THERMALLY DRIVEN ATMOSPHERIC ESCAPE: TRANSITION FROM HYDRODYNAMIC TO JEANS ESCAPE

DOE Office of Scientific and Technical Information (OSTI.GOV)

Volkov, Alexey N.; Johnson, Robert E.; Tucker, Orenthal J.

2011-03-10

Thermally driven escape from planetary atmospheres changes in nature from an organized outflow (hydrodynamic escape) to escape on a molecule-by-molecule basis (Jeans escape) with increasing Jeans parameter, {lambda}, the ratio of the gravitational to thermal energy of the atmospheric molecules. This change is described here for the first time using the direct simulation Monte Carlo method. When heating is predominantly below the lower boundary of the simulation region, R{sub 0}, and well below the exobase of a single-component atmosphere, the nature of the escape process changes over a surprisingly narrow range of Jeans parameters, {lambda}{sub 0}, evaluated at R{sub 0}.more » For an atomic gas, the transition occurs over {lambda}{sub 0} {approx} 2-3, where the lower bound, {lambda}{sub 0} {approx} 2.1, corresponds to the upper limit for isentropic, supersonic outflow. For {lambda}{sub 0} > 3 escape occurs on a molecule-by-molecule basis and we show that, contrary to earlier suggestions, for {lambda}{sub 0} > {approx}6 the escape rate does not deviate significantly from the familiar Jeans rate. In a gas composed of diatomic molecules, the transition shifts to {lambda}{sub 0} {approx} 2.4-3.6 and at {lambda}{sub 0} > {approx}4 the escape rate increases a few tens of percent over that for the monatomic gas. Scaling by the Jeans parameter and the Knudsen number, these results can be applied to thermally induced escape of the major species from solar and extrasolar planets.« less

The interaction of E. coli integration host factor and lambda cos DNA: multiple complex formation and protein-induced bending.

PubMed Central

Kosturko, L D; Daub, E; Murialdo, H

1989-01-01

The interaction of E. coli's integration Host Factor (IHF) with fragments of lambda DNA containing the cos site has been studied by gel-mobility retardation and electron microscopy. The cos fragment used in the mobility assays is 398 bp and spans a region from 48,298 to 194 on the lambda chromosome. Several different complexes of IHF with this fragment can be distinguished by their differential mobility on polyacrylamide gels. Relative band intensities indicate that the formation of a complex between IHF and this DNA fragment has an equilibrium binding constant of the same magnitude as DNA fragments containing lambda's attP site. Gel-mobility retardation and electron microscopy have been employed to show that IHF sharply bends DNA near cos and to map the bending site. The protein-induced bend is near an intrinsic bend due to DNA sequence. The position of the bend suggests that IHF's role in lambda DNA packaging may be the enhancement of terminase binding/cos cutting by manipulating DNA structure. Images PMID:2521383

Site-specificity of abnormal excision: the mechanism of formation of a specialized transducing bacteriophage lambda plac5.

PubMed Central

Shpakovski, G V; Berlin, Y A

1984-01-01

Molecular mechanism of the specialized transducing bacteriophage lambda plac5 formation has been studied. Phage-bacterial DNA junctions in lambda plac5 DNA are localized and primary structure of regions of the abnormal excisional recombination leading to the phage formation is elucidated; the crossover region proved to be comparable with the central part of attP and attB sites (the core and the adjacent tetranucleotide) in length and degree of homology. Bacterial insert in lambda plac5 DNA is shown to end immediately after Z-Y spacer, the DNA not containing lacY gene segments. The data obtained led to the conclusion of site-specific (homologous) character of abnormal excision upon formation of lambda transducing bacteriophages. Possible mechanisms of the excision are discussed. Images PMID:6091038

Enzymatic repair of selected cross-linked homoduplex molecules enhances nuclear gene rescue from Pompeii and Herculaneum remains.

PubMed

Di Bernardo, Giovanni; Del Gaudio, Stefania; Cammarota, Marcella; Galderisi, Umberto; Cascino, Antonino; Cipollaro, Marilena

2002-02-15

Ancient DNA (aDNA) samples extracted from the bone remains of six equids buried by the Vesuvius eruption in 79 AD were investigated to test pre-amplification and enzymatic repair procedures designed to enhance the rescue of nuclear genes. The extracts, which proved all positive for Equidae mtDNA amplification, proved positive only four times out of 18 when tested for single-copy Equidae nuclear genes (epsilon globin, p53 and gamma interferon). Pre-amplification did not change the number of retrieved aDNA sequences but 10 times out of 14 enzymatic repair restored the amplifiability of the genes analysed, proving that repair increases the rate of successful rescue from 22 to alpha(lambda)mu(omicron)sigma(tau) 80%. These findings support the hypothesis that some of these cross-linked aDNA molecules, which are not completely separated when DNA is extracted under denaturing conditions, become homoduplex substrates for Pol I and/or T4 ligase action upon renaturation. aDNA authenticity is proved by the homology of the nucleotide sequences of loci tested to the corresponding modern Equidae sequences. Data also indicate that cross-linked homoduplex molecules selected by denaturation of the extract are repaired without any chimera formation. The general features of aDNA amplification with and without denaturation and enzymatic repair are discussed.

