The mouse Gtl2 gene is differentially expressed during embryonic development, encodes multiple alternatively spliced transcripts, and may act as an RNA.

PubMed

Schuster-Gossler, K; Bilinski, P; Sado, T; Ferguson-Smith, A; Gossler, A

1998-06-01

We have isolated a novel mouse gene (Gtl2) from the site of a gene trap integration (Gtl2lacZ) that gave rise to developmentally regulated lacZ expression, and a dominant parental-origin-dependent phenotype. Heterozygous Gtl2lacZ mice that inherited the transgene from the father showed a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype was strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. Gtl2 expression is highly similar to the beta-galactosidase staining pattern, and is down-regulated but not abolished in mice carrying the Gtl2lacZ insertion. In early postimplantation embryos, Gtl2 is expressed in the visceral yolk sac and embryonic ectoderm. During subsequent development and organogenesis, Gtl2 transcripts are abundant in the paraxial mesoderm closely correlated with myogenic differentiation, in parts of the central nervous system, and in the epithelial ducts of developing excretory organs. The Gtl2 gene gives rise to various differentially spliced transcripts, which contain multiple small open reading frames (ORF). However, none of the ATG codons of these ORFs is in the context of a strong Kozak consensus sequence for initiation of translation, suggesting that Gtl2 might function as an RNA. Nuclear Gtl2 RNA was detected in a temporally and spatially regulated manner, and partially processed Gtl2 transcripts were readily detected in Northern blot hybridizations of polyadenylated RNA, suggesting that primary Gtl2 transcripts are differently processed in various cell types during development. Gtl2 transcript levels are present in parthenogenic embryos but may be reduced, consistent with the pattern of inheritance of the Gtl2lacZ phenotype.

The strategy of fusion genes construction determines efficient expression of introduced transcription factors.

PubMed

Adamus, Tomasz; Konieczny, Paweł; Sekuła, Małgorzata; Sułkowski, Maciej; Majka, Marcin

2014-01-01

The main goal in gene therapy and biomedical research is an efficient transcription factors (TFs) delivery system. SNAIL, a zinc finger transcription factor, is strongly involved in tumor, what makes its signaling pathways an interesting research subject. The necessity of tracking activation of intracellular pathways has prompted fluorescent proteins usage as localization markers. Advanced molecular cloning techniques allow to generate fusion proteins from fluorescent markers and transcription factors. Depending on fusion strategy, the protein expression levels and nuclear transport ability are significantly different. The P2A self-cleavage motif through its cleavage ability allows two single proteins to be simultaneously expressed. The aim of this study was to compare two strategies for introducing a pair of genes using expression vector system. We have examined GFP and SNAI1 gene fusions by comprising common nucleotide polylinker (multiple cloning site) or P2A motif in between them, resulting in one fusion or two independent protein expressions respectively. In each case transgene expression levels and translation efficiency as well as nuclear localization of expressed protein have been analyzed. Our data showed that usage of P2A motif provides more effective nuclear transport of SNAIL transcription factor than conventional genes linker. At the same time the fluorescent marker spreads evenly in subcellular space.

Expression of Shigella flexneri gluQ-rs gene is linked to dksA and controlled by a transcriptional terminator

PubMed Central

2012-01-01

Background Glutamyl queuosine-tRNAAsp synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNAAsp. Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. Results The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. Conclusions The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri. PMID:23035718

Expression of Shigella flexneri gluQ-rs gene is linked to dksA and controlled by a transcriptional terminator.

PubMed

Caballero, Valeria C; Toledo, Viviana P; Maturana, Cristian; Fisher, Carolyn R; Payne, Shelley M; Salazar, Juan Carlos

2012-10-05

Glutamyl queuosine-tRNA(Asp) synthetase (GluQ-RS) is a paralog of the catalytic domain of glutamyl-tRNA synthetase and catalyzes the formation of glutamyl-queuosine on the wobble position of tRNA(Asp). Here we analyze the transcription of its gene in Shigella flexneri, where it is found downstream of dksA, which encodes a transcriptional regulator involved in stress responses. The genomic organization, dksA-gluQ-rs, is conserved in more than 40 bacterial species. RT-PCR assays show co-transcription of both genes without a significant change in transcript levels during growth of S. flexneri. However, mRNA levels of the intergenic region changed during growth, increasing at stationary phase, indicating an additional level of control over the expression of gluQ-rs gene. Transcriptional fusions with lacZ as a reporter gene only produced β-galactosidase activity when the constructs included the dksA promoter, indicating that gluQ-rs do not have a separate promoter. Using bioinformatics, we identified a putative transcriptional terminator between dksA and gluQ-rs. Deletion or alteration of the predicted terminator resulted in increased expression of the lacZ reporter compared with cells containing the wild type terminator sequence. Analysis of the phenotype of a gluQ-rs mutant suggested that it may play a role in some stress responses, since growth of the mutant was impaired in the presence of osmolytes. The results presented here, show that the expression of gluQ-rs depends on the dksA promoter, and strongly suggest the presence and the functionality of a transcriptional terminator regulating its expression. Also, the results indicate a link between glutamyl-queuosine synthesis and stress response in Shigella flexneri.

Transcriptional analysis of the multicopy hao gene coding for hydroxylamine oxidoreductase in Nitrosomonas sp. strain ENI-11.

PubMed

Hirota, Ryuichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao; Kato, Junichi

2006-08-01

The nitrifying bacterium Nitrosomonas sp. strain ENI-11 has three copies of the gene encoding hydroxylamine oxidoreductase (hao(1), hao(2), and hao(3)) on its genome. Broad-host-range reporter plasmids containing transcriptional fusion genes between hao copies and lacZ were constructed to analyze the expression of each hydroxylamine oxidoreductase gene (hao) copy individually and quantitatively. beta-Galactosidase assays of ENI-11 harboring reporter plasmids revealed that all hao copies were transcribed in the wild-type strain. Promoter analysis of hao copies revealed that transcription of hao(3) was highest among the hao copies. Expression levels of hao(1) and hao(2) were 40% and 62% of that of hao(3) respectively. Transcription of hao(1) was negatively regulated, whereas a portion of hao(3) transcription was read through transcription from the rpsT promoter. When energy-depleted cells were incubated in the growth medium, only hao(3) expression increased. This result suggests that it is hao(3) that is responsible for recovery from energy-depleted conditions in Nitrosomonas sp. strain ENI-11.

Transcriptional analysis of the bglP gene from Streptococcus mutans.

PubMed

Cote, Christopher K; Honeyman, Allen L

2006-04-21

An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript.

Transcriptional analysis of the bglP gene from Streptococcus mutans

PubMed Central

Cote, Christopher K; Honeyman, Allen L

2006-01-01

Background An open reading frame encoding a putative antiterminator protein, LicT, was identified in the genomic sequence of Streptococcus mutans. A potential ribonucleic antitermination (RAT) site to which the LicT protein would potentially bind has been identified immediately adjacent to this open reading frame. The licT gene and RAT site are both located 5' to a beta-glucoside PTS regulon previously described in S. mutans that is responsible for esculin utilization in the presence of glucose. It was hypothesized that antitermination is the regulatory mechanism that is responsible for the control of the bglP gene expression, which encodes an esculin-specific PTS enzyme II. Results To localize the promoter activity associated with the bglP locus, a series of transcriptional lacZ gene fusions was formed on a reporter shuttle vector using various DNA fragments from the bglP promoter region. Subsequent beta-galactosidase assays in S. mutans localized the bglP promoter region and identified putative -35 and -10 promoter elements. Primer extension analysis identified the bglP transcriptional start site. In addition, a terminated bglP transcript formed by transcriptional termination was identified via transcript mapping experiments. Conclusion The physical location of these genetic elements, the RAT site and the promoter regions, and the identification of a short terminated mRNA support the hypothesis that antitermination regulates the bglP transcript. PMID:16630357

Inhibition of CRM1-mediated nuclear export of transcription factors by leukemogenic NUP98 fusion proteins.

PubMed

Takeda, Akiko; Sarma, Nayan J; Abdul-Nabi, Anmaar M; Yaseen, Nabeel R

2010-05-21

NUP98 is a nucleoporin that plays complex roles in the nucleocytoplasmic trafficking of macromolecules. Rearrangements of the NUP98 gene in human leukemia result in the expression of numerous fusion oncoproteins whose effect on nucleocytoplasmic trafficking is poorly understood. The present study was undertaken to determine the effects of leukemogenic NUP98 fusion proteins on CRM1-mediated nuclear export. NUP98-HOXA9, a prototypic NUP98 fusion, inhibited the nuclear export of two known CRM1 substrates: mutated cytoplasmic nucleophosmin and HIV-1 Rev. In vitro binding assays revealed that NUP98-HOXA9 binds CRM1 through the FG repeat motif in a Ran-GTP-dependent manner similar to but stronger than the interaction between CRM1 and its export substrates. Two NUP98 fusions, NUP98-HOXA9 and NUP98-DDX10, whose fusion partners are structurally and functionally unrelated, interacted with endogenous CRM1 in myeloid cells as shown by co-immunoprecipitation. These leukemogenic NUP98 fusion proteins interacted with CRM1, Ran, and the nucleoporin NUP214 in a manner fundamentally different from that of wild-type NUP98. NUP98-HOXA9 and NUP98-DDX10 formed characteristic aggregates within the nuclei of a myeloid cell line and primary human CD34+ cells and caused aberrant localization of CRM1 to these aggregates. These NUP98 fusions caused nuclear accumulation of two transcription factors, NFAT and NFkappaB, that are regulated by CRM1-mediated export. The nuclear entrapment of NFAT and NFkappaB correlated with enhanced transcription from promoters responsive to these transcription factors. Taken together, the results suggest a new mechanism by which NUP98 fusions dysregulate transcription and cause leukemia, namely, inhibition of CRM1-mediated nuclear export with aberrant nuclear retention of transcriptional regulators.

RNA sequencing of esophageal adenocarcinomas identifies novel fusion transcripts, including NPC1-MELK, arising from a complex chromosomal rearrangement.

PubMed

Wang, Zhixiong; Cheng, Yulan; Abraham, John M; Yan, Rong; Liu, Xi; Chen, Wei; Ibrahim, Sariat; Schroth, Gary P; Ke, Xiquan; He, Yulong; Meltzer, Stephen J

2017-10-15

Studies of chromosomal rearrangements and fusion transcripts have elucidated mechanisms of tumorigenesis and led to targeted cancer therapies. This study was aimed at identifying novel fusion transcripts in esophageal adenocarcinoma (EAC). To identify new fusion transcripts associated with EAC, targeted RNA sequencing and polymerase chain reaction (PCR) verification were performed in 40 EACs and matched nonmalignant specimens from the same patients. Genomic PCR and Sanger sequencing were performed to find the breakpoint of fusion genes. Five novel in-frame fusion transcripts were identified and verified in 40 EACs and in a validation cohort of 15 additional EACs (55 patients in all): fibroblast growth factor receptor 2 (FGFR2)-GRB2-associated binding protein 2 (GAB2) in 2 of 55 or 3.6%, Niemann-Pick C1 (NPC1)-maternal embryonic leucine zipper kinase (MELK) in 2 of 55 or 3.6%, ubiquitin-specific peptidase 54 (USP54)-calcium/calmodulin dependent protein kinase II γ (CAMK2G) in 2 of 55 or 3.6%, megakaryoblastic leukemia (translocation) 1 (MKL1)-fibulin 1 (FBLN1) in 1 of 55 or 1.8%, and CCR4-NOT transcription complex subunit 2 (CNOT2)-chromosome 12 open reading frame 49 (C12orf49) in 1 of 55 or 1.8%. A genomic analysis indicated that NPC1-MELK arose from a complex interchromosomal translocation event involving chromosomes 18, 3, and 9 with 3 rearrangement points, and this was consistent with chromoplexy. These data indicate that fusion transcripts occur at a stable frequency in EAC. Furthermore, our results indicate that chromoplexy is an underlying mechanism that generates fusion transcripts in EAC. These and other fusion transcripts merit further study as diagnostic markers and potential therapeutic targets in EAC. Cancer 2017;123:3916-24. © 2017 American Cancer Society. © 2017 American Cancer Society.

Gtl2lacZ, an insertional mutation on mouse chromosome 12 with parental origin-dependent phenotype.

PubMed

Schuster-Gossler, K; Simon-Chazottes, D; Guenet, J L; Zachgo, J; Gossler, A

1996-01-01

We have produced a transgenic mouse line, Gtl2lacZ (Gene trap locus 2), that carries an insertional mutation with a dominant modified pattern of inheritance:heterozygous Gtl2lacZ mice that inherited the transgene from the father show a proportionate dwarfism phenotype, whereas the penetrance and expressivity of the phenotype is strongly reduced in Gtl2lacZ mice that inherited the transgene from the mother. On a mixed genetic background this pattern of inheritance was reversible upon transmission of the transgene through the germ line of the opposite sex. On a predominantly 129/Sv genetic background, however, transgene passage through the female germ line modified the transgene effect, such that the penetrance of the mutation was drastically reduced and the phenotype was no longer obvious after subsequent male germ line transmission. Expression of the transgene, however, was neither affected by genetic background nor by parental legacy. Gtl2lacZ maps to mouse Chromosome 12 in a region that displays imprinting effects associated with maternal and paternal disomy. Our results suggest that the transgene insertion in Gtl2lacZ mice affects an endogenous gene(s) required for fetal and postnatal growth and that this gene(s) is predominantly paternally expressed.

Construction of new cloning, lacZ reporter and scarless-markerless suicide vectors for genetic studies in Aggregatibacter actinomycetemcomitans

PubMed Central

Juárez-Rodríguez, María Dolores; Torres-Escobar, Ascención; Demuth, Donald R.

2013-01-01

To elucidate the putative function of a gene, effective tools are required for genetic characterization that facilitate its inactivation, deletion or modification on the bacterial chromosome. In the present study, the nucleotide sequence of the Escherichia coli/Aggregatibacter actinomycetemcomitans shuttle vector pYGK was determined, allowing us to redesign and construct a new shuttle cloning vector, pJT4, and promoterless lacZ transcriptional/translational fusion plasmids, pJT3 and pJT5. Plasmids pJT4 and pJT5 contain the origin of replication necessary to maintain shuttle vector replication. In addition, a new suicide vector, pJT1, was constructed for the generation of scarless and markerless deletion mutations of genes in the oral pathogen A. actinomycetemcomitans. Plasmid pJT1 is a pUC-based suicide vector that is counter-selectable for sucrose sensitivity. This vector does not leave antibiotic markers or scars on the chromosome after gene deletion and thus provides the option to combine several mutations in the same genetic background. The effectiveness of pJT1 was demonstrated by the construction of A. actinomycetemcomitans isogenic qseB single deletion (ΔqseB) mutant and lsrRK double deletion mutants (ΔlsrRK). These new vectors may offer alternatives for genetic studies in A. actinomycetemcomitans and other members of the HACEK (Haemophilus spp., A. actinomycetemcomitans, Cardiobacterium hominis, Eikenella corrodens, and Kingella kingae) group of Gram-negative bacteria. PMID:23353051

Escherichia coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ.

PubMed

Koponen, Jonna K; Turunen, Anna-Mari; Ylä-Herttuala, Seppo

2002-03-01

Real-time PCR is a powerful method for the quantification of gene expression in biological samples. This method uses TaqMan chemistry based on the 5' -exonuclease activity of the AmpliTaq Gold DNA polymerase which releases fluorescence from hybridized probes during synthesis of each new PCR product. Many gene therapy studies use lacZ, encoding Escherichia coli beta-galactosidase, as a marker gene. Our results demonstrate that E. coli DNA contamination in AmpliTaq Gold polymerase interferes with TaqMan analysis of lacZ gene expression and decreases sensitivity of the method below the level required for biodistribution and long-term gene expression studies. In biodistribution analyses the contamination can lead to false-negative results by masking low-level lacZ expression in target and ectopic tissues, and false-positive results if sufficient controls are not used. We conclude that, to get reliable TaqMan results with lacZ, adequate controls should be included in each run to rule out contamination from AmpliTaq Gold polymerase.

Detection of antistaphylococcal and toxic compounds by biological assay systems developed with a reporter Staphylococcus aureus strain harboring a heat inducible promoter - lacZ transcriptional fusion.

PubMed

Chanda, Palas Kumar; Ganguly, Tridib; Das, Malabika; Lee, Chia Yen; Luong, Thanh T; Sau, Subrata

2007-11-30

Previously it was reported that promoter of groES-groEL operon of Staphylococcus aureus is induced by various cell-wall active antibiotics. In order to exploit the above promoter for identifying novel antistaphylococcal drugs, we have cloned the promoter containing region (P(g)) of groES-groEL operon of S. aureus Newman and found that the above promoter is induced by sublethal concentrations of many antibiotics including cell-wall active antibiotics. A reporter S. aureus RN4220 strain (designated SAU006) was constructed by inserting the P(g)-lacZ transcriptional fusion into its chromosome. Agarose-based assay developed with SAU006 shows that P(g) in single-copy is also induced distinctly by different classes of antibiotics. Data indicate that ciprofloxacin, rifampicin, ampicillin, and cephalothin are strong inducers, whereas, tetracycline, streptomycin and vancomycin induce the above promoter weakly. Sublethal concentrations of ciprofloxacin and ampicilin even have induced P(g) efficiently in microtiter plate grown SAU006. Additional studies show for the first time that above promoter is also induced weakly by arsenate salt and hydrogen peroxide. Taken together, we suggest that our simple and sensitive assay systems with SAU006 could be utilized for screening and detecting not only novel antistaphylococcal compounds but also different toxic chemicals.

Microfluidics-Based PCR for Fusion Transcript Detection.

PubMed

Chen, Hui

2016-01-01

The microfluidic technology allows the production of network of submillimeter-size fluidic channels and reservoirs in a variety of material systems. The microfluidic-based polymerase chain reaction (PCR) allows automated multiplexing of multiple samples and multiple assays simultaneously within a network of microfluidic channels and chambers that are co-ordinated in controlled fashion by the valves. The individual PCR reaction is performed in nanoliter volume, which allows testing on samples with limited DNA and RNA. The microfluidics devices are used in various types of PCR such as digital PCR and single molecular emulsion PCR for genotyping, gene expression, and miRNA expression. In this chapter, the use of a microfluidics-based PCR for simultaneous screening of 14 known fusion transcripts in patients with leukemia is described.

NCLscan: accurate identification of non-co-linear transcripts (fusion, trans-splicing and circular RNA) with a good balance between sensitivity and precision.

PubMed

Chuang, Trees-Juen; Wu, Chan-Shuo; Chen, Chia-Ying; Hung, Li-Yuan; Chiang, Tai-Wei; Yang, Min-Yu

2016-02-18

Analysis of RNA-seq data often detects numerous 'non-co-linear' (NCL) transcripts, which comprised sequence segments that are topologically inconsistent with their corresponding DNA sequences in the reference genome. However, detection of NCL transcripts involves two major challenges: removal of false positives arising from alignment artifacts and discrimination between different types of NCL transcripts (trans-spliced, circular or fusion transcripts). Here, we developed a new NCL-transcript-detecting method ('NCLscan'), which utilized a stepwise alignment strategy to almost completely eliminate false calls (>98% precision) without sacrificing true positives, enabling NCLscan outperform 18 other publicly-available tools (including fusion- and circular-RNA-detecting tools) in terms of sensitivity and precision, regardless of the generation strategy of simulated dataset, type of intragenic or intergenic NCL event, read depth of coverage, read length or expression level of NCL transcript. With the high accuracy, NCLscan was applied to distinguishing between trans-spliced, circular and fusion transcripts on the basis of poly(A)- and nonpoly(A)-selected RNA-seq data. We showed that circular RNAs were expressed more ubiquitously, more abundantly and less cell type-specifically than trans-spliced and fusion transcripts. Our study thus describes a robust pipeline for the discovery of NCL transcripts, and sheds light on the fundamental biology of these non-canonical RNA events in human transcriptome. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Functional Genomic Screening Reveals Splicing of the EWS-FLI1 Fusion Transcript as a Vulnerability in Ewing Sarcoma.

PubMed

Grohar, Patrick J; Kim, Suntae; Rangel Rivera, Guillermo O; Sen, Nirmalya; Haddock, Sara; Harlow, Matt L; Maloney, Nichole K; Zhu, Jack; O'Neill, Maura; Jones, Tamara L; Huppi, Konrad; Grandin, Magdalena; Gehlhaus, Kristen; Klumpp-Thomas, Carleen A; Buehler, Eugen; Helman, Lee J; Martin, Scott E; Caplen, Natasha J

2016-01-26

Ewing sarcoma cells depend on the EWS-FLI1 fusion transcription factor for cell survival. Using an assay of EWS-FLI1 activity and genome-wide RNAi screening, we have identified proteins required for the processing of the EWS-FLI1 pre-mRNA. We show that Ewing sarcoma cells harboring a genomic breakpoint that retains exon 8 of EWSR1 require the RNA-binding protein HNRNPH1 to express in-frame EWS-FLI1. We also demonstrate the sensitivity of EWS-FLI1 fusion transcripts to the loss of function of the U2 snRNP component, SF3B1. Disrupted splicing of the EWS-FLI1 transcript alters EWS-FLI1 protein expression and EWS-FLI1-driven expression. Our results show that the processing of the EWS-FLI1 fusion RNA is a potentially targetable vulnerability in Ewing sarcoma cells. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

Enhanced expression of cro-beta-galactosidase fusion proteins under the control of the PR promoter of bacteriophage lambda.

PubMed Central

Zabeau, M; Stanley, K K

1982-01-01

Hybrid plasmids carrying cro-lacZ gene fusions have been constructed by joining DNA segments carrying the PR promoter and the start of the cro gene of bacteriophage lambda to the lacZ gene fragment carried by plasmid pLG400 . Plasmids in which the translational reading frames of the cro and lacZ genes are joined in-register (type I) direct the synthesis of elevated levels of cro-beta-galactosidase fusion protein amounting to 30% of the total cellular protein, while plasmids in which the genes are fused out-of-register (type II) produce a low level of beta-galactosidase protein. Sequence rearrangements downstream of the cro initiator AUG were found to influence the efficiency of translation, and have been correlated with alterations in the RNA secondary structure of the ribosome-binding site. Plasmids which direct the synthesis of high levels of beta-galactosidase are conditionally lethal and can only be propagated when the PR promoter is repressed. Deletion of sequences downstream of the lacZ gene restored viability, indicating that this region of the plasmid encodes a function which inhibits the growth of the cells. The different applications of these plasmids for expression of cloned genes are discussed. Images Fig. 6. PMID:6327257

p53 deficiency alters the yield and spectrum of radiation-induced lacZ mutants in the brain of transgenic mice

NASA Technical Reports Server (NTRS)

Chang, P. Y.; Kanazawa, N.; Lutze-Mann, L.; Winegar, R. A.

2001-01-01

Exposure to heavy particle radiation in the galacto-cosmic environment poses a significant risk in space exploration and the evaluation of radiation-induced genetic damage in tissues, especially in the central nervous system, is an important consideration in long-term manned space missions. We used a plasmid-based transgenic mouse model system, with the pUR288 lacZ transgene integrated in the genome of every cell of C57Bl/6(lacZ) mice, to evaluate the genetic damage induced by iron particle radiation. In order to examine the importance of genetic background on the radiation sensitivity of individuals, we cross-bred p53 wild-type lacZ transgenic mice with p53 nullizygous mice, producing lacZ transgenic mice that were either hemizygous or nullizygous for the p53 tumor suppressor gene. Animals were exposed to an acute dose of 1 Gy of iron particles and the lacZ mutation frequency (MF) in the brain was measured at time intervals from 1 to 16 weeks post-irradiation. Our results suggest that iron particles induced an increase in lacZ MF (2.4-fold increase in p53+/+ mice, 1.3-fold increase in p53+/- mice and 2.1-fold increase in p53-/- mice) and that this induction is both temporally regulated and p53 genotype dependent. Characterization of mutants based on their restriction patterns showed that the majority of the mutants arising spontaneously are derived from point mutations or small deletions in all three genotypes. Radiation induced alterations in the spectrum of deletion mutants and reorganization of the genome, as evidenced by the selection of mutants containing mouse genomic DNA. These observations are unique in that mutations in brain tissue after particle radiation exposure have never before been reported owing to technical limitations in most other mutation assays.

Synergistic induction of the heat shock response in Escherichia coli by simultaneous treatment with chemical inducers.

PubMed Central

Van Dyk, T K; Reed, T R; Vollmer, A C; LaRossa, R A

1995-01-01

Escherichia coli strains carrying transcriptional fusions of four sigma 32-controlled E. coli heat shock promoters to luxCDABE or lacZ reporter genes were stressed by chemicals added singly or in pairs. Much more than additive induction resulted from combinations of cadmium chloride, copper sulfate, ethanol, formamide, 4-nitrophenol, and pentachlorophenol. PMID:7592357

Self-regulation of 70-kilodalton heat shock proteins in Saccharomyces cerevisiae.

PubMed Central

Stone, D E; Craig, E A

1990-01-01

To determine whether the 70-kilodalton heat shock proteins of Saccharomyces cerevisiae play a role in regulating their own synthesis, we studied the effect of overexpressing the SSA1 protein on the activity of the SSA1 5'-regulatory region. The constitutive level of Ssa1p was increased by fusing the SSA1 structural gene to the GAL1 promoter. A reporter vector consisting of an SSA1-lacZ translational fusion was used to assess SSA1 promoter activity. In a strain producing approximately 10-fold the normal heat shock level of Ssa1p, induction of beta-galactosidase activity by heat shock was almost entirely blocked. Expression of a transcriptional fusion vector in which the CYC1 upstream activating sequence of a CYC1-lacZ chimera was replaced by a sequence containing a heat shock upstream activating sequence (heat shock element 2) from the 5'-regulatory region of SSA1 was inhibited by excess Ssa1p. The repression of an SSA1 upstream activating sequence by the SSA1 protein indicates that SSA1 self-regulation is at least partially mediated at the transcriptional level. The expression of another transcriptional fusion vector, containing heat shock element 2 and a lesser amount of flanking sequence, is not inhibited when Ssa1p is overexpressed. This suggests the existence of an element, proximal to or overlapping heat shock element 2, that confers sensitivity to the SSA1 protein. Images PMID:2181281

Dual Regulation of Bacillus subtilis kinB Gene Encoding a Sporulation Trigger by SinR through Transcription Repression and Positive Stringent Transcription Control.

PubMed

Fujita, Yasutaro; Ogura, Mitsuo; Nii, Satomi; Hirooka, Kazutake

2017-01-01

It is known that transcription of kinB encoding a trigger for Bacillus subtilis sporulation is under repression by SinR, a master repressor of biofilm formation, and under positive stringent transcription control depending on the adenine species at the transcription initiation nucleotide (nt). Deletion and base substitution analyses of the kinB promoter (P kinB ) region using lacZ fusions indicated that either a 5-nt deletion (Δ5, nt -61/-57, +1 is the transcription initiation nt) or the substitution of G at nt -45 with A (G-45A) relieved kinB repression. Thus, we found a pair of SinR-binding consensus sequences (GTTCTYT; Y is T or C) in an inverted orientation (SinR-1) between nt -57/-42, which is most likely a SinR-binding site for kinB repression. This relief from SinR repression likely requires SinI, an antagonist of SinR. Surprisingly, we found that SinR is essential for positive stringent transcription control of P kinB . Electrophoretic mobility shift assay (EMSA) analysis indicated that SinR bound not only to SinR-1 but also to SinR-2 (nt -29/-8) consisting of another pair of SinR consensus sequences in a tandem repeat arrangement; the two sequences partially overlap the '-35' and '-10' regions of P kinB . Introduction of base substitutions (T-27C C-26T) in the upstream consensus sequence of SinR-2 affected positive stringent transcription control of P kinB , suggesting that SinR binding to SinR-2 likely causes this positive control. EMSA also implied that RNA polymerase and SinR are possibly bound together to SinR-2 to form a transcription initiation complex for kinB transcription. Thus, it was suggested in this work that derepression of kinB from SinR repression by SinI induced by Spo0A∼P and occurrence of SinR-dependent positive stringent transcription control of kinB might induce effective sporulation cooperatively, implying an intimate interplay by stringent response, sporulation, and biofilm formation.

Role of an expansin-like molecule in Dictyostelium morphogenesis and regulation of its gene expression by the signal transducer and activator of transcription protein Dd-STATa.

PubMed

Ogasawara, Shun; Shimada, Nao; Kawata, Takefumi

2009-02-01

Expansins are proteins involved in plant morphogenesis, exerting their effects on cellulose to extend cell walls. Dictyostelium is an organism that possesses expansin-like molecules, but their functions are not known. In this study, we analyzed the expL7 (expansin-like 7) gene, which has been identified as a putative target of Dd-STATa, a Dictyostelium homolog of the metazoan signal transducer and activator of transcription (STAT) proteins. Promoter fragments of the expL7 were fused to a lacZ reporter and the expression patterns determined. As expected from the behavior of the endogenous expL7 gene, the expL7/lacZ fusion gene was downregulated in Dd-STATa null slugs. In the parental strain, the expL7 promoter was activated in the anterior tip region. Mutational analysis of the promoter identified a sequence that was necessary for expression in tip cells. In addition, an activator sequence for pstAB cells was identified. These sequences act in combination with the repressor region to prevent ectopic expL7 expression in the prespore and prestalk regions of the slug and culminant. Although the expL7 null mutant showed no phenotypic change, the expL7 overexpressor showed aberrant stalk formation. These results indicate that the expansin-like molecule is important for morphogenesis in Dictyostelium.

Comparative assessment of methods for the fusion transcripts detection from RNA-Seq data

PubMed Central

Kumar, Shailesh; Vo, Angie Duy; Qin, Fujun; Li, Hui

2016-01-01

RNA-Seq made possible the global identification of fusion transcripts, i.e. “chimeric RNAs”. Even though various software packages have been developed to serve this purpose, they behave differently in different datasets provided by different developers. It is important for both users, and developers to have an unbiased assessment of the performance of existing fusion detection tools. Toward this goal, we compared the performance of 12 well-known fusion detection software packages. We evaluated the sensitivity, false discovery rate, computing time, and memory usage of these tools in four different datasets (positive, negative, mixed, and test). We conclude that some tools are better than others in terms of sensitivity, positive prediction value, time consumption and memory usage. We also observed small overlaps of the fusions detected by different tools in the real dataset (test dataset). This could be due to false discoveries by various tools, but could also be due to the reason that none of the tools are inclusive. We have found that the performance of the tools depends on the quality, read length, and number of reads of the RNA-Seq data. We recommend that users choose the proper tools for their purpose based on the properties of their RNA-Seq data. PMID:26862001

Mfd translocase is necessary and sufficient for transcription-coupled repair in Escherichia coli.

PubMed

Adebali, Ogun; Sancar, Aziz; Selby, Christopher P

2017-11-10

Nucleotide excision repair in Escherichia coli is stimulated by transcription, specifically in the transcribed strand. Previously, it was shown that this transcription-coupled repair (TCR) is mediated by the Mfd translocase. Recently, it was proposed that in fact the majority of TCR in E. coli is catalyzed by a second pathway ("backtracking-mediated TCR") that is dependent on the UvrD helicase and the guanosine pentaphosphate (ppGpp) alarmone/stringent response regulator. Recently, we reported that as measured by the excision repair-sequencing (XR-seq), UvrD plays no role in TCR genome-wide. Here, we tested the role of ppGpp and UvrD in TCR genome-wide and in the lacZ operon using the XR-seq method, which directly measures repair. We found that the mfd mutation abolishes TCR genome-wide and in the lacZ operon. In contrast, the relA - spoT - mutant deficient in ppGpp synthesis carries out normal TCR. We conclude that UvrD and ppGpp play no role in TCR in E. coli . © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Domain retention in transcription factor fusion genes and its biological and clinical implications: a pan-cancer study

PubMed Central

Kim, Pora; Ballester, Leomar Y.; Zhao, Zhongming

2017-01-01

Genomic rearrangements involving transcription factors (TFs) can form fusion proteins resulting in either enhanced, weakened, or even loss of TF activity. Functional domain (FD) retention is a critical factor in the activity of transcription factor fusion genes (TFFGs). A systematic investigation of FD retention in TFFGs and their outcome (e.g. expression changes) in a pan-cancer study has not yet been completed. Here, we examined the FD retention status in 386 TFFGs across 13 major cancer types and identified 83 TFFGs involving 67 TFs that retained FDs. To measure the potential biological relevance of TFs in TFFGs, we introduced a Major Active Isofusion Index (MAII) and built a prioritized TFFG network using MAII scores and the observed frequency of fusion positive samples. Interestingly, the four TFFGs (PML-RARA, RUNX1-RUNX1T1, TMPRSS2-ERG, and SFPQ-TFE3) with the highest MAII scores showed 50 differentially expressed target genes (DETGs) in fusion-positive versus fusion-negative cancer samples. DETG analysis revealed that they were involved in tumorigenesis-related processes in each cancer type. PLAU, which encodes plasminogen activator urokinase and serves as a biomarker for tumor invasion, was found to be consistently activated in the samples with the highest MAII scores. Among the 50 DETGs, 21 were drug targetable genes. Fourteen of these 21 DETGs were expressed in acute myeloid leukemia (AML) samples. Accordingly, we constructed an AML-specific TFFG network, which included 38 DETGs in RUNX1-RUNX1T1 or PML-RARA positive samples. In summary, this study revealed several TFFGs and their potential target genes, and provided insights into the clinical implications of TFFGs. PMID:29299133

Performance characteristics of a reverse transcriptase-polymerase chain reaction assay for the detection of tumor-specific fusion transcripts from archival tissue.

PubMed

Fritsch, Michael K; Bridge, Julia A; Schuster, Amy E; Perlman, Elizabeth J; Argani, Pedram

2003-01-01

Pediatric small round cell tumors still pose tremendous diagnostic problems. In difficult cases, the ability to detect tumor-specific gene fusion transcripts for several of these neoplasms, including Ewing sarcoma/peripheral primitive neuroectodermal tumor (ES/PNET), synovial sarcoma (SS), alveolar rhabdomyosarcoma (ARMS), and desmoplastic small round cell tumor (DSRCT) using reverse transcriptase-polymerase chain reaction (RT-PCR), can be extremely helpful. Few studies to date, however, have systematically examined several different tumor types for the presence of multiple different fusion transcripts in order to determine the specificity and sensitivity of the RT-PCR method, and no study has addressed this issue for formalin-fixed material. The objectives of this study were to address the specificity, sensitivity, and practicality of such an assay applied strictly to formalin-fixed tissue blocks. Our results demonstrate that, for these tumors, the overall sensitivity for detecting each fusion transcript is similar to that reported in the literature for RT-PCR on fresh or formalin-fixed tissues. The specificity of the assay is very high, being essentially 100% for each primer pair when interpreting the results from visual inspection of agarose gels. However, when these same agarose gels were examined using Southern blotting, a small number of tumors also yielded reproducibly detectable weak signals for unexpected fusion products, in addition to a strong signal for the expected fusion product. Fluorescence in situ hybridization (FISH) studies in one such case indicated that a rearrangement that would account for the unexpected fusion was not present, while another case was equivocal. The overall specificity for each primer pair used in this assay ranged from 94 to 100%. Therefore, RT-PCR using formalin-fixed paraffin-embedded tissue sections can be used to detect chimeric transcripts as a reliable, highly sensitive, and highly specific diagnostic assay. However, we

IQCJ-SCHIP1, a novel fusion transcript encoding a calmodulin-binding IQ motif protein

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kwasnicka-Crawford, Dorota A.; Carson, Andrew R.; Scherer, Stephen W.

The existence of transcripts that span two adjacent, independent genes is considered rare in the human genome. This study characterizes a novel human fusion gene named IQCJ-SCHIP1. IQCJ-SCHIP1 is the longest isoform of a complex transcriptional unit that bridges two separate genes that encode distinct proteins, IQCJ, a novel IQ motif containing protein and SCHIP1, a schwannomin interacting protein that has been previously shown to interact with the Neurofibromatosis type 2 (NF2) protein. IQCJ-SCHIP1 is located on the chromosome 3q25 and comprises a 1692-bp transcript encompassing 11 exons spanning 828 kb of the genomic DNA. We show that IQCJ-SCHIP1 mRNAmore » is highly expressed in the brain. Protein encoded by the IQCJ-SCHIP1 gene was localized to cytoplasm and actin-rich regions and in differentiated PC12 cells was also seen in neurite extensions.« less

Development of Transcriptional Fusions to Assess Leptospira interrogans Promoter Activity

PubMed Central

Cerqueira, Gustavo M.; Souza, Natalie M.; Araújo, Eduardo R.; Barros, Aline T.; Morais, Zenaide M.; Vasconcellos, Sílvio A.; Nascimento, Ana L. T. O.

2011-01-01

Background Leptospirosis is a zoonotic infectious disease that affects both humans and animals. The existing genetic tools for Leptospira spp. have improved our understanding of the biology of this spirochete as well as the interaction of pathogenic leptospires with the mammalian host. However, new tools are necessary to provide novel and useful information to the field. Methodology and Principal Findings A series of promoter-probe vectors carrying a reporter gene encoding green fluorescent protein (GFP) were constructed for use in L. biflexa. They were tested by constructing transcriptional fusions between the lipL41, Leptospiral Immunoglobulin-like A (ligA) and Sphingomielynase 2 (sph2) promoters from L. interrogans and the reporter gene. ligA and sph2 promoters were the most active, in comparison to the lipL41 promoter and the non-induced controls. The results obtained are in agreement with LigA expression from the L. interrogans Fiocruz L1-130 strain. Conclusions The novel vectors facilitated the in vitro evaluation of L. interrogans promoter activity under defined growth conditions which simulate the mammalian host environment. The fluorescence and rt-PCR data obtained closely reflected transcriptional regulation of the promoters, thus demonstrating the suitability of these vectors for assessing promoter activity in L. biflexa. PMID:21445252

Vibrio parahaemolyticus CalR down regulates the thermostable direct hemolysin (TDH) gene transcription and thereby inhibits hemolytic activity.

PubMed

Zhang, Yiquan; Zhang, Ying; Gao, He; Zhang, Lingyu; Yin, Zhe; Huang, Xinxiang; Zhou, Dongsheng; Yang, Huiying; Yang, Wenhui; Wang, Li

2017-05-20

TDH, encoded by tdh gene, is a major virulent determinant of V. parahaemolyticus that controls various biological activities, such as hemolytic activity, cytotoxicity, and enterotoxicity. The hemolytic activity on Wagatsuma agar ascribed to TDH is called Kanagawa phenomenon (KP). All KP positive strains contain tdh1 and tdh2 genes, but tdh2 is predominantly responsible for KP. CalR is a regulatory protein that was originally identified as a repressor of swarming motility and T3SS1 gene expression in V. parahaemolyticus. In the present study, the regulation of tdh2 by CalR was investigated using a set of experiments including qRT-PCR, primer extension, LacZ fusion, hemolytic phenotype, EMSA, and DNase I footprinting assays. The results showed that His-CalR protected a single region from 224bp to 318bp upstream of tdh2 against DNase I digestion, and a transcriptional start site located at 42bp upstream of tdh2 was detected and its transcribed activity was inhibited by CalR. Moreover, the KP test results showed that the hemolytic activity of V. parahaemolyticus is also under negative control of CalR. The data demonstrated that CalR is a repressor of the tdh2 transcription and thereby inhibits the hemolytic activity of V. parahaemolyticus. Copyright © 2017. Published by Elsevier B.V.

The phzA2-G2 Transcript Exhibits Direct RsmA-Mediated Activation in Pseudomonas aeruginosa M18

PubMed Central

Ren, Bin; Shen, Huifeng; Lu, Zhi John; Liu, Haiming; Xu, Yuquan

2014-01-01

In bacteria, RNA-binding proteins of the RsmA/CsrA family act as post-transcriptional regulators that modulate translation initiation at target transcripts. The Pseudomonas aeruginosa genome contains two phenazine biosynthetic (phz) gene clusters, phzA1-G1 (phz1) and phzA2-G2 (phz2), each of which is responsible for phenazine-1-carboxylic acid (PCA) biosynthesis. In the present study, we show that RsmA exhibits differential gene regulation on two phz clusters in P. aeruginosa M18 at the post-transcriptional level. Based on the sequence analysis, four GGA motifs, the potential RsmA binding sites, are found on the 5′-untranslated region (UTR) of the phz2 transcript. Studies with a series of lacZ reporter fusions, and gel mobility shift assays suggest that the third GGA motif (S3), located 21 nucleotides upstream of the Shine-Dalgarno (SD) sequence, is involved in direct RsmA-mediated activation of phz2 expression. We therefore propose a novel model in which the binding of RsmA to the target S3 results in the destabilization of the stem-loop structure and the enhancement of ribosome access. This model could be fully supported by RNA structure prediction, free energy calculations, and nucleotide replacement studies. In contrast, various RsmA-mediated translation repression mechanisms have been identified in which RsmA binds near the SD sequence of target transcripts, thereby blocking ribosome access. Similarly, RsmA is shown to negatively regulate phz1 expression. Our new findings suggest that the differential regulation exerted by RsmA on the two phz clusters may confer an advantage to P. aeruginosa over other pseudomonads containing only a single phz cluster in their genomes. PMID:24586939

Cryptic chromosome 9q34 deletion generates TAF-Ialpha/CAN and TAF-Ibeta/CAN fusion transcripts in acute myeloid leukemia.

PubMed

Rosati, Roberto; La Starza, Roberta; Barba, Gianluca; Gorello, Paolo; Pierini, Valentina; Matteucci, Caterina; Roti, Giovanni; Crescenzi, Barbara; Aloisi, Teresa; Aversa, Franco; Martelli, Massimo Fabrizio; Mecucci, Cristina

2007-02-01

In hematologic malignancies chromosome aberrations generating fusion genes include cryptic deletions. In a patient with acute myeloid leukemia and normal karyo-type we discovered a new cryptic 9q34 deletion and here report the cytogenetic and molecular findings. The 9q34 deletion extends 2.5 megabases and juxtaposes the 5' TAF-I to the 3' CAN producing a TAF-I/CAN fusion gene. TAF-I/CAN transcribes into two fusion proteins bearing either TAF-Ialpha or TAF-Ibeta moieties. We set up molecular assays to monitor the chimeric TAF-Ialpha/CAN and TAF-Ibeta/CAN transcripts which, after hematopoietic stem cell transplantation from an HLA-identical sibling, were no longer detected.

RegA, an AraC-like protein, is a global transcriptional regulator that controls virulence gene expression in Citrobacter rodentium.

PubMed

Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J; Frankel, Gad; Hartland, Elizabeth L; Robins-Browne, Roy M

2008-11-01

Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5alpha, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization.

RegA, an AraC-Like Protein, Is a Global Transcriptional Regulator That Controls Virulence Gene Expression in Citrobacter rodentium▿

PubMed Central

Hart, Emily; Yang, Ji; Tauschek, Marija; Kelly, Michelle; Wakefield, Matthew J.; Frankel, Gad; Hartland, Elizabeth L.; Robins-Browne, Roy M.

2008-01-01

Citrobacter rodentium is an attaching and effacing pathogen which causes transmissible colonic hyperplasia in mice. Infection with C. rodentium serves as a model for infection of humans with enteropathogenic and enterohemorrhagic Escherichia coli. To identify novel colonization factors of C. rodentium, we screened a signature-tagged mutant library of C. rodentium in mice. One noncolonizing mutant had a single transposon insertion in an open reading frame (ORF) which we designated regA because of its homology to genes encoding members of the AraC family of transcriptional regulators. Deletion of regA in C. rodentium resulted in markedly reduced colonization of the mouse intestine. Examination of lacZ transcriptional fusions using promoter regions of known and putative virulence-associated genes of C. rodentium revealed that RegA strongly stimulated transcription of two newly identified genes located close to regA, which we designated adcA and kfcC. The cloned adcA gene conferred autoaggregation and adherence to mammalian cells to E. coli strain DH5α, and a kfc mutation led to a reduction in the duration of intestinal colonization, but the kfc mutant was far less attenuated than the regA mutant. These results indicated that other genes of C. rodentium whose expression required activation by RegA were required for colonization. Microarray analysis revealed a number of RegA-regulated ORFs encoding proteins homologous to known colonization factors. Transcription of these putative virulence determinants was activated by RegA only in the presence of sodium bicarbonate. Taken together, these results show that RegA is a global regulator of virulence in C. rodentium which activates factors that are required for intestinal colonization. PMID:18765720

kdgREcc Negatively Regulates Genes for Pectinases, Cellulase, Protease, HarpinEcc, and a Global RNA Regulator in Erwinia carotovora subsp. carotovora†

PubMed Central

Liu, Yang; Jiang, Guoqiao; Cui, Yaya; Mukherjee, Asita; Ma, Wei Lei; Chatterjee, Arun K.

1999-01-01

Erwinia carotovora subsp. carotovora produces extracellular pectate lyase (Pel), polygalacturonase (Peh), cellulase (Cel), and protease (Prt). The concerted actions of these enzymes largely determine the virulence of this plant-pathogenic bacterium. E. carotovora subsp. carotovora also produces HarpinEcc, the elicitor of the hypersensitive reaction. We document here that KdgREcc (Kdg, 2-keto-3-deoxygluconate; KdgR, general repressor of genes involved in pectin and galacturonate catabolism), a homolog of the E. chrysanthemi repressor, KdgREch and the Escherichia coli repressor, KdgREco, negatively controls not only the pectinases, Pel and Peh, but also Cel, Prt, and HarpinEcc production in E. carotovora subsp. carotovora. The levels of pel-1, peh-1, celV, and hrpNEcc transcripts are markedly affected by KdgREcc. The KdgREcc− mutant is more virulent than the KdgREcc+ parent. Thus, our data for the first time establish a global regulatory role for KdgREcc in E. carotovora subsp. carotovora. Another novel observation is the negative effect of KdgREcc on the transcription of rsmB (previously aepH), which specifies an RNA regulator controlling exoenzyme and HarpinEcc production. The levels of rsmB RNA are higher in the KdgREcc− mutant than in the KdgREcc+ parent. Moreover, by DNase I protection assays we determined that purified KdgREcc protected three 25-bp regions within the transcriptional unit of rsmB. Alignment of the protected sequences revealed the 21-mer consensus sequence of the KdgREcc-binding site as 5′-G/AA/TA/TGAAA[N6]TTTCAG/TG/TA-3′. Two such KdgREcc-binding sites occur in rsmB DNA in a close proximity to each other within nucleotides +79 and +139 and the third KdgREcc-binding site within nucleotides +207 and +231. Analysis of lacZ transcriptional fusions shows that the KdgR-binding sites negatively affect the expression of rsmB. KdgREcc also binds the operator DNAs of pel-1 and peh-1 genes and represses expression of a pel1-lacZ and a peh1-lacZ

Strong expression of the neuronal transcription factor FOXP2 is linked to an increased risk of early PSA recurrence in ERG fusion-negative cancers.

PubMed

Stumm, Laura; Burkhardt, Lia; Steurer, Stefan; Simon, Ronald; Adam, Meike; Becker, Andreas; Sauter, Guido; Minner, Sarah; Schlomm, Thorsten; Sirma, Hüseyin; Michl, Uwe

2013-07-01

Transcription factors of the forkhead box P (FOXP1-4) family have been implicated in various human cancer types before. The relevance and role of neuronal transcription factor FOXP2 in prostate cancer is unknown. A tissue microarray containing samples from more than 11 000 prostate cancers from radical prostatectomy specimens with clinical follow-up data was analysed for FOXP2 expression by immunohistochemistry. FOXP2 data were also compared with pre-existing ERG fusion (by fluorescence in situ hybridisation and immunohistochemistry) and cell proliferation (Ki67 labelling index) data. There was a moderate to strong FOXP2 protein expression in basal and secretory cells of normal prostatic glands. As compared with normal cells, FOXP2 expression was lost or reduced in 25% of cancers. Strong FOXP2 expression was linked to advanced tumour stage, high Gleason score, presence of lymph node metastases and early tumour recurrence (p<0.0001; each) in ERG fusion-negative, but not in ERG fusion-positive cancers. High FOXP2 expression was linked to high Ki67 labelling index (p<0.0001) in all cancers irrespective of ERG fusion status. These data demonstrate that similar high FOXP2 protein levels as in normal prostate epithelium exert a 'paradoxical' oncogenic role in 'non fusion-type' prostate cancer. It may be speculated that interaction of FOXP2 with members of pathways that are specifically activated in 'non fusion-type' cancers may be responsible for this phenomenon.

Transgenic mouse model harboring the transcriptional fusion ccl20-luciferase as a novel reporter of pro-inflammatory response.

PubMed

Crispo, Martina; Van Maele, Laurye; Tabareau, Julien; Cayet, Delphine; Errea, Agustina; Ferreira, Ana María; Rumbo, Martin; Sirard, Jean Claude

2013-01-01

The chemokine CCL20, the unique ligand of CCR6 functions as an attractant of immune cells. Expression of CCL20 is induced by Toll-like Receptor (TLR) signaling or proinflammatory cytokine stimulation. However CCL20 is also constitutively produced at specific epithelial sites of mucosa. This expression profile is achieved by transcriptional regulation. In the present work we characterized regulatory features of mouse Ccl20 gene. Transcriptional fusions between the mouse Ccl20 promoter and the firefly luciferase (luc) encoding gene were constructed and assessed in in vitro and in vivo assays. We found that liver CCL20 expression and luciferase activity were upregulated by systemic administration of the TLR5 agonist flagellin. Using shRNA and dominant negative form specific for mouse TLR5, we showed that this expression was controlled by TLR5. To address in situ the regulation of gene activity, a transgenic mouse line harboring a functional Ccl20-luc fusion was generated. The luciferase expression was highly concordant with Ccl20 expression in different tissues. Our data indicate that the transgenic mouse model can be used to monitor activation of innate response in vivo.

Transgenic Mouse Model Harboring the Transcriptional Fusion Ccl20-Luciferase as a Novel Reporter of Pro-Inflammatory Response

PubMed Central

Crispo, Martina; Van Maele, Laurye; Tabareau, Julien; Cayet, Delphine; Errea, Agustina; Ferreira, Ana María; Rumbo, Martin; Sirard, Jean Claude

2013-01-01

The chemokine CCL20, the unique ligand of CCR6 functions as an attractant of immune cells. Expression of CCL20 is induced by Toll-like Receptor (TLR) signaling or proinflammatory cytokine stimulation. However CCL20 is also constitutively produced at specific epithelial sites of mucosa. This expression profile is achieved by transcriptional regulation. In the present work we characterized regulatory features of mouse Ccl20 gene. Transcriptional fusions between the mouse Ccl20 promoter and the firefly luciferase (luc) encoding gene were constructed and assessed in in vitro and in vivo assays. We found that liver CCL20 expression and luciferase activity were upregulated by systemic administration of the TLR5 agonist flagellin. Using shRNA and dominant negative form specific for mouse TLR5, we showed that this expression was controlled by TLR5. To address in situ the regulation of gene activity, a transgenic mouse line harboring a functional Ccl20-luc fusion was generated. The luciferase expression was highly concordant with Ccl20 expression in different tissues. Our data indicate that the transgenic mouse model can be used to monitor activation of innate response in vivo. PMID:24265691

Insights into mutagenesis using Escherichia coli chromosomal lacZ strains that enable detection of a wide spectrum of mutational events.

PubMed

Seier, Tracey; Padgett, Dana R; Zilberberg, Gal; Sutera, Vincent A; Toha, Noor; Lovett, Susan T

2011-06-01

Strand misalignments at DNA repeats during replication are implicated in mutational hotspots. To study these events, we have generated strains carrying mutations in the Escherichia coli chromosomal lacZ gene that revert via deletion of a short duplicated sequence or by template switching within imperfect inverted repeat (quasipalindrome, QP) sequences. Using these strains, we demonstrate that mutation of the distal repeat of a quasipalindrome, with respect to replication fork movement, is about 10-fold higher than the proximal repeat, consistent with more common template switching on the leading strand. The leading strand bias was lost in the absence of exonucleases I and VII, suggesting that it results from more efficient suppression of template switching by 3' exonucleases targeted to the lagging strand. The loss of 3' exonucleases has no effect on strand misalignment at direct repeats to produce deletion. To compare these events to other mutations, we have reengineered reporters (designed by Cupples and Miller 1989) that detect specific base substitutions or frameshifts in lacZ with the reverting lacZ locus on the chromosome rather than an F' element. This set allows rapid screening of potential mutagens, environmental conditions, or genetic loci for effects on a broad set of mutational events. We found that hydroxyurea (HU), which depletes dNTP pools, slightly elevated templated mutations at inverted repeats but had no effect on deletions, simple frameshifts, or base substitutions. Mutations in nucleotide diphosphate kinase, ndk, significantly elevated simple mutations but had little effect on the templated class. Zebularine, a cytosine analog, elevated all classes.

N-acetylcysteine augments adenovirus-mediated gene expression in human endothelial cells by enhancing transgene transcription and virus entry.

PubMed

Jornot, L; Morris, M A; Petersen, H; Moix, I; Rochat, T

2002-01-01

It has previously been shown that oxidants reduce the efficiency of adenoviral transduction in human umbilical vein endothelial cells (HUVECs). In this study, the effect of the antioxidant N-acetylcysteine (NAC) in adenovirus-mediated gene transfer has been investigated. HUVECs were pretreated or not with NAC, and infected with E1E3-deleted adenovirus (Ad) containing the LacZ gene expressed from the RSV-LTR promoter/enhancer in the presence and absence of NAC. Transgene expression was assessed at the protein level (histochemical staining, measurement of beta-Gal activity, and western blot), mRNA level (real-time RT-PCR) and gene level (nuclear run on) 24 h and 48 h after infection. Adenoviral DNA was quantitated by real-time PCR, and cell surface expression of Coxsackie/adenovirus receptors (CAR) was determined by FACS analysis. Pretreatment of cells with NAC prior to Ad infection enhanced beta-Gal activity by two-fold due to an increase in viral DNA, which was related to increased CAR expression. When NAC was present only during the post-infection period, a five-fold increase in beta-Gal activity and LacZ gene transcriptional activity was observed. When NAC was present during both the pretreatment and the post-infection period, beta-Gal activity was further enhanced, by 15-fold. Augmentation of beta-Gal activity was paralleled by an increase in beta-Gal protein and mRNA levels. NAC did not affect the half-life of LacZ mRNA. Pretreatment with NAC prior to Ad infection enhances virus entry, while treatment with NAC post-infection increases transgene transcription. This strategy permits the use of lower adenoviral loads and thus might be helpful for gene therapy of vascular diseases. Copyright 2001 John Wiley & Sons, Ltd.

Expression of the homeotic gene mab-5 during Caenorhabditis elegans embryogenesis.

PubMed

Cowing, D W; Kenyon, C

1992-10-01

mab-5 is a member of a complex of homeobox-containing genes evolutionarily related to the Antennapedia and bithorax complexes of Drosophila melanogaster. Like the homeotic genes in Drosophila, mab-5 is required in a particular region along the anterior-posterior body axis, and acts during postembryonic development to give cells in this region their characteristic identities. We have used a mab-5-lacZ fusion integrated into the C. elegans genome to study the posterior-specific expression of mab-5 during embryogenesis. The mab-5-lacZ fusion was expressed in the posterior of the embryo by 180 minutes after the first cleavage, indicating that the mechanisms responsible for the position-specific expression of mab-5-lacZ act at a relatively early stage of embryogenesis. In embryos homozygous for mutations in the par genes, which disrupt segregation of factors during early cleavages, expression of mab-5-lacZ was no longer localized to the posterior. This suggests that posterior-specific expression of mab-5 depends on the appropriate segregation of developmental factors during early embryogenesis. After extrusion of any blastomere of the four-cell embryo, descendants of the remaining three cells could still express the mab-5-lacZ fusion. In these partial embryos, however, the fusion was often expressed in cells scattered throughout the embryo, suggesting that cell-cell interactions and/or proper positioning of early blastomeres are required for mab-5 expression to be localized to the posterior.

Overlapping reading frames at the LYS5 locus in the yeast Yarrowia lipolytica.

PubMed Central

Xuan, J W; Fournier, P; Declerck, N; Chasles, M; Gaillardin, C

1990-01-01

Mutants affected at the LYS5 locus of Yarrowia lipolytica lack detectable dehydrogenase (SDH) activity. The LYS5 gene has previously been cloned, and we present here the sequence of the 2.5-kilobase-pair (kb) DNA fragment complementing the lys5 mutation. Two large antiparallel open reading frames (ORF1 and ORF2) were observed, flanked by potential transcription signals. Both ORFs appear to be transcribed, but several lines of evidence suggest that only ORF2 is translated and encodes SDH. (i) The global amino acid compositions of Saccharomyces cerevisiae SDH and of the putative ORF2 product are similar and that of ORF1 is dissimilar. (ii) An in-frame translational fusion of ORF2 with the Escherichia coli lacZ gene was introduced into yeast cells and resulted in a beta-galactosidase activity regulated similarly to SDH; no beta-galactosidase activity was obtained with an in-frame fusion of ORF1 with lacZ. (iii) The introduction of a stop codon at the beginning of ORF2 prevented SDH expression in yeast cells, whereas no phenotypic effect was observed when ORF1 translation was blocked. Images PMID:2388625

The "grep" command but not FusionMap, FusionFinder or ChimeraScan captures the CIC-DUX4 fusion gene from whole transcriptome sequencing data on a small round cell tumor with t(4;19)(q35;q13).

PubMed

Panagopoulos, Ioannis; Gorunova, Ludmila; Bjerkehagen, Bodil; Heim, Sverre

2014-01-01

Whole transcriptome sequencing was used to study a small round cell tumor in which a t(4;19)(q35;q13) was part of the complex karyotype but where the initial reverse transcriptase PCR (RT-PCR) examination did not detect a CIC-DUX4 fusion transcript previously described as the crucial gene-level outcome of this specific translocation. The RNA sequencing data were analysed using the FusionMap, FusionFinder, and ChimeraScan programs which are specifically designed to identify fusion genes. FusionMap, FusionFinder, and ChimeraScan identified 1017, 102, and 101 fusion transcripts, respectively, but CIC-DUX4 was not among them. Since the RNA sequencing data are in the fastq text-based format, we searched the files using the "grep" command-line utility. The "grep" command searches the text for specific expressions and displays, by default, the lines where matches occur. The "specific expression" was a sequence of 20 nucleotides from the coding part of the last exon 20 of CIC (Reference Sequence: NM_015125.3) chosen since all the so far reported CIC breakpoints have occurred here. Fifteen chimeric CIC-DUX4 cDNA sequences were captured and the fusion between the CIC and DUX4 genes was mapped precisely. New primer combinations were constructed based on these findings and were used together with a polymerase suitable for amplification of GC-rich DNA templates to amplify CIC-DUX4 cDNA fragments which had the same fusion point found with "grep". In conclusion, FusionMap, FusionFinder, and ChimeraScan generated a plethora of fusion transcripts but did not detect the biologically important CIC-DUX4 chimeric transcript; they are generally useful but evidently suffer from imperfect both sensitivity and specificity. The "grep" command is an excellent tool to capture chimeric transcripts from RNA sequencing data when the pathological and/or cytogenetic information strongly indicates the presence of a specific fusion gene.

Comparison between S+L- assay and LacZ marker rescue assay for detecting replication-competent gammaretroviruses.

PubMed

Hashimoto-Gotoh, A; Yoshikawa, R; Miyazawa, T

2015-09-01

To avoid contamination of adventitious gammaretroviruses in biological products such as vaccines, it is necessary to check the master seed cells for manufacturing. There are several assays to detect infectious gammaretroviruses. Among these, sarcoma-positive, leukemia-negative (S+L-) assay is a classical infectivity assay, which is often recommended in governmental guidelines. The S+L- cells used in S+L- assay generate unique focus upon the infection of replication-competent gammaretroviruses. Although S+L- assay is well recognized for the detection, their applicability is questionable in some cases. On the other hand, LacZ marker rescue (LMR) assay detects infectious gammaretroviruses by transducing LacZ marker gene to the target cells, which shows lacZ-positive foci if the infectious virus is present. In this study, we compared LMR and S+L- assays for detection of a variety of endogenous and exogenous gammaretroviruses. As results, LMR assay could detect all gammaretroviruses examined. On the other hand, S+L- assay using feline S+L- cells, termed QN10S, could not detect porcine endogenous retrovirus (PERV) subgroups A/B. Further, S+L- mink cells could not detect feline leukemia virus subgroups B in addition to PERV-A/B. These data indicate that LMR assay is better suited to detect wider range of gammaretroviruses. Copyright © 2015 The International Alliance for Biological Standardization. Published by Elsevier Ltd. All rights reserved.

Investigation of fusion gene expression in HCT116 cells.

PubMed

Zhang, Yanmei; Ren, Juan; Fang, Mengdie; Wang, Xiaoju

2017-12-01

Colon cancer is the most common type of gastrointestinal cancer. A number of specific and sensitive biomarkers facilitate the diagnosis and monitoring of patients with colon cancer. Fusion genes are typically identified in cancer and a majority of the newly identified fusion genes are oncogenic in nature. Therefore, fusion genes are potential biomarkers and/or therapy targets in cancer. In the present study, the regulation of specific candidate fusion genes were investigated using Brother of the Regulator of Imprinted Sites (BORIS) in the HCT116 colon cancer cell line, which is a paralog of the fusion gene regulator CCCTC-binding factor (CTCF). The copy number of BORIS increased correspondingly to the progression of colorectal carcinoma from the M0 to the M1a stage. It was identified that EIF3E(e1)-RSPO2(e2) , EIF3E(e1)-RSPO2(e3) , PTPRK(e1)-RSPO3(e2) , PTPRK(e7)-RSPO3(e2), TADA2A-MEF2B and MED13L-CD4 are fusion transcripts present in the transcriptome of the HCT116 colon cancer cell line. CDC42SE2-KIAAO146 is a genomic fusion transcript, which originates from DNA arrangement in HCT116 cells. BORIS suppresses the expression of EIF3E , RSPO2 , PTPRK , RSPO3 , TADA2A and CD4 to inhibit the expression of fusion transcripts in HCT116 cells. It was hypothesized that the fusion transcripts investigated in the present study may not be oncogenic in HCT116 cells. As BORIS is not colorectal carcinoma-specific, the fusion genes investigated may be a biomarker assemblage for monitoring the progression of colorectal carcinoma.

Investigation of fusion gene expression in HCT116 cells

PubMed Central

Zhang, Yanmei; Ren, Juan; Fang, Mengdie; Wang, Xiaoju

2017-01-01

Colon cancer is the most common type of gastrointestinal cancer. A number of specific and sensitive biomarkers facilitate the diagnosis and monitoring of patients with colon cancer. Fusion genes are typically identified in cancer and a majority of the newly identified fusion genes are oncogenic in nature. Therefore, fusion genes are potential biomarkers and/or therapy targets in cancer. In the present study, the regulation of specific candidate fusion genes were investigated using Brother of the Regulator of Imprinted Sites (BORIS) in the HCT116 colon cancer cell line, which is a paralog of the fusion gene regulator CCCTC-binding factor (CTCF). The copy number of BORIS increased correspondingly to the progression of colorectal carcinoma from the M0 to the M1a stage. It was identified that EIF3E(e1)-RSPO2(e2), EIF3E(e1)-RSPO2(e3), PTPRK(e1)-RSPO3(e2), PTPRK(e7)-RSPO3(e2), TADA2A-MEF2B and MED13L-CD4 are fusion transcripts present in the transcriptome of the HCT116 colon cancer cell line. CDC42SE2-KIAAO146 is a genomic fusion transcript, which originates from DNA arrangement in HCT116 cells. BORIS suppresses the expression of EIF3E, RSPO2, PTPRK, RSPO3, TADA2A and CD4 to inhibit the expression of fusion transcripts in HCT116 cells. It was hypothesized that the fusion transcripts investigated in the present study may not be oncogenic in HCT116 cells. As BORIS is not colorectal carcinoma-specific, the fusion genes investigated may be a biomarker assemblage for monitoring the progression of colorectal carcinoma. PMID:29181107

Shh pathway in wounds in non-diabetic Shh-Cre-eGFP/Ptch1-LacZ mice treated with MAA beads.

PubMed

Lisovsky, Alexandra; Sefton, Michael V

2016-09-01

Previously, poly(methacrylic acid-co-methyl methacrylate) (MAA) beads were shown to improve vessel formation with a concomitant increase in the expression of the sonic hedgehog (Shh) gene, a pleiotropic factor implicated in vascularization. The aim of this study was to follow up on this observation in the absence of the confounding factors of diabetes in non-diabetic Shh-Cre-eGFP/Ptch1-LacZ mice; in this mouse, expression of GFP and β-Gal is consistent with the transcription patterns of Shh and its receptor patched 1 (Ptch1), respectively. In agreement with studies in diabetic males, MAA beads improved vascularization in large (15 mm × 15 mm) wounds in non-diabetic males at day 7. Shh pathway activation was suggested, as the numbers of GFP+ (Shh) and β-Gal+ (Ptch1, a target of the pathway) cells increased in the granulation tissue. Shh signaling pathway modulation was also suggested in the healthy skin surrounding the wound bed, as evidenced by an increase in the number of GFP+ and β-Gal+ cells in males at day 4. Gene expression analysis of the wounds confirmed increase in Ptch1 and showed the upregulation of a downstream transcription factor Gli3, involved in the vascular effect of the Shh pathway, implicating the pathway in the effect of MAA beads. The efficacy of MAA beads was also investigated in females; MAA beads modulated the Shh pathway within granulation tissue similarly as in males, but had no enhancement effect on the healthy skin and on vascularization. We believe that understanding the molecular and cellular mechanisms of MAA-based biomaterials and testing the efficacy of therapeutics in both sexes will inform the development of novel therapeutic biomaterials. Copyright © 2016 Elsevier Ltd. All rights reserved.

NFATC3-PLA2G15 Fusion Transcript Identified by RNA Sequencing Promotes Tumor Invasion and Proliferation in Colorectal Cancer Cell Lines.

PubMed

Jang, Jee-Eun; Kim, Hwang-Phill; Han, Sae-Won; Jang, Hoon; Lee, Si-Hyun; Song, Sang-Hyun; Bang, Duhee; Kim, Tae-You

2018-06-14

This study was designed to identify novel fusion transcripts (FTs) and their functional significance in colorectal cancer lines. We performed paired-end RNA sequencing of 28 colorectal cancer (CRC) cell lines. FT candidates were identified using TopHat-fusion, ChimeraScan, and FusionMap tools and further experimental validation was conducted through reverse transcription-polymerase chain reaction and Sanger sequencing. FT was depleted in human CRC line and the effects on cell proliferation, cell migration, and cell invasion were analyzed. 1,380 FT candidates were detected through bioinformatics filtering. We selected 6 candidate FTs, including 4 inter-chromosomal and 2 intra-chromosomal FTs and each FT was found in at least 1 of the 28 cell lines. Moreover, when we tested 19 pairs of CRC tumor and adjacent normal tissue samples, NFATC3-PLA2G15 FT was found in 2. Knockdown of NFATC3-PLA2G15 using siRNA reduced mRNA expression of epithelial-mesenchymal transition (EMT) markers such as vimentin, twist, and fibronectin and increased mesenchymal-epithelial transition markers of E-cadherin, claudin-1, and FOXC2 in colo-320 cell line harboring NFATC3-PLA2G15 FT. The NFATC3-PLA2G15 knockdown also inhibited invasion, colony formation capacity, and cell proliferation. These results suggest that that NFATC3-PLA2G15 FTs may contribute to tumor progression by enhancing invasion by EMT and proliferation.

The Transcription Factor Ste12 Mediates the Regulatory Role of the Tmk1 MAP Kinase in Mycoparasitism and Vegetative Hyphal Fusion in the Filamentous Fungus Trichoderma atroviride

PubMed Central

Gruber, Sabine; Zeilinger, Susanne

2014-01-01

Mycoparasitic species of the fungal genus Trichoderma are potent antagonists able to combat plant pathogenic fungi by direct parasitism. An essential step in this mycoparasitic fungus-fungus interaction is the detection of the fungal host followed by activation of molecular weapons in the mycoparasite by host-derived signals. The Trichoderma atroviride MAP kinase Tmk1, a homolog of yeast Fus3/Kss1, plays an essential role in regulating the mycoparasitic host attack, aerial hyphae formation and conidiation. However, the transcription factors acting downstream of Tmk1 are hitherto unknown. Here we analyzed the functions of the T. atroviride Ste12 transcription factor whose orthologue in yeast is targeted by the Fus3 and Kss1 MAP kinases. Deletion of the ste12 gene in T. atroviride not only resulted in reduced mycoparasitic overgrowth and lysis of host fungi but also led to loss of hyphal avoidance in the colony periphery and a severe reduction in conidial anastomosis tube formation and vegetative hyphal fusion events. The transcription of several orthologues of Neurospora crassa hyphal fusion genes was reduced upon ste12 deletion; however, the Δste12 mutant showed enhanced expression of mycoparasitism-relevant chitinolytic and proteolytic enzymes and of the cell wall integrity MAP kinase Tmk2. Based on the comparative analyses of Δste12 and Δtmk1 mutants, an essential role of the Ste12 transcriptional regulator in mediating outcomes of the Tmk1 MAPK pathway such as regulation of the mycoparasitic activity, hyphal fusion and carbon source-dependent vegetative growth is suggested. Aerial hyphae formation and conidiation, in contrast, were found to be independent of Ste12. PMID:25356841

The transcription factor Ste12 mediates the regulatory role of the Tmk1 MAP kinase in mycoparasitism and vegetative hyphal fusion in the filamentous fungus Trichoderma atroviride.

PubMed

Gruber, Sabine; Zeilinger, Susanne

2014-01-01

Mycoparasitic species of the fungal genus Trichoderma are potent antagonists able to combat plant pathogenic fungi by direct parasitism. An essential step in this mycoparasitic fungus-fungus interaction is the detection of the fungal host followed by activation of molecular weapons in the mycoparasite by host-derived signals. The Trichoderma atroviride MAP kinase Tmk1, a homolog of yeast Fus3/Kss1, plays an essential role in regulating the mycoparasitic host attack, aerial hyphae formation and conidiation. However, the transcription factors acting downstream of Tmk1 are hitherto unknown. Here we analyzed the functions of the T. atroviride Ste12 transcription factor whose orthologue in yeast is targeted by the Fus3 and Kss1 MAP kinases. Deletion of the ste12 gene in T. atroviride not only resulted in reduced mycoparasitic overgrowth and lysis of host fungi but also led to loss of hyphal avoidance in the colony periphery and a severe reduction in conidial anastomosis tube formation and vegetative hyphal fusion events. The transcription of several orthologues of Neurospora crassa hyphal fusion genes was reduced upon ste12 deletion; however, the Δste12 mutant showed enhanced expression of mycoparasitism-relevant chitinolytic and proteolytic enzymes and of the cell wall integrity MAP kinase Tmk2. Based on the comparative analyses of Δste12 and Δtmk1 mutants, an essential role of the Ste12 transcriptional regulator in mediating outcomes of the Tmk1 MAPK pathway such as regulation of the mycoparasitic activity, hyphal fusion and carbon source-dependent vegetative growth is suggested. Aerial hyphae formation and conidiation, in contrast, were found to be independent of Ste12.

The Drosophila melanogaster Eip74EF-PA transcription factor directly binds the sciarid BhC4-1 promoter.

