMID:22852045
Wijesinghe, Priyanga; Bepler, Gerold
2014-01-01
Introduction ROS1 and RET gene fusions were recently discovered in non-small cell lung cancer (NSCLC) as potential therapeutic targets with small molecule kinase inhibitors. The conventional screening methods of these fusions are time consuming and require samples of high quality and quantity. Here, we describe a novel and efficient method by coupling the power of multiplexing PCR and the sensitivity of mass spectrometry. Methods The multiplex mass spectrometry platform simultaneously tests samples for the expression of nine ROS1 and six RET fusion genes. The assay incorporates detection of wild-type exon junctions immediately upstream and downstream of the fusion junction to exclude false negative results. To flag false positives, the system also comprises two independent assays for each fusion gene junction. Results The characteristic mass spectrometric peaks of the gene fusions were obtained using engineered plasmid constructs. Specific assays targeting the wild-type gene exon junctions were validated using cDNA from lung tissue of healthy individuals. The system was further validated using cDNA derived from NSCLC cell lines that express endogenous fusion genes. The expressed ROS1-SLC34A2 and CCDC6-RET gene fusions from the NSCLC cell lines HCC78 and LC-2/ad, respectively, were accurately detected by the novel assay. The assay is extremely sensitive, capable of detecting an event in test specimens containing 0.5% positive tumors. Conclusion The novel multiplexed assay is robustly capable of detecting 15 different clinically relevant RET and ROS1 fusion variants. The benefits of this detection method include exceptionally low sample input, high cost efficiency, flexibility, and rapid turnover. PMID:25384172
A Review of Data Fusion Techniques
2013-01-01
The integration of data and knowledge from several sources is known as data fusion. This paper summarizes the state of the data fusion field and describes the most relevant studies. We first enumerate and explain different classification schemes for data fusion. Then, the most common algorithms are reviewed. These methods and algorithms are presented using three different categories: (i) data association, (ii) state estimation, and (iii) decision fusion. PMID:24288502
A review of data fusion techniques.
Castanedo, Federico
2013-01-01
The integration of data and knowledge from several sources is known as data fusion. This paper summarizes the state of the data fusion field and describes the most relevant studies. We first enumerate and explain different classification schemes for data fusion. Then, the most common algorithms are reviewed. These methods and algorithms are presented using three different categories: (i) data association, (ii) state estimation, and (iii) decision fusion.
Sensor data fusion for spectroscopy-based detection of explosives
NASA Astrophysics Data System (ADS)
Shah, Pratik V.; Singh, Abhijeet; Agarwal, Sanjeev; Sedigh, Sahra; Ford, Alan; Waterbury, Robert
2009-05-01
In-situ trace detection of explosive compounds such as RDX, TNT, and ammonium nitrate, is an important problem for the detection of IEDs and IED precursors. Spectroscopic techniques such as LIBS and Raman have shown promise for the detection of residues of explosive compounds on surfaces from standoff distances. Individually, both LIBS and Raman techniques suffer from various limitations, e.g., their robustness and reliability suffers due to variations in peak strengths and locations. However, the orthogonal nature of the spectral and compositional information provided by these techniques makes them suitable candidates for the use of sensor fusion to improve the overall detection performance. In this paper, we utilize peak energies in a region by fitting Lorentzian or Gaussian peaks around the location of interest. The ratios of peak energies are used for discrimination, in order to normalize the effect of changes in overall signal strength. Two data fusion techniques are discussed in this paper. Multi-spot fusion is performed on a set of independent samples from the same region based on the maximum likelihood formulation. Furthermore, the results from LIBS and Raman sensors are fused using linear discriminators. Improved detection performance with significantly reduced false alarm rates is reported using fusion techniques on data collected for sponsor demonstration at Fort Leonard Wood.
Kobayashi, Makoto; Sakakibara, Tomohiro; Inoue, Akira; Fukuhara, Tatsuro; Sasano, Hironobu; Ichinose, Masakazu; Nukiwa, Toshihiro
2014-01-01
A novel fusion gene that comprises the echinoderm microtubule-associated protein-like 4 (EML4) and anaplastic lymphoma kinase (ALK) genes was recently identified in non-small cell lung cancer (NSCLC), particularly in adenocarcinoma. A specific ALK inhibitor has been shown to exert anti-tumor effects in NSCLC with the EML4-ALK fusion gene. Previous reports suggested an EML4-ALK incidence of approximately 5% in a pan-NSCLC population, with an increased frequency in younger patients, but an appropriate strategy for further selecting patients with the EML4-ALK fusion gene remains unknown. Patients, 55 years of age or younger, who were diagnosed with NSCLC without typical squamous cell carcinoma features at our institute were retrospectively evaluated. The tumor specimens were examined by immunohistochemistry for the EML4-ALK fusion gene and by polymerase chain reaction for epidermal growth factor receptor (EGFR) mutations. Between January 2004 and September 2011, the EML4-ALK fusion gene was detected in 19.6% (9/46) of patients. The fusion gene incidence increased to 31% (9/29) when patients with EGFR mutations were excluded. The EML4-ALK fusion gene was further detected in 2 cases of undifferentiated cell carcinoma. EML4-ALK fusion gene examinations could be more effectively performed by selecting young NSCLC patients without EGFR mutations, whereas selection on the basis of a non-smoking or adenocarcinoma history, as reported in previous studies, may not correctly identify the patient groups with potential EML4-ALK fusion gene. Copyright © 2013 The Japanese Respiratory Society. Published by Elsevier B.V. All rights reserved.
Neutrinos from the primary proton-proton fusion process in the Sun
NASA Astrophysics Data System (ADS)
BOREXINO Collaboration; Bellini, G.; Benziger, J.; Bick, D.; Bonfini, G.; Bravo, D.; Caccianiga, B.; Cadonati, L.; Calaprice, F.; Caminata, A.; Cavalcante, P.; Chavarria, A.; Chepurnov, A.; D'Angelo, D.; Davini, S.; Derbin, A.; Empl, A.; Etenko, A.; Fomenko, K.; Franco, D.; Gabriele, F.; Galbiati, C.; Gazzana, S.; Ghiano, C.; Giammarchi, M.; Göger-Neff, M.; Goretti, A.; Gromov, M.; Hagner, C.; Hungerford, E.; Ianni, Aldo; Ianni, Andrea; Kobychev, V.; Korablev, D.; Korga, G.; Kryn, D.; Laubenstein, M.; Lehnert, B.; Lewke, T.; Litvinovich, E.; Lombardi, F.; Lombardi, P.; Ludhova, L.; Lukyanchenko, G.; Machulin, I.; Manecki, S.; Maneschg, W.; Marcocci, S.; Meindl, Q.; Meroni, E.; Meyer, M.; Miramonti, L.; Misiaszek, M.; Montuschi, M.; Mosteiro, P.; Muratova, V.; Oberauer, L.; Obolensky, M.; Ortica, F.; Otis, K.; Pallavicini, M.; Papp, L.; Perasso, L.; Pocar, A.; Ranucci, G.; Razeto, A.; Re, A.; Romani, A.; Rossi, N.; Saldanha, R.; Salvo, C.; Schönert, S.; Simgen, H.; Skorokhvatov, M.; Smirnov, O.; Sotnikov, A.; Sukhotin, S.; Suvorov, Y.; Tartaglia, R.; Testera, G.; Vignaud, D.; Vogelaar, R. B.; von Feilitzsch, F.; Wang, H.; Winter, J.; Wojcik, M.; Wright, A.; Wurm, M.; Zaimidoroga, O.; Zavatarelli, S.; Zuber, K.; Zuzel, G.
2014-08-01
In the core of the Sun, energy is released through sequences of nuclear reactions that convert hydrogen into helium. The primary reaction is thought to be the fusion of two protons with the emission of a low-energy neutrino. These so-called pp neutrinos constitute nearly the entirety of the solar neutrino flux, vastly outnumbering those emitted in the reactions that follow. Although solar neutrinos from secondary processes have been observed, proving the nuclear origin of the Sun's energy and contributing to the discovery of neutrino oscillations, those from proton-proton fusion have hitherto eluded direct detection. Here we report spectral observations of pp neutrinos, demonstrating that about 99 per cent of the power of the Sun, 3.84 × 1033 ergs per second, is generated by the proton-proton fusion process.
Is the Aligning Prism Measured with the Mallett Unit Correlated with Fusional Vergence Reserves?
Conway, Miriam L.; Thomas, Jennifer; Subramanian, Ahalya
2012-01-01
Background The Mallett Unit is a clinical test designed to detect the fixation disparity that is most likely to occur in the presence of a decompensated heterophoria. It measures the associated phoria, which is the “aligning prism” needed to nullify the subjective disparity. The technique has gained widespread acceptance within professions such as optometry, for investigating suspected cases of decompensating heterophoria; it is, however, rarely used by orthoptists and ophthalmologists. The aim of this study was to investigate whether fusional vergence reserves, measured routinely by both orthoptists and ophthalmologists to detect heterophoria decompensation, were correlated with aligning prism (associated phoria) in a normal clinical population. Methodology/Principal Findings Aligning prism (using the Mallett Unit) and fusional vergence reserves (using a prism bar) were measured in 500 participants (mean 41.63 years; standard deviation 11.86 years) at 40 cm and 6 m. At 40 cm a strong correlation (p<0.001) between base in aligning prism (Exo FD) and positive fusional reserves was found. Of the participants with zero aligning prism 30% had reduced fusional reserves. At 6 m a weak correlation between base out aligning prism (Eso FD) and negative fusional reserves was found to break (p = 0.01) and to recovery (p = 0.048). Of the participants with zero aligning prism 12% reported reduced fusional reserves. Conclusions/Significance For near vision testing, the strong inverse correlation between base in aligning prism (Exo FD) and fusional vergence reserves supports the notion that both measures are indicators of decompensation of heterophoria. For distance vision testing and for those patients reporting zero aligning prism further research is required to determine why the relationship appears to be weak/non-existent? PMID:22905174
Suehara, Yoshiyuki; Arcila, Maria; Wang, Lu; Hasanovic, Adnan; Ang, Daphne; Ito, Tatsuo; Kimura, Yuki; Drilon, Alexander; Guha, Udayan; Rusch, Valerie; Kris, Mark G.; Zakowski, Maureen F.; Rizvi, Naiyer; Khanin, Raya; Ladanyi, Marc
2014-01-01
Background The mutually exclusive pattern of the major driver oncogenes in lung cancer suggests that other mutually exclusive oncogenes exist. We performed a systematic search for tyrosine kinase (TK) fusions by screening all TKs for aberrantly high RNA expression levels of the 3′ kinase domain (KD) exons relative to more 5′ exons. Methods We studied 69 patients (including 5 never smokers and 64 current or former smokers) with lung adenocarcinoma negative for all major mutations in KRAS, EGFR, BRAF, MEK1, and HER2, and for ALK fusions (termed “pan-negative”). A NanoString-based assay was designed to query the transcripts of 90 TKs at two points: 5′ to the KD and within the KD or 3′ to it. Tumor RNAs were hybridized to the NanoString probes and analyzed for outlier 3′ to 5′ expression ratios. Presumed novel fusion events were studied by rapid amplification of cDNA ends (RACE) and confirmatory RT-PCR and FISH. Results We identified 1 case each of aberrant 3′ to 5′ ratios in ROS1 and RET. RACE isolated a GOPC-ROS1 (FIG-ROS1) fusion in the former and a KIF5B-RET fusion in the latter, both confirmed by RT-PCR. The RET rearrangement was also confirmed by FISH. The KIF5B-RET patient was one of only 5 never smokers in this cohort. Conclusion The KIF5B-RET fusion defines an additional subset of lung cancer with a potentially targetable driver oncogene enriched in never smokers with “pan-negative” lung adenocarcinomas. We also report for the first time in lung cancer the GOPC-ROS1 fusion previously characterized in glioma. PMID:23052255
Critical Fusion--Technology and Equity in Secondary Education
ERIC Educational Resources Information Center
Magolda, Peter
2006-01-01
This manuscript reports on the first year of a formative, external program evaluation of the Critical Fusion Initiative (CFI), which involved a higher education institution, a public high school, a corporation, and two nonprofit organizations. The initiative fused technology and education to address the issue of equity by assisting 16 high school…
Outer nuclear membrane fusion of adjacent nuclei in varicella-zoster virus-induced syncytia.
Wang, Wei; Yang, Lianwei; Huang, Xiumin; Fu, Wenkun; Pan, Dequan; Cai, Linli; Ye, Jianghui; Liu, Jian; Xia, Ningshao; Cheng, Tong; Zhu, Hua
2017-12-01
Syncytia formation has been considered important for cell-to-cell spread and pathogenesis of many viruses. As a syncytium forms, individual nuclei often congregate together, allowing close contact of nuclear membranes and possibly fusion to occur. However, there is currently no reported evidence of nuclear membrane fusion between adjacent nuclei in wild-type virus-induced syncytia. Varicella-zoster virus (VZV) is one typical syncytia-inducing virus that causes chickenpox and shingles in humans. Here, we report, for the first time, an interesting observation of apparent fusion of the outer nuclear membranes from juxtaposed nuclei that comprise VZV syncytia both in ARPE-19 human epithelial cells in vitro and in human skin xenografts in the SCID-hu mouse model in vivo. This work reveals a novel aspect of VZV-related cytopathic effect in the context of multinucleated syncytia. Additionally, the information provided by this study could be helpful for future studies on interactions of viruses with host cell nuclei. Copyright © 2017 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pimputkar, S.M.; McCoy, J.K.; Stets, J.A.
1991-03-01
The integrity of a pipeline system is determined by its weakest links which may be the joints. Heat fusion is the most common method for joining gas distribution polyethylene (PE) piping. There are procedural, thermal, and mechanical aspects of making fusion joints. Acceptable procedural aspects, such as heater calibration and cleanliness, can be assured by rigorous training and certification of the operators. Thermal and mechanical aspects consist of specifying joining conditions such as the heater temperature, heating time, and joining pressure. In the absence of procedural errors, the strength of a fusion joint should depend on the pipe material, pipemore » dimensions, and the thermal and mechanical joining conditions. Socket heat fusion was studied both experimentally and analytically to determine how the strength of the joint varied with the conditions under which it was made. The standard tensile impact test was modified to test socket fusion joint samples in shear. The developed shear impact energy test data were found to be reliable measures of strength if the setups for conditions were meticulously identical. A parameter, termed the socket joining parameter, was found to characterize the joining conditions. It is a strong function of melt volume at the end of the heating phase, and physically, it is polyethylene transported parallel to the axis during insertion. The results for three resins are presented in the form of three nomographs. The nomographs may be used to select the required heater temperature or the heating time, for a given ambient temperature and a PE resin, to ensure a structurally sound socket heat fusion joint.« less
Fusion barrier characteristics of actinides
NASA Astrophysics Data System (ADS)
Manjunatha, H. C.; Sridhar, K. N.
2018-03-01
We have studied fusion barrier characteristics of actinide compound nuclei with atomic number range 89 ≤ Z ≤ 103 for all projectile target combinations. After the calculation of fusion barrier heights and positions, we have searched for their parameterization. We have achieved the empirical formula for fusion barrier heights (VB), positions (RB), curvature of the inverted parabola (ħω) of actinide compound nuclei with atomic number range 89 ≤ Z ≤ 103 for all projectile target combinations (6
Achieving Fairness in Data Fusion Performance Evaluation Development
2006-04-30
display a currently valid OMB control number. PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE (DD-MM-YYYY) 2.REPORT TYPE 13. DATES...for and evaluation (T&E) organization is how to affordably achieve fairness in the application of its PE systems. Our PE framework provides a ...as a fusion system design balances probability of mission success with complexity/cost). The key issue for and evaluation (T&E) organization is how to
Fusion of single proteoliposomes with planar, cushioned bilayers in microfluidic flow cells
Karatekin, Erdem; Rothman, James E.
