Wegener, Marius; Vogtmann, Kristina; Huber, Madeleine; Laass, Sebastian; Soppa, Jörg
2016-12-01
Reporter genes facilitate the characterization of promoter activities, transcript stabilities, translational efficiencies, or intracellular localization. Various reporter genes for Escherichia coli have been established, however, most of them have drawbacks like transcript instability or the inability to be used in genetic selections. Therefore, the glpD gene encoding glycerol-3-phosphate dehydrogenase was introduced as a novel reporter gene for E. coli. The enzymatic assay was optimized, and it was verified that growth on glycerol strictly depends on the presence of GlpD. The 5'-UTRs of three E. coli genes were chosen and cloned upstream of the new reporter gene glpD as well as the established reporter genes lacZ and gusA. Protein and transcript levels were quantified and translational efficiencies were calculated. The lacZ transcript was very unstable and its level highly depended on its translation, compromising its use as a reporter. The results obtained with gusA and glpD were similar, however, only glpD can be used for genetic selections. Therefore, glpD was found to be a superior novel reporter gene compared to the established reporter genes lacZ and gusA. Copyright © 2016 Elsevier B.V. All rights reserved.
An in vitro bioassay for xenobiotics using the SXR-driven human CYP3A4/lacZ reporter gene.
Lee, Mi R; Kim, Yeon J; Hwang, Dae Y; Kang, Tae S; Hwang, Jin H; Lim, Chae H; Kang, Hyung K; Goo, Jun S; Lim, Hwa J; Ahn, Kwang S; Cho, Jung S; Chae, Kap R; Kim, Yong K
2003-01-01
The dose and time effect of nine xenobiotics, including 17beta-estradiol, corticosterone, dexamethasone, progesterone, nifedipine, bisphenol A, rifampicin, methamphetamine, and nicotine were investigated, in vitro, using human steroid and xenobiotics receptor (SXR)-binding sites on the human CYP3A4 promoter, which can enhance the linked lacZ reporter gene transcription. To test this, liver-specific SAP (human serum amyloid P component)-SXR (SAP/SXR) and human CYP3A4 promoter-regulated lacZ (hCYP3A4/lacZ) constructs were transiently transfected into HepG2 and NIH3T3 cells to compare the xenobiotic responsiveness between human and nonhuman cell lines. In the HepG2 cells, rifampicin, followed by corticosterone, nicotine, methamphetamine, and dexamethasone, exhibited enhanced levels of the lacZ transcript, whereas those of bisphenol A and nifedipine were found to be reduced. No significant responses were observed with 17beta-estradiol or progesterone. In addition, 17beta-estradiol and progesterone did not change the levels of the lacZ transcripts in the HepG2 cells, but did induce significant increases in the transcripts of the NIH3T3 cells. Treatment with corticosterone and dexamethasone, which were highly expressed in the HepG2 cells, did not affect the levels of the lacZ transcript in NIH3T3 cells. These results show that lacZ transcripts can be measured, rapidly and reproducibly, using reverse transcriptase-polymerase chain reaction (RT-PCR) based on the expression of the hCYP3A4/lacZ reporter gene, and was mediated by the SXR. Thus, this in vitro reporter gene bioassay is useful for measuring xenobiotic activities, and is a means to a better relevant bioassay, using human cells, human genes and human promoters, in order to get a closer look at actual human exposure.
Reichel, J M; Bedenk, B T; Gassen, N C; Hafner, K; Bura, S A; Almeida-Correa, S; Genewsky, A; Dedic, N; Giesert, F; Agarwal, A; Nave, K-A; Rein, T; Czisch, M; Deussing, J M; Wotjak, C T
2016-10-01
Expression of the lacZ-sequence is a widely used reporter-tool to assess the transgenic and/or transfection efficacy of a target gene in mice. Once activated, lacZ is permanently expressed. However, protein accumulation is one of the hallmarks of neurodegenerative diseases. Furthermore, the protein product of the bacterial lacZ gene is ß-galactosidase, an analog to the mammalian senescence-associated ß-galactosidase, a molecular marker for aging. Therefore we studied the behavioral, structural and molecular consequences of lacZ expression in distinct neuronal sub-populations. lacZ expression in cortical glutamatergic neurons resulted in severe impairments in hippocampus-dependent memory accompanied by marked structural alterations throughout the CNS. In contrast, GFP expression or the expression of the ChR2/YFP fusion product in the same cell populations did not result in either cognitive or structural deficits. GABAergic lacZ expression caused significantly decreased hyper-arousal and mild cognitive deficits. Attenuated structural and behavioral consequences of lacZ expression could also be induced in adulthood, and lacZ transfection in neuronal cell cultures significantly decreased their viability. Our findings provide a strong caveat against the use of lacZ reporter mice for phenotyping studies and point to a particular sensitivity of the hippocampus formation to detrimental consequences of lacZ expression. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Lafuente, M J; Petit, T; Gancedo, C
1997-12-22
We have constructed a series of plasmids to facilitate the fusion of promoters with or without coding regions of genes of Schizosaccharomyces pombe to the lacZ gene of Escherichia coli. These vectors carry a multiple cloning region in which fission yeast DNA may be inserted in three different reading frames with respect to the coding region of lacZ. The plasmids were constructed with the ura4+ or the his3+ marker of S. pombe. Functionality of the plasmids was tested measuring in parallel the expression of fructose 1,6-bisphosphatase and beta-galactosidase under the control of the fbp1+ promoter in different conditions.
A gene expression resource generated by genome-wide lacZ profiling in the mouse
Tuck, Elizabeth; Estabel, Jeanne; Oellrich, Anika; Maguire, Anna Karin; Adissu, Hibret A.; Souter, Luke; Siragher, Emma; Lillistone, Charlotte; Green, Angela L.; Wardle-Jones, Hannah; Carragher, Damian M.; Karp, Natasha A.; Smedley, Damian; Adams, Niels C.; Bussell, James N.; Adams, David J.; Ramírez-Solis, Ramiro; Steel, Karen P.; Galli, Antonella; White, Jacqueline K.
2015-01-01
ABSTRACT Knowledge of the expression profile of a gene is a critical piece of information required to build an understanding of the normal and essential functions of that gene and any role it may play in the development or progression of disease. High-throughput, large-scale efforts are on-going internationally to characterise reporter-tagged knockout mouse lines. As part of that effort, we report an open access adult mouse expression resource, in which the expression profile of 424 genes has been assessed in up to 47 different organs, tissues and sub-structures using a lacZ reporter gene. Many specific and informative expression patterns were noted. Expression was most commonly observed in the testis and brain and was most restricted in white adipose tissue and mammary gland. Over half of the assessed genes presented with an absent or localised expression pattern (categorised as 0-10 positive structures). A link between complexity of expression profile and viability of homozygous null animals was observed; inactivation of genes expressed in ≥21 structures was more likely to result in reduced viability by postnatal day 14 compared with more restricted expression profiles. For validation purposes, this mouse expression resource was compared with Bgee, a federated composite of RNA-based expression data sets. Strong agreement was observed, indicating a high degree of specificity in our data. Furthermore, there were 1207 observations of expression of a particular gene in an anatomical structure where Bgee had no data, indicating a large amount of novelty in our data set. Examples of expression data corroborating and extending genotype-phenotype associations and supporting disease gene candidacy are presented to demonstrate the potential of this powerful resource. PMID:26398943
Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.
Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A
1996-01-01
We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.
Koponen, Jonna K; Turunen, Anna-Mari; Ylä-Herttuala, Seppo
2002-03-01
Real-time PCR is a powerful method for the quantification of gene expression in biological samples. This method uses TaqMan chemistry based on the 5' -exonuclease activity of the AmpliTaq Gold DNA polymerase which releases fluorescence from hybridized probes during synthesis of each new PCR product. Many gene therapy studies use lacZ, encoding Escherichia coli beta-galactosidase, as a marker gene. Our results demonstrate that E. coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ gene expression and decreases sensitivity of the method below the level required for biodistribution and long-term gene expression studies. In biodistribution analyses the contamination can lead to false-negative results by masking low-level lacZ expression in target and ectopic tissues, and false-positive results if sufficient controls are not used. We conclude that, to get reliable TaqMan results with lacZ, adequate controls should be included in each run to rule out contamination from AmpliTaq Gold polymerase.
NASA Technical Reports Server (NTRS)
Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.
2001-01-01
Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.
Pichery, Mélanie; Mirey, Emilie; Mercier, Pascale; Lefrancais, Emma; Dujardin, Arnaud; Ortega, Nathalie; Girard, Jean-Philippe
2012-04-01
IL-33 (previously known as NF from high endothelial venules) is an IL-1 family cytokine that signals through the ST2 receptor and drives cytokine production in mast cells, basophils, eosinophils, invariant NKT and NK cells, Th2 lymphocytes, and type 2 innate immune cells (natural helper cells, nuocytes, and innate helper 2 cells). Little is known about endogenous IL-33; for instance, the cellular sources of IL-33 in mouse tissues have not yet been defined. In this study, we generated an Il-33-LacZ gene trap reporter strain (Il-33(Gt/Gt)) and used this novel tool to analyze expression of endogenous IL-33 in vivo. We found that the Il-33 promoter exhibits constitutive activity in mouse lymphoid organs, epithelial barrier tissues, brain, and embryos. Immunostaining with anti-IL-33 Abs, using Il-33(Gt/Gt) (Il-33-deficient) mice as control, revealed that endogenous IL-33 protein is highly expressed in mouse epithelial barrier tissues, including stratified squamous epithelia from vagina and skin, as well as cuboidal epithelium from lung, stomach, and salivary gland. Constitutive expression of IL-33 was not detected in blood vessels, revealing the existence of species-specific differences between humans and mice. Importantly, IL-33 protein was always localized in the nucleus of producing cells with no evidence for cytoplasmic localization. Finally, strong expression of the Il-33-LacZ reporter was also observed in inflamed tissues, in the liver during LPS-induced endotoxin shock, and in the lung alveoli during papain-induced allergic airway inflammation. Together, our findings support the possibility that IL-33 may function as a nuclear alarmin to alert the innate immune system after injury or infection in epithelial barrier tissues.
Lu, Yifei; Yan, Hongxiang; Deng, Jiezhong; Huang, Zhigang; Jin, Xurui; Yu, Yanlan; Hu, Qiwen; Hu, Fuquan; Wang, Jing
2017-09-18
Lactococcus lactis is a food grade probiotics and widely used to express heterologous proteins. Generally, target genes are knocked into the L. lactis genome through double-crossover recombination to express heterologous proteins stably. However, creating marker-less heterologous genes knocked-in clones is laborious. In this study, an efficient heterologous gene knock-in reporter system was developed in L. lactis NZ9000. Our knock-in reporter system consists of a temperature-sensitive plasmid pJW and a recombinant L. lactis strain named NZB. The pJW contains homologous arms, and was constructed to knock-in heterologous genes at a fixed locus of NZ9000 genome. lacZ (β-galactosidase) gene was knocked into the chromosome of NZ9000 as a counter-selective marker through the plasmid pJW to generate NZB. The engineered NZB strain formed blue colonies on X-Gal plate. The desired double-crossover mutants formed white colonies distinctive from the predominantly blue colonies (parental and plasmid-integrated clones) when the embedded lacZ was replaced with the target heterologous genes carried by pJW in NZB. By using the system, the heterologous gene knocked-in clones are screened by colony phenotype change rather than by checking colonies individually. Our new knock-in reporter system provides an efficient method to create heterologous genes knocked-in clones.
Highly efficient gene transfer into adult ventricular myocytes by recombinant adenovirus.
Kirshenbaum, L A; MacLellan, W R; Mazur, W; French, B A; Schneider, M D
1993-01-01
Molecular dissection of mechanisms that govern the differentiated cardiac phenotype has, for cogent technical reasons, largely been undertaken to date in neonatal ventricular myocytes. To circumvent expected limitations of other methods, the present study was initiated to determine whether replication-deficient adenovirus would enable efficient gene transfer to adult cardiac cells in culture. Adult rat ventricular myocytes were infected, 24 h after plating, with adenovirus type 5 containing a cytomegalovirus immediate-early promoter-driven lacZ reporter gene and were assayed for the presence of beta-galactosidase 48 h after infection. The frequency of lacZ+ rod-shaped myocytes was half-maximal at 4 x 10(5) plaque-forming units (PFU) and approached 90% at 1 x 10(8) PFU. Uninfected cells and cells infected with lacZ- virus remained colorless. Beta-galactosidase activity concurred with the proportion of lacZ+ cells and was contingent on the exogenous lacZ gene. At 10(8) PFU/dish, cell number, morphology, and viability each were comparable to uninfected cells. Thus, adult ventricular myocytes are amenable to efficient gene transfer with recombinant adenovirus. The relative uniformity for gene transfer by adenovirus should facilitate tests to determine the impact of putative regulators upon the endogenous genes and gene products of virally modified adult ventricular muscle cells. Images PMID:8326005
Progress in gene targeting and gene therapy for retinitis pigmentosa
DOE Office of Scientific and Technical Information (OSTI.GOV)
Farrar, G.J.; Humphries, M.M.; Erven, A.
1994-09-01
Previously, we localized disease genes involved in retinitis pigmentosa (RP), an inherited retinal degeneration, close to the rhodopsin and peripherin genes on 3q and 6p. Subsequently, we and others identified mutations in these genes in RP patients. Currently animal models for human retinopathies are being generated using gene targeting by homologous recombination in embryonic stem (ES) cells. Genomic clones for retinal genes including rhodopsin and peripherin have been obtained from a phage library carrying mouse DNA isogenic with the ES cell line (CC1.2). The peripherin clone has been sequenced to establish the genomic structure of the mouse gene. Targeting vectorsmore » for rhodopsin and peripherin including a neomycin cassette for positive selection and thymidine kinase genes enabling selection against random intergrants are under construction. Progress in vector construction will be presented. Simultaneously we are developing systems for delivery of gene therapies to retinal tissues utilizing replication-deficient adenovirus (Ad5). Efficacy of infection subsequent to various methods of intraocular injection and with varying viral titers is being assayed using an adenovirus construct containing a CMV promoter LacZ fusion as reporter and the range of tissues infected and the level of duration of LacZ expression monitored. Viral constructs with the LacZ reporter gene under the control of retinal specific promoters such as rhodopsin and IRBP cloned into pXCJL.1 are under construction. An update on developments in photoreceptor cell-directed expression of virally delivered genes will be presented.« less
Stefan, Alessandra; Schwarz, Flavio; Bressanin, Daniela; Hochkoeppler, Alejandro
2010-11-01
Silencing of the lacZ gene in Escherichia coli was attempted by means of the expression of antisense RNAs (asRNAs) in vivo. A short fragment of lacZ was cloned into the pBAD expression vector, in reverse orientation, using the EcoRI and PstI restriction sites. This construct (pBAD-Zcal1) was used to transform E. coli cells, and the antisense transcription was induced simply by adding arabinose to the culture medium. We demonstrated that the Zcal1 asRNA effectively silenced lacZ using β-galactosidase activity determinations, SDS-PAGE, and Western blotting. Because the concentration of the lac mRNA was always high in cells that expressed Zcal1, we hypothesize that this antisense acts by inhibiting messenger translation. Similar analyses, performed with a series of site-specific Zcal1 mutants, showed that the Shine-Dalgarno sequence, which is conferred by the pBAD vector, is an essential requisite for silencing competence. Indeed, the presence of the intact Shine-Dalgarno sequence positively affects asRNA stability and, hence, silencing effectiveness. Our observations will contribute to the understanding of the main determinants of silencing as exerted by asRNAs as well as provide useful support for the design of robust and efficient prokaryotic gene silencers. Copyright © 2010 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Seier, Tracey; Padgett, Dana R; Zilberberg, Gal; Sutera, Vincent A; Toha, Noor; Lovett, Susan T
2011-06-01
Strand misalignments at DNA repeats during replication are implicated in mutational hotspots. To study these events, we have generated strains carrying mutations in the Escherichia coli chromosomal lacZ gene that revert via deletion of a short duplicated sequence or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences. Using these strains, we demonstrate that mutation of the distal repeat of a quasipalindrome, with respect to replication fork movement, is about 10-fold higher than the proximal repeat, consistent with more common template switching on the leading strand. The leading strand bias was lost in the absence of exonucleases I and VII, suggesting that it results from more efficient suppression of template switching by 3' exonucleases targeted to the lagging strand. The loss of 3' exonucleases has no effect on strand misalignment at direct repeats to produce deletion. To compare these events to other mutations, we have reengineered reporters (designed by Cupples and Miller 1989) that detect specific base substitutions or frameshifts in lacZ with the reverting lacZ locus on the chromosome rather than an F' element. This set allows rapid screening of potential mutagens, environmental conditions, or genetic loci for effects on a broad set of mutational events. We found that hydroxyurea (HU), which depletes dNTP pools, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple frameshifts, or base substitutions. Mutations in nucleotide diphosphate kinase, ndk, significantly elevated simple mutations but had little effect on the templated class. Zebularine, a cytosine analog, elevated all classes.
A perspective of gene therapy in the glaucomas.
Kaufman, P L; Jia, W W; Tan, J; Chen, Z; Gabelt, B T; Booth, V; Tufaro, F; Cynader, M
1999-06-01
Gene therapy in the anterior and posterior segment tissues may have the potential to favorably influence aqueous hydrodynamics and retinal ganglion cell biology, thereby preventing, delaying, or minimizing glaucomatous damage to the optic nerve. We demonstrated the feasibility of using a herpes viral vector (ribonucleotide reductase defective HSV-1, hrR3) to deliver the lacZ reporter gene to living cat and rat eyes. Cats received injections into the anterior chamber and rats into the vitreous cavity. In cats, lacZ expression was detectable at 1 to 2 days in the anterior outer portion of the ciliary muscle and the lining of the intertrabecular spaces of the corneoscleral and uveal meshwork. Rat eyes showed lacZ expression in the retinal pigment epithelium and photoreceptor outer segments 2 days after injection.
Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.
2013-01-01
To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051
Deletion of p66Shc in mice increases the frequency of size-change mutations in the lacZ transgene.
Beltrami, Elena; Ruggiero, Antonella; Busuttil, Rita; Migliaccio, Enrica; Pelicci, Pier Giuseppe; Vijg, Jan; Giorgio, Marco
2013-04-01
Upon oxidative challenge the genome accumulates adducts and breaks that activate the DNA damage response to repair, arrest, or eliminate the damaged cell. Thus, reactive oxygen species (ROS) generated by endogenous oxygen metabolism are thought to affect mutation frequency. However, few studies determined the mutation frequency when oxidative stress is reduced. To test whether in vivo spontaneous mutation frequency is altered in mice with reduced oxidative stress and cell death rate, we crossed p66Shc knockout (p66KO) mice, characterized by reduced intracellular concentration of ROS and by impaired apoptosis, with a transgenic line harboring multiple copies of the lacZ mutation reporter gene as part of a plasmid that can be recovered from organs into Escherichia coli to measure mutation rate. Liver and small intestine from 2- to 24-month-old, lacZ (p66Shc+/+) and lacZp66KO mice, were investigated revealing no difference in overall mutation frequency but a significant increase in the frequency of size-change mutations in the intestine of lacZp66KO mice. This difference was further increased upon irradiation of mice with X-ray. In addition, we found that knocking down cyclophilin D, a gene that facilitates mitochondrial apoptosis acting downstream of p66Shc, increased the size-change mutation frequency in small intestine. Size-change mutations also accumulated in death-resistant embryonic fibroblasts from lacZp66KO mice treated with H2 O2 . These results indicate that p66Shc plays a role in the accumulation of DNA rearrangements and suggest that p66Shc functions to clear damaged cells rather than affect DNA metabolism. © 2012 The Authors Aging Cell © 2012 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.
Wu, Yi-Hsuan; Taggart, Janet; Song, Pamela Xiyao; MacDiarmid, Colin; Eide, David J.
2016-01-01
The Msc2 and Zrg17 proteins of Saccharomyces cerevisiae form a complex to transport zinc into the endoplasmic reticulum. ZRG17 is transcriptionally induced in zinc-limited cells by the Zap1 transcription factor. In this report, we show that MSC2 mRNA also increases (~1.5 fold) in zinc-limited cells. The MSC2 gene has two in-frame ATG codons at its 5’ end, ATG1 and ATG2; ATG2 is the predicted initiation codon. When the MSC2 promoter was fused at ATG2 to the lacZ gene, we found that unlike the chromosomal gene this reporter showed a 4-fold decrease in lacZ mRNA in zinc-limited cells. Surprisingly, β-galactosidase activity generated by this fusion gene increased ~7 fold during zinc deficiency suggesting the influence of post-transcriptional factors. Transcription of MSC2ATG2-lacZ was found to start upstream of ATG1 in zinc-replete cells. In zinc-limited cells, transcription initiation shifted to sites just upstream of ATG2. From the results of mutational and polysome profile analyses, we propose the following explanation for these effects. In zinc-replete cells, MSC2ATG2-lacZ mRNA with long 5’ UTRs fold into secondary structures that inhibit translation. In zinc-limited cells, transcripts with shorter unstructured 5’ UTRs are generated that are more efficiently translated. Surprisingly, chromosomal MSC2 did not show start site shifts in response to zinc status and only shorter 5’ UTRs were observed. However, the shifts that occur in the MSC2ATG2-lacZ construct led us to identify significant transcription start site changes affecting the expression of ~3% of all genes. Therefore, zinc status can profoundly alter transcription initiation across the yeast genome. PMID:27657924
Direct adenovirus-mediated gene delivery to the temporomandibular joint in guinea-pigs.
Kuboki, T; Nakanishi, T; Kanyama, M; Sonoyama, W; Fujisawa, T; Kobayashi, K; Ikeda, T; Kubo, T; Yamashita, A; Takigawa, M
1999-09-01
Adenovirus vector system is expected to be useful for direct gene therapy for joint disease. This study first sought to confirm that foreign genes can be transferred to articular chondrocytes in primary culture. Next, recombinant adenovirus vectors harbouring beta-galactosidase gene (LacZ) was injected directly into the temporomandibular joints of Hartley guinea-pigs to clarify the in vivo transfer availability of the adenovirus vectors. Specifically, recombinant adenovirus harbouring LacZ gene (AxlCALacZ) was injected into the upper joint cavities of both mandibular joints of four male 6-week-old Hartley guinea-pigs. Either the same amount of recombinant adenovirus without LacZ gene (Axlw) suspension (placebo) or the same amount of phosphate-buffered saline solution (control) were injected into the upper joint cavities of both joints of another four male guinea-pigs. At 1, 2, 3 and 4 weeks after injection, the joints were dissected and the expression of delivered LacZ was examined by 5-bromo-4-chloro-3-indolyl-beta-D-galactopyranoside (X-gal) staining and reverse transcriptase-polymerase chain reaction (RT-PCR). To investigate the expression of transferred gene in other organs, total RNA was extracted from liver, kidney, heart and brain and the expression of LacZ mRNA and 18 S ribosomal RNA were analysed by RT-PCR. Clear expression of LacZ was observed in the articular surfaces of the temporal tubercle, articular disc and synovium of the temporomandibular joints even 4 weeks after injection in the AxlCALacZ-injected group, while no expression was detected in placebo and control groups. Histological examination confirmed that LacZ activity was clearly detected in a few cell layers of the articular surface tissues, which is much more efficient than in a previously study of the knee joint. In the other organs, expression of the delivered transgene was not observed. Based on these findings, direct gene delivery into the articular surface of the temporomandibular joint
Hashimoto-Gotoh, A; Yoshikawa, R; Miyazawa, T
2015-09-01
To avoid contamination of adventitious gammaretroviruses in biological products such as vaccines, it is necessary to check the master seed cells for manufacturing. There are several assays to detect infectious gammaretroviruses. Among these, sarcoma-positive, leukemia-negative (S+L-) assay is a classical infectivity assay, which is often recommended in governmental guidelines. The S+L- cells used in S+L- assay generate unique focus upon the infection of replication-competent gammaretroviruses. Although S+L- assay is well recognized for the detection, their applicability is questionable in some cases. On the other hand, LacZ marker rescue (LMR) assay detects infectious gammaretroviruses by transducing LacZ marker gene to the target cells, which shows lacZ-positive foci if the infectious virus is present. In this study, we compared LMR and S+L- assays for detection of a variety of endogenous and exogenous gammaretroviruses. As results, LMR assay could detect all gammaretroviruses examined. On the other hand, S+L- assay using feline S+L- cells, termed QN10S, could not detect porcine endogenous retrovirus (PERV) subgroups A/B. Further, S+L- mink cells could not detect feline leukemia virus subgroups B in addition to PERV-A/B. These data indicate that LMR assay is better suited to detect wider range of gammaretroviruses. Copyright © 2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.
Expression of the homeotic gene mab-5 during Caenorhabditis elegans embryogenesis.
Cowing, D W; Kenyon, C
1992-10-01
mab-5 is a member of a complex of homeobox-containing genes evolutionarily related to the Antennapedia and bithorax complexes of Drosophila melanogaster. Like the homeotic genes in Drosophila, mab-5 is required in a particular region along the anterior-posterior body axis, and acts during postembryonic development to give cells in this region their characteristic identities. We have used a mab-5-lacZ fusion integrated into the C. elegans genome to study the posterior-specific expression of mab-5 during embryogenesis. The mab-5-lacZ fusion was expressed in the posterior of the embryo by 180 minutes after the first cleavage, indicating that the mechanisms responsible for the position-specific expression of mab-5-lacZ act at a relatively early stage of embryogenesis. In embryos homozygous for mutations in the par genes, which disrupt segregation of factors during early cleavages, expression of mab-5-lacZ was no longer localized to the posterior. This suggests that posterior-specific expression of mab-5 depends on the appropriate segregation of developmental factors during early embryogenesis. After extrusion of any blastomere of the four-cell embryo, descendants of the remaining three cells could still express the mab-5-lacZ fusion. In these partial embryos, however, the fusion was often expressed in cells scattered throughout the embryo, suggesting that cell-cell interactions and/or proper positioning of early blastomeres are required for mab-5 expression to be localized to the posterior.
Zhang, Chuan-Xi; Hu, Cui; Wu, Xiang-Fu
1998-01-01
The coding region of BmvPK-1 gene of Bombyx mori NPV (Strain ZJ8) is 828 nt long and encodes a 276 aa polypeptide with predicted molecular mass of 32 kD. Dot blot analysis showed its mRNA to be gene is first detectable at 18 h p.i. and reaching the highest transcriptional level at 48 h p.i. The result suggested that BmvPK-1 gene is a late or very late gene. The most conserved 365 bp of the BmvPK-1 gene was deleted in a transfer vector (pUCPK-lac), and a report gene (lacZ) was inserted in the deleted position. Cotransfection of BmN cells with pUCPK-lac DNA and BmNPV DNA resulted in the recombinant virus which expressed detectable product of lacZ gene. But the virus with the deleted BmvPK-1 gene could not be isolated from the wild BmNPV by plaque purification method. The result showed that the BmvPK-1 gene deleted virus can multiply only with the help of the product of this gene from the wild type virus, and the gene is necessary for the virus to finish its life cycle in the cultured cells.
Transduction of ferret airway epithelia using a pre-treatment and lentiviral gene vector.
Cmielewski, Patricia; Farrow, Nigel; Donnelley, Martin; McIntyre, Chantelle; Penny-Dimri, Jahan; Kuchel, Tim; Parsons, David
2014-11-21
The safety and efficiency of gene therapies for cystic fibrosis (CF) need to be assessed in pre-clinical models. Using the normal ferret, this study sought to determine whether ferret airway epithelia could be transduced with a lysophosphatidylcholine (LPC) pre-treatment followed by a VSV-G pseudotyped HIV-1 based lentiviral (LV) vector, in preparation for future studies in CF ferrets. Six normal ferrets (7 -8 weeks old) were treated with a 150 μL LPC pre-treatment, followed one hour later by a 500 μL LV vector dose containing the LacZ transgene. LacZ gene expression in the conducting airways and lung was assessed by X-gal staining after 7 days. The presence of transduction in the lung, as well as off-target transduction in the liver, spleen and gonads, were assessed by qPCR. The levels of LV vector p24 protein bio-distribution in blood sera were assessed by ELISA at 0, 1, 3, 5 and 7 days. The dosing protocol was well tolerated. LacZ gene expression was observed en face in the trachea of all animals. Histology showed that ciliated and basal cells were transduced in the trachea, with rare LacZ transduced single cells noted in lung. p24 levels was not detectable in the sera of 5 of the 6 animals. The LacZ gene was not detected in the lung tissue and no off-target transduction was detected by qPCR. This study shows that ferret airway epithelia are transducible using our unique two-step pre-treatment and LV vector dosing protocol. We have identified a number of unusual anatomical factors that are likely to influence the level of transduction that can be achieved in ferret airways. The ability to transduce ferret airway epithelium is a promising step towards therapeutic LV-CFTR testing in a CF ferret model.
Genetics in methylotrophic bacteria: Appendix. Final report
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lidstrom, M.E.
This research has focused primarily on promoters in Methylobacterium extorquens AM1 and in methanotrophic bacteria. In Methylobacterium extorquens work continued on the moxF promoter. The author constructed chromosomal lacZ fusions of this promoter to avoid the regulation problems of plasmid-borne fragments and has shown that this is regulated normally in the chromosome. She has constructed lacZ fusions to some of the mox genes involved in the synthesis of the cofactor, PQQ, in order to carry out similar analysis of transcription of PQQ genes. The author has continued to isolate mox genes in methanotrophs for the purpose of studying their promotersmore » and transcriptional regulation.« less
Gfi1-Cre knock-in mouse line: A tool for inner ear hair cell-specific gene deletion
Yang, Hua; Gan, Jean; Xie, Xiaoling; Deng, Min; Feng, Liang; Chen, Xiaowei; Gao, Zhiqiang; Gan, Lin
2010-01-01
Summary Gfi1encodes a zinc-finger transcription factor essential for the development and maintenance of haematopoiesis and the inner ear. In mouse inner ear, Gfi1 expression is confined to hair cells during development and in adulthood. To construct a genetic tool for inner ear hair cell-specific gene deletion, we generated a Gfi1-Cre mouse line by knocking-in Cre coding sequences into the Gfi1 locus and inactivating the endogenous Gfi1. The specificity and efficiency of Gfi1-Cre recombinase-mediated recombination in the developing inner ear was revealed through the expression of the conditional R26R-lacZ reporter gene. The onset of lacZ expression in the Gfi1Cre/+ inner ear was first detected at E13.5 in the vestibule and at E15.5 in the cochlea, coinciding with the generation of hair cells. Throughout inner ear development, lacZ expression was detected only in hair cells. Thus, Gfi1-Cre knock-in mouse line provides a useful tool for gene manipulations specifically in inner ear hair cells. PMID:20533399
Schuster-Gossler, K; Bilinski, P; Sado, T; Ferguson-Smith, A; Gossler, A
1998-06-01
We have isolated a novel mouse gene (Gtl2) from the site of a gene trap integration (Gtl2lacZ) that gave rise to developmentally regulated lacZ expression, and a dominant parental-origin-dependent phenotype. Heterozygous Gtl2lacZ mice that inherited the transgene from the father showed a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype was strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. Gtl2 expression is highly similar to the beta-galactosidase staining pattern, and is down-regulated but not abolished in mice carrying the Gtl2lacZ insertion. In early postimplantation embryos, Gtl2 is expressed in the visceral yolk sac and embryonic ectoderm. During subsequent development and organogenesis, Gtl2 transcripts are abundant in the paraxial mesoderm closely correlated with myogenic differentiation, in parts of the central nervous system, and in the epithelial ducts of developing excretory organs. The Gtl2 gene gives rise to various differentially spliced transcripts, which contain multiple small open reading frames (ORF). However, none of the ATG codons of these ORFs is in the context of a strong Kozak consensus sequence for initiation of translation, suggesting that Gtl2 might function as an RNA. Nuclear Gtl2 RNA was detected in a temporally and spatially regulated manner, and partially processed Gtl2 transcripts were readily detected in Northern blot hybridizations of polyadenylated RNA, suggesting that primary Gtl2 transcripts are differently processed in various cell types during development. Gtl2 transcript levels are present in parthenogenic embryos but may be reduced, consistent with the pattern of inheritance of the Gtl2lacZ phenotype.
Chakraborty, Anirban; Tapryal, Nisha; Venkova, Tatiana; Horikoshi, Nobuo; Pandita, Raj K.; Sarker, Altaf H.; Sarkar, Partha S.; Pandita, Tej K.; Hazra, Tapas K.
2016-01-01
DNA double-strand breaks (DSBs) leading to loss of nucleotides in the transcribed region can be lethal. Classical non-homologous end-joining (C-NHEJ) is the dominant pathway for DSB repair (DSBR) in adult mammalian cells. Here we report that during such DSBR, mammalian C-NHEJ proteins form a multiprotein complex with RNA polymerase II and preferentially associate with the transcribed genes after DSB induction. Depletion of C-NHEJ factors significantly abrogates DSBR in transcribed but not in non-transcribed genes. We hypothesized that nascent RNA can serve as a template for restoring the missing sequences, thus allowing error-free DSBR. We indeed found pre-mRNA in the C-NHEJ complex. Finally, when a DSB-containing plasmid with several nucleotides deleted within the E. coli lacZ gene was allowed time to repair in lacZ-expressing mammalian cells, a functional lacZ plasmid could be recovered from control but not C-NHEJ factor-depleted cells, providing important mechanistic insights into C-NHEJ-mediated error-free DSBR of the transcribed genome. PMID:27703167
In vitro study for laser gene transfer in BHK-21 fibroblast cell line
NASA Astrophysics Data System (ADS)
Abdel Aziz, M.; Salem, D. S.; Salama, M. S.; Badr, Y.
2009-02-01
Modifications to our previously introduced system for laser microbeam cell surgery were carried out in the present work to match animal cells. These modifications included: 1- Using other laser system that used before, Excimer laser with 193 and 308 nm wavelengths. The used laser here, is He-Cd with low power and 441.5 nm wavelength in the visible region. 2- Instead of using pulsed laser, we used here CW He-Cd chopped by electrical chopper, which is synchronized with the mechanical motion of the mobile stage with step 40 microns, according to cell dimensions to avoid puncturing the same cell twice. The advantages of the modified here laser setup for gene transfer is: it is less damaging to the sensitive animal cell which has thin cell membrane. The present work aimed to: 1- Design a modified laser microbeam cell surgery, applicable to animal cells, such as fibroblast cells 2- To examine the efficiency of such system. 3- To assure gene transfer and its expression in the used cells. 4- To evaluate the ultra damages produced from using the laser beam as a modality for gene transfer. On the other wards, to introduce: safe, efficient and less damaging modality for gene transfer in animal cells. To achieve these goals, we applied the introduced here home-made laser setup with its synchronized parameters to introduce pBK-CMV phagemid, containing LacZ and neomycin resistance (neor )genes into BHK-21 fibroblast cell line. The results of the present work showed that: 1- Our modified laser microbeam cell surgery setup proved to be useful and efficient tool for gene transfer into fibroblast cells. 2- The presence and expression of LacZ gene was achieved using histochemical LacZ assay. 3- Selection of G418 antibiotic sensitivity assay confirmed the presence and expression towards stability of neor gene with time. 4- Presence of LacZ and neor genes in the genomic DNA of transfected fibroblast cells was indicated using PCR analysis. 5- Transmission electron microscopy indicated
Liu, Xiaoli; Simpson, Jeremy A; Brunt, Keith R; Ward, Christopher A; Hall, Sean R R; Kinobe, Robert T; Barrette, Valerie; Tse, M Yat; Pang, Stephen C; Pachori, Alok S; Dzau, Victor J; Ogunyankin, Kofo O; Melo, Luis G
2007-07-01
We reported previously that predelivery of heme oxygenase-1 (HO-1) gene to the heart by adeno-associated virus-2 (AAV-2) markedly reduces ischemia and reperfusion (I/R)-induced myocardial injury. However, the effect of preemptive HO-1 gene delivery on long-term survival and prevention of postinfarction heart failure has not been determined. We assessed the effect of HO-1 gene delivery on long-term survival, myocardial function, and left ventricular (LV) remodeling 1 yr after myocardial infarction (MI) using echocardiographic imaging, pressure-volume (PV) analysis, and histomorphometric approaches. Two groups of Lewis rats were injected with 2 x 10(11) particles of AAV-LacZ (control) or AAV-human HO-1 (hHO-1) in the anterior-posterior apical region of the LV wall. Six weeks after gene transfer, animals were subjected to 30 min of ischemia by ligation of the left anterior descending artery followed by reperfusion. Echocardiographic measurements and PV analysis of LV function were obtained at 2 wk and 12 mo after I/R. One year after acute MI, mortality was markedly reduced in the HO-1-treated animals compared with the LacZ-treated animals. PV analysis demonstrated significantly enhanced LV developed pressure, elevated maximal dP/dt, and lower end-diastolic volume in the HO-1 animals compared with the LacZ animals. Echocardiography showed a larger apical anterior-to-posterior wall ratio in HO-1 animals compared with LacZ animals. Morphometric analysis revealed extensive myocardial scarring and fibrosis in the infarcted LV area of LacZ animals, which was reduced by 62% in HO-1 animals. These results suggest that preemptive HO-1 gene delivery may be useful as a therapeutic strategy to reduce post-MI LV remodeling and heart failure.
Kamm, Gretel B.; López-Leal, Rodrigo; Lorenzo, Juan R.; Franchini, Lucía F.
2013-01-01
The developmental brain gene NPAS3 stands out as a hot spot in human evolution because it contains the largest number of human-specific, fast-evolving, conserved, non-coding elements. In this paper we studied 2xHAR142, one of these elements that is located in the fifth intron of NPAS3. Using transgenic mice, we show that the mouse and chimp 2xHAR142 orthologues behave as transcriptional enhancers driving expression of the reporter gene lacZ to a similar NPAS3 expression subdomain in the mouse central nervous system. Interestingly, the human 2xHAR142 orthologue drives lacZ expression to an extended expression pattern in the nervous system. Thus, molecular evolution of 2xHAR142 provides the first documented example of human-specific heterotopy in the forebrain promoted by a transcriptional enhancer and suggests that it may have contributed to assemble the unique properties of the human brain. PMID:24218632
2009-10-01
NUMBER E -Mail: 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER...transcriptional activation, protein expression, and protein interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most...1) Cell preparation (a) Stably transfected PC3 cell line: E . coli lacZ gene (from pSV-β-gal vector, Promega, Madison,WI) was inserted into high
Woods, J P; Heinecke, E L; Goldman, W E
1998-04-01
We developed an efficient electrotransformation system for the pathogenic fungus Histoplasma capsulatum and used it to examine the effects of features of the transforming DNA on transformation efficiency and fate of the transforming DNA and to demonstrate fungal expression of two recombinant Escherichia coli genes, hph and lacZ. Linearized DNA and plasmids containing Histoplasma telomeric sequences showed the greatest transformation efficiencies, while the plasmid vector had no significant effect, nor did the derivation of the selectable URA5 marker (native Histoplasma gene or a heterologous Podospora anserina gene). Electrotransformation resulted in more frequent multimerization, other modification, or possibly chromosomal integration of transforming telomeric plasmids when saturating amounts of DNA were used, but this effect was not observed with smaller amounts of transforming DNA. We developed another selection system using a hygromycin B resistance marker from plasmid pAN7-1, consisting of the E. coli hph gene flanked by Aspergillus nidulans promoter and terminator sequences. Much of the heterologous fungal sequences could be removed without compromising function in H. capsulatum, allowing construction of a substantially smaller effective marker fragment. Transformation efficiency increased when nonselective conditions were maintained for a time after electrotransformation before selection with the protein synthesis inhibitor hygromycin B was imposed. Finally, we constructed a readily detectable and quantifiable reporter gene by fusing Histoplasma URA5 with E. coli lacZ, resulting in expression of functional beta-galactosidase in H. capsulatum. Demonstration of expression of bacterial genes as effective selectable markers and reporters, together with a highly efficient electrotransformation system, provide valuable approaches for molecular genetic analysis and manipulation of H. capsulatum, which have proven useful for examination of targeted gene disruption
Shen, Jin-Song; Meng, Xing-Li; Yokoo, Takashi; Sakurai, Ken; Watabe, Kazuhiko; Ohashi, Toya; Eto, Yoshikatsu
2005-05-01
Brain-directed prenatal gene therapy may benefit some lysosomal storage diseases that affect the central nervous system (CNS) before birth. Our previous study showed that intrauterine introduction of recombinant adenoviruses into cerebral ventricles results in efficient gene transfer to the CNS in the mouse. However, transgene expression decreased with time due to the non-integrative property of adenoviral vectors. In this study, in order to obtain permanent gene transduction, we investigated the feasibility of retrovirus-mediated in utero gene transduction. Concentrated retrovirus encoding the LacZ gene was injected into the cerebral ventricles of the embryos of normal and twitcher mice (a murine model of Krabbe disease) at embryonic day 12. The distribution and maintenance of the transgene expression in the recipient brain were analyzed histochemically, biochemically and by the quantitative polymerase chain reaction method pre- and postnatally. Efficient and highly persistent gene transduction to the brain was achieved both in normal and the twitcher mouse. Transduced neurons, astrocytes and oligodendrocytes were distributed throughout the brain. The transduced LacZ gene, its transcript and protein expression in the brain were maintained for 14 months without decrement. In addition, gene transduction to multiple tissues other than the brain was also detected at low levels. This study suggests that brain-directed in utero gene transfer using retrovirus vector may be beneficial to the treatment of lysosomal storage diseases with severe brain damage early in life, such as Krabbe disease. Copyright (c) 2005 John Wiley & Sons, Ltd.
Luo, Wangtai; Miao, Jing; Feng, Zhibin; Lu, Ruiyang; Sun, Xiaoqiang; Zhang, Baoshen; Ding, Weiqiu; Lu, Yang; Wang, Yanhua; Chi, Xiaoyan; Ge, Yihe
2018-05-28
In our recent work, we found that pyrrolnitrin, and not phenazines, pyrrolnitrin contributed to the suppression of the mycelia growth of Fusarium graminearum that causes heavy Fusarium head blight (FHB) disease in cereal crops. However, pyrrolnitrin production of Pseudomonas chlororaphis G05 in King's B medium was very low. Although a few regulatory genes mediating the prnABCD (the prn operon, pyrrolnitrin biosynthetic locus) expression have been identified, it is not enough for us to enhance pyrrolnitrin production by systematically constructing a genetically-engineered strain. To obtain new candidate genes involved in regulation of the prn operon expression, we successfully constructed a fusion mutant G05ΔphzΔprn::lacZ, in which most of the coding regions of the prn operon and the phzABCDEFG (the phz operon, phenazine biosynthetic locus) were deleted, and the promoter region plus the first thirty condons of the prnA was in-frame fused with the truncated lacZ gene on its chromosome. The expression of the fused lacZ reporter gene driven by the promoter of the prn operon made it easy for us to detect the level of the prn expression in terms of the color variation of colonies on LB agar plates supplemented with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal). With this fusion mutant as a recipient strain, mini-Tn5-based random insertional mutagenesis was then conducted. By picking up colonies with color change, it is possible for us to screen and identify new candidate genes involved in regulation of the prn expression. Identification of additional regulatory genes in further work could reasonably be expected to increase pyrrolnitrin production in G05 and to improve its biological control function.
Minigene-like inhibition of protein synthesis mediated by hungry codons near the start codon
Jacinto-Loeza, Eva; Vivanco-Domínguez, Serafín; Guarneros, Gabriel; Hernández-Sánchez, Javier
2008-01-01
Rare AGA or AGG codons close to the initiation codon inhibit protein synthesis by a tRNA-sequestering mechanism as toxic minigenes do. To further understand this mechanism, a parallel analysis of protein synthesis and peptidyl-tRNA accumulation was performed using both a set of lacZ constructs where AGAAGA codons were moved codon by codon from +2, +3 up to +7, +8 positions and a series of 3–8 codon minigenes containing AGAAGA codons before the stop codon. β-Galactosidase synthesis from the AGAAGA lacZ constructs (in a Pth defective in vitro system without exogenous tRNA) diminished as the AGAAGA codons were closer to AUG codon. Likewise, β-galactosidase expression from the reporter +7 AGA lacZ gene (plus tRNA, 0.25 μg/μl) waned as the AGAAGAUAA minigene shortened. Pth counteracted both the length-dependent minigene effect on the expression of β-galactosidase from the +7 AGA lacZ reporter gene and the positional effect from the AGAAGA lacZ constructs. The +2, +3 AGAAGA lacZ construct and the shortest +2, +3 AGAAGAUAA minigene accumulated the highest percentage of peptidyl-tRNAArg4. These observations lead us to propose that hungry codons at early positions, albeit with less strength, inhibit protein synthesis by a minigene-like mechanism involving accumulation of peptidyl-tRNA. PMID:18583364
Lang, Claus; Smith, Lucinda S.; Haney, Cara H.; Long, Sharon R.
2018-01-01
The formation of nitrogen fixing root nodules by Medicago truncatula and Sinorhizobium meliloti requires communication between both organisms and coordinated differentiation of plant and bacterial cells. After an initial signal exchange, the bacteria invade the tissue of the growing nodule via plant-derived tubular structures, called infection threads. The bacteria are released from the infection threads into invasion-competent plant cells, where they differentiate into nitrogen-fixing bacteroids. Both organisms undergo dramatic transcriptional, metabolic and morphological changes during nodule development. To identify plant processes that are essential for the formation of nitrogen fixing nodules after nodule development has been initiated, large scale mutageneses have been conducted to discover underlying plant symbiosis genes. Such screens yield numerous uncharacterized plant lines with nitrogen fixation deficient nodules. In this study, we report construction of a S. meliloti strain carrying four distinct reporter constructs to reveal stages of root nodule development. The strain contains a constitutively expressed lacZ reporter construct; a PexoY-mTFP fusion that is expressed in infection threads but not in differentiated bacteroids; a PbacA-mcherry construct that is expressed in infection threads and during bacteroid differentiation; and a PnifH-uidA construct that is expressed during nitrogen fixation. We used this strain together with fluorescence microscopy to study nodule development over time in wild type nodules and to characterize eight plant mutants from a fast neutron bombardment screen. Based on the signal intensity and the localization patterns of the reporter genes, we grouped mutants with similar phenotypes and placed them in a developmental context. PMID:29467773
Lang, Claus; Smith, Lucinda S; Long, Sharon R
2018-01-01
The formation of nitrogen fixing root nodules by Medicago truncatula and Sinorhizobium meliloti requires communication between both organisms and coordinated differentiation of plant and bacterial cells. After an initial signal exchange, the bacteria invade the tissue of the growing nodule via plant-derived tubular structures, called infection threads. The bacteria are released from the infection threads into invasion-competent plant cells, where they differentiate into nitrogen-fixing bacteroids. Both organisms undergo dramatic transcriptional, metabolic and morphological changes during nodule development. To identify plant processes that are essential for the formation of nitrogen fixing nodules after nodule development has been initiated, large scale mutageneses have been conducted to discover underlying plant symbiosis genes. Such screens yield numerous uncharacterized plant lines with nitrogen fixation deficient nodules. In this study, we report construction of a S. meliloti strain carrying four distinct reporter constructs to reveal stages of root nodule development. The strain contains a constitutively expressed lacZ reporter construct; a P exoY -mTFP fusion that is expressed in infection threads but not in differentiated bacteroids; a P bacA -mcherry construct that is expressed in infection threads and during bacteroid differentiation; and a P nifH -uidA construct that is expressed during nitrogen fixation. We used this strain together with fluorescence microscopy to study nodule development over time in wild type nodules and to characterize eight plant mutants from a fast neutron bombardment screen. Based on the signal intensity and the localization patterns of the reporter genes, we grouped mutants with similar phenotypes and placed them in a developmental context.
Li, Qianhong; Guo, Yiru; Wu, Wen-Jian; Ou, Qinghui; Zhu, Xiaoping; Tan, Wei; Yuan, Fangping; Chen, Ning; Dawn, Buddhadeb; Luo, Li; O'Brien, Erin; Bolli, Roberto
2011-11-01
The ultimate goal of prophylactic gene therapy is to confer permanent protection against ischemia. Although gene therapy with inducible nitric oxide synthase (iNOS) is known to protect against myocardial infarction at 3 days and up to 2 months, the long-term effects on myocardial ischemic injury and function are unknown. To address this issue, we created a recombinant adeno-associated viral vector carrying the iNOS gene (rAAV/iNOS), which enables long-lasting transgene expression. The ability of rAAV/iNOS to direct the expression of functional iNOS protein was confirmed in COS-7 cells before in vivo gene transfer. Mice received injections in the anterior LV wall of rAAV/LacZ or rAAV/iNOS; 1 year later, they underwent a 30-min coronary occlusion (O) and 4 h of reperfusion (R). iNOS gene transfer resulted in elevated iNOS protein expression (+3-fold vs. the LacZ group, n = 6; P < 0.05) and iNOS activity (+4.4-fold vs. the LacZ group, n = 6; P < 0.05) 1 year later. Infarct size (% of risk region) was dramatically reduced at 1 year after iNOS gene transfer (13.5 ± 2.2%, n = 12, vs. 41.7 ± 2.9%, n = 10, in the LacZ group; P < 0.05). The infarct-sparing effect of iNOS gene therapy at 1 year was as powerful as that observed 24 h after ischemic preconditioning (six 4-min O/4-min R cycles) (19.3 ± 2.3%, n = 11; P < 0.05). Importantly, compared with the LacZ group (n = 11), iNOS gene transfer (n = 10) had no effect on LV dimensions or function for up to 1 year (at 1 year: FS 34.5 ± 2.0 vs. 34.6 ± 2.6%, EF 57.0 ± 2.0 vs. 59.7 ± 2.9%, LVEDD 4.3 ± 0.1 vs. 4.2 ± 0.2 mm, LVESD 2.8 ± 0.1 vs. 2.9 ± 0.2 mm) (echocardiography). These data demonstrate, for the first time, that rAAV-mediated iNOS gene transfer affords long-term, probably permanent (1 year), cardioprotection without adverse functional consequences, providing a strong rationale for further preclinical testing of prophylactic gene therapy.
Minimal phenotype of mice homozygous for a null mutation in the forkhead/winged helix gene, Mf2.
Kume, T; Deng, K; Hogan, B L
2000-02-01
Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2(lacZ)) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes.
Dacquin, Romain; Starbuck, Michael; Schinke, Thorsten; Karsenty, Gérard
2002-06-01
Cell- and time-specific gene inactivation should enhance our knowledge of bone biology. Implementation of this technique requires construction of transgenic mouse lines expressing Cre recombinase in osteoblasts, the bone forming cell. We tested several promoter fragments for their ability to drive efficient Cre expression in osteoblasts. In the first mouse transgenic line, the Cre gene was placed under the control of the 2.3-kb proximal fragment of the alpha1(I)-collagen promoter, which is expressed at high levels in osteoblasts throughout their differentiation. Transgenic mice expressing this transgene in bone were bred with the ROSA26 reporter (R26R) strain in which the ROSA26 locus is targeted with a conditional LacZ reporter cassette. In R26R mice, Cre expression and subsequent Cre-mediated recombination lead to expression of the LacZ reporter gene, an event that can be monitored by LacZ staining. LacZ staining was detected in virtually all osteoblasts of alpha1(I)-Cre;R26R mice indicating that homologous recombination occurred in these cells. No other cell type stained blue. In the second line studied, the 1.3-kb fragment of osteocalcin gene 2 (OG2) promoter, which is active in differentiated osteoblasts, was used to drive Cre expression. OG2-Cre mice expressed Cre specifically in bone. However, cross of OG2-Cre mice with R26R mice did not lead to any detectable LacZ staining in osteoblasts. Lastly, we tested a more active artificial promoter derived from the OG2 promoter. The artificial OG2-Cre transgene was expressed by reverse transcriptase-polymerase chain reaction in cartilage and bone samples. After cross of the artificial OG2-Cre mice with R26R mice, we detected a LacZ staining in articular chondrocytes but not in osteoblasts. Our data suggest that the only promoter able to drive Cre expression at a level sufficient to induce recombination in osteoblasts is the alpha1(I)-collagen promoter. Copyright 2002 Wiley-Liss, Inc.
Minimal Phenotype of Mice Homozygous for a Null Mutation in the Forkhead/Winged Helix Gene, Mf2
Kume, Tsutomu; Deng, Keyu; Hogan, Brigid L. M.
2000-01-01
Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2lacZ) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes. PMID:10648626
2007-10-01
colored plates: ALL DTIC reproductions will be in black and white. 14. ABSTRACT The lacZ gene encoding E . coli beta-gal has already been...interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most commonly used reporter system.[34] However, the well-established...Figure 7 Moreover, we are deeply encouraged by the success on the synthesis of the target molecule M7, as shown in Figure 8. f e d cba OH N
Li, Qianhong; Guo, Yiru; Ou, Qinghui; Wu, Wen-Jian; Chen, Ning; Zhu, Xiaoping; Tan, Wei; Yuan, Fangping; Dawn, Buddhadeb; Luo, Li; Hunt, Gregory N; Bolli, Roberto
2011-11-01
Extensive evidence indicates that heme oxygenase-1 (HO-1) exerts potent cytoprotective effects in response to stress. Previous studies have shown that gene therapy with HO-1 protects against myocardial ischemia/reperfusion injury for up to 8 weeks after gene transfer. However, the long-term effects of HO-1 gene therapy on myocardial ischemic injury and function are unknown. To address this issue, we created a recombinant adeno-associated viral vector carrying the HO-1 gene (rAAV/HO-1) that enables long-lasting transgene expression. Mice received injections in the anterior LV wall of rAAV/LacZ (LacZ group) or rAAV/HO-1 (HO-1 group); 1 year later, they were subjected to a 30-min coronary occlusion (O) and 4 h of reperfusion (R). Cardiac HO-1 gene expression was confirmed at 1 month and 1 year after gene transfer by immunoblotting and immunohistochemistry analyses. In the HO-1 group, infarct size (% of risk region) was dramatically reduced at 1 year after gene transfer (11.2 ± 2.1%, n = 12, vs. 44.7 ± 3.6%, n = 8, in the LacZ group; P < 0.05). The infarct-sparing effects of HO-1 gene therapy at 1 year were as powerful as those observed 24 h after ischemic PC (six 4-min O/4-min R cycles) (15.0 ± 1.7%, n = 10). There were no appreciable changes in LV fractional shortening, LV ejection fraction, or LV end-diastolic or end-systolic diameter at 1 year after HO-1 gene transfer as compared to the age-matched controls or with the LacZ group. Histology showed no inflammation in the myocardium 1 year after rAAV/HO-1-mediated gene transfer. These results demonstrate, for the first time, that rAAV-mediated HO-1 gene transfer confers long-term (1 year), possibly permanent, cardioprotection without adverse functional consequences, providing proof of principle for the concept of achieving prophylactic cardioprotection (i.e., "immunization against infarction").
Msx genes define a population of mural cell precursors required for head blood vessel maturation.
Lopes, Miguel; Goupille, Olivier; Saint Cloment, Cécile; Lallemand, Yvan; Cumano, Ana; Robert, Benoît
2011-07-01
Vessels are primarily formed from an inner endothelial layer that is secondarily covered by mural cells, namely vascular smooth muscle cells (VSMCs) in arteries and veins and pericytes in capillaries and veinules. We previously showed that, in the mouse embryo, Msx1(lacZ) and Msx2(lacZ) are expressed in mural cells and in a few endothelial cells. To unravel the role of Msx genes in vascular development, we have inactivated the two Msx genes specifically in mural cells by combining the Msx1(lacZ), Msx2(lox) and Sm22α-Cre alleles. Optical projection tomography demonstrated abnormal branching of the cephalic vessels in E11.5 mutant embryos. The carotid and vertebral arteries showed an increase in caliber that was related to reduced vascular smooth muscle coverage. Taking advantage of a newly constructed Msx1(CreERT2) allele, we demonstrated by lineage tracing that the primary defect lies in a population of VSMC precursors. The abnormal phenotype that ensues is a consequence of impaired BMP signaling in the VSMC precursors that leads to downregulation of the metalloprotease 2 (Mmp2) and Mmp9 genes, which are essential for cell migration and integration into the mural layer. Improper coverage by VSMCs secondarily leads to incomplete maturation of the endothelial layer. Our results demonstrate that both Msx1 and Msx2 are required for the recruitment of a population of neural crest-derived VSMCs.
The mutY gene: a mutator locus in Escherichia coli that generates G.C----T.A transversions.
Nghiem, Y; Cabrera, M; Cupples, C G; Miller, J H
1988-01-01
We have used a strain with an altered lacZ gene, which reverts to wild type via only certain transversions, to detect transversion-specific mutators in Escherichia coli. Detection relied on a papillation technique that uses a combination of beta-galactosides to reveal blue Lac+ papillae. One class of mutators is specific for the G.C----T.A transversion as determined by the reversion pattern of a set of lacZ mutations and by the distribution of forward nonsense mutations in the lacI gene. The locus responsible for the mutator phenotype is designated mutY and maps near 64 min on the genetic map of E. coli. The mutY locus may act in a similar but reciprocal fashion to the previously characterized mutT locus, which results in A.T----C.G transversions. Images PMID:3128795
Souza, André L F; Invitti, Adriana L; Rego, Fabiane G M; Monteiro, Rose A; Klassen, Giseli; Souza, Emanuel M; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U
2010-02-01
The pathway of electron transport to nitrogenase in the endophytic beta-Proteobacterium Herbaspirillum seropedicae has not been characterized. We have generated mutants in two nif-associated genes encoding putative ferredoxins, fdxA and fdxN. The fdxA gene is part of the operon nifHDKENXorf1orf2fdxAnifQmodABC and is transcribed from the nifH promoter, as revealed by lacZ gene fusion. The fdxN gene is probably cotranscribed with the nifB gene. Mutational analysis suggests that the FdxA protein is essential for maximum nitrogenase activity, since the nitrogenase activity of the fdxA mutant strain was reduced to about 30% of that of the wild-type strain. In addition, the fdxA mutation had no effect on the nitrogenase switch-off in response to ammonium. Nitrogenase activity of a mutant strain lacking the fdxN gene was completely abolished. This phenotype was reverted by complementation with fdxN expressed under lacZ promoter control. The results suggest that the products of both the fdxA and fdxN genes are probably involved in electron transfer during nitrogen fixation.
2012-01-01
Background Glutamyl queuosine-tRNAAsp synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNAAsp. Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. Results The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. Conclusions The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri. PMID:23035718
Caballero, Valeria C; Toledo, Viviana P; Maturana, Cristian; Fisher, Carolyn R; Payne, Shelley M; Salazar, Juan Carlos
2012-10-05
Glutamyl queuosine-tRNA(Asp) synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNA(Asp). Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri.
In vivo retroviral gene transfer into human bronchial epithelia of xenografts.
Engelhardt, J F; Yankaskas, J R; Wilson, J M
1992-12-01
Cystic fibrosis (CF) is the most common lethal inherited disease in the Caucasian population with an incidence of approximately 1 in 2,500 live births. Pulmonary complications of CF, which are the most morbid aspects of the disease, are caused by primary abnormalities in epithelial cells that lead to impaired mucociliary clearance. One potential therapeutic strategy is to reconstitute expression of the CF gene in airway epithelia by somatic gene transfer. To this end, we have developed an animal model of the human airway using bronchial xenografts and have tested the efficiency of in vivo retroviral gene transfer. Using the LacZ reporter gene, we find the efficiency of in vivo retroviral gene transfer to be dramatically dependent on the regenerative and mitotic state of the epithelium. Within an undifferentiated regenerating epithelium in which 40% of nuclei labeled with BrdU, 5-10% retroviral gene transfer was obtained. In contrast, no gene transfer was noted in a fully differentiated epithelium in which 1% of nuclei labeled with BrdU. These findings suggest that retroviral mediated gene transfer to the airway in vivo may be feasible if the proper regenerative state can be induced.
Jornot, L; Morris, M A; Petersen, H; Moix, I; Rochat, T
2002-01-01
It has previously been shown that oxidants reduce the efficiency of adenoviral transduction in human umbilical vein endothelial cells (HUVECs). In this study, the effect of the antioxidant N-acetylcysteine (NAC) in adenovirus-mediated gene transfer has been investigated. HUVECs were pretreated or not with NAC, and infected with E1E3-deleted adenovirus (Ad) containing the LacZ gene expressed from the RSV-LTR promoter/enhancer in the presence and absence of NAC. Transgene expression was assessed at the protein level (histochemical staining, measurement of beta-Gal activity, and western blot), mRNA level (real-time RT-PCR) and gene level (nuclear run on) 24 h and 48 h after infection. Adenoviral DNA was quantitated by real-time PCR, and cell surface expression of Coxsackie/adenovirus receptors (CAR) was determined by FACS analysis. Pretreatment of cells with NAC prior to Ad infection enhanced beta-Gal activity by two-fold due to an increase in viral DNA, which was related to increased CAR expression. When NAC was present only during the post-infection period, a five-fold increase in beta-Gal activity and LacZ gene transcriptional activity was observed. When NAC was present during both the pretreatment and the post-infection period, beta-Gal activity was further enhanced, by 15-fold. Augmentation of beta-Gal activity was paralleled by an increase in beta-Gal protein and mRNA levels. NAC did not affect the half-life of LacZ mRNA. Pretreatment with NAC prior to Ad infection enhances virus entry, while treatment with NAC post-infection increases transgene transcription. This strategy permits the use of lower adenoviral loads and thus might be helpful for gene therapy of vascular diseases. Copyright 2001 John Wiley & Sons, Ltd.
Durantel, D; Croizier, L; Ayres, M D; Croizier, G; Possee, R D; López-Ferber, M
1998-03-01
Autographa californica nucleopolyhedrovirus (AcMNPV) ORF 86, located within the HindIII C fragment, potentially encodes a protein which shares sequence similarity with two T4 bacteriophage gene products, RNA ligase and polynucleotide kinase. This AcMNPV gene has been designated pnk/pnl but has yet to be assigned a function in virus replication. It has been classified as an immediate early virus gene, since the promoter was active in uninfected insect cells and mRNA transcripts were detectable from 4 to 48 h post-infection and in the presence of cycloheximide or aphidicolin in virus-infected cells. The extremities of the transcript have been mapped by primer extension and 3' RACE-PCR to positions -18 from the translational start codon and +15 downstream of the stop codon. The function of pnk/pnl was investigated by producing a recombinant virus (Acdel86lacZ) with the coding region replaced with that of lacZ. This virus replicated normally in Spodoptera frugiperda (Sf 21) cells, indicating that pnk/pnl is not essential for propagation in these cells. Virus protein production in Acdel86lacZ-infected Sf 21 cells also appeared to be unaffected, with normal synthesis of the IE-1, GP64, VP39 and polyhedrin proteins. Shut-down of host protein synthesis was not abolished in recombinant infection. When other baculovirus genomes were examined for the presence of pnk/pnl by restriction enzyme digestion and PCR, a deletion was found in AcMNPV 1.2, Galleria mellonella NPV (GmMNPV) and Bombyx mori NPV (BmNPV), suggesting that in many isolates this gene has either never been acquired or has been lost during genome evolution. This is one of the first baculovirus immediate early genes that appears to be nonessential for virus survival.
Ogasawara, Shun; Shimada, Nao; Kawata, Takefumi
2009-02-01
Expansins are proteins involved in plant morphogenesis, exerting their effects on cellulose to extend cell walls. Dictyostelium is an organism that possesses expansin-like molecules, but their functions are not known. In this study, we analyzed the expL7 (expansin-like 7) gene, which has been identified as a putative target of Dd-STATa, a Dictyostelium homolog of the metazoan signal transducer and activator of transcription (STAT) proteins. Promoter fragments of the expL7 were fused to a lacZ reporter and the expression patterns determined. As expected from the behavior of the endogenous expL7 gene, the expL7/lacZ fusion gene was downregulated in Dd-STATa null slugs. In the parental strain, the expL7 promoter was activated in the anterior tip region. Mutational analysis of the promoter identified a sequence that was necessary for expression in tip cells. In addition, an activator sequence for pstAB cells was identified. These sequences act in combination with the repressor region to prevent ectopic expL7 expression in the prespore and prestalk regions of the slug and culminant. Although the expL7 null mutant showed no phenotypic change, the expL7 overexpressor showed aberrant stalk formation. These results indicate that the expansin-like molecule is important for morphogenesis in Dictyostelium.
Gupta, S C; Siddique, H R; Saxena, D K; Chowdhuri, D Kar
2005-01-01
This study investigated the working hypothesis that two widely used organophosphate pesticides; Nuvan and Dimecron, exert toxic effects in Drosophila. Transgenic D. melanogaster (hsp70-lacZ) was used as a model for assaying stress gene expression and AchE activity as an endpoint for toxicity and also to evaluate whether stress gene expression is sufficient to protect against toxic insult of the chemicals and to prevent tissue damage. The study was extended to investigate the effect of the pesticides on the life cycle and reproduction of the organism. The study showed that Nuvan affected emergence of the exposed flies more drastically than Dimecron and the effect was lethal at the highest tested concentration (0.075 ppm). While Nuvan at 0.0075 and 0.015 ppm concentrations affected reproduction of the flies significantly, the effect of Dimecron was significant only at 0.015 and 0.075 ppm. Nuvan-exposed third-instar larvae exhibited a 1.2-fold to 1.5-fold greater hsp70 expression compared to Dimecron at concentrations ranging from 0.0075 to 0.075 ppm following 12 and 18 h exposure. While maximum expression of hsp70 was observed in Nuvan-exposed third-instar larval tissues following 18 h exposure at 0.075 ppm, Dimecron at the same dietary concentration induced a maximum expression of hsp70 following 24 h exposure. Further, concomitant with a significant induction of hsp70, significant inhibition of AchE was observed following chemical exposure and temperature shock. Concurrent with a significant decline in hsp70 expression in Nuvan-exposed larvae after 48 h at 0.075 ppm, tissue damage was evident. Dimecron-exposed larvae exhibited a plateau in hsp70 induction even after 48 h exposure and moderate tissue damage was observed in these larvae. The present study suggests that Nuvan is more cytotoxic than Dimecron in transgenic Drosophila melanogaster.
Senoo, M; Matsubara, Y; Fujii, K; Nagasaki, Y; Hiratsuka, M; Kure, S; Uehara, S; Okamura, K; Yajima, A; Narisawa, K
2000-04-01
Fetal somatic cell gene therapy could become an attractive solution for some congenital genetic diseases or the disorders which manifest themselves during the fetal period. We performed adenovirus-mediated gene transfer to mice and guinea pig fetuses in utero and evaluated the efficiency of gene transfer by histochemical analysis and a quantitative TaqMan-polymerase chain reaction (TaqMan-PCR) assay. We first injected a replication-deficient recombinant adenovirus containing the Escherichia coli LacZ gene driven by a CAG promoter (AxCALacZ) into pregnant mice through the amniotic space, placenta, or intraperitoneal space of the fetus. Histochemical analysis showed limited transgene expression in fetal tissues. We then administered AxCALacZ to guinea pig fetuses in the late stage of pregnancy through the umbilical vein. The highest beta-galactosidase expression was observed in liver followed by moderate expression in heart, spleen, and adrenal gland. The transgene expression was also present in kidney, intestine, and placenta to a lesser degree. No positively stained cells were observed in lung, muscle, or pancreas except in the vascular endothelium of these organs. Quantitative measurement of recombinant adenoviral DNA by the TaqMan-PCR assay showed that the vast majority of the injected viruses was present in liver. The current study indicated that adenovirus-mediated gene transfer into guinea pig fetus through the umbilical vein is feasible and results in efficient transgene expression in fetal tissues. The experimental procedures using pregnant guinea pigs might serve as a good experimental model for in utero gene transfer. Since our TaqMan-PCR assay detects the LacZ gene, one of the most widely used reporter genes, it may be generally applicable to adenovirus quantification in various gene transfer experiments.
Nakashima, N; Tamura, T
2013-06-01
Here, we report on the construction of doxycycline (tetracycline analogue)-inducible vectors that express antisense RNAs in Escherichia coli. Using these vectors, the expression of genes of interest can be silenced conditionally. The expression of antisense RNAs from the vectors was more tightly regulated than the previously constructed isopropyl-β-D-galactopyranoside-inducible vectors. Furthermore, expression levels of antisense RNAs were enhanced by combining the doxycycline-inducible promoter with the T7 promoter-T7 RNA polymerase system; the T7 RNA polymerase gene, under control of the doxycycline-inducible promoter, was integrated into the lacZ locus of the genome without leaving any antibiotic marker. These vectors are useful for investigating gene functions or altering cell phenotypes for biotechnological and industrial applications. A gene silencing method using antisense RNAs in Escherichia coli is described, which facilitates the investigation of bacterial gene function. In particular, the method is suitable for comprehensive analyses or phenotypic analyses of genes essential for growth. Here, we describe expansion of vector variations for expressing antisense RNAs, allowing choice of a vector appropriate for the target genes or experimental purpose. © 2013 The Society for Applied Microbiology.
Rinder, H; Bayer, T A; Gertzen, E M; Hoffmann, W
1992-01-01
Ependymins are secretory products of meningeal cells and represent the predominant glycoproteins in the cerebrospinal fluid from various orders of teleost fish. In the zebrafish, their expression starts between 48 and 72 h post-fertilization. Generally, they share characteristics with proteins involved in cell-contact phenomena. Here, we characterize the ependymin gene from Brachydanio rerio and its flanking regions. The sequence was obtained from clones generated using the polymerase chain reaction (PCR), including a variation of an "anchored" PCR. Also, clones from a conventional phage library were analyzed. We found that the transcribed portion is arranged in six exons. Transient expression of an ependymin-promoter-lacZ gene fusion in zebrafish embryos revealed that the 2.0-kb upstream regulatory region used is sufficient to direct the ependymin-specific correct temporal and spatial expression pattern of the lacZ reporter gene.
Takahashi, Hiroki; Hotta, Kohji; Takagi, Chiyo; Ueno, Naoto; Satoh, Nori; Shoguchi, Eiichi
2010-02-01
Brachyury, a T-box transcription factor, is expressed in ascidian embryos exclusively in primordial notochord cells and plays a pivotal role in differentiation of notochord cells. Previously, we identified approximately 450 genes downstream of Ciona intestinalis Brachyury (Ci-Bra), and characterized the expression profiles of 45 of these in differentiating notochord cells. In this study, we looked for cisregulatory sequences in minimal enhancers of 20 Ci-Bra downstream genes by electroporating region within approximately 3 kb upstream of each gene fused with lacZ. Eight of the 20 reporters were expressed in notochord cells. The minimal enchancer for each of these eight genes was narrowed to a region approximately 0.5-1.0-kb long. We also explored the genome-wide and coordinate regulation of 43 Ci-Bra-downstream genes. When we determined their chromosomal localization, it became evident that they are not clustered in a given region of the genome, but rather distributed evenly over 13 of the 14 pairs of chromosomes, suggesting that gene clustering does not contribute to coordinate control of the Ci-Bra downstream gene expression. Our results might provide Insights Into the molecular mechanisms underlying notochord formation in chordates.
Hirota, Ryuichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao; Kato, Junichi
2006-08-01
The nitrifying bacterium Nitrosomonas sp. strain ENI-11 has three copies of the gene encoding hydroxylamine oxidoreductase (hao(1), hao(2), and hao(3)) on its genome. Broad-host-range reporter plasmids containing transcriptional fusion genes between hao copies and lacZ were constructed to analyze the expression of each hydroxylamine oxidoreductase gene (hao) copy individually and quantitatively. beta-Galactosidase assays of ENI-11 harboring reporter plasmids revealed that all hao copies were transcribed in the wild-type strain. Promoter analysis of hao copies revealed that transcription of hao(3) was highest among the hao copies. Expression levels of hao(1) and hao(2) were 40% and 62% of that of hao(3) respectively. Transcription of hao(1) was negatively regulated, whereas a portion of hao(3) transcription was read through transcription from the rpsT promoter. When energy-depleted cells were incubated in the growth medium, only hao(3) expression increased. This result suggests that it is hao(3) that is responsible for recovery from energy-depleted conditions in Nitrosomonas sp. strain ENI-11.
Shh pathway in wounds in non-diabetic Shh-Cre-eGFP/Ptch1-LacZ mice treated with MAA beads.
Lisovsky, Alexandra; Sefton, Michael V
2016-09-01
Previously, poly(methacrylic acid-co-methyl methacrylate) (MAA) beads were shown to improve vessel formation with a concomitant increase in the expression of the sonic hedgehog (Shh) gene, a pleiotropic factor implicated in vascularization. The aim of this study was to follow up on this observation in the absence of the confounding factors of diabetes in non-diabetic Shh-Cre-eGFP/Ptch1-LacZ mice; in this mouse, expression of GFP and β-Gal is consistent with the transcription patterns of Shh and its receptor patched 1 (Ptch1), respectively. In agreement with studies in diabetic males, MAA beads improved vascularization in large (15 mm × 15 mm) wounds in non-diabetic males at day 7. Shh pathway activation was suggested, as the numbers of GFP+ (Shh) and β-Gal+ (Ptch1, a target of the pathway) cells increased in the granulation tissue. Shh signaling pathway modulation was also suggested in the healthy skin surrounding the wound bed, as evidenced by an increase in the number of GFP+ and β-Gal+ cells in males at day 4. Gene expression analysis of the wounds confirmed increase in Ptch1 and showed the upregulation of a downstream transcription factor Gli3, involved in the vascular effect of the Shh pathway, implicating the pathway in the effect of MAA beads. The efficacy of MAA beads was also investigated in females; MAA beads modulated the Shh pathway within granulation tissue similarly as in males, but had no enhancement effect on the healthy skin and on vascularization. We believe that understanding the molecular and cellular mechanisms of MAA-based biomaterials and testing the efficacy of therapeutics in both sexes will inform the development of novel therapeutic biomaterials. Copyright © 2016 Elsevier Ltd. All rights reserved.
Single-step method for β-galactosidase assays in Escherichia coli using a 96-well microplate reader.
Schaefer, Jorrit; Jovanovic, Goran; Kotta-Loizou, Ioly; Buck, Martin
2016-06-15
Historically, the lacZ gene is one of the most universally used reporters of gene expression in molecular biology. Its activity can be quantified using an artificial substrate, o-nitrophenyl-ß-d-galactopyranoside (ONPG). However, the traditional method for measuring LacZ activity (first described by J. H. Miller in 1972) can be challenging for a large number of samples, is prone to variability, and involves hazardous compounds for lysis (e.g., chloroform, toluene). Here we describe a single-step assay using a 96-well microplate reader with a proven alternative cell permeabilization method. This modified protocol reduces handling time by 90%. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Turunen, Tytteli A K; Kurkipuro, Jere; Heikura, Tommi; Vuorio, Taina; Hytönen, Elisa; Izsvák, Zsuzsanna; Ylä-Herttuala, Seppo
2016-01-01
Plasmid-based Sleeping Beauty (SB) transposon vectors were developed and used to deliver genes for low-density lipoprotein and very-low-density lipoprotein receptors (LDLR and VLDLR, respectively) or lacZ reporter into liver of an LDLR-deficient mouse model of familial hypercholesterolemia (FH). SB transposase, SB100x, was used to integrate the therapeutic transposons into mice livers for evaluating the feasibility of the vectors in reducing high blood cholesterol and the progression of atherosclerosis. Hydrodynamic gene delivery of transposon-VLDLR into the livers of the mice resulted in initial 17–19% reductions in plasma cholesterol, and at the later time points, in a significant stabilization of the cholesterol level for the 6.5-month duration of the study compared to the control mice. Transposon-LDLR-treated animals also demonstrated a trend of stabilization in the cholesterol levels in the long term. Vector-treated mice had slightly less lipid accumulation in the liver and reduced aortic atherosclerosis. Clinical chemistry and histological analyses revealed normal liver function and morphology comparable to that of the controls during the follow-up with no safety issues regarding the vector type, transgenes, or the gene transfer method. The study demonstrates the safety and potential benefits of the SB transposon vectors in the treatment of FH. PMID:26670130
Dlx homeobox gene family expression in osteoclasts.
Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A
2010-06-01
Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.
Jiang, Yi-Bo; Zhang, Xiao-Li; Tang, Yao-Liang; Ma, Gen-Shan; Shen, Cheng-Xing; Wei, Qin; Zhu, Qi; Yao, Yu-Yu; Liu, Nai-Feng
2011-02-01
Mesenchymal stem cells (MSCs) transplantation may partially restore heart function in the treatment of acute myocardial infarction (AMI). The aim of this study was to explore the beneficial effects of MSCs modified with heme xygenase-1 (HO-1) on post-infarct swine hearts to determine whether the induction of therapeutic angiogenesis is modified by the angiogenic cytokines released from the implanted cells. In vitro, MSCs were divided into four groups: (1) non-transfected MSCs (MSCs group), (2) MSCs transfected with the pcDNA3.1-Lacz plasmid (Lacz-MSCs group), (3) MSCs transfected with pcDNA3.1-hHO-1 (HO-1-MSCs group), and (4) MSCs transfected with pcDNA3.1-hHO-1 and pretreatment with an HO inhibitor, tin protoporphyrin (SnPP) (HO-1-MSCs + SnPP group). Cells were cultured in an airtight incubation bottle for 24 hours, in which the oxygen concentration was maintained at < 1%, followed by 12 hours of reoxygenation. After hypoxia/reoxygen treatment, ELISA was used to measure transforming growth factor (TGF-β) and fibroblast growth factor (FGF-2) in the supernatant. In vivo, 28 Chinese mini-pigs were randomly allocated to the following treatment groups: (1) control group (saline), (2) Lacz-MSCs group, (3) HO-1-MSCs group, and (4) HO-1-MSCs + SnPP group. About 1 × 10(7) of autologous stem cells or an identical volume of saline was injected intracoronary into porcine hearts 1 hour after MI. Magnetic resonance imaging (MRI) assay and postmortem analysis were assessed four weeks after stem cell transplantation. Post hypoxia/reoxygenation in vitro, TGF-β in the supernatant was significantly increased in the HO-1-MSCs ((874.88 ± 68.23) pg/ml) compared with Lacz-MSCs ((687.81 ± 57.64) pg/ml, P < 0.001). FGF-2 was also significantly increased in the HO-1-MSCs ((1106.48 ± 107.06) pg/ml) compared with the Lacz-MSCs ((853.85 ± 74.44) pg/ml, P < 0.001). In vivo, at four weeks after transplantation, HO-1 gene transfer increased the capillary density in the peri-infarct area
Tadra-Sfeir, M. Z.; Souza, E. M.; Faoro, H.; Müller-Santos, M.; Baura, V. A.; Tuleski, T. R.; Rigo, L. U.; Yates, M. G.; Wassem, R.; Pedrosa, F. O.; Monteiro, R. A.
2011-01-01
Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants. PMID:21257805
Tadra-Sfeir, M Z; Souza, E M; Faoro, H; Müller-Santos, M; Baura, V A; Tuleski, T R; Rigo, L U; Yates, M G; Wassem, R; Pedrosa, F O; Monteiro, R A
2011-03-01
Five thousand mutants of Herbaspirillum seropedicae SmR1 carrying random insertions of transposon pTnMod-OGmKmlacZ were screened for differential expression of LacZ in the presence of naringenin. Among the 16 mutants whose expression was regulated by naringenin were genes predicted to be involved in the synthesis of exopolysaccharides, lipopolysaccharides, and auxin. These loci are probably involved in establishing interactions with host plants.