PubMed

Frank, Henrique Oliveira; Sanchez, Danilo Garcia; de Freitas Oliveira, Lucas; Kobarg, Jörg; Monesi, Nadia

2017-11-01

The DNA puff BhC4-1 gene of Bradysia hygida (Diptera, Sciaridae) is amplified and expressed in the salivary glands at the end of the last larval instar. Even though there are no BhC4-1 orthologs in Drosophila melanogaster, the mechanisms that regulate BhC4-1 gene expression in B. hygida are for the most part conserved in D. melanogaster. The BhC4-1 promoter contains a 129bp (-186/-58) cis-regulatory module (CRM) that drives developmentally regulated expression in transgenic salivary glands at the onset of metamorphosis. Both in the sciarid and in transgenic D. melanogaster, BhC4-1 gene expression is induced by the increase in ecdysone titers that triggers metamorphosis. Genetic interaction experiments revealed that in the absence of the Eip74EF-PA early gene isoform BhC4-1-lacZ levels of expression in the salivary gland are severely reduced. Here we show that the overexpression of the Eip74EF-PA transcription factor is sufficient to anticipate BhC4-1-lacZ expression in transgenic D. melanogaster. Through yeast one-hybrid assays we confirm that the Eip74EF-PA transcription factor directly binds to the 129 bp sciarid CRM. Together, these results contribute to the characterization of an insect CRM and indicate that the ecdysone gene regulatory network that promotes metamorphosis is conserved between D. melanogaster and the sciarid B. hygida. © 2017 Wiley Periodicals, Inc.

Connections between Transcription Downstream of Genes and cis-SAGe Chimeric RNA.

PubMed

Chwalenia, Katarzyna; Qin, Fujun; Singh, Sandeep; Tangtrongstittikul, Panjapon; Li, Hui

2017-11-22

cis-Splicing between adjacent genes (cis-SAGe) is being recognized as one way to produce chimeric fusion RNAs. However, its detail mechanism is not clear. Recent study revealed induction of transcriptions downstream of genes (DoGs) under osmotic stress. Here, we investigated the influence of osmotic stress on cis-SAGe chimeric RNAs and their connection to DoGs. We found,the absence of induction of at least some cis-SAGe fusions and/or their corresponding DoGs at early time point(s). In fact, these DoGs and their cis-SAGe fusions are inversely correlated. This negative correlation was changed to positive at a later time point. These results suggest a direct competition between the two categories of transcripts when total pool of readthrough transcripts is limited at an early time point. At a later time point, DoGs and corresponding cis-SAGe fusions are both induced, indicating that total readthrough transcripts become more abundant. Finally, we observed overall enhancement of cis-SAGe chimeric RNAs in KCl-treated samples by RNA-Seq analysis.

Post-fusion treatment with MG132 increases transcription factor expression in somatic cell nuclear transfer embryos in pigs.

PubMed

You, Jinyoung; Lee, Joohyeong; Kim, Jinyoung; Park, Junhong; Lee, Eunsong

2010-02-01

The objective of this study was to examine the effect of post-fusion treatment of somatic cell nuclear transfer (SCNT) oocytes with the proteasomal inhibitor MG132 on maturation promoting factor (MPF) activity, nuclear remodeling, embryonic development, and gene expression of cloned pig embryos. Immediately after electrofusion, SCNT oocytes were treated with MG132 and/or caffeine for 2 hr, vanadate for 0.5 hr, or vanadate for 0.5 hr followed by MG132 for 1.5 hr. Of the MG132 concentrations tested (0-5 microM), the 1 microM concentration showed a higher rate of blastocyst formation (25.9%) than 0 (14.2%), 0.5 (16.9%), and 5 microM (16.9%). Post-fusion treatment with MG132, caffeine, and both MG132 and caffeine improved blastocyst formation (22.1%, 21.4%, and 24.4%, respectively), whereas vanadate treatment inhibited blastocyst formation (6.5%) compared to the control (11.1%). When examined 2 hr after fusion and 1 hr after activation, MPF activity remained at a higher (P < 0.05) level in SCNT oocytes that were treated post-fusion with caffeine and/or MG132, but it was decreased by vanadate. The rate of oocytes showing premature chromosome condensation was not altered by MG132 but was decreased by vanadate treatment. In addition, formation of single pronuclei was increased by MG132 compared to control and vanadate treatment. MG132-treated embryos showed increased expression of POU5F1, DPPA2, DPPA3, DPPA5, and NDP52l1 genes compared to control embryos. Our results demonstrate that post-fusion treatment of SCNT oocytes with MG132 prevents MPF degradation and increases expression of transcription factors in SCNT embryos, which are necessary for normal development of SCNT embryos. (c) 2009 Wiley-Liss, Inc.

Comprehensive characterization of RSPO fusions in colorectal traditional serrated adenomas.

PubMed

Sekine, Shigeki; Ogawa, Reiko; Hashimoto, Taiki; Motohiro, Kojima; Yoshida, Hiroshi; Taniguchi, Hirokazu; Saito, Yutaka; Yasuhiro, Ohno; Ochiai, Atsushi; Hiraoka, Nobuyoshi

2017-10-01

Traditional serrated adenoma (TSA) is a rare but distinct type of colorectal polyp. Our previous study showed that PTPRK-RSPO3 fusions are frequent and characteristic genetic alterations in TSAs. This study aimed to characterize comprehensively the prevalence and variability of RSPO fusions in colorectal TSAs. We examined RSPO expression and explored novel RSPO fusions in 129 TSAs, including 66 lesions analysed previously for WNT pathway gene mutations. Quantitative polymerase chain reaction (qPCR) analyses identified three and 43 TSAs overexpressing RSPO2 and RSPO3, respectively, whereas the expression of RSPO1 and RSPO4 was marginal or undetectable in all cases. RSPO overexpression was always mutually exclusive with other WNT pathway gene mutations. Known PTPRK-RSPO3 fusions were detected in 37 TSAs, all but one of which overexpressed RSPO3. In addition, rapid amplification of cDNA ends revealed three novel RSPO fusion transcripts, an NRIP1-RSPO2 fusion and two PTPRK-RSPO3 fusion isoforms, in six TSAs. Overall, 43 TSAs had RSPO fusions (33%), whereas four TSAs (3%) overexpressed RSPO in the absence of RSPO fusions. TSAs with RSPO fusions showed several clinicopathological features, including distal localization (P = 0.0063), larger size (P = 0.0055), prominent ectopic crypt foci (P = 8.4 × 10 -4 ), association of a high-grade component (P = 1.1 × 10 -4 ), and the presence of KRAS mutations (P = 4.5 × 10 -5 ). The present study identified RSPO fusion transcripts, including three novel transcripts, in one-third of colorectal TSAs and showed that PTPRK-RSPO3 fusions were the predominant cause of RSPO overexpression in colorectal TSA. © 2017 John Wiley & Sons Ltd.

Analysis of Rheb in the cellular slime mold Dictyostelium discoideum: cellular localization, spatial expression and overexpression.

PubMed

Swer, Pynskhem Bok; Bhadoriya, Pooja; Saran, Shweta

2014-03-01

Dictyostelium discoideum encodes a single Rheb protein showing sequence similarity to human homologues of Rheb. The DdRheb protein shares 52 percent identity and 100 percent similarity with the human Rheb1 protein. Fluorescence of Rheb yellow fluorescent protein fusion was detected in the D. discoideum cytoplasm. Reverse transcription-polymerase chain reaction and whole-mount in situ hybridization analyses showed that rheb is expressed at all stages of development and in prestalk cells in the multicellular structures developed. When the expression of rheb as a fusion with lacZ was driven under its own promoter, the beta-galactosidase activity was seen in the prestalk cells. D. discoideum overexpressing Rheb shows an increase in the size of the cell. Treatment of the overexpressing Rheb cells with rapamycin confirms its involvement in the TOR signalling pathway.

Comparison of nested competitive RT-PCR and real-time RT-PCR for the detection and quantification of AML1/MTG8 fusion transcripts in t(8;21) positive acute myelogenous leukemia.

PubMed

Wattjes, M P; Krauter, J; Nagel, S; Heidenreich, O; Ganser, A; Heil, G

2000-02-01

The chromosomal translocation t(8;21)(q22;q22) is one of the most frequent karyotypic aberrations in acute myeloid leukemia (AML) and results in a chimeric fusion transcript AML1/MTG8. Since AML1/MTG8 fusion transcripts remain detectable by RT-PCR in t(8;21) AML patients in long-term hematological remission, quantitative assessment of AML1/MTG8 transcripts is necessary for the monitoring of minimal residual disease (MRD) in these patients. Competitive RT-PCR and recently real-time RT-PCR are increasingly used for detection and quantification of leukemia specific fusion transcripts. For the direct comparison of both methods we cloned a 42 bp DNA fragment into the original AML1/MTG8 sequence. The resulting molecule was used as an internal competitor for our novel competitive nested RT-PCR for AML1/MTG8 and as an external standard for the generation of AML1/MTG8 standard curves in a real-time PCR assay. Using this standard molecule for both PCR techniques, we compared their sensitivity, linearity and reproducibility. Both methods were comparable with regard to all parameters tested irrespective of analyzing serial dilutions of plasmids, cell lines or samples from t(8;21) positive AML patients at different stages of the disease. Therefore, both techniques can be recommended for the monitoring of MRD in these particular AML patients. However, the automatization of the real-time PCR technique offers some technical advantages.

Regulation of glutamine synthetase II activity in Rhizobium meliloti 104A14.

PubMed Central

Shatters, R G; Somerville, J E; Kahn, M L

1989-01-01

Most rhizobia contain two glutamine synthetase (GS) enzymes: GSI, encoded by glnA, and GSII, encoded by glnII. We have found that WSU414, a Rhizobium meliloti 104A14 glutamine auxotroph derived from a glnA parental strain, is an ntrA mutant. The R. meliloti glnII promoter region contains DNA sequences similar to those found in front of other genes that require ntrA for their transcription. No GSII was found in the glnA ntrA mutant, and when a translational fusion of glnII to the Escherichia coli lacZ gene was introduced into WSU414, no beta-galactosidase was expressed. These results indicate that ntrA is required for glnII expression. The ntrA mutation did not prevent the expression of GSI. In free-living culture, the level of GSII and of the glnII-lacZ fusion protein was regulated by altering transcription in response to available nitrogen. No GSII protein was detected in alfalfa, pea, or soybean nodules when anti-GSII-specific antiserum was used. Images PMID:2570059

Studies on the Nucleotide Sequence, Transcription and Deletion Analysis of the BmNPV Protein Kinase Gene.

PubMed

Zhang, Chuan-Xi; Hu, Cui; Wu, Xiang-Fu

1998-01-01

The coding region of BmvPK-1 gene of Bombyx mori NPV (Strain ZJ8) is 828 nt long and encodes a 276 aa polypeptide with predicted molecular mass of 32 kD. Dot blot analysis showed its mRNA to be gene is first detectable at 18 h p.i. and reaching the highest transcriptional level at 48 h p.i. The result suggested that BmvPK-1 gene is a late or very late gene. The most conserved 365 bp of the BmvPK-1 gene was deleted in a transfer vector (pUCPK-lac), and a report gene (lacZ) was inserted in the deleted position. Cotransfection of BmN cells with pUCPK-lac DNA and BmNPV DNA resulted in the recombinant virus which expressed detectable product of lacZ gene. But the virus with the deleted BmvPK-1 gene could not be isolated from the wild BmNPV by plaque purification method. The result showed that the BmvPK-1 gene deleted virus can multiply only with the help of the product of this gene from the wild type virus, and the gene is necessary for the virus to finish its life cycle in the cultured cells.

Molecular characterization of epithelioid haemangioendotheliomas identifies novel WWTR1-CAMTA1 fusion variants.

PubMed

Patel, Nimesh R; Salim, Alaa A; Sayeed, Hadi; Sarabia, Stephen F; Hollingsworth, Faith; Warren, Mikako; Jakacky, Jared; Tanas, Munir; Oliveira, Andre M; Rubin, Brian P; Lazar, Alexander J; López-Terrada, Dolores; Wang, Wei-Lien

2015-11-01

Epithelioid haemangioendothelioma (EHE) is a malignant vascular neoplasm. Subsets have been characterized previously by translocations resulting in either WWTR1-CAMTA1 or YAP1-TFE3 fusion. We sought to develop molecular and immunohistochemical (IHC) assays to aid in the diagnosis and characterization of EHE. Fifty-two formalin-fixed, paraffin-embedded (FFPE) cases diagnosed between 2002 and 2014 were retrieved from the pathology files of our institutions. Reverse transcription-polymerase chain reaction (RT-PCR) assays were optimized to detect WWTR1-CAMTA1 and YAP1-TFE3 fusion transcripts in FFPE tissue and transcription factor E3 (TFE3) protein accumulation was examined by immunohistochemistry (IHC). RNA was extracted from 33 adequate samples, with more recent cases providing a greater yield of high quality RNA. Fourteen of 18 informative cases were positive for WWTR1-CAMTA1 fusion transcripts, four of which showed higher-grade cytological features termed by some as 'malignant EHE'. Novel in-frame fusion transcripts were identified in four cases by direct sequencing. IHC revealed variable nuclear TFE3 staining in six of 17 cases; three with patchy staining showed WWTR1-CAMTA1 fusion. One of 18 informative cases was positive for YAP1-TFE3 fusion and showed strong nuclear TFE3 staining by IHC. This study confirms the high incidence of WWTR1-CAMTA1 and YAP1-TFE3 rearrangements in EHE and indicates that the staining pattern for TFE3 IHC is critical for specificity. © 2015 John Wiley & Sons Ltd.

Detection of alveolar rhabdomyosarcoma in pleural fluid with immunocytochemistry on cell block and determination of PAX/FKHR fusion mRNA by reverse transcription-polymerase chain reaction.

PubMed

Sawangpanich, Ruchchadol; Larbcharoensub, Noppadol; Jinawath, Artit; Pongtippan, Atcharaporn; Anurathapan, Usanarat; Hongeng, Suradej

2011-11-01

Alveolar rhabdomyosarcoma is a primitive malignant round cell neoplasm, which shows skeletal muscle differentiation. Although their histopathologic and immunohistochemical findings are well known, the cytology, immunocytochemistry and molecular study on pleural effusion have not been well documented. To apply molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma. The case of a 14-year-old Thai male, who presented with dyspnea and left pleural effusion. Computed tomography of the chest and abdomen showed a huge heterogeneous enhancing mass at the left retroperitoneum. Pleural fluid cytology showed malignant small round blue cells. Immunocytochemical stains on cell block material showed positive reactivity to vimentin, sarcomeric actin, desmin, MyoD1, myogenin, and CD56 in round cell tumor Reverse transcription-polymerase chain reaction (RT-PCR) demonstrated PAX/FKHR fusion transcript. The patient received chemotherapeutic regimen for advanced-stage rhabdomyosarcoma. Finally, he succumbed to the disease, thirteen months after the diagnosis. Immunocytochemistry on cell block in conjunction with determination of PAX/FKHR fusion mRNA by RT-PCR is a molecular method in the diagnosis and monitoring of alveolar rhabdomyosarcoma inpleural fluid.

Reanalysis of RNA-Sequencing Data Reveals Several Additional Fusion Genes with Multiple Isoforms

PubMed Central

Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

2012-01-01

RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts. PMID:23119097

Reanalysis of RNA-sequencing data reveals several additional fusion genes with multiple isoforms.

PubMed

Kangaspeska, Sara; Hultsch, Susanne; Edgren, Henrik; Nicorici, Daniel; Murumägi, Astrid; Kallioniemi, Olli

2012-01-01

RNA-sequencing and tailored bioinformatic methodologies have paved the way for identification of expressed fusion genes from the chaotic genomes of solid tumors. We have recently successfully exploited RNA-sequencing for the discovery of 24 novel fusion genes in breast cancer. Here, we demonstrate the importance of continuous optimization of the bioinformatic methodology for this purpose, and report the discovery and experimental validation of 13 additional fusion genes from the same samples. Integration of copy number profiling with the RNA-sequencing results revealed that the majority of the gene fusions were promoter-donating events that occurred at copy number transition points or involved high-level DNA-amplifications. Sequencing of genomic fusion break points confirmed that DNA-level rearrangements underlie selected fusion transcripts. Furthermore, a significant portion (>60%) of the fusion genes were alternatively spliced. This illustrates the importance of reanalyzing sequencing data as gene definitions change and bioinformatic methods improve, and highlights the previously unforeseen isoform diversity among fusion transcripts.

VanT, a Homologue of Vibrio harveyi LuxR, Regulates Serine, Metalloprotease, Pigment, and Biofilm Production in Vibrio anguillarum

PubMed Central

Croxatto, Antony; Chalker, Victoria J.; Lauritz, Johan; Jass, Jana; Hardman, Andrea; Williams, Paul; Cámara, Miguel; Milton, Debra L.

2002-01-01

Vibrio anguillarum possesses at least two N-acylhomoserine lactone (AHL) quorum-sensing circuits, one of which is related to the luxMN system of Vibrio harveyi. In this study, we have cloned an additional gene of this circuit, vanT, encoding a V. harveyi LuxR-like transcriptional regulator. A V. anguillarum ΔvanT null mutation resulted in a significant decrease in total protease activity due to loss of expression of the metalloprotease EmpA, but no changes in either AHL production or virulence. Additional genes positively regulated by VanT were identified from a plasmid-based gene library fused to a promoterless lacZ. Three lacZ fusions (serA::lacZ, hpdA-hgdA::lacZ, and sat-vps73::lacZ) were identified which exhibited decreased expression in the ΔvanT strain. SerA is similar to 3-phosphoglycerate dehydrogenases and catalyzes the first step in the serine-glycine biosynthesis pathway. HgdA has identity with homogentisate dioxygenases, and HpdA is homologous to 4-hydroxyphenylpyruvate dioxygenases (HPPDs) involved in pigment production. V. anguillarum strains require an active VanT to produce high levels of an l-tyrosine-induced brown color via HPPD, suggesting that VanT controls pigment production. Vps73 and Sat are related to Vibrio cholerae proteins encoded within a DNA locus required for biofilm formation. A V. anguillarum ΔvanT mutant and a mutant carrying a polar mutation in the sat-vps73 DNA locus were shown to produce defective biofilms. Hence, a new member of the V. harveyi LuxR transcriptional activator family has been characterized in V. anguillarum that positively regulates serine, metalloprotease, pigment, and biofilm production. PMID:11872713

VanT, a homologue of Vibrio harveyi LuxR, regulates serine, metalloprotease, pigment, and biofilm production in Vibrio anguillarum.

PubMed

Croxatto, Antony; Chalker, Victoria J; Lauritz, Johan; Jass, Jana; Hardman, Andrea; Williams, Paul; Cámara, Miguel; Milton, Debra L

2002-03-01

Vibrio anguillarum possesses at least two N-acylhomoserine lactone (AHL) quorum-sensing circuits, one of which is related to the luxMN system of Vibrio harveyi. In this study, we have cloned an additional gene of this circuit, vanT, encoding a V. harveyi LuxR-like transcriptional regulator. A V. anguillarum Delta vanT null mutation resulted in a significant decrease in total protease activity due to loss of expression of the metalloprotease EmpA, but no changes in either AHL production or virulence. Additional genes positively regulated by VanT were identified from a plasmid-based gene library fused to a promoterless lacZ. Three lacZ fusions (serA::lacZ, hpdA-hgdA::lacZ, and sat-vps73::lacZ) were identified which exhibited decreased expression in the Delta vanT strain. SerA is similar to 3-phosphoglycerate dehydrogenases and catalyzes the first step in the serine-glycine biosynthesis pathway. HgdA has identity with homogentisate dioxygenases, and HpdA is homologous to 4-hydroxyphenylpyruvate dioxygenases (HPPDs) involved in pigment production. V. anguillarum strains require an active VanT to produce high levels of an L-tyrosine-induced brown color via HPPD, suggesting that VanT controls pigment production. Vps73 and Sat are related to Vibrio cholerae proteins encoded within a DNA locus required for biofilm formation. A V. anguillarum Delta vanT mutant and a mutant carrying a polar mutation in the sat-vps73 DNA locus were shown to produce defective biofilms. Hence, a new member of the V. harveyi LuxR transcriptional activator family has been characterized in V. anguillarum that positively regulates serine, metalloprotease, pigment, and biofilm production.

The OTT-MAL fusion oncogene activates RBPJ-mediated transcription and induces acute megakaryoblastic leukemia in a knockin mouse model

PubMed Central

Mercher, Thomas; Raffel, Glen D.; Moore, Sandra A.; Cornejo, Melanie G.; Baudry-Bluteau, Dominique; Cagnard, Nicolas; Jesneck, Jonathan L.; Pikman, Yana; Cullen, Dana; Williams, Ifor R.; Akashi, Koichi; Shigematsu, Hirokazu; Bourquin, Jean-Pierre; Giovannini, Marco; Vainchenker, William; Levine, Ross L.; Lee, Benjamin H.; Bernard, Olivier A.; Gilliland, D. Gary

2009-01-01

Acute megakaryoblastic leukemia (AMKL) is a form of acute myeloid leukemia (AML) associated with a poor prognosis. The genetics and pathophysiology of AMKL are not well understood. We generated a knockin mouse model of the one twenty-two–megakaryocytic acute leukemia (OTT-MAL) fusion oncogene that results from the t(1;22)(p13;q13) translocation specifically associated with a subtype of pediatric AMKL. We report here that OTT-MAL expression deregulated transcriptional activity of the canonical Notch signaling pathway transcription factor recombination signal binding protein for immunoglobulin κ J region (RBPJ) and caused abnormal fetal megakaryopoiesis. Furthermore, cooperation between OTT-MAL and an activating mutation of the thrombopoietin receptor myeloproliferative leukemia virus oncogene (MPL) efficiently induced a short-latency AMKL that recapitulated all the features of human AMKL, including megakaryoblast hyperproliferation and maturation block, thrombocytopenia, organomegaly, and extensive fibrosis. Our results establish that concomitant activation of RBPJ (Notch signaling) and MPL (cytokine signaling) transforms cells of the megakaryocytic lineage and suggest that specific targeting of these pathways could be of therapeutic value for human AMKL. PMID:19287095

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

An improved ChIP-seq peak detection system for simultaneously identifying post-translational modified transcription factors by combinatorial fusion, using SUMOylation as an example.

PubMed

Cheng, Chia-Yang; Chu, Chia-Han; Hsu, Hung-Wei; Hsu, Fang-Rong; Tang, Chung Yi; Wang, Wen-Ching; Kung, Hsing-Jien; Chang, Pei-Ching

2014-01-01

Post-translational modification (PTM) of transcriptional factors and chromatin remodelling proteins is recognized as a major mechanism by which transcriptional regulation occurs. Chromatin immunoprecipitation (ChIP) in combination with high-throughput sequencing (ChIP-seq) is being applied as a gold standard when studying the genome-wide binding sites of transcription factor (TFs). This has greatly improved our understanding of protein-DNA interactions on a genomic-wide scale. However, current ChIP-seq peak calling tools are not sufficiently sensitive and are unable to simultaneously identify post-translational modified TFs based on ChIP-seq analysis; this is largely due to the wide-spread presence of multiple modified TFs. Using SUMO-1 modification as an example; we describe here an improved approach that allows the simultaneous identification of the particular genomic binding regions of all TFs with SUMO-1 modification. Traditional peak calling methods are inadequate when identifying multiple TF binding sites that involve long genomic regions and therefore we designed a ChIP-seq processing pipeline for the detection of peaks via a combinatorial fusion method. Then, we annotate the peaks with known transcription factor binding sites (TFBS) using the Transfac Matrix Database (v7.0), which predicts potential SUMOylated TFs. Next, the peak calling result was further analyzed based on the promoter proximity, TFBS annotation, a literature review, and was validated by ChIP-real-time quantitative PCR (qPCR) and ChIP-reChIP real-time qPCR. The results show clearly that SUMOylated TFs are able to be pinpointed using our pipeline. A methodology is presented that analyzes SUMO-1 ChIP-seq patterns and predicts related TFs. Our analysis uses three peak calling tools. The fusion of these different tools increases the precision of the peak calling results. TFBS annotation method is able to predict potential SUMOylated TFs. Here, we offer a new approach that enhances Ch

Over-expression of phage HK022 Nun protein is toxic for Escherichia coli

PubMed Central

Uc-Mass, Augusto; Khodursky, Arkady; Brown, Lewis; Gottesman, Max E.

2008-01-01

The Nun protein of coliphage HK022 excludes superinfecting λ phage. Nun recognizes and binds to the N utilization (nut) sites on phage λ nascent RNA and induces transcription termination. Over-expression of Nun from a high-copy plasmid is toxic for E.coli, despite the fact that nut sites are not encoded in the E.coli genome. Cells expressing Nun cannot exit stationary phase. Toxicity is related to transcription termination, since host and nun mutations that block termination also suppress cell killing. Nun inhibits expression of wild-type lacZ, but not lacZ expressed from the Crp/cAMP–independent lacUV5 promoter. Microarray and proteomics analyses show Nun down-regulates crp and tnaA. Crp over-expression and high indole concentrations partially reverse Nun-mediated toxicity and restore lacZ expression. PMID:18571198

The transcription factor GCN4 regulates PHM8 and alters triacylglycerol metabolism in Saccharomyces cerevisiae.

PubMed

Yadav, Kamlesh Kumar; Rajasekharan, Ram

2016-11-01

PHM8 is a very important enzyme in nonpolar lipid metabolism because of its role in triacylglycerol (TAG) biosynthesis under phosphate stress conditions. It is positively regulated by the PHO4 transcription factor under low phosphate conditions; however, its regulation has not been explored under normal physiological conditions. General control nonderepressible (GCN4), a basic leucine-zipper transcription factor activates the transcription of amino acids, purine biosynthesis genes and many stress response genes under various stress conditions. In this study, we demonstrate that the level of TAG is regulated by the transcription factor GCN4. GCN4 directly binds to its consensus recognition sequence (TGACTC) in the PHM8 promoter and controls its expression. The analysis of cells expressing the P PHM8 -lacZ reporter gene showed that mutations (TGACTC-GGGCCC) in the GCN4-binding sequence caused a significant increase in β-galactosidase activity. Mutation in the GCN4 binding sequence causes an increase in PHM8 expression, lysophosphatidic acid phosphatase activity and TAG level. PHM8, in conjunction with DGA1, a mono- and diacylglycerol transferase, controls the level of TAG. These results revealed that GCN4 negatively regulates PHM8 and that deletion of GCN4 causes de-repression of PHM8, which is responsible for the increased TAG content in gcn4∆ cells.

Control of early cardiac-specific transcription of Nkx2-5 by a GATA-dependent enhancer.

PubMed

Lien, C L; Wu, C; Mercer, B; Webb, R; Richardson, J A; Olson, E N

1999-01-01

The homeobox gene Nkx2-5 is the earliest known marker of the cardiac lineage in vertebrate embryos. Nkx2-5 expression is first detected in mesodermal cells specified to form heart at embryonic day 7.5 in the mouse and expression is maintained throughout the developing and adult heart. In addition to the heart, Nkx2-5 is transiently expressed in the developing pharynx, thyroid and stomach. To investigate the mechanisms that initiate cardiac transcription during embryogenesis, we analyzed the Nkx2-5 upstream region for regulatory elements sufficient to direct expression of a lacZ transgene in the developing heart of transgenic mice. We describe a cardiac enhancer, located about 9 kilobases upstream of the Nkx2-5 gene, that fully recapitulates the expression pattern of the endogenous gene in cardiogenic precursor cells from the onset of cardiac lineage specification and throughout the linear and looping heart tube. Thereafter, as the atrial and ventricular chambers become demarcated, enhancer activity becomes restricted to the developing right ventricle. Transcription of Nkx2-5 in pharynx, thyroid and stomach is controlled by regulatory elements separable from the cardiac enhancer. This distal cardiac enhancer contains a high-affinity binding site for the cardiac-restricted zinc finger transcription factor GATA4 that is essential for transcriptional activity. These results reveal a novel GATA-dependent mechanism for activation of Nkx2-5 transcription in the developing heart and indicate that regulation of Nkx2-5 is controlled in a modular manner, with multiple regulatory regions responding to distinct transcriptional networks in different compartments of the developing heart.

The effect of myotonic dystrophy transcript levels and location on muscle differentiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mastroyiannopoulos, Nikolaos P.; Chrysanthou, Elina; Kyriakides, Tassos C.

2008-12-12

In myotonic dystrophy type I (DM1), nuclear retention of mutant DMPK transcripts compromises muscle cell differentiation. Although several reports have identified molecular defects in myogenesis, it remains still unclear how exactly the retention of the mutant transcripts induces this defect. We have recently created a novel cellular model in which the mutant DMPK 3' UTR transcripts were released to the cytoplasm of myoblasts by using the WPRE genetic element. As a result, muscle cell differentiation was repaired. In this paper, this cellular model was further exploited to investigate the effect of the levels and location of the mutant transcripts onmore » muscle differentiation. Results show that the levels of these transcripts were proportional to the inhibition of both the initial fusion of myoblasts and the maturity of myotubes. Moreover, the cytoplasmic export of the mutant RNAs to the cytoplasm caused less inhibition only in the initial fusion of myoblasts.« less

Transcriptional Regulation of Aggregatibacter actinomycetemcomitans lsrACDBFG and lsrRK Operons and Their Role in Biofilm Formation

PubMed Central

Torres-Escobar, Ascención; Juárez-Rodríguez, María Dolores; Lamont, Richard J.

2013-01-01

Autoinducer-2 (AI-2) is required for biofilm formation and virulence of the oral pathogen Aggregatibacter actinomycetemcomitans, and we previously showed that lsrB codes for a receptor for AI-2. The lsrB gene is expressed as part of the lsrACDBFG operon, which is divergently transcribed from an adjacent lsrRK operon. In Escherichia coli, lsrRK encodes a repressor and AI-2 kinase that function to regulate lsrACDBFG. To determine if lsrRK controls lsrACDBFG expression and influences biofilm growth of A. actinomycetemcomitans, we first defined the promoters for each operon. Transcriptional reporter plasmids containing the 255-bp lsrACDBFG-lsrRK intergenic region (IGR) fused to lacZ showed that essential elements of lsrR promoter reside 89 to 255 bp upstream from the lsrR start codon. Two inverted repeat sequences that represent potential binding sites for LsrR and two sequences resembling the consensus cyclic AMP receptor protein (CRP) binding site were identified in this region. Using electrophoretic mobility shift assay (EMSA), purified LsrR and CRP proteins were shown to bind probes containing these sequences. Surprisingly, the 255-bp IGR did not contain the lsrA promoter. Instead, a fragment encompassing nucleotides +1 to +159 of lsrA together with the 255-bp IGR was required to promote lsrA transcription. This suggests that a region within the lsrA coding sequence influences transcription, or alternatively that the start codon of A. actinomycetemcomitans lsrA has been incorrectly annotated. Transformation of ΔlsrR, ΔlsrK, ΔlsrRK, and Δcrp deletion mutants with lacZ reporters containing the lsrA or lsrR promoter showed that LsrR negatively regulates and CRP positively regulates both lsrACDBFG and lsrRK. However, in contrast to what occurs in E. coli, deletion of lsrK had no effect on the transcriptional activity of the lsrA or lsrR promoters, suggesting that another kinase may be capable of phosphorylating AI-2 in A. actinomycetemcomitans. Finally, biofilm

Deletion of p66Shc in mice increases the frequency of size-change mutations in the lacZ transgene.

PubMed

Beltrami, Elena; Ruggiero, Antonella; Busuttil, Rita; Migliaccio, Enrica; Pelicci, Pier Giuseppe; Vijg, Jan; Giorgio, Marco

2013-04-01

Upon oxidative challenge the genome accumulates adducts and breaks that activate the DNA damage response to repair, arrest, or eliminate the damaged cell. Thus, reactive oxygen species (ROS) generated by endogenous oxygen metabolism are thought to affect mutation frequency. However, few studies determined the mutation frequency when oxidative stress is reduced. To test whether in vivo spontaneous mutation frequency is altered in mice with reduced oxidative stress and cell death rate, we crossed p66Shc knockout (p66KO) mice, characterized by reduced intracellular concentration of ROS and by impaired apoptosis, with a transgenic line harboring multiple copies of the lacZ mutation reporter gene as part of a plasmid that can be recovered from organs into Escherichia coli to measure mutation rate. Liver and small intestine from 2- to 24-month-old, lacZ (p66Shc+/+) and lacZp66KO mice, were investigated revealing no difference in overall mutation frequency but a significant increase in the frequency of size-change mutations in the intestine of lacZp66KO mice. This difference was further increased upon irradiation of mice with X-ray. In addition, we found that knocking down cyclophilin D, a gene that facilitates mitochondrial apoptosis acting downstream of p66Shc, increased the size-change mutation frequency in small intestine. Size-change mutations also accumulated in death-resistant embryonic fibroblasts from lacZp66KO mice treated with H2 O2 . These results indicate that p66Shc plays a role in the accumulation of DNA rearrangements and suggest that p66Shc functions to clear damaged cells rather than affect DNA metabolism. © 2012 The Authors Aging Cell © 2012 Blackwell Publishing Ltd/Anatomical Society of Great Britain and Ireland.

The significance of alternative transcripts for Caenorhabditis elegans transcription factor genes, based on expression pattern analysis

PubMed Central

2013-01-01

Background Sequence-specific DNA-binding proteins, with their paramount importance in the regulation of expression of the genetic material, are encoded by approximately 5% of the genes in an animal’s genome. But it is unclear to what extent alternative transcripts from these genes may further increase the complexity of the transcription factor complement. Results Of the 938 potential C. elegans transcription factor genes, 197 were annotated in WormBase as encoding at least two distinct isoforms. Evaluation of prior evidence identified, with different levels of confidence, 50 genes with alternative transcript starts, 23 with alternative transcript ends, 35 with alternative splicing and 34 with alternative transcripts generated by a combination of mechanisms, leaving 55 that were discounted. Expression patterns were determined for transcripts for a sample of 29 transcription factor genes, concentrating on those with alternative transcript starts for which the evidence was strongest. Seamless fosmid recombineering was used to generate reporter gene fusions with minimal modification to assay expression of specific transcripts while maintaining the broad genomic DNA context and alternative transcript production. Alternative transcription factor gene transcripts were typically expressed with identical or substantially overlapping distributions rather than in distinct domains. Conclusions Increasingly sensitive sequencing technologies will reveal rare transcripts but many of these are clearly non-productive. The majority of the transcription factor gene alternative transcripts that are productive may represent tolerable noise rather than encoding functionally distinct isoforms. PMID:23586691

Construction of a β-galactosidase-gene-based fusion is convenient for screening candidate genes involved in regulation of pyrrolnitrin biosynthesis in Pseudomonas chlororaphis G05.

PubMed

Luo, Wangtai; Miao, Jing; Feng, Zhibin; Lu, Ruiyang; Sun, Xiaoqiang; Zhang, Baoshen; Ding, Weiqiu; Lu, Yang; Wang, Yanhua; Chi, Xiaoyan; Ge, Yihe

2018-05-28

In our recent work, we found that pyrrolnitrin, and not phenazines, pyrrolnitrin contributed to the suppression of the mycelia growth of Fusarium graminearum that causes heavy Fusarium head blight (FHB) disease in cereal crops. However, pyrrolnitrin production of Pseudomonas chlororaphis G05 in King's B medium was very low. Although a few regulatory genes mediating the prnABCD (the prn operon, pyrrolnitrin biosynthetic locus) expression have been identified, it is not enough for us to enhance pyrrolnitrin production by systematically constructing a genetically-engineered strain. To obtain new candidate genes involved in regulation of the prn operon expression, we successfully constructed a fusion mutant G05ΔphzΔprn::lacZ, in which most of the coding regions of the prn operon and the phzABCDEFG (the phz operon, phenazine biosynthetic locus) were deleted, and the promoter region plus the first thirty condons of the prnA was in-frame fused with the truncated lacZ gene on its chromosome. The expression of the fused lacZ reporter gene driven by the promoter of the prn operon made it easy for us to detect the level of the prn expression in terms of the color variation of colonies on LB agar plates supplemented with 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-Gal). With this fusion mutant as a recipient strain, mini-Tn5-based random insertional mutagenesis was then conducted. By picking up colonies with color change, it is possible for us to screen and identify new candidate genes involved in regulation of the prn expression. Identification of additional regulatory genes in further work could reasonably be expected to increase pyrrolnitrin production in G05 and to improve its biological control function.

Regulation of iron assimilation: nucleotide sequence analysis of an iron-regulated promoter from a fluorescent pseudomonad.

PubMed

O'Sullivan, D J; O'Gara, F

1991-08-01

An iron-regulated promoter was cloned on a 2.1 kb Bg/II fragment from Pseudomonas sp. strain M114 and fused to the lacZ reporter gene. Iron-regulated lacZ expression from the resulting construct (pSP1) in strain M114 was mediated via the Fur-like repressor which also regulates siderophore production in this strain. A 390 bp StuI-PstI internal fragment contained the necessary information for iron-regulated promoter expression. This fragment was sequenced and the initiation point for transcription was determined by primer extension analysis. The region directly upstream of the transcription start point contained no significant homology to known promoter consensus sequences. However the -16 to -25 bp region contained homology to four other iron-regulated pseudomonad promoters. Deletion of bases downstream from the transcriptional start did not affect the iron-regulated expression of the promoter. The -37 and -43 bp regions exhibited some homology to the 19 bp Escherichia coli Fur-binding consensus sequence. When expressed in E. coli (via a cloned transacting factor from strain M114) lacZ expression from pSP1 was found to be regulated by iron. A region of greater than 77 bases but less than 131 upstream from the transcriptional start was found to be necessary for promoter activity, further suggesting that a transcriptional activator may be required for expression.

The mitochondrial cytochrome c peroxidase Ccp1 of Saccharomyces cerevisiae is involved in conveying an oxidative stress signal to the transcription factor Pos9 (Skn7).

PubMed

Charizanis, C; Juhnke, H; Krems, B; Entian, K D

1999-10-01

In Saccharomyces cerevisiae two transcription factors, Pos9 (Skn7) and Yap1, are involved in the response to oxidative stress. Fusion of the Pos9 response-regulator domain to the Gal4 DNA-binding domain results in a transcription factor which renders the expression of a GAL1-lacZ reporter gene dependent on oxidative stress. To identify genes which are involved in the oxygen-dependent activation of the Gal4-Pos9 hybrid protein we screened for mutants that failed to induce the heterologous test system upon oxidative stress (fap mutants for factors activating Pos9). We isolated several respiration-deficient and some respiration-competent mutants by this means. We selected for further characterization only those mutants which also displayed an oxidative-stress-sensitive phenotype. One of the respiration-deficient mutants (complementation groupfap6) could be complemented by the ISM1 gene, which encodes mitochondrial isoleucyl tRNA synthetase, suggesting that respiration competence was important for signalling of oxidative stress. In accordance with this notion a rho0 strain and a wild-type strain in which respiration had been blocked (by treatment with antimycin A or with cyanide) also failed to activate Gal4-Pos9 upon imposition of oxidative stress. Another mutant, fap24, which was respiration-competent, could be complemented by CCP1, which encodes the mitochondrial cytochrome c peroxidase. Mitochondrial cytochrome c peroxidase degrades reactive oxygen species within the mitochondria. This suggested a possible sensor function for the enzyme in the oxidative stress response. To test this we used the previously described point mutant ccp1 W191F, which is characterized by a 10(4)-fold decrease in electron flux between cytochrome c and cytochrome c peroxidase. The Ccp1W191F mutant was still capable of activating the Pos9 transcriptional activation domain, suggesting that the signalling function of Ccp1 is independent of electron flux rates.

The recX gene product is involved in the SOS response in Herbaspirillum seropedicae.

PubMed

Galvão, Carolina W; Pedrosa, Fábio O; Souza, Emanuel M; Yates, M Geoffrey; Chubatsu, Leda S; Steffens, Maria Berenice R

2003-02-01

The recA and the recX genes of Herbaspirillum seropedicae were sequenced. The recX is located 359 bp downstream from recA. Sequence analysis indicated the presence of a putative operator site overlapping a probable sigma70-dependent promoter upstream of recA and a transcription terminator downstream from recX, with no apparent promoter sequence in the intergenic region. Transcriptional analysis using lacZ promoter fusions indicated that recA expression increased three- to fourfold in the presence of methyl methanesulfonate (MMS). The roles of recA and recX genes in the SOS response were determined from studies of chromosomal mutants. The recA mutant showed the highest sensitivity to MMS and UV, and the recX mutant had an intermediate sensitivity, compared with the wild type (SMR1), confirming the essential role of the RecA protein in cell viability in the presence of mutagenic agents and also indicating a role for RecX in the SOS response.

Novel Chromosomal Rearrangements and breakpoints at the t(6;9) in Salivary Adenoid Cystic Carcinoma: association with MYB-NFIB chimeric fusion, MYB expression, and clinical outcome

PubMed Central

Mitani, Yoshitsugu; Rao, Pulivarthi H.; Futreal, P. Andrew; Roberts, Dianna B.; Stephens, Philip J.; Zhao, Yi-Jue; Zhang, Li; Mitani, Mutsumi; Weber, Randal S.; Lippman, Scott M.; Caulin, Carlos; El-Naggar, Adel K.

2011-01-01

Objective To investigate the molecular-genetic heterogeneity associated with the t(6:9) in adenoid cystic carcinoma (ACC) and correlate the findings with patient clinical outcome. Experimental Design Multi-molecular and genetic techniques complemented with massive pair-ended sequencing and SNP array analyses were used on tumor specimens from 30 new and 52 previously RT-PCR analyzed fusion transcript negative ACCs. MYB mRNA expression level was determined by quantitative RT-PCR. The results of 102 tumors (30 new and 72 previously reported cases) were correlated with the clinicopathologic factors and patients’ survival. Results The FISH analysis showed 34/82 (41.5%) fusion positive tumors and molecular techniques identified fusion transcripts in 21 of the 82 (25.6%) tumors. Detailed FISH analysis of 11 out the 15 tumors with gene fusion without transcript formation showed translocation of NFIB sequences to proximal or distal sites of the MYB gene. Massive pair-end sequencing of a subset of tumors confirmed the proximal translocation to an NFIB sequence and led to the identification of a new fusion gene (NFIB-AIG1) in one of the tumors. Overall, MYB-NFIB gene fusion rate by FISH was in 52.9% while fusion transcript forming incidence was 38.2%. Significant statistical association between the 5′ MYB transcript expression and patient survival was found. Conclusions We conclude that: 1) t(6;9) results in a complex genetic and molecular alterations in ACC, 2) MYB-NFIB gene fusion may not always be associated with chimeric transcript formation, 3) non-canonical MYB, NFIB gene fusions occur in a subset of tumors, 4) high MYB expression correlates with worse patient survival. PMID:21976542

Silencing of the PiAvr3a effector-encoding gene from Phytophthora infestans by transcriptional fusion to a short interspersed element.

PubMed

Vetukuri, Ramesh R; Tian, Zhendong; Avrova, Anna O; Savenkov, Eugene I; Dixelius, Christina; Whisson, Stephen C

2011-12-01

Phytophthora infestans is the notorious oomycete causing late blight of potato and tomato. A large proportion of the P. infestans genome is composed of transposable elements, the activity of which may be controlled by RNA silencing. Accumulation of small RNAs is one of the hallmarks of RNA silencing. Here we demonstrate the presence of small RNAs corresponding to the sequence of a short interspersed retrotransposable element (SINE) suggesting that small RNAs might be involved in silencing of SINEs in P. infestans. This notion was exploited to develop novel tools for gene silencing in P. infestans by engineering transcriptional fusions of the PiAvr3a gene, encoding an RXLR avirulence effector, to the infSINEm retroelement. Transgenic P. infestans lines expressing either 5'-infSINEm::PiAvr3a-3' or 5'-PiAvr3a::SINEm-3' chimeric transcripts initially exhibited partial silencing of PiAvr3a. Over time, PiAvr3a either recovered wild type transcript levels in some lines, or became fully silenced in others. Introduction of an inverted repeat construct was also successful in yielding P. infestans transgenic lines silenced for PiAvr3a. In contrast, constructs expressing antisense or aberrant RNA transcripts failed to initiate silencing of PiAvr3a. Lines exhibiting the most effective silencing of PiAvr3a were either weakly or non-pathogenic on susceptible potato cv. Bintje. This study expands the repertoire of reverse genetics tools available for P. infestans research, and provides insights into a possible mode of variation in effector expression through spread of silencing from adjacent retroelements. Crown Copyright © 2011. Published by Elsevier Ltd. All rights reserved.

Novel gene fusion of PRCC-MITF defines a new member of MiT family translocation renal cell carcinoma: clinicopathological analysis and detection of the gene fusion by RNA sequencing and FISH.

PubMed

Xia, Qiu-Yuan; Wang, Xiao-Tong; Ye, Sheng-Bing; Wang, Xuan; Li, Rui; Shi, Shan-Shan; Fang, Ru; Zhang, Ru-Song; Ma, Heng-Hui; Lu, Zhen-Feng; Shen, Qin; Bao, Wei; Zhou, Xiao-Jun; Rao, Qiu

2018-04-01

MITF, TFE3, TFEB and TFEC belong to the same microphthalmia-associated transcription factor family (MiT). Two transcription factors in this family have been identified in two unusual types of renal cell carcinoma (RCC): Xp11 translocation RCC harbouring TFE3 gene fusions and t(6;11) RCC harbouring a MALAT1-TFEB gene fusion. The 2016 World Health Organisation classification of renal neoplasia grouped these two neoplasms together under the category of MiT family translocation RCC. RCCs associated with the other two MiT family members, MITF and TFEC, have rarely been reported. Herein, we identify a case of MITF translocation RCC with the novel PRCC-MITF gene fusion by RNA sequencing. Histological examination of the present tumour showed typical features of MiT family translocation RCCs, overlapping with Xp11 translocation RCC and t(6;11) RCC. However, this tumour showed negative results in TFE3 and TFEB immunochemistry and split fluorescence in-situ hybridisation (FISH) assays. The other MiT family members, MITF and TFEC, were tested further immunochemically and also showed negative results. RNA sequencing and reverse transcription-polymerase chain reaction confirmed the presence of a PRCC-MITF gene fusion: a fusion of PRCC exon 5 to MITF exon 4. We then developed FISH assays covering MITF break-apart probes and PRCC-MITF fusion probes to detect the MITF gene rearrangement. This study both proves the recurring existence of MITF translocation RCC and expands the genotype spectrum of MiT family translocation RCCs. © 2017 John Wiley & Sons Ltd.

Fungal mediator tail subunits contain classical transcriptional activation domains.

PubMed

Liu, Zhongle; Myers, Lawrence C

2015-04-01

Classical activation domains within DNA-bound eukaryotic transcription factors make weak interactions with coactivator complexes, such as Mediator, to stimulate transcription. How these interactions stimulate transcription, however, is unknown. The activation of reporter genes by artificial fusion of Mediator subunits to DNA binding domains that bind to their promoters has been cited as evidence that the primary role of activators is simply to recruit Mediator. We have identified potent classical transcriptional activation domains in the C termini of several tail module subunits of Saccharomyces cerevisiae, Candida albicans, and Candida dubliniensis Mediator, while their N-terminal domains are necessary and sufficient for their incorporation into Mediator but do not possess the ability to activate transcription when fused to a DNA binding domain. This suggests that Mediator fusion proteins actually are functioning in a manner similar to that of a classical DNA-bound activator rather than just recruiting Mediator. Our finding that deletion of the activation domains of S. cerevisiae Med2 and Med3, as well as C. dubliniensis Tlo1 (a Med2 ortholog), impairs the induction of certain genes shows these domains function at native promoters. Activation domains within coactivators are likely an important feature of these complexes and one that may have been uniquely leveraged by a common fungal pathogen. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Prostate Cancer Evaluation: Design, Synthesis and Evaluation of Novel Enzyme-Activated Proton MRI Contrast Agents

DTIC Science & Technology

2009-10-01

NUMBER E -Mail: 5f. WORK UNIT NUMBER 7. PERFORMING ORGANIZATION NAME(S) AND ADDRESS(ES) 8. PERFORMING ORGANIZATION REPORT NUMBER...transcriptional activation, protein expression, and protein interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most...1) Cell preparation (a) Stably transfected PC3 cell line: E . coli lacZ gene (from pSV-β-gal vector, Promega, Madison,WI) was inserted into high

Novel chromosomal rearrangements and break points at the t(6;9) in salivary adenoid cystic carcinoma: association with MYB-NFIB chimeric fusion, MYB expression, and clinical outcome.

PubMed

Mitani, Yoshitsugu; Rao, Pulivarthi H; Futreal, P Andrew; Roberts, Dianna B; Stephens, Philip J; Zhao, Yi-Jue; Zhang, Li; Mitani, Mutsumi; Weber, Randal S; Lippman, Scott M; Caulin, Carlos; El-Naggar, Adel K

2011-11-15

To investigate the molecular genetic heterogeneity associated with the t(6:9) in adenoid cystic carcinoma (ACC) and correlate the findings with patient clinical outcome. Multimolecular and genetic techniques complemented with massive pair-ended sequencing and single-nucleotide polymorphism array analyses were used on tumor specimens from 30 new and 52 previously analyzed fusion transcript-negative ACCs by reverse transcriptase PCR (RT-PCR). MYB mRNA expression level was determined by quantitative RT-PCR. The results of 102 tumors (30 new and 72 previously reported cases) were correlated with the clinicopathologic factors and patients' survival. The FISH analysis showed 34 of 82 (41.5%) fusion-positive tumors and molecular techniques identified fusion transcripts in 21 of the 82 (25.6%) tumors. Detailed FISH analysis of 11 out the 15 tumors with gene fusion without transcript formation showed translocation of NFIB sequences to proximal or distal sites of the MYB gene. Massive pair-end sequencing of a subset of tumors confirmed the proximal translocation to an NFIB sequence and led to the identification of a new fusion gene (NFIB-AIG1) in one of the tumors. Overall, MYB-NFIB gene fusion rate by FISH was in 52.9% whereas fusion transcript forming incidence was 38.2%. Significant statistical association between the 5' MYB transcript expression and patient survival was found. We conclude that: (i) t(6;9) results in complex genetic and molecular alterations in ACC, (ii) MYB-NFIB gene fusion may not always be associated with chimeric transcript formation, (iii) noncanonical MYB-NFIB gene fusions occur in a subset of tumors, (iv) high MYB expression correlates with worse patient survival.

Swinger RNAs with sharp switches between regular transcription and transcription systematically exchanging ribonucleotides: Case studies.

PubMed

Seligmann, Hervé

2015-09-01

During RNA transcription, DNA nucleotides A,C,G, T are usually matched by ribonucleotides A, C, G and U. However occasionally, this rule does not apply: transcript-DNA homologies are detectable only assuming systematic exchanges between ribonucleotides. Nine symmetric (X ↔ Y, e.g. A ↔ C) and fourteen asymmetric (X ↔ Y ↔ Z, e.g. A ↔ C ↔ G) exchanges exist, called swinger transcriptions. Putatively, polymerases occasionally stabilize in unspecified swinger conformations, possibly similar to transient conformations causing punctual misinsertions. This predicts chimeric transcripts, part regular, part swinger-transformed, reflecting polymerases switching to swinger polymerization conformation(s). Four chimeric Genbank transcripts (three from human mitochondrion and one murine cytosolic) are described here: (a) the 5' and 3' extremities reflect regular polymerization, the intervening sequence exchanges systematically between ribonucleotides (swinger rule G ↔ U, transcript (1), with sharp switches between regular and swinger sequences; (b) the 5' half is 'normal', the 3' half systematically exchanges ribonucleotides (swinger rule C ↔ G, transcript (2), with an intercalated sequence lacking homology; (c) the 3' extremity fits A ↔ G exchanges (10% of transcript length), the 5' half follows regular transcription; the intervening region seems a mix of regular and A ↔ G transcriptions (transcript 3); (d) murine cytosolic transcript 4 switches to A ↔ U + C ↔ G, and is fused with A ↔ U + C ↔ G swinger transformed precursor rRNA. In (c), each concomitant transcript 5' and 3' extremities match opposite genome strands. Transcripts 3 and 4 combine transcript fusions with partial swinger transcriptions. Occasional (usually sharp) switches between regular and swinger transcriptions reveal greater coding potential than detected until now, suggest stable polymerase swinger conformations. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

Discovering and understanding oncogenic gene fusions through data intensive computational approaches

PubMed Central

Latysheva, Natasha S.; Babu, M. Madan

2016-01-01

Abstract Although gene fusions have been recognized as important drivers of cancer for decades, our understanding of the prevalence and function of gene fusions has been revolutionized by the rise of next-generation sequencing, advances in bioinformatics theory and an increasing capacity for large-scale computational biology. The computational work on gene fusions has been vastly diverse, and the present state of the literature is fragmented. It will be fruitful to merge three camps of gene fusion bioinformatics that appear to rarely cross over: (i) data-intensive computational work characterizing the molecular biology of gene fusions; (ii) development research on fusion detection tools, candidate fusion prioritization algorithms and dedicated fusion databases and (iii) clinical research that seeks to either therapeutically target fusion transcripts and proteins or leverages advances in detection tools to perform large-scale surveys of gene fusion landscapes in specific cancer types. In this review, we unify these different—yet highly complementary and symbiotic—approaches with the view that increased synergy will catalyze advancements in gene fusion identification, characterization and significance evaluation. PMID:27105842

TMPRSS2-ERG gene fusion in small cell carcinoma of the prostate.

PubMed

Guo, Charles C; Dancer, Jane Y; Wang, Yan; Aparicio, Ana; Navone, Nora M; Troncoso, Patricia; Czerniak, Bogdan A

2011-01-01

Recent studies have shown that most prostate cancers carry the TMPRSS2-ERG gene fusion. Here we evaluated the TMPRSS2-ERG gene fusion in small cell carcinoma of the prostate (n = 12) in comparison with small cell carcinoma of the urinary bladder (n = 12) and lung (n = 11). Fluorescence in situ hybridization demonstrated rearrangement of the ERG gene in 8 cases of prostatic small cell carcinoma (67%), and the rearrangement was associated with deletion of the 5' ERG gene in 7 cases, but rearrangement of the ERG gene was not present in any small cell carcinoma of the urinary bladder or lung. Next we evaluated the TMPRSS2-ERG gene fusion in nude mouse xenografts that were derived from 2 prostatic small cell carcinomas carrying the TMPRSS2-ERG gene fusion. Two transcripts encoded by the TMPRSS2-ERG gene fusion were detected by reverse transcriptase polymerase chain reaction, and DNA sequencing demonstrated that the 2 transcripts were composed of fusions of exon 1 of the TMPRSS2 gene to exon 4 or 5 of the ERG gene. Our study demonstrates the specific presence of TMPRSS2-ERG gene fusion in prostatic small cell carcinoma, which may be helpful in distinguishing small cell carcinoma of prostatic origin from nonprostatic origins. The high prevalence of the TMPRSS2-ERG gene fusion in prostatic small cell carcinoma as well as adenocarcinoma implies that small cell carcinoma may share a common pathogenic pathway with adenocarcinoma in the prostate. Copyright © 2011 Elsevier Inc. All rights reserved.

POZ domain transcription factor, FBI-1, represses transcription of ADH5/FDH by interacting with the zinc finger and interfering with DNA binding activity of Sp1.

PubMed

Lee, Dong-Kee; Suh, Dongchul; Edenberg, Howard J; Hur, Man-Wook

2002-07-26

The POZ domain is a protein-protein interaction motif that is found in many transcription factors, which are important for development, oncogenesis, apoptosis, and transcription repression. We cloned the POZ domain transcription factor, FBI-1, that recognizes the cis-element (bp -38 to -22) located just upstream of the core Sp1 binding sites (bp -22 to +22) of the ADH5/FDH minimal promoter (bp -38 to +61) in vitro and in vivo, as revealed by electrophoretic mobility shift assay and chromatin immunoprecipitation assay. The ADH5/FDH minimal promoter is potently repressed by the FBI-1. Glutathione S-transferase fusion protein pull-down showed that the POZ domains of FBI-1, Plzf, and Bcl-6 directly interact with the zinc finger DNA binding domain of Sp1. DNase I footprinting assays showed that the interaction prevents binding of Sp1 to the GC boxes of the ADH5/FDH promoter. Gal4-POZ domain fusions targeted proximal to the GC boxes repress transcription of the Gal4 upstream activator sequence-Sp1-adenovirus major late promoter. Our data suggest that POZ domain represses transcription by interacting with Sp1 zinc fingers and by interfering with the DNA binding activity of Sp1.

Control of transcription of the Bacillus subtilis spoIIIG gene, which codes for the forespore-specific transcription factor sigma G.

PubMed

Sun, D X; Cabrera-Martinez, R M; Setlow, P

1991-05-01

The Bacillus subtilis spoIIIG gene codes for a sigma factor termed sigma G which directs transcription of genes expressed only in the forespore compartment of the sporulating cell. Use of spoIIIG-lacZ transcriptional fusions showed that spoIIIG is cotranscribed with the spoIIG operon beginning at t0.5-1 of sporulation. However, this large mRNA produced little if any sigma G, and transferring the spoIIIG gene without the spoIIG promoter into the amyE locus resulted in a Spo+ phenotype. Significant translation of spoIIIG began at t2.5-3 with use of an mRNA whose 5' end is just upstream of the spoIIIG coding sequence. Synthesis of this spoIIIG-specific mRNA was not abolished by a deletion in spoIIIG itself. Similar results were obtained when a spoIIIG-lacZ translational fusion lacking the spoIIG promoter was integrated at the amyE locus. These data suggest that synthesis of sigma G is dependent neither on transcription from the spoIIG promoter nor on sigma G itself but can be due to another transcription factor. This transcription factor may be sigma F, the product of the spoIIAC locus, since a spoIIAC mutation blocked spoIIIG expression, and sequences upstream of the 5' end of the spoIIIG-specific mRNA agree well with the recognition sequence for sigma F. RNA polymerase containing sigma F (E sigma F) initiated transcription in vitro on a spoIIIG template at the 5' end found in vivo, as did E sigma G. However, E sigma F showed a greater than 20-fold preference for spoIIIG over a known sigma G-dependent gene compared with the activity of E sigma G.

Activation of both acfA and acfD transcription by Vibrio cholerae ToxT requires binding to two centrally located DNA sites in an inverted repeat conformation.

PubMed

Withey, Jeffrey H; DiRita, Victor J

2005-05-01

The Gram-negative bacterium Vibrio cholerae is the infectious agent responsible for the disease Asiatic cholera. The genes required for V. cholerae virulence, such as those encoding the cholera toxin (CT) and toxin-coregulated pilus (TCP), are controlled by a cascade of transcriptional activators. Ultimately, the direct transcriptional activator of the majority of V. cholerae virulence genes is the AraC/XylS family member ToxT protein, the expression of which is activated by the ToxR and TcpP proteins. Previous studies have identified the DNA sites to which ToxT binds upstream of the ctx operon, encoding CT, and the tcpA operon, encoding, among other products, the major subunit of the TCP. These known ToxT binding sites are seemingly dissimilar in sequence other than being A/T rich. Further results suggested that ctx and tcpA each has a pair of ToxT binding sites arranged in a direct repeat orientation upstream of the core promoter elements. In this work, using both transcriptional lacZ fusions and in vitro copper-phenanthroline footprinting experiments, we have identified the ToxT binding sites between the divergently transcribed acfA and acfD genes, which encode components of the accessory colonization factor required for efficient intestinal colonization by V. cholerae. Our results indicate that ToxT binds to a pair of DNA sites between acfA and acfD in an inverted repeat orientation. Moreover, a mutational analysis of the ToxT binding sites indicates that both binding sites are required by ToxT for transcriptional activation of both acfA and acfD. Using copper-phenanthroline footprinting to assess the occupancy of ToxT on DNA having mutations in one of these binding sites, we found that protection by ToxT of the unaltered binding site was not affected, whereas protection by ToxT of the mutant binding site was significantly reduced in the region of the mutations. The results of further footprinting experiments using DNA templates having +5 bp and +10 bp

Expression of Leukemia-Associated Nup98 Fusion Proteins Generates an Aberrant Nuclear Envelope Phenotype.

PubMed

Fahrenkrog, Birthe; Martinelli, Valérie; Nilles, Nadine; Fruhmann, Gernot; Chatel, Guillaume; Juge, Sabine; Sauder, Ursula; Di Giacomo, Danika; Mecucci, Cristina; Schwaller, Jürg

2016-01-01

Chromosomal translocations involving the nucleoporin NUP98 have been described in several hematopoietic malignancies, in particular acute myeloid leukemia (AML). In the resulting chimeric proteins, Nup98's N-terminal region is fused to the C-terminal region of about 30 different partners, including homeodomain (HD) transcription factors. While transcriptional targets of distinct Nup98 chimeras related to immortalization are relatively well described, little is known about other potential cellular effects of these fusion proteins. By comparing the sub-nuclear localization of a large number of Nup98 fusions with HD and non-HD partners throughout the cell cycle we found that while all Nup98 chimeras were nuclear during interphase, only Nup98-HD fusion proteins exhibited a characteristic speckled appearance. During mitosis, only Nup98-HD fusions were concentrated on chromosomes. Despite the difference in localization, all tested Nup98 chimera provoked morphological alterations in the nuclear envelope (NE), in particular affecting the nuclear lamina and the lamina-associated polypeptide 2α (LAP2α). Importantly, such aberrations were not only observed in transiently transfected HeLa cells but also in mouse bone marrow cells immortalized by Nup98 fusions and in cells derived from leukemia patients harboring Nup98 fusions. Our findings unravel Nup98 fusion-associated NE alterations that may contribute to leukemogenesis.

Expression of Leukemia-Associated Nup98 Fusion Proteins Generates an Aberrant Nuclear Envelope Phenotype

PubMed Central

Fahrenkrog, Birthe; Martinelli, Valérie; Nilles, Nadine; Fruhmann, Gernot; Chatel, Guillaume; Juge, Sabine; Sauder, Ursula; Di Giacomo, Danika; Mecucci, Cristina; Schwaller, Jürg

2016-01-01

Chromosomal translocations involving the nucleoporin NUP98 have been described in several hematopoietic malignancies, in particular acute myeloid leukemia (AML). In the resulting chimeric proteins, Nup98's N-terminal region is fused to the C-terminal region of about 30 different partners, including homeodomain (HD) transcription factors. While transcriptional targets of distinct Nup98 chimeras related to immortalization are relatively well described, little is known about other potential cellular effects of these fusion proteins. By comparing the sub-nuclear localization of a large number of Nup98 fusions with HD and non-HD partners throughout the cell cycle we found that while all Nup98 chimeras were nuclear during interphase, only Nup98-HD fusion proteins exhibited a characteristic speckled appearance. During mitosis, only Nup98-HD fusions were concentrated on chromosomes. Despite the difference in localization, all tested Nup98 chimera provoked morphological alterations in the nuclear envelope (NE), in particular affecting the nuclear lamina and the lamina-associated polypeptide 2α (LAP2α). Importantly, such aberrations were not only observed in transiently transfected HeLa cells but also in mouse bone marrow cells immortalized by Nup98 fusions and in cells derived from leukemia patients harboring Nup98 fusions. Our findings unravel Nup98 fusion-associated NE alterations that may contribute to leukemogenesis. PMID:27031510

Detection of PAX3-FKHR and PAX7-FKHR fusion transcripts in rhabdomyosarcoma by reverse transcriptase-polymerase chain reaction using paraffin-embedded tissue.

PubMed

Chen, B F; Chen, M L; Liang, D C; Huang, Y W; Liu, H C; Chen, S H

1999-02-01

Alveolar rhabdomyosarcoma (RMS) is associated with a characteristic chromosomal translocation t(2;13)(q35;q14). The genes involved in this translocation are paired box (PAX)3 on chromosome 2 and forkhead in RMS (FKHR) on chromosome 13. An occasional variant translocation t(1;13)(p36;q14) affecting PAX7 and FKHR on chromosomes 1 and 13, respectively, has also been described. Chromosomal translocations in RMS are detected using conventional cytogenetic analysis, fluorescence in situ hybridization (FISH) or reverse transcriptase-polymerase chain reaction (RT-PCR) on fresh or frozen tissue samples. We describe the results of RT-PCR analysis of PAX3-FKHR and PAX7-FKHR chimeric messages in formalin-fixed, paraffin-embedded tissue samples from 17 RMS cases. RNA was extracted from formalin-fixed, paraffin-embedded RMS tissue. Oligonucleotide primers corresponding to the regions of PAX3, PAX7 and FKHR were used for the detection of PAX3-FKHR and PAX7-FKHR chimeric messages. A seminested PCR of the PCR products was used to increase the sensitivity of detection. The amplified fragments were purified and directly sequenced to confirm the specificity of the methods. The PAX3-FKHR chimeric message was detected in all three cases of alveolar RMS but not in any of the 12 embryonal and two pleomorphic RMS cases. The PAX7-FKHR fusion transcript was detected in one case of embryonal RMS. The results indicate that the RT-PCR assay is a reliable method for the detection of the PAX3-FKHR fusion transcript of alveolar RMS in formalin-fixed, paraffin-embedded tissue. This simple method enables pathologists to identify chromosomal rearrangements in RMS as a diagnostic aid in cases where fresh or frozen tissue is not available.

Prostate Cancer Evaluation: Design, Synthesis, and Evaluation of Novel Enzyme-Activated Proton MRI Contrast Agents

DTIC Science & Technology

2006-10-01

colored plates: ALL DTIC reproductions will be in black and white. 14. ABSTRACT The lacZ gene encoding E . coli beta-gal has already been...transcriptional activation, protein expression, and protein interaction, lacZ gene encoding E . coli β-gal has already been recognized as the most commonly...Cancer Facts and Figures, 2004. (www.cancer.org). 2. Jemal A, Thomas A, Murray T, Thun M, 2002 Cancer statistics, 2002, CA Cancer J. Clin., 52, 23-47

HIP1-ALK, a novel fusion protein identified in lung adenocarcinoma.

PubMed

Hong, Mineui; Kim, Ryong Nam; Song, Ji-Young; Choi, So-Jung; Oh, Ensel; Lira, Maruja E; Mao, Mao; Takeuchi, Kengo; Han, Joungho; Kim, Jhingook; Choi, Yoon-La

2014-03-01

The most common mechanism underlying overexpression and activation of anaplastic lymphoma kinase (ALK) in non-small-cell lung carcinoma could be attributed to the formation of a fusion protein. To date, five fusion partners of ALK have been reported, namely, echinoderm microtubule associated protein like 4, tropomyosin-related kinase-fused gene, kinesin family member 5B, kinesin light chain 1, and protein tyrosine phosphatase, nonreceptor type 3. In this article, we report a novel fusion gene huntingtin interacting protein 1 (HIP1)-ALK, which is conjoined between the huntingtin-interacting protein 1 gene HIP1 and ALK. Reverse-transcriptase polymerase chain reaction and immunohistochemical analysis were used to detect this fusion gene's transcript and protein expression, respectively. We had amplified the full-length cDNA sequence of this novel fusion gene by using 5'-rapid amplification of cDNA ends. The causative genomic translocation t(2;7)(p23;q11.23) for generating this novel fusion gene was verified by using genomic sequencing. The examined adenocarcinoma showed predominant acinar pattern, and ALK immunostaining was localized to the cytoplasm, with intense staining in the submembrane region. In break-apart, fluorescence in situ hybridization analysis for ALK, split of the 5' and 3' probe signals, and isolated 3' signals were observed. Reverse-transcriptase polymerase chain reaction revealed that the tumor harbored a novel fusion transcript in which exon 21 of HIP1 was fused to exon 20 of ALK in-frame. The novel fusion gene and its protein HIP1-ALK harboring epsin N-terminal homology, coiled-coil, juxtamembrane, and kinase domains, which could play a role in carcinogenesis, could become diagnostic and therapeutic target of the lung adenocarcinoma and deserve a further study in the future.

Transcriptional regulation of Drosophila gonad formation.

PubMed

Tripathy, Ratna; Kunwar, Prabhat S; Sano, Hiroko; Renault, Andrew D

2014-08-15

The formation of the Drosophila embryonic gonad, involving the fusion of clusters of somatic gonadal precursor cells (SGPs) and their ensheathment of germ cells, provides a simple and genetically tractable model for the interplay between cells during organ formation. In a screen for mutants affecting gonad formation we identified a SGP cell autonomous role for Midline (Mid) and Longitudinals lacking (Lola). These transcriptional factors are required for multiple aspects of SGP behaviour including SGP cluster fusion, germ cell ensheathment and gonad compaction. The lola locus encodes more than 25 differentially spliced isoforms and we have identified an isoform specific requirement for lola in the gonad which is distinct from that in nervous system development. Mid and Lola work in parallel in gonad formation and surprisingly Mid overexpression in a lola background leads to additional SGPs at the expense of fat body cells. Our findings support the idea that although the transcription factors required by SGPs can ostensibly be assigned to those being required for either SGP specification or behaviour, they can also interact to impinge on both processes. Copyright © 2014 Elsevier Inc. All rights reserved.

A rapid and efficient newly established method to detect COL1A1-PDGFB gene fusion in dermatofibrosarcoma protuberans

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yokoyama, Yoko; Shimizu, Akira; Okada, Etsuko

Highlights: Black-Right-Pointing-Pointer We developed new method to rapidly identify COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer New PCR method using a single primer pair detected COL1A1-PDGFB fusion in DFSP. Black-Right-Pointing-Pointer This is the first report of DFSP with a novel COL1A1 breakpoint in exon 5. -- Abstract: The detection of fusion transcripts of the collagen type 1{alpha}1 (COL1A1) and platelet-derived growth factor-BB (PDGFB) genes by genetic analysis has recognized as a reliable and valuable molecular tool for the diagnosis of dermatofibrosarcoma protuberans (DFSP). To detect the COL1A1-PDGFB fusion, almost previous reports performed reverse transcription polymerase chain reaction (RT-PCR) using multiplex forward primersmore » from COL1A1. However, it has possible technical difficulties with respect to the handling of multiple primers and reagents in the procedure. The objective of this study is to establish a rapid, easy, and efficient one-step method of PCR using only a single primer pair to detect the fusion transcripts of the COL1A1 and PDGFB in DFSP. To validate new method, we compared the results of RT-PCR in five patients of DFSP between the previous method using multiplex primers and our established one-step RT-PCR using a single primer pair. In all cases of DFSP, the COL1A1-PDGFB fusion was detected by both previous method and newly established one-step PCR. Importantly, we detected a novel COL1A1 breakpoint in exon 5. The newly developed method is valuable to rapidly identify COL1A1-PDGFB fusion transcripts in DFSP.« less

Adenylyl cyclase A expression is tip-specific in Dictyostelium slugs and directs StatA nuclear translocation and CudA gene expression.

PubMed

Verkerke-van Wijk, I; Fukuzawa, M; Devreotes, P N; Schaap, P

2001-06-01

cAMP oscillations, generated by adenylyl cyclase A (ACA), coordinate cell aggregation in Dictyostelium and have also been implicated in organizer function during multicellular development. We used a gene fusion of the ACA promoter with a labile lacZ derivative to study the expression pattern of ACA. During aggregation, most cells expressed ACA, but thereafter expression was lost in all cells except those of the anterior tip. Before aggregation, ACA transcription was strongly upregulated by nanomolar cAMP pulses. Postaggregative transcription was sustained by nanomolar cAMP pulses, but downregulated by a continuous micromolar cAMP stimulus and by the stalk-cell-inducing factor DIF. Earlier work showed that the transcription factor StatA displays tip-specific nuclear translocation and directs tip-specific expression of the nuclear protein CudA, which is essential for culmination. Both StatA and CudA were present in nuclei throughout the entire slug in an aca null mutant that expresses ACA from the constitutive actin15 promoter. This suggests that the tip-specific expression of ACA directs tip-specific nuclear translocation of StatA and tip-specific expression of CudA. Copyright 2001 Academic Press.