2013-01-01
Many biological processes rely on membrane fusion, therefore assays to study its mechanisms are necessary. Here we report an assay with sensitivity to single-vesicle, even to single-molecule events using fluorescently labeled vesicle-associated v-SNARE liposomes and target-membrane-associated t-SNARE-reconstituted planar, supported bilayers (SBLs). Docking and fusion events can be detected using conventional far-field epifluorescence or total internal reflection fluorsecence microscopy. Unlike most previous attempts, fusion here is dependent on SNAP25, one of the t-SNARE subunits that is required for fusion in vivo. The success of the assay is due to the use of (i) bilayers covered with a thin layer of poly(ethylene glycol) to control bilayer-bilayer and bilayer-substrate interactions, (ii) microfluidic flow channels which presents many advantages such as the removal of non-specifically bound liposomes by flow. The protocol takes 6–8 days to complete. Analysis can take up to two weeks. PMID:22517259
HEDP and new directions for fusion energy
NASA Astrophysics Data System (ADS)
Kirkpatrick, Ronald C.
2010-06-01
Magnetic-confinement fusion energy and inertia-confinement fusion energy (IFE) represent two extreme approaches to the quest for the application of thermonuclear fusion to electrical energy generation. Blind pursuit of these extreme approaches has long delayed the achievement of their common goal. We point out the possibility of an intermediate approach that promises cheaper, and consequently more rapid development of fusion energy. For example, magneto-inertial fusion appears to be possible over a broad range of parameter space. It is further argued that imposition of artificial constraints impedes the discovery of physics solutions for the fusion energy problem.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Maingi, Rajesh; Zinkle, Steven J.; Foster, Mark S.
2015-05-01
The realization of controlled thermonuclear fusion as an energy source would transform society, providing a nearly limitless energy source with renewable fuel. Under the auspices of the U.S. Department of Energy, the Fusion Energy Sciences (FES) program management recently launched a series of technical workshops to “seek community engagement and input for future program planning activities” in the targeted areas of (1) Integrated Simulation for Magnetic Fusion Energy Sciences, (2) Control of Transients, (3) Plasma Science Frontiers, and (4) Plasma-Materials Interactions aka Plasma-Materials Interface (PMI). Over the past decade, a number of strategic planning activities1-6 have highlighted PMI and plasmamore » facing components as a major knowledge gap, which should be a priority for fusion research towards ITER and future demonstration fusion energy systems. There is a strong international consensus that new PMI solutions are required in order for fusion to advance beyond ITER. The goal of the 2015 PMI community workshop was to review recent innovations and improvements in understanding the challenging PMI issues, identify high-priority scientific challenges in PMI, and to discuss potential options to address those challenges. The community response to the PMI research assessment was enthusiastic, with over 80 participants involved in the open workshop held at Princeton Plasma Physics Laboratory on May 4-7, 2015. The workshop provided a useful forum for the scientific community to review progress in scientific understanding achieved during the past decade, and to openly discuss high-priority unresolved research questions. One of the key outcomes of the workshop was a focused set of community-initiated Priority Research Directions (PRDs) for PMI. Five PRDs were identified, labeled A-E, which represent community consensus on the most urgent near-term PMI scientific issues. For each PRD, an assessment was made of the scientific challenges, as well as a set of
76 FR 49757 - Fusion Energy Sciences Advisory Committee
Federal Register 2010, 2011, 2012, 2013, 2014
2011-08-11
... DEPARTMENT OF ENERGY Fusion Energy Sciences Advisory Committee AGENCY: Office of Science... Services Administration, notice is hereby given that the Fusion Energy Sciences Advisory Committee will be... science, fusion science, and fusion technology related to the Fusion Energy Sciences program. Additionally...
NASA Technical Reports Server (NTRS)
Thio, Y. C. Francis; Schmidt, George R.; Santarius, John F.; Turchi, Peter J.; Siemon, Richard E.; Rodgers, Stephen L. (Technical Monitor)
2002-01-01
The need for fusion propulsion for interplanetary flights is discussed. For a propulsion system, there are three important system attributes: (1) The absolute amount of energy available, (2) the propellant exhaust velocity, and (3) the jet power per unit mass of the propulsion system (specific power). For efficient and affordable human exploration of the solar system, propellant exhaust velocity in excess of 100 km/s and specific power in excess of 10 kW/kg are required. Chemical combustion obviously cannot meet the requirement in propellant exhaust velocity. Nuclear fission processes typically result in producing energy in the form of heat that needs to be manipulated at temperatures limited by materials to about 2,800 K. Using the fission energy to heat a low atomic weight propellant produces propellant velocity of the order of 10 kinds. Alternatively the fission energy can be converted into electricity that is used to accelerate particles to high exhaust velocity. However, the necessary power conversion and conditioning equipment greatly increases the mass of the propulsion system. Fundamental considerations in waste heat rejection and power conditioning in a fission electric propulsion system place a limit on its jet specific power to the order of about 0.2 kW/kg. If fusion can be developed for propulsion, it appears to have the best of all worlds - it can provide the largest absolute amount of energy, the propellant exhaust velocity (> 100 km/s), and the high specific jet power (> 10 kW/kg). An intermediate step towards fusion propulsion might be a bimodal system in which a fission reactor is used to provide some of the energy to drive a fusion propulsion unit. There are similarities as well as differences between applying fusion to propulsion and to terrestrial electrical power generation. The similarities are the underlying plasma and fusion physics, the enabling component technologies, the computational and the diagnostics capabilities. These physics and
PI(4,5)P2 regulates myoblast fusion through Arp2/3 regulator localization at the fusion site
Bothe, Ingo; Deng, Su; Baylies, Mary
2014-01-01
Cell-cell fusion is a regulated process that requires merging of the opposing membranes and underlying cytoskeletons. However, the integration between membrane and cytoskeleton signaling during fusion is not known. Using Drosophila, we demonstrate that the membrane phosphoinositide PI(4,5)P2 is a crucial regulator of F-actin dynamics during myoblast fusion. PI(4,5)P2 is locally enriched and colocalizes spatially and temporally with the F-actin focus that defines the fusion site. PI(4,5)P2 enrichment depends on receptor engagement but is upstream or parallel to actin remodeling. Regulators of actin branching via Arp2/3 colocalize with PI(4,5)P2 in vivo and bind PI(4,5)P2 in vitro. Manipulation of PI(4,5)P2 availability leads to impaired fusion, with a reduction in the F-actin focus size and altered focus morphology. Mechanistically, the changes in the actin focus are due to a failure in the enrichment of actin regulators at the fusion site. Moreover, improper localization of these regulators hinders expansion of the fusion interface. Thus, PI(4,5)P2 enrichment at the fusion site encodes spatial and temporal information that regulates fusion progression through the localization of activators of actin polymerization. PMID:24821989
Association of insurance status and spinal fusion usage in the United States during two decades.
John, Jason; Mirahmadizadeh, Alireza; Seifi, Ali
2018-05-01
This study examined the distribution of spinal fusion usage among payer groups in the United States. Using the National Inpatient Sample (NIS) database, total discharges, length of stay, and mean hospital charges of patients who underwent spinal fusion from 1997 to 2014 in the United States were determined and analyzed. 5,715,625 total discharges with spinal fusion were reported. Among them, 2,875,188 (50.3%) were covered by private insurance, 1,710,182 by Medicare (29.9%), 342,638 (6.0%) by Medicaid, and 91,990 (1.6%) were uninsured. A statistically significant increase in spinal fusion usage occurred within each payer group over the study period (P < 0.001). For every year of the study period, private insurance patients had the most number and uninsured patients had the least number of total discharges with spinal fusion. Furthermore, annual growth in spinal fusion usage was greatest among private insurance patients, and smallest among uninsured patients. Total discharges with spinal fusion increased significantly across all payer groups between 1997 and 2014, but not equally. Further inquiry is indicated to determine the etiology of spinal fusion usage discrepancies between payer groups. Copyright © 2018 Elsevier Ltd. All rights reserved.
Furuhashi, Hiroki; Togawa, Daisuke; Koyama, Hiroshi; Hoshino, Hironobu; Yasuda, Tatsuya; Matsuyama, Yukihiro
2017-05-01
Several reports have indicated that anterior dislocation of total hip arthroplasty (THA) can be caused by spinal degenerative changes with excessive pelvic retroversion. However, no reports have indicated that posterior dislocation can be caused by fixed pelvic anteversion after corrective spine surgery. We describe a rare case experiencing repeated posterior THA dislocation that occurred at 5 months after corrective spinal long fusion with pelvic fixation. A 64-year-old woman had undergone bilateral THA at 13 years before presenting to our institution. She had been diagnosed with kyphoscoliosis and underwent three subsequent spinal surgeries after the THA. We finally performed spinal corrective long fusion from T5 to ilium with pelvic fixation (with iliac screws). Five months later, she experienced severe hip pain when she tried to stand up from the toilet, and was unable to move, due to posterior THA dislocation. Therefore, we performed closed reduction under sedation, and her left hip was easily reduced. After the reduction, she started to walk with a hip abduction brace. However, she had experienced 5 subsequent dislocations. Based on our findings and previous reports, we have hypothesized that posterior dislocation could be occurred after spinal corrective long fusion with pelvic fixation due to three mechanisms: (1) a change in the THA cup alignment before and after spinal corrective long fusion surgery, (2) decreased and fixed pelvic posterior tilt in the sitting position, or (3) the trunk's forward tilting during standing-up motion after spinopelvic fixation. Spinal long fusion with pelvic fixation could be a risk factor for posterior THA dislocation.
Magnetized Target Fusion At General Fusion: An Overview
NASA Astrophysics Data System (ADS)
Laberge, Michel; O'Shea, Peter; Donaldson, Mike; Delage, Michael; Fusion Team, General
2017-10-01
Magnetized Target Fusion (MTF) involves compressing an initial magnetically confined plasma on a timescale faster than the thermal confinement time of the plasma. If near adiabatic compression is achieved, volumetric compression of 350X or more of a 500 eV target plasma would achieve a final plasma temperature exceeding 10 keV. Interesting fusion gains could be achieved provided the compressed plasma has sufficient density and dwell time. General Fusion (GF) is developing a compression system using pneumatic pistons to collapse a cavity formed in liquid metal containing a magnetized plasma target. Low cost driver, straightforward heat extraction, good tritium breeding ratio and excellent neutron protection could lead to a practical power plant. GF (65 employees) has an active plasma R&D program including both full scale and reduced scale plasma experiments and simulation of both. Although pneumatic driven compression of full scale plasmas is the end goal, present compression studies use reduced scale plasmas and chemically accelerated aluminum liners. We will review results from our plasma target development, motivate and review the results of dynamic compression field tests and briefly describe the work to date on the pneumatic driver front.
Fusion technologies for Laser Inertial Fusion Energy (LIFE)
NASA Astrophysics Data System (ADS)
Kramer, K. J.; Latkowski, J. F.; Abbott, R. P.; Anklam, T. P.; Dunne, A. M.; El-Dasher, B. S.; Flowers, D. L.; Fluss, M. J.; Lafuente, A.; Loosmore, G. A.; Morris, K. R.; Moses, E.; Reyes, S.
2013-11-01
The Laser Inertial Fusion-based Energy (LIFE) engine design builds upon on going progress at the National Ignition Facility (NIF) and offers a near-term pathway to commercial fusion. Fusion technologies that are critical to success are reflected in the design of the first wall, blanket and tritium separation subsystems. The present work describes the LIFE engine-related components and technologies. LIFE utilizes a thermally robust indirect-drive target and a chamber fill gas. Coolant selection and a large chamber solid-angle coverage provide ample tritium breeding margin and high blanket gain. Target material selection eliminates the need for aggressive chamber clearing, while enabling recycling. Demonstrated tritium separation and storage technologies limit the site tritium inventory to attractive levels. These key technologies, along with the maintenance and advanced materials qualification program have been integrated into the LIFE delivery plan. This describes the development of components and subsystems, through prototyping and integration into a First Of A Kind power plant. This work performed under the auspices of the U.S. Department of Energy by Lawrence Livermore National Laboratory under Contract DE-AC52-07NA27344.
Heiney, Jake; Cher, Daniel
2015-01-01
Background A number of studies have been published regarding minimally invasive surgical (MIS) fusion of the sacroiliac (SI) joint using a lateral transarticular approach. Herein we report a systematic review and meta-analysis to summarize operative measures and clinical outcomes reported in published studies of MIS SI joint fusion. Methods The systematic review was done according to PRISMA standards. PubMed and EMBASE were searched using the terms sacroiliac joint AND fusion. Original peer-reviewed articles in the English language that reported clinical outcomes on at least 5 cases of MIS SI joint fusion using a lateral transarticular approach were included. Random effects meta-analysis (RMA) was performed on selected variables using the DerSimonian and Laird method, including operative measures, VAS SI joint pain ratings (0-10 scale) and Oswestry Disability Index (ODI). Mean and 95% confidence intervals (CI) were calculated and heterogeneity was assessed. Other findings were summarized qualitatively. Results A total of 18 articles met the inclusion criteria. After accounting for overlapping cohorts, 12 unique cohorts from 4 countries were extracted for a total of 432 subjects. The RMA mean (range) was 59 minutes (27-78) for procedure time, 36.9cc (10-70) for estimated blood loss and 1.7 days (range 0-7) for length of stay (LOS). The RMA mean [95% CI] pain score dropped by 5.2 points at 6 months and 5.3 points at 12 months (baseline score of 8.1 [7.8-8.4], 12-month score of 2.7 [2.1-3.3]), and a 24-month score of 2.0(1.4-2.5). ODI decreased by 31 points at 12 months (baseline score of 56.2 [51.0-61.5], 6-month score of 30.7 [21.8-39.6], and 12-month score of 25.1 [12.3-37.9]). Some estimates showed significant variation across studies and between the types of implants used. Other reported outcomes were supportive of the positive effects of SI joint fusion. Conclusion Published studies of MIS SI joint fusion using a lateral transarticular approach confirm its
Saw, Wan Ting; Matsuda, Zene; Eisenberg, Roselyn J; Cohen, Gary H; Atanasiu, Doina
2015-11-15
Herpes simplex virus (HSV) entry and cell-cell fusion require the envelope proteins gD, gH/gL and gB. We propose that receptor-activated conformational changes to gD activate gH/gL, which then triggers gB (the fusogen) into an active form. To study this dynamic process, we have adapted a dual split protein assay originally developed to study the kinetics of human immunodeficiency virus (HIV) mediated fusion. This assay uses a chimera of split forms of renilla luciferase (RL) and green fluorescent protein (GFP). Effector cells are co-transfected with the glycoproteins and one of the split reporters. Receptor-bearing target cells are transfected with the second reporter. Co-culture results in fusion and restoration of RL, which can convert a membrane permeable substrate into a luminescent product, thereby enabling one to monitor initiation and extent of fusion in live cells in real time. Restoration of GFP can also be studied by fluorescence microscopy. Two sets of split reporters have been developed: the original one allows one to measure fusion kinetics over hours whereas the more recent version was designed to enhance the sensitivity of RL activity allowing one to monitor both initiation and rates of fusion in minutes. Here, we provide a detailed, step-by-step protocol for the optimization of the assay (which we call the SLA for split luciferase assay) using the HSV system. We also show several examples of the power of this assay to examine both the initiation and kinetics of cell-cell fusion by wild type forms of gD, gB, gH/gL of both serotypes of HSV as well as the effect of mutations and antibodies that alter the kinetics of fusion. The SLA can be applied to other viral systems that carry out membrane fusion. Copyright © 2015 Elsevier Inc. All rights reserved.
Saw, Wan Ting; Matsuda, Zene; Eisenberg, Roselyn J; Cohen, Gary H; Atanasiu, Doina
2015-01-01
Herpes simplex virus (HSV) entry and cell-cell fusion require the envelope proteins gD, gH/gL and gB. We propose that receptor-activated conformational changes to gD activate gH/gL, which then triggers gB (the fusogen) into an active form. To study this dynamic process, we have adapted a dual split protein assay originally developed to study the kinetics of human immunodeficiency virus (HIV) mediated fusion. This assay uses a chimera of split forms of renilla luciferase (RL) and green fluorescent protein (GFP). Effector cells are co-transfected with the glycoproteins and one of the split reporters. Receptor-bearing target cells are transfected with the second reporter. Co-culture results in fusion and restoration of RL, which can convert a membrane permeable substrate into a luminescent product, thereby enabling one to monitor initiation and extent of fusion in live cells in real time. Restoration of GFP can also be studied by fluorescence microscopy. Two sets of split reporters have been developed: the original one allows one to measure fusion kinetics over hours whereas the more recent version was designed to enhance the sensitivity of RL activity allowing one to monitor both initiation and rates of fusion in minutes. Here, we provide a detailed, step-by-step protocol for the optimization of the assay (which we call the SLA for split luciferase assay) using the HSV system. We also show several examples of the power of this assay to examine both the initiation and kinetics of cell-cell fusion by wild type forms of gD, gB, gH/gL of both serotypes of HSV as well as the effect of mutations and antibodies that alter the kinetics of fusion. The SLA can be applied to other viral systems that carry out membrane fusion. PMID:26022509
Zhao, Zheng; Song, Zhangjun; Wang, Xuwei; Sun, Haifeng; Yang, Xiaomin; Yuan, Yong; Yu, Pan
2017-01-01
ROS1 fusion is a common genetic alteration in non-small-cell lung cancer. Crizotinib, an anaplastic lymphoma kinase inhibitor, shows efficacy in the treatment of lung cancer cases with ROS1 translocation. We report the response to crizotinib of a lung adenocarcinoma patient harboring a novel SLC34A2 - ROS1 fusion variant, which was different from the two common SLC34A2 - ROS1 fusion types reported in the literature. After crizotinib administration, overall recovery was good in this patient; the primary lesion was successfully treated, the lymph node metastases had disappeared, and the metabolism was normal.