Kovács, Ákos T.; van Hartskamp, Mariska; Kuipers, Oscar P.; van Kranenburg, Richard
2010-01-01
Bacillus coagulans has good potential as an industrial production organism for platform chemicals from renewable resources but has limited genetic tools available. Here, we present a targeted gene disruption system using the Cre-lox system, development of a LacZ reporter assay for monitoring gene transcription, and heterologous d-lactate dehydrogenase expression. PMID:20400555
Patterns of expression of position-dependent integrated transgenes in mouse embryo.
Bonnerot, C; Grimber, G; Briand, P; Nicolas, J F
1990-01-01
The abilities to introduce foreign DNA into the genome of mice and to visualize gene expression at the single-cell level underlie a method for defining individual elements of a genetic program. We describe the use of an Escherichia coli lacZ reporter gene fused to the promoter of the gene for hypoxanthine phosphoribosyl transferase that is expressed in all tissues. Most transgenic mice (six of seven) obtained with this construct express the lacZ gene from the hypoxanthine phosphoribosyltransferase promoter. Unexpectedly, however, the expression is temporally and spatially regulated. Each transgenic line is characterized by a specific, highly reproducible pattern of lacZ expression. These results show that, for expression, the integrated construct must be complemented by elements of the genome. These elements exert dominant developmental control on the hypoxanthine phosphoribosyltransferase promoter. The expression patterns in some transgenic mice conform to a typological marker and in others to a subtle combination of typology and topography. These observations define discrete heterogeneities of cell types and of certain structures, particularly in the nervous system and in the mesoderm. This system opens opportunities for developmental studies by providing cellular, molecular, and genetic markers of cell types, cell states, and cells from developmental compartments. Finally this method illustrates that genes transduced or transposed to a different position in the genome acquire different spatiotemporal specificities, a result that has implications for evolution. Images PMID:1696727
An Approach for Treating the Hepatobiliary Disease of Cystic Fibrosis by Somatic Gene Transfer
NASA Astrophysics Data System (ADS)
Yang, Yiping; Raper, Steven E.; Cohn, Jonathan A.; Engelhardt, John F.; Wilson, James M.
1993-05-01
Cystic fibrosis (CF) is an inherited disease of epithelial cell ion transport that is associated with pathology in multiple organ systems, including lung, pancreas, and liver. As treatment of the pulmonary manifestations of CF has improved, management of CF liver disease has become increasingly important in adult patients. This report describes an approach for treating CF liver disease by somatic gene transfer. In situ hybridization and immunocytochemistry analysis of rat liver sections indicated that the endogenous CFTR (cystic fibrosis transmembrane conductance regulator) gene is primarily expressed in the intrahepatic biliary epithelial cells. To specifically target recombinant genes to the biliary epithelium in vivo, recombinant adenoviruses expressing lacZ or human CFTR were infused retrograde into the biliary tract through the common bile duct. Conditions were established for achieving recombinant gene expression in virtually all cells of the intrahepatic bile ducts in vivo. Expression persisted in the smaller bile ducts for the duration of the experiment, which was 21 days. These studies suggest that it may be feasible to prevent CF liver disease by genetically reconstituting CFTR expression in the biliary tract, using an approach that is clinically feasible.
Burdon, Kathryn P; McKay, James D; Sale, Michèle M; Russell-Eggitt, Isabelle M; Mackey, David A; Wirth, M Gabriela; Elder, James E; Nicoll, Alan; Clarke, Michael P; FitzGerald, Liesel M; Stankovich, James M; Shaw, Marie A; Sharma, Shiwani; Gajovic, Srecko; Gruss, Peter; Ross, Shelley; Thomas, Paul; Voss, Anne K; Thomas, Tim; Gécz, Jozef; Craig, Jamie E
2003-11-01
Nance-Horan syndrome (NHS) is an X-linked disorder characterized by congenital cataracts, dental anomalies, dysmorphic features, and, in some cases, mental retardation. NHS has been mapped to a 1.3-Mb interval on Xp22.13. We have confirmed the same localization in the original, extended Australian family with NHS and have identified protein-truncating mutations in a novel gene, which we have called "NHS," in five families. The NHS gene encompasses approximately 650 kb of genomic DNA, coding for a 1,630-amino acid putative nuclear protein. NHS orthologs were found in other vertebrates, but no sequence similarity to known genes was identified. The murine developmental expression profile of the NHS gene was studied using in situ hybridization and a mouse line containing a lacZ reporter-gene insertion in the Nhs locus. We found a complex pattern of temporally and spatially regulated expression, which, together with the pleiotropic features of NHS, suggests that this gene has key functions in the regulation of eye, tooth, brain, and craniofacial development.
Burdon, Kathryn P.; McKay, James D.; Sale, Michèle M.; Russell-Eggitt, Isabelle M.; Mackey, David A.; Wirth, M. Gabriela; Elder, James E.; Nicoll, Alan; Clarke, Michael P.; FitzGerald, Liesel M.; Stankovich, James M.; Shaw, Marie A.; Sharma, Shiwani; Gajovic, Srecko; Gruss, Peter; Ross, Shelley; Thomas, Paul; Voss, Anne K.; Thomas, Tim; Gécz, Jozef; Craig, Jamie E.
2003-01-01
Nance-Horan syndrome (NHS) is an X-linked disorder characterized by congenital cataracts, dental anomalies, dysmorphic features, and, in some cases, mental retardation. NHS has been mapped to a 1.3-Mb interval on Xp22.13. We have confirmed the same localization in the original, extended Australian family with NHS and have identified protein-truncating mutations in a novel gene, which we have called “NHS,” in five families. The NHS gene encompasses ∼650 kb of genomic DNA, coding for a 1,630–amino acid putative nuclear protein. NHS orthologs were found in other vertebrates, but no sequence similarity to known genes was identified. The murine developmental expression profile of the NHS gene was studied using in situ hybridization and a mouse line containing a lacZ reporter-gene insertion in the Nhs locus. We found a complex pattern of temporally and spatially regulated expression, which, together with the pleiotropic features of NHS, suggests that this gene has key functions in the regulation of eye, tooth, brain, and craniofacial development. PMID:14564667
Tissue-specific expression of FoxD reporter constructs in amphioxus embryos.
Yu, Jr-Kai; Holland, Nicholas D; Holland, Linda Z
2004-10-15
Cephalochordates (amphioxus), the closest living invertebrate relatives of the vertebrates, are key to understanding the evolution of developmental mechanisms during the invertebrate-to-vertebrate transition. However, a major impediment to amphioxus as a model organism for developmental biology has been the inability to introduce transgenes or other macromolecules into the embryos. Here, we report the development of a reproducible method for microinjection of amphioxus eggs. Specifically, we show that expression of a LacZ reporter construct including 6.3 kb of AmphiFoxD upstream regulatory DNA recapitulates expression of the endogenous gene in the nerve cord, somites, and notochord. We have also identified the 1.6 kb at the 5' end of this region as essential for expression in the first two of these domains and the 4.7 kb at the 3' end as sufficient for expression in the notochord. This study, which is the first report of a method for introduction of large molecules such as DNA into amphioxus embryos, opens the way for studies of gene regulation and function in amphioxus and for comparative studies with vertebrates to understand the relationship between the extensive gene duplications that occurred within the vertebrate lineage and the evolution of vertebrate innovations such as neural crest.
Bharatan, Shanti M; Reddy, Manjula; Gowrishankar, J
2004-01-01
A conditional lethal galE(Ts)-based strategy was employed in Escherichia coli, first to eliminate all growth-associated chromosomal reversions in lacZ or forward mutations in lacI/lacO by incubation at the restrictive temperature and subsequently to recover (as papillae) spontaneous mutations that had arisen in the population of nondividing cells after shift to the permissive temperature. Data from lacZ reversion studies in mutator strains indicated that the products of all genes for mismatch repair (mutHLS, dam, uvrD), of some for oxidative damage repair (mutMT), and of that for polymerase proofreading (dnaQ) are required in dividing cells; some others for oxidative damage repair (mutY, nth nei) are required in both dividing and nondividing cells; and those for alkylation damage repair (ada ogt) are required in nondividing cells. The spectrum of lacI/lacO mutations in nondividing cells was distinguished both by lower frequencies of deletions and IS1 insertions and by the unique occurrence of GC-to-AT transitions at lacO +5. In the second approach to study mutations that had occurred in nondividing cells, lacI/lacO mutants were selected as late-arising papillae from the lawn of a galE+ strain; once again, transitions at lacO +5 were detected among the mutants that had been obtained from populations initially grown on poor carbon sources such as acetate, palmitate, or succinate. Our results indicate that the lacO +5 site is mutable only in nondividing cells, one possible mechanism for which might be that random endogenous alkylation (or oxidative) damage to DNA in these cells is efficiently corrected by the Ada Ogt (or Nth Nei) repair enzymes at most sites but not at lacO +5. Furthermore, the late-arising papillae from the second approach were composed almost exclusively of dominant lacI/lacO mutants. This finding lends support to "instantaneous gratification" models in which a spontaneous lesion, occurring at a random site in DNA of a nondividing cell, is most
Heikura, Tommi; Nieminen, Tiina; Roschier, Miia M; Karvinen, Henna; Kaikkonen, Minna U; Mähönen, Anssi J; Lesch, Hanna P; Rissanen, Tuomas T; Laitinen, Olli H; Airenne, Kari J; Ylä-Herttuala, Seppo
2012-01-01
Occluded arteries and ischemic tissues cannot always be treated by angioplasty, stenting or by-pass-surgery. Under such circumstances, viral gene therapy may be useful in inducing increased blood supply to ischemic area. There is evidence of improved blood flow in ischemic skeletal muscle and myocardium in both animal and human studies using adenoviral vascular endothelial growth factor (VEGF) gene therapy. However, the expression is transient and repeated gene transfers with the same vector are inefficient due to immune responses. Different baculoviral vectors pseudotyped with or without vesicular stomatitis virus glycoprotein (VSV-G) and/or carrying woodchuck hepatitis virus post-transcriptional regulatory element (Wpre) were tested both in vitro and in vivo. VEGF-D(ΔNΔC) was used as therapeutic transgene and lacZ as a control. In vivo efficacy was evaluated as capillary enlargement and transgene expression in New Zealand White (NZW) rabbit skeletal muscle. A statistically significant capillary enlargement was detected 6 days after gene transfer in transduced areas compared to the control gene transfers with baculovirus and adenovirus encoding β-galactosidase (lacZ). Substantially improved gene transfer efficiency was achieved with a modified baculovirus pseudotyped with VSV-G and carrying Wpre. Dose escalation experiments revealed that either too large volume or too many virus particles caused inflammation and necrosis in the target tissue, whereas 10(9) plaque forming units injected in multiple aliquots resulted in transgene expression with only mild immune reactions. We show the first evidence of biologically significant baculoviral gene transfer in skeletal muscle of NZW rabbits using VEGF-D(ΔNΔC) as a therapeutic transgene. Copyright © 2012 John Wiley & Sons, Ltd.
Ueki, Toshiyuki; Inouye, Sumiko
2005-12-01
FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development.
A Bacillus subtilis Gene Induced by Cold Shock Encodes a Membrane Phospholipid Desaturase
Aguilar, Pablo S.; Cronan, John E.; de Mendoza, Diego
1998-01-01
Bacillus subtilis grown at 37°C synthesizes saturated fatty acids with only traces of unsaturated fatty acids (UFAs). However, when cultures growing at 37°C are transferred to 20°C, UFA synthesis is induced. We report the identification and characterization of the gene encoding the fatty acid desaturase of B. subtilis. This gene, called des, was isolated by complementation of Escherichia coli strains with mutations in either of two different genes of UFA synthesis. The des gene encodes a polypeptide of 352 amino acid residues containing the three conserved histidine cluster motifs and two putative membrane-spanning domains characteristic of the membrane-bound desaturases of plants and cyanobacteria. Expression of the des gene in E. coli resulted in desaturation of palmitic acid moieties of the membrane phospholipids to give the novel mono-UFA cis-5-hexadecenoic acid, indicating that the B. subtilis des gene product is a Δ5 acyl-lipid desaturase. The des gene was disrupted, and the resulting null mutant strains were unable to synthesize UFAs upon a shift to low growth temperatures. The des null mutant strain grew as well as its congenic parent at 20 or 37°C but showed severely reduced survival during stationary phase. Analysis of operon fusions in which the des promoter directed the synthesis of a lacZ reporter gene showed that des expression is repressed at 37°C, but a shift of cultures from 37 to 20°C resulted in a 10- to 15-fold increase in transcription. This is the first report of a membrane phospholipid desaturase in a nonphotosynthetic organism and the first direct evidence for cold induction of a desaturase. PMID:9555904
Structure and regulation of KGD1, the structural gene for yeast alpha-ketoglutarate dehydrogenase.
Repetto, B; Tzagoloff, A
1989-06-01
Nuclear respiratory-defective mutants of Saccharomyces cerevisiae have been screened for lesions in the mitochondrial alpha-ketoglutarate dehydrogenase complex. Strains assigned to complementation group G70 were ascertained to be deficient in enzyme activity due to mutations in the KGD1 gene coding for the alpha-ketoglutarate dehydrogenase component of the complex. The KGD1 gene has been cloned by transformation of a representative kgd1 mutant, C225/U1, with a recombinant plasmid library of wild-type yeast nuclear DNA. Transformants containing the gene on a multicopy plasmid had three- to four-times-higher alpha-ketoglutarate dehydrogenase activity than did wild-type S. cerevisiae. Substitution of the chromosomal copy of KGD1 with a disrupted allele (kgd1::URA3) induced a deficiency in alpha-ketoglutarate dehydrogenase. The sequence of the cloned region of DNA which complements kgd1 mutants was found to have an open reading frame of 3,042 nucleotides capable of coding for a protein of Mw 114,470. The encoded protein had 38% identical residues with the reported sequence of alpha-ketoglutarate dehydrogenase from Escherichia coli. Two lines of evidence indicated that transcription of KGD1 is catabolite repressed. Higher steady-state levels of KGD1 mRNA were detected in wild-type yeast grown on the nonrepressible sugar galactose than in yeast grown on high glucose. Regulation of KGD1 was also studied by fusing different 5'-flanking regions of KGD1 to the lacZ gene of E. coli and measuring the expression of beta-galactosidase in yeast. Transformants harboring a fusion of 693 nucleotides of the 5'-flanking sequence expressed 10 times more beta-galactosidase activity when grown under derepressed conditions. The response to the carbon source was reduced dramatically when the same lacZ fusion was present in a hap2 or hap3 mutant. The promoter element(s) responsible for the regulated expression of KGD1 has been mapped to the -354 to -143 region. This region contained several
Novel Fe3+-Based 1H MRI β-Galactosidase Reporter Molecules**
Yu, Jian-Xin; Gulaka, Praveen K.; Liu, Li; Kodibagkar, Vikram D.; Mason, Ralph P.
2012-01-01
There is increasing interest in the development of reporter agents to reveal enzyme activity in vivo using small animal imaging. We have previously demonstrated the feasibility of detecting lacZ gene activity using the commercially available 3,4-cyclohexenoesculetin-β-D-galactopyranoside (S-Gal™) as a 1H MRI reporter. Specifically, β-galactosidase (β-gal) releases the aglycone, which forms an MR contrast-inducing paramagnetic precipitate in the presence of Fe3+. Contrast was primarily T2-weighted signal loss, but T1 effects were also observed. Since T1-contrast generally provides signal enhancement as opposed to loss, it appeared attractive to explore whether analogues could be generated with enhanced characteristics. We now report the design and successful synthesis of novel analogues together with characterization of 1H MRI contrast based on both T1 and T2 response to β-gal activity in vitro for the lead agent. PMID:23807909
2013-01-01
Background One of the main challenges for heterologous protein production by the methylotrophic yeast Pichia pastoris at large-scale is related to its high oxygen demand. A promising solution is a co-feeding strategy based on a methanol/sorbitol mixture during the induction phase. Nonetheless, a deep understanding of the cellular physiology and the regulation of the AOX1 promoter, used to govern heterologous protein production, during this co-feeding strategy is still scarce. Results Transient continuous cultures with a dilution rate of 0.023 h-1 at 25°C were performed to quantitatively assess the benefits of a methanol/sorbitol co-feeding process with a Mut+ strain in which the pAOX1-lacZ construct served as a reporter gene. Cell growth and metabolism, including O2 consumption together with CO2 and heat production were analyzed with regard to a linear change of methanol fraction in the mixed feeding media. In addition, the regulation of the promoter AOX1 was investigated by means of β-galactosidase measurements. Our results demonstrated that the cell-specific oxygen consumption (qO2) could be reduced by decreasing the methanol fraction in the feeding media. More interestingly, maximal β-galactosidase cell-specific activity (>7500 Miller unit) and thus, optimal pAOX1 induction, was achieved and maintained in the range of 0.45 ~ 0.75 C-mol/C-mol of methanol fraction. In addition, the qO2 was reduced by 30% at most in those conditions. Based on a simplified metabolic network, metabolic flux analysis (MFA) was performed to quantify intracellular metabolic flux distributions during the transient continuous cultures, which further shed light on the advantages of methanol/sorbitol co-feeding process. Finally, our observations were further validated in fed-batch cultures. Conclusion This study brings quantitative insight into the co-feeding process, which provides valuable data for the control of methanol/sorbitol co-feeding, aiming at enhancing biomass and
Mfsd14a (Hiat1) gene disruption causes globozoospermia and infertility in male mice.
Doran, Joanne; Walters, Cara; Kyle, Victoria; Wooding, Peter; Hammett-Burke, Rebecca; Colledge, William Henry
2016-07-01
The Mfsd14a gene, previously called Hiat1, encodes a transmembrane protein of unknown function with homology to the solute carrier protein family. To study the function of the MFSD14A protein, mutant mice (Mus musculus, strain 129S6Sv/Ev) were generated with the Mfsd14a gene disrupted with a LacZ reporter gene. Homozygous mutant mice are viable and healthy, but males are sterile due to a 100-fold reduction in the number of spermatozoa in the vas deferens. Male mice have adequate levels of testosterone and show normal copulatory behaviour. The few spermatozoa that are formed show rounded head defects similar to those found in humans with globozoospermia. Spermatogenesis proceeds normally up to the round spermatid stage, but the subsequent structural changes associated with spermiogenesis are severely disrupted with failure of acrosome formation, sperm head condensation and mitochondrial localization to the mid-piece of the sperm. Staining for β-galactosidase activity as a surrogate for Mfsd14a expression indicates expression in Sertoli cells, suggesting that MFSD14A may transport a solute from the bloodstream that is required for spermiogenesis. © 2016 Society for Reproduction and Fertility.
Ueki, Toshiyuki; Inouye, Sumiko
2005-01-01
FruA is an essential transcription factor for Myxococcus xanthus development. The expression of tps and dofA genes is fruA dependent. In this study, we show by gel shift and footprint assays with the C-terminal DNA-binding domain of FruA and by a lacZ fusion assay that FruA may directly activate dofA expression during development. PMID:16321956
Pereira, Clifford T; Herndon, David N; Rocker, Roland; Jeschke, Marc G
2007-05-15
Growth factors affect the complex cascade of wound healing; however, interaction between different growth factors during dermal and epidermal regeneration are still not entirely defined. In the present study, we thought to determine the interaction between keratinocyte growth factor (KGF) administered as liposomal cDNA with other dermal and epidermal growth factors and collagen synthesis in an acute wound. Rats received an acute wound and were divided into two groups to receive weekly subcutaneous injections of liposomes plus the Lac-Z gene (0.22 microg, vehicle), or liposomes plus the KGF cDNA (2.2 microg) and Lac-Z gene (0.22 microg). Histological and immunohistochemical techniques were used to determine growth factor, collagen expression, and dermal and epidermal structure. KGF cDNA increased insulin-like growth factor-I (IGF-I), insulin-like growth factor binding protein-3 (IGFBP-3), and fibroblast growth factor (FGF), decreased transforming growth factor-beta (TGF-beta), while it had no effect on platelet-derived growth factor (PDGF) levels in the wound. KGF cDNA significantly increased collagen Type IV at both the wound edge as well as the wound bed, while it had no effect on collagen Type I and III. KGF cDNA increased re-epithelialization, improved dermal regeneration, and increased neovascularization. Exogenous administered KGF cDNA causes increases in IGF-I, IGF-BP3, FGF, and collagen IV and decreases TGF-beta concentration. KGF gene transfer accelerates wound healing without causing an increase in collagen I or III.
Pereira, Glauber B.; Meng, Fanxue; Kockara, Neriman T.; Yang, Baoli; Wight, Patricia A.
2012-01-01
Myelin proteolipid protein gene (Plp1) expression is temporally regulated in brain, which peaks during the active myelination period of CNS development. Previous studies with Plp1-lacZ transgenic mice demonstrated that (mouse) Plp1 intron 1 DNA is required for high levels of expression in oligodendrocytes. Deletion-transfection analysis revealed the intron contains a single positive regulatory element operative in the N20.1 oligodendroglial cell line, which was named ASE (antisilencer/enhancer) based on its functional properties in these cells. To investigate the role of the ASE in vivo, the element was deleted from the native gene in mouse using a Cre/lox strategy. While removal of the ASE from Plp1-lacZ constructs profoundly decreased expression in transfected oligodendroglial cell lines (N20.1 and Oli-neu), the element was dispensable to achieve normal levels of Plp1 gene expression in mouse during development (except perhaps at postnatal day 15) and throughout the remyelination period following cuprizone-induced (acute) demyelination. Thus, it is possible that the ASE is nonfunctional in vivo, or that loss of the ASE from the native gene in mouse can be compensated for by the presence of other regulatory elements within the Plp1 gene. PMID:23157328
Pereira, Glauber B; Meng, Fanxue; Kockara, Neriman T; Yang, Baoli; Wight, Patricia A
2013-02-01
Myelin proteolipid protein gene (Plp1) expression is temporally regulated in brain, which peaks during the active myelination period of CNS development. Previous studies with Plp1-lacZ transgenic mice demonstrated that (mouse) Plp1 intron 1 DNA is required for high levels of expression in oligodendrocytes. Deletion-transfection analysis revealed the intron contains a single positive regulatory element operative in the N20.1 oligodendroglial cell line, which was named ASE (antisilencer/enhancer) based on its functional properties in these cells. To investigate the role of the ASE in vivo, the element was deleted from the native gene in mouse using a Cre/lox strategy. Although removal of the ASE from Plp1-lacZ constructs profoundly decreased expression in transfected oligodendroglial cell lines (N20.1 and Oli-neu), the element was dispensable to achieve normal levels of Plp1 gene expression in mouse during development (except perhaps at postnatal day 15) and throughout the remyelination period following cuprizone-induced (acute) demyelination. Thus, it is possible that the ASE is non-functional in vivo, or that loss of the ASE from the native gene in mouse can be compensated for by the presence of other regulatory elements within the Plp1 gene. © 2012 International Society for Neurochemistry.
Bandara, G; Mueller, G M; Galea-Lauri, J; Tindal, M H; Georgescu, H I; Suchanek, M K; Hung, G L; Glorioso, J C; Robbins, P D; Evans, C H
1993-01-01
Gene therapy offers a radical different approach to the treatment of arthritis. Here we have demonstrated that two marker genes (lacZ and neo) and cDNA coding for a potentially therapeutic protein (human interleukin 1-receptor-antagonist protein; IRAP or IL-1ra) can be delivered, by ex vivo techniques, to the synovial lining of joints; intraarticular expression of IRAP inhibited intraarticular responses to interleukin 1. To achieve this, lapine synoviocytes were first transduced in culture by retroviral infection. The genetically modified synovial cells were then transplanted by intraarticular injection into the knee joints of rabbits, where they efficiently colonized the synovium. Assay of joint lavages confirmed the in vivo expression of biologically active human IRAP. With allografted cells, IRAP expression was lost by 12 days after transfer. In contrast, autografted synoviocytes continued to express IRAP for approximately 5 weeks. Knee joints expressing human IRAP were protected from the leukocytosis that otherwise follows the intraarticular injection of recombinant human interleukin 1 beta. Thus, we report the intraarticular expression and activity of a potentially therapeutic protein by gene-transfer technology; these experiments demonstrate the feasibility of treating arthritis and other joint disorders with gene therapy. Images Fig. 1 Fig. 2 PMID:8248169
Niu, Hongxing; Jost, Laurent; Pirlot, Nathalie; Sassi, Hosni; Daukandt, Marc; Rodriguez, Christian; Fickers, Patrick
2013-04-08
One of the main challenges for heterologous protein production by the methylotrophic yeast Pichia pastoris at large-scale is related to its high oxygen demand. A promising solution is a co-feeding strategy based on a methanol/sorbitol mixture during the induction phase. Nonetheless, a deep understanding of the cellular physiology and the regulation of the AOX1 promoter, used to govern heterologous protein production, during this co-feeding strategy is still scarce. Transient continuous cultures with a dilution rate of 0.023 h(-1) at 25°C were performed to quantitatively assess the benefits of a methanol/sorbitol co-feeding process with a Mut+ strain in which the pAOX1-lacZ construct served as a reporter gene. Cell growth and metabolism, including O2 consumption together with CO2 and heat production were analyzed with regard to a linear change of methanol fraction in the mixed feeding media. In addition, the regulation of the promoter AOX1 was investigated by means of β-galactosidase measurements. Our results demonstrated that the cell-specific oxygen consumption (qO2) could be reduced by decreasing the methanol fraction in the feeding media. More interestingly, maximal β-galactosidase cell-specific activity (>7500 Miller unit) and thus, optimal pAOX1 induction, was achieved and maintained in the range of 0.45 ~ 0.75 C-mol/C-mol of methanol fraction. In addition, the qO2 was reduced by 30% at most in those conditions. Based on a simplified metabolic network, metabolic flux analysis (MFA) was performed to quantify intracellular metabolic flux distributions during the transient continuous cultures, which further shed light on the advantages of methanol/sorbitol co-feeding process. Finally, our observations were further validated in fed-batch cultures. This study brings quantitative insight into the co-feeding process, which provides valuable data for the control of methanol/sorbitol co-feeding, aiming at enhancing biomass and heterologous protein productivities
NASA Technical Reports Server (NTRS)
Halfon, M. S.; Kose, H.; Chiba, A.; Keshishian, H.
1997-01-01
We have developed a method to target gene expression in the Drosophila embryo to a specific cell without having a promoter that directs expression in that particular cell. Using a digitally enhanced imaging system to identify single cells within the living embryo, we apply a heat shock to each cell individually by using a laser microbeam. A 1- to 2-min laser treatment is sufficient to induce a heat-shock response but is not lethal to the heat-shocked cells. Induction of heat shock was measured in a variety of cell types, including neurons and somatic muscles, by the expression of beta-galactosidase from an hsp26-lacZ reporter construct or by expression of a UAS target gene after induction of hsGAL4. We discuss the applicability of this technique to ectopic gene expression studies, lineage tracing, gene inactivation studies, and studies of cells in vitro. Laser heat shock is a versatile technique that can be adapted for use in a variety of research organisms and is useful for any studies in which it is desirable to express a given gene in only a distinct cell or clone of cells, either transiently or constitutively, at a time point of choice.
Transcriptional analysis of the bglP gene from Streptococcus mutans.
Cote, Christopher K; Honeyman, Allen L
2006-04-21
An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript.
Transcriptional analysis of the bglP gene from Streptococcus mutans
Cote, Christopher K; Honeyman, Allen L
2006-01-01
Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript. PMID:16630357
A Luciferase Reporter Gene System for High-Throughput Screening of γ-Globin Gene Activators.
Xie, Wensheng; Silvers, Robert; Ouellette, Michael; Wu, Zining; Lu, Quinn; Li, Hu; Gallagher, Kathleen; Johnson, Kathy; Montoute, Monica
2016-01-01
Luciferase reporter gene assays have long been used for drug discovery due to their high sensitivity and robust signal. A dual reporter gene system contains a gene of interest and a control gene to monitor non-specific effects on gene expression. In our dual luciferase reporter gene system, a synthetic promoter of γ-globin gene was constructed immediately upstream of the firefly luciferase gene, followed downstream by a synthetic β-globin gene promoter in front of the Renilla luciferase gene. A stable cell line with the dual reporter gene was cloned and used for all assay development and HTS work. Due to the low activity of the control Renilla luciferase, only the firefly luciferase activity was further optimized for HTS. Several critical factors, such as cell density, serum concentration, and miniaturization, were optimized using tool compounds to achieve maximum robustness and sensitivity. Using the optimized reporter assay, the HTS campaign was successfully completed and approximately 1000 hits were identified. In this chapter, we also describe strategies to triage hits that non-specifically interfere with firefly luciferase.
Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José
2013-01-01
Myxococcus xanthus is a soil-dwelling member of the δ-Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains.
2006-10-01
colored plates: ALL DTIC reproductions will be in black and white. 14. ABSTRACT The lacZ gene encoding E . coli beta-gal has already been...transcriptional activation, protein expression, and protein interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most commonly...Cancer Facts and Figures, 2004. (www.cancer.org). 2. Jemal A, Thomas A, Murray T, Thun M, 2002 Cancer statistics, 2002, CA Cancer J. Clin., 52, 23-47
Ivanov, E. L.; Sugawara, N.; Fishman-Lobell, J.; Haber, J. E.
1996-01-01
HO endonuclease-induced double-strand breaks (DSBs) within a direct duplication of Escherichia coli lacZ genes are repaired either by gene conversion or by single-strand annealing (SSA), with >80% being SSA. Previously it was demonstrated that the RAD52 gene is required for DSB-induced SSA. In the present study, the effects of other genes belonging to the RAD52 epistasis group were analyzed. We show that RAD51, RAD54, RAD55, and RAD57 genes are not required for SSA irrespective of whether recombination occurred in plasmid or chromosomal DNA. In both plasmid and chromosomal constructs with homologous sequences in direct orientation, the proportion of SSA events over gene conversion was significantly elevated in the mutant strains. However, gene conversion was not affected when the two lacZ sequences were in inverted orientation. These results suggest that there is a competition between SSA and gene conversion processes that favors SSA in the absence of RAD51, RAD54, RAD55 and RAD57. Mutations in RAD50 and XRS2 genes do not prevent the completion, but markedly retard the kinetics, of DSB repair by both mechanisms in the lacZ direct repeat plasmid, a result resembling the effects of these genes during mating-type (MAT) switching. PMID:8849880
Clough, S J; Flavier, A B; Schell, M A; Denny, T P
1997-03-01
A complex network regulates virulence in Ralstonia solanacearum (formerly Pseudomonas solanacearum); central to this system is PhcA, a LysR-type transcriptional regulator. We report here that two PhcA-regulated virulence factors, endoglucanase (Egl) and acidic exopolysaccharide I (EPS I), and motility are expressed differentially during exponential growth in batch cultures. Tests with strains carrying lacZ fusions in a wild-type genetic background revealed that expression (on a per-cell basis) of phcA was constant but expression of egl and epsB increased 20- to 50-fold during multiplication from 1 x 10(sup7) to 5 x 10(sup8) CFU/ml. Expression of xpsR, an intermediate regulator downstream of PhcA in the regulatory cascade for eps expression, was similar to that of epsB and egl. Motility track photography revealed that all strains were essentially nonmotile at 10(sup6) CFU/ml. As cell density increased, 30 to 50% of wild-type cells were motile between 10(sup7) and 10(sup8) CFU/ml, but this population was again nonmotile at 10(sup9) CFU/ml. In contrast, about 60% of the cells of phcB and phcA mutants remained motile at 10(sup9) CFU/ml. Expression of phcB, which is not positively regulated by PhcA, was the inverse of epsB, egl, and xpsR (i.e., it decreased 20-fold at high cell density). PhcB is essential for production of an extracellular factor, tentatively identified as 3-hydroxypalmitic acid methyl ester (3-OH PAME), that might act as an exponential-phase signal to activate motility or expression of virulence genes. However, growth of the lacZ fusion strains in medium containing excess 3-OH PAME did not result in motility or expression of virulence genes at dramatically lower cell densities, suggesting that 3-OH PAME is not the only factor controlling these traits.
Gonzalez, S M; Ferland, L H; Robert, B; Abdelhay, E
1998-06-01
Vertebrate Msx genes are related to one of the most divergent homeobox genes of Drosophila, the muscle segment homeobox (msh) gene, and are expressed in a well-defined pattern at sites of tissue interactions. This pattern of expression is conserved in vertebrates as diverse as quail, zebrafish, and mouse in a range of sites including neural crest, appendages, and craniofacial structures. In the present work, we performed structural and functional analyses in order to identify potential cis-acting elements that may be regulating Msx1 gene expression. To this end, a 4.9-kb segment of the 5'-flanking region was sequenced and analyzed for transcription-factor binding sites. Four regions showing a high concentration of these sites were identified. Transfection assays with fragments of regulatory sequences driving the expression of the bacterial lacZ reporter gene showed that a region of 4 kb upstream of the transcription start site contains positive and negative elements responsible for controlling gene expression. Interestingly, a fragment of 130 bp seems to contain the minimal elements necessary for gene expression, as its removal completely abolishes gene expression in cultured cells. These results are reinforced by comparison of this region with the human Msx1 gene promoter, which shows extensive conservation, including many consensus binding sites, suggesting a regulatory role for them.
Van Dyk, T K; Reed, T R; Vollmer, A C; LaRossa, R A
1995-01-01
Escherichia coli strains carrying transcriptional fusions of four sigma 32-controlled E. coli heat shock promoters to luxCDABE or lacZ reporter genes were stressed by chemicals added singly or in pairs. Much more than additive induction resulted from combinations of cadmium chloride, copper sulfate, ethanol, formamide, 4-nitrophenol, and pentachlorophenol. PMID:7592357
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
2010-01-01
Background Regulatory elements that control expression of specific genes during development have been shown in many cases to contain functionally-conserved modules that can be transferred between species and direct gene expression in a comparable developmental pattern. An example of such a module has been identified at the rat myosin light chain (MLC) 1/3 locus, which has been well characterised in transgenic mouse studies. This locus contains two promoters encoding two alternatively spliced isoforms of alkali myosin light chain. These promoters are differentially regulated during development through the activity of two enhancer elements. The MLC3 promoter alone has been shown to confer expression of a reporter gene in skeletal and cardiac muscle in transgenic mice and the addition of the downstream MLC enhancer increased expression levels in skeletal muscle. We asked whether this regulatory module, sufficient for striated muscle gene expression in the mouse, would drive expression in similar domains in the chicken. Results We have observed that a conserved downstream MLC enhancer is present in the chicken MLC locus. We found that the rat MLC1/3 regulatory elements were transcriptionally active in chick skeletal muscle primary cultures. We observed that a single copy lentiviral insert containing this regulatory cassette was able to drive expression of a lacZ reporter gene in the fast-fibres of skeletal muscle in chicken in three independent transgenic chicken lines in a pattern similar to the endogenous MLC locus. Reporter gene expression in cardiac muscle tissues was not observed for any of these lines. Conclusions From these results we conclude that skeletal expression from this regulatory module is conserved in a genomic context between rodents and chickens. This transgenic module will be useful in future investigations of muscle development in avian species. PMID:20184756
Ellisor, Debra; Koveal, Dorothy; Hagan, Nellwyn; Brown, Ashly; Zervas, Mark
2009-10-01
A long-standing problem in development is understanding how progenitor cells transiently expressing genes contribute to complex anatomical and functional structures. In the developing nervous system an additional level of complexity arises when considering how cells of distinct lineages relate to newly established neural circuits. To address these problems, we used both cumulative marking with Cre/loxP and Genetic Inducible Fate Mapping (GIFM), which permanently and heritably marks small populations of progenitors and their descendants with fine temporal control using CreER/loxP. A key component used in both approaches is a conditional phenotyping allele that has the potential to be expressed in all cell types, but is quiescent because of a loxP flanked Stop sequence, which precedes a reporter allele. Upon recombination, the resulting phenotyping allele is 'turned on' and then constitutively expressed. Thus, the reporter functions as a high fidelity genetic lineage tracer in vivo. Currently there is an array of reporter alleles that can be used in marking strategies, but their recombination efficiency and applicability to a wide array of tissues has not been thoroughly described. To assess the recombination/marking potential of the reporters, we utilized CreER(T) under the control of a Wnt1 transgene (Wnt1-CreER(T)) as well as a cumulative, non-inducible En1(Cre) knock-in line in combination with three different reporters: R26R (LacZ reporter), Z/EG (EGFP reporter), and Tau-Lox-STOP-Lox-mGFP-IRES-NLS-LacZ (membrane-targeted GFP/nuclear LacZ reporter). We marked the Wnt1 lineage using each of the three reporters at embryonic day (E) 8.5 followed by analysis at E10.0, E12.5, and in the adult. We also compared cumulative marking of cells with a history of En1 expression at the same stages. We evaluated the reporters by whole-mount and section analysis and ascertained the strengths and weaknesses of each of the reporters. Comparative analysis with the reporters
Factors affecting expression of the recF gene of Escherichia coli K-12.
Sandler, S J; Clark, A J
1990-01-31
This report describes four factors which affect expression of the recF gene from strong upstream lambda promoters under temperature-sensitive cIAt2-encoded repressor control. The first factor was the long mRNA leader sequence consisting of the Escherichia coli dnaN gene and 95% of the dnaA gene and lambda bet, N (double amber) and 40% of the exo gene. When most of this DNA was deleted, RecF became detectable in maxicells. The second factor was the vector, pBEU28, a runaway replication plasmid. When we substituted pUC118 for pBEU28, RecF became detectable in whole cells by the Coomassie blue staining technique. The third factor was the efficiency of initiation of translation. We used site-directed mutagenesis to change the mRNA leader, ribosome-binding site and the 3 bp before and after the translational start codon. Monitoring the effect of these mutational changes by translational fusion to lacZ, we discovered that the efficiency of initiation of translation was increased 30-fold. Only an estimated two- or threefold increase in accumulated levels of RecF occurred, however. This led us to discover the fourth factor, namely sequences in the recF gene itself. These sequences reduce expression of the recF-lacZ fusion genes 100-fold. The sequences responsible for this decrease in expression occur in four regions in the N-terminal half of recF. Expression is reduced by some sequences at the transcriptional level and by others at the translational level.
Zabeau, M; Stanley, K K
1982-01-01
Hybrid plasmids carrying cro-lacZ gene fusions have been constructed by joining DNA segments carrying the PR promoter and the start of the cro gene of bacteriophage lambda to the lacZ gene fragment carried by plasmid pLG400 . Plasmids in which the translational reading frames of the cro and lacZ genes are joined in-register (type I) direct the synthesis of elevated levels of cro-beta-galactosidase fusion protein amounting to 30% of the total cellular protein, while plasmids in which the genes are fused out-of-register (type II) produce a low level of beta-galactosidase protein. Sequence rearrangements downstream of the cro initiator AUG were found to influence the efficiency of translation, and have been correlated with alterations in the RNA secondary structure of the ribosome-binding site. Plasmids which direct the synthesis of high levels of beta-galactosidase are conditionally lethal and can only be propagated when the PR promoter is repressed. Deletion of sequences downstream of the lacZ gene restored viability, indicating that this region of the plasmid encodes a function which inhibits the growth of the cells. The different applications of these plasmids for expression of cloned genes are discussed. Images Fig. 6. PMID:6327257
Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J.; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José
2013-01-01
Myxococcus xanthus is a soil-dwelling member of the δ–Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains. PMID:23874560
Sakaguchi, M; Urakawa, T; Hirayama, Y; Miki, N; Yamamoto, M; Zhu, G S; Hirai, K
1993-07-01
The open reading frame (ORF) of 1206 bp within the short unique region (Us) of Marek's disease virus type 1 (MDV1) shows significant homology with the herpes simplex virus type 1 US3 gene encoding protein kinase (PK). The lacZ gene of Escherichia coli was inserted within the ORF, designated MDV1-US3, of MDV1 K544 strain DNA by homologous recombination. The plaque-purified recombinant MDV1 stably expressed the beta-galactosidase encoded by the inserted lacZ gene in infected cells and replicated well as the parental K544 strain. Antibodies against both MDV1 antigen and beta-galactosidase were detected in the sera of chickens immunized with recombinant MDV1. Chickens vaccinated with the recombinant MDV1 were protected from challenge with virulent MDV1. The MDV1 US3 gene expressed by a baculovirus vector encoded a 44-kDa protein. Mouse antisera against the 44-kDa protein reacted with two proteins of 44 and 45 kDa in extracts of cells infected with MDV1 but not with MDV types 2 or 3. The PK activity was detected in immune complexes of the anti-44-kDa sera with extracts of cells infected with MDV1 but not with the recombinant MDV1. Thus, PK encoded from the MDV1-US3 is not essential for virus replication in cell culture and vaccine-induced immunity.
Mercado-Blanco, J; García, F; Fernández-López, M; Olivares, J
1993-01-01
Melanin production by Rhizobium meliloti GR4 is linked to nonsymbiotic plasmid pRmeGR4b (140 MDa). Transfer of this plasmid to GR4-cured derivatives or to Agrobacterium tumefaciens enables these bacteria to produce melanin. Sequence analysis of a 3.5-kb PstI fragment of plasmid pRmeGR4b has revealed the presence of a open reading frame 1,481-bp that codes for a protein whose sequence shows strong homology to two conserved regions involved in copper binding in tyrosinases and hemocyanins. In vitro-coupled transcription-translation experiments showed that this open reading frame codes for a 55-kDa polypeptide. Melanin production in GR4 is not under the control of the RpoN-NifA regulatory system, unlike that in R. leguminosarum bv. phaseoli 8002. The GR4 tyrosinase gene could be expressed in Escherichia coli under the control of the lacZ promoter. For avoiding confusion with mel genes (for melibiose), a change of the name of the previously reported mel genes of R. leguminosarum bv. phaseoli and other organisms to mep genes (for melanin production) is proposed. Images PMID:8366027
Venkatesan, Jagadeesh Kumar; Moutos, Franklin T; Rey-Rico, Ana; Estes, Bradley T; Frisch, Janina; Schmitt, Gertrud; Madry, Henning; Guilak, Farshid; Cucchiarini, Magali
2018-05-02
Combining gene therapy approaches with tissue engineering procedures is an active area of translational research for the effective treatment of articular cartilage lesions, especially to target chondrogenic progenitor cells such as those derived from the bone marrow. Here, we evaluated the effect of genetically modifying concentrated human mesenchymal stem cells from bone marrow to induce chondrogenesis by recombinant adeno-associated viral (rAAV) vector gene transfer of the sex-determining region Y-type high-mobility group box 9 (SOX9) factor upon seeding in three-dimensional (3D) woven poly(ε-caprolactone) (PCL) scaffolds that provide mechanical properties mimicking those of native articular cartilage. Prolonged, effective SOX9 expression was reported in the constructs for at least 21 days, the longest time point evaluated, leading to enhanced metabolic and chondrogenic activities relative to the control conditions (reporter lacZ gene transfer or absence of vector treatment) but without affecting the proliferative activities in the samples. The application of the rAAV SOX9 vector also prevented undesirable hypertrophic and terminal differentiation in the seeded concentrates. As bone marrow is readily accessible during surgery, such findings reveal the therapeutic potential of providing rAAV-modified marrow concentrates within 3D woven PCL scaffolds for repair of focal cartilage lesions.
Adenoviral vector gene delivery via the round window membrane in guinea pigs.
Suzuki, Mitsuya; Yamasoba, Tatsuya; Suzukawa, Keigo; Kaga, Kimitaka
2003-10-27
We have found that damage from a local anesthetic solution containing phenol permitted beta-galactosidase (beta-gal) gene delivery to the guinea pig inner ear via the round window membrane (RWM). RWM damage was evident as degeneration of the outer epithelium. After adenovirus lacZ vector was applied to the damaged RWM, immunohistochemistry showed strong beta-gal expression in the RWM, mesothelial cells, organ of Corti, spiral limbus, spiral ligament and spiral ganglion. In the vestibular labyrinth, expression was seen in the sensory and supporting cells, transitional cells, and the dark-cell area. Thus, adenovirus can transfect a variety of inner ear cells in the guinea pig through a damaged RWM.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ge Shimei; Xie Baoen; Chen Sanfeng
2006-03-10
The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not existmore » in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.« less
Green, David W; Kim, Eun-Jung; Jung, Han-Sung
2015-09-01
The effectiveness of nonviral gene therapy remains uncertain because of low transfection efficiencies and high toxicities compared with viral-based strategies. We describe a simple system for transient transfection of continuous human cell lines, with low toxicity, using mineral-coated chitosan and alginate capsules. As proof-of-concept, we demonstrate transfection of Saos-2 and MG63 human osteosarcoma continuous cell lines with gfp, LacZ reporter genes, and a Sox-9 carrying plasmid, to illustrate expression of a functional gene with therapeutic relevance. We show that continuous cell lines transfect with significant efficiency of up to 65% possibly through the interplay between chitosan and DNA complexation and calcium/phosphate-induced translocation into cells entrapped within the 3D polysaccharide based environment, as evidenced by an absence of transfection in unmineralized and chitosan-free capsules. We demonstrated that our transfection system was equally effective at transfection of primary human bone marrow stromal cells. To illustrate, the Sox-9, DNA plasmid was spontaneously expressed in primary human bone marrow stromal cells at 7 days with up to 90% efficiency in two repeats. Mineralized polysaccharide macrocapsules are gene delivery vehicles with a number of biological and practical advantages. They are highly efficient at self-transfecting primary bone cells, with programmable spatial and temporal delivery prospects, premineralized bone-like environments, and have no cytotoxic effects, as compared with many other nonviral systems. © 2015 Wiley Periodicals, Inc.
Mukhopadhyay, Indranil; Saxena, Daya Krishna; Chowdhuri, Debapratim Kar
2003-01-01
Hazardous effects of an effluent from the chrome plating industry were examined by exposing transgenic Drosophila melanogaster (hsp70-lacZ) to various concentrations (0.05, 0.1, 1.0, 10.0, and 100.0 micro L/mL) of the effluent through diet. The emergence pattern of adult flies was affected, along with impaired reproductive performance at the higher dietary concentrations of the effluent. Interestingly, the effect of the effluent was more pronounced in male than in female flies. The effect of the effluent on development of adult flies was concurrent with the expression pattern of the heat shock protein 70 gene (hsp70), both in larval tissues and in the reproductive organs of adult flies. We observed a dose- and time-dependent expression of hsp70 in third instar larvae exposed for different time intervals. Absence of hsp70 expression in larvae exposed to 0.1 micro L/mL of the effluent indicated that this is the highest nontoxic concentration for Drosophila. The stress gene assay in the reproductive organs of adult flies revealed hsp70 expression in the testis of male flies only. However, trypan blue dye exclusion tests in these tissues indicate tissue damage in the male accessory gland of adult flies, which was further confirmed by ultrastructural observations. In the present study we demonstrate the utility of transgenic Drosophila as an alternative animal model for evaluating hazardous effects of the effluent from the chrome plating industry and further reveal the cytoprotective role of hsp70 and its expression as an early marker in environmental risk assessment. PMID:14644668
Large Genomic Fragment Deletions and Insertions in Mouse Using CRISPR/Cas9
Satheka, Achim Cchitvsanzwhoh; Togo, Jacques; An, Yao; Humphrey, Mabwi; Ban, Luying; Ji, Yan; Jin, Honghong; Feng, Xuechao; Zheng, Yaowu
2015-01-01
ZFN, TALENs and CRISPR/Cas9 system have been used to generate point mutations and large fragment deletions and insertions in genomic modifications. CRISPR/Cas9 system is the most flexible and fast developing technology that has been extensively used to make mutations in all kinds of organisms. However, the most mutations reported up to date are small insertions and deletions. In this report, CRISPR/Cas9 system was used to make large DNA fragment deletions and insertions, including entire Dip2a gene deletion, about 65kb in size, and β-galactosidase (lacZ) reporter gene insertion of larger than 5kb in mouse. About 11.8% (11/93) are positive for 65kb deletion from transfected and diluted ES clones. High targeting efficiencies in ES cells were also achieved with G418 selection, 46.2% (12/26) and 73.1% (19/26) for left and right arms respectively. Targeted large fragment deletion efficiency is about 21.4% of live pups or 6.0% of injected embryos. Targeted insertion of lacZ reporter with NEO cassette showed 27.1% (13/48) of targeting rate by ES cell transfection and 11.1% (2/18) by direct zygote injection. The procedures have bypassed in vitro transcription by directly co-injection of zygotes or co-transfection of embryonic stem cells with circular plasmid DNA. The methods are technically easy, time saving, and cost effective in generating mouse models and will certainly facilitate gene function studies. PMID:25803037
Molecular-genetic imaging based on reporter gene expression.
Kang, Joo Hyun; Chung, June-Key
2008-06-01
Molecular imaging includes proteomic, metabolic, cellular biologic process, and genetic imaging. In a narrow sense, molecular imaging means genetic imaging and can be called molecular-genetic imaging. Imaging reporter genes play a leading role in molecular-genetic imaging. There are 3 major methods of molecular-genetic imaging, based on optical, MRI, and nuclear medicine modalities. For each of these modalities, various reporter genes and probes have been developed, and these have resulted in successful transitions from bench to bedside applications. Each of these imaging modalities has its unique advantages and disadvantages. Fluorescent and bioluminescent optical imaging modalities are simple, less expensive, more convenient, and more user friendly than other imaging modalities. Another advantage, especially of bioluminescence imaging, is its ability to detect low levels of gene expression. MRI has the advantage of high spatial resolution, whereas nuclear medicine methods are highly sensitive and allow data from small-animal imaging studies to be translated to clinical practice. Moreover, multimodality imaging reporter genes will allow us to choose the imaging technologies that are most appropriate for the biologic problem at hand and facilitate the clinical application of reporter gene technologies. Reporter genes can be used to visualize the levels of expression of particular exogenous and endogenous genes and several intracellular biologic phenomena, including specific signal transduction pathways, nuclear receptor activities, and protein-protein interactions. This technique provides a straightforward means of monitoring tumor mass and can visualize the in vivo distributions of target cells, such as immune cells and stem cells. Molecular imaging has gradually evolved into an important tool for drug discovery and development, and transgenic mice with an imaging reporter gene can be useful during drug and stem cell therapy development. Moreover, instrumentation
Bej, A K; McCarty, S C; Atlas, R M
1991-01-01
Multiplex polymerase chain reaction (PCR) and gene probe detection of target lacZ and uidA genes were used to detect total coliform bacteria and Escherichia coli, respectively, for determining water quality. In tests of environmental water samples, the lacZ PCR method gave results statistically equivalent to those of the plate count and defined substrate methods accepted by the U.S. Environmental Protection Agency for water quality monitoring and the uidA PCR method was more sensitive than 4-methylumbelliferyl-beta-D-glucuronide-based defined substrate tests for specific detection of E. coli. Images PMID:1768116
A source of artifact in the lacZ reversion assay in Escherichia coli.
Hoffmann, George R; Gray, Carol L; Lange, Paulina B; Marando, Christie I
2015-06-01
The lacZ reversion assay in Escherichia coli measures point mutations that occur by specific base substitutions and frameshift mutations. The tester strains cannot use lactose as a carbon source (Lac(-)), and revertants are easily detected by growth on lactose medium (Lac(+)). Six strains identify the six possible base substitutions, and five strains measure +G, -G, -CG, +A and -A frameshifts. Strong mutagens give dose-dependent increases in numbers of revertants per plate and revertant frequencies. Testing compounds that are arguably nonmutagens or weakly mutagenic, we often noted statistically significant dose-dependent increases in revertant frequency that were not accompanied by an absolute increase in numbers of revertants. The increase in frequency was wholly ascribable to a declining number of viable cells owing to toxicity. Analysis of the conditions revealed that the frequency of spontaneous revertants is higher when there are fewer viable cells per plate. The phenomenon resembles "adaptive" or "stress" mutagenesis, whereby lactose revertants accumulate in Lac(-) bacteria under starvation conditions in the absence of catabolite repression. Adaptive mutation is observed after long incubation and might be expected to be irrelevant in a standard assay using 48-h incubation. However, we found that elevated revertant frequencies occur under typical assay conditions when the bacterial lawn is thin, and this can cause increases in revertant frequency that mimic chemical mutagenesis when treatments are toxic but not mutagenic. Responses that resemble chemical mutagenesis were observed in the absence of mutagenic treatment in strains that revert by different frameshift mutations. The magnitude of the artifact is affected by cell density, dilution, culture age, incubation time, catabolite repression and the age and composition of media. Although the specific reversion assay is effective for quickly distinguishing classes of mutations induced by potent mutagens, its
Msx1 is expressed in retina endothelial cells at artery branching sites.
Lopes, Miguel; Goupille, Olivier; Saint Cloment, Cécile; Robert, Benoît
2012-04-15
Msx1 and Msx2 encode homeodomain transcription factors that play a role in several embryonic developmental processes. Previously, we have shown that in the adult mouse, Msx1(lacZ) is expressed in vascular smooth muscle cells (VSMCs) and pericytes, and that Msx2(lacZ) is also expressed in VSMCs as well as in a few endothelial cells (ECs). The mouse retina and choroid are two highly vascularized tissues. Vessel alterations in the retina are associated with several human diseases and the retina has been intensely used for angiogenesis studies, whereas the choroid has been much less investigated. Using the Msx1(lacZ) and Msx2(lacZ) reporter alleles, we observed that Msx2 is not expressed in the eye vascular tree in contrast to Msx1, for which we establish the spatial and temporal expression pattern in these tissues. In the retina, expression of Msx1 takes place from P3, and by P10, it becomes confined to a subpopulation of ECs at branching points of superficial arterioles. These branching sites are characterized by a subpopulation of mural cells that also show specific expression programs. Specific Msx gene inactivation in the endothelium, using Msx1 and Msx2 conditional mutant alleles together with a Tie2-Cre transgene, did not lead to conspicuous structural defects in the retinal vascular network. Expression of Msx1 at branching sites might therefore be linked to vessel physiology. The retinal blood flow is autonomously regulated and perfusion of capillaries has been proposed to depend on arteriolar precapillary structures that might be the sites for Msx1 expression. On the other hand, branching sites are subject to shear stress that might induce Msx1 expression. In the choroid vascular layer Msx1(lacZ) is expressed more broadly and dynamically. At birth Msx1(lacZ) expression takes place in the endothelium but at P21 its expression has shifted towards the mural layer. We discuss the possible functions of Msx1 in the eye vasculature.
Msx1 is expressed in retina endothelial cells at artery branching sites
Lopes, Miguel; Goupille, Olivier; Saint Cloment, Cécile; Robert, Benoît
2012-01-01
Summary Msx1 and Msx2 encode homeodomain transcription factors that play a role in several embryonic developmental processes. Previously, we have shown that in the adult mouse, Msx1lacZ is expressed in vascular smooth muscle cells (VSMCs) and pericytes, and that Msx2lacZ is also expressed in VSMCs as well as in a few endothelial cells (ECs). The mouse retina and choroid are two highly vascularized tissues. Vessel alterations in the retina are associated with several human diseases and the retina has been intensely used for angiogenesis studies, whereas the choroid has been much less investigated. Using the Msx1lacZ and Msx2lacZ reporter alleles, we observed that Msx2 is not expressed in the eye vascular tree in contrast to Msx1, for which we establish the spatial and temporal expression pattern in these tissues. In the retina, expression of Msx1 takes place from P3, and by P10, it becomes confined to a subpopulation of ECs at branching points of superficial arterioles. These branching sites are characterized by a subpopulation of mural cells that also show specific expression programs. Specific Msx gene inactivation in the endothelium, using Msx1 and Msx2 conditional mutant alleles together with a Tie2-Cre transgene, did not lead to conspicuous structural defects in the retinal vascular network. Expression of Msx1 at branching sites might therefore be linked to vessel physiology. The retinal blood flow is autonomously regulated and perfusion of capillaries has been proposed to depend on arteriolar precapillary structures that might be the sites for Msx1 expression. On the other hand, branching sites are subject to shear stress that might induce Msx1 expression. In the choroid vascular layer Msx1lacZ is expressed more broadly and dynamically. At birth Msx1lacZ expression takes place in the endothelium but at P21 its expression has shifted towards the mural layer. We discuss the possible functions of Msx1 in the eye vasculature. PMID:23213427
Wolter, R; Siede, W; Brendel, M
1996-02-05
The interstrand cross-link repair gene SNM1 of Saccharomyces cerevisiae was examined for regulation in response to DNA-damaging agents. Induction of SNM1-lacZ fusions was detected in response to nitrogen mustard, cis-platinum (II) diamine dichloride, UV light, and 8-methoxypsoralen + UVA, but not after heat-shock treatment or incubation with 2-dimethylaminoethylchloride, methylmethane sulfonate or 4-nitroquinoline-N-oxide. The promoter of SNM1 contains a 15 bp motif, which shows homology to the DRE2 box of the RAD2 promoter. Similar motifs have been found in promoter regions of other damage-inducible DNA repair genes. Deletion of this motif results in loss of inducibility of SNM1. Also, a putative negative upstream regulation sequence was found to be responsible for repression of constitutive transcription of SNM1. Surprisingly, no inducibility of SNM1 was found after treatment with DNA-damaging agents in strains without an intact DUN1 gene, while regulation seems unchanged in sad1 mutants.
Hirano, M; Mori, H; Onogi, T; Yamazoe, M; Niki, H; Ogura, T; Hiraga, S
1998-02-01
The sopAB operon and the sopC sequence, which acts as a centromere, are essential for stable maintenance of the mini-F plasmid. Immunoprecipitation experiments with purified SopA and SopB proteins have demonstrated that these proteins interact in vitro. Expression studies using the lacZ gene as a reporter revealed that the sopAB operon is repressed by the cooperative action of SopA and SopB. Using immunofluorescence microscopy, we found discrete fluorescent foci of SopA and SopB in cells that produce both SopA and SopB in the presence of the sopC DNA segment, but not in the absence of sopC, suggesting the SopA-SopB complex binds to sopC segments. SopA was exclusively found to colocalize with nucleoids in cells that produced only SopA, while, in the absence of SopA, SopB was distributed in the cytosolic spaces.
In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression.
Carlin, Sean; Pugachev, Andrei; Sun, Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C Clifton; Humm, John L
2009-10-01
To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer (18)F-fluoromisonidazole ((18)F-FMISO). Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe (124)I-2'-fluoro-2'-deoxy-1-beta-d-arabinofuranosyl-5-iodouracil ((124)I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between (124)I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe (18)F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with (124)I-FIAU (3 h before sacrifice) and (18)F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between (18)F-FMISO and (124)I-FIAU on a pixel-by-pixel basis was performed. Correlation coefficients between (124)I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between (18)F-FMISO and (124)I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of this model for the
Benhar, I; Miller, C; Engelberg-Kulka, H
1993-01-01
The Escherichia coli trpR gene encodes the 108-amino-acid-long Trp repressor. We have shown previously that a +1 frameshifting event occurs during the expression of trpR, resulting in the synthesis of an additional (+1 frame) polypeptide. Using trpR-lac'Z fusions, we have recently found that the transition from the 0 to the +1 frame occurs via the bypassing of a 55-nucleotide-long segment of the trpR+1-lac'Z mRNA (I. Benhar, and H. Engelberg-Kulka, Cell 72:121-130, 1993). Here we show that the frequency of trpR frameshifting (or bypassing) can be regulated both in vivo and in vitro. This frequency is inversely proportional to the rate of initiation of translation of the trpR gene. Hence, modulating the level of translation initiation affects the frequency of frameshifting. Images PMID:8491735
Guenther, Catherine A; Wang, Zhen; Li, Emma; Tran, Misha C; Logan, Catriona Y; Nusse, Roel; Pantalena-Filho, Luiz; Yang, George P; Kingsley, David M
2015-08-01
Bone morphogenetic proteins (BMPs) are key signaling molecules required for normal development of bones and other tissues. Previous studies have shown that null mutations in the mouse Bmp5 gene alter the size, shape and number of multiple bone and cartilage structures during development. Bmp5 mutations also delay healing of rib fractures in adult mutants, suggesting that the same signals used to pattern embryonic bone and cartilage are also reused during skeletal regeneration and repair. Despite intense interest in BMPs as agents for stimulating bone formation in clinical applications, little is known about the regulatory elements that control developmental or injury-induced BMP expression. To compare the DNA sequences that activate gene expression during embryonic bone formation and following acute injuries in adult animals, we assayed regions surrounding the Bmp5 gene for their ability to stimulate lacZ reporter gene expression in transgenic mice. Multiple genomic fragments, distributed across the Bmp5 locus, collectively coordinate expression in discrete anatomic domains during normal development, including in embryonic ribs. In contrast, a distinct regulatory region activated expression following rib fracture in adult animals. The same injury control region triggered gene expression in mesenchymal cells following tibia fracture, in migrating keratinocytes following dorsal skin wounding, and in regenerating epithelial cells following lung injury. The Bmp5 gene thus contains an "injury response" control region that is distinct from embryonic enhancers, and that is activated by multiple types of injury in adult animals. Copyright © 2015 Elsevier Inc. All rights reserved.
Tang, Qiu-sha; Zhang, Dong-sheng; Cong, Xiao-ming; Wan, Mei-ling; Jin, Li-qiang
2008-06-01
One of the main advantages of gene therapy over traditional therapy is the potential to target the expression of therapeutic genes in desired cells or tissues. To achieve targeted gene expression, we developed a novel heat-inducible gene expression system in which thermal energy generated by Mn-Zn ferrite magnetic nanoparticles (MZF-NPs) under an alternating magnetic field (AMF) was used to activate gene expression. MZF-NPs, obtained by co-precipitation method, were firstly surface modified with cation poly(ethylenimine) (PEI). Then thermodynamic test of various doses of MZF-NPs was preformed in vivo and in vitro. PEI-MZF-NPs showed good DNA binding ability and high transfection efficiency. In AMF, they could rise to a steady temperature. To analyze the heat-induced gene expression under an AMF, we combined P1730OR vector transfection with hyperthermia produced by irradiation of MZF-NPs. By using LacZ gene as a reporter gene and Hsp70 as a promoter, it was demonstrated that expression of a heterogeneous gene could be elevated to 10 to 500-fold over background by moderate hyperthermia (added 12.24 or 25.81 mg MZF-NPs to growth medium) in tissue cultured cells. When injected with 2.6 or 4.6 mg MZF-NPs, the temperature of tumor-bearing nude mice could rise to 39.5 or 42.8 degrees C, respectively, and the beta-gal concentration could increase up to 3.8 or 8.1 mU/mg proteins accordingly 1 day after hyperthermia treatment. Our results therefore supported hyperthermia produced by irradiation of MZF-NPs under an AMF as a feasible approach for targeted heat-induced gene expression. This novel system made use of the relative low Curie point of MZF-NPs to control the in vivo hyperthermia temperature and therefore acquired safe and effective heat-inducible transgene expression.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Luethi, E.; Jasmat, N.B.; Grayling, R.A.
1991-03-01
A {lambda} recombinant phage expressing {beta}-mannanase activity in Escherichia coli has been isolated from a genomic library of the extremely thermophilic anaerobe Caldocellum saccharolyticum. The gene was cloned into pBR322 on a 5-kb BamHI fragment, and its location was obtained by deletion analysis. The sequence of a 2.1-kb fragment containing the mannanase gene has been determined. One open reading frame was found which could code for a protein of M{sub r} 38,904. The mannanase gene (manA) was overexpressed in E. coli by cloning the gene downstream from the lacZ promoter of pUC18. The enzyme was most active at pH 6more » and 80 C and degraded locust bean gum, guar gum, Pinus radiata glucomannan, and konjak glucomannan. The noncoding region downstream from the mannanase gene showed strong homology to celB, a gene coding for a cellulase from the same organism, suggesting that the manA gene might have been inserted into its present position on the C. saccharolyticum genome by homologous recombination.« less
Liu, Yang; Jiang, Guoqiao; Cui, Yaya; Mukherjee, Asita; Ma, Wei Lei; Chatterjee, Arun K.
1999-01-01
Erwinia carotovora subsp. carotovora produces extracellular pectate lyase (Pel), polygalacturonase (Peh), cellulase (Cel), and protease (Prt). The concerted actions of these enzymes largely determine the virulence of this plant-pathogenic bacterium. E. carotovora subsp. carotovora also produces HarpinEcc, the elicitor of the hypersensitive reaction. We document here that KdgREcc (Kdg, 2-keto-3-deoxygluconate; KdgR, general repressor of genes involved in pectin and galacturonate catabolism), a homolog of the E. chrysanthemi repressor, KdgREch and the Escherichia coli repressor, KdgREco, negatively controls not only the pectinases, Pel and Peh, but also Cel, Prt, and HarpinEcc production in E. carotovora subsp. carotovora. The levels of pel-1, peh-1, celV, and hrpNEcc transcripts are markedly affected by KdgREcc. The KdgREcc− mutant is more virulent than the KdgREcc+ parent. Thus, our data for the first time establish a global regulatory role for KdgREcc in E. carotovora subsp. carotovora. Another novel observation is the negative effect of KdgREcc on the transcription of rsmB (previously aepH), which specifies an RNA regulator controlling exoenzyme and HarpinEcc production. The levels of rsmB RNA are higher in the KdgREcc− mutant than in the KdgREcc+ parent. Moreover, by DNase I protection assays we determined that purified KdgREcc protected three 25-bp regions within the transcriptional unit of rsmB. Alignment of the protected sequences revealed the 21-mer consensus sequence of the KdgREcc-binding site as 5′-G/AA/TA/TGAAA[N6]TTTCAG/TG/TA-3′. Two such KdgREcc-binding sites occur in rsmB DNA in a close proximity to each other within nucleotides +79 and +139 and the third KdgREcc-binding site within nucleotides +207 and +231. Analysis of lacZ transcriptional fusions shows that the KdgR-binding sites negatively affect the expression of rsmB. KdgREcc also binds the operator DNAs of pel-1 and peh-1 genes and represses expression of a pel1-lacZ and a peh1-lacZ
Uchida, Kenzo; Nakajima, Hideaki; Hirai, Takayuki; Yayama, Takafumi; Chen, Kebing; Guerrero, Alexander Rodriguez; Johnson, William Eustace; Baba, Hisatoshi
2012-12-15
The twy/twy mouse undergoes spontaneous chronic mechanical compression of the spinal cord; this in vivo model system was used to examine the effects of retrograde adenovirus (adenoviral vector [AdV])-mediated brain-derived neurotrophic factor (BDNF) gene delivery to spinal neural cells. To investigate the targeting and potential neuroprotective effect of retrograde AdV-mediated BDNF gene transfection in the chronically compressed spinal cord in terms of prevention of apoptosis of neurons and oligodendrocytes. Several studies have investigated the neuroprotective effects of neurotrophins, including BDNF, in spinal cord injury. However, no report has described the effects of retrograde neurotrophic factor gene delivery in compressed spinal cords, including gene targeting and the potential to prevent neural cell apoptosis. AdV-BDNF or AdV-LacZ (as a control gene) was injected into the bilateral sternomastoid muscles of 18-week old twy/twy mice for retrograde gene delivery via the spinal accessory motor neurons. Heterozygous Institute of Cancer Research mice (+/twy), which do not undergo spontaneous spinal compression, were used as a control for the effects of such compression on gene delivery. The localization and cell specificity of β-galactosidase expression (produced by LacZ gene transfection) and BDNF expression in the spinal cord were examined by coimmunofluorescence staining for neural cell markers (NeuN, neurons; reactive immunology protein, oligodendrocytes; glial fibrillary acidic protein, astrocytes; OX-42, microglia) 4 weeks after gene injection. The possible neuroprotection afforded by retrograde AdV-BDNF gene delivery versus AdV-LacZ-transfected control mice was assessed by scoring the prevalence of apoptotic cells (terminal deoxynucleotidyl transferase-mediated dUTP-biotin nick end labeling-positive cells) and immunoreactivity to active caspases -3, -8, and -9, p75, neurofilament 200 kD (NF), and for the oligodendroglial progenitor marker, NG2. RESULTS
Insertion and deletion mutagenesis of the human cytomegalovirus genome
DOE Office of Scientific and Technical Information (OSTI.GOV)
Spaete, R.R.; Mocarski, E.S.
1987-10-01
Studies on human cytomegalovirus (CMV) have been limited by a paucity of molecular genetic techniques available for manipulating the viral genome. The authors have developed methods for site-specific insertion and deletion mutagenesis of CMV utilizing a modified Escherichia coli lacZ gene as a genetic marker. The lacZ gene was placed under the control of the major ..beta.. gene regulatory signals and inserted into the viral genome by homologous recombination, disrupting one of two copies of this ..beta.. gene within the L-component repeats of CMV DNA. They observed high-level expression of ..beta..-galactosidase by the recombinant in a temporally authentic manner, withmore » levels of this enzyme approaching 1% of total protein in infected cells. Thus, CMV is an efficient vector for high-level expression of foreign gene products in human cells. Using back selection of lacZ-deficient virus in the presence of the chromogenic substrate 5-bromo-4-chloro-3-indolyl ..beta..-D-galactoside, they generated random endpoint deletion mutants. Analysis of these mutant revealed that CMV DNA sequences flanking the insert had been removed, thereby establishing this approach as a means of determining whether sequences flanking a lacZ insertion are dispensable for viral growth. In an initial test of the methods, they have shown that 7800 base pairs of one copy of L-component repeat sequences can be deleted without affecting viral growth in human fibroblasts.« less
Sumoy, L; Wang, C K; Lichtler, A C; Pierro, L J; Kosher, R A; Upholt, W B
1995-07-01
Msx-2 is a member of the Msx family of homeobox-containing genes expressed in a variety of embryonic tissues involved in epithelial-mesenchymal interactions and pattern formation. In the developing chick limb bud, Msx-2 is expressed in the apical ectodermal ridge, which plays a crucial role in directing the growth and patterning of limb mesoderm. In addition, Msx-2 is expressed in the anterior nonskeletal-forming mesoderm of the limb bud, in the posterior necrotic zone, and in the interdigital mesenchyme. Studies of the altered expression patterns of Msx-2 in amelic and polydactylous mutant chick limbs have suggested that the apical ectodermal ridge and mesodermal domains of Msx-2 expression are independently regulated and that there might be separate cis-regulatory elements in the Msx-2 gene controlling its spatially distinct domains of expression. To test this hypothesis, we have isolated the chicken Msx-2 gene and have tested the ability of various regions of the gene to target expression of LacZ reporter gene to specific regions of the limbs of transgenic mice. A variety of these constructs are consistently expressed only in the apical ectodermal ridge and the ectoderm of the genital tubercle and are not expressed in the mesoderm of the limb bud or in other regions of the embryo where the endogenous Msx-2 gene is expressed. These results suggest the presence of spatially specific cis-regulatory elements in the Msx-2 gene. We identified a 348-bp region in the 5' flanking region of the Msx-2 gene which can act as an apical ectodermal ridge enhancer element when placed in reverse orientation in front of the reporter gene with transcription initiation directed by the minimal hsp68 promoter.
Design and interpretation of microRNA-reporter gene activity.
Carroll, Adam P; Tooney, Paul A; Cairns, Murray J
2013-06-15
MicroRNAs (miRNAs) are small noncoding RNA molecules that act as sequence specificity guides to direct post-transcriptional gene silencing. In doing so, miRNAs regulate many critical developmental processes, including cellular proliferation, differentiation, migration, and apoptosis, as well as more specialized biological functions such as dendritic spine development and synaptogenesis. Interactions between miRNAs and their miRNA recognition elements occur via partial complementarity, rendering tremendous redundancy in targeting such that miRNAs are predicted to regulate 60% of the genome, with each miRNA estimated to regulate more than 200 genes. Because these predictions are prone to false positives and false negatives, there is an ever present need to provide material support to these assertions to firmly establish the biological function of specific miRNAs in both normal and pathophysiological contexts. Using schizophrenia-associated miR-181b as an example, we present detailed guidelines and novel insights for the rapid establishment of a streamlined miRNA-reporter gene assay and explore various design concepts for miRNA-reporter gene applications, including bidirectional miRNA modulation. In exemplifying this approach, we report seven novel miR-181b target sites for five schizophrenia candidate genes (DISC1, BDNF, ENKUR, GRIA1, and GRIK1) and dissect a number of vital concepts regarding future developments for miRNA-reporter gene assays and the interpretation of their results. Copyright © 2013 Elsevier Inc. All rights reserved.
The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.
Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R
2003-02-01
The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.
Leskiw, B K; Lawlor, E J; Fernandez-Abalos, J M; Chater, K F
1991-01-01
In Streptomyces coelicolor A3(2) and the related species Streptomyces lividans 66, aerial mycelium formation and antibiotic production are blocked by mutations in bldA, which specifies a tRNA(Leu)-like gene product which would recognize the UUA codon. Here we show that phenotypic expression of three disparate genes (carB, lacZ, and ampC) containing TTA codons depends strongly on bldA. Site-directed mutagenesis of carB, changing its two TTA codons to CTC (leucine) codons, resulted in bldA-independent expression; hence the bldA product is the principal tRNA for the UUA codon. Two other genes (hyg and aad) containing TTA codons show a medium-dependent reduction in phenotypic expression (hygromycin resistance and spectinomycin resistance, respectively) in bldA mutants. For hyg, evidence is presented that the UUA codon is probably being translated by a tRNA with an imperfectly matched anticodon, giving very low levels of gene product but relatively high resistance to hygromycin. It is proposed that TTA codons may be generally absent from genes expressed during vegetative growth and from the structural genes for differentiation and antibiotic production but present in some regulatory and resistance genes associated with the latter processes. The codon may therefore play a role in developmental regulation. Images PMID:1826053
Generation of stable cell line by using chitosan as gene delivery system.
Şalva, Emine; Turan, Suna Özbaş; Ekentok, Ceyda; Akbuğa, Jülide
2016-08-01
Establishing stable cell lines are useful tools to study the function of various genes and silence or induce the expression of a gene of interest. Nonviral gene transfer is generally preferred to generate stable cell lines in the manufacturing of recombinant proteins. In this study, we aimed to establish stable recombinant HEK-293 cell lines by transfection of chitosan complexes preparing with pDNA which contain LacZ and GFP genes. Chitosan which is a cationic polymer was used as gene delivery system. Stable HEK-293 cell lines were established by transfection of cells with complexes which were prepared with chitosan and pVitro-2 plasmid vector that contains neomycin drug resistance gene, beta gal and GFP genes. The transfection efficiency was shown with GFP expression in the cells using fluorescence microscopy. Beta gal protein expression in stable cells was examined by beta-galactosidase assay as enzymatically and X-gal staining method as histochemically. Full complexation was shown in the above of 1/1 ratio in the chitosan/pDNA complexes. The highest beta-galactosidase activity was obtained with transfection of chitosan complexes. Beta gal gene expression was 15.17 ng/ml in the stable cells generated by chitosan complexes. In addition, intensive blue color was observed depending on beta gal protein expression in the stable cell line with X-gal staining. We established a stable HEK-293 cell line that can be used for recombinant protein production or gene expression studies by transfecting the gene of interest.
Detection of Protein Interactions in T3S Systems Using Yeast Two-Hybrid Analysis.
Nilles, Matthew L
2017-01-01
Two-hybrid systems, sometimes termed interaction traps, are genetic systems designed to find and analyze interactions between proteins. The most common systems are yeast based (commonly Saccharomyces cerevisae) and rely on the functional reconstitution of the GAL4 transcriptional activator. Reporter genes, such as the lacZ gene of Escherichia coli (encodes β-galactosidase), are placed under GAL4-dependent transcriptional control to provide quick and reliable detection of protein interactions. In this method the use of a yeast-based two-hybrid system is described to study protein interactions between components of type III secretion systems.
Maye, Peter; Stover, Mary Louise; Liu, Yaling; Rowe, David W; Gong, Shiaochin; Lichtler, Alexander C
2009-03-13
Reporter gene mice are valuable animal models for biological research providing a gene expression readout that can contribute to cellular characterization within the context of a developmental process. With the advancement of bacterial recombination techniques to engineer reporter gene constructs from BAC genomic clones and the generation of optically distinguishable fluorescent protein reporter genes, there is an unprecedented capability to engineer more informative transgenic reporter mouse models relative to what has been traditionally available. We demonstrate here our first effort on the development of a three stage bacterial recombination strategy to physically link multiple genes together with their respective fluorescent protein (FP) reporters in one DNA fragment. This strategy uses bacterial recombination techniques to: (1) subclone genes of interest into BAC linking vectors, (2) insert desired reporter genes into respective genes and (3) link different gene-reporters together. As proof of concept, we have generated a single DNA fragment containing the genes Trap, Dmp1, and Ibsp driving the expression of ECFP, mCherry, and Topaz FP reporter genes, respectively. Using this DNA construct, we have successfully generated transgenic reporter mice that retain two to three gene readouts. The three stage methodology to link multiple genes with their respective fluorescent protein reporter works with reasonable efficiency. Moreover, gene linkage allows for their common chromosomal integration into a single locus. However, the testing of this multi-reporter DNA construct by transgenesis does suggest that the linkage of two different genes together, despite their large size, can still create a positional effect. We believe that gene choice, genomic DNA fragment size and the presence of endogenous insulator elements are critical variables.
Lézot, F; Thomas, B; Hotton, D; Forest, N; Orestes-Cardoso, S; Robert, B; Sharpe, P; Berdal, A
2000-03-01
Msx and Dlx homeobox genes encode for transcription factors that control early morphogenesis. More specifically, Msx-1, Msx-2, and Dlx-2 homeobox genes contribute to the initial patterning of the dentition. The present study is devoted to the potential role of those homeobox genes during the late formation of mineralized tissues, using the rodent incisor as an experimental system. The continuously erupting mandibular incisor allows (1) the coinvestigation of the whole sequences of amelogenesis and dentinogenesis, aligned along the main dental axis in a single sample in situ and (2) the differential characterization of transcripts generated by epithelial and ectomesenchymal odontogenic cells. Northern blot experiments on microdissected cells showed the continuing expression of Msx-2 and Dlx-2 in the later stages of dental biomineralization, differentially in epithelial and ectomesenchymal compartments. Transgenic mice produced with LacZ reporter constructs for Dlx-2 and Msx-1 were used to detect different components of the gene expression patterns with the sensitive beta-galactosidase histoenzymology. The results show a prominent epithelial involvement of Dlx-2, with stage-specific variations in the cells involved in enamel formation. Quantitative analyses identified specific modulations of Dlx-2 expression in ameloblasts depending on the anatomical sites of the incisor, showing more specifically an inverse linear relationship between the Dlx-2 promoter activity level and enamel thickness. This investigation extends the role of homeoproteins to postmitotic stages, which would control secretory cell activity, in a site-specific manner as shown here for Dlx-2.
Optical imaging of reporter gene expression using a positron-emission-tomography probe
NASA Astrophysics Data System (ADS)
Liu, Hongguang; Ren, Gang; Liu, Shuanglong; Zhang, Xiaofen; Chen, Luxi; Han, Peizhen; Cheng, Zhen
2010-11-01
Reporter gene/reporter probe technology is one of the most important techniques in molecular imaging. Lately, many reporter gene/reporter probe systems have been coupled to different imaging modalities such as positron emission tomography (PET) and optical imaging (OI). It has been recently found that OI techniques could be used to monitor radioactive tracers in vitro and in living subjects. In this study, we further demonstrate that a reporter gene/nuclear reporter probe system [herpes simplex virus type-1 thymidine kinase (HSV1-tk) and 9-(4-18F-fluoro-3-[hydroxymethyl] butyl) guanine ([18F]FHBG)] could be successfully imaged by OI in vitro and in vivo. OI with radioactive reporter probes will facilitate and broaden the applications of reporter gene/reporter probe techniques in medical research.