Peginterferon lambda for the treatment of HBeAg-positive chronic hepatitis B: A randomized phase 2b study (LIRA-B).

PubMed

Chan, Henry L Y; Ahn, Sang Hoon; Chang, Ting-Tsung; Peng, Cheng-Yuan; Wong, David; Coffin, Carla S; Lim, Seng Gee; Chen, Pei-Jer; Janssen, Harry L A; Marcellin, Patrick; Serfaty, Lawrence; Zeuzem, Stefan; Cohen, David; Critelli, Linda; Xu, Dong; Wind-Rotolo, Megan; Cooney, Elizabeth

2016-05-01

Peginterferon lambda-1a (lambda) is a Type-III interferon, which, like alfa interferons, has antiviral activity in vitro against hepatitis B virus (HBV) and hepatitis C virus (HCV); however, lambda has a more limited extra-hepatic receptor distribution. This phase 2b study (LIRA-B) evaluated lambda in patients with chronic HBV infection. Adult HBeAg+ interferon-naive patients were randomized (1:1) to weekly lambda (180 μg) or peginterferon alfa-2a (alfa) for 48 weeks. The primary efficacy endpoint was HBeAg seroconversion at week 24 post-treatment; lambda non-inferiority was demonstrated if the 80% confidence interval (80% CI) lower bound was >-15%. Baseline characteristics were balanced across groups (lambda N=80; alfa N=83). Early on-treatment declines in HBV-DNA and qHBsAg through week 24 were greater with lambda. HBeAg seroconversion rates were comparable for lambda and alfa at week 48 (17.5% vs. 16.9%, respectively); however lambda non-inferiority was not met at week 24 post-treatment (13.8% vs. 30.1%, respectively; lambda vs. alfa 80% CI lower bound -24%). Results for other key secondary endpoints (virologic, serologic, biochemical) and post hoc combined endpoints (HBV-DNA <2000 IU/ml plus HBeAg seroconversion or ALT normalization) mostly favored alfa. Overall adverse events (AE), serious AE, and AE-discontinuation rates were comparable between arms but AE-spectra differed (more cytopenias, flu-like, and musculoskeletal symptoms observed with alfa, more ALT flares and bilirubin elevations seen with lambda). Most on-treatment flares occurred early (weeks 4-12), associated with HBV-DNA decline; all post-treatment flares were preceded by HBV-DNA rise. On-treatment, lambda showed greater early effects on HBV-DNA and qHBsAg, and comparable serologic/virologic responses at end-of-treatment. However, post-treatment, alfa-associated HBeAg seroconversion rates were higher, and key secondary results mostly favored alfa. ClinicalTrials.gov number: NCT01204762. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

[Ru(phen)2DPPZ]2+ is in contact with DNA bases when it forms a luminescent complex with single-stranded oligonucleotides.

PubMed

Moon, Seok Joon; Kim, Jong Moon; Choi, Ji Youn; Kim, Seog K; Lee, Je Seung; Jang, Ho G

2005-05-01

The luminescence intensity of the Delta- and Lambda-enantiomer of [Ru(phen)2DPPZ]2+ ([Ru(phenanthroline)2 dipyrido[3,2-a:2',3'-c]phenazine]2+) complex enhanced upon binding to double stranded DNA, which has been known as "light switch effect". The enhancement of the luminescence required the intercalation of the large ligand between DNA base pairs. In this study, we report the enhancement in the luminescence intensity when the metal complexes bind to single stranded oligonucleotides, indicating that the "light switch effect" does not require intercalation of the large DPPZ ligand. Oligonucleotides may provide a hydrophobic cavity for the [Ru(phen)2DPPZ]2+ complex to prevent the quenching by the water molecule. In the cavity, the metal complex is in contact with DNA bases as is evidenced by the observation that the excited energy of the DNA bases transfer to the bound metal complex. However, the contact of the metal complex with DNA bases is different from the stacking of DPPZ in the intercalation pocket. In addition to the normal two luminescence lifetimes, a short lifetime in the range of 1-2 ns was found for both the delta- and lambda-enantiomer of [Ru(phen)2DPPZ]2+ when complexed with single stranded oligonucleotides, which may be assigned to the metal complex that is outside of the cavity, interacting with phosphate groups of DNA.