BRAF Fusion Analysis in Pilocytic Astrocytomas: KIAA1549-BRAF 15-9 Fusions Are More Frequent in the Midline Than Within the Cerebellum

PubMed Central

Faulkner, Claire; Ellis, Hayley Patricia; Shaw, Abigail; Penman, Catherine; Palmer, Abigail; Wragg, Christopher; Greenslade, Mark; Haynes, Harry Russell; Williams, Hannah; Lowis, Stephen; White, Paul; Williams, Maggie; Capper, David; Kurian, Kathreena Mary

2015-01-01

Abstract Pilocytic astrocytomas (PAs) are increasingly tested for KIAA1549-BRAF fusions. We used reverse transcription polymerase chain reaction for the 3 most common KIAA1549-BRAF fusions, together with BRAF V600E and histone H3.3 K27M analyses to identify relationships of these molecular characteristics with clinical features in a cohort of 32 PA patients. In this group, the overall BRAF fusion detection rate was 24 (75%). Ten (42%) of the 24 had the 16-9 fusion, 8 (33%) had only the 15-9 fusion, and 1 (4%) of the patients had only the 16-11 fusion. In the PAs with only the 15-9 fusion, 1 PA was in the cerebellum and 7 were centered in the midline outside of the cerebellum, that is, in the hypothalamus (n = 4), optic pathways (n = 2), and brainstem (n = 1). Tumors within the cerebellum were negatively associated with fusion 15-9. Seven (22%) of the 32 patients had tumor-related deaths and 25 of the patients (78%) were alive between 2 and 14 years after initial biopsy. Age, sex, tumor location, 16-9 fusion, and 15-9 fusion were not associated with overall survival. Thus, in this small cohort, 15-9 KIAA1549-BRAF fusion was associated with midline PAs located outside of the cerebellum; these tumors, which are generally difficult to resect, are prone to recurrence. PMID:26222501

Hox cluster polarity in early transcriptional availability: a high order regulatory level of clustered Hox genes in the mouse.

PubMed

Roelen, Bernard A J; de Graaff, Wim; Forlani, Sylvie; Deschamps, Jacqueline

2002-11-01

The molecular mechanism underlying the 3' to 5' polarity of induction of mouse Hox genes is still elusive. While relief from a cluster-encompassing repression was shown to lead to all Hoxd genes being expressed like the 3'most of them, Hoxd1 (Kondo and Duboule, 1999), the molecular basis of initial activation of this 3'most gene, is not understood yet. We show that, already before primitive streak formation, prior to initial expression of the first Hox gene, a dramatic transcriptional stimulation of the 3'most genes, Hoxb1 and Hoxb2, is observed upon a short pulse of exogenous retinoic acid (RA), whereas it is not in the case for more 5', cluster-internal, RA-responsive Hoxb genes. In contrast, the RA-responding Hoxb1lacZ transgene that faithfully mimics the endogenous gene (Marshall et al., 1994) did not exhibit the sensitivity of Hoxb1 to precocious activation. We conclude that polarity in initial activation of Hoxb genes reflects a greater availability of 3'Hox genes for transcription, suggesting a pre-existing (susceptibility to) opening of the chromatin structure at the 3' extremity of the cluster. We discuss the data in the context of prevailing models involving differential chromatin opening in the directionality of clustered Hox gene transcription, and regarding the importance of the cluster context for correct timing of initial Hox gene expression.Interestingly, Cdx1 manifested the same early transcriptional availability as Hoxb1. Copyright 2002 Elsevier Science Ireland Ltd.

Fusion gene addiction: can tumours be forced to give up the habit?

PubMed

Selfe, Joanna L; Shipley, Janet

2017-07-01

Fusion of genes in tumours can have oncogenic roles in reprogramming cells through overexpression of oncogenes or the production of novel fusion proteins. A fundamental question in cancer biology is what genetic events are critical for initiation and whether these are also required for cancer progression. In recent work published in The Journal of Pathology, dependency on a fusion protein was addressed using a model of alveolar rhabdomyosarcomas - a sarcoma subtype with frequent fusion of PAX3 and FOXO1 genes that is associated with poor outcome. PAX3-FOXO1 encodes a potent transcription factor that together with MYCN alters the transcriptional landscape of cells. Building on previous work, an inducible model in human myoblast cells was used to show that PAX3-FOXO1 and MYCN can initiate rhabdomyosarcoma development but, contrary to current thinking, tumour recurrences occasionally arose independent of the fusion protein. Further work needs to identify the molecular nature of this independence and assess any relevance in human tumours. Such functional approaches are required together with computational modeling of molecular data to unravel spatial and temporal dependencies on specific genetic events. This may support molecular prognostic markers and therapeutic targets. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Complex transcriptional and post-transcriptional regulation of an enzyme for Lipopolysaccharide modification

PubMed Central

Moon, Kyung; Six, David A.; Lee, Hyun-Jung; Raetz, Christian R.H.; Gottesman, Susan

2013-01-01

Summary The PhoQ/PhoP two-component system activates many genes for lipopolysaccharide (LPS) modification when cells are grown at low Mg2+ concentrations. An additional target of PhoQ and PhoP is MgrR, an Hfq-dependent small RNA that negatively regulates expression of eptB, also encoding a protein that carries out LPS modification. Examination of LPS confirmed that MgrR effectively silences EptB; the phosphoethanolamine modification associated with EptB is found in ΔmgrR::kan but not mgrR+ cells. Sigma E has been reported to positively regulate eptB, although the eptB promoter does not have the expected Sigma E recognition motifs. The effects of Sigma E and deletion of mgrR on levels of eptB mRNA were independent, and the same 5′ end was found in both cases. In vitro transcription and the behavior of transcriptional and translational fusions demonstrate that Sigma E acts directly at the level of transcription initiation for eptB, from the same start point as Sigma 70. The results suggest that when Sigma E is active, synthesis of eptB transcript outstrips MgrR-dependent degradation; presumably the modification of LPS is important under these conditions. Adding to the complexity of eptB regulation is a second sRNA, ArcZ, which also directly and negatively regulates eptB. PMID:23659637

A pharmacological study of Arabidopsis cell fusion between the persistent synergid and endosperm.

PubMed

Motomura, Kazuki; Kawashima, Tomokazu; Berger, Frédéric; Kinoshita, Tetsu; Higashiyama, Tetsuya; Maruyama, Daisuke

2018-01-29

Cell fusion is a pivotal process in fertilization and multinucleate cell formation. A plant cell is ubiquitously surrounded by a hard cell wall, and very few cell fusions have been observed except for gamete fusions. We recently reported that the fertilized central cell (the endosperm) absorbs the persistent synergid, a highly differentiated cell necessary for pollen tube attraction. The synergid-endosperm fusion (SE fusion) appears to eliminate the persistent synergid from fertilized ovule in Arabidopsis thaliana Here, we analyzed the effects of various inhibitors on SE fusion in an in vitro culture system. Different from other cell fusions, neither disruption of actin polymerization nor protein secretion impaired SE fusion. However, transcriptional and translational inhibitors decreased the SE fusion success rate and also inhibited endosperm division. Failures of SE fusion and endosperm nuclear proliferation were also induced by roscovitine, an inhibitor of cyclin-dependent kinases (CDK). These data indicate unique aspects of SE fusion such as independence of filamentous actin support and the importance of CDK-mediated mitotic control. © 2018. Published by The Company of Biologists Ltd.

Transcriptional and functional studies of Human Endogenous Retrovirus envelope EnvP(b) and EnvV genes in human trophoblasts

DOE Office of Scientific and Technical Information (OSTI.GOV)

Vargas, Amandine, E-mail: amandine.vargas@voila.fr; Thiery, Maxime, E-mail: thiery.maxime@courrier.uqam.ca; Lafond, Julie, E-mail: lafond.julie@uqam.ca

2012-03-30

HERV (Human Endogenous Retrovirus)-encoded envelope proteins are implicated in the development of the placenta. Indeed, Syncytin-1 and -2 play a crucial role in the fusion of human trophoblasts, a key step in placentation. Other studies have identified two other HERV env proteins, namely EnvP(b) and EnvV, both expressed in the placenta. In this study, we have fully characterized both env transcripts and their expression pattern and have assessed their implication in trophoblast fusion. Through RACE analyses, standard spliced transcripts were detected, while EnvV transcripts demonstrated alternative splicing at its 3 Prime end. Promoter activity and expression of both genes weremore » induced in forskolin-stimulated BeWo cells and in primary trophoblasts. Although we have confirmed the fusogenic activity of EnvP(b), overexpression or silencing experiments revealed no impact of this protein on trophoblast fusion. Our results demonstrate that both env genes are expressed in human trophoblasts but are not required for syncytialization.« less

Temperature sensing in Yersinia pestis: regulation of yopE transcription by lcrF.

PubMed Central

Hoe, N P; Minion, F C; Goguen, J D

1992-01-01

In Escherichia coli, a yopE::lacZ fusion was found to be regulated by temperature in the presence of the cloned BamHI G fragment of Yersinia pestis plasmid pCD1, which contains the lcrF locus. Increasing the copy number of lcrF relative to that of the yopE reporter had a negligible effect on the induction ratio (26 versus 37 degrees C) but caused large reductions in the absolute levels of yopE transcription. We localized the lcrF gene by monitoring the induction phenotype of BamHI G deletion derivatives. Sequencing revealed an open reading frame capable of encoding a protein of 30.8 kDa. A protein product of this size was detected in a T7 expression system, and LcrF-dependent yopE-specific DNA binding activity was observed. As expected, LcrF exhibited 98% homology to VirF of Yersinia enterocolitica and significant homology to the carboxy termini of other members of the AraC family of transcriptional regulatory proteins. These proteins could be divided into two classes according to function: those regulating operons involved in catabolism of carbon and energy sources and those involved in regulating virulence genes. lcrF::lacZ transcriptional fusions were constructed and analyzed in Y. pestis and E. coli. The activity of the fusions was not affected by the native pCD1 virulence plasmid, an intact lcrF gene, or temperature. Thus, induction of lcrF transcription is not essential for temperature-dependent activation of yopE transcription. A portion of LcrF was found associated with the membrane fraction in E. coli; however, pulse-chase experiments indicated that this result is an artifact of fractionation. Images PMID:1624422

Multiple environmental factors regulate the expression of the carbohydrate-selective OprB porin of Pseudomonas aeruginosa.

PubMed

Adewoye, L O; Worobec, E A

1999-12-01

In response to low extracellular glucose concentration, Pseudomonas aeruginosa induces the expression of the outer membrane carbohydrate-selective OprB porin. The promoter region of the oprB gene was cloned into a lacZ transcriptional fusion vector, and the construct was mobilized into P. aeruginosa OprB-deficient strain, WW100, to evaluate additional environmental factors that influence OprB porin gene expression. Growth temperature, pH of the growth medium, salicylate concentration, and carbohydrate source were found to differentially influence porin expression. This expression pattern was compared to those of whole-cell [14C]glucose uptake under conditions of high osmolarity, ionicity, variable pH, growth temperatures, and carbohydrate source. These studies revealed that the high-affinity glucose transport genes are down-regulated by salicylic acid, differentially regulated by pH and temperature, and are specifically responsive to exogenous glucose induction.

A serum response factor-dependent transcriptional regulatory program identifies distinct smooth muscle cell sublineages.

PubMed Central

Kim, S; Ip, H S; Lu, M M; Clendenin, C; Parmacek, M S

1997-01-01

The SM22alpha promoter has been used as a model system to define the molecular mechanisms that regulate smooth muscle cell (SMC) specific gene expression during mammalian development. The SM22alpha gene is expressed exclusively in vascular and visceral SMCs during postnatal development and is transiently expressed in the heart and somites during embryogenesis. Analysis of the SM22alpha promoter in transgenic mice revealed that 280 bp of 5' flanking sequence is sufficient to restrict expression of the lacZ reporter gene to arterial SMCs and the myotomal component of the somites. DNase I footprint and electrophoretic mobility shift analyses revealed that the SM22alpha promoter contains six nuclear protein binding sites (designated smooth muscle elements [SMEs] -1 to -6, respectively), two of which bind serum response factor (SRF) (SME-1 and SME-4). Mutational analyses demonstrated that a two-nucleotide substitution that selectively eliminates SRF binding to SME-4 decreases SM22alpha promoter activity in arterial SMCs by approximately 90%. Moreover, mutations that abolish binding of SRF to SME-1 and SME-4 or mutations that eliminate each SME-3 binding activity totally abolished SM22alpha promoter activity in the arterial SMCs and somites of transgenic mice. Finally, we have shown that a multimerized copy of SME-4 (bp -190 to -110) when linked to the minimal SM22alpha promoter (bp -90 to +41) is necessary and sufficient to direct high-level transcription in an SMC lineage-restricted fashion. Taken together, these data demonstrate that distinct transcriptional regulatory programs control SM22alpha gene expression in arterial versus visceral SMCs. Moreover, these data are consistent with a model in which combinatorial interactions between SRF and other transcription factors that bind to SME-4 (and that bind directly to SRF) activate transcription of the SM22alpha gene in arterial SMCs. PMID:9121477

The novel fusion transcript NR5A2-KLHL29FT is generated by an insertion at the KLHL29 locus.

PubMed

Sun, Zhenguo; Ke, Xiquan; Salzberg, Steven L; Kim, Daehwan; Antonescu, Valentin; Cheng, Yulan; Huang, Binbin; Song, Jee Hoon; Abraham, John M; Ibrahim, Sariat; Tian, Hui; Meltzer, Stephen J

2017-05-01

Novel fusion transcripts (FTs) caused by chromosomal rearrangement are common factors in the development of cancers. In the current study, the authors used massively parallel RNA sequencing to identify new FTs in colon cancers. RNA sequencing (RNA-Seq) and TopHat-Fusion were used to identify new FTs in colon cancers. The authors then investigated whether the novel FT nuclear receptor subfamily 5, group A, member 2 (NR5A2)-Kelch-like family member 29 FT (KLHL29FT) was transcribed from a genomic chromosomal rearrangement. Next, the expression of NR5A2-KLHL29FT was measured by quantitative real-time polymerase chain reaction in colon cancers and matched corresponding normal epithelia. The authors identified the FT NR5A2-KLHL29FT in normal and cancerous epithelia. While investigating this transcript, it was unexpectedly found that it was due to an uncharacterized polymorphic germline insertion of the NR5A2 sequence from chromosome 1 into the KLHL29 locus at chromosome 2, rather than a chromosomal rearrangement. This germline insertion, which occurred at a population frequency of 0.40, appeared to bear no relationship to cancer development. Moreover, expression of NR5A2-KLHL29FT was validated in RNA specimens from samples with insertions of NR5A2 at the KLHL29 gene locus, but not from samples without this insertion. It is interesting to note that NR5A2-KLH29FT expression levels were significantly lower in colon cancers than in matched normal colonic epithelia (P =.029), suggesting the potential participation of NR5A2-KLHL29FT in the origin or progression of this tumor type. NR5A2-KLHL29FT was generated from a polymorphism insertion of the NR5A2 sequence into the KLHL29 locus. NR5A2-KLHL29FT may influence the origin or progression of colon cancer. Moreover, researchers should be aware that similar FTs may occur due to transchromosomal insertions that are not correctly annotated in genome databases, especially with current assembly algorithms. Cancer 2017;123:1507-1515. �

A small-molecule inhibitor of the aberrant transcription factor CBFβ-SMMHC delays leukemia in mice

PubMed Central

Illendula, Anuradha; Pulikkan, John A.; Zong, Hongliang; Grembecka, Jolanta; Xue, Liting; Sen, Siddhartha; Zhou, Yunpeng; Boulton, Adam; Kuntimaddi, Aravinda; Gao, Yan; Rajewski, Roger A.; Guzman, Monica L.; Castilla, Lucio H.; Bushweller, John H.

2015-01-01

Acute myeloid leukemia (AML) is the most common form of adult leukemia. The transcription factor fusion CBFβ-SMMHC (core binding factor β and the smooth-muscle myosin heavy chain), expressed in AML with the chromosome inversion inv(16)(p13q22), outcompetes wild-type CBFβ for binding to the transcription factor RUNX1, deregulates RUNX1 activity in hematopoiesis, and induces AML. Current inv(16) AML treatment with nonselective cytotoxic chemotherapy results in a good initial response but limited long-term survival. Here, we report the development of a protein-protein interaction inhibitor, AI-10-49, that selectively binds to CBFβ-SMMHC and disrupts its binding to RUNX1. AI-10-49 restores RUNX1 transcriptional activity, displays favorable pharmacokinetics, and delays leukemia progression in mice. Treatment of primary inv(16) AML patient blasts with AI-10-49 triggers selective cell death. These data suggest that direct inhibition of the oncogenic CBFβ-SMMHC fusion protein may be an effective therapeutic approach for inv(16) AML, and they provide support for transcription factor targeted therapy in other cancers. PMID:25678665

Transcription factor mutations in myelodysplastic/myeloproliferative neoplasms

PubMed Central

Ernst, Thomas; Chase, Andrew; Zoi, Katerina; Waghorn, Katherine; Hidalgo-Curtis, Claire; Score, Joannah; Jones, Amy; Grand, Francis; Reiter, Andreas; Hochhaus, Andreas; Cross, Nicholas C.P.

2010-01-01

Background Aberrant activation of tyrosine kinases, caused by either mutation or gene fusion, is of major importance for the development of many hematologic malignancies, particularly myeloproliferative neoplasms. We hypothesized that hitherto unrecognized, cytogenetically cryptic tyrosine kinase fusions may be common in non-classical or atypical myeloproliferative neoplasms and related myelodysplastic/myeloproliferative neoplasms. Design and Methods To detect genomic copy number changes associated with such fusions, we performed a systematic search in 68 patients using custom designed, targeted, high-resolution array comparative genomic hybridization. Arrays contained 44,000 oligonucleotide probes that targeted 500 genes including all 90 tyrosine kinases plus downstream tyrosine kinase signaling components, other translocation targets, transcription factors, and other factors known to be important for myelopoiesis. Results No abnormalities involving tyrosine kinases were detected; however, nine cytogenetically cryptic copy number imbalances were detected in seven patients, including hemizygous deletions of RUNX1 or CEBPA in two cases with atypical chronic myeloid leukemia. Mutation analysis of the remaining alleles revealed non-mutated RUNX1 and a frameshift insertion within CEBPA. A further mutation screen of 187 patients with myelodysplastic/myeloproliferative neoplasms identified RUNX1 mutations in 27 (14%) and CEBPA mutations in seven (4%) patients. Analysis of other transcription factors known to be frequently mutated in acute myeloid leukemia revealed NPM1 mutations in six (3%) and WT1 mutations in two (1%) patients with myelodysplastic/myeloproliferative neoplasms. Univariate analysis indicated that patients with mutations had a shorter overall survival (28 versus 44 months, P=0.019) compared with patients without mutations, with the prognosis for cases with CEBPA, NPM1 or WT1 mutations being particularly poor. Conclusions We conclude that mutations of

Msn2p/Msn4p act as a key transcriptional activator of yeast cytoplasmic thiol peroxidase II.

PubMed

Hong, Seung-Keun; Cha, Mee-Kyung; Choi, Yong-Soo; Kim, Won-Cheol; Kim, Il-Han

2002-04-05

We observed that the transcription of Saccharomyces cerevisiae cytoplasmic thiol peroxidase type II (cTPx II) (YDR453C) is regulated in response to various stresses (e.g. oxidative stress, carbon starvation, and heat-shock). It has been suggested that both transcription-activating proteins, Yap1p and Skn7p, regulate the transcription of cTPx II upon exposure to oxidative stress. However, a dramatic loss of transcriptional response to various stresses in yeast mutant strains lacking both Msn2p and Msn4p suggests that the transcription factors act as a principal transcriptional activator. In addition to two Yap1p response elements (YREs), TTACTAA and TTAGTAA, the presence of two stress response elements (STREs) (CCCCT) in the upstream sequence of cTPx II also suggests that Msn2p/Msn4p could control stress-induced expression of cTPx II. Analysis of the transcriptional activity of site-directed mutagenesis of the putative STREs (STRE1 and STRE2) and YREs (TRE1 and YRE2) in terms of the activity of a lacZ reporter gene under control of the cTPx II promoter indicates that STRE2 acts as a principal binding element essential for transactivation of the cTPx II promoter. The transcriptional activity of the cTPx II promoter was exponentially increased after postdiauxic growth. The transcriptional activity of the cTPx II promoter is greatly increased by rapamycin. Deletion of Tor1, Tor2, Ras1, and Ras2 resulted in a considerable induction when compared with their parent strains, suggesting that the transcription of cTPx II is under negative control of the Ras/cAMP and target of rapamycin signaling pathways. Taken together, these results suggest that cTPx II is a target of Msn2p/Msn4p transcription factors under negative control of the Ras-protein kinase A and target of rapamycin signaling pathways. Furthermore, the accumulation of cTPx II upon exposure to oxidative stress and during the postdiauxic shift suggests an important antioxidant role in stationary phase yeast cells.

Transcription Factors Expressed in Lateral Organ Boundaries: Identification of Downstream Targets

DOE Office of Scientific and Technical Information (OSTI.GOV)

Springer, Patricia S

2010-07-12

The processes of lateral organ initiation and patterning are central to the generation of mature plant form. Characterization of the molecular mechanisms underlying these processes is essential to our understanding of plant development. Communication between the shoot apical meristem and initiating organ primordia is important both for functioning of the meristem and for proper organ patterning, and very little is known about this process. In particular, the boundary between meristem and leaf is emerging as a critical region that is important for SAM maintenance and regulation of organogenesis. The goal of this project was to characterize three boundary-expressed genes thatmore » encode predicted transcription factors. Specifically, we have studied LATERAL ORGAN BOUNDARIES (LOB), LATERAL ORGAN FUSION1 (LOF1), and LATERAL ORGAN FUSION2 (LOF2). LOB encodes the founding member of the LOB-DOMAIN (LBD) plant-specific DNA binding transcription factor family and LOF1 and LOF2 encode paralogous MYB-domain transcription factors. We characterized the genetic relationship between these three genes and other boundary and meristem genes. We also used an ectopic inducible expression system to identify direct targets of LOB.« less

The Transcription Factor Atonal homolog 8 Regulates Gata4 and Friend of Gata-2 during Vertebrate Development

PubMed Central

Rawnsley, David R.; Xiao, Jiping; Lee, John S.; Liu, Xi; Mericko-Ishizuka, Patricia; Kumar, Vinayak; He, Jie; Basu, Arindam; Lu, MinMin; Lynn, Francis C.; Pack, Michael; Gasa, Rosa; Kahn, Mark L.

2013-01-01

GATA and Friend of GATA (FOG) form a transcriptional complex that plays a key role in cardiovascular development in both fish and mammals. In the present study we demonstrate that the basic helix-loop-helix transcription factor Atonal homolog 8 (Atoh8) is required for development of the heart in fish but not in mice. Genetic studies reveal that Atoh8 interacts specifically with Gata4 and Fog1 during development of the heart and swim bladder in the fish. Biochemical studies reveal that ATOH8, GATA4, and FOG2 associate in a single complex in vitro. In contrast to fish, ATOH8-deficient mice exhibit normal cardiac development and loss of ATOH8 does not alter cardiac development in Gata4+/− mice. This species difference in the role of ATOH8 is explained in part by LacZ and GFP reporter alleles that reveal restriction of Atoh8 expression to atrial but not ventricular myocardium in the mouse. Our findings identify ATOH8 as a novel regulator of GATA-FOG function that is required for cardiac development in the fish but not the mouse. Whether ATOH8 modulates GATA-FOG function at other sites or in more subtle ways in mammals is not yet known. PMID:23836893

CRTC1-MAML2 and CRTC3-MAML2 fusions were not detected in metaplastic Warthin tumor and metaplastic pleomorphic adenoma of salivary glands.

PubMed

Skálová, Alena; Vanecek, Tomas; Simpson, Roderick H W; Vazmitsel, Marina A; Majewska, Hanna; Mukensnabl, Petr; Hauer, Lukas; Andrle, Pavel; Hosticka, Lubor; Grossmann, Petr; Michal, Michal

2013-11-01

The recurrent translocations t(11;19) and t(11;15) resulting in CRTC1-MAML2 or CRTC3-MAML2 fusion oncogenes, respectively, are identified in a large proportion of mucoepidermoid carcinomas (MECs) of the salivary gland and have impact on prognosis. However, there are conflicting data on the specificity of this translocation, in particular, on its putative occurrence in Warthin tumor (WT) of the parotid gland as reported in few previous cases. It was speculated that extensive squamous metaplasia could explain the presence of t(11;19) translocation in a subset of WTs. We evaluated 76 salivary gland tumors, including 16 cases of metaplastic WT and 8 cases of pleomorphic adenoma (PA) with squamous and/or mucinous metaplasia, extensive enough morphologically to mimic MEC. Detection of CRTC1-MAML2 and CRTC3-MAML2 fusion transcripts and MAML2 gene break was performed using nested reverse transcription-polymerase chain reaction and fluorescence in situ hybridization (FISH), respectively. None of 16 analyzed metaplastic WTs showed positivity for fusion transcripts CRTC1-MAML2 or CRTC3-MAML2, and none showed rearrangement of the MAML2 gene by FISH. Similarly, we did not detect these transcripts or break of MAML2 gene in any case of PA with extensive squamous/mucinous metaplasia. For comparison, 40 cases of low-grade MEC were also evaluated. CRTC1-MAML2 and CRTC3-MAML2 fusion transcripts were detected in 17 and 5 cases, respectively. The FISH method using break-apart probe demonstrated the MAML2 gene rearrangement in 25 cases of low-grade MEC. In contrast to low-grade MEC, neither metaplastic WTs nor metaplastic PAs harbored translocations t(11;19) and anticipated t(11;15) resulting in CRTC1-MAML2 and CRTC3-MAML2 fusion transcripts, respectively, and/or MAML2 gene rearrangement.

Detection of SYT-SSX mutant transcripts in formalin-fixed paraffin-embedded sarcoma tissues using one-step reverse transcriptase real-time PCR.

PubMed

Norlelawati, A T; Mohd Danial, G; Nora, H; Nadia, O; Zatur Rawihah, K; Nor Zamzila, A; Naznin, M

2016-04-01

Synovial sarcoma (SS) is a rare cancer and accounts for 5-10% of adult soft tissue sarcomas. Making an accurate diagnosis is difficult due to the overlapping histological features of SS with other types of sarcomas and the non-specific immunohistochemistry profile findings. Molecular testing is thus considered necessary to confirm the diagnosis since more than 90% of SS cases carry the transcript of t(X;18)(p11.2;q11.2). The purpose of this study is to diagnose SS at molecular level by testing for t(X;18) fusion-transcript expression through One-step reverse transcriptase real-time Polymerase Chain Reaction (PCR). Formalin-fixed paraffin-embedded tissue blocks of 23 cases of soft tissue sarcomas, which included 5 and 8 cases reported as SS as the primary diagnosis and differential diagnosis respectively, were retrieved from the Department of Pathology, Tengku Ampuan Afzan Hospital, Kuantan, Pahang. RNA was purified from the tissue block sections and then subjected to One-step reverse transcriptase real-time PCR using sequence specific hydrolysis probes for simultaneous detection of either SYT-SSX1 or SYT-SSX2 fusion transcript. Of the 23 cases, 4 cases were found to be positive for SYT-SSX fusion transcript in which 2 were diagnosed as SS whereas in the 2 other cases, SS was the differential diagnosis. Three cases were excluded due to failure of both amplification assays SYT-SSX and control β-2-microglobulin. The remaining 16 cases were negative for the fusion transcript. This study has shown that the application of One-Step reverse transcriptase real time PCR for the detection SYT-SSX transcript is feasible as an aid in confirming the diagnosis of synovial sarcoma.

Functional Impact and Evolution of a Novel Human Polymorphic Inversion That Disrupts a Gene and Creates a Fusion Transcript

PubMed Central

Puig, Marta; Castellano, David; Pantano, Lorena; Giner-Delgado, Carla; Izquierdo, David; Gayà-Vidal, Magdalena; Lucas-Lledó, José Ignacio; Esko, Tõnu; Terao, Chikashi; Matsuda, Fumihiko; Cáceres, Mario

2015-01-01

Despite many years of study into inversions, very little is known about their functional consequences, especially in humans. A common hypothesis is that the selective value of inversions stems in part from their effects on nearby genes, although evidence of this in natural populations is almost nonexistent. Here we present a global analysis of a new 415-kb polymorphic inversion that is among the longest ones found in humans and is the first with clear position effects. This inversion is located in chromosome 19 and has been generated by non-homologous end joining between blocks of transposable elements with low identity. PCR genotyping in 541 individuals from eight different human populations allowed the detection of tag SNPs and inversion genotyping in multiple populations worldwide, showing that the inverted allele is mainly found in East Asia with an average frequency of 4.7%. Interestingly, one of the breakpoints disrupts the transcription factor gene ZNF257, causing a significant reduction in the total expression level of this gene in lymphoblastoid cell lines. RNA-Seq analysis of the effects of this expression change in standard homozygotes and inversion heterozygotes revealed distinct expression patterns that were validated by quantitative RT-PCR. Moreover, we have found a new fusion transcript that is generated exclusively from inverted chromosomes around one of the breakpoints. Finally, by the analysis of the associated nucleotide variation, we have estimated that the inversion was generated ~40,000–50,000 years ago and, while a neutral evolution cannot be ruled out, its current frequencies are more consistent with those expected for a deleterious variant, although no significant association with phenotypic traits has been found so far. PMID:26427027

Functional Impact and Evolution of a Novel Human Polymorphic Inversion That Disrupts a Gene and Creates a Fusion Transcript.

PubMed

Puig, Marta; Castellano, David; Pantano, Lorena; Giner-Delgado, Carla; Izquierdo, David; Gayà-Vidal, Magdalena; Lucas-Lledó, José Ignacio; Esko, Tõnu; Terao, Chikashi; Matsuda, Fumihiko; Cáceres, Mario

2015-10-01

Despite many years of study into inversions, very little is known about their functional consequences, especially in humans. A common hypothesis is that the selective value of inversions stems in part from their effects on nearby genes, although evidence of this in natural populations is almost nonexistent. Here we present a global analysis of a new 415-kb polymorphic inversion that is among the longest ones found in humans and is the first with clear position effects. This inversion is located in chromosome 19 and has been generated by non-homologous end joining between blocks of transposable elements with low identity. PCR genotyping in 541 individuals from eight different human populations allowed the detection of tag SNPs and inversion genotyping in multiple populations worldwide, showing that the inverted allele is mainly found in East Asia with an average frequency of 4.7%. Interestingly, one of the breakpoints disrupts the transcription factor gene ZNF257, causing a significant reduction in the total expression level of this gene in lymphoblastoid cell lines. RNA-Seq analysis of the effects of this expression change in standard homozygotes and inversion heterozygotes revealed distinct expression patterns that were validated by quantitative RT-PCR. Moreover, we have found a new fusion transcript that is generated exclusively from inverted chromosomes around one of the breakpoints. Finally, by the analysis of the associated nucleotide variation, we have estimated that the inversion was generated ~40,000-50,000 years ago and, while a neutral evolution cannot be ruled out, its current frequencies are more consistent with those expected for a deleterious variant, although no significant association with phenotypic traits has been found so far.

Recurrent R-spondin fusions in colon cancer.

PubMed

Seshagiri, Somasekar; Stawiski, Eric W; Durinck, Steffen; Modrusan, Zora; Storm, Elaine E; Conboy, Caitlin B; Chaudhuri, Subhra; Guan, Yinghui; Janakiraman, Vasantharajan; Jaiswal, Bijay S; Guillory, Joseph; Ha, Connie; Dijkgraaf, Gerrit J P; Stinson, Jeremy; Gnad, Florian; Huntley, Melanie A; Degenhardt, Jeremiah D; Haverty, Peter M; Bourgon, Richard; Wang, Weiru; Koeppen, Hartmut; Gentleman, Robert; Starr, Timothy K; Zhang, Zemin; Largaespada, David A; Wu, Thomas D; de Sauvage, Frederic J

2012-08-30

Identifying and understanding changes in cancer genomes is essential for the development of targeted therapeutics. Here we analyse systematically more than 70 pairs of primary human colon tumours by applying next-generation sequencing to characterize their exomes, transcriptomes and copy-number alterations. We have identified 36,303 protein-altering somatic changes that include several new recurrent mutations in the Wnt pathway gene TCF7L2, chromatin-remodelling genes such as TET2 and TET3 and receptor tyrosine kinases including ERBB3. Our analysis for significantly mutated cancer genes identified 23 candidates, including the cell cycle checkpoint kinase ATM. Copy-number and RNA-seq data analysis identified amplifications and corresponding overexpression of IGF2 in a subset of colon tumours. Furthermore, using RNA-seq data we identified multiple fusion transcripts including recurrent gene fusions involving R-spondin family members RSPO2 and RSPO3 that together occur in 10% of colon tumours. The RSPO fusions were mutually exclusive with APC mutations, indicating that they probably have a role in the activation of Wnt signalling and tumorigenesis. Consistent with this we show that the RSPO fusion proteins were capable of potentiating Wnt signalling. The R-spondin gene fusions and several other gene mutations identified in this study provide new potential opportunities for therapeutic intervention in colon cancer.

Recurrent R-spondin fusions in colon cancer

PubMed Central

Seshagiri, Somasekar; Stawiski, Eric W.; Durinck, Steffen; Modrusan, Zora; Storm, Elaine E.; Conboy, Caitlin B.; Chaudhuri, Subhra; Guan, Yinghui; Janakiraman, Vasantharajan; Jaiswal, Bijay S.; Guillory, Joseph; Ha, Connie; Dijkgraaf, Gerrit J. P.; Stinson, Jeremy; Gnad, Florian; Huntley, Melanie A.; Degenhardt, Jeremiah D.; Haverty, Peter M.; Bourgon, Richard; Wang, Weiru; Koeppen, Hartmut; Gentleman, Robert; Starr, Timothy K.; Zhang, Zemin; Largaespada, David A.; Wu, Thomas D.; de Sauvage, Frederic J

2013-01-01

Identifying and understanding changes in cancer genomes is essential for the development of targeted therapeutics1. Here we analyse systematically more than 70 pairs of primary human colon tumours by applying next-generation sequencing to characterize their exomes, transcriptomes and copy-number alterations. We have identified 36,303 protein-altering somatic changes that include several new recurrent mutations in the Wnt pathway gene TCF7L2, chromatin-remodelling genes such as TET2 and TET3 and receptor tyrosine kinases including ERBB3. Our analysis for significantly mutated cancer genes identified 23 candidates, including the cell cycle checkpoint kinase ATM. Copy-number and RNA-seq data analysis identified amplifications and corresponding overexpression of IGF2 in a subset of colon tumours. Furthermore, using RNA-seq data we identified multiple fusion transcripts including recurrent gene fusions involving R-spondin family members RSPO2 and RSPO3 that together occur in 10% of colon tumours. The RSPO fusions were mutually exclusive with APC mutations, indicating that they probably have a role in the activation of Wnt signalling and tumorigenesis. Consistent with this we show that the RSPO fusion proteins were capable of potentiating Wnt signalling. The R-spondin gene fusions and several other gene mutations identified in this study provide new potential opportunities for therapeutic intervention in colon cancer. PMID:22895193

Nanoparticle delivery of miR-223 to attenuate macrophage fusion

PubMed Central

Moore, Laura Beth; Sawyer, Andrew J.; Saucier-Sawyer, Jennifer; Saltzman, W. Mark; Kyriakides, Themis R.

2016-01-01

The foreign body response (FBR) begins with injury acquired during implantation of a biomaterial (BM) and is detrimental due to the eventual encapsulation of the implant. Fusion of macrophages to form foreign body giant cells (FBGC), a hallmark of the FBR, is the consequence of a multistep mechanism induced by interleukin (IL)-4 that includes the acquisition of a fusion competent state and subsequent cytoskeletal rearrangements. However, the precise mechanism, regulation, and interplay among molecular mediators to generate FBGCs are insufficiently understood. Seeking novel mediators of fusion that might be regulated at the post-transcriptional level, we examined the role of microRNAs (miRs) in this process. A miR microarray was screened and identified miR-223 as a negative regulator of macrophage fusion. In addition, transfection of primary macrophages with a mir-223 mimic attenuated IL-4-induced fusion. Furthermore, miR-223 KO mice and mir-223 deficient cells displayed increased fusion in vivo and in vitro, respectively. Finally, we developed a method for in vivo delivery of miR-223 mimic utilizing PLGA nanoparticles, which inhibited FBGC formation in a biomaterial implant model. Our results identify miR-223 as a negative regulator of fusion and demonstrate miR-223 mimic-loaded nanoparticles as a therapeutic inhibitor of macrophage fusion. PMID:26967647

RET fusion as a novel driver of medullary thyroid carcinoma.

PubMed

Grubbs, Elizabeth G; Ng, Patrick Kwok-Shing; Bui, Jacquelin; Busaidy, Naifa L; Chen, Ken; Lee, Jeffrey E; Lu, Xinyan; Lu, Hengyu; Meric-Bernstam, Funda; Mills, Gordon B; Palmer, Gary; Perrier, Nancy D; Scott, Kenneth L; Shaw, Kenna R; Waguespack, Steven G; Williams, Michelle D; Yelensky, Roman; Cote, Gilbert J

2015-03-01

Oncogenic RET tyrosine kinase gene fusions and activating mutations have recently been identified in lung cancers, prompting initiation of targeted therapy trials in this disease. Although RET point mutation has been identified as a driver of tumorigenesis in medullary thyroid carcinoma (MTC), no fusions have been described to date. We evaluated the role of RET fusion as an oncogenic driver in MTC. We describe a patient who died from aggressive sporadic MTC < 10 months after diagnosis. Her tumor was evaluated by means of next-generation sequencing, including an intronic capture strategy. A reciprocal translocation involving RET intron 12 was identified. The fusion was validated using a targeted break apart fluorescence in situ hybridization probe, and RNA sequencing confirmed the existence of an in-frame fusion transcript joining MYH13 exon 35 with RET exon 12. Ectopic expression of fusion product in a murine Ba/F3 cell reporter model established strong oncogenicity. Three tyrosine kinase inhibitors currently used to treat MTC in clinical practice blocked tumorigenic cell growth. This finding represents the report of a novel RET fusion, the first of its kind described in MTC. The finding of this potential novel oncogenic mechanism has clear implications for sporadic MTC, which in the majority of cases has no driver mutation identified. The presence of a RET fusion also provides a plausible target for RET tyrosine kinase inhibitor therapies.

RELATIVE EXPRESSION AND STABILITY OF A CHROMOSOMALLY INTEGRATED AND PLASMID-BORNE MARKER GENE FUSION IN ENVIRONMENTALLY COMPETENT BACTERIA

EPA Science Inventory

A xyIE-iceC transcriptional fusion was created by ligating a DNA fragment harboring the cloned xyIE structural gene from the TOL plasmid of Pseudomonas putida mt-2 into the cloned iceC gene of Pseudomonas syringae Cit7. This fusion construct was integrated into chromosome of Pseu...

BCOR-CCNB3 Fusions Are Frequent in Undifferentiated Sarcomas of Male Children

PubMed Central

Peters, Tricia L.; Kumar, Vijetha; Polikepahad, Sumanth; Lin, Frank Y.; Sarabia, Stephen F.; Liang, Yu; Wang, Wei-Lien; Lazar, Alexander J.; Doddapaneni, Harsha Vardhan; Chao, Hsu; Muzny, Donna M.; Wheeler, David A.; Okcu, M. Fatih; Plon, Sharon E.; Hicks, M. John; López-Terrada, Dolores; Parsons, D. Williams; Roy, Angshumoy

2014-01-01

The BCOR-CCNB3 fusion gene, resulting from a chromosome X paracentric inversion, was recently described in translocation-negative ‘Ewing-like’ sarcomas arising in bone and soft tissue. Genetic subclassification of undifferentiated unclassified sarcomas may potentially offer markers for reproducible diagnosis and substrates for therapy. Using whole transcriptome paired end RNA sequencing (RNA-seq) we unexpectedly identified BCOR-CCNB3 fusion transcripts in an undifferentiated spindle cell sarcoma. RNA-seq results were confirmed through direct RT-PCR of tumor RNA and cloning of the genomic breakpoints from tumor DNA. Five additional undifferentiated sarcomas with BCOR-CCNB3 fusions were identified in a series of 42 pediatric and adult unclassified sarcomas. Genomic breakpoint analysis demonstrated unique breakpoint locations in each case at the DNA level even though the resulting fusion mRNA was identical in all cases. All patients with BCOR-CCNB3 sarcoma were males diagnosed in mid-childhood (7-13 years of age). Tumors were equally distributed between axial and extra-axial locations. Five of the six tumors were soft tissue lesions with either predominant spindle cell morphology or spindle cell areas interspersed with ovoid to round cells. CCNB3 immunohistochemistry showed strong nuclear positivity in 5 tumors prior to oncologic therapy, but was patchy to negative in post-treatment tumor samples. An RT-PCR assay developed to detect the fusion transcript in archival formalin-fixed tissue was positive in all 6 cases, with high sensitivity and specificity in both pre- and post-treated samples. This study adds to recent reports on the clinicopathologic spectrum of BCOR-CCNB3 fusion-positive sarcomas, a newly-emerging entity within the undifferentiated unclassified sarcoma category, and describes a simple RT-PCR assay that in conjunction with CCNB3 immunohistochemistry can be useful in diagnosing these tumors. PMID:25360585

Inversion-mediated gene fusions involving NAB2-STAT6 in an unusual malignant meningioma.

PubMed

Gao, F; Ling, C; Shi, L; Commins, D; Zada, G; Mack, W J; Wang, K

2013-08-20

Meningiomas are the most common primary intracranial tumours, with ∼3% meeting current histopathologic criteria for malignancy. In this study, we explored the transcriptome of meningiomas using RNA-Seq. Inversion-mediated fusions between two adjacent genes, NAB2 and STAT6, were detected in one malignant tumour, creating two novel in-frame transcripts that were validated by RT-PCR and Sanger sequencing. Gene fusions of NAB2-STAT6 were recently implicated in the pathogenesis of solitary fibrous tumours; our study suggested that similar fusions may also have a role in a malignant meningioma with unusual histopathologic features.

A Multiplexed Amplicon Approach for Detecting Gene Fusions by Next-Generation Sequencing.

PubMed

Beadling, Carol; Wald, Abigail I; Warrick, Andrea; Neff, Tanaya L; Zhong, Shan; Nikiforov, Yuri E; Corless, Christopher L; Nikiforova, Marina N

2016-03-01

Chromosomal rearrangements that result in oncogenic gene fusions are clinically important drivers of many cancer types. Rapid and sensitive methods are therefore needed to detect a broad range of gene fusions in clinical specimens that are often of limited quantity and quality. We describe a next-generation sequencing approach that uses a multiplex PCR-based amplicon panel to interrogate fusion transcripts that involve 19 driver genes and 94 partners implicated in solid tumors. The panel also includes control assays that evaluate the 3'/5' expression ratios of 12 oncogenic kinases, which might be used to infer gene fusion events when the partner is unknown or not included on the panel. There was good concordance between the solid tumor fusion gene panel and other methods, including fluorescence in situ hybridization, real-time PCR, Sanger sequencing, and other next-generation sequencing panels, because 40 specimens known to harbor gene fusions were correctly identified. No specific fusion reads were observed in 59 fusion-negative specimens. The 3'/5' expression ratio was informative for fusions that involved ALK, RET, and NTRK1 but not for BRAF or ROS1 fusions. However, among 37 ALK or RET fusion-negative specimens, four exhibited elevated 3'/5' expression ratios, indicating that fusions predicted solely by 3'/5' read ratios require confirmatory testing. Copyright © 2016 American Society for Investigative Pathology and the Association for Molecular Pathology. Published by Elsevier Inc. All rights reserved.

Detection of Echinoderm Microtubule Associated Protein Like 4-Anaplastic Lymphoma Kinase Fusion Genes in Non-small Cell Lung Cancer Clinical Samples by a Real-time Quantitative Reverse Transcription Polymerase Chain Reaction Method.

PubMed

Zhao, Jing; Zhao, Jin-Yin; Chen, Zhi-Xia; Zhong, Wei; Li, Long-Yun; Liu, Li-Cheng; Hu, Xiao-Xu; Chen, Wei-Jun; Wang, Meng-Zhao

2016-12-20

Objective To establish a real-time quantitative reverse transcription polymerase chain reaction assay (qRT-PCR) for the rapid, sensitive, and specific detection of echinoderm microtubule associated protein like 4-anaplastic lymphoma kinase (EML4-ALK) fusion genes in non-small cell lung cancer. Methods The specific primers for the four variants of EML4-ALK fusion genes (V1, V2, V3a, and V3b) and Taqman fluorescence probes for the detection of the target sequences were carefully designed by the Primer Premier 5.0 software. Then, using pseudovirus containing EML4-ALK fusion genes variants (V1, V2, V3a, and V3b) as the study objects, we further analyzed the lower limit, sensitivity, and specificity of this method. Finally, 50 clinical samples, including 3 ALK-fluorescence in situ hybridization (FISH) positive specimens, were collected and used to detect EML4-ALK fusion genes using this method. Results The lower limit of this method for the detection of EML4-ALK fusion genes was 10 copies/μl if no interference of background RNA existed. Regarding the method's sensitivity, the detection resolution was as high as 1% and 0.5% in the background of 500 and 5000 copies/μl wild-type ALK gene, respectively. Regarding the method's specificity, no non-specific amplification was found when it was used to detect EML4-ALK fusion genes in leukocyte and plasma RNA samples from healthy volunteers. Among the 50 clinical samples, 47 ALK-FISH negative samples were also negative. Among 3 ALK-FISH positive samples, 2 cases were detected positive using this method, but another was not detected because of the failure of RNA extraction. Conclusion The proposed qRT-PCR assay for the detection of EML4-ALK fusion genes is rapid, simple, sensitive, and specific, which is deserved to be validated and widely used in clinical settings.

Identification of novel recurrent ETV6-IGH fusions in primary central nervous system lymphoma.

PubMed

Bruno, Aurélie; Labreche, Karim; Daniau, Maïlys; Boisselier, Blandine; Gauchotte, Guillaume; Royer-Perron, Louis; Rahimian, Amithys; Lemoine, Frédéric; de la Grange, Pierre; Guégan, Justine; Bielle, Franck; Polivka, Marc; Adam, Clovis; Meyronet, David; Figarella-Branger, Dominique; Villa, Chiara; Chrétien, Fabrice; Eimer, Sandrine; Davi, Frédéric; Rousseau, Audrey; Houillier, Caroline; Soussain, Carole; Mokhtari, Karima; Hoang-Xuan, Khê; Alentorn, Agusti

2018-02-08

Primary central nervous system lymphoma (PCNSL) represents a particular entity within non-Hodgkin lymphomas and is associated with poor outcome. The present study addresses the potential clinical relevance of chimeric transcripts in PCSNL discovered by using RNA-sequencing (RNA-Seq). Seventy-two immunocompetent and newly diagnosed PCNSL cases were included in the present study. Among them, six were analyzed by RNA-seq to detect new potential fusion transcripts. We confirmed the results in the remaining 66 PCNSL. The gene fusion was validated by fluorescence in situ hybridization (FISH) using formalin-fixed paraffin-embedded (FFPE) samples. We assessed the biological and clinical impact of one new gene fusion. We identified a novel recurrent gene fusion ETV6-IgH. Overall, ETV6-IgH was found in 13 out of 72 PCNSL (18%). No fusion conserved an intact functional domain of ETV6 and ETV6 was significantly underexpressed at gene level, suggesting an ETV6 haploinsufficiency mechanism. The presence of the gene fusion was also validated by FISH in FFPE samples. Finally, PCNSL samples harboring ETV6-IgH showed a better prognosis in multivariate analysis, p-value=0.03, HR=0.33, 95% interval confidence (IC95) [0.12-0.88]. The overall survival at 5 years was of 69% for PCNSL harboring ETV6-IgH vs 29% for samples without this gene fusion. ETV6-IgH is a new potential surrogate marker of PCNSL with favorable prognosis with ETV6 haploinsuffiency as a possible mechanism. The potential clinical impact of ETV6-IgH should be validated in larger prospective studies. © The Author(s) 2018. Published by Oxford University Press on behalf of the Society for Neuro-Oncology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com

Ubiquitin fusion constructs allow the expression and purification of multi-KOW domain complexes of the Saccharomyces cerevisiae transcription elongation factor Spt4/5.

PubMed

Blythe, Amanda; Gunasekara, Sanjika; Walshe, James; Mackay, Joel P; Hartzog, Grant A; Vrielink, Alice

2014-08-01

Spt4/5 is a hetero-dimeric transcription elongation factor that can both inhibit and promote transcription elongation by RNA polymerase II (RNAPII). However, Spt4/5's mechanism of action remains elusive. Spt5 is an essential protein and the only universally-conserved RNAP-associated transcription elongation factor. The protein contains multiple Kyrpides, Ouzounis and Woese (KOW) domains. These domains, in other proteins, are thought to bind RNA although there is little direct evidence in the literature to support such a function in Spt5. This could be due, at least in part, to difficulties in expressing and purifying recombinant Spt5. When expressed in Escherichia coli (E. coli), Spt5 is innately insoluble. Here we report a new approach for the successful expression and purification of milligram quantities of three different multi-KOW domain complexes of Saccharomyces cerevisiae Spt4/5 for use in future functional studies. Using the E. coli strain Rosetta2 (DE3) we have developed strategies for co-expression of Spt4 and multi-KOW domain Spt5 complexes from the bi-cistronic pET-Duet vector. In a second strategy, Spt4/5 was expressed via co-transformation of Spt4 in the vector pET-M11 with Spt5 ubiquitin fusion constructs in the vector pHUE. We characterized the multi-KOW domain Spt4/5 complexes by Western blot, limited proteolysis, circular dichroism, SDS-PAGE and size exclusion chromatography-multiangle light scattering and found that the proteins are folded with a Spt4:Spt5 hetero-dimeric stoichiometry of 1:1. These expression constructs encompass a larger region of Spt5 than has previously been reported, and will provide the opportunity to elucidate the biological function of the multi-KOW containing Spt5. Copyright © 2014 Elsevier Inc. All rights reserved.

Antisense RNA: effect of ribosome binding sites, target location, size, and concentration on the translation of specific mRNA molecules.

PubMed

Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S

1989-01-01

A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.

Intergenic disease-associated regions are abundant in novel transcripts.

PubMed

Bartonicek, N; Clark, M B; Quek, X C; Torpy, J R; Pritchard, A L; Maag, J L V; Gloss, B S; Crawford, J; Taft, R J; Hayward, N K; Montgomery, G W; Mattick, J S; Mercer, T R; Dinger, M E

2017-12-28

Genotyping of large populations through genome-wide association studies (GWAS) has successfully identified many genomic variants associated with traits or disease risk. Unexpectedly, a large proportion of GWAS single nucleotide polymorphisms (SNPs) and associated haplotype blocks are in intronic and intergenic regions, hindering their functional evaluation. While some of these risk-susceptibility regions encompass cis-regulatory sites, their transcriptional potential has never been systematically explored. To detect rare tissue-specific expression, we employed the transcript-enrichment method CaptureSeq on 21 human tissues to identify 1775 multi-exonic transcripts from 561 intronic and intergenic haploblocks associated with 392 traits and diseases, covering 73.9 Mb (2.2%) of the human genome. We show that a large proportion (85%) of disease-associated haploblocks express novel multi-exonic non-coding transcripts that are tissue-specific and enriched for GWAS SNPs as well as epigenetic markers of active transcription and enhancer activity. Similarly, we captured transcriptomes from 13 melanomas, targeting nine melanoma-associated haploblocks, and characterized 31 novel melanoma-specific transcripts that include fusion proteins, novel exons and non-coding RNAs, one-third of which showed allelically imbalanced expression. This resource of previously unreported transcripts in disease-associated regions ( http://gwas-captureseq.dingerlab.org ) should provide an important starting point for the translational community in search of novel biomarkers, disease mechanisms, and drug targets.

Designed Transcriptional Regulation in Mammalian Cells Based on TALE- and CRISPR/dCas9.

PubMed

Lebar, Tina; Jerala, Roman

2018-01-01

Transcriptional regulation lies at the center of many cellular processes and is the result of cellular response to different external and internal signals. Control of transcription of selected genes enables an unprecedented access to shape the cellular response. While orthogonal transcription factors from bacteria, yeast, plants, or other cells have been used to introduce new cellular logic into mammalian cells, the discovery of designable modular DNA binding domains, such as Transcription Activator-Like Effectors (TALEs) and the CRISPR system, enable targeting of almost any selected DNA sequence. Fusion or conditional association of DNA targeting domain with transcriptional effector domains enables controlled regulation of almost any endogenous or ectopic gene. Moreover, the designed regulators can be linked into genetic circuits to implement complex responses, such as different types of Boolean functions and switches. In this chapter, we describe the protocols for achieving efficient transcriptional regulation with TALE- and CRISPR-based designed transcription factors in mammalian cells.

A gene expression resource generated by genome-wide lacZ profiling in the mouse

PubMed Central

Tuck, Elizabeth; Estabel, Jeanne; Oellrich, Anika; Maguire, Anna Karin; Adissu, Hibret A.; Souter, Luke; Siragher, Emma; Lillistone, Charlotte; Green, Angela L.; Wardle-Jones, Hannah; Carragher, Damian M.; Karp, Natasha A.; Smedley, Damian; Adams, Niels C.; Bussell, James N.; Adams, David J.; Ramírez-Solis, Ramiro; Steel, Karen P.; Galli, Antonella; White, Jacqueline K.

2015-01-01

ABSTRACT Knowledge of the expression profile of a gene is a critical piece of information required to build an understanding of the normal and essential functions of that gene and any role it may play in the development or progression of disease. High-throughput, large-scale efforts are on-going internationally to characterise reporter-tagged knockout mouse lines. As part of that effort, we report an open access adult mouse expression resource, in which the expression profile of 424 genes has been assessed in up to 47 different organs, tissues and sub-structures using a lacZ reporter gene. Many specific and informative expression patterns were noted. Expression was most commonly observed in the testis and brain and was most restricted in white adipose tissue and mammary gland. Over half of the assessed genes presented with an absent or localised expression pattern (categorised as 0-10 positive structures). A link between complexity of expression profile and viability of homozygous null animals was observed; inactivation of genes expressed in ≥21 structures was more likely to result in reduced viability by postnatal day 14 compared with more restricted expression profiles. For validation purposes, this mouse expression resource was compared with Bgee, a federated composite of RNA-based expression data sets. Strong agreement was observed, indicating a high degree of specificity in our data. Furthermore, there were 1207 observations of expression of a particular gene in an anatomical structure where Bgee had no data, indicating a large amount of novelty in our data set. Examples of expression data corroborating and extending genotype-phenotype associations and supporting disease gene candidacy are presented to demonstrate the potential of this powerful resource. PMID:26398943

The pharmacological efficacy of the anti-IL17 scFv and sTNFR1 bispecific fusion protein in inflammation mouse stimulated by LPS.

PubMed

Yang, Yongbi; Zhang, Teng; Cao, Hongxue; Yu, Dan; Zhang, Tong; Zhao, Shaojuan; Jing, Xiaohui; Song, Liying; Liu, Yunye; Che, Ruixiang; Liu, Xin; Li, Deshan; Ren, Guiping

2017-08-01

Acute lung injury (ALI) is still a leading cause of morbidity and mortality in critically ill patients. Recently, our study found that a bispecific fusion protein treatment can ameliorate the lung injury induced by LPS. However, the molecular mechanisms which bispecific fusion protein ameliorates acute lung injury remain unclear. In this study, we found that the bispecific fusion protein treatment inhibited the nuclear transcription of NF-κB in confocal laser scanning fluorescence microscopy, the bispecific fusion protein exert protective effects in the cell model of ALI induced by lipopolysaccharide (LPS) via inhibiting the nuclear factor κB (NF-κB) signaling pathway and mediate inflammation. Moreover, the treatment of the bispecific fusion protein show its efficacy in animal models stimulated by LPS, the results of real-time PCR and ELISA demonstrate that bispecific fusion protein treatment effectively inhibited the over-expression of inflammatory cytokines(tumor necrosis factor α, interleukin 1β and interleukin 17). In addition, LPS-challenged mice exhibited significant lung injury characterized by the deterioration of histopathology, which was meliorated by bispecific fusion protein treatment. Collectively, these results demonstrate that bispecific fusion protein treatment ameliorates LPS-induced ALI through reducing inflammatory cytokines and lung inflammation, which may be associated with the decreased the nuclear transcription of NF-κB. The bispecific fusion protein may be useful as a novel therapy to treat ALI. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Transcriptional Activation of Pyoluteorin Operon Mediated by the LysR-Type Regulator PltR Bound at a 22 bp lys Box in Pseudomonas aeruginosa M18

PubMed Central

Wang, Guohao; Xu, Yuquan

2012-01-01

Pseudomonas aeruginosa M18, a rhizosphere-isolated bacterial strain showing strong antifungal activity, can produce secondary metabolites such as phenazine-1-carboxylic acid and pyoluteorin (Plt). The LysR-type transcriptional regulator PltR activates the Plt biosynthesis operon pltLABCDEFG, the expression of which is induced by Plt. Here, we identified and characterized the non-conserved pltL promoter (pltLp) specifically activated by PltR and its upstream neighboring lys box from the complicated pltR–pltL intergenic sequence. The 22 bp palindromic lys box, which consists of two 9 bp complementary inverted repeats interrupted by 4 bp, was found to contain the conserved, GC-rich LysR-binding motif (T-N11-A). Evidence obtained in vivo from mutational and lacZ report analyses and in vitro from electrophoretic mobility shift assays reveals that the PltR protein directly bound to the pltLp region as the indispensable binding motif “lys box”, thereby transcriptionally activating the pltLp-driven plt operon expression. Plt, as a potential non-essential coinducer of PltR, specifically induced the pltLp expression and thus strengthened its biosynthetic plt operon expression. PMID:22761817

Regulation of the cnr Cobalt and Nickel Resistance Determinant from Ralstonia sp. Strain CH34†

PubMed Central

Grass, Gregor; Große, Cornelia; Nies, Dietrich H.

2000-01-01

Ralstonia sp. strain CH34 is resistant to nickel and cobalt cations. Resistance is mediated by the cnr determinant located on plasmid pMOL28. The cnr genes are organized in two clusters, cnrYXH and cnrCBA. As revealed by reverse transcriptase PCR and primer extension, transcription from these operons is initiated from promoters located upstream of the cnrY and cnrC genes. These two promoters exhibit conserved sequences at the −10 (CCGTATA) and −35 (CRAGGGGRAG) regions. The CnrH gene product, which is required for expression of both operons, is a sigma factor belonging to the sigma L family, whose activity seems to be governed by the membrane-bound CnrY and CnrX gene products in response to Ni2+. Half-maximal activation from the cnrCBA operon was determined by using appropriate lacZ gene fusions and was shown to occur at an Ni2+ concentration of about 50 μM. PMID:10671463

Regulation of SNM1, an inducible Saccharomyces cerevisiae gene required for repair of DNA cross-links.

PubMed

Wolter, R; Siede, W; Brendel, M

1996-02-05

The interstrand cross-link repair gene SNM1 of Saccharomyces cerevisiae was examined for regulation in response to DNA-damaging agents. Induction of SNM1-lacZ fusions was detected in response to nitrogen mustard, cis-platinum (II) diamine dichloride, UV light, and 8-methoxypsoralen + UVA, but not after heat-shock treatment or incubation with 2-dimethylaminoethylchloride, methylmethane sulfonate or 4-nitroquinoline-N-oxide. The promoter of SNM1 contains a 15 bp motif, which shows homology to the DRE2 box of the RAD2 promoter. Similar motifs have been found in promoter regions of other damage-inducible DNA repair genes. Deletion of this motif results in loss of inducibility of SNM1. Also, a putative negative upstream regulation sequence was found to be responsible for repression of constitutive transcription of SNM1. Surprisingly, no inducibility of SNM1 was found after treatment with DNA-damaging agents in strains without an intact DUN1 gene, while regulation seems unchanged in sad1 mutants.

Development of Peptidomimetic Inhibitors of the ERG Gene Fusion Product in Prostate Cancer.

PubMed

Wang, Xiaoju; Qiao, Yuanyuan; Asangani, Irfan A; Ateeq, Bushra; Poliakov, Anton; Cieślik, Marcin; Pitchiaya, Sethuramasundaram; Chakravarthi, Balabhadrapatruni V S K; Cao, Xuhong; Jing, Xiaojun; Wang, Cynthia X; Apel, Ingrid J; Wang, Rui; Tien, Jean Ching-Yi; Juckette, Kristin M; Yan, Wei; Jiang, Hui; Wang, Shaomeng; Varambally, Sooryanarayana; Chinnaiyan, Arul M

2017-04-10

Transcription factors play a key role in the development of diverse cancers, and therapeutically targeting them has remained a challenge. In prostate cancer, the gene encoding the transcription factor ERG is recurrently rearranged and plays a critical role in prostate oncogenesis. Here, we identified a series of peptides that interact specifically with the DNA binding domain of ERG. ERG inhibitory peptides (EIPs) and derived peptidomimetics bound ERG with high affinity and specificity, leading to proteolytic degradation of the ERG protein. The EIPs attenuated ERG-mediated transcription, chromatin recruitment, protein-protein interactions, cell invasion and proliferation, and tumor growth. Thus, peptidomimetic targeting of transcription factor fusion products may provide a promising therapeutic strategy for prostate cancer as well as other malignancies. Copyright © 2017 Elsevier Inc. All rights reserved.

MYB and MYBL1 in adenoid cystic carcinoma: diversity in the mode of genomic rearrangement and transcripts.

PubMed

Togashi, Yuki; Dobashi, Akito; Sakata, Seiji; Sato, Yukiko; Baba, Satoko; Seto, Akira; Mitani, Hiroki; Kawabata, Kazuyoshi; Takeuchi, Kengo

2018-02-06

MYB-NFIB and MYBL1-NFIB have been reported in ~60% of adenoid cystic carcinoma cases, but driver alterations in the remaining ~40% of adenoid cystic carcinoma remain unclear. We examined 100 adenoid cystic carcinoma cases for MYB and MYBL1 locus rearrangements by fluorescence in situ hybridization (FISH) with originally designed probe sets using formalin-fixed paraffin-embedded materials. Approximately one-third of samples were also analyzed by fusion transcript-specific RT-PCR and capture RNA sequencing. In the 27 cases with frozen materials, MYB-NFIB and MYBL1-NFIB fusion transcripts were detected in 9 (33%) and 6 cases (22%) by RT-PCR, respectively. Meanwhile, high expression of MYB (18 cases, 67%) or MYBL1 (9 cases, 33%) was detected in all 27 cases in a mutually exclusive manner, regardless of its form (full-length, truncation, or fusion transcript). Interestingly, genomic rearrangements around the corresponding highly-expressed gene were observed in all 27 cases by FISH, suggesting a causative relationship between genomic rearrangements and gene expression. Among the 100 cases, including additional 73 cases, 97 harbored genomic rearrangements in the MYB (73 cases) or MYBL1 locus (24 cases) including 10 cases with atypical FISH patterns undetectable through ordinary split FISH approaches: breakpoints far distant from MYB (5 cases) and a small NFIB locus insertion into the MYB (3 cases) or MYBL1 locus (2 cases). In clinicopathological analyses, histological grade, primary tumor size, and lymph node metastasis were identified as prognostic factors, whereas MYB/MYBL1 rearrangements were not, but were associated with histological grade. In the present study, MYB or MYBL1 locus rearrangement was detected in nearly all adenoid cystic carcinoma cases, and therefore it would be a good diagnostic marker for adenoid cystic carcinoma. However, fusion transcript-specific RT-PCR for MYB-NFIB and MYBL1-NFIB and ordinary split FISH assays for MYB and MYBL1 were less

Identification and Transcript Analysis of the TCP Transcription Factors in the Diploid Woodland Strawberry Fragaria vesca

PubMed Central

Wei, Wei; Hu, Yang; Cui, Meng-Yuan; Han, Yong-Tao; Gao, Kuan; Feng, Jia-Yue

2016-01-01

Plant-specific TEOSINTE BRANCHED 1, CYCLOIDEA, and PROLIFERATING CELL FACTORS (TCP) transcription factors play versatile functions in multiple processes of plant growth and development. However, no systematic study has been performed in strawberry. In this study, 19 FvTCP genes were identified in the diploid woodland strawberry (Fragaria vesca) accession Heilongjiang-3. Phylogenetic analysis suggested that the FvTCP genes were classified into two main classes, with the second class further divided into two subclasses, which was supported by the exon-intron organizations and the conserved motif structures. Promoter analysis revealed various cis-acting elements related to growth and development, hormone and/or stress responses. We analyzed FvTCP gene transcript accumulation patterns in different tissues and fruit developmental stages. Among them, 12 FvTCP genes exhibited distinct tissue-specific transcript accumulation patterns. Eleven FvTCP genes were down-regulated in different fruit developmental stages, while five FvTCP genes were up-regulated. Transcripts of FvTCP genes also varied with different subcultural propagation periods and were induced by hormone treatments and biotic and abiotic stresses. Subcellular localization analysis showed that six FvTCP-GFP fusion proteins showed distinct localizations in Arabidopsis mesophyll protoplasts. Notably, transient over-expression of FvTCP9 in strawberry fruits dramatically affected the expression of a series of genes implicated in fruit development and ripening. Taken together, the present study may provide the basis for functional studies to reveal the role of this gene family in strawberry growth and development. PMID:28066489

Pax2 regulates a fadd-dependent molecular switch that drives tissue fusion during eye development.

PubMed

Viringipurampeer, Ishaq A; Ferreira, Todd; DeMaria, Shannon; Yoon, Jookyung J; Shan, Xianghong; Moosajee, Mariya; Gregory-Evans, Kevin; Ngai, John; Gregory-Evans, Cheryl Y

2012-05-15

Tissue fusion is an essential morphogenetic mechanism in development, playing a fundamental role in developing neural tube, palate and the optic fissure. Disruption of genes associated with the tissue fusion can lead to congenital malformations, such as spina bifida, cleft lip/palate and ocular coloboma. For instance, the Pax2 transcription factor is required for optic fissure closure, although the mechanism of Pax2 action leading to tissue fusion remains elusive. This lack of information defining how transcription factors drive tissue morphogenesis at the cellular level is hampering new treatments options. Through loss- and gain-of-function analysis, we now establish that pax2 in combination with vax2 directly regulate the fas-associated death domain (fadd) gene. In the presence of fadd, cell proliferation is restricted in the developing eye through a caspase-dependent pathway. However, the loss of fadd results in a proliferation defect and concomitant activation of the necroptosis pathway through RIP1/RIP3 activity, leading to an abnormal open fissure. Inhibition of RIP1 with the small molecule drug necrostatin-1 rescues the pax2 eye fusion defect, thereby overcoming the underlying genetic defect. Thus, fadd has an essential physiological function in protecting the developing optic fissure neuroepithelium from RIP3-dependent necroptosis. This study demonstrates the molecular hierarchies that regulate a cellular switch between proliferation and the apoptotic and necroptotic cell death pathways, which in combination drive tissue morphogenesis. Furthermore, our data suggest that future therapeutic strategies may be based on small molecule drugs that can bypass the gene defects causing common congenital tissue fusion defects.

Ewing-like sarcomas with BCOR-CCNB3 fusion transcript: a clinical, radiological and pathological retrospective study from the Société Française des Cancers de L'Enfant.

PubMed

Cohen-Gogo, Sarah; Cellier, Cécile; Coindre, Jean-Michel; Mosseri, Véronique; Pierron, Gaëlle; Guillemet, Cécile; Italiano, Antoine; Brugières, Laurence; Orbach, Daniel; Laurence, Valérie; Delattre, Olivier; Michon, Jean

2014-12-01

This retrospective multicenter study assessed the clinical, radiological and pathological presentation, treatment and outcome of 26 patients with Ewing-like sarcoma harboring BCOR-CCNB3 gene fusion transcript. Tumor samples had been collected between 1994 and April 2012. Eligibility criteria included assessment of a BCOR-CCNB3 transcript-positive tumor after molecular analysis and availability of minimal clinical and pathological data. Radiological data were also retrieved when possible. Data were analyzed by descriptive statistics and methods for survival analysis. Median age at diagnosis was 13.1 years (5.9 to 25.6 years). Most patients (24/26) had localized tumors. All tumors but five were localized to bone. CCNB3 immunochemistry showed strong nuclear staining on all samples. No specific radiological features were found. Most patients received chemotherapy (15 according to protocols designed for Ewing tumors), before and/or after local treatment (surgery and/or radiotherapy, with 46.2% receiving both). Local and metastatic relapses were of poor prognosis. Induction chemotherapy and treatment according to an Ewing protocol might influence survival for patients with localized tumors. Sixteen patients are alive in complete remission with a median follow-up of 86 months. Five year overall survival and disease-free survival were respectively 76.5% (95% CI, 58%-95%) and 67.9% (95% CI, 48%-88%). BCOR-CCNB3 transcript-positive Ewing-like sarcoma diagnosis should be discussed for a transcript-negative small round cell sarcoma in a child, adolescent or young adult patient. Diagnosis needs to be stated through CCNB3 immunochemistry or transcript identification. The exquisite chemosensitivity of these tumors should encourage the use of polychemotherapy for appropriate care, associated with best local tumor control. © 2014 Wiley Periodicals, Inc.

The Transcriptional Response to Nonself in the Fungus Podospora anserina

PubMed Central

Bidard, Frédérique; Clavé, Corinne; Saupe, Sven J.

2013-01-01

In fungi, heterokaryon incompatibility is a nonself recognition process occurring when filaments of different isolates of the same species fuse. Compatibility is controlled by so-called het loci and fusion of strains of unlike het genotype triggers a complex incompatibility reaction that leads to the death of the fusion cell. Herein, we analyze the transcriptional changes during the incompatibility reaction in Podospora anserina. The incompatibility response was found to be associated with a massive transcriptional reprogramming: 2231 genes were up-regulated by a factor 2 or more during incompatibility. In turn, 2441 genes were down-regulated. HET, NACHT, and HeLo domains previously found to be involved in the control of heterokaryon incompatibility were enriched in the up-regulated gene set. In addition, incompatibility was characterized by an up-regulation of proteolytic and other hydrolytic activities, of secondary metabolism clusters and toxins and effector-like proteins. The up-regulated set was found to be enriched for proteins lacking orthologs in other species and chromosomal distribution of the up-regulated genes was uneven with up-regulated genes residing preferentially in genomic islands and on chromosomes IV and V. There was a significant overlap between regulated genes during incompatibility in P. anserina and Neurospora crassa, indicating similarities in the incompatibility responses in these two species. Globally, this study illustrates that the expression changes occurring during cell fusion incompatibility in P. anserina are in several aspects reminiscent of those described in host-pathogen or symbiotic interactions in other fungal species. PMID:23589521

Eukaryote-like Ser/Thr protein kinase PrkA modulates sporulation via regulating the transcriptional factor σ(K) in Bacillus subtilis.

PubMed

Yan, Jinyuan; Zou, Wei; Fang, Juan; Huang, Xiaowei; Gao, Feng; He, Zeying; Zhang, Keqin; Zhao, Ninghui

2015-01-01

Protein kinase A (PrkA), also known as AMP-activated protein kinase, functions as a serine/threonine protein kinase (STPK), has been shown to be involved in a variety of important biologic processes, including pathogenesis of many important diseases in mammals. However, the biological functions of PrkA are less known in prokaryote cells. Here, we explored the function of PrkA as well as its underlying molecular mechanisms using the model bacterium Bacillus subtilis168. When PrkA is inhibited by 9-β-D-arabinofuranosyladenine (ara-A) in the wild type strain or deleted in the ΔprkA mutant strain, we observed sporulation defects in B. subtilis 168, suggesting that PrkA functions as a sporulation-related protein. Transcriptional analysis using the lacZ reporter gene demonstrated that deletion of prkA significantly reduced the expression of the transcriptional factor σ(K) and its downstream genes. Complementation of sigK gene in prkA knockout mutant partially rescued the phenotype of ΔprkA, further supporting the hypothesis that the decreased σ(K) expression should be one of the reasons for the sporulation defect resulting from prkA disruption. Finally, our data confirmed that Hpr (ScoC) negatively controlled the expression of transcriptional factor σ(K), and thus PrkA accelerated sporulation and the expression of σ(K) by suppression of Hpr (ScoC). Taken together, our study discovered a novel function of the eukaryotic-like STPK PrkA in spore development as well as its underlying molecular mechanism in B. subtilis.

A source of artifact in the lacZ reversion assay in Escherichia coli.