Jiao, Song; Yu, Huimin; Shen, Zhongyao
2018-09-25
To satisfy the urgent demand for promoter engineering that can accurately regulate the metabolic circuits and expression of specific genes in the Rhodococcus microbial platform, a promoter-ribosome binding site (RBS) coupled mini-pool with fine-tuning of different activity levels was successfully established. Transcriptome analyses of R. ruber TH revealed several representative promoters with different activity levels, e.g., Pami, Pcs, Pnh, P50sl36, PcbiM, PgroE and Pniami. β-Galactosidase (LacZ) reporter measurement demonstrated that different gene expression levels could be obtained with these natural promoters combined with an optimal RBS of ami. Further use of these promoters to overexpress the nitrile hydratase (NHase) gene with RBSami in R. ruber THdAdN produced different expression levels consistent with the transcription analyses. The -35 and -10 core elements of different promoters were further analyzed, and the conserved sequences were revealed to be TTGNNN and (T/C)GNNA(A/C)AAT. By mutating the core elements of the strong promoters, Pnh and Pami, into the above consensus sequence, two even stronger promoters, PnhM and PamiM, were obtained with 2.2-fold and 7.7-fold improvements in transcription, respectively. Integrating several strategies, including transcriptome promoter screening, -35 and -10 core element identification, core element point-mutation, RBS optimization and diverse reporter verification, a fine-tuning promoter-RBS combination mini-pool with different activity levels in Rhodococcus strains was successfully established. This development is significant for broad applications of the Rhodococcus genus as a microbial platform. Copyright © 2018 Elsevier B.V. All rights reserved.
Development of Plant Gene Vectors for Tissue-Specific Expression Using GFP as a Reporter Gene
NASA Technical Reports Server (NTRS)
Jackson, Jacquelyn; Egnin, Marceline; Xue, Qi-Han; Prakash, C. S.
1997-01-01
Reporter genes are widely employed in plant molecular biology research to analyze gene expression and to identify promoters. Gus (UidA) is currently the most popular reporter gene but its detection requires a destructive assay. The use of jellyfish green fluorescent protein (GFP) gene from Aequorea Victoria holds promise for noninvasive detection of in vivo gene expression. To study how various plant promoters are expressed in sweet potato (Ipomoea batatas), we are transcriptionally fusing the intron-modified (mGFP) or synthetic (modified for codon-usage) GFP coding regions to these promoters: double cauliflower mosaic virus 35S (CaMV 35S) with AMV translational enhancer, ubiquitin7-intron-ubiquitin coding region (ubi7-intron-UQ) and sporaminA. A few of these vectors have been constructed and introduced into E. coli DH5a and Agrobacterium tumefaciens EHA105. Transient expression studies are underway using protoplast-electroporation and particle bombardment of leaf tissues.
Kwan, C T; Tsang, S L; Krumlauf, R; Sham, M H
2001-04-01
The expression pattern of the mouse Hoxb3 gene is exceptionally complex and dynamic compared with that of other members of the Hoxb cluster. There are multiple types of transcripts for Hoxb3 gene, and the anterior boundaries of its expression vary at different stages of development. Two enhancers flanking Hoxb3 on the 3' and 5' sides regulate Hoxb2 and Hoxb4, respectively, and these control regions define the two ends of a 28-kb interval in and around the Hoxb3 locus. To assay the regulatory potential of DNA fragments in this interval we have used transgenic analysis with a lacZ reporter gene to locate cis-elements for directing the dynamic patterns of Hoxb3 expression. Our detailed analysis has identified four new and widely spaced cis-acting regulatory regions that can together account for major aspects of the Hoxb3 expression pattern. Elements Ib, IIIa, and IVb control gene expression in neural and mesodermal tissues; element Va controls mesoderm-specific gene expression. The most anterior neural expression domain of Hoxb3 is controlled by an r5 enhancer (element IVa); element IIIa directs reporter expression in the anterior spinal cord and hindbrain up to r6, and the region A enhancer (in element I) mediates posterior neural expression. Hence, the regulation of segmental expression of Hoxb3 in the hindbrain is different from that of Hoxa3, as two separate enhancer elements contribute to expression in r5 and r6. The mesoderm-specific element (Va) directs reporter expression to prevertebra C1 at 12.5 dpc, which is the anterior limit of paraxial mesoderm expression for Hoxb3. When tested in combinations, these cis-elements appear to work as modules in an additive manner to recapitulate the major endogenous expression patterns of Hoxb3 during embryogenesis. Together our study shows that multiple control elements direct reporter gene expression in diverse tissue-, temporal-, and spatially restricted subset of the endogenous Hoxb3 expression domains and work in
Role of Spermidine in Overwintering of Cyanobacteria
Zhu, Xiangzhi; Li, Qiong; Yin, Chuntao; Fang, Xiantao
2015-01-01
ABSTRACT Polyamines are found in all groups of cyanobacteria, but their role in environmental adaptation has been barely investigated. In Synechocystis sp. strain PCC 6803, inactivation of spermidine synthesis genes significantly reduced the survivability under chill (5°C)-light stress, and the survivability could be restored by addition of spermidine. To analyze the effects of spermidine on gene expression at 5°C, lacZ was expressed from the promoter of carboxy(nor)spermidine decarboxylase gene (CASDC) in Synechocystis. Synechocystis 6803::PCASDC-lacZ pretreated at 15°C showed a high level of LacZ activity for a long period of time at 5°C; without the pretreatment or with protein synthesis inhibited at 5°C, the enzyme activity gradually decreased. In a spermidine-minus mutant harboring PCASDC-lacZ, lacZ showed an expression pattern as if protein synthesis were inhibited at 5°C, even though the stability of its mRNA increased. Four other genes, including rpoA that encodes the α subunit of RNA polymerase, showed similar expression patterns. The chill-light stress led to a rapid increase of protein carbonylation in Synechocystis. The protein carbonylation then quickly returned to the background level in the wild type but continued to slowly increase in the spermidine-minus mutant. Our results indicate that spermidine promotes gene expression and replacement of damaged proteins in cyanobacteria under the chill-light stress in winter. IMPORTANCE Outbreak of cyanobacterial blooms in freshwater lakes is a worldwide environmental problem. In the annual cycle of bloom-forming cyanobacteria, overwintering is the least understood stage. Survival of Synechocystis sp. strain PCC 6803 under long-term chill (5°C)-light stress has been established as a model for molecular studies on overwintering of cyanobacteria. Here, we show that spermidine, the most common polyamine in cyanobacteria, promotes the survivability of Synechocystis under long-term chill-light stress and
Visualization of ecdysteroid activity using a reporter gene in the crustacean, Daphnia.
Asada, Miki; Kato, Yasuhiko; Matsuura, Tomoaki; Watanabe, Hajime
2014-02-01
Ecdysone is a hormone known to play a pivotal role in crustaceans and insects. In order to evaluate the ecdysone activities in the environment and within the organism, we have developed a biomonitoring Daphnia strain by introducing a reporter gene. In this study, the ecdysone response element was inserted in the upstream region of a reporter gene, and the DNA construct was injected into Daphnia eggs. The expression of the reporter gene was detected during the early embryonic development stage. In addition, when the eggs expressing the reporter gene were exposed to ecdysone, there was enhanced expression of the reporter gene at detectable levels, while the presence of an antagonist led to its downregulation. These results suggested that this system could be potentially developed for monitoring ecdysone activities in media. Copyright © 2013 Elsevier Ltd. All rights reserved.
Watch out for reporter gene assays with Renilla luciferase and paclitaxel.
Theile, Dirk; Spalwisz, Adriana; Weiss, Johanna
2013-06-15
Luminescence-based reporter gene assays are widely used in biochemistry. Signals from reporter genes (e.g., firefly luminescence) are usually normalized to signals from constantly luminescing luciferases such as Renilla luciferase. This normalization step can be performed by modern luminometry devices automatically providing final results. Here we demonstrate paclitaxel to strikingly enhance Renilla luminescence, thereby potentially flawing results from reporter gene assays. In consequence, these data advocate for careful examination of raw data and militate against automatic data processing. Copyright © 2013 Elsevier Inc. All rights reserved.
Rentsendorj, Otgonchimeg; Nagy, Andrea; Sinkó, Ildikó; Daraba, Andreea; Barta, Endre; Kiss, Ibolya
2005-08-01
The matrilin-1 gene has the unique feature that it is expressed in chondrocytes in a developmental stage-specific manner. Previously, we found that the chicken matrilin-1 long promoter with or without the intronic enhancer and the short promoter with the intronic enhancer restricted the transgene expression to the columnar proliferative chondroblasts and prehypertrophic chondrocytes of growth-plate cartilage in transgenic mice. To study whether the short promoter shared by these transgenes harbours cartilage-specific control elements, we generated transgenic mice expressing the LacZ reporter gene under the control of the matrilin-1 promoter between -338 and +67. Histological analysis of the founder embryos demonstrated relatively weak transgene activity in the developing chondrocranium, axial and appendicular skeleton with highest level of expression in the columnar proliferating chondroblasts and prehypertrophic chondrocytes. Computer analysis of the matrilin-1 genes of amniotes revealed a highly conserved Pe1 (proximal promoter element 1) and two less-conserved sequence blocks in the distal promoter region. The inverted Sox motifs of the Pe1 element interacted with chondrogenic transcription factors Sox9, L-Sox5 and Sox6 in vitro and another factor bound to the spacer region. Point mutations in the Sox motifs or in the spacer region interfered with or altered the formation of nucleoprotein complexes in vitro and significantly decreased the reporter gene activity in transient expression assays in chondrocytes. In vivo occupancy of the Sox motifs in genomic footprinting in the expressing cell type, but not in fibroblasts, also supported the involvement of Pe1 in the tissue-specific regulation of the gene. Our results indicate that interaction of Pe1 with distal DNA elements is required for the high level, cartilage- and developmental stage-specific transgene expression.
Alpha-fetoprotein-targeted reporter gene expression imaging in hepatocellular carcinoma.
Kim, Kwang Il; Chung, Hye Kyung; Park, Ju Hui; Lee, Yong Jin; Kang, Joo Hyun
2016-07-21
Hepatocellular carcinoma (HCC) is one of the most common cancers in Eastern Asia, and its incidence is increasing globally. Numerous experimental models have been developed to better our understanding of the pathogenic mechanism of HCC and to evaluate novel therapeutic approaches. Molecular imaging is a convenient and up-to-date biomedical tool that enables the visualization, characterization and quantification of biologic processes in a living subject. Molecular imaging based on reporter gene expression, in particular, can elucidate tumor-specific events or processes by acquiring images of a reporter gene's expression driven by tumor-specific enhancers/promoters. In this review, we discuss the advantages and disadvantages of various experimental HCC mouse models and we present in vivo images of tumor-specific reporter gene expression driven by an alpha-fetoprotein (AFP) enhancer/promoter system in a mouse model of HCC. The current mouse models of HCC development are established by xenograft, carcinogen induction and genetic engineering, representing the spectrum of tumor-inducing factors and tumor locations. The imaging analysis approach of reporter genes driven by AFP enhancer/promoter is presented for these different HCC mouse models. Such molecular imaging can provide longitudinal information about carcinogenesis and tumor progression. We expect that clinical application of AFP-targeted reporter gene expression imaging systems will be useful for the detection of AFP-expressing HCC tumors and screening of increased/decreased AFP levels due to disease or drug treatment.
O'Sullivan, D J; O'Gara, F
1991-08-01
An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.
Li, Lili; Wang, Zhan; Zhou, Yubai; Zhang, Fang; Shen, Sisi; Li, Zelin; Zeng, Yi
2015-09-01
For rapid and accurate screening of recombinant modified vaccinia virus Ankara (rMVA) that satisfied the quality standards of clinical trials, a novel shuttle vector that can delete the marker gene automatically during virus propagation was construted: pZL-EGFP. To construct the pZL-EGFP, the original shuttle vector pSC11 was modified by replacing the LacZ marker gene with enhanced green fluorescent protein (EGFP) and then inserting homologous sequences of TKL into the flank regions of EGFP. Baby hamster kidney (BHK)-21 cells were cotransfected with pZL-EGFP and MVA, and underwent ten passages and one plaque screening to obtain the EGFP-free rMVA carrying the exogenous gene. Resulting rMVA was tested by polymerase chain reaction and western blotting to verify pZL-EGFP function. A novel shuttle vector pZL-EGFP containing an EGFP marker gene which could be deleted automatically was constructed. This gene deletion had no effect on the activities of rMVA, and the exogenous gene could be expressed stably. These results suggest that rMVA can be packaged efficiently by homologous recombination between pZL-EGFP and MVA in BHK-21 cells, and that the carried EGFP gene can be removed automatically by intramolecular homologous recombination during virus passage. Meanwhile, the gene deletion had no influence on the activities of rMVA and the expression of exogenous target gene. This study lays a solid foundation for the future research.
Winteler, H V; Schneidinger, B; Jaeger, K E; Haas, D
1996-01-01
The anaerobically inducible arcDABC operon encodes the enzymes of the arginine deiminase pathway in Pseudomonas aeruginosa. Upon induction, the arcAB mRNAs and proteins reach high intracellular levels, because of a strong anaerobically controlled promoter and mRNA processing in arcD, leading to stable downstream transcripts. We explored the usefulness of this system for the construction of expression vectors. The lacZ gene of Escherichia coli was expressed to the highest levels when fused close to the arc promoter. Insertion of lacZ further downstream into arcA or arcB did not stabilize the intrinsically unstable lacZ mRNA. On the contrary, lacZ mRNA appeared to be a vulnerable endonuclease target destabilizing arcAB mRNAs in the 5'-to-3' direction in P. aeruginosa. The native arc promoter was modified for optional expression in the -10 sequence and in the -40 region, which is a binding site for the anaerobic regulator ANR. In P. aeruginosa grown either anaerobically or with oxygen limitation in unshaken cultures, this promoter was stronger than the induced tac promoter. The P. aeruginosa lipAH genes, which encode extracellular lipase and lipase foldase, respectively, were fused directly to the modified arc promoter in an IncQ vector plasmid. Semianaerobic static cultures of P. aeruginosa PAO1 carrying this recombinant plasmid overproduced extracellular lipase 30-fold during stationary phase compared with the production by strain PAO1 without the plasmid. Severe oxygen limitation, in contrast, resulted in poor lipase productivity despite effective induction of the ANR-dependent promoter, suggesting that secretion of active lipase is blocked by the absence of oxygen. In conclusion, the modified arc promoter is useful for driving the expression of cloned genes in P. aeruginosa during oxygen-limited growth and stationary phase. PMID:8795231
Fatemeh, Dehghan; Reza, Zolfaghari Mohammad; Mohammad, Arjomandzadegan; Salomeh, Kalantari; Reza, Ahmari Gholam; Hossein, Sarmadian; Maryam, Sadrnia; Azam, Ahmadi; Mana, Shojapoor; Negin, Najarian; Reza, Kasravi Alii; Saeed, Falahat
2014-01-01
Objective To analyse molecular detection of coliforms and shorten the time of PCR. Methods Rapid detection of coliforms by amplification of lacZ and uidA genes in a multiplex PCR reaction was designed and performed in comparison with most probably number (MPN) method for 16 artificial and 101 field samples. The molecular method was also conducted on isolated coliforms from positive MPN samples; standard sample for verification of microbial method certificated reference material; isolated strains from certificated reference material and standard bacteria. The PCR and electrophoresis parameters were changed for reducing the operation time. Results Results of PCR for lacZ and uidA genes were similar in all of standard, operational and artificial samples and showed the 876 bp and 147 bp bands of lacZ and uidA genes by multiplex PCR. PCR results were confirmed by MPN culture method by sensitivity 86% (95% CI: 0.71-0.93). Also the total execution time, with a successful change of factors, was reduced to less than two and a half hour. Conclusions Multiplex PCR method with shortened operation time was used for the simultaneous detection of total coliforms and Escherichia coli in distribution system of Arak city. It's recommended to be used at least as an initial screening test, and then the positive samples could be randomly tested by MPN. PMID:25182727
Non-invasive imaging using reporter genes altering cellular water permeability
NASA Astrophysics Data System (ADS)
Mukherjee, Arnab; Wu, Di; Davis, Hunter C.; Shapiro, Mikhail G.
2016-12-01
Non-invasive imaging of gene expression in live, optically opaque animals is important for multiple applications, including monitoring of genetic circuits and tracking of cell-based therapeutics. Magnetic resonance imaging (MRI) could enable such monitoring with high spatiotemporal resolution. However, existing MRI reporter genes based on metalloproteins or chemical exchange probes are limited by their reliance on metals or relatively low sensitivity. Here we introduce a new class of MRI reporters based on the human water channel aquaporin 1. We show that aquaporin overexpression produces contrast in diffusion-weighted MRI by increasing tissue water diffusivity without affecting viability. Low aquaporin levels or mixed populations comprising as few as 10% aquaporin-expressing cells are sufficient to produce MRI contrast. We characterize this new contrast mechanism through experiments and simulations, and demonstrate its utility in vivo by imaging gene expression in tumours. Our results establish an alternative class of sensitive, metal-free reporter genes for non-invasive imaging.
Extracorporeal circulation as a new experimental pathway for myoblast implantation in mdx mice.
Torrente, Y; D'Angelo, M G; Del Bo, R; DeLiso, A; Casati, R; Benti, R; Corti, S; Comi, G P; Gerundini, P; Anichini, A; Scarlato, G; Bresolin, N
1999-01-01
The deficiency of dystrophin, a sarcolemmal associated protein, is responsible for Duchenne muscular dystrophy (DMD). Gene replacement is attractive as a potential therapy. In this article, we describe a new method for myoblast transplantation and expression of dystrophin in skeletal muscle tissue of dystrophin-deficient mdx mouse through iliac vessels extracorporeal circulation. We evaluated the extracorporeal circulation as an alternative route of delivering myoblasts to the target tissue. Two series of experiments were performed with the extracorporeal circulation. In a first series, L6 rat myoblasts, transfected with LacZ reporter gene, were perfused in limbs of 15 rats. In the second series, the muscle limbs of three 6-8-week-old mdx were perfused with myoblasts of donor C57BL10J mice. Before these perfusions, the right tibialis anterior (TA) muscle of the rats and mdx was injected three times at several sites with bupivacaine (BPVC) and hyaluronidase. The ability of injected cells to migrate in the host tissue was assessed in rats by technetium-99m cell labeling. No radioactivity was detected in the lungs, bowels, and liver of animals treated with extracorporeal circulation. The tissue integration and viability of the myoblasts were ultimately confirmed by genetic and histochemical analysis of LacZ reporter gene. Following a single extracorporeal perfusion of myoblasts from donor C57BL10J, sarcolemmal expression of dystrophin was observed in clusters of myofibers in tibialis anterior muscles previously treated with BPVC and hyaluronidase. Furthermore, large clusters of dystrophin-positive fibers were observed in muscles up to 21 days after repeated treatments. These clusters represented an average of 4.2% of the total muscle fibers. These results demonstrate that the extracorporeal circulation allows selective myoblast-mediated gene transfer to muscles, opening new perspectives in muscular dystrophy gene therapy.
Tissue plasminogen activator (tPA) as a reporter gene in transient gene expression.
Cheng, S M; Lee, S G; Kalyan, N K; McCloud, S; Levner, M; Hung, P P
1987-01-01
Using the gene coding for tissue plasminogen activator (tPA) as a reporter gene, a transient gene expression system has been established. Vectors containing the full-length cDNA of tPA with its signal sequences were introduced into mammalian recipient cells by a modified gene transfer procedure. Thirty hours after transfection, the secreted tPA was found in serum-free medium and measured by a fibrin-agarose plate assay (FAPA). In this assay, tPA converts plasminogen into plasmin which then degrades high-Mr fibrin to produce cleared zones. The sizes of these zones correspond to quantities of tPA. The combination of transient tPA expression system and the FAPA provides a quick, sensitive, quantitative and non-destructive method to examine the strength of eukaryotic regulatory elements in tissue-culture cells.
Zampini, Massimiliano; Mur, Luis A J; Rees Stevens, Pauline; Pachebat, Justin A; Newbold, C James; Hayes, Finbarr; Kingston-Smith, Alison
2016-05-25
Synthetic biology is characterized by the development of novel and powerful DNA fabrication methods and by the application of engineering principles to biology. The current study describes Terminator Operon Reporter (TOR), a new gene assembly technology based on the conditional activation of a reporter gene in response to sequence errors occurring at the assembly stage of the synthetic element. These errors are monitored by a transcription terminator that is placed between the synthetic gene and reporter gene. Switching of this terminator between active and inactive states dictates the transcription status of the downstream reporter gene to provide a rapid and facile readout of the accuracy of synthetic assembly. Designed specifically and uniquely for the synthesis of protein coding genes in bacteria, TOR allows the rapid and cost-effective fabrication of synthetic constructs by employing oligonucleotides at the most basic purification level (desalted) and without the need for costly and time-consuming post-synthesis correction methods. Thus, TOR streamlines gene assembly approaches, which are central to the future development of synthetic biology.
Xu, Kan; Uchida, Kenzo; Nakajima, Hideaki; Kobayashi, Shigeru; Baba, Hisatoshi
2006-08-01
Immunohistochemical analysis after adenovirus (AdV)-mediated BDNF gene transfer in and around the area of mechanical compression in the cervical spinal cord of the hyperostotic mouse (twy/twy). To investigate the neuroprotective effect of targeted AdV-BDNF gene transfection in the twy mouse with spontaneous chronic compression of the spinal cord motoneurons. Several studies reported the neuroprotective effects of neurotrophins on injured spinal cord. However, no report has described the effect of targeted retrograde neurotrophic gene delivery on motoneuron survival in chronic compression lesions of the cervical spinal cord resembling lesions of myelopathy. LacZ marker gene using adenoviral vector (AdV-LacZ) was used to evaluate retrograde delivery from the sternomastoid muscle in adult twy mice (16-week-old) and (control). Four weeks after the AdV-LacZ or AdV-BDNF injection, the compressed cervical spinal cord was removed en bloc for immunohistologic investigation of b-galactosidase activity and immunoreactivity and immunoblot analyses of BDNF. The number of anterior horn neurons was counted using Nissl, ChAT and AChE staining. Spinal accessory motoneurons between C1 and C3 segments were successfully transfected by AdV-LacZ in both twy and ICR mice after targeted intramuscular injection. Immunoreactivity to BDNF was significantly stronger in AdV-BDNF-gene transfected twy mice than in AdV-LacZ-gene transfected mice. At the cord level showing the maximum compression in AdV-BDNF-transfected twy mice, the number of anterior horn neurons was sinificantly higher in the topographic neuronal cell counting of Nissl-, ChAT-, and AChE-stained samples than in AdV-LacZ-injected twy mice. Targeted AdV-BDNF-gene delivery significantly increased Nissl-stained anterior horn neurons and enhanced cholinergic enzyme activities in the twy. Our results suggest that targeted retrograde AdV-BDNF-gene in vivo delivery may enhance neuronal survival even under chronic mechanical compression.
Thymidine Kinase PET Reporter Gene Imaging of Cancer Cells In Vivo.
McCracken, Melissa N
2018-01-01
Positron emission tomography (PET) is a three dimensional imaging modality that detects the accumulation of radiolabeled isotopes in vivo. Ectopic expression of a thymidine kinase reporter gene allows for the specific detection of reporter cells in vivo by imaging with the reporter specific probe. PET reporter imaging is sensitive, quantitative and can be scaled into larger tumors or animals with little to no tissue diffraction. Here, we describe how thymidine kinase PET reporter genes can be used to noninvasively image cancer cells in vivo.
Dani, Sergio U; Espindola, Rachel
2002-06-30
We developed a model system for testing gene vectors, based on the growth of murine tumors on the chorioallantoic membrane (CAM) of embryonic chickens. The ability of selected murine cells to grow on the CAM was rated according to the following criteria: i) formation of tumor masses; ii) metastasis formation; iii) reproducibility; iv) yield, indicated as the number of embryos surviving to assessment time with visible tumors on the CAM; v) maintainability of the cell, both in the original host and the embryonic chick, or 'shuttle maintainability'; vi) detection by the naked eye, and vii) cost/benefit relation. The murine melanoma cell lineage, B16F10, which efficiently forms distinct, pigmented tumor masses and metastases on the CAM, performed better in this model than the murine B61 cell line. In vitro transduction of B16F10 cells with a recombinant adenovirus carrying a construct of the E. coli LacZ gene followed by inoculation onto the CAM resulted in beta-galactosidase expression in the tumor mass growing on the CAM. This model is potentially applicable to preclinical evaluation of gene vectors, especially for gene therapy of cancer.
Reporter gene bioassays in environmental analysis.
Köhler, S; Belkin, S; Schmid, R D
2000-01-01
In parallel to the continuous development of increasingly more sophisticated physical and chemical analytical technologies for the detection of environmental pollutants, there is a progressively more urgent need also for bioassays which report not only on the presence of a chemical but also on its bioavailability and its biological effects. As a partial fulfillment of that need, there has been a rapid development of biosensors based on genetically engineered bacteria. Such microorganisms typically combine a promoter-operator, which acts as the sensing element, with reporter gene(s) coding for easily detectable proteins. These sensors have the ability to detect global parameters such as stress conditions, toxicity or DNA-damaging agents as well as specific organic and inorganic compounds. The systems described in this review, designed to detect different groups of target chemicals, vary greatly in their detection limits, specificity, response times and more. These variations reflect on their potential applicability which, for most of the constructs described, is presently rather limited. Nevertheless, present trends promise that additional improvements will make microbial biosensors an important tool for future environmental analysis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fields, C.A.
1994-09-01
This Report concludes the DOE Human Genome Program project, ``Identification of Genes in Anonymous DNA Sequence.`` The central goals of this project have been (1) understanding the problem of identifying genes in anonymous sequences, and (2) development of tools, primarily the automated identification system gm, for identifying genes. The activities supported under the previous award are summarized here to provide a single complete report on the activities supported as part of the project from its inception to its completion.
Ferritin heavy chain as a molecular imaging reporter gene in glioma xenografts.
Cheng, Sen; Mi, Ruifang; Xu, Yu; Jin, Guishan; Zhang, Junwen; Zhou, Yiqiang; Chen, Zhengguang; Liu, Fusheng
2017-06-01
The development of glioma therapy in clinical practice (e.g., gene therapy) calls for efficiently visualizing and tracking glioma cells in vivo. Human ferritin heavy chain is a novel gene reporter in magnetic resonance imaging. This study proposes hFTH as a reporter gene for MR molecular imaging in glioma xenografts. Rat C6 glioma cells were infected by packaged lentivirus carrying hFTH and EGFP genes and obtained by fluorescence-activated cell sorting. The iron-loaded ability was analyzed by the total iron reagent kit. Glioma nude mouse models were established subcutaneously and intracranially. Then, in vivo tumor bioluminescence was performed via the IVIS spectrum imaging system. The MR imaging analysis was analyzed on a 7T animal MRI scanner. Finally, the expression of hFTH was analyzed by western blotting and histological analysis. Stable glioma cells carrying hFTH and EGFP reporter genes were successfully obtained. The intracellular iron concentration was increased without impairing the cell proliferation rate. Glioma cells overexpressing hFTH showed significantly decreased signal intensity on T 2 -weighted MRI both in vitro and in vivo. EGFP fluorescent imaging could also be detected in the subcutaneous and intracranial glioma xenografts. Moreover, the expression of the transferritin receptor was significantly increased in glioma cells carrying the hFTH reporter gene. Our study illustrated that hFTH generated cellular MR imaging contrast efficiently in glioma via regulating the expression of transferritin receptor. This might be a useful reporter gene in cell tracking and MR molecular imaging for glioma diagnosis, gene therapy and tumor metastasis.
Roelen, Bernard A J; de Graaff, Wim; Forlani, Sylvie; Deschamps, Jacqueline
2002-11-01
The molecular mechanism underlying the 3' to 5' polarity of induction of mouse Hox genes is still elusive. While relief from a cluster-encompassing repression was shown to lead to all Hoxd genes being expressed like the 3'most of them, Hoxd1 (Kondo and Duboule, 1999), the molecular basis of initial activation of this 3'most gene, is not understood yet. We show that, already before primitive streak formation, prior to initial expression of the first Hox gene, a dramatic transcriptional stimulation of the 3'most genes, Hoxb1 and Hoxb2, is observed upon a short pulse of exogenous retinoic acid (RA), whereas it is not in the case for more 5', cluster-internal, RA-responsive Hoxb genes. In contrast, the RA-responding Hoxb1lacZ transgene that faithfully mimics the endogenous gene (Marshall et al., 1994) did not exhibit the sensitivity of Hoxb1 to precocious activation. We conclude that polarity in initial activation of Hoxb genes reflects a greater availability of 3'Hox genes for transcription, suggesting a pre-existing (susceptibility to) opening of the chromatin structure at the 3' extremity of the cluster. We discuss the data in the context of prevailing models involving differential chromatin opening in the directionality of clustered Hox gene transcription, and regarding the importance of the cluster context for correct timing of initial Hox gene expression.Interestingly, Cdx1 manifested the same early transcriptional availability as Hoxb1. Copyright 2002 Elsevier Science Ireland Ltd.
Selwood, T; Sinnott, M L
1990-06-01
1. Michaelis-Menten parameters for the hydrolysis of 4-nitrophenyl beta-D-galactopyranoside and 3,4-dinitrophenyl beta-D-galactopyranoside Escherichia coli (lacZ) beta-galactosidase were measured as a function of pH or pD (pL) in both 1H2O and 2H2O. 2. For hydrolysis of 4-nitrophenyl beta-D-galactopyranoside by Mg2(+)-free enzyme, V is pL-independent below pL 9, but the V/Km-pL profile is sigmoid, the pK values shifting from 7.6 +/- 0.1 in 1H2O to 8.2 +/- 0.1 in 2H2O, and solvent kinetic isotope effects are negligible, in accord with the proposal [Sinnott, Withers & Viratelle (1978) Biochem. J. 175, 539-546] that glycone-aglycone fission without acid catalysis governs both V and V/Km. 3. V for hydrolysis of 4-nitrophenyl beta-D-galactopyranoside by Mg2(+)-enzyme varies sigmoidally with pL, the pK value shifting from 9.19 +/- 0.09 to 9.70 +/- 0.07; V/Km shows both a low-pL fall, probably due to competition between Mg2+ and protons [Tenu, Viratelle, Garnier & Yon (1971) Eur. J. Biochem. 20, 363-370], and a high-pL fall, governed by a pK that shifts from 8.33 +/- 0.08 to 8.83 +/- 0.08. There is a negligible solvent kinetic isotope effect on V/Km, but one of 1.7 on V, which a linear proton inventory shows to arise from one transferred proton. 4. The variation of V and V/Km with pL is sigmoid for hydrolysis of 3,4-dinitrophenyl beta-D-galactopyranoside by Mg2(+)-enzyme, with pK values showing small shifts, from 8.78 +/- 0.09 to 8.65 +/- 0.08 and from 8.7 +/- 0.1 to 8.9 +/- 0.1 respectively. There is no solvent isotope effect on V or V/Km for 3,4-dinitrophenyl beta-D-galactopyranoside, despite hydrolysis of the galactosyl-enzyme intermediate governing V. 5. Identification of the 'conformation change' in the hydrolysis of aryl galactosides proposed by Sinnott & Souchard [(1973) Biochem. J. 133, 89-98] with the protolysis of the magnesium phenoxide arising from the action of enzyme-bound Mg2+ as an electrophilic catalyst rationalizes these data and also resolves the
GAPTrap: A Simple Expression System for Pluripotent Stem Cells and Their Derivatives.
Kao, Tim; Labonne, Tanya; Niclis, Jonathan C; Chaurasia, Ritu; Lokmic, Zerina; Qian, Elizabeth; Bruveris, Freya F; Howden, Sara E; Motazedian, Ali; Schiesser, Jacqueline V; Costa, Magdaline; Sourris, Koula; Ng, Elizabeth; Anderson, David; Giudice, Antonietta; Farlie, Peter; Cheung, Michael; Lamande, Shireen R; Penington, Anthony J; Parish, Clare L; Thomson, Lachlan H; Rafii, Arash; Elliott, David A; Elefanty, Andrew G; Stanley, Edouard G
2016-09-13
The ability to reliably express fluorescent reporters or other genes of interest is important for using human pluripotent stem cells (hPSCs) as a platform for investigating cell fates and gene function. We describe a simple expression system, designated GAPTrap (GT), in which reporter genes, including GFP, mCherry, mTagBFP2, luc2, Gluc, and lacZ are inserted into the GAPDH locus in hPSCs. Independent clones harboring variations of the GT vectors expressed remarkably consistent levels of the reporter gene. Differentiation experiments showed that reporter expression was reliably maintained in hematopoietic cells, cardiac mesoderm, definitive endoderm, and ventral midbrain dopaminergic neurons. Similarly, analysis of teratomas derived from GT-lacZ hPSCs showed that β-galactosidase expression was maintained in a spectrum of cell types representing derivatives of the three germ layers. Thus, the GAPTrap vectors represent a robust and straightforward tagging system that enables indelible labeling of PSCs and their differentiated derivatives. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Gaillard, Dany; Barlow, Linda A.
2012-01-01
Wnt/β-catenin signaling initiates taste papilla development in mouse embryos, however, its involvement in taste cell turnover in adult mice has not been explored. Here we used the BATGAL reporter mouse model, which carries an engineered allele in which the LacZ gene is expressed in the presence of activated β-catenin, to determine the responsiveness of adult taste bud cells to canonical Wnt signaling. Double immunostaining with markers of differentiated taste cells revealed that a subset of type I, II and III taste cells express β-galactosidase. Using in situ hybridization, we showed that β-catenin activates the transcription of the LacZ gene mainly in intragemmal basal cells that are immature taste cells, identified by their expression of Sonic Hedgehog (Shh). Finally, we showed that β-catenin activity is significantly reduced in taste buds of 25 week-old mice compared to 10 week-old animals. Our data suggest that Wnt/β-catenin signaling may influence taste cell turnover by regulating cell differentiation. Reduced canonical Wnt signaling in older mice could explain in part the loss of taste sensitivity with aging, implicating a possible deficiency in the rate of taste cell renewal. More investigations are now necessary to understand if and how Wnt signaling regulates adult taste cell turnover. PMID:21328519
2010-01-01
Background The parasitic mite Varroa destructor is considered the major pest of the European honey bee (Apis mellifera) and responsible for declines in honey bee populations worldwide. Exploiting the full potential of gene sequences becoming available for V. destructor requires adaptation of modern molecular biology approaches to this non-model organism. Using a mu-class glutathione S-transferase (VdGST-mu1) as a candidate gene we investigated the feasibility of gene knockdown in V. destructor by double-stranded RNA-interference (dsRNAi). Results Intra-haemocoelic injection of dsRNA-VdGST-mu1 resulted in 97% reduction in VdGST-mu1 transcript levels 48 h post-injection compared to mites injected with a bolus of irrelevant dsRNA (LacZ). This gene suppression was maintained to, at least, 72 h. Total GST catalytic activity was reduced by 54% in VdGST-mu1 gene knockdown mites demonstrating the knockdown was effective at the translation step as well as the transcription steps. Although near total gene knockdown was achieved by intra-haemocoelic injection, only half of such treated mites survived this traumatic method of dsRNA administration and less invasive methods were assessed. V. destructor immersed overnight in 0.9% NaCl solution containing dsRNA exhibited excellent reduction in VdGST-mu1 transcript levels (87% compared to mites immersed in dsRNA-LacZ). Importantly, mites undergoing the immersion approach had greatly improved survival (75-80%) over 72 h, approaching that of mites not undergoing any treatment. Conclusions Our findings on V. destructor are the first report of gene knockdown in any mite species and demonstrate that the small size of such organisms is not a major impediment to applying gene knockdown approaches to the study of such parasitic pests. The immersion in dsRNA solution method provides an easy, inexpensive, relatively high throughput method of gene silencing suitable for studies in V. destructor, other small mites and immature stages of ticks
[Role of the sweet taste receptor in glucose metabolism: no sweets for diabetes?].
Nomura, Masatoshi; Kawahara, Yuta
2015-01-01
Type 2 diabetes is closely associated with our daily diets and has become a global health problem with increasing number of patients. Maintaining energy homeostasis is essentially required for the treatment of diabetes. Energy metabolism starts with taking in a meal. Nutrients including amino acids, fatty acids and glucose in the digest have been shown to act on the neuroendocrine cells in the gastrointestinal (GI) tract, and thereby play important roles in energy homeostasis. Therefore, the GI tract is now recognized as a sensor system for nutrient signals. Taste receptor type 1 member 2 (T1R2) is known to function as a co-receptor with T1R3 to detect sweet chemicals in the taste buds. It has been proposed that the T1R2/T1R3 receptor complex acts as sweet sensor in the intestine, and plays a pivotal role in sensing sugars and maintaining glucose homeostasis through incretin secretion. To clarify the physiological roles of T1R2 in glucose homeostasis, T1r2-lacZ knock-in/knock-out mice were generated. We found lacZ gene expression in the GI tract where T1r3 expression has been reported. Interestingly, the T1r2-lacZ knock-in mice showed impaired glucose tolerance on oral glucose challenge but not on intraperitoneal injection. However, the fasting glucose level in T1r2-lacZ knock-in mice was comparable to that in wild type mice. These results suggest an important role of the sweet taste receptor system in the intestine when stimulated by glucose. Therefore, the roles of T1R2 will be presented and the mechanism for metabolic homeostasis will be discussed.
Alpha-fetoprotein-targeted reporter gene expression imaging in hepatocellular carcinoma
Kim, Kwang Il; Chung, Hye Kyung; Park, Ju Hui; Lee, Yong Jin; Kang, Joo Hyun
2016-01-01
Hepatocellular carcinoma (HCC) is one of the most common cancers in Eastern Asia, and its incidence is increasing globally. Numerous experimental models have been developed to better our understanding of the pathogenic mechanism of HCC and to evaluate novel therapeutic approaches. Molecular imaging is a convenient and up-to-date biomedical tool that enables the visualization, characterization and quantification of biologic processes in a living subject. Molecular imaging based on reporter gene expression, in particular, can elucidate tumor-specific events or processes by acquiring images of a reporter gene’s expression driven by tumor-specific enhancers/promoters. In this review, we discuss the advantages and disadvantages of various experimental HCC mouse models and we present in vivo images of tumor-specific reporter gene expression driven by an alpha-fetoprotein (AFP) enhancer/promoter system in a mouse model of HCC. The current mouse models of HCC development are established by xenograft, carcinogen induction and genetic engineering, representing the spectrum of tumor-inducing factors and tumor locations. The imaging analysis approach of reporter genes driven by AFP enhancer/promoter is presented for these different HCC mouse models. Such molecular imaging can provide longitudinal information about carcinogenesis and tumor progression. We expect that clinical application of AFP-targeted reporter gene expression imaging systems will be useful for the detection of AFP-expressing HCC tumors and screening of increased/decreased AFP levels due to disease or drug treatment. PMID:27468205
Tantawiwat, Suwalee; Tansuphasiri, Unchalee; Wongwit, Waranya; Wongchotigul, Varee; Kitayaporn, Dwip
2005-01-01
Multiplex PCR amplification of lacZ, uidA and plc genes was developed for the simultaneous detection of total coliform bacteria for Escherichia coli and Clostridium perfringens, in drinking water. Detection by agarose gel electrophoresis yielded a band of 876 bp for the lacZ gene of all coliform bacteria; a band of 147 bp for the uidA gene and a band of 876 bp for the lacZ gene of all strains of E. coli; a band of 280 bp for the p/c gene for all strains of C. perfringens; and a negative result for all three genes when tested with other bacteria. The detection limit was 100 pg for E. coli and C. perfringens, and 1 ng for coliform bacteria when measured with purified DNA. This assay was applied to the detection of these bacteria in spiked water samples. Spiked water samples with 0-1,000 CFU/ml of coliform bacteria and/or E. coli and/or C. perfringens were detected by this multiplex PCR after a pre-enrichment step to increase the sensitivity and to ensure that the detection was based on the presence of cultivable bacteria. The result of bacterial detection from the multiplex PCR was comparable with that of a standard plate count on selective medium (p=0.62). When using standard plate counts as a gold standard, the sensitivity for this test was 99.1% (95% CI 95.33, 99.98) and the specificity was 90.9 % (95% CI 75.67, 98.08). Multiplex PCR amplification with a pre-enrichment step was shown to be an effective, sensitive and rapid method for the simultaneous detection of these three microbiological parameters in drinking water.
Reproducible and efficient murine CNS gene delivery using a microprocessor-controlled injector.
Brooks, A I; Halterman, M W; Chadwick, C A; Davidson, B L; Haak-Frendscho, M; Radel, C; Porter, C; Federoff, H J
1998-04-30
To develop a reproducible gene transfer method for the murine CNS we evaluated delivery of various gene vehicles using mechanical or manual stereotaxic intracranial inoculation. A microprocessor controlled microsyringe pump (The World Precision Instruments/UltraMicroPump) programmable for volume, rate and syringe size and designed to dispense nanoliter and picoliter volumes was compared to a standard manual deliver method. Gene transfer efficiency of two viral vectors, two synthetic cationic lipid molecules, and naked DNA were evaluated in mice injected unilaterally in two brain regions. Animals received 1 microl over 10 min. of either HSVlac (1 x 10(5) b.f.u), AdLac (1 x 10(5) p.f.u), Tfx-10 or Tfx-20 (2.6 microg DNA in 2.0 microl Tfx; 1:1 charge ratio of DNA to liposome), or naked DNA (HSVlac plasmid, 10 microg/microl). After 4 days, animals from each group were perfused and tissue prepared for X-gal histochemical detection of beta-galactosidase expression. Blue cells were observed in the HSV, Adenovirus, and Tfx-20 groups only at the injection site in animals injected using the UMP. Animals injected manually exhibited fewer blue cells and positive cells were not restricted to the injection site. To quantify expression, tissue punches harvested from the injection sites as well as other brain regions were analyzed using a chemiluminescent reporter assay to detect beta-galactosidase (Galacto-Light). These data indicated increased activity in all animals injected with a lacZ containing vector via the UMP as compared to manual delivery: A 41% increase in the expression levels of beta-gal in HSVlac infected animals (p = 0.0029); a 29% increase in Adlac infected animals (p = 0.01); a 56% increase in Tfx-10 transduced animals (p = 0.04); a 24% increase in Tfx-20 transduced animals (p = 0.01); and a 69% increase in naked DNA gene transfer (p = 0.05). Total beta-galactosidase activity was greatest in HSVlac infected mice followed by Adlac > Tfx-20 > Tfx-10 = naked DNA.
Luke, Garry A; Ryan, Martin D
2018-01-01
To date, a huge range of different proteins-many with cotranslational and posttranslational subcellular localization signals-have been coexpressed together with various reporter proteins in vitro and in vivo using 2A peptides. The pros and cons of 2A co-expression technology are considered below, followed by a simple example of a "how to" protocol to concatenate multiple genes of interest, together with a reporter gene, into a single gene linked via 2As for easy identification or selection of transduced cells.
Marui, Junichiro; Yoshimi, Akira; Hagiwara, Daisuke; Fujii-Watanabe, Yoshimi; Oda, Ken; Koike, Hideaki; Tamano, Koichi; Ishii, Tomoko; Sano, Motoaki; Machida, Masayuki; Abe, Keietsu
2010-08-01
Demand for novel antifungal drugs for medical and agricultural uses has been increasing because of the diversity of pathogenic fungi and the emergence of drug-resistant strains. Genomic resources for various living species, including pathogenic fungi, can be utilized to develop novel and effective antifungal compounds. We used Aspergillus oryzae as a model to construct a reporter system for exploring novel antifungal compounds and their target genes. The comprehensive gene expression analysis showed that the actin-encoding actB gene was transcriptionally highly induced by benomyl treatment. We therefore used the actB gene to construct a novel reporter system for monitoring responses to cytoskeletal stress in A. oryzae by introducing the actB promoter::EGFP fusion gene. Distinct fluorescence was observed in the reporter strain with minimum background noise in response to not only benomyl but also compounds inhibiting lipid metabolism that is closely related to cell membrane integrity. The fluorescent responses indicated that the reporter strain can be used to screen for lead compounds affecting fungal microtubule and cell membrane integrity, both of which are attractive antifungal targets. Furthermore, the reporter strain was shown to be technically applicable for identifying novel target genes of antifungal drugs triggering perturbation of fungal microtubules or membrane integrity.
Bogani, Debora; Morgan, Marc A. J.; Nelson, Andrew C.; Costello, Ita; McGouran, Joanna F.; Kessler, Benedikt M.
2013-01-01
Prdm4 is a highly conserved member of the Prdm family of PR/SET domain zinc finger proteins. Many well-studied Prdm family members play critical roles in development and display striking loss-of-function phenotypes. Prdm4 functional contributions have yet to be characterized. Here, we describe its widespread expression in the early embryo and adult tissues. We demonstrate that DNA binding is exclusively mediated by the Prdm4 zinc finger domain, and we characterize its tripartite consensus sequence via SELEX (systematic evolution of ligands by exponential enrichment) and ChIP-seq (chromatin immunoprecipitation-sequencing) experiments. In embryonic stem cells (ESCs), Prdm4 regulates key pluripotency and differentiation pathways. Two independent strategies, namely, targeted deletion of the zinc finger domain and generation of a EUCOMM LacZ reporter allele, resulted in functional null alleles. However, homozygous mutant embryos develop normally and adults are healthy and fertile. Collectively, these results strongly suggest that Prdm4 functions redundantly with other transcriptional partners to cooperatively regulate gene expression in the embryo and adult animal. PMID:23918801
White, J H; Johnson, A L; Lowndes, N F; Johnston, L H
1991-01-01
By fusing the CDC9 structural gene to the PGK upstream sequences and the CDC9 upstream to lacZ, we showed that the cell cycle expression of CDC9 is largely due to transcriptional regulation. To investigate the role of six ATGATT upstream repeats in CDC9 regulation, synthetic copies of the sequence were attached to a heterologous gene. The repeats stimulated transcription strongly and additively, but, unlike conventional yeast UAS elements, only when present in one orientation. Transcription driven by the repeats declines in cells held at START of the cell cycle or in stationary phase, as occurs with CDC9. However, the repeats by themselves cannot impart cell cycle regulation to a heterologous gene. CDC9 may therefore be controlled by an activating system operating through the repeats that is sensitive to cellular proliferation and a separate mechanism that governs the periodic expression in the cell cycle. Images PMID:1901644
Gross, C H; Russell, R L; Rohrmann, G F
1994-05-01
To investigate the regulation of p10 and polyhedron envelope protein (PEP) gene expression and their role in polyhedron development, Orgyia pseudotsugata multinucleocapsid nuclear polyhedrosis viruses lacking these genes were constructed. Recombinant viruses were produced, in which the p10 gene, the PEP gene or both genes were disrupted with the beta-glucuronidase (GUS) or beta-galactosidase (lacZ) genes. GUS activity under the control of the PEP protein promoter was observed later in infection and its maximal expression was less than 10% the level for p10 promoter-GUS constructs. Tissues from O. pseudotsugata larvae infected with these recombinants were examined by electron microscopy. Cells from insects infected with the p10- viruses lacked p10-associated fibrillar structures, but fragments of polyhedron envelope-like structures were observed on the surface of some polyhedra. Immunogold labelling of cells infected with the p10-GUS+ virus with an antibody directed against PEP showed that the PEP was concentrated at the surface of polyhedra. Although polyhedra produced by p10 and PEP gene deletion mutants demonstrated what appeared to be a polyhedron envelope by transmission electron microscopy, scanning electron microscopy showed that they had irregular, pitted surfaces that were different from wild-type polyhedra. These data suggested that both p10 and PEP are important for the proper formation of the periphery of polyhedra.
Munjal, Neha; Jawed, Kamran; Wajid, Saima; Yazdani, Syed Shams
2015-01-01
The production of biofuels from lignocellulosic biomass appears to be attractive and viable due to the abundance and availability of this biomass. The hydrolysis of this biomass, however, is challenging because of the complex lignocellulosic structure. The ability to produce hydrolytic cellulase enzymes in a cost-effective manner will certainly accelerate the process of making lignocellulosic ethanol production a commercial reality. These cellulases may need to be produced aerobically to generate large amounts of protein in a short time or anaerobically to produce biofuels from cellulose via consolidated bioprocessing. Therefore, it is important to identify a promoter that can constitutively drive the expression of cellulases under both aerobic and anaerobic conditions without the need for an inducer. Using lacZ as reporter gene, we analyzed the strength of the promoters of four genes, namely lacZ, gapA, ldhA and pflB, and found that the gapA promoter yielded the maximum expression of the β-galactosidase enzyme under both aerobic and anaerobic conditions. We further cloned the genes for two cellulolytic enzymes, β-1,4-endoglucanase and β-1,4-glucosidase, under the control of the gapA promoter, and we expressed these genes in Escherichia coli, which secreted the products into the extracellular medium. An ethanologenic E. colistrain transformed with the secretory β-glucosidase gene construct fermented cellobiose in both defined and complex medium. This recombinant strain also fermented wheat straw hydrolysate containing glucose, xylose and cellobiose into ethanol with an 85% efficiency of biotransformation. An ethanologenic strain that constitutively secretes a cellulolytic enzyme is a promising platform for producing lignocellulosic ethanol. PMID:25768292
Selwood, T; Sinnott, M L
1990-01-01
1. Michaelis-Menten parameters for the hydrolysis of 4-nitrophenyl beta-D-galactopyranoside and 3,4-dinitrophenyl beta-D-galactopyranoside Escherichia coli (lacZ) beta-galactosidase were measured as a function of pH or pD (pL) in both 1H2O and 2H2O. 2. For hydrolysis of 4-nitrophenyl beta-D-galactopyranoside by Mg2(+)-free enzyme, V is pL-independent below pL 9, but the V/Km-pL profile is sigmoid, the pK values shifting from 7.6 +/- 0.1 in 1H2O to 8.2 +/- 0.1 in 2H2O, and solvent kinetic isotope effects are negligible, in accord with the proposal [Sinnott, Withers & Viratelle (1978) Biochem. J. 175, 539-546] that glycone-aglycone fission without acid catalysis governs both V and V/Km. 3. V for hydrolysis of 4-nitrophenyl beta-D-galactopyranoside by Mg2(+)-enzyme varies sigmoidally with pL, the pK value shifting from 9.19 +/- 0.09 to 9.70 +/- 0.07; V/Km shows both a low-pL fall, probably due to competition between Mg2+ and protons [Tenu, Viratelle, Garnier & Yon (1971) Eur. J. Biochem. 20, 363-370], and a high-pL fall, governed by a pK that shifts from 8.33 +/- 0.08 to 8.83 +/- 0.08. There is a negligible solvent kinetic isotope effect on V/Km, but one of 1.7 on V, which a linear proton inventory shows to arise from one transferred proton. 4. The variation of V and V/Km with pL is sigmoid for hydrolysis of 3,4-dinitrophenyl beta-D-galactopyranoside by Mg2(+)-enzyme, with pK values showing small shifts, from 8.78 +/- 0.09 to 8.65 +/- 0.08 and from 8.7 +/- 0.1 to 8.9 +/- 0.1 respectively. There is no solvent isotope effect on V or V/Km for 3,4-dinitrophenyl beta-D-galactopyranoside, despite hydrolysis of the galactosyl-enzyme intermediate governing V. 5. Identification of the 'conformation change' in the hydrolysis of aryl galactosides proposed by Sinnott & Souchard [(1973) Biochem. J. 133, 89-98] with the protolysis of the magnesium phenoxide arising from the action of enzyme-bound Mg2+ as an electrophilic catalyst rationalizes these data and also resolves the
Hypervitaminosis A resulting in DNA aberration in fetal transgenic mice (Muta Mouse).
Inomata, Tomo; Kiuchi, Akio; Yoshida, Tomoo; Hisamatsu, Shin; Takizawa, Akiko; Kashiwazaki, Naomi; Akahori, Fumiaki; Ninomiya, Hiroyoshi
2005-09-05
Treatment with excessive amounts of Vitamin A during maternity induces fetal malformations. However, it is unclear whether these malformations are due to gene mutations or not. Using transgenic mice (containing lacZ gene showing beta-galactosidase enzymatic activity), we planned to observe whether gene mutations occur in the fetal tissues after treatment during maternity with Vitamin A (retinol palmitate). On the 11th day of pregnancy, mothers were given 30 mg (group 2), 150 mg (group 3) and 300 mg (group 4) of Vitamin A/kg body weight orally. Fetuses obtained on the 18th day of gestation showed malformations, such as cleft palate, origodactyly, brachydactyly and ectromeria. Most notably, cleft palate occurred dose dependently. The incidental rates were 100% in group 4, 58% in group 3 and 6% in group 2. The number of dead and absorbed fetuses also increased dose dependently with the treatments. DNA (integrated vectors containing lacZ genes) extracted from each fetus showed Vitamin A-induced lacZ mutations, especially in the malformed fetuses. The mutation frequencies were 4.99x10(-5) in group 4, 5.28x10(-5) in group 3 and 4.26x10(-5) in group 2. The frequencies of group 3 were significantly higher (p<0.05) than that of the controls (group 1), 2.79x10(-5). Maternal treatment with Vitamin A (150 mg/kg of body weight) was carried out on the 11th day of pregnancy. Fetuses obtained on the 14th day of gestation showed a much higher incidence of mutation, approximately 8.91x10(-5) (group 6) that was significantly higher (p<0.0001) than those from the controls (group 5), 2.94x10(-5). The present study indicates a possibility that hypervitaminosis A-induced fetal malformation and death might be caused by gene mutations.
Treger, J M; Magee, T R; McEntee, K
1998-02-04
The DDR2 gene of Saccharomyces cerevisiae is a multistress response gene whose transcription is rapidly and strongly induced by a diverse array of xenobiotic agents, and environmental and physiological conditions. The multistress response of this gene requires the pentanucleotide, 5' CCCCT, (C4T;STRE (STress Response Element)) and the zinc-finger transcription factors, Msn2p and Msn4p. A 51bp oligonucleotide (oligo 31/32) containing two STREs from the DDR2 promoter region was previously shown to direct heat shock activation of a lacZ reporter gene. In this work we demonstrate that the same element conferred a complete multistress response to an E. coli galK reporter gene introduced into yeast cells. A variant oligonucleotide in which both the STRE spacing and neighboring sequences were altered responded to the same spectrum of stresses, while substitution of nucleotides within the pentanucleotide completely abolished the multistress response. These results directly demonstrate that STREs are not only necessary but are sufficient for mediating a transcriptional response to a surprisingly diverse set of environmental and physiological conditions.
The effect of mutation on Rhodococcus equi virulence plasmid gene expression and mouse virulence.
Ren, Jun; Prescott, John F
2004-11-15
An 81 kb virulence plasmid containing a pathogenicity island (PI) plays a crucial role in the pathogenesis of Rhodococcus equi pneumonia in foals but its specific function in virulence and regulation of plasmid-encoded virulence genes is unclear. Using a LacZ selection marker developed for R. equi in this study, in combination with an apramycin resistance gene, an efficient two-stage homologous recombination targeted gene mutation procedure was used to mutate three virulence plasmid genes, a LysR regulatory gene homologue (ORF4), a ResD-like two-component response regulator homologue (ORF8), and a gene (ORF10) of unknown function that is highly expressed by R. equi inside macrophages, as well as the chromosomal gene operon, phoPR. Virulence testing by liver clearance after intravenous injection in mice showed that the ORF4 and ORF8 mutants were fully attenuated, that the phoPR mutant was hypervirulent, and that virulence of the ORF10 mutant remained unchanged. A virulence plasmid DNA microarray was used to compare the plasmid gene expression profile of each of the four gene-targeted mutants against the parental R. equi strain. Changes were limited to PI genes and gene induction was observed for all mutants, suggesting that expression of virulence plasmid genes is dominated by a negative regulatory network. The finding of attenuation of ORF4 and ORF8 mutants despite enhanced transcription of vapA suggests that factors other than VapA are important for full expression of virulence. ORF1, a putative Lsr antigen gene, was strongly and similarly induced in all mutants, implying a common regulatory pathway affecting this gene for all four mutated genes. ORF8 is apparently the centre of this common pathway. Two distinct highly correlated gene induction patterns were observed, that of the ORF4 and ORF8 mutants, and that of the ORF10 and phoPR mutants. The gene induction pattern distinguishing these two groups paralleled their virulence in mice.
Programmable probiotics for detection of cancer in urine
Danino, Tal; Prindle, Arthur; Kwong, Gabriel A.; Skalak, Matthew; Li, Howard; Allen, Kaitlin; Hasty, Jeff; Bhatia, Sangeeta N.
2015-01-01
Rapid advances in the forward engineering of genetic circuitry in living cells has positioned synthetic biology as a potential means to solve numerous biomedical problems, including disease diagnosis and therapy. One challenge in exploiting synthetic biology for translational applications is to engineer microbes that are well tolerated by patients and seamlessly integrate with existing clinical methods. We use the safe and widely used probiotic Escherichia coli Nissle 1917 to develop an orally administered diagnostic that can noninvasively indicate the presence of liver metastasis by producing easily detectable signals in urine. Our microbial diagnostic generated a high-contrast urine signal through selective expansion in liver metastases (106-fold enrichment) and high expression of a lacZ reporter maintained by engineering a stable plasmid system. The lacZ reporter cleaves a substrate to produce a small molecule that can be detected in urine. E. coli Nissle 1917 robustly colonized tumor tissue in rodent models of liver metastasis after oral delivery but did not colonize healthy organs or fibrotic liver tissue. We saw no deleterious health effects on the mice for more than 12 months after oral delivery. Our results demonstrate that probiotics can be programmed to safely and selectively deliver synthetic gene circuits to diseased tissue microenvironments in vivo. PMID:26019220
Carbon Limitation Induces ςS-Dependent Gene Expression in Pseudomonas fluorescens in Soil
Koch, Birgit; Worm, Jakob; Jensen, Linda E.; Højberg, Ole; Nybroe, Ole
2001-01-01
Recent studies employing reporter gene technology indicate that the availabilities of the major nutrients nitrogen, phosphate, and iron to Pseudomonas are not severely limited in bulk soil. Indirect evidence has pointed to carbon limitation as a severe nutritional stress in this environment. We show that a plasmid (pGM115)-borne transcriptional fusion between the ςS-dependent Escherichia coli promoter Pfic and lacZ functions as a reliable reporter for carbon availability in Pseudomonas fluorescens. When P. fluorescens strain DF57(pGM115) was introduced into bulk soil, carbon-limiting conditions were indicated by citrate-repressible induction of β-galactosidase activity. To address carbon availability at the single-cell level, we developed an immunofluorescence double-staining procedure for individual DF57 cells expressing β-galactosidase from Pfic. Changes in cell size and expression of β-galactosidase were analyzed by flow cytometry. Cells extracted from soil microcosms reduced their size less than carbon-starved cells in pure culture and showed an increased tendency to aggregate. The single-cell analysis revealed that for cells residing in soil, the expression of β-galactosidase became heterogeneous and only a DF57 subpopulation appeared to be carbon limited. In soil amended with barley straw, limited nitrogen availability has been determined by use of the bioluminescent reporter strain P. fluorescens DF57-N3. We used strain DF57-N3(pGM115) as a double reporter for carbon and nitrogen limitation that allowed us to study the dynamics of carbon and nitrogen availabilities in more detail. In straw-amended soil β-galactosidase activity remained low, while nitrogen limitation-dependent bioluminescence appeared after a few days. Hence, nitrogen became limited under conditions where carbon resources were not completely exhausted. PMID:11472905
Yang, Shuo; Li, Jia-li; Bi, Hui-chang; Zhou, Shou-ning; Liu, Xiao-man; Zeng, Hang; Hu, Bing-fang; Huang, Min
2016-01-01
This study aims to investigate the function of two SNPs (rs8904C > T and rs696G >A) in 3' untranslated region (3'UTR) of NFKBIA gene by constructing luciferase reporter gene. A patient's genomic DNA with rs8904 CC and rs696 GA genotype was used as the PCR template. Full-length 3'UTR of NFKBIA gene was amplified by different primers. After sequencing validation, these fragments were inserted to the luciferase reporter vector, pGL3-promoter to construct recombinant plasmids containing four kinds of haplotypes, pGL3-rs8904C/rs696G, pGL3-rs8904C/rs696A, pGL3-rs8904T/rs696G and pGL3-rs8904T/rs696A. Then these plasmids were transfected into LS174T cells and the luciferase activity was detected. Compared with pGL3-vector transfected cells (negative control), the luciferase activity of the four kinds of recombinant plasmids was significantly decreased (P < 0.001). For rs696G > A, the luciferase activity of the recombinant plasmids containing A allele (pGL3-rs8904C/rs696A and pGL3-rs8904T/rs696A) was about 45.1% (P < 0.05) and 56.1% (P < 0.001) lower than those containing G allele (pGL3-rs8904C/rs696G and pGL3-rs8904T/rs696G), respectively. For rs8904C > T, there were no significant differences in the luciferase activity between the recombinant plasmids containing T allele and those with C allele. Together, the luciferase reporter gene vectors containing SNPs in NFKBIA gene 3'UTR were constructed successfully and rs696G > A could decrease the luciferase activity while rs8904C >T didn't have much effect on the luciferase activity.
Gaillard, Dany; Barlow, Linda A
2011-04-01
Wnt/β-catenin signaling initiates taste papilla development in mouse embryos, however, its involvement in taste cell turnover in adult mice has not been explored. Here we used the BATGAL reporter mouse model, which carries an engineered allele in which the LacZ gene is expressed in the presence of activated β-catenin, to determine the responsiveness of adult taste bud cells to canonical Wnt signaling. Double immunostaining with markers of differentiated taste cells revealed that a subset of Type I, II, and III taste cells express β-galactosidase. Using in situ hybridization, we showed that β-catenin activates the transcription of the LacZ gene mainly in intragemmal basal cells that are immature taste cells, identified by their expression of Sonic Hedgehog (Shh). Finally, we showed that β-catenin activity is significantly reduced in taste buds of 25-week-old mice compared with 10-week-old animals. Our data suggest that Wnt/β-catenin signaling may influence taste cell turnover by regulating cell differentiation. Reduced canonical Wnt signaling in older mice could explain in part the loss of taste sensitivity with aging, implicating a possible deficiency in the rate of taste cell renewal. More investigations are now necessary to understand if and how Wnt signaling regulates adult taste cell turnover. Copyright © 2011 Wiley-Liss, Inc.
Adenovirus-mediated gene delivery to hypothalamic magnocellular neurons in mice
NASA Technical Reports Server (NTRS)
Vasquez, E. C.; Beltz, T. G.; Meyrelles, S. S.; Johnson, A. K.
1999-01-01
Vasopressin is synthesized by magnocellular neurons in supraoptic (SON) and paraventricular (PVN) hypothalamic nuclei and released by their axon terminals in the neurohypophysis (NH). With its actions as an antidiuretic hormone and vasoactive agent, vasopressin plays a pivotal role in the control of body fluids and cardiovascular homeostasis. Because of its well-defined neurobiology and functional importance, the SON/PVN-NH system is ideal to establish methods for gene transfer of genetic material into specific pathways in the mouse central nervous system. In these studies, we compared the efficiency of transferring the gene lacZ, encoding for beta-galactosidase (beta-gal), versus a gene encoding for green fluorescent protein by using replication-deficient adenovirus (Ad) vectors in adult mice. Transfection with viral concentrations up to 2 x 10(7) plaque-forming units per coverslip of NH, PVN, and SON in dissociated, cultured cells caused efficient transfection without cytotoxicity. However, over an extended period of time, higher levels (50% to 75% of the cells) of beta-gal expression were detected in comparison with green fluorescent protein (5% to 50% of the cells). With the use of a stereotaxic approach, the pituitary glands of mice were injected with Ad (4 x 10(6) plaque-forming units). In material from these animals, we were able to visualize the expression of the beta-gal gene in the NH and in magnocellular neurons of both the PVN and SON. The results of these experiments indicate that Ad-Rous sarcoma virus promoter-beta-gal is taken up by nerve terminals at the injection site (NH) and retrogradely transported to the soma of the neurons projecting to the NH. We conclude that the application of these experimental approaches will provide powerful tools for physiological studies and potential approaches to deliver therapeutic genes to treat diseases.
Fang, Chong; Stiegeler, Emanuel; Cook, Gregory M.; Mascher, Thorsten; Gebhard, Susanne
2014-01-01
To combat antibiotic resistance of Enterococcus faecalis, a better understanding of the molecular mechanisms, particularly of antibiotic detection, signal transduction and gene regulation is needed. Because molecular studies in this bacterium can be challenging, we aimed at exploiting the genetically highly tractable Gram-positive model organism Bacillus subtilis as a heterologous host. Two fundamentally different regulators of E. faecalis resistance against cell wall antibiotics, the bacitracin sensor BcrR and the vancomycin-sensing two-component system VanSB-VanRB, were produced in B. subtilis and their functions were monitored using target promoters fused to reporter genes (lacZ and luxABCDE). The bacitracin resistance system BcrR-BcrAB of E. faecalis was fully functional in B. subtilis, both regarding regulation of bcrAB expression and resistance mediated by the transporter BcrAB. Removal of intrinsic bacitracin resistance of B. subtilis increased the sensitivity of the system. The lacZ and luxABCDE reporters were found to both offer sensitive detection of promoter induction on solid media, which is useful for screening of large mutant libraries. The VanSB-VanRB system displayed a gradual dose-response behaviour to vancomycin, but only when produced at low levels in the cell. Taken together, our data show that B. subtilis is a well-suited host for the molecular characterization of regulatory systems controlling resistance against cell wall active compounds in E. faecalis. Importantly, B. subtilis facilitates the careful adjustment of expression levels and genetic background required for full functionality of the introduced regulators. PMID:24676422
Fang, Chong; Stiegeler, Emanuel; Cook, Gregory M; Mascher, Thorsten; Gebhard, Susanne
2014-01-01
To combat antibiotic resistance of Enterococcus faecalis, a better understanding of the molecular mechanisms, particularly of antibiotic detection, signal transduction and gene regulation is needed. Because molecular studies in this bacterium can be challenging, we aimed at exploiting the genetically highly tractable Gram-positive model organism Bacillus subtilis as a heterologous host. Two fundamentally different regulators of E. faecalis resistance against cell wall antibiotics, the bacitracin sensor BcrR and the vancomycin-sensing two-component system VanSB-VanRB, were produced in B. subtilis and their functions were monitored using target promoters fused to reporter genes (lacZ and luxABCDE). The bacitracin resistance system BcrR-BcrAB of E. faecalis was fully functional in B. subtilis, both regarding regulation of bcrAB expression and resistance mediated by the transporter BcrAB. Removal of intrinsic bacitracin resistance of B. subtilis increased the sensitivity of the system. The lacZ and luxABCDE reporters were found to both offer sensitive detection of promoter induction on solid media, which is useful for screening of large mutant libraries. The VanSB-VanRB system displayed a gradual dose-response behaviour to vancomycin, but only when produced at low levels in the cell. Taken together, our data show that B. subtilis is a well-suited host for the molecular characterization of regulatory systems controlling resistance against cell wall active compounds in E. faecalis. Importantly, B. subtilis facilitates the careful adjustment of expression levels and genetic background required for full functionality of the introduced regulators.
Evaluating Reported Candidate Gene Associations with Polycystic Ovary Syndrome
Pau, Cindy; Saxena, Richa; Welt, Corrine Kolka
2013-01-01
Objective To replicate variants in candidate genes associated with PCOS in a population of European PCOS and control subjects. Design Case-control association analysis and meta-analysis. Setting Major academic hospital Patients Women of European ancestry with PCOS (n=525) and controls (n=472), aged 18 to 45 years. Intervention Variants previously associated with PCOS in candidate gene studies were genotyped (n=39). Metabolic, reproductive and anthropomorphic parameters were examined as a function of the candidate variants. All genetic association analyses were adjusted for age, BMI and ancestry and were reported after correction for multiple testing. Main Outcome Measure Association of candidate gene variants with PCOS. Results Three variants, rs3797179 (SRD5A1), rs12473543 (POMC), and rs1501299 (ADIPOQ), were nominally associated with PCOS. However, they did not remain significant after correction for multiple testing and none of the variants replicated in a sufficiently powered meta-analysis. Variants in the FBN3 gene (rs17202517 and rs73503752) were associated with smaller waist circumferences and variant rs727428 in the SHBG gene was associated with lower SHBG levels. Conclusion Previously identified variants in candidate genes do not appear to be associated with PCOS risk. PMID:23375202
A Dual-Color Reporter Assay of Cohesin-Mediated Gene Regulation in Budding Yeast Meiosis.
Fan, Jinbo; Jin, Hui; Yu, Hong-Guo
2017-01-01
In this chapter, we describe a quantitative fluorescence-based assay of gene expression using the ratio of the reporter green fluorescence protein (GFP) to the internal red fluorescence protein (RFP) control. With this dual-color heterologous reporter assay, we have revealed cohesin-regulated genes and discovered a cis-acting DNA element, the Ty1-LTR, which interacts with cohesin and regulates gene expression during yeast meiosis. The method described here provides an effective cytological approach for quantitative analysis of global gene expression in budding yeast meiosis.
Gabriel, J E; Guerra-Slompo, E P; de Souza, E M; de Carvalho, F A L; Madeira, H M F; de Vasconcelos, A T R
2015-08-21
The purpose of the present study was to functionally evaluate the influence of superoxide radical-generating compounds on the heterologous induction of a predicted promoter region of open reading frames for paraquat-inducible genes (pqi genes) revealed during genome annotation analyses of the Chromobacterium violaceum bacterium. A 388-bp fragment corresponding to a pqi gene promoter of C. violaceum was amplified using specific primers and cloned into a conjugative vector containing the Escherichia coli lacZ gene without a promoter. Assessments of the expression of the β-galactosidase enzyme were performed in the presence of menadione (MEN) and phenazine methosulfate (PMS) compounds at different final concentrations to evaluate the heterologous activation of the predicted promoter region of interest in C. violaceum induced by these substrates. Under these experimental conditions, the MEN reagent promoted highly significant increases in the expression of the β-galactosidase enzyme modulated by activating the promoter region of the pqi genes at all concentrations tested. On the other hand, significantly higher levels in the expression of the β-galactosidase enzyme were detected exclusively in the presence of the PMS reagent at a final concentration of 50 μg/mL. The findings described in the present study demonstrate that superoxide radical-generating compounds can activate a predicted promoter DNA motif for pqi genes of the C. violaceum bacterium in a dose-dependent manner.
The first human report of mobile colistin resistance gene, mcr-1, in Finland.
Gröndahl-Yli-Hannuksela, Kirsi; Lönnqvist, Emilia; Kallonen, Teemu; Lindholm, Laura; Jalava, Jari; Rantakokko-Jalava, Kaisu; Vuopio, Jaana
2018-05-01
Colistin resistance mediated by mobile mcr-1 gene has raised concern during the last years. After steep increase in mcr-1 reports, other mcr-gene variants (mcr-2 to mcr-5) have been revealed as well. In 2016, a clinical study was conducted on asymptomatic stool carriage of extended spectrum beta-lactamase (ESBL) producing Escherichia coli and Klebsiella pneumoniae among Finnish adults. All suspected ESBL producing bacterial isolates were first tested by phenotypic ESBL-confirmation methods, and then further analyzed with whole genome sequencing to identify the resistance genes. We found one study subject carrying a colistin resistant E. coli with a transferrable mcr-1 gene. This multi-drug resistant isolate, although initially suspected to be an ESBL producer, did not carry any ESBL genes, but was proven to carry several other resistance genes by using whole genome sequencing. Sequence type was ST93. The mcr-1 gene was connected to IncX4 plasmid which suggests that the colistin resistance gene locates in the respective plasmid. Here, we report the finding of a mcr-1 harboring human E. coli isolate from Finland. Clinical antimicrobial resistance (AMR) rates are low in Finland, and mobile colistin resistance has not been reported previously. This highlights the importance of AMR surveillance also in populations with low levels of resistance. © 2018 The Authors. APMIS published by John Wiley & Sons Ltd on behalf of Scandinavian Societies for Medical Microbiology and Pathology.
Sadowsky, M J; Cregan, P B; Gottfert, M; Sharma, A; Gerhold, D; Rodriguez-Quinones, F; Keyser, H H; Hennecke, H; Stacey, G
1991-01-01
Several soybean genotypes have been identified which specifically exclude nodulation by members of Bradyrhizobium japonicum serocluster 123. We have identified and sequenced a DNA region from B. japonicum strain USDA 110 which is involved in genotype-specific nodulation of soybeans. This 2.3-kilobase region, cloned in pMJS12, allows B. japonicum serocluster 123 isolates to form nodules on plants of serogroup 123-restricting genotypes. The nodules, however, were ineffective for symbiotic nitrogen fixation. The nodulation-complementing region is located approximately 590 base pairs transcriptionally downstream from nodD2. The 5' end of pMJS12 contains a putative open reading frame (ORF) of 710 base pairs, termed nolA. Transposon Tn3-HoHo mutations only within the ORF abolished nodulation complementation. The N terminus of the predicted nolA gene product has strong similarity with the N terminus of MerR, the regulator of mercury resistance genes. Translational lacZ fusion experiments indicated that nolA was moderately induced by soybean seed extract and the isoflavone genistein. Restriction fragments that hybridize to pMJS12 were detected in genomic DNAs from both nodulation-restricted and -unrestricted strains. PMID:1988958
FOXP2 gene deletion and infant feeding difficulties: a case report.
Zimmerman, Emily; Maron, Jill L
2016-01-01
Forkhead box protein P2 (FOXP2) is a well-studied gene known to play an essential role in normal speech development. Deletions in the gene have been shown to result in developmental speech disorders and regulatory disruption of downstream gene targets associated with common forms of language impairments. Despite similarities in motor planning and execution between speech development and oral feeding competence, there have been no reports to date linking deletions within the FOXP2 gene to oral feeding impairments in the newborn. The patient was a nondysmorphic, appropriately and symmetrically grown male infant born at 35-wk gestational age. He had a prolonged neonatal intensive care unit stay because of persistent oral feeding incoordination requiring gastrostomy tube placement. Cardiac and neurological imagings were within normal limits. A microarray analysis found an ∼9-kb loss within chromosome band 7q3.1 that contains exon 2 of FOXP2, demonstrating a single copy of this region instead of the normal two copies per diploid gene. This case study expands our current understanding of the role FOXP2 exerts on motor planning and coordination necessary for both oral feeding success and speech-language development. This case report has important consequences for future diagnosis and treatment for infants with FOXP2 deletions, mutations, and varying levels of gene expression.
Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.
Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam
2017-01-01
Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.
Ichige, A; Walker, G C
1997-01-01
The Rhizobium meliloti bacA gene encodes a function that is essential for bacterial differentiation into bacteroids within plant cells in the symbiosis between R. meliloti and alfalfa. An Escherichia coli homolog of BacA, SbmA, is implicated in the uptake of microcin B17, microcin J25 (formerly microcin 25), and bleomycin. When expressed in E. coli with the lacZ promoter, the R. meliloti bacA gene was found to suppress all the known defects of E. coli sbmA mutants, namely, increased resistance to microcin B17, microcin J25, and bleomycin, demonstrating the functional similarity between the two proteins. The R. meliloti bacA386::Tn(pho)A mutant, as well as a newly constructed bacA deletion mutant, was found to show increased resistance to bleomycin. However, it also showed increased resistance to certain aminoglycosides and increased sensitivity to ethanol and detergents, suggesting that the loss of bacA function causes some defect in membrane integrity. The E. coli sbmA gene suppressed all these bacA mutant phenotypes as well as the Fix- phenotype when placed under control of the bacA promoter. Taken together, these results strongly suggest that the BacA and SbmA proteins are functionally similar and thus provide support for our previous hypothesis that BacA may be required for uptake of some compound that plays an important role in bacteroid development. However, the additional phenotypes of bacA mutants identified in this study suggest the alternative possibility that BacA may be needed for membrane integrity, which is likely to be critically important during the early stages of bacterial differentiation within plant cells. PMID:8982000
Shiba, Kazuhiro; Torashima, Takashi; Hirai, Hirokazu; Ogawa, Kazuma; Akhter, Nasima; Nakajima, Kenichi; Kinuya, Seigo; Mori, Hirofumi
2009-02-01
We investigated a gene expression imaging method to examine the level of therapeutic gene expression in the cerebellum. Using a human immunodeficiency virus derived lentivial vector, we expressed the dopamine D(2) receptor (D(2)R) as a reporter protein to mouse cerebellar Purkinje cells. Biodistribution and ex vivo autoradiography studies were performed by giving [(125)I]5-iodo-7-N-[(1-ethyl-2-pyrrolidinyl)methyl]carboxamide-2,3-dihydrobenzofuran ([(125)I]IBF) (1.85 MBq), as a radioactive D(2)R ligand, to model mice expressing the D(2)R with an HA tag (HA-D(2)R) in the cerebellum. In this study, [(125)I]IBF was bound to the D(2)R expressed in the cerebellum of the model mice selectively. Immunostaining was performed to confirm the HA-D(2)R expression in the cerebellum of the model mice. A significant correlation (r=0.900, P<0.001) between areas that expressed HA-D(2)R by immunostaining and areas in which [(125)I]IBF accumulated by the ex vivo autoradiograms was found. These results indicated that radioiodinated IBF is useful as a reporter probe to detect D(2)R reporter gene expression, which can be used for monitoring therapeutic gene expression in the cerebellum.
Abh and AbrB Control of Bacillus subtilis Antimicrobial Gene Expression▿
Strauch, Mark A.; Bobay, Benjamin G.; Cavanagh, John; Yao, Fude; Wilson, Angelo; Le Breton, Yoann
2007-01-01
The Bacillus subtilis abh gene encodes a protein whose N-terminal domain has 74% identity to the DNA-binding domain of the global regulatory protein AbrB. Strains with a mutation in abh showed alterations in the production of antimicrobial compounds directed against some other Bacillus species and gram-positive microbes. Relative to its wild-type parental strain, the abh mutant was found deficient, enhanced, or unaffected for the production of antimicrobial activity. Using lacZ fusions, we examined the effects of abh upon the expression of 10 promoters known to be regulated by AbrB, including five that transcribe well-characterized antimicrobial functions (SdpC, SkfA, TasA, sublancin, and subtilosin). For an otherwise wild-type background, the results show that Abh plays a negative regulatory role in the expression of four of the promoters, a positive role for the expression of three, and no apparent regulatory role in the expression of the other three promoters. Binding of AbrB and Abh to the promoter regions was examined using DNase I footprinting, and the results revealed significant differences. The transcription of abh is not autoregulated, but it is subject to a degree of AbrB-afforded negative regulation. The results indicate that Abh is part of the complex interconnected regulatory system that controls gene expression during the transition from active growth to stationary phase. PMID:17720793
Reconstructing Dynamic Promoter Activity Profiles from Reporter Gene Data.