[Verification of a decrease in the rigidity of the phage lambda DNA polymeric chain in low ionic strength aqueous solutions by testing the polymer-polymer interlink interactions].

PubMed

Arutiunian, A V; Ivanova, M A; Kurliand, D I; Kapshin, Iu S; Landa, S B; Poshekhonov, S T; Drobchenko, E A; Shevelev, I V

2011-01-01

Changes in the rigidity of the polymetric chain of phage lambda double-strand DNA have been studied by laser correlation spectroscopy. It was shown that, as the ionic strength increases, the effect of the screening of the hydrodynamic interaction of the links of the polymeric chain specific for polymeric coils arises in a DNA solution. It is assumed that the screening occurs when the threshold of the overlapping of DNA coils is achieved. The overlapping of coils is the result of a previously observed significant rise of DNA coil size from abnormally small DNA coils in low ionic strength buffers (about 10(-2) M Na+ or less) to maximum possible large coils in the 5SSC and 5SSC-like buffers. Further analysis of the far interlink interactions in linear lambda phage DNA coils in similar buffers at pH 7 and 4 confirms the earlier proposal about the role of H+ ions in the appearance of abnormally small DNA coils. The abnormal decrease in the DNA coil size in low ionic strength buffers is not a specific feature of lambda phage DNA only.

An integrated optics microfluidic device for detecting single DNA molecules.

PubMed

Krogmeier, Jeffrey R; Schaefer, Ian; Seward, George; Yantz, Gregory R; Larson, Jonathan W

2007-12-01

A fluorescence-based integrated optics microfluidic device is presented, capable of detecting single DNA molecules in a high throughput and reproducible manner. The device integrates microfluidics for DNA stretching with two optical elements for single molecule detection (SMD): a plano-aspheric refractive lens for fluorescence excitation (illuminator) and a solid parabolic reflective mirror for fluorescence collection (collector). Although miniaturized in size, both optical components were produced and assembled onto the microfluidic device by readily manufacturable fabrication techniques. The optical resolution of the device is determined by the small and relatively low numerical aperture (NA) illuminator lens (0.10 effective NA, 4.0 mm diameter) that delivers excitation light to a diffraction limited 2.0 microm diameter spot at full width half maximum within the microfluidic channel. The collector (0.82 annular NA, 15 mm diameter) reflects the fluorescence over a large collection angle, representing 71% of a hemisphere, toward a single photon counting module in an infinity-corrected scheme. As a proof-of-principle experiment for this simple integrated device, individual intercalated lambda-phage DNA molecules (48.5 kb) were stretched in a mixed elongational-shear microflow, detected, and sized with a fluorescence signal to noise ratio of 9.9 +/-1.0. We have demonstrated that SMD does not require traditional high numerical aperture objective lenses and sub-micron positioning systems conventionally used in many applications. Rather, standard manufacturing processes can be combined in a novel way that promises greater accessibility and affordability for microfluidic-based single molecule applications.

Environmental chemistry, ecotoxicity, and fate of lambda-cyhalothrin.

PubMed

He, Li-Ming; Troiano, John; Wang, Albert; Goh, Kean

2008-01-01

Lambda-cyhalothrin is a pyrethroid insecticide used for controlling pest insects in agriculture, public health, and in construction and households. Lambda-cyhalothrin is characterized by low vapor pressure and a low Henry's law constant but by a high octanol-water partition coefficient (K(ow)) and high water-solid-organic carbon partition coefficient (K(oc)) values. Lambda-cyhalothrin is quite stable in water at pH < 8, whereas it hydrolyzes to form HCN and aldehyde under alkaline conditions. Although lambda-cyhalothrin is relatively photostable under natural irradiation, with a half-life > 3 wk, its photolysis process is fast under UV irradiation, with a half-life < 10 min. The fate of lambda-cyhalothrin in aquatic ecosystems depends on the nature of system components such as suspended solids (mineral and organic particulates) and aquatic organisms (algae, macrophytes, or aquatic animals). Lambda-cyhalothrin residues dissolved in water decrease rapidly if suspended solids and/or aquatic organisms are present because lambda-cyhalothrin molecules are strongly adsorbed by particulates and plants. Adsorbed lambda-cyhalothrin molecules show decreased degradation rates because they are less accessible to breakdown than free molecules in the water column. On the other hand, lambda-cyhalothrin adsorbed to suspended solids or bottom sediments may provide a mechanism to mitigate its acute toxicity to aquatic organisms by reducing their short-term bioavailability in the water column. The widespread use of lambda-cyhalothrin has resulted in residues in sediment, which have been found to be toxic to aquatic organisms including fish and amphipods. Mitigation measures have been used to reduce the adverse impact of lambda-cyhalothrin contributed from agricultural or urban runoff. Mitigation may be achieved by reducing the quantity of runoff and suspended solid content in runoff through wetlands, detention ponds, or vegetated ditches.