Zhao, Zheng; Song, Zhangjun; Wang, Xuwei; Sun, Haifeng; Yang, Xiaomin; Yuan, Yong; Yu, Pan
2017-01-01
ROS1 fusion is a common genetic alteration in non-small-cell lung cancer. Crizotinib, an anaplastic lymphoma kinase inhibitor, shows efficacy in the treatment of lung cancer cases with ROS1 translocation. We report the response to crizotinib of a lung adenocarcinoma patient harboring a novel SLC34A2-ROS1 fusion variant, which was different from the two common SLC34A2-ROS1 fusion types reported in the literature. After crizotinib administration, overall recovery was good in this patient; the primary lesion was successfully treated, the lymph node metastases had disappeared, and the metabolism was normal. PMID:28860822
Carp, Julia; Sethi, Anil; Bartol, Stephen; Craig, Joseph; Les, Clifford M.
2007-01-01
The use of bone morphogenetic protein-2 (rhBMP-2) in spinal fusion has increased dramatically since an FDA approval for its use in anterior lumbar fusion with the LT cage. There are several reports of its use in transforaminal lumbar interbody fusion, posterolateral fusion, and anterior cervical fusion. Reports on adverse effects of rhBMP-2 when used in spinal fusion are scarce in literature. An Institutional Review Board approved retrospective study was conducted in patients undergoing anterior spinal fusion and instrumentation following diskectomy at a single center. Forty-six consecutive patients were included. Twenty-two patients treated with rhBMP-2 and PEEK cages were compared to 24 in whom allograft spacers and demineralized bone matrix was used. Patients filled out Cervical Oswestry Scores, VAS for arm pain, neck pain, and had radiographs preoperatively as well at every follow up visit. Radiographic examination following surgery revealed end plate resorption in all patients in whom rhBMP-2 was used. This was followed by a period of new bone formation commencing at 6 weeks. In contrast, allograft patients showed a progressive blurring of end plate-allograft junction. Dysphagia was a common complication and it was significantly more frequent and more severe in patients in whom rhBMP-2 was used. Post operative swelling anterior to the vertebral body on lateral cervical spine X-ray was significantly larger in the rhBMP-2 group when measured from 1 to 6 weeks after which it was similar. These effects are possibly due to an early inflammatory response to rhBMP-2 and were observed to be dose related. With the parameters we used, there was no significant difference in the clinical outcome of patients in the two groups at 2 years. The cost of implants in patients treated with rhBMP-2 and PEEK spacers was more than three times the cost of allograft spacers and demineralized bone matrix in 1, 2, and 3-level cases. Despite providing consistently good fusion rates
Lunar Helium-3 and Fusion Power
NASA Technical Reports Server (NTRS)
1988-01-01
The NASA Office of Exploration sponsored the NASA Lunar Helium-3 and Fusion Power Workshop. The meeting was held to understand the potential of using He-3 from the moon for terrestrial fusion power production. It provided an overview, two parallel working sessions, a review of sessions, and discussions. The lunar mining session concluded that mining, beneficiation, separation, and return of He-3 from the moon would be possible but that a large scale operation and improved technology is required. The fusion power session concluded that: (1) that He-3 offers significant, possibly compelling, advantages over fusion of tritium, principally increased reactor life, reduced radioactive wastes, and high efficiency conversion, (2) that detailed assessment of the potential of the D/He-3 fuel cycle requires more information, and (3) D/He-3 fusion may be best for commercial purposes, although D/T fusion is more near term.
Multispectral image fusion for target detection
NASA Astrophysics Data System (ADS)
Leviner, Marom; Maltz, Masha
2009-09-01
Various different methods to perform multi-spectral image fusion have been suggested, mostly on the pixel level. However, the jury is still out on the benefits of a fused image compared to its source images. We present here a new multi-spectral image fusion method, multi-spectral segmentation fusion (MSSF), which uses a feature level processing paradigm. To test our method, we compared human observer performance in an experiment using MSSF against two established methods: Averaging and Principle Components Analysis (PCA), and against its two source bands, visible and infrared. The task that we studied was: target detection in the cluttered environment. MSSF proved superior to the other fusion methods. Based on these findings, current speculation about the circumstances in which multi-spectral image fusion in general and specific fusion methods in particular would be superior to using the original image sources can be further addressed.
Two heretical thoughts on fusion and climate
NASA Astrophysics Data System (ADS)
Manheimer, Wallace
2016-10-01
This presents and explores 2 heretical thoughts regarding controlled fusion and climate. First, the only way that fusion can contribute to midcentury power is by switching its goal from pure fusion, to fusion breeding. Fusion breeding makes many fewer demands on the fusion device than does pure fusion. Fusion breeding could lead to a sustainable, carbon free, environmentally and economically viable, midcentury infrastructure, with little or no proliferation risk, which could provide terawatts of power for the world. The second involves climate. We are all inundated by media warnings, not only of warming from CO2 in the atmosphere, but all sorts of other environmental disasters. For instance there will be more intense storms, rising sea levels, wild fires, retreating glaciers, droughts, loss of agricultural productivity... These assertions are very easy to check out. Such a search shows that we are nowhere near any sort of environmental crisis. The timing could be serendipitous; the time necessary to develop fusion breeding could well match up to the time when it is needed so as to avoid harm to the earth's climate and/or depletion of finite energy resources.
Spherical torus fusion reactor
Martin Peng, Y.K.M.
1985-10-03
The object of this invention is to provide a compact torus fusion reactor with dramatic simplification of plasma confinement design. Another object of this invention is to provide a compact torus fusion reactor with low magnetic field and small aspect ratio stable plasma confinement. In accordance with the principles of this invention there is provided a compact toroidal-type plasma confinement fusion reactor in which only the indispensable components inboard of a tokamak type of plasma confinement region, mainly a current conducting medium which carries electrical current for producing a toroidal magnet confinement field about the toroidal plasma region, are retained.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kelsey, D.R.; Flanagan, T.D.; Young, J.E.
1991-06-01
Hydrophobic di- and tripeptides which are capable of inhibiting enveloped virus infection of cells are also capable of inhibiting at least three different types of membrane fusion events. Large unilamellar vesicles (LUV) of N-methyl dioleoylphosphatidylethanolamine (N-methyl DOPE), containing encapsulated 1-aminonaphthalene-3,6,8-trisulfonic acid (ANTS) and/or p-xylene bis(pyridinium bromide) (DPX), were formed by extrusion. Vesicle fusion and leakage were then monitored with the ANTS/DPX fluorescence assay. Sendai virus fusion with lipid vesicles and Sendai virus fusion with human erythrocyte membranes were measured by following the relief of fluorescence quenching of virus labeled with octadecylrhodamine B chloride (R18). This study found that the effectivenessmore » of the peptides carbobenzoxy-L-Phe-L-Phe (Z-L-Phe-L-Phe), Z-L-Phe, Z-D-Phe, and Z-Gly-L-Phe-L-Phe in inhibiting N-methyl DOPE LUV fusion or fusion of virus with N-methyl DOPE LUV also paralleled their reported ability to block viral infectivity. Furthermore, Z-D-Phe-L-PheGly and Z-Gly-L-Phe inhibited Sendai virus fusion with human erythrocyte membranes with the same relative potency with which they inhibited vesicle-vesicle and virus-vesicle fusion. The evidence suggests a mechanism by which these peptides exert their inhibition of plaque formation by enveloped viruses. This class of inhibitors apparently acts by inhibiting fusion of the viral envelope with the target cell membrane, thereby preventing viral infection. The physical pathway by which these peptides inhibit membrane fusion was investigated. {sup 31}P nuclear magnetic resonance (NMR) of proposed intermediates in the pathway for membrane fusion in LUV revealed that the potent fusion inhibitor Z-D-Phe-L-PheGly selectively altered the structure (or dynamics) of the hypothesized fusion intermediates and that the poor inhibitor Z-Gly-L-Phe did not.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ge Shimei; Xie Baoen; Chen Sanfeng
2006-03-10
The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not existmore » in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.« less
Fusion Propulsion Z-Pinch Engine Concept
NASA Technical Reports Server (NTRS)
Miernik, J.; Statham, G.; Fabisinski, L.; Maples, C. D.; Adams, R.; Polsgrove, T.; Fincher, S.; Cassibry, J.; Cortez, R.; Turner, M.;
2011-01-01
Fusion-based nuclear propulsion has the potential to enable fast interplanetary transportation. Due to the great distances between the planets of our solar system and the harmful radiation environment of interplanetary space, high specific impulse (Isp) propulsion in vehicles with high payload mass fractions must be developed to provide practical and safe vehicles for human spaceflight missions. The Z-Pinch dense plasma focus method is a Magneto-Inertial Fusion (MIF) approach that may potentially lead to a small, low cost fusion reactor/engine assembly1. Recent advancements in experimental and theoretical understanding of this concept suggest favorable scaling of fusion power output yield 2. The magnetic field resulting from the large current compresses the plasma to fusion conditions, and this process can be pulsed over short timescales (10(exp -6 sec). This type of plasma formation is widely used in the field of Nuclear Weapons Effects testing in the defense industry, as well as in fusion energy research. A Decade Module 2 (DM2), approx.500 KJ pulsed-power is coming to the RSA Aerophysics Lab managed by UAHuntsville in January, 2012. A Z-Pinch propulsion concept was designed for a vehicle based on a previous fusion vehicle study called "Human Outer Planet Exploration" (HOPE), which used Magnetized Target Fusion (MTF) 3 propulsion. The reference mission is the transport of crew and cargo to Mars and back, with a reusable vehicle.
Novel kinase fusion transcripts found in endometrial cancer
Tamura, Ryo; Yoshihara, Kosuke; Yamawaki, Kaoru; Suda, Kazuaki; Ishiguro, Tatsuya; Adachi, Sosuke; Okuda, Shujiro; Inoue, Ituro; Verhaak, Roel G. W.; Enomoto, Takayuki
2015-01-01
Recent advances in RNA-sequencing technology have enabled the discovery of gene fusion transcripts in the transcriptome of cancer cells. However, it remains difficult to differentiate the therapeutically targetable fusions from passenger events. We have analyzed RNA-sequencing data and DNA copy number data from 25 endometrial cancer cell lines to identify potential therapeutically targetable fusion transcripts, and have identified 124 high-confidence fusion transcripts, of which 69% are associated with gene amplifications. As targetable fusion candidates, we focused on three in-frame kinase fusion transcripts that retain a kinase domain (CPQ-PRKDC, CAPZA2-MET, and VGLL4-PRKG1). We detected only CPQ-PRKDC fusion transcript in three of 122 primary endometrial cancer tissues. Cell proliferation of the fusion-positive cell line was inhibited by knocking down the expression of wild-type PRKDC but not by blocking the CPQ-PRKDC fusion transcript expression. Quantitative real-time RT-PCR demonstrated that the expression of the CPQ-PRKDC fusion transcript was significantly lower than that of wild-type PRKDC, corresponding to a low transcript allele fraction of this fusion, based on RNA-sequencing read counts. In endometrial cancers, the CPQ-PRKDC fusion transcript may be a passenger aberration related to gene amplification. Our findings suggest that transcript allele fraction is a useful predictor to find bona-fide therapeutic-targetable fusion transcripts. PMID:26689674
Novel kinase fusion transcripts found in endometrial cancer.
Tamura, Ryo; Yoshihara, Kosuke; Yamawaki, Kaoru; Suda, Kazuaki; Ishiguro, Tatsuya; Adachi, Sosuke; Okuda, Shujiro; Inoue, Ituro; Verhaak, Roel G W; Enomoto, Takayuki
2015-12-22
Recent advances in RNA-sequencing technology have enabled the discovery of gene fusion transcripts in the transcriptome of cancer cells. However, it remains difficult to differentiate the therapeutically targetable fusions from passenger events. We have analyzed RNA-sequencing data and DNA copy number data from 25 endometrial cancer cell lines to identify potential therapeutically targetable fusion transcripts, and have identified 124 high-confidence fusion transcripts, of which 69% are associated with gene amplifications. As targetable fusion candidates, we focused on three in-frame kinase fusion transcripts that retain a kinase domain (CPQ-PRKDC, CAPZA2-MET, and VGLL4-PRKG1). We detected only CPQ-PRKDC fusion transcript in three of 122 primary endometrial cancer tissues. Cell proliferation of the fusion-positive cell line was inhibited by knocking down the expression of wild-type PRKDC but not by blocking the CPQ-PRKDC fusion transcript expression. Quantitative real-time RT-PCR demonstrated that the expression of the CPQ-PRKDC fusion transcript was significantly lower than that of wild-type PRKDC, corresponding to a low transcript allele fraction of this fusion, based on RNA-sequencing read counts. In endometrial cancers, the CPQ-PRKDC fusion transcript may be a passenger aberration related to gene amplification. Our findings suggest that transcript allele fraction is a useful predictor to find bona-fide therapeutic-targetable fusion transcripts.
Abulizi, Yakefu; Liang, Wei-Dong; Muheremu, Aikeremujiang; Maimaiti, Maierdan; Sheng, Wei-Bin
2017-07-14
Spinal brucellosis is a less commonly reported infectious spinal pathology. There are few reports regarding the surgical treatment of spinal brucellosis in existing literature. This retrospective study was conducted to determine the effectiveness of single-stage transforaminal decompression, debridement, interbody fusion, and posterior instrumentation for lumbosacral spinal brucellosis. From February 2012 to April 2015, 32 consecutive patients (19 males and 13 females, mean age 53.7 ± 8.7) with lumbosacral brucellosis treated by transforaminal decompression, debridement, interbody fusion, and posterior instrumentation were enrolled. Medical records, imaging studies, laboratory data were collected and summarized. Surgical outcomes were evaluated based on visual analogue scale (VAS), Oswestry Disability Index (ODI) and Japanese Orthopaedic Association (JOA) scale. The changes in C-reactive protein (CRP) levels, erythrocyte sedimentation rate (ESR), clinical symptoms and complications were investigated. Graft fusion was evaluated using Bridwell grading criteria. The mean follow-up period was 24.9 ± 8.2 months. Back pain and radiating leg pain was relieved significantly in all patients after operation. No implant failures were observed in any patients. Wound infection was observed in two patients and sinus formation was observed in one patient. Solid bony fusion was achieved in 30 patients and the fusion rate was 93.8%. The levels of ESR and CRP were returned to normal by the end of three months' follow-up. VAS and ODI scores were significantly improved (P < 0.05). According to JOA score, surgical improvement was excellent in 22 cases (68.8%), good in 9 cases (28.1%), moderate in 1 case (3.1%) at the last follow-up. Single-stage transforaminal decompression, debridement, interbody fusion, and posterior instrumentation is an effective and safe approach for lumbosacral brucellosis.