Kannan, Soumya; Sams, Thomas; Maury, Jérôme; Workman, Christopher T
2018-03-16
Accurate characterization of promoter activity is important when designing expression systems for systems biology and metabolic engineering applications. Promoters that respond to changes in the environment enable the dynamic control of gene expression without the necessity of inducer compounds, for example. However, the dynamic nature of these processes poses challenges for estimating promoter activity. Most experimental approaches utilize reporter gene expression to estimate promoter activity. Typically the reporter gene encodes a fluorescent protein that is used to infer a constant promoter activity despite the fact that the observed output may be dynamic and is a number of steps away from the transcription process. In fact, some promoters that are often thought of as constitutive can show changes in activity when growth conditions change. For these reasons, we have developed a system of ordinary differential equations for estimating dynamic promoter activity for promoters that change their activity in response to the environment that is robust to noise and changes in growth rate. Our approach, inference of dynamic promoter activity (PromAct), improves on existing methods by more accurately inferring known promoter activity profiles. This method is also capable of estimating the correct scale of promoter activity and can be applied to quantitative data sets to estimate quantitative rates.
Long Term Non-Invasive Imaging of Embryonic Stem Cells Using Reporter Genes
Sun, Ning; Lee, Andrew; Wu, Joseph C.
2013-01-01
Development of non-invasive and accurate methods to track cell fate following delivery will greatly expedite transition of embryonic stem (ES) cell therapy to the clinic. Here we describe a protocol for the in vivo monitoring of stem cell survival, proliferation, and migration using reporter genes. We established stable ES cell lines constitutively expressing double fusion (DF; enhanced green fluorescent protein and firefly luciferase) or triple fusion (TF; monomeric red fluorescent protein, firefly luciferase, and herpes simplex virus thymidine kinase) reporter genes using lentiviral transduction. We used fluorescence activated cell sorting to purify these populations in vitro, bioluminescence imaging and positron emission tomography imaging to track them in vivo, and fluorescence immunostaining to confirm the results ex vivo. Unlike other methods of cell tracking such as iron particle and radionuclide labeling, reporter genes are inherited genetically and can be used to monitor cell proliferation and survival for the lifetime of transplanted cells and their progeny. PMID:19617890
Ratiometric Gas Reporting: A Nondisruptive Approach To Monitor Gene Expression in Soils.
Cheng, Hsiao-Ying; Masiello, Caroline A; Del Valle, Ilenne; Gao, Xiaodong; Bennett, George N; Silberg, Jonathan J
2018-03-16
Fluorescent proteins are ubiquitous tools that are used to monitor the dynamic functions of natural and synthetic genetic circuits. However, these visual reporters can only be used in transparent settings, a limitation that complicates nondisruptive measurements of gene expression within many matrices, such as soils and sediments. We describe a new ratiometric gas reporting method for nondisruptively monitoring gene expression within hard-to-image environmental matrices. With this approach, C 2 H 4 is continuously synthesized by ethylene forming enzyme to provide information on viable cell number, and CH 3 Br is conditionally synthesized by placing a methyl halide transferase gene under the control of a conditional promoter. We show that ratiometric gas reporting enables the creation of Escherichia coli biosensors that report on acylhomoserine lactone (AHL) autoinducers used for quorum sensing by Gram-negative bacteria. Using these biosensors, we find that an agricultural soil decreases the bioavailable concentration of a long-chain AHL up to 100-fold. We also demonstrate that these biosensors can be used in soil to nondisruptively monitor AHLs synthesized by Rhizobium leguminosarum and degraded by Bacillus thuringiensis. Finally, we show that this new reporting approach can be used in Shewanella oneidensis, a bacterium that lives in sediments.
Uchiyama, Taku; Miyazaki, Kentaro
2010-11-01
A reporter assay-based screening method for enzymes, which we named product-induced gene expression (PIGEX), was developed and used to screen a metagenomic library for amidases. A benzoate-responsive transcriptional activator, BenR, was placed upstream of the gene encoding green fluorescent protein and used as a sensor. Escherichia coli sensor cells carrying the benR-gfp gene cassette fluoresced in response to benzoate concentrations as low as 10 μM but were completely unresponsive to the substrate benzamide. An E. coli metagenomic library consisting of 96,000 clones was grown in 96-well format in LB medium containing benzamide. The library cells were then cocultivated with sensor cells. Eleven amidase genes were recovered from 143 fluorescent wells; eight of these genes were homologous to known bacterial amidase genes while three were novel genes. In addition to their activity toward benzamide, the enzymes were active toward various substrates, including d- and l-amino acid amides, and displayed enantioselectivity. Thus, we demonstrated that PIGEX is an effective approach for screening novel enzymes based on product detection.
Houtman, Corine J; Sterk, Saskia S; van de Heijning, Monique P M; Brouwer, Abraham; Stephany, Rainer W; van der Burg, Bart; Sonneveld, Edwin
2009-04-01
Anabolic androgenic steroids (AAS) are a class of steroid hormones related to the male hormone testosterone. They are frequently detected as drugs in sport doping control. Being similar to or derived from natural male hormones, AAS share the activation of the androgen receptor (AR) as common mechanism of action. The mammalian androgen responsive reporter gene assay (AR CALUX bioassay), measuring compounds interacting with the AR can be used for the analysis of AAS without the necessity of knowing their chemical structure beforehand, whereas current chemical-analytical approaches may have difficulty in detecting compounds with unknown structures, such as designer steroids. This study demonstrated that AAS prohibited in sports and potential designer AAS can be detected with this AR reporter gene assay, but that also additional steroid activities of AAS could be found using additional mammalian bioassays for other types of steroid hormones. Mixtures of AAS were found to behave additively in the AR reporter gene assay showing that it is possible to use this method for complex mixtures as are found in doping control samples, including mixtures that are a result of multi drug use. To test if mammalian reporter gene assays could be used for the detection of AAS in urine samples, background steroidal activities were measured. AAS-spiked urine samples, mimicking doping positive samples, showed significantly higher androgenic activities than unspiked samples. GC-MS analysis of endogenous androgens and AR reporter gene assay analysis of urine samples showed how a combined chemical-analytical and bioassay approach can be used to identify samples containing AAS. The results indicate that the AR reporter gene assay, in addition to chemical-analytical methods, can be a valuable tool for the analysis of AAS for doping control purposes.
Kathiria, Palak; Sidler, Corinne; Woycicki, Rafal; Yao, Youli; Kovalchuk, Igor
2013-07-01
The role of resistance (R) genes in plant pathogen interaction has been studied extensively due to its economical impact on agriculture. Interaction between tobacco mosaic virus (TMV) and the N protein from tobacco is one of the most widely used models to understand various aspects of pathogen resistance. The transcription activity governed by N gene promoter is one of the least understood elements of the model. In this study, the N gene promoter was cloned and fused with two different reporter genes, one encoding β-glucuronidase (N::GUS) and another, luciferase (N::LUC). Tobacco plants transformed with the N::GUS or N::LUC reporter constructs were screened for homozygosity and stable expression. Histochemical analysis of N::GUS tobacco plants revealed that the expression is organ specific and developmentally regulated. Whereas two week old plants expressed GUS in midveins only, 6-wk-old plants also expressed GUS in leaf lamella. Roots did not show GUS expression at any time during development. Experiments to address effects of external stress were performed using N::LUC tobacco plants. These experiments showed that N gene promoter expression was suppressed when plants were exposed to high but not low temperatures. Expression was also upregulated in response to TMV, but no changes were observed in plants treated with SA.
Irx1 regulates dental outer enamel epithelial and lung alveolar type II epithelial differentiation
Yu, Wenjie; Li, Xiao; Eliason, Steven; Romero-Bustillos, Miguel; Ries, Ryan J.; Cao, Huojun; Amendt, Brad A.
2017-01-01
The Iroquois genes (Irx) appear to regulate fundamental processes that lead to cell proliferation, differentiation, and maturation during development. In this report, the Iroquois homeobox 1 (Irx1) transcription factor was functionally disrupted using a LacZ insert and LacZ expression demonstrated stage-specific expression during embryogenesis. Irx1 is highly expressed in the brain, lung, digits, kidney, testis and developing teeth. Irx1 null mice are neonatal lethal and this lethality it due to pulmonary immaturity. Irx1−/− mice show delayed lung maturation characterized by defective surfactant protein secretion and Irx1 marks a population of SP-C expressing alveolar type II cells. Irx1 is specifically expressed in the outer enamel epithelium (OEE), stellate reticulum (SR) and stratum intermedium (SI) layers of the developing tooth. Irx1 mediates dental epithelial cell differentiation in the lower incisors resulting in delayed growth of the lower incisors. Irx1 is specifically and temporally expressed during developmental stages and we have focused on lung and dental development in this report. Irx1+ cells are unique to the development of the incisor outer enamel epithelium, patterning of Lef-1+ and Sox2+ cells as well as a new marker for lung alveolar type II cells. Mechanistically, Irx1 regulates Foxj1 and Sox9 to control cell differentiation during development. PMID:28746823
Irx1 regulates dental outer enamel epithelial and lung alveolar type II epithelial differentiation.
Yu, Wenjie; Li, Xiao; Eliason, Steven; Romero-Bustillos, Miguel; Ries, Ryan J; Cao, Huojun; Amendt, Brad A
2017-09-01
The Iroquois genes (Irx) appear to regulate fundamental processes that lead to cell proliferation, differentiation, and maturation during development. In this report, the Iroquois homeobox 1 (Irx1) transcription factor was functionally disrupted using a LacZ insert and LacZ expression demonstrated stage-specific expression during embryogenesis. Irx1 is highly expressed in the brain, lung, digits, kidney, testis and developing teeth. Irx1 null mice are neonatal lethal and this lethality it due to pulmonary immaturity. Irx1 -/- mice show delayed lung maturation characterized by defective surfactant protein secretion and Irx1 marks a population of SP-C expressing alveolar type II cells. Irx1 is specifically expressed in the outer enamel epithelium (OEE), stellate reticulum (SR) and stratum intermedium (SI) layers of the developing tooth. Irx1 mediates dental epithelial cell differentiation in the lower incisors resulting in delayed growth of the lower incisors. Irx1 is specifically and temporally expressed during developmental stages and we have focused on lung and dental development in this report. Irx1+ cells are unique to the development of the incisor outer enamel epithelium, patterning of Lef-1+ and Sox2+ cells as well as a new marker for lung alveolar type II cells. Mechanistically, Irx1 regulates Foxj1 and Sox9 to control cell differentiation during development. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Balic, Adam; Garcia-Morales, Carla; Vervelde, Lonneke; Gilhooley, Hazel; Sherman, Adrian; Garceau, Valerie; Gutowska, Maria W; Burt, David W; Kaiser, Pete; Hume, David A; Sang, Helen M
2014-08-01
We have generated the first transgenic chickens in which reporter genes are expressed in a specific immune cell lineage, based upon control elements of the colony stimulating factor 1 receptor (CSF1R) locus. The Fms intronic regulatory element (FIRE) within CSF1R is shown to be highly conserved in amniotes and absolutely required for myeloid-restricted expression of fluorescent reporter genes. As in mammals, CSF1R-reporter genes were specifically expressed at high levels in cells of the macrophage lineage and at a much lower level in granulocytes. The cell lineage specificity of reporter gene expression was confirmed by demonstration of coincident expression with the endogenous CSF1R protein. In transgenic birds, expression of the reporter gene provided a defined marker for macrophage-lineage cells, identifying the earliest stages in the yolk sac, throughout embryonic development and in all adult tissues. The reporter genes permit detailed and dynamic visualisation of embryonic chicken macrophages. Chicken embryonic macrophages are not recruited to incisional wounds, but are able to recognise and phagocytose microbial antigens. © 2014. Published by The Company of Biologists Ltd.
Aoshima, Ryota; Hiraoka, Rieko; Shimada, Nao; Kawata, Takefumi
2006-01-01
A Dd-STATa-null mutant, which is defective in expression of a Dictyostelium homologue of the metazoan STAT (signal transducers and activators of transcription) proteins, fails to culminate and this phenotype correlates with the loss of expression of various prestalk (pst) genes. An EST clone, SSK395, encodes a close homologue of the adducin amino-terminal head domain and harbors a putative actin-binding domain. We fused promoter fragments of the cognate gene, ahhA (adducin head homologue A), to a lacZ reporter and determined their expression pattern. The proximal promoter region is necessary for the expression of ahhA at an early (pre-aggregative) stage of development and this expression is Dd-STATa independent. The distal promoter region is necessary for expression at later stages of development in pstA cells, of the slug and in upper cup and pstAB cells during culmination. The distal region is partly Dd-STATa-dependent. The ahhA-null mutant develops almost normally until culmination, but it forms slanting culminants that tend to collapse on to the substratum. The mutant also occasionally forms fruiting bodies with swollen papillae and with constrictions in the prestalk region. The AhhA protein localizes to the stalk tube entrance and also to the upper cup cells and in cells at or near to the constricted region where an F-actin ring is localized. These findings suggest that Dd-STATa regulates culmination and may be necessary for straight downward elongation of the stalk, via the putative actin-binding protein AhhA.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reddy, S.T.; Stoker, A.W.; Bissell, M.J.
1991-12-01
Retroviruses are valuable tools in studies of embryonic development, both as gene expression vectors and as cell lineage markers. In this study early chicken blastoderm cells are shown to be permissive for infection by Rous sarcoma virus and derivative replication-defective by Rous sarcoma virus and derivative replication-defective vectors, and, in contrast to previously published data, these cells will readily express viral genes. In cultured blastoderm cells, Rous sarcoma virus stably integrates and is transcribed efficiently, producing infectious virus particles. Using replication-defective vectors encoding the bacterial lacZ gene, the authors further show that blastoderms can be infected in culture and inmore » ovo. In ovo, lacZ expression is seen within 24 hours of virus inoculation, and by 96 hours stably expressing clones of cells are observed in diverse tissues throughout the embryo, including epidermis, somites, and heart, as well as in extraembryonic membranes. Given the rapid onset of vector expression and the broad range of permissive cell types, it should be feasible to use Rous sarcoma virus-derived retroviruses as early lineage markers and expression vectors beginning at the blastoderm stage of avian embryogenesis.« less
Allen, Jeremy P; Hathway, Gareth J; Clarke, Neil J; Jowett, Mike I; Topps, Stephanie; Kendrick, Keith M; Humphrey, Patrick P A; Wilkinson, Lawrence S; Emson, Piers C
2003-05-01
The peptide somatostatin can modulate the functional output of the basal ganglia. The exact sites and mechanisms of this action, however, are poorly understood, and the physiological context in which somatostatin acts is unknown. Somatostatin acts as a neuromodulator via a family of five 7-transmembrane G protein-coupled receptors, SSTR1-5, one of which, SSTR2, is known to be functional in the striatum. We have investigated the role of SSTR2 in basal ganglia function using mice in which Sstr2 has been inactivated and replaced by the lacZ reporter gene. Analysis of Sstr2lacZ expression in the brain by beta-galactosidase histochemistry demonstrated a widespread pattern of expression. By comparison to previously published in situ hybridization and immunohistochemical data, Sstr2lacZ expression was shown to accurately recapitulate that of Sstr2 and thus provided a highly sensitive model to investigate cell-type-specific expression of Sstr2. In the striatum, Sstr2 expression was identified in medium spiny projection neurons restricted to the matrix compartment and in cholinergic interneurons. Sstr2 expression was not detected in any other nuclei of the basal ganglia except for a sparse number of nondopaminergic neurons in the substantia nigra. Microdialysis in the striatum showed Sstr2-null mice were selectively refractory to somatostatin-induced dopamine and glutamate release. In behavioural tests, Sstr2-null mice showed normal levels of locomotor activity and normal coordination in undemanding tasks. However, in beam-walking, a test of fine motor control, Sstr2-null mice were severely impaired. Together these data implicate an important neuromodulatory role for SSTR2 in the striatum.
Jiang, Yibo; Chen, Lijuan; Tang, Yaoliang; Ma, Genshan; Shen, Chengxing; Qi, Chunmei; Zhu, Qi; Yao, Yuyu; Liu, Naifeng
2010-05-01
To determine the effect of intracoronary transfer of superparamagnetic iron oxide (SPIO) labeled heme oxygenase-1 (HO-1) overexpressed bone marrow stromal cells (BMSCs) in a porcine myocardial ischemia/reperfusion model. Cell apoptosis was assayed and supernatant cytokine concentrations were measured in BMSCs that underwent hypoxia/reoxygen in vitro. Female mini-swines that underwent 1 h LAD occlusion followed by 1 h reperfusion were randomly allocated to receive intracoronary saline (control), 1 x 10(7) SPIO-labeled BMSCs transfected with pcDNA3.1-Lacz plasmid (Lacz-BMSCs), pcDNA3.1-human HO-1 (HO-1-BMSCs), pcDNA3.1-hHO-1 pretreated with a HO inhibitor, tin protoporphyrin (SnPP, n = 10 each). MRI and postmortem histological analysis were made at 1 week or 3 months thereafter. Post hypoxia/reoxygen in vitro, apoptosis was significantly reduced, supernatant VEGF significantly increased while TNF-alpha and IL-6 significantly reduced in HO-1-BMSCs group compared with Lacz-BMSCs group (all p < 0.05). Myocardial expression of VEGF was significantly higher in HO-1-BMSCs than in Lacz-BMSCs group at 1 week post transplantation (all p < 0.05). Signal voids induced by the SPIO were detected in the peri-infarction region in all BMSC groups at 1 week but not at 3 months post transplantation and the extent of the hypointense signal was the highest in HO-1-BMSCs group, and histological analysis showed that signal voids represented cardiac macrophages that engulfed the SPIO-labeled BMSCs. Pretreatment with SnPP significantly attenuated the beneficial effects of HO-1-BMSCs. Transplantation of HO-1-overexpressed BMSCs significantly enhanced the beneficial effects of BMSCs on improving cardiac function in this model.
Cytotoxicity and gene induction by some essential oils in the yeast Saccharomyces cerevisiae.
Bakkali, F; Averbeck, S; Averbeck, D; Zhiri, A; Idaomar, M
2005-08-01
In order to get an insight into the possible genotoxicity of essential oils (EOs) used in traditional pharmacological applications we tested five different oils extracted from the medicinal plants Origanum compactum, Coriandrum sativum, Artemisia herba alba, Cinnamomum camphora (Ravintsara aromatica) and Helichrysum italicum (Calendula officinalis) for genotoxic effects using the yeast Saccharomyces cerevisiae. Clear cytotoxic effects were observed in the diploid yeast strain D7, with the cells being more sensitive to EOs in exponential than in stationary growth phase. The cytotoxicity decreased in the following order: Origanum compactum>Coriandrum sativum>Artemisia herba alba>Cinnamomum camphora>Helichrysum italicum. In the same order, all EOs, except that derived from Helichrysum italicum, clearly induced cytoplasmic petite mutations indicating damage to mitochondrial DNA. However, no nuclear genetic events such as point mutations or mitotic intragenic or intergenic recombination were induced. The capacity of EOs to induce nuclear DNA damage-responsive genes was tested using suitable Lac-Z fusion strains for RNR3 and RAD51, which are genes involved in DNA metabolism and DNA repair, respectively. At equitoxic doses, all EOs demonstrated significant gene induction, approximately the same as that caused by hydrogen peroxide, but much lower than that caused by methyl methanesulfonate (MMS). EOs affect mitochondrial structure and function and can stimulate the transcriptional expression of DNA damage-responsive genes. The induction of mitochondrial damage by EOs appears to be closely linked to overall cellular cytotoxicity and appears to mask the occurrence of nuclear genetic events. EO-induced cytotoxicity involves oxidative stress, as is evident from the protection observed in the presence of ROS inhibitors such as glutathione, catalase or the iron-chelating agent deferoxamine.
Bhaumik, S; Lewis, X Z; Gambhir, S S
2004-01-01
We have recently demonstrated that Renilla luciferase (Rluc) is a promising bioluminescence reporter gene that can be used for noninvasive optical imaging of reporter gene expression in living mice, with the aid of a cooled charged couple device (CCD) camera. In the current study, we explore the expression of a novel synthetic Renilla luciferase reporter gene (hRluc) in living mice, which has previously been reported to be a more sensitive reporter than native Rluc in mammalian cells. We explore the strategies of simultaneous imaging of both Renilla luciferase enzyme (RL) and synthetic Renilla luciferase enzyme (hRL):coelenterazine (substrate for RL/hRL) in the same living mouse. We also demonstrate that hRL:coelenterazine can yield a higher signal when compared to Firefly luciferase enzyme (FL): D-Luciferin, both in cell culture studies and when imaged from cells at the surface and from lungs of living mice. These studies demonstrate that hRluc should be a useful primary reporter gene with high sensitivity when used alone or in conjunction with other bioluminescence reporter genes for imaging in living rodents. (c) 2004 Society of Photo-Optical Instrumentation Engineers.
Zhang, Yiquan; Zhang, Ying; Gao, He; Zhang, Lingyu; Yin, Zhe; Huang, Xinxiang; Zhou, Dongsheng; Yang, Huiying; Yang, Wenhui; Wang, Li
2017-05-20
TDH, encoded by tdh gene, is a major virulent determinant of V. parahaemolyticus that controls various biological activities, such as hemolytic activity, cytotoxicity, and enterotoxicity. The hemolytic activity on Wagatsuma agar ascribed to TDH is called Kanagawa phenomenon (KP). All KP positive strains contain tdh1 and tdh2 genes, but tdh2 is predominantly responsible for KP. CalR is a regulatory protein that was originally identified as a repressor of swarming motility and T3SS1 gene expression in V. parahaemolyticus. In the present study, the regulation of tdh2 by CalR was investigated using a set of experiments including qRT-PCR, primer extension, LacZ fusion, hemolytic phenotype, EMSA, and DNase I footprinting assays. The results showed that His-CalR protected a single region from 224bp to 318bp upstream of tdh2 against DNase I digestion, and a transcriptional start site located at 42bp upstream of tdh2 was detected and its transcribed activity was inhibited by CalR. Moreover, the KP test results showed that the hemolytic activity of V. parahaemolyticus is also under negative control of CalR. The data demonstrated that CalR is a repressor of the tdh2 transcription and thereby inhibits the hemolytic activity of V. parahaemolyticus. Copyright © 2017. Published by Elsevier B.V.
Winbanks, Catherine E; Beyer, Claudia; Qian, Hongwei; Gregorevic, Paul
2012-01-01
Recombinant adeno-associated viral vectors (rAAV vectors) are promising tools for delivering transgenes to skeletal muscle, in order to study the mechanisms that control the muscle phenotype, and to ameliorate diseases that perturb muscle homeostasis. Many studies have employed rAAV vectors carrying reporter genes encoding for β-galactosidase (β-gal), human placental alkaline phosphatase (hPLAP), and green fluorescent protein (GFP) as experimental controls when studying the effects of manipulating other genes. However, it is not clear to what extent these reporter genes can influence signaling and gene expression signatures in skeletal muscle, which may confound the interpretation of results obtained in experimentally manipulated muscles. Herein, we report a strong pro-inflammatory effect of expressing reporter genes in skeletal muscle. Specifically, we show that the administration of rAAV6:hPLAP vectors to the hind limb muscles of mice is associated with dose- and time-dependent macrophage recruitment, and skeletal muscle damage. Dose-dependent expression of hPLAP also led to marked activity of established pro-inflammatory IL-6/Stat3, TNFα, IKKβ and JNK signaling in lysates obtained from homogenized muscles. These effects were independent of promoter type, as expression cassettes featuring hPLAP under the control of constitutive CMV and muscle-specific CK6 promoters both drove cellular responses when matched for vector dose. Importantly, the administration of rAAV6:GFP vectors did not induce muscle damage or inflammation except at the highest doses we examined, and administration of a transgene-null vector (rAAV6:MCS) did not cause damage or inflammation at any of the doses tested, demonstrating that GFP-expressing, or transgene-null vectors may be more suitable as experimental controls. The studies highlight the importance of considering the potential effects of reporter genes when designing experiments that examine gene manipulation in vivo.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gambhir, Sanjiv; Pritha, Ray
Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.
Gambhir, Sanjiv; Pritha, Ray
2015-07-14
Novel double and triple fusion reporter gene constructs harboring distinct imagable reporter genes are provided, as well as applications for the use of such double and triple fusion constructs in living cells and in living animals using distinct imaging technologies.
Cre-mediated recombination in pituitary somatotropes
Nasonkin, Igor O.; Potok, Mary Anne; Camper, Sally A.
2009-01-01
We report a transgenic line with highly penetrant cre recombinase activity in the somatotrope cells of the anterior pituitary gland. Expression of the cre transgene is under the control of the locus control region of the human growth hormone gene cluster and the rat growth hormone promoter. Cre recombinase activity was assessed with two different lacZ reporter genes that require excision of a floxed stop sequence for expression: a chick β-actin promoter with the CMV enhancer transgene and a ROSA26 knock-in. Cre activity is detectable in the developing pituitary after initiation of Gh transcription and persists through adulthood with high penetrance in Gh expressing cells and lower penetrance in lactotropes, a cell type that shares a common origin with somatotropes. This Gh-cre transgenic line is suitable for efficient, cell-specific deletion of floxed regions of genomic DNA in differentiated somatotropes and a subset of lactotrope cells of the anterior pituitary gland. PMID:19039787
Croxatto, Antony; Chalker, Victoria J.; Lauritz, Johan; Jass, Jana; Hardman, Andrea; Williams, Paul; Cámara, Miguel; Milton, Debra L.
2002-01-01
Vibrio anguillarum possesses at least two N-acylhomoserine lactone (AHL) quorum-sensing circuits, one of which is related to the luxMN system of Vibrio harveyi. In this study, we have cloned an additional gene of this circuit, vanT, encoding a V. harveyi LuxR-like transcriptional regulator. A V. anguillarum ΔvanT null mutation resulted in a significant decrease in total protease activity due to loss of expression of the metalloprotease EmpA, but no changes in either AHL production or virulence. Additional genes positively regulated by VanT were identified from a plasmid-based gene library fused to a promoterless lacZ. Three lacZ fusions (serA::lacZ, hpdA-hgdA::lacZ, and sat-vps73::lacZ) were identified which exhibited decreased expression in the ΔvanT strain. SerA is similar to 3-phosphoglycerate dehydrogenases and catalyzes the first step in the serine-glycine biosynthesis pathway. HgdA has identity with homogentisate dioxygenases, and HpdA is homologous to 4-hydroxyphenylpyruvate dioxygenases (HPPDs) involved in pigment production. V. anguillarum strains require an active VanT to produce high levels of an l-tyrosine-induced brown color via HPPD, suggesting that VanT controls pigment production. Vps73 and Sat are related to Vibrio cholerae proteins encoded within a DNA locus required for biofilm formation. A V. anguillarum ΔvanT mutant and a mutant carrying a polar mutation in the sat-vps73 DNA locus were shown to produce defective biofilms. Hence, a new member of the V. harveyi LuxR transcriptional activator family has been characterized in V. anguillarum that positively regulates serine, metalloprotease, pigment, and biofilm production. PMID:11872713
Croxatto, Antony; Chalker, Victoria J; Lauritz, Johan; Jass, Jana; Hardman, Andrea; Williams, Paul; Cámara, Miguel; Milton, Debra L
2002-03-01
Vibrio anguillarum possesses at least two N-acylhomoserine lactone (AHL) quorum-sensing circuits, one of which is related to the luxMN system of Vibrio harveyi. In this study, we have cloned an additional gene of this circuit, vanT, encoding a V. harveyi LuxR-like transcriptional regulator. A V. anguillarum Delta vanT null mutation resulted in a significant decrease in total protease activity due to loss of expression of the metalloprotease EmpA, but no changes in either AHL production or virulence. Additional genes positively regulated by VanT were identified from a plasmid-based gene library fused to a promoterless lacZ. Three lacZ fusions (serA::lacZ, hpdA-hgdA::lacZ, and sat-vps73::lacZ) were identified which exhibited decreased expression in the Delta vanT strain. SerA is similar to 3-phosphoglycerate dehydrogenases and catalyzes the first step in the serine-glycine biosynthesis pathway. HgdA has identity with homogentisate dioxygenases, and HpdA is homologous to 4-hydroxyphenylpyruvate dioxygenases (HPPDs) involved in pigment production. V. anguillarum strains require an active VanT to produce high levels of an L-tyrosine-induced brown color via HPPD, suggesting that VanT controls pigment production. Vps73 and Sat are related to Vibrio cholerae proteins encoded within a DNA locus required for biofilm formation. A V. anguillarum Delta vanT mutant and a mutant carrying a polar mutation in the sat-vps73 DNA locus were shown to produce defective biofilms. Hence, a new member of the V. harveyi LuxR transcriptional activator family has been characterized in V. anguillarum that positively regulates serine, metalloprotease, pigment, and biofilm production.
USDA-ARS?s Scientific Manuscript database
The Autographa californica multiple nucleopolyhedrovirus (AcMNPV) odv-e56 gene encodes an occlusion-derived virus (ODV)-specific envelope protein, ODV-E56. To determine the role of ODV-E56 in oral infectivity, we produced recombinant EGFP-expressing AcMNPV clones (Ac69GFP-e56lacZ and AcIEGFP-e56lac...
Tolar, Jakub; Adair, Jennifer E; Antoniou, Michael; Bartholomae, Cynthia C; Becker, Pamela S; Blazar, Bruce R; Bueren, Juan; Carroll, Thomas; Cavazzana-Calvo, Marina; Clapp, D Wade; Dalgleish, Robert; Galy, Anne; Gaspar, H Bobby; Hanenberg, Helmut; Von Kalle, Christof; Kiem, Hans-Peter; Lindeman, Dirk; Naldini, Luigi; Navarro, Susana; Renella, Raffaele; Rio, Paula; Sevilla, Julián; Schmidt, Manfred; Verhoeyen, Els; Wagner, John E; Williams, David A; Thrasher, Adrian J
2011-07-01
Survival rates after allogeneic hematopoietic cell transplantation (HCT) for Fanconi anemia (FA) have increased dramatically since 2000. However, the use of autologous stem cell gene therapy, whereby the patient's own blood stem cells are modified to express the wild-type gene product, could potentially avoid the early and late complications of allogeneic HCT. Over the last decades, gene therapy has experienced a high degree of optimism interrupted by periods of diminished expectation. Optimism stems from recent examples of successful gene correction in several congenital immunodeficiencies, whereas diminished expectations come from the realization that gene therapy will not be free of side effects. The goal of the 1st International Fanconi Anemia Gene Therapy Working Group Meeting was to determine the optimal strategy for moving stem cell gene therapy into clinical trials for individuals with FA. To this end, key investigators examined vector design, transduction method, criteria for large-scale clinical-grade vector manufacture, hematopoietic cell preparation, and eligibility criteria for FA patients most likely to benefit. The report summarizes the roadmap for the development of gene therapy for FA.
Tolar, Jakub; Adair, Jennifer E; Antoniou, Michael; Bartholomae, Cynthia C; Becker, Pamela S; Blazar, Bruce R; Bueren, Juan; Carroll, Thomas; Cavazzana-Calvo, Marina; Clapp, D Wade; Dalgleish, Robert; Galy, Anne; Gaspar, H Bobby; Hanenberg, Helmut; Von Kalle, Christof; Kiem, Hans-Peter; Lindeman, Dirk; Naldini, Luigi; Navarro, Susana; Renella, Raffaele; Rio, Paula; Sevilla, Julián; Schmidt, Manfred; Verhoeyen, Els; Wagner, John E; Williams, David A; Thrasher, Adrian J
2011-01-01
Survival rates after allogeneic hematopoietic cell transplantation (HCT) for Fanconi anemia (FA) have increased dramatically since 2000. However, the use of autologous stem cell gene therapy, whereby the patient's own blood stem cells are modified to express the wild-type gene product, could potentially avoid the early and late complications of allogeneic HCT. Over the last decades, gene therapy has experienced a high degree of optimism interrupted by periods of diminished expectation. Optimism stems from recent examples of successful gene correction in several congenital immunodeficiencies, whereas diminished expectations come from the realization that gene therapy will not be free of side effects. The goal of the 1st International Fanconi Anemia Gene Therapy Working Group Meeting was to determine the optimal strategy for moving stem cell gene therapy into clinical trials for individuals with FA. To this end, key investigators examined vector design, transduction method, criteria for large-scale clinical-grade vector manufacture, hematopoietic cell preparation, and eligibility criteria for FA patients most likely to benefit. The report summarizes the roadmap for the development of gene therapy for FA. PMID:21540837
Guo, Ruomi; Li, Qingling; Yang, Fei; Hu, Xiaojun; Jiao, Ju; Guo, Yu; Wang, Jin; Zhang, Yong
2018-06-01
The purpose of this study was to investigate the feasibility of dual magnetic resonance imaging (MRI) reporter genes, including ferritin heavy subunit (Fth) and transferrin receptor (TfR), which provide sufficient MRI contrast for in vivo MRI tracking, and the Deltex-1 (DTX1) gene, which promotes human mesenchymal stem cell (hMSC) differentiation to smooth muscle cells (SMCs), to treat closed penile fracture (CPF). Multi-gene co-expressing hMSCs were generated. The expression of mRNA and proteins was assessed, and the original biological properties of hMSCs were determined and compared. The intracellular uptake of iron was evaluated, and the ability to differentiate into SMCs was detected. Fifty rabbits with CPF were randomly transplanted with PBS, hMSCs, Fth-TfR-hMSCs, DTX1-hMSCs, and Fth-TfR-DTX1-hMSCs. In vivo MRI was performed to detect the distribution and migration of the grafted cells and healing progress of CPF, and the results were correlated with histology. The mRNA and proteins of the multi-gene were highly expressed. The transgenes could not influence the original biological properties of hMSCs. The dual MRI reporter genes increased the iron accumulation capacity, and the DTX1 gene promoted hMSC differentiation into SMCs. The distribution and migration of the dual MRI reporter gene-modified hMSCs, and the healing state of CPF could be obviously detected by MRI and confirmed by histology. The dual MRI reporter genes could provide sufficient MRI contrast, and the distribution and migration of MSCs could be detected in vivo. The DTX1 gene can promote MSC differentiation into SMCs for the treatment of CPF and effectively inhibit granulation tissue formation.
Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources
Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam
2017-01-01
Background: Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Materials and Methods: Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Results: Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli. PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. Conclusion: The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources. PMID:29142893
Effects of Epigenetic Modulation on Reporter Gene Expression: Implications for Stem Cell Imaging
Krishnan, Manickam; Park, Jinha M.; Cao, Feng; Wang, Dongxu; Paulmurugan, Ramasay; Tseng, Jeffrey R.; Gonzalgo, Mark L.; Gambhir, Sanjiv S.; Wu, Joseph C.
2013-01-01
Tracking stem cell localization, survival, differentiation, and proliferation following transplantation in living subjects is essential for understanding stem cell biology and physiology. In this study, we investigated the long-term stability of reporter gene expression in an embryonic rat cardiomyoblast cell line and the role of epigenetic modulation on reversing reporter gene silencing. Cells were stably transfected with plasmids carrying cytomegalovirus promoter driving firefly luciferase reporter gene (CMV-Fluc) and passaged repeatedly for 3–8 months. Within the highest expressor clone, the firefly luciferase activity decreased progressively from passage-1 (843±28) to passage-20 (250±10) to passage-40 (44±3) to passage-60 (3±1 RLU/µg) (P<0.05 vs. passage-1). Firefly luciferase activity was maximally rescued by treatment with 5-azacytidine (DNA methyltransferase inhibitor) compared to trichostatin A (histone deacetylase inhibitor) and retinoic acid (transcriptional activator) (P<0.05). Increasing dosages of 5-azacytidine treatment led to higher levels of firefly luciferase mRNA (RT-PCR) and protein (Western blots) and inversely lower levels of methylation in the CMV promoter (DNA nucleotide sequence). These in vitro results were extended to in vivo bioluminescence imaging (BLI) of cell transplant in living animals. Cells treated with 5-azacytidine were monitored for 2 weeks compared to 1 week for untreated cells (P<0.05). These findings should have important implications for reporter gene-based imaging of stem cell transplantation. PMID:16246867
Ochiai, Hiroshi; Sakamoto, Naoaki; Fujita, Kazumasa; Nishikawa, Masatoshi; Suzuki, Ken-ichi; Matsuura, Shinya; Miyamoto, Tatsuo; Sakuma, Tetsushi; Shibata, Tatsuo; Yamamoto, Takashi
2012-01-01
To understand complex biological systems, such as the development of multicellular organisms, it is important to characterize the gene expression dynamics. However, there is currently no universal technique for targeted insertion of reporter genes and quantitative imaging in multicellular model systems. Recently, genome editing using zinc-finger nucleases (ZFNs) has been reported in several models. ZFNs consist of a zinc-finger DNA-binding array with the nuclease domain of the restriction enzyme FokI and facilitate targeted transgene insertion. In this study, we successfully inserted a GFP reporter cassette into the HpEts1 gene locus of the sea urchin, Hemicentrotus pulcherrimus. We achieved this insertion by injecting eggs with a pair of ZFNs for HpEts1 with a targeting donor construct that contained ∼1-kb homology arms and a 2A-histone H2B–GFP cassette. We increased the efficiency of the ZFN-mediated targeted transgene insertion by in situ linearization of the targeting donor construct and cointroduction of an mRNA for a dominant-negative form of HpLig4, which encodes the H. pulcherrimus homolog of DNA ligase IV required for error-prone nonhomologous end joining. We measured the fluorescence intensity of GFP at the single-cell level in living embryos during development and found that there was variation in HpEts1 expression among the primary mesenchyme cells. These findings demonstrate the feasibility of ZFN-mediated targeted transgene insertion to enable quantification of the expression levels of endogenous genes during development in living sea urchin embryos. PMID:22711830
Estevez, Carlos; Villegas, Pedro
2006-06-01
Recombinant avian adeno-associated viruses coding for the LacZ gene were used to inoculate embryonating chicken eggs, to assess the usefulness of the system for the expression of a transgene in vivo. The results obtained indicate significantly higher levels of expression of the reporter gene at various time intervals in the embryos inoculated with the recombinant virus in comparison with the mock-inoculated controls. At the embryo level, significant differences were evident at 120 hr postinoculation; hatched chicks showed transgene expression up to 14 days of age. In a second experiment, different cell-line cultures were transfected with plasmids encoding for a reporter gene flanked by the avian adeno-associated virus inverted terminal repeats (ITR), either alone or in the presence of the major nonstructural proteins of the virus (Rep 78/68) to assess the ability of these proteins and DNA elements to enhance gene expression. Results indicate that the inclusion of the viral ITR alone or during coexpression of the Rep proteins significantly enhances the expression of the transgene in all cell lines tested, as evidenced by the detection of the beta-galacrosidase protein through chemiluminescence reactions and staining of transfected monolayers.
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-03-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.
Evaluation of a GFP Report Gene Construct for Environmental Arsenic Detection
DOE Office of Scientific and Technical Information (OSTI.GOV)
Roberto, F.F.; Barnes, J.M.; Bruhn, D.F.
Detection of arsenic and other heavy metal contaminants in the environment is critical to ensuring safe drinking water and effective cleanup of historic activities that have led to widespread contamination of soil and groundwater. Biosensors have the potential to significantly reduce the costs associated with site characterization and long term environmental monitoring. By exploiting the highly selective and sensitive natural mechanisms by which bacteria and other living organisms respond to heavy metals, and fusing transcriptionally active components of these mechanisms to reporter genes, such as B-galactosidase, bacterial luciferase (lux), or green fluorescent protein (GFP) from marine jellyfish, it is possiblemore » to produce inexpensive, yet effective biosensors. This article describes the response to submicrogram quantities of arsenite and arsenate of a whole cell arsenic biosensor utilizing a GFP reporter gene.« less
Rational Design of a Triple Reporter Gene for Multimodality Molecular Imaging
Hsieh, Ya-Ju; Ke, Chien-Chih; Yeh, Skye Hsin-Hsien; Lin, Chien-Feng; Chen, Fu-Du; Lin, Kang-Ping; Chen, Ran-Chou; Liu, Ren-Shyan
2014-01-01
Multimodality imaging using noncytotoxic triple fusion (TF) reporter genes is an important application for cell-based tracking, drug screening, and therapy. The firefly luciferase (fl), monomeric red fluorescence protein (mrfp), and truncated herpes simplex virus type 1 thymidine kinase SR39 mutant (ttksr39) were fused together to create TF reporter gene constructs with different order. The enzymatic activities of TF protein in vitro and in vivo were determined by luciferase reporter assay, H-FEAU cellular uptake experiment, bioluminescence imaging, and micropositron emission tomography (microPET). The TF construct expressed in H1299 cells possesses luciferase activity and red fluorescence. The tTKSR39 activity is preserved in TF protein and mediates high levels of H-FEAU accumulation and significant cell death from ganciclovir (GCV) prodrug activation. In living animals, the luciferase and tTKSR39 activities of TF protein have also been successfully validated by multimodality imaging systems. The red fluorescence signal is relatively weak for in vivo imaging but may expedite FACS-based selection of TF reporter expressing cells. We have developed an optimized triple fusion reporter construct DsRedm-fl-ttksr39 for more effective and sensitive in vivo animal imaging using fluorescence, bioluminescence, and PET imaging modalities, which may facilitate different fields of biomedical research and applications. PMID:24809057
Cheng, Hsiao-Ying; Masiello, Caroline A; Bennett, George N; Silberg, Jonathan J
2016-08-16
Traditional visual reporters of gene expression have only very limited use in soils because their outputs are challenging to detect through the soil matrix. This severely restricts our ability to study time-dependent microbial gene expression in one of the Earth's largest, most complex habitats. Here we describe an approach to report on dynamic gene expression within a microbial population in a soil under natural water levels (at and below water holding capacity) via production of methyl halides using a methyl halide transferase. As a proof-of-concept application, we couple the expression of this gas reporter to the conjugative transfer of a bacterial plasmid in a soil matrix and show that gas released from the matrix displays a strong correlation with the number of transconjugant bacteria that formed. Gas reporting of gene expression will make possible dynamic studies of natural and engineered microbes within many hard-to-image environmental matrices (soils, sediments, sludge, and biomass) at sample scales exceeding those used for traditional visual reporting.
Scala, Stefania; Portella, Giuseppe; Fedele, Monica; Chiappetta, Gennaro; Fusco, Alfredo
2000-01-01
High mobility group I (HMGI) proteins are overexpressed in several human malignant tumors. We previously demonstrated that inhibition of HMGI synthesis prevents thyroid cell transformation. Here, we report that an adenovirus carrying the HMGI(Y) gene in an antisense orientation (Ad-Yas) induced programmed cell death of two human thyroid anaplastic carcinoma cell lines (ARO and FB-1), but not normal thyroid cells. The Ad-Yas virus led to death of lung, colon, and breast carcinoma cells. A control adenovirus carrying the lacZ gene did not inhibit the growth of either normal or neoplastic cells. Ad-Yas treatment of tumors induced in athymic mice by ARO cells caused a drastic reduction in tumor size. Therefore, suppression of HMGI(Y) protein synthesis by an HMGI(Y) antisense adenoviral vector may be a useful treatment strategy in a variety of human malignant neoplasias, in which HMGI(Y) gene overexpression is a general event. PMID:10759549
Gil, Jose S.; Machado, Hidevaldo B.; Herschman, Harvey R.
2013-01-01
Purpose Our goal is to develop a simple, quantitative, robust method to compare the efficacy of imaging reporter genes in culture and in vivo. We describe an adenoviral vector-liver transduction procedure, and compare the luciferase reporter efficacies. Procedures Alternative reporter genes are expressed in a common adenoviral vector. Vector amounts used in vivo are based on cell culture titrations, ensuring the same transduction efficacy is used for each vector. After imaging, in vivo and in vitro values are normalized to hepatic vector transduction using quantitative real-time PCR. Results We assayed standard firefly luciferase (FLuc), enhanced firefly luciferase (EFLuc), luciferase 2 (Luc2), humanized Renilla luciferase (hRLuc), Renilla luciferase 8.6-535 (RLuc8.6), and a membrane-bound Gaussia luciferase variant (extGLuc) in cell culture and in vivo. We observed a greater that 100-fold increase in bioluminescent signal for both EFLuc and Luc2 when compared to FLuc, and a greater than 106-fold increase for RLuc8.6 when compared to hRLuc. ExtGLuc was not detectable in liver. Conclusions Our findings contrast, in some cases, with conclusions drawn in prior comparisons of these reporter genes, and demonstrate the need for a standardized method to evaluate alternative reporter genes in vivo. Our procedure can be adapted for reporter genes that utilize alternative imaging modalities (fluorescence, bioluminescence, MRI, SPECT, PET). PMID:21850545
Maghami, Fatemeh; Tabei, Seyed Mohammad Bagher; Moravej, Hossein; Dastsooz, Hassan; Modarresi, Farzaneh; Silawi, Mohammad; Faghihi, Mohammad Ali
2018-05-25
Osteogenesis imperfecta (OI) is a group of connective tissue disorder caused by mutations of genes involved in the production of collagen and its supporting proteins. Although the majority of reported OI variants are in COL1A1 and COL1A2 genes, recent reports have shown problems in other non-collagenous genes involved in the post translational modifications, folding and transport, transcription and proliferation of osteoblasts, bone mineralization, and cell signaling. Up to now, 17 types of OI have been reported in which types I to IV are the most frequent cases with autosomal dominant pattern of inheritance. Here we report an 8- year- old boy with OI who has had multiple fractures since birth and now he is wheelchair-dependent. To identify genetic cause of OI in our patient, whole exome sequencing (WES) was carried out and it revealed a novel deleterious homozygote splice acceptor site mutation (c.1257-2A > G, IVS7-2A > G) in FKBP10 gene in the patient. Then, the identified mutation was confirmed using Sanger sequencing in the proband as homozygous and in his parents as heterozygous, indicating its autosomal recessive pattern of inheritance. In addition, we performed RT-PCR on RNA transcripts originated from skin fibroblast of the proband to analyze the functional effect of the mutation on splicing pattern of FKBP10 gene and it showed skipping of the exon 8 of this gene. Moreover, Real-Time PCR was carried out to quantify the expression level of FKBP10 in the proband and his family members in which it revealed nearly the full decrease in the level of FKBP10 expression in the proband and around 75% decrease in its level in the carriers of the mutation, strongly suggesting the pathogenicity of the mutation. Our study identified, for the first time, a private pathogenic splice site mutation in FKBP10 gene and further prove the involvement of this gene in the rare cases of autosomal recessive OI type XI with distinguished clinical manifestations.
In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M
1997-01-01
Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation. PMID:9062372
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Jang, Mi-Gyeong; Lee, Ji Yeon; Yang, Jae-Yeon; Park, Hyojung; Kim, Jung Hee; Kim, Jung-Eun; Shin, Chan Soo; Kim, Seong Yeon; Kim, Sang Wan
2016-09-01
Mature osteoblasts have three fates: as osteocytes, quiescent lining cells, or osteoblasts that undergo apoptosis. However, whether intermittent parathyroid hormone (PTH) can modulate the fate of mature osteoblasts in vivo is uncertain. We performed a lineage-tracing study using an inducible gene system. Dmp1-CreERt2 mice were crossed with Rosa26R reporter mice to obtain targeted mature osteoblasts and their descendants, lining cells or osteocytes, which were detected using X-gal staining. Rosa26R:Dmp1-CreERt2(+) mice were injected with 0.25 mg 4-OH-tamoxifen (4-OHTam) on postnatal days 5, 7, 9, 16, and 23. In a previous study, at 22 days after the last 4-OHTam, most LacZ+ cells on the periosteal surface were inactive lining cells. On day 25 (D25), the mice were challenged with an injection of human PTH (1-34, 80 μg/kg) or vehicle daily for 10 (D36) or 20 days (D46). We evaluated the number and thickness of LacZ+ osteoblast descendants in the calvaria and tibia. In the vehicle group, the number and thickness of LacZ+ osteoblast descendants at both D36 and D46 significantly decreased compared to D25, which was attenuated in the PTH group. In line with these results, PTH inhibited the decrease in the number of LacZ+/osteocalcin-positive cells compared to vehicle at both D36 and D46. As well, the serum levels of sclerostin decreased, as did the protein expression of sclerostin in the cortical bone. These results suggest that intermittent PTH treatment can increase the number of periosteal osteoblasts by preventing mature osteoblasts from transforming into lining cells in vivo.
Replication-Competent Influenza A Viruses Expressing Reporter Genes.
Breen, Michael; Nogales, Aitor; Baker, Steven F; Martínez-Sobrido, Luis
2016-06-23
Influenza A viruses (IAV) cause annual seasonal human respiratory disease epidemics. In addition, IAV have been implicated in occasional pandemics with inordinate health and economic consequences. Studying IAV, in vitro or in vivo, requires the use of laborious secondary methodologies to identify virus-infected cells. To circumvent this requirement, replication-competent IAV expressing an easily traceable reporter protein can be used. Here we discuss the development and applications of recombinant replication-competent IAV harboring diverse fluorescent or bioluminescent reporter genes in different locations of the viral genome. These viruses have been employed for in vitro and in vivo studies, such as the screening of neutralizing antibodies or antiviral compounds, the identification of host factors involved in viral replication, cell tropism, the development of vaccines, or the assessment of viral infection dynamics. In summary, reporter-expressing, replicating-competent IAV represent a powerful tool for the study of IAV both in vitro and in vivo.
Replication-Competent Influenza A Viruses Expressing Reporter Genes
Breen, Michael; Nogales, Aitor; Baker, Steven F.; Martínez-Sobrido, Luis
2016-01-01
Influenza A viruses (IAV) cause annual seasonal human respiratory disease epidemics. In addition, IAV have been implicated in occasional pandemics with inordinate health and economic consequences. Studying IAV, in vitro or in vivo, requires the use of laborious secondary methodologies to identify virus-infected cells. To circumvent this requirement, replication-competent IAV expressing an easily traceable reporter protein can be used. Here we discuss the development and applications of recombinant replication-competent IAV harboring diverse fluorescent or bioluminescent reporter genes in different locations of the viral genome. These viruses have been employed for in vitro and in vivo studies, such as the screening of neutralizing antibodies or antiviral compounds, the identification of host factors involved in viral replication, cell tropism, the development of vaccines, or the assessment of viral infection dynamics. In summary, reporter-expressing, replicating-competent IAV represent a powerful tool for the study of IAV both in vitro and in vivo. PMID:27347991
Meissner, Tobias; Seckinger, Anja; Rème, Thierry; Hielscher, Thomas; Möhler, Thomas; Neben, Kai; Goldschmidt, Hartmut; Klein, Bernard; Hose, Dirk
2011-12-01
Multiple myeloma is an incurable malignant plasma cell disease characterized by survival ranging from several months to more than 15 years. Assessment of risk and underlying molecular heterogeneity can be excellently done by gene expression profiling (GEP), but its way into clinical routine is hampered by the lack of an appropriate reporting tool and the integration with other prognostic factors into a single "meta" risk stratification. The GEP-report (GEP-R) was built as an open-source software developed in R for gene expression reporting in clinical practice using Affymetrix microarrays. GEP-R processes new samples by applying a documentation-by-value strategy to the raw data to be able to assign thresholds and grouping algorithms defined on a reference cohort of 262 patients with multiple myeloma. Furthermore, we integrated expression-based and conventional prognostic factors within one risk stratification (HM-metascore). The GEP-R comprises (i) quality control, (ii) sample identity control, (iii) biologic classification, (iv) risk stratification, and (v) assessment of target genes. The resulting HM-metascore is defined as the sum over the weighted factors gene expression-based risk-assessment (UAMS-, IFM-score), proliferation, International Staging System (ISS) stage, t(4;14), and expression of prognostic target genes (AURKA, IGF1R) for which clinical grade inhibitors exist. The HM-score delineates three significantly different groups of 13.1%, 72.1%, and 14.7% of patients with a 6-year survival rate of 89.3%, 60.6%, and 18.6%, respectively. GEP reporting allows prospective assessment of risk and target gene expression and integration of current prognostic factors in clinical routine, being customizable about novel parameters or other cancer entities. ©2011 AACR.
Frank, Henrique Oliveira; Sanchez, Danilo Garcia; de Freitas Oliveira, Lucas; Kobarg, Jörg; Monesi, Nadia
2017-11-01
The DNA puff BhC4-1 gene of Bradysia hygida (Diptera, Sciaridae) is amplified and expressed in the salivary glands at the end of the last larval instar. Even though there are no BhC4-1 orthologs in Drosophila melanogaster, the mechanisms that regulate BhC4-1 gene expression in B. hygida are for the most part conserved in D. melanogaster. The BhC4-1 promoter contains a 129bp (-186/-58) cis-regulatory module (CRM) that drives developmentally regulated expression in transgenic salivary glands at the onset of metamorphosis. Both in the sciarid and in transgenic D. melanogaster, BhC4-1 gene expression is induced by the increase in ecdysone titers that triggers metamorphosis. Genetic interaction experiments revealed that in the absence of the Eip74EF-PA early gene isoform BhC4-1-lacZ levels of expression in the salivary gland are severely reduced. Here we show that the overexpression of the Eip74EF-PA transcription factor is sufficient to anticipate BhC4-1-lacZ expression in transgenic D. melanogaster. Through yeast one-hybrid assays we confirm that the Eip74EF-PA transcription factor directly binds to the 129 bp sciarid CRM. Together, these results contribute to the characterization of an insect CRM and indicate that the ecdysone gene regulatory network that promotes metamorphosis is conserved between D. melanogaster and the sciarid B. hygida. © 2017 Wiley Periodicals, Inc.
Bacterial host and reporter gene optimization for genetically encoded whole cell biosensors.
Brutesco, Catherine; Prévéral, Sandra; Escoffier, Camille; Descamps, Elodie C T; Prudent, Elsa; Cayron, Julien; Dumas, Louis; Ricquebourg, Manon; Adryanczyk-Perrier, Géraldine; de Groot, Arjan; Garcia, Daniel; Rodrigue, Agnès; Pignol, David; Ginet, Nicolas
2017-01-01
Whole-cell biosensors based on reporter genes allow detection of toxic metals in water with high selectivity and sensitivity under laboratory conditions; nevertheless, their transfer to a commercial inline water analyzer requires specific adaptation and optimization to field conditions as well as economical considerations. We focused here on both the influence of the bacterial host and the choice of the reporter gene by following the responses of global toxicity biosensors based on constitutive bacterial promoters as well as arsenite biosensors based on the arsenite-inducible P ars promoter. We observed important variations of the bioluminescence emission levels in five different Escherichia coli strains harboring two different lux-based biosensors, suggesting that the best host strain has to be empirically selected for each new biosensor under construction. We also investigated the bioluminescence reporter gene system transferred into Deinococcus deserti, an environmental, desiccation- and radiation-tolerant bacterium that would reduce the manufacturing costs of bacterial biosensors for commercial water analyzers and open the field of biodetection in radioactive environments. We thus successfully obtained a cell survival biosensor and a metal biosensor able to detect a concentration as low as 100 nM of arsenite in D. deserti. We demonstrated that the arsenite biosensor resisted desiccation and remained functional after 7 days stored in air-dried D. deserti cells. We also report here the use of a new near-infrared (NIR) fluorescent reporter candidate, a bacteriophytochrome from the magnetotactic bacterium Magnetospirillum magneticum AMB-1, which showed a NIR fluorescent signal that remained optimal despite increasing sample turbidity, while in similar conditions, a drastic loss of the lux-based biosensors signal was observed.
Iyer, Meera; Berenji, Manijeh; Templeton, Nancy S; Gambhir, Sanjiv S
2002-10-01
Gene therapy involves the safe and effective delivery of one or more genes of interest to target cells in vivo. The advantages of using nonviral delivery systems include ease of preparation, low toxicity, and weak immunogenicity. Nonviral delivery methods, when combined with a noninvasive, clinically applicable imaging assay, will greatly aid in the optimization of gene therapy approaches for cancer. We demonstrate cationic lipid-mediated noninvasive monitoring of reporter gene expression of firefly (Photinus pyralis) luciferase (fl) and a mutant herpes simplex virus type I thymidine kinase (HSV1-sr39tk, tk) in living mice using a cooled charge coupled device (CCD) camera and positron emission tomography (PET), respectively. We observe a high level of fl and tk reporter gene expression predominantly in the lungs after a single injection of the extruded DOTAP:cholesterol DNA liposome complexes by way of the tail vein, seen to be time- and dose-dependent. We observe a good correlation between the in vivo bioluminescent signal and the ex vivo firefly luciferase enzyme (FL) activity in different organs. We further demonstrate the feasibility of noninvasively imaging both optical and PET reporter gene expression in the same animal using the CCD camera and microPET, respectively.
Fu, Yu; Zhao, Yong; Liu, Yue; Zhu, Yejing; Chi, Jinyu; Hu, Jing; Zhang, Xiaohui; Yin, Xinhua
2012-10-01
In our previous study, we have demonstrated that tissue factor pathway inhibitor (TFPI) gene could induce vascular smooth muscle cell (VSMC) apoptosis. This study was conducted to investigate whether the overexpression of the TFPI gene can induce VSMC apoptosis by inhibiting JAK-2/STAT-3 pathway phosphorylation and thereby inhibiting the expression of such downstream targets as the apoptotic protein Bcl-2 and cell cycle protein cyclin D1. The effect of TFPI on the expression of survivin, a central molecule in cell survival, was also investigated. Rat VSMCs were infected with recombinant adenovirus containing either the TFPI (Ad-TFPI) or LacZ (Ad-LacZ) gene or DMEM in vitro. TFPI expression was detected by ELISA. TUNEL staining and electron microscope were carried out to determine the apoptosis of VSMCs. The expression levels of JAK-2, p-JAK-2, STAT-3, p-STAT-3, cyclin D1, Bcl-2 and survivin were examined by western blot analysis. TFPI protein was detected in the TFPI group after gene transfer and the peak expression was at the 3rd day. At the 3rd, 5th and 7th days after gene transfer, the apoptotic rates by TUNEL assay in the TFPI group were 10.91 ± 1.66%, 13.46 ± 1.28% and 17.04 ± 1.95%, respectively, whereas those in the LacZ group were 3.28 ± 0.89%, 4.01 ± 0.72% and 4.89 ± 1.17%, respectively. We observed cell contraction, slight mitochondrial swelling, nuclear pyknosis and apoptotic body formation in TFPI-treated VSMCs using electron microscopy. JAK-2, p-JAK-2, STAT-3, p-STAT-3, cyclin D1 and Bcl-2, which are all involved in the JAK-2/STAT-3 pathway, were detected in the VSMCs on the 3rd, 5th and 7th days after gene transfer, which is consistent with previously demonstrated time points when VSMCs apoptosis occurred. The expression levels of p-JAK-2, p-STAT-3, cyclin D1 and Bcl-2 were significantly decreased over time in the TFPI group (each P<0.05) but not in the Ad-LacZ and DMEM groups. However, this attenuation of expression was not observed for JAK-2
High-Throughput Screening of a Luciferase Reporter of Gene Silencing on the Inactive X Chromosome.
Keegan, Alissa; Plath, Kathrin; Damoiseaux, Robert
2018-01-01
Assays of luciferase gene activity are a sensitive and quantitative reporter system suited to high-throughput screening. We adapted a luciferase assay to a screening strategy for identifying factors that reactivate epigenetically silenced genes. This epigenetic luciferase reporter is subject to endogenous gene silencing mechanisms on the inactive X chromosome (Xi) in primary mouse cells and thus captures the multilayered nature of chromatin silencing in development. Here, we describe the optimization of an Xi-linked luciferase reactivation assay in 384-well format and adaptation of the assay for high-throughput siRNA and chemical screening. Xi-luciferase reactivation screening has applications in stem cell biology and cancer therapy. We have used the approach described here to identify chromatin-modifying proteins and to identify drug combinations that enhance the gene reactivation activity of the DNA demethylating drug 5-aza-2'-deoxycytidine.
Loss of imprinting at the Dlk1-Gtl2 locus caused by insertional mutagenesis in the Gtl2 5' region
Steshina, Ekaterina Y; Carr, Michael S; Glick, Elena A; Yevtodiyenko, Aleksey; Appelbe, Oliver K; Schmidt, Jennifer V
2006-01-01
Background The Dlk1 and Gtl2 genes define a region of mouse chromosome 12 that is subject to genomic imprinting, the parental allele-specific expression of a gene. Although imprinted genes play important roles in growth and development, the mechanisms by which imprinting is established and maintained are poorly understood. Differentially methylated regions (DMRs), which carry methylation on only one parental allele, are involved in imprinting control at many loci. The Dlk1-Gtl2 region contains three known DMRs, the Dlk1 DMR in the 3' region of Dlk1, the intergenic DMR 15 kb upstream of Gtl2, and the Gtl2 DMR at the Gtl2 promoter. Three mouse models are analyzed here that provide new information about the regulation of Dlk1-Gtl2 imprinting. Results A previously existing insertional mutation (Gtl2lacZ), and a targeted deletion in which the Gtl2 upstream region was replaced by a Neo cassette (Gtl2Δ5'Neo), display partial lethality and dwarfism upon paternal inheritance. Molecular characterization shows that both mutations cause loss of imprinting and changes in expression of the Dlk1, Gtl2 and Meg8/Rian genes. Dlk1 levels are decreased upon paternal inheritance of either mutation, suggesting Dlk1 may be causative for the lethality and dwarfism. Loss of imprinting on the paternal chromosome in both Gtl2lacZ and Gtl2Δ5'Neo mice is accompanied by the loss of paternal-specific Gtl2 DMR methylation, while maternal loss of imprinting suggests a previously unknown regulatory role for the maternal Gtl2 DMR. Unexpectedly, when the Neo gene is excised, Gtl2Δ5' animals are of normal size, imprinting is unchanged and the Gtl2 DMR is properly methylated. The exogenous DNA sequences integrated upstream of Gtl2 are therefore responsible for the growth and imprinting effects. Conclusion These data provide further evidence for the coregulation of the imprinted Dlk1 and Gtl2 genes, and support a role for Dlk1 as an important neonatal growth factor. The ability of the Gtl2lacZ and
Yu, Hong; Dai, Wangde; Yang, Zhe; Romaguera, Rita L; Kirkman, Paul; Rowe, Vincent L
2005-01-01
The objective of this study was to examine the effect of tissue plasminogen activator (tPA) and endothelial nitric oxide synthase (eNOS) on thrombosis and neointimal hyperplasia on a polytetrafluoroethylene (PTFE) graft seeded with smooth muscle cells (SMCs). SMCs retrovirally transduced with tPA and eNOS genes were seeded on PTFE grafts and then implanted into the infrarenal rabbit aorta. Thrombosis and neointimal hyperplasia on the grafts were examined after 30 and 100 days of implantation. At 30 days of implantation, thrombus was observed on the luminal surface of both unseeded and SMC seeded control grafts, whereas grafts seeded with SMCs secreting tPA were nearly free of thrombus. At 100 days, the neointima on grafts seeded with tPA transduced SMCs was significantly thicker (925 +/- 150 microm, n = 5) than neointima on the other grafts (range, 132 to 374 microm; P < .001). Neointima thickness on grafts seeded with eNOS transduced SMCs (154 +/- 27 microm) was similar to that of unseeded grafts (132 +/- 16 microm, P > .05); both were thinner than those on grafts seeded with SMCs transduced with only lacZ gene (287 +/- 35 microm). The ratio of seeded cells in the neointima was significantly higher on SMC/tPA grafts (46% +/- 8%) than SMC/NOS grafts (21% +/- 6%, P < .05), indicating tPA transduced cells proliferated more than eNOS transduced cells. Engineered tPA expression in seeded SMCs causes significantly more neointimal hyperplasia, despite the favorable inhibition of luminal thrombus. eNOS expression in the seeded cells inhibits neointimal hyperplasia.
Wheatley, Robert W.; Lo, Summie; Jancewicz, Larisa J.; Dugdale, Megan L.; Huber, Reuben E.
2013-01-01
β-Galactosidase (lacZ) has bifunctional activity. It hydrolyzes lactose to galactose and glucose and catalyzes the intramolecular isomerization of lactose to allolactose, the lac operon inducer. β-Galactosidase promotes the isomerization by means of an acceptor site that binds glucose after its cleavage from lactose and thus delays its exit from the site. However, because of its relatively low affinity for glucose, details of this site have remained elusive. We present structural data mapping the glucose site based on a substituted enzyme (G794A-β-galactosidase) that traps allolactose. Various lines of evidence indicate that the glucose of the trapped allolactose is in the acceptor position. The evidence includes structures with Bis-Tris (2,2-bis(hydroxymethyl)-2,2′,2″-nitrilotriethanol) and l-ribose in the site and kinetic binding studies with substituted β-galactosidases. The site is composed of Asn-102, His-418, Lys-517, Ser-796, Glu-797, and Trp-999. Ser-796 and Glu-797 are part of a loop (residues 795–803) that closes over the active site. This loop appears essential for the bifunctional nature of the enzyme because it helps form the glucose binding site. In addition, because the loop is mobile, glucose binding is transient, allowing the release of some glucose. Bioinformatics studies showed that the residues important for interacting with glucose are only conserved in a subset of related enzymes. Thus, intramolecular isomerization is not a universal feature of β-galactosidases. Genomic analyses indicated that lac repressors were co-selected only within the conserved subset. This shows that the glucose binding site of β-galactosidase played an important role in lac operon evolution. PMID:23486479
A single secreted luciferase-based gene reporter assay.
Barriscale, Kathy A; O'Sullivan, Sharon A; McCarthy, Tommie V
2014-05-15
Promoter analysis typically employs a reporter gene fused to a test promoter combined with a second reporter fused to a control promoter that is used for normalization purposes. However, this approach is not valid when experimental conditions affect the control promoter. We have developed and validated a single secreted luciferase reporter (SSLR) assay for promoter analysis that avoids the use of a control reporter. The approach uses an early level of expression of a secreted luciferase linked to a test promoter as an internal normalization control for subsequent analysis of the same promoter. Comparison of the SSLR assay with the dual luciferase reporter (DLR) assay using HMGCR (3-hydroxy-3-methylglutaryl-coenzyme A reductase) and LDLR (low-density lipoprotein receptor) promoter constructs, which are down-regulated by 25-hydroxycholesterol, show that both assays yield similar results. Comparison of the response of the HMGCR promoter in SSLR transient assays compared very favorably with the response of the same promoter in the stable cell line. Overall, the SSLR assay proved to be a valid alternative to the DLR assay for certain applications and had significant advantages in that measurement of only one luciferase is required and monitoring can be continuous because cell lysis is not necessary. Copyright © 2014 Elsevier Inc. All rights reserved.
The antiretrovirus drug 3'-azido-3'-deoxythymidine increases the retrovirus mutation rate.
Julias, J G; Kim, T; Arnold, G; Pathak, V K
1997-01-01
It was previously observed that the nucleoside analog 5-azacytidine increased the spleen necrosis virus (SNV) mutation rate 13-fold in one cycle of retrovirus replication (V. K. Pathak and H. M. Temin, J. Virol. 66:3093-3100, 1992). Based on this observation, we hypothesized that nucleoside analogs used as antiviral drugs may also increase retrovirus mutation rates. We sought to determine if 3'-azido-3'-deoxythymidine (AZT), the primary treatment for human immunodeficiency virus type 1 (HIV-1) infection, increases the retrovirus mutation rate. Two assays were used to determine the effects of AZT on retrovirus mutation rates. The strategy of the first assay involved measuring the in vivo rate of inactivation of the lacZ gene in one replication cycle of SNV- and murine leukemia virus-based retroviral vectors. We observed 7- and 10-fold increases in the SNV mutant frequency following treatment of target cells with 0.1 and 0.5 microM AZT, respectively. The murine leukemia virus mutant frequency increased two- and threefold following treatment of target cells with 0.5 and 1.0 microM AZT, respectively. The second assay used an SNV-based shuttle vector containing the lacZ alpha gene. Proviruses were recovered as plasmids in Escherichia coli, and the rate of inactivation of lacZ alpha was measured. The results indicated that treatment of target cells increased the overall mutation rate two- to threefold. DNA sequence analysis of mutant proviruses indicated that AZT increased both the deletion and substitution rates. These results suggest that AZT treatment of HIV-1 infection may increase the degree of viral variation and alter virus evolution or pathogenesis. PMID:9151812
The first report of the vanC₁ gene in Enterococcus faecium isolated from a human clinical specimen.
Sun, Mingyue; Wang, Yue; Chen, Zhongju; Zhu, Xuhui; Tian, Lei; Sun, Ziyong
2014-09-01
The vanC₁ gene, which is chromosomally located, confers resistance to vancomycin and serves as a species marker for Enterococcus gallinarum. Enterococcus faecium TJ4031 was isolated from a blood culture and harbours the vanC₁gene. Polymerase chain reaction (PCR) assays were performed to detect vanXYc and vanTc genes. Only the vanXYc gene was found in the E. faecium TJ4031 isolate. The minimum inhibitory concentrations of vancomycin and teicoplanin were 2 µg/mL and 1 µg/mL, respectively. Real-time reverse transcription-PCR results revealed that the vanC₁ and vanXYc genes were not expressed. Pulsed-field gel electrophoresis and southern hybridisation results showed that the vanC₁ gene was encoded in the chromosome. E. faecalis isolated from animals has been reported to harbour vanC₁gene. However, this study is the first to report the presence of the vanC₁gene in E. faecium of human origin. Additionally, our research showed the vanC₁gene cannot serve as a species-specific gene of E. gallinarum and that it is able to be transferred between bacteria. Although the resistance marker is not expressed in the strain, our results showed that E. faecium could acquire the vanC₁gene from different species.
Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J; Frankel, Gad; Hartland, Elizabeth L; Robins-Browne, Roy M
2008-11-01
Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5alpha, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization.
Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J.; Frankel, Gad; Hartland, Elizabeth L.; Robins-Browne, Roy M.
2008-01-01
Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5α, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization. PMID:18765720
Reporter gene imaging of targeted T cell immunotherapy in recurrent glioma.
Keu, Khun Visith; Witney, Timothy H; Yaghoubi, Shahriar; Rosenberg, Jarrett; Kurien, Anita; Magnusson, Rachel; Williams, John; Habte, Frezghi; Wagner, Jamie R; Forman, Stephen; Brown, Christine; Allen-Auerbach, Martin; Czernin, Johannes; Tang, Winson; Jensen, Michael C; Badie, Behnam; Gambhir, Sanjiv S
2017-01-18
High-grade gliomas are aggressive cancers that often become rapidly fatal. Immunotherapy using CD8 + cytotoxic T lymphocytes (CTLs), engineered to express both herpes simplex virus type 1 thymidine kinase (HSV1-TK) and interleukin-13 (IL-13) zetakine chimeric antigen receptor (CAR), is a treatment strategy with considerable potential. To optimize this and related immunotherapies, it would be helpful to monitor CTL viability and trafficking to glioma cells. We show that noninvasive positron emission tomography (PET) imaging with 9-[4-[ 18 F]fluoro-3-(hydroxymethyl)butyl]guanine ([ 18 F]FHBG) can track HSV1-tk reporter gene expression present in CAR-engineered CTLs. [ 18 F]FHBG imaging was safe and enabled the longitudinal imaging of T cells stably transfected with a PET reporter gene in patients. Further optimization of this imaging approach for monitoring in vivo cell trafficking should greatly benefit various cell-based therapies for cancer. Copyright © 2017, American Association for the Advancement of Science.
Opaque-2 is a transcriptional activator that recognizes a specific target site in 22-kD zein genes.
Schmidt, R J; Ketudat, M; Aukerman, M J; Hoschek, G
1992-01-01
opaque-2 (o2) is a regulatory locus in maize that plays an essential role in controlling the expression of genes encoding the 22-kD zein proteins. Through DNase I footprinting and DNA binding analyses, we have identified the binding site for the O2 protein (O2) in the promoter of 22-kD zein genes. The sequence in the 22-kD zein gene promoter that is recognized by O2 is similar to the target site recognized by other "basic/leucine zipper" (bZIP) proteins in that it contains an ACGT core that is necessary for DNA binding. The site is located in the -300 region relative to the translation start and lies about 20 bp downstream of the highly conserved zein gene sequence motif known as the "prolamin box." Employing gel mobility shift assays, we used O2 antibodies and nuclear extracts from an o2 null mutant to demonstrate that the O2 protein in maize endosperm nuclei recognizes the target site in the zein gene promoter. Mobility shift assays using nuclear proteins from an o2 null mutant indicated that other endosperm proteins in addition to O2 can bind the O2 target site and that O2 may be associated with one of these proteins. We also demonstrated that in yeast cells the O2 protein can activate expression of a lacZ gene containing a multimer of the O2 target sequence as part of its promoter, thus confirming its role as a transcriptional activator. A computer-assisted search indicated that the O2 target site is not present in the promoters of zein genes other than those of the 22-kD class. These data suggest a likely explanation at the molecular level for the differential effect of o2 mutations on expression of certain members of the zein gene family. PMID:1392590
Luckert, Claudia; Hessel, Stefanie; Lampen, Alfonso; Braeuning, Albert
2015-10-15
Reporter gene assays are widely used for the assessment of transcription factor activation following xenobiotic exposure of cells. A critical issue with such assays is the possibility of interference of test compounds with the test system, for example, by direct inhibition of the reporter enzyme. Here we show that the pyrrolizidine alkaloid heliotrine interferes with reporter signals derived from GAL4-based nuclear receptor transactivation assays by a mechanism independent of luciferase enzyme inhibition. These data highlight the necessity to conduct proper control experiments in order to avoid perturbation of reporter assays by test chemicals. Copyright © 2015 Elsevier Inc. All rights reserved.
Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica.
Xuan, J W; Fournier, P; Declerck, N; Chasles, M; Gaillardin, C
1990-01-01
Mutants affected at the LYS5 locus of Yarrowia lipolytica lack detectable dehydrogenase (SDH) activity. The LYS5 gene has previously been cloned, and we present here the sequence of the 2.5-kilobase-pair (kb) DNA fragment complementing the lys5 mutation. Two large antiparallel open reading frames (ORF1 and ORF2) were observed, flanked by potential transcription signals. Both ORFs appear to be transcribed, but several lines of evidence suggest that only ORF2 is translated and encodes SDH. (i) The global amino acid compositions of Saccharomyces cerevisiae SDH and of the putative ORF2 product are similar and that of ORF1 is dissimilar. (ii) An in-frame translational fusion of ORF2 with the Escherichia coli lacZ gene was introduced into yeast cells and resulted in a beta-galactosidase activity regulated similarly to SDH; no beta-galactosidase activity was obtained with an in-frame fusion of ORF1 with lacZ. (iii) The introduction of a stop codon at the beginning of ORF2 prevented SDH expression in yeast cells, whereas no phenotypic effect was observed when ORF1 translation was blocked. Images PMID:2388625
Reporter enzyme inhibitor study to aid assembly of orthogonal reporter gene assays.
Ho, Pei-i; Yue, Kimberley; Pandey, Pramod; Breault, Lyne; Harbinski, Fred; McBride, Aaron J; Webb, Brian; Narahari, Janaki; Karassina, Natasha; Wood, Keith V; Hill, Adam; Auld, Douglas S
2013-05-17
Reporter gene assays (RGAs) are commonly used to measure biological pathway modulation by small molecules. Understanding how such compounds interact with the reporter enzyme is critical to accurately interpret RGA results. To improve our understanding of reporter enzymes and to develop optimal RGA systems, we investigated eight reporter enzymes differing in brightness, emission spectrum, stability, and substrate requirements. These included common reporter enzymes such as firefly luciferase (Photinus pyralis), Renilla reniformis luciferase, and β-lactamase, as well as mutated forms of R. reniformis luciferase emitting either blue- or green-shifted luminescence, a red-light emitting form of Luciola cruciata firefly luciferase, a mutated form of Gaussia princeps luciferase, and a proprietary luciferase termed "NanoLuc" derived from the luminescent sea shrimp Oplophorus gracilirostris. To determine hit rates and structure-activity relationships, we screened a collection of 42,460 PubChem compounds at 10 μM using purified enzyme preparations. We then compared hit rates and chemotypes of actives for each enzyme. The hit rates ranged from <0.1% for β-lactamase to as high as 10% for mutated forms of Renilla luciferase. Related luciferases such as Renilla luciferase mutants showed high degrees of inhibitor overlap (40-70%), while unrelated luciferases such as firefly luciferases, Gaussia luciferase, and NanoLuc showed <10% overlap. Examination of representative inhibitors in cell-based assays revealed that inhibitor-based enzyme stabilization can lead to increases in bioluminescent signal for firefly luciferase, Renilla luciferase, and NanoLuc, with shorter half-life reporters showing increased activation responses. From this study we suggest strategies to improve the construction and interpretation of assays employing these reporter enzymes.
Yamamoto, Hiroki; Serizawa, Masakuni; Thompson, John; Sekiguchi, Junichi
2001-01-01
Maltose metabolism and the regulation of the glv operon of Bacillus subtilis, comprising three genes, glvA (6-phospho-α-glucosidase), yfiA (now designated glvR), and glvC (EIICB transport protein), were investigated. Maltose dissimilation was dependent primarily upon the glv operon, and insertional inactivation of either glvA, glvR, or glvC markedly inhibited growth on the disaccharide. A second system (MalL) contributed to a minor extent to maltose metabolism. Northern blotting revealed two transcripts corresponding to a monocistronic mRNA of glvA and a polycistronic mRNA of glvA-glvR-glvC. Primer extension analysis showed that both transcripts started at the same base (G) located 26 bp upstream of the 5′ end of glvA. When glvR was placed under control of the spac promoter, expression of the glv operon was dependent upon the presence of isopropyl-β-d-thiogalactopyranoside (IPTG). In regulatory studies, the promoter sequence of the glv operon was fused to lacZ and inserted into the amyE locus, and the resultant strain (AMGLV) was then transformed with a citrate-controlled glvR plasmid, pHYCM2VR. When cultured in Difco sporulation medium containing citrate, this transformant [AMGLV(pHYCM2VR)] expressed LacZ activity, but synthesis of LacZ was repressed by glucose. In an isogenic strain, [AMGLVCR(pHYCM2VR)], except for a mutation in the sequence of a catabolite-responsive element (cre), LacZ activity was expressed in the presence of citrate and glucose. Insertion of a citrate-controlled glvR plasmid at the amyE locus of ccpA+ and ccpA mutant organisms yielded strains AMCMVR and AMCMVRCC, respectively. In the presence of both glucose and citrate, AMCMVR failed to express the glv operon, whereas under the same conditions high-level expression of both mRNA transcripts was found in strain AMCMVRCC. Collectively, our findings suggest that GlvR (the product of the glvR gene) is a positive regulator of the glv operon and that glucose exerts its effect via catabolite
Using reporter gene assays to identify cis regulatory differences between humans and chimpanzees.