Direct Isolation of Purines and Pyrimidines from Nucleic Acids Using Sublimation

NASA Technical Reports Server (NTRS)

Glavin, Daniel P.; Schubert, Michael; Bada, Jeffrey L.

2003-01-01

A sublimation technique was developed to isolate purines and pyrimidines directly from lambda-deoxyribonucleic acid (lambda-DNA) and Escherichia coli cells. The sublimation of adenine, cytosine, guanine, and thymine from lambda-DNA was tested under reduced pressure (approx. 0.5 Torr) at temperatures of >150 C. With the exception of guanine, approximately 60 -75% of each base was sublimed directly from the lambda-DNA and recovered on a coldfinger of the sublimation apparatus after heating to 450 C. Several nucleobases including adenine, cytosine, thymine, and uracil were also recovered from E. coli bacteria after heating the cells to the same temperature, although some thermal decomposition of the bases also occurred. These results demonstrate the feasibility of using sublimation to isolate purines and pyrimidines from native E. coli DNA and RNA without any chemical treatment of the cells.

Fabrication and characterization of a solid state nanopore with self-aligned carbon nanoelectrodes for molecular detection

NASA Astrophysics Data System (ADS)

Spinney, Patrick; Collins, Scott D.; Howitt, David G.; Smith, Rosemary L.

2012-06-01

Rapid and cost-effective DNA sequencing is a pivotal prerequisite for the genomics era. Many of the recent advances in forensics, medicine, agriculture, taxonomy, and drug discovery have paralleled critical advances in DNA sequencing technology. Nanopore modalities for DNA sequencing have recently surfaced including the electrical interrogation of protein ion channels and/or solid-state nanopores during translocation of DNA. However to date, most of this work has met with mixed success. In this work, we present a unique nanofabrication strategy that realizes an artificial nanopore articulated with carbon electrodes to sense the current modulations during the transport of DNA through the nanopore. This embodiment overcomes most of the technical difficulties inherent in other artificial nanopore embodiments and present a versatile platform for the testing of DNA single nucleotide detection. Characterization of the device using gold nanoparticles, silica nanoparticles, lambda dsDNA and 16-mer ssDNA are presented. Although single molecule DNA sequencing is still not demonstrated, the device shows a path towards this goal.

Multiple factors and processes involved in host cell killing by bacteriophage Mu: characterization and mapping.

PubMed

Waggoner, B T; Marrs, C F; Howe, M M; Pato, M L

1984-07-15

The regions of bacteriophage Mu involved in host cell killing were determined by infection of a lambda-immune host with 12 lambda pMu-transducing phages carrying different amounts of Mu DNA beginning at the left end. Infecting lambda pMu phages containing 5.0 (+/- 0.2) kb or less of the left end of Mu DNA did not kill the lambda-immune host, whereas lambda pMu containing 5.1 kb did kill, thus locating the right end of the kil gene between approximately 5.0 and 5.1 kb. For the Kil+ phages the extent of killing increased as the multiplicity of infection (m.o.i.) increased. In addition, killing was also affected by the presence of at least two other regions of Mu DNA: one, located between 5.1 and 5.8 kb, decreased the extent of killing; the other, located between 6.3 and 7.9 kb, greatly increased host cell killing. Killing was also assayed after lambda pMu infection of a lambda-immune host carrying a mini-Mu deleted for most of the B gene and the middle region of Mu DNA. Complementation of mini-Mu replication by infecting B+ lambda pMu phages resulted in killing of the lambda-immune, mini-Mu-containing host, regardless of the presence or absence of the Mu kil gene. The extent of host cell killing increased as the m.o.i. of the infecting lambda pMu increased, and was further enhanced by both the presence of the kil gene and the region located between 6.3 and 7.9 kb. These distinct processes of kil-mediated killing in the absence of replication and non-kil-mediated killing in the presence of replication were also observed after induction of replication-deficient and kil mutant prophages, respectively.

Analysis of the genome of fish lymphocystis disease virus isolated directly from epidermal tumours of pleuronectes.