A local approach for focussed Bayesian fusion
NASA Astrophysics Data System (ADS)
Sander, Jennifer; Heizmann, Michael; Goussev, Igor; Beyerer, Jürgen
2009-04-01
Local Bayesian fusion approaches aim to reduce high storage and computational costs of Bayesian fusion which is separated from fixed modeling assumptions. Using the small world formalism, we argue why this proceeding is conform with Bayesian theory. Then, we concentrate on the realization of local Bayesian fusion by focussing the fusion process solely on local regions that are task relevant with a high probability. The resulting local models correspond then to restricted versions of the original one. In a previous publication, we used bounds for the probability of misleading evidence to show the validity of the pre-evaluation of task specific knowledge and prior information which we perform to build local models. In this paper, we prove the validity of this proceeding using information theoretic arguments. For additional efficiency, local Bayesian fusion can be realized in a distributed manner. Here, several local Bayesian fusion tasks are evaluated and unified after the actual fusion process. For the practical realization of distributed local Bayesian fusion, software agents are predestinated. There is a natural analogy between the resulting agent based architecture and criminal investigations in real life. We show how this analogy can be used to improve the efficiency of distributed local Bayesian fusion additionally. Using a landscape model, we present an experimental study of distributed local Bayesian fusion in the field of reconnaissance, which highlights its high potential.
Fusomorphogenesis: cell fusion in organ formation.
Shemer, G; Podbilewicz, B
2000-05-01
Cell fusion is a universal process that occurs during fertilization and in the formation of organs such as muscles, placenta, and bones. Very little is known about the molecular and cellular mechanisms of cell fusion during pattern formation. Here we review the dynamic anatomy of all cell fusions during embryonic and postembryonic development in an organism. Nearly all the cell fates and cell lineages are invariant in the nematode C. elegans and one third of the cells that are born fuse to form 44 syncytia in a reproducible and stereotyped way. To explain the function of cell fusion in organ formation we propose the fusomorphogenetic model as a simple cellular mechanism to efficiently redistribute membranes using a combination of cell fusion and polarized membrane recycling during morphogenesis. Thus, regulated intercellular and intracellular membrane fusion processes may drive elongation of the embryo as well as postembryonic organ formation in C. elegans. Finally, we use the fusomorphogenetic hypothesis to explain the role of cell fusion in the formation of organs like muscles, bones, and placenta in mammals and other species and to speculate on how the intracellular machinery that drive fusomorphogenesis may have evolved.
URREF Reliability Versus Credibility in Information Fusion
2013-07-01
Fusion, Vol. 3, No. 2, December, 2008. [31] E. Blasch, J. Dezert, and P. Valin , “DSMT Applied to Seismic and Acoustic Sensor Fusion,” Proc. IEEE Nat...44] E. Blasch, P. Valin , E. Bossé, “Measures of Effectiveness for High- Level Fusion,” Int. Conference on Information Fusion, 2010. [45] X. Mei, H...and P. Valin , “Information Fusion Measures of Effectiveness (MOE) for Decision Support,” Proc. SPIE 8050, 2011. [49] Y. Zheng, W. Dong, and E
Adjacent-level arthroplasty following cervical fusion.
Rajakumar, Deshpande V; Hari, Akshay; Krishna, Murali; Konar, Subhas; Sharma, Ankit
2017-02-01
OBJECTIVE Adjacent-level disc degeneration following cervical fusion has been well reported. This condition poses a major treatment dilemma when it becomes symptomatic. The potential application of cervical arthroplasty to preserve motion in the affected segment is not well documented, with few studies in the literature. The authors present their initial experience of analyzing clinical and radiological results in such patients who were treated with arthroplasty for new or persistent arm and/or neck symptoms related to neural compression due to adjacent-segment disease after anterior cervical discectomy and fusion (ACDF). METHODS During a 5-year period, 11 patients who had undergone ACDF anterior cervical discectomy and fusion (ACDF) and subsequently developed recurrent neck or arm pain related to adjacent-level cervical disc disease were treated with cervical arthroplasty at the authors' institution. A total of 15 devices were implanted (range of treated levels per patient: 1-3). Clinical evaluation was performed both before and after surgery, using a visual analog scale (VAS) for pain and the Neck Disability Index (NDI). Radiological outcomes were analyzed using pre- and postoperative flexion/extension lateral radiographs measuring Cobb angle (overall C2-7 sagittal alignment), functional spinal unit (FSU) angle, and range of motion (ROM). RESULTS There were no major perioperative complications or device-related failures. Statistically significant results, obtained in all cases, were reflected by an improvement in VAS scores for neck/arm pain and NDI scores for neck pain. Radiologically, statistically significant increases in the overall lordosis (as measured by Cobb angle) and ROM at the treated disc level were observed. Three patients were lost to follow-up within the first year after arthroplasty. In the remaining 8 cases, the duration of follow-up ranged from 1 to 3 years. None of these 8 patients required surgery for the same vertebral level during the follow
Fusion Stage of HIV-1 Entry Depends on Virus-Induced Cell Surface Exposure of Phosphatidylserine.
Zaitseva, Elena; Zaitsev, Eugene; Melikov, Kamran; Arakelyan, Anush; Marin, Mariana; Villasmil, Rafael; Margolis, Leonid B; Melikyan, Gregory B; Chernomordik, Leonid V
2017-07-12
HIV-1 entry into host cells starts with interactions between the viral envelope glycoprotein (Env) and cellular CD4 receptors and coreceptors. Previous work has suggested that efficient HIV entry also depends on intracellular signaling, but this remains controversial. Here we report that formation of the pre-fusion Env-CD4-coreceptor complexes triggers non-apoptotic cell surface exposure of the membrane lipid phosphatidylserine (PS). HIV-1-induced PS redistribution depends on Ca 2+ signaling triggered by Env-coreceptor interactions and involves the lipid scramblase TMEM16F. Externalized PS strongly promotes Env-mediated membrane fusion and HIV-1 infection. Blocking externalized PS or suppressing TMEM16F inhibited Env-mediated fusion. Exogenously added PS promoted fusion, with fusion dependence on PS being especially strong for cells with low surface density of coreceptors. These findings suggest that cell-surface PS acts as an important cofactor that promotes the fusogenic restructuring of pre-fusion complexes and likely focuses the infection on cells conducive to PS signaling. Published by Elsevier Inc.
Accelerators for Fusion Materials Testing
NASA Astrophysics Data System (ADS)
Knaster, Juan; Okumura, Yoshikazu
Fusion materials research is a worldwide endeavor as old as the parallel one working toward the long term stable confinement of ignited plasma. In a fusion reactor, the preservation of the required minimum thermomechanical properties of the in-vessel components exposed to the severe irradiation and heat flux conditions is an indispensable factor for safe operation; it is also an essential goal for the economic viability of fusion. Energy from fusion power will be extracted from the 14 MeV neutron freed as a product of the deuterium-tritium fusion reactions; thus, this kinetic energy must be absorbed and efficiently evacuated and electricity eventually generated by the conventional methods of a thermal power plant. Worldwide technological efforts to understand the degradation of materials exposed to 14 MeV neutron fluxes >1018 m-2s-1, as expected in future fusion power plants, have been intense over the last four decades. Existing neutron sources can reach suitable dpa (“displacement-per-atom”, the figure of merit to assess materials degradation from being exposed to neutron irradiation), but the differences in the neutron spectrum of fission reactors and spallation sources do not allow one to unravel the physics and to anticipate the degradation of materials exposed to fusion neutrons. Fusion irradiation conditions can be achieved through Li (d, xn) nuclear reactions with suitable deuteron beam current and energy, and an adequate flowing lithium screen. This idea triggered in the late 1970s at Los Alamos National Laboratory (LANL) a campaign working toward the feasibility of continuous wave (CW) high current linacs framed by the Fusion Materials Irradiation Test (FMIT) project. These efforts continued with the Low Energy Demonstrating Accelerator (LEDA) (a validating prototype of the canceled Accelerator Production of Tritium (APT) project), which was proposed in 2002 to the fusion community as a 6.7MeV, 100mA CW beam injector for a Li (d, xn) source to bridge
Accelerators for Fusion Materials Testing
NASA Astrophysics Data System (ADS)
Knaster, Juan; Okumura, Yoshikazu
Fusion materials research is a worldwide endeavor as old as the parallel one working toward the long term stable confinement of ignited plasma. In a fusion reactor, the preservation of the required minimum thermomechanical properties of the in-vessel components exposed to the severe irradiation and heat flux conditions is an indispensable factor for safe operation; it is also an essential goal for the economic viability of fusion. Energy from fusion power will be extracted from the 14 MeV neutron freed as a product of the deuterium-tritium fusion reactions; thus, this kinetic energy must be absorbed and efficiently evacuated and electricity eventually generated by the conventional methods of a thermal power plant. Worldwide technological efforts to understand the degradation of materials exposed to 14 MeV neutron fluxes > 1018 m-2s-1, as expected in future fusion power plants, have been intense over the last four decades. Existing neutron sources can reach suitable dpa ("displacement-per-atom", the figure of merit to assess materials degradation from being exposed to neutron irradiation), but the differences in the neutron spectrum of fission reactors and spallation sources do not allow one to unravel the physics and to anticipate the degradation of materials exposed to fusion neutrons. Fusion irradiation conditions can be achieved through Li (d, xn) nuclear reactions with suitable deuteron beam current and energy, and an adequate flowing lithium screen. This idea triggered in the late 1970s at Los Alamos National Laboratory (LANL) a campaign working toward the feasibility of continuous wave (CW) high current linacs framed by the Fusion Materials Irradiation Test (FMIT) project. These efforts continued with the Low Energy Demonstrating Accelerator (LEDA) (a validating prototype of the canceled Accelerator Production of Tritium (APT) project), which was proposed in 2002 to the fusion community as a 6.7MeV, 100mA CW beam injector for a Li (d, xn) source to bridge
Sensor fusion for synthetic vision
NASA Technical Reports Server (NTRS)
Pavel, M.; Larimer, J.; Ahumada, A.
1991-01-01
Display methodologies are explored for fusing images gathered by millimeter wave sensors with images rendered from an on-board terrain data base to facilitate visually guided flight and ground operations in low visibility conditions. An approach to fusion based on multiresolution image representation and processing is described which facilitates fusion of images differing in resolution within and between images. To investigate possible fusion methods, a workstation-based simulation environment is being developed.
Data Fusion for Enhanced Aircraft Engine Prognostics and Health Management
NASA Technical Reports Server (NTRS)
Volponi, Al
2005-01-01
Aircraft gas-turbine engine data is available from a variety of sources, including on-board sensor measurements, maintenance histories, and component models. An ultimate goal of Propulsion Health Management (PHM) is to maximize the amount of meaningful information that can be extracted from disparate data sources to obtain comprehensive diagnostic and prognostic knowledge regarding the health of the engine. Data fusion is the integration of data or information from multiple sources for the achievement of improved accuracy and more specific inferences than can be obtained from the use of a single sensor alone. The basic tenet underlying the data/ information fusion concept is to leverage all available information to enhance diagnostic visibility, increase diagnostic reliability and reduce the number of diagnostic false alarms. This report describes a basic PHM data fusion architecture being developed in alignment with the NASA C-17 PHM Flight Test program. The challenge of how to maximize the meaningful information extracted from disparate data sources to obtain enhanced diagnostic and prognostic information regarding the health and condition of the engine is the primary goal of this endeavor. To address this challenge, NASA Glenn Research Center, NASA Dryden Flight Research Center, and Pratt & Whitney have formed a team with several small innovative technology companies to plan and conduct a research project in the area of data fusion, as it applies to PHM. Methodologies being developed and evaluated have been drawn from a wide range of areas including artificial intelligence, pattern recognition, statistical estimation, and fuzzy logic. This report will provide a chronology and summary of the work accomplished under this research contract.
A defect in myoblast fusion underlies Carey-Fineman-Ziter syndrome
Di Gioia, Silvio Alessandro; Connors, Samantha; Matsunami, Norisada; Cannavino, Jessica; Rose, Matthew F.; Gilette, Nicole M.; Artoni, Pietro; de Macena Sobreira, Nara Lygia; Chan, Wai-Man; Webb, Bryn D.; Robson, Caroline D.; Cheng, Long; Van Ryzin, Carol; Ramirez-Martinez, Andres; Mohassel, Payam; Leppert, Mark; Scholand, Mary Beth; Grunseich, Christopher; Ferreira, Carlos R.; Hartman, Tyler; Hayes, Ian M.; Morgan, Tim; Markie, David M.; Fagiolini, Michela; Swift, Amy; Chines, Peter S.; Speck-Martins, Carlos E.; Collins, Francis S.; Jabs, Ethylin Wang; Bönnemann, Carsten G.; Olson, Eric N.; Andrews, Caroline V.; Barry, Brenda J.; Hunter, David G.; Mackinnon, Sarah E.; Shaaban, Sherin; Erazo, Monica; Frempong, Tamiesha; Hao, Ke; Naidich, Thomas P.; Rucker, Janet C.; Zhang, Zhongyang; Biesecker, Barbara B.; Bonnycastle, Lori L.; Brewer, Carmen C.; Brooks, Brian P.; Butman, John A.; Chien, Wade W.; Farrell, Kathleen; FitzGibbon, Edmond J.; Gropman, Andrea L.; Hutchinson, Elizabeth B.; Jain, Minal S.; King, Kelly A.; Lehky, Tanya J.; Lee, Janice; Liberton, Denise K.; Narisu, Narisu; Paul, Scott M.; Sadeghi, Neda; Snow, Joseph; Solomon, Beth; Summers, Angela; Toro, Camilo; Thurm, Audrey; Zalewski, Christopher K.; Carey, John C.; Robertson, Stephen P.; Manoli, Irini; Engle, Elizabeth C.
2017-01-01
Multinucleate cellular syncytial formation is a hallmark of skeletal muscle differentiation. Myomaker, encoded by Mymk (Tmem8c), is a well-conserved plasma membrane protein required for myoblast fusion to form multinucleated myotubes in mouse, chick, and zebrafish. Here, we report that autosomal recessive mutations in MYMK (OMIM 615345) cause Carey-Fineman-Ziter syndrome in humans (CFZS; OMIM 254940) by reducing but not eliminating MYMK function. We characterize MYMK-CFZS as a congenital myopathy with marked facial weakness and additional clinical and pathologic features that distinguish it from other congenital neuromuscular syndromes. We show that a heterologous cell fusion assay in vitro and allelic complementation experiments in mymk knockdown and mymkinsT/insT zebrafish in vivo can differentiate between MYMK wild type, hypomorphic and null alleles. Collectively, these data establish that MYMK activity is necessary for normal muscle development and maintenance in humans, and expand the spectrum of congenital myopathies to include cell-cell fusion deficits. PMID:28681861
A defect in myoblast fusion underlies Carey-Fineman-Ziter syndrome.
Di Gioia, Silvio Alessandro; Connors, Samantha; Matsunami, Norisada; Cannavino, Jessica; Rose, Matthew F; Gilette, Nicole M; Artoni, Pietro; de Macena Sobreira, Nara Lygia; Chan, Wai-Man; Webb, Bryn D; Robson, Caroline D; Cheng, Long; Van Ryzin, Carol; Ramirez-Martinez, Andres; Mohassel, Payam; Leppert, Mark; Scholand, Mary Beth; Grunseich, Christopher; Ferreira, Carlos R; Hartman, Tyler; Hayes, Ian M; Morgan, Tim; Markie, David M; Fagiolini, Michela; Swift, Amy; Chines, Peter S; Speck-Martins, Carlos E; Collins, Francis S; Jabs, Ethylin Wang; Bönnemann, Carsten G; Olson, Eric N; Carey, John C; Robertson, Stephen P; Manoli, Irini; Engle, Elizabeth C
2017-07-06
Multinucleate cellular syncytial formation is a hallmark of skeletal muscle differentiation. Myomaker, encoded by Mymk (Tmem8c), is a well-conserved plasma membrane protein required for myoblast fusion to form multinucleated myotubes in mouse, chick, and zebrafish. Here, we report that autosomal recessive mutations in MYMK (OMIM 615345) cause Carey-Fineman-Ziter syndrome in humans (CFZS; OMIM 254940) by reducing but not eliminating MYMK function. We characterize MYMK-CFZS as a congenital myopathy with marked facial weakness and additional clinical and pathologic features that distinguish it from other congenital neuromuscular syndromes. We show that a heterologous cell fusion assay in vitro and allelic complementation experiments in mymk knockdown and mymk insT/insT zebrafish in vivo can differentiate between MYMK wild type, hypomorphic and null alleles. Collectively, these data establish that MYMK activity is necessary for normal muscle development and maintenance in humans, and expand the spectrum of congenital myopathies to include cell-cell fusion deficits.