Chabot, Adrien; Shrit, Ralla A; Blekhman, Ran; Gilad, Yoav
2007-08-01
Most phenotypic differences between human and chimpanzee are likely to result from differences in gene regulation, rather than changes to protein-coding regions. To date, however, only a handful of human-chimpanzee nucleotide differences leading to changes in gene regulation have been identified. To hone in on differences in regulatory elements between human and chimpanzee, we focused on 10 genes that were previously found to be differentially expressed between the two species. We then designed reporter gene assays for the putative human and chimpanzee promoters of the 10 genes. Of seven promoters that we found to be active in human liver cell lines, human and chimpanzee promoters had significantly different activity in four cases, three of which recapitulated the gene expression difference seen in the microarray experiment. For these three genes, we were therefore able to demonstrate that a change in cis influences expression differences between humans and chimpanzees. Moreover, using site-directed mutagenesis on one construct, the promoter for the DDA3 gene, we were able to identify three nucleotides that together lead to a cis regulatory difference between the species. High-throughput application of this approach can provide a map of regulatory element differences between humans and our close evolutionary relatives.
Confocal quantification of cis-regulatory reporter gene expression in living sea urchin.
Damle, Sagar; Hanser, Bridget; Davidson, Eric H; Fraser, Scott E
2006-11-15
Quantification of GFP reporter gene expression at single cell level in living sea urchin embryos can now be accomplished by a new method of confocal laser scanning microscopy (CLSM). Eggs injected with a tissue-specific GFP reporter DNA construct were grown to gastrula stage and their fluorescence recorded as a series of contiguous Z-section slices that spanned the entire embryo. To measure the depth-dependent signal decay seen in the successive slices of an image stack, the eggs were coinjected with a freely diffusible internal fluorescent standard, rhodamine dextran. The measured rhodamine fluorescence was used to generate a computational correction for the depth-dependent loss of GFP fluorescence per slice. The intensity of GFP fluorescence was converted to the number of GFP molecules using a conversion constant derived from CLSM imaging of eggs injected with a measured quantity of GFP protein. The outcome is a validated method for accurately counting GFP molecules in given cells in reporter gene transfer experiments, as we demonstrate by use of an expression construct expressed exclusively in skeletogenic cells.
Gsg1, Trnp1, and Tmem215 Mark Subpopulations of Bipolar Interneurons in the Mouse Retina
Park, Ko Uoon; Randazzo, Grace; Jones, Kenneth L.; Brzezinski, Joseph A.
2017-01-01
Purpose How retinal bipolar cell interneurons are specified and assigned to specialized subtypes is only partially understood. In part, this is due to a lack of early pan- and subtype-specific bipolar cell markers. To discover these factors, we identified genes that were upregulated in Blimp1 (Prdm1) mutant retinas, which exhibit precocious bipolar cell development. Methods Postnatal day (P)2 retinas from Blimp1 conditional knock-out (CKO) mice and controls were processed for RNA sequencing. Genes that increased at least 45% and were statistically different between conditions were considered candidate bipolar-specific factors. Candidates were further evaluated by RT-PCR, in situ hybridization, and immunohistochemistry. Knock-in Tmem215-LacZ mice were used to better trace retinal expression. Results A comparison between Blimp1 CKO and control RNA-seq datasets revealed approximately 40 significantly upregulated genes. We characterized the expression of three genes that have no known function in the retina, Gsg1 (germ cell associated gene), Trnp1 (TMF-regulated nuclear protein), and Tmem215 (a predicted transmembrane protein). Germ cell associated gene appeared restricted to a small subset of cone bipolars while Trnp1 was seen in all ON type bipolar cells. Using Tmem215-LacZ heterozygous knock-in mice, we observed that β-galactosidase expression started early in bipolar cell development. In adults, Tmem215 was expressed by a subset of ON and OFF cone bipolar cells. Conclusions We have identified Gsg1, Tmem215, and Trnp1 as novel bipolar subtype-specific genes. The spatial and temporal pattern of their expression is consistent with a role in controlling bipolar subtype fate choice, differentiation, or physiology. PMID:28199486
Sala, Claudia; Forti, Francesca; Magnoni, Francesca; Ghisotti, Daniela
2008-01-01
Background In Mycobacterium tuberculosis and in Mycobacterium smegmatis the furA-katG loci, encoding the FurA regulatory protein and the KatG catalase-peroxidase, are highly conserved. In M. tuberculosis furA-katG constitute a single operon, whereas in M. smegmatis a single mRNA covering both genes could not be found. In both species, specific 5' ends have been identified: the first one, located upstream of the furA gene, corresponds to transcription initiation from the furA promoter; the second one is the katG mRNA 5' end, located in the terminal part of furA. Results In this work we demonstrate by in vitro transcription and by RNA polymerase Chromatin immunoprecipitation that no promoter is present in the M. smegmatis region covering the latter 5' end, suggesting that it is produced by specific processing of longer transcripts. Several DNA fragments of M. tuberculosis and M. smegmatis were inserted in a plasmid between the sigA promoter and the lacZ reporter gene, and expression of the reporter gene was measured. A polypurine sequence, located four bp upstream of the katG translation start codon, increased beta-galactosidase activity and stabilized the lacZ transcript. Mutagenesis of this sequence led to destabilization of the mRNA. Analysis of constructs, in which the polypurine sequence of M. smegmatis was followed by an increasing number of katG codons, demonstrated that mRNA stability requires translation of at least 20 amino acids. In order to define the requirements for the 5' processing of the katG transcript, we created several mutations in this region and analyzed the 5' ends of the transcripts: the distance from the polypurine sequence does not seem to influence the processing, neither the sequence around the cutting point. Only mutations which create a double stranded region around the processing site prevented RNA processing. Conclusion This is the first reported case in mycobacteria, in which both a polypurine sequence and translation initiation are
Wolfs, Esther; Holvoet, Bryan; Ordovas, Laura; Breuls, Natacha; Helsen, Nicky; Schönberger, Matthias; Raitano, Susanna; Struys, Tom; Vanbilloen, Bert; Casteels, Cindy; Sampaolesi, Maurilio; Van Laere, Koen; Lambrichts, Ivo; Verfaillie, Catherine M; Deroose, Christophe M
2017-10-01
Molecular imaging is indispensable for determining the fate and persistence of engrafted stem cells. Standard strategies for transgene induction involve the use of viral vectors prone to silencing and insertional mutagenesis or the use of nonhuman genes. Methods: We used zinc finger nucleases to induce stable expression of human imaging reporter genes into the safe-harbor locus adeno-associated virus integration site 1 in human embryonic stem cells. Plasmids were generated carrying reporter genes for fluorescence, bioluminescence imaging, and human PET reporter genes. Results: In vitro assays confirmed their functionality, and embryonic stem cells retained differentiation capacity. Teratoma formation assays were performed, and tumors were imaged over time with PET and bioluminescence imaging. Conclusion: This study demonstrates the application of genome editing for targeted integration of human imaging reporter genes in human embryonic stem cells for long-term molecular imaging. © 2017 by the Society of Nuclear Medicine and Molecular Imaging.
Meoli, Luca; Isensee, Jörg; Zazzu, Valeria; Nabzdyk, Christoph S; Soewarto, Dian; Witt, Henning; Foryst-Ludwig, Anna; Kintscher, Ulrich; Noppinger, Patricia Ruiz
2014-05-01
The G protein-coupled receptor 30 (GPR30) has been claimed as an estrogen receptor. However, the literature reports controversial findings and the physiological function of GPR30 is not fully understood yet. Consistent with studies assigning a role of GPR30 in the cardiovascular and metabolic systems, GPR30 expression has been reported in small arterial vessels, pancreas and chief gastric cells of the stomach. Therefore, we hypothesized a role of GPR30 in the onset and progression of cardiovascular and metabolic diseases. In order to test our hypothesis, we investigated the effects of a high-fat diet on the metabolic and cardiovascular profiles of Gpr30-deficient mice (GPR30-lacZ mice). We found that GPR30-lacZ female, rather than male, mice had significant lower levels of HDL along with an increase in fat liver accumulation as compared to control mice. However, two indicators of cardiac performance assessed by echocardiography, ejection fraction and fractional shortening were both decreased in an age-dependent manner only in Gpr30-lacZ male mice. Collectively our results point to a potential role of Gpr30 in preserving lipid metabolism and cardiac function in a sex- and age-dependent fashion. Copyright © 2014 Elsevier B.V. All rights reserved.
Melnikov, Olga; Zaritsky, Arieh; Zarka, Aliza; Boussiba, Sammy; Malchin, Natalia; Yagil, Ezra; Kolot, Mikhail
2009-07-01
The integrase (Int) of the lambda-like coliphage HK022 catalyzes the site-specific integration and excision of the phage DNA into and from the chromosome of its host, Escherichia coli. Int recognizes two different pairs of recombining sites attP x attB and attL x attR for integration and excision, respectively. This system was adapted to the cyanobacterium Anabaena sp. strain PCC 7120 as a potential tool for site-specific gene manipulations in the cyanobacterium. Two plasmids were consecutively cointroduced by conjugation into Anabaena cells, one plasmid that expresses HK022 Int recombinase and the other plasmid that carries the excision substrate P(glnA)-attL-T1/T2-attR-lacZ, where T1/T2 are the strong transcription terminators of rrnB, to prevent expression of the lacZ reporter under the constitutive promoter P(glnA). The Int-catalyzed site-specific recombination reaction was monitored by the expression of lacZ emanating as a result of T1/T2 excision. Int catalyzed the site-specific excision reaction in Anabaena cells when its substrate was located either on the plasmid or on the chromosome with no need to supply an accessory protein, such as integration host factor and excisionase (Xis), which are indispensable for this reaction in its host, E. coli.
Shifera, Amde Selassie; Hardin, John A.
2009-01-01
The Renilla luciferase gene is commonly used as an internal control in luciferase-based reporter gene assays to normalize the values of the experimental reporter gene for variations that could be caused by transfection efficiency and sample handling. Various plasmids encoding Renilla luciferase under different promoter constructs are commercially available. The validity of the use of Renilla luciferase as an internal control is based on the assumption that it is constitutively expressed in transfected cells and that its constitutive expression is not modulated by experimental factors that could result in either the upregulation or the downregulation of the amounts of the enzyme produced. During the past ten years, a number of reports have appeared that identified a variety of conditions that could alter the basal constitutive expression of Renilla luciferase. The use of Renilla luciferase in those circumstances would not be valid and an alternative way of normalization would be necessary. This review covers the factors that have been reported thus far as modulating the expression of Renilla luciferase from plasmid constructs. PMID:19788887
Shen, Sanbing; Spratt, Christopher; Sheward, W. John; Kallo, Imre; West, Katrine; Morrison, Christine F.; Coen, Clive W.; Marston, Hugh M.; Harmar, Anthony J.
2000-01-01
The neuropeptides vasoactive intestinal peptide (VIP) and pituitary adenylate cyclase-activating polypeptide (PACAP) belong to a superfamily of structurally related peptide hormones that includes glucagon, glucagon-like peptides, secretin, and growth hormone-releasing hormone. Microinjection of VIP or PACAP into the rodent suprachiasmatic nucleus (SCN) phase shifts the circadian pacemaker and VIP antagonists, and antisense oligodeoxynucleotides have been shown to disrupt circadian function. VIP and PACAP have equal potency as agonists of the VPAC2 receptor (VPAC2R), which is expressed abundantly in the SCN, in a circadian manner. To determine whether manipulating the level of expression of the VPAC2R can influence the control of the circadian clock, we have created transgenic mice overexpressing the human VPAC2R gene from a yeast artificial chromosome (YAC) construct. The YAC was modified by a strategy using homologous recombination to introduce (i) the HA epitope tag sequence (from influenza virus hemagglutinin) at the carboxyl terminus of the VPAC2R protein, (ii) the lacZ reporter gene, and (iii) a conditional centromere, enabling YAC DNA to be amplified in culture in the presence of galactose. High levels of lacZ expression were detected in the SCN, habenula, pancreas, and testis of the transgenic mice, with lower levels in the olfactory bulb and various hypothalamic areas. Transgenic mice resynchronized more quickly than wild-type controls to an advance of 8 h in the light-dark (LD) cycle and exhibited a significantly shorter circadian period in constant darkness (DD). These data suggest that the VPAC2R can influence the rhythmicity and photic entrainment of the circadian clock. PMID:11027354
The first report of prion-related protein gene (PRNT) polymorphisms in goat.
Kim, Yong-Chan; Jeong, Byung-Hoon
2017-06-01
Prion protein is encoded by the prion protein gene (PRNP). Polymorphisms of several members of the prion gene family have shown association with prion diseases in several species. Recent studies on a novel member of the prion gene family in rams have shown that prion-related protein gene (PRNT) has a linkage with codon 26 of prion-like protein (PRND). In a previous study, codon 26 polymorphism of PRND has shown connection with PRNP haplotype which is strongly associated with scrapie vulnerability. In addition, the genotype of a single nucleotide polymorphism (SNP) at codon 26 of PRND is related to fertilisation capacity. These findings necessitate studies on the SNP of PRNT gene which is connected with PRND. In goat, several polymorphism studies have been performed for PRNP, PRND, and shadow of prion protein gene (SPRN). However, polymorphism on PRNT has not been reported. Hence, the objective of this study was to determine the genotype and allelic distribution of SNPs of PRNT in 238 Korean native goats and compare PRNT DNA sequences between Korean native goats and several ruminant species. A total of five SNPs, including PRNT c.-114G > T, PRNT c.-58A > G in the upstream of PRNT gene, PRNT c.71C > T (p.Ala24Val) and PRNT c.102G > A in the open reading frame (ORF) and c.321C > T in the downstream of PRNT gene, were found in this study. All five SNPs of caprine PRNT gene in Korean native goat are in complete linkage disequilibrium (LD) with a D' value of 1.0. Interestingly, comparative sequence analysis of the PRNT gene revealed five mismatches between DNA sequences of Korean native goats and those of goats deposited in the GenBank. Korean native black goats also showed 5 mismatches in PRNT ORF with cattle. To the best of our knowledge, this is the first genetic research of the PRNT gene in goat.
Xiong, Ai-Sheng; Peng, Ri-He; Zhuang, Jing; Chen, Jian-Min; Zhang, Bin; Zhang, Jian; Yao, Quan-Hong
2011-01-01
A β-glucuronidase variant, GUS-TR3337, that was obtained by directed evolution exhibited higher thermostability than the wild-type enzyme, GUS-WT. In this study, the utility of GUS-TR337 as an improved reporter was evaluated. The corresponding gus-tr3337 and gus-wt genes were independently cloned in a plant expression vector and introduced into Arabidopsis thaliana. With 4-MUG as a substrate, plants containing the gus-wt gene showed no detectable β-glucuronidase activity after exposure to 60°C for 10 min, while those hosting the gus-tr3337 gene retained 70% or 50% activity after exposure to 80°C for 10 min or 30 min, respectively. Similarly, in vivo β-glucuronidase activity could be demonstrated by using X-GLUC as a substrate in transgenic Arabidopsis plants hosting the gus-tr3337 gene that were exposed to 80°C for up to 30 min. Thus, the thermostability of GUS-TR3337 can be exploited to distinguish between endogenous and transgenic β-glucuronidase activity, which is a welcome improvement in its use as a reporter. PMID:22096498
Remans, Tony; Keunen, Els; Bex, Geert Jan; Smeets, Karen; Vangronsveld, Jaco; Cuypers, Ann
2014-10-01
Reverse transcription-quantitative PCR (RT-qPCR) has been widely adopted to measure differences in mRNA levels; however, biological and technical variation strongly affects the accuracy of the reported differences. RT-qPCR specialists have warned that, unless researchers minimize this variability, they may report inaccurate differences and draw incorrect biological conclusions. The Minimum Information for Publication of Quantitative Real-Time PCR Experiments (MIQE) guidelines describe procedures for conducting and reporting RT-qPCR experiments. The MIQE guidelines enable others to judge the reliability of reported results; however, a recent literature survey found low adherence to these guidelines. Additionally, even experiments that use appropriate procedures remain subject to individual variation that statistical methods cannot correct. For example, since ideal reference genes do not exist, the widely used method of normalizing RT-qPCR data to reference genes generates background noise that affects the accuracy of measured changes in mRNA levels. However, current RT-qPCR data reporting styles ignore this source of variation. In this commentary, we direct researchers to appropriate procedures, outline a method to present the remaining uncertainty in data accuracy, and propose an intuitive way to select reference genes to minimize uncertainty. Reporting the uncertainty in data accuracy also serves for quality assessment, enabling researchers and peer reviewers to confidently evaluate the reliability of gene expression data. © 2014 American Society of Plant Biologists. All rights reserved.
Reporter gene expression in fish following cutaneous infection with pantropic retroviral vectors.
Paul, T A; Burns, J C; Shike, H; Getchell, R; Bowser, P R; Whitlock, K E; Casey, J W
2001-06-01
A central issue in gene delivery systems is choosing promoters that will direct defined and sustainable levels of gene expression. Pantropic retroviral vectors provide a means to insert genes into either somatic or germline cells. In this study, we focused on somatic cell infection by evaluating the activity of 3 promoters inserted by vectors into fish cell lines and fish skin using pantropic retroviruses. In bluegill and zebrafish cell lines, the highest levels of luciferase expression were observed from the 5' murine leukemia virus long terminal repeat of the retroviral vector. The Rous sarcoma virus long terminal repeat and cytomegalovirus early promoter, as internal promoters, generated lower levels of luciferase. Luciferase reporter vectors infected zebrafish skin, as measured by the presence of viral DNA, and expressed luciferase. We infected developing walleye dermal sarcomas with retroviral vectors to provide an environment with enhanced cell proliferation, a condition necessary for integration of the provirus into the host genome. We demonstrated a 4-fold to 7-fold increase in luciferase gene expression in tumor tissue over infections in normal walleye skin.
Mapping the Shh long-range regulatory domain
Anderson, Eve; Devenney, Paul S.; Hill, Robert E.; Lettice, Laura A.
2014-01-01
Coordinated gene expression controlled by long-distance enhancers is orchestrated by DNA regulatory sequences involving transcription factors and layers of control mechanisms. The Shh gene and well-established regulators are an example of genomic composition in which enhancers reside in a large desert extending into neighbouring genes to control the spatiotemporal pattern of expression. Exploiting the local hopping activity of the Sleeping Beauty transposon, the lacZ reporter gene was dispersed throughout the Shh region to systematically map the genomic features responsible for expression activity. We found that enhancer activities are retained inside a genomic region that corresponds to the topological associated domain (TAD) defined by Hi-C. This domain of approximately 900 kb is in an open conformation over its length and is generally susceptible to all Shh enhancers. Similar to the distal enhancers, an enhancer residing within the Shh second intron activates the reporter gene located at distances of hundreds of kilobases away, suggesting that both proximal and distal enhancers have the capacity to survey the Shh topological domain to recognise potential promoters. The widely expressed Rnf32 gene lying within the Shh domain evades enhancer activities by a process that may be common among other housekeeping genes that reside in large regulatory domains. Finally, the boundaries of the Shh TAD do not represent the absolute expression limits of enhancer activity, as expression activity is lost stepwise at a number of genomic positions at the verges of these domains. PMID:25252942
Kang, Young-Mi; Choi, Yun-Rak; Yun, Chae-Ok; Park, Jin-Oh; Suk, Kyung-Soo; Kim, Hak-Sun; Park, Moon-Soo; Lee, Byung-Ho; Lee, Hwan-Mo; Moon, Seong-Hwan
2014-04-01
Dupuytren's disease is a fibroproliferative connective tissue disorder characterized by contracture of the palmer fascia of the hand. Relaxin (RLN) is a multifunctional factor which contributes to the remodeling of the pelvic ligament by inhibiting fibrosis and inflammatory activities. The aim of this study was to investigate the effect of the RLN gene on the inhibition of fibrosis in myofibroblastic cells. Myofibroblast cells with adenovirus LacZ (Ad-LacZ) as a marker gene or adenovirus relaxin (Ad-RLN) as therapeutic gene showed transgene expressions in beta-galactosidase assay and Western blot analysis. Myofibroblastic cells with Ad-RLN demonstrated a 22% and 48% reduction in collagen I and III mRNA expressions respectively, a 50% decrease in MMP-1, 70% decrease in MMP-2, 80% decrease in MMP-9, and a 15% reduction in MMP-13 protein expression compared with cultures with viral control and saline control. In addition, myofibroblastic cells with Ad-RLN showed a 40% decrease in TIMP 1 and a 15% increase in TIMP 3 protein expression at 48 h compared to cultures with viral control and saline control. Also, myofibroblastic cell with Ad-RLN demonstrated a 74% inhibition of fibronectin and a 52% decrease in total collagen synthesis at 48 h compared with cultures with viral control and saline control. In conclusion, the RLN gene render antifibrogenic effect on myofibroblastic cells from Dupuytren's nodule via direct inhibition of collagen synthesis not through collagenolytic pathway such as MMP-1, -13, TIMP 1, and 3. Therefore relaxin can be an alternative therapeutic strategy in initial stage of Dupuytren's disease by its antifibrogenic effect. © 2013 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
Tang, Yao Liang; Qian, Keping; Zhang, Y Clare; Shen, Leping; Phillips, M Ian
2005-12-01
The effect of a cardiac specific, hypoxia-regulated, human heme oxygenase-1 (hHO-1) vector to provide cardioprotection from ischemia-reperfusion injury was assessed. When myocardial ischemia and reperfusion is asymptomatic, the damaging effects are cumulative and patients miss timely treatment. A gene therapy approach that expresses therapeutic genes only when ischemia is experienced is a desirable strategy. We have developed a cardiac-specific, hypoxia-regulated gene therapy "vigilant vector'' system that amplifies cardioprotective gene expression. Vigilant hHO-1 plasmids, LacZ plasmids, or saline (n = 40 per group) were injected into mouse heart 2 days in advance of ischemia-reperfusion injury. Animals were exposed to 60 minutes of ischemia followed by 24 hours of reperfusion. For that term (24 hours) effects, the protein levels of HO-1, inflammatory responses, apoptosis, and infarct size were determined. For long-term (3 week) effects, the left ventricular remodeling and recovery of cardiac function were assessed. Ischemia-reperfusion resulted in a timely overexpression of HO-1 protein. Infarct size at 24 hours after ischemia-reperfusion was significantly reduced in the HO-1-treated animals compared with the LacZ-treated group or saline-treated group (P < .001). The reduction of infarct size was accompanied by a decrease in lipid peroxidant activity, inflammatory cell infiltration, and proapoptotic protein level in ischemia-reperfusion-injured myocardium. The long-term study demonstrated that timely, hypoxia-induced HO-1 overexpression is beneficial in conserving cardiac function and attenuating left ventricle remodelling. The vigilant HO-1 vector provides a protective therapy in the heart for reducing cellular damage during ischemia-reperfusion injury and preserving heart function.
2014-01-01
Background Down-regulation or silencing of transgene expression can be a major hurdle to both molecular studies and biotechnology applications in many plant species. Sugarcane is particularly effective at silencing introduced transgenes, including reporter genes such as the firefly luciferase gene. Synthesizing transgene coding sequences optimized for usage in the host plant is one method of enhancing transgene expression and stability. Using specified design rules we have synthesised new coding sequences for both the firefly luciferase and Renilla luciferase reporter genes. We have tested these optimized versions for enhanced levels of luciferase activity and for increased steady state luciferase mRNA levels in sugarcane. Results The synthetic firefly luciferase (luc*) and Renilla luciferase (Renluc*) coding sequences have elevated G + C contents in line with sugarcane codon usage, but maintain 75% identity to the native firefly or Renilla luciferase nucleotide sequences and 100% identity to the protein coding sequences. Under the control of the maize pUbi promoter, the synthetic luc* and Renluc* genes yielded 60x and 15x higher luciferase activity respectively, over the native firefly and Renilla luciferase genes in transient assays on sugarcane suspension cell cultures. Using a novel transient assay in sugarcane suspension cells combining co-bombardment and qRT-PCR, we showed that synthetic luc* and Renluc* genes generate increased transcript levels compared to the native firefly and Renilla luciferase genes. In stable transgenic lines, the luc* transgene generated significantly higher levels of expression than the native firefly luciferase transgene. The fold difference in expression was highest in the youngest tissues. Conclusions We developed synthetic versions of both the firefly and Renilla luciferase reporter genes that resist transgene silencing in sugarcane. These transgenes will be particularly useful for evaluating the expression patterns conferred
Chou, Ting-Chun; Moyle, Richard L
2014-04-08
Down-regulation or silencing of transgene expression can be a major hurdle to both molecular studies and biotechnology applications in many plant species. Sugarcane is particularly effective at silencing introduced transgenes, including reporter genes such as the firefly luciferase gene.Synthesizing transgene coding sequences optimized for usage in the host plant is one method of enhancing transgene expression and stability. Using specified design rules we have synthesised new coding sequences for both the firefly luciferase and Renilla luciferase reporter genes. We have tested these optimized versions for enhanced levels of luciferase activity and for increased steady state luciferase mRNA levels in sugarcane. The synthetic firefly luciferase (luc*) and Renilla luciferase (Renluc*) coding sequences have elevated G + C contents in line with sugarcane codon usage, but maintain 75% identity to the native firefly or Renilla luciferase nucleotide sequences and 100% identity to the protein coding sequences.Under the control of the maize pUbi promoter, the synthetic luc* and Renluc* genes yielded 60x and 15x higher luciferase activity respectively, over the native firefly and Renilla luciferase genes in transient assays on sugarcane suspension cell cultures.Using a novel transient assay in sugarcane suspension cells combining co-bombardment and qRT-PCR, we showed that synthetic luc* and Renluc* genes generate increased transcript levels compared to the native firefly and Renilla luciferase genes.In stable transgenic lines, the luc* transgene generated significantly higher levels of expression than the native firefly luciferase transgene. The fold difference in expression was highest in the youngest tissues. We developed synthetic versions of both the firefly and Renilla luciferase reporter genes that resist transgene silencing in sugarcane. These transgenes will be particularly useful for evaluating the expression patterns conferred by existing and newly isolated
WUS and STM-based reporter genes for studying meristem development in poplar
USDA-ARS?s Scientific Manuscript database
We describe the development of a reporter system for monitoring meristem initiation in poplar using promoters of poplar homologs to the meristem-active regulatory genes WUSCHEL (WUS) and SHOOTMERISTEMLESS (STM). When ~3 kb of the 5’ flanking regions of close homologs were used to drive expression o...
Blackford, John A.; Guo, Chunhua; Zhu, Rong; Dougherty, Edward J.; Chow, Carson C.; Simons, S. Stoney
2012-01-01
A currently obscure area of steroid hormone action is where the component factors, including receptor and reporter gene, act. The DNA binding of factors can be precisely defined, but the location and timing of factor binding and action are usually not equivalent. These questions are addressed for several factors (e.g. glucocorticoid receptor (GR), reporter, TIF2, NCoR, NELF-A, sSMRT, and STAMP) using our recently developed competition assay. This assay reveals both the kinetically defined mechanism of factor action and where the above factors act relative to both each other and the equilibrium equivalent to the rate-limiting step, which we call the concentration limiting step (CLS). The utility of this competition assay would be greatly increased if the position of the CLS is invariant and if the factor acting at the CLS is known. Here we report that the exogenous GREtkLUC reporter acts at the CLS as an accelerator for gene induction by GRs in U2OS cells. This mechanism of reporter function at the CLS persists with different reporters, factors, receptors, and cell types. We, therefore, propose that the reporter gene always acts at the CLS during gene induction and constitutes a landmark around which one can order the actions of all other factors. Current data suggest that how and where GR and the short form of SMRT act is also constant. These results validate a novel and rational methodology for identifying distally acting factors that would be attractive targets for pharmaceutical intervention in the treatment of diseases involving GR-regulated genes. PMID:23055525
Export of the Virulence Factors from Shigella Flexneri and Characterization of the mxi loci
1992-07-20
steps in Shigella pathogenesis. To identify temperature-regulated virulence genes on the plasmid, lacZ protein fusions were randomly generated in S ...this locus conferred the Mxi- phenotype and was found to affect virulence of S . flexneri at the level of invasion, which correlated with reduced...excretion of IpaC. Protease protection experiments indicated the presence of high intracellular reservoirs of Ipa proteins in wild-type S . flexneri as
A reporter gene assay for the detection of phytoestrogens in traditional Chinese medicine.
Miller-Martini, D M; Chan, R Y; Ip, N Y; Sheu, S J; Wong, Y H
2001-09-01
Bupleurum & Peony Formula (Jia Wei Xiao Yao San) is a herbal formula which possesses a clinical history for the treatment of menopausal syndrome and menstrual irregularity. The present investigation reports the ability to monitor the formula's phytoestrogen content that will allow for the implementation of a standardization protocol that is based on a quantifiable biological response. Utilizing an oestrogen-sensitive chimeric receptor/reporter gene element which has been stably transfected into HeLa cells, the botanical formula was shown to induce the expression of the reporter gene, luciferase, in a dose dependent manner. Pretreatment of the HeLa cells with the botanical formula produced a 5-fold increase in bioluminescence compared with the control. Additionally, our studies showed that the response of the cells, when challenged by the botanical formula, was oestrogen specific. Pretreatment of the cells with tamoxifen effectively blocked the activation of the chimeric oestrogen receptor by the botanical formula. The cell line provides a sensitive assay that can easily detect the presence of phytoestrogens in complex botanical formulas. Copyright 2001 John Wiley & Sons, Ltd.
Reporter gene expression in dendritic cells after gene gun administration of plasmid DNA.
Watkins, Craig; Hopkins, John; Harkiss, Gordon
2005-07-21
Dendritic cells (DC) play an integral role in plasmid DNA vaccination. However, the interaction between plasmid DNA and DC in vivo is incompletely understood. In this report, we utilise the sheep pseudoafferent cannulation model to examine the interaction between plasmid DNA encoding enhanced green fluorescent protein (pEGFP) and afferent lymph DC (ALDC) following gene gun administration. The results show that peaks of fluorescent ALDC tended to appear around days 1-4 and 9-13, then erratically thereafter for up to 2 months. Phenotypic analysis showed that EGFP+ ALDC expressed MHC class II, WC6, CD1b, and SIRPalpha markers. Plasmid, detected by PCR, was found in lymph cells and cell-free plasma on a daily basis, and was present variably for up to 2 months. Plasmid was also detected in purified CD1b+ ALDC, but the presence of plasmid did not correlate with EGFP expression by ALDC. Free EGFP in afferent lymph plasma was detectable by luminometry only after three administrations of the plasmid. The results show that gene gun administered pEGFP persisted for extended periods after a single administration, leeching out of skin on a daily basis. The plasmid was associated with both the cellular and fluid components of afferent lymph. EGFP protein appeared in afferent lymph in a pulsatile manner, but associated only with ALDC.
A major defect in mast cell effector functions in CRACM1-/- mice
Vig, Monika; Dehaven, Wayne I; Bird, Gary S; Billingsley, James M; Wang, Huiyun; Rao, Patricia E; Hutchings, Amy B; Jouvin, Marie-Hélène; Putney, James W; Kinet, Jean-Pierre
2008-01-01
CRACM1 (Orai1) constitutes the pore subunit of CRAC channels that are crucial for many physiological processes 1-6. A point mutation in CRACM1 has been associated with SCID disease in humans 2. We have generated CRACM1 deficient mice using gene trap, where β-galactosidase (LacZ) activity identifies CRACM1 expression in tissues. We show here that the homozygous CRACM1 deficient mice are considerably smaller in size and are grossly defective in mast cell degranulation and cytokine secretion. FcεRI-mediated in vivo allergic reactions were also inhibited in CRACM1-/- mice. Other tissues expressing truncated CRACM1-LacZ fusion protein include skeletal muscles, kidney and regions in the brain and heart. Surprisingly, no CRACM1 expression was seen in the lymphoid regions of thymus. Accordingly, we found no defect in T cell development. Thus, our data reveal novel crucial roles for CRAC channels including a putative role in excitable cells. PMID:18059270
Bartosiak-Jentys, Jeremy; Eley, Kirstin
2012-01-01
The pheB gene from Geobacillus stearothermophilus DSM6285 has been exploited as a reporter gene for Geobacillus spp. The gene product, catechol 2,3-dioxygenase (C23O), catalyzes the formation of 2-hydroxymuconic semialdehyde, which can be readily assayed. The reporter was used to examine expression from the ldh promoter associated with fermentative metabolism. PMID:22685159
Gene and enhancer trap tagging of vascular-expressed genes in poplar trees
Andrew Groover; Joseph R. Fontana; Gayle Dupper; Caiping Ma; Robert Martienssen; Steven Strauss; Richard Meilan
2004-01-01
We report a gene discovery system for poplar trees based on gene and enhancer traps. Gene and enhancer trap vectors carrying the β-glucuronidase (GUS) reporter gene were inserted into the poplar genome via Agrobacterium tumefaciens transformation, where they reveal the expression pattern of genes at or near the insertion sites. Because GUS...
NASA Astrophysics Data System (ADS)
Takahashi, Akihisa; Ohnishi, Takeo; Suzuki, Hiromi; Omori, Katsunori; Seki, Masaya; Hashizume, Toko; Shimazu, Toru; Ishioka, Noriaki
The space environment contains two major biologically significant influences: space radiations and microgravity. A p53 tumor suppressor protein plays a role as a guardian of the genome through the activity of p53-centered signal transduction pathways. The aim of this study was to clarify the biological effects of space radiations, microgravity and a space environment on the gene and protein expression of p53-dependent regulated genes. Space experiments were performed with two human cultured lymphoblastoid cell lines: one cells line (TSCE5) bears a wild-type p53 gene status, and another cells line (WTK1) bears a mutated p53 gene status. Un-der one gravity or microgravity condition, the cells were grown in the cell biology experimental facility (CBEF) of the International Space Station (ISS) for 8 days without experiencing the stress during launching and landing because the cells were frozen during these periods. Ground control samples also were cultured for 8 days in the CBEF on the ground during the same periods as space flight. Gene and protein expression was analyzed by using DNA chip (a 44k whole human genome microarray, Agilent Technologies Inc.) and protein chip (PanoramaTM Ab MicroArray, Sigma-Aldrich Co.), respectively. In addition, we analyzed the gene expression in cultured cells after space flight during 133 days with frozen condition. We report the results and discussion from the viewpoint of the functions of the up-regulated and down-regulated genes after an exposure to space radiations and/or microgravity. The initial goal of this space experiment was completely achieved. It is expected that data from this type of work will be helpful in designing physical protection from the deleterious effects of space radiations during long term stays in space.
Ota, Satoshi; Taimatsu, Kiyohito; Yanagi, Kanoko; Namiki, Tomohiro; Ohga, Rie; Higashijima, Shin-Ichi; Kawahara, Atsuo
2016-10-11
The CRISPR/Cas9 complex, which is composed of a guide RNA (gRNA) and the Cas9 nuclease, is useful for carrying out genome modifications in various organisms. Recently, the CRISPR/Cas9-mediated locus-specific integration of a reporter, which contains the Mbait sequence targeted using Mbait-gRNA, the hsp70 promoter and the eGFP gene, has allowed the visualization of the target gene expression. However, it has not been ascertained whether the reporter integrations at both targeted alleles cause loss-of-function phenotypes in zebrafish. In this study, we have inserted the Mbait-hs-eGFP reporter into the pax2a gene because the disruption of pax2a causes the loss of the midbrain-hindbrain boundary (MHB) in zebrafish. In the heterozygous Tg[pax2a-hs:eGFP] embryos, MHB formed normally and the eGFP expression recapitulated the endogenous pax2a expression, including the MHB. We observed the loss of the MHB in homozygous Tg[pax2a-hs:eGFP] embryos. Furthermore, we succeeded in integrating the Mbait-hs-eGFP reporter into an uncharacterized gene epdr1. The eGFP expression in heterozygous Tg[epdr1-hs:eGFP] embryos overlapped the epdr1 expression, whereas the distribution of eGFP-positive cells was disorganized in the MHB of homozygous Tg[epdr1-hs:eGFP] embryos. We propose that the locus-specific integration of the Mbait-hs-eGFP reporter is a powerful method to investigate both gene expression profiles and loss-of-function phenotypes.
Ota, Satoshi; Taimatsu, Kiyohito; Yanagi, Kanoko; Namiki, Tomohiro; Ohga, Rie; Higashijima, Shin-ichi; Kawahara, Atsuo
2016-01-01
The CRISPR/Cas9 complex, which is composed of a guide RNA (gRNA) and the Cas9 nuclease, is useful for carrying out genome modifications in various organisms. Recently, the CRISPR/Cas9-mediated locus-specific integration of a reporter, which contains the Mbait sequence targeted using Mbait-gRNA, the hsp70 promoter and the eGFP gene, has allowed the visualization of the target gene expression. However, it has not been ascertained whether the reporter integrations at both targeted alleles cause loss-of-function phenotypes in zebrafish. In this study, we have inserted the Mbait-hs-eGFP reporter into the pax2a gene because the disruption of pax2a causes the loss of the midbrain-hindbrain boundary (MHB) in zebrafish. In the heterozygous Tg[pax2a-hs:eGFP] embryos, MHB formed normally and the eGFP expression recapitulated the endogenous pax2a expression, including the MHB. We observed the loss of the MHB in homozygous Tg[pax2a-hs:eGFP] embryos. Furthermore, we succeeded in integrating the Mbait-hs-eGFP reporter into an uncharacterized gene epdr1. The eGFP expression in heterozygous Tg[epdr1-hs:eGFP] embryos overlapped the epdr1 expression, whereas the distribution of eGFP-positive cells was disorganized in the MHB of homozygous Tg[epdr1-hs:eGFP] embryos. We propose that the locus-specific integration of the Mbait-hs-eGFP reporter is a powerful method to investigate both gene expression profiles and loss-of-function phenotypes. PMID:27725766
Nadeem, Amina; Mumtaz, Sadaf; Naveed, Abdul Khaliq; Aslam, Muhammad; Siddiqui, Arif; Lodhi, Ghulam Mustafa; Ahmad, Tausif
2015-05-15
Inflammation plays a significant role in the etiology of type 2 diabetes mellitus (T2DM). The rise in the pro-inflammatory cytokines is the essential step in glucotoxicity and lipotoxicity induced mitochondrial injury, oxidative stress and beta cell apoptosis in T2DM. Among the recognized markers are interleukin (IL)-6, IL-1, IL-10, IL-18, tissue necrosis factor-alpha (TNF-α), C-reactive protein, resistin, adiponectin, tissue plasminogen activator, fibrinogen and heptoglobins. Diabetes mellitus has firm genetic and very strong environmental influence; exhibiting a polygenic mode of inheritance. Many single nucleotide polymorphisms (SNPs) in various genes including those of pro and anti-inflammatory cytokines have been reported as a risk for T2DM. Not all the SNPs have been confirmed by unifying results in different studies and wide variations have been reported in various ethnic groups. The inter-ethnic variations can be explained by the fact that gene expression may be regulated by gene-gene, gene-environment and gene-nutrient interactions. This review highlights the impact of these interactions on determining the role of single nucleotide polymorphism of IL-6, TNF-α, resistin and adiponectin in pathogenesis of T2DM.
Bar-Shir, Amnon; Liu, Guanshu; Greenberg, Marc M; Bulte, Jeff W M; Gilad, Assaf A
2013-01-01
In experiments involving transgenic animals or animals treated with transgenic cells, it is important to have a method to monitor the expression of the relevant genes longitudinally and noninvasively. An MRI-based reporter gene enables monitoring of gene expression in the deep tissues of living subjects. This information can be co-registered with detailed high-resolution anatomical and functional information. We describe here the synthesis of the reporter probe, 5-methyl-5,6-dihydrothymidine (5-MDHT), which can be used for imaging of the herpes simplex virus type 1 thymidine kinase (HSV1-tk) reporter gene expression in rodents by MRI. The protocol also includes data acquisition and data processing routines customized for chemical exchange saturation transfer (CEST) contrast mechanisms. The dihydropyrimidine 5-MDHT is synthesized through a catalytic hydrogenation of the 5,6-double bond of thymidine to yield 5,6-dihydrothymidine, which is methylated on the C-5 position of the resulting saturated pyrimidine ring. The synthesis of 5-MDHT can be completed within 5 d, and the compound is stable for more than 1 year. PMID:24177294
Implantation of Vascular Grafts Lined with Genetically Modified Endothelial Cells
NASA Astrophysics Data System (ADS)
Wilson, James M.; Birinyi, Louis K.; Salomon, Robert N.; Libby, Peter; Callow, Allan D.; Mulligan, Richard C.
1989-06-01
The possibility of using the vascular endothelial cell as a target for gene replacement therapy was explored. Recombinant retroviruses were used to transduce the lacZ gene into endothelial cells harvested from mongrel dogs. Prosthetic vascular grafts seeded with the genetically modified cells were implanted as carotid interposition grafts into the dogs from which the original cells were harvested. Analysis of the graft 5 weeks after implantation revealed genetically modified endothelial cells lining the luminal surface of the graft. This technology could be used in the treatment of atherosclerosis disease and the design of new drug delivery systems.
Ju, Yawen; Li, Jie; Xie, Chao; Ritchlin, Christopher T; Xing, Lianping; Hilton, Matthew J; Schwarz, Edward M
2013-09-01
The troponin complex, which consists of three regulatory proteins (troponin C, troponin I, and troponin T), is known to regulate muscle contraction in skeletal and cardiac muscle, but its role in smooth muscle remains controversial. Troponin T3 (TnnT3) is a fast skeletal muscle troponin believed to be expressed only in skeletal muscle cells. To determine the in vivo function and tissue-specific expression of Tnnt3, we obtained the heterozygous Tnnt3+/flox/lacZ mice from Knockout Mouse Project (KOMP) Repository. Tnnt3(lacZ/+) mice are smaller than their WT littermates throughout development but do not display any gross phenotypes. Tnnt3(lacZ/lacZ) embryos are smaller than heterozygotes and die shortly after birth. Histology revealed hemorrhagic tissue in Tnnt3(lacZ/lacZ) liver and kidney, which was not present in Tnnt3(lacZ/+) or WT, but no other gross tissue abnormalities. X-gal staining for Tnnt3 promoter-driven lacZ transgene expression revealed positive staining in skeletal muscle and diaphragm and smooth muscle cells located in the aorta, bladder, and bronchus. Collectively, these findings suggest that troponins are expressed in smooth muscle and are required for normal growth and breathing for postnatal survival. Moreover, future studies with this mouse model can explore TnnT3 function in adult muscle function using the conditional-inducible gene deletion approach Copyright © 2013 Wiley Periodicals, Inc.
Kram, Karin E; Hovel-Miner, Galadriel A; Tomich, Mladen; Figurski, David H
2008-06-01
The tad (tight adherence) locus of Aggregatibacter actinomycetemcomitans includes genes for the biogenesis of Flp pili, which are necessary for bacterial adhesion to surfaces, biofilm formation, and pathogenesis. Although studies have elucidated the functions of some of the Tad proteins, little is known about the regulation of the tad locus in A. actinomycetemcomitans. A promoter upstream of the tad locus was previously identified and shown to function in Escherichia coli. Using a specially constructed reporter plasmid, we show here that this promoter (tadp) functions in A. actinomycetemcomitans. To study expression of the pilin gene (flp-1) relative to that of tad secretion complex genes, we used Northern hybridization analysis and a lacZ reporter assay. We identified three terminators, two of which (T1 and T2) can explain flp-1 mRNA abundance, while the third (T3) is at the end of the locus. T1 and T3 have the appearance and behavior of intrinsic terminators, while T2 has a different structure and is inhibited by bicyclomycin, indicating that T2 is probably Rho dependent. To help achieve the appropriate stoichiometry of the Tad proteins, we show that a transcriptional-termination cascade is important to the proper expression of the tad genes. These data indicate a previously unreported mechanism of regulation in A. actinomycetemcomitans and lead to a more complete understanding of its Flp pilus biogenesis.
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
GenePRIMP: A Gene Prediction Improvement Pipeline For Prokaryotic Genomes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kyrpides, Nikos C.; Ivanova, Natalia N.; Pati, Amrita
2010-07-08
GenePRIMP (Gene Prediction Improvement Pipeline, Http://geneprimp.jgi-psf.org), a computational process that performs evidence-based evaluation of gene models in prokaryotic genomes and reports anomalies including inconsistent start sites, missing genes, and split genes. We show that manual curation of gene models using the anomaly reports generated by GenePRIMP improves their quality and demonstrate the applicability of GenePRIMP in improving finishing quality and comparing different genome sequencing and annotation technologies. Keywords in context: Gene model, Quality Control, Translation start sites, Automatic correction. Hardware requirements; PC, MAC; Operating System: UNIX/LINUX; Compiler/Version: Perl 5.8.5 or higher; Special requirements: NCBI Blast and nr installation; File Types:more » Source Code, Executable module(s), Sample problem input data; installation instructions other; programmer documentation. Location/transmission: http://geneprimp.jgi-psf.org/gp.tar.gz« less
2015-01-01
Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein–protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein–protein interactions within whole animals. PMID:25265085
Pandey, Naresh; Nobles, Christopher L; Zechiedrich, Lynn; Maresso, Anthony W; Silberg, Jonathan J
2015-05-15
Gene fission can convert monomeric proteins into two-piece catalysts, reporters, and transcription factors for systems and synthetic biology. However, some proteins can be challenging to fragment without disrupting function, such as near-infrared fluorescent protein (IFP). We describe a directed evolution strategy that can overcome this challenge by randomly fragmenting proteins and concomitantly fusing the protein fragments to pairs of proteins or peptides that associate. We used this method to create libraries that express fragmented IFP as fusions to a pair of associating peptides (IAAL-E3 and IAAL-K3) and proteins (CheA and CheY) and screened for fragmented IFP with detectable near-infrared fluorescence. Thirteen novel fragmented IFPs were identified, all of which arose from backbone fission proximal to the interdomain linker. Either the IAAL-E3 and IAAL-K3 peptides or CheA and CheY proteins could assist with IFP fragment complementation, although the IAAL-E3 and IAAL-K3 peptides consistently yielded higher fluorescence. These results demonstrate how random gene fission can be coupled to rational gene fusion to create libraries enriched in fragmented proteins with AND gate logic that is dependent upon a protein-protein interaction, and they suggest that these near-infrared fluorescent protein fragments will be suitable as reporters for pairs of promoters and protein-protein interactions within whole animals.
McCann, Matthew R.; Tamplin, Owen J.; Rossant, Janet; Séguin, Cheryle A.
2012-01-01
SUMMARY Back pain related to intervertebral disc degeneration is the most common musculoskeletal problem, with a lifetime prevalence of 82%. The lack of effective treatment for this widespread problem is directly related to our limited understanding of disc development, maintenance and degeneration. The aim of this study was to determine the developmental origins of nucleus pulposus cells within the intervertebral disc using a novel notochord-specific Cre mouse. To trace the fate of notochordal cells within the intervertebral disc, we derived a notochord-specific Cre mouse line by targeting the homeobox gene Noto. Expression of this gene is restricted to the node and the posterior notochord during gastrulation [embryonic day 7.5 (E7.5)-E12.5]. The Noto-cre mice were crossed with a conditional lacZ reporter for visualization of notochord fate in whole-mount embryos. We performed lineage-tracing experiments to examine the contribution of the notochord to spinal development from E12.5 through to skeletally mature mice (9 months). Fate mapping studies demonstrated that, following elongation and formation of the primitive axial skeleton, the notochord gives rise to the nucleus pulposus in fully formed intervertebral discs. Cellular localization of β-galactosidase (encoded by lacZ) and cytokeratin-8 demonstrated that both notochordal cells and chondrocyte-like nucleus pulposus cells are derived from the embryonic notochord. These studies establish conclusively that notochordal cells act as embryonic precursors to all cells found within the nucleus pulposus of the mature intervertebral disc. This suggests that notochordal cells might serve as tissue-specific progenitor cells within the disc and establishes the Noto-cre mouse as a unique tool to interrogate the contribution of notochordal cells to both intervertebral disc development and disc degeneration. PMID:22028328
McCann, Matthew R; Tamplin, Owen J; Rossant, Janet; Séguin, Cheryle A
2012-01-01
Back pain related to intervertebral disc degeneration is the most common musculoskeletal problem, with a lifetime prevalence of 82%. The lack of effective treatment for this widespread problem is directly related to our limited understanding of disc development, maintenance and degeneration. The aim of this study was to determine the developmental origins of nucleus pulposus cells within the intervertebral disc using a novel notochord-specific Cre mouse. To trace the fate of notochordal cells within the intervertebral disc, we derived a notochord-specific Cre mouse line by targeting the homeobox gene Noto. Expression of this gene is restricted to the node and the posterior notochord during gastrulation [embryonic day 7.5 (E7.5)-E12.5]. The Noto-cre mice were crossed with a conditional lacZ reporter for visualization of notochord fate in whole-mount embryos. We performed lineage-tracing experiments to examine the contribution of the notochord to spinal development from E12.5 through to skeletally mature mice (9 months). Fate mapping studies demonstrated that, following elongation and formation of the primitive axial skeleton, the notochord gives rise to the nucleus pulposus in fully formed intervertebral discs. Cellular localization of β-galactosidase (encoded by lacZ) and cytokeratin-8 demonstrated that both notochordal cells and chondrocyte-like nucleus pulposus cells are derived from the embryonic notochord. These studies establish conclusively that notochordal cells act as embryonic precursors to all cells found within the nucleus pulposus of the mature intervertebral disc. This suggests that notochordal cells might serve as tissue-specific progenitor cells within the disc and establishes the Noto-cre mouse as a unique tool to interrogate the contribution of notochordal cells to both intervertebral disc development and disc degeneration.
Beck, Heather J.; Fleming, Ian M. C.
2016-01-01
Analysis of the Escherichia coli transcriptome identified a unique subset of messenger RNAs (mRNAs) that contain a conventional untranslated leader and Shine-Dalgarno (SD) sequence upstream of the gene’s start codon while also containing an AUG triplet at the mRNA’s 5’- terminus (5’-uAUG). Fusion of the coding sequence specified by the 5’-terminal putative AUG start codon to a lacZ reporter gene, as well as primer extension inhibition assays, reveal that the majority of the 5’-terminal upstream open reading frames (5’-uORFs) tested support some level of lacZ translation, indicating that these mRNAs can function both as leaderless and canonical SD-leadered mRNAs. Although some of the uORFs were expressed at low levels, others were expressed at levels close to that of the respective downstream genes and as high as the naturally leaderless cI mRNA of bacteriophage λ. These 5’-terminal uORFs potentially encode peptides of varying lengths, but their functions, if any, are unknown. In an effort to determine whether expression from the 5’-terminal uORFs impact expression of the immediately downstream cistron, we examined expression from the downstream coding sequence after mutations were introduced that inhibit efficient 5’-uORF translation. These mutations were found to affect expression from the downstream cistrons to varying degrees, suggesting that some 5’-uORFs may play roles in downstream regulation. Since the 5’-uAUGs found on these conventionally leadered mRNAs can function to bind ribosomes and initiate translation, this indicates that canonical mRNAs containing 5’-uAUGs should be examined for their potential to function also as leaderless mRNAs. PMID:27467758
Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.
Stone, D E; Craig, E A
1990-01-01
To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281
DOE Office of Scientific and Technical Information (OSTI.GOV)
Marton, L.
1994-12-31
This report describes progress aimed at constructing gene-transfer technology for Nicotiana plumbaginifolia. Most actual effort as described herein has so far been directed at exploring new perspectives and limitations in Agrobacterium mediated gene transfer. Accomplishments are described using a core homologous gene targeting vector.
2013-01-01
Background Streptococcus infantarius subsp. infantarius (Sii) belongs to the Streptococcus bovis/Streptococcus equinus complex associated with several human and animal infections. Sii is a predominant bacterium in spontaneously fermented milk products in Africa. The genome sequence of Sii strain CJ18 was compared with that of other Streptococcus species to identify dairy adaptations including genome decay such as in Streptococcus thermophilus, traits for its competitiveness in spontaneous milk fermentation and to assess potential health risks for consumers. Results The genome of Sii CJ18 harbors several unique regions in comparison to Sii ATCC BAA-102T, among others an enlarged exo- and capsular polysaccharide operon; Streptococcus thermophilus-associated genes; a region containing metabolic and hypothetical genes mostly unique to CJ18 and the dairy isolate Streptococcus gallolyticus subsp. macedonicus; and a second oligopeptide transport operon. Dairy adaptations in CJ18 are reflected by a high percentage of pseudogenes (4.9%) representing genome decay which includes the inactivation of the lactose phosphotransferase system (lacIIABC) by multiple transposases integration. The presence of lacS and lacZ genes is the major dairy adaptation affecting lactose metabolism pathways also due to the disruption of lacIIABC. We constructed mutant strains of lacS, lacZ and lacIIABC and analyzed the resulting strains of CJ18 to confirm the redirection of lactose metabolism via LacS and LacZ. Natural competence genes are conserved in both Sii strains, but CJ18 contains a lower number of CRISPR spacers which indicates a reduced defense capability against alien DNA. No classical streptococcal virulence factors were detected in both Sii strains apart from those involved in adhesion which should be considered niche factors. Sii-specific virulence factors are not described. Several Sii-specific regions encoding uncharacterized proteins provide new leads for virulence analyses and
Rubino, Elisa; Vacca, Alessandro; Gallone, Salvatore; Govone, Flora; Zucca, Milena; Gai, Annalisa; Ferrero, Patrizia; Fenoglio, Pierpaola; Giordana, Maria Teresa; Rainero, Innocenzo
2017-11-01
Bipolar disorder is a chronic psychiatric illness characterised by fluctuation in mood state, with a relapsing and remitting course. Frontotemporal dementia (FTD) is a clinically and genetically heterogeneous syndrome, with the most frequent phenotype being behavioural variant frontotemporal dementia (bvFTD). Here, we report the case of an Italian male presenting with late-onset bipolar disorder that developed into bvFTD over time, carrying a mutation in the GRN gene. Interestingly, the patient carried the c.1639 C > T variant in the GRN gene, resulting in a R547C substitution. Our case report further corroborates the notion that, in addition to FTD, progranulin may be involved in the neurobiology of bipolar disorder type 1, and suggests to screen patients with late-onset bipolar disorder for GRN mutations.
The Molecular Basis of the Response to Radiation
1999-07-01
S. cerevisiae and S. pombe ). After PCR amplification of human cDNA libraries as described below, PCR products are analyzed on 4% NuSieve agarose...media lacking uracil as well as counterselected against on media containing uracil and 0.1% 5-fluoroorotic acid (5FOA). Induction of the LacZ gene...evolutionarily distant species (S. cerevisiae andS. pombe ) to develop degenerate PCR based primers. For example, a fission yeast homolog of RAD9 named rhp9 was
DOE Office of Scientific and Technical Information (OSTI.GOV)
Long, Alexandra S., E-mail: alexandra.long@hc-sc.gc.ca; Mechanistic Studies Division, Environmental Health Science and Research Bureau, Health Canada, Ottawa, ON; Lemieux, Christine L.
Test batteries to screen chemicals for mutagenic hazard include several endpoints regarded as effective for detecting genotoxic carcinogens. Traditional in vivo methods primarily examine clastogenic endpoints in haematopoietic tissues. Although this approach is effective for identifying systemically distributed clastogens, some mutagens may not induce clastogenic effects; moreover, genotoxic effects may be restricted to the site of contact and/or related tissues. An OECD test guideline for transgenic rodent (TGR) gene mutation assays was released in 2011, and the TGR assays permit assessment of mutagenicity in any tissue. This study assessed the responses of two genotoxicity endpoints following sub-chronic oral exposures ofmore » male Muta™Mouse to 9 carcinogenic polycyclic aromatic hydrocarbons (PAHs). Clastogenicity was assessed via induction of micronuclei in peripheral blood, and mutagenicity via induction of lacZ transgene mutations in bone marrow, glandular stomach, small intestine, liver, and lung. Additionally, the presence of bulky PAH-DNA adducts was examined. Five of the 9 PAHs elicited positive results across all endpoints in at least one tissue, and no PAHs were negative or equivocal across all endpoints. All PAHs were positive for lacZ mutations in at least one tissue (sensitivity = 100%), and for 8 PAHs, one or more initial sites of chemical contact (i.e., glandular stomach, liver, small intestine) yielded a greater response than bone marrow. Five PAHs were positive in the micronucleus assay (sensitivity = 56%). Furthermore, all PAHs produced DNA adducts in at least one tissue. The results demonstrate the utility of the TGR assay for mutagenicity assessment, especially for compounds that may not be systemically distributed. - Highlights: • The Muta™Mouse is a reliable tool for in vivo mutagenicity assessment of PAHs. • All 9 PAHs induced lacZ transgene mutations in small intestine. • Only 5 of 9 PAHs induced lacZ mutations and micronuclei
Embryo-specific expression of a visual reporter gene as a selection system for citrus transformation
Zambon, Flavia T.; Erpen, Lígia; Soriano, Leonardo; Grosser, Jude
2018-01-01
The embryo-specific Dc3 gene promoter driving the VvMybA1 anthocyanin regulatory gene was used to develop a visual selection system for the genetic transformation of citrus. Agrobacterium-mediated transformation of cell suspension cultures resulted in the production of purple transgenic somatic embryos that could be easily separated from the green non-transgenic embryos. The somatic embryos produced phenotypically normal plants devoid of any visual purple coloration. These results were also confirmed using protoplast transformation. There was minimal gene expression in unstressed one-year-old transgenic lines. Cold and drought stress did not have any effect on gene expression, while exogenous ABA and NaCl application resulted in a minor change in gene expression in several transgenic lines. When gas exchange was measured in intact leaves, the transgenic lines were similar to controls under the same environment. Our results provide conclusive evidence for the utilization of a plant-derived, embryo-specific visual reporter system for the genetic transformation of citrus. Such a system could aid in the development of an all-plant, consumer-friendly GM citrus tree. PMID:29293649
Kokura, Kenji; Kuromi, Yasushi; Endo, Takeshi; Anzai, Naohiko; Kazuki, Yasuhiro; Oshimura, Mitsuo; Ohbayashi, Tetsuya
2016-10-01
Kidney injury molecule-1 (Kim-1) has been validated as a urinary biomarker for acute and chronic renal damage. The expression of Kim-1 mRNA is also activated by acute kidney injury induced by cisplatin in rodents and humans. To date, the measurement of Kim-1 expression has not fully allowed the detection of in vitro cisplatin nephrotoxicity in immortalized culture cells, such as human kidney-2 cells and immortalized proximal tubular epithelial cells. We measured the augmentation of Kim-1 mRNA expression after the addition of cisplatin using immortalized S3 cells established from the kidneys of transgenic mice harboring temperature-sensitive large T antigen from Simian virus 40. A mouse Kim-1 gene luciferase reporter in conjunction with an Hprt gene reporter detected cisplatin-induced nephrotoxicity in S3 cells. These two reporter genes were contained in a mouse artificial chromosome, and two luciferases that emitted different wavelengths were used to monitor the respective gene expression. However, the Kim-1 reporter gene failed to respond to cisplatin in A9 fibroblast cells that contained the same reporter mouse artificial chromosome, suggesting cell type-specificity for activation of the reporter. We report the feasibility of measuring in vitro cisplatin nephrotoxicity using a Kim-1 reporter gene in S3 cells. © 2016 The Authors. The Journal of Gene Medicine Published by John Wiley & Sons, Ltd.
NASA Astrophysics Data System (ADS)
Märk, Julia; Ruschke, Karen; Dortay, Hakan; Schreiber, Isabelle; Sass, Andrea; Qazi, Taimoor; Pumberger, Matthias; Laufer, Jan
2014-03-01
The capability to image stem cells in vivo in small animal models over extended periods of time is important to furthering our understanding of the processes involved in tissue regeneration. Photoacoustic imaging is suited to this application as it can provide high resolution (tens of microns) absorption-based images of superficial tissues (cm depths). However, stem cells are rare, highly migratory, and can divide into more specialised cells. Genetic labelling strategies are therefore advantageous for their visualisation. In this study, methods for the transfection and viral transduction of mesenchymal stem cells with reporter genes for the co-expression of tyrosinase and a fluorescent protein (mCherry). Initial photoacoustic imaging experiments of tyrosinase expressing cells in small animal models of tissue regeneration were also conducted. Lentiviral transduction methods were shown to result in stable expression of tyrosinase and mCherry in mesenchymal stem cells. The results suggest that photoacoustic imaging using reporter genes is suitable for the study of stem cell driven tissue regeneration in small animals.
Identification of a novel CLRN1 gene mutation in Usher syndrome type 3: two case reports.
Yoshimura, Hidekane; Oshikawa, Chie; Nakayama, Jun; Moteki, Hideaki; Usami, Shin-Ichi
2015-05-01
This study examines the CLRN1 gene mutation analysis in Japanese patients who were diagnosed with Usher syndrome type 3 (USH3) on the basis of clinical findings. Genetic analysis using massively parallel DNA sequencing (MPS) was conducted to search for 9 causative USH genes in 2 USH3 patients. We identified the novel pathogenic mutation in the CLRN1 gene in 2 patients. The missense mutation was confirmed by functional prediction software and segregation analysis. Both patients were diagnosed as having USH3 caused by the CLRN1 gene mutation. This is the first report of USH3 with a CLRN1 gene mutation in Asian populations. Validating the presence of clinical findings is imperative for properly differentiating among USH subtypes. In addition, mutation screening using MPS enables the identification of causative mutations in USH. The clinical diagnosis of this phenotypically variable disease can then be confirmed. © The Author(s) 2015.
NASA Astrophysics Data System (ADS)
Lemaire-Vieille, Catherine; Schulze, Tobias; Podevin-Dimster, Valérie; Follet, Jérome; Bailly, Yannick; Blanquet-Grossard, Françoise; Decavel, Jean-Pierre; Heinen, Ernst; Cesbron, Jean-Yves
2000-05-01
The expression of the cellular form of the prion protein (PrPc) gene is required for prion replication and neuroinvasion in transmissible spongiform encephalopathies. The identification of the cell types expressing PrPc is necessary to understanding how the agent replicates and spreads from peripheral sites to the central nervous system. To determine the nature of the cell types expressing PrPc, a green fluorescent protein reporter gene was expressed in transgenic mice under the control of 6.9 kb of the bovine PrP gene regulatory sequences. It was shown that the bovine PrP gene is expressed as two populations of mRNA differing by alternative splicing of one 115-bp 5' untranslated exon in 17 different bovine tissues. The analysis of transgenic mice showed reporter gene expression in some cells that have been identified as expressing PrP, such as cerebellar Purkinje cells, lymphocytes, and keratinocytes. In addition, expression of green fluorescent protein was observed in the plexus of the enteric nervous system and in a restricted subset of cells not yet clearly identified as expressing PrP: the epithelial cells of the thymic medullary and the endothelial cells of both the mucosal capillaries of the intestine and the renal capillaries. These data provide valuable information on the distribution of PrPc at the cellular level and argue for roles of the epithelial and endothelial cells in the spread of infection from the periphery to the brain. Moreover, the transgenic mice described in this paper provide a model that will allow for the study of the transcriptional activity of the PrP gene promoter in response to scrapie infection.
Heart valve cardiomyocytes of mouse embryos express the serotonin transporter SERT
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pavone, Luigi Michele; Department of Biochemistry and Medical Biotechnologies, University of Naples Federico II, Naples; Spina, Anna
2008-12-12
Multiple evidence demonstrate a role for serotonin and its transporter SERT in heart valve development and disease. By utilizing a Cre/loxP system driven by SERT gene expression, we recently demonstrated a regionally restricted distribution of SERT-expressing cells in developing mouse heart. In order to characterize the cell types exhibiting SERT expression within the mouse heart valves at early developmental stages, in this study we performed immunohistochemistry for Islet1 (Isl1) and connexin-43 (Cx-43) on heart sections from SERT{sup Cre/+};ROSA26R embryos previously stained with X-gal. We observed the co-localization of LacZ staining with Isl1 labelling in the outflow tract, the right ventriclemore » and the conal region of E11.5 mouse heart. Cx-43 labelled cells co-localized with LacZ stained cells in the forming atrioventricular valves. These results demonstrate the cardiomyocyte phenotype of SERT-expressing cells in heart valves of the developing mouse heart, thus suggesting an active role of SERT in early heart valve development.« less
McLean, K M; Gutman, P D; Minton, K W; Clark, E P
1992-06-01
Cells cope with radiation damage through several mechanisms: (1) increased DNA repair activity, (2) scavenging and inactivation of radiation-induced radical molecules, and (3) entry into a G0-like quiescent state. We have investigated a chromosomal rearrangement to elucidate further the molecular and genetic mechanisms underlying these phenomena. A mutant of Escherichia coli JM83 (phi 80dlacZ delta M15) was isolated that demonstrated significantly increased resistance to both ionizing and ultraviolet radiation. Surviving fractions of mutant and wild-type cells were measured following exposure to standardized doses of radiation. Increased radioresistance was directly related to a chromosomal alteration near the bacteriophage phi 80 attachment site (attB), as initially detected by the LacZ- phenotype of the isolate. Southern hybridization of chromosomal DNA from the mutant and wild-type E. coli JM83 strains indicated that a deletion had occurred. We propose that the deletion near the attB locus produces the radioresistant phenotype of the E. coli JM83 LacZ- mutant, perhaps through the alteration or inactivation of a gene or its controlling element(s).
Verkerke-van Wijk, I; Fukuzawa, M; Devreotes, P N; Schaap, P
2001-06-01
cAMP oscillations, generated by adenylyl cyclase A (ACA), coordinate cell aggregation in Dictyostelium and have also been implicated in organizer function during multicellular development. We used a gene fusion of the ACA promoter with a labile lacZ derivative to study the expression pattern of ACA. During aggregation, most cells expressed ACA, but thereafter expression was lost in all cells except those of the anterior tip. Before aggregation, ACA transcription was strongly upregulated by nanomolar cAMP pulses. Postaggregative transcription was sustained by nanomolar cAMP pulses, but downregulated by a continuous micromolar cAMP stimulus and by the stalk-cell-inducing factor DIF. Earlier work showed that the transcription factor StatA displays tip-specific nuclear translocation and directs tip-specific expression of the nuclear protein CudA, which is essential for culmination. Both StatA and CudA were present in nuclei throughout the entire slug in an aca null mutant that expresses ACA from the constitutive actin15 promoter. This suggests that the tip-specific expression of ACA directs tip-specific nuclear translocation of StatA and tip-specific expression of CudA. Copyright 2001 Academic Press.
[Hyperuricemia and gene mutations: a case report].
Tattoli, Fabio; Falconi, Daniela; De Prisco, Ornella; Maurizio, Gherzi; Marazzi, Federico; Marengo, Marita; Serra, Ilaria; Tamagnone, Michela; Cordero di Montezemolo, Luca; Pasini, Barbara; Formica, Marco
2017-06-01
Hyperuricemia is frequently found in nephrology. The case presented may be useful to clarify some pathogenetic aspects. It is a patient of 18 years, hyperuricaemic. Non-consanguineous parents, hyperuricemia in the paternal line, not neuropsychiatric disorders in the family. Delay in neuromotor acquisitions, average intellectual disabilities, anxiety disorder, obsessive-compulsive personality traits. Normal renal function and renal ultrasound. Evidence of hyperuricemia in 2015. Never gouty episodes and / or lithiasis, initiated allopurinol 100 mg on alternate days, with no side effects, urea in the control range, slightly below normal uricuria. Given the complex clinical, he carried out a genetic analysis of array-CGH. He showed a deletion on the short arm of chromosome 3 (3p12.3) and a duplication of the long arm of chromosome 1 (19q13-42). The deletion 3p12.3 (paternal inheritance), involves the ROBO2 gene. Duplication 19q13.42, (maternal inheritance), includes NLRP12, DPRX, ZNF331 genes. The ROBO2 gene with its mutation, is associated with vesicoureteral reflux. The NLRP12 gene encodes proteins called "Nalps", forming a subfamily of proteins "CATERPILLAR". Many "Nalps" as well as the "Nalps 12" have an N-terminal domain (DYP) with a purin. Since uric acid is a byproduct of purine metabolism, considered the familiarity, we believe that we can hypothesize that the mutations found. In particular those concerning the NLRP-12 gene, may have a role in the presence of hyperuricemia. We believe that in patients with hyperuricemia, associated with a particular impairment of neurological picture, it is likely that there is a subtended common genetic deficiency. Copyright by Società Italiana di Nefrologia SIN, Rome, Italy.
Madry, H; Kaul, G; Zurakowski, D; Vunjak-Novakovic, G; Cucchiarini, M
2013-04-16
Tissue engineering combined with gene therapy is a promising approach for promoting articular cartilage repair. Here, we tested the hypothesis that engineered cartilage with chondrocytes overexpressing a human insulin-like growth factor I (IGF-I) gene can enhance the repair of osteochondral defects, in a manner dependent on the duration of cultivation. Genetically modified chondrocytes were cultured on biodegradable polyglycolic acid scaffolds in dynamic flow rotating bioreactors for either 10 or 28 d. The resulting cartilaginous constructs were implanted into osteochondral defects in rabbit knee joints. After 28 weeks of in vivo implantation, immunoreactivity to ß-gal was detectable in the repair tissue of defects that received lacZ constructs. Engineered cartilaginous constructs based on IGF-I-overexpressing chondrocytes markedly improved osteochondral repair compared with control (lacZ) constructs. Moreover, IGF-I constructs cultivated for 28 d in vitro significantly promoted osteochondral repair vis-à-vis similar constructs cultivated for 10 d, leading to significantly decreased osteoarthritic changes in the cartilage adjacent to the defects. Hence, the combination of spatially defined overexpression of human IGF-I within a tissue-engineered construct and prolonged bioreactor cultivation resulted in most enhanced articular cartilage repair and reduction of osteoarthritic changes in the cartilage adjacent to the defect. Such genetically enhanced tissue engineering provides a versatile tool to evaluate potential therapeutic genes in vivo and to improve our comprehension of the development of the repair tissue within articular cartilage defects. Insights gained with additional exploration using this model may lead to more effective treatment options for acute cartilage defects.
Madry, Henning; Kaul, Gunter; Zurakowski, David; Vunjak-Novakovic, Gordana; Cucchiarini, Magali
2015-01-01
Tissue engineering combined with gene therapy is a promising approach for promoting articular cartilage repair. Here, we tested the hypothesis that engineered cartilage with chondrocytes over expressing a human insulin-like growth factor I (IGF-I) gene can enhance the repair of osteochondral defects, in a manner dependent on the duration of cultivation. Genetically modified chondrocytes were cultured on biodegradable polyglycolic acid scaffolds in dynamic flow rotating bioreactors for either 10 or 28 d. The resulting cartilaginous constructs were implanted into osteochondral defects in rabbit knee joints. After 28 weeks of in vivo implantation, immunoreactivity to ß-gal was detectable in the repair tissue of defects that received lacZ constructs. Engineered cartilaginous constructs based on IGF-I-over expressing chondrocytes markedly improved osteochondral repair compared with control (lacZ) constructs. Moreover, IGF-I constructs cultivated for 28 d in vitro significantly promoted osteochondral repair vis-à-vis similar constructs cultivated for 10 d, leading to significantly decreased osteoarthritic changes in the cartilage adjacent to the defects. Hence, the combination of spatially defined overexpression of human IGF-I within a tissue-engineered construct and prolonged bioreactor cultivation resulted in most enhanced articular cartilage repair and reduction of osteoarthritic changes in the cartilage adjacent to the defect. Such genetically enhanced tissue engineering provides a versatile tool to evaluate potential therapeutic genes in vivo and to improve our comprehension of the development of the repair tissue within articular cartilage defects. Insights gained with additional exploration using this model may lead to more effective treatment options for acute cartilage defects. PMID:23588785
Luciferase NanoLuc as a reporter for gene expression and protein levels in Saccharomyces cerevisiae.
Masser, Anna E; Kandasamy, Ganapathi; Kaimal, Jayasankar Mohanakrishnan; Andréasson, Claes
2016-05-01
Reporter proteins are essential tools in the study of biological processes and are employed to monitor changes in gene expression and protein levels. Luciferases are reporter proteins that enable rapid and highly sensitive detection with an outstanding dynamic range. Here we evaluated the usefulness of the 19 kDa luciferase NanoLuc (Nluc), derived from the deep sea shrimp Oplophorus gracilirostris, as a reporter protein in yeast. Cassettes with codon-optimized genes expressing yeast Nluc (yNluc) or its destabilized derivative yNlucPEST have been assembled in the context of the dominant drug resistance marker kanMX. The reporter proteins do not impair the growth of yeast cells and exhibit half-lives of 40 and 5 min, respectively. The commercial substrate Nano-Glo® is compatible with detection of yNluc bioluminescence in < 50 cells. Using the unstable yNlucPEST to report on the rapid and transient expression of a heat-shock promoter (PCYC1-HSE ), we found a close match between the intensity of the bioluminescent signal and mRNA levels during both induction and decay. We demonstrated that the bioluminescence of yNluc fused to the C-terminus of a temperature-sensitive protein reports on its protein levels. In conclusion, yNluc and yNlucPEST are valuable new reporter proteins suitable for experiments with yeast using standard commercial substrate. © 2016 The Authors. Yeast published by John Wiley & Sons Ltd. © 2016 The Authors. Yeast published by John Wiley & Sons Ltd.
Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S
1989-01-01
A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.
Han, J H; Yim, S W; Lim, C S; Park, C W; Kaang, B K
1999-05-01
We assessed the role of a non-inactivating K+ channel (aKv5.1) in the resting potential by overexpressing this channel by heat shock in the neurons. A reporter gene lacZ linked to a promoter region spanning from the -285 to the +88 base of the rat HSP70ib gene was induced 62.5-fold when this DNA construct was microinjected into the neurons of the marine mollusk Aplysia and treated with heat shock at 30 degrees C for 3 h. Using this efficient induction system, we induced the expression of aKv5.1 by heat shock in cultured, electrically silent neurons of Aplysia and examined its effect on the resting potential. The channel expression increased the resting potential by approximately 10 mV. This increase was specific to heat shock induction and abolished by treatment with TEA, a specific K+ channel blocker. These results provide the direct evidence that a low voltage-activated, non-inactivating K+ channel can contribute to the resting potential.
Kang, Joo Hyun; Chung, June-Key; Lee, Yong Jin; Kim, Kwang Il; Jeong, Jae Min; Lee, Dong Soo; Lee, Myung Chul
2006-10-01
Oestrogen receptors are ligand-dependent transcription factors whose activity is modulated either by oestrogens or by an alternative signalling pathway. Oestrogen receptors interact via a specific DNA-binding domain, the oestrogen responsive element (ERE), in the promoter region of sensitive genes. This binding leads to an initiation of gene expression and hormonal effects. To determine the transcriptional activity of the oestrogen receptor, we developed a molecular imaging system using sodium iodide symporter (NIS) as a reporter gene. The NIS reporter gene was placed under the control of an artificial ERE derived from pERE-TA-SEAP and named as pERE-NIS. pERE-NIS was transferred to MCF-7, human breast cancer cells, which highly expressed oestrogen receptor-alpha with lipofectamine. Stably expressing cells were generated by selection with G418 for 14 days. After treatment of 17beta-oestradiol and tamoxifen with serial doses, the (125)I uptake was measured for the determination of NIS expression. The inhibition of NIS activity was performed with 50 micromol x l(-1) potassium perchlorate. The MCF7/pERE-NIS treated with 17beta-oestradiol accumulated (125)I up to 70-80% higher than did non-treated cells. NIS expression was increased according to increasing doses of 17beta-oestradiol. MCF7/pERE-NIS treated with tamoxifen also accumulated (125)I up to 50% higher than did non-treated cells. Potassium perchlorate completely inhibited (125)I uptake. When MDA-MB231 cells, the oestrogen receptor-negative breast cancer cells, were transfected with pERE-NIS, (125)I uptake of MDA-MB-231/pERE-NIS did not increase. This pERE-NIS reporter system is sufficiently sensitive for monitoring transcriptional activity of the oestrogen receptor. Therefore, cis-enhancer reporter systems with ERE will be applicable to the development of a novel selective oestrogen receptor modulator with low toxicity and high efficacy.
Hennessy, Rosanna C; Christiansen, Line; Olsson, Stefan; Stougaard, Peter
2018-01-01
Fluorescence-based reporter systems are valuable tools for studying gene expression dynamics in living cells. Here we describe a dual-fluorescence reporter system carrying the red fluorescent marker mCherry and the blue fluorescent protein EBFP2 enabling the simultaneous analysis of two promoters in broad-host range autofluorescent Gram-negative bacteria. Copyright © 2017 Elsevier B.V. All rights reserved.