PubMed

Hoffmann, George R; Gray, Carol L; Lange, Paulina B; Marando, Christie I

2015-06-01

The lacZ reversion assay in Escherichia coli measures point mutations that occur by specific base substitutions and frameshift mutations. The tester strains cannot use lactose as a carbon source (Lac(-)), and revertants are easily detected by growth on lactose medium (Lac(+)). Six strains identify the six possible base substitutions, and five strains measure +G, -G, -CG, +A and -A frameshifts. Strong mutagens give dose-dependent increases in numbers of revertants per plate and revertant frequencies. Testing compounds that are arguably nonmutagens or weakly mutagenic, we often noted statistically significant dose-dependent increases in revertant frequency that were not accompanied by an absolute increase in numbers of revertants. The increase in frequency was wholly ascribable to a declining number of viable cells owing to toxicity. Analysis of the conditions revealed that the frequency of spontaneous revertants is higher when there are fewer viable cells per plate. The phenomenon resembles "adaptive" or "stress" mutagenesis, whereby lactose revertants accumulate in Lac(-) bacteria under starvation conditions in the absence of catabolite repression. Adaptive mutation is observed after long incubation and might be expected to be irrelevant in a standard assay using 48-h incubation. However, we found that elevated revertant frequencies occur under typical assay conditions when the bacterial lawn is thin, and this can cause increases in revertant frequency that mimic chemical mutagenesis when treatments are toxic but not mutagenic. Responses that resemble chemical mutagenesis were observed in the absence of mutagenic treatment in strains that revert by different frameshift mutations. The magnitude of the artifact is affected by cell density, dilution, culture age, incubation time, catabolite repression and the age and composition of media. Although the specific reversion assay is effective for quickly distinguishing classes of mutations induced by potent mutagens, its

Regulation of the Carnitine Pathway in Escherichia coli: Investigation of the cai-fix Divergent Promoter Region

PubMed Central

Buchet, Anne; Eichler, Knut; Mandrand-Berthelot, Marie-Andrée

1998-01-01

The divergent structural operons caiTABCDE and fixABCX of Escherichia coli are required for anaerobic carnitine metabolism. Transcriptional monocopy lacZ fusion studies showed that both operons are coexpressed during anaerobic growth in the presence of carnitine, respond to common environmental stimuli (like glucose and nitrate), and are modulated positively by the same general regulators, CRP and FNR, and negatively by H-NS. Overproduction of the CaiF specific regulatory protein mediating the carnitine signal restored induction in an fnr mutant, corresponding to its role as the primary target for anaerobiosis. Transcript analysis identified two divergent transcription start points initiating 289 bp apart. DNase I footprinting revealed three sites with various affinities for the binding of the cAMP-CRP complex inside this regulatory region. Site-directed mutagenesis experiments indicated that previously reported perfect CRP motif 1, centered at −41.5 of the cai transcriptional start site, plays a direct role in the sole cai activation. In contrast, mutation in CRP site 2, positioned at −69.5 of the fix promoter, caused only a threefold reduction in fix expression. Thus, the role of the third CRP site, located at −126.5 of fix, might be to reinforce the action of site 2. A critical 50-bp cis-acting sequence overlapping the fix mRNA start site was found, by deletion analysis, to be necessary for cai transcription. This region is thought to be involved in transduction of the signal mediated by the CaiF regulator. PMID:9573142

A fast-evolving human NPAS3 enhancer gained reporter expression in the developing forebrain of transgenic mice

PubMed Central

Kamm, Gretel B.; López-Leal, Rodrigo; Lorenzo, Juan R.; Franchini, Lucía F.

2013-01-01

The developmental brain gene NPAS3 stands out as a hot spot in human evolution because it contains the largest number of human-specific, fast-evolving, conserved, non-coding elements. In this paper we studied 2xHAR142, one of these elements that is located in the fifth intron of NPAS3. Using transgenic mice, we show that the mouse and chimp 2xHAR142 orthologues behave as transcriptional enhancers driving expression of the reporter gene lacZ to a similar NPAS3 expression subdomain in the mouse central nervous system. Interestingly, the human 2xHAR142 orthologue drives lacZ expression to an extended expression pattern in the nervous system. Thus, molecular evolution of 2xHAR142 provides the first documented example of human-specific heterotopy in the forebrain promoted by a transcriptional enhancer and suggests that it may have contributed to assemble the unique properties of the human brain. PMID:24218632

Adult-onset renal cell carcinoma associated with Xp11.2 translocations/TFE3 gene fusion with smooth muscle stroma and abnormal vessels.

PubMed

Kuroda, Naoto; Tamura, Masato; Tanaka, Yukichi; Hes, Ondrej; Michal, Michal; Inoue, Kaori; Ohara, Masahiko; Mizuno, Keiko; Lee, Gang-Hong

2009-07-01

Renal cell carcinoma (RCC) associated with Xp11.2 translocation/TFE3 gene fusion has been recently identified. Herein is presented a case of RCC with Xp11.2 translocations/TFE3 gene fusions with unusual histological findings. A 68-year-old Japanese woman was incidentally found to have a renal mass on CT. Histological examination showed clear cell neoplasm with alveolar and papillary growth patterns. The nuclear atypia corresponded to Fuhrman grade 3. Additionally, smooth muscle stroma was observed and abnormal vessels showing a heterogeniety in thickness were also identified. On immunohistochemistry, neoplastic cells were diffusely positive for transcription factor E3 (TFE3) and Melan A, and focally positive for CD10 and RCC marker. The smooth muscle stroma was positive for alpha-smooth muscle actin and h-caldesmon, but reverse transcription-polymerase chain reaction of the tumor using frozen material could not detect any previously reported chimeric transcripts including ASPL-TFE3, PRCC-TFE3, CLTC-TFE3, PSF-TFE3 or NoNo-TFE3. G-band karyotype was unsuccessful. Pathologists should pay attention to the afore-described unusual stromal reaction of adult-onset RCC associated with Xp11.2 translocations/TFE3 gene fusions.

Fusion genes with ALK as recurrent partner in ependymoma-like gliomas: a new brain tumor entity?

PubMed Central

Olsen, Thale Kristin; Panagopoulos, Ioannis; Meling, Torstein R.; Micci, Francesca; Gorunova, Ludmila; Thorsen, Jim; Due-Tønnessen, Bernt; Scheie, David; Lund-Iversen, Marius; Krossnes, Bård; Saxhaug, Cathrine; Heim, Sverre; Brandal, Petter

2015-01-01

Background We have previously characterized 19 ependymal tumors using Giemsa banding and high-resolution comparative genomic hybridization. The aim of this study was to analyze these tumors searching for fusion genes. Methods RNA sequencing was performed in 12 samples. Potential fusion transcripts were assessed by seed count and structural chromosomal aberrations. Transcripts of interest were validated using fluorescence in situ hybridization and PCR followed by direct sequencing. Results RNA sequencing identified rearrangements of the anaplastic lymphoma kinase gene (ALK) in 2 samples. Both tumors harbored structural aberrations involving the ALK locus 2p23. Tumor 1 had an unbalanced t(2;14)(p23;q22) translocation which led to the fusion gene KTN1-ALK. Tumor 2 had an interstitial del(2)(p16p23) deletion causing the fusion of CCDC88A and ALK. In both samples, the breakpoint of ALK was located between exons 19 and 20. Both patients were infants and both tumors were supratentorial. The tumors were well demarcated from surrounding tissue and had both ependymal and astrocytic features but were diagnosed and treated as ependymomas. Conclusions By combining karyotyping and RNA sequencing, we identified the 2 first ever reported ALK rearrangements in CNS tumors. Such rearrangements may represent the hallmark of a new entity of pediatric glioma characterized by both ependymal and astrocytic features. Our findings are of particular importance because crizotinib, a selective ALK inhibitor, has demonstrated effect in patients with lung cancer harboring ALK rearrangements. Thus, ALK emerges as an interesting therapeutic target in patients with ependymal tumors carrying ALK fusions. PMID:25795305

Environmental conditions affect transcription of the pectinase genes of Erwinia chrysanthemi 3937.

PubMed Central

Hugouvieux-Cotte-Pattat, N; Dominguez, H; Robert-Baudouy, J

1992-01-01

To depolymerize plant pectin, the phytopathogenic enterobacterium Erwinia chrysanthemi produces a series of enzymes which include a pectin-methyl-esterase encoded by the pem gene and five isoenzymes of pectate lyases encoded by the five genes pelA, pelB, pelC, pelD, and pelE. We have constructed transcriptional fusions between the pectinase gene promoters and the uidA gene, encoding beta-glucuronidase, to study the regulation of these E. chrysanthemi pectinase genes individually. The transcription of the pectinase genes is dependent on many environmental conditions. All the fusions were induced by pectic catabolic products and responded, to different degrees, to growth phase, catabolite repression, temperature, and nitrogen starvation. Transcription of pelA, pelD, and pelE was also increased in anaerobic growth conditions. High osmolarity of the culture medium increased expression of pelE but decreased that of pelD; the other pectinase genes were not affected. The level of expression of each gene was different. Transcription of pelA was very low under all growth conditions. The expression of the pelB, pelC, and pem genes was intermediate. The pelE gene had a high basal level of expression. Expression of pelD was generally the most affected by changes in culture conditions and showed a low basal level but very high induced levels. These differences in the expression of the pectinase genes of E. chrysanthemi 3937 presumably reflect their role during infection of plants, because the degradation of pectic polymers of the plant cell walls is the main determinant of tissue maceration caused by soft rot erwiniae. PMID:1447147

FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events.

PubMed

Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J P; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok

2015-01-01

Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain-domain interactions, protein-protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist's mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop 'novel' therapeutic approaches. Database URL: http://ppi.bioinfo.asia.edu.tw/FARE-CAFE. © The Author(s) 2015. Published by Oxford University Press.

FARE-CAFE: a database of functional and regulatory elements of cancer-associated fusion events

PubMed Central

Korla, Praveen Kumar; Cheng, Jack; Huang, Chien-Hung; Tsai, Jeffrey J. P.; Liu, Yu-Hsuan; Kurubanjerdjit, Nilubon; Hsieh, Wen-Tsong; Chen, Huey-Yi; Ng, Ka-Lok

2015-01-01

Chromosomal translocation (CT) is of enormous clinical interest because this disorder is associated with various major solid tumors and leukemia. A tumor-specific fusion gene event may occur when a translocation joins two separate genes. Currently, various CT databases provide information about fusion genes and their genomic elements. However, no database of the roles of fusion genes, in terms of essential functional and regulatory elements in oncogenesis, is available. FARE-CAFE is a unique combination of CTs, fusion proteins, protein domains, domain–domain interactions, protein–protein interactions, transcription factors and microRNAs, with subsequent experimental information, which cannot be found in any other CT database. Genomic DNA information including, for example, manually collected exact locations of the first and second break points, sequences and karyotypes of fusion genes are included. FARE-CAFE will substantially facilitate the cancer biologist’s mission of elucidating the pathogenesis of various types of cancer. This database will ultimately help to develop ‘novel’ therapeutic approaches. Database URL: http://ppi.bioinfo.asia.edu.tw/FARE-CAFE PMID:26384373

A novel type of EWS-CHOP fusion gene in myxoid liposarcoma

DOE Office of Scientific and Technical Information (OSTI.GOV)

Matsui, Yoshito; Ueda, Takafumi; Kubo, Takahiro

2006-09-22

The cytogenetic hallmark of myxoid type and round cell type liposarcoma consists of reciprocal translocation of t(12;16)(q13;p11) and t(12;22)(q13;q12), which results in fusion of TLS/FUS and CHOP, and EWS and CHOP, respectively. Nine structural variations of the TLS/FUS-CHOP chimeric transcript have been reported, however, only two types of EWS-CHOP have been described. We describe here a case of myxoid liposarcoma containing a novel EWS-CHOP chimeric transcript and identified the breakpoint occurring in intron 13 of EWS. Reverse transcription-polymerase chain reaction and direct sequence showed that exon 13 of EWS was in-frame fused to exon 2 of CHOP. Genomic analysis revealedmore » that the breaks were located in intron 13 of EWS and intron 1 of CHOP.« less

Detection of 22 common leukemic fusion genes using a single-step multiplex qRT-PCR-based assay.

PubMed

Lyu, Xiaodong; Wang, Xianwei; Zhang, Lina; Chen, Zhenzhu; Zhao, Yu; Hu, Jieying; Fan, Ruihua; Song, Yongping

2017-07-25

Fusion genes generated from chromosomal translocation play an important role in hematological malignancies. Detection of fusion genes currently employ use of either conventional RT-PCR methods or fluorescent in situ hybridization (FISH), where both methods involve tedious methodologies and require prior characterization of chromosomal translocation events as determined by cytogenetic analysis. In this study, we describe a real-time quantitative reverse transcription PCR (qRT-PCR)-based multi-fusion gene screening method with the capacity to detect 22 fusion genes commonly found in leukemia. This method does not require pre-characterization of gene translocation events, thereby facilitating immediate diagnosis and therapeutic management. We performed fluorescent qRT-PCR (F-qRT-PCR) using a commercially-available multi-fusion gene detection kit on a patient cohort of 345 individuals comprising 108 cases diagnosed with acute myeloid leukemia (AML) for initial evaluation; remaining patients within the cohort were assayed for confirmatory diagnosis. Results obtained by F-qRT-PCR were compared alongside patient analysis by cytogenetic characterization. Gene translocations detected by F-qRT-PCR in AML cases were diagnosed in 69.4% of the patient cohort, which was comparatively similar to 68.5% as diagnosed by cytogenetic analysis, thereby demonstrating 99.1% concordance. Overall gene fusion was detected in 53.7% of the overall patient population by F-qRT-PCR, 52.9% by cytogenetic prediction in leukemia, and 9.1% in non-leukemia patients by both methods. The overall concordance rate was calculated to be 99.0%. Fusion genes were detected by F-qRT-PCR in 97.3% of patients with CML, followed by 69.4% with AML, 33.3% with acute lymphoblastic leukemia (ALL), 9.1% with myelodysplastic syndromes (MDS), and 0% with chronic lymphocytic leukemia (CLL). We describe the use of a F-qRT-PCR-based multi-fusion gene screening method as an efficient one-step diagnostic procedure as an

Differential Expression of Virulence Genes and Motility in Ralstonia (Pseudomonas) solanacearum during Exponential Growth.

PubMed

Clough, S J; Flavier, A B; Schell, M A; Denny, T P

1997-03-01

A complex network regulates virulence in Ralstonia solanacearum (formerly Pseudomonas solanacearum); central to this system is PhcA, a LysR-type transcriptional regulator. We report here that two PhcA-regulated virulence factors, endoglucanase (Egl) and acidic exopolysaccharide I (EPS I), and motility are expressed differentially during exponential growth in batch cultures. Tests with strains carrying lacZ fusions in a wild-type genetic background revealed that expression (on a per-cell basis) of phcA was constant but expression of egl and epsB increased 20- to 50-fold during multiplication from 1 x 10(sup7) to 5 x 10(sup8) CFU/ml. Expression of xpsR, an intermediate regulator downstream of PhcA in the regulatory cascade for eps expression, was similar to that of epsB and egl. Motility track photography revealed that all strains were essentially nonmotile at 10(sup6) CFU/ml. As cell density increased, 30 to 50% of wild-type cells were motile between 10(sup7) and 10(sup8) CFU/ml, but this population was again nonmotile at 10(sup9) CFU/ml. In contrast, about 60% of the cells of phcB and phcA mutants remained motile at 10(sup9) CFU/ml. Expression of phcB, which is not positively regulated by PhcA, was the inverse of epsB, egl, and xpsR (i.e., it decreased 20-fold at high cell density). PhcB is essential for production of an extracellular factor, tentatively identified as 3-hydroxypalmitic acid methyl ester (3-OH PAME), that might act as an exponential-phase signal to activate motility or expression of virulence genes. However, growth of the lacZ fusion strains in medium containing excess 3-OH PAME did not result in motility or expression of virulence genes at dramatically lower cell densities, suggesting that 3-OH PAME is not the only factor controlling these traits.

Fusion 2.0: The Next Generation of Fusion in California: Aligning State and Regional Fusion Centers

DTIC Science & Technology

2010-03-01

bible ” for fusion center management, as evidenced by the theme of the 2009 National Fusion Center Conference; appropriately called “Achieving Baseline...NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS FUSION 2.0: THE NEXT GENERATION OF FUSION IN CALIFORNIA: ALIGNING STATE AND...Master’s Thesis 4. TITLE AND SUBTITLE Fusion 2.0: The Next Generation of Fusion in California: Aligning State and Regional Fusion

The bHLH transcription factor Hand is regulated by Alk in the Drosophila embryonic gut

DOE Office of Scientific and Technical Information (OSTI.GOV)

Varshney, Gaurav K.; Palmer, Ruth H.

2006-12-29

During embryonic development the midgut visceral muscle is formed by fusion of cells within the visceral mesoderm, a process initiated by the specification of a specialised cell type, the founder cell, within this tissue. Activation of the receptor tyrosine kinase Anaplastic lymphoma kinase (Alk) in the developing visceral muscle of Drosophila melanogaster initiates a signal transduction pathway required for muscle fusion. In this paper, we have investigated downstream components which are regulated by this novel signalling pathway. Here we show that Alk-mediated signal transduction drives the expression of the bHLH transcription factor Hand in vivo. Loss of Alk function resultsmore » in a complete lack of Hand expression in this tissue, whereas Alk gain of function results in an expansion of Hand expression. Finally, we have investigated the process of muscle fusion in the gut of Hand mutant animals and can find no obvious defects in this process, suggesting that Hand is not critical for visceral muscle fusion per se.« less

Colorimetric TMPRSS2-ERG Gene Fusion Detection in Prostate Cancer Urinary Samples via Recombinase Polymerase Amplification.

PubMed

Koo, Kevin M; Wee, Eugene J H; Trau, Matt

2016-01-01

TMPRSS2 (Exon 1)-ERG (Exon 4) is the most frequent gene fusion event in prostate cancer (PC), and is highly PC-specific unlike the current serum prostate specific antigen (PSA) biomarker. However, TMPRSS2-ERG levels are currently measured with quantitative reverse-transcription PCR (RT-qPCR) which is time-consuming and requires costly equipment, thus limiting its use in clinical diagnostics. Herein, we report a novel rapid, cost-efficient and minimal-equipment assay named "FusBLU" for detecting TMPRSS2-ERG gene fusions from urine. TMPRSS2-ERG mRNA was amplified by isothermal reverse transcription-recombinase polymerase amplification (RT-RPA), magnetically-isolated, and detected through horseradish peroxidase (HRP)-catalyzed colorimetric reaction. FusBLU was specific for TMPRSS2-ERG mRNA with a low visual detection limit of 10(5) copies. We also demonstrated assay readout versatility on 3 potentially useful platforms. The colorimetric readout was detectable by naked eye for a quick yes/no evaluation of gene fusion presence. On the other hand, a more quantitative TMPRSS2-ERG detection was achievable by absorbance/electrochemical measurements. FusBLU was successfully applied to 12 urinary samples and results were validated by gold-standard RT-qPCR. We also showed that sediment RNA was likely the main source of TMPRSS2-ERG mRNA in urinary samples. We believe that our assay is a potential clinical screening tool for PC and could also have wide applications for other disease-related fusion genes.

Transcriptional regulation of fatty acid biosynthesis in mycobacteria

PubMed Central

Mondino, S.; Gago, G.; Gramajo, H.

2013-01-01

SUMMARY The main purpose of our study is to understand how mycobacteria exert control over the biosynthesis of their membrane lipids and find out the key components of the regulatory network that control fatty acid biosynthesis at the transcriptional level. In this paper we describe the identification and purification of FasR, a transcriptional regulator from Mycobacterium sp. that controls the expression of the fatty acid synthase (fas) and the 4-phosphopantetheinyl transferase (acpS) encoding genes, whose products are involved in the fatty acid and mycolic acid biosynthesis pathways. In vitro studies demonstrated that fas and acpS genes are part of the same transcriptional unit and that FasR specifically binds to three conserved operator sequences present in the fas-acpS promoter region (Pfas). The construction and further characterization of a fasR conditional mutant confirmed that FasR is a transcriptional activator of the fas-acpS operon and that this protein is essential for mycobacteria viability. Furthermore, the combined used of Pfas-lacZ fusions in different fasR backgrounds and electrophoretic mobility shift assays experiments, strongly suggested that long-chain acyl-CoAs are the effector molecules that modulate the affinity of FasR for its DNA binding sequences and therefore the expression of the essential fas-acpS operon. PMID:23721164

Development of a biochip-based assay integrated in a global strategy for identification of fusion transcripts in acute myeloid leukemia: a work flow for acute myeloid leukemia diagnosis.

PubMed

Giusiano, S; Formisano-Tréziny, C; Benziane, A; Maroc, N; Picard, C; Hermitte, F; Taranger-Charpin, C; Gabert, J

2010-08-01

Three major types of rearrangements are involved in acute myeloid leukemias (AML): t(8;21)(q22;q22), inv(16)(p13q22), and 11q23/MLL abnormalities. Their precise identification becomes essential for diagnosis, prognosis, and therapeutic choices. Resulting fusion transcripts (FT) are also powerful markers for monitoring the efficacy of treatment, the minimal residual disease (MRD) and could become therapeutic targets. Today, the challenge is to propose an individual follow-up for each patient even for those with a rare fusion event. In this study, we propose a biochip-based assay integrated in a global strategy for identification of rare FT in AML, after fluorescence in situ hybridization detection, as described by the World Health Organization classification. Using cell lines, we developed and validated a biochip-based assay called the AMLFusionChip that identifies every FT of AML1-ETO, CBFbeta-MYH11 as well as MLL-AF9, MLL-ENL, MLL-AF6, and MLL-AF10. The original design of our AMLFusionChip.v01 enables the identification of these FT wherever the breakpoint on the partner gene may be. In case of biochip negative result, our 3'RACE amplification strategy enables to clone and then sequence the new translocation partner. This AMLFusionChip strategy fits into the concept of personalized medicine for the largest number of patients.

A model for genesis of transcription systems.

PubMed

Burton, Zachary F; Opron, Kristopher; Wei, Guowei; Geiger, James H

2016-01-01

Repeating sequences generated from RNA gene fusions/ligations dominate ancient life, indicating central importance of building structural complexity in evolving biological systems. A simple and coherent story of life on earth is told from tracking repeating motifs that generate α/β proteins, 2-double-Ψ-β-barrel (DPBB) type RNA polymerases (RNAPs), general transcription factors (GTFs), and promoters. A general rule that emerges is that biological complexity that arises through generation of repeats is often bounded by solubility and closure (i.e., to form a pseudo-dimer or a barrel). Because the first DNA genomes were replicated by DNA template-dependent RNA synthesis followed by RNA template-dependent DNA synthesis via reverse transcriptase, the first DNA replication origins were initially 2-DPBB type RNAP promoters. A simplifying model for evolution of promoters/replication origins via repetition of core promoter elements is proposed. The model can explain why Pribnow boxes in bacterial transcription (i.e., (-12)TATAATG(-6)) so closely resemble TATA boxes (i.e., (-31)TATAAAAG(-24)) in archaeal/eukaryotic transcription. The evolution of anchor DNA sequences in bacterial (i.e., (-35)TTGACA(-30)) and archaeal (BRE(up); BRE for TFB recognition element) promoters is potentially explained. The evolution of BRE(down) elements of archaeal promoters is potentially explained.

Spatiotemporal regulation of cell fusion by JNK and JAK/STAT signaling during Drosophila wound healing.

PubMed

Lee, Ji-Hyun; Lee, Chan-Wool; Park, Si-Hyoung; Choe, Kwang-Min

2017-06-01

Cell-cell fusion is widely observed during development and disease, and imposes a dramatic change on participating cells. Cell fusion should be tightly controlled, but the underlying mechanism is poorly understood. Here, we found that the JAK/STAT pathway suppressed cell fusion during wound healing in the Drosophila larval epidermis, restricting cell fusion to the vicinity of the wound. In the absence of JAK/STAT signaling, a large syncytium containing a 3-fold higher number of nuclei than observed in wild-type tissue formed in wounded epidermis. The JAK/STAT ligand-encoding genes upd2 and upd3 were transcriptionally induced by wounding, and were required for suppressing excess cell fusion. JNK (also known as Basket in flies) was activated in the wound vicinity and activity peaked at ∼8 h after injury, whereas JAK/STAT signaling was activated in an adjoining concentric ring and activity peaked at a later stage. Cell fusion occurred primarily in the wound vicinity, where JAK/STAT activation was suppressed by fusion-inducing JNK signaling. JAK/STAT signaling was both necessary and sufficient for the induction of βPS integrin (also known as Myospheroid) expression, suggesting that the suppression of cell fusion was mediated at least in part by integrin protein. © 2017. Published by The Company of Biologists Ltd.

Regulation of the glv Operon in Bacillus subtilis: YfiA (GlvR) Is a Positive Regulator of the Operon That Is Repressed through CcpA and cre

PubMed Central

Yamamoto, Hiroki; Serizawa, Masakuni; Thompson, John; Sekiguchi, Junichi

2001-01-01

Maltose metabolism and the regulation of the glv operon of Bacillus subtilis, comprising three genes, glvA (6-phospho-α-glucosidase), yfiA (now designated glvR), and glvC (EIICB transport protein), were investigated. Maltose dissimilation was dependent primarily upon the glv operon, and insertional inactivation of either glvA, glvR, or glvC markedly inhibited growth on the disaccharide. A second system (MalL) contributed to a minor extent to maltose metabolism. Northern blotting revealed two transcripts corresponding to a monocistronic mRNA of glvA and a polycistronic mRNA of glvA-glvR-glvC. Primer extension analysis showed that both transcripts started at the same base (G) located 26 bp upstream of the 5′ end of glvA. When glvR was placed under control of the spac promoter, expression of the glv operon was dependent upon the presence of isopropyl-β-d-thiogalactopyranoside (IPTG). In regulatory studies, the promoter sequence of the glv operon was fused to lacZ and inserted into the amyE locus, and the resultant strain (AMGLV) was then transformed with a citrate-controlled glvR plasmid, pHYCM2VR. When cultured in Difco sporulation medium containing citrate, this transformant [AMGLV(pHYCM2VR)] expressed LacZ activity, but synthesis of LacZ was repressed by glucose. In an isogenic strain, [AMGLVCR(pHYCM2VR)], except for a mutation in the sequence of a catabolite-responsive element (cre), LacZ activity was expressed in the presence of citrate and glucose. Insertion of a citrate-controlled glvR plasmid at the amyE locus of ccpA+ and ccpA mutant organisms yielded strains AMCMVR and AMCMVRCC, respectively. In the presence of both glucose and citrate, AMCMVR failed to express the glv operon, whereas under the same conditions high-level expression of both mRNA transcripts was found in strain AMCMVRCC. Collectively, our findings suggest that GlvR (the product of the glvR gene) is a positive regulator of the glv operon and that glucose exerts its effect via catabolite

TaqMan based real time PCR assay targeting EML4-ALK fusion transcripts in NSCLC.

PubMed

Robesova, Blanka; Bajerova, Monika; Liskova, Kvetoslava; Skrickova, Jana; Tomiskova, Marcela; Pospisilova, Sarka; Mayer, Jiri; Dvorakova, Dana

2014-07-01

Lung cancer with the ALK rearrangement constitutes only a small fraction of patients with non-small cell lung cancer (NSCLC). However, in the era of molecular-targeted therapy, efficient patient selection is crucial for successful treatment. In this context, an effective method for EML4-ALK detection is necessary. We developed a new highly sensitive variant specific TaqMan based real time PCR assay applicable to RNA from formalin-fixed paraffin-embedded tissue (FFPE). This assay was used to analyze the EML4-ALK gene in 96 non-selected NSCLC specimens and compared with two other methods (end-point PCR and break-apart FISH). EML4-ALK was detected in 33/96 (34%) specimens using variant specific real time PCR, whereas in only 23/96 (24%) using end-point PCR. All real time PCR positive samples were confirmed with direct sequencing. A total of 46 specimens were subsequently analyzed by all three detection methods. Using variant specific real time PCR we identified EML4-ALK transcript in 17/46 (37%) specimens, using end-point PCR in 13/46 (28%) specimens and positive ALK rearrangement by FISH was detected in 8/46 (17.4%) specimens. Moreover, using variant specific real time PCR, 5 specimens showed more than one EML4-ALK variant simultaneously (in 2 cases the variants 1+3a+3b, in 2 specimens the variants 1+3a and in 1 specimen the variant 1+3b). In one case of 96 EML4-ALK fusion gene and EGFR mutation were detected. All simultaneous genetic variants were confirmed using end-point PCR and direct sequencing. Our variant specific real time PCR assay is highly sensitive, fast, financially acceptable, applicable to FFPE and seems to be a valuable tool for the rapid prescreening of NSCLC patients in clinical practice, so, that most patients able to benefit from targeted therapy could be identified. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Identification of KIF5B-RET and GOPC-ROS1 fusions in lung adenocarcinomas through a comprehensive mRNA-based screen for tyrosine kinase fusions

PubMed Central

Suehara, Yoshiyuki; Arcila, Maria; Wang, Lu; Hasanovic, Adnan; Ang, Daphne; Ito, Tatsuo; Kimura, Yuki; Drilon, Alexander; Guha, Udayan; Rusch, Valerie; Kris, Mark G.; Zakowski, Maureen F.; Rizvi, Naiyer; Khanin, Raya; Ladanyi, Marc

2014-01-01

Background The mutually exclusive pattern of the major driver oncogenes in lung cancer suggests that other mutually exclusive oncogenes exist. We performed a systematic search for tyrosine kinase (TK) fusions by screening all TKs for aberrantly high RNA expression levels of the 3′ kinase domain (KD) exons relative to more 5′ exons. Methods We studied 69 patients (including 5 never smokers and 64 current or former smokers) with lung adenocarcinoma negative for all major mutations in KRAS, EGFR, BRAF, MEK1, and HER2, and for ALK fusions (termed “pan-negative”). A NanoString-based assay was designed to query the transcripts of 90 TKs at two points: 5′ to the KD and within the KD or 3′ to it. Tumor RNAs were hybridized to the NanoString probes and analyzed for outlier 3′ to 5′ expression ratios. Presumed novel fusion events were studied by rapid amplification of cDNA ends (RACE) and confirmatory RT-PCR and FISH. Results We identified 1 case each of aberrant 3′ to 5′ ratios in ROS1 and RET. RACE isolated a GOPC-ROS1 (FIG-ROS1) fusion in the former and a KIF5B-RET fusion in the latter, both confirmed by RT-PCR. The RET rearrangement was also confirmed by FISH. The KIF5B-RET patient was one of only 5 never smokers in this cohort. Conclusion The KIF5B-RET fusion defines an additional subset of lung cancer with a potentially targetable driver oncogene enriched in never smokers with “pan-negative” lung adenocarcinomas. We also report for the first time in lung cancer the GOPC-ROS1 fusion previously characterized in glioma. PMID:23052255

Imaging Erg and Jun transcription factor interaction in living cells using fluorescence resonance energy transfer analyses

DOE Office of Scientific and Technical Information (OSTI.GOV)

Camuzeaux, Barbara; Spriet, Corentin; Heliot, Laurent

2005-07-15

Physical interactions between transcription factors play important roles in modulating gene expression. Previous in vitro studies have shown a transcriptional synergy between Erg protein, an Ets family member, and Jun/Fos heterodimer, members of the bZip family, which requires direct Erg-Jun protein interactions. Visualization of protein interactions in living cells is a new challenge in biology. For this purpose, we generated fusion proteins of Erg, Fos, and Jun with yellow and cyan fluorescent proteins, YFP and CFP, respectively. After transient expression in HeLa cells, interactions of the resulting fusion proteins were explored by fluorescence resonance energy transfer microscopy (FRET) in fixedmore » and living cells. FRET between YFP-Erg and CFP-Jun was monitored by using photobleaching FRET and fluorescence lifetime imaging microscopy. Both techniques revealed the occurrence of intermolecular FRET between YFP-Erg and CFP-Jun. This is stressed by loss of FRET with an YFP-Erg version carrying a point mutation in its ETS domain. These results provide evidence for the interaction of Erg and Jun proteins in living cells as a critical prerequisite of their transcriptional synergy, but also for the essential role of the Y371 residue, conserved in most Ets proteins, in this interaction.« less

Transcriptional regulation of the tad locus in Aggregatibacter actinomycetemcomitans: a termination cascade.

PubMed

Kram, Karin E; Hovel-Miner, Galadriel A; Tomich, Mladen; Figurski, David H

2008-06-01

The tad (tight adherence) locus of Aggregatibacter actinomycetemcomitans includes genes for the biogenesis of Flp pili, which are necessary for bacterial adhesion to surfaces, biofilm formation, and pathogenesis. Although studies have elucidated the functions of some of the Tad proteins, little is known about the regulation of the tad locus in A. actinomycetemcomitans. A promoter upstream of the tad locus was previously identified and shown to function in Escherichia coli. Using a specially constructed reporter plasmid, we show here that this promoter (tadp) functions in A. actinomycetemcomitans. To study expression of the pilin gene (flp-1) relative to that of tad secretion complex genes, we used Northern hybridization analysis and a lacZ reporter assay. We identified three terminators, two of which (T1 and T2) can explain flp-1 mRNA abundance, while the third (T3) is at the end of the locus. T1 and T3 have the appearance and behavior of intrinsic terminators, while T2 has a different structure and is inhibited by bicyclomycin, indicating that T2 is probably Rho dependent. To help achieve the appropriate stoichiometry of the Tad proteins, we show that a transcriptional-termination cascade is important to the proper expression of the tad genes. These data indicate a previously unreported mechanism of regulation in A. actinomycetemcomitans and lead to a more complete understanding of its Flp pilus biogenesis.

Decoding of exon splicing patterns in the human RUNX1-RUNX1T1 fusion gene.

PubMed

Grinev, Vasily V; Migas, Alexandr A; Kirsanava, Aksana D; Mishkova, Olga A; Siomava, Natalia; Ramanouskaya, Tatiana V; Vaitsiankova, Alina V; Ilyushonak, Ilia M; Nazarov, Petr V; Vallar, Laurent; Aleinikova, Olga V

2015-11-01

The t(8;21) translocation is the most widespread genetic defect found in human acute myeloid leukemia. This translocation results in the RUNX1-RUNX1T1 fusion gene that produces a wide variety of alternative transcripts and influences the course of the disease. The rules of combinatorics and splicing of exons in the RUNX1-RUNX1T1 transcripts are not known. To address this issue, we developed an exon graph model of the fusion gene organization and evaluated its local exon combinatorics by the exon combinatorial index (ECI). Here we show that the local exon combinatorics of the RUNX1-RUNX1T1 gene follows a power-law behavior and (i) the vast majority of exons has a low ECI, (ii) only a small part is represented by "exons-hubs" of splicing with very high ECI values, and (iii) it is scale-free and very sensitive to targeted skipping of "exons-hubs". Stochasticity of the splicing machinery and preferred usage of exons in alternative splicing can explain such behavior of the system. Stochasticity may explain up to 12% of the ECI variance and results in a number of non-coding and unproductive transcripts that can be considered as a noise. Half-life of these transcripts is increased due to the deregulation of some key genes of the nonsense-mediated decay system in leukemia cells. On the other hand, preferred usage of exons may explain up to 75% of the ECI variability. Our analysis revealed a set of splicing-related cis-regulatory motifs that can explain "attractiveness" of exons in alternative splicing but only when they are considered together. Cis-regulatory motifs are guides for splicing trans-factors and we observed a leukemia-specific profile of expression of the splicing genes in t(8;21)-positive blasts. Altogether, our results show that alternative splicing of the RUNX1-RUNX1T1 transcripts follows strict rules and that the power-law component of the fusion gene organization confers a high flexibility to this process. Copyright © 2015 Elsevier Ltd. All rights

Oncogenic fusion proteins adopt the insulin-like growth factor signaling pathway.

PubMed

Werner, Haim; Meisel-Sharon, Shilhav; Bruchim, Ilan

2018-02-19

The insulin-like growth factor-1 receptor (IGF1R) has been identified as a potent anti-apoptotic, pro-survival tyrosine kinase-containing receptor. Overexpression of the IGF1R gene constitutes a typical feature of most human cancers. Consistent with these biological roles, cells expressing high levels of IGF1R are expected not to die, a quintessential feature of cancer cells. Tumor specific chromosomal translocations that disrupt the architecture of transcription factors are a common theme in carcinogenesis. Increasing evidence gathered over the past fifteen years demonstrate that this type of genomic rearrangements is common not only among pediatric and hematological malignancies, as classically thought, but may also provide a molecular and cytogenetic foundation for an ever-increasing portion of adult epithelial tumors. In this review article we provide evidence that the mechanism of action of oncogenic fusion proteins associated with both pediatric and adult malignancies involves transactivation of the IGF1R gene, with ensuing increases in IGF1R levels and ligand-mediated receptor phosphorylation. Disrupted transcription factors adopt the IGF1R signaling pathway and elicit their oncogenic activities via activation of this critical regulatory network. Combined targeting of oncogenic fusion proteins along with the IGF1R may constitute a promising therapeutic approach.

Nucleophosmin regulates the stability and transcriptional activity of p53.

PubMed

Colombo, Emanuela; Marine, Jean-Christophe; Danovi, Davide; Falini, Brunangelo; Pelicci, Pier Giuseppe

2002-07-01

Nucleophosmin (NPM) is a ubiquitously expressed nucleolar phosphoprotein that continuously shuttles between the nucleus and cytoplasm. It has been proposed to function in ribosomal protein assembly and transport, and also as a molecular chaperone that prevents proteins from aggregating in the crowded environment of the nucleolus. The NPM gene is involved in several tumour-associated chromosome translocations, which have resulted in the formation of fusion proteins that retain the amino terminus of NPM, including NPM ALK, NPM RAR and NPM MLF1 (ref. 6). It is generally thought that the NPM component is not involved in the transforming potential of these fusion proteins, but instead provides a dimerization interface for the oligomerization and the oncogenic conversion of the various NPM partners (ALK, RAR, MLF1). Here we show that NPM interacts directly with the tumour suppressor p53, regulates the increase in stability and transcriptional activation of p53 after different types of stress, and induces p53-dependent premature senescence on overexpression in diploid fibroblasts. These findings indicate that NPM is a crucial regulator of p53 and suggest that alterations of the NPM function by NPM fusion proteins might lead to deregulation of p53 in tumours.

EDITORIAL: The Nuclear Fusion Award The Nuclear Fusion Award

NASA Astrophysics Data System (ADS)

Kikuchi, M.

2011-01-01

The Nuclear Fusion Award ceremony for 2009 and 2010 award winners was held during the 23rd IAEA Fusion Energy Conference in Daejeon. This time, both 2009 and 2010 award winners were celebrated by the IAEA and the participants of the 23rd IAEA Fusion Energy Conference. The Nuclear Fusion Award is a paper prize to acknowledge the best distinguished paper among the published papers in a particular volume of the Nuclear Fusion journal. Among the top-cited and highly-recommended papers chosen by the Editorial Board, excluding overview and review papers, and by analyzing self-citation and non-self-citation with an emphasis on non-self-citation, the Editorial Board confidentially selects ten distinguished papers as nominees for the Nuclear Fusion Award. Certificates are given to the leading authors of the Nuclear Fusion Award nominees. The final winner is selected among the ten nominees by the Nuclear Fusion Editorial Board voting confidentially. 2009 Nuclear Fusion Award nominees For the 2009 award, the papers published in the 2006 volume were assessed and the following papers were nominated, most of which are magnetic confinement experiments, theory and modeling, while one addresses inertial confinement. Sabbagh S.A. et al 2006 Resistive wall stabilized operation in rotating high beta NSTX plasmas Nucl. Fusion 46 635-44 La Haye R.J. et al 2006 Cross-machine benchmarking for ITER of neoclassical tearing mode stabilization by electron cyclotron current drive Nucl. Fusion 46 451-61 Honrubia J.J. et al 2006 Three-dimensional fast electron transport for ignition-scale inertial fusion capsules Nucl. Fusion 46 L25-8 Ido T. et al 2006 Observation of the interaction between the geodesic acoustic mode and ambient fluctuation in the JFT-2M tokamak Nucl. Fusion 46 512-20 Plyusnin V.V. et al 2006 Study of runaway electron generation during major disruptions in JET Nucl. Fusion 46 277-84 Pitts R.A. et al 2006 Far SOL ELM ion energies in JET Nucl. Fusion 46 82-98 Berk H.L. et al 2006

Inducible somatic embryogenesis in Theobroma cacao achieved using the DEX-activatable transcription factor-glucocorticoid receptor fusion.

PubMed

Shires, Morgan E; Florez, Sergio L; Lai, Tina S; Curtis, Wayne R

2017-11-01

To carry out mass propagation of superior plants to improve agricultural and silvicultural production though advancements in plant cell totipotency, or the ability of differentiated somatic plant cells to regenerate an entire plant. The first demonstration of a titratable control over somatic embryo formation in a commercially relevant plant, Theobroma cacao (Chocolate tree), was achieved using a dexamethasone activatable chimeric transcription factor. This four-fold enhancement in embryo production rate utilized a glucocorticoid receptor fused to an embryogenic transcription factor LEAFY COTYLEDON 2. Where previous T. cacao somatic embryogenesis has been restricted to dissected flower parts, this construct confers an unprecedented embryogenic potential to leaves. Activatable chimeric transcription factors provide a means for elucidating the regulatory cascade associated with plant somatic embryogenesis towards improving its use for somatic regeneration of transgenics and plant propagation.

Fusion

NASA Astrophysics Data System (ADS)

Herman, Robin

1990-10-01

The book abounds with fascinating anecdotes about fusion's rocky path: the spurious claim by Argentine dictator Juan Peron in 1951 that his country had built a working fusion reactor, the rush by the United States to drop secrecy and publicize its fusion work as a propaganda offensive after the Russian success with Sputnik; the fortune Penthouse magazine publisher Bob Guccione sank into an unconventional fusion device, the skepticism that met an assertion by two University of Utah chemists in 1989 that they had created "cold fusion" in a bottle. Aimed at a general audience, the book describes the scientific basis of controlled fusion--the fusing of atomic nuclei, under conditions hotter than the sun, to release energy. Using personal recollections of scientists involved, it traces the history of this little-known international race that began during the Cold War in secret laboratories in the United States, Great Britain and the Soviet Union, and evolved into an astonishingly open collaboration between East and West.

Genetic Tool Development for a New Host for Biotechnology, the Thermotolerant Bacterium Bacillus coagulans▿ †

PubMed Central

Kovács, Ákos T.; van Hartskamp, Mariska; Kuipers, Oscar P.; van Kranenburg, Richard

2010-01-01

Bacillus coagulans has good potential as an industrial production organism for platform chemicals from renewable resources but has limited genetic tools available. Here, we present a targeted gene disruption system using the Cre-lox system, development of a LacZ reporter assay for monitoring gene transcription, and heterologous d-lactate dehydrogenase expression. PMID:20400555

MYB89 Transcription Factor Represses Seed Oil Accumulation1[OPEN

PubMed Central

Li, Dong; Jin, Changyu; Duan, Shaowei; Zhu, Yana; Qi, Shuanghui; Liu, Kaige; Gao, Chenhao; Ma, Haoli; Liao, Yuncheng

2017-01-01

In many higher plants, seed oil accumulation is precisely controlled by intricate multilevel regulatory networks, among which transcriptional regulation mainly influences oil biosynthesis. In Arabidopsis (Arabidopsis thaliana), the master positive transcription factors, WRINKLED1 (WRI1) and LEAFY COTYLEDON1-LIKE (L1L), are important for seed oil accumulation. We found that an R2R3-MYB transcription factor, MYB89, was expressed predominantly in developing seeds during maturation. Oil and major fatty acid biosynthesis in seeds was significantly promoted by myb89-1 mutation and MYB89 knockdown; thus, MYB89 was an important repressor during seed oil accumulation. RNA sequencing revealed remarkable up-regulation of numerous genes involved in seed oil accumulation in myb89 seeds at 12 d after pollination. Posttranslational activation of a MYB89-glucocorticoid receptor fusion protein and chromatin immunoprecipitation assays demonstrated that MYB89 inhibited seed oil accumulation by directly repressing WRI1 and five key genes and by indirectly suppressing L1L and 11 key genes involved in oil biosynthesis during seed maturation. These results help us to understand the novel function of MYB89 and provide new insights into the regulatory network of transcriptional factors controlling seed oil accumulation in Arabidopsis. PMID:27932421

Multi-layered nanoparticles for penetrating the endosome and nuclear membrane via a step-wise membrane fusion process.

PubMed

Akita, Hidetaka; Kudo, Asako; Minoura, Arisa; Yamaguti, Masaya; Khalil, Ikramy A; Moriguchi, Rumiko; Masuda, Tomoya; Danev, Radostin; Nagayama, Kuniaki; Kogure, Kentaro; Harashima, Hideyoshi

2009-05-01

Efficient targeting of DNA to the nucleus is a prerequisite for effective gene therapy. The gene-delivery vehicle must penetrate through the plasma membrane, and the DNA-impermeable double-membraned nuclear envelope, and deposit its DNA cargo in a form ready for transcription. Here we introduce a concept for overcoming intracellular membrane barriers that involves step-wise membrane fusion. To achieve this, a nanotechnology was developed that creates a multi-layered nanoparticle, which we refer to as a Tetra-lamellar Multi-functional Envelope-type Nano Device (T-MEND). The critical structural elements of the T-MEND are a DNA-polycation condensed core coated with two nuclear membrane-fusogenic inner envelopes and two endosome-fusogenic outer envelopes, which are shed in stepwise fashion. A double-lamellar membrane structure is required for nuclear delivery via the stepwise fusion of double layered nuclear membrane structure. Intracellular membrane fusions to endosomes and nuclear membranes were verified by spectral imaging of fluorescence resonance energy transfer (FRET) between donor and acceptor fluorophores that had been dually labeled on the liposome surface. Coating the core with the minimum number of nucleus-fusogenic lipid envelopes (i.e., 2) is essential to facilitate transcription. As a result, the T-MEND achieves dramatic levels of transgene expression in non-dividing cells.

Desmoplastic small round cell tumor: evaluation of reverse transcription-polymerase chain reaction and fluorescence in situ hybridization as ancillary molecular diagnostic techniques.

PubMed

Mohamed, Mustafa; Gonzalez, David; Fritchie, Karen J; Swansbury, John; Wren, Dorte; Benson, Charlotte; Jones, Robin L; Fisher, Cyril; Thway, Khin

2017-11-01

Desmoplastic small round cell tumor (DSRCT) is a rare, biologically aggressive soft tissue neoplasm of uncertain differentiation, most often arising in the abdominal and pelvic cavities of adolescents and young adults with a striking male predominance. Histologically, it is characterized by islands of uniform small round cells in prominent desmoplastic stroma, and it has a polyimmunophenotypic profile, typically expressing WT1 and cytokeratin, desmin, and neural/neuroendocrine differentiation markers to varying degrees. Tumors at other sites and with variant morphology are more rarely described. DSRCT is associated with a recurrent t(11;22)(p13;q12) translocation, leading to the characteristic EWSR1-WT1 gene fusion. Fluorescence in situ hybridization (FISH), to detect EWSR1 rearrangement, and reverse transcription-polymerase chain reaction (RT-PCR) to assess for EWSR1-WT1 fusion transcripts are routine diagnostic ancillary tools. We present a large institutional comparative series of FISH and RT-PCR for DSRCT diagnosis. Twenty-six specimens (from 25 patients) histologically diagnosed as DSRCT were assessed for EWSR1 rearrangement and EWSR1-WT1 fusion transcripts. Of these 26 specimens, 24 yielded positive results with either FISH or RT-PCR or both. FISH was performed in 23 samples, with EWSR1 rearrangement seen in 21 (91.3%). RT-PCR was performed in 18 samples, of which 13 (72.2%) harbored EWSR1-WT1 fusion transcripts. The sensitivity of FISH in detecting DSRCT was 91.3%, and that of RT-PCR was 92.8% following omission of four technical failures. Therefore, both methods are comparable in terms of sensitivity. FISH is more sensitive if technical failures for RT-PCR are taken into account, and RT-PCR is more specific in confirming DSRCT. Both methods complement each other by confirming cases that the other method may not. In isolation, FISH is a relatively non-specific diagnostic adjunct due to the number of different neoplasms that can harbor EWSR1 rearrangement

Development of novel metabolite-responsive transcription factors via transposon-mediated protein fusion.

PubMed

Younger, Andrew K D; Su, Peter Y; Shepard, Andrea J; Udani, Shreya V; Cybulski, Thaddeus R; Tyo, Keith E J; Leonard, Joshua N

2018-02-01

Naturally evolved metabolite-responsive biosensors enable applications in metabolic engineering, ranging from screening large genetic libraries to dynamically regulating biosynthetic pathways. However, there are many metabolites for which a natural biosensor does not exist. To address this need, we developed a general method for converting metabolite-binding proteins into metabolite-responsive transcription factors-Biosensor Engineering by Random Domain Insertion (BERDI). This approach takes advantage of an in vitro transposon insertion reaction to generate all possible insertions of a DNA-binding domain into a metabolite-binding protein, followed by fluorescence activated cell sorting to isolate functional biosensors. To develop and evaluate the BERDI method, we generated a library of candidate biosensors in which a zinc finger DNA-binding domain was inserted into maltose binding protein, which served as a model well-studied metabolite-binding protein. Library diversity was characterized by several methods, a selection scheme was deployed, and ultimately several distinct and functional maltose-responsive transcriptional biosensors were identified. We hypothesize that the BERDI method comprises a generalizable strategy that may ultimately be applied to convert a wide range of metabolite-binding proteins into novel biosensors for applications in metabolic engineering and synthetic biology. © The Author(s) 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

PubMed

Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

2010-07-04

Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

Dual-mode enhancement of metallothionein protein with cell transduction and retention peptide fusion.

PubMed

Lim, Kwang Suk; Lim, Myoung-Hwa; Won, Young-Wook; Kim, Jang Kyoung; Kang, Young Cheol; Park, Eun Jeong; Chae, Ji-Won; Kim, So-Mi; Ryu, Seong-Eon; Pak, Youngmi Kim; Kim, Yong-Hee

2013-10-28

Protein transduction domains (PTDs), also known as cell-penetrating peptides (CPPs), have been developed as effective systems for delivering bio-active cargos such as proteins, genes and particles. Further improvements on cell-specific targeting, intracellular organelle targeting and intracellular retention are still necessary to enhance the therapeutic effect of PTD fusion proteins. In order to enhance the cell transduction and retention of anti-oxidative metallothionein protein (MT), MT was recombinantly fused with transcriptional activator (Tat) with or without a short peptide (sMTS) derived from mitochondria malate dehydrogenase (mMDH). Cellular uptake and retention time of fusion protein were significantly increased in the H9c2 cell by sMTS. The Tat-sMTS-MT (TMM) fusion protein protected H9c2 cells more effectively against hypoxia, hyperglycemia and combination compared with Tat-MT (TM) by reducing intracellular ROS level. It maintained the normal blood glucose level over an extended period of time in a streptozotocin-induced diabetic mouse model. PTD-sMTS-MT fusion protein has a potential to be used as a therapeutic protein for the treatment or prevention of diabetes and diabetic complications. © 2013.

Export of the Virulence Factors from Shigella Flexneri and Characterization of the mxi loci

DTIC Science & Technology

1992-07-20

steps in Shigella pathogenesis. To identify temperature-regulated virulence genes on the plasmid, lacZ protein fusions were randomly generated in S ...this locus conferred the Mxi- phenotype and was found to affect virulence of S . flexneri at the level of invasion, which correlated with reduced...excretion of IpaC. Protease protection experiments indicated the presence of high intracellular reservoirs of Ipa proteins in wild-type S . flexneri as

EWS-FLI1 inhibits TNF{alpha}-induced NF{kappa}B-dependent transcription in Ewing sarcoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lagirand-Cantaloube, Julie, E-mail: julie.cantaloube@crbm.cnrs.fr; Laud, Karine, E-mail: karine.laud@curie.fr; Institut Curie, Genetique et biologie des cancers, Paris

2010-09-03

Research highlights: {yields} EWS-FLI1 interferes with TNF-induced activation of NF{kappa}B in Ewing sarcoma cells. {yields} EWS-FLI1 knockdown in Ewing sarcoma cells increases TNF-induced NF{kappa}B binding to DNA. {yields} EWS-FLI1 reduces TNF-stimulated NF{kappa}B-dependent transcriptional activation. {yields} Constitutive NF{kappa}B activity is not affected by EWS-FLI1. {yields} EWS-FLI1 physically interacts with NF{kappa}B p65 in vivo. -- Abstract: Ewing sarcoma is primarily caused by a t(11;22) chromosomal translocation encoding the EWS-FLI1 fusion protein. To exert its oncogenic function, EWS-FLI1 acts as an aberrant transcription factor, broadly altering the gene expression profile of tumor cells. Nuclear factor-kappaB (NF{kappa}B) is a tightly regulated transcription factor controllingmore » cell survival, proliferation and differentiation, as well as tumorigenesis. NF{kappa}B activity is very low in unstimulated Ewing sarcoma cells, but can be induced in response to tumor necrosis factor (TNF). We wondered whether NF{kappa}B activity could be modulated by EWS-FLI1 in Ewing sarcoma. Using a knockdown approach in Ewing sarcoma cells, we demonstrated that EWS-FLI1 has no influence on NF{kappa}B basal activity, but impairs TNF-induced NF{kappa}B-driven transcription, at least in part through inhibition of NF{kappa}B binding to DNA. We detected an in vivo physical interaction between the fusion protein and NF{kappa}B p65, which could mediate these effects. Our findings suggest that, besides directly controlling the activity of its primary target promoters, EWS-FLI1 can also indirectly influence gene expression in tumor cells by modulating the activity of key transcription factors such as NF{kappa}B.« less

Endogenous IL-33 is highly expressed in mouse epithelial barrier tissues, lymphoid organs, brain, embryos, and inflamed tissues: in situ analysis using a novel Il-33-LacZ gene trap reporter strain.

PubMed

Pichery, Mélanie; Mirey, Emilie; Mercier, Pascale; Lefrancais, Emma; Dujardin, Arnaud; Ortega, Nathalie; Girard, Jean-Philippe

2012-04-01

IL-33 (previously known as NF from high endothelial venules) is an IL-1 family cytokine that signals through the ST2 receptor and drives cytokine production in mast cells, basophils, eosinophils, invariant NKT and NK cells, Th2 lymphocytes, and type 2 innate immune cells (natural helper cells, nuocytes, and innate helper 2 cells). Little is known about endogenous IL-33; for instance, the cellular sources of IL-33 in mouse tissues have not yet been defined. In this study, we generated an Il-33-LacZ gene trap reporter strain (Il-33(Gt/Gt)) and used this novel tool to analyze expression of endogenous IL-33 in vivo. We found that the Il-33 promoter exhibits constitutive activity in mouse lymphoid organs, epithelial barrier tissues, brain, and embryos. Immunostaining with anti-IL-33 Abs, using Il-33(Gt/Gt) (Il-33-deficient) mice as control, revealed that endogenous IL-33 protein is highly expressed in mouse epithelial barrier tissues, including stratified squamous epithelia from vagina and skin, as well as cuboidal epithelium from lung, stomach, and salivary gland. Constitutive expression of IL-33 was not detected in blood vessels, revealing the existence of species-specific differences between humans and mice. Importantly, IL-33 protein was always localized in the nucleus of producing cells with no evidence for cytoplasmic localization. Finally, strong expression of the Il-33-LacZ reporter was also observed in inflamed tissues, in the liver during LPS-induced endotoxin shock, and in the lung alveoli during papain-induced allergic airway inflammation. Together, our findings support the possibility that IL-33 may function as a nuclear alarmin to alert the innate immune system after injury or infection in epithelial barrier tissues.

A metabolic function of FGFR3-TACC3 gene fusions in cancer.

PubMed

Frattini, Véronique; Pagnotta, Stefano M; Tala; Fan, Jerry J; Russo, Marco V; Lee, Sang Bae; Garofano, Luciano; Zhang, Jing; Shi, Peiguo; Lewis, Genevieve; Sanson, Heloise; Frederick, Vanessa; Castano, Angelica M; Cerulo, Luigi; Rolland, Delphine C M; Mall, Raghvendra; Mokhtari, Karima; Elenitoba-Johnson, Kojo S J; Sanson, Marc; Huang, Xi; Ceccarelli, Michele; Lasorella, Anna; Iavarone, Antonio

2018-01-11

Chromosomal translocations that generate in-frame oncogenic gene fusions are notable examples of the success of targeted cancer therapies. We have previously described gene fusions of FGFR3-TACC3 (F3-T3) in 3% of human glioblastoma cases. Subsequent studies have reported similar frequencies of F3-T3 in many other cancers, indicating that F3-T3 is a commonly occuring fusion across all tumour types. F3-T3 fusions are potent oncogenes that confer sensitivity to FGFR inhibitors, but the downstream oncogenic signalling pathways remain unknown. Here we show that human tumours with F3-T3 fusions cluster within transcriptional subgroups that are characterized by the activation of mitochondrial functions. F3-T3 activates oxidative phosphorylation and mitochondrial biogenesis and induces sensitivity to inhibitors of oxidative metabolism. Phosphorylation of the phosphopeptide PIN4 is an intermediate step in the signalling pathway of the activation of mitochondrial metabolism. The F3-T3-PIN4 axis triggers the biogenesis of peroxisomes and the synthesis of new proteins. The anabolic response converges on the PGC1α coactivator through the production of intracellular reactive oxygen species, which enables mitochondrial respiration and tumour growth. These data illustrate the oncogenic circuit engaged by F3-T3 and show that F3-T3-positive tumours rely on mitochondrial respiration, highlighting this pathway as a therapeutic opportunity for the treatment of tumours with F3-T3 fusions. We also provide insights into the genetic alterations that initiate the chain of metabolic responses that drive mitochondrial metabolism in cancer.

Annexin A2-S100A10 heterotetramer is upregulated by PML/RARα fusion protein and promotes plasminogen-dependent fibrinolysis and matrix invasion in acute promyelocytic leukemia.

PubMed

Huang, Dan; Yang, Yan; Sun, Jian; Dong, Xiaorong; Wang, Jiao; Liu, Hongchen; Lu, Chengquan; Chen, Xueyu; Shao, Jing; Yan, Jinsong

2017-09-01

Aberrant expression of annexin A2-S100A10 heterotetramer (AIIt) associated with PML/RARα fusion protein causes lethal hyperfibrinolysis in acute promyelocytic leukemia (APL), but the mechanism is unclear. To facilitate the investigation of regulatory association between ANXA2 and promyelocytic leukemia/retinoic acid receptor a (PML/RARα) fusion protein, this work was performed to determine the transcription start site of ANXA2 promoter with rapid amplification of 5'-cDNA ends analysis. Zinc-induced U937/PR9 cells expressed PML/RARα fusion protein, and resultant increases in ANXA2 transcripts and translational expressions of both ANXA2 and S100A10, while S100A10 transcripts remained constitutive. The transactivation of ANXA2 promoter by PML/RARα fusion protein was 3.29 ± 0.13 fold higher than that by control pSG5 vector or wild-type RARα. The overexpression of ANXA2 in U937 transfected with full-length ANXA2 cDNA was associated with increased S100A10 subunit, although S100A10 transcripts remained constitutive. The tPA-dependent initial rate of plasmin generation (IRPG) in zinc-treated U937/PR9 increased by 2.13-fold, and cell invasiveness increased by 27.6%. Antibodies against ANXA2, S100A10, or combination of both all remarkably inhibited the IRPG and invasiveness in U937/PR9 and NB4. Treatment of zinc-induced U937/PR9 or circulating APL blasts with all-trans retinoic acid (ATRA) significantly reduced cell surface ANXA2 and S100A10 and associated reductions in IRPG and invasiveness. Thus, PML/RARα fusion protein transactivated the ANXA2 promoter to upregulate ANXA2 and accumulate S100A10. Increased AIIt promoted IRPG and invasiveness, both of which were partly abolished by antibodies against ANXA2 and S100A10 or by ATRA.

The Effects of Select Histidine to Cysteine Mutations on Transcriptional Regulation by E. coli RcnR‡

PubMed Central

Higgins, Khadine A.; Hu, Heidi Q.; Chivers, Peter T.; Maroney, Michael J.

2013-01-01

The RcnR metalloregulator represses the transcription of the Co(II) and Ni(II) exporter, RcnAB. Previous studies have shown that Co(II) and Ni(II) bind to RcnR in six-coordinate sites, resulting in de-repression. Here, the roles of His60, His64, and His67 in specific metal recognition are examined. His60 and His64 correspond to ligands that are important for Cu(I) binding in the homologous Cu(I)-responsive metalloregulator, CsoR. These residues are known to be functionally important in RcnR transcriptional regulation. XAS was used to examine the structure of bound cognate and non-cognate metal ions, and lacZ reporter assays were used to assess the transcription of rcnA in response to metal binding in the three His → Cys mutations, H60C, H64C and H67C. These studies confirm that both Ni(II) and Co(II) use His64 as a ligand. H64C-RcnR is also the only known mutation that retains a Co(II) response while eliminating the response to Ni(II) binding. XAS data indicate that His60 and His67 are potential Co(II) ligands. The effects of the mutations of His60, His64, and His67 residues on the structures of the non-cognate metal ions (Zn(II) and Cu(I)) reveals that these residues have distinctive roles in binding non-cognate metals. None of the His → Cys mutants in RcnR confer any response to Cu(I) binding, including H64C-RcnR, where the ligands involved in Cu(I) binding in CsoR are present. These data indicate that while the secondary, tertiary and quaternary structures of CsoR and RcnR are quite similar, small changes in primary sequence reveal that the specific mechanisms involved in metal recognition are quite different. PMID:23215580

Unscrambling the genomic chaos of osteosarcoma reveals extensive transcript fusion, recurrent rearrangements and frequent novel TP53 aberrations

PubMed Central

Lorenz, Susanne; Barøy, Tale; Sun, Jinchang; Nome, Torfinn; Vodák, Daniel; Bryne, Jan-Christian; Håkelien, Anne-Mari; Fernandez-Cuesta, Lynnette; Möhlendick, Birte; Rieder, Harald; Szuhai, Karoly; Zaikova, Olga; Ahlquist, Terje C.; Thomassen, Gard O. S.; Skotheim, Rolf I.; Lothe, Ragnhild A.; Tarpey, Patrick S.; Campbell, Peter; Flanagan, Adrienne

2016-01-01

In contrast to many other sarcoma subtypes, the chaotic karyotypes of osteosarcoma have precluded the identification of pathognomonic translocations. We here report hundreds of genomic rearrangements in osteosarcoma cell lines, showing clear characteristics of microhomology-mediated break-induced replication (MMBIR) and end-joining repair (MMEJ) mechanisms. However, at RNA level, the majority of the fused transcripts did not correspond to genomic rearrangements, suggesting the involvement of trans-splicing, which was further supported by typical trans-splicing characteristics. By combining genomic and transcriptomic analysis, certain recurrent rearrangements were identified and further validated in patient biopsies, including a PMP22-ELOVL5 gene fusion, genomic structural variations affecting RB1, MTAP/CDKN2A and MDM2, and, most frequently, rearrangements involving TP53. Most cell lines (7/11) and a large fraction of tumor samples (10/25) showed TP53 rearrangements, in addition to somatic point mutations (6 patient samples, 1 cell line) and MDM2 amplifications (2 patient samples, 2 cell lines). The resulting inactivation of p53 was demonstrated by a deficiency of the radiation-induced DNA damage response. Thus, TP53 rearrangements are the major mechanism of p53 inactivation in osteosarcoma. Together with active MMBIR and MMEJ, this inactivation probably contributes to the exceptional chromosomal instability in these tumors. Although rampant rearrangements appear to be a phenotype of osteosarcomas, we demonstrate that among the huge number of probable passenger rearrangements, specific recurrent, possibly oncogenic, events are present. For the first time the genomic chaos of osteosarcoma is characterized so thoroughly and delivered new insights in mechanisms involved in osteosarcoma development and may contribute to new diagnostic and therapeutic strategies. PMID:26672768

Distinct signatures for mutator sensitivity of lacZ reversions and for the spectrum of lacI/lacO forward mutations on the chromosome of nondividing Escherichia coli.

PubMed Central

Bharatan, Shanti M; Reddy, Manjula; Gowrishankar, J

2004-01-01

A conditional lethal galE(Ts)-based strategy was employed in Escherichia coli, first to eliminate all growth-associated chromosomal reversions in lacZ or forward mutations in lacI/lacO by incubation at the restrictive temperature and subsequently to recover (as papillae) spontaneous mutations that had arisen in the population of nondividing cells after shift to the permissive temperature. Data from lacZ reversion studies in mutator strains indicated that the products of all genes for mismatch repair (mutHLS, dam, uvrD), of some for oxidative damage repair (mutMT), and of that for polymerase proofreading (dnaQ) are required in dividing cells; some others for oxidative damage repair (mutY, nth nei) are required in both dividing and nondividing cells; and those for alkylation damage repair (ada ogt) are required in nondividing cells. The spectrum of lacI/lacO mutations in nondividing cells was distinguished both by lower frequencies of deletions and IS1 insertions and by the unique occurrence of GC-to-AT transitions at lacO +5. In the second approach to study mutations that had occurred in nondividing cells, lacI/lacO mutants were selected as late-arising papillae from the lawn of a galE+ strain; once again, transitions at lacO +5 were detected among the mutants that had been obtained from populations initially grown on poor carbon sources such as acetate, palmitate, or succinate. Our results indicate that the lacO +5 site is mutable only in nondividing cells, one possible mechanism for which might be that random endogenous alkylation (or oxidative) damage to DNA in these cells is efficiently corrected by the Ada Ogt (or Nth Nei) repair enzymes at most sites but not at lacO +5. Furthermore, the late-arising papillae from the second approach were composed almost exclusively of dominant lacI/lacO mutants. This finding lends support to "instantaneous gratification" models in which a spontaneous lesion, occurring at a random site in DNA of a nondividing cell, is most

High Level Information Fusion (HLIF) with nested fusion loops

NASA Astrophysics Data System (ADS)

Woodley, Robert; Gosnell, Michael; Fischer, Amber

2013-05-01

Situation modeling and threat prediction require higher levels of data fusion in order to provide actionable information. Beyond the sensor data and sources the analyst has access to, the use of out-sourced and re-sourced data is becoming common. Through the years, some common frameworks have emerged for dealing with information fusion—perhaps the most ubiquitous being the JDL Data Fusion Group and their initial 4-level data fusion model. Since these initial developments, numerous models of information fusion have emerged, hoping to better capture the human-centric process of data analyses within a machine-centric framework. 21st Century Systems, Inc. has developed Fusion with Uncertainty Reasoning using Nested Assessment Characterizer Elements (FURNACE) to address challenges of high level information fusion and handle bias, ambiguity, and uncertainty (BAU) for Situation Modeling, Threat Modeling, and Threat Prediction. It combines JDL fusion levels with nested fusion loops and state-of-the-art data reasoning. Initial research has shown that FURNACE is able to reduce BAU and improve the fusion process by allowing high level information fusion (HLIF) to affect lower levels without the double counting of information or other biasing issues. The initial FURNACE project was focused on the underlying algorithms to produce a fusion system able to handle BAU and repurposed data in a cohesive manner. FURNACE supports analyst's efforts to develop situation models, threat models, and threat predictions to increase situational awareness of the battlespace. FURNACE will not only revolutionize the military intelligence realm, but also benefit the larger homeland defense, law enforcement, and business intelligence markets.

Epithelioid fibrous histiocytoma: molecular characterization of ALK fusion partners in 23 cases.

PubMed

Dickson, Brendan C; Swanson, David; Charames, George S; Fletcher, Christopher Dm; Hornick, Jason L

2018-05-01

Epithelioid fibrous histiocytoma is a rare and distinctive cutaneous neoplasm. Most cases harbor ALK rearrangement and show ALK overexpression, which distinguish this neoplasm from conventional cutaneous fibrous histiocytoma and variants. SQSTM1 and VCL have previously been shown to partner with ALK in one case each of epithelioid fibrous histiocytoma. The purpose of this study was to examine a large cohort of epithelioid fibrous histiocytomas by next-generation sequencing to characterize the nature and prevalence of ALK fusion partners. A retrospective archival review was performed to identify cases of epithelioid fibrous histiocytoma (2012-2016). Immunohistochemistry was performed to confirm ALK expression. Targeted next-generation sequencing was applied on RNA extracted from formalin-fixed paraffin-embedded tissue to identify the fusion partners. Twenty-three cases fulfilled inclusion criteria. The mean patient age was 39 years (range, 8-74), there was no sex predilection, and >75% of cases involved the lower extremities. The most common gene fusions were SQSTM1-ALK (N=12; 52%) and VCL-ALK (N=7; 30%); the other four cases harbored novel fusion partners (DCTN1, ETV6, PPFIBP1, and SPECC1L). The pattern of ALK immunoreactivity was usually granular cytoplasmic (N=12; 52%) or granular cytoplasmic and nuclear (N=10; 43%); the case containing an ETV6 fusion partner showed nuclear staining alone. There was no apparent relationship between tumor morphology and the ALK fusion partner. In summary, SQSTM1 and VCL are the most common ALK fusion partners in epithelioid fibrous histiocytoma; DCTN1, ETV6, PPFIBP1, and SPECC1L represent rare fusion partners. The proteins encoded by these genes play diverse roles in scaffolding, cell adhesion, signaling, and transcription (among others) without clear commonalities. These findings expand the oncogenic promiscuity of many of these ALK fusion genes, which drive neoplasia in tumors of diverse lineages with widely varied clinical

Recurrent PAX3-MAML3 Fusion in Biphenotypic Sinonasal Sarcoma

PubMed Central

Wang, Xiaoke; Bledsoe, Krista L.; Graham, Rondell P.; Asmann, Yan W.; Viswanatha, David S.; Lewis, Jean E.; Lewis, Jason T.; Chou, Margaret M.; Yaszemski, Michael J.; Jen, Jin; Westendorf, Jennifer J.; Oliveira, André M.

2014-01-01

Biphenotypic sinonasal sarcoma (SNS) is a newly described tumor of the nasal and paranasal areas. Herein, we report the novel recurring chromosomal translocation t(2;4)(q35;q31.1) in SNS. The translocation results in the formation of the fusion protein PAX3-MAML3, which is a potent transcriptional activator of PAX3 response elements. The SNS phenotype is characterized by aberrant expression of genes involved in neuroectodermal and myogenic differentiation, which closely simulates the developmental roles of PAX3. PMID:24859338

Msx1 is expressed in retina endothelial cells at artery branching sites.

PubMed

Lopes, Miguel; Goupille, Olivier; Saint Cloment, Cécile; Robert, Benoît

2012-04-15

Msx1 and Msx2 encode homeodomain transcription factors that play a role in several embryonic developmental processes. Previously, we have shown that in the adult mouse, Msx1(lacZ) is expressed in vascular smooth muscle cells (VSMCs) and pericytes, and that Msx2(lacZ) is also expressed in VSMCs as well as in a few endothelial cells (ECs). The mouse retina and choroid are two highly vascularized tissues. Vessel alterations in the retina are associated with several human diseases and the retina has been intensely used for angiogenesis studies, whereas the choroid has been much less investigated. Using the Msx1(lacZ) and Msx2(lacZ) reporter alleles, we observed that Msx2 is not expressed in the eye vascular tree in contrast to Msx1, for which we establish the spatial and temporal expression pattern in these tissues. In the retina, expression of Msx1 takes place from P3, and by P10, it becomes confined to a subpopulation of ECs at branching points of superficial arterioles. These branching sites are characterized by a subpopulation of mural cells that also show specific expression programs. Specific Msx gene inactivation in the endothelium, using Msx1 and Msx2 conditional mutant alleles together with a Tie2-Cre transgene, did not lead to conspicuous structural defects in the retinal vascular network. Expression of Msx1 at branching sites might therefore be linked to vessel physiology. The retinal blood flow is autonomously regulated and perfusion of capillaries has been proposed to depend on arteriolar precapillary structures that might be the sites for Msx1 expression. On the other hand, branching sites are subject to shear stress that might induce Msx1 expression. In the choroid vascular layer Msx1(lacZ) is expressed more broadly and dynamically. At birth Msx1(lacZ) expression takes place in the endothelium but at P21 its expression has shifted towards the mural layer. We discuss the possible functions of Msx1 in the eye vasculature.