Pons, Tracey; Shipton, Edward A
2011-04-01
There are no comparative randomised controlled trials of physiotherapy modalities for chronic low back and radicular pain associated with multilevel fusion. Physiotherapy-based rehabilitation to control pain and improve activation levels for persistent pain following multilevel fusion can be challenging. This is a case report of a 68-year-old man who was referred for physiotherapy intervention 10 months after a multilevel spinal fusion for spinal stenosis. He reported high levels of persistent postoperative pain with minimal activity as a consequence of his pain following the surgery. The physiotherapy interventions consisted of three phases of rehabilitation starting with pool exercise that progressed to land-based walking. These were all combined with transcutaneous electrical nerve stimulation (TENS) that was used consistently for up to 8 hours per day. As outcome measures, daily pain levels and walking distances were charted once the pool programme was completed (in the third phase). Phase progression was determined by shuttle test results. The pain level was correlated with the distance walked using linear regression over a 5-day average. Over a 5-day moving average, the pain level reduced and walking distance increased. The chart of recorded pain level and walking distance showed a trend toward decreased pain with the increased distance walked. In a patient undergoing multilevel lumbar fusion, the combined use of TENS and a progressive walking programme (from pool to land) reduced pain and increased walking distance. This improvement was despite poor medication compliance and a reported high level of postsurgical pain.
Magnetized Target Fusion in Advanced Propulsion Research
NASA Technical Reports Server (NTRS)
Cylar, Rashad
2003-01-01
The Magnetized Target Fusion (MTF) Propulsion lab at NASA Marshall Space Flight Center in Huntsville, Alabama has a program in place that has adopted to attempt to create a faster, lower cost and more reliable deep space transportation system. In this deep space travel the physics and development of high velocity plasma jets must be understood. The MTF Propulsion lab is also in attempt to open up the solar system for human exploration and commercial use. Fusion, as compared to fission, is just the opposite. Fusion involves the light atomic nuclei combination to produce denser nuclei. In the process, the energy is created by destroying the mass according to the distinguished equation: E = mc2 . Fusion energy development is being pursued worldwide as a very sustainable form of energy that is environmentally friendly. For the purposes of space exploration fusion reactions considered include the isotopes of hydrogen-deuterium (D2) and tritium (T3). Nuclei have an electrostatic repulsion between them and in order for the nuclei to fuse this repulsion must be overcome. One technique to bypass repulsion is to heat the nuclei to very high temperatures. The temperatures vary according to the type of reactions. For D-D reactions, one billion degrees Celsius is required, and for D-T reactions, one hundred million degrees is sufficient. There has to be energy input for useful output to be obtained form the fusion To make fusion propulsion practical, the mass, the volume, and the cost of the equipment to produce the reactions (generally called the reactor) need to be reduced by an order of magnitude or two from the state-of-the-art fusion machines. Innovations in fusion schemes are therefore required, especially for obtaining thrust for propulsive applications. Magnetized target fusion (MTF) is one of the innovative fusion concepts that have emerged over the last several years. MSFC is working with Los Alamos National Laboratory and other research groups in studying the
2013-01-01
Background Biologically active inclusion bodies (IBs) have gained much attention in recent years. Fusion with IB-inducing partner has been shown to be an efficient strategy for generating active IBs. To make full use of the advantages of active IBs, one of the key issues will be to improve the activity yield of IBs when expressed in cells, which would need more choices on IB-inducing fusion partners and approaches for engineering IBs. Green fluorescent protein (GFP) has been reported to aggregate when overexpressed, but GFP fusion has not been considered as an IB-inducing approach for these fusion proteins so far. In addition, the role of linker in fusion proteins has been shown to be important for protein characteristics, yet impact of linker on active IBs has never been reported. Results Here we report that by fusing GFP and acid phosphatase PhoC via a linker region, the resultant PhoC-GFPs were expressed largely as IBs. These IBs show high levels of specific fluorescence and specific PhoC activities (phosphatase and phosphotransferase), and can account for up to over 80% of the total PhoC activities in the cells. We further demonstrated that the aggregation of GFP moiety in the fusion protein plays an essential role in the formation of PhoC-GFP IBs. In addition, PhoC-GFP IBs with linkers of different flexibility were found to exhibit different levels of activities and ratios in the cells, suggesting that the linker region can be utilized to manipulate the characteristics of active IBs. Conclusions Our results show that active IBs of PhoC can be generated by GFP fusion, demonstrating for the first time the potential of GFP fusion to induce active IB formation of another soluble protein. We also show that the linker sequence in PhoC-GFP fusion proteins plays an important role on the regulation of IB characteristics, providing an alternative and important approach for engineering of active IBs with the goal of obtaining high activity yield of IBs. PMID:23497261
Paramyxovirus Glycoproteins and the Membrane Fusion Process.
Aguilar, Hector C; Henderson, Bryce A; Zamora, J Lizbeth; Johnston, Gunner P
2016-09-01
The family Paramyxoviridae includes many viruses that significantly affect human and animal health. An essential step in the paramyxovirus life cycle is viral entry into host cells, mediated by virus-cell membrane fusion. Upon viral entry, infection results in expression of the paramyxoviral glycoproteins on the infected cell surface. This can lead to cell-cell fusion (syncytia formation), often linked to pathogenesis. Thus membrane fusion is essential for both viral entry and cell-cell fusion and an attractive target for therapeutic development. While there are important differences between viral-cell and cell-cell membrane fusion, many aspects are conserved. The paramyxoviruses generally utilize two envelope glycoproteins to orchestrate membrane fusion. Here, we discuss the roles of these glycoproteins in distinct steps of the membrane fusion process. These findings can offer insights into evolutionary relationships among Paramyxoviridae genera and offer future targets for prophylactic and therapeutic development.
Paramyxovirus Glycoproteins and the Membrane Fusion Process
Aguilar, Hector C.; Henderson, Bryce A.; Zamora, J. Lizbeth; Johnston, Gunner P.
2016-01-01
The family Paramyxoviridae includes many viruses that significantly affect human and animal health. An essential step in the paramyxovirus life cycle is viral entry into host cells, mediated by virus-cell membrane fusion. Upon viral entry, infection results in expression of the paramyxoviral glycoproteins on the infected cell surface. This can lead to cell-cell fusion (syncytia formation), often linked to pathogenesis. Thus membrane fusion is essential for both viral entry and cell-cell fusion and an attractive target for therapeutic development. While there are important differences between viral-cell and cell-cell membrane fusion, many aspects are conserved. The paramyxoviruses generally utilize two envelope glycoproteins to orchestrate membrane fusion. Here, we discuss the roles of these glycoproteins in distinct steps of the membrane fusion process. These findings can offer insights into evolutionary relationships among Paramyxoviridae genera and offer future targets for prophylactic and therapeutic development. PMID:28138419
ERIC Educational Resources Information Center
Greco, Laurie A.; Lambert, Warren; Baer, Ruth A.
2008-01-01
The authors describe the development and validation of the Avoidance and Fusion Questionnaire for Youth (AFQ-Y), a child-report measure of psychological inflexibility engendered by high levels of cognitive fusion and experiential avoidance. Consistent with the theory underlying acceptance and commitment therapy (ACT), items converged into a…
ERIC Educational Resources Information Center
Lo, Mun Ling; Chik, Pakey Pui Man
2016-01-01
In this paper, we aim to differentiate the internal and external horizons of "fusion." "Fusion" in the internal horizon relates to the structure and meaning of the object of learning as experienced by the learner. It clarifies the interrelationships among an object's critical features and aspects. It also illuminates the…
DOE Office of Scientific and Technical Information (OSTI.GOV)
Song, Kai; The State Key Laboratory Breeding Base of Basic Science of Stomatology; Song, Yong
Most previous studies have linked cancer–macrophage fusion with tumor progression and metastasis. However, the characteristics of hybrid cells derived from oral cancer and endothelial cells and their involvement in cancer remained unknown. Double-immunofluorescent staining and fluorescent in situ hybridization (FISH) were performed to confirm spontaneous cell fusion between eGFP-labeled human umbilical vein endothelial cells (HUVECs) and RFP-labeled SCC9, and to detect the expression of vementin and cytokeratin 18 in the hybrids. The property of chemo-resistance of such hybrids was examined by TUNEL assay. The hybrid cells in xenografted tumor were identified by FISH and GFP/RFP dual-immunofluoresence staining. We showed thatmore » SCC9 cells spontaneously fused with cocultured endothelial cells, and the resultant hybrid cells maintained the division and proliferation activity after re-plating and thawing. Such hybrids expressed markers of both parental cells and became more resistant to chemotherapeutic drug cisplatin as compared to the parental SCC9 cells. Our in vivo data indicated that the hybrid cells contributed to tumor composition by using of immunostaining and FISH analysis, even though the hybrid cells and SCC9 cells were mixed with 1:10,000, according to the FACS data. Our study suggested that the fusion events between oral cancer and endothelial cells undergo nuclear fusion and acquire a new property of drug resistance and consequently enhanced survival potential. These experimental findings provide further supportive evidence for the theory that cell fusion is involved in cancer progression. - Highlights: • The fusion events between oral cancer and endothelial cells undergo nuclear fusion. • The resulting hybrid cells acquire a new property of drug resistance. • The resulting hybrid cells express the markers of both parental cells (i.e. vimentin and cytokeratin 18). • The hybrid cells contribute to tumor repopulation in vivo.« less
Assessment of NDE Methods to Detect Lack of Fusion in HDPE Butt Fusion Joints
DOE Office of Scientific and Technical Information (OSTI.GOV)
Crawford, Susan L.; Doctor, Steven R.; Cinson, Anthony D.
2011-07-31
Studies at the Pacific Northwest National Laboratory (PNNL) in Richland, Washington, were conducted to evaluate nondestructive examinations (NDE) coupled with mechanical testing of butt fusion joints in high-density polyethylene (HDPE) pipe for assessing lack of fusion. The work provided information to the United States Nuclear Regulatory Commission (NRC) on the effectiveness of volumetric inspection techniques of HDPE butt fusion joints in Section III, Division 1, Class 3, buried piping systems in nuclear power plants. This paper describes results from assessments using ultrasonic and microwave nondestructive techniques and mechanical testing with the high-speed tensile impact test and the side-bend test formore » determining joint integrity. A series of butt joints were fabricated in 3408, 12-inch (30.5-cm) IPS DR-11 HDPE material by varying the fusion parameters to create good joints and joints containing a range of lack-of-fusion conditions. Six of these butt joints were volumetrically examined with time-of-flight diffraction (TOFD), phased-array (PA) ultrasound, and the Evisive microwave system. The outer diameter (OD) weld beads were removed for microwave evaluation and the pipes ultrasonically re-evaluated. In two of the six pipes, both the outer and inner diameter (ID) weld beads were removed and the pipe joints re-evaluated. Some of the pipes were sectioned and the joints destructively evaluated with the high-speed tensile test and the side-bend test. The fusion parameters, nondestructive and destructive evaluation results have been correlated to validate the effectiveness of what each NDE technology detects and what each does not detect. There was no single NDE method that detected all of the lack-of-fusion flaws but a combination of NDE methods did detect most of the flaws.« less
Fusion of Visible and Thermal Descriptors Using Genetic Algorithms for Face Recognition Systems.
Hermosilla, Gabriel; Gallardo, Francisco; Farias, Gonzalo; San Martin, Cesar
2015-07-23
The aim of this article is to present a new face recognition system based on the fusion of visible and thermal features obtained from the most current local matching descriptors by maximizing face recognition rates through the use of genetic algorithms. The article considers a comparison of the performance of the proposed fusion methodology against five current face recognition methods and classic fusion techniques used commonly in the literature. These were selected by considering their performance in face recognition. The five local matching methods and the proposed fusion methodology are evaluated using the standard visible/thermal database, the Equinox database, along with a new database, the PUCV-VTF, designed for visible-thermal studies in face recognition and described for the first time in this work. The latter is created considering visible and thermal image sensors with different real-world conditions, such as variations in illumination, facial expression, pose, occlusion, etc. The main conclusions of this article are that two variants of the proposed fusion methodology surpass current face recognition methods and the classic fusion techniques reported in the literature, attaining recognition rates of over 97% and 99% for the Equinox and PUCV-VTF databases, respectively. The fusion methodology is very robust to illumination and expression changes, as it combines thermal and visible information efficiently by using genetic algorithms, thus allowing it to choose optimal face areas where one spectrum is more representative than the other.
Tritium Breeding Blanket for a Commercial Fusion Power Plant - A System Engineering Assessment
DOE Office of Scientific and Technical Information (OSTI.GOV)
Meier, Wayne R.
The goal of developing a new source of electric power based on fusion has been pursued for decades. If successful, future fusion power plants will help meet growing world-wide demand for electric power. A key feature and selling point for fusion is that its fuel supply is widely distributed globally and virtually inexhaustible. Current world-wide research on fusion energy is focused on the deuterium-tritium (DT for short) fusion reaction since it will be the easiest to achieve in terms of the conditions (e.g., temperature, density and confinement time of the DT fuel) required to produce net energy. Over the pastmore » decades countless studies have examined various concepts for TBBs for both magnetic fusion energy (MFE) and inertial fusion energy (IFE). At this time, the key organizations involved are government sponsored research organizations world-wide. The near-term focus of the MFE community is on the development of TBB mock-ups to be tested on the ITER tokamak currently under construction in Caderache France. TBB concepts for IFE tend to be different from MFE primarily due to significantly different operating conditions and constraints. This report focuses on longer-term commercial power plants where the key stakeholders include: electric utilities, plant owner and operator, manufacturer, regulators, utility customers, and in-plant subsystems including the heat transfer and conversion systems, fuel processing system, plant safety systems, and the monitoring control systems.« less
Fusion of Visible and Thermal Descriptors Using Genetic Algorithms for Face Recognition Systems
Hermosilla, Gabriel; Gallardo, Francisco; Farias, Gonzalo; San Martin, Cesar
2015-01-01
The aim of this article is to present a new face recognition system based on the fusion of visible and thermal features obtained from the most current local matching descriptors by maximizing face recognition rates through the use of genetic algorithms. The article considers a comparison of the performance of the proposed fusion methodology against five current face recognition methods and classic fusion techniques used commonly in the literature. These were selected by considering their performance in face recognition. The five local matching methods and the proposed fusion methodology are evaluated using the standard visible/thermal database, the Equinox database, along with a new database, the PUCV-VTF, designed for visible-thermal studies in face recognition and described for the first time in this work. The latter is created considering visible and thermal image sensors with different real-world conditions, such as variations in illumination, facial expression, pose, occlusion, etc. The main conclusions of this article are that two variants of the proposed fusion methodology surpass current face recognition methods and the classic fusion techniques reported in the literature, attaining recognition rates of over 97% and 99% for the Equinox and PUCV-VTF databases, respectively. The fusion methodology is very robust to illumination and expression changes, as it combines thermal and visible information efficiently by using genetic algorithms, thus allowing it to choose optimal face areas where one spectrum is more representative than the other. PMID:26213932
Akyürek, Elkan G; van Asselt, E Manon
2015-12-01
When two different color stimuli are presented in rapid succession, the resulting percept is sometimes that of a mixture of both colors, due to a perceptual process called color fusion. Although color fusion might seem to occur very early in the visual pathway, and only happens across the briefest of stimulus presentation intervals (< 50 ms), the present study showed that spatial attention can alter the fusion process. In a series of experiments, spatial cues were presented that either validly indicated the location of a pair of (different) color stimuli in successive stimulus arrays, or did not, pointing toward isoluminant gray distractors in the other visual hemifield. Increased color fusion was observed for valid cues across a range of stimulus durations, at the expense of individual color reports. By contrast, perception of repeated, same-color stimulus pairs did not change, suggesting that the enhancement was specific to fusion, not color discrimination per se. Electrophysiological measures furthermore showed that the amplitude of the N1, N2pc, and P3 components of the ERP were differentially modulated during the perception of individual and fused colors, as a function of cueing and stimulus duration. Fusion itself, collapsed across cueing conditions, was reflected uniquely in N1 amplitude. Overall, the results suggest that spatial attention enhances color fusion and decreases competition between stimuli, constituting an adaptive slowdown in service of temporal integration. © 2015 Society for Psychophysiological Research.
Synaptotagmin C2B Domain Regulates Ca2+-triggered Fusion in Vitro
Gaffaney, Jon D.; Dunning, F. Mark; Wang, Zhao; Hui, Enfu; Chapman, Edwin R.