Wallace, Lindsay M; Moreo, Andrew; Clark, K Reed; Harper, Scott Q
2013-04-16
Gene therapy has historically focused on delivering protein-coding genes to target cells or tissues using a variety of vectors. In recent years, the field has expanded to include gene-silencing strategies involving delivery of noncoding inhibitory RNAs, such as short hairpin RNAs or microRNAs (miRNAs). Often called RNA interference (RNAi) triggers, these small inhibitory RNAs are difficult or impossible to visualize in living cells or tissues. To circumvent this detection problem and ensure efficient delivery in preclinical studies, vectors can be engineered to coexpress a fluorescent reporter gene to serve as a marker of transduction. In this study, we set out to optimize adeno-associated viral (AAV) vectors capable of delivering engineered miRNAs and green fluorescent protein (GFP) reporter genes to skeletal muscle. Although the more broadly utilized enhanced GFP (eGFP) gene derived from the jellyfish, Aequorea victoria was a conventional choice, we were concerned about some previous studies suggesting this protein was myotoxic. We thus opted to test vectors carrying the humanized Renilla reniformis-derived GFP (hrGFP) gene, which has not seen as extensive usage as eGFP but was purported to be a safer and less cytotoxic alternative. Employing AAV6 vector dosages typically used in preclinical gene transfer studies (3×10(10) -1 × 10(11) particles), we found that hrGFP caused dose-dependent myopathy when delivered to wild-type (wt) mouse muscle, whereas identical titers of AAV6 carrying eGFP were relatively benign. Dose de-escalation at or below 8 × 10(9) AAV particles effectively reduced or eliminated hrGFP-associated myotoxicity, but also had dampening effects on green fluorescence and miRNA-mediated gene silencing in whole muscles. We conclude that hrGFP is impractical for use as a transduction marker in preclinical, AAV-based RNA interference therapy studies where adult mouse muscle is the target organ. Moreover, our data support that eGFP is superior to hr
Wallace, Lindsay M; Moreo, Andrew; Clark, K Reed; Harper, Scott Q
2013-01-01
Gene therapy has historically focused on delivering protein-coding genes to target cells or tissues using a variety of vectors. In recent years, the field has expanded to include gene-silencing strategies involving delivery of noncoding inhibitory RNAs, such as short hairpin RNAs or microRNAs (miRNAs). Often called RNA interference (RNAi) triggers, these small inhibitory RNAs are difficult or impossible to visualize in living cells or tissues. To circumvent this detection problem and ensure efficient delivery in preclinical studies, vectors can be engineered to coexpress a fluorescent reporter gene to serve as a marker of transduction. In this study, we set out to optimize adeno-associated viral (AAV) vectors capable of delivering engineered miRNAs and green fluorescent protein (GFP) reporter genes to skeletal muscle. Although the more broadly utilized enhanced GFP (eGFP) gene derived from the jellyfish, Aequorea victoria was a conventional choice, we were concerned about some previous studies suggesting this protein was myotoxic. We thus opted to test vectors carrying the humanized Renilla reniformis-derived GFP (hrGFP) gene, which has not seen as extensive usage as eGFP but was purported to be a safer and less cytotoxic alternative. Employing AAV6 vector dosages typically used in preclinical gene transfer studies (3×1010 –1 × 1011 particles), we found that hrGFP caused dose-dependent myopathy when delivered to wild-type (wt) mouse muscle, whereas identical titers of AAV6 carrying eGFP were relatively benign. Dose de-escalation at or below 8 × 109 AAV particles effectively reduced or eliminated hrGFP-associated myotoxicity, but also had dampening effects on green fluorescence and miRNA-mediated gene silencing in whole muscles. We conclude that hrGFP is impractical for use as a transduction marker in preclinical, AAV-based RNA interference therapy studies where adult mouse muscle is the target organ. Moreover, our data support that eGFP is superior to hrGFP as
staggerer phenotype in retinoid-related orphan receptor α-deficient mice
Steinmayr, Markus; André, Elisabeth; Conquet, François; Rondi-Reig, Laure; Delhaye-Bouchaud, Nicole; Auclair, Nathalie; Daniel, Hervé; Crépel, Francis; Mariani, Jean; Sotelo, Constantino; Becker-André, Michael
1998-01-01
Retinoid-related orphan receptor α (RORα) is a member of the nuclear receptor superfamily. To study its physiological role we generated null-mutant mice by targeted insertion of a lacZ reporter gene encoding the enzyme β-galactosidase. In heterozygous RORα+/− mice we found β-galactosidase activity, indicative of RORα protein expression, confined to the central nervous system, skin and testis. In the central nervous system, the RORα gene is expressed in cerebellar Purkinje cells, the thalamus, the suprachiasmatic nuclei, and retinal ganglion cells. In skin, RORα is strongly expressed in the hair follicle, the epidermis, and the sebaceous gland. Finally, the peritubular cells of the testis and the epithelial cells of the epididymis also strongly express RORα. Recently, it was reported that the ataxic mouse mutant staggerer (sg/sg) is caused by a deletion in the RORα gene. The analysis of the cerebellar and the behavioral phenotype of homozygous RORα−/− mice proves identity to sg/sg mice. Although the absence of RORα causes dramatic developmental effects in the cerebellum, it has no apparent morphological effect on thalamus, hypothalamus, and retina. Similarly, testis and skin of RORα−/− mice display a normal phenotype. However, the pelage hair of both sg/sg and RORα−/− is significantly less dense and when shaved shows reluctance to regrow. PMID:9520475
Colbert, M C; Linney, E; LaMantia, A S
1993-01-01
We have assessed whether retinoic acid (RA) comes from local sources or is available widely to activate gene expression in embryos. We used an RA-responsive indicator cell line, L-C2A5, to localize RA sources. In these cells, an RA-sensitive promoter/lacZ reporter construct used previously by us to produce indicator transgenic mice is induced globally by RA in medium or locally by RA released at physiological concentrations (1 nM) from AG-1X2 resin beads. Furthermore, the cells are differentially responsive to the 9-cis and all-trans isomers of RA at low concentrations. Indicator transgenic mice with the same promoter/reporter construct were used to identify regions of RA-mediated gene activation. There are distinct domains of lacZ expression in the cervical and lumbar spinal cords of embryonic indicator mice. This pattern might reflect localized RA sources or restricted spatial and temporal expression of RA receptors, binding proteins, or other factors. To resolve this issue we compared the pattern of transgene activation in indicator cell monolayers cocultured with normal embryonic spinal cords with that in transgenic spinal cords. The explants induced reporter gene expression in L-C2A5 monolayers in a pattern identical to that in transgenic mice: alar regions of the cervical and lumbar cord were positive whereas those in the thoracic and sacral regions were not. We conclude that restricted sources of RA in the developing spinal cord mediate the local activation of RA-inducible genes. Thus, region-specific gene activation in embryos can be mediated by precisely localized sources of inductive molecules like RA. Images Fig. 1 Fig. 2 Fig. 3 PMID:8341670
Multimodality Imaging of Gene Transfer with a Receptor-Based Reporter Gene
Chen, Ron; Parry, Jesse J.; Akers, Walter J.; Berezin, Mikhail Y.; El Naqa, Issam M.; Achilefu, Samuel; Edwards, W. Barry; Rogers, Buck E.
2010-01-01
Gene therapy trials have traditionally used tumor and tissue biopsies for assessing the efficacy of gene transfer. Non-invasive imaging techniques offer a distinct advantage over tissue biopsies in that the magnitude and duration of gene transfer can be monitored repeatedly. Human somatostatin receptor subtype 2 (SSTR2) has been used for the nuclear imaging of gene transfer. To extend this concept, we have developed a somatostatin receptor–enhanced green fluorescent protein fusion construct (SSTR2-EGFP) for nuclear and fluorescent multimodality imaging. Methods An adenovirus containing SSTR2-EGFP (AdSSTR2-EGFP) was constructed and evaluated in vitro and in vivo. SCC-9 human squamous cell carcinoma cells were infected with AdEGFP, AdSSTR2, or AdSSTR2-EGFP for in vitro evaluation by saturation binding, internalization, and fluorescence spectroscopy assays. In vivo biodistribution and nano-SPECT imaging studies were conducted with mice bearing SCC-9 tumor xenografts directly injected with AdSSTR2-EGFP or AdSSTR2 to determine the tumor localization of 111In-diethylenetriaminepentaacetic acid (DTPA)-Tyr3-octreotate. Fluorescence imaging was conducted in vivo with mice receiving intratumoral injections of AdSSTR2, AdSSTR2-EGFP, or AdEGFP as well as ex vivo with tissues extracted from mice. Results The similarity between AdSSTR2-EGFP and wild-type AdSSTR2 was demonstrated in vitro by the saturation binding and internalization assays, and the fluorescence emission spectra of cells infected with AdSSTR2-EGFP was almost identical to the spectra of cells infected with wild-type AdEGFP. Biodistribution studies demonstrated that the tumor uptake of 111In-DTPA-Tyr3-octreotate was not significantly different (P > 0.05) when tumors (n = 5) were injected with AdSSTR2 or AdSSTR2-EGFP but was significantly greater than the uptake in control tumors. Fluorescence was observed in tumors injected with AdSSTR2-EGFP and AdEGFP in vivo and ex vivo but not in tumors injected with AdSSTR2
Sellars, Laura E; Bryant, Jack A; Sánchez-Romero, María-Antonia; Sánchez-Morán, Eugenio; Busby, Stephen J W; Lee, David J
2017-08-03
In bacteria, many transcription activator and repressor proteins regulate multiple transcription units that are often distally distributed on the bacterial genome. To investigate the subcellular location of DNA bound proteins in the folded bacterial nucleoid, fluorescent reporters have been developed which can be targeted to specific DNA operator sites. Such Fluorescent Reporter-Operator System (FROS) probes consist of a fluorescent protein fused to a DNA binding protein, which binds to an array of DNA operator sites located within the genome. Here we have developed a new FROS probe using the Escherichia coli MalI transcription factor, fused to mCherry fluorescent protein. We have used this in combination with a LacI repressor::GFP protein based FROS probe to assess the cellular location of commonly regulated transcription units that are distal on the Escherichia coli genome. We developed a new DNA binding fluorescent reporter, consisting of the Escherichia coli MalI protein fused to the mCherry fluorescent protein. This was used in combination with a Lac repressor:green fluorescent protein fusion to examine the spatial positioning and possible co-localisation of target genes, regulated by the Escherichia coli AraC protein. We report that induction of gene expression with arabinose does not result in co-localisation of AraC-regulated transcription units. However, measurable repositioning was observed when gene expression was induced at the AraC-regulated promoter controlling expression of the araFGH genes, located close to the DNA replication terminus on the chromosome. Moreover, in dividing cells, arabinose-induced expression at the araFGH locus enhanced chromosome segregation after replication. Regions of the chromosome regulated by AraC do not colocalise, but transcription events can induce movement of chromosome loci in bacteria and our observations suggest a role for gene expression in chromosome segregation.
Chen, Juhong; Alcaine, Samuel D; Jackson, Angelyca A; Rotello, Vincent M; Nugen, Sam R
2017-04-28
T7 bacteriophages (phages) have been genetically engineered to carry the lacZ operon, enabling the overexpression of beta-galactosidase (β-gal) during phage infection and allowing for the enhanced colorimetric detection of Escherichia coli (E. coli). Following the phage infection of E. coli, the enzymatic activity of the released β-gal was monitored using a colorimetric substrate. Compared with a control T7 phage, our T7 lacZ phage generated significantly higher levels of β-gal expression following phage infection, enabling a lower limit of detection for E. coli cells. Using this engineered T7 lacZ phage, we were able to detect E. coli cells at 10 CFU·mL -1 within 7 h. Furthermore, we demonstrated the potential for phage-based sensing of bacteria antibiotic resistance profiling using our T7 lacZ phage, and subsequent β-gal expression to detect antibiotic resistant profile of E. coli strains.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1991-12-31
This report details progress made in setting up a laboratory for optical microscopy of genes. The apparatus including a fluorescence microscope, a scanning optical microscope, various spectrometers, and supporting computers is described. Results in developing photon and exciton tips, and in preparing samples are presented. (GHH)
Gene-Environment Interactions in Cancer Epidemiology: A National Cancer Institute Think Tank Report
Hutter, Carolyn M.; Mechanic, Leah E.; Chatterjee, Nilanjan; Kraft, Peter; Gillander, Elizabeth M.
2014-01-01
Cancer risk is determined by a complex interplay of genetic and environmental factors. Genome-wide association studies (GWAS) have identified hundreds of common (minor allele frequency [MAF]>0.05) and less common (0.01
Reuther, Peter; Göpfert, Kristina; Dudek, Alexandra H.; Heiner, Monika; Herold, Susanne; Schwemmle, Martin
2015-01-01
Influenza A viruses (IAV) pose a constant threat to the human population and therefore a better understanding of their fundamental biology and identification of novel therapeutics is of upmost importance. Various reporter-encoding IAV were generated to achieve these goals, however, one recurring difficulty was the genetic instability especially of larger reporter genes. We employed the viral NS segment coding for the non-structural protein 1 (NS1) and nuclear export protein (NEP) for stable expression of diverse reporter proteins. This was achieved by converting the NS segment into a single open reading frame (ORF) coding for NS1, the respective reporter and NEP. To allow expression of individual proteins, the reporter genes were flanked by two porcine Teschovirus-1 2A peptide (PTV-1 2A)-coding sequences. The resulting viruses encoding luciferases, fluorescent proteins or a Cre recombinase are characterized by a high genetic stability in vitro and in mice and can be readily employed for antiviral compound screenings, visualization of infected cells or cells that survived acute infection. PMID:26068081
A reporter gene assay in a cultured rainbow trout cell line was used to determine the influence of temperature on the expression of an estrogen-responsive gene. Rainbow trout hepatoma cells (RTH 149) incubated at 11 or 18 degrees C were co-transfected with an estrogen-responsive ...
2010-01-01
Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158
Shalaby, Shahinaz Mahmood; Khater, Mostafa K; Mas Perucho, Aymara; Mohamed, Sara A; Helwa, Inas; Laknaur, Archana; Lebedyeva, Iryna; Liu, Yutao; Diamond, Michael P; Al-Hendy, Ayman A
2016-01-01
Uterine fibroid(s) (UF/UFs) are benign tumors commonly found in women of reproductive age. The long-term outcomes of myomectomies are often hampered by high rates of recurrence (up to 60%). Objective To study whether efficient transduction and subsequent elimination of fibroid tumor initiating stem cells during debulking of tumor cells will aid in completely eradicating the tumor as well as decreasing the likelihood of recurrence. Design We have developed a localized non-surgical adenovirus-based alternative for the treatment of UFs. Combining viral based gene delivery with nanotechnology provides an opportunity to develop more efficient targeted viral gene therapy. Magnetic nanoparticles (MNPs) complexed to adenovirus, in the presence of an external magnetic field, accelerate adenovirus transduction. Setting Research laboratory located in Georgia Regents University, an academic research institution. Patients N/A Interventions MNPs complexed to adenovirus (AD GFP) or (AD LacZ) were used to transfect differentiated human fibroid cells in vitro. Main Outcome Measures rate of transduction and tumor growth inhibition. Results We observed a significant increase in transduction efficiency among differentiated human fibroid cells at 2 different multiplicities of infection (MOI); 1 and 10 respectively, with MNPs as compared to adenovirus-alone. Human fibroid stem cells transfected with AD-LacZ expressed β-Galactosidaze at (MOI) of 1, 10, and 50 at percentages of 19%, 62%, and 90%, respectively, which were significantly enhanced with MNPs. Conclusion When applied with adenovirus herpes simplex thymidine kinase, magnetofection significantly suppressed proliferation and induced apoptosis in both cell types. Through the use of magnetofection, we will prove that a lower viral dose will effectively increase the overall safety profile of suicide gene therapy against fibroid tumors. PMID:27020169
Berdichevets, Iryna N; Shimshilashvili, Hristina R; Gerasymenko, Iryna M; Sindarovska, Yana R; Sheludko, Yuriy V; Goldenkova-Pavlova, Irina V
2010-07-01
Thermostable lichenase encoded by licB gene of Clostridium thermocellum can be used as a reporter protein in plant, bacterial, yeast, and mammalian cells. It has important advantages of high sensitivity and specificity in qualitative and quantitative assays. Deletion variants of LicB (e.g., LicBM3) retain its enzymatic activity and thermostability and can be expressed in translational fusion with target proteins without compromising with their properties. Fusion with the lichenase reporter is especially convenient for the heterologous expression of proteins whose analysis is difficult or compromised by host enzyme activities, as it is in case of fatty acid desaturases occurring in all groups of organisms. Recombinant desaturase-lichenase genes can be used for creating genetically modified (GM) plants with improved chill tolerance. Development of an analytical method for detection of fused desaturase-lichenase transgenes is necessary both for production of GM plants and for their certification. Here, we report a multiplex polymerase chain reaction method for detection of desA and desC desaturase genes of cyanobacteria Synechocystis sp. PCC6803 and Synechococcus vulcanus, respectively, fused to licBM3 reporter in GM plants.
Kyöstiö, S R; Cramer, C L; Lacy, G H
1991-01-01
The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878
Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G.; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B.; Grillone, Teresa; Giovannone, Emilia D.; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A. S.; Bond, Heather M.; Mesuraca, Maria; Morrone, Giovanni
2014-01-01
Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and –LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG–LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and
Chiarella, Emanuela; Carrà, Giovanna; Scicchitano, Stefania; Codispoti, Bruna; Mega, Tiziana; Lupia, Michela; Pelaggi, Daniela; Marafioti, Maria G; Aloisio, Annamaria; Giordano, Marco; Nappo, Giovanna; Spoleti, Cristina B; Grillone, Teresa; Giovannone, Emilia D; Spina, Raffaella; Bernaudo, Francesca; Moore, Malcolm A S; Bond, Heather M; Mesuraca, Maria; Morrone, Giovanni
2014-01-01
Lentiviral vectors are widely used to investigate the biological properties of regulatory proteins and/or of leukaemia-associated oncogenes by stably enforcing their expression in hematopoietic stem and progenitor cells. In these studies it is critical to be able to monitor and/or sort the infected cells, typically via fluorescent proteins encoded by the modified viral genome. The most popular strategy to ensure co-expression of transgene and reporter gene is to insert between these cDNAs an IRES element, thus generating bi-cistronic mRNAs whose transcription is driven by a single promoter. However, while the product of the gene located upstream of the IRES is generally abundantly expressed, the translation of the downstream cDNA (typically encoding the reporter protein) is often inconsistent, which hinders the detection and the isolation of transduced cells. To overcome these limitations, we developed novel lentiviral dual-promoter vectors (named UMG-LV5 and -LV6) where transgene expression is driven by the potent UBC promoter and that of the reporter protein, EGFP, by the minimal regulatory element of the WASP gene. These vectors, harboring two distinct transgenes, were tested in a variety of human haematopoietic cell lines as well as in primary human CD34+ cells in comparison with the FUIGW vector that contains the expression cassette UBC-transgene-IRES-EGFP. In these experiments both UMG-LV5 and UMG-LV6 yielded moderately lower transgene expression than FUIGW, but dramatically higher levels of EGFP, thereby allowing the easy distinction between transduced and non-transduced cells. An additional construct was produced, in which the cDNA encoding the reporter protein is upstream, and the transgene downstream of the IRES sequence. This vector, named UMG-LV11, proved able to promote abundant expression of both transgene product and EGFP in all cells tested. The UMG-LVs represent therefore useful vectors for gene transfer-based studies in hematopoietic stem and
User-centered design of multi-gene sequencing panel reports for clinicians.
Cutting, Elizabeth; Banchero, Meghan; Beitelshees, Amber L; Cimino, James J; Fiol, Guilherme Del; Gurses, Ayse P; Hoffman, Mark A; Jeng, Linda Jo Bone; Kawamoto, Kensaku; Kelemen, Mark; Pincus, Harold Alan; Shuldiner, Alan R; Williams, Marc S; Pollin, Toni I; Overby, Casey Lynnette
2016-10-01
The objective of this study was to develop a high-fidelity prototype for delivering multi-gene sequencing panel (GS) reports to clinicians that simulates the user experience of a final application. The delivery and use of GS reports can occur within complex and high-paced healthcare environments. We employ a user-centered software design approach in a focus group setting in order to facilitate gathering rich contextual information from a diverse group of stakeholders potentially impacted by the delivery of GS reports relevant to two precision medicine programs at the University of Maryland Medical Center. Responses from focus group sessions were transcribed, coded and analyzed by two team members. Notification mechanisms and information resources preferred by participants from our first phase of focus groups were incorporated into scenarios and the design of a software prototype for delivering GS reports. The goal of our second phase of focus group, to gain input on the prototype software design, was accomplished through conducting task walkthroughs with GS reporting scenarios. Preferences for notification, content and consultation from genetics specialists appeared to depend upon familiarity with scenarios for ordering and delivering GS reports. Despite familiarity with some aspects of the scenarios we proposed, many of our participants agreed that they would likely seek consultation from a genetics specialist after viewing the test reports. In addition, participants offered design and content recommendations. Findings illustrated a need to support customized notification approaches, user-specific information, and access to genetics specialists with GS reports. These design principles can be incorporated into software applications that deliver GS reports. Our user-centered approach to conduct this assessment and the specific input we received from clinicians may also be relevant to others working on similar projects. Copyright © 2016 Elsevier Inc. All rights
Gene Trapping Using Gal4 in Zebrafish
Balciuniene, Jorune; Balciunas, Darius
2013-01-01
Large clutch size and external development of optically transparent embryos make zebrafish an exceptional vertebrate model system for in vivo insertional mutagenesis using fluorescent reporters to tag expression of mutated genes. Several laboratories have constructed and tested enhancer- and gene-trap vectors in zebrafish, using fluorescent proteins, Gal4- and lexA- based transcriptional activators as reporters 1-7. These vectors had two potential drawbacks: suboptimal stringency (e.g. lack of ability to differentiate between enhancer- and gene-trap events) and low mutagenicity (e.g. integrations into genes rarely produced null alleles). Gene Breaking Transposon (GBTs) were developed to address these drawbacks 8-10. We have modified one of the first GBT vectors, GBT-R15, for use with Gal4-VP16 as the primary gene trap reporter and added UAS:eGFP as the secondary reporter for direct detection of gene trap events. Application of Gal4-VP16 as the primary gene trap reporter provides two main advantages. First, it increases sensitivity for genes expressed at low expression levels. Second, it enables researchers to use gene trap lines as Gal4 drivers to direct expression of other transgenes in very specific tissues. This is especially pertinent for genes with non-essential or redundant functions, where gene trap integration may not result in overt phenotypes. The disadvantage of using Gal4-VP16 as the primary gene trap reporter is that genes coding for proteins with N-terminal signal sequences are not amenable to trapping, as the resulting Gal4-VP16 fusion proteins are unlikely to be able to enter the nucleus and activate transcription. Importantly, the use of Gal4-VP16 does not pre-select for nuclear proteins: we recovered gene trap mutations in genes encoding proteins which function in the nucleus, the cytoplasm and the plasma membrane. PMID:24121167
Validating tyrosinase homologue melA as a photoacoustic reporter gene for imaging Escherichia coli
NASA Astrophysics Data System (ADS)
Paproski, Robert J.; Li, Yan; Barber, Quinn; Lewis, John D.; Campbell, Robert E.; Zemp, Roger
2015-10-01
To understand the pathogenic processes for infectious bacteria, appropriate research tools are required for replicating and characterizing infections. Fluorescence and bioluminescence imaging have primarily been used to image infections in animal models, but optical scattering in tissue significantly limits imaging depth and resolution. Photoacoustic imaging, which has improved depth-to-resolution ratio compared to conventional optical imaging, could be useful for visualizing melA-expressing bacteria since melA is a bacterial tyrosinase homologue which produces melanin. Escherichia coli-expressing melA was visibly dark in liquid culture. When melA-expressing bacteria in tubes were imaged with a VisualSonics Vevo LAZR system, the signal-to-noise ratio of a 9× dilution sample was 55, suggesting that ˜20 bacteria cells could be detected with our system. Multispectral (680, 700, 750, 800, 850, and 900 nm) analysis of the photoacoustic signal allowed unmixing of melA-expressing bacteria from blood. To compare photoacoustic reporter gene melA (using Vevo system) with luminescent and fluorescent reporter gene Nano-lantern (using Bruker Xtreme In-Vivo system), tubes of bacteria expressing melA or Nano-lantern were submerged 10 mm in 1% Intralipid, spaced between <1 and 20 mm apart from each other, and imaged with the appropriate imaging modality. Photoacoustic imaging could resolve the two tubes of melA-expressing bacteria even when the tubes were less than 1 mm from each other, while bioluminescence and fluorescence imaging could not resolve the two tubes of Nano-lantern-expressing bacteria even when the tubes were spaced 10 mm from each other. After injecting 100-μL of melA-expressing bacteria in the back flank of a chicken embryo, photoacoustic imaging allowed visualization of melA-expressing bacteria up to 10-mm deep into the embryo. Photoacoustic signal from melA could also be separated from deoxy- and oxy-hemoglobin signal observed within the embryo and
Ponomarev, Vladimir; Doubrovin, Michael; Serganova, Inna; Beresten, Tatiana; Vider, Jelena; Shavrin, Aleksander; Ageyeva, Ludmila; Balatoni, Julius; Blasberg, Ronald; Tjuvajev, Juri Gelovani
2003-01-01
Abstract To optimize the sensitivity of imaging HSV1-tk/GFP reporter gene expression, a series of HSV1-tk/GFP mutants was developed with altered nuclear localization and better cellular enzymatic activity, compared to that of the native HSV1-tk/GFP fusion protein (HSV1-tk/GFP). Several modifications of HSV1-tk/GFP reporter gene were performed, including targeted inactivating mutations in the nuclear localization signal (NLS), the addition of a nuclear export signal (NES), a combination of both mutation types, and a truncation of the first 135 bp of the native hsv1-tk coding sequence containing a “cryptic” testicular promoter and the NLS. A recombinant HSV1-tk/GFP protein and a highly sensitive sandwich enzyme-linked immunosorbent assay for HSV1-tk/GFP were developed to quantitate the amount of reporter gene product in different assays to allow normalization of the data. These different mutations resulted in various degrees of nuclear clearance, predominant cytoplasmic distribution, and increased total cellular enzymatic activity of the HSV1-tk/GFP mutants, compared to native HSV1-tk/GFP when expressed at the same levels. This appears to be the result of improvedmetabolic bioavailability of cytoplasmically retargeted mutant HSV1-tk/GFP enzymes for reaction with the radiolabeled probe (e.g., FIAU). The analysis of enzymatic properties of different HSV1-tk/GFP mutants using FIAU as a substrate revealed no significant differences from that of the native HSV1-tk/GFP. Improved total cellular enzymatic activity of cytoplasmically retargeted HSV1-tk/GFP mutants observed in vitro was confirmed by noninvasive imaging of transduced subcutaneous tumor xenografts bearing these reporters using [131I]FIAU and a γ-camera. PMID:12869307
MNL1 Regulates Weak Acid–induced Stress Responses of the Fungal Pathogen Candida albicans
Selway, Laura; Stead, David; Walker, Jan; Yin, Zhikang; Nicholls, Susan M.; Crowe, Jonathan; Sheils, Emma M.; Brown, Alistair J.P.
2008-01-01
MNL1, the Candida albicans homologue of an orphan Msn2-like gene (YER130c in Saccharomyces cerevisiae) has no known function. Here we report that MNL1 regulates weak acid stress responses. Deletion of MNL1 prevents the long-term adaptation of C. albicans cells to weak acid stresses and compromises their global transcriptional response under these conditions. The promoters of Mnl1-dependent genes contain a novel STRE-like element (SLE) that imposes Mnl1-dependent, weak acid stress–induced transcription upon a lacZ reporter in C. albicans. The SLE (HHYYCCCCTTYTY) is related to the Nrg1 response element (NRE) element recognized by the transcriptional repressor Nrg1. Deletion of NRG1 partially restores the ability of C. albicans mnl1 cells to adapt to weak acid stress, indicating that Mnl1 and Nrg1 act antagonistically to regulate this response. Molecular, microarray, and proteomic analyses revealed that Mnl1-dependent adaptation does not occur in cells exposed to proapoptotic or pronecrotic doses of weak acid, suggesting that Ras-pathway activation might suppress the Mnl1-dependent weak acid response in dying cells. Our work defines a role for this YER130c orthologue in stress adaptation and cell death. PMID:18653474
Piazza, Francesco; Costoya, José A; Merghoub, Taha; Hobbs, Robin M; Pandolfi, Pier Paolo
2004-12-01
Deregulated function of members of the POK (POZ and Kruppel) family of transcriptional repressors, such as promyelocytic leukemia zinc finger (PLZF) and B-cell lymphoma 6 (BCL-6), plays a critical role in the pathogenesis of acute promyelocytic leukemia (APL) and non-Hodgkin's lymphoma, respectively. PLZP, also known as TZFP, FAZF, or ROG, is a novel POK protein that displays strong homology with PLZF and has been implicated in the pathogenesis of the cancer-predisposing syndrome, Fanconi's anemia, and of APL, in view of its ability to heterodimerize with the FANC-C and PLZF proteins, respectively. Here we report the generation and characterization of mice in which we have specifically inactivated the PLZP gene through in-frame insertion of a lacZ reporter and without perturbing the expression of the neighboring MLL2 gene. We show that PLZP-deficient mice display defects in cell cycle control and cytokine production in the T-cell compartment. Importantly, PLZP inactivation perturbs the homeostasis of the hematopoietic stem and/or progenitor cell. On the basis of our data, a deregulation of PLZP function in Fanconi's anemia and APL may affect the biology of the hematopoietic stem cell, in turn contributing to the pathogenesis of these disorders.
Role of CCK-A receptor for pancreatic function in mice: a study in CCK-A receptor knockout mice.
Takiguchi, Soichi; Suzuki, Shinji; Sato, Yuko; Kanai, Setsuko; Miyasaka, Kyoko; Jimi, Atsuo; Shinozaki, Hirotsugu; Takata, Yutaka; Funakoshi, Akihiro; Kono, Akira; Minowa, Osamu; Kobayashi, Tomoko; Noda, Tetsuo
2002-04-01
The cholecystokinin (CCK) family of peptides and receptors is present throughout the brain and gastrointestinal tract. The CCK receptors can be pharmacologically subdivided into two subtypes: CCK-A and CCK-B. CCK-A receptor is enriched in the pancreas of mice. To determine pancreatic functions in a CCK-A receptor deficient mouse mutant generated by gene targeting in embryonic stem cells. The targeting vector contained lacZ and neo insertions in exon 2. To examine exocrine functions, amylase release from the dispersed acini in vitro was examined. In the in vivo study, the mixture of bile-pancreatic juice was collected, and amylase, bicarbonate, and bile acid outputs were determined after the administration of various stimulants. The cystic duct of the gallbladder and the pylorus were ligated to exclude the involvement of gallbladder contraction and gastric acid. Pancreatic enzyme content was measured, and histologic examinations by HE and lacZ staining were conducted. To examine endocrine functions, oral glucose tolerance test (2 g/kg) was determined. The body weight, pancreatic wet weight, and enzyme content in the pancreas were similar among the three genotypes. Amylase release in vivo and in vitro and bicarbonate secretion in vivo were not stimulated by CCK-8 in CCK-AR (-/-) mice, whereas the responses to other stimulants were substantial in (-/-) mice. Administration of secretin did not increase bicarbonate secretion regardless of genotype. A normal glucose tolerance was observed in (-/-) mice. Acinar cells, islets, and duct cells were stained by lacZ, and HE staining revealed no pathologic findings. The CCK-A receptor is important for pancreatic exocrine secretion, but not essential for maintaining glucose concentration and pancreatic growth in mice.
Xiao, Dan; Zhang, Weifeng; Li, Yan; Liu, Kuan; Zhao, Junli; Sun, Xiaohong; Shan, Linlin; Mao, Qinwen; Xia, Haibin
2016-02-10
Sox2 is an important transcriptional factor that has multiple functions in stem cell maintenance and tumorigenesis. To investigate the transcriptional regulation of the Sox2 gene, a luciferase knock-in reporter system was established in HEK293 cells by placing the luciferase gene in the genome under the control of the Sox2 gene promoter using a transcription activator-like effector nuclease (TALEN)-mediated genome editing technique. PCR and Southern blot results confirmed the site-specific integration of a single copy of the exogenous luciferase gene into the genome. To prove the reliability and sensitivity of this novel luciferase knock-in system, a CRISPR/Cas transcription activation system for the Sox2 gene was constructed and applied to the knock-in system. The results indicated that luciferase activity was directly correlated with the activity of the Sox2 endogenous promoter. This novel system will be a useful tool to study the transcriptional regulation of Sox2, and has great potential in medical and industrial applications. Copyright © 2015 Elsevier B.V. All rights reserved.
Walsh, Kyle M; Anderson, Erik; Hansen, Helen M; Decker, Paul A; Kosel, Matt L; Kollmeyer, Thomas; Rice, Terri; Zheng, Shichun; Xiao, Yuanyuan; Chang, Jeffrey S; McCoy, Lucie S; Bracci, Paige M; Wiemels, Joe L; Pico, Alexander R; Smirnov, Ivan; Lachance, Daniel H; Sicotte, Hugues; Eckel-Passow, Jeanette E; Wiencke, John K; Jenkins, Robert B; Wrensch, Margaret R
2013-02-01
Genomewide association studies (GWAS) and candidate-gene studies have implicated single-nucleotide polymorphisms (SNPs) in at least 45 different genes as putative glioma risk factors. Attempts to validate these associations have yielded variable results and few genetic risk factors have been consistently replicated. We conducted a case-control study of Caucasian glioma cases and controls from the University of California San Francisco (810 cases, 512 controls) and the Mayo Clinic (852 cases, 789 controls) in an attempt to replicate previously reported genetic risk factors for glioma. Sixty SNPs selected from the literature (eight from GWAS and 52 from candidate-gene studies) were successfully genotyped on an Illumina custom genotyping panel. Eight SNPs in/near seven different genes (TERT, EGFR, CCDC26, CDKN2A, PHLDB1, RTEL1, TP53) were significantly associated with glioma risk in the combined dataset (P < 0.05), with all associations in the same direction as in previous reports. Several SNP associations showed considerable differences across histologic subtype. All eight successfully replicated associations were first identified by GWAS, although none of the putative risk SNPs from candidate-gene studies was associated in the full case-control sample (all P values > 0.05). Although several confirmed associations are located near genes long known to be involved in gliomagenesis (e.g., EGFR, CDKN2A, TP53), these associations were first discovered by the GWAS approach and are in noncoding regions. These results highlight that the deficiencies of the candidate-gene approach lay in selecting both appropriate genes and relevant SNPs within these genes. © 2012 WILEY PERIODICALS, INC.
Repression of choline kinase by inositol and choline in Saccharomyces cerevisiae.
Hosaka, K; Murakami, T; Kodaki, T; Nikawa, J; Yamashita, S
1990-01-01
The regulation of choline kinase (EC 2.7.1.32), the initial enzyme in the CDP-choline pathway, was examined in Saccharomyces cerevisiae. The addition of myo-inositol to a culture of wild-type cells resulted in a significant decrease in choline kinase activity. Additional supplementation of choline caused a further reduction in the activity. The coding frame of the choline kinase gene, CK1, was joined to the carboxyl terminus of lacZ and expressed in Escherichia coli as a fusion protein, which was then used to prepare an anti-choline kinase antibody. Upon Western (immuno-) and Northern (RNA) blot analyses using the antibody and a CK1 probe, respectively, the decrease in the enzyme activity was found to be correlated with decreases in the enzyme amount and mRNA abundance. The molecular mass of the enzyme was estimated to be 66 kilodaltons, in agreement with the value predicted previously from the nucleotide sequence of the gene. The coding region of CK1 was replaced with that of lacZ, and CK1 expression was measured by assaying beta-galactosidase. The expression of beta-galactosidase from this fusion was repressed by myo-inositol and choline and derepressed in a time-dependent manner upon their removal. The present findings indicate that yeast choline kinase is regulated by myo-inositol and choline at the level of mRNA abundance. Images FIG. 3 FIG. 4 PMID:2156807
Live-cell Imaging of Pol II Promoter Activity to Monitor Gene expression with RNA IMAGEtag reporters
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shin, Ilchung; Ray, Judhajeet; Gupta, Vinayak
2014-04-20
We describe a ribonucleic acid (RNA) reporter system for live-cell imaging of gene expression to detect changes in polymerase II activity on individual promoters in individual cells. The reporters use strings of RNA aptamers that constitute IMAGEtags (Intracellular MultiAptamer GEnetic tags) that can be expressed from a promoter of choice. For imaging, the cells are incubated with their ligands that are separately conjugated with one of the FRET pair, Cy3 and Cy5. The IMAGEtags were expressed in yeast from the GAL1, ADH1 or ACT1 promoters. Transcription from all three promoters was imaged in live cells and transcriptional increases from themore » GAL1 promoter were observed with time after adding galactose. Expression of the IMAGEtags did not affect cell proliferation or endogenous gene expression. Advantages of this method are that no foreign proteins are produced in the cells that could be toxic or otherwise influence the cellular response as they accumulate, the IMAGEtags are short lived and oxygen is not required to generate their signals. The IMAGEtag RNA reporter system provides a means of tracking changes in transcriptional activity in live cells and in real time.« less
Neuronal activity-dependent membrane traffic at the neuromuscular junction
Miana-Mena, Francisco Javier; Roux, Sylvie; Benichou, Jean-Claude; Osta, Rosario; Brûlet, Philippe
2002-01-01
During development and also in adulthood, synaptic connections are modulated by neuronal activity. To follow such modifications in vivo, new genetic tools are designed. The nontoxic C-terminal fragment of tetanus toxin (TTC) fused to a reporter gene such as LacZ retains the retrograde and transsynaptic transport abilities of the holotoxin itself. In this work, the hybrid protein is injected intramuscularly to analyze in vivo the mechanisms of intracellular and transneuronal traffics at the neuromuscular junction (NMJ). Traffic on both sides of the synapse are strongly dependent on presynaptic neural cell activity. In muscle, a directional membrane traffic concentrates β-galactosidase-TTC hybrid protein into the NMJ postsynaptic side. In neurons, the probe is sorted across the cell to dendrites and subsequently to an interconnected neuron. Such fusion protein, sensitive to presynaptic neuronal activity, would be extremely useful to analyze morphological changes and plasticity at the NMJ. PMID:11880654
Abu-Bakar, A'edah; Hu, Hao; Lang, Matti A
2018-05-22
The murine cytochrome P450 2a5 (Cyp2a5) gene is regulated by complex interactions of various stress-activated transcription factors (TFs). Elevated Cyp2a5 transcription under chemical-induced stress conditions is achieved by interplay between the various TFs-including as aryl hydrocarbon receptor (AhR) and nuclear factor (erythroid-derived 2)-like 2 wild-type (Nrf2)-at the "stress-responding" cluster of response elements on the Cyp2a5 promoter, as well as through mRNA stabilisation mediated by interaction of the stress-activated heterogeneous nuclear ribonucleoprotein A1 (hnRNP A1) with the 3'UTR of the CYP2A5 mRNA. We design a unique toxicity pathway-based reporter assay to include regulatory regions from both the 5' and the 3' untranslated regions of Cyp2a5 in a luciferase reporter plasmid to reflect in vivo responses to chemical insult. Human breast cancer, MCF-7 cells were stably transfected with pGL4.38-Cyp2a5_Wt3k (wildtype) or mutants-pGL4.38-Cyp2a5-StREMut and pGL4.38-Cyp2a5-XREMut-reporter gene to monitor chemical-induced cellular response mediated by AhR and Nrf2 signalling. The recombinant cells were treated with representative of AhR agonist, polycyclic aromatic hydrocarbons, brominated flame retardant, fluorosurfactant, aromatic organic compound and metal, to determine sensitivity of the Cyp2a5 promoter-based gene reporter assays to chemical insults by measuring the LC 50 and EC 50 of the respective chemicals. The three assays are sensitive to sub-lethal cellular responses of chemicals, which is an ideal feature for toxicity pathway-based bioassay for toxicity prediction. The wildtype reporter responded well to chemicals that activate cross-talk between the AhR and Nrf2, whilst the mutant reporters effectively gauge cellular response driven by either Nrf2/StRE or AhR/XRE signalling. Thus, the three gene reporter assays could be used tandemly to determine the predominant toxicity pathway of a given compound. This article is protected by copyright. All
Vande Velde, G; Rangarajan, J R; Toelen, J; Dresselaers, T; Ibrahimi, A; Krylychkina, O; Vreys, R; Van der Linden, A; Maes, F; Debyser, Z; Himmelreich, U; Baekelandt, V
2011-06-01
The development of in vivo imaging protocols to reliably track transplanted cells or to report on gene expression is critical for treatment monitoring in (pre)clinical cell and gene therapy protocols. Therefore, we evaluated the potential of lentiviral vectors (LVs) and adeno-associated viral vectors (AAVs) to express the magnetic resonance imaging (MRI) reporter gene ferritin in the rodent brain. First, we compared the induction of background MRI contrast for both vector systems in immune-deficient and immune-competent mice. LV injection resulted in hypointense (that is, dark) changes of T(2)/T(2)(*) (spin-spin relaxation time)-weighted MRI contrast at the injection site, which can be partially explained by an inflammatory response against the vector injection. In contrast to LVs, AAV injection resulted in reduced background contrast. Moreover, AAV-mediated ferritin overexpression resulted in significantly enhanced contrast to background on T(2)(*)-weighted MRI. Although sensitivity associated with the ferritin reporter remains modest, AAVs seem to be the most promising vector system for in vivo MRI reporter gene imaging.
Jia, Junshuang; Lin, Xiaolin; Lin, Xia; Lin, Taoyan; Chen, Bangzhu; Hao, Weichao; Cheng, Yushuang; Liu, Yu; Dian, Meijuan; Yao, Kaitai; Xiao, Dong; Gu, Weiwang
2016-10-01
The Cre/loxP system has become an important tool for the conditional gene knockout and conditional gene expression in genetically engineered mice. The applications of this system depend on transgenic reporter mouse lines that provide Cre recombinase activity with a defined cell type-, tissue-, or developmental stage-specificity. To develop a sensitive assay for monitoring Cre-mediated DNA excisions in mice, we generated Cre-mediated excision reporter mice, designated R/L mice (R/L: mRFP(monomeric red fluorescent protein)/luciferase), express mRFP throughout embryonic development and adult stages, while Cre-mediated excision deletes a loxP-flanked mRFP reporter gene and STOP sequence, thereby activating the expression of the second reporter gene luciferase, as assayed by in vivo and ex vivo bioluminescence imaging. After germ line deletion of the floxed mRFP and STOP sequence in R/L mice by EIIa-Cre mice, the resulting luciferase transgenic mice in which the loxP-mRFP-STOP-loxP cassette is excised from all cells express luciferase in all tissues and organs examined. The expression of luciferase transgene was activated in liver of RL/Alb-Cre double transgenic mice and in brain of RL/Nestin-Cre double transgenic mice when R/L reporter mice were mated with Alb-Cre mice and Nestin-Cre mice, respectively. Our findings reveal that the double reporter R/L mouse line is able to indicate the occurrence of Cre-mediated excision from early embryonic to adult lineages. Taken together, these findings demonstrate that the R/L mice serve as a sensitive reporter for Cre-mediated DNA excision both in living animals and in organs, tissues, and cells following necropsy.
The First Report of a 290-bp Deletion in β-Globin Gene in the South of Iran
Hamid, Mohammad; Nejad, Ladan Dawoody; Shariati, Gholamreza; Galehdari, Hamid; Saberi, Alihossein; Mohammadi-Anaei, Marziye
2017-01-01
Background: β-thalassemia is one of the most widespread diseases in the world, including Iran. In this study, we reported, for the first time, a 290-bp β-globin gene deletion in the south of Iran. Methods: Four individuals from three unrelated families with Arabic ethnic background were studied in Khuzestan Province. Red blood cell indices and hemoglobin analysis were carried out according to the standard methods. Genomic DNA was obtained from peripheral blood cells by salting out procedures. β-globin gene amplification, multiplex ligation-dependent probe amplification (MLPA), and DNA sequencing were performed. Results: The PCR followed by sequencing and MLPA test of the β-globin gene confirmed the presence of a 290-bp deletion in the heterozygous form, along with -88C>A mutation. All the individuals had elevated hemoglobin A2 and normal fetal hemoglobin levels. Conclusions: This mutation causes β0-thalassemia and can be highly useful for prenatal diagnosis in compound heterozygous condition with different β-globin gene mutations. PMID:26948378
Aarskog-Scott syndrome: clinical update and report of nine novel mutations of the FGD1 gene.
Orrico, A; Galli, L; Faivre, L; Clayton-Smith, J; Azzarello-Burri, S M; Hertz, J M; Jacquemont, S; Taurisano, R; Arroyo Carrera, I; Tarantino, E; Devriendt, K; Melis, D; Thelle, T; Meinhardt, U; Sorrentino, V
2010-02-01
Mutations in the FGD1 gene have been shown to cause Aarskog-Scott syndrome (AAS), or facio-digito-genital dysplasia (OMIM#305400), an X-linked disorder characterized by distinctive genital and skeletal developmental abnormalities with a broad spectrum of clinical phenotypes. To date, 20 distinct mutations have been reported, but little phenotypic data are available on patients with molecularly confirmed AAS. In the present study, we report on our experience of screening for mutations in the FGD1 gene in a cohort of 60 European patients with a clinically suspected diagnosis of AAS. We identified nine novel mutations in 11 patients (detection rate of 18.33%), including three missense mutations (p.R402Q; p.S558W; p.K748E), four truncating mutations (p.Y530X; p.R656X; c.806delC; c.1620delC), one in-frame deletion (c.2020_2022delGAG) and the first reported splice site mutation (c.1935+3A>C). A recurrent mutation (p.R656X) was detected in three independent families. We did not find any evidence for phenotype-genotype correlations between type and position of mutations and clinical features. In addition to the well-established phenotypic features of AAS, other clinical features are also reported and discussed. Copyright 2010 Wiley-Liss, Inc.
Mellor, J R; Wisden, W; Randall, A D
2000-07-10
Electrophysiological investigation of cultured cerebellar murine granule cells revealed differences between the GABA(A) receptors at inhibitory synapses and those on the cell body. Specifically, mIPSCs decayed more rapidly than cell body receptors deactivated, the mean single channel conductance at the synapse (32 pS) was greater than that at cell body (21 pS) and only cell body receptors were sensitive to Zn(2+) (150 microM), which depressed response amplitude by 82+/-5% and almost doubled the rate of channel deactivation. The GABA(A) receptor alpha6 subunit is selectively expressed in cerebellar granule cells. Although concentrated at synapses, it is also found on extrasynaptic membranes. Using a mouse line (Deltaalpha6lacZ) lacking this subunit, we investigated its role in the somato-synaptic differences in GABA(A) receptor function. All differences between cell body and synaptic GABA(A) receptors observed in wild-type (WT) granule cells persisted in Deltaalpha6lacZ cells, thus demonstrating that they are not specifically due to the cellular distribution of the alpha6 subunit. However, mIPSCs from WT and Deltaalpha6lacZ cells differed in both their kinetics (faster decay in WT cells) and underlying single channel conductance (32 pS WT, 25 pS Deltaalpha6lacZ). This provides good evidence for a functional contribution of the alpha6 subunit to postsynaptic GABA(A) receptors in these cells. Despite this, deactivation kinetics of mIPSCs in WT and Deltaalpha6lacZ granule cells exhibited similar benzodiazepene (BDZ) sensitivity. This suggests that the enhanced BDZ-induced ataxia seen in Deltaalpha6lacZ mice may reflect physiological activity at extrasynaptic receptors which, unlike those at synapses, display differential BDZ-sensitivity in WT and Deltaalpha6lacZ granule cells (Jones, A.M., Korpi, E.R., McKernan, R.M., Nusser, Z., Pelz, R., Makela, R., Mellor, J.R., Pollard, S., Bahn, S., Stephenson, F.A., Randall, A.D., Sieghart, W., Somogyi, P., Smith, A.J.H., Wisden
Sabri, Suriana; Steen, Jennifer A; Bongers, Mareike; Nielsen, Lars K; Vickers, Claudia E
2013-06-24
Metabolic engineering projects often require integration of multiple genes in order to control the desired phenotype. However, this often requires iterative rounds of engineering because many current insertion approaches are limited by the size of the DNA that can be transferred onto the chromosome. Consequently, construction of highly engineered strains is very time-consuming. A lack of well-characterised insertion loci is also problematic. A series of knock-in/knock-out (KIKO) vectors was constructed for integration of large DNA sequences onto the E. coli chromosome at well-defined loci. The KIKO plasmids target three nonessential genes/operons as insertion sites: arsB (an arsenite transporter); lacZ (β-galactosidase); and rbsA-rbsR (a ribose metabolism operon). Two homologous 'arms' target each insertion locus; insertion is mediated by λ Red recombinase through these arms. Between the arms is a multiple cloning site for the introduction of exogenous sequences and an antibiotic resistance marker (either chloramphenicol or kanamycin) for selection of positive recombinants. The resistance marker can subsequently be removed by flippase-mediated recombination. The insertion cassette is flanked by hairpin loops to isolate it from the effects of external transcription at the integration locus. To characterize each target locus, a xylanase reporter gene (xynA) was integrated onto the chromosomes of E. coli strains W and K-12 using the KIKO vectors. Expression levels varied between loci, with the arsB locus consistently showing the highest level of expression. To demonstrate the simultaneous use of all three loci in one strain, xynA, green fluorescent protein (gfp) and a sucrose catabolic operon (cscAKB) were introduced into lacZ, arsB and rbsAR respectively, and shown to be functional. The KIKO plasmids are a useful tool for efficient integration of large DNA fragments (including multiple genes and pathways) into E. coli. Chromosomal insertion provides stable
Regulation of the cnr Cobalt and Nickel Resistance Determinant from Ralstonia sp. Strain CH34†
Grass, Gregor; Große, Cornelia; Nies, Dietrich H.
2000-01-01
Ralstonia sp. strain CH34 is resistant to nickel and cobalt cations. Resistance is mediated by the cnr determinant located on plasmid pMOL28. The cnr genes are organized in two clusters, cnrYXH and cnrCBA. As revealed by reverse transcriptase PCR and primer extension, transcription from these operons is initiated from promoters located upstream of the cnrY and cnrC genes. These two promoters exhibit conserved sequences at the −10 (CCGTATA) and −35 (CRAGGGGRAG) regions. The CnrH gene product, which is required for expression of both operons, is a sigma factor belonging to the sigma L family, whose activity seems to be governed by the membrane-bound CnrY and CnrX gene products in response to Ni2+. Half-maximal activation from the cnrCBA operon was determined by using appropriate lacZ gene fusions and was shown to occur at an Ni2+ concentration of about 50 μM. PMID:10671463
Bordbar, Mohammad Reza; Modarresi, Farzaneh; Farazi Fard, Mohammad Ali; Dastsooz, Hassan; Shakib Azad, Nader; Faghihi, Mohammad Ali
2017-05-03
Hemophagocytic Lymphohistiocytosis (HLH) is a life-threatening immunodeficiency and multi-organ disease that affects people of all ages and ethnic groups. Common symptoms and signs of this disease are high fever, hepatosplenomegaly, and cytopenias. Familial form of HLH disease, which is an autosomal recessive hematological disorder is due to disease-causing mutations in several genes essential for NK and T-cell granule-mediated cytotoxic function. For an effective cytotoxic response from cytotoxic T lymphocyte or NK cell encountering an infected cell or tumor cell, different processes are required, including trafficking, docking, priming, membrane fusion, and entry of cytotoxic granules into the target cell leading to apoptosis. Therefore, genes involved in these steps play important roles in the pathogenesis of HLH disease which include PRF1, UNC13D (MUNC13-4), STX11, and STXBP2 (MUNC18-2). Here, we report a novel missense mutation in an 8-year-old boy suffered from hepatosplenomegaly, hepatitis, epilepsy and pancytopenia. The patient was born to a first-cousin parents with no previous documented disease in his parents. To identify mutated gene in the proband, Whole Exome Sequencing (WES) utilizing next generation sequencing was used on an Illumina HiSeq 2000 platform on DNA sample from the patient. Results showed a novel deleterious homozygous missense mutation in PRF1 gene (NM_001083116: exon3: c. 1120 T > G, p.W374G) in the patient and then using Sanger sequencing it was confirmed in the proband and his parents. Since his parents were heterozygous for the identified mutation, autosomal recessive pattern of inheritance was confirmed in the family. Our study identified a rare new pathogenic missense mutation in PRF1 gene in patient with HLH disease and it is the first report of mutation in PRF1 in Iranian patients with this disease.
Gene Architectures that Minimize Cost of Gene Expression.
Frumkin, Idan; Schirman, Dvir; Rotman, Aviv; Li, Fangfei; Zahavi, Liron; Mordret, Ernest; Asraf, Omer; Wu, Song; Levy, Sasha F; Pilpel, Yitzhak
2017-01-05
Gene expression burdens cells by consuming resources and energy. While numerous studies have investigated regulation of expression level, little is known about gene design elements that govern expression costs. Here, we ask how cells minimize production costs while maintaining a given protein expression level and whether there are gene architectures that optimize this process. We measured fitness of ∼14,000 E. coli strains, each expressing a reporter gene with a unique 5' architecture. By comparing cost-effective and ineffective architectures, we found that cost per protein molecule could be minimized by lowering transcription levels, regulating translation speeds, and utilizing amino acids that are cheap to synthesize and that are less hydrophobic. We then examined natural E. coli genes and found that highly expressed genes have evolved more forcefully to minimize costs associated with their expression. Our study thus elucidates gene design elements that improve the economy of protein expression in natural and heterologous systems. Copyright © 2017 Elsevier Inc. All rights reserved.
Afanas'eva, K P; Aleksandrova, M V; Aleksandrov, I D; Korablinova, S V
2012-01-01
The results of the PCR-assay of mutation lesions at each of 16 fragments overlapping the entire vestigial (vg) gene of Drosophila melanogaster in 52 gamma-ray-, neutron- and neutron + gamma-ray-induced vg mutants having the inversion or translocation breakpoint within the vg microregion are presented. 4 from 52 mutants studied were found to have large deletions of about 200 kb covering the entire vg gene and adjacent to sca and l(2)C gene-markers as well. 23 mutants from 48 (47.9%) were found to have a wild-type gene structure showing that the exchange breakpoints are located outside of the vg gene. 25 others display the intragenic lesions of different complexity detected by PCR as the absence of(i) either one fragment or (ii) two or more (6-7) adjacent fragments and (iii) simultaneously several (i) or (i) and (ii) types separated by normal gene regions. It is important that 6 from 25 mutants have the breakpoint inside the vg gene and display the (i) or (ii) type of lesions at the gene regions containing the putative break whereas 5 others from 25 with the above lesions have the exchange breakpoint outside the vg gene. Therefore, the breakpoints underlying either inversions or translocations induced by low- and high-LET radiation are likely to be located within and outside the gene under study. Thereby, the formation of exchanges is accompanied by DNA deletions of various sizes at the exchange breakpoints. The molecular model of formation of such exchange-deletion rearrangements is elaborated and presented. Also, conception of the predominately clustered action of both low- and high-LET radiation on the germ cell genome is suggested as the summing-up of the presented results. The ability of ionizing radiation to induce the clusters of genetic alterations in the form of hidden DNA damages as well as gene/chromosome mutations is determined by the track structure and hierarchical organization of the genome. To detect the quality and frequency patterns of all
Borrás, Teresa; Smith, Matthew H; Buie, LaKisha K
2015-04-01
Soft tissue calcification is a pathological condition. Matrix Gla (MGP) is a potent mineralization inhibitor secreted by cartilage chondrocytes and arteries' vascular smooth muscle cells. Mgp knock-out mice die at 6 weeks due to massive arterial calcification. Arterial calcification results in arterial stiffness and higher systolic blood pressure. Intriguingly, MGP was highly abundant in trabecular meshwork (TM). Because tissue stiffness is relevant to glaucoma, we investigated which additional eye tissues use Mgp's function using knock-in mice. An Mgp-Cre-recombinase coding sequence (Cre) knock-in mouse, containing Mgp DNA plus an internal ribosomal entry site (IRES)-Cre-cassette was generated by homologous recombination. Founders were crossed with Cre-mediated reporter mouse R26R-lacZ. Their offspring expresses lacZ where Mgp is transcribed. Eyes from MgpCre/+;R26RlacZ/+ (Mgp-lacZ knock-in) and controls, 1 to 8 months were assayed for β-gal enzyme histochemistry. As expected, Mgp-lacZ knock-in's TM was intensely blue. In addition, this mouse revealed high specific expression in the sclera, particularly in the peripapillary scleral region (ppSC). Ciliary muscle and sclera above the TM were also positive. Scleral staining was located immediately underneath the choroid (chondrocyte layer), began midsclera and was remarkably high in the ppSC. Cornea, iris, lens, ciliary body, and retina were negative. All mice exhibited similar staining patterns. All controls were negative. Matrix Gla's restricted expression to glaucoma-associated tissues from anterior and posterior segments suggests its involvement in the development of the disease. Matrix Gla's anticalcification/antistiffness properties in the vascular tissue, together with its high TM and ppCS expression, place this gene as a strong candidate for TM's softness and sclera's stiffness regulation in glaucoma.
Green fluorescent protein as a reporter of gene expression and protein localization.
Kain, S R; Adams, M; Kondepudi, A; Yang, T T; Ward, W W; Kitts, P
1995-10-01
The green fluorescent protein (GFP) from the jellyfish Aequorea victoria is rapidly becoming an important reporter molecule for monitoring gene expression and protein localization in vivo, in situ and in real time. GFP emits bright green light (lambda max = 509 nm) when excited with UV or blue light (lambda max = 395 nm, minor peak at 470 nm). The fluorescence excitation and emission spectra of GFP are similar to those of fluorescein, and the conditions used to visualize this fluorophore are also suitable for GFP. Unlike other bioluminescent reporters, the chromophore in GFP is intrinsic to the primary structure of the protein, and GFP fluorescence does not require a substrate or cofactor. GFP fluorescence is stable, species-independent and can be monitored non-invasively in living cells and, in the case of transparent organisms, whole animals. Here we demonstrate GFP fluorescence in bacterial and mammalian cells and introduce our Living Colors line of GFP reporter vectors, GFP protein and anti-GFP antiserum. The reporter vectors for GFP include a promoterless GFP vector for monitoring the expression of cloned promoters/enhancers in mammalian cells and a series of six vectors for creating fusion protein to either the N or C terminus of GFP.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gaur, Naseem Akhtar; Manoharlal, Raman; Saini, Preeti
2005-06-24
Resistance to azole antifungal drugs in clinical isolates of the human fungal pathogen Candida albicans is often caused by constitutive overexpression of the CDR1 gene, which encodes a multidrug efflux pump of the ABC transporter superfamily. To understand the relevance of a recently identified negative regulatory element (NRE) in the CDR1 promoter for the control of CDR1 expression in the clinical scenario, we investigated the effect of mutation or deletion of the NRE on CDR1 expression in two matched pairs of azole-sensitive and resistant clinical isolates of C. albicans. Expression of GFP or lacZ reporter genes from the wild typemore » CDR1 promoter was much higher in the azole-resistant C. albicans isolates than in the azole-susceptible isolates, reflecting the known differences in CDR1 expression in these strains. Deletion or mutation of the NRE resulted in enhanced reporter gene expression in azole-sensitive strains, but did not further increase the already high CDR1 promoter activity in the azole-resistant strains. In agreement with these findings, electrophoretic mobility shift assays showed a reduced binding to the NRE of nuclear extracts from the resistant C. albicans isolates as compared with extracts from the sensitive isolates. These results demonstrate that the NRE is involved in maintaining CDR1 expression at basal levels and that this repression is overcome in azole-resistant clinical C. albicans isolates, resulting in constitutive CDR1 overexpression and concomitant drug resistance.« less
Konishi, Yuko; Karnan, Sivasundaram; Takahashi, Miyuki; Ota, Akinobu; Damdindorj, Lkhagvasuren; Hosokawa, Yoshitaka; Konishi, Hiroyuki
2012-09-01
Gene targeting in a broad range of human somatic cell lines has been hampered by inefficient homologous recombination. To improve this technology and facilitate its widespread application, it is critical to first have a robust and efficient research system for measuring gene targeting efficiency. Here, using a fusion gene consisting of hygromycin B phosphotransferase and 3'-truncated enhanced GFP (HygR-5' EGFP) as a reporter gene, we created a molecular system monitoring the ratio of homologous to random integration (H/R ratio) of targeting vectors into the genome. Cell clones transduced with a reporter vector containing HygR-5' EGFP were efficiently established from two human somatic cell lines. Established HygR-5' EGFP reporter clones retained their capacity to monitor gene targeting efficiency for a longer duration than a conventional reporter system using an unfused 5' EGFP gene. With the HygR-5' EGFP reporter system, we reproduced previous findings of gene targeting frequency being up-regulated by the use of an adeno-associated viral (AAV) backbone, a promoter-trap system, or a longer homology arm in a targeting vector, suggesting that this system accurately monitors H/R ratio. Thus, our HygR-5' EGFP reporter system will assist in the development of an efficient AAV-based gene targeting technology.
1994-01-01
The 40-S subunit of eukaryotic ribosomes binds to the capped 5'-end of mRNA and scans for the first AUG in a favorable sequence context to initiate translation. Most eukaryotic mRNAs therefore have a short 5'- untranslated region (5'-UTR) and no AUGs upstream of the translational start site; features that seem to assure efficient translation. However, approximately 5-10% of all eukaryotic mRNAs, particularly those encoding for regulatory proteins, have complex leader sequences that seem to compromise translational initiation. The retinoic-acid- receptor-beta 2 (RAR beta 2) mRNA is such a transcript with a long (461 nucleotides) 5'-UTR that contains five, partially overlapping, upstream open reading frames (uORFs) that precede the major ORF. We have begun to investigate the function of this complex 5'-UTR in transgenic mice, by introducing mutations in the start/stop codons of the uORFs in RAR beta 2-lacZ reporter constructs. When we compared the expression patterns of mutant and wild-type constructs we found that these mutations affected expression of the downstream RAR beta 2-ORF, resulting in an altered regulation of RAR beta 2-lacZ expression in heart and brain. Other tissues were unaffected. RNA analysis of adult tissues demonstrated that the uORFs act at the level of translation; adult brains and hearts of transgenic mice carrying a construct with either the wild-type or a mutant UTR, had the same levels of mRNA, but only the mutant produced protein. Our study outlines an unexpected role for uORFs: control of tissue-specific and developmentally regulated gene expression. PMID:7962071
Auclair, Jessie; Leroux, Dominique; Desseigne, Françoise; Lasset, Christine; Saurin, Jean Christophe; Joly, Marie Odile; Pinson, Stéphane; Xu, Xiao Li; Montmain, Gilles; Ruano, Eric; Navarro, Claudine; Puisieux, Alain; Wang, Qing
2007-11-01
Since the first report by our group in 1999, more than 20 unrelated biallelic mutations in DNA mismatch repair genes (MMR) have been identified. In the present report, we describe two novel cases: one carrying compound heterozygous mutations in the MSH6 gene; and the other, compound heterozygous mutations in the PMS2 gene. Interestingly, the inactivation of one PMS2 allele was likely caused by gene conversion. Although gene conversion has been suggested to be a mutation mechanism underlying PMS2 inactivation, this is the first report of its involvement in a pathogenic mutation. The clinical features of biallelic mutation carriers were similar to other previously described patients, with the presence of café-au-lait spots (CALS), early onset of brain tumors, and colorectal neoplasia. Our data provide further evidence of the existence, although rare, of a distinct recessively inherited syndrome on the basis of MMR constitutional inactivation. The identification of this syndrome should be useful for genetic counseling, especially in families with atypical hereditary nonpolyposis colon cancer (HNPCC) associated with childhood cancers, and for the clinical surveillance of these mutation carriers. 2007 Wiley-Liss, Inc.
Militaru, Mariela S; Popp, Radu A; Trifa, Adrian P
2010-06-01
While classical hereditary haemochromatosis, usually associated with mutations in the HFE gene, has an adult age onset and a long, progressive evolution, juvenile haemochromatosis, most often associated with mutations in the HJV gene, is a more severe, rapidly progressive condition and has an onset before the age of 30. We report a 26-year old woman with a severe iron overload, affected by hypogonadotropic hypogonadism and moderate dilative cardiomyopathy, in whom the molecular analysis revealed a homozygous genotype for G320V mutation in the HJV gene. As juvenile haemochromatosis is a severe disease, death usually occurring from cardiac involvement, an efficient iron removal from the body strategy should be started as soon as possible, in order to prevent irreversible damage.
Adewoye, L O; Worobec, E A
1999-12-01
In response to low extracellular glucose concentration, Pseudomonas aeruginosa induces the expression of the outer membrane carbohydrate-selective OprB porin. The promoter region of the oprB gene was cloned into a lacZ transcriptional fusion vector, and the construct was mobilized into P. aeruginosa OprB-deficient strain, WW100, to evaluate additional environmental factors that influence OprB porin gene expression. Growth temperature, pH of the growth medium, salicylate concentration, and carbohydrate source were found to differentially influence porin expression. This expression pattern was compared to those of whole-cell [14C]glucose uptake under conditions of high osmolarity, ionicity, variable pH, growth temperatures, and carbohydrate source. These studies revealed that the high-affinity glucose transport genes are down-regulated by salicylic acid, differentially regulated by pH and temperature, and are specifically responsive to exogenous glucose induction.
Simple Monitoring of Gene Targeting Efficiency in Human Somatic Cell Lines Using the PIGA Gene
Karnan, Sivasundaram; Konishi, Yuko; Ota, Akinobu; Takahashi, Miyuki; Damdindorj, Lkhagvasuren; Hosokawa, Yoshitaka; Konishi, Hiroyuki
2012-01-01
Gene targeting in most of human somatic cell lines has been labor-intensive because of low homologous recombination efficiency. The development of an experimental system that permits a facile evaluation of gene targeting efficiency in human somatic cell lines is the first step towards the improvement of this technology and its application to a broad range of cell lines. In this study, we utilized phosphatidylinositol glycan anchor biosynthesis class A (PIGA), a gene essential for the synthesis of glycosylphosphatidyl inositol (GPI) anchors, as a reporter of gene targeting events in human somatic cell lines. Targeted disruption of PIGA was quantitatively detected with FLAER, a reagent that specifically binds to GPI anchors. Using this PIGA-based reporter system, we successfully detected adeno-associated virus (AAV)-mediated gene targeting events both with and without promoter-trap enrichment of gene-targeted cell population. The PIGA-based reporter system was also capable of reproducing previous findings that an AAV-mediated gene targeting achieves a remarkably higher ratio of homologous versus random integration (H/R ratio) of targeting vectors than a plasmid-mediated gene targeting. The PIGA-based system also detected an approximately 2-fold increase in the H/R ratio achieved by a small negative selection cassette introduced at the end of the AAV-based targeting vector with a promoter-trap system. Thus, our PIGA-based system is useful for monitoring AAV-mediated gene targeting and will assist in improving gene targeting technology in human somatic cell lines. PMID:23056640
Haase, Santiago; McCarthy, Christina B.; Ferrelli, M. Leticia; Pidre, Matias L.; Sciocco-Cap, Alicia; Romanowski, Victor
2015-01-01
Anticarsia gemmatalis is an important pest in legume crops in South America and it has been successfully controlled using Anticarsia gemmatalis Multiple Nucleopolyhedrovirus (AgMNPV) in subtropical climate zones. Nevertheless, in temperate climates its speed of kill is too slow. Taking this into account, genetic modification of AgMNPV could lead to improvements of its biopesticidal properties. Here we report the generation of a two-component system that allows the production of recombinant AgMNPV. This system is based on a parental AgMNPV in which the polyhedrin gene (polh) was replaced by a bacterial β-galactosidase (lacZ) gene flanked by two target sites for the homing endonuclease I-PpoI. Co-transfection of insect cells with linearized (I-PpoI-digested) parental genome and a transfer vector allowed the restitution of polh and the expression of a heterologous gene upon homologous recombination, with a low background of non-recombinant AgMNPV. The system was validated by constructing a recombinant occlusion-positive (polh+) AgMNPV expressing the green fluorescent protein gene (gfp). This recombinant virus infected larvae normally per os and led to the expression of GFP in cell culture as well as in A. gemmatalis larvae. These results demonstrate that the system is an efficient method for the generation of recombinant AgMNPV expressing heterologous genes, which can be used for manifold purposes, including biotechnological and pharmaceutical applications and the production of orally infectious recombinants with improved biopesticidal properties. PMID:25835531
Regulation of the yeast EKI1-encoded ethanolamine kinase by inositol and choline.
Kersting, Michael C; Choi, Hyeon-Son; Carman, George M
2004-08-20
Regulation of the EKI1-encoded ethanolamine kinase by inositol and choline was examined in Saccharomyces cerevisiae. Transcription of the EKI1 gene was monitored by following the expression of beta-galactosidase activity driven by a P(EKI1)-lacZ reporter gene. The addition of inositol to the growth medium resulted in a dose-dependent decrease in EKI1 expression. Supplementation of choline to inositol-containing growth medium brought about a further decrease in expression, whereas choline supplementation alone had no effect. Analysis of EKI1 expression in ino2Delta, ino4Delta, and opi1Delta mutants indicated that the transcription factors Ino2p, Ino4p, and Opi1p played a role in this regulation. Moreover, mutational analysis showed that the UAS(INO) element in the EKI1 promoter was required for the inositol-mediated regulation. The regulation of EKI1 expression by inositol and choline was confirmed by corresponding changes in ethanolamine kinase mRNA, protein, and activity levels. The repression of ethanolamine kinase by inositol supplementation correlated with a decrease in the incorporation of ethanolamine into CDP-ethanolamine pathway intermediates and into phosphatidylethanolamine and phosphatidylcholine.
Lanktree, Matthew B; Hegele, Robert A
2009-02-26
Despite the recent success of genome-wide association studies (GWASs) in identifying loci consistently associated with coronary artery disease (CAD), a large proportion of the genetic components of CAD and its metabolic risk factors, including plasma lipids, type 2 diabetes and body mass index, remain unattributed. Gene-gene and gene-environment interactions might produce a meaningful improvement in quantification of the genetic determinants of CAD. Testing for gene-gene and gene-environment interactions is thus a new frontier for large-scale GWASs of CAD. There are several anecdotal examples of monogenic susceptibility to CAD in which the phenotype was worsened by an adverse environment. In addition, small-scale candidate gene association studies with functional hypotheses have identified gene-environment interactions. For future evaluation of gene-gene and gene-environment interactions to achieve the same success as the single gene associations reported in recent GWASs, it will be important to pre-specify agreed standards of study design and statistical power, environmental exposure measurement, phenomic characterization and analytical strategies. Here we discuss these issues, particularly in relation to the investigation and potential clinical utility of gene-gene and gene-environment interactions in CAD.
Insulators to improve expression of a 3(')IgH LCR-driven reporter gene in transgenic mouse models.
Guglielmi, Laurence; Le Bert, Marc; Truffinet, Véronique; Cogné, Michel; Denizot, Yves
2003-08-01
A locus control region (LCR) containing four transcriptional enhancers lies downstream of the IgH chain locus. We studied transgenes carrying a 3(')IgH LCR-driven GFP reporter gene for expression and B cell differentiation stage specificity. We also compared transgenes that were or were not flanked by two copies of the beta-globin HS4 insulator, an element defined by its ability to protect transgenes from the influences of surrounding genes at the insertion site. Results indicate that insulators are instrumental in sustaining GFP expression in GFP-3(')LCR transgenic mice when they were included. Flow cytometry experiments reported a strictly B cell specific GFP expression from pre-B cells in bone marrow to mature B cells in spleen. Despite addition of 5(')HS4 insulators to the GFP-3(')LCR construct, complete transgene silencing occurred in some transgenic lines and was systematically observed in ageing animals from all lines.
Different EGFR gene mutations in two patients with synchronous multiple lung cancers: A case report
Sakai, Hiroki; Kimura, Hiroyuki; Tsuda, Masataka; Wakiyama, Yoichi; Miyazawa, Tomoyuki; Marushima, Hideki; Kojima, Koji; Hoshikawa, Masahiro; Takagi, Masayuki; Nakamura, Haruhiko
2017-01-01
Routine clinical and pathological evaluations to determine the relationship between different lesions are often not completely conclusive. Interestingly, detailed genetic analysis of tumor samples may provide important additional information and identify second primary lung cancers. In the present study, we report cases of two synchronous lung adenocarcinomas composed of two distinct pathological subtypes with different EGFR gene mutations: a homozygous deletion in exon 19 of the papillary adenocarcinoma subtype and a point mutation of L858R in exon 21 of the tubular adenocarcinoma. The present report highlights the clinical importance of molecular cancer biomarkers to guide management decisions in cases involving multiple lung tumors. PMID:29090842
Racsa, Lori D; Luu, Hung S; Park, Jason Y; Mitui, Midori; Timmons, Charles F
2014-06-01
Hemoglobin (Hb) Austin was defined in 1977, using amino acid sequencing of samples from 3 unrelated Mexican-Americans, as a substitution of serine for arginine at position 40 of the β-globin chain (Arg40Ser). Its electrophoretic migration on both cellulose acetate (pH 8.4) and citrate agar (pH 6.2) was reported between Hb F and Hb A, and this description persists in reference literature. OBJECTIVES.-To review the clinical features and redefine the diagnostic characteristics of Hb Austin. Eight samples from 6 unrelated individuals and 2 siblings, all with Hispanic surnames, were submitted for abnormal Hb identification between June 2010 and September 2011. High-performance liquid chromatography, isoelectric focusing (IEF), citrate agar electrophoresis, and bidirectional DNA sequencing of the entire β-globin gene were performed. DNA sequencing confirmed all 8 individuals to be heterozygous for Hb Austin (Arg40Ser). Retention time on high-performance liquid chromatography and migration on citrate agar electrophoresis were consistent with that identification. Migration on IEF, however, was not between Hb F and Hb A, as predicted from the report of cellulose acetate electrophoresis. By IEF, Hb Austin migrated anodal to ("faster than") Hb A. Hemoglobin Austin (Arg40Ser) appears on IEF as a "fast," anodally migrating, Hb variant, just as would be expected from its amino acid substitution. The cited historic report is, at best, not applicable to IEF and is probably erroneous. Our observation of 8 cases in 16 months suggests that this variant may be relatively common in some Hispanic populations, making its recognition important. Furthermore, gene sequencing is proving itself a powerful and reliable tool for definitive identification of Hb variants.
Systematic Search for Gene-Gene Interaction Effect on Prostate Cancer Risk
2011-07-01
PLEASE DO NOT RETURN YOUR FORM TO THE ABOVE ADDRESS. 1. REPORT DATE (DD-MM-YYYY) 2 . REPORT TYPE 3. DATES COVERED (From - To) 4. TITLE AND SUBTITLE 5a...identify SNPs in the genome that interact to have stronger effects on PCa risk in the CGEMS GWAS data, 2 ) confirm the gene-gene interaction effect on PCa...for pairs of SNPs implicated in Aim 2 among the remaining 1,893 cases and 781 controls in CAPS, and 4) fine map the genomic regions where SNPs have
He, Xiaoya; Cai, Jinhua; Li, Hao; Liu, Bo; Qin, Yong; Zhong, Yi; Wang, Longlun; Liao, Yifan
2016-11-29
As a promising magnetic resonance imaging (MRI) reporter, ferritin has been used to track cells in vivo; however, its continuous overexpression can be cytotoxic, which restricts its application. In this study, we aimed to develop a switch to turn this genetic reporter "on" or "off" while monitoring cell grafts via MRI. To accomplish this, we genetically modified the ferritin heavy chain (FTH1) with a Tet-On switch and assessed the expression of FTH1 in transduced neuroblastoma cells (SK-N-SH) in vitro and in xenografted tumors in vivo. We found that FTH1 expression induced by doxycycline (Dox) in SK-N-SH-FTH1 cells depended on treatment dose and duration. We successfully detected T2-weighted MRI contrast in cell grafts after switching "on" the reporter gene using Dox, and this contrast disappeared when we switched it "off". The genetic reporter FTH1 can thus be switched "on" or "off" throughout longitudinal monitoring of cell grafts, limiting expression to when MRI contrast is needed. The controllable imaging system we have developed minimizes risks from constitutive reporter gene overexpression and facilitates tumor cell monitoring in vitro and in vivo.
Mesak, Lili R; Mesak, Felix M; Dahl, Michael K
2004-01-01
Background The Bacillus subtilis glucokinase operon was predicted to be comprised of the genes, yqgP (now named gluP), yqgQ, and glcK. We have previously established a role for glcK in glucose metabolism. In the absence of enzymes that phosphorylate glucose, such as GlcK and/or enzyme IIGlc, accumulated cytoplasmic glucose can be transported out of the cell. Genes within the glucokinase operon were not previously known to play a role in glucose transport. Here we describe the expression of gluP and its function in glucose transport. Results We found that transcription of the glucokinase operon was regulated, putatively, by two promoters: σA and σH. Putative σA and σH-recognition sites were located upstream of and within gluP, respectively. Transcriptional glucokinase operon – lacZ fusions and Northern blotting were used to analyze the expression of gluP. GluP was predicted to be an integral membrane protein. Moreover, the prediction of GluP structure revealed interesting signatures: a rhomboid domain and two tetracopeptide repeat (TPR) motifs. Microscopic analysis showed that GluP minus cells were unable to divide completely, resulting in a filamentous phenotype. The cells were grown in either rich or minimal medium. We found GluP may be involved in glucose transport. [14C]-glucose uptake by the GluP minus strain was slightly less than in the wild type. On the other hand, trehalose-derived glucose in the growth medium of the GluP minus strain was detected in very low amounts. Experimental controls comprised of single or multiple genes mutations within the glucose transporting phosphotransferase system. Conclusions gluP seems to be regulated only by a putative σA-dependent promoter. The glucose uptake and export assays suggest that GluP is important for glucose export and may act as an exporter. This also supports the role of the glucokinase operon in glucose utilization. PMID:15050034
Cheng, Ruhong; Yan, Ming; Ni, Cheng; Zhang, Jia; Li, Ming; Yao, Zhirong
2016-10-01
Recently, homozygous mutations in the desmoglein-1 (DSG1) gene and heterozygous mutation in the desmoplakin (DSP) gene have been demonstrated to be associated with severe dermatitis, multiple allergies and metabolic wasting (SAM) syndrome (Mendelian Inheritance in Man no. 615508). We aim to identify the molecular basis for a Chinese pedigree of SAM syndrome. A Chinese pedigree of SAM syndrome was subjected to mutation detection in the DSG1 gene. Sequence analysis of the DSG1 gene and quantitative reverse transcriptase polymerase chain reaction analysis for gene expression of DSG1 using cDNA derived from the epidermis of patients and controls were both performed. Skin biopsies were also taken from patients for pathological study and transmission electron microscopy observation. Novel homozygous splicing mutation c.1892-1delG in the exon-intron border of the DSG1 gene has been demonstrated to be associated with SAM syndrome. We report a new family of SAM syndrome of Asian decent and expand the spectrum of mutations in the DSG1 gene. © 2016 Japanese Dermatological Association.
Activating Hair Follicle Stem Cells via R-spondin2 to Stimulate Hair Growth.
Smith, Andrew A; Li, Jingtao; Liu, Bo; Hunter, Daniel; Pyles, Malcolm; Gillette, Martin; Dhamdhere, Girija R; Abo, Arie; Oro, Anthony; Helms, Jill A
2016-08-01
Wnt signaling is required for the development of the hair follicle, and for inciting the growth (anagen) phase of the hair cycle. Most strategies to enhance Wnt signaling for hair growth create a state of constitutive Wnt activation, which leads to neoplastic transformation of the epithelial hair matrix. Using Axin2(LacZ/+) and Axin2(Cre/+)R26R(mTmG/+) reporter mice and RNA analyses, we show that Wnt signaling is elevated during anagen, is reduced at the onset of catagen, and can be reamplified in the skin and surrounding hair follicles via intradermal injection of recombinant R-spondin2 protein. Using Lgr5(LacZ/+) reporter mice, we demonstrate that this amplified Wnt environment leads to activation of leucine-rich repeat-containing G-protein coupled receptor 5-positive stem cells in the hair follicle. The onset of catagen is repressed by R-spondin2 injection, and the anagen phase persists. As a consequence, hair shafts grow longer. We conclude that R-spondin2 treatment activates hair follicle stem cells and therefore may have therapeutic potential to promote hair growth. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Evaluation of genotoxic potential of neurotoxin anatoxin-a with the use of umuC test.
Sieroslawska, Anna; Rymuszka, Anna
2010-01-01
The aim of this study was to evaluate genotoxicity of anatoxin-a, cyanotoxin of neurotoxic activity. Additionally, other frequently detected cyanotoxin of previously described genotoxic potential, microcystin-LR, was used at the same concentrations, as well as the mixture of both toxins, anatoxin-a and microcystin-LR. Genotoxicity of the toxins was determined with the use of the umuC assay, in which the induction and expression of the umuC - lacZ reporter gene was assessed. The test was conducted on Salmonella typhimurium TA 1535/pSK1002 strain, with and without metabolic transformation. The toxin concentrations were 0.25, 0.5, 1 and 2 µg/ml. The exposure time was 2 h. The highest inefficient concentration of anatoxin-a without metabolic transformation was 0.25 µg/ml, of microcystin-LR was 0.5 µg/ml and in case of the toxin mixture all used concentrations induced the umuC gene. When S9 fraction was added to the samples, no effects were detected. To our knowledge, this is the first report on genotoxic effects of anatoxin-a. Although the study is preliminary and needs further research, however, indicates the new potential activity of the toxin, as well as the possible increase of genotoxicity of other cyanotoxins, more stable in the environment, e.g. microcystin-LR.