PubMed

Darai, G; Anders, K; Koch, H G; Delius, H; Gelderblom, H; Samalecos, C; Flügel, R M

1983-04-30

Virions of fish lymphocystis disease virus (FLDV), a member of the iridovirus family, were isolated directly from lymphocystis disease lesions of individual flatfishes and purified by sucrose and subsequent cesium chloride gradient centrifugation to homogeneity as judged by electron microscopy. The isolated FLDV DNAs appear to be heterogeneous in size. Contour length measurements of 43 DNA molecules gave an average length of 49 +/- 23 microns, corresponding to 93 +/- 44 X 10(6) D. Molecular weight estimations of FLDV DNA by restriction enzyme analysis resulted in only 64.8 X 10(6) D indicating an excess length of the DNA of about 50%. FLDV DNA was sensitive to lambda 5'-exonuclease and to E. coli 3'-exonuclease III without preference of any one terminal DNA restriction fragment. Denaturation and reannealing experiments of FLDV DNA resulted in the formation of circular DNA molecules of 34.25 microns contour length (= 65.22 X 10(6) D). This result suggests that FLDV DNA contains directly repeated sequences at both ends and that it is terminally redundant. FLDV DNA is methylated in cytosine. FLDV DNA did not hybridize with frog virus DNA indicating that the two iridoviruses are not closely related to each other. Restriction enzyme analysis and Southern blot hybridizations revealed that FLDV isolates can be classified into two different strains: FLDV strain 1 occurs in flounders and plaice, whereas strain 2 is usually found in lesions of dabs.

Recombination between bacteriophage lambda and plasmid pBR322 in Escherichia coli.

PubMed Central

Pogue-Geile, K L; Dassarma, S; King, S R; Jaskunas, S R

1980-01-01

Recombinant lambda phages were isolated that resulted from recombination between the lambda genome and plasmid pBR322 in Escherichia coli, even though these deoxyribonucleic acids (DNAs) did not share extensive regions of homology. The characterization of these recombinant DNAs by heteroduplex analysis and restriction endonucleases is described. All but one of the recombinants appeared to have resulted from reciprocal recombination between a site on lambda DNA and a site on the plasmid. In general, there were two classes of recombinants. One class appeared to have resulted from recombination at the phage attachment site that probably resulted from lambda integration into secondary attachment sites on the plasmid. Seven different secondary attachment sites on pBR322 were found. The other class resulted from plasmid integration at other sites that were widely scattered on the lambda genome. For this second class of recombinants, more than one site on the plasmid could recombine with lambda DNA. Thus, the recombination did not appear to be site specific with respect to lambda or the plasmid. Possible mechanisms for generating these recombinants are discussed. Images PMID:6247334

Experimental transport studies of yttrium barium copper oxide and lambda-DNA

NASA Astrophysics Data System (ADS)

Zhang, Yuexing

This dissertation consists of two parts. In Part I, we focus on the quasi-particle transport properties in the high temperature superconductor YBa2Cu3O7-delta (YBCO), probed by the thermal Hall conductivity (kappa xy). The thermal Hall conductivity selectively reflects the transport behaviors of the charge carriers. By measuring kappaxy in the normal state YBCO, we established a new method to determine the Wiedemann-Franz (WF) ratio in cuprates. We determined the Hall-channel WF ratio kappa xy/sigmaxyT in Cu and YBCO. In the latter, we uncovered a T-linear dependence and suppression of the Hallchannel WF ratio. The suppression of the Hall-channel WF ratio in systems with predominant electron-electron scattering will be discussed. Thermal transport behaviors of the quasi-particles in the mixed state were studied by measuring kappaxx and kappa xy in a high-purity YBCO crystal. From the field-dependence of the thermal conductivity kappaxx, we separated the quasi particle contribution (kappae) from the phonon background. In the Hall channel, we observed that the (weak-field) kappa xy increased 103-fold between T c (90 K) and 30 K, implying a 100-fold enhancement of the quasi-particle lifetime. We found that kappaxy exhibited a specific scaling behavior below ˜30 K. The implication of the scaling behavior will be discussed. In Part II, we describe an experiment on determining the electrical conductivity of the bacteriophage lambda-DNA, an issue currently under intense debate. We covalently bonded the DNA to Au electrodes by incorporating thiol modified dTTP into the 'sticky' ends of the lambda-DNA. Two-probe measurements on such molecules provided a lower bound for the resistivity rho > 10 6 mum at bias potentials up to 20 V, in conflict with recent claims of moderate to high conductivity. We stress the importance of eliminating salt residues in these measurements.