2008-01-01
Synaptotagmin (syt) 1 is localized to synaptic vesicles, binds Ca2+, and regulates neuronal exocytosis. Syt 1 harbors two Ca2+-binding motifs referred to as C2A and C2B. In this study we examine the function of the isolated C2 domains of Syt 1 using a reconstituted, SNARE (soluble N-ethylmaleimide-sensitive factor attachment receptor)-mediated, fusion assay. We report that inclusion of phosphatidylethanolamine into reconstituted SNARE vesicles enabled isolated C2B, but not C2A, to regulate Ca2+-triggered fusion. The isolated C2B domain had a 6-fold lower EC for Ca2+ 50-activated fusion than the intact cytosolic domain of Syt 1 (C2AB). Phosphatidylethanolamine increased both the rate and efficiency of C2AB- and C2B-regulated fusion without affecting their abilities to bind membrane-embedded syntaxin-SNAP-25 (t-SNARE) complexes. At equimolar concentrations, the isolated C2A domain was an effective inhibitor of C2B-, but not C2AB-regulated fusion; hence, C2A has markedly different effects in the fusion assay depending on whether it is tethered to C2B. Finally, scanning alanine mutagenesis of C2AB revealed four distinct groups of mutations within the C2B domain that play roles in the regulation of SNARE-mediated fusion. Surprisingly, substitution of Arg-398 with alanine, which lies on the opposite end of C2B from the Ca2+/membrane-binding loops, decreases C2AB t-SNARE binding and Ca2+-triggered fusion in vitro without affecting Ca2+-triggered interactions with phosphatidylserine or vesicle aggregation. In addition, some mutations uncouple the clamping and stimulatory functions of syt 1, suggesting that these two activities are mediated by distinct structural determinants in C2B. PMID:18784080
Targeting of Cytolytic T-Cells for Breast Cancer Therapy Using Novel-Fusion Proteins
1999-07-01
1 construct was subsequently subcloned into the Pichia pastoris expression plasmid pPICZcxB (Invitrogen) which contains the alcohol oxidase promoter...breast carcinomas, and the extracellular domain of B7.2 (CD86). This fusion protein was expressed and purified from Pichia pastoris, shown to retain...year’s report, the hB7.2/B1 chimeric fusion protein produced in Pichia pastoris, was shown to bind to both recombinant and cell surface tumor marker erbB
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haralalka, Shruti; Abmayr, Susan M., E-mail: sma@stowers.org; Department of Anatomy and Cell Biology, University of Kansas Medical Center, Kansas City, MO 66160
2010-11-01
The body wall musculature of a Drosophila larva is composed of an intricate pattern of 30 segmentally repeated muscle fibers in each abdominal hemisegment. Each muscle fiber has unique spatial and behavioral characteristics that include its location, orientation, epidermal attachment, size and pattern of innervation. Many, if not all, of these properties are dictated by founder cells, which determine the muscle pattern and seed the fusion process. Myofibers are then derived from fusion between a specific founder cell and several fusion competent myoblasts (FCMs) fusing with as few as 3-5 FCMs in the small muscles on the most ventral sidemore » of the embryo and as many as 30 FCMs in the larger muscles on the dorsal side of the embryo. The focus of the present review is the formation of the larval muscles in the developing embryo, summarizing the major issues and players in this process. We have attempted to emphasize experimentally-validated details of the mechanism of myoblast fusion and distinguish these from the theoretically possible details that have not yet been confirmed experimentally. We also direct the interested reader to other recent reviews that discuss myoblast fusion in Drosophila, each with their own perspective on the process . With apologies, we use gene nomenclature as specified by Flybase (http://flybase.org) but provide Table 1 with alternative names and references.« less
NASA Technical Reports Server (NTRS)
Orth, Charles D.; Klein, Gail; Sercel, Joel; Hoffman, Nate; Murray, Kathy; Chang-Diaz, Franklin
1987-01-01
Inertial Confinement Fusion (ICF) is an attractive engine power source for interplanetary manned spacecraft, especially for near-term missions requiring minimum flight duration, because ICF has inherent high power-to-mass ratios and high specific impulses. We have developed a new vehicle concept called VISTA that uses ICF and is capable of round-trip manned missions to Mars in 100 days using A.D. 2020 technology. We describe VISTA's engine operation, discuss associated plasma issues, and describe the advantages of DT fuel for near-term applications. Although ICF is potentially superior to non-fusion technologies for near-term interplanetary transport, the performance capabilities of VISTA cannot be meaningfully compared with those of magnetic-fusion systems because of the lack of a comparable study of the magnetic-fusion systems. We urge that such a study be conducted.
Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.
2013-01-01
β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479
NASA Astrophysics Data System (ADS)
Ngatchou, Annita
2010-01-01
Pheochromocytoma is a tumor of the adrenal gland which originates from chromaffin cells and is characterized by the secretion of excessive amounts of neurotransmitter which lead to high blood pressure and palpitations. Pheochromocytoma contain membrane bound granules that store neurotransmitter. The release of these stored molecules into the extracellular space occurs by fusion of the granule membrane with the cell plasma membrane, a process called exocytosis. The molecular mechanism of this membrane fusion is not well understood. It is proposed that the so called SNARE proteins [1] are the pillar of vesicle fusion as their cleavage by clostridial toxin notably, Botulinum neurotoxin and Tetanus toxin abrogate the secretion of neurotransmitter [2]. Here, I describe how physical principles are applied to a biological cell to explore the role of the vesicle SNARE protein synaptobrevin-2 in easing granule fusion. The data presented here suggest a paradigm according to which the movement of the C-terminal of synaptobrevin-2 disrupts the lipid bilayer to form a fusion pore through which molecules can exit.
Yeom, Chan Joo; Chung, Taemoon; Youn, Hyewon; Kang, Keon Wook; Lee, Dong Soo; Chung, June-Key
2015-01-01
The function of membrane-localized sodium iodide symporter (NIS) determines the efficacy of radioiodine therapy in thyroid cancer. Here, we describe a dual mode reporter fused with human NIS (hNIS) and a red fluorescent protein named tandem dimeric Tomato (tdTomato) for the in vitro and in vivo imaging of hNIS protein expression, localization, and iodide uptake function. Human cervical epithelial adenocarcinoma cell line (HeLa)-hNIS/tdTomato cells were established by transducing a fusion gene expressing hNIS/tdTomato under the control of a cytomegalovirus promoter. Fluorescence imaging, confocal microscopy, and an 125I uptake assay were performed to validate the integrity of the fusion protein. Actinomycin D and cycloheximide were used to block newly synthesized hNIS proteins. In vivo images were acquired using a gamma camera and a Maestro fluorescence imaging device. The fluorescence intensity of membrane-localized hNIS and 125I uptake both were increased after heat shock. Scintigraphy and fluorescence imaging indicated specific accumulation of the hNIS/tdTomato fusion protein in xenografted tumors, supporting the utility of this system for in vivo monitoring of hNIS expression and activity. We developed a novel hNIS/tdTomato dual mode reporter that enables visualization of the expression, localization, and iodine uptake function of hNIS in vitro and in vivo.
Myoblast fusion: lessons from flies and mice
Abmayr, Susan M.; Pavlath, Grace K.
2012-01-01
The fusion of myoblasts into multinucleate syncytia plays a fundamental role in muscle function, as it supports the formation of extended sarcomeric arrays, or myofibrils, within a large volume of cytoplasm. Principles learned from the study of myoblast fusion not only enhance our understanding of myogenesis, but also contribute to our perspectives on membrane fusion and cell-cell fusion in a wide array of model organisms and experimental systems. Recent studies have advanced our views of the cell biological processes and crucial proteins that drive myoblast fusion. Here, we provide an overview of myoblast fusion in three model systems that have contributed much to our understanding of these events: the Drosophila embryo; developing and regenerating mouse muscle; and cultured rodent muscle cells. PMID:22274696
Farzan, Shohreh F; Palermo, Laura M; Yokoyama, Christine C; Orefice, Gianmarco; Fornabaio, Micaela; Sarkar, Aurijit; Kellogg, Glen E; Greengard, Olga; Porotto, Matteo; Moscona, Anne
2011-11-04
Paramyxoviruses, including the childhood pathogen human parainfluenza virus type 3, enter host cells by fusion of the viral and target cell membranes. This fusion results from the concerted action of its two envelope glycoproteins, the hemagglutinin-neuraminidase (HN) and the fusion protein (F). The receptor-bound HN triggers F to undergo conformational changes that render it competent to mediate fusion of the viral and cellular membranes. We proposed that, if the fusion process could be activated prematurely before the virion reaches the target host cell, infection could be prevented. We identified a small molecule that inhibits paramyxovirus entry into target cells and prevents infection. We show here that this compound works by an interaction with HN that results in F-activation prior to receptor binding. The fusion process is thereby prematurely activated, preventing fusion of the viral membrane with target cells and precluding viral entry. This first evidence that activation of a paramyxovirus F can be specifically induced before the virus contacts its target cell suggests a new strategy with broad implications for the design of antiviral agents.
Ohtori, Seiji; Orita, Sumihisa; Yamauchi, Kazuyo; Eguchi, Yawara; Aoki, Yasuchika; Nakamura, Junichi; Miyagi, Masayuki; Suzuki, Miyako; Kubota, Gou; Inage, Kazuhide; Sainoh, Takeshi; Sato, Jun; Fujimoto, Kazuki; Shiga, Yasuhiro; Abe, Koki; Kanamoto, Hiroto; Inoue, Gen; Takahashi, Kazuhisa; Furuya, Takeo; Koda, Masao
2017-02-01
Retrospective case series. The purpose of this study was to examine changes in the ligamentum flavum thickness and remodeling of the spinal canal after anterior fusion during a 10-year follow-up. Extreme lateral interbody fusion provides minimally invasive treatment of the lumbar spine; this anterior fusion without direct posterior decompression, so-called indirect decompression, can achieve pain relief. Anterior fusion may restore disc height, stretch the flexure of the ligamentum flavum, and increase the spinal canal diameter. However, changes in the ligamentum flavum thickness and remodeling of the spinal canal after anterior fusion during a long follow-up have not yet been reported. We evaluated 10 patients with L4 spondylolisthesis who underwent stand-alone anterior interbody fusion using the iliac crest bone. Magnetic resonance imaging was performed 10 years after surgery. The cross-sectional area (CSA) of the dural sac and the ligamentum flavum at L1-2 to L5-S1 was calculated using a Picture Archiving and Communication System. Spinal fusion with correction loss (average, 4.75 mm anterior slip) was achieved in all patients 10 years postsurgery. The average CSAs of the dural sac and the ligamentum flavum at L1-2 to L5-S1 were 150 mm 2 and 78 mm 2 , respectively. The average CSA of the ligamentum flavum at L4-5 (30 mm 2 ) (fusion level) was significantly less than that at L1-2 to L3-4 or L5-S1. Although patients had an average anterior slip of 4.75 mm, the average CSA of the dural sac at L4-5 was significantly larger than at the other levels. Spinal stability induced a lumbar ligamentum flavum change and a sustained remodeling of the spinal canal, which may explain the long-term pain relief after indirect decompression fusion surgery.
Evolution of fusion hindrance for asymmetric systems at deep sub-barrier energies
NASA Astrophysics Data System (ADS)
Shrivastava, A.; Mahata, K.; Pandit, S. K.; Nanal, V.; Ichikawa, T.; Hagino, K.; Navin, A.; Palshetkar, C. S.; Parkar, V. V.; Ramachandran, K.; Rout, P. C.; Kumar, Abhinav; Chatterjee, A.; Kailas, S.
2016-04-01
Measurements of fusion cross-sections of 7Li and 12C with 198Pt at deep sub-barrier energies are reported to unravel the role of the entrance channel in the occurrence of fusion hindrance. The onset of fusion hindrance has been clearly observed in 12C +198Pt system but not in 7Li +198Pt system, within the measured energy range. Emergence of the hindrance, moving from lighter (6,7Li) to heavier (12C, 16O) projectiles is explained employing a model that considers a gradual transition from a sudden to adiabatic regime at low energies. The model calculation reveals a weak effect of the damping of coupling to collective motion for the present systems as compared to that obtained for systems with heavier projectiles.
2010-12-01
NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS Approved for public release; distribution is unlimited SOCIAL MEDIA...DATE December 2010 3. REPORT TYPE AND DATES COVERED Master’s Thesis 4. TITLE AND SUBTITLE Social Media Integration into State-Operated Fusion...technologies, particularly social media, within fusion centers and local law enforcement entities could enable a more expedient exchange of information among
Lu, Mengxiao; Gantz, Donald L; Herscovitz, Haya; Gursky, Olga
2012-10-01
Fusion of modified LDL in the arterial wall promotes atherogenesis. Earlier we showed that thermal denaturation mimics LDL remodeling and fusion, and revealed kinetic origin of LDL stability. Here we report the first quantitative analysis of LDL thermal stability. Turbidity data show sigmoidal kinetics of LDL heat denaturation, which is unique among lipoproteins, suggesting that fusion is preceded by other structural changes. High activation energy of denaturation, E(a) = 100 ± 8 kcal/mol, indicates disruption of extensive packing interactions in LDL. Size-exclusion chromatography, nondenaturing gel electrophoresis, and negative-stain electron microscopy suggest that LDL dimerization is an early step in thermally induced fusion. Monoclonal antibody binding suggests possible involvement of apoB N-terminal domain in early stages of LDL fusion. LDL fusion accelerates at pH < 7, which may contribute to LDL retention in acidic atherosclerotic lesions. Fusion also accelerates upon increasing LDL concentration in near-physiologic range, which likely contributes to atherogenesis. Thermal stability of LDL decreases with increasing particle size, indicating that the pro-atherogenic properties of small dense LDL do not result from their enhanced fusion. Our work provides the first kinetic approach to measuring LDL stability and suggests that lipid-lowering therapies that reduce LDL concentration but increase the particle size may have opposite effects on LDL fusion.
Quark-level analogue of nuclear fusion with doubly heavy baryons.
Karliner, Marek; Rosner, Jonathan L
2017-11-01
The essence of nuclear fusion is that energy can be released by the rearrangement of nucleons between the initial- and final-state nuclei. The recent discovery of the first doubly charmed baryon , which contains two charm quarks (c) and one up quark (u) and has a mass of about 3,621 megaelectronvolts (MeV) (the mass of the proton is 938 MeV) also revealed a large binding energy of about 130 MeV between the two charm quarks. Here we report that this strong binding enables a quark-rearrangement, exothermic reaction in which two heavy baryons (Λ c ) undergo fusion to produce the doubly charmed baryon and a neutron n (), resulting in an energy release of 12 MeV. This reaction is a quark-level analogue of the deuterium-tritium nuclear fusion reaction (DT → 4 He n). The much larger binding energy (approximately 280 MeV) between two bottom quarks (b) causes the analogous reaction with bottom quarks () to have a much larger energy release of about 138 MeV. We suggest some experimental setups in which the highly exothermic nature of the fusion of two heavy-quark baryons might manifest itself. At present, however, the very short lifetimes of the heavy bottom and charm quarks preclude any practical applications of such reactions.
Quark-level analogue of nuclear fusion with doubly heavy baryons
NASA Astrophysics Data System (ADS)
Karliner, Marek; Rosner, Jonathan L.
2017-11-01
The essence of nuclear fusion is that energy can be released by the rearrangement of nucleons between the initial- and final-state nuclei. The recent discovery of the first doubly charmed baryon , which contains two charm quarks (c) and one up quark (u) and has a mass of about 3,621 megaelectronvolts (MeV) (the mass of the proton is 938 MeV) also revealed a large binding energy of about 130 MeV between the two charm quarks. Here we report that this strong binding enables a quark-rearrangement, exothermic reaction in which two heavy baryons (Λc) undergo fusion to produce the doubly charmed baryon and a neutron n (), resulting in an energy release of 12 MeV. This reaction is a quark-level analogue of the deuterium-tritium nuclear fusion reaction (DT → 4He n). The much larger binding energy (approximately 280 MeV) between two bottom quarks (b) causes the analogous reaction with bottom quarks () to have a much larger energy release of about 138 MeV. We suggest some experimental setups in which the highly exothermic nature of the fusion of two heavy-quark baryons might manifest itself. At present, however, the very short lifetimes of the heavy bottom and charm quarks preclude any practical applications of such reactions.