Gasmi, Najla; Jacques, Pierre-Etienne; Klimova, Natalia; Guo, Xiao; Ricciardi, Alessandra; Robert, François; Turcotte, Bernard
2014-10-01
In the yeast Saccharomyces cerevisiae, fermentation is the major pathway for energy production, even under aerobic conditions. However, when glucose becomes scarce, ethanol produced during fermentation is used as a carbon source, requiring a shift to respiration. This adaptation results in massive reprogramming of gene expression. Increased expression of genes for gluconeogenesis and the glyoxylate cycle is observed upon a shift to ethanol and, conversely, expression of some fermentation genes is reduced. The zinc cluster proteins Cat8, Sip4, and Rds2, as well as Adr1, have been shown to mediate this reprogramming of gene expression. In this study, we have characterized the gene YBR239C encoding a putative zinc cluster protein and it was named ERT1 (ethanol regulated transcription factor 1). ChIP-chip analysis showed that Ert1 binds to a limited number of targets in the presence of glucose. The strongest enrichment was observed at the promoter of PCK1 encoding an important gluconeogenic enzyme. With ethanol as the carbon source, enrichment was observed with many additional genes involved in gluconeogenesis and mitochondrial function. Use of lacZ reporters and quantitative RT-PCR analyses demonstrated that Ert1 regulates expression of its target genes in a manner that is highly redundant with other regulators of gluconeogenesis. Interestingly, in the presence of ethanol, Ert1 is a repressor of PDC1 encoding an important enzyme for fermentation. We also show that Ert1 binds directly to the PCK1 and PDC1 promoters. In summary, Ert1 is a novel factor involved in the regulation of gluconeogenesis as well as a key fermentation gene. Copyright © 2014 by the Genetics Society of America.
Salmond, G P; Lutkenhaus, J F; Donachie, W D
1980-01-01
We report the identification, cloning, and mapping of a new cell envelope gene, murG. This lies in a group of five genes of similar phenotype (in the order murE murF murG murC ddl) all concerned with peptidoglycan biosynthesis. This group is in a larger cluster of at least 10 genes, all of which are involved in some way with cell envelope growth. Images PMID:6998962
Tao, Ke; Frisch, Janina; Rey-Rico, Ana; Venkatesan, Jagadeesh K; Schmitt, Gertrud; Madry, Henning; Lin, Jianhao; Cucchiarini, Magali
2016-02-01
Articular cartilage has a limited potential for self-healing. Transplantation of genetically modified progenitor cells like bone marrow-derived mesenchymal stem cells (MSCs) is an attractive strategy to improve the intrinsic repair capacities of damaged articular cartilage. In this study, we examined the potential benefits of co-overexpressing the pleiotropic transformation growth factor beta (TGF-β) with the cartilage-specific transcription factor SOX9 via gene transfer with recombinant adeno-associated virus (rAAV) vectors upon the biological activities of human MSCs (hMSCs). Freshly isolated hMSCs were transduced over time with separate rAAV vectors carrying either TGF-β or sox9 in chondrogenically-induced aggregate cultures to evaluate the efficacy and duration of transgene expression and to monitor the effects of rAAV-mediated genetic modification upon the cellular activities (proliferation, matrix synthesis) and chondrogenic differentiation potency compared with control conditions (lacZ treatment, sequential transductions). Significant, prolonged TGF-β/sox9 co-overexpression was achieved in chondrogenically-induced hMSCs upon co-transduction via rAAV for up to 21 days, leading to enhanced proliferative, biosynthetic, and chondrogenic activities relative to control treatments, especially when co-applying the candidate vectors at the highest vector doses tested. Optimal co-administration of TGF-β with sox9 also advantageously reduced hypertrophic differentiation of the cells in the conditions applied here. The present findings demonstrate the possibility of modifying MSCs by combined therapeutic gene transfer as potent future strategies for implantation in clinically relevant animal models of cartilage defects in vivo.
HZE particle radiation induces tissue-specific and p53-dependent mutagenesis in transgenic animals
NASA Technical Reports Server (NTRS)
Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R.
2001-01-01
Transgenic animals, with the integrated target gene, provide a unique approach for measuring and characterizing mutations in any tissue of the animal. We are using the plasmid-based lacZ transgenic mice with different p53 genetic background to examine radiation-induced genetic damage resulting from exposure to heavy particle radiation. We measured lacZ mutation frequencies (MF) in the brain and spleen tissues at various times after exposing animals to an acute dose of 1 Gy of 1GeV/amu iron particles. MF in the spleen of p53+/+ animals increased up to 2.6-fold above spontaneous levels at 8 weeks post irradiation. In contrast, brain MF from the same animals increased 1.7-fold above controls in the same period. In the p53-/- animals, brain MF increased to 2.2-fold above spontaneous levels at 1 week after treatment, but returned to control levels thereafter. Radiation also induced alterations in the spectrum of mutants in both tissues, accompanied by changes in the frequency of mutants with deletions extending past the transgene into mouse genomic DNA. Our results indicate that the accumulation of transgene MF after radiation exposure is dependant on the tissue examined as well as the p53 genetic background of the animals.
Chau, Michael; Forcinito, Patricia; Andrade, Anenisia C; Hegde, Anita; Ahn, Sohyun; Lui, Julian C; Baron, Jeffrey; Nilsson, Ola
2011-08-01
In embryonic growth cartilage, Indian hedgehog (Ihh) and parathyroid hormone-related protein (PTHrP) participate in a negative feedback loop that regulates chondrocyte differentiation. Postnatally, this region undergoes major structural and functional changes. To explore the organization of the Ihh–PTHrP system in postnatal growth plate, we microdissected growth plates of 7-day-old rats into their constituent zones and assessed expression of genes participating in the h–PTHrP feedback loop. Ihh, Patched 1, Smoothened, Gli1, Gli2, Gli3, and Pthr1 were expressed in regions analogous to the expression domains in embryonic growth cartilage. However, PTHrP was expressed in resting zone cartilage, a site that differs from the embryonic source, the periarticular cells. We then used mice in which lacZ has replaced coding sequences of Gli1 and thus serves as a marker for active hedgehog signaling. At 1, 4, 8, and 12 weeks of age, lacZ expression was detected in a pattern analogous to that of embryonic cartilage. The findings support the hypothesis that the embryonic Ihh–PTHrP feedback loop is maintained in the postnatal growth plate except that the source of PTHrP has shifted to a more proximal location in the resting zone.
Purcell, M.K.; Laing, K.J.; Woodson, J.C.; Thorgaard, G.H.; Hansen, J.D.
2009-01-01
The genes encoding the type I and type II interferons (IFNs) have previously been identified in rainbow trout and their proteins partially characterized. These previous studies reported a single type II IFN (rtIFN-??) and three rainbow trout type I IFN genes that are classified into either group I (rtIFN1, rtIFN2) or group II (rtIFN3). In this present study, we report the identification of a novel IFN-?? gene (rtIFN-??2) and a novel type I group II IFN (rtIFN4) in homozygous rainbow trout and predict that additional IFN genes or pseudogenes exist in the rainbow trout genome. Additionally, we provide evidence that short and long forms of rtIFN1 are actively and differentially transcribed in homozygous trout, and likely arose due to alternate splicing of the first exon. Quantitative reverse transcriptase PCR (qRT-PCR) assays were developed to systematically profile all of the rainbow trout IFN transcripts, with high specificity at an individual gene level, in na??ve fish and after stimulation with virus or viral-related molecules. Cloned PCR products were used to ensure the specificity of the qRT-PCR assays and as absolute standards to assess transcript abundance of each gene. All IFN genes were modulated in response to Infectious hematopoietic necrosis virus (IHNV), a DNA vaccine based on the IHNV glycoprotein, and poly I:C. The most inducible of the type I IFN genes, by all stimuli tested, were rtIFN3 and the short transcript form of rtIFN1. Gene expression of rtIFN-??1 and rtIFN-??2 was highly up-regulated by IHNV infection and DNA vaccination but rtIFN-??2 was induced to a greater magnitude. The specificity of the qRT-PCR assays reported here will be useful for future studies aimed at identifying which cells produce IFNs at early time points after infection. ?? 2008 Elsevier Ltd.
Yoshino, T P; Wu, X J; Liu, H D
1998-09-01
Studies were initiated to begin developing a genetic transformation system for cells derived from the freshwater gastropod, Biomphalaria glabrata, an intermediate host of the human blood fluke Schistosoma mansoni. Using a 70-kD heat-shock protein (HSP70) cDNA probe obtained from the B. glabrata embryonic (Bge) cell line, we cloned from Bge cells a complete HSP70 gene including a 1-kb genomic DNA fragment in its 5'-flanking region containing sequences indicative of a HSP promoter. Identified in the 5'-half (416 nucleotides) of this genomic fragment were TATA and CAAT boxes, two putative transcription initiation sites, and a series of palindromic DNA repeats with shared homology to the heat-shock element consensus sequence (Bge HSP70(0.5k) promoter). The 3'-half of this upstream flanking region was comprised of a 508-base intron located immediately 5' of the ATG start codon. To determine the functionality of the putative snail promoter sequence, Bge HSP promoter/luciferase (Luc) reporter gene constructs were introduced into Bge cells by N-(1-(2,3-dioleoyloxy) propyl)-N,N,N-trimethylammonium methylsulfate (DOTAP)-mediated transfection methods, and assayed for Luc activity 48 hr following a 1.5-hr heat-shock treatment (40 degrees C). Compared with control vectors or the Bge HSP70(0.5k/1.0k) promoter constructs at 26 degrees C, a 10- to 300-fold increase in Luc expression was obtained only in the Bge HSP70 promoter/Luc-transfected cells following heat-shock. Results of transfection experiments demonstrate that the Bge HSP70(0.5k) DNA segment contains appropriate promoter sequences for driving temperature-inducible gene expression in the Bge snail cell line. This report represents the first isolation and functional characterization of an inducible promoter from a freshwater gastropod mollusc. Successful transient expression of a foreign reporter gene in Bge cells using a homologous, inducible promoter sequence now paves the way for development of methods for stable
Franke, Lude; Bakel, Harm van; Fokkens, Like; de Jong, Edwin D.; Egmont-Petersen, Michael; Wijmenga, Cisca
2006-01-01
Most common genetic disorders have a complex inheritance and may result from variants in many genes, each contributing only weak effects to the disease. Pinpointing these disease genes within the myriad of susceptibility loci identified in linkage studies is difficult because these loci may contain hundreds of genes. However, in any disorder, most of the disease genes will be involved in only a few different molecular pathways. If we know something about the relationships between the genes, we can assess whether some genes (which may reside in different loci) functionally interact with each other, indicating a joint basis for the disease etiology. There are various repositories of information on pathway relationships. To consolidate this information, we developed a functional human gene network that integrates information on genes and the functional relationships between genes, based on data from the Kyoto Encyclopedia of Genes and Genomes, the Biomolecular Interaction Network Database, Reactome, the Human Protein Reference Database, the Gene Ontology database, predicted protein-protein interactions, human yeast two-hybrid interactions, and microarray coexpressions. We applied this network to interrelate positional candidate genes from different disease loci and then tested 96 heritable disorders for which the Online Mendelian Inheritance in Man database reported at least three disease genes. Artificial susceptibility loci, each containing 100 genes, were constructed around each disease gene, and we used the network to rank these genes on the basis of their functional interactions. By following up the top five genes per artificial locus, we were able to detect at least one known disease gene in 54% of the loci studied, representing a 2.8-fold increase over random selection. This suggests that our method can significantly reduce the cost and effort of pinpointing true disease genes in analyses of disorders for which numerous loci have been reported but for which
Case Report: A Case of Plasmodium falciparum hrp2 and hrp3 Gene Mutation in Bangladesh.
Nima, Maisha Khair; Hougard, Thomas; Hossain, Mohammad Enayet; Kibria, Mohammad Golam; Mohon, Abu Naser; Johora, Fatema Tuj; Rahman, Rajibur; Haque, Rashidul; Alam, Mohammad Shafiul
2017-10-01
Several species of Plasmodium are responsible for causing malaria in humans. Proper diagnoses are crucial to case management, because severity and treatment varies between species. Diagnoses can be made using rapid diagnostic tests (RDTs), which detect Plasmodium proteins. Plasmodium falciparum causes the most virulent cases of malaria, and P. falciparum histidine-rich protein 2 (PfHRP2) is a common target of falciparum malaria RDTs. Here we report a case in which a falciparum malaria patient in Bangladesh tested negative on PfHRP2-based RDTs. The negative results can be attributed to a deletion of part of the pfhrp2 gene and frameshift mutations in both pfhrp2 and pfhrp3 gene. This finding may have implications for malaria diagnostics and case management in Bangladesh and other regions of South Asia.
Fusco, Carlo; Spagnoli, Carlotta; Salerno, Grazia Gabriella; Pavlidis, Elena; Frattini, Daniele; Pisani, Francesco
2017-10-27
Hereditary neuropathy with liability to pressure palsy (HNPP) is an autosomal dominant disorder most commonly presenting with acute-onset, non-painful focal sensory and motor mononeuropathy. Approximately 80% of patients carry a 1.5 Mb deletion of chromosome 17p11.2 involving the peripheral myelin protein 22 gene (PMP22), the same duplicated in Charcot-Marie-Tooth 1A patients. In a small proportion of patients the disease is caused by PMP22 point mutations. We report on a familial case harbouring a new point mutation in the PMP22 gene. The proband is a 4-years-old girl with acute onset of focal numbness and weakness in her right hand. Electroneurography demonstrated transient sensory and motor radial nerves involvement. In her father, reporting chronic symptoms (cramps and exercise-induced myalgia), we uncovered mild atrophy and areflexia on clinical examination and a mixed (predominantly demyelinating) polyneuropathy with sensory-motor involvement on electrophysiological study. Both carried a nucleotidic substitution c.178 + 2 T > C on intron 3 of the PMP22 gene, involving the splicing donor site, not reported on databases but predicted to be likely pathogenic. We described a previously unreported point mutation in PMP22 gene, which led to the development of a HNPP phenotype in a child and her father. In children evaluated for a sensory and motor transient episode, HNPP disorder due to PMP22 mutations should be suspected. Clinical and electrophysiological studies should be extended to all family members even in the absence of previous episodes suggestive for HNPP.
Sun, Yueming K; Flematti, Gavin R; Smith, Steven M; Waters, Mark T
2016-01-01
Karrikins are potent germination stimulants generated by the combustion of plant matter. Treatment of Arabidopsis with karrikins triggers a signaling process that is dependent upon a putative receptor protein KARRIKIN INSENSITIVE 2 (KAI2). KAI2 is a homolog of DWARF 14 (D14), the receptor for endogenous strigolactone hormones. Genetic analyses suggest that KAI2 also perceives endogenous signal(s) that are not strigolactones. Activation of KAI2 by addition of karrikins to Arabidopsis plants induces expression of transcripts including D14-LIKE 2 ( DLK2 ). We constructed the synthetic reporter gene DLK2 : LUC in Arabidopsis , which comprises the firefly luciferase gene ( LUC ) driven by the DLK2 promoter. Here we describe a luminescence-based reporter assay with Arabidopsis seeds to detect chemical signals that can activate the KAI2 signaling pathway. We demonstrate that the DLK2 : LUC assay can selectively and sensitively detect karrikins and a functionally similar synthetic strigolactone analog. Crucially we show that crude extracts from Arabidopsis leaves can also activate DLK2 : LUC in a KAI2-dependent manner. Our work provides the first direct evidence for the existence of endogenous chemical signals that can activate the KAI2-mediated signaling pathway in Arabidopsis . This sensitive reporter system can now be used for the bioassay-guided purification and identification of putative endogenous KAI2 ligands or their precursors, and endogenous compounds that might modulate the KAI2 signaling pathway.
Sun, Yueming K.; Flematti, Gavin R.; Smith, Steven M.; Waters, Mark T.
2016-01-01
Karrikins are potent germination stimulants generated by the combustion of plant matter. Treatment of Arabidopsis with karrikins triggers a signaling process that is dependent upon a putative receptor protein KARRIKIN INSENSITIVE 2 (KAI2). KAI2 is a homolog of DWARF 14 (D14), the receptor for endogenous strigolactone hormones. Genetic analyses suggest that KAI2 also perceives endogenous signal(s) that are not strigolactones. Activation of KAI2 by addition of karrikins to Arabidopsis plants induces expression of transcripts including D14-LIKE 2 (DLK2). We constructed the synthetic reporter gene DLK2:LUC in Arabidopsis, which comprises the firefly luciferase gene (LUC) driven by the DLK2 promoter. Here we describe a luminescence-based reporter assay with Arabidopsis seeds to detect chemical signals that can activate the KAI2 signaling pathway. We demonstrate that the DLK2:LUC assay can selectively and sensitively detect karrikins and a functionally similar synthetic strigolactone analog. Crucially we show that crude extracts from Arabidopsis leaves can also activate DLK2:LUC in a KAI2-dependent manner. Our work provides the first direct evidence for the existence of endogenous chemical signals that can activate the KAI2-mediated signaling pathway in Arabidopsis. This sensitive reporter system can now be used for the bioassay-guided purification and identification of putative endogenous KAI2 ligands or their precursors, and endogenous compounds that might modulate the KAI2 signaling pathway. PMID:27994609
Reporter gene assay for fish-killing activity produced by Pfiesteria piscicida.
Fairey, E R; Edmunds, J S; Deamer-Melia, N J; Glasgow, H; Johnson, F M; Moeller, P R; Burkholder, J M; Ramsdell, J S
1999-01-01
Collaborative studies were performed to develop a functional assay for fish-killing activity produced by Pfiesteria piscicida. Eight cell lines were used to screen organic fractions and residual water fraction by using a 3-[4, 5-dimethylthiazol-(2-4)]-diphenyltetrazolium bromide cytotoxicity assay. Diethyl ether and a residual water fraction were cytotoxic to several cell lines including rat pituitary (GH(4)C(1)) cells. Residual water as well as preextracted culture water containing P. piscicida cells induced c-fos-luciferase expressed in GH(4)C(1) cells with a rapid time course of induction and sensitive detection. The reporter gene assay detected activity in toxic isolates of P. piscicida from several North Carolina estuaries in 1997 and 1998 and may also be suitable for detecting toxic activity in human and animal serum. Images Figure 1 Figure 2 Figure 3 Figure 4 PMID:10464070
Yu, Zhanjiang; Yang, Xiaoda; Wang, Kui
2006-06-01
The aim of this work is to define the relationship between heat shock protein (HSP) and reactive oxygen species (ROS) in the cells exposed to different concentrations of metal ions, and to evaluate a new method for tracing the dynamic levels of cellular reactive oxygen species using a HSE-SEAP reporter gene. The expression of heat shock protein was measured using a secreted alkaline phosphatase (SEAP) reporter gene transformed into HeLa cell strain, the levels of superoxide anion (O(2)(-)) and hydrogen peroxide (H(2)O(2)) were determined by NBT reduction assay and DCFH staining flow cytometry (FCM), respectively. The experimental results demonstrated that the expression of heat shock protein induced by metal ions was linearly related to the cellular superoxide anion level before cytotoxic effects were observed, but not related to the cellular hydrogen peroxide level. The experimental results suggested that metal ions might induce heat shock protein by elevating cellular superoxide anion level, and thus the expression of heat shock protein indicated by the HSE-SEAP reporter gene can be an effective model for monitoring the dynamic level of superoxide anion and early metal-induced oxidative stress/cytotoxicity.
Yadav, Kamlesh Kumar; Rajasekharan, Ram
2016-11-01
PHM8 is a very important enzyme in nonpolar lipid metabolism because of its role in triacylglycerol (TAG) biosynthesis under phosphate stress conditions. It is positively regulated by the PHO4 transcription factor under low phosphate conditions; however, its regulation has not been explored under normal physiological conditions. General control nonderepressible (GCN4), a basic leucine-zipper transcription factor activates the transcription of amino acids, purine biosynthesis genes and many stress response genes under various stress conditions. In this study, we demonstrate that the level of TAG is regulated by the transcription factor GCN4. GCN4 directly binds to its consensus recognition sequence (TGACTC) in the PHM8 promoter and controls its expression. The analysis of cells expressing the P PHM8 -lacZ reporter gene showed that mutations (TGACTC-GGGCCC) in the GCN4-binding sequence caused a significant increase in β-galactosidase activity. Mutation in the GCN4 binding sequence causes an increase in PHM8 expression, lysophosphatidic acid phosphatase activity and TAG level. PHM8, in conjunction with DGA1, a mono- and diacylglycerol transferase, controls the level of TAG. These results revealed that GCN4 negatively regulates PHM8 and that deletion of GCN4 causes de-repression of PHM8, which is responsible for the increased TAG content in gcn4∆ cells.
Decoding genes with coexpression networks and metabolomics - 'majority report by precogs'.
Saito, Kazuki; Hirai, Masami Y; Yonekura-Sakakibara, Keiko
2008-01-01
Following the sequencing of whole genomes of model plants, high-throughput decoding of gene function is a major challenge in modern plant biology. In view of remarkable technical advances in transcriptomics and metabolomics, integrated analysis of these 'omics' by data-mining informatics is an excellent tool for prediction and identification of gene function, particularly for genes involved in complicated metabolic pathways. The availability of Arabidopsis public transcriptome datasets containing data of >1000 microarrays reinforces the potential for prediction of gene function by transcriptome coexpression analysis. Here, we review the strategy of combining transcriptome and metabolome as a powerful technology for studying the functional genomics of model plants and also crop and medicinal plants.
Sharma, Sanjai; Murai, Fukashi; Miyanohara, Atsushi; Friedmann, Theodore
1997-01-01
Retrovirus packaging cell lines expressing the Moloney murine leukemia virus gag and pol genes but lacking virus envelope genes produce virus-like particles constitutively, whether or not they express a transcript from an integrated retroviral provirus. In the absence of a proviral transcript, the assembled particles contain processed gag and reverse transcriptase, and particles made by cells expressing an integrated lacZ provirus also contain viral RNA. The virus-like particles from both cell types are enveloped and are secreted/budded into the extracellular space but are noninfectious. Their physicochemical properties are similar to those of mature retroviral particles. The noninfectious gag pol RNA particles can readily be made infectious by the addition of lipofection reagents to produce preparations with titers of up to 105 colony-forming units per ml. PMID:9380714
Over-expression of phage HK022 Nun protein is toxic for Escherichia coli
Uc-Mass, Augusto; Khodursky, Arkady; Brown, Lewis; Gottesman, Max E.
2008-01-01
The Nun protein of coliphage HK022 excludes superinfecting λ phage. Nun recognizes and binds to the N utilization (nut) sites on phage λ nascent RNA and induces transcription termination. Over-expression of Nun from a high-copy plasmid is toxic for E.coli, despite the fact that nut sites are not encoded in the E.coli genome. Cells expressing Nun cannot exit stationary phase. Toxicity is related to transcription termination, since host and nun mutations that block termination also suppress cell killing. Nun inhibits expression of wild-type lacZ, but not lacZ expressed from the Crp/cAMP–independent lacUV5 promoter. Microarray and proteomics analyses show Nun down-regulates crp and tnaA. Crp over-expression and high indole concentrations partially reverse Nun-mediated toxicity and restore lacZ expression. PMID:18571198
Immunoglobulin λ Gene Rearrangement Can Precede κ Gene Rearrangement
Berg, Jörg; Mcdowell, Mindy; Jäck, Hans-Martin; ...
1990-01-01
Imore » mmunoglobulin genes are generated during differentiation of B lymphocytes by joining gene segments. A mouse pre-B cell contains a functional immunoglobulin heavy-chain gene, but no light-chain gene. Although there is only one heavy-chain locus, there are two lightchain loci: κ and λ .t has been reported that κ loci in the germ-line configuration are never (in man) or very rarely (in the mouse) present in cells with functionally rearranged λ -chain genes. Two explanations have been proposed to explain this: (a) the ordered rearrangement theory, which postulates that light-chain gene rearrangement in the pre-B cell is first attempted at the κ locus, and that only upon failure to produce a functional κ chain is there an attempt to rearrange the λ locus; and (b) the stochastic theory, which postulates that rearrangement at the λ locus proceeds at a rate that is intrinsically much slower than that at the κ locus. We show here that λ -chain genes are generated whether or not the κ locus has lost its germ-line arrangement, a result that is compatible only with the stochastic theory.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fields, C.A.
1996-06-01
The objective of this project is the development of practical software to automate the identification of genes in anonymous DNA sequences from the human, and other higher eukaryotic genomes. A software system for automated sequence analysis, gm (gene modeler) has been designed, implemented, tested, and distributed to several dozen laboratories worldwide. A significantly faster, more robust, and more flexible version of this software, gm 2.0 has now been completed, and is being tested by operational use to analyze human cosmid sequence data. A range of efforts to further understand the features of eukaryoyic gene sequences are also underway. This progressmore » report also contains papers coming out of the project including the following: gm: a Tool for Exploratory Analysis of DNA Sequence Data; The Human THE-LTR(O) and MstII Interspersed Repeats are subfamilies of a single widely distruted highly variable repeat family; Information contents and dinucleotide compostions of plant intron sequences vary with evolutionary origin; Splicing signals in Drosophila: intron size, information content, and consensus sequences; Integration of automated sequence analysis into mapping and sequencing projects; Software for the C. elegans genome project.« less
Chronology of Islet Differentiation Revealed By Temporal Cell Labeling
Miyatsuka, Takeshi; Li, Zhongmei; German, Michael S.
2009-01-01
OBJECTIVE Neurogenin 3 plays a pivotal role in pancreatic endocrine differentiation. Whereas mouse models expressing reporters such as eGFP or LacZ under the control of the Neurog3 gene enable us to label cells in the pancreatic endocrine lineage, the long half-life of most reporter proteins makes it difficult to distinguish cells actively expressing neurogenin 3 from differentiated cells that have stopped transcribing the gene. RESEARCH DESIGN AND METHODS In order to separate the transient neurogenin 3 –expressing endocrine progenitor cells from the differentiating endocrine cells, we developed a mouse model (Ngn3-Timer) in which DsRed-E5, a fluorescent protein that shifts its emission spectrum from green to red over time, was expressed transgenically from the NEUROG3 locus. RESULTS In the Ngn3-Timer embryos, green-dominant cells could be readily detected by microscopy or flow cytometry and distinguished from green/red double-positive cells. When fluorescent cells were sorted into three different populations by a fluorescence-activated cell sorter, placed in culture, and then reanalyzed by flow cytometry, green-dominant cells converted to green/red double-positive cells within 6 h. The sorted cell populations were then used to determine the temporal patterns of expression for 145 transcriptional regulators in the developing pancreas. CONCLUSIONS The precise temporal resolution of this model defines the narrow window of neurogenin 3 expression in islet progenitor cells and permits sequential analyses of sorted cells as well as the testing of gene regulatory models for the differentiation of pancreatic islet cells. PMID:19478145
An intronic microRNA silences genes that are functionally antagonistic to its host gene.
Barik, Sailen
2008-09-01
MicroRNAs (miRNAs) are short noncoding RNAs that down-regulate gene expression by silencing specific target mRNAs. While many miRNAs are transcribed from their own genes, nearly half map within introns of 'host' genes, the significance of which remains unclear. We report that transcriptional activation of apoptosis-associated tyrosine kinase (AATK), essential for neuronal differentiation, also generates miR-338 from an AATK gene intron that silences a family of mRNAs whose protein products are negative regulators of neuronal differentiation. We conclude that an intronic miRNA, transcribed together with the host gene mRNA, may serve the interest of its host gene by silencing a cohort of genes that are functionally antagonistic to the host gene itself.
Gene-environment interactions in cancer epidemiology: a National Cancer Institute Think Tank report.
Hutter, Carolyn M; Mechanic, Leah E; Chatterjee, Nilanjan; Kraft, Peter; Gillanders, Elizabeth M
2013-11-01
Cancer risk is determined by a complex interplay of genetic and environmental factors. Genome-wide association studies (GWAS) have identified hundreds of common (minor allele frequency [MAF] > 0.05) and less common (0.01 < MAF < 0.05) genetic variants associated with cancer. The marginal effects of most of these variants have been small (odds ratios: 1.1-1.4). There remain unanswered questions on how best to incorporate the joint effects of genes and environment, including gene-environment (G × E) interactions, into epidemiologic studies of cancer. To help address these questions, and to better inform research priorities and allocation of resources, the National Cancer Institute sponsored a "Gene-Environment Think Tank" on January 10-11, 2012. The objective of the Think Tank was to facilitate discussions on (1) the state of the science, (2) the goals of G × E interaction studies in cancer epidemiology, and (3) opportunities for developing novel study designs and analysis tools. This report summarizes the Think Tank discussion, with a focus on contemporary approaches to the analysis of G × E interactions. Selecting the appropriate methods requires first identifying the relevant scientific question and rationale, with an important distinction made between analyses aiming to characterize the joint effects of putative or established genetic and environmental factors and analyses aiming to discover novel risk factors or novel interaction effects. Other discussion items include measurement error, statistical power, significance, and replication. Additional designs, exposure assessments, and analytical approaches need to be considered as we move from the current small number of success stories to a fuller understanding of the interplay of genetic and environmental factors. © 2013 WILEY PERIODICALS, INC.
1994-01-01
JNM1, a novel gene on chromosome XIII in the yeast Saccharomyces cerevisiae, is required for proper nuclear migration. jnm1 null mutants have a temperature-dependent defect in nuclear migration and an accompanying alteration in astral microtubules. At 30 degrees C, a significant proportion of the mitotic spindles is not properly located at the neck between the mother cell and the bud. This defect is more severe at low temperature. At 11 degrees C, 60% of the cells accumulate with large buds, most of which have two DAPI staining regions in the mother cell. Although mitosis is delayed and nuclear migration is defective in jnm1 mutant, we rarely observe more than two nuclei in a cell, nor do we frequently observe anuclear cells. No loss of viability is observed at 11 degrees C and cells continue to grow exponentially with increased doubling time. At low temperature the large budded cells of jnm1 mutants exhibit extremely long astral microtubules that often wind around the periphery of the cell. jnm1 mutants are not defective in chromosome segregation during mitosis, as assayed by the rate of chromosome loss, or nuclear migration during conjugation, as assayed by the rate of mating and cytoduction. The phenotype of a jnm1 mutant is strikingly similar to that for mutants in the dynein heavy chain gene (Eshel, D., L. A. Urrestarazu, S. Vissers, J.-C. Jauniaux, J. C. van Vliet-Reedijk, R. J. Plants, and I. R. Gibbons. 1993. Proc. Natl. Acad. Sci. USA. 90:11172-11176; Li, Y. Y., E. Yeh, T. Hays, and K. Bloom. 1993. Proc. Natl. Acad. Sci. USA. 90:10096-10100). The JNM1 gene product is predicted to encode a 44-kD protein containing three coiled coil domains. A JNM1:lacZ gene fusion is able to complement the cold sensitivity and microtubule phenotype of a jnm1 deletion strain. This hybrid protein localizes to a single spot in the cell, most often near the spindle pole body in unbudded cells and in the bud in large budded cells. Together these results point to a specific role
Zammaretti, Francesca; Panzica, Giancarlo; Eva, Carola
2007-01-01
In this study we investigated whether long-term consumption of a moderate/high fat (MHF), high-energy diet can affect the gene expression of the Y1 receptor (Y1R) for neuropeptide Y (NPY) in the dorsomedial (DMH), ventromedial (VMH), arcuate (ARC) and paraventricular (PVN) hypothalamic nuclei of male and female Y1R/LacZ transgenic mice, carrying the murine Y1R promoter linked to the LacZ gene. MHF diet-fed male mice showed an increased consumption of metabolizable energy that was associated with a significant increase in body weight as compared with chow-fed controls. In parallel, consumption of a MHF diet for 8 weeks significantly decreased Y1R/LacZ transgene expression in the DMH and VMH of male mice whereas no changes were found in the ARC and PVN. Leptin treatment reduced body weight of both MHF diet- and chow-fed male mice but failed to prevent the decrease in Y1R/LacZ transgene expression apparent in the DMH and VMH of male mice after 8 weeks of MHF diet intake. Conversely, no significant changes of metabolizable energy intake, body weight or hypothalamic β-galactosidase expression were found in MHF diet-fed female Y1R/LacZ transgenic mice. A gender-related difference of Y1R/LacZ transgenic mice was also observed in response to leptin treatment that failed to decrease body weight of both MHF diet- and chow-fed female mice. Results herein demonstrate that Y1R/LacZ FVB mice show a sexual dimorphism both on energy intake and on nucleus-specific regulation of the NPY Y1R system in the hypothalamus. Overall, these results provide new insights into the mechanism by which diet composition affects the hypothalamic circuit that controls energy homeostasis. PMID:17584829
Pine Gene Discovery Project - Final Report - 08/31/1997 - 02/28/2001
DOE Office of Scientific and Technical Information (OSTI.GOV)
Whetten, R. W.; Sederoff, R. R.; Kinlaw, C.
2001-04-30
Integration of pines into the large scope of plant biology research depends on study of pines in parallel with study of annual plants, and on availability of research materials from pine to plant biologists interested in comparing pine with annual plant systems. The objectives of the Pine Gene Discovery Project were to obtain 10,000 partial DNA sequences of genes expressed in loblolly pine, to determine which of those pine genes were similar to known genes from other organisms, and to make the DNA sequences and isolated pine genes available to plant researchers to stimulate integration of pines into the widermore » scope of plant biology research. Those objectives have been completed, and the results are available to the public. Requests for pine genes have been received from a number of laboratories that would otherwise not have included pine in their research, indicating that progress is being made toward the goal of integrating pine research into the larger molecular biology research community.« less
Androgen-responsive gene database: integrated knowledge on androgen-responsive genes.
Jiang, Mei; Ma, Yunsheng; Chen, Congcong; Fu, Xuping; Yang, Shu; Li, Xia; Yu, Guohua; Mao, Yumin; Xie, Yi; Li, Yao
2009-11-01
Androgen signaling plays an important role in many biological processes. Androgen Responsive Gene Database (ARGDB) is devoted to providing integrated knowledge on androgen-controlled genes. Gene records were collected on the basis of PubMed literature collections. More than 6000 abstracts and 950 original publications were manually screened, leading to 1785 human genes, 993 mouse genes, and 583 rat genes finally included in the database. All the collected genes were experimentally proved to be regulated by androgen at the expression level or to contain androgen-responsive regions. For each gene important details of the androgen regulation experiments were collected from references, such as expression change, androgen-responsive sequence, response time, tissue/cell type, experimental method, ligand identity, and androgen amount, which will facilitate further evaluation by researchers. Furthermore, the database was integrated with multiple annotation resources, including National Center for Biotechnology Information, Gene Ontology, and Kyoto Encyclopedia of Genes and Genomes pathway, to reveal the biological characteristics and significance of androgen-regulated genes. The ARGDB web site is mainly composed of the Browse, Search, Element Scan, and Submission modules. It is user friendly and freely accessible at http://argdb.fudan.edu.cn. Preliminary analysis of the collected data was performed. Many disease pathways, such as prostate carcinogenesis, were found to be enriched in androgen-regulated genes. The discovered androgen-response motifs were similar to those in previous reports. The analysis results are displayed in the web site. In conclusion, ARGDB provides a unified gateway to storage, retrieval, and update of information on androgen-regulated genes.
Yang, Jinfeng; Wang, Nan; Chen, Deying; Yu, Jiong; Pan, Qiaoling; Wang, Dan; Liu, Jingqi; Shi, Xiaowei; Dong, Xiaotian; Cao, Hongcui; Li, Liang; Li, Lanjuan
2017-01-01
Green fluorescent protein (GFP) is widely used as a reporter gene in regenerative medicine research to label and track stem cells. Here, we examined whether expressing GFP gene may impact the metabolism of human placental mesenchymal stem cells (hPMSCs). The GFP gene was transduced into hPMSCs using lentiviral-based infection to establish GFP + hPMSCs. A sensitive 13 C/ 12 C-dansyl labeling LC-MS method targeting the amine/phenol submetabolome was used for in-depth cell metabolome profiling. A total of 1151 peak pairs or metabolites were detected from 12 LC-MS runs. Principal component analysis and partial least squares discriminant analysis showed poor separation, and the volcano plots demonstrated that most of the metabolites were not significantly changed when hPMSCs were tagged with GFP. Overall, 739 metabolites were positively or putatively identified. Only 11 metabolites showed significant changes. Metabolic pathway analyses indicated that three of the identified metabolites were involved in nine pathways. However, these metabolites are unlikely to have a large impact on the metabolic pathways due to their nonessential roles and limited hits in pathway analysis. This study indicated that the expression of ectopic GFP reporter gene did not significantly alter the metabolomics pathways covered by the amine/phenol submetabolome.
Thomas, Paul D.; Wood, Valerie; Mungall, Christopher J.; Lewis, Suzanna E.; Blake, Judith A.
2012-01-01
A recent paper (Nehrt et al., PLoS Comput. Biol. 7:e1002073, 2011) has proposed a metric for the “functional similarity” between two genes that uses only the Gene Ontology (GO) annotations directly derived from published experimental results. Applying this metric, the authors concluded that paralogous genes within the mouse genome or the human genome are more functionally similar on average than orthologous genes between these genomes, an unexpected result with broad implications if true. We suggest, based on both theoretical and empirical considerations, that this proposed metric should not be interpreted as a functional similarity, and therefore cannot be used to support any conclusions about the “ortholog conjecture” (or, more properly, the “ortholog functional conservation hypothesis”). First, we reexamine the case studies presented by Nehrt et al. as examples of orthologs with divergent functions, and come to a very different conclusion: they actually exemplify how GO annotations for orthologous genes provide complementary information about conserved biological functions. We then show that there is a global ascertainment bias in the experiment-based GO annotations for human and mouse genes: particular types of experiments tend to be performed in different model organisms. We conclude that the reported statistical differences in annotations between pairs of orthologous genes do not reflect differences in biological function, but rather complementarity in experimental approaches. Our results underscore two general considerations for researchers proposing novel types of analysis based on the GO: 1) that GO annotations are often incomplete, potentially in a biased manner, and subject to an “open world assumption” (absence of an annotation does not imply absence of a function), and 2) that conclusions drawn from a novel, large-scale GO analysis should whenever possible be supported by careful, in-depth examination of examples, to help ensure the
Parashurama, Natesh; Ahn, Byeong-Cheol; Ziv, Keren; Ito, Ken; Paulmurugan, Ramasamy; Willmann, Jürgen K.; Chung, Jaehoon; Ikeno, Fumiaki; Swanson, Julia C.; Merk, Denis R.; Lyons, Jennifer K.; Yerushalmi, David; Teramoto, Tomohiko; Kosuge, Hisanori; Dao, Catherine N.; Ray, Pritha; Patel, Manishkumar; Chang, Ya-fang; Mahmoudi, Morteza; Cohen, Jeff Eric; Goldstone, Andrew Brooks; Habte, Frezghi; Bhaumik, Srabani; Yaghoubi, Shahriar; Robbins, Robert C.; Dash, Rajesh; Yang, Phillip C.; Brinton, Todd J.; Yock, Paul G.; McConnell, Michael V.
2016-01-01
Purpose To use multimodality reporter-gene imaging to assess the serial survival of marrow stromal cells (MSC) after therapy for myocardial infarction (MI) and to determine if the requisite preclinical imaging end point was met prior to a follow-up large-animal MSC imaging study. Materials and Methods Animal studies were approved by the Institutional Administrative Panel on Laboratory Animal Care. Mice (n = 19) that had experienced MI were injected with bone marrow–derived MSC that expressed a multimodality triple fusion (TF) reporter gene. The TF reporter gene (fluc2-egfp-sr39ttk) consisted of a human promoter, ubiquitin, driving firefly luciferase 2 (fluc2), enhanced green fluorescent protein (egfp), and the sr39tk positron emission tomography reporter gene. Serial bioluminescence imaging of MSC-TF and ex vivo luciferase assays were performed. Correlations were analyzed with the Pearson product-moment correlation, and serial imaging results were analyzed with a mixed-effects regression model. Results Analysis of the MSC-TF after cardiac cell therapy showed significantly lower signal on days 8 and 14 than on day 2 (P = .011 and P = .001, respectively). MSC-TF with MI demonstrated significantly higher signal than MSC-TF without MI at days 4, 8, and 14 (P = .016). Ex vivo luciferase activity assay confirmed the presence of MSC-TF on days 8 and 14 after MI. Conclusion Multimodality reporter-gene imaging was successfully used to assess serial MSC survival after therapy for MI, and it was determined that the requisite preclinical imaging end point, 14 days of MSC survival, was met prior to a follow-up large-animal MSC study. © RSNA, 2016 Online supplemental material is available for this article. PMID:27308957
Long, Melissa C.; Leong, Vivian; Schaffer, Priscilla A.; Spencer, Charlotte A.; Rice, Stephen A.
1999-01-01
Herpes simplex virus type 1 (HSV-1) infection alters the phosphorylation of the large subunit of RNA polymerase II (RNAP II), resulting in the depletion of the hypophosphorylated and hyperphosphorylated forms of this polypeptide (known as IIa and IIo, respectively) and induction of a novel, alternatively phosphorylated form (designated IIi). We previously showed that the HSV-1 immediate-early protein ICP22 is involved in this phenomenon, since induction of IIi and depletion of IIa are deficient in cells infected with 22/n199, an HSV-1 ICP22 nonsense mutant (S. A. Rice, M. C. Long, V. Lam, P. A. Schaffer, and C. A. Spencer, J. Virol. 69:5550–5559, 1995). However, depletion of IIo still occurs in 22/n199-infected cells. This suggests either that another viral gene product affects the RNAP II large subunit or that the truncated ICP22 polypeptide encoded by 22/n199 retains residual activity which leads to IIo depletion. To distinguish between these possibilities, we engineered an HSV-1 ICP22 null mutant, d22-lacZ, and compared it to 22/n199. The two mutants are indistinguishable in their effects on the RNAP II large subunit, suggesting that an additional viral gene product is involved in altering RNAP II. Two candidates are UL13, a protein kinase which has been implicated in ICP22 phosphorylation, and the virion host shutoff (Vhs) factor, the expression of which is positively regulated by ICP22 and UL13. To test whether UL13 is involved, a UL13-deficient viral mutant, d13-lacZ, was engineered. This mutant was defective in IIi induction and IIa depletion, displaying a phenotype very similar to that of d22-lacZ. In contrast, a Vhs mutant had effects that were indistinguishable from wild-type HSV-1. Therefore, UL13 but not the Vhs function plays a role in modifying the RNAP II large subunit. To study the potential role of UL13 in viral transcription, we carried out nuclear run-on transcription analyses in infected human embryonic lung cells. Infections with either UL13
Generation and characterization of Atoh1-Cre knock-in mouse line
Yang, Hua; Xie, Xiaoling; Deng, Min; Chen, Xiaowei; Gan, Lin
2010-01-01
Summary Atoh1 encodes a basic helix-loop-helix (bHLH) transcription factor required for the development of the inner ear sensory epithelia, the dorsal spinal cord, brainstem, cerebellum, and intestinal secretory cells. In this study to create a genetic tool for the research on gene function in the ear sensory organs, we generated an Atoh1-Cre knock-in mouse line by replacing the entire Atoh1 coding sequences with the Cre coding sequences. Atoh1Cre/+mice were viable, fertile, and displayed no visible defects whereas the Atoh1Cre/Cremice died perinatally. The spatiotemporal activities of Cre recombinase were examined by crossing Atoh1-Cre mice with the R26R-lacZ conditional reporter mice. Atoh1-Cre activities were detected in the developing inner ear, the hindbrain, the spinal cord, and the intestine. In the inner ear, Atoh1-Cre activities were confined to the sensory organs in which lacZ expression is detected in nearly all of the hair cells and in many supporting cells. Thus, Atoh1-Cre mouse line serves as a useful tool for the functional study of genes in the inner ear. In addition, our results demonstrate that Atoh1 is expressed in the common progenitors destined for both hair and supporting cells. PMID:20533400
Why study gene-environment interactions?
USDA-ARS?s Scientific Manuscript database
PURPOSE OF REVIEW: We examine the reasons for investigating gene-environment interactions and address recent reports evaluating interactions between genes and environmental modulators in relation to cardiovascular disease and its common risk factors. RECENT FINDINGS: Studies focusing on smoking, phy...
Picker, Alexander; Scholpp, Steffen; Böhli, Heike; Takeda, Hiroyuki; Brand, Michael
2002-07-01
The pax2.1 gene encodes a paired-box transcription factor that is one of the earliest genes to be specifically activated in development of the midbrain and midbrain-hindbrain boundary (MHB), and is required for the development and organizer activity of this territory. To understand how this spatially restricted transcriptional activity of pax2.1 is achieved, we have isolated and characterized the pax2.1-promoter using a lacZ and a GFP reporter gene in transient injection assays and transgenic lines. Stable transgenic expression of this reporter gene shows that a 5.3-kb fragment of the 5' region contains most, but not all, elements required for driving pax2.1 expression. The expressing tissues include the MHB, hindbrain, spinal cord, ear and pronephros. Transgene activation in the pronephros and developing ear suggests that these pax2.1-expressing tissues are composed of independently regulated subdomains. In addition, ectopic but spatially restricted activation of the reporter genes in rhombomeres 3 and 5 and in the forebrain, which do not normally express endogenous pax2.1, demonstrates the importance of negative regulation of pax2.1. Comparison of transgene expression in wild-type and homozygous pax2.1 mutant no isthmus (noi) embryos reveals that the transgene contains control element(s) for a novel, positive transcriptional feedback loop in MHB development. Transcription of endogenous pax2.1 at the MHB is known to be initially Pax2.1 independent, during activation in late gastrulation. In contrast, transgene expression requires the endogenous Pax2.1 function. Transplantations, mRNA injections and morpholino knock-down experiments show that this feedback regulation of pax2.1 transcription occurs cell-autonomously, and that it requires eng2 and eng3 as known targets for Pax2.1 regulation. We suggest that this novel feedback loop may allow continuation of pax2.1 expression, and hence development of the MHB organizer, to become independent of the patterning
Case report: value of gene expression profiling in the diagnosis of atypical neuroblastoma.
Harttrampf, Anne C; Chen, Qingrong; Jüttner, Eva; Geiger, Julia; Vansant, Gordon; Khan, Javed; Kontny, Udo
2017-08-17
Nephroblastoma and neuroblastoma belong to the most common abdominal malignancies in childhood. Similarities in the initial presentation may provide difficulties in distinguishing between these two entities, especially if unusual variations to prevalent patterns of disease manifestation occur. Because of the risk of tumor rupture, European protocols do not require biopsy for diagnosis, which leads to misdiagnosis in some cases. We report on a 4½-year-old girl with a renal tumor displaying radiological and laboratory characteristics supporting the diagnosis of nephroblastoma. Imaging studies showed tumor extension into the inferior vena cava and bilateral lung metastases while urine catecholamines and MIBG-scintigraphy were negative. Preoperative chemotherapy with vincristine, actinomycine D and adriamycin according to the SIOP2001/GPOH protocol for the treatment of nephroblastoma was initiated and followed by surgical tumor resection. Histopathology revealed an undifferentiated tumor with expression of neuronal markers, suggestive of neuroblastoma. MYCN amplification could not be detected. DNA-microarray analysis was performed using Affymetrix genechip human genome U133 plus 2.0 and artificial neural network analysis. Results were confirmed by multiplex RT-PCR. Principal component analysis using 84 genes showed that the patient sample was clearly clustering with neuroblastoma tumors. This was confirmed by hierarchical clustering of the multiplex RT-PCR data. The patient underwent treatment for high-risk neuroblastoma comprising chemotherapy including cisplatin, etoposide, vindesine, dacarbacine, ifosfamide, vincristine, adriamycine and autologous stem cell transplantation followed by maintenance therapy with 13-cis retinoic acid (GPOH NB2004 High Risk Trial Protocol) and is in complete long-term remission. The use of gene expression profiling in an individual patient strongly contributed to clarification in a diagnostic dilemma which finally led to a change of
Wei, Liang; Xu, Ning; Wang, Yiran; Zhou, Wei; Han, Guoqiang; Ma, Yanhe; Liu, Jun
2018-05-01
Due to the lack of efficient control elements and tools, the fine-tuning of gene expression in the multi-gene metabolic pathways is still a great challenge for engineering microbial cell factories, especially for the important industrial microorganism Corynebacterium glutamicum. In this study, the promoter library-based module combination (PLMC) technology was developed to efficiently optimize the expression of genes in C. glutamicum. A random promoter library was designed to contain the putative - 10 (NNTANANT) and - 35 (NNGNCN) consensus motifs, and refined through a three-step screening procedure to achieve numerous genetic control elements with different strength levels, including fluorescence-activated cell sorting (FACS) screening, agar plate screening, and 96-well plate screening. Multiple conventional strategies were employed for further precise characterizations of the promoter library, such as real-time quantitative PCR, sodium dodecyl sulfate polyacrylamide gel electrophoresis, FACS analysis, and the lacZ reporter system. These results suggested that the established promoter elements effectively regulated gene expression and showed varying strengths over a wide range. Subsequently, a multi-module combination technology was created based on the efficient promoter elements for combination and optimization of modules in the multi-gene pathways. Using this technology, the threonine biosynthesis pathway was reconstructed and optimized by predictable tuning expression of five modules in C. glutamicum. The threonine titer of the optimized strain was significantly improved to 12.8 g/L, an approximate 6.1-fold higher than that of the control strain. Overall, the PLMC technology presented in this study provides a rapid and effective method for combination and optimization of multi-gene pathways in C. glutamicum.
Zinc-finger protein-targeted gene regulation: Genomewide single-gene specificity
Tan, Siyuan; Guschin, Dmitry; Davalos, Albert; Lee, Ya-Li; Snowden, Andrew W.; Jouvenot, Yann; Zhang, H. Steven; Howes, Katherine; McNamara, Andrew R.; Lai, Albert; Ullman, Chris; Reynolds, Lindsey; Moore, Michael; Isalan, Mark; Berg, Lutz-Peter; Campos, Bradley; Qi, Hong; Spratt, S. Kaye; Case, Casey C.; Pabo, Carl O.; Campisi, Judith; Gregory, Philip D.
2003-01-01
Zinc-finger protein transcription factors (ZFP TFs) can be designed to control the expression of any desired target gene, and thus provide potential therapeutic tools for the study and treatment of disease. Here we report that a ZFP TF can repress target gene expression with single-gene specificity within the human genome. A ZFP TF repressor that binds an 18-bp recognition sequence within the promoter of the endogenous CHK2 gene gives a >10-fold reduction in CHK2 mRNA and protein. This level of repression was sufficient to generate a functional phenotype, as demonstrated by the loss of DNA damage-induced CHK2-dependent p53 phosphorylation. We determined the specificity of repression by using DNA microarrays and found that the ZFP TF repressed a single gene (CHK2) within the monitored genome in two different cell types. These data demonstrate the utility of ZFP TFs as precise tools for target validation, and highlight their potential as clinical therapeutics. PMID:14514889
Zouheir Habbal, Mohammad; Bou-Assi, Tarek; Zhu, Jun; Owen, Renius; Chehab, Farid F
2014-01-01
Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD). Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5-16 Mb), one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband's phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin.
Habbal, Mohammad Zouheir; Bou-Assi, Tarek; Zhu, Jun; Owen, Renius; Chehab, Farid F.
2014-01-01
Alkaptonuria is often diagnosed clinically with episodes of dark urine, biochemically by the accumulation of peripheral homogentisic acid and molecularly by the presence of mutations in the homogentisate 1,2-dioxygenase gene (HGD). Alkaptonuria is invariably associated with HGD mutations, which consist of single nucleotide variants and small insertions/deletions. Surprisingly, the presence of deletions beyond a few nucleotides among over 150 reported deleterious mutations has not been described, raising the suspicion that this gene might be protected against the detrimental mechanisms of gene rearrangements. The quest for an HGD mutation in a proband with AKU revealed with a SNP array five large regions of homozygosity (5–16 Mb), one of which includes the HGD gene. A homozygous deletion of 649 bp deletion that encompasses the 72 nucleotides of exon 2 and surrounding DNA sequences in flanking introns of the HGD gene was unveiled in a proband with AKU. The nature of this deletion suggests that this in-frame deletion could generate a protein without exon 2. Thus, we modeled the tertiary structure of the mutant protein structure to determine the effect of exon 2 deletion. While the two β-pleated sheets encoded by exon 2 were missing in the mutant structure, other β-pleated sheets are largely unaffected by the deletion. However, nine novel α-helical coils substituted the eight coils present in the native HGD crystal structure. Thus, this deletion results in a deleterious enzyme, which is consistent with the proband’s phenotype. Screening for mutations in the HGD gene, particularly in the Middle East, ought to include this exon 2 deletion in order to determine its frequency and uncover its origin. PMID:25233259
A novel mutation of the MITF gene in a family with Waardenburg syndrome type 2: A case report
SHI, YUNFANG; LI, XIAOZHOU; JU, DUAN; LI, YAN; ZHANG, XIULING; ZHANG, YING
2016-01-01
Waardenburg syndrome (WS) is an autosomal dominant disorder with varying degrees of sensorineural hearing loss, and accumulation of pigmentation in hair, skin and iris. There are four types of WS (WS1–4) with differing characteristics. Mutations in six genes [paired box gene 3 (PAX3), microphthalmia-associated transcription factor (MITF), endothelin 3 (END3), endothelin receptor type B (EDNRB), SRY (sex determining region Y)-box 10 (SOX10) and snail homolog 2 (SNAI2)] have been identified to be associated with the various types. This case report describes the investigation of genetic mutations in three patients with WS2 from a single family. Genomic DNA was extracted, and the six WS-related genes were sequenced using next-generation sequencing technology. In addition to mutations in PAX3, EDNRB and SOX10, a novel heterozygous MITF mutation, p.Δ315Arg (c.944_946delGAA) on exon 8 was identified. This is predicted to be a candidate disease-causing mutation that may affect the structure and function of the enzyme. PMID:27073475
A novel mutation of the MITF gene in a family with Waardenburg syndrome type 2: A case report.
Shi, Yunfang; Li, Xiaozhou; Ju, Duan; Li, Yan; Zhang, Xiuling; Zhang, Ying
2016-04-01
Waardenburg syndrome (WS) is an autosomal dominant disorder with varying degrees of sensorineural hearing loss, and accumulation of pigmentation in hair, skin and iris. There are four types of WS (WS1-4) with differing characteristics. Mutations in six genes [paired box gene 3 ( PAX3 ), microphthalmia-associated transcription factor ( MITF ), endothelin 3 ( END3 ), endothelin receptor type B ( EDNRB ), SRY (sex determining region Y)-box 10 ( SOX10 ) and snail homolog 2 ( SNAI2 )] have been identified to be associated with the various types. This case report describes the investigation of genetic mutations in three patients with WS2 from a single family. Genomic DNA was extracted, and the six WS-related genes were sequenced using next-generation sequencing technology. In addition to mutations in PAX3, EDNRB and SOX10, a novel heterozygous MITF mutation, p.Δ315Arg (c.944_946delGAA) on exon 8 was identified. This is predicted to be a candidate disease-causing mutation that may affect the structure and function of the enzyme.
Babiker, Amir M I; Al Gadi, Iman; Al-Jurayyan, Nasir A M; Al Nemri, Abdulrahman M H; Al Haboob, Ali Abdu N; Al Boukai, Ahmed Amer; Al Zahrani, Ali; Habib, Hanan Ahmed
2014-11-05
Rickets can occur due to Vitamin D deficiency or defects in its metabolism. Three rare genetic types of rickets with different alterations of genes have been reported, including: Vitamin D dependent rickets type 1, Vitamin D dependent rickets type 2 or also known as Vitamin D resistant rickets and 25 hydroxylase deficiency rickets. Vitamin D dependent rickets type 1 is inherited in an autosomal recessive pattern, and is caused by mutations in the CYP27B1 gene encoding the 1α-hydroxylase enzyme. We report here a new mutation in CYP27B1, which lead to Vitamin D dependent rickets type 1. We report on a 13-month-old Arabic Saudi girl with Vitamin D dependent rickets type 1 presented with multiple fractures and classic features of rickets. A whole exome sequencing identified a novel pathogenic missense mutation (CYP27B1:Homozygous c.1510C > T(p.Q504X)) which results in a protein truncating alteration. Both parents are heterozygous carriers of the mutation. Based on data search in Human Gene Mutation Database, 63 CYP27B1 alterations were reported: only 28.6% are protein truncating (5 nonsense, 13 frameshift insertions/deletions, 0 gross deletions), while 61.9% are non-truncating (38 missense, 1 small in-frame insertions/deletion), and 9.5% are possible protein-truncating (5 splice, 1 regulatory). The deleterious effect of this alteration, which was the only mutation detected in the CYP27B1 common gene of Vitamin D dependent rickets type 1 in the proband, and its autosomal recessive inheritance fashion, both support a pathogenic nature of this mutation as the cause of Vitamin D dependent rickets type 1.
Hingorani, Pooja; Missiaglia, Edoardo; Shipley, Janet; Anderson, James R; Triche, Timothy J; Delorenzi, Mauro; Gastier-Foster, Julie; Wing, Michele; Hawkins, Douglas S; Skapek, Stephen X
2015-10-15
Pediatric rhabdomyosarcoma (RMS) has two common histologic subtypes: embryonal (ERMS) and alveolar (ARMS). PAX-FOXO1 fusion gene status is a more reliable prognostic marker than alveolar histology, whereas fusion gene-negative (FN) ARMS patients are clinically similar to ERMS patients. A five-gene expression signature (MG5) previously identified two diverse risk groups within the fusion gene-negative RMS (FN-RMS) patients, but this has not been independently validated. The goal of this study was to test whether expression of the MG5 metagene, measured using a technical platform that can be applied to routine pathology material, would correlate with outcome in a new cohort of patients with FN-RMS. Cases were taken from the Children's Oncology Group (COG) D9803 study of children with intermediate-risk RMS, and gene expression profiling for the MG5 genes was performed using the nCounter assay. The MG5 score was correlated with clinical and pathologic characteristics as well as overall and event-free survival. MG5 standardized score showed no significant association with any of the available clinicopathologic variables. The MG5 signature score showed a significant correlation with overall (N = 57; HR, 7.3; 95% CI, 1.9-27.0; P = 0.003) and failure-free survival (N = 57; HR, 6.1; 95% CI, 1.9-19.7; P = 0.002). This represents the first, validated molecular prognostic signature for children with FN-RMS who otherwise have intermediate-risk disease. The capacity to measure the expression of a small number of genes in routine pathology material and apply a simple mathematical formula to calculate the MG5 metagene score provides a clear path toward better risk stratification in future prospective clinical trials. ©2015 American Association for Cancer Research.
Qadeer, Muhammad Imran; Amar, Ali; Mann, J John; Hasnain, Shahida
2017-01-01
Genetic factors contribute to antisocial and criminal behavior. Dopamine transporter DAT-1 (SLC6A3) and DRD2 gene for the dopamine-2 receptor are dopaminergic system genes that regulate dopamine reuptake and signaling, and may be part of the pathogenesis of psychiatric disorders including antisocial behaviors and traits. No previous studies have analyzed DAT-1 and DRD2 polymorphisms in convicted murderers, particularly from Indian subcontinent. In this study we investigated the association of 40 bp VNTR polymorphism of DAT-1 and Taq1 variant of DRD2 gene (rs1800479) with criminal behavior and self-reported aggression in 729 subjects, including 370 men in Pakistani prisons convicted of first degree murder(s) and 359 control men without any history of violence or criminal tendency. The 9R allele of DAT-1 VNTR polymorphism was more prevalent in convicted murderers compared with control samples, for either one or two risk alleles (OR = 1.49 and 3.99 respectively, P = 0.003). This potential association of DAT-1 9R allele polymorphism with murderer phenotype was confirmed assuming different genetic models of inheritance. However, no genetic association was found for DRD2 Taq1 polymorphism. In addition, a combined haplotype (9R-A2) of DAT-1 and DRD2 genes was associated with this murderer phenotype. Further, 9R allele of DAT-1 was also associated with response to verbal abuse and parental marital complications, but not with other measures pertinent to self-reported aggression. These results suggest that 9R allele, which may influence levels of intra-synaptic dopamine in the brain, may contribute to criminal tendency in this sample of violent murderers of Pakistani origin. Future studies are needed to replicate this finding in other populations of murderers and see if this finding extends to other forms of violence and lesser degrees of aggression.
Qadeer, Muhammad Imran; Amar, Ali; Mann, J. John; Hasnain, Shahida
2017-01-01
Genetic factors contribute to antisocial and criminal behavior. Dopamine transporter DAT-1 (SLC6A3) and DRD2 gene for the dopamine-2 receptor are dopaminergic system genes that regulate dopamine reuptake and signaling, and may be part of the pathogenesis of psychiatric disorders including antisocial behaviors and traits. No previous studies have analyzed DAT-1 and DRD2 polymorphisms in convicted murderers, particularly from Indian subcontinent. In this study we investigated the association of 40 bp VNTR polymorphism of DAT-1 and Taq1 variant of DRD2 gene (rs1800479) with criminal behavior and self-reported aggression in 729 subjects, including 370 men in Pakistani prisons convicted of first degree murder(s) and 359 control men without any history of violence or criminal tendency. The 9R allele of DAT-1 VNTR polymorphism was more prevalent in convicted murderers compared with control samples, for either one or two risk alleles (OR = 1.49 and 3.99 respectively, P = 0.003). This potential association of DAT-1 9R allele polymorphism with murderer phenotype was confirmed assuming different genetic models of inheritance. However, no genetic association was found for DRD2 Taq1 polymorphism. In addition, a combined haplotype (9R-A2) of DAT-1 and DRD2 genes was associated with this murderer phenotype. Further, 9R allele of DAT-1 was also associated with response to verbal abuse and parental marital complications, but not with other measures pertinent to self-reported aggression. These results suggest that 9R allele, which may influence levels of intra-synaptic dopamine in the brain, may contribute to criminal tendency in this sample of violent murderers of Pakistani origin. Future studies are needed to replicate this finding in other populations of murderers and see if this finding extends to other forms of violence and lesser degrees of aggression. PMID:28582390
Conservation demands safe gene drive.
Esvelt, Kevin M; Gemmell, Neil J
2017-11-01
Interest in developing gene drive systems to control invasive species is growing, with New Zealand reportedly considering the nascent technology as a way to locally eliminate the mammalian pests that threaten its unique flora and fauna. If gene drives successfully eradicated these invasive populations, many would rejoice, but what are the possible consequences? Here, we explore the risk of accidental spread posed by self-propagating gene drive technologies, highlight new gene drive designs that might achieve better outcomes, and explain why we need open and international discussions concerning a technology that could have global ramifications.
Park, Arnold; Yun, Tatyana; Hill, Terence E; Ikegami, Tetsuro; Juelich, Terry L; Smith, Jennifer K; Zhang, Lihong; Freiberg, Alexander N; Lee, Benhur
2016-04-01
Incorporation of reporter genes within virus genomes is an indispensable tool for interrogation of virus biology and pathogenesis. In previous work, we incorporated a fluorophore into a viral ORF by attaching it to the viral gene via a P2A ribosomal skipping sequence. This recombinant Nipah virus, however, was attenuated in vitro relative to WT virus. In this work, we determined that inefficient ribosomal skipping was a major contributing factor to this attenuation. Inserting a GSG linker before the P2A sequence resulted in essentially complete skipping, significantly improved growth in vitro, and WT lethality in vivo. To the best of our knowledge, this represents the first time a recombinant virus of Mononegavirales with integration of a reporter into a viral ORF has been compared with the WT virus in vivo. Incorporating the GSG linker for improved skipping efficiency whenever functionally important is a critical consideration for recombinant virus design.
Kimura, Yukiko; Hisano, Yu; Kawahara, Atsuo; Higashijima, Shin-ichi
2014-10-08
The type II bacterial CRISPR/Cas9 system is rapidly becoming popular for genome-engineering due to its simplicity, flexibility, and high efficiency. Recently, targeted knock-in of a long DNA fragment via homology-independent DNA repair has been achieved in zebrafish using CRISPR/Cas9 system. This raised the possibility that knock-in transgenic zebrafish could be efficiently generated using CRISPR/Cas9. However, how widely this method can be applied for the targeting integration of foreign genes into endogenous genomic loci is unclear. Here, we report efficient generation of knock-in transgenic zebrafish that have cell-type specific Gal4 or reporter gene expression. A donor plasmid containing a heat-shock promoter was co-injected with a short guide RNA (sgRNA) targeted for genome digestion, a sgRNA targeted for donor plasmid digestion, and Cas9 mRNA. We have succeeded in establishing stable knock-in transgenic fish with several different constructs for 4 genetic loci at a frequency being exceeding 25%. Due to its simplicity, design flexibility, and high efficiency, we propose that CRISPR/Cas9-mediated knock-in will become a standard method for the generation transgenic zebrafish.
Zhao, Si-Si; Zhao, Guo-Dong; Di, Tian-Yuan; Ding, Hua; Wan, Xiao-Ling; Li, Bing; Chen, Yu-Hua; Xu, Ya-Xiang; Shen, Wei-De; Wei, Zheng-Guo
2013-02-01
Cytochrome P450s (CYPs) are widespread proteins that interact with exogenous chemicals from the diet or the environment. CYP9A subfamily genes are important in the silkworm Bombyx mori. We previously reported transcriptional levels of two CYP9A genes in different tissues and their responses to sodium fluoride (NaF). In this study, promoter truncation analysis using a dual-luciferase reporter assay in B. mori ovary cells (BmN) showed that the regions -1,496 to -1,102 bp for CYP9A19, and -1,630 to -1,210 bp for CYP9A22 were essential for basal transcriptional activity. Sequence analysis of these regions revealed several transcriptional regulatory elements but no typical promoter elements. Promoter activities were regulated after NaF induction and with an obvious dose effect. Although the dual-luciferase assay has been widely used to determine the activity of a given promoter in cell lines, problems with it still exist. Our results indicate that both plasmid size and construct protocols affect the experimental results.
Shmelkov, Sergey V.; Butler, Jason M.; Hooper, Andrea T.; Hormigo, Adilia; Kushner, Jared; Milde, Till; St. Clair, Ryan; Baljevic, Muhamed; White, Ian; Jin, David K.; Chadburn, Amy; Murphy, Andrew J.; Valenzuela, David M.; Gale, Nicholas W.; Thurston, Gavin; Yancopoulos, George D.; D’Angelica, Michael; Kemeny, Nancy; Lyden, David; Rafii, Shahin
2008-01-01
Colon cancer stem cells are believed to originate from a rare population of putative CD133+ intestinal stem cells. Recent publications suggest that a small subset of colon cancer cells expresses CD133, and that only these CD133+ cancer cells are capable of tumor initiation. However, the precise contribution of CD133+ tumor-initiating cells in mediating colon cancer metastasis remains unknown. Therefore, to temporally and spatially track the expression of CD133 in adult mice and during tumorigenesis, we generated a knockin lacZ reporter mouse (CD133lacZ/+), in which the expression of lacZ is driven by the endogenous CD133 promoters. Using this model and immunostaining, we discovered that CD133 expression in colon is not restricted to stem cells; on the contrary, CD133 is ubiquitously expressed on differentiated colonic epithelium in both adult mice and humans. Using Il10–/–CD133lacZ mice, in which chronic inflammation in colon leads to adenocarcinomas, we demonstrated that CD133 is expressed on a full gamut of colonic tumor cells, which express epithelial cell adhesion molecule (EpCAM). Similarly, CD133 is widely expressed by human primary colon cancer epithelial cells, whereas the CD133– population is composed mostly of stromal and inflammatory cells. Conversely, CD133 expression does not identify the entire population of epithelial and tumor-initiating cells in human metastatic colon cancer. Indeed, both CD133+ and CD133– metastatic tumor subpopulations formed colonospheres in in vitro cultures and were capable of long-term tumorigenesis in a NOD/SCID serial xenotransplantation model. Moreover, metastatic CD133– cells form more aggressive tumors and express typical phenotypic markers of cancer-initiating cells, including CD44 (CD44+CD24–), whereas the CD133+ fraction is composed of CD44lowCD24+ cells. Collectively, our data suggest that CD133 expression is not restricted to intestinal stem or cancer-initiating cells, and during the metastatic
Development of the 5-HT2CR-Tango System Combined with an EGFP Reporter Gene.
Watanabe, Yoshihisa; Tsujimura, Atsushi; Aoki, Miku; Taguchi, Katsutoshi; Tanaka, Masaki
2016-02-01
The serotonin 2C receptor (5-HT2CR) is a G-protein-coupled receptor implicated in emotion, feeding, reward, and cognition. 5-HT2CRs are pharmacological targets for mental disorders and metabolic and reward system abnormalities, as alterations in 5-HT2CR expression, RNA editing, and SNPs are involved in these disturbances. To date, 5-HT2CR activity has mainly been measured by quantifying inositol phosphate production and intracellular Ca(2+) release, but these assays are not suitable for in vivo analysis. Here, we developed a 5-HT2CR-Tango assay system, a novel analysis tool of 5-HT2CR activity based on the G-protein-coupled receptor (GPCR)-arrestin interaction. With desensitization of activated 5-HT2CR by arrestin, this system converts the 5-HT2CR-arrestin interaction into EGFP reporter gene signal via the LexA transcriptional activation system. For validation of our system, we measured activity of two 5-HT2CR RNA-editing isoforms (INI and VGV) in HEK293 cells transfected with EGFP reporter gene. The INI isoform displayed both higher basal- and 5-HT-stimulated activities than the VGV isoform. Moreover, an inhibitory effect of 5-HT2CR antagonist SB242084 was also detected by 5-HT2CR-Tango system. This novel tool is useful for in vitro high-throughput targeted 5-HT2CR drug screening and can be applied to future in vivo brain function studies associated with 5-HT2CRs in transgenic animal models.
Non-invasive imaging of prostate cancer progression in nude mice using iRFP gene reporter
NASA Astrophysics Data System (ADS)
Zhu, Banghe; Wu, Grace; Robinson, Holly; Wilganowski, Nathaniel; Sevick-Muraca, Eva M.
2013-03-01
Prostate cancer (PCa) is the second most common cancer in US men. Metastasis is the final step of tumor progression and remains the primary cause of PCa death. Hence preclinical, orthotopic models of PCa metastasis are necessary to develop new therapeutics against metastatic disease. Yet unlike irrelevant subcutaneous tumor models, the deployment of orthotopic models of cancer metastasis in drug research and development is limited by the inability to longitudinally monitor cancer progression/regression in response to administration of experimental pharmaceuticals. Recently, a nearinfrared fluorescent protein (iRFP) was created for deeper imaging [1]. Imaging prostate tumor growth and lymph node metastasis in nude mice therefore becomes possible using this new fluorescent gene reporter. In this study, we first developed an intensified CCD (ICCD)-based iRFP fluorescence imaging device. Then human PCa PC3 cell lines expressing iRFP gene reporter were orthotopically implanted in male Nu/Nu mice at 8-10 weeks old. After 6-10 weeks, in vivo, in situ and ex vivo fluorescence imaging was performed. In vivo iRFP fluorescence imaging showed that the detected fluorescence concentrated at the prostate and became stronger over time, indicating the growth of implanted PCa. Fluorescence was non-invasively detected at locations of prostate-draining lymph nodes as early as 5 weeks post implantation, indicating the metastasis to lymph nodes. In situ and ex vivo fluorescence imaging demonstrated that the detected signals from PCa and lymph nodes were correlated with cancer positive status of tissues as assessed through standard pathology.
A gene-trap strategy identifies quiescence-induced genes in synchronized myoblasts.
Sambasivan, Ramkumar; Pavlath, Grace K; Dhawan, Jyotsna
2008-03-01
Cellular quiescence is characterized not only by reduced mitotic and metabolic activity but also by altered gene expression. Growing evidence suggests that quiescence is not merely a basal state but is regulated by active mechanisms. To understand the molecular programme that governs reversible cell cycle exit, we focused on quiescence-related gene expression in a culture model of myogenic cell arrest and activation. Here we report the identification of quiescence-induced genes using a gene-trap strategy. Using a retroviral vector, we generated a library of gene traps in C2C12 myoblasts that were screened for arrest-induced insertions by live cell sorting (FACS-gal). Several independent gene- trap lines revealed arrest-dependent induction of betagal activity, confirming the efficacy of the FACS screen. The locus of integration was identified in 15 lines. In three lines,insertion occurred in genes previously implicated in the control of quiescence, i.e. EMSY - a BRCA2--interacting protein, p8/com1 - a p300HAT -- binding protein and MLL5 - a SET domain protein. Our results demonstrate that expression of chromatin modulatory genes is induced in G0, providing support to the notion that this reversibly arrested state is actively regulated.
ERIC Educational Resources Information Center
Corbani, S.; Chouery, E.; Fayyad, J.; Fawaz, A.; El Tourjuman, O.; Badens, C.; Lacoste, C.; Delague, V.; Megarbane, A.
2012-01-01
Background: Rett syndrome (RTT), an X-linked, dominant, neurodevelopment disorder represents 10% of female subjects with profound intellectual disability. Mutations in the "MECP2" gene are responsible for up to 95% of the classical RTT cases, and nearly 500 different mutations distributed throughout the gene have been reported. Methods:…
Gene and domain duplication in the chordate Otx gene family: insights from amphioxus Otx.
Williams, N A; Holland, P W
1998-05-01
We report the genomic organization and deduced protein sequence of a cephalochordate member of the Otx homeobox gene family (AmphiOtx) and show its probable single-copy state in the genome. We also present molecular phylogenetic analysis indicating that there was single ancestral Otx gene in the first chordates which was duplicated in the vertebrate lineage after it had split from the lineage leading to the cephalochordates. Duplication of a C-terminal protein domain has occurred specifically in the vertebrate lineage, strengthening the case for a single Otx gene in an ancestral chordate whose gene structure has been retained in an extant cephalochordate. Comparative analysis of protein sequences and published gene expression patterns suggest that the ancestral chordate Otx gene had roles in patterning the anterior mesendoderm and central nervous system. These roles were elaborated following Otx gene duplication in vertebrates, accompanied by regulatory and structural divergence, particularly of Otx1 descendant genes.
Kaczmarek, Frank M.; Dib-Hajj, Fadia; Shang, Wenchi; Gootz, Thomas D.
2006-01-01
Clinical isolates of Klebsiella pneumoniae resistant to carbapenems and essentially all other antibiotics (multidrug resistant) are being isolated from some hospitals in New York City with increasing frequency. A highly related pair of K. pneumoniae strains isolated on the same day from one patient in a hospital in New York City were studied for antibiotic resistance. One (KP-2) was resistant to imipenem, meropenem, and sulopenem (MICs of 16 to 32 μg/ml) while the other (KP-1) was susceptible (MIC of 0.5 μg/ml); both contained the blaACT-1, blaSHV-1, and blaTEM-1 β-lactamases. blaACT-1 in both strains was encoded on a large ∼150-kb plasmid. Both isolates contained an identical class 1 integron encoding resistance to aminoglycosides and chloramphenicol. They each had identical insertions in ompK35 and ompK36, resulting in disruption of these key porin genes. The carbapenem-resistant and -susceptible isolates were extensively studied for differences in the structural and regulatory genes for the operons acrRAB, marORAB, romA-ramA, soxRS, micF, micC, phoE, phoBR, rpoS, and hfq. No changes were detected between the isolates except for a significant down-regulation of ompK37, phoB, and phoE in KP-2 as deduced from reverse transcription-PCR analysis of mRNA and polyacrylamide gel electrophoresis separation of outer membrane proteins. Backcross analysis was conducted using the wild-type phoE gene cloned into the vector pGEM under regulation of its native promoter as well as the lacZ promoter following transformation into the resistant KP-2 isolate. The wild-type gene reversed carbapenem resistance only when under control of the heterologous lacZ promoter. In the background of ompK35-ompK36 gene disruption, the up-regulation of phoE in KP-1 apparently compensated for porin loss and conferred carbapenem susceptibility. Down-regulation of phoE in KP-2 may represent the normal state of this gene, or it may have been selected from KP-1 in vivo under antibiotic pressure
Kaczmarek, Frank M; Dib-Hajj, Fadia; Shang, Wenchi; Gootz, Thomas D
2006-10-01
Clinical isolates of Klebsiella pneumoniae resistant to carbapenems and essentially all other antibiotics (multidrug resistant) are being isolated from some hospitals in New York City with increasing frequency. A highly related pair of K. pneumoniae strains isolated on the same day from one patient in a hospital in New York City were studied for antibiotic resistance. One (KP-2) was resistant to imipenem, meropenem, and sulopenem (MICs of 16 to 32 microg/ml) while the other (KP-1) was susceptible (MIC of 0.5 microg/ml); both contained the bla(ACT-1), bla(SHV-1), and bla(TEM-1) beta-lactamases. bla(ACT-1) in both strains was encoded on a large approximately 150-kb plasmid. Both isolates contained an identical class 1 integron encoding resistance to aminoglycosides and chloramphenicol. They each had identical insertions in ompK35 and ompK36, resulting in disruption of these key porin genes. The carbapenem-resistant and -susceptible isolates were extensively studied for differences in the structural and regulatory genes for the operons acrRAB, marORAB, romA-ramA, soxRS, micF, micC, phoE, phoBR, rpoS, and hfq. No changes were detected between the isolates except for a significant down-regulation of ompK37, phoB, and phoE in KP-2 as deduced from reverse transcription-PCR analysis of mRNA and polyacrylamide gel electrophoresis separation of outer membrane proteins. Backcross analysis was conducted using the wild-type phoE gene cloned into the vector pGEM under regulation of its native promoter as well as the lacZ promoter following transformation into the resistant KP-2 isolate. The wild-type gene reversed carbapenem resistance only when under control of the heterologous lacZ promoter. In the background of ompK35-ompK36 gene disruption, the up-regulation of phoE in KP-1 apparently compensated for porin loss and conferred carbapenem susceptibility. Down-regulation of phoE in KP-2 may represent the normal state of this gene, or it may have been selected from KP-1 in vivo
Arabidopsis gene expression patterns are altered during spaceflight
NASA Astrophysics Data System (ADS)
Paul, Anna-Lisa; Popp, Michael P.; Gurley, William B.; Guy, Charles; Norwood, Kelly L.; Ferl, Robert J.
The exposure of Arabidopsis thaliana (Arabidopsis) plants to spaceflight environments results in differential gene expression. A 5-day mission on orbiter Columbia in 1999 (STS-93) carried transgenic Arabidopsis plants engineered with a transgene composed of the alcohol dehydrogenase (Adh) gene promoter linked to the β-Glucuronidase (GUS) reporter gene. The plants were used to evaluate the effects of spaceflight on gene expression patterns initially by using the Adh/GUS transgene to address specifically the possibility that spaceflight induces a hypoxic stress response (Paul, A.L., Daugherty, C.J., Bihn, E.A., Chapman, D.K., Norwood, K.L., Ferl, R.J., 2001. Transgene expression patterns indicate that spaceflight affects stress signal perception and transduction in arabidopsis, Plant Physiol. 126, 613-621). As a follow-on to the reporter gene analysis, we report here the evaluation of genome-wide patterns of native gene expression within Arabidopsis shoots utilizing the Agilent DNA array of 21,000 Arabidopsis genes. As a control for the veracity of the array analyses, a selection of genes was further characterized with quantitative Real-Time RT PCR (ABI - Taqman®). Comparison of the patterns of expression for arrays probed with RNA isolated from plants exposed to spaceflight compared to RNA isolated from ground control plants revealed 182 genes that were differentially expressed in response to the spaceflight mission by more than 4-fold, and of those only 50 genes were expressed at levels chosen to support a conservative change call. None of the genes that are hallmarks of hypoxic stress were induced to this level. However, genes related to heat shock were dramatically induced - but in a pattern and under growth conditions that are not easily explained by elevated temperatures. These gene expression data are discussed in light of current models for plant responses to the spaceflight environment and with regard to potential future spaceflight experiment
Miaskowski, Christine; Cooper, Bruce A.; Dhruva, Anand; Dunn, Laura B.; Langford, Dale J.; Cataldo, Janine K.; Baggott, Christina R.; Merriman, John D.; Dodd, Marylin; Lee, Kathryn; West, Claudia; Paul, Steven M.; Aouizerat, Bradley E.