Msx1 is expressed in retina endothelial cells at artery branching sites

PubMed Central

Lopes, Miguel; Goupille, Olivier; Saint Cloment, Cécile; Robert, Benoît

2012-01-01

Summary Msx1 and Msx2 encode homeodomain transcription factors that play a role in several embryonic developmental processes. Previously, we have shown that in the adult mouse, Msx1lacZ is expressed in vascular smooth muscle cells (VSMCs) and pericytes, and that Msx2lacZ is also expressed in VSMCs as well as in a few endothelial cells (ECs). The mouse retina and choroid are two highly vascularized tissues. Vessel alterations in the retina are associated with several human diseases and the retina has been intensely used for angiogenesis studies, whereas the choroid has been much less investigated. Using the Msx1lacZ and Msx2lacZ reporter alleles, we observed that Msx2 is not expressed in the eye vascular tree in contrast to Msx1, for which we establish the spatial and temporal expression pattern in these tissues. In the retina, expression of Msx1 takes place from P3, and by P10, it becomes confined to a subpopulation of ECs at branching points of superficial arterioles. These branching sites are characterized by a subpopulation of mural cells that also show specific expression programs. Specific Msx gene inactivation in the endothelium, using Msx1 and Msx2 conditional mutant alleles together with a Tie2-Cre transgene, did not lead to conspicuous structural defects in the retinal vascular network. Expression of Msx1 at branching sites might therefore be linked to vessel physiology. The retinal blood flow is autonomously regulated and perfusion of capillaries has been proposed to depend on arteriolar precapillary structures that might be the sites for Msx1 expression. On the other hand, branching sites are subject to shear stress that might induce Msx1 expression. In the choroid vascular layer Msx1lacZ is expressed more broadly and dynamically. At birth Msx1lacZ expression takes place in the endothelium but at P21 its expression has shifted towards the mural layer. We discuss the possible functions of Msx1 in the eye vasculature. PMID:23213427

A novel positive transcriptional feedback loop in midbrain-hindbrain boundary development is revealed through analysis of the zebrafish pax2.1 promoter in transgenic lines.

PubMed

Picker, Alexander; Scholpp, Steffen; Böhli, Heike; Takeda, Hiroyuki; Brand, Michael

2002-07-01

The pax2.1 gene encodes a paired-box transcription factor that is one of the earliest genes to be specifically activated in development of the midbrain and midbrain-hindbrain boundary (MHB), and is required for the development and organizer activity of this territory. To understand how this spatially restricted transcriptional activity of pax2.1 is achieved, we have isolated and characterized the pax2.1-promoter using a lacZ and a GFP reporter gene in transient injection assays and transgenic lines. Stable transgenic expression of this reporter gene shows that a 5.3-kb fragment of the 5' region contains most, but not all, elements required for driving pax2.1 expression. The expressing tissues include the MHB, hindbrain, spinal cord, ear and pronephros. Transgene activation in the pronephros and developing ear suggests that these pax2.1-expressing tissues are composed of independently regulated subdomains. In addition, ectopic but spatially restricted activation of the reporter genes in rhombomeres 3 and 5 and in the forebrain, which do not normally express endogenous pax2.1, demonstrates the importance of negative regulation of pax2.1. Comparison of transgene expression in wild-type and homozygous pax2.1 mutant no isthmus (noi) embryos reveals that the transgene contains control element(s) for a novel, positive transcriptional feedback loop in MHB development. Transcription of endogenous pax2.1 at the MHB is known to be initially Pax2.1 independent, during activation in late gastrulation. In contrast, transgene expression requires the endogenous Pax2.1 function. Transplantations, mRNA injections and morpholino knock-down experiments show that this feedback regulation of pax2.1 transcription occurs cell-autonomously, and that it requires eng2 and eng3 as known targets for Pax2.1 regulation. We suggest that this novel feedback loop may allow continuation of pax2.1 expression, and hence development of the MHB organizer, to become independent of the patterning

KIAA1549-BRAF fusions and IDH mutations can coexist in diffuse gliomas of adults.

PubMed

Badiali, Manuela; Gleize, Vincent; Paris, Sophie; Moi, Loredana; Elhouadani, Selma; Arcella, Antonietta; Morace, Roberta; Antonelli, Manila; Buttarelli, Francesca Romana; Figarella-Branger, Dominique; Kim, Young-Ho; Ohgaki, Hiroko; Mokhtari, Karima; Sanson, Marc; Giangaspero, Felice

2012-11-01

KIAA1549-BRAF fusion gene and isocitrate dehydrogenase (IDH) mutations are considered two mutually exclusive genetic events in pilocytic astrocytomas and diffuse gliomas, respectively. We investigated the presence of the KIAA1549-BRAF fusion gene in conjunction with IDH mutations and 1p/19q loss in 185 adult diffuse gliomas. Moreover BRAF(v600E) mutation was also screened. The KIAA1549-BRAF fusion gene was evaluated by reverse-transcription polymerase chain reaction (RT-PCR) and sequencing. We found IDH mutations in 125 out 175 cases (71.4%). There were KIAA1549-BRAF fusion gene in 17 out of 180 (9.4%) cases and BRAF(v600E) in 2 out of 133 (1.5%) cases. In 11 of these 17 cases, both IDH mutations and the KIAA1549-BRAF fusion were present, as independent molecular events. Moreover, 6 of 17 cases showed co-presence of 1p/19q loss, IDH mutations and KIAA1549-BRAF fusion. Among the 17 cases with KIAA1549-BRAF fusion gene 15 (88.2%) were oligodendroglial neoplasms. Similarly, the two cases with BRAF(v600E) mutation were both oligodendroglioma and one had IDH mutations and 1p/19q co-deletion. Our results suggest that in a small fraction of diffuse gliomas, KIAA1549-BRAF fusion gene and BRAF(v600E) mutation may be responsible for deregulation of the Ras-RAF-ERK signaling pathway. Such alterations are more frequent in oligodendroglial neoplasm and may be co-present with IDH mutations and 1p/19q loss. © 2012 The Authors; Brain Pathology © 2012 International Society of Neuropathology.

A novel fusion of HNRNPA1-ALK in inflammatory myofibroblastic tumor of urinary bladder.

PubMed

Inamura, Kentaro; Kobayashi, Maki; Nagano, Hiroko; Sugiura, Yoshiya; Ogawa, Masahiro; Masuda, Hitoshi; Yonese, Junji; Ishikawa, Yuichi

2017-11-01

Here, we report an inflammatory myofibroblastic tumor (IMT) of the urinary bladder with a novel HNRNPA1-ALK fusion. To the best of our knowledge, this is the first case of a tumor with HNRNPA1-ALK fusion. A 42-year-old Japanese man underwent total cystectomy because of an invasive urinary bladder tumor. Grossly, the tumor had invaded the peribladder fat tissue. Histologically, it comprised spindle neoplastic cells with intermingled inflammatory cells. Immunohistochemically, it was positive for ALK, SMA, desmin, cytokeratin, and vimentin, consistent with the immunohistochemical characteristics of IMTs. Fluorescence in situ hybridization demonstrated an ALK split, and the presence of HNRNPA1-ALK was revealed by RNA sequencing. We identified a novel transcript fusion of exon 2 of HNRNPA1 and exon 18 of ALK, resulting in ALK protein overexpression. These findings provide useful information on the biology and tumorigenesis of IMTs, thus facilitating the development of molecular-targeted therapeutics. Copyright © 2017 Elsevier Inc. All rights reserved.

Shikimate Induced Transcriptional Activation of Protocatechuate Biosynthesis Genes by QuiR, a LysR-Type Transcriptional Regulator, in Listeria monocytogenes.

PubMed

Prezioso, Stephanie M; Xue, Kevin; Leung, Nelly; Gray-Owen, Scott D; Christendat, Dinesh

2018-04-27

Listeria monocytogenes is a common foodborne bacterial pathogen that contaminates plant and animal consumable products. The persistent nature of L. monocytogenes is associated with millions of dollars in food recalls annually. Here, we describe the role of shikimate in directly modulating the expression of genes encoding enzymes for the conversion of quinate and shikimate metabolites to protocatechuate. In L. monocytogenes, these genes are found within two operons, named qui1 and qui2. In addition, a gene named quiR, encoding a LysR-Type Transcriptional Regulator (QuiR), is located immediately upstream of the qui1 operon. Transcriptional lacZ-promoter fusion experiments show that QuiR induces gene expression of both qui1 and qui2 operons in the presence of shikimate. Furthermore, co-crystallization of the QuiR effector binding domain in complex with shikimate provides insights into the mechanism of activation of this regulator. Together these data show that upon shikimate accumulation, QuiR activates the transcription of genes encoding enzymes involved in shikimate and quinate utilization for the production of protocatechuate. Furthermore, the accumulation of protocatechuate leads to the inhibition of Listeria growth. Since protocatechuate is not known to be utilized by Listeria, its role is distinct from those established in other bacteria. Copyright © 2018 Elsevier Ltd. All rights reserved.

Fusion breeder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moir, R.W.

1982-02-22

The fusion breeder is a fusion reactor designed with special blankets to maximize the transmutation by 14 MeV neutrons of uranium-238 to plutonium or thorium to uranium-233 for use as a fuel for fission reactors. Breeding fissile fuels has not been a goal of the US fusion energy program. This paper suggests it is time for a policy change to make the fusion breeder a goal of the US fusion program and the US nuclear energy program. The purpose of this paper is to suggest this policy change be made and tell why it should be made, and to outlinemore » specific research and development goals so that the fusion breeder will be developed in time to meet fissile fuel needs.« less

Fusion breeder

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moir, R.W.

1982-04-20

The fusion breeder is a fusion reactor designed with special blankets to maximize the transmutation by 14 MeV neutrons of uranium-238 to plutonium or thorium to uranium-233 for use as a fuel for fission reactors. Breeding fissile fuels has not been a goal of the US fusion energy program. This paper suggests it is time for a policy change to make the fusion breeder a goal of the US fusion program and the US nuclear energy program. The purpose of this paper is to suggest this policy change be made and tell why it should be made, and to outlinemore » specific research and development goals so that the fusion breeder will be developed in time to meet fissile fuel needs.« less

Detection of rearrangements and transcriptional up-regulation of ALK in FFPE lung cancer specimens using a novel, sensitive, quantitative reverse transcription polymerase chain reaction assay.

PubMed

Gruber, Kim; Horn, Heike; Kalla, Jörg; Fritz, Peter; Rosenwald, Andreas; Kohlhäufl, Martin; Friedel, Godehard; Schwab, Matthias; Ott, German; Kalla, Claudia

2014-03-01

The approved dual-color fluorescence in situ hybridization (FISH) test for the detection of anaplastic lymphoma receptor tyrosine kinase (ALK) gene rearrangements in non-small-cell lung cancer (NSCLC) is complex and represents a low-throughput assay difficult to use in daily diagnostic practice. We devised a sensitive and robust routine diagnostic test for the detection of rearrangements and transcriptional up-regulation of ALK. We developed a quantitative reverse transcription polymerase chain reaction (qRT-PCR) assay adapted to RNA isolated from routine formalin-fixed, paraffin-embedded material and applied it to 652 NSCLC specimens. The reliability of this technique to detect ALK dysregulation was shown by comparison with FISH and immunohistochemistry. qRT-PCR analysis detected unbalanced ALK expression indicative of a gene rearrangement in 24 (4.6%) and full-length ALK transcript expression in six (1.1%) of 523 interpretable tumors. Among 182 tumors simultaneously analyzed by FISH and qRT-PCR, the latter accurately typed 97% of 19 rearranged and 158 nonrearranged tumors and identified ALK deregulation in two cases with insufficient FISH. Six tumors expressing full-length ALK transcripts did not show rearrangements of the gene. Immunohistochemistry detected ALK protein overexpression in tumors with gene fusions and transcriptional up-regulation, but did not distinguish between the two. One case with full-length ALK expression carried a heterozygous point mutation (S1220Y) within the kinase domain potentially interfering with kinase activity and/or inhibitor binding. Our qRT-PCR assay reliably identifies and distinguishes ALK rearrangements and full-length transcript expression in formalin-fixed, paraffin-embedded material. It is an easy-to-perform, cost-effective, and high-throughput tool for the diagnosis of ALK activation. The expression of full-length ALK transcripts may be relevant for ALK inhibitor therapy in NSCLC.

Viral membrane fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Harrison, Stephen C., E-mail: harrison@crystal.harvard.edu

2015-05-15

Membrane fusion is an essential step when enveloped viruses enter cells. Lipid bilayer fusion requires catalysis to overcome a high kinetic barrier; viral fusion proteins are the agents that fulfill this catalytic function. Despite a variety of molecular architectures, these proteins facilitate fusion by essentially the same generic mechanism. Stimulated by a signal associated with arrival at the cell to be infected (e.g., receptor or co-receptor binding, proton binding in an endosome), they undergo a series of conformational changes. A hydrophobic segment (a “fusion loop” or “fusion peptide”) engages the target-cell membrane and collapse of the bridging intermediate thus formedmore » draws the two membranes (virus and cell) together. We know of three structural classes for viral fusion proteins. Structures for both pre- and postfusion conformations of illustrate the beginning and end points of a process that can be probed by single-virion measurements of fusion kinetics. - Highlights: • Viral fusion proteins overcome the high energy barrier to lipid bilayer merger. • Different molecular structures but the same catalytic mechanism. • Review describes properties of three known fusion-protein structural classes. • Single-virion fusion experiments elucidate mechanism.« less

Osteoclast fusion is initiated by a small subset of RANKL-stimulated monocyte progenitors, which can fuse to RANKL-unstimulated progenitors.

PubMed

Levaot, Noam; Ottolenghi, Aner; Mann, Mati; Guterman-Ram, Gali; Kam, Zvi; Geiger, Benjamin

2015-10-01

Osteoclasts are multinucleated, bone-resorbing cells formed via fusion of monocyte progenitors, a process triggered by prolonged stimulation with RANKL, the osteoclast master regulator cytokine. Monocyte fusion into osteoclasts has been shown to play a key role in bone remodeling and homeostasis; therefore, aberrant fusion may be involved in a variety of bone diseases. Indeed, research in the last decade has led to the discovery of genes regulating osteoclast fusion; yet the basic cellular regulatory mechanism underlying the fusion process is poorly understood. Here, we applied a novel approach for tracking the fusion processes, using live-cell imaging of RANKL-stimulated and non-stimulated progenitor monocytes differentially expressing dsRED or GFP, respectively. We show that osteoclast fusion is initiated by a small (~2.4%) subset of precursors, termed "fusion founders", capable of fusing either with other founders or with non-stimulated progenitors (fusion followers), which alone, are unable to initiate fusion. Careful examination indicates that the fusion between a founder and a follower cell consists of two distinct phases: an initial pairing of the two cells, typically lasting 5-35 min, during which the cells nevertheless maintain their initial morphology; and the fusion event itself. Interestingly, during the initial pre-fusion phase, a transfer of the fluorescent reporter proteins from nucleus to nucleus was noticed, suggesting crosstalk between the founder and follower progenitors via the cytoplasm that might directly affect the fusion process, as well as overall transcriptional regulation in the developing heterokaryon. Copyright © 2015 Elsevier Inc. All rights reserved.

Paramyxovirus fusion: Real-time measurement of parainfluenza virus 5 virus-cell fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Connolly, Sarah A.; Lamb, Robert A.

2006-11-25

Although cell-cell fusion assays are useful surrogate methods for studying virus fusion, differences between cell-cell and virus-cell fusion exist. To examine paramyxovirus fusion in real time, we labeled viruses with fluorescent lipid probes and monitored virus-cell fusion by fluorimetry. Two parainfluenza virus 5 (PIV5) isolates (W3A and SER) and PIV5 containing mutations within the fusion protein (F) were studied. Fusion was specific and temperature-dependent. Compared to many low pH-dependent viruses, the kinetics of PIV5 fusion was slow, approaching completion within several minutes. As predicted from cell-cell fusion assays, virus containing an F protein with an extended cytoplasmic tail (rSV5 F551)more » had reduced fusion compared to wild-type virus (W3A). In contrast, virus-cell fusion for SER occurred at near wild-type levels, despite the fact that this isolate exhibits a severely reduced cell-cell fusion phenotype. These results support the notion that virus-cell and cell-cell fusion have significant differences.« less

Oncogenic KIAA1549-BRAF fusion with activation of the MAPK/ERK pathway in pediatric oligodendrogliomas.

PubMed

Kumar, Anupam; Pathak, Pankaj; Purkait, Suvendu; Faruq, Mohammed; Jha, Prerana; Mallick, Supriya; Suri, Vaishali; Sharma, Mehar C; Suri, Ashish; Sarkar, Chitra

2015-03-01

Pediatric oligodendrogliomas (pODGs) are rare central nervous system tumors, and comparatively little is known about their molecular pathogenesis. Co-deletion of 1p/19q; and IDH1, CIC, and FUBP1 mutations, which are molecular signatures of adult oligodendrogliomas, are extremely rare in pODGs. In this report, two pODGs, one each of grade II and grade III, were evaluated using clinical, radiological, histopathologic, and follow-up methods. IDH1, TP53, CIC, H3F3A, and BRAF-V600 E mutations were analyzed by Sanger sequencing and immunohistochemical methods, and 1p/19q co-deletion was analyzed by fluorescence in situ hybridization. PDGFRA amplification, BRAF gain, intragenic duplication of FGFR-TKD, and KIAA1549-BRAF fusion (validated by Sanger sequencing) were analyzed by real-time reverse transcription PCR. Notably, both cases showed the oncogenic KIAA1549_Ex15-BRAF_Ex9 fusion transcript. Further, immunohistochemical analysis showed activation of the MAPK/ERK pathway in both of these cases. However, neither 1p/19q co-deletion; IDH1, TP53, CIC, H3F3A, nor BRAF-V600 E mutation; PDGFRA amplification; BRAF gain; nor duplication of FGFR-TKD was identified. Overall, this study highlights that pODGs can harbor the KIAA1549-BRAF fusion with aberrant MAPK/ERK signaling, and there exists an option of targeting these pathways in such patients. These results indicate that pODGs with the KIAA1549-BRAF fusion may represent a subset of this rare tumor that shares molecular and genetic features of pilocytic astrocytomas. These findings will increase our understanding of pODGs and may have clinical implications. Copyright © 2015 Elsevier Inc. All rights reserved.

Coexpression of an unusual form of the EWS-WT1 fusion transcript and interleukin 2/15 receptor betamRNA in a desmoplastic small round cell tumour.

PubMed

Nakanishi, Y; Oinuma, T; Sano, M; Fuchinoue, F; Komatsu, K; Seki, T; Obana, Y; Tabata, M; Kikuchi, K; Shimamura, M; Ohmori, K; Nemoto, N

2006-10-01

The beta chain of the interleukin 2/15 receptor (IL-2/15Rbeta) is induced by the expression of the EWS-WT1. A case of desmoplastic small round cell tumour (DSRCT) expressing only an unusual EWS-WT1 treated by us is reported here. To characterise an unusual form of EWS-WT1. Frozen tissue sections of the axillary tumour were examined using a laser-assisted microdissection technique and reverse transcriptase polymerase chain reaction. The novel fusion of exon 8 of EWS and the defective exon 10 of WT1 (-KTS) was detected. Although it was an unusual form, the coexpression of the present EWS-WT1, IL-2/15Rbeta and Janus kinase (JAK1) mRNA was detected in the tumour cells. IL-2 and signal transducers and activators of transcription (STAT5) mRNA were detected in both tumour and stromal cells. The induction of the IL-2/15 receptor signalling pathway may contribute to tumorigenesis in DSRCT through a paracrine or an autocrine system, even though the EWS-WT1 was an unusual form.

Capturing in vivo RNA transcriptional dynamics from the malaria parasite Plasmodium falciparum

PubMed Central

Painter, Heather J.; Carrasquilla, Manuela; Llinás, Manuel

2017-01-01

To capture the transcriptional dynamics within proliferating cells, methods to differentiate nascent transcription from preexisting mRNAs are desired. One approach is to label newly synthesized mRNA transcripts in vivo through the incorporation of modified pyrimidines. However, the human malaria parasite, Plasmodium falciparum, is incapable of pyrimidine salvage for mRNA biogenesis. To capture cellular mRNA dynamics during Plasmodium development, we engineered parasites that can salvage pyrimidines through the expression of a single bifunctional yeast fusion gene, cytosine deaminase/uracil phosphoribosyltransferase (FCU). We show that expression of FCU allows for the direct incorporation of thiol-modified pyrimidines into nascent mRNAs. Using developmental stage-specific promoters to express FCU-GFP enables the biosynthetic capture and in-depth analysis of mRNA dynamics from subpopulations of cells undergoing differentiation. We demonstrate the utility of this method by examining the transcriptional dynamics of the sexual gametocyte stage transition, a process that is essential to malaria transmission between hosts. Using the pfs16 gametocyte-specific promoter to express FCU-GFP in 3D7 parasites, we found that sexual stage commitment is governed by transcriptional reprogramming and stabilization of a subset of essential gametocyte transcripts. We also measured mRNA dynamics in F12 gametocyte-deficient parasites and demonstrate that the transcriptional program required for sexual commitment and maturation is initiated but likely aborted due to the absence of the PfAP2-G transcriptional regulator and a lack of gametocyte-specific mRNA stabilization. Biosynthetic labeling of Plasmodium mRNAs is incredibly versatile, can be used to measure transcriptional dynamics at any stage of parasite development, and will allow for future applications to comprehensively measure RNA-protein interactions in the malaria parasite. PMID:28416533

Loss of AXIN1 drives acquired resistance to WNT pathway blockade in colorectal cancer cells carrying RSPO3 fusions.

PubMed

Picco, Gabriele; Petti, Consalvo; Centonze, Alessia; Torchiaro, Erica; Crisafulli, Giovanni; Novara, Luca; Acquaviva, Andrea; Bardelli, Alberto; Medico, Enzo

2017-03-01

In colorectal cancer (CRC), WNT pathway activation by genetic rearrangements of RSPO3 is emerging as a promising target. However, its low prevalence severely limits availability of preclinical models for in-depth characterization. Using a pipeline designed to suppress stroma-derived signal, we find that RSPO3 "outlier" expression in CRC samples highlights translocation and fusion transcript expression. Outlier search in 151 CRC cell lines identified VACO6 and SNU1411 cells as carriers of, respectively, a canonical PTPRK(e1)-RSPO3(e2) fusion and a novel PTPRK(e13)-RSPO3(e2) fusion. Both lines displayed marked in vitro and in vivo sensitivity to WNT blockade by the porcupine inhibitor LGK974, associated with transcriptional and morphological evidence of WNT pathway suppression. Long-term treatment of VACO6 cells with LGK974 led to the emergence of a resistant population carrying two frameshift deletions of the WNT pathway inhibitor AXIN1, with consequent protein loss. Suppression of AXIN1 in parental VACO6 cells by RNA interference conferred marked resistance to LGK974. These results provide the first mechanism of secondary resistance to WNT pathway inhibition. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

The Myxococcus xanthus two-component system CorSR regulates expression of a gene cluster involved in maintaining copper tolerance during growth and development.

PubMed

Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

2013-01-01

Myxococcus xanthus is a soil-dwelling member of the δ-Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains.

The glnAntrBC operon of Herbaspirillum seropedicae is transcribed by two oppositely regulated promoters upstream of glnA.

PubMed

Schwab, Stefan; Souza, Emanuel M; Yates, Marshall G; Persuhn, Darlene C; Steffens, M Berenice R; Chubatsu, Leda S; Pedrosa, Fábio O; Rigo, Liu U

2007-01-01

Herbaspirillum seropedicae is an endophytic bacterium that fixes nitrogen under microaerophilic conditions. The putative promoter sequences glnAp1 (sigma70-dependent) and glnAp2 (sigma54), and two NtrC-binding sites were identified upstream from the glnA, ntrB and ntrC genes of this microorganism. To study their transcriptional regulation, we used lacZ fusions to the H. seropedicae glnA gene, and the glnA-ntrB and ntrB-ntrC intergenic regions. Expression of glnA was up-regulated under low ammonium, but no transcription activity was detected from the intergenic regions under any condition tested, suggesting that glnA, ntrB and ntrC are co-transcribed from the promoters upstream of glnA. Ammonium regulation was lost in the ntrC mutant strain. A point mutation was introduced in the conserved -25/-24 dinucleotide (GG-->TT) of the putative sigma54-dependent promoter (glnAp2). Contrary to the wild-type promoter, glnA expression with the mutant glnAp2 promoter was repressed in the wild-type strain under low ammonium levels, but this repression was abolished in an ntrC background. Together our results indicate that the H. seropedicae glnAntrBC operon is regulated from two functional promoters upstream from glnA, which are oppositely regulated by the NtrC protein.

Genes on a Wire: The Nucleoid-Associated Protein HU Insulates Transcription Units in Escherichia coli

PubMed Central

Berger, Michael; Gerganova, Veneta; Berger, Petya; Rapiteanu, Radu; Lisicovas, Viktoras; Dobrindt, Ulrich

2016-01-01

The extent to which chromosomal gene position in prokaryotes affects local gene expression remains an open question. Several studies have shown that chromosomal re-positioning of bacterial transcription units does not alter their expression pattern, except for a general decrease in gene expression levels from chromosomal origin to terminus proximal positions, which is believed to result from gene dosage effects. Surprisingly, the question as to whether this chromosomal context independence is a cis encoded property of a bacterial transcription unit, or if position independence is a property conferred by factors acting in trans, has not been addressed so far. For this purpose, we established a genetic test system assessing the chromosomal positioning effects by means of identical promoter-fluorescent reporter gene fusions inserted equidistantly from OriC into both chromosomal replichores of Escherichia coli K-12. Our investigations of the reporter activities in mutant cells lacking the conserved nucleoid associated protein HU uncovered various drastic chromosomal positional effects on gene transcription. In addition we present evidence that these positional effects are caused by transcriptional activity nearby the insertion site of our reporter modules. We therefore suggest that the nucleoid-associated protein HU is functionally insulating transcription units, most likely by constraining transcription induced DNA supercoiling. PMID:27545593

Analysis of nuclear export using photoactivatable GFP fusion proteins and interspecies heterokaryons.

PubMed

Nakrieko, Kerry-Ann; Ivanova, Iordanka A; Dagnino, Lina

2010-01-01

In this chapter, we review protocols for the analysis of nucleocytoplasmic shuttling of transcription factors and nuclear proteins, using two different approaches. The first involves the use of photoactivatable forms of the protein of interest by fusion to photoactivatable green fluorescent protein to follow its movement out of the nucleus by live-cell confocal microscopy. This methodology allows for the kinetic characterization of protein movements as well as measurement of steady-state levels. In a second procedure to assess the ability of a nuclear protein to move into and out of the nucleus, we describe the use of interspecies heterokaryon assays, which provide a measurement of steady-state distribution. These technologies are directly applicable to the analysis of nucleocytoplasmic movements not only of transcription factors, but also other nuclear proteins.

Cross-Regulation between the phz1 and phz2 Operons Maintain a Balanced Level of Phenazine Biosynthesis in Pseudomonas aeruginosa PAO1

PubMed Central

Jiang, Bei; Xiao, Bo; Liu, Linde; Ge, Yihe; Hu, Xiaomei

2016-01-01

Gene duplication often provides selective advantages for the survival of microorganisms in adapting to varying environmental conditions. P. aeruginosa PAO1 possesses two seven-gene operons [phz1 (phzA1B1C1D1E1F1G1) and phz2 (phzA2B2C2D2E2F2G2)] that are involved in the biosynthesis of phenazine-1-carboxylic acid and its derivatives. Although the two operons are highly homologous and their functions are well known, it is unclear how the two phz operons coordinate their expressions to maintain the phenazine biosynthesis. By constructing single and double deletion mutants of the two phz operons, we found that the phz1-deletion mutant produced the same or less amount of phenazine-1-carboxylic acid and pyocyanin in GA medium than the phz2-knockout mutant while the phz1-phz2 double knockout mutant did not produce any phenazines. By generating phzA1 and phzA2 translational and transcriptional fusions with a truncated lacZ reporter, we found that the expression of the phz1 operon increased significantly at the post-transcriptional level and did not alter at the transcriptional level in the absence of the phz2 operon. Surprisingly, the expression the phz2 operon increased significantly at the post-transcriptional level and only moderately at the transcriptional level in the absence of the phz1 operon. Our findings suggested that a complex cross-regulation existed between the phz1 and phz2 operons. By mediating the upregulation of one phz operon expression while the other was deleted, this crosstalk would maintain the homeostatic balance of phenazine biosynthesis in P. aeruginosa PAO1. PMID:26735915

Directing an artificial zinc finger protein to new targets by fusion to a non-DNA-binding domain.

PubMed

Lim, Wooi F; Burdach, Jon; Funnell, Alister P W; Pearson, Richard C M; Quinlan, Kate G R; Crossley, Merlin

2016-04-20

Transcription factors are often regarded as having two separable components: a DNA-binding domain (DBD) and a functional domain (FD), with the DBD thought to determine target gene recognition. While this holds true for DNA bindingin vitro, it appears thatin vivoFDs can also influence genomic targeting. We fused the FD from the well-characterized transcription factor Krüppel-like Factor 3 (KLF3) to an artificial zinc finger (AZF) protein originally designed to target the Vascular Endothelial Growth Factor-A (VEGF-A) gene promoter. We compared genome-wide occupancy of the KLF3FD-AZF fusion to that observed with AZF. AZF bound to theVEGF-Apromoter as predicted, but was also found to occupy approximately 25,000 other sites, a large number of which contained the expected AZF recognition sequence, GCTGGGGGC. Interestingly, addition of the KLF3 FD re-distributes the fusion protein to new sites, with total DNA occupancy detected at around 50,000 sites. A portion of these sites correspond to known KLF3-bound regions, while others contained sequences similar but not identical to the expected AZF recognition sequence. These results show that FDs can influence and may be useful in directing AZF DNA-binding proteins to specific targets and provide insights into how natural transcription factors operate. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Statins Increase Plasminogen Activator Inhibitor Type 1 Gene Transcription through a Pregnane X Receptor Regulated Element

PubMed Central

Stanley, Frederick M.; Linder, Kathryn M.; Cardozo, Timothy J.

2015-01-01

Plasminogen activator inhibitor type 1 (PAI-1) is a multifunctional protein that has important roles in inflammation and wound healing. Its aberrant regulation may contribute to many disease processes such as heart disease. The PAI-1 promoter is responsive to multiple inputs including cytokines, growth factors, steroids and oxidative stress. The statin drugs, atorvastatin, mevastatin and rosuvastatin, increased basal and stimulated expression of the PAI-1 promoter 3-fold. A statin-responsive, nuclear hormone response element was previously identified in the PAI-1 promoter, but it was incompletely characterized. We characterized this direct repeat (DR) of AGGTCA with a 3-nucleotide spacer at -269/-255 using deletion and directed mutagenesis. Deletion or mutation of this element increased basal transcription from the promoter suggesting that it repressed PAI-1 transcription in the unliganded state. The half-site spacing and the ligand specificity suggested that this might be a pregnane X receptor (PXR) responsive element. Computational molecular docking showed that atorvastatin, mevastatin and rosuvastatin were structurally compatible with the PXR ligand-binding pocket in its agonist conformation. Experiments with Gal4 DNA binding domain fusion proteins showed that Gal4-PXR was activated by statins while other DR + 3 binding nuclear receptor fusions were not. Overexpression of PXR further enhanced PAI-1 transcription in response to statins. Finally, ChIP experiments using Halo-tagged PXR and RXR demonstrated that both components of the PXR-RXR heterodimer bound to this region of the PAI-1 promoter. PMID:26379245

In vivo marking of spontaneous or vaccine-induced fibrosarcomas in the domestic house cat, using an adenoviral vector containing a bifunctional fusion protein, GAL-TEK.

PubMed

Marini, F C; Cannon, J P; Belmont, J W; Shillitoe, E J; Lapeyre, J N

1995-09-01

We evaluated the ability of a replication-deficient, recombinant adenoviral vector to transfer the bifunctional gene GAL-TEK, which expresses a marking/therapeutic gene product, to naturally occurring cat fibrosarcomas in situ. GAL-TEK contains an in-frame fusion of the bacterial LacZ gene for histochemical marking of tumors with beta-galactosidase (beta-Gal) and the HSV tk gene for enzyme-prodrug activation of the prodrug ganciclovir (GCV) to induce selective tumor cell killing. GAL-TEK bifunctional marking and cell killing activities were tested in vitro after adenoviral vector infection of HT1080 human fibrosarcoma cells. The tk activity of GAL-TEK is shown to be almost as potent as HSV tk to catalyze conversion of GCV to GCV nucleotides and promote selective cell killing. Using 8 cats with recurring 2.5-cm2 fibrosarcomas that either arose spontaneously or were induced by vaccine, we determined experimentally the administration routes and times required for optimum GAL-TEK gene transfer by beta-Gal histological staining and reverse transcriptase polymerase chain reaction to the multiple compartments of the growing fibrosarcomas consonant with minimizing collateral infection of neighboring tissues and other unwanted side effects.

Fusion between Intestinal epithelial cells and macrophages in a cancer context results in nuclear reprogramming.

PubMed

Powell, Anne E; Anderson, Eric C; Davies, Paige S; Silk, Alain D; Pelz, Carl; Impey, Soren; Wong, Melissa H

2011-02-15

The most deadly phase in cancer progression is attributed to the inappropriate acquisition of molecular machinery leading to metastatic transformation and spread of disease to distant organs. Although it is appreciated that metastasis involves epithelial-mesenchymal interplay, the underlying mechanism defining this process is poorly understood. Specifically, how cancer cells evade immune surveillance and gain the ability to navigate the circulatory system remains a focus. One possible mechanism underlying metastatic conversion is fusion between blood-derived immune cells and cancer cells. While this notion is a century old, in vivo evidence that cell fusion occurs within tumors and imparts genetic or physiologic changes remains controversial. We have previously demonstrated in vivo cell fusion between blood cells and intestinal epithelial cells in an injury setting. Here, we hypothesize that immune cells, such as macrophages, fuse with tumor cells imparting metastatic capabilities by transferring their cellular identity. We used parabiosis to introduce fluorescent-labeled bone marrow-derived cells to mice with intestinal tumors, finding that fusion between circulating blood-derived cells and tumor epithelium occurs during the natural course of tumorigenesis. Moreover, we identify the macrophage as a key cellular partner for this process. Interestingly, cell fusion hybrids retain a transcriptome identity characteristic of both parental derivatives, while also expressing a unique subset of transcripts. Our data supports the novel possibility that tumorigenic cell fusion may impart physical behavior attributed to migratory macrophages, including navigation of circulation and immune evasion. As such, cell fusion may represent a promising novel mechanism underlying the metastatic conversion of cancer cells. ©2011 AACR.

ChiTaRS-3.1-the enhanced chimeric transcripts and RNA-seq database matched with protein-protein interactions.

PubMed

Gorohovski, Alessandro; Tagore, Somnath; Palande, Vikrant; Malka, Assaf; Raviv-Shay, Dorith; Frenkel-Morgenstern, Milana

2017-01-04

Discovery of chimeric RNAs, which are produced by chromosomal translocations as well as the joining of exons from different genes by trans-splicing, has added a new level of complexity to our study and understanding of the transcriptome. The enhanced ChiTaRS-3.1 database (http://chitars.md.biu.ac.il) is designed to make widely accessible a wealth of mined data on chimeric RNAs, with easy-to-use analytical tools built-in. The database comprises 34 922: chimeric transcripts along with 11 714: cancer breakpoints. In this latest version, we have included multiple cross-references to GeneCards, iHop, PubMed, NCBI, Ensembl, OMIM, RefSeq and the Mitelman collection for every entry in the 'Full Collection'. In addition, for every chimera, we have added a predicted Chimeric Protein-Protein Interaction (ChiPPI) network, which allows for easy visualization of protein partners of both parental and fusion proteins for all human chimeras. The database contains a comprehensive annotation for 34 922: chimeric transcripts from eight organisms, and includes the manual annotation of 200 sense-antiSense (SaS) chimeras. The current improvements in the content and functionality to the ChiTaRS database make it a central resource for the study of chimeric transcripts and fusion proteins. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

Structure and regulation of KGD1, the structural gene for yeast alpha-ketoglutarate dehydrogenase.

PubMed

Repetto, B; Tzagoloff, A

1989-06-01

Nuclear respiratory-defective mutants of Saccharomyces cerevisiae have been screened for lesions in the mitochondrial alpha-ketoglutarate dehydrogenase complex. Strains assigned to complementation group G70 were ascertained to be deficient in enzyme activity due to mutations in the KGD1 gene coding for the alpha-ketoglutarate dehydrogenase component of the complex. The KGD1 gene has been cloned by transformation of a representative kgd1 mutant, C225/U1, with a recombinant plasmid library of wild-type yeast nuclear DNA. Transformants containing the gene on a multicopy plasmid had three- to four-times-higher alpha-ketoglutarate dehydrogenase activity than did wild-type S. cerevisiae. Substitution of the chromosomal copy of KGD1 with a disrupted allele (kgd1::URA3) induced a deficiency in alpha-ketoglutarate dehydrogenase. The sequence of the cloned region of DNA which complements kgd1 mutants was found to have an open reading frame of 3,042 nucleotides capable of coding for a protein of Mw 114,470. The encoded protein had 38% identical residues with the reported sequence of alpha-ketoglutarate dehydrogenase from Escherichia coli. Two lines of evidence indicated that transcription of KGD1 is catabolite repressed. Higher steady-state levels of KGD1 mRNA were detected in wild-type yeast grown on the nonrepressible sugar galactose than in yeast grown on high glucose. Regulation of KGD1 was also studied by fusing different 5'-flanking regions of KGD1 to the lacZ gene of E. coli and measuring the expression of beta-galactosidase in yeast. Transformants harboring a fusion of 693 nucleotides of the 5'-flanking sequence expressed 10 times more beta-galactosidase activity when grown under derepressed conditions. The response to the carbon source was reduced dramatically when the same lacZ fusion was present in a hap2 or hap3 mutant. The promoter element(s) responsible for the regulated expression of KGD1 has been mapped to the -354 to -143 region. This region contained several

Cation-induced transcriptional regulation of the dlt operon of Staphylococcus aureus.

PubMed

Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P

2006-05-01

Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with D-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. D-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating D-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na(+) and moderate concentrations of Mg(2+) and Ca(2+) but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg(2+)-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg(2+)-induced repression of the dlt operon in S. aureus.

Cation-Induced Transcriptional Regulation of the dlt Operon of Staphylococcus aureus

PubMed Central

Koprivnjak, Tomaz; Mlakar, Vid; Swanson, Lindsey; Fournier, Benedicte; Peschel, Andreas; Weiss, Jerrold P.

2006-01-01

Lipoteichoic and wall teichoic acids (TA) are highly anionic cell envelope-associated polymers containing repeating polyglycerol/ribitol phosphate moieties. Substitution of TA with d-alanine is important for modulation of many cell envelope-dependent processes, such as activity of autolytic enzymes, binding of divalent cations, and susceptibility to innate host defenses. d-Alanylation of TA is diminished when bacteria are grown in medium containing increased NaCl concentrations, but the effects of increased salt concentration on expression of the dlt operon encoding proteins mediating d-alanylation of TA are unknown. We demonstrate that Staphylococcus aureus transcriptionally represses dlt expression in response to high concentrations of Na+ and moderate concentrations of Mg2+ and Ca2+ but not sucrose. Changes in dlt mRNA are induced within 15 min and sustained for several generations of growth. Mg2+-induced dlt repression depends on the ArlSR two-component system. Northern blotting, reverse transcription-PCR, and SMART-RACE analyses suggest that the dlt transcript begins 250 bp upstream of the dltA start codon and includes an open reading frame immediately upstream of dltA. Chloramphenicol transacetylase transcriptional fusions indicate that a region encompassing the 171 to 325 bp upstream of dltA is required for expression and Mg2+-induced repression of the dlt operon in S. aureus. PMID:16672616

Evidence for Moonlighting Functions of the θ Subunit of Escherichia coli DNA Polymerase III

PubMed Central

Dietrich, M.; Pedró, L.; García, J.; Pons, M.; Hüttener, M.; Paytubi, S.; Madrid, C.

2014-01-01

The holE gene is an enterobacterial ORFan gene (open reading frame [ORF] with no detectable homology to other ORFs in a database). It encodes the θ subunit of the DNA polymerase III core complex. The precise function of the θ subunit within this complex is not well established, and loss of holE does not result in a noticeable phenotype. Paralogs of holE are also present on many conjugative plasmids and on phage P1 (hot gene). In this study, we provide evidence indicating that θ (HolE) exhibits structural and functional similarities to a family of nucleoid-associated regulatory proteins, the Hha/YdgT-like proteins that are also encoded by enterobacterial ORFan genes. Microarray studies comparing the transcriptional profiles of Escherichia coli holE, hha, and ydgT mutants revealed highly similar expression patterns for strains harboring holE and ydgT alleles. Among the genes differentially regulated in both mutants were genes of the tryptophanase (tna) operon. The tna operon consists of a transcribed leader region, tnaL, and two structural genes, tnaA and tnaB. Further experiments with transcriptional lacZ fusions (tnaL::lacZ and tnaA::lacZ) indicate that HolE and YdgT downregulate expression of the tna operon by possibly increasing the level of Rho-dependent transcription termination at the tna operon's leader region. Thus, for the first time, a regulatory function can be attributed to HolE, in addition to its role as structural component of the DNA polymerase III complex. PMID:24375106

Rho GTPase activity modulates paramyxovirus fusion protein-mediated cell-cell fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schowalter, Rachel M.; Wurth, Mark A.; Aguilar, Hector C.

2006-07-05

The paramyxovirus fusion protein (F) promotes fusion of the viral envelope with the plasma membrane of target cells as well as cell-cell fusion. The plasma membrane is closely associated with the actin cytoskeleton, but the role of actin dynamics in paramyxovirus F-mediated membrane fusion is unclear. We examined cell-cell fusion promoted by two different paramyxovirus F proteins in three cell types in the presence of constitutively active Rho family GTPases, major cellular coordinators of actin dynamics. Reporter gene and syncytia assays demonstrated that expression of either Rac1{sup V12} or Cdc42{sup V12} could increase cell-cell fusion promoted by the Hendra ormore » SV5 glycoproteins, though the effect was dependent on the cell type expressing the viral glycoproteins. In contrast, RhoA{sup L63} decreased cell-cell fusion promoted by Hendra glycoproteins but had little affect on SV5 F-mediated fusion. Also, data suggested that GTPase activation in the viral glycoprotein-containing cell was primarily responsible for changes in fusion. Additionally, we found that activated Cdc42 promoted nuclear rearrangement in syncytia.« less

FOXO1 is a direct target of EWS-Fli1 oncogenic fusion protein in Ewing's sarcoma cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yang, Liu, E-mail: lyang@u.washington.edu; Medical Research Service, VA Puget Sound Health Care System, Seattle, WA 98108; Hu, Hsien-Ming

2010-11-05

Research highlights: {yields} Inducible and reversible siRNA knockdown of an oncogenic fusion protein such as EWS-Fli1 is feasible and more advantageous than other siRNA methods. {yields} The tumor suppressor gene FOXO1 is a new EWS-Fli1 target. {yields} While trans-activators are known for the FOXO1 gene, there has been no report on negative regulators of FOXO1 transcription. {yields} This study provides first evidence that the EWS-Fli1 oncogenic fusion protein can function as a transcriptional repressor of the FOXO1 gene. -- Abstract: Ewing's family tumors are characterized by a specific t(11;22) chromosomal translocation that results in the formation of EWS-Fli1 oncogenic fusionmore » protein. To investigate the effects of EWS-Fli1 on gene expression, we carried out DNA microarray analysis after specific knockdown of EWS-Fli1 through transfection of synthetic siRNAs. EWS-Fli1 knockdown increased expression of genes such as DKK1 and p57 that are known to be repressed by EWS-Fli1 fusion protein. Among other potential EWS-Fli1 targets identified by our microarray analysis, we have focused on the FOXO1 gene since it encodes a potential tumor suppressor and has not been previously reported in Ewing's cells. To better understand how EWS-Fli1 affects FOXO1 expression, we have established a doxycycline-inducible siRNA system to achieve stable and reversible knockdown of EWS-Fli1 in Ewing's sarcoma cells. Here we show that FOXO1 expression in Ewing's cells has an inverse relationship with EWS-Fli1 protein level, and FOXO1 promoter activity is increased after doxycycline-induced EWS-Fli1 knockdown. In addition, we have found that direct binding of EWS-Fli1 to FOXO1 promoter is attenuated after doxycycline-induced siRNA knockdown of the fusion protein. Together, these results suggest that suppression of FOXO1 function by EWS-Fli1 fusion protein may contribute to cellular transformation in Ewing's family tumors.« less

HIP1-ALK, a novel ALK fusion variant that responds to crizotinib.

PubMed

Fang, Douglas D; Zhang, Bin; Gu, Qingyang; Lira, Maruja; Xu, Qiang; Sun, Hongye; Qian, Maoxiang; Sheng, Weiqi; Ozeck, Mark; Wang, Zhenxiong; Zhang, Cathy; Chen, Xinsheng; Chen, Kevin X; Li, Jian; Chen, Shu-Hui; Christensen, James; Mao, Mao; Chan, Chi-Chung

2014-03-01

The aim of this study was to identify anaplastic lymphoma kinase (ALK) rearrangements in lung cancer patient-derived xenograft (PDX) models and to explore their responses to crizotinib. Screening of 99 lung cancer PDX models by the NanoString ALK fusion assay identified two ALK-rearranged non-small-cell lung cancer (NSCLC) tumors, including one harboring a previously known echinoderm microtubule-associated protein-like 4 (EML4)-ALK fusion and another containing an unknown ALK fusion variant. Expression array, RNA-Seq, reverse transcription polymerase chain reaction, and direct sequencing were then conducted to confirm the rearrangements and to identify the novel fusion partner in the xenograft and/or the primary patient tumor. Finally, pharmacological studies were performed in PDX models to evaluate their responses to ALK inhibitor crizotinib. Two ALK-rearranged NSCLC PDX models were identified: one carried a well-known EML4-ALK variant 3a/b and the other harbored a novel huntingtin interacting protein 1 (HIP1)-ALK fusion gene. Exon 28 of the HIP1 gene located on chromosome 7 was fused to exon 20 of the ALK gene located on chromosome 2. Both cases were clinically diagnosed as squamous cell carcinoma. Compared with the other lung cancer PDX models, both ALK-rearranged models displayed elevated ALK mRNA expression. Furthermore, in vivo efficacy studies demonstrated that, similar to the EML4-ALK-positive model, the HIP1-ALK-containing PDX model was sensitive to treatment with crizotinib. Discovery of HIP1 as a fusion partner of ALK in NSCLC is a novel finding. In addition, the HIP1-ALK-rearranged tumor is sensitive to treatment with crizotinib in vivo, implicating HIP1-ALKas an oncogenic driver of lung tumorigenesis. Collectively, our results indicate that HIP1-ALK-positive NSCLC may benefit from clinical applications of crizotinib.

Identification of Three Novel Fusion Oncogenes, SQSTM1/NTRK3, AFAP1L2/RET, and PPFIBP2/RET, in Thyroid Cancers of Young Patients in Fukushima.

PubMed

Iyama, Keita; Matsuse, Michiko; Mitsutake, Norisato; Rogounovitch, Tatiana; Saenko, Vladimir; Suzuki, Keiji; Ashizawa, Mai; Ookouchi, Chiyo; Suzuki, Satoshi; Mizunuma, Hiroshi; Fukushima, Toshihiko; Suzuki, Shinichi; Yamashita, Shunichi

2017-06-01

The BRAF V600E mutation is the most frequent genetic abnormality in adult papillary thyroid carcinomas (PTCs). On the other hand, various chromosomal rearrangements are more prevalent in childhood and adolescent PTCs. The aim of the present study was to identify novel rearrangements in PTCs from young patients. Among 63 postoperative specimens of childhood and adolescent PTCs, which had been discovered by the thyroid ultrasound screening program in Fukushima, nine samples without prevalent known oncogenes, BRAF V600E , RAS, RET/PTC1, RET/PTC3, and ETV6/NTRK3, were analyzed in the current study by quantitative real-time reverse transcription polymerase chain reaction to screen for novel fusion genes by comparing transcript expression between extracellular and kinase domains of ALK, NTRK1, NTRK3, and RET. Of the above nine samples, five samples were suspected to harbor a fusion, and using subsequent 5' rapid amplification of cDNA end (RACE), two already reported fusion oncogenes, STRN/ALK and TPR/NTRK1, and three novel fusions, SQSTM1/NTRK3, AFAP1L2/RET, and PPFIBP2/RET, were identified. Functional analyses of these three chimeric genes were performed, and their transforming abilities were confirmed through the activation of mitogen-activated protein kinase (MAPK). Three novel fusion oncogenes have been identified in young PTC patients in Fukushima, suggesting that rare fusions may be present among the cases negative for known oncogenes in this age group and that such rearrangements can play a significant role in thyroid carcinogenesis.

The Csr system regulates genome-wide mRNA stability and transcription and thus gene expression in Escherichia coli.

PubMed

Esquerré, Thomas; Bouvier, Marie; Turlan, Catherine; Carpousis, Agamemnon J; Girbal, Laurence; Cocaign-Bousquet, Muriel

2016-04-26

Bacterial adaptation requires large-scale regulation of gene expression. We have performed a genome-wide analysis of the Csr system, which regulates many important cellular functions. The Csr system is involved in post-transcriptional regulation, but a role in transcriptional regulation has also been suggested. Two proteins, an RNA-binding protein CsrA and an atypical signaling protein CsrD, participate in the Csr system. Genome-wide transcript stabilities and levels were compared in wildtype E. coli (MG1655) and isogenic mutant strains deficient in CsrA or CsrD activity demonstrating for the first time that CsrA and CsrD are global negative and positive regulators of transcription, respectively. The role of CsrA in transcription regulation may be indirect due to the 4.6-fold increase in csrD mRNA concentration in the CsrA deficient strain. Transcriptional action of CsrA and CsrD on a few genes was validated by transcriptional fusions. In addition to an effect on transcription, CsrA stabilizes thousands of mRNAs. This is the first demonstration that CsrA is a global positive regulator of mRNA stability. For one hundred genes, we predict that direct control of mRNA stability by CsrA might contribute to metabolic adaptation by regulating expression of genes involved in carbon metabolism and transport independently of transcriptional regulation.

The Fusion Gain Analysis of the Inductively Driven Liner Compression Based Fusion

NASA Astrophysics Data System (ADS)

Shimazu, Akihisa; Slough, John

2016-10-01

An analytical analysis of the fusion gain expected in the inductively driven liner compression (IDLC) based fusion is conducted to identify the fusion gain scaling at various operating conditions. The fusion based on the IDLC is a magneto-inertial fusion concept, where a Field-Reversed Configuration (FRC) plasmoid is compressed via the inductively-driven metal liner to drive the FRC to fusion conditions. In the past, an approximate scaling law for the expected fusion gain for the IDLC based fusion was obtained under the key assumptions of (1) D-T fuel at 5-40 keV, (2) adiabatic scaling laws for the FRC dynamics, (3) FRC energy dominated by the pressure balance with the edge magnetic field at the peak compression, and (4) the liner dwell time being liner final diameter divided by the peak liner velocity. In this study, various assumptions made in the previous derivation is relaxed to study the change in the fusion gain scaling from the previous result of G ml1 / 2 El11 / 8 , where ml is the liner mass and El is the peak liner kinetic energy. The implication from the modified fusion gain scaling on the performance of the IDLC fusion reactor system is also explored.

A major defect in mast cell effector functions in CRACM1-/- mice

PubMed Central

Vig, Monika; Dehaven, Wayne I; Bird, Gary S; Billingsley, James M; Wang, Huiyun; Rao, Patricia E; Hutchings, Amy B; Jouvin, Marie-Hélène; Putney, James W; Kinet, Jean-Pierre

2008-01-01

CRACM1 (Orai1) constitutes the pore subunit of CRAC channels that are crucial for many physiological processes 1-6. A point mutation in CRACM1 has been associated with SCID disease in humans 2. We have generated CRACM1 deficient mice using gene trap, where β-galactosidase (LacZ) activity identifies CRACM1 expression in tissues. We show here that the homozygous CRACM1 deficient mice are considerably smaller in size and are grossly defective in mast cell degranulation and cytokine secretion. FcεRI-mediated in vivo allergic reactions were also inhibited in CRACM1-/- mice. Other tissues expressing truncated CRACM1-LacZ fusion protein include skeletal muscles, kidney and regions in the brain and heart. Surprisingly, no CRACM1 expression was seen in the lymphoid regions of thymus. Accordingly, we found no defect in T cell development. Thus, our data reveal novel crucial roles for CRAC channels including a putative role in excitable cells. PMID:18059270

Combining multiple ChIP-seq peak detection systems using combinatorial fusion.

PubMed

Schweikert, Christina; Brown, Stuart; Tang, Zuojian; Smith, Phillip R; Hsu, D Frank

2012-01-01

Due to the recent rapid development in ChIP-seq technologies, which uses high-throughput next-generation DNA sequencing to identify the targets of Chromatin Immunoprecipitation, there is an increasing amount of sequencing data being generated that provides us with greater opportunity to analyze genome-wide protein-DNA interactions. In particular, we are interested in evaluating and enhancing computational and statistical techniques for locating protein binding sites. Many peak detection systems have been developed; in this study, we utilize the following six: CisGenome, MACS, PeakSeq, QuEST, SISSRs, and TRLocator. We define two methods to merge and rescore the regions of two peak detection systems and analyze the performance based on average precision and coverage of transcription start sites. The results indicate that ChIP-seq peak detection can be improved by fusion using score or rank combination. Our method of combination and fusion analysis would provide a means for generic assessment of available technologies and systems and assist researchers in choosing an appropriate system (or fusion method) for analyzing ChIP-seq data. This analysis offers an alternate approach for increasing true positive rates, while decreasing false positive rates and hence improving the ChIP-seq peak identification process.

Minimal phenotype of mice homozygous for a null mutation in the forkhead/winged helix gene, Mf2.

PubMed

Kume, T; Deng, K; Hogan, B L

2000-02-01

Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2(lacZ)) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes.

TFIIS-Dependent Non-coding Transcription Regulates Developmental Genome Rearrangements

PubMed Central

Maliszewska-Olejniczak, Kamila; Gruchota, Julita; Gromadka, Robert; Denby Wilkes, Cyril; Arnaiz, Olivier; Mathy, Nathalie; Duharcourt, Sandra; Bétermier, Mireille; Nowak, Jacek K.

2015-01-01

Because of their nuclear dimorphism, ciliates provide a unique opportunity to study the role of non-coding RNAs (ncRNAs) in the communication between germline and somatic lineages. In these unicellular eukaryotes, a new somatic nucleus develops at each sexual cycle from a copy of the zygotic (germline) nucleus, while the old somatic nucleus degenerates. In the ciliate Paramecium tetraurelia, the genome is massively rearranged during this process through the reproducible elimination of repeated sequences and the precise excision of over 45,000 short, single-copy Internal Eliminated Sequences (IESs). Different types of ncRNAs resulting from genome-wide transcription were shown to be involved in the epigenetic regulation of genome rearrangements. To understand how ncRNAs are produced from the entire genome, we have focused on a homolog of the TFIIS elongation factor, which regulates RNA polymerase II transcriptional pausing. Six TFIIS-paralogs, representing four distinct families, can be found in P. tetraurelia genome. Using RNA interference, we showed that TFIIS4, which encodes a development-specific TFIIS protein, is essential for the formation of a functional somatic genome. Molecular analyses and high-throughput DNA sequencing upon TFIIS4 RNAi demonstrated that TFIIS4 is involved in all kinds of genome rearrangements, including excision of ~48% of IESs. Localization of a GFP-TFIIS4 fusion revealed that TFIIS4 appears specifically in the new somatic nucleus at an early developmental stage, before IES excision. RT-PCR experiments showed that TFIIS4 is necessary for the synthesis of IES-containing non-coding transcripts. We propose that these IES+ transcripts originate from the developing somatic nucleus and serve as pairing substrates for germline-specific short RNAs that target elimination of their homologous sequences. Our study, therefore, connects the onset of zygotic non coding transcription to the control of genome plasticity in Paramecium, and establishes for

Novel cooperative neural fusion algorithms for image restoration and image fusion.

PubMed

Xia, Youshen; Kamel, Mohamed S

2007-02-01

To deal with the problem of restoring degraded images with non-Gaussian noise, this paper proposes a novel cooperative neural fusion regularization (CNFR) algorithm for image restoration. Compared with conventional regularization algorithms for image restoration, the proposed CNFR algorithm can relax need of the optimal regularization parameter to be estimated. Furthermore, to enhance the quality of restored images, this paper presents a cooperative neural fusion (CNF) algorithm for image fusion. Compared with existing signal-level image fusion algorithms, the proposed CNF algorithm can greatly reduce the loss of contrast information under blind Gaussian noise environments. The performance analysis shows that the proposed two neural fusion algorithms can converge globally to the robust and optimal image estimate. Simulation results confirm that in different noise environments, the proposed two neural fusion algorithms can obtain a better image estimate than several well known image restoration and image fusion methods.

Magnetic-confinement fusion

NASA Astrophysics Data System (ADS)

Ongena, J.; Koch, R.; Wolf, R.; Zohm, H.

2016-05-01

Our modern society requires environmentally friendly solutions for energy production. Energy can be released not only from the fission of heavy nuclei but also from the fusion of light nuclei. Nuclear fusion is an important option for a clean and safe solution for our long-term energy needs. The extremely high temperatures required for the fusion reaction are routinely realized in several magnetic-fusion machines. Since the early 1990s, up to 16 MW of fusion power has been released in pulses of a few seconds, corresponding to a power multiplication close to break-even. Our understanding of the very complex behaviour of a magnetized plasma at temperatures between 150 and 200 million °C surrounded by cold walls has also advanced substantially. This steady progress has resulted in the construction of ITER, a fusion device with a planned fusion power output of 500 MW in pulses of 400 s. ITER should provide answers to remaining important questions on the integration of physics and technology, through a full-size demonstration of a tenfold power multiplication, and on nuclear safety aspects. Here we review the basic physics underlying magnetic fusion: past achievements, present efforts and the prospects for future production of electrical energy. We also discuss questions related to the safety, waste management and decommissioning of a future fusion power plant.

Comparative toxic potential of market formulation of two organophosphate pesticides in transgenic Drosophila melanogaster (hsp70-lacZ).

PubMed

Gupta, S C; Siddique, H R; Saxena, D K; Chowdhuri, D Kar

2005-01-01

This study investigated the working hypothesis that two widely used organophosphate pesticides; Nuvan and Dimecron, exert toxic effects in Drosophila. Transgenic D. melanogaster (hsp70-lacZ) was used as a model for assaying stress gene expression and AchE activity as an endpoint for toxicity and also to evaluate whether stress gene expression is sufficient to protect against toxic insult of the chemicals and to prevent tissue damage. The study was extended to investigate the effect of the pesticides on the life cycle and reproduction of the organism. The study showed that Nuvan affected emergence of the exposed flies more drastically than Dimecron and the effect was lethal at the highest tested concentration (0.075 ppm). While Nuvan at 0.0075 and 0.015 ppm concentrations affected reproduction of the flies significantly, the effect of Dimecron was significant only at 0.015 and 0.075 ppm. Nuvan-exposed third-instar larvae exhibited a 1.2-fold to 1.5-fold greater hsp70 expression compared to Dimecron at concentrations ranging from 0.0075 to 0.075 ppm following 12 and 18 h exposure. While maximum expression of hsp70 was observed in Nuvan-exposed third-instar larval tissues following 18 h exposure at 0.075 ppm, Dimecron at the same dietary concentration induced a maximum expression of hsp70 following 24 h exposure. Further, concomitant with a significant induction of hsp70, significant inhibition of AchE was observed following chemical exposure and temperature shock. Concurrent with a significant decline in hsp70 expression in Nuvan-exposed larvae after 48 h at 0.075 ppm, tissue damage was evident. Dimecron-exposed larvae exhibited a plateau in hsp70 induction even after 48 h exposure and moderate tissue damage was observed in these larvae. The present study suggests that Nuvan is more cytotoxic than Dimecron in transgenic Drosophila melanogaster.

Characterization of two trpE genes encoding anthranilate synthase {alpha}-subunit in Azospirillum brasilense

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ge Shimei; Xie Baoen; Chen Sanfeng

2006-03-10

The previous report from our laboratory has recently identified a new trpE gene (termed trpE {sub 2}) which exists independently in Azospirillum brasilense Yu62. In this study, amplification of trpE(G) (termed trpE {sub 1}(G) here) confirmed that there are two copies of trpE gene, one trpE being fused into trpG while the other trpE existed independently. This is First report to suggest that two copies of the trpE gene exist in this bacterium. Comparison of the nucleotide sequence demonstrated that putative leader peptide, terminator, and anti-terminator were found upstream of trpE {sub 1}(G) while these sequence features did not existmore » in front of trpE {sub 2}. The {beta}-galactosidase activity of an A. brasilense strain carrying a trpE {sub 2}-lacZ fusion remained constant at different tryptophan concentrations, but the {beta}-galactosidase activity of the same strain carrying a trpE {sub 1}(G)-lacZ fusion decreased as the tryptophan concentration increased. These data suggest that the expression of trpE {sub 1}(G) is regulated at the transcriptional level by attenuation while trpE {sub 2} is constantly expressed. The anthranilate synthase assays with trpE {sub 1}(G){sup -} and trpE {sub 2} {sup -} mutants demonstrated that TrpE{sub 1}(G) fusion protein is feedback inhibited by tryptophan while TrpE{sub 2} protein is not. We also found that both trpE {sub 1}(G) and trpE {sub 2} gene products were involved in IAA synthesis.« less

Retinoic acid induces proteasome-dependent degradation of retinoic acid receptor α (RARα) and oncogenic RARα fusion proteins

PubMed Central

Zhu, Jun; Gianni, Maurizio; Kopf, Eliezer; Honoré, Nicole; Chelbi-Alix, Mounira; Koken, Marcel; Quignon, Frédérique; Rochette-Egly, Cécile; de Thé, Hugues

1999-01-01

Analyzing the pathways by which retinoic acid (RA) induces promyelocytic leukemia/retinoic acid receptor α (PML/RARα) catabolism in acute promyelocytic leukemia (APL), we found that, in addition to caspase-mediated PML/RARα cleavage, RA triggers degradation of both PML/RARα and RARα. Similarly, in non-APL cells, RA directly targeted RARα and RARα fusions to the proteasome degradation pathway. Activation of either RARα or RXRα by specific agonists induced degradation of both proteins. Conversely, a mutation in RARα that abolishes heterodimer formation and DNA binding, blocked both RARα and RXRα degradation. Mutations in the RARα DNA-binding domain or AF-2 transcriptional activation region also impaired RARα catabolism. Hence, our results link transcriptional activation to receptor catabolism and suggest that transcriptional up-regulation of nuclear receptors by their ligands may be a feedback mechanism allowing sustained target-gene activation. PMID:10611294

ETO2-GLIS2 Hijacks Transcriptional Complexes to Drive Cellular Identity and Self-Renewal in Pediatric Acute Megakaryoblastic Leukemia.

PubMed

Thirant, Cécile; Ignacimouttou, Cathy; Lopez, Cécile K; Diop, M'Boyba; Le Mouël, Lou; Thiollier, Clarisse; Siret, Aurélie; Dessen, Phillipe; Aid, Zakia; Rivière, Julie; Rameau, Philippe; Lefebvre, Céline; Khaled, Mehdi; Leverger, Guy; Ballerini, Paola; Petit, Arnaud; Raslova, Hana; Carmichael, Catherine L; Kile, Benjamin T; Soler, Eric; Crispino, John D; Wichmann, Christian; Pflumio, Françoise; Schwaller, Jürg; Vainchenker, William; Lobry, Camille; Droin, Nathalie; Bernard, Olivier A; Malinge, Sébastien; Mercher, Thomas

2017-03-13

Chimeric transcription factors are a hallmark of human leukemia, but the molecular mechanisms by which they block differentiation and promote aberrant self-renewal remain unclear. Here, we demonstrate that the ETO2-GLIS2 fusion oncoprotein, which is found in aggressive acute megakaryoblastic leukemia, confers megakaryocytic identity via the GLIS2 moiety while both ETO2 and GLIS2 domains are required to drive increased self-renewal properties. ETO2-GLIS2 directly binds DNA to control transcription of associated genes by upregulation of expression and interaction with the ETS-related ERG protein at enhancer elements. Importantly, specific interference with ETO2-GLIS2 oligomerization reverses the transcriptional activation at enhancers and promotes megakaryocytic differentiation, providing a relevant interface to target in this poor-prognosis pediatric leukemia. Copyright © 2017 Elsevier Inc. All rights reserved.

FuzzyFusion: an application architecture for multisource information fusion

NASA Astrophysics Data System (ADS)

Fox, Kevin L.; Henning, Ronda R.

2009-04-01

The correlation of information from disparate sources has long been an issue in data fusion research. Traditional data fusion addresses the correlation of information from sources as diverse as single-purpose sensors to all-source multi-media information. Information system vulnerability information is similar in its diversity of sources and content, and in the desire to draw a meaningful conclusion, namely, the security posture of the system under inspection. FuzzyFusionTM, A data fusion model that is being applied to the computer network operations domain is presented. This model has been successfully prototyped in an applied research environment and represents a next generation assurance tool for system and network security.

Transient Co-Expression of Post-Transcriptional Gene Silencing Suppressors for Increased in Planta Expression of a Recombinant Anthrax Receptor Fusion Protein

PubMed Central

Arzola, Lucas; Chen, Junxing; Rattanaporn, Kittipong; Maclean, James M.; McDonald, Karen A.

2011-01-01

Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin), CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA) domain of human capillary morphogenesis 2 (CMG2), an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG). We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS): p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI), with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI. PMID:21954339

Transient co-expression of post-transcriptional gene silencing suppressors for increased in planta expression of a recombinant anthrax receptor fusion protein.

PubMed

Arzola, Lucas; Chen, Junxing; Rattanaporn, Kittipong; Maclean, James M; McDonald, Karen A

2011-01-01

Potential epidemics of infectious diseases and the constant threat of bioterrorism demand rapid, scalable, and cost-efficient manufacturing of therapeutic proteins. Molecular farming of tobacco plants provides an alternative for the recombinant production of therapeutics. We have developed a transient production platform that uses Agrobacterium infiltration of Nicotiana benthamiana plants to express a novel anthrax receptor decoy protein (immunoadhesin), CMG2-Fc. This chimeric fusion protein, designed to protect against the deadly anthrax toxins, is composed of the von Willebrand factor A (VWA) domain of human capillary morphogenesis 2 (CMG2), an effective anthrax toxin receptor, and the Fc region of human immunoglobulin G (IgG). We evaluated, in N. benthamiana intact plants and detached leaves, the expression of CMG2-Fc under the control of the constitutive CaMV 35S promoter, and the co-expression of CMG2-Fc with nine different viral suppressors of post-transcriptional gene silencing (PTGS): p1, p10, p19, p21, p24, p25, p38, 2b, and HCPro. Overall, transient CMG2-Fc expression was higher on intact plants than detached leaves. Maximum expression was observed with p1 co-expression at 3.5 days post-infiltration (DPI), with a level of 0.56 g CMG2-Fc per kg of leaf fresh weight and 1.5% of the total soluble protein, a ten-fold increase in expression when compared to absence of suppression. Co-expression with the p25 PTGS suppressor also significantly increased the CMG2-Fc expression level after just 3.5 DPI.

Hendra virus fusion protein transmembrane domain contributes to pre-fusion protein stability

PubMed Central

Webb, Stacy; Nagy, Tamas; Moseley, Hunter; Fried, Michael; Dutch, Rebecca

2017-01-01

Enveloped viruses utilize fusion (F) proteins studding the surface of the virus to facilitate membrane fusion with a target cell membrane. Fusion of the viral envelope with a cellular membrane is required for release of viral genomic material, so the virus can ultimately reproduce and spread. To drive fusion, the F protein undergoes an irreversible conformational change, transitioning from a metastable pre-fusion conformation to a more thermodynamically stable post-fusion structure. Understanding the elements that control stability of the pre-fusion state and triggering to the post-fusion conformation is important for understanding F protein function. Mutations in F protein transmembrane (TM) domains implicated the TM domain in the fusion process, but the structural and molecular details in fusion remain unclear. Previously, analytical ultracentrifugation was utilized to demonstrate that isolated TM domains of Hendra virus F protein associate in a monomer-trimer equilibrium (Smith, E. C., Smith, S. E., Carter, J. R., Webb, S. R., Gibson, K. M., Hellman, L. M., Fried, M. G., and Dutch, R. E. (2013) J. Biol. Chem. 288, 35726–35735). To determine factors driving this association, 140 paramyxovirus F protein TM domain sequences were analyzed. A heptad repeat of β-branched residues was found, and analysis of the Hendra virus F TM domain revealed a heptad repeat leucine-isoleucine zipper motif (LIZ). Replacement of the LIZ with alanine resulted in dramatically reduced TM-TM association. Mutation of the LIZ in the whole protein resulted in decreased protein stability, including pre-fusion conformation stability. Together, our data suggest that the heptad repeat LIZ contributed to TM-TM association and is important for F protein function and pre-fusion stability. PMID:28213515

Elimination of established murine colon carcinoma metastases by antibody-interleukin 2 fusion protein therapy.

PubMed

Xiang, R; Lode, H N; Dolman, C S; Dreier, T; Varki, N M; Qian, X; Lo, K M; Lan, Y; Super, M; Gillies, S D; Reisfeld, R A

1997-11-01

A recombinant humanized antibody-interleukin 2 fusion protein (huKS1/4-IL-2) was used to direct IL-2 to the tumor microenvironment and elicit a T cell-mediated eradication of established pulmonary and hepatic CT26-KSA colon carcinoma metastases in syngeneic BALB/c mice. This antitumor effect was specific because a fusion protein, which was nonreactive with these tumor cells, failed to exert any such effect. The efficacy of the huKS1/4-IL-2 fusion protein in eliminating metastases was documented because mixtures of monoclonal antibody huKS1/4 with recombinant human IL-2 were ineffective and, at best, only partially reduced tumor load. Two lines of evidence indicated the eradication of metastases and the absence of minimal residual disease in animals treated with the fusion protein: first, the lack of detection of CT26-KSA cells by reverse transcription-PCR, which can detect one tumor cell in 10(6) liver cells; and second, the tripling of life span. The effector mechanism involved in this tumor eradication is dependent on T cells because the IL-2-directed therapy is ineffective in T cell-deficient SCID mice. The essential effector cells were further characterized as CD8+ T cells by in vivo depletion studies. Such T cells, isolated from tumor-bearing mice after fusion protein therapy, elicited MHC class I-restricted cytotoxicity in vitro against colon carcinoma target cells. Taken together, these data indicate that fusion protein-directed IL-2 therapy induces a T cell-dependent host immune response capable of eradicating established colon cancer metastases in an animal tumor model.

Characterization of fusion genes and the significantly expressed fusion isoforms in breast cancer by hybrid sequencing

PubMed Central

Weirather, Jason L.; Afshar, Pegah Tootoonchi; Clark, Tyson A.; Tseng, Elizabeth; Powers, Linda S.; Underwood, Jason G.; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai

2015-01-01

We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. PMID:26040699

Detection of Protein Interactions in T3S Systems Using Yeast Two-Hybrid Analysis.

PubMed

Nilles, Matthew L

2017-01-01

Two-hybrid systems, sometimes termed interaction traps, are genetic systems designed to find and analyze interactions between proteins. The most common systems are yeast based (commonly Saccharomyces cerevisae) and rely on the functional reconstitution of the GAL4 transcriptional activator. Reporter genes, such as the lacZ gene of Escherichia coli (encodes β-galactosidase), are placed under GAL4-dependent transcriptional control to provide quick and reliable detection of protein interactions. In this method the use of a yeast-based two-hybrid system is described to study protein interactions between components of type III secretion systems.