Fusion energy: Status and prospects
NASA Astrophysics Data System (ADS)
Salomaa, Rainer
A review of the present state of the international fusion research is given. In the largest tokamak devices (JET, TFTR, JT-60) fusion relevant temperatures are routinely obtained and the scientific feasibility of plasma confinement has been demonstrated. Plans concerning the next step are described. A critical view is presented on questions as to what extent the generic advantages of fusion (availability, sufficiency, safety, environmental acceptability, etc.) can be exploited in a practical power reactor where the formidable technological problems call for compromises.
Fc-fusion Proteins in Therapy: An Updated View.
Jafari, Reza; Zolbanin, Naime M; Rafatpanah, Houshang; Majidi, Jafar; Kazemi, Tohid
2017-01-01
Fc-fusion proteins are composed of Fc region of IgG antibody (Hinge-CH2-CH3) and a desired linked protein. Fc region of Fc-fusion proteins can bind to neonatal Fc receptor (FcRn) thereby rescuing it from degradation. The first therapeutic Fc-fusion protein was introduced for the treatment of AIDS. The molecular designing is the first stage in production of Fc-fusion proteins. The amino acid residues in the Fc region and linked protein are very important in the bioactivity and affinity of the fusion proteins. Although, therapeutic monoclonal antibodies are the top selling biologics but the application of therapeutic Fc-fusion proteins in clinic is in progress and among these medications Etanercept is the most effective in therapy. At present, eleven Fc-fusion proteins have been approved by FDA. There are novel Fc-fusion proteins which are in pre-clinical and clinical development. In this article, we review the molecular and biological characteristics of Fc-fusion proteins and then further discuss the features of novel therapeutic Fc-fusion proteins. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Structural and Functional Studies on the Marburg Virus GP2 Fusion Loop.
Liu, Nina; Tao, Yisong; Brenowitz, Michael D; Girvin, Mark E; Lai, Jonathan R
2015-10-01
Marburg virus (MARV) and the ebolaviruses belong to the family Filoviridae (the members of which are filoviruses) that cause severe hemorrhagic fever. Infection requires fusion of the host and viral membranes, a process that occurs in the host cell endosomal compartment and is facilitated by the envelope glycoprotein fusion subunit, GP2. The N-terminal fusion loop (FL) of GP2 is a hydrophobic disulfide-bonded loop that is postulated to insert and disrupt the host endosomal membrane during fusion. Here, we describe the first structural and functional studies of a protein corresponding to the MARV GP2 FL. We found that this protein undergoes a pH-dependent conformational change, as monitored by circular dichroism and nuclear magnetic resonance. Furthermore, we report that, under low pH conditions, the MARV GP2 FL can induce content leakage from liposomes. The general aspects of this pH-dependent structure and lipid-perturbing behavior are consistent with previous reports on Ebola virus GP2 FL. However, nuclear magnetic resonance studies in lipid bicelles and mutational analysis indicate differences in structure exist between MARV and Ebola virus GP2 FL. These results provide new insight into the mechanism of MARV GP2-mediated cell entry. © The Author 2015. Published by Oxford University Press on behalf of the Infectious Diseases Society of America. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Pizza, Francis X; Martin, Ryan A; Springer, Evan M; Leffler, Maxwell S; Woelmer, Bryce R; Recker, Isaac J; Leaman, Douglas W
2017-07-11
The overall objective of the study was to identify mechanisms through which intercellular adhesion molecule-1 (ICAM-1) augments the adhesive and fusogenic properties of myogenic cells. Hypotheses were tested using cultured myoblasts and fibroblasts, which do not constitutively express ICAM-1, and myoblasts and fibroblasts forced to express full length ICAM-1 or a truncated form lacking the cytoplasmic domain of ICAM-1. ICAM-1 mediated myoblast adhesion and fusion were quantified using novel assays and cell mixing experiments. We report that ICAM-1 augments myoblast adhesion to myoblasts and myotubes through homophilic trans-interactions. Such adhesive interactions enhanced levels of active Rac in adherent and fusing myoblasts, as well as triggered lamellipodia, spreading, and fusion of myoblasts through the signaling function of the cytoplasmic domain of ICAM-1. Rac inhibition negated ICAM-1 mediated lamellipodia, spreading, and fusion of myoblasts. The fusogenic property of ICAM-1-ICAM-1 interactions was restricted to myogenic cells, as forced expression of ICAM-1 by fibroblasts did not augment their fusion to ICAM-1+ myoblasts/myotubes. We conclude that ICAM-1 augments myoblast adhesion and fusion through its ability to self-associate and initiate Rac-mediated remodeling of the actin cytoskeleton.
Magnetized Target Fusion Driven by Plasma Liners
NASA Technical Reports Server (NTRS)
Thio, Y. C. Francis; Kirkpatrick, Ronald C.; Knapp, Charles E.; Rodgers, Stephen L. (Technical Monitor)
2002-01-01
Magnetized target fusion is an emerging, relatively unexplored approach to fusion for electrical power and propulsion application. The physical principles of the concept are founded upon both inertial confinement fusion (ICF) and magnetic confinement fusion (MCF). It attempts to combine the favorable attributes of both these orthogonal approaches to fusion, but at the same time, avoiding the extreme technical challenges of both by exploiting a fusion regime intermediate between them. It uses a material liner to compress, heat and contain the fusion reacting plasma (the target plasma) mentally. By doing so, the fusion burn could be made to occur at plasma densities as high as six orders of magnitude higher than conventional MCF such as tokamak, thus leading to an approximately three orders of magnitude reduction in the plasma energy required for ignition. It also uses a transient magnetic field, compressed to extremely high intensity (100's T to 1000T) in the target plasma, to slow down the heat transport to the liner and to increase the energy deposition of charged-particle fusion products. This has several compounding beneficial effects. It leads to longer energy confinement time compared with conventional ICF without magnetized target, and thus permits the use of much lower plasma density to produce reasonable burn-up fraction. The compounding effects of lower plasma density and the magneto-insulation of the target lead to greatly reduced compressional heating power on the target. The increased energy deposition rate of charged-particle fusion products also helps to lower the energy threshold required for ignition and increasing the burn-up fraction. The reduction in ignition energy and the compressional power compound to lead to reduced system size, mass and R&D cost. It is a fusion approach that has an affordable R&D pathway, and appears attractive for propulsion application in the nearer term.
Bielle, Franck; Di Stefano, Anna-Luisa; Meyronet, David; Picca, Alberto; Villa, Chiara; Bernier, Michèle; Schmitt, Yohann; Giry, Marine; Rousseau, Audrey; Figarella-Branger, Dominique; Maurage, Claude-Alain; Uro-Coste, Emmanuelle; Lasorella, Anna; Iavarone, Antonio; Sanson, Marc; Mokhtari, Karima
2017-10-04
Adult glioblastomas, IDH-wildtype represent a heterogeneous group of diseases. They are resistant to conventional treatment by concomitant radiochemotherapy and carry a dismal prognosis. The discovery of oncogenic gene fusions in these tumors has led to prospective targeted treatments, but identification of these rare alterations in practice is challenging. Here, we report a series of 30 adult diffuse gliomas with an in frame FGFR3-TACC3 oncogenic fusion (n = 27 WHO grade IV and n = 3 WHO grade II) as well as their histological and molecular features. We observed recurrent morphological features (monomorphous ovoid nuclei, nuclear palisading and thin parallel cytoplasmic processes, endocrinoid network of thin capillaries) associated with frequent microcalcifications and desmoplasia. We report a constant immunoreactivity for FGFR3, which is a valuable method for screening for the FGFR3-TACC3 fusion with 100% sensitivity and 92% specificity. We confirmed the associated molecular features (typical genetic alterations of glioblastoma, except the absence of EGFR amplification, and an increased frequency of CDK4 and MDM2 amplifications). FGFR3 immunopositivity is a valuable tool to identify gliomas that are likely to harbor the FGFR3-TACC3 fusion for inclusion in targeted therapeutic trials. © 2017 International Society of Neuropathology.
Intense fusion neutron sources
NASA Astrophysics Data System (ADS)
Kuteev, B. V.; Goncharov, P. R.; Sergeev, V. Yu.; Khripunov, V. I.
2010-04-01
The review describes physical principles underlying efficient production of free neutrons, up-to-date possibilities and prospects of creating fission and fusion neutron sources with intensities of 1015-1021 neutrons/s, and schemes of production and application of neutrons in fusion-fission hybrid systems. The physical processes and parameters of high-temperature plasmas are considered at which optimal conditions for producing the largest number of fusion neutrons in systems with magnetic and inertial plasma confinement are achieved. The proposed plasma methods for neutron production are compared with other methods based on fusion reactions in nonplasma media, fission reactions, spallation, and muon catalysis. At present, intense neutron fluxes are mainly used in nanotechnology, biotechnology, material science, and military and fundamental research. In the near future (10-20 years), it will be possible to apply high-power neutron sources in fusion-fission hybrid systems for producing hydrogen, electric power, and technological heat, as well as for manufacturing synthetic nuclear fuel and closing the nuclear fuel cycle. Neutron sources with intensities approaching 1020 neutrons/s may radically change the structure of power industry and considerably influence the fundamental and applied science and innovation technologies. Along with utilizing the energy produced in fusion reactions, the achievement of such high neutron intensities may stimulate wide application of subcritical fast nuclear reactors controlled by neutron sources. Superpower neutron sources will allow one to solve many problems of neutron diagnostics, monitor nano-and biological objects, and carry out radiation testing and modification of volumetric properties of materials at the industrial level. Such sources will considerably (up to 100 times) improve the accuracy of neutron physics experiments and will provide a better understanding of the structure of matter, including that of the neutron itself.
NASA Astrophysics Data System (ADS)
Zhirkin, A. V.; Alekseev, P. N.; Batyaev, V. F.; Gurevich, M. I.; Dudnikov, A. A.; Kuteev, B. V.; Pavlov, K. V.; Titarenko, Yu. E.; Titarenko, A. Yu.
2017-06-01
In this report the calculation accuracy requirements of the main parameters of the fusion neutron source, and the thermonuclear blankets with a DT fusion power of more than 10 MW, are formulated. To conduct the benchmark experiments the technical documentation and calculation models were developed for two blanket micro-models: the molten salt and the heavy water solid-state blankets. The calculations of the neutron spectra, and 37 dosimetric reaction rates that are widely used for the registration of thermal, resonance and threshold (0.25-13.45 MeV) neutrons, were performed for each blanket micro-model. The MCNP code and the neutron data library ENDF/B-VII were used for the calculations. All the calculations were performed for two kinds of neutron source: source I is the fusion source, source II is the source of neutrons generated by the 7Li target irradiated by protons with energy 24.6 MeV. The spectral indexes ratios were calculated to describe the spectrum variations from different neutron sources. The obtained results demonstrate the advantage of using the fusion neutron source in future experiments.
Fusion Imaging for Procedural Guidance.
Wiley, Brandon M; Eleid, Mackram F; Thaden, Jeremy J
2018-05-01
The field of percutaneous structural heart interventions has grown tremendously in recent years. This growth has fueled the development of new imaging protocols and technologies in parallel to help facilitate these minimally-invasive procedures. Fusion imaging is an exciting new technology that combines the strength of 2 imaging modalities and has the potential to improve procedural planning and the safety of many commonly performed transcatheter procedures. In this review we discuss the basic concepts of fusion imaging along with the relative strengths and weaknesses of static vs dynamic fusion imaging modalities. This review will focus primarily on echocardiographic-fluoroscopic fusion imaging and its application in commonly performed transcatheter structural heart procedures. Copyright © 2017 Sociedad Española de Cardiología. Published by Elsevier España, S.L.U. All rights reserved.
High-gain magnetized inertial fusion.
Slutz, Stephen A; Vesey, Roger A
2012-01-13
Magnetized inertial fusion (MIF) could substantially ease the difficulty of reaching plasma conditions required for significant fusion yields, but it has been widely accepted that the gain is not sufficient for fusion energy. Numerical simulations are presented showing that high-gain MIF is possible in cylindrical liner implosions based on the MagLIF concept [S. A. Slutz et al Phys. Plasmas 17, 056303 (2010)] with the addition of a cryogenic layer of deuterium-tritium (DT). These simulations show that a burn wave propagates radially from the magnetized hot spot into the surrounding much denser cold DT given sufficient hot-spot areal density. For a drive current of 60 MA the simulated gain exceeds 100, which is more than adequate for fusion energy applications. The simulated gain exceeds 1000 for a drive current of 70 MA.
Information Fusion - Methods and Aggregation Operators
NASA Astrophysics Data System (ADS)
Torra, Vicenç
Information fusion techniques are commonly applied in Data Mining and Knowledge Discovery. In this chapter, we will give an overview of such applications considering their three main uses. This is, we consider fusion methods for data preprocessing, model building and information extraction. Some aggregation operators (i.e. particular fusion methods) and their properties are briefly described as well.
Z-Pinch fusion-based nuclear propulsion
NASA Astrophysics Data System (ADS)
Miernik, J.; Statham, G.; Fabisinski, L.; Maples, C. D.; Adams, R.; Polsgrove, T.; Fincher, S.; Cassibry, J.; Cortez, R.; Turner, M.; Percy, T.
2013-02-01
Fusion-based nuclear propulsion has the potential to enable fast interplanetary transportation. Due to the great distances between the planets of our solar system and the harmful radiation environment of interplanetary space, high specific impulse (Isp) propulsion in vehicles with high payload mass fractions must be developed to provide practical and safe vehicles for human space flight missions. The Z-Pinch dense plasma focus method is a Magneto-Inertial Fusion (MIF) approach that may potentially lead to a small, low cost fusion reactor/engine assembly [1]. Recent advancements in experimental and theoretical understanding of this concept suggest favorable scaling of fusion power output yield [2]. The magnetic field resulting from the large current compresses the plasma to fusion conditions, and this process can be pulsed over short timescales (10-6 s). This type of plasma formation is widely used in the field of Nuclear Weapons Effects testing in the defense industry, as well as in fusion energy research. A Z-Pinch propulsion concept was designed for a vehicle based on a previous fusion vehicle study called "Human Outer Planet Exploration" (HOPE), which used Magnetized Target Fusion (MTF) [3] propulsion. The reference mission is the transport of crew and cargo to Mars and back, with a reusable vehicle. The analysis of the Z-Pinch MIF propulsion system concludes that a 40-fold increase of Isp over chemical propulsion is predicted. An Isp of 19,436 s and thrust of 3812 N s/pulse, along with nearly doubling the predicted payload mass fraction, warrants further development of enabling technologies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hedrick, J.; Buchholtz, B.; Ward, P.
1991-01-01
Fusion Propulsion has an enormous potential for space exploration in the near future. In the twenty-first century, a usable and efficient fusion rocket will be developed and in use. Because of the great distance between other planets and Earth, efficient use of time, fuel, and payload is essential. A nuclear spaceship would provide greater fuel efficiency, less travel time, and a larger payload. Extended missions would give more time for research, experiments, and data acquisition. With the extended mission time, a need for an artificial environment exists. The topics of magnetic fusion propulsion, living modules, artificial gravity, mass distribution, spacemore » connection, and orbital transfer to Mars are discussed. The propulsion system is a magnetic fusion reactor based on a tandem mirror design. This allows a faster, shorter trip time and a large thrust to weight ratio. The fuel proposed is a mixture of deuterium and helium. Helium can be obtained from lunar mining. There will be minimal external radiation from the reactor resulting in a safe, efficient propulsion system.« less
NASA Technical Reports Server (NTRS)
Hedrick, James; Buchholtz, Brent; Ward, Paul; Freuh, Jim; Jensen, Eric
1991-01-01
Fusion Propulsion has an enormous potential for space exploration in the near future. In the twenty-first century, a usable and efficient fusion rocket will be developed and in use. Because of the great distance between other planets and Earth, efficient use of time, fuel, and payload is essential. A nuclear spaceship would provide greater fuel efficiency, less travel time, and a larger payload. Extended missions would give more time for research, experiments, and data acquisition. With the extended mission time, a need for an artificial environment exists. The topics of magnetic fusion propulsion, living modules, artificial gravity, mass distribution, space connection, and orbital transfer to Mars are discussed. The propulsion system is a magnetic fusion reactor based on a tandem mirror design. This allows a faster, shorter trip time and a large thrust to weight ratio. The fuel proposed is a mixture of deuterium and helium-3. Helium-3 can be obtained from lunar mining. There will be minimal external radiation from the reactor resulting in a safe, efficient propulsion system.