2012-01-01
The purposes of this study were to identify distinct latent classes of individuals based on subjective reports of sleep disturbance; to examine differences in demographic, clinical, and symptom characteristics between the latent classes; and to evaluate for variations in pro- and anti-inflammatory cytokine genes between the latent classes. Among 167 oncology outpatients with breast, prostate, lung, or brain cancer and 85 of their FCs, growth mixture modeling (GMM) was used to identify latent classes of individuals based on General Sleep Disturbance Scale (GSDS) obtained prior to, during, and for four months following completion of radiation therapy. Single nucleotide polymorphisms (SNPs) and haplotypes in candidate cytokine genes were interrogated for differences between the two latent classes. Multiple logistic regression was used to assess the effect of phenotypic and genotypic characteristics on GSDS group membership. Two latent classes were identified: lower sleep disturbance (88.5%) and higher sleep disturbance (11.5%). Participants who were younger and had a lower Karnofsky Performance status score were more likely to be in the higher sleep disturbance class. Variation in two cytokine genes (i.e., IL6, NFKB) predicted latent class membership. Evidence was found for latent classes with distinct sleep disturbance trajectories. Unique genetic markers in cytokine genes may partially explain the interindividual heterogeneity characterizing these trajectories. PMID:22844404
[Detection of transgenic crop with gene chip].
Huang, Ying-Chun; Sun, Chun-Yun; Feng, Hong; Hu, Xiao-Dong; Yin, Hai-Bin
2003-05-01
Some selected available sequences of reporter genes,resistant genes, promoters and terminators are amplified by PCR for the probes of transgenic crop detection gene chip. These probes are arrayed at definite density and printed on the surface of amino-slides by bioRobot MicroGrid II. Results showed that gene chip worked quickly and correctly, when transgenic rice, pawpaw,maize and soybean were applied.
A fruit quality gene map of Prunus
2009-01-01
Background Prunus fruit development, growth, ripening, and senescence includes major biochemical and sensory changes in texture, color, and flavor. The genetic dissection of these complex processes has important applications in crop improvement, to facilitate maximizing and maintaining stone fruit quality from production and processing through to marketing and consumption. Here we present an integrated fruit quality gene map of Prunus containing 133 genes putatively involved in the determination of fruit texture, pigmentation, flavor, and chilling injury resistance. Results A genetic linkage map of 211 markers was constructed for an intraspecific peach (Prunus persica) progeny population, Pop-DG, derived from a canning peach cultivar 'Dr. Davis' and a fresh market cultivar 'Georgia Belle'. The Pop-DG map covered 818 cM of the peach genome and included three morphological markers, 11 ripening candidate genes, 13 cold-responsive genes, 21 novel EST-SSRs from the ChillPeach database, 58 previously reported SSRs, 40 RAFs, 23 SRAPs, 14 IMAs, and 28 accessory markers from candidate gene amplification. The Pop-DG map was co-linear with the Prunus reference T × E map, with 39 SSR markers in common to align the maps. A further 158 markers were bin-mapped to the reference map: 59 ripening candidate genes, 50 cold-responsive genes, and 50 novel EST-SSRs from ChillPeach, with deduced locations in Pop-DG via comparative mapping. Several candidate genes and EST-SSRs co-located with previously reported major trait loci and quantitative trait loci for chilling injury symptoms in Pop-DG. Conclusion The candidate gene approach combined with bin-mapping and availability of a community-recognized reference genetic map provides an efficient means of locating genes of interest in a target genome. We highlight the co-localization of fruit quality candidate genes with previously reported fruit quality QTLs. The fruit quality gene map developed here is a valuable tool for dissecting the
Conservation demands safe gene drive
Esvelt, Kevin M.
2017-01-01
Interest in developing gene drive systems to control invasive species is growing, with New Zealand reportedly considering the nascent technology as a way to locally eliminate the mammalian pests that threaten its unique flora and fauna. If gene drives successfully eradicated these invasive populations, many would rejoice, but what are the possible consequences? Here, we explore the risk of accidental spread posed by self-propagating gene drive technologies, highlight new gene drive designs that might achieve better outcomes, and explain why we need open and international discussions concerning a technology that could have global ramifications. PMID:29145398
The methionine salvage pathway in Bacillus subtilis
Sekowska, Agnieszka; Danchin, Antoine
2002-01-01
Background Polyamine synthesis produces methylthioadenosine, which has to be disposed of. The cell recycles it into methionine through methylthioribose (MTR). Very little was known about MTR recycling for methionine salvage in Bacillus subtilis. Results Using in silico genome analysis and transposon mutagenesis in B. subtilis we have experimentally uncovered the major steps of the dioxygen-dependent methionine salvage pathway, which, although similar to that found in Klebsiella pneumoniae, recruited for its implementation some entirely different proteins. The promoters of the genes have been identified by primer extension, and gene expression was analyzed by Northern blotting and lacZ reporter gene expression. Among the most remarkable discoveries in this pathway is the role of an analog of ribulose diphosphate carboxylase (Rubisco, the plant enzyme used in the Calvin cycle which recovers carbon dioxide from the atmosphere) as a major step in MTR recycling. Conclusions A complete methionine salvage pathway exists in B. subtilis. This pathway is chemically similar to that in K. pneumoniae, but recruited different proteins to this purpose. In particular, a paralogue or Rubisco, MtnW, is used at one of the steps in the pathway. A major observation is that in the absence of MtnW, MTR becomes extremely toxic to the cell, opening an unexpected target for new antimicrobial drugs. In addition to methionine salvage, this pathway protects B. subtilis against dioxygen produced by its natural biotope, the surface of leaves (phylloplane). PMID:12022921
Novel gene sets improve set-level classification of prokaryotic gene expression data.
Holec, Matěj; Kuželka, Ondřej; Železný, Filip
2015-10-28
Set-level classification of gene expression data has received significant attention recently. In this setting, high-dimensional vectors of features corresponding to genes are converted into lower-dimensional vectors of features corresponding to biologically interpretable gene sets. The dimensionality reduction brings the promise of a decreased risk of overfitting, potentially resulting in improved accuracy of the learned classifiers. However, recent empirical research has not confirmed this expectation. Here we hypothesize that the reported unfavorable classification results in the set-level framework were due to the adoption of unsuitable gene sets defined typically on the basis of the Gene ontology and the KEGG database of metabolic networks. We explore an alternative approach to defining gene sets, based on regulatory interactions, which we expect to collect genes with more correlated expression. We hypothesize that such more correlated gene sets will enable to learn more accurate classifiers. We define two families of gene sets using information on regulatory interactions, and evaluate them on phenotype-classification tasks using public prokaryotic gene expression data sets. From each of the two gene-set families, we first select the best-performing subtype. The two selected subtypes are then evaluated on independent (testing) data sets against state-of-the-art gene sets and against the conventional gene-level approach. The novel gene sets are indeed more correlated than the conventional ones, and lead to significantly more accurate classifiers. The novel gene sets are indeed more correlated than the conventional ones, and lead to significantly more accurate classifiers. Novel gene sets defined on the basis of regulatory interactions improve set-level classification of gene expression data. The experimental scripts and other material needed to reproduce the experiments are available at http://ida.felk.cvut.cz/novelgenesets.tar.gz.
Franco, E; Hodgson, S; Lench, N; Roberts, G J
1995-03-01
A case of Nance-Horan syndrome in a male is presented, with some features of the condition in his carrier mother and her mother. It is proposed that Nance-Horan syndrome might be a contiguous gene syndrome mapping to chromosome Xp21.2-p22.3. The proband had congenital cataract microphthalmia and dental abnormalities including screwdriver shaped incisors and evidence of enamel pitting hypoplasia. The region Xp21.2-p22.3 also contains the tooth enamel protein gene, amelogenin (AMGX). Using molecular genetic techniques, we have shown that there is no evidence that the AMGX gene is deleted in this case of the Nance-Horan syndrome.
Gene therapy progress and prospects: magnetic nanoparticle-based gene delivery.
Dobson, J
2006-02-01
The recent emphasis on the development of non-viral transfection agents for gene delivery has led to new physics and chemistry-based techniques, which take advantage of charge interactions and energetic processes. One of these techniques which shows much promise for both in vitro and in vivo transfection involves the use of biocompatible magnetic nanoparticles for gene delivery. In these systems, therapeutic or reporter genes are attached to magnetic nanoparticles, which are then focused to the target site/cells via high-field/high-gradient magnets. The technique promotes rapid transfection and, as more recent work indicates, excellent overall transfection levels as well. The advantages and difficulties associated with magnetic nanoparticle-based transfection will be discussed as will the underlying physical principles, recent studies and potential future applications.
Marini, F C; Cannon, J P; Belmont, J W; Shillitoe, E J; Lapeyre, J N
1995-09-01
We evaluated the ability of a replication-deficient, recombinant adenoviral vector to transfer the bifunctional gene GAL-TEK, which expresses a marking/therapeutic gene product, to naturally occurring cat fibrosarcomas in situ. GAL-TEK contains an in-frame fusion of the bacterial LacZ gene for histochemical marking of tumors with beta-galactosidase (beta-Gal) and the HSV tk gene for enzyme-prodrug activation of the prodrug ganciclovir (GCV) to induce selective tumor cell killing. GAL-TEK bifunctional marking and cell killing activities were tested in vitro after adenoviral vector infection of HT1080 human fibrosarcoma cells. The tk activity of GAL-TEK is shown to be almost as potent as HSV tk to catalyze conversion of GCV to GCV nucleotides and promote selective cell killing. Using 8 cats with recurring 2.5-cm2 fibrosarcomas that either arose spontaneously or were induced by vaccine, we determined experimentally the administration routes and times required for optimum GAL-TEK gene transfer by beta-Gal histological staining and reverse transcriptase polymerase chain reaction to the multiple compartments of the growing fibrosarcomas consonant with minimizing collateral infection of neighboring tissues and other unwanted side effects.
Gene-chromosome locations of neuropsychiatric diseases.
Shapshak, Paul; Somboonwit, Charurut; Sinnott, John; Commins, Deborah; Singer, Elyse; Levine, Andrew
2011-01-01
A number of genes are involved in various neuropsychiatric disorders. A comprehensive compilation of these genes is important for a better understanding of these diseases. We report an online file that lists genes by chromosome number and location. This is useful for the rapid examination of chromosome bands for genes involved in these diseases. This is not an exhaustive list and does not include single nucleotide polymorphism (SNP) results for genes that are currently being examined by genome wide association studies (GWAS) and other molecular methodologies. The database is available for free at http://www.bioinformation.net/007/paul.xls.
Peñuelas, Iván; Boán, JoséF; Martí-Climent, Josep M; Sangro, Bruno; Mazzolini, Guillermo; Prieto, Jesús; Richter, José A
2004-01-01
More than two decades of intense research have allowed gene therapy to move from the laboratory to the clinical setting, where its use for the treatment of human pathologies has been considerably increased in the last years. However, many crucial questions remain to be solved in this challenging field. In vivo imaging with positron emission tomography (PET) by combination of the appropriate PET reporter gene and PET reporter probe could provide invaluable qualitative and quantitative information to answer multiple unsolved questions about gene therapy. PET imaging could be used to define parameters not available by other techniques that are of substantial interest not only for the proper understanding of the gene therapy process, but also for its future development and clinical application in humans. This review focuses on the molecular biology basis of gene therapy and molecular imaging, describing the fundamentals of in vivo gene expression imaging by PET, and the application of PET to gene therapy, as a technology that can be used in many different ways. It could be applied to avoid invasive procedures for gene therapy monitoring; accurately diagnose the pathology for better planning of the most adequate therapeutic approach; as treatment evaluation to image the functional effects of gene therapy at the biochemical level; as a quantitative noninvasive way to monitor the location, magnitude and persistence of gene expression over time; and would also help to a better understanding of vector biology and pharmacology devoted to the development of safer and more efficient vectors.
An atlas of gene expression and gene co-regulation in the human retina.
Pinelli, Michele; Carissimo, Annamaria; Cutillo, Luisa; Lai, Ching-Hung; Mutarelli, Margherita; Moretti, Maria Nicoletta; Singh, Marwah Veer; Karali, Marianthi; Carrella, Diego; Pizzo, Mariateresa; Russo, Francesco; Ferrari, Stefano; Ponzin, Diego; Angelini, Claudia; Banfi, Sandro; di Bernardo, Diego
2016-07-08
The human retina is a specialized tissue involved in light stimulus transduction. Despite its unique biology, an accurate reference transcriptome is still missing. Here, we performed gene expression analysis (RNA-seq) of 50 retinal samples from non-visually impaired post-mortem donors. We identified novel transcripts with high confidence (Observed Transcriptome (ObsT)) and quantified the expression level of known transcripts (Reference Transcriptome (RefT)). The ObsT included 77 623 transcripts (23 960 genes) covering 137 Mb (35 Mb new transcribed genome). Most of the transcripts (92%) were multi-exonic: 81% with known isoforms, 16% with new isoforms and 3% belonging to new genes. The RefT included 13 792 genes across 94 521 known transcripts. Mitochondrial genes were among the most highly expressed, accounting for about 10% of the reads. Of all the protein-coding genes in Gencode, 65% are expressed in the retina. We exploited inter-individual variability in gene expression to infer a gene co-expression network and to identify genes specifically expressed in photoreceptor cells. We experimentally validated the photoreceptors localization of three genes in human retina that had not been previously reported. RNA-seq data and the gene co-expression network are available online (http://retina.tigem.it). © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Shoguchi, Eiichi; Beedessee, Girish; Tada, Ipputa; Hisata, Kanako; Kawashima, Takeshi; Takeuchi, Takeshi; Arakaki, Nana; Fujie, Manabu; Koyanagi, Ryo; Roy, Michael C; Kawachi, Masanobu; Hidaka, Michio; Satoh, Noriyuki; Shinzato, Chuya
2018-06-14
The marine dinoflagellate, Symbiodinium, is a well-known photosynthetic partner for coral and other diverse, non-photosynthetic hosts in subtropical and tropical shallows, where it comprises an essential component of marine ecosystems. Using molecular phylogenetics, the genus Symbiodinium has been classified into nine major clades, A-I, and one of the reported differences among phenotypes is their capacity to synthesize mycosporine-like amino acids (MAAs), which absorb UV radiation. However, the genetic basis for this difference in synthetic capacity is unknown. To understand genetics underlying Symbiodinium diversity, we report two draft genomes, one from clade A, presumed to have been the earliest branching clade, and the other from clade C, in the terminal branch. The nuclear genome of Symbiodinium clade A (SymA) has more gene families than that of clade C, with larger numbers of organelle-related genes, including mitochondrial transcription terminal factor (mTERF) and Rubisco. While clade C (SymC) has fewer gene families, it displays specific expansions of repeat domain-containing genes, such as leucine-rich repeats (LRRs) and retrovirus-related dUTPases. Interestingly, the SymA genome encodes a gene cluster for MAA biosynthesis, potentially transferred from an endosymbiotic red alga (probably of bacterial origin), while SymC has completely lost these genes. Our analysis demonstrates that SymC appears to have evolved by losing gene families, such as the MAA biosynthesis gene cluster. In contrast to the conservation of genes related to photosynthetic ability, the terminal clade has suffered more gene family losses than other clades, suggesting a possible adaptation to symbiosis. Overall, this study implies that Symbiodinium ecology drives acquisition and loss of gene families.
Tang, Fang; Yang, Shengming; Liu, Jinge
2016-01-01
Rj4 is a dominant gene in soybeans (Glycine max) that restricts nodulation by many strains of Bradyrhizobium elkanii. The soybean-B. elkanii symbiosis has a low nitrogen-fixation efficiency, but B. elkanii strains are highly competitive for nodulation; thus, cultivars harboring an Rj4 allele are considered favorable. Cloning the Rj4 gene is the first step in understanding the molecular basis of Rj4-mediated nodulation restriction and facilitates the development of molecular tools for genetic improvement of nitrogen fixation in soybeans. We finely mapped the Rj4 locus within a small genomic region on soybean chromosome 1, and validated one of the candidate genes as Rj4 using both complementation tests and CRISPR/Cas9-based gene knockout experiments. We demonstrated that Rj4 encodes a thaumatin-like protein, for which a corresponding allele is not present in the surveyed rj4 genotypes, including the reference genome Williams 82. Our conclusion disagrees with the previous report that Rj4 is the Glyma.01G165800 gene (previously annotated as Glyma01g37060). Instead, we provide convincing evidence that Rj4 is Glyma.01g165800-D, a duplicated and unique version of Glyma.01g165800, that has evolved the ability to control symbiotic specificity. PMID:26582727
Lan, Hong; Chen, Hui; Chen, Li-Cheng; Wang, Bei-Bing; Sun, Li; Ma, Mei-Ying; Fang, Sheng-Guo; Wan, Qiu-Hong
2014-01-01
Defensins play a key role in the innate immunity of various organisms. Detailed genomic studies of the defensin cluster have only been reported in a limited number of birds. Herein, we present the first characterization of defensins in a Pelecaniformes species, the crested ibis (Nipponia nippon), which is one of the most endangered birds in the world. We constructed bacterial artificial chromosome libraries, including a 4D-PCR library and a reverse-4D library, which provide at least 40 equivalents of this rare bird's genome. A cluster including 14 β-defensin loci within 129 kb was assigned to chromosome 3 by FISH, and one gene duplication of AvBD1 was found. The ibis defensin genes are characterized by multiform gene organization ranging from two to four exons through extensive exon fusion. Splicing signal variations and alternative splice variants were also found. Comparative analysis of four bird species identified one common and multiple species-specific duplications, which might be associated with high GC content. Evolutionary analysis revealed birth-and-death mode and purifying selection for avian defensin evolution, resulting in different defensin gene numbers among bird species and functional conservation within orthologous genes, respectively. Additionally, we propose various directions for further research on genetic conservation in the crested ibis. PMID:25372018
Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan
2016-12-12
Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.
Random forests-based differential analysis of gene sets for gene expression data.
Hsueh, Huey-Miin; Zhou, Da-Wei; Tsai, Chen-An
2013-04-10
In DNA microarray studies, gene-set analysis (GSA) has become the focus of gene expression data analysis. GSA utilizes the gene expression profiles of functionally related gene sets in Gene Ontology (GO) categories or priori-defined biological classes to assess the significance of gene sets associated with clinical outcomes or phenotypes. Many statistical approaches have been proposed to determine whether such functionally related gene sets express differentially (enrichment and/or deletion) in variations of phenotypes. However, little attention has been given to the discriminatory power of gene sets and classification of patients. In this study, we propose a method of gene set analysis, in which gene sets are used to develop classifications of patients based on the Random Forest (RF) algorithm. The corresponding empirical p-value of an observed out-of-bag (OOB) error rate of the classifier is introduced to identify differentially expressed gene sets using an adequate resampling method. In addition, we discuss the impacts and correlations of genes within each gene set based on the measures of variable importance in the RF algorithm. Significant classifications are reported and visualized together with the underlying gene sets and their contribution to the phenotypes of interest. Numerical studies using both synthesized data and a series of publicly available gene expression data sets are conducted to evaluate the performance of the proposed methods. Compared with other hypothesis testing approaches, our proposed methods are reliable and successful in identifying enriched gene sets and in discovering the contributions of genes within a gene set. The classification results of identified gene sets can provide an valuable alternative to gene set testing to reveal the unknown, biologically relevant classes of samples or patients. In summary, our proposed method allows one to simultaneously assess the discriminatory ability of gene sets and the importance of genes for
Development of a codon optimization strategy using the efor RED reporter gene as a test case
NASA Astrophysics Data System (ADS)
Yip, Chee-Hoo; Yarkoni, Orr; Ajioka, James; Wan, Kiew-Lian; Nathan, Sheila
2018-04-01
Synthetic biology is a platform that enables high-level synthesis of useful products such as pharmaceutically related drugs, bioplastics and green fuels from synthetic DNA constructs. Large-scale expression of these products can be achieved in an industrial compliant host such as Escherichia coli. To maximise the production of recombinant proteins in a heterologous host, the genes of interest are usually codon optimized based on the codon usage of the host. However, the bioinformatics freeware available for standard codon optimization might not be ideal in determining the best sequence for the synthesis of synthetic DNA. Synthesis of incorrect sequences can prove to be a costly error and to avoid this, a codon optimization strategy was developed based on the E. coli codon usage using the efor RED reporter gene as a test case. This strategy replaces codons encoding for serine, leucine, proline and threonine with the most frequently used codons in E. coli. Furthermore, codons encoding for valine and glycine are substituted with the second highly used codons in E. coli. Both the optimized and original efor RED genes were ligated to the pJS209 plasmid backbone using Gibson Assembly and the recombinant DNAs were transformed into E. coli E. cloni 10G strain. The fluorescence intensity per cell density of the optimized sequence was improved by 20% compared to the original sequence. Hence, the developed codon optimization strategy is proposed when designing an optimal sequence for heterologous protein production in E. coli.
Haddad, N.M.; Ente, D.; Chouery, E.; Jalkh, N.; Mehawej, C.; Khoueir, Z.; Pingault, V.; Mégarbané, A.
2011-01-01
Waardenburg syndrome (WS) is a genetic disorder characterized primarily by depigmentation of the skin and hair, heterochromia of the irides, sensorineural deafness, and sometimes by dystopia canthorum, and Hirschsprung disease. WS presents a large clinical and genetic heterogeneity. Four different types have been individualized and linked to 5 different genes. We report 2 cases of WS type II and 1 case of WS type IV from Lebanon and Syria. The genetic studies revealed 2 novel mutations in the MITF gene of the WS type II cases and 1 novel homozygous mutation in the EDNRB gene of the WS type IV case. This is the first molecular study of patients from the Arab world. Additional cases will enable a more detailed description of the clinical spectrum of Waardenburg syndrome in this region. PMID:21373256
Haddad, N M; Ente, D; Chouery, E; Jalkh, N; Mehawej, C; Khoueir, Z; Pingault, V; Mégarbané, A
2011-01-01
Waardenburg syndrome (WS) is a genetic disorder characterized primarily by depigmentation of the skin and hair, heterochromia of the irides, sensorineural deafness, and sometimes by dystopia canthorum, and Hirschsprung disease. WS presents a large clinical and genetic heterogeneity. Four different types have been individualized and linked to 5 different genes. We report 2 cases of WS type II and 1 case of WS type IV from Lebanon and Syria. The genetic studies revealed 2 novel mutations in the MITF gene of the WS type II cases and 1 novel homozygous mutation in the EDNRB gene of the WS type IV case. This is the first molecular study of patients from the Arab world. Additional cases will enable a more detailed description of the clinical spectrum of Waardenburg syndrome in this region.
Zhang, Yun; Ming, Qing-sen; Yi, Jin-yao; Wang, Xiang; Chai, Qiao-lian; Yao, Shu-qiao
2017-01-01
Gene-environment interactions that moderate aggressive behavior have been identified independently in the serotonin transporter (5-HTT) gene and monoamine oxidase A gene (MAOA). The aim of the present study was to investigate epistasis interactions between MAOA-variable number tandem repeat (VNTR), 5-HTTlinked polymorphism (LPR) and child abuse and the effects of these on aggressive tendencies in a group of otherwise healthy adolescents. A group of 546 Chinese male adolescents completed the Child Trauma Questionnaire and Youth self-report of the Child Behavior Checklist. Buccal cells were collected for DNA analysis. The effects of childhood abuse, MAOA-VNTR, 5-HTTLPR genotypes and their interactive gene-gene-environmental effects on aggressive behavior were analyzed using a linear regression model. The effect of child maltreatment was significant, and a three-way interaction among MAOA-VNTR, 5-HTTLPR and sexual abuse (SA) relating to aggressive behaviors was identified. Chinese male adolescents with high expression of the MAOA-VNTR allele and 5-HTTLPR “SS” genotype exhibited the highest aggression tendencies with an increase in SA during childhood. The findings reported support aggression being a complex behavior involving the synergistic effects of gene-gene-environment interactions. PMID:28203149
Tissue-specific epigenetics in gene neighborhoods: myogenic transcription factor genes
Chandra, Sruti; Terragni, Jolyon; Zhang, Guoqiang; Pradhan, Sriharsa; Haushka, Stephen; Johnston, Douglas; Baribault, Carl; Lacey, Michelle; Ehrlich, Melanie
2015-01-01
Myogenic regulatory factor (MRF) genes, MYOD1, MYOG, MYF6 and MYF5, are critical for the skeletal muscle lineage. Here, we used various epigenome profiles from human myoblasts (Mb), myotubes (Mt), muscle and diverse non-muscle samples to elucidate the involvement of multigene neighborhoods in the regulation of MRF genes. We found more far-distal enhancer chromatin associated with MRF genes in Mb and Mt than previously reported from studies in mice. For the MYF5/MYF6 gene-pair, regions of Mb-associated enhancer chromatin were located throughout the adjacent 236-kb PTPRQ gene even though Mb expressed negligible amounts of PTPRQ mRNA. Some enhancer chromatin regions inside PTPRQ in Mb were also seen in PTPRQ mRNA-expressing non-myogenic cells. This suggests dual-purpose PTPRQ enhancers that upregulate expression of PTPRQ in non-myogenic cells and MYF5/MYF6 in myogenic cells. In contrast, the myogenic enhancer chromatin regions distal to MYOD1 were intergenic and up to 19 kb long. Two of them contain small, known MYOD1 enhancers, and one displayed an unusually high level of 5-hydroxymethylcytosine in a quantitative DNA hydroxymethylation assay. Unexpectedly, three regions of MYOD1-distal enhancer chromatin in Mb and Mt overlapped enhancer chromatin in umbilical vein endothelial cells, which might upregulate a distant gene (PIK3C2A). Lastly, genes surrounding MYOG were preferentially transcribed in Mt, like MYOG itself, and exhibited nearby myogenic enhancer chromatin. These neighboring chromatin regions may be enhancers acting in concert to regulate myogenic expression of multiple adjacent genes. Our findings reveal the very different and complex organization of gene neighborhoods containing closely related transcription factor genes. PMID:26041816
Ethics of Cancer Gene Transfer Clinical Research.
Kimmelman, Jonathan
2015-01-01
Translation of cancer gene transfer confronts many familiar-and some distinctive-ethical challenges. In what follows, I survey three major ethical dimensions of cancer gene transfer development. Subheading 1 centers on the ethics of planning, designing, and reporting animal studies. Subheading 2 describes basic elements of human subjects protection as pertaining to cancer gene transfer. In Subheading 3, I describe how cancer gene transfer researchers have obligations to downstream consumers of the evidence they produce.
Gene therapy for sickle cell disease.
Olowoyeye, Abiola; Okwundu, Charles I
2014-10-10
Sickle cell disease encompasses a group of genetic disorders characterized by the presence of at least one hemoglobin S (Hb S) allele, and a second abnormal allele that could allow abnormal hemoglobin polymerisation leading to a symptomatic disorder.Autosomal recessive disorders (such as sickle cell disease) are good candidates for gene therapy because a normal phenotype can be restored in diseased cells with only a single normal copy of the mutant gene. The objectives of this review are:- to determine whether gene therapy can improve survival and prevent symptoms and complications associated with sickle cell disease;- to examine the risks of gene therapy against the potential long-term gain for people with sickle cell disease. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Haemoglobinopathies Trials Register, which comprises of references identified from comprehensive electronic database searches and searching relevant journals and abstract books of conference proceedings.Date of the most recent search of the Group's Haemoglobinopathies Trials Register: 21 July 2014. All randomised or quasi-randomised clinical trials (including any relevant phase 1, 2 or 3 trials) of gene therapy for all individuals with sickle cell disease, regardless of age or setting. No trials of gene therapy for sickle cell disease were found. No trials of gene therapy for sickle cell disease were reported. No randomised or quasi-randomised clinical trials of gene therapy for sickle cell disease were reported. Thus, no objective conclusions or recommendations in practice can be made on gene therapy for sickle cell disease. This systematic review has identified the need for well-designed, randomised controlled trials to assess the benefits and risks of gene therapy for sickle cell disease.
Kaneko, Tomoatsu; Okiji, Takashi; Kaneko, Reika; Suda, Hideaki; Nör, Jacques E
2009-12-01
Laser capture microdissection (LCM) allows microscopic procurement of specific cell types from tissue sections that can then be used for gene expression analysis. In conventional LCM, frozen tissues stained with hematoxylin are normally used to the molecular analysis. Recent studies suggested that it is possible to carry out gene expression analysis of formaldehyde-fixated paraffin embedded (FFPE) tissues that were stained with hematoxylin. However, it is still unclear if quantitative gene expression analyses can be performed from LCM cells from FFPE tissues that were subjected to immunostaining to enhance identification of target cells. In this proof-of-principle study, we analyzed by reverse transcription-PCR (RT-PCR) and real time PCR the expression of genes in factor VIII immunostained human endothelial cells that were dissected from FFPE tissues by LCM. We observed that immunostaining should be performed at 4 degrees C to preserve the mRNA from the cells. The expression of Bcl-2 in the endothelial cells was evaluated by RT-PCR and by real time PCR. Glyceraldehyde-3-phosphate dehydrogenase and 18S were used as house keeping genes for RT-PCR and real time PCR, respectively. This report unveils a method for quantitative gene expression analysis in cells that were identified by immunostaining and retrieved by LCM from FFPE tissues. This method is ideally suited for the analysis of relatively rare cell types within a tissue, and should improve on our ability to perform differential diagnosis of pathologies as compared to conventional LCM.
Hox genes and chordate evolution.
Holland, P W; Garcia-Fernàndez, J
1996-02-01
Hox genes are implicated in the control of axial patterning during embryonic development of many, perhaps all, animals. Here we review recent data on Hox gene diversity, genomic organization, and embryonic expression in chordates (including tunicates, amphioxus, hagfish, lampreys, teleosts) plus their putative sister group, the hemichordates. We consider the potential of comparative Hox gene data to resolve some outstanding controversies in chordate phylogeny. The use of Hox gene expression patterns to identify homologies between body plans both within the vertebrates and between the chordate subphyla is also discussed. Homology between the vertebrate hindbrain and an extensive region of amphioxus neural tube is suggested by comparison of Hox-3 homologues and strengthened by new data on amphioxus Hox-1 gene expression reported here. Finally, we give two examples of how Hox genes are giving glimpses into chordate developmental evolution. The first relates changes in Hox gene expression to transposition of vertebral of vertebral identities; the second describes a correlation between vertebrate origins and Hox gene cluster duplication. We suggest that the simultaneous duplication of many classes of genes, often interacting in gene networks, allowed the elaboration of new developmental control mechanisms at vertebrate origins.
Infrared laser-mediated local gene induction in medaka, zebrafish and Arabidopsis thaliana.
Deguchi, Tomonori; Itoh, Mariko; Urawa, Hiroko; Matsumoto, Tomohiro; Nakayama, Sohei; Kawasaki, Takashi; Kitano, Takeshi; Oda, Shoji; Mitani, Hiroshi; Takahashi, Taku; Todo, Takeshi; Sato, Junichi; Okada, Kiyotaka; Hatta, Kohei; Yuba, Shunsuke; Kamei, Yasuhiro
2009-12-01
Heat shock promoters are powerful tools for the precise control of exogenous gene induction in living organisms. In addition to the temporal control of gene expression, the analysis of gene function can also require spatial restriction. Recently, we reported a new method for in vivo, single-cell gene induction using an infrared laser-evoked gene operator (IR-LEGO) system in living nematodes (Caenorhabditis elegans). It was demonstrated that infrared (IR) irradiation could induce gene expression in single cells without incurring cellular damage. Here, we report the application of IR-LEGO to the small fish, medaka (Japanese killifish; Oryzias latipes) and zebrafish (Danio rerio), and a higher plant (Arabidopsis thaliana). Using easily observable reporter genes, we successfully induced gene expression in various tissues in these living organisms. IR-LEGO has the potential to be a useful tool in extensive research fields for cell/tissue marking or targeted gene expression in local tissues of small fish and plants.
Faith, Myles S
2008-12-01
This report summarizes emerging opportunities for behavioral science to help advance the field of gene-environment and gene-behavior interactions, based on presentations at The National Cancer Institute (NCI) Workshop, "Gene-Nutrition and Gene-Physical Activity Interactions in the Etiology of Obesity." Three opportunities are highlighted: (i) designing potent behavioral "challenges" in experiments, (ii) determining viable behavioral phenotypes for genetics studies, and (iii) identifying specific measures of the environment or environmental exposures. Additional points are underscored, including the need to incorporate novel findings from neuroimaging studies regarding motivation and drive for eating and physical activity. Advances in behavioral science theory and methods can play an important role in advancing understanding of gene-brain-behavior relationships in obesity onset.
González-Escalona, Narjol; Blackstone, George M.; DePaola, Angelo
2006-01-01
A Vibrio strain isolated from Alaskan oysters and classified by its biochemical characteristics as Vibrio alginolyticus possessed a thermostable direct hemolysin-related hemolysin (trh) gene previously reported only in Vibrio parahaemolyticus. This trh-like gene was cloned and sequenced and was 98% identical to the trh2 gene of V. parahaemolyticus. This gene seems to be functional since it was transcriptionally active in early-stationary-phase growing cells. To our knowledge, this is the first report of V. alginolyticus possessing a trh gene. PMID:17056701
Candidate genes for panhypopituitarism identified by gene expression profiling
Mortensen, Amanda H.; MacDonald, James W.; Ghosh, Debashis
2011-01-01
Mutations in the transcription factors PROP1 and PIT1 (POU1F1) lead to pituitary hormone deficiency and hypopituitarism in mice and humans. The dysmorphology of developing Prop1 mutant pituitaries readily distinguishes them from those of Pit1 mutants and normal mice. This and other features suggest that Prop1 controls the expression of genes besides Pit1 that are important for pituitary cell migration, survival, and differentiation. To identify genes involved in these processes we used microarray analysis of gene expression to compare pituitary RNA from newborn Prop1 and Pit1 mutants and wild-type littermates. Significant differences in gene expression were noted between each mutant and their normal littermates, as well as between Prop1 and Pit1 mutants. Otx2, a gene critical for normal eye and pituitary development in humans and mice, exhibited elevated expression specifically in Prop1 mutant pituitaries. We report the spatial and temporal regulation of Otx2 in normal mice and Prop1 mutants, and the results suggest Otx2 could influence pituitary development by affecting signaling from the ventral diencephalon and regulation of gene expression in Rathke's pouch. The discovery that Otx2 expression is affected by Prop1 deficiency provides support for our hypothesis that identifying molecular differences in mutants will contribute to understanding the molecular mechanisms that control pituitary organogenesis and lead to human pituitary disease. PMID:21828248
Chanda, Palas Kumar; Ganguly, Tridib; Das, Malabika; Lee, Chia Yen; Luong, Thanh T; Sau, Subrata
2007-11-30
Previously it was reported that promoter of groES-groEL operon of Staphylococcus aureus is induced by various cell-wall active antibiotics. In order to exploit the above promoter for identifying novel antistaphylococcal drugs, we have cloned the promoter containing region (P(g)) of groES-groEL operon of S. aureus Newman and found that the above promoter is induced by sublethal concentrations of many antibiotics including cell-wall active antibiotics. A reporter S. aureus RN4220 strain (designated SAU006) was constructed by inserting the P(g)-lacZ transcriptional fusion into its chromosome. Agarose-based assay developed with SAU006 shows that P(g) in single-copy is also induced distinctly by different classes of antibiotics. Data indicate that ciprofloxacin, rifampicin, ampicillin, and cephalothin are strong inducers, whereas, tetracycline, streptomycin and vancomycin induce the above promoter weakly. Sublethal concentrations of ciprofloxacin and ampicilin even have induced P(g) efficiently in microtiter plate grown SAU006. Additional studies show for the first time that above promoter is also induced weakly by arsenate salt and hydrogen peroxide. Taken together, we suggest that our simple and sensitive assay systems with SAU006 could be utilized for screening and detecting not only novel antistaphylococcal compounds but also different toxic chemicals.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Arranz, M.; Sharma, T.; Sham, P.
Crow et al. have reported excess sharing of alleles by male sibling pairs with schizophrenia, at a triplet repeat marker within the androgen receptor gene, indicating that mutations at or near this gene may be a risk factor for males. In this report, we describe a pair of male siblings concordant for both schizophrenia and Reifenstein syndrome, which is caused by a mutation in this gene. This provides support for the hypothesis that the androgen receptor may contribute to liability to develop schizophrenia. Because of this, we have examined a collection of 23 pedigrees multiply affected by schizophrenia for linkagemore » to the androgen receptor. We have found no evidence for linkage by both the LOD score and affected sibling-pair methods, under a range of genetic models with a broad and narrow definition of phenotype, and when families with male-to-male transmission are excluded. However, because of the small number of informative male-male pairs in our sample, we cannot confirm or refute the excess allele sharing for males reported by Crow. 35 refs., 1 fig., 2 tabs.« less
NASA Astrophysics Data System (ADS)
Jia, Chen; Qian, Hong; Chen, Min; Zhang, Michael Q.
2018-03-01
The transient response to a stimulus and subsequent recovery to a steady state are the fundamental characteristics of a living organism. Here we study the relaxation kinetics of autoregulatory gene networks based on the chemical master equation model of single-cell stochastic gene expression with nonlinear feedback regulation. We report a novel relation between the rate of relaxation, characterized by the spectral gap of the Markov model, and the feedback sign of the underlying gene circuit. When a network has no feedback, the relaxation rate is exactly the decaying rate of the protein. We further show that positive feedback always slows down the relaxation kinetics while negative feedback always speeds it up. Numerical simulations demonstrate that this relation provides a possible method to infer the feedback topology of autoregulatory gene networks by using time-series data of gene expression.
Characterization of embryo-specific genes
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
1989-01-01
The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that is not expressed in mature tissues -- the embryonic genes. In the last two years, using cDNA clones, we have isolated 22 cDNA clones, and characterized the expression pattern of their corresponding RNA. At least 4 cDNA clones detect RNAs of embryonic genes. These cDNA clones detect RNAs expressed in somatic as well as zygotic embryos of carrot. Using the cDNA clones, we screened the genomic library of carrot embryo DNA, and isolatedmore » genomic clones for three genes. The structure and function of two genes DC 8 and DC 59 have been characterized and are reported in this paper.« less
Baril, Patrick; Martin-Duque, Pilar; Vassaux, Georges
2010-02-01
Biotherapies involve the utilization of antibodies, genetically modified viruses, bacteria or cells for therapeutic purposes. Molecular imaging has the potential to provide unique information that will guarantee their biosafety in humans and provide a rationale for the future development of new generations of reagents. In this context, non-invasive imaging of gene expression is an attractive prospect, allowing precise, spacio-temporal measurements of gene expression in longitudinal studies involving gene transfer vectors. With the emergence of cell therapies in regenerative medicine, it is also possible to track cells injected into subjects. In this context, the Na/I symporter (NIS) has been used in preclinical studies. Associated with a relevant radiotracer ((123)I(-), (124)I(-), (99m)TcO4(-)), NIS can be used to monitor gene transfer and the spread of selectively replicative viruses in tumours as well as in cells with a therapeutic potential. In addition to its imaging potential, NIS can be used as a therapeutic transgene through its ability to concentrate therapeutic doses of radionuclides in target cells. This dual property has applications in cancer treatment and could also be used to eradicate cells with therapeutic potential in the case of adverse events. Through experience acquired in preclinical studies, we can expect that non-invasive molecular imaging using NIS as a transgene will be pivotal for monitoring in vivo the exact distribution and pharmacodynamics of gene expression in a precise and quantitative way. This review highlights the applications of NIS in biotherapy, with a particular emphasis on image-guided radiotherapy, monitoring of gene and vector biodistribution and trafficking of stem cells.
Efficient disruption of Zebrafish genes using a Gal4-containing gene trap
2013-01-01
Background External development and optical transparency of embryos make zebrafish exceptionally suitable for in vivo insertional mutagenesis using fluorescent proteins to visualize expression patterns of mutated genes. Recently developed Gene Breaking Transposon (GBT) vectors greatly improve the fidelity and mutagenicity of transposon-based gene trap vectors. Results We constructed and tested a bipartite GBT vector with Gal4-VP16 as the primary gene trap reporter. Our vector also contains a UAS:eGFP cassette for direct detection of gene trap events by fluorescence. To confirm gene trap events, we generated a UAS:mRFP tester line. We screened 270 potential founders and established 41 gene trap lines. Three of our gene trap alleles display homozygous lethal phenotypes ranging from embryonic to late larval: nsf tpl6, atp1a3atpl10 and flrtpl19. Our gene trap cassette is flanked by direct loxP sites, which enabled us to successfully revert nsf tpl6, atp1a3atpl10 and flrtpl19 gene trap alleles by injection of Cre mRNA. The UAS:eGFP cassette is flanked by direct FRT sites. It can be readily removed by injection of Flp mRNA for use of our gene trap alleles with other tissue-specific GFP-marked lines. The Gal4-VP16 component of our vector provides two important advantages over other GBT vectors. The first is increased sensitivity, which enabled us to detect previously unnoticed expression of nsf in the pancreas. The second advantage is that all our gene trap lines, including integrations into non-essential genes, can be used as highly specific Gal4 drivers for expression of other transgenes under the control of Gal4 UAS. Conclusions The Gal4-containing bipartite Gene Breaking Transposon vector presented here retains high specificity for integrations into genes, high mutagenicity and revertibility by Cre. These features, together with utility as highly specific Gal4 drivers, make gene trap mutants presented here especially useful to the research community. PMID:24034702
Dynamic monitoring of horizontal gene transfer in soil
NASA Astrophysics Data System (ADS)
Cheng, H. Y.; Masiello, C. A.; Silberg, J. J.; Bennett, G. N.
2015-12-01
Soil microbial gene expression underlies microbial behaviors (phenotypes) central to many aspects of C, N, and H2O cycling. However, continuous monitoring of microbial gene expression in soils is challenging because genetically-encoded reporter proteins widely used in the lab are difficult to deploy in soil matrices: for example, green fluorescent protein cannot be easily visualized in soils, even in the lab. To address this problem we have developed a reporter protein that releases small volatile gases. Here, we applied this gas reporter in a proof-of-concept soil experiment, monitoring horizontal gene transfer, a microbial activity that alters microbial genotypes and phenotypes. Horizontal gene transfer is central to bacterial evolution and adaptation and is relevant to problems such as the spread of antibiotic resistance, increasing metal tolerance in superfund sites, and bioremediation capability of bacterial consortia. This process is likely to be impacted by a number of matrix properties not well-represented in the petri dish, such as microscale variations in water, nutrients, and O2, making petri-dish experiments a poor proxy for environmental processes. We built a conjugation system using synthetic biology to demonstrate the use of gas-reporting biosensors in safe, lab-based biogeochemistry experiments, and here we report the use of these sensors to monitor horizontal gene transfer in soils. Our system is based on the F-plasmid conjugation in Escherichia coli. We have found that the gas signal reports on the number of cells that acquire F-plasmids (transconjugants) in a loamy Alfisol collected from Kellogg Biological Station. We will report how a gas signal generated by transconjugants varies with the number of F-plasmid donor and acceptor cells seeded in a soil, soil moisture, and soil O2 levels.
Using RNA-seq data to select reference genes for normalizing gene expression in apple roots.
Zhou, Zhe; Cong, Peihua; Tian, Yi; Zhu, Yanmin
2017-01-01
Gene expression in apple roots in response to various stress conditions is a less-explored research subject. Reliable reference genes for normalizing quantitative gene expression data have not been carefully investigated. In this study, the suitability of a set of 15 apple genes were evaluated for their potential use as reliable reference genes. These genes were selected based on their low variance of gene expression in apple root tissues from a recent RNA-seq data set, and a few previously reported apple reference genes for other tissue types. Four methods, Delta Ct, geNorm, NormFinder and BestKeeper, were used to evaluate their stability in apple root tissues of various genotypes and under different experimental conditions. A small panel of stably expressed genes, MDP0000095375, MDP0000147424, MDP0000233640, MDP0000326399 and MDP0000173025 were recommended for normalizing quantitative gene expression data in apple roots under various abiotic or biotic stresses. When the most stable and least stable reference genes were used for data normalization, significant differences were observed on the expression patterns of two target genes, MdLecRLK5 (MDP0000228426, a gene encoding a lectin receptor like kinase) and MdMAPK3 (MDP0000187103, a gene encoding a mitogen-activated protein kinase). Our data also indicated that for those carefully validated reference genes, a single reference gene is sufficient for reliable normalization of the quantitative gene expression. Depending on the experimental conditions, the most suitable reference genes can be specific to the sample of interest for more reliable RT-qPCR data normalization.
Using RNA-seq data to select reference genes for normalizing gene expression in apple roots
Zhou, Zhe; Cong, Peihua; Tian, Yi
2017-01-01
Gene expression in apple roots in response to various stress conditions is a less-explored research subject. Reliable reference genes for normalizing quantitative gene expression data have not been carefully investigated. In this study, the suitability of a set of 15 apple genes were evaluated for their potential use as reliable reference genes. These genes were selected based on their low variance of gene expression in apple root tissues from a recent RNA-seq data set, and a few previously reported apple reference genes for other tissue types. Four methods, Delta Ct, geNorm, NormFinder and BestKeeper, were used to evaluate their stability in apple root tissues of various genotypes and under different experimental conditions. A small panel of stably expressed genes, MDP0000095375, MDP0000147424, MDP0000233640, MDP0000326399 and MDP0000173025 were recommended for normalizing quantitative gene expression data in apple roots under various abiotic or biotic stresses. When the most stable and least stable reference genes were used for data normalization, significant differences were observed on the expression patterns of two target genes, MdLecRLK5 (MDP0000228426, a gene encoding a lectin receptor like kinase) and MdMAPK3 (MDP0000187103, a gene encoding a mitogen-activated protein kinase). Our data also indicated that for those carefully validated reference genes, a single reference gene is sufficient for reliable normalization of the quantitative gene expression. Depending on the experimental conditions, the most suitable reference genes can be specific to the sample of interest for more reliable RT-qPCR data normalization. PMID:28934340
DOE Office of Scientific and Technical Information (OSTI.GOV)
Uchiyama, Toru; Kumaki, Satoru; Ishikawa, Yoshinori
Recently, a serious adverse effect of uncontrolled clonal T cell proliferation due to insertional mutagenesis of retroviral vector was reported in X-SCID gene therapy clinical trial. To offset the side effect, we have incorporated a suicide gene into therapeutic retroviral vector for selective elimination of transduced cells. In this study, B-cell lines from two X-SCID patients were transduced with bicistronic retroviral vector carrying human {gamma}c chain cDNA and Herpes simplex virus thymidine kinase gene. After confirmation of functional reconstitution of the {gamma}c chain, the cells were treated with ganciclovir (GCV). The {gamma}c chain positive cells were eliminated under low concentrationmore » without cytotoxicity on untransduced cells and have not reappeared at least for 5 months. Furthermore, the {gamma}c chain transduced cells were still sensitive to GCV after five months. These results demonstrated the efficacy of the suicide gene therapy although further in vivo studies are required to assess feasibility of this approach in clinical trial.« less
Du, Hongchun; Guo, Yubiao; Ma, Di; Tang, Kejing; Cai, Decheng; Luo, Yifeng; Xie, Canmao
2018-05-01
Dyskeratosis congenita (DC) is a rare inherited disease characterized by the classical mucocutaneous triad. Pulmonary fibrosis, bone marrow failure, and solid tumors are the main causes of mortality in DC. Pathogenic variants in TERT, TERC, and DKC1 have been identified in individuals with familial pulmonary fibrosis. Mutations in TINF2 gene have been reported to be associated with bone marrow failure in most cases. However, the relationship between TINF2 mutation and pulmonary fibrosis is not yet clear. Here, we report the case of a 32-year-old woman presented with irritating cough for 2 years and progressive breathlessness for 6 months. The patient was diagnosed with DC based on the following clinical evidences. Along with some family members, she had the typical mucocutaneous triad and pulmonary fibrosis. A heterozygous mutation (c.844C>T), located in exon 6 of TINF2 gene, that changed arginine to cysteine (Arg282Cys) was identified in this proband by whole exome sequencing. The patient received corticosteroid therapy but refused to receive lung transplantation. The proband died of respiratory failure 4 months after the diagnosis. The missense mutation was located in the conserved region of TINF2 gene and predicted to be deleterious by altering the protein structure. Lung transplantation should be considered for improved survival of patients with DC, and pulmonary fibrosis. Whole exome and whole genome sequencing should be widely used in the identification of such rare genetic variants for clinical diagnosis. The study of DC with pulmonary fibrosis can provide a more appropriate means of clinical research and therapy to the unfortunate patients who suffer from this rare disorder.
Kinetically-Defined Component Actions in Gene Repression
Chow, Carson C.; Finn, Kelsey K.; Storchan, Geoffery B.; Lu, Xinping; Sheng, Xiaoyan; Simons, S. Stoney
2015-01-01
Gene repression by transcription factors, and glucocorticoid receptors (GR) in particular, is a critical, but poorly understood, physiological response. Among the many unresolved questions is the difference between GR regulated induction and repression, and whether transcription cofactor action is the same in both. Because activity classifications based on changes in gene product level are mechanistically uninformative, we present a theory for gene repression in which the mechanisms of factor action are defined kinetically and are consistent for both gene repression and induction. The theory is generally applicable and amenable to predictions if the dose-response curve for gene repression is non-cooperative with a unit Hill coefficient, which is observed for GR-regulated repression of AP1LUC reporter induction by phorbol myristate acetate. The theory predicts the mechanism of GR and cofactors, and where they act with respect to each other, based on how each cofactor alters the plots of various kinetic parameters vs. cofactor. We show that the kinetically-defined mechanism of action of each of four factors (reporter gene, p160 coactivator TIF2, and two pharmaceuticals [NU6027 and phenanthroline]) is the same in GR-regulated repression and induction. What differs is the position of GR action. This insight should simplify clinical efforts to differentially modulate factor actions in gene induction vs. gene repression. PMID:25816223
Delimiting Coalescence Genes (C-Genes) in Phylogenomic Data Sets.
Springer, Mark S; Gatesy, John
2018-02-26
coalescence methods have emerged as a popular alternative for inferring species trees with large genomic datasets, because these methods explicitly account for incomplete lineage sorting. However, statistical consistency of summary coalescence methods is not guaranteed unless several model assumptions are true, including the critical assumption that recombination occurs freely among but not within coalescence genes (c-genes), which are the fundamental units of analysis for these methods. Each c-gene has a single branching history, and large sets of these independent gene histories should be the input for genome-scale coalescence estimates of phylogeny. By contrast, numerous studies have reported the results of coalescence analyses in which complete protein-coding sequences are treated as c-genes even though exons for these loci can span more than a megabase of DNA. Empirical estimates of recombination breakpoints suggest that c-genes may be much shorter, especially when large clades with many species are the focus of analysis. Although this idea has been challenged recently in the literature, the inverse relationship between c-gene size and increased taxon sampling in a dataset-the 'recombination ratchet'-is a fundamental property of c-genes. For taxonomic groups characterized by genes with long intron sequences, complete protein-coding sequences are likely not valid c-genes and are inappropriate units of analysis for summary coalescence methods unless they occur in recombination deserts that are devoid of incomplete lineage sorting (ILS). Finally, it has been argued that coalescence methods are robust when the no-recombination within loci assumption is violated, but recombination must matter at some scale because ILS, a by-product of recombination, is the raison d'etre for coalescence methods. That is, extensive recombination is required to yield the large number of independently segregating c-genes used to infer a species tree. If coalescent methods are powerful
Delimiting Coalescence Genes (C-Genes) in Phylogenomic Data Sets
Springer, Mark S.; Gatesy, John
2018-01-01
Summary coalescence methods have emerged as a popular alternative for inferring species trees with large genomic datasets, because these methods explicitly account for incomplete lineage sorting. However, statistical consistency of summary coalescence methods is not guaranteed unless several model assumptions are true, including the critical assumption that recombination occurs freely among but not within coalescence genes (c-genes), which are the fundamental units of analysis for these methods. Each c-gene has a single branching history, and large sets of these independent gene histories should be the input for genome-scale coalescence estimates of phylogeny. By contrast, numerous studies have reported the results of coalescence analyses in which complete protein-coding sequences are treated as c-genes even though exons for these loci can span more than a megabase of DNA. Empirical estimates of recombination breakpoints suggest that c-genes may be much shorter, especially when large clades with many species are the focus of analysis. Although this idea has been challenged recently in the literature, the inverse relationship between c-gene size and increased taxon sampling in a dataset—the ‘recombination ratchet’—is a fundamental property of c-genes. For taxonomic groups characterized by genes with long intron sequences, complete protein-coding sequences are likely not valid c-genes and are inappropriate units of analysis for summary coalescence methods unless they occur in recombination deserts that are devoid of incomplete lineage sorting (ILS). Finally, it has been argued that coalescence methods are robust when the no-recombination within loci assumption is violated, but recombination must matter at some scale because ILS, a by-product of recombination, is the raison d’etre for coalescence methods. That is, extensive recombination is required to yield the large number of independently segregating c-genes used to infer a species tree. If coalescent
Gene therapy for sickle cell disease.
Olowoyeye, Abiola; Okwundu, Charles I
2016-11-14
Sickle cell disease encompasses a group of genetic disorders characterized by the presence of at least one hemoglobin S (Hb S) allele, and a second abnormal allele that could allow abnormal hemoglobin polymerisation leading to a symptomatic disorder.Autosomal recessive disorders (such as sickle cell disease) are good candidates for gene therapy because a normal phenotype can be restored in diseased cells with only a single normal copy of the mutant gene. This is an update of a previously published Cochrane Review. The objectives of this review are:to determine whether gene therapy can improve survival and prevent symptoms and complications associated with sickle cell disease;to examine the risks of gene therapy against the potential long-term gain for people with sickle cell disease. We searched the Cochrane Cystic Fibrosis and Genetic Disorders Group Haemoglobinopathies Trials Register, which comprises of references identified from comprehensive electronic database searches and searching relevant journals and abstract books of conference proceedings.Date of the most recent search of the Group's Haemoglobinopathies Trials Register: 15 August 2016. All randomised or quasi-randomised clinical trials (including any relevant phase 1, 2 or 3 trials) of gene therapy for all individuals with sickle cell disease, regardless of age or setting. No trials of gene therapy for sickle cell disease were found. No trials of gene therapy for sickle cell disease were reported. No randomised or quasi-randomised clinical trials of gene therapy for sickle cell disease were reported. Thus, no objective conclusions or recommendations in practice can be made on gene therapy for sickle cell disease. This systematic review has identified the need for well-designed, randomised controlled trials to assess the benefits and risks of gene therapy for sickle cell disease.
Putative signaling action of amelogenin utilizes the Wnt/beta-catenin pathway.
Matsuzawa, M; Sheu, T-J; Lee, Y-J; Chen, M; Li, T-F; Huang, C T; Holz, J D; Puzas, J E
2009-06-01
While it has long been known that amelogenin is essential for the proper development of enamel, its role has generally been seen as structural in nature. However, our new data implicate this protein in the regulation of cell signaling pathways in periodontal ligament cells and osteoblasts. In this article we report the successful purification of a recombinant mouse amelogenin protein and demonstrate that it has signaling activity in isolated mouse calvarial cells and human periodontal ligament cells. To determine the regulatory function of canonical Wnt signaling by amelogenin, we used TOPGAL transgenic mice. These mice express a beta-galactosidase transgene under the control of a LEF/TCF and beta-catenin-inducible promoter. To investigate in greater detail the molecular mechanisms involved in the beta-catenin signaling pathway, isolated osteoblasts and periodontal ligament cells were exposed to full-length recombinant mouse amelogenin and were evaluated for phenotypic changes and beta-catenin signaling using a TOPFLASH construct and the LacZ reporter gene. In these in vitro models, we showed that amelogenin can activate beta-catenin signaling. Using the TOPGAL transgenic mouse we showed that amelogenin expression in vivo is localized mainly around the root, the periodontal ligament and the alveolar bone.
Targeting gene therapy to cancer: a review.
Dachs, G U; Dougherty, G J; Stratford, I J; Chaplin, D J
1997-01-01
In recent years the idea of using gene therapy as a modality in the treatment of diseases other than genetically inherited, monogenic disorders has taken root. This is particularly obvious in the field of oncology where currently more than 100 clinical trials have been approved worldwide. This report will summarize some of the exciting progress that has recently been made with respect to both targeting the delivery of potentially therapeutic genes to tumor sites and regulating their expression within the tumor microenvironment. In order to specifically target malignant cells while at the same time sparing normal tissue, cancer gene therapy will need to combine highly selective gene delivery with highly specific gene expression, specific gene product activity, and, possibly, specific drug activation. Although the efficient delivery of DNA to tumor sites remains a formidable task, progress has been made in recent years using both viral (retrovirus, adenovirus, adeno-associated virus) and nonviral (liposomes, gene gun, injection) methods. In this report emphasis will be placed on targeted rather than high-efficiency delivery, although those would need to be combined in the future for effective therapy. To date delivery has been targeted to tumor-specific and tissue-specific antigens, such as epithelial growth factor receptor, c-kit receptor, and folate receptor, and these will be described in some detail. To increase specificity and safety of gene therapy further, the expression of the therapeutic gene needs to be tightly controlled within the target tissue. Targeted gene expression has been analyzed using tissue-specific promoters (breast-, prostate-, and melanoma-specific promoters) and disease-specific promoters (carcinoembryonic antigen, HER-2/neu, Myc-Max response elements, DF3/MUC). Alternatively, expression could be regulated externally with the use of radiation-induced promoters or tetracycline-responsive elements. Another novel possibility that will be
Klangnurak, Wanlada; Fukuyo, Taketo; Rezanujjaman, M D; Seki, Masahide; Sugano, Sumio; Suzuki, Yutaka; Tokumoto, Toshinobu
2018-01-01
We previously reported the microarray-based selection of three ovulation-related genes in zebrafish. We used a different selection method in this study, RNA sequencing analysis. An additional eight up-regulated candidates were found as specifically up-regulated genes in ovulation-induced samples. Changes in gene expression were confirmed by qPCR analysis. Furthermore, up-regulation prior to ovulation during natural spawning was verified in samples from natural pairing. Gene knock-out zebrafish strains of one of the candidates, the starmaker gene (stm), were established by CRISPR genome editing techniques. Unexpectedly, homozygous mutants were fertile and could spawn eggs. However, a high percentage of unfertilized eggs and abnormal embryos were produced from these homozygous females. The results suggest that the stm gene is necessary for fertilization. In this study, we selected additional ovulation-inducing candidate genes, and a novel function of the stm gene was investigated.
Case reports of juvenile GM1 gangliosidosisis type II caused by mutation in GLB1 gene.
Karimzadeh, Parvaneh; Naderi, Samaneh; Modarresi, Farzaneh; Dastsooz, Hassan; Nemati, Hamid; Farokhashtiani, Tayebeh; Shamsian, Bibi Shahin; Inaloo, Soroor; Faghihi, Mohammad Ali
2017-07-17
Type II or juvenile GM1-gangliosidosis is an autosomal recessive lysosomal storage disorder, which is clinically distinct from infantile form of the disease by the lack of characteristic cherry-red spot and hepatosplenomegaly. The disease is characterized by slowly progressive neurodegeneration and mild skeletal changes. Due to the later age of onset and uncharacteristic presentation, diagnosis is frequently puzzled with other ataxic and purely neurological disorders. Up to now, 3-4 types of GM1-gangliosidosis have been reported and among them type I is the most common phenotype with the age of onset around 6 months. Various forms of GM1-gangliosidosis are caused by GLB1 gene mutations but severity of the disease and age of onset are directly related to the position and the nature of deleterious mutations. However, due to its unique genetic cause and overlapping clinical features, some researchers believe that GM1 gangliosidosis represents an overlapped disease spectrum instead of four distinct types. Here, we report a less frequent type of autosomal recessive GM1 gangliosidosis with perplexing clinical presentation in three families in the southwest part of Iran, who are unrelated but all from "Lurs" ethnic background. To identify disease-causing mutations, Whole Exome Sequencing (WES) utilizing next generation sequencing was performed. Four patients from three families were investigated with the age of onset around 3 years old. Clinical presentations were ataxia, gate disturbances and dystonia leading to wheelchair-dependent disability, regression of intellectual abilities, and general developmental regression. They all were born in consanguineous families with no previous documented similar disease in their parents. A homozygote missense mutation in GLB1 gene (c. 601 G > A, p.R201C) was found in all patients. Using Sanger sequencing this identified mutation was confirmed in the proband, their parents, grandparents, and extended family members, confirming
ERIC Educational Resources Information Center
Hessl, David; Tassone, Flora; Cordeiro, Lisa; Koldewyn, Kami; McCormick, Carolyn; Green, Cherie; Wegelin, Jacob; Yuhas, Jennifer; Hagerman, Randi J.
2008-01-01
Although fragile X syndrome (FXS) is a single gene disorder with a well-described phenotype, it is not known why some individuals develop more significant maladaptive behaviors such as aggression or autistic symptoms. Here, we studied two candidate genes known to affect mood and aggression, the serotonin transporter (5-HTTLPR) and monoamine…
Ledley, F D; McNamee, L M; Uzdil, V; Morgan, I W
2014-02-01
This report examines the commercialization of gene therapy in the context of innovation theories that posit a relationship between the maturation of a technology through its life cycle and prospects for successful product development. We show that the field of gene therapy has matured steadily since the 1980s, with the congruent accumulation of >35 000 papers, >16 000 US patents, >1800 clinical trials and >$4.3 billion in capital investment in gene therapy companies. Gene therapy technologies comprise a series of dissimilar approaches for gene delivery, each of which has introduced a distinct product architecture. Using bibliometric methods, we quantify the maturation of each technology through a characteristic life cycle S-curve, from a Nascent stage, through a Growing stage of exponential advance, toward an Established stage and projected limit. Capital investment in gene therapy is shown to have occurred predominantly in Nascent stage technologies and to be negatively correlated with maturity. Gene therapy technologies are now achieving the level of maturity that innovation research and biotechnology experience suggest may be requisite for efficient product development. Asynchrony between the maturation of gene therapy technologies and capital investment in development-focused business models may have stalled the commercialization of gene therapy.
Vasculature-Specific Adenovirus Vectors for Gene Therapy of Prostate Cancer
2007-02-01
reporter gene. To this end, a recombinant replication-deficient retrovirus vector containing an open reading frame of Renilla luciferase (hRLuc...dual-mode reporter gene ( Renilla luciferase and green fluorescent protein) has been designed and produced in a pan- tropic configuration. • Dual
First Report of Arg587Cys Mutation of Notch3 Gene in Two Chinese Families with CADASIL.
You, Jinsong; Liao, Shaojun; Zhang, Foming; Ma, Zhaohui; Li, Guifu
2017-01-01
To explore Notch3 mutation sites of Chinese patients with cerebral autosomal dominant arteriopathy with subcortical infarcts and leukoencephalopathy (CADASIL). Direct sequencing of all exons in Notch3 gene was performed on 12 unrelated suspected CADASIL cases from mainland China. A missense p.Arg587Cys (1759C>T) mutation in exon 11 was identified in 2 patients through genetic analysis. Chinese patients with CADASIL of R587C mutation in exon 11 was firstly reported. Copyright © 2017 National Stroke Association. Published by Elsevier Inc. All rights reserved.
[Construction of screening system for mutation of negative regulatory genes in Streptomyces].
Zhu, Yu; Feng, Chi; Tan, Huarong; Tian, Yuqing
2013-10-04
We aimed to create a novel report system for screening the mutation of the negative regulatory genes, especially for those repressing the expression of cryptic antibiotics clusters. We used marker-free gene disruption strategy, which combines with the "REDIRECT (Rapid Efficient Directed Recombination Time Saving)" technology and in vivo site-specific recombination by Streptomyces phage phiBT1 integrase, to construct a scbR2/inoA double mutant strain of S. coelicolor M145. This strain was used as the host of the report system. For the construction of the reporter plasmid, the ScbR2 repressed promoter of cpkO from CPK (cryptic polyketide) cluster was used to drive the expression of a promoterless conserved gene inoA of S. coelicolor. Then the reporter plasmid was introduced into the host strain described above to test the availability of inoA as a reporter gene in this system. The scbR2/inoA double mutant strain gave rise to a bald pheno type on MM medium in the absence of inositol, and produced yellow pigmented secondary metabolite by the disruption of scbR2 to release the repression of cpkO, a pathway specific activator gene situated in CPK cluster. After introducing the reporter plasmid into this test stain, the resulting strain recovered the phenotype as wild-type strain, indicating that the promoter of cpkO can drive the expression of inoA in scbR2 mutant and consequently restore the biosynthesis of inositol. Our results indicated that inoA can be used as a novel reporter gene for Streptomyces, especially for detecting the activation of the "silent" promoter. This report system might be available for screening the mutation of the negative regulatory genes for the cryptic secondary metabolic gene clusters.
Mfd translocase is necessary and sufficient for transcription-coupled repair in Escherichia coli.
Adebali, Ogun; Sancar, Aziz; Selby, Christopher P
2017-11-10
Nucleotide excision repair in Escherichia coli is stimulated by transcription, specifically in the transcribed strand. Previously, it was shown that this transcription-coupled repair (TCR) is mediated by the Mfd translocase. Recently, it was proposed that in fact the majority of TCR in E. coli is catalyzed by a second pathway ("backtracking-mediated TCR") that is dependent on the UvrD helicase and the guanosine pentaphosphate (ppGpp) alarmone/stringent response regulator. Recently, we reported that as measured by the excision repair-sequencing (XR-seq), UvrD plays no role in TCR genome-wide. Here, we tested the role of ppGpp and UvrD in TCR genome-wide and in the lacZ operon using the XR-seq method, which directly measures repair. We found that the mfd mutation abolishes TCR genome-wide and in the lacZ operon. In contrast, the relA - spoT - mutant deficient in ppGpp synthesis carries out normal TCR. We conclude that UvrD and ppGpp play no role in TCR in E. coli . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
GNormPlus: An Integrative Approach for Tagging Genes, Gene Families, and Protein Domains
Lu, Zhiyong
2015-01-01
The automatic recognition of gene names and their associated database identifiers from biomedical text has been widely studied in recent years, as these tasks play an important role in many downstream text-mining applications. Despite significant previous research, only a small number of tools are publicly available and these tools are typically restricted to detecting only mention level gene names or only document level gene identifiers. In this work, we report GNormPlus: an end-to-end and open source system that handles both gene mention and identifier detection. We created a new corpus of 694 PubMed articles to support our development of GNormPlus, containing manual annotations for not only gene names and their identifiers, but also closely related concepts useful for gene name disambiguation, such as gene families and protein domains. GNormPlus integrates several advanced text-mining techniques, including SimConcept for resolving composite gene names. As a result, GNormPlus compares favorably to other state-of-the-art methods when evaluated on two widely used public benchmarking datasets, achieving 86.7% F1-score on the BioCreative II Gene Normalization task dataset and 50.1% F1-score on the BioCreative III Gene Normalization task dataset. The GNormPlus source code and its annotated corpus are freely available, and the results of applying GNormPlus to the entire PubMed are freely accessible through our web-based tool PubTator. PMID:26380306
Low levels of citrin (SLC25A13) expression in adult mouse brain restricted to neuronal clusters.
Contreras, Laura; Urbieta, Almudena; Kobayashi, Keiko; Saheki, Takeyori; Satrústegui, Jorgina
2010-04-01
The mitochondrial aspartate-glutamate carriers (AGC) aralar (SLC25A12) and citrin (SLC25A13) are components of the malate aspartate shuttle (MAS), a major intracellular pathway to transfer reducing equivalents from NADH to the mitochondrial matrix. Aralar is the main AGC isoform present in the adult brain, and it is expressed mainly in neurons. To search for the other AGC isoform, citrin, in brain glial cells, we used a citrin knockout mouse in which the lacZ gene was inserted into the citrin locus as reporter gene. In agreement with the low citrin levels known to be present in the adult mouse brain, beta-galactosidase expression was very low. Surprisingly, unlike the case with astroglial cultures that express citrin, no beta-galactosidase was found in brain glial cells. It was confined to neuronal cells within discrete neuronal clusters. Double-immunolabelling experiments showed that beta-galactosidase colocalized not with glial cell markers but with the pan-neuronal marker NeuN. The deep cerebellar nuclei and a few midbrain nuclei (reticular tegmental pontine nuclei; magnocellular red nuclei) were the regions where beta-galactosidase expression was highest, and it was up-regulated in fasted mice, as was also the case for liver beta-galactosidase. The results support the notion that glial cells have much lower AGC levels and MAS activity than neurons. (c) 2009 Wiley-Liss, Inc.
Moorefield, Emily C.; Andres, Sarah F.; Blue, R. Eric; Van Landeghem, Laurianne; Mah, Amanda T.; Santoro, M. Agostina; Ding, Shengli
2017-01-01
Intestinal epithelial stem cells (IESCs) are critical to maintain intestinal epithelial function and homeostasis. We tested the hypothesis that aging promotes IESC dysfunction using old (18-22 months) and young (2-4 month) Sox9-EGFP IESC reporter mice. Different levels of Sox9-EGFP permit analyses of active IESC (Sox9-EGFPLow), activatable reserve IESC and enteroendocrine cells (Sox9-EGFPHigh), Sox9-EGFPSublow progenitors, and Sox9-EGFPNegative differentiated lineages. Crypt-villus morphology, cellular composition and apoptosis were measured by histology. IESC function was assessed by crypt culture, and proliferation by flow cytometry and histology. Main findings were confirmed in Lgr5-EGFP and Lgr5-LacZ mice. Aging-associated gene expression changes were analyzed by Fluidigm mRNA profiling. Crypts culture from old mice yielded fewer and less complex enteroids. Histology revealed increased villus height and Paneth cells per crypt in old mice. Old mice showed increased numbers and hyperproliferation of Sox9-EGFPLow IESC and Sox9-EGFPHigh cells. Cleaved caspase-3 staining demonstrated increased apoptotic cells in crypts and villi of old mice. Gene expression profiling revealed aging-associated changes in mRNAs associated with cell cycle, oxidative stress and apoptosis specifically in IESC. These findings provide new, direct evidence for aging associated IESC dysfunction, and define potential biomarkers and targets for translational studies to assess and maintain IESC function during aging. PMID:28854151
Rios, Hector; Koushik, Shrinagesh V.; Wang, Haiyan; Wang, Jian; Zhou, Hong-Ming; Lindsley, Andrew; Rogers, Rhonda; Chen, Zhi; Maeda, Manabu; Kruzynska-Frejtag, Agnieszka; Feng, Jian Q.; Conway, Simon J.
2005-01-01
Periostin was originally identified as an osteoblast-specific factor and is highly expressed in the embryonic periosteum, cardiac valves, placenta, and periodontal ligament as well as in many adult cancerous tissues. To investigate its role during development, we generated mice that lack the periostin gene and replaced the translation start site and first exon with a lacZ reporter gene. Surprisingly, although periostin is widely expressed in many developing organs, periostin-deficient (perilacZ) embryos are grossly normal. Postnatally, however, ∼14% of the nulls die before weaning and all of the remaining perilacZ nulls are severely growth retarded. Skeletal analysis revealed that trabecular bone in adult homozygous skeletons was sparse, but overall bone growth was unaffected. Furthermore, by 3 months, the nulls develop an early-onset periodontal disease-like phenotype. Unexpectedly, these mice also show a severe incisor enamel defect, although there is no apparent change in ameloblast differentiation. Significantly, placing the perilacZ nulls on a soft diet that alleviated mechanical strain on the periodontal ligament resulted in a partial rescue of both the enamel and periodontal disease-like phenotypes. Combined, these data suggest that a healthy periodontal ligament is required for normal amelogenesis and that periostin is critically required for maintenance of the integrity of the periodontal ligament in response to mechanical stresses. PMID:16314533
Gene therapy for ocular diseases.
Liu, Melissa M; Tuo, Jingsheng; Chan, Chi-Chao
2011-05-01
The eye is an easily accessible, highly compartmentalised and immune-privileged organ that offers unique advantages as a gene therapy target. Significant advancements have been made in understanding the genetic pathogenesis of ocular diseases, and gene replacement and gene silencing have been implicated as potentially efficacious therapies. Recent improvements have been made in the safety and specificity of vector-based ocular gene transfer methods. Proof-of-concept for vector-based gene therapies has also been established in several experimental models of human ocular diseases. After nearly two decades of ocular gene therapy research, preliminary successes are now being reported in phase 1 clinical trials for the treatment of Leber congenital amaurosis. This review describes current developments and future prospects for ocular gene therapy. Novel methods are being developed to enhance the performance and regulation of recombinant adeno-associated virus- and lentivirus-mediated ocular gene transfer. Gene therapy prospects have advanced for a variety of retinal disorders, including retinitis pigmentosa, retinoschisis, Stargardt disease and age-related macular degeneration. Advances have also been made using experimental models for non-retinal diseases, such as uveitis and glaucoma. These methodological advancements are critical for the implementation of additional gene-based therapies for human ocular diseases in the near future.
Baril, Patrick; Martin-Duque, Pilar; Vassaux, Georges
2010-01-01
Biotherapies involve the utilization of antibodies, genetically modified viruses, bacteria or cells for therapeutic purposes. Molecular imaging has the potential to provide unique information that will guarantee their biosafety in humans and provide a rationale for the future development of new generations of reagents. In this context, non-invasive imaging of gene expression is an attractive prospect, allowing precise, spacio-temporal measurements of gene expression in longitudinal studies involving gene transfer vectors. With the emergence of cell therapies in regenerative medicine, it is also possible to track cells injected into subjects. In this context, the Na/I symporter (NIS) has been used in preclinical studies. Associated with a relevant radiotracer (123I-, 124I-, 99mTcO4-), NIS can be used to monitor gene transfer and the spread of selectively replicative viruses in tumours as well as in cells with a therapeutic potential. In addition to its imaging potential, NIS can be used as a therapeutic transgene through its ability to concentrate therapeutic doses of radionuclides in target cells. This dual property has applications in cancer treatment and could also be used to eradicate cells with therapeutic potential in the case of adverse events. Through experience acquired in preclinical studies, we can expect that non-invasive molecular imaging using NIS as a transgene will be pivotal for monitoring in vivo the exact distribution and pharmacodynamics of gene expression in a precise and quantitative way. This review highlights the applications of NIS in biotherapy, with a particular emphasis on image-guided radiotherapy, monitoring of gene and vector biodistribution and trafficking of stem cells. This article is part of a themed section on Imaging in Pharmacology. To view the editorial for this themed section visit http://dx.doi.org/10.1111/j.1476-5381.2010.00685.x PMID:19814733
Zhan, Yijing; Xu, Zheng; Li, Sha; Liu, Xiaoliu; Xu, Lu; Feng, Xiaohai; Xu, Hong
2014-03-19
The functional sweetener, d-tagatose, is commonly transformed from galactose by l-arabinose isomerase. To make use of a much cheaper starting material, lactose, hydrolization, and isomerization are required to take place collaboratively. Therefore, a single-step method involving β-d-galactosidase was explored for d-tagatose production. The two vital genes, β-d-galactosidase gene (lacZ) and l-arabinose isomerase mutant gene (araA') were extracted separately from Escherichia coli strains and incorporated into E. coli simultaneously. This gave us E. coli-ZY, a recombinant producing strain capable of coexpressing the two key enzymes. The resulted cells exhibited maximum d-tagatose producing activity at 34 °C and pH 6.5 and in the presence of borate, 10 mM Fe(2+), and 1 mM Mn(2+). Further monitoring showed that the recombinant cells could hydrolyze more than 95% lactose and convert 43% d-galactose into d-tagatose. This research has verified the feasibility of single-step d-tagatose fermentation, thereby laying down the foundation for industrial usage of lactose.
Singh, Pratichi; Dass, J Febin Prabhu
2016-10-01
HCV infection causes acute and chronic liver diseases including, cirrhosis and hepatocellular carcinoma. Following HCV infection, spontaneous clearance occurs in approximately 20 % of the population dependant upon HCV genotype. In this study, functional and non-functional variant analysis was executed for the classical and the latest HCV clearance candidate genes namely, KIR2DL3 and IFNL3. Initially, the functional effects of non-synonymous SNPs were assigned on exposing to homology based tools, SIFT, PolyPhen-2 and PROVEAN. Further, UTR and splice sites variants were scanned for the gene expression and regulation changes. Subsequently, the haplotype and CNV were also identified. The mutation H77Y of KIR2DL3 and R157Q, H156Y, S63L, R157W, F179V, H128R, T101M, R180C, and F176I of IFNL3 results in conservation, RMSD, total energy, stability, and secondary structures revealed a negative impact on the structural fitness. UTRscan and the splice site result indicate functional change, which may affect gene regulation and expression. The graphical display of selected population shows alleles like rs270779, rs2296370, rs10423751, rs12982559, rs9797797, and rs35987710 of KIR2DL3 and rs12972991, rs12980275, rs4803217, rs8109886, and rs8099917 of IFNL3 are in high LD with a measure of [Formula: see text] broadcasting its protective effect in HCV clearance. Similarly, CNV report suggests major DNA fragment loss that could have a profound impact on the gene expression affecting the overall phenotype. This roundup report specifies the effect of NK cell receptor, KIR2DL3 and IFNL3 variants that can have a better prospect in GWAS and immunogenetic studies leading to better understanding of HCV clearance and progression.
2010-01-01
Background Horizontal gene transfer (HGT) is relatively common in plant mitochondrial genomes but the mechanisms, extent and consequences of transfer remain largely unknown. Previous results indicate that parasitic plants are often involved as either transfer donors or recipients, suggesting that direct contact between parasite and host facilitates genetic transfer among plants. Results In order to uncover the mechanistic details of plant-to-plant HGT, the extent and evolutionary fate of transfer was investigated between two groups: the parasitic genus Cuscuta and a small clade of Plantago species. A broad polymerase chain reaction (PCR) survey of mitochondrial genes revealed that at least three genes (atp1, atp6 and matR) were recently transferred from Cuscuta to Plantago. Quantitative PCR assays show that these three genes have a mitochondrial location in the one species line of Plantago examined. Patterns of sequence evolution suggest that these foreign genes degraded into pseudogenes shortly after transfer and reverse transcription (RT)-PCR analyses demonstrate that none are detectably transcribed. Three cases of gene conversion were detected between native and foreign copies of the atp1 gene. The identical phylogenetic distribution of the three foreign genes within Plantago and the retention of cytidines at ancestral positions of RNA editing indicate that these genes were probably acquired via a single, DNA-mediated transfer event. However, samplings of multiple individuals from two of the three species in the recipient Plantago clade revealed complex and perplexing phylogenetic discrepancies and patterns of sequence divergence for all three of the foreign genes. Conclusions This study reports the best evidence to date that multiple mitochondrial genes can be transferred via a single HGT event and that transfer occurred via a strictly DNA-level intermediate. The discovery of gene conversion between co-resident foreign and native mitochondrial copies suggests