Half molecular exchange of IgGs in the blood of healthy humans: chimeric lambda-kappa-immunoglobulins containing HL fragments of antibodies of different subclasses (IgG1-IgG4).

PubMed

Sedykh, Sergey E; Lekchnov, Evgenii A; Prince, Viktor V; Buneva, Valentina N; Nevinsky, Georgy A

2016-10-20

In the classic paradigm, immunoglobulins represent products of clonal B cell populations, each producing antibodies recognizing a single antigen (monospecific). There is a common belief that IgGs in mammalian biological fluids are monospecific molecules having stable structures and two identical antigen-binding sites. But the issue concerning the possibility of exchange by HL-fragments between the antibody molecules in human blood is still unexplored. Different physico-chemical and immunological methods for analysis of half-molecule exchange between human blood IgGs were used. Using eighteen blood samples of healthy humans we have shown unexpected results for the first time: blood antibodies undergo extensive post-transcriptional half-molecule exchange and IgG pools on average consist of 62.4 ± 6.5% IgGs containing kappa light chains (kappa-kappa-IgGs), 29.8.6 ± 5.4% lambda light chains (lambda-lambda-IgGs), and 8.8 ± 2.7% (range 2.6-16.8%) IgGs containing both kappa- and lambda-light chains. Kappa-kappa-IgGs and lambda-lambda-IgGs contained on average (%): IgG1 (36.0 and 32.3), IgG2 (50.9 and 51.4), IgG3 (9.7 and 9.9), and IgG4 (6.5 and 5.7), while chimeric kappa-lambda-IgGs consisted of (%): 25.5 ± 4.2 IgG1, 50.8 ± 3.9 IgG2, 9.1 ± 2.1 IgG3, and 14.5 ± 2.2 IgG4. Our unexpected data are indicative of the possibility of half-molecule exchange between blood IgGs of various subclasses, raised against different antigens. The existence of blood chimeric bifunctional IgGs with different binding sites destroys the classic paradigm. Due to the phenomenon of polyspecificity and cross-reactivity of bifunctional IgGs containing HL-fragments of different types to different antigens, such IgGs may be important in human blood for widening their different biological functions.

Inhibitory effect of tocotrienol on eukaryotic DNA polymerase {lambda} and angiogenesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Mizushina, Yoshiyuki; Nakagawa, Kiyotaka; Shibata, Akira

2006-01-20

Tocotrienols, vitamin E compounds that have an unsaturated side chain with three double bonds, selectively inhibited the activity of mammalian DNA polymerase {lambda} (pol {lambda}) in vitro. These compounds did not influence the activities of replicative pols such as {alpha}, {delta}, and {epsilon}, or even the activity of pol {beta} which is thought to have a very similar three-dimensional structure to the pol {beta}-like region of pol {lambda}. Since {delta}-tocotrienol had the strongest inhibitory effect among the four ({alpha}- to {delta}-) tocotrienols, the isomer's structure might be an important factor in the inhibition of pol {lambda}. The inhibitory effect ofmore » {delta}-tocotrienol on both intact pol {lambda} (residues 1-575) and a truncated pol {lambda} lacking the N-terminal BRCA1 C-terminus (BRCT) domain (residues 133-575, del-1 pol {lambda}) was dose-dependent, with 50% inhibition observed at a concentration of 18.4 and 90.1 {mu}M, respectively. However, del-2 pol {lambda} (residues 245-575) containing the C-terminal pol {beta}-like region was unaffected. Tocotrienols also inhibited the proliferation of and formation of tubes by bovine aortic endothelial cells, with {delta}-tocotrienol having the greatest effect. These results indicated that tocotrienols targeted both pol {lambda} and angiogenesis as anti-cancer agents. The relationship between the inhibition of pol {lambda} and anti-angiogenesis by {delta}-tocotrienol was discussed.« less

Cloning and study of the pectate lyase gene of Erwinia carotovora

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bukanov, N.O.; Fonshtein, M.Yu.; Evtushenkov, A.N.

1986-04-01

The cloning of the gene of a secretable protein of Erwinia carotovora, pectate lyase, in Escherichia coli was described. Primary cloning was conducted using the phage vector lambda 47.1. In the gene library of E. carotovora obtained, eight phages carrying the gene sought were identified according to the appearance of enzymatic activity of the gene product, pectate lyase, in situ. The BamHI fragment of DNA, common to all these phages, was recloned on the plasmid pUC19. It was shown that the cloned pectate lyase gene is represented on the E. carotovora chromosome in one copy. Methods of production of representativemore » gene libraries on phage vectors from no less than 1 ..mu..g of cloned DNA even for the genomes of eukaryotes have now been developed. Vectors have been created, for example, lambda 47.1, permitting the selection only of hybrid molecules. A number of methods have been developed for the search for a required gene in the library, depending on whether the cloned gene can be expressed or not, and if it can, what properties it will impart to the hybrid clone containing it.« less

Linear nicking endonuclease-mediated strand-displacement DNA amplification.