Massive NGS Data Analysis Reveals Hundreds Of Potential Novel Gene Fusions in Human Cell Lines.

PubMed

Gioiosa, Silvia; Bolis, Marco; Flati, Tiziano; Massini, Annalisa; Garattini, Enrico; Chillemi, Giovanni; Fratelli, Maddalena; Castrignanò, Tiziana

2018-06-01

Gene fusions derive from chromosomal rearrangements and the resulting chimeric transcripts are often endowed with oncogenic potential. Furthermore, they serve as diagnostic tools for the clinical classification of cancer subgroups with different prognosis and, in some cases, they can provide specific drug targets. So far, many efforts have been carried out to study gene fusion events occurring in tumor samples. In recent years, the availability of a comprehensive Next Generation Sequencing dataset for all the existing human tumor cell lines has provided the opportunity to further investigate these data in order to identify novel and still uncharacterized gene fusion events. In our work, we have extensively reanalyzed 935 paired-end RNA-seq experiments downloaded from "The Cancer Cell Line Encyclopedia" repository, aiming at addressing novel putative cell-line specific gene fusion events in human malignancies. The bioinformatics analysis has been performed by the execution of four different gene fusion detection algorithms. The results have been further prioritized by running a bayesian classifier which makes an in silico validation. The collection of fusion events supported by all of the predictive softwares results in a robust set of ∼ 1,700 in-silico predicted novel candidates suitable for downstream analyses. Given the huge amount of data and information produced, computational results have been systematized in a database named LiGeA. The database can be browsed through a dynamical and interactive web portal, further integrated with validated data from other well known repositories. Taking advantage of the intuitive query forms, the users can easily access, navigate, filter and select the putative gene fusions for further validations and studies. They can also find suitable experimental models for a given fusion of interest. We believe that the LiGeA resource can represent not only the first compendium of both known and putative novel gene fusion events in the

Divergent transcription is associated with promoters of transcriptional regulators

PubMed Central

2013-01-01

Background Divergent transcription is a wide-spread phenomenon in mammals. For instance, short bidirectional transcripts are a hallmark of active promoters, while longer transcripts can be detected antisense from active genes in conditions where the RNA degradation machinery is inhibited. Moreover, many described long non-coding RNAs (lncRNAs) are transcribed antisense from coding gene promoters. However, the general significance of divergent lncRNA/mRNA gene pair transcription is still poorly understood. Here, we used strand-specific RNA-seq with high sequencing depth to thoroughly identify antisense transcripts from coding gene promoters in primary mouse tissues. Results We found that a substantial fraction of coding-gene promoters sustain divergent transcription of long non-coding RNA (lncRNA)/mRNA gene pairs. Strikingly, upstream antisense transcription is significantly associated with genes related to transcriptional regulation and development. Their promoters share several characteristics with those of transcriptional developmental genes, including very large CpG islands, high degree of conservation and epigenetic regulation in ES cells. In-depth analysis revealed a unique GC skew profile at these promoter regions, while the associated coding genes were found to have large first exons, two genomic features that might enforce bidirectional transcription. Finally, genes associated with antisense transcription harbor specific H3K79me2 epigenetic marking and RNA polymerase II enrichment profiles linked to an intensified rate of early transcriptional elongation. Conclusions We concluded that promoters of a class of transcription regulators are characterized by a specialized transcriptional control mechanism, which is directly coupled to relaxed bidirectional transcription. PMID:24365181

Muon Catalyzed Fusion

NASA Technical Reports Server (NTRS)

Armour, Edward A.G.

2007-01-01

Muon catalyzed fusion is a process in which a negatively charged muon combines with two nuclei of isotopes of hydrogen, e.g, a proton and a deuteron or a deuteron and a triton, to form a muonic molecular ion in which the binding is so tight that nuclear fusion occurs. The muon is normally released after fusion has taken place and so can catalyze further fusions. As the muon has a mean lifetime of 2.2 microseconds, this is the maximum period over which a muon can participate in this process. This article gives an outline of the history of muon catalyzed fusion from 1947, when it was first realised that such a process might occur, to the present day. It includes a description of the contribution that Drachrnan has made to the theory of muon catalyzed fusion and the influence this has had on the author's research.

PecS and PecT coregulate the synthesis of HrpN and pectate lyases, two virulence determinants in Erwinia chrysanthemi 3937.

PubMed

Nasser, William; Reverchon, Sylvie; Vedel, Regine; Boccara, Martine

2005-11-01

Erwinia chrysanthemi strain 3937 is a necrotrophic bacterial plant pathogen. Pectinolytic enzymes and, in particular, pectate lyases play a key role in soft rot symptoms; however, the efficient colonization of plants by E. chrysanthemi requires additional factors. These factors include HrpN (harpin), a heat-stable, glycine-rich hydrophilic protein, which is secreted by the type III secretion system. We investigated the expression of hrpN in E. chrysanthemi 3937 in various environmental conditions and different regulatory backgrounds. Using lacZ fusions, hrpN expression was markedly influenced by the carbon source, osmolarity, growth phase, and growth substrate. hrpN was repressed when pectinolysis started and negatively regulated by the repressors of pectate lyase synthesis, PecS and PecT. Primer extension data and in vitro DNA-protein interaction experiments support a model whereby PecS represses hrpN expression by binding to the hrpN regulatory region and inhibiting transcript elongation. The results suggest coordinated regulation of HrpN and pectate lyases by PecS and PecT. A putative model of the synthesis of these two virulence factors in E. chrysanthemi during pathogenesis is presented.

Identification and characterization of PhbF: a DNA binding protein with regulatory role in the PHB metabolism of Herbaspirillum seropedicae SmR1.

PubMed

Kadowaki, Marco A S; Müller-Santos, Marcelo; Rego, Fabiane G M; Souza, Emanuel M; Yates, Marshall G; Monteiro, Rose A; Pedrosa, Fabio O; Chubatsu, Leda S; Steffens, Maria B R

2011-10-14

Herbaspirillum seropedicae SmR1 is a nitrogen fixing endophyte associated with important agricultural crops. It produces polyhydroxybutyrate (PHB) which is stored intracellularly as granules. However, PHB metabolism and regulatory control is not yet well studied in this organism. In this work we describe the characterization of the PhbF protein from H. seropedicae SmR1 which was purified and characterized after expression in E. coli. The purified PhbF protein was able to bind to eleven putative promoters of genes involved in PHB metabolism in H. seropedicae SmR1. In silico analyses indicated a probable DNA-binding sequence which was shown to be protected in DNA footprinting assays using purified PhbF. Analyses using lacZ fusions showed that PhbF can act as a repressor protein controlling the expression of PHB metabolism-related genes. Our results indicate that H. seropedicae SmR1 PhbF regulates expression of phb-related genes by acting as a transcriptional repressor. The knowledge of the PHB metabolism of this plant-associated bacterium may contribute to the understanding of the plant-colonizing process and the organism's resistance and survival in planta.

Identification and characterization of PhbF: A DNA binding protein with regulatory role in the PHB metabolism of Herbaspirillum seropedicae SmR1

PubMed Central

2011-01-01

Background Herbaspirillum seropedicae SmR1 is a nitrogen fixing endophyte associated with important agricultural crops. It produces polyhydroxybutyrate (PHB) which is stored intracellularly as granules. However, PHB metabolism and regulatory control is not yet well studied in this organism. Results In this work we describe the characterization of the PhbF protein from H. seropedicae SmR1 which was purified and characterized after expression in E. coli. The purified PhbF protein was able to bind to eleven putative promoters of genes involved in PHB metabolism in H. seropedicae SmR1. In silico analyses indicated a probable DNA-binding sequence which was shown to be protected in DNA footprinting assays using purified PhbF. Analyses using lacZ fusions showed that PhbF can act as a repressor protein controlling the expression of PHB metabolism-related genes. Conclusions Our results indicate that H. seropedicae SmR1 PhbF regulates expression of phb-related genes by acting as a transcriptional repressor. The knowledge of the PHB metabolism of this plant-associated bacterium may contribute to the understanding of the plant-colonizing process and the organism's resistance and survival in planta. PMID:21999748

The Bradyrhizobium japonicum nolA gene and its involvement in the genotype-specific nodulation of soybeans.

PubMed Central

Sadowsky, M J; Cregan, P B; Gottfert, M; Sharma, A; Gerhold, D; Rodriguez-Quinones, F; Keyser, H H; Hennecke, H; Stacey, G

1991-01-01

Several soybean genotypes have been identified which specifically exclude nodulation by members of Bradyrhizobium japonicum serocluster 123. We have identified and sequenced a DNA region from B. japonicum strain USDA 110 which is involved in genotype-specific nodulation of soybeans. This 2.3-kilobase region, cloned in pMJS12, allows B. japonicum serocluster 123 isolates to form nodules on plants of serogroup 123-restricting genotypes. The nodules, however, were ineffective for symbiotic nitrogen fixation. The nodulation-complementing region is located approximately 590 base pairs transcriptionally downstream from nodD2. The 5' end of pMJS12 contains a putative open reading frame (ORF) of 710 base pairs, termed nolA. Transposon Tn3-HoHo mutations only within the ORF abolished nodulation complementation. The N terminus of the predicted nolA gene product has strong similarity with the N terminus of MerR, the regulator of mercury resistance genes. Translational lacZ fusion experiments indicated that nolA was moderately induced by soybean seed extract and the isoflavone genistein. Restriction fragments that hybridize to pMJS12 were detected in genomic DNAs from both nodulation-restricted and -unrestricted strains. PMID:1988958

E.coli polynucleotide phosphorylase expression is autoregulated through an RNase III-dependent mechanism.

PubMed Central

Robert-Le Meur, M; Portier, C

1992-01-01

It has been previously shown that the pnp messenger RNAs are cleaved by RNase III at the 5' end and that these cleavages induce a rapid decay of these messengers. A translational fusion between pnp and lacZ was introduced into the chromosome of a delta lac strain to study the expression of pnp. In the presence of increased cellular concentrations of polynucleotide phosphorylase, the level of the hybrid beta-galactosidase is repressed, whereas the synthesis rate of the corresponding message is not significantly affected. In the absence of pnp, the level of the hybrid protein increases strongly. Thus, polynucleotide phosphorylase is post-transcriptionally autocontrolled. However, autocontrol is totally abolished in strains where the RNase III site on the pnp message has been deleted or in strains devoid of RNase III. These results suggest that polynucleotide phosphorylase requires RNase III cleavages to autoregulate the translation of its message. Other mutations in the ribosome binding site region support the hypothesis that this 3' to 5' processive enzyme could recognize a specific repressor binding site at the 5' end of pnp mRNA. Implications of these results on the mechanism of regulation and on messenger degradation are discussed. Images PMID:1628624

E.coli polynucleotide phosphorylase expression is autoregulated through an RNase III-dependent mechanism.

PubMed

Robert-Le Meur, M; Portier, C

1992-07-01

It has been previously shown that the pnp messenger RNAs are cleaved by RNase III at the 5' end and that these cleavages induce a rapid decay of these messengers. A translational fusion between pnp and lacZ was introduced into the chromosome of a delta lac strain to study the expression of pnp. In the presence of increased cellular concentrations of polynucleotide phosphorylase, the level of the hybrid beta-galactosidase is repressed, whereas the synthesis rate of the corresponding message is not significantly affected. In the absence of pnp, the level of the hybrid protein increases strongly. Thus, polynucleotide phosphorylase is post-transcriptionally autocontrolled. However, autocontrol is totally abolished in strains where the RNase III site on the pnp message has been deleted or in strains devoid of RNase III. These results suggest that polynucleotide phosphorylase requires RNase III cleavages to autoregulate the translation of its message. Other mutations in the ribosome binding site region support the hypothesis that this 3' to 5' processive enzyme could recognize a specific repressor binding site at the 5' end of pnp mRNA. Implications of these results on the mechanism of regulation and on messenger degradation are discussed.

Hendra virus fusion protein transmembrane domain contributes to pre-fusion protein stability.

PubMed

Webb, Stacy; Nagy, Tamas; Moseley, Hunter; Fried, Michael; Dutch, Rebecca

2017-04-07

Enveloped viruses utilize fusion (F) proteins studding the surface of the virus to facilitate membrane fusion with a target cell membrane. Fusion of the viral envelope with a cellular membrane is required for release of viral genomic material, so the virus can ultimately reproduce and spread. To drive fusion, the F protein undergoes an irreversible conformational change, transitioning from a metastable pre-fusion conformation to a more thermodynamically stable post-fusion structure. Understanding the elements that control stability of the pre-fusion state and triggering to the post-fusion conformation is important for understanding F protein function. Mutations in F protein transmembrane (TM) domains implicated the TM domain in the fusion process, but the structural and molecular details in fusion remain unclear. Previously, analytical ultracentrifugation was utilized to demonstrate that isolated TM domains of Hendra virus F protein associate in a monomer-trimer equilibrium (Smith, E. C., Smith, S. E., Carter, J. R., Webb, S. R., Gibson, K. M., Hellman, L. M., Fried, M. G., and Dutch, R. E. (2013) J. Biol. Chem. 288, 35726-35735). To determine factors driving this association, 140 paramyxovirus F protein TM domain sequences were analyzed. A heptad repeat of β-branched residues was found, and analysis of the Hendra virus F TM domain revealed a heptad repeat leucine-isoleucine zipper motif (LIZ). Replacement of the LIZ with alanine resulted in dramatically reduced TM-TM association. Mutation of the LIZ in the whole protein resulted in decreased protein stability, including pre-fusion conformation stability. Together, our data suggest that the heptad repeat LIZ contributed to TM-TM association and is important for F protein function and pre-fusion stability. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

ESWR1-CREM Fusion in an Intracranial Myxoid Angiomatoid Fibrous Histiocytoma-Like Tumor: A Case Report and Literature Review.

PubMed

Gareton, Albane; Pierron, Gaëlle; Mokhtari, Karima; Tran, Suzanne; Tauziède-Espariat, Arnault; Pallud, Johan; Louvel, Guillaume; Meary, Eric; Capelle, Laurent; Chrétien, Fabrice; Varlet, Pascale

2018-05-19

Gene fusions of EWSR1 with members of the CREB family of transcription factors (CREB1, ATF1, and CREM) have recently been described in exceptional intracranial myxoid mesenchymal tumors. Although this is a known gene fusion found in various mesenchymal tumors, EWSR1 fusion with CREM has only been observed in 3 intracranial myxoid tumors. In this paper, we present 1 such tumor with in-depth histopathological description and long-term follow-up. There is controversy regarding whether these tumors represent a novel entity or simply an intracranial localization of the myxoid variant of angiomatoid fibrous histiocytoma, a rare soft tissue tumor of the extremities. Out of 11 cases mentioned in the literature, the 3 isolated case reports by Dunham et al, Ochalski et al, and Alshareef et al are designated as angiomatoid fibrous histiocytoma, whereas the others are defined as a novel tumoral entity called intracranial myxoid mesenchymal tumor with EWSR1-CREB fusion. We believe the vast morphological and immunohistochemical spectrum of angiomatoid fibrous histiocytoma makes it difficult to dismiss this diagnosis.

FusionAnalyser: a new graphical, event-driven tool for fusion rearrangements discovery

PubMed Central

Piazza, Rocco; Pirola, Alessandra; Spinelli, Roberta; Valletta, Simona; Redaelli, Sara; Magistroni, Vera; Gambacorti-Passerini, Carlo

2012-01-01

Gene fusions are common driver events in leukaemias and solid tumours; here we present FusionAnalyser, a tool dedicated to the identification of driver fusion rearrangements in human cancer through the analysis of paired-end high-throughput transcriptome sequencing data. We initially tested FusionAnalyser by using a set of in silico randomly generated sequencing data from 20 known human translocations occurring in cancer and subsequently using transcriptome data from three chronic and three acute myeloid leukaemia samples. in all the cases our tool was invariably able to detect the presence of the correct driver fusion event(s) with high specificity. In one of the acute myeloid leukaemia samples, FusionAnalyser identified a novel, cryptic, in-frame ETS2–ERG fusion. A fully event-driven graphical interface and a flexible filtering system allow complex analyses to be run in the absence of any a priori programming or scripting knowledge. Therefore, we propose FusionAnalyser as an efficient and robust graphical tool for the identification of functional rearrangements in the context of high-throughput transcriptome sequencing data. PMID:22570408

FusionAnalyser: a new graphical, event-driven tool for fusion rearrangements discovery.

PubMed

Piazza, Rocco; Pirola, Alessandra; Spinelli, Roberta; Valletta, Simona; Redaelli, Sara; Magistroni, Vera; Gambacorti-Passerini, Carlo

2012-09-01

Gene fusions are common driver events in leukaemias and solid tumours; here we present FusionAnalyser, a tool dedicated to the identification of driver fusion rearrangements in human cancer through the analysis of paired-end high-throughput transcriptome sequencing data. We initially tested FusionAnalyser by using a set of in silico randomly generated sequencing data from 20 known human translocations occurring in cancer and subsequently using transcriptome data from three chronic and three acute myeloid leukaemia samples. in all the cases our tool was invariably able to detect the presence of the correct driver fusion event(s) with high specificity. In one of the acute myeloid leukaemia samples, FusionAnalyser identified a novel, cryptic, in-frame ETS2-ERG fusion. A fully event-driven graphical interface and a flexible filtering system allow complex analyses to be run in the absence of any a priori programming or scripting knowledge. Therefore, we propose FusionAnalyser as an efficient and robust graphical tool for the identification of functional rearrangements in the context of high-throughput transcriptome sequencing data.

Junction region of EWS-FLI1 fusion protein has a dominant negative effect in Ewing's sarcoma in vitro.

PubMed

Jully, Babu; Vijayalakshmi, Ramshankar; Gopal, Gopisetty; Sabitha, Kesavan; Rajkumar, Thangarajan

2012-11-12

Ewing's sarcoma is a malignancy characterized by a specific 11:22 chromosomal translocation which generates a novel EWS-FLI1 fusion protein functioning as an aberrant transcription factor. In the present study, we have further characterized the junction region of the EWS-FLI1 fusion protein. In-silico model of EWS-FLI1 fusion protein was analysed for ligand binding sites, and a putative region (amino acid (aa) 251-343 of the type 1 fusion protein) in the vicinity of the fusion junction was cloned and expressed using bacterial expression. The recombinant protein was characterized by Circular Dichroism (CD). We then expressed aa 251-280 ectopically in Ewing's sarcoma cell-line and its effect on cell proliferation, tumorigenicity and expression of EWS-FLI1 target genes were analysed. Our modelling analysis indicated that Junction region (aa 251-343) encompasses potential ligand biding sites in the EWS-FLI1 protein and when expressed in bacteria was present as soluble form. Ectopically expressing this region in Ewing's sarcoma cells inhibited tumorigenicity, and EWS-FLI1 target genes indicating a dominant negative biological effect. Junction region can be exploited further as target for drug development in future to specifically target EWS-FLI1 in Ewing's Sarcoma.

Characterization of fusion genes and the significantly expressed fusion isoforms in breast cancer by hybrid sequencing.

PubMed

Weirather, Jason L; Afshar, Pegah Tootoonchi; Clark, Tyson A; Tseng, Elizabeth; Powers, Linda S; Underwood, Jason G; Zabner, Joseph; Korlach, Jonas; Wong, Wing Hung; Au, Kin Fai

2015-10-15

We developed an innovative hybrid sequencing approach, IDP-fusion, to detect fusion genes, determine fusion sites and identify and quantify fusion isoforms. IDP-fusion is the first method to study gene fusion events by integrating Third Generation Sequencing long reads and Second Generation Sequencing short reads. We applied IDP-fusion to PacBio data and Illumina data from the MCF-7 breast cancer cells. Compared with the existing tools, IDP-fusion detects fusion genes at higher precision and a very low false positive rate. The results show that IDP-fusion will be useful for unraveling the complexity of multiple fusion splices and fusion isoforms within tumorigenesis-relevant fusion genes. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Molecular cloning, polyclonal antibody preparation, and characterization of a functional iron-related transcription factor IRO2 from Malus xiaojinensis.

PubMed

Yin, Lili; Wang, Yi; Yan, Mudan; Zhang, Xinzhong; Pan, Haifa; Xu, Xuefeng; Han, Zhenhai

2013-06-01

Transcription factors play important roles in plant growth and responses to environmental stresses. In this study, a novel basic helix-loop-helix iron-related transcription factor, IRO2, containing a 762-bp open reading frame and encoding 253 amino acids, was cloned from the iron-efficient genotype of Malus xiaojinensis. Localization analyses in onion showed that the MxIRO2 protein was targeted to the nucleus and activation studies in yeast indicated MxIRO2-BD had weak transcriptional activation activity. Prokaryotic expression of MxIRO2 in Escherichia coli BL21 (DE3) pLysS cells resulted in high expression levels of the protein when induced with isopropyl-β-d-thiogalactoside. The fusion protein was purified using Ni-NTA His-bind resin, and the purified MxIRO2-His fusion protein was used as the antigen to immunize a New Zealand rabbit. The resulting antiserum was purified by precipitation with 50% saturated ammonium sulfate and DEAE Sephadex A-50 chromatography to obtain the immunoglobulin G fraction. The expression of MxIRO2 in roots and leaves of M. xiaojinensis seedlings under iron deficiency was determined. The results indicated that MxIRO2 was induced in both roots and leaves under iron deficiency. In these experimental conditions, the transcription and translation levels first increased and then decreased under iron deficiency. This work offers an important basis for further investigating the mechanisms of fruit tree adaptation to iron deficiency. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

Nuclear Fusion prize laudation Nuclear Fusion prize laudation

NASA Astrophysics Data System (ADS)

Burkart, W.

2011-01-01

Clean energy in abundance will be of critical importance to the pursuit of world peace and development. As part of the IAEA's activities to facilitate the dissemination of fusion related science and technology, the journal Nuclear Fusion is intended to contribute to the realization of such energy from fusion. In 2010, we celebrated the 50th anniversary of the IAEA journal. The excellence of research published in the journal is attested to by its high citation index. The IAEA recognizes excellence by means of an annual prize awarded to the authors of papers judged to have made the greatest impact. On the occasion of the 2010 IAEA Fusion Energy Conference in Daejeon, Republic of Korea at the welcome dinner hosted by the city of Daejeon, we celebrated the achievements of the 2009 and 2010 Nuclear Fusion prize winners. Steve Sabbagh, from the Department of Applied Physics and Applied Mathematics, Columbia University, New York is the winner of the 2009 award for his paper: 'Resistive wall stabilized operation in rotating high beta NSTX plasmas' [1]. This is a landmark paper which reports record parameters of beta in a large spherical torus plasma and presents a thorough investigation of the physics of resistive wall mode (RWM) instability. The paper makes a significant contribution to the critical topic of RWM stabilization. John Rice, from the Plasma Science and Fusion Center, MIT, Cambridge is the winner of the 2010 award for his paper: 'Inter-machine comparison of intrinsic toroidal rotation in tokamaks' [2]. The 2010 award is for a seminal paper that analyzes results across a range of machines in order to develop a universal scaling that can be used to predict intrinsic rotation. This paper has already triggered a wealth of experimental and theoretical work. I congratulate both authors and their colleagues on these exceptional papers. W. Burkart Deputy Director General Department of Nuclear Sciences and Applications International Atomic Energy Agency, Vienna

Measuring time of flight of fusion products in an inertial electrostatic confinement fusion device for spatial profiling of fusion reactions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Donovan, D. C.; Boris, D. R.; Kulcinski, G. L.

2013-03-15

A new diagnostic has been developed that uses the time of flight (TOF) of the products from a nuclear fusion reaction to determine the location where the fusion reaction occurred. The TOF diagnostic uses charged particle detectors on opposing sides of the inertial electrostatic confinement (IEC) device that are coupled to high resolution timing electronics to measure the spatial profile of fusion reactions occurring between the two charged particle detectors. This diagnostic was constructed and tested by the University of Wisconsin-Madison Inertial Electrostatic Confinement Fusion Group in the IEC device, HOMER, which accelerates deuterium ions to fusion relevant energies inmore » a high voltage ({approx}100 kV), spherically symmetric, electrostatic potential well [J. F. Santarius, G. L. Kulcinski, R. P. Ashley, D. R. Boris, B. B. Cipiti, S. K. Murali, G. R. Piefer, R. F. Radel, T. E. Radel, and A. L. Wehmeyer, Fusion Sci. Technol. 47, 1238 (2005)]. The TOF diagnostic detects the products of D(d,p)T reactions and determines where along a chord through the device the fusion event occurred. The diagnostic is also capable of using charged particle spectroscopy to determine the Doppler shift imparted to the fusion products by the center of mass energy of the fusion reactants. The TOF diagnostic is thus able to collect spatial profiles of the fusion reaction density along a chord through the device, coupled with the center of mass energy of the reactions occurring at each location. This provides levels of diagnostic detail never before achieved on an IEC device.« less

Spinal Fusion

MedlinePlus

... concept of fusion is similar to that of welding in industry. Spinal fusion surgery, however, does not ... bone taken from the patient has a long history of use and results in predictable healing. Autograft ...

Review of fusion synfuels

DOE Office of Scientific and Technical Information (OSTI.GOV)

Fillo, J.A.

1980-01-01

Thermonuclear fusion offers an inexhaustible source of energy for the production of hydrogen from water. Depending on design, electric generation efficiencies of approx. 40 to 60% and hydrogen production efficiencies by high-temperature electrolysis of approx. 50 to 65% are projected for fusion reactors using high-temperatures blankets. Fusion/coal symbiotic systems appear economically promising for the first generation of commercial fusion synfuels plants. Coal production requirements and the environmental effects of large-scale coal usage would be greatly reduced by a fusion/coal system. In the long term, there could be a gradual transition to an inexhaustible energy system based solely on fusion.

Clinicopathological features of younger (aged ≤ 50 years) lung adenocarcinoma patients harboring the EML4-ALK fusion gene.

PubMed

Kometani, Takuro; Sugio, Kenji; Osoegawa, Atsushi; Seto, Takashi; Ichinose, Yukito

2018-05-01

The EML4-ALK fusion gene has recently been identified as a driver mutation in a subset of non-small cell lung cancers. In subsequent studies, EML4-ALK has been detected in a low percentage of patients, and was associated with a lack of EGFR or KRAS mutations, younger age, and adenocarcinoma with acinar histology. Cases with the EML4-ALK fusion gene were examined to clarify the clinicopathological characteristics of young adenocarcinoma patients. Between December 1998 and May 2009, 85 patients aged ≤ 50 with lung adenocarcinoma were treated at our hospital. We examined 49 samples from adenocarcinoma patients who underwent surgical resection, chemotherapy, and/or radiotherapy for the EML4-ALK gene. None of the patients received ALK inhibitors because these drugs had not been approved in Japan before 2012. EML4-ALK fusion genes were screened using multiplex reverse-transcription PCR assay, and were confirmed by direct sequencing. The EML4-ALK fusion gene was detected in five tumors (10.2%). One patient had stage IB disease, one had stage IIIA, and three had stage IV. Histologically, there was one solid adenocarcinoma, two acinar adenocarcinomas, and two papillary adenocarcinomas. EML4-ALK fusion genes were mutually exclusive to EGFR and KRAS mutations. The five-year survival rate was 59.4% in patients without EML4-ALK fusion and was not reached in patients with EML4-ALK fusion. The EML4-ALK fusion gene may be a strong oncogene in younger patients with lung adenocarcinoma. © 2018 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

Minimal Phenotype of Mice Homozygous for a Null Mutation in the Forkhead/Winged Helix Gene, Mf2

PubMed Central

Kume, Tsutomu; Deng, Keyu; Hogan, Brigid L. M.

2000-01-01

Mf2 (mesoderm/mesenchyme forkhead 2) encodes a forkhead/winged helix transcription factor expressed in numerous tissues of the mouse embryo, including paraxial mesoderm, somites, branchial arches, vibrissae, developing central nervous system, and developing kidney. We have generated mice homozygous for a null mutation in the Mf2 gene (Mf2lacZ) to examine its role during embryonic development. The lacZ allele also allows monitoring of Mf2 gene expression. Homozygous null mutants are viable and fertile and have no major developmental defects. Some mutants show renal abnormalities, including kidney hypoplasia and hydroureter, but the penetrance of this phenotype is only 40% or lower, depending on the genetic background. These data suggest that Mf2 can play a unique role in kidney development, but there is functional redundancy in this organ and other tissues with other forkhead/winged helix genes. PMID:10648626

Arthroscopic partial wrist fusion.

PubMed

Ho, Pak-Cheong

2008-12-01

The wide intraarticular exposure of the wrist joint under arthroscopic view provides an excellent ground for various forms of partial wrist fusion. Combining with percutaneous fixation technique, arthroscopic partial wrist fusion can potentially generate the best possible functional outcome by preserving the maximal motion pertained with each type of partial wrist fusion because the effect of extraarticular adhesion associated with open surgery can be minimized. From November 1997 to May 2008, the author had performed 12 cases of arthroscopic partial wrist fusion, including scaphotrapeziotrapezoid fusion in 3, scaphoidectomy and 4-corner fusion in 4, radioscapholunate fusion in 3, radiolunate fusion in 1, and lunotriquetral fusion in 1 case. Through the radiocarpal or midcarpal joint, the corresponding articular surfaces were denuded of cartilage using arthroscopic burr and curette. Carpal bones involved in the fusion process were then transfixed with K wires percutaneously after alignment corrected and confirmed under fluoroscopic control. Autogenous cancellous bone graft or bone substitute were inserted and impacted to the fusion site through cannula under direct arthroscopic view. Final fixation could be by multiple K wires or cannulated screw system. Early mobilization was encouraged. Surgical complications were minor, including pin tract infection, skin burn, and delay union in 1 case. Uneventful radiologic union was obtained in 9 cases, stable fibrous union in 2, and nonunion in 1. The average follow-up period was 70 months. Symptom was resolved or improved, and functional motion was gained in all cases. All surgical scars were almost invisible, and aesthetic outcome was excellent.

Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

PubMed Central

2010-01-01

Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

Magneto-Inertial Fusion

DOE PAGES

Wurden, G. A.; Hsu, S. C.; Intrator, T. P.; ...

2015-11-17

In this community white paper, we describe an approach to achieving fusion which employs a hybrid of elements from the traditional magnetic and inertial fusion concepts, called magneto-inertial fusion (MIF). Furthermore, the status of MIF research in North America at multiple institutions is summarized including recent progress, research opportunities, and future plans.

Cloning and characterization of GETS-1, a goldfish Ets family member that functions as a transcriptional repressor in muscle.

PubMed

Goldman, D; Sapru, M K; Stewart, S; Plotkin, J; Libermann, T A; Wasylyk, B; Guan, K

1998-10-15

An Ets transcription factor family member, GETS-1, was cloned from a goldfish retina cDNA library. GETS-1 contains a conserved Ets DNA-binding domain at its N-terminus and is most similar to ternary complex factor (TCF) serum-response-factor protein-1a (SAP-1a). GETS-1 is expressed in many tissues, but is enriched in retina and brain. As with the TCFs SAP-1a and ets-related protein (ERP), overexpression of the GETS-1 promoter suppresses nicotinic acetylcholine receptor epsilon-subunit gene expression in cultured muscle cells. A consensus Ets binding site sequence in the promoter of the epsilon-subunit gene is required for GETS-1-mediated repression. GETS-1 repressor activity is abrogated by overexpression of an activated Ras/mitogen-activated protein kinase (MAP kinase) or by mutation of Ser-405, a MAP kinase phosphorylation site in GETS-1. Fusion proteins created between GETS-1 and the Gal4 DNA-binding domain show that, like other TCFs, GETS-1 contains a C-terminal activation domain that is activated by a Ras/MAP kinase signalling cascade. Interestingly, mutation of Ser-405 located within this activation domain abrogated transcriptional activation of the fusion protein.

Intact or broken-apart RNA: an alternative concept for ALK fusion screening in non-small cell lung cancer (NSCLC).

PubMed

Kotoula, Vassiliki; Bobos, Mattheos; Vassilakopoulou, Maria; Tsolaki, Eleftheria; Chrisafi, Sofia; Psyrri, Amanda; Lazaridis, George; Papadopoulou, Kyriaki; Efstratiou, Ioannis; Michail-Strantzia, Catherine; Debelenko, Larisa V; Kosmidis, Paris; Fountzilas, George

2015-01-01

Anaplastic lymphoma kinase (ALK) break-apart fluorescent in situ hybridization (FISH) is currently used in diagnostics for the selection of non-small cell lung cancer (NSCLC) patients to receive crizotinib. We evaluated ALK status in NSCLC with a novel ALK mRNA test based on the break-apart FISH concept, which we called break-apart transcript (BAT) test. ALK5' and ALK3' transcript patterns were established with qPCR for ALK-expressing controls including fusion-negative neuroblastomas, as well as fusion-positive anaplastic large cell lymphomas and NSCLC. The BAT test was evaluated on 271 RNA samples from routinely processed paraffin NSCLC tissues. Test results were compared with ALK FISH (n=121), immunohistochemical (IHC) analysis (n=86), and automated quantitative analysis (AQUA, n=83). On the basis of the nonoverlapping ALK BAT patterns in ALK-expressing controls (P<0.0001), 8/174 adenocarcinomas (4.6%) among 259 informative NSCLC were predicted as fusion positive. Overall concordance for paired method results was high (94.1% to 98.8%) but mainly concerned negative prediction because of the limited availability of positive-matched cases. Tumors with 100% cytoplasmic IHC staining of any intensity (n=3) were positive for AQUA, FISH, and BAT test; tumors with lower IHC positivity and different staining patterns were AQUA-negative. Upon multiple reevaluations, ALK gene status was considered as originally misinterpreted by FISH in 3/121 cases (2.5%). Tumors with >4 ALK gene copies were associated with longer overall survival upon first-line chemotherapy. In conclusion, application of the ALK BAT test on routinely processed NSCLC tissues yields the same fusion partner independent information as ALK break-apart FISH but is more robust and cost-effective. The BAT concept may be considered for the development of further drug-predictive translocation tests.

Membrane fusion and exocytosis.

PubMed

Jahn, R; Südhof, T C

1999-01-01

Membrane fusion involves the merger of two phospholipid bilayers in an aqueous environment. In artificial lipid bilayers, fusion proceeds by means of defined transition states, including hourglass-shaped intermediates in which the proximal leaflets of the fusing membranes are merged whereas the distal leaflets are separate (fusion stalk), followed by the reversible opening of small aqueous fusion pores. Fusion of biological membranes requires the action of specific fusion proteins. Best understood are the viral fusion proteins that are responsible for merging the viral with the host cell membrane during infection. These proteins undergo spontaneous and dramatic conformational changes upon activation. In the case of the paradigmatic fusion proteins of the influenza virus and of the human immunodeficiency virus, an amphiphilic fusion peptide is inserted into the target membrane. The protein then reorients itself, thus forcing the fusing membranes together and inducing lipid mixing. Fusion of intracellular membranes in eukaryotic cells involves several protein families including SNAREs, Rab proteins, and Sec1/Munc-18 related proteins (SM-proteins). SNAREs form a novel superfamily of small and mostly membrane-anchored proteins that share a common motif of about 60 amino acids (SNARE motif). SNAREs reversibly assemble into tightly packed helical bundles, the core complexes. Assembly is thought to pull the fusing membranes closely together, thus inducing fusion. SM-proteins comprise a family of soluble proteins that bind to certain types of SNAREs and prevent the formation of core complexes. Rab proteins are GTPases that undergo highly regulated GTP-GDP cycles. In their GTP form, they interact with specific proteins, the effector proteins. Recent evidence suggests that Rab proteins function in the initial membrane contact connecting the fusing membranes but are not involved in the fusion reaction itself.

Erwinia carotovora subsp. carotovora extracellular protease: characterization and nucleotide sequence of the gene.

PubMed Central

Kyöstiö, S R; Cramer, C L; Lacy, G H

1991-01-01

The prt1 gene encoding extracellular protease from Erwinia carotovora subsp. carotovora EC14 in cosmid pCA7 was subcloned to create plasmid pSK1. The partial nucleotide sequence of the insert in pSK1 (1,878 bp) revealed a 1,041-bp open reading frame (ORF1) that correlated with protease activity in deletion mutants. ORF1 encodes a polypeptide of 347 amino acids with a calculated molecular mass of 38,826 Da. Escherichia coli transformed with pSK1 or pSK23, a subclone of pSK1, produces a protease (Prt1) intracellularly with a molecular mass of 38 kDa and a pI of 4.8. Prt1 activity was inhibited by phenanthroline, suggesting that it is a metalloprotease. The prt1 promoter was localized between 173 and 1,173 bp upstream of ORF1 by constructing transcriptional lacZ fusions. Primer extension identified the prt1 transcription start site 205 bp upstream of ORF1. The deduced amino acid sequence of ORF1 showed significant sequence identity to metalloproteases from Bacillus thermoproteolyticus (thermolysin), B. subtilis (neutral protease), Legionella pneumophila (metalloprotease), and Pseudomonas aeruginosa (elastase). It has less sequence similarity to metalloproteases from Serratia marcescens and Erwinia chrysanthemi. Locations for three zinc ligands and the active site for E. carotovora subsp. carotovora protease were predicted from thermolysin. Images FIG. 2 FIG. 5 FIG. 6 FIG. 8 FIG. 9 PMID:1917878

Mechanisms of iron regulation of luminescence in Vibrio fischeri.

PubMed Central

Haygood, M G; Nealson, K H

1985-01-01

Synthesis of luciferase (an autoinducible enzyme) is repressed by iron in the symbiotic bioluminescent bacterium Vibrio fischeri. Possible mechanisms of iron regulation of luciferase synthesis were tested with V. fischeri and with Escherichia coli clones containing plasmids carrying V. fischeri luminescence genes. Experiments were conducted in complete medium with and without the synthetic iron chelator ethylenediamine-di(o-hydroxyphenyl acetic acid). Comparison of the effect of ethylenediamine-di(o-hydroxyphenyl acetic acid) and another growth inhibitor, (2-n-heptyl-4-hydroxyquinoline-N-oxide), showed that iron repression is not due to inhibition of growth. A quantitative bioassay for autoinducer was developed with E. coli HB101 containing pJE411, a plasmid carrying V. fischeri luminescence genes with a transcriptional fusion between luxI and E. coli lacZ. Bioassay experiments showed no effect of iron on either autoinducer activity or production (before induction) or transcription of the lux operon. Ethylenediamine-di(o-hydroxyphenyl acetic acid) did not affect luciferase induction in E. coli strains with wild-type iron assimilation (ED8654) or impaired iron assimilation (RW193) bearing pJE202 (a plasmid with functional V. fischeri lux genes), suggesting that the genes responsible for the iron effect are missing or substituted in these clones. Two models are consistent with the data: (i) iron represses autoinducer transport, and (ii) iron acts through an autoinduction-independent regulatory system (e.g., an iron repressor). PMID:3920202

The Myxococcus xanthus Two-Component System CorSR Regulates Expression of a Gene Cluster Involved in Maintaining Copper Tolerance during Growth and Development

PubMed Central

Sánchez-Sutil, María Celestina; Pérez, Juana; Gómez-Santos, Nuria; Shimkets, Lawrence J.; Moraleda-Muñoz, Aurelio; Muñoz-Dorado, José

2013-01-01

Myxococcus xanthus is a soil-dwelling member of the δ–Proteobacteria that exhibits a complex developmental cycle upon starvation. Development comprises aggregation and differentiation into environmentally resistant myxospores in an environment that includes fluctuations in metal ion concentrations. While copper is essential for M. xanthus cells because several housekeeping enzymes use it as a cofactor, high copper concentrations are toxic. These opposing effects force cells to maintain a tight copper homeostasis. A plethora of paralogous genes involved in copper detoxification, all of which are differentially regulated, have been reported in M. xanthus. The use of in-frame deletion mutants and fusions with the reporter gene lacZ has allowed the identification of a two-component system, CorSR, that modulates the expression of an operon termed curA consisting of nine genes whose expression slowly increases after metal addition, reaching a plateau. Transcriptional regulation of this operon is complex because transcription can be initiated at different promoters and by different types of regulators. These genes confer copper tolerance during growth and development. Copper induces carotenoid production in a ΔcorSR mutant at lower concentrations than with the wild-type strain due to lack of expression of a gene product resembling subunit III of cbb3-type cytochrome c oxidase. This data may explain why copper induces carotenoid biosynthesis at suboptimal rather than optimal growth conditions in wild-type strains. PMID:23874560

Post-transcriptional regulatory network of epithelial-to-mesenchymal and mesenchymal-to-epithelial transitions

PubMed Central

2014-01-01

Epithelial-to-mesenchymal transition (EMT) and its reverse process, mesenchymal-to-epithelial transition (MET), play important roles in embryogenesis, stem cell biology, and cancer progression. EMT can be regulated by many signaling pathways and regulatory transcriptional networks. Furthermore, post-transcriptional regulatory networks regulate EMT; these networks include the long non-coding RNA (lncRNA) and microRNA (miRNA) families. Specifically, the miR-200 family, miR-101, miR-506, and several lncRNAs have been found to regulate EMT. Recent studies have illustrated that several lncRNAs are overexpressed in various cancers and that they can promote tumor metastasis by inducing EMT. MiRNA controls EMT by regulating EMT transcription factors or other EMT regulators, suggesting that lncRNAs and miRNA are novel therapeutic targets for the treatment of cancer. Further efforts have shown that non-coding-mediated EMT regulation is closely associated with epigenetic regulation through promoter methylation (e.g., miR-200 or miR-506) and protein regulation (e.g., SET8 via miR-502). The formation of gene fusions has also been found to promote EMT in prostate cancer. In this review, we discuss the post-transcriptional regulatory network that is involved in EMT and MET and how targeting EMT and MET may provide effective therapeutics for human disease. PMID:24598126

The use of quantitative real-time reverse transcriptase PCR for 5' and 3' portions of ALK transcripts to detect ALK rearrangements in lung cancers.

PubMed

Wang, Rui; Pan, Yunjian; Li, Chenguang; Hu, Haichuan; Zhang, Yang; Li, Hang; Luo, Xiaoyang; Zhang, Jie; Fang, Zhaoyuan; Li, Yuan; Shen, Lei; Ji, Hongbin; Garfield, David; Sun, Yihua; Chen, Haiquan

2012-09-01

Approximately 3% to 7% of non-small cell lung cancers (NSCLC) harbor an ALK fusion gene, thus defining a tumor group that may be responsive to targeted therapy. The breakpoint in ALK consistently occurs at exon 20 and EML4 or other fusion partners, thus driving a strong expression of ALK kinase domain and resulting in an unbalanced expression in 5' and 3' portions of ALK transcripts. We have developed a rapid and accurate method by simultaneously detecting the expression in 5' and 3' portions of ALK mRNA. Quantitative real-time reverse transcriptase PCR (qRT-PCR) was used to examine expression levels of the 5' and 3' portions of ALK transcripts in177 NSCLCs, in which EGFR, KRAS, HER2, and BRAF mutations were absent. If unbalanced ALK mRNA expression was seen, ALK rearrangement was assumed to exist. ALK FISH was used to confirm the accuracy of qRT-PCR. RT-PCR and 5' RACE coupling sequencing identified the fusion variants. Real-time RT-PCR showed excellent sensitivity and specificity (100% and 100%, respectively) for detection of ALK rearrangements in resected specimens. In addition, six novel ALK fusion variants were identified, including one KIF5B-ALK (E17;A20) and five EML4-ALK variants (E6a;A19, E6a/b ins 18;A20, E17b ins 39;A20, E10a/b, E13;A20, and E17 ins 65;A20). Real-time RT-PCR is a rapid and accurate method for diagnosing ALK-rearranged lung cancers. Coupling of 5' RACE to this method should further facilitate rapid identification of novel ALK fusion genes. ©2012 AACR.

Review of the magnetic fusion program by the 1986 ERAB Fusion Panel

NASA Astrophysics Data System (ADS)

Davidson, Ronald C.

1987-09-01

The 1986 ERAB Fusion Panel finds that fusion energy continues to be an attractive energy source with great potential for the future, and that the magnetic fusion program continues to make substantial technical progress. In addition, fusion research advances plasma physics, a sophisticated and useful branch of applied science, as well as technologies important to industry and defense. These factors fully justify the substantial expenditures by the Department of Energy in fusion research and development (R&D). The Panel endorses the overall program direction, strategy, and plans, and recognizes the importance and timeliness of proceeding with a burning plasma experiment, such as the proposed Compact Ignition Tokamak (CIT) experiment.

Novel BCOR-MAML3 and ZC3H7B-BCOR Gene Fusions in Undifferentiated Small Blue Round Cell Sarcomas.

PubMed

Specht, Katja; Zhang, Lei; Sung, Yun-Shao; Nucci, Marisa; Dry, Sarah; Vaiyapuri, Sumathi; Richter, Gunther H S; Fletcher, Christopher D M; Antonescu, Cristina R

2016-04-01

Small blue round cell tumors (SBRCTs) are a heterogenous group of tumors that are difficult to diagnose because of overlapping morphologic, immunohistochemical, and clinical features. About two-thirds of EWSR1-negative SBRCTs are associated with CIC-DUX4-related fusions, whereas another small subset shows BCOR-CCNB3 X-chromosomal paracentric inversion. Applying paired-end RNA sequencing to an SBRCT index case of a 44-year-old man, we identified a novel BCOR-MAML3 chimeric fusion, which was validated by reverse transcription polymerase chain reaction and fluorescence in situ hybridization techniques. We then screened a total of 75 SBRCTs lacking EWSR1, FUS, SYT, CIC, and BCOR-CCNB3 abnormalities for BCOR break-apart probes by fluorescence in situ hybridization to detect potential recurrent BCOR gene rearrangements outside the typical X-chromosomal inversion. Indeed, 8/75 (11%) SBRCTs showed distinct BCOR gene rearrangements, with 2 cases each showing either a BCOR-MAML3 or the alternative ZC3H7B-BCOR fusion, whereas no fusion partner was detected in the remaining 4 cases. Gene expression of the BCOR-MAML3-positive index case showed a distinct transcriptional profile with upregulation of HOX-gene signature, compared with classic Ewing's sarcoma or CIC-DUX4-positive SBRCTs. The clinicopathologic features of the SBRCTs with alternative BCOR rearrangements were also compared with a group of BCOR-CCNB3 inversion-positive cases, combining 11 from our files with a meta-analysis of 42 published cases. The BCOR-CCNB3-positive tumors occurred preferentially in children and in bone, in contrast to alternative BCOR-rearranged SBRCTs, which presented in young adults, with a variable anatomic distribution. Furthermore, BCOR-rearranged tumors often displayed spindle cell areas, either well defined in intersecting fascicles or blending with the round cell component, which appears distinct from most other fusion-positive SBRCTs and shares histologic overlap with poorly

Regulation of TCF ETS-domain transcription factors by helix-loop-helix motifs.

PubMed

Stinson, Julie; Inoue, Toshiaki; Yates, Paula; Clancy, Anne; Norton, John D; Sharrocks, Andrew D

2003-08-15

DNA binding by the ternary complex factor (TCF) subfamily of ETS-domain transcription factors is tightly regulated by intramolecular and intermolecular interactions. The helix-loop-helix (HLH)-containing Id proteins are trans-acting negative regulators of DNA binding by the TCFs. In the TCF, SAP-2/Net/ERP, intramolecular inhibition of DNA binding is promoted by the cis-acting NID region that also contains an HLH-like motif. The NID also acts as a transcriptional repression domain. Here, we have studied the role of HLH motifs in regulating DNA binding and transcription by the TCF protein SAP-1 and how Cdk-mediated phosphorylation affects the inhibitory activity of the Id proteins towards the TCFs. We demonstrate that the NID region of SAP-1 is an autoinhibitory motif that acts to inhibit DNA binding and also functions as a transcription repression domain. This region can be functionally replaced by fusion of Id proteins to SAP-1, whereby the Id moiety then acts to repress DNA binding in cis. Phosphorylation of the Ids by cyclin-Cdk complexes results in reduction in protein-protein interactions between the Ids and TCFs and relief of their DNA-binding inhibitory activity. In revealing distinct mechanisms through which HLH motifs modulate the activity of TCFs, our results therefore provide further insight into the role of HLH motifs in regulating TCF function and how the inhibitory properties of the trans-acting Id HLH proteins are themselves regulated by phosphorylation.

The actin cytoskeleton inhibits pore expansion during PIV5 fusion protein-promoted cell-cell fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wurth, Mark A.; Schowalter, Rachel M.; Smith, Everett Clinton

2010-08-15

Paramyxovirus fusion (F) proteins promote both virus-cell fusion, required for viral entry, and cell-cell fusion, resulting in syncytia formation. We used the F-actin stabilizing drug, jasplakinolide, and the G-actin sequestrant, latrunculin A, to examine the role of actin dynamics in cell-cell fusion mediated by the parainfluenza virus 5 (PIV5) F protein. Jasplakinolide treatment caused a dose-dependent increase in cell-cell fusion as measured by both syncytia and reporter gene assays, and latrunculin A treatment also resulted in fusion stimulation. Treatment with jasplakinolide or latrunculin A partially rescued a fusion pore opening defect caused by deletion of the PIV5 F protein cytoplasmicmore » tail, but these drugs had no effect on fusion inhibited at earlier stages by either temperature arrest or by a PIV5 heptad repeat peptide. These data suggest that the cortical actin cytoskeleton is an important regulator of fusion pore enlargement, an energetically costly stage of viral fusion protein-mediated membrane merger.« less

The actin cytoskeleton inhibits pore expansion during PIV5 fusion protein-promoted cell-cell fusion

PubMed Central

Wurth, Mark A.; Schowalter, Rachel M.; Smith, Everett Clinton; Moncman, Carole L.; Dutch, Rebecca Ellis; McCann, Richard O.

2010-01-01

Paramyxovirus fusion (F) proteins promote both virus-cell fusion, required for viral entry, and cell-cell fusion, resulting in syncytia formation. We used the F-actin stabilizing drug, jasplakinolide, and the G-actin sequestrant, latrunculin A, to examine the role of actin dynamics in cell-cell fusion mediated by the parainfluenza virus 5 (PIV5) F protein. Jasplakinolide treatment caused a dose-dependent increase in cell-cell fusion as measured by both syncytia and reporter gene assays, and latrunculin A treatment also resulted in fusion stimulation. Treatment with jasplakinolide or latrunculin A partially rescued a fusion pore opening defect caused by deletion of the PIV5 F protein cytoplasmic tail, but these drugs had no effect on fusion inhibited at earlier stages by either temperature arrest or by a PIV5 heptad repeat peptide. These data suggest that the cortical actin cytoskeleton is an important regulator of fusion pore enlargement, an energetically costly stage of viral fusion protein-mediated membrane merger. PMID:20537366

Expression and Functional Analysis of WRKY Transcription Factors in Chinese Wild Hazel, Corylus heterophylla Fisch

PubMed Central

Liang, Li-Song; Ma, Qing-Hua; Chen, Xin; Zong, Jian-Wei; Wang, Gui-Xi

2015-01-01

Plant WRKY transcription factors are known to regulate various biotic and abiotic stress responses. In this study we identified a total of 30 putative WRKY unigenes in a transcriptome dataset of the Chinese wild Hazel, Corylus heterophylla, a species that is noted for its cold tolerance. Thirteen full-length of these ChWRKY genes were cloned and found to encode complete protein sequences, and they were divided into three groups, based on the number of WRKY domains and the pattern of zinc finger structures. Representatives of each of the groups, Unigene25835 (group I), Unigene37641 (group II) and Unigene20441 (group III), were transiently expressed as fusion proteins with yellow fluorescent fusion protein in Nicotiana benthamiana, where they were observed to accumulate in the nucleus, in accordance with their predicted roles as transcriptional activators. An analysis of the expression patterns of all 30 WRKY genes revealed differences in transcript abundance profiles following exposure to cold, drought and high salinity conditions. Among the stress-inducible genes, 23 were up-regulated by all three abiotic stresses and the WRKY genes collectively exhibited four different patterns of expression in flower buds during the overwintering period from November to April. The organ/tissue related expression analysis showed that 18 WRKY genes were highly expressed in stem but only 2 (Unigene9262 and Unigene43101) were greatest in male anthotaxies. The expression of Unigene37641, a member of the group II WRKY genes, was substantially up-regulated by cold, drought and salinity treatments, and its overexpression in Arabidopsis thaliana resulted in better seedling growth, compared with wild type plants, under cold treatment conditions. The transgenic lines also had exhibited higher soluble protein content, superoxide dismutase and peroxidase activiety and lower levels of malondialdehyde, which collectively suggets that Unigene37641 expression promotes cold tolerance. PMID

Expression and Functional Analysis of WRKY Transcription Factors in Chinese Wild Hazel, Corylus heterophylla Fisch.

PubMed

Zhao, Tian-Tian; Zhang, Jin; Liang, Li-Song; Ma, Qing-Hua; Chen, Xin; Zong, Jian-Wei; Wang, Gui-Xi

2015-01-01

Plant WRKY transcription factors are known to regulate various biotic and abiotic stress responses. In this study we identified a total of 30 putative WRKY unigenes in a transcriptome dataset of the Chinese wild Hazel, Corylus heterophylla, a species that is noted for its cold tolerance. Thirteen full-length of these ChWRKY genes were cloned and found to encode complete protein sequences, and they were divided into three groups, based on the number of WRKY domains and the pattern of zinc finger structures. Representatives of each of the groups, Unigene25835 (group I), Unigene37641 (group II) and Unigene20441 (group III), were transiently expressed as fusion proteins with yellow fluorescent fusion protein in Nicotiana benthamiana, where they were observed to accumulate in the nucleus, in accordance with their predicted roles as transcriptional activators. An analysis of the expression patterns of all 30 WRKY genes revealed differences in transcript abundance profiles following exposure to cold, drought and high salinity conditions. Among the stress-inducible genes, 23 were up-regulated by all three abiotic stresses and the WRKY genes collectively exhibited four different patterns of expression in flower buds during the overwintering period from November to April. The organ/tissue related expression analysis showed that 18 WRKY genes were highly expressed in stem but only 2 (Unigene9262 and Unigene43101) were greatest in male anthotaxies. The expression of Unigene37641, a member of the group II WRKY genes, was substantially up-regulated by cold, drought and salinity treatments, and its overexpression in Arabidopsis thaliana resulted in better seedling growth, compared with wild type plants, under cold treatment conditions. The transgenic lines also had exhibited higher soluble protein content, superoxide dismutase and peroxidase activiety and lower levels of malondialdehyde, which collectively suggets that Unigene37641 expression promotes cold tolerance.

Ontological Issues in Higher Levels of Information Fusion: User Refinement of the Fusion Process

DTIC Science & Technology

2003-01-01

fusion question, the thing that is separates the Greek We explore the higher-level purpose offusion systems by philosophical questions and modem day...the The Greeks focused on both data fusion and the Fusion02 conference there are common fusion questions philosophical questions of an ontology - the...data World of Visible Things Belief (pistis) fusion - user refinement. The rest of the paper is as Appearances follows: Section 2 details the Greek

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning

PubMed Central

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-01-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion® Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure. PMID:26633465

Rapid Construction of Stable Infectious Full-Length cDNA Clone of Papaya Leaf Distortion Mosaic Virus Using In-Fusion Cloning.

PubMed

Tuo, Decai; Shen, Wentao; Yan, Pu; Li, Xiaoying; Zhou, Peng

2015-12-01

Papaya leaf distortion mosaic virus (PLDMV) is becoming a threat to papaya and transgenic papaya resistant to the related pathogen, papaya ringspot virus (PRSV). The generation of infectious viral clones is an essential step for reverse-genetics studies of viral gene function and cross-protection. In this study, a sequence- and ligation-independent cloning system, the In-Fusion(®) Cloning Kit (Clontech, Mountain View, CA, USA), was used to construct intron-less or intron-containing full-length cDNA clones of the isolate PLDMV-DF, with the simultaneous scarless assembly of multiple viral and intron fragments into a plasmid vector in a single reaction. The intron-containing full-length cDNA clone of PLDMV-DF was stably propagated in Escherichia coli. In vitro intron-containing transcripts were processed and spliced into biologically active intron-less transcripts following mechanical inoculation and then initiated systemic infections in Carica papaya L. seedlings, which developed similar symptoms to those caused by the wild-type virus. However, no infectivity was detected when the plants were inoculated with RNA transcripts from the intron-less construct because the instability of the viral cDNA clone in bacterial cells caused a non-sense or deletion mutation of the genomic sequence of PLDMV-DF. To our knowledge, this is the first report of the construction of an infectious full-length cDNA clone of PLDMV and the splicing of intron-containing transcripts following mechanical inoculation. In-Fusion cloning shortens the construction time from months to days. Therefore, it is a faster, more flexible, and more efficient method than the traditional multistep restriction enzyme-mediated subcloning procedure.

Enhancement of Arabidopsis growth characteristics using genome interrogation with artificial transcription factors

PubMed Central

Pinas, Johan E.; Henkel, Christiaan V.; Augustijn, Dieuwertje; Hooykaas, Paul J. J.; van der Zaal, Bert J.

2017-01-01

The rapidly growing world population has a greatly increasing demand for plant biomass, thus creating a great interest in the development of methods to enhance the growth and biomass accumulation of crop species. In this study, we used zinc finger artificial transcription factor (ZF-ATF)-mediated genome interrogation to manipulate the growth characteristics and biomass of Arabidopsis plants. We describe the construction of two collections of Arabidopsis lines expressing fusions of three zinc fingers (3F) to the transcriptional repressor motif EAR (3F-EAR) or the transcriptional activator VP16 (3F-VP16), and the characterization of their growth characteristics. In total, six different 3F-ATF lines with a consistent increase in rosette surface area (RSA) of up to 55% were isolated. For two lines we demonstrated that 3F-ATF constructs function as dominant in trans acting causative agents for an increase in RSA and biomass, and for five larger plant lines we have investigated 3F-ATF induced transcriptomic changes. Our results indicate that genome interrogation can be used as a powerful tool for the manipulation of plant growth and biomass and that it might supply novel cues for the discovery of genes and pathways involved in these properties. PMID:28358915

Enhancement of Arabidopsis growth characteristics using genome interrogation with artificial transcription factors.

PubMed

Tol, Niels van; Rolloos, Martijn; Pinas, Johan E; Henkel, Christiaan V; Augustijn, Dieuwertje; Hooykaas, Paul J J; van der Zaal, Bert J

2017-01-01

The rapidly growing world population has a greatly increasing demand for plant biomass, thus creating a great interest in the development of methods to enhance the growth and biomass accumulation of crop species. In this study, we used zinc finger artificial transcription factor (ZF-ATF)-mediated genome interrogation to manipulate the growth characteristics and biomass of Arabidopsis plants. We describe the construction of two collections of Arabidopsis lines expressing fusions of three zinc fingers (3F) to the transcriptional repressor motif EAR (3F-EAR) or the transcriptional activator VP16 (3F-VP16), and the characterization of their growth characteristics. In total, six different 3F-ATF lines with a consistent increase in rosette surface area (RSA) of up to 55% were isolated. For two lines we demonstrated that 3F-ATF constructs function as dominant in trans acting causative agents for an increase in RSA and biomass, and for five larger plant lines we have investigated 3F-ATF induced transcriptomic changes. Our results indicate that genome interrogation can be used as a powerful tool for the manipulation of plant growth and biomass and that it might supply novel cues for the discovery of genes and pathways involved in these properties.

Transcriptional regulation of the Borrelia burgdorferi antigenically variable VlsE surface protein.

PubMed

Bykowski, Tomasz; Babb, Kelly; von Lackum, Kate; Riley, Sean P; Norris, Steven J; Stevenson, Brian

2006-07-01

The Lyme disease agent Borrelia burgdorferi can persistently infect humans and other animals despite host active immune responses. This is facilitated, in part, by the vls locus, a complex system consisting of the vlsE expression site and an adjacent set of 11 to 15 silent vls cassettes. Segments of nonexpressed cassettes recombine with the vlsE region during infection of mammalian hosts, resulting in combinatorial antigenic variation of the VlsE outer surface protein. We now demonstrate that synthesis of VlsE is regulated during the natural mammal-tick infectious cycle, being activated in mammals but repressed during tick colonization. Examination of cultured B. burgdorferi cells indicated that the spirochete controls vlsE transcription levels in response to environmental cues. Analysis of PvlsE::gfp fusions in B. burgdorferi indicated that VlsE production is controlled at the level of transcriptional initiation, and regions of 5' DNA involved in the regulation were identified. Electrophoretic mobility shift assays detected qualitative and quantitative changes in patterns of protein-DNA complexes formed between the vlsE promoter and cytoplasmic proteins, suggesting the involvement of DNA-binding proteins in the regulation of vlsE, with at least one protein acting as a transcriptional activator.

TFE3-Fusion Variant Analysis Defines Specific Clinicopathologic Associations Among Xp11 Translocation Cancers

PubMed Central

Argani, Pedram; Zhong, Minghao; Reuter, Victor E.; Fallon, John T.; Epstein, Jonathan I.; Netto, George J.; Antonescu, Cristina R.

2016-01-01

Xp11 translocation cancers include Xp11 translocation renal cell carcinoma (RCC), Xp11 translocation perivascular epithelioid cell tumor (PEComa), and melanotic Xp11 translocation renal cancer. In Xp11 translocation cancers, oncogenic activation of TFE3 is driven by the fusion of TFE3 with a number of different gene partners, however, the impact of individual fusion variant on specific clinicopathologic features of Xp11 translocation cancers has not been well defined. In this study, we analyze 60 Xp11 translocation cancers by fluorescence in situ hybridization (FISH) using custom BAC probes to establish their TFE3 fusion gene partner. In 5 cases RNA sequencing (RNA-seq) was also used to further characterize the fusion transcripts. The 60 Xp11 translocation cancers included 47 Xp11 translocation RCC, 8 Xp11 translocation PEComas, and 5 melanotic Xp11 translocation renal cancers. A fusion partner was identified in 53/60 (88%) cases, including 18 SFPQ (PSF), 16 PRCC, 12 ASPSCR1 (ASPL), 6 NONO, and 1 DVL2. We provide the first morphologic description of the NONO-TFE3 RCC, which frequently demonstrates sub-nuclear vacuoles leading to distinctive suprabasal nuclear palisading. Similar sub-nuclear vacuolization was also characteristic of SFPQ-TFE3 RCC, creating overlapping features with clear cell papillary RCC. We also describe the first RCC with a DVL2-TFE3 gene fusion, in addition to an extrarenal pigmented PEComa with a NONO-TFE3 gene fusion. Furthermore, among neoplasms with the SFPQ-TFE3, NONO-TFE3, DVL2-TFE3 and ASPL-TFE3 gene fusions, the RCC are almost always PAX8-positive, cathepsin K-negative by immunohistochemistry, whereas the mesenchymal counterparts (Xp11 translocation PEComas, melanotic Xp11 translocation renal cancers, and alveolar soft part sarcoma) are PAX8-negative, cathepsin K-positive. These findings support the concept that despite an identical gene fusion, the RCCs are distinct from the corresponding mesenchymal neoplasms, perhaps due to the

Distinct Requirements for HIV-Cell Fusion and HIV-mediated Cell-Cell Fusion*

PubMed Central

Kondo, Naoyuki; Marin, Mariana; Kim, Jeong Hwa; Desai, Tanay M.; Melikyan, Gregory B.

2015-01-01

Whether HIV-1 enters cells by fusing with the plasma membrane or with endosomes is a subject of active debate. The ability of HIV-1 to mediate fusion between adjacent cells, a process referred to as “fusion-from-without” (FFWO), shows that this virus can fuse with the plasma membrane. To compare FFWO occurring at the cell surface with HIV-cell fusion through a conventional entry route, we designed an experimental approach that enabled the measurements of both processes in the same sample. The following key differences were observed. First, a very small fraction of viruses fusing with target cells participated in FFWO. Second, whereas HIV-1 fusion with adherent cells was insensitive to actin inhibitors, post-CD4/coreceptor binding steps during FFWO were abrogated. A partial dependence of HIV-cell fusion on actin remodeling was observed in CD4+ T cells, but this effect appeared to be due to the actin dependence of virus uptake. Third, deletion of the cytoplasmic tail of HIV-1 gp41 dramatically enhanced the ability of the virus to promote FFWO, while having a modest effect on virus-cell fusion. Distinct efficiencies and actin dependences of FFWO versus HIV-cell fusion are consistent with the notion that, except for a minor fraction of particles that mediate fusion between the plasma membranes of adjacent cells, HIV-1 enters through an endocytic pathway. We surmise, however, that cell-cell contacts enabling HIV-1 fusion with the plasma membrane could be favored at the sites of high density of target cells, such as lymph nodes. PMID:25589785

Clinicopathological features of younger (aged ≤ 50 years) lung adenocarcinoma patients harboring the EML4‐ALK fusion gene

PubMed Central

Sugio, Kenji; Osoegawa, Atsushi; Seto, Takashi; Ichinose, Yukito

2018-01-01

Background The EML4‐ALK fusion gene has recently been identified as a driver mutation in a subset of non‐small cell lung cancers. In subsequent studies, EML4‐ALK has been detected in a low percentage of patients, and was associated with a lack of EGFR or KRAS mutations, younger age, and adenocarcinoma with acinar histology. Cases with the EML4‐ALK fusion gene were examined to clarify the clinicopathological characteristics of young adenocarcinoma patients. Methods Between December 1998 and May 2009, 85 patients aged ≤ 50 with lung adenocarcinoma were treated at our hospital. We examined 49 samples from adenocarcinoma patients who underwent surgical resection, chemotherapy, and/or radiotherapy for the EML4‐ALK gene. None of the patients received ALK inhibitors because these drugs had not been approved in Japan before 2012. EML4‐ALK fusion genes were screened using multiplex reverse‐transcription PCR assay, and were confirmed by direct sequencing. Results The EML4‐ALK fusion gene was detected in five tumors (10.2%). One patient had stage IB disease, one had stage IIIA, and three had stage IV. Histologically, there was one solid adenocarcinoma, two acinar adenocarcinomas, and two papillary adenocarcinomas. EML4‐ALK fusion genes were mutually exclusive to EGFR and KRAS mutations. The five‐year survival rate was 59.4% in patients without EML4‐ALK fusion and was not reached in patients with EML4‐ALK fusion. Conclusion The EML4‐ALK fusion gene may be a strong oncogene in younger patients with lung adenocarcinoma. PMID:29517858

Evolution and tinkering: what do a protein kinase, a transcriptional regulator and chromosome segregation/cell division proteins have in common?

PubMed

Derouiche, Abderahmane; Shi, Lei; Kalantari, Aida; Mijakovic, Ivan

2016-02-01

In this study, we focus on functional interactions among multi-domain proteins which share a common evolutionary origin. The examples we develop are four Bacillus subtilis proteins, which all possess an ATP-binding Walker motif: the bacterial tyrosine kinase (BY-kinase) PtkA, the chromosome segregation protein Soj (ParA), the cell division protein MinD and a transcription regulator SalA. These proteins have arisen via duplication of the ancestral ATP-binding domain, which has undergone fusions with other functional domains in the process of divergent evolution. We point out that these four proteins, despite having very different physiological roles, engage in an unusually high number of binary functional interactions. Namely, MinD attracts Soj and PtkA to the cell pole, and in addition, activates the kinase function of PtkA. SalA also activates the kinase function of PtkA, and it gets phosphorylated by PtkA as well. The consequence of this phosphorylation is the activation of SalA as a transcriptional repressor. We hypothesize that these functional interactions remain preserved during divergent evolution and represent a constraint on the process of evolutionary "tinkering", brought about by fusions of different functional domains.

Technologies for Army Knowledge Fusion

DTIC Science & Technology

2004-09-01

interpret it in context and understand the implications (Alberts et al., 2002). Note that the knowledge / information fusion issue arises immediately here...Army Knowledge Fusion Richard Scherl Department of Computer Science Monmouth University Dana L. Ulery Computational and Information Sciences...civilian and military sources. Knowledge fusion, also called information fusion and multisensor data fusion, names the body of techniques needed to

Influence of incomplete fusion on complete fusion at energies above the Coulomb barrier

NASA Astrophysics Data System (ADS)

Shuaib, Mohd; Sharma, Vijay R.; Yadav, Abhishek; Sharma, Manoj Kumar; Singh, Pushpendra P.; Singh, Devendra P.; Kumar, R.; Singh, R. P.; Muralithar, S.; Singh, B. P.; Prasad, R.

2017-10-01

In the present work, excitation functions of several reaction residues in the system 19F+169Tm, populated via the complete and incomplete fusion processes, have been measured using off-line γ-ray spectroscopy. The analysis of excitation functions has been done within the framework of statistical model code pace4. The excitation functions of residues populated via xn and pxn channels are found to be in good agreement with those estimated by the theoretical model code, which confirms the production of these residues solely via complete fusion process. However, a significant enhancement has been observed in the cross-sections of residues involving α-emitting channels as compared to the theoretical predictions. The observed enhancement in the cross-sections has been attributed to the incomplete fusion processes. In order to have a better insight into the onset and strength of incomplete fusion, the incomplete fusion strength function has been deduced. At present, there is no theoretical model available which can satisfactorily explain the incomplete fusion reaction data at energies ≈4-6 MeV/nucleon. In the present work, the influence of incomplete fusion on complete fusion in the 19F+169Tm system has also been studied. The measured cross-section data may be important for the development of reactor technology as well. It has been found that the incomplete fusion strength function strongly depends on the α-Q value of the projectile, which is found to be in good agreement with the existing literature data. The analysis strongly supports the projectile-dependent mass-asymmetry systematics. In order to study the influence of Coulomb effect ({Z}{{P}}{Z}{{T}}) on incomplete fusion, the deduced strength function for the present work is compared with the nearby projectile-target combinations. The incomplete fusion strength function is found to increase linearly with {Z}{{P}}{Z}{{T}}, indicating a strong influence of Coulomb effect in the incomplete fusion reactions.

Cluster-impact fusion, or beam-contaminant fusion? (abstract)a),b)

NASA Astrophysics Data System (ADS)

Lo, Daniel H.; Petrasso, Richard D.; Wenzel, Kevin W.

1992-10-01

Beuhler, Friedlander, and Friedman (BFF) reported anomalously huge D-D fusion rates while bombarding deuterated targets with (D2O)N+ clusters (N˜25-1000) accelerated to ≊325 keV [R. J. Beuhler et al., Phys. Rev. Lett. 63, 1292 (1989); R. J. Beuhler et al., J. Phys. Chem. 94, 7665 (1990)] [i.e., ≊0.3 keV lab energy for D in (D2O)100+]. However, from our analysis of BFF's fusion product spectra, we conclude that their D lab energy was ˜50 keV. Therefore, no gross anomalies exist. Also, from our analysis of the BFF beam-ranging experiments through 500 μg/cm2 of Au, we conclude that light-ion-beam contaminants (e.g., D+ of order 100 keV) have not been ruled out, and are the probable cause of their fusion reactions. This work was supported by LLNL Subcontract B116798, Department of Energy (DOE) Grant No. DE-FG02-91ER54109, DOE Magnetic Fusion Energy Technology Fellowship Program (D. H. Lo), and DOE Fusion Energy Postdoctoral Research Program (Kevin W. Wenzel).

Fluorescent protein-tagged Vpr dissociates from HIV-1 core after viral fusion and rapidly enters the cell nucleus.