Wawra, Stephan; Djamei, Armin; Albert, Isabell; Nürnberger, Thorsten; Kahmann, Regine; van West, Pieter
2013-05-01
Plant-pathogenic oomycetes have a large set of secreted effectors that can be translocated into their host cells during infection. One group of these effectors are the RxLR effectors for which it has been shown, in a few cases, that the RxLR motif is important for their translocation. It has been suggested that the RxLR-leader sequences alone are enough to translocate the respective effectors into eukaryotic cells through binding to surface-exposed phosphoinositol-3-phosphate. These conclusions were primary based on translocation experiments conducted with recombinant fusion proteins whereby the RxLR leader of RxLR effectors (i.e., Avr1b from Phytophthora sojae) were fused to the green fluorescent protein reporter-protein. However, we failed to observe specific cellular uptake for a comparable fusion protein where the RxLR leader of the P. infestans AVR3a was fused to monomeric red fluorescent protein. Therefore, we reexamined the ability of the reported P. sojae AVR1b RxLR leader to enter eukaryotic cells. Different relevant experiments were performed in three independent laboratories, using fluorescent reporter fusion constructs of AVR3a and Avr1b proteins in a side-by-side comparative study on plant tissue and human and animal cells. We report that we were unable to obtain conclusive evidence for specific RxLR-mediated translocation.
Gardner, Amanda E.; Dutch, Rebecca E.
2007-01-01
Paramyxoviruses utilize both an attachment protein and a fusion (F) protein to drive virus-cell and cell-cell fusion. F exists functionally as a trimer of two disulfide-linked subunits: F1 and F2. Alignment and analysis of a set of paramyxovirus F protein sequences identified three conserved blocks (CB): one in the fusion peptide/heptad repeat A domain, known to play important roles in fusion promotion, one in the region between the heptad repeats of F1 (CBF1) (A. E. Gardner, K. L. Martin, and R. E. Dutch, Biochemistry 46:5094-5105, 2007), and one in the F2 subunit (CBF2). To analyze the functions of CBF2, alanine substitutions at conserved positions were created in both the simian virus 5 (SV5) and Hendra virus F proteins. A number of the CBF2 mutations resulted in folding and expression defects. However, the CBF2 mutants that were properly expressed and trafficked had altered fusion promotion activity. The Hendra virus CBF2 Y79A and P89A mutants showed significantly decreased levels of fusion, whereas the SV5 CBF2 I49A mutant exhibited greatly increased cell-cell fusion relative to that for wild-type F. Additional substitutions at SV5 F I49 suggest that both side chain volume and hydrophobicity at this position are important in the folding of the metastable, prefusion state and the subsequent triggering of membrane fusion. The recently published prefusogenic structure of parainfluenza virus 5/SV5 F (H. S. Yin et al., Nature 439:38-44, 2006) places CBF2 in direct contact with heptad repeat A. Our data therefore indicate that this conserved region plays a critical role in stabilizing the prefusion state, likely through interactions with heptad repeat A, and in triggering membrane fusion. PMID:17507474
Msx1 is expressed in retina endothelial cells at artery branching sites.
Lopes, Miguel; Goupille, Olivier; Saint Cloment, Cécile; Robert, Benoît
2012-04-15
Msx1 and Msx2 encode homeodomain transcription factors that play a role in several embryonic developmental processes. Previously, we have shown that in the adult mouse, Msx1(lacZ) is expressed in vascular smooth muscle cells (VSMCs) and pericytes, and that Msx2(lacZ) is also expressed in VSMCs as well as in a few endothelial cells (ECs). The mouse retina and choroid are two highly vascularized tissues. Vessel alterations in the retina are associated with several human diseases and the retina has been intensely used for angiogenesis studies, whereas the choroid has been much less investigated. Using the Msx1(lacZ) and Msx2(lacZ) reporter alleles, we observed that Msx2 is not expressed in the eye vascular tree in contrast to Msx1, for which we establish the spatial and temporal expression pattern in these tissues. In the retina, expression of Msx1 takes place from P3, and by P10, it becomes confined to a subpopulation of ECs at branching points of superficial arterioles. These branching sites are characterized by a subpopulation of mural cells that also show specific expression programs. Specific Msx gene inactivation in the endothelium, using Msx1 and Msx2 conditional mutant alleles together with a Tie2-Cre transgene, did not lead to conspicuous structural defects in the retinal vascular network. Expression of Msx1 at branching sites might therefore be linked to vessel physiology. The retinal blood flow is autonomously regulated and perfusion of capillaries has been proposed to depend on arteriolar precapillary structures that might be the sites for Msx1 expression. On the other hand, branching sites are subject to shear stress that might induce Msx1 expression. In the choroid vascular layer Msx1(lacZ) is expressed more broadly and dynamically. At birth Msx1(lacZ) expression takes place in the endothelium but at P21 its expression has shifted towards the mural layer. We discuss the possible functions of Msx1 in the eye vasculature.
Msx1 is expressed in retina endothelial cells at artery branching sites
Lopes, Miguel; Goupille, Olivier; Saint Cloment, Cécile; Robert, Benoît
2012-01-01
Summary Msx1 and Msx2 encode homeodomain transcription factors that play a role in several embryonic developmental processes. Previously, we have shown that in the adult mouse, Msx1lacZ is expressed in vascular smooth muscle cells (VSMCs) and pericytes, and that Msx2lacZ is also expressed in VSMCs as well as in a few endothelial cells (ECs). The mouse retina and choroid are two highly vascularized tissues. Vessel alterations in the retina are associated with several human diseases and the retina has been intensely used for angiogenesis studies, whereas the choroid has been much less investigated. Using the Msx1lacZ and Msx2lacZ reporter alleles, we observed that Msx2 is not expressed in the eye vascular tree in contrast to Msx1, for which we establish the spatial and temporal expression pattern in these tissues. In the retina, expression of Msx1 takes place from P3, and by P10, it becomes confined to a subpopulation of ECs at branching points of superficial arterioles. These branching sites are characterized by a subpopulation of mural cells that also show specific expression programs. Specific Msx gene inactivation in the endothelium, using Msx1 and Msx2 conditional mutant alleles together with a Tie2-Cre transgene, did not lead to conspicuous structural defects in the retinal vascular network. Expression of Msx1 at branching sites might therefore be linked to vessel physiology. The retinal blood flow is autonomously regulated and perfusion of capillaries has been proposed to depend on arteriolar precapillary structures that might be the sites for Msx1 expression. On the other hand, branching sites are subject to shear stress that might induce Msx1 expression. In the choroid vascular layer Msx1lacZ is expressed more broadly and dynamically. At birth Msx1lacZ expression takes place in the endothelium but at P21 its expression has shifted towards the mural layer. We discuss the possible functions of Msx1 in the eye vasculature. PMID:23213427
Fusion of footsteps and face biometrics on an unsupervised and uncontrolled environment
NASA Astrophysics Data System (ADS)
Vera-Rodriguez, Ruben; Tome, Pedro; Fierrez, Julian; Ortega-Garcia, Javier
2012-06-01
This paper reports for the first time experiments on the fusion of footsteps and face on an unsupervised and not controlled environment for person authentication. Footstep recognition is a relatively new biometric based on signals extracted from people walking over floor sensors. The idea of the fusion between footsteps and face starts from the premise that in an area where footstep sensors are installed it is very simple to place a camera to capture also the face of the person that walks over the sensors. This setup may find application in scenarios like ambient assisted living, smart homes, eldercare, or security access. The paper reports a comparative assessment of both biometrics using the same database and experimental protocols. In the experimental work we consider two different applications: smart homes (small group of users with a large set of training data) and security access (larger group of users with a small set of training data) obtaining results of 0.9% and 5.8% EER respectively for the fusion of both modalities. This is a significant performance improvement compared with the results obtained by the individual systems.
Estrada, Beatriz; Maeland, Anne D; Gisselbrecht, Stephen S; Bloor, James W; Brown, Nicholas H; Michelson, Alan M
2007-07-15
Multinucleated myotubes develop by the sequential fusion of individual myoblasts. Using a convergence of genomic and classical genetic approaches, we have discovered a novel gene, singles bar (sing), that is essential for myoblast fusion. sing encodes a small multipass transmembrane protein containing a MARVEL domain, which is found in vertebrate proteins involved in processes such as tight junction formation and vesicle trafficking where--as in myoblast fusion--membrane apposition occurs. sing is expressed in both founder cells and fusion competent myoblasts preceding and during myoblast fusion. Examination of embryos injected with double-stranded sing RNA or embryos homozygous for ethane methyl sulfonate-induced sing alleles revealed an identical phenotype: replacement of multinucleated myofibers by groups of single, myosin-expressing myoblasts at a stage when formation of the mature muscle pattern is complete in wild-type embryos. Unfused sing mutant myoblasts form clusters, suggesting that early recognition and adhesion of these cells are unimpaired. To further investigate this phenotype, we undertook electron microscopic ultrastructural studies of fusing myoblasts in both sing and wild-type embryos. These experiments revealed that more sing mutant myoblasts than wild-type contain pre-fusion complexes, which are characterized by electron-dense vesicles paired on either side of the fusing plasma membranes. In contrast, embryos mutant for another muscle fusion gene, blown fuse (blow), have a normal number of such complexes. Together, these results lead to the hypothesis that sing acts at a step distinct from that of blow, and that sing is required on both founder cell and fusion-competent myoblast membranes to allow progression past the pre-fusion complex stage of myoblast fusion, possibly by mediating fusion of the electron-dense vesicles to the plasma membrane.
Integrated Data Analysis for Fusion: A Bayesian Tutorial for Fusion Diagnosticians
NASA Astrophysics Data System (ADS)
Dinklage, Andreas; Dreier, Heiko; Fischer, Rainer; Gori, Silvio; Preuss, Roland; Toussaint, Udo von
2008-03-01
Integrated Data Analysis (IDA) offers a unified way of combining information relevant to fusion experiments. Thereby, IDA meets with typical issues arising in fusion data analysis. In IDA, all information is consistently formulated as probability density functions quantifying uncertainties in the analysis within the Bayesian probability theory. For a single diagnostic, IDA allows the identification of faulty measurements and improvements in the setup. For a set of diagnostics, IDA gives joint error distributions allowing the comparison and integration of different diagnostics results. Validation of physics models can be performed by model comparison techniques. Typical data analysis applications benefit from IDA capabilities of nonlinear error propagation, the inclusion of systematic effects and the comparison of different physics models. Applications range from outlier detection, background discrimination, model assessment and design of diagnostics. In order to cope with next step fusion device requirements, appropriate techniques are explored for fast analysis applications.
Forecasting Chronic Diseases Using Data Fusion.
Acar, Evrim; Gürdeniz, Gözde; Savorani, Francesco; Hansen, Louise; Olsen, Anja; Tjønneland, Anne; Dragsted, Lars Ove; Bro, Rasmus
2017-07-07
Data fusion, that is, extracting information through the fusion of complementary data sets, is a topic of great interest in metabolomics because analytical platforms such as liquid chromatography-mass spectrometry (LC-MS) and nuclear magnetic resonance (NMR) spectroscopy commonly used for chemical profiling of biofluids provide complementary information. In this study, with a goal of forecasting acute coronary syndrome (ACS), breast cancer, and colon cancer, we jointly analyzed LC-MS, NMR measurements of plasma samples, and the metadata corresponding to the lifestyle of participants. We used supervised data fusion based on multiple kernel learning and exploited the linearity of the models to identify significant metabolites/features for the separation of healthy referents and the cases developing a disease. We demonstrated that (i) fusing LC-MS, NMR, and metadata provided better separation of ACS cases and referents compared with individual data sets, (ii) NMR data performed the best in terms of forecasting breast cancer, while fusion degraded the performance, and (iii) neither the individual data sets nor their fusion performed well for colon cancer. Furthermore, we showed the strengths and limitations of the fusion models by discussing their performance in terms of capturing known biomarkers for smoking and coffee. While fusion may improve performance in terms of separating certain conditions by jointly analyzing metabolomics and metadata sets, it is not necessarily always the best approach as in the case of breast cancer.
Goldstein, Christina L; Phillips, Frank M; Rampersaud, Y Raja
2016-04-01
Systematic review of randomized and nonrandomized comparative studies. To summarize the literature examining comparative effectiveness and economic evaluation of minimally invasive versus open transforaminal/posterior lumbar interbody fusion (T/PLIF). Minimally invasive approaches to lumbar fusion have been proposed as an alternative to open surgery to decrease patient morbidity and improve clinical and patient-reported outcomes, with the possibility of secondary cost-savings. The comparative clinical and economic effectiveness of minimally invasive versus open T/PLIF remains largely undetermined. A systematic review of Medline, EMBASE, Web of Science, and Cochrane from database inception to September 2015 inclusive was performed. Reference lists were manually searched. Studies comparing MIS to open T/PLIF for degenerative lumbar conditions, including at least 10 patients in each arm and reporting at least one clinical, perioperative, radiographic, adverse event, or economic outcome, were included. Between database inception and October 2015, 45 studies meeting inclusion criteria were identified with 3472 subjects undergoing MIS fusion and 5925 having an open procedure. There were no significant differences in operative time between the two groups, whereas patients undergoing MIS fusion consistently demonstrated less blood loss (16.1-88.7%) and shorter hospital stays (15.0-64.0% shorter). There was no difference in variably reported VAS, ODI, SF-36, SF-12, or EQ-5D scores between the two techniques at intermediate to long-term follow-up (12-60 months). Complication rates and fusion rates were also equivalent between the two groups. Economic studies demonstrate cost-savings in favor of MIS fusion ranging from 2.5 to 49.3%. Limited quality comparative observational cohort and randomized controlled studies of MIS versus open T/PLIF consistently demonstrate improved perioperative outcomes including operative time, estimated blood loss, and length of stay with no
Mesenchymal stem cells generate distinct functional hybrids in vitro via cell fusion or entosis.
Sottile, Francesco; Aulicino, Francesco; Theka, Ilda; Cosma, Maria Pia
2016-11-09
Homotypic and heterotypic cell-to-cell fusion are key processes during development and tissue regeneration. Nevertheless, aberrant cell fusion can contribute to tumour initiation and metastasis. Additionally, a form of cell-in-cell structure called entosis has been observed in several human tumours. Here we investigate cell-to-cell interaction between mouse mesenchymal stem cells (MSCs) and embryonic stem cells (ESCs). MSCs represent an important source of adult stem cells since they have great potential for regenerative medicine, even though they are also involved in cancer progression. We report that MSCs can either fuse forming heterokaryons, or be invaded by ESCs through entosis. While entosis-derived hybrids never share their genomes and induce degradation of the target cell, fusion-derived hybrids can convert into synkaryons. Importantly we show that hetero-to-synkaryon transition occurs through cell division and not by nuclear membrane fusion. Additionally, we also observe that the ROCK-actin/myosin pathway is required for both fusion and entosis in ESCs but only for entosis in MSCs. Overall, we show that MSCs can undergo fusion or entosis in culture by generating distinct functional cellular entities. These two processes are profoundly different and their outcomes should be considered given the beneficial or possible detrimental effects of MSC-based therapeutic applications.
Status and problems of fusion reactor development.
Schumacher, U
2001-03-01
Thermonuclear fusion of deuterium and tritium constitutes an enormous potential for a safe, environmentally compatible and sustainable energy supply. The fuel source is practically inexhaustible. Further, the safety prospects of a fusion reactor are quite favourable due to the inherently self-limiting fusion process, the limited radiologic toxicity and the passive cooling property. Among a small number of approaches, the concept of toroidal magnetic confinement of fusion plasmas has achieved most impressive scientific and technical progress towards energy release by thermonuclear burn of deuterium-tritium fuels. The status of thermonuclear fusion research activity world-wide is reviewed and present solutions to the complicated physical and technological problems are presented. These problems comprise plasma heating, confinement and exhaust of energy and particles, plasma stability, alpha particle heating, fusion reactor materials, reactor safety and environmental compatibility. The results and the high scientific level of this international research activity provide a sound basis for the realisation of the International Thermonuclear Experimental Reactor (ITER), whose goal is to demonstrate the scientific and technological feasibility of a fusion energy source for peaceful purposes.