PubMed

Joneja, Aric; Huang, Xiaohua

2011-07-01

We describe a method for linear isothermal DNA amplification using nicking endonuclease-mediated strand displacement by a DNA polymerase. The nicking of one strand of a DNA target by the endonuclease produces a primer for the polymerase to initiate synthesis. As the polymerization proceeds, the downstream strand is displaced into a single-stranded form while the nicking site is also regenerated. The combined continuous repetitive action of nicking by the endonuclease and strand-displacement synthesis by the polymerase results in linear amplification of one strand of the DNA molecule. We demonstrate that DNA templates up to 5000 nucleotides can be linearly amplified using a nicking endonuclease with 7-bp recognition sequence and Sequenase version 2.0 in the presence of single-stranded DNA binding proteins. We also show that a mixture of three templates of 500, 1000, and 5000 nucleotides in length is linearly amplified with the original molar ratios of the templates preserved. Moreover, we demonstrate that a complex library of hydrodynamically sheared genomic DNA from bacteriophage lambda can be amplified linearly. Copyright © 2011 Elsevier Inc. All rights reserved.

Linear nicking endonuclease-mediated strand displacement DNA amplification

PubMed Central

Joneja, Aric; Huang, Xiaohua

2011-01-01

We describe a method for linear isothermal DNA amplification using nicking endonuclease-mediated strand displacement by a DNA polymerase. The nicking of one strand of a DNA target by the endonuclease produces a primer for the polymerase to initiate synthesis. As the polymerization proceeds, the downstream strand is displaced into a single-stranded form while the nicking site is also regenerated. The combined continuous repetitive action of nicking by the endonuclease and strand displacement synthesis by the polymerase results in linear amplification of one strand of the DNA molecule. We demonstrate that DNA templates up to five thousand nucleotides can be linearly amplified using a nicking endonuclease with seven base-pair recognition sequence and Sequenase version 2.0 in the presence of single-stranded DNA binding proteins. We also show that a mixture of three templates of 500, 1000, and 5000 nucleotides in length are linearly amplified with the original molar ratios of the templates preserved. Moreover, we demonstrate that a complex library of hydrodynamically sheared genomic DNA from bacteriophage lambda can be amplified linearly. PMID:21342654

Imaging The Genetic Code of a Virus

NASA Astrophysics Data System (ADS)

Graham, Jenna; Link, Justin

2013-03-01

Atomic Force Microscopy (AFM) has allowed scientists to explore physical characteristics of nano-scale materials. However, the challenges that come with such an investigation are rarely expressed. In this research project a method was developed to image the well-studied DNA of the virus lambda phage. Through testing and integrating several sample preparations described in literature, a quality image of lambda phage DNA can be obtained. In our experiment, we developed a technique using the Veeco Autoprobe CP AFM and mica substrate with an appropriate absorption buffer of HEPES and NiCl2. This presentation will focus on the development of a procedure to image lambda phage DNA at Xavier University. The John A. Hauck Foundation and Xavier University

Homologous recombination between overlapping thymidine kinase gene fragments stably inserted into a mouse cell genome.

PubMed

Lin, F L; Sternberg, N

1984-05-01

We have constructed a substrate to study homologous recombination between adjacent segments of chromosomal DNA. This substrate, designated lambda tk2 , consists of one completely defective and one partially defective herpes simplex virus thymidine kinase (tk) gene cloned in bacteriophage lambda DNA. The two genes have homologous 984-base-pair sequences and are separated by 3 kilobases of largely vector DNA. When lambda tk2 DNA was transferred into mouse LMtk- cells by the calcium phosphate method, rare TK+ transformants were obtained that contained many (greater than 40) copies of the unrecombined DNA. Tk- revertants, which had lost most of the copies of unrecombined DNA, were isolated from these TK+-transformed lines. Two of these Tk- lines were further studied by analysis of their reversion back to the Tk+ phenotype. They generated ca. 200 Tk+ revertants per 10(8) cells after growth in nonselecting medium for 5 days. All of these Tk+ revertants have an intact tk gene reconstructed by homologous recombination; they also retain various amounts of unrecombined lambda tk2 DNA. Southern blot analysis suggested that at least some of the recombination events involve unequal sister chromatid exchanges. We also tested three agents, mitomycin C, 12-O-tetradecanoyl-phorbol-13-acetate, and mezerein, that are thought to stimulate recombination to determine whether they affect the reversion from Tk- to Tk+. Only mitomycin C increased the number of Tk+ revertants.