PubMed

Desai, Tanay M; Marin, Mariana; Sood, Chetan; Shi, Jiong; Nawaz, Fatima; Aiken, Christopher; Melikyan, Gregory B

2015-10-29

HIV-1 Vpr is recruited into virions during assembly and appears to remain associated with the viral core after the reverse transcription and uncoating steps of entry. This feature has prompted the use of fluorescently labeled Vpr to visualize viral particles and to follow trafficking of post-fusion HIV-1 cores in the cytoplasm. Here, we tracked single pseudovirus entry and fusion and observed that fluorescently tagged Vpr gradually dissociates from post-fusion viral cores over the course of several minutes and accumulates in the nucleus. Kinetics measurements showed that fluorescent Vpr released from the cores very rapidly entered the cell nucleus. More than 10,000 Vpr molecules can be delivered into the cell nucleus within 45 min of infection by HIV-1 particles pseudotyped with the avian sarcoma and leukosis virus envelope glycoprotein. The fraction of Vpr from cell-bound viruses that accumulated in the nucleus was proportional to the extent of virus-cell fusion and was fully blocked by viral fusion inhibitors. Entry of virus-derived Vpr into the nucleus occurred independently of envelope glycoproteins or target cells. Fluorescence correlation spectroscopy revealed two forms of nuclear Vpr-monomers and very large complexes, likely involving host factors. The kinetics of viral Vpr entering the nucleus after fusion was not affected by point mutations in the capsid protein that alter the stability of the viral core. The independence of Vpr shedding of capsid stability and its relatively rapid dissociation from post-fusion cores suggest that this process may precede capsid uncoating, which appears to occur on a slower time scale. Our results thus demonstrate that a bulk of fluorescently labeled Vpr incorporated into HIV-1 particles is released shortly after fusion. Future studies will address the question whether the quick and efficient nuclear delivery of Vpr derived from incoming viruses can regulate subsequent steps of HIV-1 infection.

Fusion Science Education Outreach

NASA Astrophysics Data System (ADS)

Danielson, C. A.; DIII-D Education Group

1996-11-01

This presentation will focus on education outreach activities at General Atomics that have been expanded to include the general population on science education with a focus on fusion energy. Outreach materials are distributed upon request both nationally and internationally. These materials include a notebook containing copies of DIII--D tour panels, fusion poster, new fusion energy video, new fusion energy brochure, and the electromagnetic spectrum curriculum. The 1996 Fusion Forum (held in the House Caucus Room) included a student/ teacher lunch with Energy Secretary Hazel O'Leary and a private visit to the Forum exhibits. The continuing partnership with Kearny High School includes lectures, job shadowing, internship, equipment donations and an award-winning electric car-racing program. Development of distribution by CD of the existing interactive fusion energy kiosk and a virtual reality tour of the DIII--D facility are underway. The DIII--D fusion education WWW site includes e-mail addresses to ``Ask the Wizard,'' and/or receive GA's outreach materials. Steve Rodecker, a local science teacher, aided by DIII--D fusion staff, won his second Tapestry Award; he also was named the ``1995 National Science Teacher of the Year'' and will be present to share his experiences with the DIII--D educational outreach program.

Roles of mono-ubiquitinated Smad4 in the formation of Smad transcriptional complexes.

PubMed

Wang, Bei; Suzuki, Hiroyuki; Kato, Mitsuyasu

2008-11-14

TGF-beta activates receptor-regulated Smad (R-Smad) through phosphorylation by type I receptors. Activated R-Smad binds to Smad4 and the complex translocates into the nucleus and stimulates the transcription of target genes through association with co-activators including p300. It is not clear, however, how activated Smad complexes are removed from target genes. In this study, we show that TGF-beta enhances the mono-ubiquitination of Smad4. Smad4 mono-ubiquitination was promoted by p300 and suppressed by the c-Ski co-repressor. Smad4 mono-ubiquitination disrupted the interaction with Smad2 in the presence of constitutively active TGF-beta type I receptor. Furthermore, mono-ubiquitinated Smad4 was not found in DNA-binding Smad complexes. A Smad4-Ubiquitin fusion protein, which mimics mono-ubiquitinated Smad4, enhanced localization to the cytoplasm. These results suggest that mono-ubiquitination of Smad4 occurs in the transcriptional activator complex and facilitates the turnover of Smad complexes at target genes.

Fusion Studies in Japan

NASA Astrophysics Data System (ADS)

Ogawa, Yuichi

2016-05-01

A new strategic energy plan decided by the Japanese Cabinet in 2014 strongly supports the steady promotion of nuclear fusion development activities, including the ITER project and the Broader Approach activities from the long-term viewpoint. Atomic Energy Commission (AEC) in Japan formulated the Third Phase Basic Program so as to promote an experimental fusion reactor project. In 2005 AEC has reviewed this Program, and discussed on selection and concentration among many projects of fusion reactor development. In addition to the promotion of ITER project, advanced tokamak research by JT-60SA, helical plasma experiment by LHD, FIREX project in laser fusion research and fusion engineering by IFMIF were highly prioritized. Although the basic concept is quite different between tokamak, helical and laser fusion researches, there exist a lot of common features such as plasma physics on 3-D magnetic geometry, high power heat load on plasma facing component and so on. Therefore, a synergetic scenario on fusion reactor development among various plasma confinement concepts would be important.

Fusion Rate and Clinical Outcomes in Two-Level Posterior Lumbar Interbody Fusion.

PubMed

Aono, Hiroyuki; Takenaka, Shota; Nagamoto, Yukitaka; Tobimatsu, Hidekazu; Yamashita, Tomoya; Furuya, Masayuki; Iwasaki, Motoki

2018-04-01

Posterior lumbar interbody fusion (PLIF) has become a general surgical method for degenerative lumbar diseases. Although many reports have focused on single-level PLIF, few have focused on 2-level PLIF, and no report has covered the fusion status of 2-level PLIF. The purpose of this study is to investigate clinical outcomes and fusion for 2-level PLIF by using a combination of dynamic radiographs and multiplanar-reconstruction computed tomography scans. This study consisted of 48 consecutive patients who underwent 2-level PLIF for degenerative lumbar diseases. We assessed surgery duration, estimated blood loss, complications, clinical outcomes as measured by the Japanese Orthopaedic Association score, lumbar sagittal alignment as measured on standing lateral radiographs, and fusion status as measured by dynamic radiographs and multiplanar-reconstruction computed tomography. Patients were examined at a follow-up point of 4.8 ± 2.2 years after surgery. Thirty-eight patients who did not undergo lumbosacral fusion comprised the lumbolumbar group, and 10 patients who underwent lumbosacral fusion comprised the lumbosacral group. The mean Japanese Orthopaedic Association score improved from 12.1 to 22.4 points by the final follow-up examination. Sagittal alignment also was improved. All patients had fusion in the cranial level. Seven patients had nonunion in the caudal level, and the lumbosacral group (40%) had a significantly poorer fusion rate than the lumbolumbar group (97%) did. Surgical outcomes of 2-level PLIF were satisfactory. The fusion rate at both levels was 85%. All nonunion was observed at the caudal level and concentrated at L5-S level in L4-5-S PLIF. Copyright © 2018 Elsevier Inc. All rights reserved.

Heat-directed tumor cell fusion.

PubMed

Brade, Anthony M; Szmitko, Paul; Ngo, Duc; Liu, Fei-Fei; Klamut, Henry J

2003-03-20

In previous studies we demonstrated that a modified human HSP70b promoter (HSE.70b) directs high levels of gene expression to tumor cells after mild hyperthermia treatment in the range of 41.5-44 degrees C. This transcriptional targeting system exhibits low basal activity at 37 degrees C, is highly induced (950-fold) after mild heat treatment (43 degrees C/30 min), and returns to basal activity levels within 12-24 hours of activation. Here we describe heat-directed targeting of an activated form of the Gibbon ape leukemia virus env protein (GALV FMG) to tumor cells. GALV FMG mediates cell-cell fusion, and when expressed in tumor cells can produce bystander effects of up to 1:200. Transient transfection of a HSE70b.GALV FMG minigene caused extensive syncytia formation in HeLa and HT-1080 cells following mild heat treatment (44 degrees C/30 min). Stable transfection into HT-1080 cells produced a cell line (HG5) that exhibits massive syncytia formation and a 60% reduction in viability relative to a vector-only control (CI1) following heat treatment in vitro. Mild hyperthermia also resulted in syncytia formation, necrosis, and complete macroscopic regression of HG5 xenograft tumors grown in the footpads of mice with severe combined immunodeficiency disorders (SCID). Median survival increased from 12.5 (in heated CI1 controls) to 52 days after a single heat treatment. Heat-directed tumor cell fusion may prove to be a highly beneficial adjunct to existing cancer treatment strategies that take advantage of the synergistic interaction between mild hyperthermia and radiation or chemotherapeutic drugs.

Control of mechanically activated polymersome fusion: Factors affecting fusion

DOE PAGES

Henderson, Ian M.; Paxton, Walter F.

2014-12-15

Previously we have studied the mechanically-activated fusion of extruded (200 nm) polymer vesicles into giant polymersomes using agitation in the presence of salt. In this study we have investigated several factors contributing to this phenomenon, including the effects of (i) polymer vesicle concentration, (ii) agitation speed and duration, and iii) variation of the salt and its concentration. It was found that increasing the concentration of the polymer dramatically increases the production of giant vesicles through the increased collisions of polymersomes. Our investigations also found that increasing the frequency of agitation increased the efficiency of fusion, though ultimately limited the sizemore » of vesicle which could be produced due to the high shear involved. Finally it was determined that salt-mediation of the fusion process was not limited to NaCl, but is instead a general effect facilitated by the presence of solvated ionic compounds, albeit with different salts initiating fusion at different concentration.« less

ICP22 and the UL13 Protein Kinase Are both Required for Herpes Simplex Virus-Induced Modification of the Large Subunit of RNA Polymerase II

PubMed Central

Long, Melissa C.; Leong, Vivian; Schaffer, Priscilla A.; Spencer, Charlotte A.; Rice, Stephen A.

1999-01-01

Herpes simplex virus type 1 (HSV-1) infection alters the phosphorylation of the large subunit of RNA polymerase II (RNAP II), resulting in the depletion of the hypophosphorylated and hyperphosphorylated forms of this polypeptide (known as IIa and IIo, respectively) and induction of a novel, alternatively phosphorylated form (designated IIi). We previously showed that the HSV-1 immediate-early protein ICP22 is involved in this phenomenon, since induction of IIi and depletion of IIa are deficient in cells infected with 22/n199, an HSV-1 ICP22 nonsense mutant (S. A. Rice, M. C. Long, V. Lam, P. A. Schaffer, and C. A. Spencer, J. Virol. 69:5550–5559, 1995). However, depletion of IIo still occurs in 22/n199-infected cells. This suggests either that another viral gene product affects the RNAP II large subunit or that the truncated ICP22 polypeptide encoded by 22/n199 retains residual activity which leads to IIo depletion. To distinguish between these possibilities, we engineered an HSV-1 ICP22 null mutant, d22-lacZ, and compared it to 22/n199. The two mutants are indistinguishable in their effects on the RNAP II large subunit, suggesting that an additional viral gene product is involved in altering RNAP II. Two candidates are UL13, a protein kinase which has been implicated in ICP22 phosphorylation, and the virion host shutoff (Vhs) factor, the expression of which is positively regulated by ICP22 and UL13. To test whether UL13 is involved, a UL13-deficient viral mutant, d13-lacZ, was engineered. This mutant was defective in IIi induction and IIa depletion, displaying a phenotype very similar to that of d22-lacZ. In contrast, a Vhs mutant had effects that were indistinguishable from wild-type HSV-1. Therefore, UL13 but not the Vhs function plays a role in modifying the RNAP II large subunit. To study the potential role of UL13 in viral transcription, we carried out nuclear run-on transcription analyses in infected human embryonic lung cells. Infections with either UL13

Repression of choline kinase by inositol and choline in Saccharomyces cerevisiae.

PubMed Central

Hosaka, K; Murakami, T; Kodaki, T; Nikawa, J; Yamashita, S

1990-01-01

The regulation of choline kinase (EC 2.7.1.32), the initial enzyme in the CDP-choline pathway, was examined in Saccharomyces cerevisiae. The addition of myo-inositol to a culture of wild-type cells resulted in a significant decrease in choline kinase activity. Additional supplementation of choline caused a further reduction in the activity. The coding frame of the choline kinase gene, CK1, was joined to the carboxyl terminus of lacZ and expressed in Escherichia coli as a fusion protein, which was then used to prepare an anti-choline kinase antibody. Upon Western (immuno-) and Northern (RNA) blot analyses using the antibody and a CK1 probe, respectively, the decrease in the enzyme activity was found to be correlated with decreases in the enzyme amount and mRNA abundance. The molecular mass of the enzyme was estimated to be 66 kilodaltons, in agreement with the value predicted previously from the nucleotide sequence of the gene. The coding region of CK1 was replaced with that of lacZ, and CK1 expression was measured by assaying beta-galactosidase. The expression of beta-galactosidase from this fusion was repressed by myo-inositol and choline and derepressed in a time-dependent manner upon their removal. The present findings indicate that yeast choline kinase is regulated by myo-inositol and choline at the level of mRNA abundance. Images FIG. 3 FIG. 4 PMID:2156807

Image fusion

NASA Technical Reports Server (NTRS)

Pavel, M.

1993-01-01

The topics covered include the following: a system overview of the basic components of a system designed to improve the ability of a pilot to fly through low-visibility conditions such as fog; the role of visual sciences; fusion issues; sensor characterization; sources of information; image processing; and image fusion.

50 years of fusion research

NASA Astrophysics Data System (ADS)

Meade, Dale

2010-01-01

Fusion energy research began in the early 1950s as scientists worked to harness the awesome power of the atom for peaceful purposes. There was early optimism for a quick solution for fusion energy as there had been for fission. However, this was soon tempered by reality as the difficulty of producing and confining fusion fuel at temperatures of 100 million °C in the laboratory was appreciated. Fusion research has followed two main paths—inertial confinement fusion and magnetic confinement fusion. Over the past 50 years, there has been remarkable progress with both approaches, and now each has a solid technical foundation that has led to the construction of major facilities that are aimed at demonstrating fusion energy producing plasmas.

Fusion for Space Propulsion

NASA Technical Reports Server (NTRS)

Thio, Y. C. Francis; Schafer, Charles (Technical Monitor)

2001-01-01

There is little doubt that humans will attempt to explore and develop the solar system in this century. A large amount of energy will be required for accomplishing this. The need for fusion propulsion is discussed. For a propulsion system, there are three important thermodynamical attributes: (1) The absolute amount of energy available, (2) the propellant exhaust velocity, and (3) the jet power per unit mass of the propulsion system (specific power). For human exploration and development of the solar system, propellant exhaust velocity in excess of 100 km/s and specific power in excess of 10 kW/kg are required. Chemical combustion can produce exhaust velocity up to about 5 km/s. Nuclear fission processes typically result in producing energy in the form of heat that needs to be manipulated at temperatures limited by materials to about 2,800 K. Using the energy to heat a hydrogen propellant increases the exhaust velocity by only a factor of about two. Alternatively the energy can be converted into electricity which is then used to accelerate particles to high exhaust velocity. The necessary power conversion and conditioning equipment, however, increases the mass of the propulsion system for the same jet power by more than two orders of magnitude over chemical system, thus greatly limits the thrust-to-weight ratio attainable. The principal advantage of the fission process is that its development is relatively mature and is available right now. If fusion can be developed, fusion appears to have the best of all worlds in terms of propulsion - it can provide the absolute amount, the propellant exhaust velocity, and the high specific jet power. An intermediate step towards pure fusion propulsion is a bimodal system in which a fission reactor is used to provide some of the energy to drive a fusion propulsion unit. The technical issues related to fusion for space propulsion are discussed. The technical priorities for developing and applying fusion for propulsion are

C-terminal tyrosine residues modulate the fusion activity of the Hendra virus fusion protein

PubMed Central

Popa, Andreea; Pager, Cara Teresia; Dutch, Rebecca Ellis

2011-01-01

The paramyxovirus family includes important human pathogens such as measles, mumps, respiratory syncytial virus and the recently emerged, highly pathogenic Hendra and Nipah viruses. The viral fusion (F) protein plays critical roles in infection, promoting both the viral-cell membrane fusion events needed for viral entry as well as cell-cell fusion events leading to syncytia formation. We describe the surprising finding that addition of the short epitope HA tag to the cytoplasmic tail (CT) of the Hendra virus F protein leads to a significant increase in cell-cell membrane fusion. This increase was not due to alterations in surface expression, cleavage state, or association with lipid microdomains. Addition of a Myc tag of similar length did not alter Hendra F fusion activity, indicating that the observed stimulation was not solely a result of lengthening the CT. Three tyrosine residues within the HA tag were critical for the increase in fusion, suggesting C-terminal tyrosines may modulate Hendra fusion activity. The effects of HA tag addition varied with other fusion proteins, as parainfluenza virus 5 F-HA showed decreased surface expression and no stimulation in fusion. These results indicate that additions to the C-terminal end of the F protein CT can modulate protein function in a sequence specific manner, reinforcing the need for careful analysis of epitope tagged glycoproteins. In addition, our results implicate C-terminal tyrosine residues in modulation of the membrane fusion reaction promoted by these viral glycoproteins. PMID:21175223

Xp11.2 translocation renal cell carcinoma with TFE3 gene fusion: A case report

PubMed Central

Pan, Xiang; Quan, Jing; Zhao, Liwen; Li, Wenhua; Wei, Benlin; Yang, Shangqi; Lai, Yongqing

2018-01-01

Xp11.2 translocation renal cell carcinoma (RCC) with transcription factor E3 (TFE3) gene fusion is a rare tumor, and the prognosis of this tumor is poorer compared with that of other subtypes of RCC. The patient presented herein was a 70-year-old man who presented with a solid mass sized ~8.2×6.1 cm in the right kidney and underwent radical right nephrectomy. Following pathological and immunohistochemical (IHC) examination and fluorescent in situ hybridization (FISH), the patient was diagnosed with Xp11.2 translocation RCC with TFE3 gene fusion. These tumors are more commonly encountered in children rather than in adults, and adult Xp11.2 translocation RCC is associated with a poorer prognosis compared with its pediatric counterpart. IHC assay and FISH are important diagnostic methods. However, there is currently no established effective treatment for Xp11.2 RCC. PMID:29399348

Xp11.2 translocation renal cell carcinoma with TFE3 gene fusion: A case report.

PubMed

Pan, Xiang; Quan, Jing; Zhao, Liwen; Li, Wenhua; Wei, Benlin; Yang, Shangqi; Lai, Yongqing

2018-01-01

Xp11.2 translocation renal cell carcinoma (RCC) with transcription factor E3 (TFE3) gene fusion is a rare tumor, and the prognosis of this tumor is poorer compared with that of other subtypes of RCC. The patient presented herein was a 70-year-old man who presented with a solid mass sized ~8.2×6.1 cm in the right kidney and underwent radical right nephrectomy. Following pathological and immunohistochemical (IHC) examination and fluorescent in situ hybridization (FISH), the patient was diagnosed with Xp11.2 translocation RCC with TFE3 gene fusion. These tumors are more commonly encountered in children rather than in adults, and adult Xp11.2 translocation RCC is associated with a poorer prognosis compared with its pediatric counterpart. IHC assay and FISH are important diagnostic methods. However, there is currently no established effective treatment for Xp11.2 RCC.

Opioids delay healing of spinal fusion: a rabbit posterolateral lumbar fusion model.

PubMed

Jain, Nikhil; Himed, Khaled; Toth, Jeffrey M; Briley, Karen C; Phillips, Frank M; Khan, Safdar N

2018-04-19

Opioid use is prevalent for management of pre- and post-operative pain in patients undergoing spinal fusion. There is evidence that opioids downregulate osteoblasts in-vitro, and one previous study found that morphine delays the maturation and remodeling of callus in a rat femur fracture model. However, the effect of opioids on healing of spinal fusion has not been investigated before. Isolating the effect of opioid exposure in humans would be limited by the numerous confounding factors that affect fusion healing. Therefore, we have used a well-established rabbit model to study the process of spinal fusion healing that closely mimics humans. To study the effect of systemic opioids on the process of healing of spinal fusion in a rabbit posterolateral spinal fusion model. Pre-clinical animal study. 24 adult New Zealand white rabbits were studied in two groups after approval from the Institutional Animal Care and Use Committee (IACUC). The opioid group (n=12) received four-weeks pre-operative and six-weeks post-operative transdermal fentanyl. Serum fentanyl levels were measured just before surgery and four-weeks post-operatively to ensure adequate levels. The control group (n=12) received only peri-operative pain control as necessary. All animals received a bilateral L5-L6 posterolateral spinal fusion using iliac crest autograft. Animals were euthanized at the six-week post-operative time point, and assessment of fusion was done by manual palpation, plain radiographs, micro-computed tomography (microCT), and histology. 12 animals in control group and 11 animals in the opioid group were available for analysis at the end of six weeks. The fusion scores on manual palpation, radiographs, and microCT were not statistically different. Three-dimensional microCT morphometry found that the fusion mass in the opioid group had a lower bone volume (p=0.09), lower trabecular number (p=0.02) and higher trabecular separation (p=0.02) as compared to control. Histological analysis

Identification and Characterization of LFD-2, a Predicted Fringe Protein Required for Membrane Integrity during Cell Fusion in Neurospora crassa

PubMed Central

Palma-Guerrero, Javier; Zhao, Jiuhai; Gonçalves, A. Pedro; Starr, Trevor L.

2015-01-01

The molecular mechanisms of membrane merger during somatic cell fusion in eukaryotic species are poorly understood. In the filamentous fungus Neurospora crassa, somatic cell fusion occurs between genetically identical germinated asexual spores (germlings) and between hyphae to form the interconnected network characteristic of a filamentous fungal colony. In N. crassa, two proteins have been identified to function at the step of membrane fusion during somatic cell fusion: PRM1 and LFD-1. The absence of either one of these two proteins results in an increase of germling pairs arrested during cell fusion with tightly appressed plasma membranes and an increase in the frequency of cell lysis of adhered germlings. The level of cell lysis in ΔPrm1 or Δlfd-1 germlings is dependent on the extracellular calcium concentration. An available transcriptional profile data set was used to identify genes encoding predicted transmembrane proteins that showed reduced expression levels in germlings cultured in the absence of extracellular calcium. From these analyses, we identified a mutant (lfd-2, for late fusion defect-2) that showed a calcium-dependent cell lysis phenotype. lfd-2 encodes a protein with a Fringe domain and showed endoplasmic reticulum and Golgi membrane localization. The deletion of an additional gene predicted to encode a low-affinity calcium transporter, fig1, also resulted in a strain that showed a calcium-dependent cell lysis phenotype. Genetic analyses showed that LFD-2 and FIG1 likely function in separate pathways to regulate aspects of membrane merger and repair during cell fusion. PMID:25595444

Suppressor of fusion, a Fusarium oxysporum homolog of Ndt80, is required for nutrient-dependent regulation of anastomosis.

PubMed

Shahi, Shermineh; Fokkens, Like; Houterman, Petra M; Rep, Martijn

2016-10-01

Heterokaryon formation is an essential step in asexual recombination in Fusarium oxysporum. Filamentous fungi have an elaborate nonself recognition machinery to prevent formation and proliferation of heterokaryotic cells, called heterokaryon incompatibility (HI). In F. oxysporum the regulation of this machinery is not well understood. In Neurospora crassa, Vib-1, a putative transcription factor of the p53-like Ndt80 family of transcription factors, has been identified as global regulator of HI. In this study we investigated the role of the F. oxysporum homolog of Vib-1, called Suf, in vegetative hyphal and conidial anastomosis tube (CAT) fusion and HI. We identified a novel function for an Ndt80 homolog as a nutrient-dependent regulator of anastomosis. Strains carrying the SUF deletion mutation display a hyper-fusion phenotype during vegetative growth as well as germling development. In addition, conidial paring of incompatible SUF deletion strains led to more heterokaryon formation, which is independent of suppression of HI. Our data provides further proof for the divergence in the functions of different members Ndt80 family. We propose that Ndt80 homologs mediate responses to nutrient quality and quantity, with specific responses varying between species. Copyright © 2016 Elsevier Inc. All rights reserved.

Systematic analysis of advanced fusion fuel in inertial fusion energy

NASA Astrophysics Data System (ADS)

Velarde, G.; Eliezer, S.; Henis, Z.; Piera, M.; Martinez-Val, J. M.

1997-04-01

Aneutronic fusion reactions can be considered as the cleanest way to exploit nuclear energy. However, these reactions present in general two main drawbacks.—very high temperatures are needed to reach relevant values of their cross sections—Moderate (and even low) energy yield per reaction. This value is still lower if measured in relation to the Z number of the reacting particles. It is already known that bremsstrahlung overruns the plasma reheating by fusion born charged-particles in most of the advanced fuels. This is for instance the case for proton-boron-11 fusion in a stoichiometric plasma and is also so in lithium isotopes fusion reactions. In this paper, the use of deuterium-tritium seeding is suggested to allow to reach higher burnup fractions of advanced fuels, starting at a lower ignition temperature. Of course, neutron production increases as DT contents does. Nevertheless, the ratio of neutron production to energy generation is much lower in DT-advanced fuel mixtures than in pure DT plasmas. One of the main findings of this work is that some natural resources (as D and Li-7) can be burned-up in a catalytic regime for tritium. In this case, neither external tritium breeding nor tritium storage are needed, because the tritium inventory after the fusion burst is the same as before it. The fusion reactor can thus operate on a pure recycling of a small tritium inventory.

A Critical Role for CRM1 in Regulating HOXA Gene Transcription in CALM-AF10 Leukemias

PubMed Central

Conway, Amanda E.; Haldeman, Jonathan M.; Wechsler, Daniel S.; Lavau, Catherine P.

2014-01-01

The leukemogenic CALM-AF10 fusion protein is found in patients with immature acute myeloid and T-lymphoid malignancies. CALM-AF10 leukemias display abnormal H3K79 methylation and increased HOXA cluster gene transcription. Elevated expression of HOXA genes is critical for leukemia maintenance and progression; however, the precise mechanism by which CALM-AF10 alters HOXA gene expression is unclear. We previously determined that CALM contains a CRM1-dependent nuclear export signal (NES), which is both necessary and sufficient for CALM-AF10-mediated leukemogenesis. Here, we find that interaction of CALM-AF10 with the nuclear export receptor CRM1 is necessary for activating HOXA gene expression. We show that CRM1 localizes to HOXA loci where it recruits CALM-AF10, leading to transcriptional and epigenetic activation of HOXA genes. Genetic and pharmacological inhibition of the CALM-CRM1 interaction prevents CALM-AF10 enrichment at HOXA chromatin, resulting in immediate loss of transcription. These results provide a comprehensive mechanism by which the CALM-AF10 translocation activates the critical HOXA cluster genes. Furthermore, this report identifies a novel function of CRM1: the ability to bind chromatin and recruit the NES-containing CALM-AF10 transcription factor. PMID:25027513

FusionHub: A unified web platform for annotation and visualization of gene fusion events in human cancer.

PubMed

Panigrahi, Priyabrata; Jere, Abhay; Anamika, Krishanpal

2018-01-01

Gene fusion is a chromosomal rearrangement event which plays a significant role in cancer due to the oncogenic potential of the chimeric protein generated through fusions. At present many databases are available in public domain which provides detailed information about known gene fusion events and their functional role. Existing gene fusion detection tools, based on analysis of transcriptomics data usually report a large number of fusion genes as potential candidates, which could be either known or novel or false positives. Manual annotation of these putative genes is indeed time-consuming. We have developed a web platform FusionHub, which acts as integrated search engine interfacing various fusion gene databases and simplifies large scale annotation of fusion genes in a seamless way. In addition, FusionHub provides three ways of visualizing fusion events: circular view, domain architecture view and network view. Design of potential siRNA molecules through ensemble method is another utility integrated in FusionHub that could aid in siRNA-based targeted therapy. FusionHub is freely available at https://fusionhub.persistent.co.in.

Chromatin potentiates transcription

PubMed Central

Nagai, Shigeki; Davis, Ralph E.; Mattei, Pierre Jean; Eagen, Kyle Patrick; Kornberg, Roger D.

2017-01-01

Chromatin isolated from the chromosomal locus of the PHO5 gene of yeast in a transcriptionally repressed state was transcribed with 12 pure proteins (80 polypeptides): RNA polymerase II, six general transcription factors, TFIIS, the Pho4 gene activator protein, and the SAGA, SWI/SNF, and Mediator complexes. Contrary to expectation, a nucleosome occluding the TATA box and transcription start sites did not impede transcription but rather, enhanced it: the level of chromatin transcription was at least sevenfold greater than that of naked DNA, and chromatin gave patterns of transcription start sites closely similar to those occurring in vivo, whereas naked DNA gave many aberrant transcripts. Both histone acetylation and trimethylation of H3K4 (H3K4me3) were important for chromatin transcription. The nucleosome, long known to serve as a general gene repressor, thus also performs an important positive role in transcription. PMID:28137832

The same pocket in menin binds both MLL and JUND but has opposite effects on transcription

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Jing; Gurung, Buddha; Wan, Bingbing

2013-04-08

Menin is a tumour suppressor protein whose loss or inactivation causes multiple endocrine neoplasia 1 (MEN1), a hereditary autosomal dominant tumour syndrome that is characterized by tumorigenesis in multiple endocrine organs. Menin interacts with many proteins and is involved in a variety of cellular processes. Menin binds the JUN family transcription factor JUND and inhibits its transcriptional activity. Several MEN1 missense mutations disrupt the menin-JUND interaction, suggesting a correlation between the tumour-suppressor function of menin and its suppression of JUND-activated transcription. Menin also interacts with mixed lineage leukaemia protein 1 (MLL1), a histone H3 lysine 4 methyltransferase, and functions asmore » an oncogenic cofactor to upregulate gene transcription and promote MLL1-fusion-protein-induced leukaemogenesis. A recent report on the tethering of MLL1 to chromatin binding factor lens epithelium-derived growth factor (LEDGF) by menin indicates that menin is a molecular adaptor coordinating the functions of multiple proteins. Despite its importance, how menin interacts with many distinct partners and regulates their functions remains poorly understood. Here we present the crystal structures of human menin in its free form and in complexes with MLL1 or with JUND, or with an MLL1-LEDGF heterodimer. These structures show that menin contains a deep pocket that binds short peptides of MLL1 or JUND in the same manner, but that it can have opposite effects on transcription. The menin-JUND interaction blocks JUN N-terminal kinase (JNK)-mediated JUND phosphorylation and suppresses JUND-induced transcription. In contrast, menin promotes gene transcription by binding the transcription activator MLL1 through the peptide pocket while still interacting with the chromatin-anchoring protein LEDGF at a distinct surface formed by both menin and MLL1.« less

Gene Fusion Markup Language: a prototype for exchanging gene fusion data.

PubMed

Kalyana-Sundaram, Shanker; Shanmugam, Achiraman; Chinnaiyan, Arul M

2012-10-16

An avalanche of next generation sequencing (NGS) studies has generated an unprecedented amount of genomic structural variation data. These studies have also identified many novel gene fusion candidates with more detailed resolution than previously achieved. However, in the excitement and necessity of publishing the observations from this recently developed cutting-edge technology, no community standardization approach has arisen to organize and represent the data with the essential attributes in an interchangeable manner. As transcriptome studies have been widely used for gene fusion discoveries, the current non-standard mode of data representation could potentially impede data accessibility, critical analyses, and further discoveries in the near future. Here we propose a prototype, Gene Fusion Markup Language (GFML) as an initiative to provide a standard format for organizing and representing the significant features of gene fusion data. GFML will offer the advantage of representing the data in a machine-readable format to enable data exchange, automated analysis interpretation, and independent verification. As this database-independent exchange initiative evolves it will further facilitate the formation of related databases, repositories, and analysis tools. The GFML prototype is made available at http://code.google.com/p/gfml-prototype/. The Gene Fusion Markup Language (GFML) presented here could facilitate the development of a standard format for organizing, integrating and representing the significant features of gene fusion data in an inter-operable and query-able fashion that will enable biologically intuitive access to gene fusion findings and expedite functional characterization. A similar model is envisaged for other NGS data analyses.

Gene Fusion Markup Language: a prototype for exchanging gene fusion data

PubMed Central

2012-01-01

Background An avalanche of next generation sequencing (NGS) studies has generated an unprecedented amount of genomic structural variation data. These studies have also identified many novel gene fusion candidates with more detailed resolution than previously achieved. However, in the excitement and necessity of publishing the observations from this recently developed cutting-edge technology, no community standardization approach has arisen to organize and represent the data with the essential attributes in an interchangeable manner. As transcriptome studies have been widely used for gene fusion discoveries, the current non-standard mode of data representation could potentially impede data accessibility, critical analyses, and further discoveries in the near future. Results Here we propose a prototype, Gene Fusion Markup Language (GFML) as an initiative to provide a standard format for organizing and representing the significant features of gene fusion data. GFML will offer the advantage of representing the data in a machine-readable format to enable data exchange, automated analysis interpretation, and independent verification. As this database-independent exchange initiative evolves it will further facilitate the formation of related databases, repositories, and analysis tools. The GFML prototype is made available at http://code.google.com/p/gfml-prototype/. Conclusion The Gene Fusion Markup Language (GFML) presented here could facilitate the development of a standard format for organizing, integrating and representing the significant features of gene fusion data in an inter-operable and query-able fashion that will enable biologically intuitive access to gene fusion findings and expedite functional characterization. A similar model is envisaged for other NGS data analyses. PMID:23072312

Line tension at lipid phase boundaries as driving force for HIV fusion peptide-mediated fusion

NASA Astrophysics Data System (ADS)

Yang, Sung-Tae; Kiessling, Volker; Tamm, Lukas K.

2016-04-01

Lipids and proteins are organized in cellular membranes in clusters, often called `lipid rafts'. Although raft-constituent ordered lipid domains are thought to be energetically unfavourable for membrane fusion, rafts have long been implicated in many biological fusion processes. For the case of HIV gp41-mediated membrane fusion, this apparent contradiction can be resolved by recognizing that the interfaces between ordered and disordered lipid domains are the predominant sites of fusion. Here we show that line tension at lipid domain boundaries contributes significant energy to drive gp41-fusion peptide-mediated fusion. This energy, which depends on the hydrophobic mismatch between ordered and disordered lipid domains, may contribute tens of kBT to fusion, that is, it is comparable to the energy required to form a lipid stalk intermediate. Line-active compounds such as vitamin E lower line tension in inhomogeneous membranes, thereby inhibit membrane fusion, and thus may be useful natural viral entry inhibitors.

Large-scale screening and molecular characterization of EML4-ALK fusion variants in archival non-small-cell lung cancer tumor specimens using quantitative reverse transcription polymerase chain reaction assays.

PubMed

Li, Tianhong; Maus, Martin K H; Desai, Sonal J; Beckett, Laurel A; Stephens, Craig; Huang, Eric; Hsiang, Jack; Zeger, Gary; Danenberg, Kathleen D; Astrow, Stephanie H; Gandara, David R

2014-01-01

The objective of this study was to identify and characterize echinoderm microtubule-associated protein-like 4 anaplastic lymphoma kinase fusion (EML4-ALK+) cancers by variant-specific, quantitative reverse transcription polymerase chain reaction (RT-PCR) assays in a large cohort of North American non-small-cell lung cancer (NSCLC) patients. We developed a panel of single and multiplex RT-PCR assays suitable for rapid and accurate detection of the eight most common EML4-ALK+ variants and ALK gene expression in archival formalin-fixed, paraffin-embedded NSCLC specimens. EGFR and KRAS genotyping and thymidylate synthase RNA level by RT-PCR assays were available in a subset of patients. Between December 2009 and September 2012, 7344 NSCLC specimens were tested. An EML4-ALK+ transcript was detected in 200 cases (2.7%), including 109 V1 (54.5%), 20 V2 (10.0%), 68 V3 (34.0%), and three V5a (1.5%) variants. Median age was 54.5 years (range, 23-89), and 104 patients (52.0%) were women. The great majority (n=188, 94.0%) of EML4-ALK+ NSCLC tumors had adenocarcinoma histology. ALK expression level varied significantly among different EML4-ALK+ variants and individual tumors. Only one case each of concurrent EGFR or KRAS mutation was detected. The median thymidylate synthase RNA level from 85 EML4-ALK+ cancers was significantly lower compared with that of EML4-ALK-negative lung adenocarcinomas (2.02 versus 3.29, respectively, p<0.001). This panel of variant-specific, quantitative RT-PCR assays detects common EML4-ALK+ variants as well as ALK gene expression level in archival formalin-fixed paraffin-embedded NSCLC specimens. These RT-PCR assays may be useful as an adjunct to the standard fluorescence in situ hybridization assay to better understand biologic variability and response patterns to anaplastic lymphoma kinase inhibitors.

Gradient-based multiresolution image fusion.

PubMed

Petrović, Valdimir S; Xydeas, Costas S

2004-02-01

A novel approach to multiresolution signal-level image fusion is presented for accurately transferring visual information from any number of input image signals, into a single fused image without loss of information or the introduction of distortion. The proposed system uses a "fuse-then-decompose" technique realized through a novel, fusion/decomposition system architecture. In particular, information fusion is performed on a multiresolution gradient map representation domain of image signal information. At each resolution, input images are represented as gradient maps and combined to produce new, fused gradient maps. Fused gradient map signals are processed, using gradient filters derived from high-pass quadrature mirror filters to yield a fused multiresolution pyramid representation. The fused output image is obtained by applying, on the fused pyramid, a reconstruction process that is analogous to that of conventional discrete wavelet transform. This new gradient fusion significantly reduces the amount of distortion artefacts and the loss of contrast information usually observed in fused images obtained from conventional multiresolution fusion schemes. This is because fusion in the gradient map domain significantly improves the reliability of the feature selection and information fusion processes. Fusion performance is evaluated through informal visual inspection and subjective psychometric preference tests, as well as objective fusion performance measurements. Results clearly demonstrate the superiority of this new approach when compared to conventional fusion systems.

A Cell-Cell Fusion Assay to Assess Arenavirus Envelope Glycoprotein Membrane-Fusion Activity.

PubMed

York, Joanne; Nunberg, Jack H

2018-01-01

For many viruses that enter their target cells through pH-dependent fusion of the viral and endosomal membranes, cell-cell fusion assays can provide an experimental platform for investigating the structure-function relationships that promote envelope glycoprotein membrane-fusion activity. Typically, these assays employ effector cells expressing the recombinant envelope glycoprotein on the cell surface and target cells engineered to quantitatively report fusion with the effector cell. In the protocol described here, Vero cells are transfected with a plasmid encoding the arenavirus envelope glycoprotein complex GPC and infected with the vTF7-3 vaccinia virus expressing the bacteriophage T7 RNA polymerase. These effector cells are mixed with target cells infected with the vCB21R-lacZ vaccinia virus encoding a β-galactosidase reporter under the control of the T7 promoter. Cell-cell fusion is induced upon exposure to low-pH medium (pH 5.0), and the resultant expression of the β-galactosidase reporter is quantitated using a chemiluminescent substrate. We have utilized this robust microplate cell-cell fusion assay extensively to study arenavirus entry and its inhibition by small-molecule fusion inhibitors.

ITER Fusion Energy

ScienceCinema

Holtkamp, Norbert

2018-01-09

ITER (in Latin “the way”) is designed to demonstrate the scientific and technological feasibility of fusion energy. Fusion is the process by which two light atomic nuclei combine to form a heavier over one and thus release energy. In the fusion process two isotopes of hydrogen – deuterium and tritium – fuse together to form a helium atom and a neutron. Thus fusion could provide large scale energy production without greenhouse effects; essentially limitless fuel would be available all over the world. The principal goals of ITER are to generate 500 megawatts of fusion power for periods of 300 to 500 seconds with a fusion power multiplication factor, Q, of at least 10. Q ? 10 (input power 50 MW / output power 500 MW). The ITER Organization was officially established in Cadarache, France, on 24 October 2007. The seven members engaged in the project – China, the European Union, India, Japan, Korea, Russia and the United States – represent more than half the world’s population. The costs for ITER are shared by the seven members. The cost for the construction will be approximately 5.5 billion Euros, a similar amount is foreseen for the twenty-year phase of operation and the subsequent decommissioning.

Paramyxovirus F1 protein has two fusion peptides: implications for the mechanism of membrane fusion.

PubMed

Peisajovich, S G; Samuel, O; Shai, Y

2000-03-10

Viral fusion proteins contain a highly hydrophobic segment, named the fusion peptide, which is thought to be responsible for the merging of the cellular and viral membranes. Paramyxoviruses are believed to contain a single fusion peptide at the N terminus of the F1 protein. However, here we identified an additional internal segment in the Sendai virus F1 protein (amino acids 214-226) highly homologous to the fusion peptides of HIV-1 and RSV. A synthetic peptide, which includes this region, was found to induce membrane fusion of large unilamellar vesicles, at concentrations where the known N-terminal fusion peptide is not effective. A scrambled peptide as well as several peptides from other regions of the F1 protein, which strongly bind to membranes, are not fusogenic. The functional and structural characterization of this active segment suggest that the F1 protein has an additional internal fusion peptide that could participate in the actual fusion event. The presence of homologous regions in other members of the same family suggests that the concerted action of two fusion peptides, one N-terminal and the other internal, is a general feature of paramyxoviruses. Copyright 2000 Academic Press.

Factors affecting expression of the recF gene of Escherichia coli K-12.

PubMed

Sandler, S J; Clark, A J

1990-01-31

This report describes four factors which affect expression of the recF gene from strong upstream lambda promoters under temperature-sensitive cIAt2-encoded repressor control. The first factor was the long mRNA leader sequence consisting of the Escherichia coli dnaN gene and 95% of the dnaA gene and lambda bet, N (double amber) and 40% of the exo gene. When most of this DNA was deleted, RecF became detectable in maxicells. The second factor was the vector, pBEU28, a runaway replication plasmid. When we substituted pUC118 for pBEU28, RecF became detectable in whole cells by the Coomassie blue staining technique. The third factor was the efficiency of initiation of translation. We used site-directed mutagenesis to change the mRNA leader, ribosome-binding site and the 3 bp before and after the translational start codon. Monitoring the effect of these mutational changes by translational fusion to lacZ, we discovered that the efficiency of initiation of translation was increased 30-fold. Only an estimated two- or threefold increase in accumulated levels of RecF occurred, however. This led us to discover the fourth factor, namely sequences in the recF gene itself. These sequences reduce expression of the recF-lacZ fusion genes 100-fold. The sequences responsible for this decrease in expression occur in four regions in the N-terminal half of recF. Expression is reduced by some sequences at the transcriptional level and by others at the translational level.

C11orf95-MKL2 is the Resulting Fusion Oncogene of t(11;16)(q13;p13) in Chondroid Lipoma

PubMed Central

Huang, Dali; Sumegi, Janos; Cin, Paola Dal; Reith, John D.; Yasuda, Taketoshi; Nelson, Marilu; Muirhead, David; Bridge, Julia A.

2010-01-01

Chondroid lipoma, a rare benign adipose tissue tumor, may histologically resemble myxoid liposarcoma or extraskeletal myxoid chondrosarcoma, but is genetically distinct. In the current study, an identical reciprocal translocation, t(11;16)(q13;p13) was identified in three chondroid lipomas, a finding consistent with previous isolated reports. A fluorescence in situ hybridization (FISH)-based positional cloning strategy using a series of bacterial artificial chromosome (BAC) probe combinations designed to narrow the 16p13 breakpoint revealed MKL2 as the candidate gene. Subsequent 5′ RACE studies demonstrated C11orf95 as the MKL2 fusion gene partner. MKL/myocardin-like 2 (MKL2) encodes myocardin-related transcription factor B (MRTF-B) in a megakaryoblastic leukemia gene family, and C11orf95 (chromosome 11 open reading frame 95) is a hypothetical protein. Sequencing analysis of RT-PCR generated transcripts from all three chondroid lipomas defined the fusion as occurring between exons 5 and 9 of C11orf95 and MKL2, respectively. Dual-color breakpoint spanning probe sets custom-designed for recognition of the translocation event in interphase cells confirmed the anticipated rearrangements of the C11orf95 and MKL2 loci in all cases. The FISH and RT-PCR assays developed in this study can serve as diagnostic adjuncts for identification of this novel C11orf95-MKL2 fusion oncogene in chondroid lipoma. PMID:20607705

Cell fusion and nuclear fusion in plants.

PubMed

Maruyama, Daisuke; Ohtsu, Mina; Higashiyama, Tetsuya

2016-12-01

Eukaryotic cells are surrounded by a plasma membrane and have a large nucleus containing the genomic DNA, which is enclosed by a nuclear envelope consisting of the outer and inner nuclear membranes. Although these membranes maintain the identity of cells, they sometimes fuse to each other, such as to produce a zygote during sexual reproduction or to give rise to other characteristically polyploid tissues. Recent studies have demonstrated that the mechanisms of plasma membrane or nuclear membrane fusion in plants are shared to some extent with those of yeasts and animals, despite the unique features of plant cells including thick cell walls and intercellular connections. Here, we summarize the key factors in the fusion of these membranes during plant reproduction, and also focus on "non-gametic cell fusion," which was thought to be rare in plant tissue, in which each cell is separated by a cell wall. Copyright © 2016 Elsevier Ltd. All rights reserved.

Interactions between the promoter and first intron are involved in transcriptional control of alpha 1(I) collagen gene expression.

PubMed Central

Bornstein, P; McKay, J; Liska, D J; Apone, S; Devarayalu, S

1988-01-01

The first intron of the human collagen alpha 1(I) gene contains several positively and negatively acting elements. We have studied the transcription of collagen-human growth hormone fusion genes, containing deletions and rearrangements of collagen intronic sequences, by transient transfection of chick tendon fibroblasts and NIH 3T3 cells. In chick tendon fibroblasts, but not in 3T3 cells, inversion of intronic sequences containing a previously studied 274-base-pair segment, A274, resulted in markedly reduced human growth hormone mRNA levels as determined by an RNase protection assay. This inhibitory effect was largely alleviated when deletions were introduced in the collagen promoter of plasmids containing negatively oriented intronic sequences. Evidence for interaction of the promoter with the intronic segment, A274, was obtained by gel mobility shift assays. We suggest that promoter-intron interactions, mediated by DNA-binding proteins, regulate collagen gene transcription. Inversion of intronic segments containing critical interactive elements might then lead to an altered geometry and reduced activity of a transcriptional complex in those cells with sufficiently high levels of appropriate transcription factors. We further suggest that the deleted promoter segment plays a key role in directing DNA interactions involved in transcriptional control. Images PMID:3211130

Deep RNA sequencing analysis of readthrough gene fusions in human prostate adenocarcinoma and reference samples

PubMed Central

2011-01-01

Background Readthrough fusions across adjacent genes in the genome, or transcription-induced chimeras (TICs), have been estimated using expressed sequence tag (EST) libraries to involve 4-6% of all genes. Deep transcriptional sequencing (RNA-Seq) now makes it possible to study the occurrence and expression levels of TICs in individual samples across the genome. Methods We performed single-end RNA-Seq on three human prostate adenocarcinoma samples and their corresponding normal tissues, as well as brain and universal reference samples. We developed two bioinformatics methods to specifically identify TIC events: a targeted alignment method using artificial exon-exon junctions within 200,000 bp from adjacent genes, and genomic alignment allowing splicing within individual reads. We performed further experimental verification and characterization of selected TIC and fusion events using quantitative RT-PCR and comparative genomic hybridization microarrays. Results Targeted alignment against artificial exon-exon junctions yielded 339 distinct TIC events, including 32 gene pairs with multiple isoforms. The false discovery rate was estimated to be 1.5%. Spliced alignment to the genome was less sensitive, finding only 18% of those found by targeted alignment in 33-nt reads and 59% of those in 50-nt reads. However, spliced alignment revealed 30 cases of TICs with intervening exons, in addition to distant inversions, scrambled genes, and translocations. Our findings increase the catalog of observed TIC gene pairs by 66%. We verified 6 of 6 predicted TICs in all prostate samples, and 2 of 5 predicted novel distant gene fusions, both private events among 54 prostate tumor samples tested. Expression of TICs correlates with that of the upstream gene, which can explain the prostate-specific pattern of some TIC events and the restriction of the SLC45A3-ELK4 e4-e2 TIC to ERG-negative prostate samples, as confirmed in 20 matched prostate tumor and normal samples and 9 lung cancer

Investigations of image fusion

NASA Astrophysics Data System (ADS)

Zhang, Zhong

1999-12-01

The objective of image fusion is to combine information from multiple images of the same scene. The result of image fusion is a single image which is more suitable for the purpose of human visual perception or further image processing tasks. In this thesis, a region-based fusion algorithm using the wavelet transform is proposed. The identification of important features in each image, such as edges and regions of interest, are used to guide the fusion process. The idea of multiscale grouping is also introduced and a generic image fusion framework based on multiscale decomposition is studied. The framework includes all of the existing multiscale-decomposition- based fusion approaches we found in the literature which did not assume a statistical model for the source images. Comparisons indicate that our framework includes some new approaches which outperform the existing approaches for the cases we consider. Registration must precede our fusion algorithms. So we proposed a hybrid scheme which uses both feature-based and intensity-based methods. The idea of robust estimation of optical flow from time- varying images is employed with a coarse-to-fine multi- resolution approach and feature-based registration to overcome some of the limitations of the intensity-based schemes. Experiments show that this approach is robust and efficient. Assessing image fusion performance in a real application is a complicated issue. In this dissertation, a mixture probability density function model is used in conjunction with the Expectation- Maximization algorithm to model histograms of edge intensity. Some new techniques are proposed for estimating the quality of a noisy image of a natural scene. Such quality measures can be used to guide the fusion. Finally, we study fusion of images obtained from several copies of a new type of camera developed for video surveillance. Our techniques increase the capability and reliability of the surveillance system and provide an easy way to obtain 3-D

NPM and BRG1 mediate transcriptional resistance to retinoic acid in Acute Promyelocytic Leukemia

PubMed Central

Nichol, Jessica N.; Galbraith, Matthew D.; Kleinman, Claudia L.; Espinosa, Joaquín M.; Miller, Wilson H.

2016-01-01

Summary Perturbation in the transcriptional control of genes driving differentiation is an established paradigm whereby oncogenic fusion proteins promote leukemia. From a retinoic acid (RA) sensitive Acute Promyelocytic Leukemia (APL) cell line, we derived an RA-resistant clone characterized by a block in transcription initiation, despite maintaining wild-type PML/RARA expression. We uncovered an aberrant interaction between PML/RARA, Nucleophosmin (NPM) and Topoisomerase II Beta (TOP2B). Surprisingly, RA stimulation in these cells results in enhanced chromatin association of the nucleosome remodeler BRG1. Inhibition of NPM or TOP2B abrogated BRG1 recruitment. Furthermore, NPM inhibition and targeting BRG1 restored differentiation when combined with RA. Here, we demonstrate a role for NPM and BRG1 in obstructing RA-differentiation and implicate chromatin remodeling in mediating therapeutic resistance in malignancies. NPM mutations are the most common genetic change in patients with acute leukemia (AML) therefore, our model may be applicable to other more common leukemias driven by NPM. PMID:26997274

Fe65 does not stabilize AICD during activation of transcription in a luciferase assay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huysseune, Sandra; Kienlen-Campard, Pascal; Octave, Jean-Noel

2007-09-21

The APP intracellular domain (AICD) could be involved in signaling via interaction with the adaptor protein Fe65, and with the histone acetyl transferase Tip60. However, the real function of AICD and Fe65 in regulation of transcription remains controversial. In this study, the human APPGal4 fusion protein was expressed in CHO cells and the transcriptional activity of AICDGal4 was measured in a luciferase-based reporter assay. AICDGal4 was stabilized by expression of Fe65 and levels of AICDGal4 controlled luciferase activity. On the contrary, when human APP was expressed in CHO cells, coexpression of Fe65 increased luciferase activity without affecting the amount ofmore » AICD fragment. AICD produced from APP was protected from degradation by orthophenanthroline, but not by lactacystine, indicating that AICD is not a substrate of the chymotryptic activity of the proteasome. It is concluded that Fe65 can control luciferase activity without stabilizing the labile AICD fragment.« less

Identification of a novel FN1-FGFR1 genetic fusion as a frequent event in phosphaturic mesenchymal tumour.

PubMed

Lee, Jen-Chieh; Jeng, Yung-Ming; Su, Sheng-Yao; Wu, Chen-Tu; Tsai, Keh-Sung; Lee, Cheng-Han; Lin, Chung-Yen; Carter, Jodi M; Huang, Jenq-Wen; Chen, Shu-Hwa; Shih, Shyang-Rong; Mariño-Enríquez, Adrián; Chen, Chih-Chi; Folpe, Andrew L; Chang, Yih-Leong; Liang, Cher-Wei

2015-03-01

Phosphaturic mesenchymal tumours (PMTs) are uncommon soft tissue and bone tumours that typically cause hypophosphataemia and tumour-induced osteomalacia (TIO) through secretion of phosphatonins including fibroblast growth factor 23 (FGF23). PMT has recently been accepted by the World Health Organization as a formal tumour entity. The genetic basis and oncogenic pathways underlying its tumourigenesis remain obscure. In this study, we identified a novel FN1-FGFR1 fusion gene in three out of four PMTs by next-generation RNA sequencing. The fusion transcripts and proteins were subsequently confirmed with RT-PCR and western blotting. Fluorescence in situ hybridization analysis showed six cases with FN1-FGFR1 fusion out of an additional 11 PMTs. Overall, nine out of 15 PMTs (60%) harboured this fusion. The FN1 gene possibly provides its constitutively active promoter and the encoded protein's oligomerization domains to overexpress and facilitate the activation of the FGFR1 kinase domain. Interestingly, unlike the prototypical leukaemia-inducing FGFR1 fusion genes, which are ligand-independent, the FN1-FGFR1 chimeric protein was predicted to preserve its ligand-binding domains, suggesting an advantage of the presence of its ligands (such as FGF23 secreted at high levels by the tumour) in the activation of the chimeric receptor tyrosine kinase, thus effecting an autocrine or a paracrine mechanism of tumourigenesis. Copyright © 2014 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

Quantitative Analysis of Lipid Droplet Fusion: Inefficient Steady State Fusion but Rapid Stimulation by Chemical Fusogens

PubMed Central

Murphy, Samantha; Martin, Sally; Parton, Robert G.

2010-01-01

Lipid droplets (LDs) are dynamic cytoplasmic organelles containing neutral lipids and bounded by a phospholipid monolayer. Previous studies have suggested that LDs can undergo constitutive homotypic fusion, a process linked to the inhibitory effects of fatty acids on glucose transporter trafficking. Using strict quantitative criteria for LD fusion together with refined light microscopic methods and real-time analysis, we now show that LDs in diverse cell types show low constitutive fusogenic activity under normal growth conditions. To investigate the possible modulation of LD fusion, we screened for agents that can trigger fusion. A number of pharmacological agents caused homotypic fusion of lipid droplets in a variety of cell types. This provided a novel cell system to study rapid regulated fusion between homotypic phospholipid monolayers. LD fusion involved an initial step in which the two adjacent membranes became continuous (<10 s), followed by the slower merging (100 s) of the neutral lipid cores to produce a single spherical LD. These fusion events were accompanied by changes to the LD surface organization. Measurements of LDs undergoing homotypic fusion showed that fused LDs maintained their initial volume, with a corresponding decrease in surface area suggesting rapid removal of membrane from the fused LD. This study provides estimates for the level of constitutive LD fusion in cells and questions the role of LD fusion in vivo. In addition, it highlights the extent of LD restructuring which occurs when homotypic LD fusion is triggered in a variety of cell types. PMID:21203462

MIXTA-Like Transcription Factors and WAX INDUCER1/SHINE1 Coordinately Regulate Cuticle Development in Arabidopsis and Torenia fournieri[C][W

PubMed Central

Oshima, Yoshimi; Shikata, Masahito; Koyama, Tomotsugu; Ohtsubo, Norihiro; Mitsuda, Nobutaka; Ohme-Takagi, Masaru

2013-01-01

The waxy plant cuticle protects cells from dehydration, repels pathogen attack, and prevents organ fusion during development. The transcription factor WAX INDUCER1/SHINE1 (WIN1/SHN1) regulates the biosynthesis of waxy substances in Arabidopsis thaliana. Here, we show that the MIXTA-like MYB transcription factors MYB106 and MYB16, which regulate epidermal cell morphology, also regulate cuticle development coordinately with WIN1/SHN1 in Arabidopsis and Torenia fournieri. Expression of a MYB106 chimeric repressor fusion (35S:MYB106-SRDX) and knockout/down of MYB106 and MYB16 induced cuticle deficiencies characterized by organ adhesion and reduction of epicuticular wax crystals and cutin nanoridges. A similar organ fusion phenotype was produced by expression of a WIN1/SHN1 chimeric repressor. Conversely, the dominant active form of MYB106 (35S:MYB106-VP16) induced ectopic production of cutin nanoridges and increased expression of WIN1/SHN1 and wax biosynthetic genes. Microarray experiments revealed that MYB106 and WIN1/SHN1 regulate similar sets of genes, predominantly those involved in wax and cutin biosynthesis. Furthermore, WIN1/SHN1 expression was induced by MYB106-VP16 and repressed by MYB106-SRDX. These results indicate that the regulatory cascade of MIXTA-like proteins and WIN1/SHN1 coordinately regulate cutin biosynthesis and wax accumulation. This study reveals an additional key aspect of MIXTA-like protein function and suggests a unique relationship between cuticle development and epidermal cell differentiation. PMID:23709630

Targeting the epigenetic readers in Ewing Sarcoma inhibits the oncogenic transcription factor EWS/Fli1

PubMed Central

Jacques, Camille; Lamoureux, François; Baud’huin, Marc; Calleja, Lidia Rodriguez; Quillard, Thibaut; Amiaud, Jérôme; Tirode, Franck; Rédini, Françoise; Bradner, James E.; Heymann, Dominique; Ory, Benjamin

2016-01-01

Ewing Sarcoma is a rare bone and soft tissue malignancy affecting children and young adults. Chromosomal translocations in this cancer produce fusion oncogenes as characteristic molecular signatures of the disease. The most common case is the translocation t (11; 22) (q24;q12) which yields the EWS-Fli1 chimeric transcription factor. Finding a way to directly target EWS-Fli1 remains a central therapeutic approach to eradicate this aggressive cancer. Here we demonstrate that treating Ewing Sarcoma cells with JQ1(+), a BET bromodomain inhibitor, represses directly EWS-Fli1 transcription as well as its transcriptional program. Moreover, the Chromatin Immuno Precipitation experiments demonstrate for the first time that these results are a consequence of the depletion of BRD4, one of the BET bromodomains protein from the EWS-Fli1 promoter. In vitro, JQ1(+) treatment reduces the cell viability, impairs the cell clonogenic and the migratory abilities, and induces a G1-phase blockage as well as a time- and a dose-dependent apoptosis. Furthermore, in our in vivo model, we observed a tumor burden delay, an inhibition of the global vascularization and an increase of the mice overall survival. Taken together, our data indicate that inhibiting the BET bromodomains interferes with EWS-FLi1 transcription and could be a promising strategy in the Ewing tumors context. PMID:27006472

Spatiotemporal regulation of cAMP signaling controls the human trophoblast fusion

PubMed Central

Gerbaud, Pascale; Taskén, Kjetil; Pidoux, Guillaume

2015-01-01

During human placentation, mononuclear cytotrophoblasts fuse to form multinucleated syncytia ensuring hormonal production and nutrient exchanges between the maternal and fetal circulation. Syncytial formation is essential for the maintenance of pregnancy and for fetal growth. The cAMP signaling pathway is the major route to trigger trophoblast fusion and its activation results in phosphorylation of specific intracellular target proteins, in transcription of fusogenic genes and assembly of macromolecular protein complexes constituting the fusogenic machinery at the plasma membrane. Specificity in cAMP signaling is ensured by generation of localized pools of cAMP controlled by cAMP phosphodiesterases (PDEs) and by discrete spatial and temporal activation of protein kinase A (PKA) in supramolecular signaling clusters inside the cell organized by A-kinase-anchoring proteins (AKAPs) and by organization of signal termination by protein phosphatases (PPs). Here we present original observations on the available components of the cAMP signaling pathway in the human placenta including PKA, PDE, and PP isoforms as well as AKAPs. We continue to discuss the current knowledge of the spatiotemporal regulation of cAMP signaling triggering trophoblast fusion. PMID:26441659

Transcription factor levels enable metabolic diversification of single cells of environmental bacteria.

PubMed

Guantes, Raúl; Benedetti, Ilaria; Silva-Rocha, Rafael; de Lorenzo, Víctor

2016-05-01

Transcriptional noise is a necessary consequence of the molecular events that drive gene expression in prokaryotes. However, some environmental microorganisms that inhabit polluted sites, for example, the m-xylene degrading soil bacterium Pseudomonas putida mt-2 seem to have co-opted evolutionarily such a noise for deploying a metabolic diversification strategy that allows a cautious exploration of new chemical landscapes. We have examined this phenomenon under the light of deterministic and stochastic models for activation of the main promoter of the master m-xylene responsive promoter of the system (Pu) by its cognate transcriptional factor (XylR). These analyses consider the role of co-factors for Pu activation and determinants of xylR mRNA translation. The model traces the onset and eventual disappearance of the bimodal distribution of Pu activity along time to the growth-phase dependent abundance of XylR itself, that is, very low in exponentially growing cells and high in stationary. This tenet was validated by examining the behaviour of a Pu-GFP fusion in a P. putida strain in which xylR expression was engineered under the control of an IPTG-inducible system. This work shows how a relatively simple regulatory scenario (for example, growth-phase dependent expression of a limiting transcription factor) originates a regime of phenotypic diversity likely to be advantageous in competitive environmental settings.

Anaerobically controlled expression system derived from the arcDABC operon of Pseudomonas aeruginosa: application to lipase production.

PubMed Central

Winteler, H V; Schneidinger, B; Jaeger, K E; Haas, D

1996-01-01

The anaerobically inducible arcDABC operon encodes the enzymes of the arginine deiminase pathway in Pseudomonas aeruginosa. Upon induction, the arcAB mRNAs and proteins reach high intracellular levels, because of a strong anaerobically controlled promoter and mRNA processing in arcD, leading to stable downstream transcripts. We explored the usefulness of this system for the construction of expression vectors. The lacZ gene of Escherichia coli was expressed to the highest levels when fused close to the arc promoter. Insertion of lacZ further downstream into arcA or arcB did not stabilize the intrinsically unstable lacZ mRNA. On the contrary, lacZ mRNA appeared to be a vulnerable endonuclease target destabilizing arcAB mRNAs in the 5'-to-3' direction in P. aeruginosa. The native arc promoter was modified for optional expression in the -10 sequence and in the -40 region, which is a binding site for the anaerobic regulator ANR. In P. aeruginosa grown either anaerobically or with oxygen limitation in unshaken cultures, this promoter was stronger than the induced tac promoter. The P. aeruginosa lipAH genes, which encode extracellular lipase and lipase foldase, respectively, were fused directly to the modified arc promoter in an IncQ vector plasmid. Semianaerobic static cultures of P. aeruginosa PAO1 carrying this recombinant plasmid overproduced extracellular lipase 30-fold during stationary phase compared with the production by strain PAO1 without the plasmid. Severe oxygen limitation, in contrast, resulted in poor lipase productivity despite effective induction of the ANR-dependent promoter, suggesting that secretion of active lipase is blocked by the absence of oxygen. In conclusion, the modified arc promoter is useful for driving the expression of cloned genes in P. aeruginosa during oxygen-limited growth and stationary phase. PMID:8795231

Fusion gene profile of biphenotypic sinonasal sarcoma: an analysis of 44 cases.

PubMed

Fritchie, Karen J; Jin, Long; Wang, Xiaoke; Graham, Rondell P; Torbenson, Michael S; Lewis, Jean E; Rivera, Michael; Garcia, Joaquin J; Schembri-Wismayer, David J; Westendorf, Jennifer J; Chou, Margaret M; Dong, Jie; Oliveira, Andre M

2016-12-01

Biphenotypic sinonasal sarcoma (SNS) is a locally aggressive tumour that occurs in the sinonasal region. PAX3-MAML3 has recently been identified as a recurrent fusion gene event in this entity; however, a subset of tumours harbour alternative PAX3 rearrangement without the involvement of MAML3. In this study we sought to characterize the molecular profile of a large series of cases, with a special emphasis on tumours with alternative fusions. Forty-four examples of SNS were screened by fluorescence in-situ hybridization and reverse transcription polymerase chain reaction to better characterize its molecular profile and identify potential novel fusion genes. Twenty-four were positive for PAX3-MAML3 (55%), 15 showed rearrangements of PAX3 without MAML3 involvement (34%), one showed rearrangement of MAML3 without PAX3 involvement, and four were negative for the involvement of either gene (9%). Among 15 cases with PAX3 involvement only, three were found to harbour PAX3-FOXO1. Two of these cases arose in the nasal cavities of female patients (aged 31 and 47 years), and one showed bilateral involvement of the nasal cavities of a 35-year-old male. A fourth case involved the skull base of a 47-year-old male, and was positive for PAX3-NCOA1. Patients with fusion-negative tumours were slightly older. More than half of the SNSs in this series were positive for PAX3-MAML3. However, a subset of tumours may harbour alternative PAX3 fusion genes or show no involvement of PAX3. Except for a possible weak association between age and molecular profile, the overall morphological and immunophenotypic features of all cases seem to be similar. Because of the rarity of these tumours, the impact of the molecular profile on the clinical course of these tumours remains to be determined. © 2016 John Wiley & Sons Ltd.

Enhanced image capture through fusion

NASA Technical Reports Server (NTRS)

Burt, Peter J.; Hanna, Keith; Kolczynski, Raymond J.

1993-01-01

Image fusion may be used to combine images from different sensors, such as IR and visible cameras, to obtain a single composite with extended information content. Fusion may also be used to combine multiple images from a given sensor to form a composite image in which information of interest is enhanced. We present a general method for performing image fusion and show that this method is effective for diverse fusion applications. We suggest that fusion may provide a powerful tool for enhanced image capture with broad utility in image processing and computer vision.

Positional effects of fusion partners on the yield and solubility of MBP fusion proteins

PubMed Central

Raran-Kurussi, Sreejith; Keefe, Karina; Waugh, David S.

2015-01-01

Escherichia coli maltose-binding protein (MBP) is exceptionally effective at promoting the solubility of its fusion partners. However, there are conflicting reports in the literature claiming that 1) MBP is an effective solubility enhancer only when it is joined to the N-terminus of an aggregation-prone passenger protein, and 2) MBP is equally effective when fused to either end of the passenger. Here, we endeavor to resolve this controversy by comparing the solubility of a diverse set of MBP fusion proteins that, unlike those analyzed in previous studies, are identical in every way except for the order of the two domains. The results indicate that fusion proteins with an N-terminal MBP provide an excellent solubility advantage along with more robust expression when compared to analogous fusions in which MBP is the C-terminal fusion partner. We find that only intrinsically soluble passenger proteins (i.e., those not requiring a solubility enhancer) are produced as soluble fusions when they precede MBP. We also report that even subtle differences in inter-domain linker sequences can influence the solubility of fusion proteins. PMID:25782741

Fusion or confusion: knowledge or nonsense?

NASA Astrophysics Data System (ADS)

Rothman, Peter L.; Denton, Richard V.

1991-08-01

The terms 'data fusion,' 'sensor fusion,' multi-sensor integration,' and 'multi-source integration' have been used widely in the technical literature to refer to a variety of techniques, technologies, systems, and applications which employ and/or combine data derived from multiple information sources. Applications of data fusion range from real-time fusion of sensor information for the navigation of mobile robots to the off-line fusion of both human and technical strategic intelligence data. The Department of Defense Critical Technologies Plan lists data fusion in the highest priority group of critical technologies, but just what is data fusion? The DoD Critical Technologies Plan states that data fusion involves 'the acquisition, integration, filtering, correlation, and synthesis of useful data from diverse sources for the purposes of situation/environment assessment, planning, detecting, verifying, diagnosing problems, aiding tactical and strategic decisions, and improving system performance and utility.' More simply states, sensor fusion refers to the combination of data from multiple sources to provide enhanced information quality and availability over that which is available from any individual source alone. This paper presents a survey of the state-of-the- art in data fusion technologies, system components, and applications. A set of characteristics which can be utilized to classify data fusion systems is presented. Additionally, a unifying mathematical and conceptual framework within which to understand and organize fusion technologies is described. A discussion of often overlooked issues in the development of sensor fusion systems is also presented.

Dicentric breakage at telomere fusions

PubMed Central

Pobiega, Sabrina; Marcand, Stéphane

2010-01-01

Nonhomologous end-joining (NHEJ) inhibition at telomeres ensures that native chromosome ends do not fuse together. But the occurrence and consequences of rare telomere fusions are not well understood. It is notably unclear whether a telomere fusion could be processed to restore telomere ends. Here we address the behavior of individual dicentrics formed by telomere fusion in the yeast Saccharomyces cerevisiae. Our approach was to first stabilize and amplify fusions between two chromosomes by temporarily inactivating one centromere. Next we analyzed dicentric breakage following centromere reactivation. Unexpectedly, dicentrics often break at the telomere fusions during progression through mitosis, a process that restores the parental chromosomes. This unforeseen result suggests a rescue pathway able to process telomere fusions and to back up NHEJ inhibition at telomeres. PMID:20360388

Magnetized Target Fusion

NASA Technical Reports Server (NTRS)

Griffin, Steven T.

2002-01-01

Magnetized target fusion (MTF) is under consideration as a means of building a low mass, high specific impulse, and high thrust propulsion system for interplanetary travel. This unique combination is the result of the generation of a high temperature plasma by the nuclear fusion process. This plasma can then be deflected by magnetic fields to provide thrust. Fusion is initiated by a small traction of the energy generated in the magnetic coils due to the plasma's compression of the magnetic field. The power gain from a fusion reaction is such that inefficiencies due to thermal neutrons and coil losses can be overcome. Since the fusion reaction products are directly used for propulsion and the power to initiate the reaction is directly obtained from the thrust generation, no massive power supply for energy conversion is required. The result should be a low engine mass, high specific impulse and high thrust system. The key is to successfully initiate fusion as a proof-of-principle for this application. Currently MSFC is implementing MTF proof-of-principle experiments. This involves many technical details and ancillary investigations. Of these, selected pertinent issues include the properties, orientation and timing of the plasma guns and the convergence and interface development of the "pusher" plasma. Computer simulations of the target plasma's behavior under compression and the convergence and mixing of the gun plasma are under investigation. This work is to focus on the gun characterization and development as it relates to plasma initiation and repeatability.

Crystal Structure of the Pre-fusion Nipah Virus Fusion Glycoprotein Reveals a Novel Hexamer-of-Trimers Assembly.

PubMed

Xu, Kai; Chan, Yee-Peng; Bradel-Tretheway, Birgit; Akyol-Ataman, Zeynep; Zhu, Yongqun; Dutta, Somnath; Yan, Lianying; Feng, YanRu; Wang, Lin-Fa; Skiniotis, Georgios; Lee, Benhur; Zhou, Z Hong; Broder, Christopher C; Aguilar, Hector C; Nikolov, Dimitar B

2015-12-01

Nipah virus (NiV) is a paramyxovirus that infects host cells through the coordinated efforts of two envelope glycoproteins. The G glycoprotein attaches to cell receptors, triggering the fusion (F) glycoprotein to execute membrane fusion. Here we report the first crystal structure of the pre-fusion form of the NiV-F glycoprotein ectodomain. Interestingly this structure also revealed a hexamer-of-trimers encircling a central axis. Electron tomography of Nipah virus-like particles supported the hexameric pre-fusion model, and biochemical analyses supported the hexamer-of-trimers F assembly in solution. Importantly, structure-assisted site-directed mutagenesis of the interfaces between F trimers highlighted the functional relevance of the hexameric assembly. Shown here, in both cell-cell fusion and virus-cell fusion systems, our results suggested that this hexamer-of-trimers assembly was important during fusion pore formation. We propose that this assembly would stabilize the pre-fusion F conformation prior to cell attachment and facilitate the coordinated transition to a post-fusion conformation of all six F trimers upon triggering of a single trimer. Together, our data reveal a novel and functional pre-fusion architecture of a paramyxoviral fusion glycoprotein.

Fusion Power measurement at ITER

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bertalot, L.; Barnsley, R.; Krasilnikov, V.

2015-07-01

Nuclear fusion research aims to provide energy for the future in a sustainable way and the ITER project scope is to demonstrate the feasibility of nuclear fusion energy. ITER is a nuclear experimental reactor based on a large scale fusion plasma (tokamak type) device generating Deuterium - Tritium (DT) fusion reactions with emission of 14 MeV neutrons producing up to 700 MW fusion power. The measurement of fusion power, i.e. total neutron emissivity, will play an important role for achieving ITER goals, in particular the fusion gain factor Q related to the reactor performance. Particular attention is given also tomore » the development of the neutron calibration strategy whose main scope is to achieve the required accuracy of 10% for the measurement of fusion power. Neutron Flux Monitors located in diagnostic ports and inside the vacuum vessel will measure ITER total neutron emissivity, expected to range from 1014 n/s in Deuterium - Deuterium (DD) plasmas up to almost 10{sup 21} n/s in DT plasmas. The neutron detection systems as well all other ITER diagnostics have to withstand high nuclear radiation and electromagnetic fields as well ultrahigh vacuum and thermal loads. (authors)« less

A sensitive HIV-1 envelope induced fusion assay identifies fusion enhancement of thrombin

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, De-Chun; Zhong, Guo-Cai; Su, Ju-Xiang

2010-01-22

To evaluate the interaction between HIV-1 envelope glycoprotein (Env) and target cell receptors, various cell-cell-fusion assays have been developed. In the present study, we established a novel fusion system. In this system, the expression of the sensitive reporter gene, firefly luciferase (FL) gene, in the target cells was used to evaluate cell fusion event. Simultaneously, constitutively expressed Renilla luciferase (RL) gene was used to monitor effector cell number and viability. FL gave a wider dynamic range than other known reporters and the introduction of RL made the assay accurate and reproducible. This system is especially beneficial for investigation of potentialmore » entry-influencing agents, for its power of ruling out the false inhibition or enhancement caused by the artificial cell-number variation. As a case study, we applied this fusion system to observe the effect of a serine protease, thrombin, on HIV Env-mediated cell-cell fusion and have found the fusion enhancement activity of thrombin over two R5-tropic HIV strains.« less

C11orf95-RELA fusion present in a primary supratentorial ependymoma and recurrent sarcoma.

PubMed

Cachia, David; Wani, Khalida; Penas-Prado, Marta; Olar, Adriana; McCutcheon, Ian E; Benjamin, Robert S; Armstrong, Terri S; Gilbert, Mark R; Aldape, Kenneth D

2015-04-01

Ependymomas are rare glial tumors of the central nervous system that arise from the cells lining the ventricles and central canal within the spinal cord. The distribution of these tumors along the neuroaxis varies by age, most commonly involving the spinal cord in adults and the posterior fossa in children. It is becoming evident that ependymomas of infratentorial, supratentorial, and spinal cord location are genetically distinct which may explain the differences in clinical outcomes. A novel oncogenic fusion involving the C11orf95 and RELA genes was recently described in supratentorial ependymomas that results in constitutive aberrant activation of the nuclear factor-kB signaling pathway. Ependymosarcomas are rare neoplasms in which a malignant mesenchymal component arises within an ependymoma. We here describe a case of a sarcoma developing in a patient previously treated with chemotherapy and radiation whose original ependymoma and recurrent sarcoma were both shown to carry the type 1 C11orf95-RELA fusion transcript indicating a monoclonal origin for both tumors.

Cell-cycle dependent expression of a translocation-mediated fusion oncogene mediates checkpoint adaptation in rhabdomyosarcoma.

PubMed

Kikuchi, Ken; Hettmer, Simone; Aslam, M Imran; Michalek, Joel E; Laub, Wolfram; Wilky, Breelyn A; Loeb, David M; Rubin, Brian P; Wagers, Amy J; Keller, Charles

2014-01-01

Rhabdomyosarcoma is the most commonly occurring soft-tissue sarcoma in childhood. Most rhabdomyosarcoma falls into one of two biologically distinct subgroups represented by alveolar or embryonal histology. The alveolar subtype harbors a translocation-mediated PAX3:FOXO1A fusion gene and has an extremely poor prognosis. However, tumor cells have heterogeneous expression for the fusion gene. Using a conditional genetic mouse model as well as human tumor cell lines, we show that that Pax3:Foxo1a expression is enriched in G2 and triggers a transcriptional program conducive to checkpoint adaptation under stress conditions such as irradiation in vitro and in vivo. Pax3:Foxo1a also tolerizes tumor cells to clinically-established chemotherapy agents and emerging molecularly-targeted agents. Thus, the surprisingly dynamic regulation of the Pax3:Foxo1a locus is a paradigm that has important implications for the way in which oncogenes are modeled in cancer cells.

Fusion of Enveloped Viruses in Endosomes

PubMed Central

White, Judith M.; Whittaker, Gary R.

2016-01-01

Ari Helenius launched the field of enveloped virus fusion in endosomes with a seminal paper in the Journal of Cell Biology in 1980. In the intervening years a great deal has been learned about the structures and mechanisms of viral membrane fusion proteins as well as about the endosomes in which different enveloped viruses fuse and the endosomal cues that trigger fusion. We now recognize three classes of viral membrane fusion proteins based on structural criteria and four mechanisms of fusion triggering. After reviewing general features of viral membrane fusion proteins and viral fusion in endosomes, we delve into three characterized mechanisms for viral fusion triggering in endosomes: by low pH, by receptor binding plus low pH, and by receptor binding plus the action of a protease. We end with a discussion of viruses that may employ novel endosomal fusion triggering mechanisms. A key take home message is that enveloped viruses that enter cells by fusing in endosomes traverse the endocytic pathway until they reach an endosome that has all of the environmental conditions (pH, proteases, ions, intracellular receptors, and lipid composition) to (if needed) prime and (in all cases) trigger the fusion protein and to support membrane fusion. PMID:26935856

The occlusion-derived virus envelope protein ODV-E56 is required for optimal oral infectivity but is not essential for virus binding and fusion

USDA-ARS?s Scientific Manuscript database

The Autographa californica multiple nucleopolyhedrovirus (AcMNPV) odv-e56 gene encodes an occlusion-derived virus (ODV)-specific envelope protein, ODV-E56. To determine the role of ODV-E56 in oral infectivity, we produced recombinant EGFP-expressing AcMNPV clones (Ac69GFP-e56lacZ and AcIEGFP-e56lac...

Feasibility study on sensor data fusion for the CP-140 aircraft: fusion architecture analyses

NASA Astrophysics Data System (ADS)

Shahbazian, Elisa

1995-09-01

Loral Canada completed (May 1995) a Department of National Defense (DND) Chief of Research and Development (CRAD) contract, to study the feasibility of implementing a multi- sensor data fusion (MSDF) system onboard the CP-140 Aurora aircraft. This system is expected to fuse data from: (a) attributed measurement oriented sensors (ESM, IFF, etc.); (b) imaging sensors (FLIR, SAR, etc.); (c) tracking sensors (radar, acoustics, etc.); (d) data from remote platforms (data links); and (e) non-sensor data (intelligence reports, environmental data, visual sightings, encyclopedic data, etc.). Based on purely theoretical considerations a central-level fusion architecture will lead to a higher performance fusion system. However, there are a number of systems and fusion architecture issues involving fusion of such dissimilar data: (1) the currently existing sensors are not designed to provide the type of data required by a fusion system; (2) the different types (attribute, imaging, tracking, etc.) of data may require different degree of processing, before they can be used within a fusion system efficiently; (3) the data quality from different sensors, and more importantly from remote platforms via the data links must be taken into account before fusing; and (4) the non-sensor data may impose specific requirements on the fusion architecture (e.g. variable weight/priority for the data from different sensors). This paper presents the analyses performed for the selection of the fusion architecture for the enhanced sensor suite planned for the CP-140 aircraft in the context of the mission requirements and environmental conditions.

Transcriptional regulation of fksA, a β-1,3-glucan synthase gene, by the APSES protein StuA during Aspergillus nidulans development.

PubMed

Park, Bum-Chan; Park, Yun-Hee; Yi, Soohyun; Choi, Yu Kyung; Kang, Eun-Hye; Park, Hee-Moon

2014-11-01

The temporal and spatial regulation of β-1,3-glucan synthesis plays an important role in morphogenesis during fungal growth and development. Northern blot analysis showed that the transcription of fksA, the gene encoding β-1,3-glucan synthase in Aspergillus nidulans, was cell-cycle-dependent and increased steadily over the duration of the vegetative period, but its overall expression during the asexual and sexual stages was fairly constant up until the time of transcription cessation. In an A. nidulans strain mutated in the eukaryotic bHLH-like APSES transcription factor stuA1, the transcriptional level of fksA, and consequently the content of alkali-insoluble cell wall β-glucan, significantly increased at the conidial chain formation and maturation stage. Electrophoretic mobility shift assays revealed that StuA was bound to StREs (StuA Response Elements) on the fksA promoter region. Promoter analysis with sGFP-fusion constructs also indicated the negative regulation of fksA expression by StuA, especially during asexual development. Taken together, these data suggest that StuA plays an important role in cell wall biogenesis during the development of A. nidulans, by controlling the transcription level of fksA.

Positional effects of fusion partners on the yield and solubility of MBP fusion proteins.

PubMed

Raran-Kurussi, Sreejith; Keefe, Karina; Waugh, David S

2015-06-01

Escherichia coli maltose-binding protein (MBP) is exceptionally effective at promoting the solubility of its fusion partners. However, there are conflicting reports in the literature claiming that (1) MBP is an effective solubility enhancer only when it is joined to the N-terminus of an aggregation-prone passenger protein, and (2) MBP is equally effective when fused to either end of the passenger. Here, we endeavor to resolve this controversy by comparing the solubility of a diverse set of MBP fusion proteins that, unlike those analyzed in previous studies, are identical in every way except for the order of the two domains. The results indicate that fusion proteins with an N-terminal MBP provide an excellent solubility advantage along with more robust expression when compared to analogous fusions in which MBP is the C-terminal fusion partner. We find that only intrinsically soluble passenger proteins (i.e., those not requiring a solubility enhancer) are produced as soluble fusions when they precede MBP. We also report that even subtle differences in inter-domain linker sequences can influence the solubility of fusion proteins. Published by Elsevier Inc.

A Genetic Selection For Neurospora crassa Mutants Altered in Their Light Regulation of Transcription

PubMed Central

Navarro-Sampedro, Laura; Yanofsky, Charles; Corrochano, Luis M.

2008-01-01

Transcription of the Neurospora crassa gene con-10 is induced during conidiation and following exposure of vegetative mycelia to light, but light activation is transient due to photoadaptation. We describe mutational analyses of photoadaptation using a N. crassa strain bearing a translational fusion of con-10, including its regulatory region, to a selectable bacterial gene conferring hygromycin resistance (hph). Growth of this strain was sensitive to hygromycin, upon continuous culture in the light. Five mutants were isolated that were resistant to hygromycin when cultured under constant light. Three mutant strains displayed elevated, sustained accumulation of con-10∷hph mRNA during continued light exposure, suggesting that they bear mutations that reduce or eliminate the presumed light-dependent repression mechanism that blocks con-10 transcription upon prolonged illumination. These mutations altered photoadaptation for only a specific group of genes (con-10 and con-6), suggesting that regulation of photoadaptation is relatively gene specific. The mutations increased light-dependent mRNA accumulation for genes al-1, al-2, and al-3, each required for carotenoid biosynthesis, resulting in a threefold increase in carotenoid accumulation following continuous light exposure. Identification of the altered gene or genes in these mutants may reveal novel proteins that participate in light regulation of gene transcription in fungi. PMID:18202366

Exo-endo cellulase fusion protein

DOEpatents

Bower, Benjamin S [Palo Alto, CA; Larenas, Edmund A [Palo Alto, CA; Mitchinson, Colin [Palo Alto, CA

2012-01-17

The present invention relates to a heterologous exo-endo cellulase fusion construct, which encodes a fusion protein having cellulolytic activity comprising a catalytic domain derived from a fungal exo-cellobiohydrolase and a catalytic domain derived from an endoglucanase. The invention also relates to vectors and fungal host cells comprising the heterologous exo-endo cellulase fusion construct as well as methods for producing a cellulase fusion protein and enzymatic cellulase compositions.

Two Strategic Decisions Facing Fusion

NASA Astrophysics Data System (ADS)

Baldwin, D. E.

1998-06-01

Two strategic decisions facing the U.S. fusion program are described. The first decision deals with the role and rationale of the tokamak within the U. S. fusion program, and it underlies the debate over our continuing role in the evolving ITER collaboration (mid-1998). The second decision concerns how to include Inertial Fusion Energy (IFE) as a viable part of the national effort to harness fusion energy.

SFPQ/PSF-TFE3 renal cell carcinoma: a clinicopathologic study emphasizing extended morphology and reviewing the differences between SFPQ-TFE3 RCC and the corresponding mesenchymal neoplasm despite an identical gene fusion.

PubMed

Wang, Xiao-Tong; Xia, Qiu-Yuan; Ni, Hao; Ye, Sheng-Bing; Li, Rui; Wang, Xuan; Shi, Shan-Shan; Zhou, Xiao-Jun; Rao, Qiu

2017-05-01

Xp11 translocation renal cell carcinoma (RCC) with SFPQ/PSF-TFE3 gene fusion is a rare epithelial tumor. Of note, the appearance of the gene fusion does not necessarily mean that it is renal cell carcinoma. The corresponding mesenchymal neoplasms, including Xp11 neoplasm with melanocytic differentiation, TFE3 rearrangement-associated perivascular epithelioid cell tumor (PEComa) and melanotic Xp11 translocation renal cancer, can also harbor the identical gene fusion. However, the differences between Xp11 translocation RCC and the corresponding mesenchymal neoplasm have only recently been described. Herein, we examined 5 additional cases of SFPQ-TFE3 RCCs using clinicopathologic, immunohistochemical, and molecular analyses. One tumor had the typical morphologic features of SFPQ-TFE3 RCC, whereas other 3 cases demonstrated the unusual morphologic features associated with pseudorosettes formation or clusters of smaller cells, mimicking TFEB RCC. The remaining one showed branching tubules and papillary structure composed of clear and eosinophilic tumor cells. Immunohistochemically, all 5 cases demonstrated moderate (2+) or strong (3+) positive staining for TFE3, PAX-8 and CD10, whereas no cases demonstrated TFEB, Cathepsin K, CA-IX, CK7, Melan-A, or HMB-45 expression. Genetically, the fusion transcripts were identified in 3 cases by reverse-transcription polymerase chain reaction (RT-PCR). On the basis of fluorescence in situ hybridization (FISH) analysis, all the cases were detected with SFPQ-TFE3 gene fusion. Clinical follow-up data were available for all the patients, and no one developed tumor recurrence, progression, or metastasis. We also review the differences between SFPQ-TFE3 RCC and the corresponding mesenchymal neoplasm despite the identical gene fusion. The presence of pseudorosettes also expands the known histological features of SFPQ-TFE3 RCC. Copyright © 2017 Elsevier Inc. All rights reserved.

Frontier of Fusion Research: Path to the Steady State Fusion Reactor by Large Helical Device

NASA Astrophysics Data System (ADS)

Motojima, Osamu

2006-12-01

The ITER, the International Thermonuclear Experimental Reactor, which will be built in Cadarache in France, has finally started this year, 2006. Since the thermal energy produced by fusion reactions divided by the external heating power, i.e., the Q value, will be larger than 10, this is a big step of the fusion research for half a century trying to tame the nuclear fusion for the 6.5 Billion people on the Earth. The source of the Sun's power is lasting steadily and safely for 8 Billion years. As a potentially safe environmentally friendly and economically competitive energy source, fusion should provide a sustainable future energy supply for all mankind for ten thousands of years. At the frontier of fusion research important milestones are recently marked on a long road toward a true prototype fusion reactor. In its own merits, research into harnessing turbulent burning plasmas and thereby controlling fusion reaction, is one of the grand challenges of complex systems science. After a brief overview of a status of world fusion projects, a focus is given on fusion research at the National Institute for Fusion Science (NIFS) in Japan, which is playing a role of the Inter University Institute, the coordinating Center of Excellence for academic fusion research and by the Large Helical Device (LHD), the world's largest superconducting heliotron device, as a National Users' facility. The current status of LHD project is presented focusing on the experimental program and the recent achievements in basic parameters and in steady state operations. Since, its start in a year 1998, a remarkable progress has presently resulted in the temperature of 140 Million degree, the highest density of 500 Thousand Billion/cc with the internal density barrier (IDB) and the highest steady average beta of 4.5% in helical plasma devices and the largest total input energy of 1.6 GJ, in all magnetic confinement fusion devices. Finally, a perspective is given of the ITER Broad Approach program

The dengue virus type 2 envelope protein fusion peptide is essential for membrane fusion

DOE Office of Scientific and Technical Information (OSTI.GOV)

Huang, Claire Y.-H., E-mail: CHuang1@cdc.go; Butrapet, Siritorn; Moss, Kelly J.

The flaviviral envelope (E) protein directs virus-mediated membrane fusion. To investigate membrane fusion as a requirement for virus growth, we introduced 27 unique mutations into the fusion peptide of an infectious cDNA clone of dengue 2 virus and recovered seven stable mutant viruses. The fusion efficiency of the mutants was impaired, demonstrating for the first time the requirement for specific FP AAs in optimal fusion. Mutant viruses exhibited different growth kinetics and/or genetic stabilities in different cell types and adult mosquitoes. Virus particles could be recovered following RNA transfection of cells with four lethal mutants; however, recovered viruses could notmore » re-infect cells. These viruses could enter cells, but internalized virus appeared to be retained in endosomal compartments of infected cells, thus suggesting a fusion blockade. Mutations of the FP also resulted in reduced virus reactivity with flavivirus group-reactive antibodies, confirming earlier reports using virus-like particles.« less

Nighttime images fusion based on Laplacian pyramid

NASA Astrophysics Data System (ADS)

Wu, Cong; Zhan, Jinhao; Jin, Jicheng

2018-02-01

This paper expounds method of the average weighted fusion, image pyramid fusion, the wavelet transform and apply these methods on the fusion of multiple exposures nighttime images. Through calculating information entropy and cross entropy of fusion images, we can evaluate the effect of different fusion. Experiments showed that Laplacian pyramid image fusion algorithm is suitable for processing nighttime images fusion, it can reduce the halo while preserving image details.

Growth phase-dependent induction of stationary-phase promoters of Escherichia coli in different gram-negative bacteria.

PubMed Central

Miksch, G; Dobrowolski, P

1995-01-01

RSF1010-derived plasmids carrying a fusion of a promoterless lacZ gene with the sigma s-dependent growth phase-regulated promoters of Escherichia coli, bolAp1 and fic, were constructed. The plasmids were mobilized into the gram-negative bacterial species Acetobacter methanolicus, Xanthomonas campestris, Pseudomonas putida, and Rhizobium meliloti. The beta-galactosidase activities of bacterial cultures were determined during exponential and stationary growth phases. Transcriptional activation of the fic promoter in the different bacteria was growth phase dependent as in E. coli and was initiated generally during the transition to stationary phase. The induction of the bolA promoter was also growth phase dependent in the bacteria tested. While the expression in E. coli and R. meliloti was initiated during the transition from exponential to stationary phase, the induction in A. methanolicus, P. putida, and X. campestris started some hours after stationary growth phase was reached. In all the species tested, DNA fragments hybridizing with the rpoS gene of E. coli were detected. The results show that in different gram-negative bacteria, stationary-phase-specific sigma factors which are structurally and functionally homologous to sigma s and are able to recognize the promoter sequences of both bolA and fic exist. PMID:7665531

Fusion of disubstituted benzenes.

PubMed

Martin, E; Yalkowsky, S H; Wells, J E

1979-05-01

The entropy of fusion of 84 disubstituted benzenes was essentially constant and independent of the participation of the compounds in intramolecular or intermolecular hydrogen bonding. It was also independent of the shapes, sizes, and dipole moments of the rigid molecules studied. While the entropy of fusion was independent of these parameters, the melting point and the heat of fusion showed a direct dependence on molecular properties.

Comparison of instrumented anterior interbody fusion with instrumented circumferential lumbar fusion.

PubMed

Madan, S S; Boeree, N R

2003-12-01

Posterior lumbar interbody fusion (PLIF) restores disc height, the load bearing ability of anterior ligaments and muscles, root canal dimensions, and spinal balance. It immobilizes the painful degenerate spinal segment and decompresses the nerve roots. Anterior lumbar interbody fusion (ALIF) does the same, but could have complications of graft extrusion, compression and instability contributing to pseudarthrosis in the absence of instrumentation. The purpose of this study was to assess and compare the outcome of instrumented circumferential fusion through a posterior approach [PLIF and posterolateral fusion (PLF)] with instrumented ALIF using the Hartshill horseshoe cage, for comparable degrees of internal disc disruption and clinical disability. It was designed as a prospective study, comparing the outcome of two methods of instrumented interbody fusion for internal disc disruption. Between April 1994 and June 1998, the senior author (N.R.B.) performed 39 instrumented ALIF procedures and 35 instrumented circumferential fusion with PLIF procedures. The second author, an independent assessor (S.M.), performed the entire review. Preoperative radiographic assessment included plain radiographs, magnetic resonance imaging (MRI) and provocative discography in all the patients. The outcome in the two groups was compared in terms of radiological improvement and clinical improvement, measured on the basis of improvement of back pain and work capacity. Preoperatively, patients were asked to fill out a questionnaire giving their demographic details, maximum walking distance and current employment status in order to establish the comparability of the two groups. Patient assessment was with the Oswestry Disability Index, quality of life questionnaire (subjective), pain drawing, visual analogue scale, disability benefit, compensation status, and psychological profile. The results of the study showed a satisfactory outcome (score< or =30) on the subjective (quality of life

Ephrin reverse signaling mediates palatal fusion and epithelial-to-mesenchymal transition independently of Tgfß3.

PubMed

Serrano, Maria J; Liu, Jingpeng; Svoboda, Kathy K H; Nawshad, Ali; Benson, M Douglas

2015-12-01

The mammalian secondary palate forms from shelves of epithelia-covered mesenchyme that meet at midline and fuse. The midline epithelial seam (MES) is thought to degrade by apoptosis, epithelial-to-mesenchymal transition (EMT), or both. Failure to degrade the MES blocks fusion and causes cleft palate. It was previously thought that transforming growth factor ß3 (Tgfß3) is required to initiate fusion. Members of the Eph tyrosine kinase receptor family and their membrane-bound ephrin ligands are expressed on the MES. We demonstrated that treatment of mouse palates with recombinant EphB2/Fc to activate ephrin reverse signaling (where the ephrin acts as a receptor and transduces signals from its cytodomain) was sufficient to cause mouse palatal fusion when Tgfß3 signaling was blocked by an antibody against Tgfß3 or by an inhibitor of the TgfßrI serine/threonine receptor kinase. Cultured palatal epithelial cells traded their expression of epithelial cell markers for that of mesenchymal cells and became motile after treatment with EphB2/Fc. They concurrently increased their expression of the EMT-associated transcription factors Snail, Sip1, and Twist1. EphB2/Fc did not cause apoptosis in these cells. These data reveal that ephrin reverse signaling directs palatal fusion in mammals through a mechanism that involves EMT but not apoptosis and activates a gene expression program not previously associated with ephrin reverse signaling. © 2015 Wiley Periodicals, Inc.

Studies on the Expression of Sesquiterpene Synthases Using Promoter-β-Glucuronidase Fusions in Transgenic Artemisia annua L

PubMed Central

Wang, Hongzhen; Han, Junli; Kanagarajan, Selvaraju; Lundgren, Anneli; Brodelius, Peter E.

2013-01-01

In order to better understand the influence of sesquiterpene synthases on artemisinin yield in Artemisia annua, the expression of some sesquiterpene synthases has been studied using transgenic plants expressing promoter-GUS fusions. The cloned promoter sequences were 923, 1182 and 1510 bp for β-caryophyllene (CPS), epi-cedrol (ECS) and β-farnesene (FS) synthase, respectively. Prediction of cis-acting regulatory elements showed that the promoters are involved in complex regulation of expression. Transgenic A. annua plants carrying promoter-GUS fusions were studied to elucidate the expression pattern of the three sesquiterpene synthases and compared to the previously studied promoter of amorpha-4,11-diene synthase (ADS), a key enzyme of artemisinin biosynthesis. The CPS and ECS promoters were active in T-shaped trichomes of leaves and stems, basal bracts of flower buds and also in some florets cells but not in glandular secretory trichome while FS promoter activity was only observed in leaf cells and trichomes of transgenic shoots. ADS, CPS, ECS and FS transcripts were induced by wounding in a time depended manner. The four sesquiterpene synthases may be involved in responsiveness of A. annua to herbivory. Methyl jasmonate treatment triggered activation of the promoters of all four sesquiterpene synthases in a time depended manner. Southern blot result showed that the GUS gene was inserted into genomic DNA of transgenic lines as a single copy or two copies. The relative amounts of CPS and ECS as well as germacrene A synthase (GAS) transcripts are much lower than that of ADS transcript. Consequently, down-regulation of the expression of the CPS, ECS or GAS gene may not improve artemsinin yield. However, blocking the expression of FS may have effects on artemisinin production. PMID:24278301

Preparation of GST Fusion Proteins.

PubMed

Einarson, Margret B; Pugacheva, Elena N; Orlinick, Jason R

2007-04-01

INTRODUCTIONThis protocol describes the preparation of glutathione-S-transferase (GST) fusion proteins, which have had a wide range of applications since their introduction as tools for synthesis of recombinant proteins in bacteria. GST was originally selected as a fusion moiety because of several desirable properties. First and foremost, when expressed in bacteria alone, or as a fusion, GST is not sequestered in inclusion bodies (in contrast to previous fusion protein systems). Second, GST can be affinity-purified without denaturation because it binds to immobilized glutathione, which provides the basis for simple purification. Consequently, GST fusion proteins are routinely used for antibody generation and purification, protein-protein interaction studies, and biochemical analysis.

Neurospora crassa Female Development Requires the PACC and Other Signal Transduction Pathways, Transcription Factors, Chromatin Remodeling, Cell-To-Cell Fusion, and Autophagy

PubMed Central

Chinnici, Jennifer L.; Fu, Ci; Caccamise, Lauren M.; Arnold, Jason W.; Free, Stephen J.

2014-01-01

Using a screening protocol we have identified 68 genes that are required for female development in the filamentous fungus Neurospora crassa. We find that we can divide these genes into five general groups: 1) Genes encoding components of the PACC signal transduction pathway, 2) Other signal transduction pathway genes, including genes from the three N. crassa MAP kinase pathways, 3) Transcriptional factor genes, 4) Autophagy genes, and 5) Other miscellaneous genes. Complementation and RIP studies verified that these genes are needed for the formation of the female mating structure, the protoperithecium, and for the maturation of a fertilized protoperithecium into a perithecium. Perithecia grafting experiments demonstrate that the autophagy genes and the cell-to-cell fusion genes (the MAK-1 and MAK-2 pathway genes) are needed for the mobilization and movement of nutrients from an established vegetative hyphal network into the developing protoperithecium. Deletion mutants for the PACC pathway genes palA, palB, palC, palF, palH, and pacC were found to be defective in two aspects of female development. First, they were unable to initiate female development on synthetic crossing medium. However, they could form protoperithecia when grown on cellophane, on corn meal agar, or in response to the presence of nearby perithecia. Second, fertilized perithecia from PACC pathway mutants were unable to produce asci and complete female development. Protein localization experiments with a GFP-tagged PALA construct showed that PALA was localized in a peripheral punctate pattern, consistent with a signaling center associated with the ESCRT complex. The N. crassa PACC signal transduction pathway appears to be similar to the PacC/Rim101 pathway previously characterized in Aspergillus nidulans and Saccharomyces cerevisiae. In N. crassa the pathway plays a key role in regulating female development. PMID:25333968

Neurospora crassa female development requires the PACC and other signal transduction pathways, transcription factors, chromatin remodeling, cell-to-cell fusion, and autophagy.

PubMed

Chinnici, Jennifer L; Fu, Ci; Caccamise, Lauren M; Arnold, Jason W; Free, Stephen J

2014-01-01

Using a screening protocol we have identified 68 genes that are required for female development in the filamentous fungus Neurospora crassa. We find that we can divide these genes into five general groups: 1) Genes encoding components of the PACC signal transduction pathway, 2) Other signal transduction pathway genes, including genes from the three N. crassa MAP kinase pathways, 3) Transcriptional factor genes, 4) Autophagy genes, and 5) Other miscellaneous genes. Complementation and RIP studies verified that these genes are needed for the formation of the female mating structure, the protoperithecium, and for the maturation of a fertilized protoperithecium into a perithecium. Perithecia grafting experiments demonstrate that the autophagy genes and the cell-to-cell fusion genes (the MAK-1 and MAK-2 pathway genes) are needed for the mobilization and movement of nutrients from an established vegetative hyphal network into the developing protoperithecium. Deletion mutants for the PACC pathway genes palA, palB, palC, palF, palH, and pacC were found to be defective in two aspects of female development. First, they were unable to initiate female development on synthetic crossing medium. However, they could form protoperithecia when grown on cellophane, on corn meal agar, or in response to the presence of nearby perithecia. Second, fertilized perithecia from PACC pathway mutants were unable to produce asci and complete female development. Protein localization experiments with a GFP-tagged PALA construct showed that PALA was localized in a peripheral punctate pattern, consistent with a signaling center associated with the ESCRT complex. The N. crassa PACC signal transduction pathway appears to be similar to the PacC/Rim101 pathway previously characterized in Aspergillus nidulans and Saccharomyces cerevisiae. In N. crassa the pathway plays a key role in regulating female development.

Estimating the melting point, entropy of fusion, and enthalpy of fusion of organic compounds via SPARC.

PubMed

Whiteside, T S; Hilal, S H; Brenner, A; Carreira, L A

2016-08-01

The entropy of fusion, enthalpy of fusion, and melting point of organic compounds can be estimated through three models developed using the SPARC (SPARC Performs Automated Reasoning in Chemistry) platform. The entropy of fusion is modelled through a combination of interaction terms and physical descriptors. The enthalpy of fusion is modelled as a function of the entropy of fusion, boiling point, and flexibility of the molecule. The melting point model is the enthalpy of fusion divided by the entropy of fusion. These models were developed in part to improve SPARC's vapour pressure and solubility models. These models have been tested on 904 unique compounds. The entropy model has a RMS of 12.5 J mol(-1) K(-1). The enthalpy model has a RMS of 4.87 kJ mol(-1). The melting point model has a RMS of 54.4°C.

Progress in gene targeting and gene therapy for retinitis pigmentosa

DOE Office of Scientific and Technical Information (OSTI.GOV)

Farrar, G.J.; Humphries, M.M.; Erven, A.

1994-09-01

Previously, we localized disease genes involved in retinitis pigmentosa (RP), an inherited retinal degeneration, close to the rhodopsin and peripherin genes on 3q and 6p. Subsequently, we and others identified mutations in these genes in RP patients. Currently animal models for human retinopathies are being generated using gene targeting by homologous recombination in embryonic stem (ES) cells. Genomic clones for retinal genes including rhodopsin and peripherin have been obtained from a phage library carrying mouse DNA isogenic with the ES cell line (CC1.2). The peripherin clone has been sequenced to establish the genomic structure of the mouse gene. Targeting vectorsmore » for rhodopsin and peripherin including a neomycin cassette for positive selection and thymidine kinase genes enabling selection against random intergrants are under construction. Progress in vector construction will be presented. Simultaneously we are developing systems for delivery of gene therapies to retinal tissues utilizing replication-deficient adenovirus (Ad5). Efficacy of infection subsequent to various methods of intraocular injection and with varying viral titers is being assayed using an adenovirus construct containing a CMV promoter LacZ fusion as reporter and the range of tissues infected and the level of duration of LacZ expression monitored. Viral constructs with the LacZ reporter gene under the control of retinal specific promoters such as rhodopsin and IRBP cloned into pXCJL.1 are under construction. An update on developments in photoreceptor cell-directed expression of virally delivered genes will be presented.« less

Roles of mono-ubiquitinated Smad4 in the formation of Smad transcriptional complexes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Bei; Suzuki, Hiroyuki; Kato, Mitsuyasu

2008-11-14

TGF-{beta} activates receptor-regulated Smad (R-Smad) through phosphorylation by type I receptors. Activated R-Smad binds to Smad4 and the complex translocates into the nucleus and stimulates the transcription of target genes through association with co-activators including p300. It is not clear, however, how activated Smad complexes are removed from target genes. In this study, we show that TGF-{beta} enhances the mono-ubiquitination of Smad4. Smad4 mono-ubiquitination was promoted by p300 and suppressed by the c-Ski co-repressor. Smad4 mono-ubiquitination disrupted the interaction with Smad2 in the presence of constitutively active TGF-{beta} type I receptor. Furthermore, mono-ubiquitinated Smad4 was not found in DNA-binding Smadmore » complexes. A Smad4-Ubiquitin fusion protein, which mimics mono-ubiquitinated Smad4, enhanced localization to the cytoplasm. These results suggest that mono-ubiquitination of Smad4 occurs in the transcriptional activator complex and facilitates the turnover of Smad complexes at target genes.« less

The homogentisate pathway: a central catabolic pathway involved in the degradation of L-phenylalanine, L-tyrosine, and 3-hydroxyphenylacetate in Pseudomonas putida.

PubMed

Arias-Barrau, Elsa; Olivera, Elías R; Luengo, José M; Fernández, Cristina; Galán, Beatriz; García, José L; Díaz, Eduardo; Miñambres, Baltasar

2004-08-01

Pseudomonas putida metabolizes Phe and Tyr through a peripheral pathway involving hydroxylation of Phe to Tyr (PhhAB), conversion of Tyr into 4-hydroxyphenylpyruvate (TyrB), and formation of homogentisate (Hpd) as the central intermediate. Homogentisate is then catabolized by a central catabolic pathway that involves three enzymes, homogentisate dioxygenase (HmgA), fumarylacetoacetate hydrolase (HmgB), and maleylacetoacetate isomerase (HmgC), finally yielding fumarate and acetoacetate. Whereas the phh, tyr, and hpd genes are not linked in the P. putida genome, the hmgABC genes appear to form a single transcriptional unit. Gel retardation assays and lacZ translational fusion experiments have shown that hmgR encodes a specific repressor that controls the inducible expression of the divergently transcribed hmgABC catabolic genes, and homogentisate is the inducer molecule. Footprinting analysis revealed that HmgR protects a region in the Phmg promoter that spans a 17-bp palindromic motif and an external direct repetition from position -16 to position 29 with respect to the transcription start site. The HmgR protein is thus the first IclR-type regulator that acts as a repressor of an aromatic catabolic pathway. We engineered a broad-host-range mobilizable catabolic cassette harboring the hmgABC, hpd, and tyrB genes that allows heterologous bacteria to use Tyr as a unique carbon and energy source. Remarkably, we show here that the catabolism of 3-hydroxyphenylacetate in P. putida U funnels also into the homogentisate central pathway, revealing that the hmg cluster is a key catabolic trait for biodegradation of a small number of aromatic compounds.

Kinetic advantage of controlled intermediate nuclear fusion

NASA Astrophysics Data System (ADS)

Guo, Xiaoming

2012-09-01

The dominated process of controlled fusion is to let nuclei gain enough kinetic energy to overcome Coulomb barrier. As a result, a fusion scheme can consider two factors in its design: to increase kinetic energy of nuclei and to alter the Coulomb barrier. Cold Fusion and Hot fusion are all one-factor schemes while Intermediate Fusion is a twofactors scheme. This made CINF kinetically superior. Cold Fusion reduces deuteron-deuteron distance, addressing Coulomb barrier, and Hot Fusion heat up plasma into extreme high temperature, addressing kinetic energy. Without enough kinetic energy made Cold Fusion skeptical. Extreme high temperature made Hot Fusion very difficult to engineer. Because CIFN addresses both factors, CIFN is a more promising technique to be industrialized.

Transcription control by the ENL YEATS domain in acute leukaemia.

PubMed

Erb, Michael A; Scott, Thomas G; Li, Bin E; Xie, Huafeng; Paulk, Joshiawa; Seo, Hyuk-Soo; Souza, Amanda; Roberts, Justin M; Dastjerdi, Shiva; Buckley, Dennis L; Sanjana, Neville E; Shalem, Ophir; Nabet, Behnam; Zeid, Rhamy; Offei-Addo, Nana K; Dhe-Paganon, Sirano; Zhang, Feng; Orkin, Stuart H; Winter, Georg E; Bradner, James E

2017-03-09

Recurrent chromosomal translocations producing a chimaeric MLL oncogene give rise to a highly aggressive acute leukaemia associated with poor clinical outcome. The preferential involvement of chromatin-associated factors as MLL fusion partners belies a dependency on transcription control. Despite recent progress made in targeting chromatin regulators in cancer, available therapies for this well-characterized disease remain inadequate, prompting the need to identify new targets for therapeutic intervention. Here, using unbiased CRISPR-Cas9 technology to perform a genome-scale loss-of-function screen in an MLL-AF4-positive acute leukaemia cell line, we identify ENL as an unrecognized gene that is specifically required for proliferation in vitro and in vivo. To explain the mechanistic role of ENL in leukaemia pathogenesis and dynamic transcription control, a chemical genetic strategy was developed to achieve targeted protein degradation. Acute loss of ENL suppressed the initiation and elongation of RNA polymerase II at active genes genome-wide, with pronounced effects at genes featuring a disproportionate ENL load. Notably, an intact YEATS chromatin-reader domain was essential for ENL-dependent leukaemic growth. Overall, these findings identify a dependency factor in acute leukaemia and suggest a mechanistic rationale for disrupting the YEATS domain in disease.

Robotics and local fusion

NASA Astrophysics Data System (ADS)

Emmerman, Philip J.

2005-05-01

Teams of robots or mixed teams of warfighters and robots on reconnaissance and other missions can benefit greatly from a local fusion station. A local fusion station is defined here as a small mobile processor with interfaces to enable the ingestion of multiple heterogeneous sensor data and information streams, including blue force tracking data. These data streams are fused and integrated with contextual information (terrain features, weather, maps, dynamic background features, etc.), and displayed or processed to provide real time situational awareness to the robot controller or to the robots themselves. These blue and red force fusion applications remove redundancies, lessen ambiguities, correlate, aggregate, and integrate sensor information with context such as high resolution terrain. Applications such as safety, team behavior, asset control, training, pattern analysis, etc. can be generated or enhanced by these fusion stations. This local fusion station should also enable the interaction between these local units and a global information world.

Fusion gamma diagnostics

NASA Astrophysics Data System (ADS)

Medley, S. S.; Cecil, F. E.; Cole, D.; Conway, M. A.; Wilkinson, F. J., III

1985-05-01

Nuclear reactions of interest in fusion research often possess a branch yielding prompt emission of gamma radiation in excess of 15 MeV which can be exploited to provide a new fusion reaction diagnostic having applications similar to conventional neutron emission measurements. Conceptual aspects of fusion gamma diagnostics are discussed with emphasis on application to the Tokamak Fusion Test Reactor (TFTR) during deuterium neutral beam heating of D-T and D-3He plasmas. Recent measurements of the D (T, γ)5He, D(3He, γ)5Li, and D(D, γ)4He branching ratios at low center-of-mass energy (30-100 keV) and of the response of a large volume Ne226 detector for gamma detection in high neutron backgrounds are presented. Using a well-shielded Ne226 detector during 20 MW-120 kV deuterium beam heating of a tritium plasma in TFTR, the D(T, γ)5He gamma signal level is estimated to be 3.5×105 cps.

Acquisition of genomic events leading to lymphoblastic transformation in a rare case of myeloproliferative neoplasm with BCR-JAK2 fusion transcript.

PubMed

Duployez, Nicolas; Nibourel, Olivier; Ducourneau, Benoît; Grardel, Nathalie; Boyer, Thomas; Bories, Claire; Darre, Stéphane; Coiteux, Valérie; Berthon, Céline; Preudhomme, Claude; Roche-Lestienne, Catherine

2016-10-01

We report a case of myeloproliferative neoplasm (MPN) with an atypical t(9;22;15)(p24;q11;q21) translocation, leading to a BCR-JAK2 fusion, associated with a trisomy of chromosome 8 in clonal evolution at karyotype. Patient's evolution was marked by an aggressive clinical course with rapid progression to blast phase within the first year after diagnosis. Examination of matched chronic phase and blast crisis samples by SNP-array karyotyping identified secondary acquired cryptic genetic events at the time of lymphoblastic transformation, including biallelic IKZF1 alteration and EBF1 and CDKN2A/B codeletions. This case is the first report describing acquisition of secondary genetic events leading to acute lymphoblastic progression in a rare MPN with BCR-JAK2 fusion. © 2016 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

The cytoplasmic domain of the gamete membrane fusion protein HAP2 targets the protein to the fusion site in Chlamydomonas and regulates the fusion reaction.

PubMed

Liu, Yanjie; Pei, Jimin; Grishin, Nick; Snell, William J

2015-03-01

Cell-cell fusion between gametes is a defining step during development of eukaryotes, yet we know little about the cellular and molecular mechanisms of the gamete membrane fusion reaction. HAP2 is the sole gamete-specific protein in any system that is broadly conserved and shown by gene disruption to be essential for gamete fusion. The wide evolutionary distribution of HAP2 (also known as GCS1) indicates it was present in the last eukaryotic common ancestor and, therefore, dissecting its molecular properties should provide new insights into fundamental features of fertilization. HAP2 acts at a step after membrane adhesion, presumably directly in the merger of the lipid bilayers. Here, we use the unicellular alga Chlamydomonas to characterize contributions of key regions of HAP2 to protein location and function. We report that mutation of three strongly conserved residues in the ectodomain has no effect on targeting or fusion, although short deletions that include those residues block surface expression and fusion. Furthermore, HAP2 lacking a 237-residue segment of the cytoplasmic region is expressed at the cell surface, but fails to localize at the apical membrane patch specialized for fusion and fails to rescue fusion. Finally, we provide evidence that the ancient HAP2 contained a juxta-membrane, multi-cysteine motif in its cytoplasmic region, and that mutation of a cysteine dyad in this motif preserves protein localization, but substantially impairs HAP2 fusion activity. Thus, the ectodomain of HAP2 is essential for its surface expression, and the cytoplasmic region targets HAP2 to the site of fusion and regulates the fusion reaction. © 2015. Published by The Company of Biologists Ltd.

Microprocessor mediates transcriptional termination of long noncoding RNA transcripts hosting microRNAs.

PubMed

Dhir, Ashish; Dhir, Somdutta; Proudfoot, Nick J; Jopling, Catherine L

2015-04-01

MicroRNAs (miRNAs) play a major part in the post-transcriptional regulation of gene expression. Mammalian miRNA biogenesis begins with cotranscriptional cleavage of RNA polymerase II (Pol II) transcripts by the Microprocessor complex. Although most miRNAs are located within introns of protein-coding transcripts, a substantial minority of miRNAs originate from long noncoding (lnc) RNAs, for which transcript processing is largely uncharacterized. We show, by detailed characterization of liver-specific lnc-pri-miR-122 and genome-wide analysis in human cell lines, that most lncRNA transcripts containing miRNAs (lnc-pri-miRNAs) do not use the canonical cleavage-and-polyadenylation pathway but instead use Microprocessor cleavage to terminate transcription. Microprocessor inactivation leads to extensive transcriptional readthrough of lnc-pri-miRNA and transcriptional interference with downstream genes. Consequently we define a new RNase III-mediated, polyadenylation-independent mechanism of Pol II transcription termination in mammalian cells.

Differential transactivation by orphan nuclear receptor NOR1 and its fusion gene product EWS/NOR1: possible involvement of poly(ADP-ribose) polymerase I, PARP-1.

PubMed

Ohkura, Naganari; Nagamura, Yuko; Tsukada, Toshihiko

2008-10-15

In extraskeletal myxoid chondrosarcoma, a chromosomal translocation creates a gene fusion between EWS and an orphan nuclear receptor, NOR1. The resulting fusion protein EWS/NOR1 has been believed to lead to malignant transformation by functioning as a transactivator for NOR1-target genes. By comparing the gene expression profiles of NOR1- and EWS/NOR1-overexpressing cells, we found that they largely shared up-regulated genes, but no significant correlation was observed with respect to the transactivation levels of each gene. In addition, the proteins associated with NOR1 and EWS/NOR1 were mostly the same in these cells. The results suggest that these proteins differentially transactivate overlapping target genes through a similar transcriptional machinery. To clarify the mechanisms underlying the transcriptional divergence between NOR1 and EWS/NOR1, we searched for alternatively associated proteins, and identified poly(ADP-ribose) polymerase I (PARP-1) as an NOR1-specific binding protein. Consistent with its binding properties, PARP-1 acted as a transcriptional repressor of NOR1, but not EWS/NOR1, in a luciferase reporter assay employing PARP-1(-/-) fibroblasts. Interestingly, suppressive activity of PARP-1 was observed in a DNA response element-specific manner, and in a subtype-specific manner toward the NR4A family (Nur77, Nurr1, and NOR1), suggesting that PARP-1 plays a role in the diversity of transcriptional regulation mediated by the NR4A family in normal cells. Altogether, our findings suggest that NOR1 and EWS/NOR1 regulate overlapping target genes differently by utilizing associated proteins, including PARP-1; and that EWS/NOR1 may acquire oncogenic activities by avoiding (or gaining) transcription factor-specific modulation by the associated proteins. (c) 2008 Wiley-Liss, Inc.

Inertial-confinement fusion with lasers

NASA Astrophysics Data System (ADS)

Betti, R.; Hurricane, O. A.

2016-05-01

The quest for controlled fusion energy has been ongoing for over a half century. The demonstration of ignition and energy gain from thermonuclear fuels in the laboratory has been a major goal of fusion research for decades. Thermonuclear ignition is widely considered a milestone in the development of fusion energy, as well as a major scientific achievement with important applications in national security and basic sciences. The US is arguably the world leader in the inertial confinement approach to fusion and has invested in large facilities to pursue it, with the objective of establishing the science related to the safety and reliability of the stockpile of nuclear weapons. Although significant progress has been made in recent years, major challenges still remain in the quest for thermonuclear ignition via laser fusion. Here, we review the current state of the art in inertial confinement fusion research and describe the underlying physical principles.

Pedicle screw fixation for isthmic spondylolisthesis: does posterior lumbar interbody fusion improve outcome over posterolateral fusion?

PubMed

La Rosa, Giovanni; Conti, Alfredo; Cacciola, Fabio; Cardali, Salvatore; La Torre, Domenico; Gambadauro, Nicola Maria; Tomasello, Francesco

2003-09-01

Posterolateral fusion involving instrumentation-assisted segmental fixation represents a valid procedure in the treatment of lumbar instability. In cases of anterior column failure, such as in isthmic spondylolisthesis, supplemental posterior lumbar interbody fusion (PLIF) may improve the fusion rate and endurance of the construct. Posterior lumbar interbody fusion is, however, a more demanding procedure and increases costs and risks of the intervention. The advantages of this technique must, therefore, be weighed against those of a simple posterior lumbar fusion. Thirty-five consecutive patients underwent pedicle screw fixation for isthmic spondylolisthesis. In 18 patients posterior lumbar fusion was performed, and in 17 patients PLIF was added. Clinical, economic, functional, and radiographic data were assessed to determine differences in clinical and functional results and biomechanical properties. At 2-year follow-up examination, the correction of subluxation, disc height, and foraminal area were maintained in the group in which a PLIF procedure was performed, but not in the posterolateral fusion-only group (p < 0.05). Nevertheless, no statistical intergroup differences were demonstrated in terms of neurological improvement (p = 1), economic (p = 0.43), or functional (p = 0.95) outcome, nor in terms of fusion rate (p = 0.49). The authors' findings support the view that an interbody fusion confers superior mechanical strength to the spinal construct; when posterolateral fusion is the sole intervention, progressive loss of the extreme correction can be expected. Such mechanical insufficiency, however, did not influence clinical outcome.

Disc replacement adjacent to cervical fusion: a biomechanical comparison of hybrid construct versus two-level fusion.

PubMed

Lee, Michael J; Dumonski, Mark; Phillips, Frank M; Voronov, Leonard I; Renner, Susan M; Carandang, Gerard; Havey, Robert M; Patwardhan, Avinash G

2011-11-01

A cadaveric biomechanical study. To investigate the biomechanical behavior of the cervical spine after cervical total disc replacement (TDR) adjacent to a fusion as compared to a two-level fusion. There are concerns regarding the biomechanical effects of cervical fusion on the mobile motion segments. Although previous biomechanical studies have demonstrated that cervical disc replacement normalizes adjacent segment motion, there is a little information regarding the function of a cervical disc replacement adjacent to an anterior cervical decompression and fusion, a potentially common clinical application. Nine cadaveric cervical spines (C3-T1, age: 60.2 ± 3.5 years) were tested under load- and displacement-control testing. After intact testing, a simulated fusion was performed at C4-C5, followed by C6-C7. The simulated fusion was then reversed, and the response of TDR at C5-C6 was measured. A hybrid construct was then tested with the TDR either below or above a single-level fusion and contrasted with a simulated two-level fusion (C4-C6 and C5-C7). The external fixator device used to simulate fusion significantly reduced range of motion (ROM) at C4-C5 and C6-C7 by 74.7 ± 8.1% and 78.1 ± 11.5%, respectively (P < 0.05). Removal of the fusion construct restored the motion response of the spinal segments to their intact state. Arthroplasty performed at C5-C6 using the porous-coated motion disc prosthesis maintained the total flexion-extension ROM to the level of the intact controls when used as a stand-alone procedure or when implanted adjacent to a single-level fusion (P > 0.05). The location of the single-level fusion, whether above or below the arthroplasty, did not significantly affect the motion response of the arthroplasty in the hybrid construct. Performing a two-level fusion significantly increased the motion demands on the nonoperated segments as compared to a hybrid TDR-plus fusion construct when the spine was required to reach the same motion end points

WRKY transcription factors.

PubMed

Rushton, Paul J; Somssich, Imre E; Ringler, Patricia; Shen, Qingxi J

2010-05-01

WRKY transcription factors are one of the largest families of transcriptional regulators in plants and form integral parts of signalling webs that modulate many plant processes. Here, we review recent significant progress in WRKY transcription factor research. New findings illustrate that WRKY proteins often act as repressors as well as activators, and that members of the family play roles in both the repression and de-repression of important plant processes. Furthermore, it is becoming clear that a single WRKY transcription factor might be involved in regulating several seemingly disparate processes. Mechanisms of signalling and transcriptional regulation are being dissected, uncovering WRKY protein functions via interactions with a diverse array of protein partners, including MAP kinases, MAP kinase kinases, 14-3-3 proteins, calmodulin, histone deacetylases, resistance proteins and other WRKY transcription factors. WRKY genes exhibit extensive autoregulation and cross-regulation that facilitates transcriptional reprogramming in a dynamic web with built-in redundancy. 2010 Elsevier Ltd. All rights reserved.

Controlled Nuclear Fusion.

ERIC Educational Resources Information Center

Glasstone, Samuel

This publication is one of a series of information booklets for the general public published by The United States Atomic Energy Commission. Among the topics discussed are: Importance of Fusion Energy; Conditions for Nuclear Fusion; Thermonuclear Reactions in Plasmas; Plasma Confinement by Magnetic Fields; Experiments With Plasmas; High-Temperature…

CEP72-ROS1: A novel ROS1 oncogenic fusion variant in lung adenocarcinoma identified by next-generation sequencing.

PubMed

Zhu, You-Cai; Zhou, Yue-Fen; Wang, Wen-Xian; Xu, Chun-Wei; Zhuang, Wu; Du, Kai-Qi; Chen, Gang

2018-05-01

ROS1 rearrangement is a validated therapeutic driver gene in non-small cell lung cancer (NSCLC) and represents a small subset (1-2%) of NSCLC. A total of 17 different fusion partner genes of ROS1 in NSCLC have been reported. The multi-targeted MET/ALK/ROS1 tyrosine kinase inhibitor (TKI) crizotinib has demonstrated remarkable efficacy in ROS1-rearranged NSCLC. Consequently, ROS1 detection assays include fluorescence in situ hybridization, immunohistochemistry, and real-time PCR. Next-generation sequencing (NGS) assay covers a range of fusion genes and approaches to discover novel receptor-kinase rearrangements in lung cancer. A 63-year-old male smoker with stage IV NSCLC (TxNxM1) was detected with a novel ROS1 fusion. Histological examination of the tumor showed lung adenocarcinoma. NGS analysis of the hydrothorax cellblocks revealed a novel CEP72-ROS1 rearrangement. This novel CEP72-ROS1 fusion variant is generated by the fusion of exons 1-11 of CEP72 on chromosome 5p15 to exons 23-43 of ROS1 on chromosome 6q22. The predicted CEP72-ROS1 protein product contains 1202 amino acids comprising the N-terminal amino acids 594-647 of CEP72 and C-terminal amino acid 1-1148 of ROS1. CEP72-ROS1 is a novel ROS1 fusion variant in NSCLC discovered by NGS and could be included in ROS1 detection assay, such as reverse transcription PCR. Pleural effusion samples show good diagnostic performance in clinical practice. © 2018 The Authors. Thoracic Cancer published by China Lung Oncology Group and John Wiley & Sons Australia, Ltd.

Fusion Simulation Project Workshop Report

NASA Astrophysics Data System (ADS)

Kritz, Arnold; Keyes, David

2009-03-01

The mission of the Fusion Simulation Project is to develop a predictive capability for the integrated modeling of magnetically confined plasmas. This FSP report adds to the previous activities that defined an approach to integrated modeling in magnetic fusion. These previous activities included a Fusion Energy Sciences Advisory Committee panel that was charged to study integrated simulation in 2002. The report of that panel [Journal of Fusion Energy 20, 135 (2001)] recommended the prompt initiation of a Fusion Simulation Project. In 2003, the Office of Fusion Energy Sciences formed a steering committee that developed a project vision, roadmap, and governance concepts [Journal of Fusion Energy 23, 1 (2004)]. The current FSP planning effort involved 46 physicists, applied mathematicians and computer scientists, from 21 institutions, formed into four panels and a coordinating committee. These panels were constituted to consider: Status of Physics Components, Required Computational and Applied Mathematics Tools, Integration and Management of Code Components, and Project Structure and Management. The ideas, reported here, are the products of these panels, working together over several months and culminating in a 3-day workshop in May 2007.

Alternative approaches to fusion. [reactor design and reactor physics for Tokamak fusion reactors

NASA Technical Reports Server (NTRS)

Roth, R. J.

1976-01-01

The limitations of the Tokamak fusion reactor concept are discussed and various other fusion reactor concepts are considered that employ the containment of thermonuclear plasmas by magnetic fields (i.e., stellarators). Progress made in the containment of plasmas in toroidal devices is reported. Reactor design concepts are illustrated. The possibility of using fusion reactors as a power source in interplanetary space travel and electric power plants is briefly examined.

The importance of proximal fusion level selection for outcomes of multi-level lumbar posterolateral fusion.

PubMed

Nam, Woo Dong; Cho, Jae Hwan

2015-03-01

There are few studies about risk factors for poor outcomes from multi-level lumbar posterolateral fusion limited to three or four level lumbar posterolateral fusions. The purpose of this study was to analyze the outcomes of multi-level lumbar posterolateral fusion and to search for possible risk factors for poor surgical outcomes. We retrospectively analyzed 37 consecutive patients who underwent multi-level lumbar or lumbosacral posterolateral fusion with posterior instrumentation. The outcomes were deemed either 'good' or 'bad' based on clinical and radiological results. Many demographic and radiological factors were analyzed to examine potential risk factors for poor outcomes. Student t-test, Fisher exact test, and the chi-square test were used based on the nature of the variables. Multiple logistic regression analysis was used to exclude confounding factors. Twenty cases showed a good outcome (group A, 54.1%) and 17 cases showed a bad outcome (group B, 45.9%). The overall fusion rate was 70.3%. The revision procedures (group A: 1/20, 5.0%; group B: 4/17, 23.5%), proximal fusion to L2 (group A: 5/20, 25.0%; group B: 10/17, 58.8%), and severity of stenosis (group A: 12/19, 63.3%; group B: 3/11, 27.3%) were adopted as possible related factors to the outcome in univariate analysis. Multiple logistic regression analysis revealed that only the proximal fusion level (superior instrumented vertebra, SIV) was a significant risk factor. The cases in which SIV was L2 showed inferior outcomes than those in which SIV was L3. The odds ratio was 6.562 (95% confidence interval, 1.259 to 34.203). The overall outcome of multi-level lumbar or lumbosacral posterolateral fusion was not as high as we had hoped it would be. Whether the SIV was L2 or L3 was the only significant risk factor identified for poor outcomes in multi-level lumbar or lumbosacral posterolateral fusion in the current study. Thus, the authors recommend that proximal fusion levels be carefully determined when

Cross-Talk Between Mitochondrial Fusion and the Hippo Pathway in Controlling Cell Proliferation During Drosophila Development.

PubMed

Deng, Qiannan; Guo, Ting; Zhou, Xiu; Xi, Yongmei; Yang, Xiaohang; Ge, Wanzhong

2016-08-01

Cell proliferation and tissue growth depend on the coordinated regulation of multiple signaling molecules and pathways during animal development. Previous studies have linked mitochondrial function and the Hippo signaling pathway in growth control. However, the underlying molecular mechanisms are not fully understood. Here we identify a Drosophila mitochondrial inner membrane protein ChChd3 as a novel regulator for tissue growth. Loss of ChChd3 leads to tissue undergrowth and cell proliferation defects. ChChd3 is required for mitochondrial fusion and removal of ChChd3 increases mitochondrial fragmentation. ChChd3 is another mitochondrial target of the Hippo pathway, although it is only partially required for Hippo pathway-mediated overgrowth. Interestingly, lack of ChChd3 leads to inactivation of Hippo activity under normal development, which is also dependent on the transcriptional coactivator Yorkie (Yki). Furthermore, loss of ChChd3 induces oxidative stress and activates the JNK pathway. In addition, depletion of other mitochondrial fusion components, Opa1 or Marf, inactivates the Hippo pathway as well. Taken together, we propose that there is a cross-talk between mitochondrial fusion and the Hippo pathway, which is essential in controlling cell proliferation and tissue homeostasis in Drosophila. Copyright © 2016 by the Genetics Society of America.

Degenerative lumbar scoliosis in elderly patients: dynamic stabilization without fusion versus posterior instrumented fusion.

PubMed

Di Silvestre, Mario; Lolli, Francesco; Bakaloudis, Georgios

2014-01-01

Posterolateral fusion with pedicle screw instrumentation is currently the most widely accepted technique for degenerative lumbar scoliosis in elderly patients. However, a high incidence of complications has been reported in most series. Dynamic stabilization without fusion in patients older than 60 years has not previously been compared with the use of posterior fusion in degenerative lumbar scoliosis. To compare dynamic stabilization without fusion and posterior instrumented fusion in the treatment of degenerative lumbar scoliosis in elderly patients, in terms of perioperative findings, clinical outcomes, and adverse events. A retrospective study. Fifty-seven elderly patients were included. There were 45 women (78%) and 12 men (22%) with a mean age of 68.1 years (range, 61-78 years). All patients had degenerative de novo lumbar scoliosis, associated with vertebral canal stenosis in 51 cases (89.4%) and degenerative spondylolisthesis in 24 patients (42.1%). Clinical (Oswestry Disability Index, visual analog scale, Roland-Morris Disability Questionnaire) and radiological (scoliosis and lordosis corrections) outcomes as well as incidence of complications. Patients were divided into two groups: 32 patients (dynamic group) had dynamic stabilization without fusion and 25 patients (fusion group) underwent posterior instrumented fusion. All the patients' medical records and X-rays were reviewed. Preoperative, postoperative, and follow-up questionnaires were obtained to evaluate clinical outcomes. At an average follow-up of 64 months (range, 42-90 months), clinical results improved similarly in both groups of patients. Statistically superior scoliosis and final lordosis corrections were achieved with posterior fusion (56.9% vs. 37.3% and -46.8° vs. -35.8°, respectively). However, in the dynamic group, incidence of overall complications was lower (25% vs. 44%), and fewer patients required revision surgery (6.2% vs. 16%). Furthermore, lower average values of operative

Versatile fusion source integrator AFSI for fast ion and neutron studies in fusion devices

NASA Astrophysics Data System (ADS)

Sirén, Paula; Varje, Jari; Äkäslompolo, Simppa; Asunta, Otto; Giroud, Carine; Kurki-Suonio, Taina; Weisen, Henri; JET Contributors, The

2018-01-01

ASCOT Fusion Source Integrator AFSI, an efficient tool for calculating fusion reaction rates and characterizing the fusion products, based on arbitrary reactant distributions, has been developed and is reported in this paper. Calculation of reactor-relevant D-D, D-T and D-3He fusion reactions has been implemented based on the Bosch-Hale fusion cross sections. The reactions can be calculated between arbitrary particle populations, including Maxwellian thermal particles and minority energetic particles. Reaction rate profiles, energy spectra and full 4D phase space distributions can be calculated for the non-isotropic reaction products. The code is especially suitable for integrated modelling in self-consistent plasma physics simulations as well as in the Serpent neutronics calculation chain. Validation of the model has been performed for neutron measurements at the JET tokamak and the code has been applied to predictive simulations in ITER.

Plant-Derived Transcription Factors for Orthologous Regulation of Gene Expression in the Yeast Saccharomyces cerevisiae.

PubMed

Naseri, Gita; Balazadeh, Salma; Machens, Fabian; Kamranfar, Iman; Messerschmidt, Katrin; Mueller-Roeber, Bernd

2017-09-15

Control of gene expression by transcription factors (TFs) is central in many synthetic biology projects for which a tailored expression of one or multiple genes is often needed. As TFs from evolutionary distant organisms are unlikely to affect gene expression in a host of choice, they represent excellent candidates for establishing orthogonal control systems. To establish orthogonal regulators for use in yeast (Saccharomyces cerevisiae), we chose TFs from the plant Arabidopsis thaliana. We established a library of 106 different combinations of chromosomally integrated TFs, activation domains (yeast GAL4 AD, herpes simplex virus VP64, and plant EDLL) and synthetic promoters harboring cognate cis-regulatory motifs driving a yEGFP reporter. Transcriptional output of the different driver/reporter combinations varied over a wide spectrum, with EDLL being a considerably stronger transcription activation domain in yeast than the GAL4 activation domain, in particular when fused to Arabidopsis NAC TFs. Notably, the strength of several NAC-EDLL fusions exceeded that of the strong yeast TDH3 promoter by 6- to 10-fold. We furthermore show that plant TFs can be used to build regulatory systems encoded by centromeric or episomal plasmids. Our library of TF-DNA binding site combinations offers an excellent tool for diverse synthetic biology applications in yeast.

Transcriptional network control of normal and leukaemic haematopoiesis

PubMed Central

Sive, Jonathan I.; Göttgens, Berthold

2014-01-01

Transcription factors (TFs) play a key role in determining the gene expression profiles of stem/progenitor cells, and defining their potential to differentiate into mature cell lineages. TF interactions within gene-regulatory networks are vital to these processes, and dysregulation of these networks by TF overexpression, deletion or abnormal gene fusions have been shown to cause malignancy. While investigation of these processes remains a challenge, advances in genome-wide technologies and growing interactions between laboratory and computational science are starting to produce increasingly accurate network models. The haematopoietic system provides an attractive experimental system to elucidate gene regulatory mechanisms, and allows experimental investigation of both normal and dysregulated networks. In this review we examine the principles of TF-controlled gene regulatory networks and the key experimental techniques used to investigate them. We look in detail at examples of how these approaches can be used to dissect out the regulatory mechanisms controlling normal haematopoiesis, as well as the dysregulated networks associated with haematological malignancies. PMID:25014893

Complementation between avirulent Newcastle disease virus and a fusion protein gene expressed from a retrovirus vector: requirements for membrane fusion.

PubMed Central

Morrison, T; McQuain, C; McGinnes, L

1991-01-01

The cDNA derived from the fusion gene of the virulent AV strain of Newcastle disease virus (NDV) was expressed in chicken embryo cells by using a retrovirus vector. The fusion protein expressed in this system was transported to the cell surface and was efficiently cleaved into the disulfide-linked F1-F2 form found in infectious virions. The cells expressing the fusion gene grew normally and could be passaged many times. Monolayers of these cells would plaque, in the absence of trypsin, avirulent NDV strains (strains which encode a fusion protein which is not cleaved in tissue culture). Fusion protein-expressing cells would not fuse if mixed with uninfected cells or uninfected cells expressing the hemagglutinin-neuraminidase (HN) protein. However, the fusion protein-expressing cells, if infected with avirulent strains of NDV, would fuse with uninfected cells, suggesting that fusion requires both the fusion protein and another viral protein expressed in the same cell. Fusion was also seen after transfection of the HN protein gene into fusion protein-expressing cells. Thus, the expressed fusion protein gene is capable of complementing the virus infection, providing an active cleaved fusion protein required for the spread of infection. However, the fusion protein does not mediate cell fusion unless the cell also expresses the HN protein. Fusion protein-expressing cells would not plaque influenza virus in the absence of trypsin, nor would influenza virus-infected fusion protein-expressing cells fuse with uninfected cells. Thus, the influenza virus HA protein will not substitute for the NDV HN protein in cell-to-cell fusion. Images PMID:1987376

Structural Transition and Antibody Binding of EBOV GP and ZIKV E Proteins from Pre-Fusion to Fusion-Initiation State.

PubMed

Lappala, Anna; Nishima, Wataru; Miner, Jacob; Fenimore, Paul; Fischer, Will; Hraber, Peter; Zhang, Ming; McMahon, Benjamin; Tung, Chang-Shung

2018-05-10

Membrane fusion proteins are responsible for viral entry into host cells—a crucial first step in viral infection. These proteins undergo large conformational changes from pre-fusion to fusion-initiation structures, and, despite differences in viral genomes and disease etiology, many fusion proteins are arranged as trimers. Structural information for both pre-fusion and fusion-initiation states is critical for understanding virus neutralization by the host immune system. In the case of Ebola virus glycoprotein (EBOV GP) and Zika virus envelope protein (ZIKV E), pre-fusion state structures have been identified experimentally, but only partial structures of fusion-initiation states have been described. While the fusion-initiation structure is in an energetically unfavorable state that is difficult to solve experimentally, the existing structural information combined with computational approaches enabled the modeling of fusion-initiation state structures of both proteins. These structural models provide an improved understanding of four different neutralizing antibodies in the prevention of viral host entry.

STATs and macrophage fusion.

PubMed

Miyamoto, Takeshi

2013-07-01

Macrophages play a pivotal role in host defense against multiple foreign materials such as bacteria, parasites and artificial devices. Some macrophage lineage cells, namely osteoclasts and foreign body giant cells (FBGCs), form multi-nuclear giant cells by the cell-cell fusion of mono-nuclear cells. Osteoclasts are bone-resorbing cells, and are formed in the presence of RANKL on the surface of bones, while FBGCs are formed in the presence of IL-4 or IL-13 on foreign materials such as artificial joints, catheters and parasites. Recently, fusiogenic mechanisms and the molecules required for the cell-cell fusion of these macrophage lineage cells were, at least in part, clarified. Dendritic cell specific transmembrane protein (DC-STAMP) and osteoclast stimulatory transmembrane protein (OC-STAMP), both of which comprise seven transmembrane domains, are required for both osteoclast and FBGC cell-cell fusion. STAT6 was demonstrated to be required for the cell-cell fusion of FBGCs but not osteoclasts. In this review, advances in macrophage cell-cell fusion are discussed.

Membrane fusion triggers rapid degradation of two gamete-specific, fusion-essential proteins in a membrane block to polygamy in Chlamydomonas.

PubMed

Liu, Yanjie; Misamore, Michael J; Snell, William J

2010-05-01

The plasma membranes of gametes are specialized for fusion, yet, once fusion occurs, in many organisms the new zygote becomes incapable of further membrane fusion reactions. The molecular mechanisms that underlie this loss of fusion capacity (block to polygamy) remain unknown. During fertilization in the green alga Chlamydomonas, the plus gamete-specific membrane protein FUS1 is required for adhesion between the apically localized sites on the plasma membranes of plus and minus gametes that are specialized for fusion, and the minus-specific membrane protein HAP2 is essential for completion of the membrane fusion reaction. HAP2 (GCS1) family members are also required for fertilization in Arabidopsis, and for the membrane fusion reaction in the malaria organism Plasmodium berghei. Here, we tested whether Chlamydomonas gamete fusion triggers alterations in FUS1 and HAP2 and renders the plasma membranes of the cells incapable of subsequent fusion. We find that, even though the fusogenic sites support multi-cell adhesions, triploid zygotes are rare, indicating a fusion-triggered block to the membrane fusion reaction. Consistent with the extinction of fusogenic capacity, both FUS1 and HAP2 are degraded upon fusion. The rapid, fusion-triggered cleavage of HAP2 in zygotes is distinct from degradation occurring during constitutive turnover in gametes. Thus, gamete fusion triggers specific degradation of fusion-essential proteins and renders the zygote incapable of fusion. Our results provide the first molecular explanation for a membrane block to polygamy in any organism.

Magnetized Target Fusion: Prospects for Low-Cost Fusion Energy

NASA Technical Reports Server (NTRS)

Siemon, Richard E.; Turchi, Peter J.; Barnes, Daniel C.; Degnan, James; Parks, Paul; Ryutov, Dmitri D.; Thio, Y. C. Francis; Schafer, Charles (Technical Monitor)

2001-01-01

Magnetized Target Fusion (MTF) has attracted renewed interest in recent years because it has the potential to resolve one of the major problems with conventional fusion energy research - the high cost of facilities to do experiments and in general develop practical fusion energy. The requirement for costly facilities can be traced to fundamental constraints. The Lawson condition implies large system size in the case of conventional magnetic confinement, or large heating power in the case of conventional inertial confinement. The MTF approach is to use much higher fuel density than with conventional magnetic confinement (corresponding to megabar pressures), which results in a much-reduced system size to achieve Lawson conditions. Intrinsically the system must be pulsed because the pressures exceed the strength of any known material. To facilitate heating the fuel (or "target") to thermonuclear conditions with a high-power high-intensity source of energy, magnetic fields are used to insulate the high-pressure fuel from material surroundings (thus "magnetized target"). Because of magnetic insulation, the required heating power intensity is reduced by many orders of magnitude compared to conventional inertial fusion, even with relatively poor energy confinement in the magnetic field, such as that characterized by Bohm diffusion. In this paper we show semi-quantitatively why MTF-should allow fusion energy production without costly facilities within the same generally accepted physical constraints used for conventional magnetic and inertial fusion. We also briefly discuss potential applications of this technology ranging from nuclear rockets for space propulsion to a practical commercial energy system. Finally, we report on the exploratory research underway, and the interesting physics issues that arise in the MTF regime of parameters. Experiments at Los Alamos are focused on formation of a suitable plasma target for compression, utilizing the knowledge base for compact

Host control of plasmid replication: requirement for the sigma factor sigma 32 in transcription of mini-F replication initiator gene.

PubMed Central

Wada, C; Imai, M; Yura, T

1987-01-01

Replication of F factor or mini-F plasmid is strongly inhibited in the rpoH (htpR) mutants of Escherichia coli deficient in the sigma factor (sigma 32) known to be required for heat shock gene expression. Transcription of the mini-F repE gene encoding a replication initiator protein (E protein) was examined by operon fusion and by direct determination of repE mRNA. The synthesis rate and the level of repE mRNA were found to increase transiently upon temperature upshift (30 degrees C to 42 degrees C) in wild-type cells but to decrease rapidly in the rpoH mutants. Thus sigma 32 appeared to be directly involved in transcription of repE whose product, E protein, in turn activates DNA replication from the mini-F ori2 region. This scheme of host-controlled plasmid replication is further supported by the analysis of transcription in vitro: RNA synthesis can be initiated from the repE promoter by a minor form of RNA polymerase containing sigma 32 but not by the major polymerase containing the normal sigma factor sigma 70. The sigma 32-mediated transcription from the repE promoter is strongly inhibited by the E protein. We conclude that transcription of the mini-F repE gene is mediated by the host transcription factor sigma 32 and is negatively controlled by its own product. Images PMID:2447584

Phosphorylation of a WRKY transcription factor by MAPKs is required for pollen development and function in Arabidopsis.