Structural relationship of curcumin derivatives binding to the BRCT domain of human DNA polymerase lambda.

PubMed

Takeuchi, Toshifumi; Ishidoh, Tomomi; Iijima, Hiroshi; Kuriyama, Isoko; Shimazaki, Noriko; Koiwai, Osamu; Kuramochi, Kouji; Kobayashi, Susumu; Sugawara, Fumio; Sakaguchi, Kengo; Yoshida, Hiromi; Mizushina, Yoshiyuki

2006-03-01

We previously reported that phenolic compounds, petasiphenol and curcumin (diferuloylmethane), were a selective inhibitor of DNA polymerase lambda (pol lambda) in vitro. The purpose of this study was to investigate the molecular structural relationship of curcumin and 13 chemically synthesized derivatives of curcumin. The inhibitory effect on pol lambda (full-length, i.e. intact pol lambda including the BRCA1 C- terminal [BRCT] domain) by some derivatives was stronger than that by curcumin, and monoacetylcurcumin (compound 13) was the strongest pol lambda inhibitor of all the compounds tested, achieving 50% inhibition at a concentration of 3.9 microm. The compound did not influence the activities of replicative pols such as alpha, delta, and epsilon. It had no effect on pol beta activity either, although the three-dimensional structure of pol beta is thought to be highly similar to that of pol lambda. Compound 13 did not inhibit the activity of the C-terminal catalytic domain of pol lambda including the pol beta-like core, in which the BRCT motif was deleted from its N-terminal region. MALDI-TOF MS analysis demonstrated that compound 13 bound selectively to the N-terminal domain of pol lambda, but did not bind to the C-terminal region. Based on these results, the pol lambda-inhibitory mechanism of compound 13 is discussed.

Experimental and numerical studies of tethered DNA dynamics in shear flow

NASA Astrophysics Data System (ADS)

Lueth, Christopher A.

Polymer physics has a rich tradition spanning nearly two centuries. In the 1830s, Henri Braconnot and coworkers were perhaps the first to work on what is today known as polymer science when they derived semi-synthetic materials from naturally occurring cellulose. However, the true nature of polymers, as long chain molecules, had not been proposed until 1910 by Pickles. It was not until the 1950's when polymer models were developed using statistical mechanics. Recently, the field has been revitalized by the ability to study individual polymer molecules for the first time. The development of DNA single molecule fluorescence microscopy coupled with ever increasing computational power has opened the door to molecular level understanding of polymer physics, resolving old disputes and uncovering new interesting phenomena. In this work, we use a combination of theoretical predictions and lambda-phage DNA single molecule fluorescence microscopy to study the behavior of polymers tethered to surfaces. Brownian dynamics simulations of a number of coarse-grained polymer models---dynamic and equilibrium Kratky-Porod chains as well as bead-spring chains---were completed and compared with analytical and experimental results. First, an expression is developed for the entropic exclusion force experienced by a tethered polymer chain. We propose that, for a freely jointed chain, a modification to the free entropic force of kBT/y is needed in the direction normal to the surface. Analogously, we propose that for a wormlike chain, a modification of 2kBT/y is needed, due to the finite curvature of the model. Then, the reliability of discretized bead spring simulations containing this modified entropic force are analyzed using Kratky-Porod simulations and are found to reproduce most statistics, except for those very near the surface, such as end-wall contact. Next, experiments of tethered lambda-phage DNA in shear flow are presented for the first time in the flow-gradient plane. The tethering surface chemistry proved to be arduous work, but with the aide of contact angle and ellipsometry measurements, success was achieved. Extension behavior was shown to agree well with bead spring simulations, but deviations were discovered for weak flows in the extensional fluctuations, mean distance from the wall, and orientation angle. Cyclic dynamics---where the polymer continuously diffuses away from the wall, subsequently undergoes stretch in the flow direction, is then "entropically pulled back" towards the wall, and finally recoils---was observed and quantified through correlation and power spectral densities. Again, quantitative agreement was observed between experiments and bead spring simulations. The onset of cyclic dynamics was found to occur at Wi ≈ 3 and was found to decline with increasing Wi up to ≈ 200. Finally, a reliable procedure was developed utilizing Dip Pen Nanolithography to controllably tether DNA to gold surfaces. Preliminary experiments were performed and successful tethering was achieved, an important first step toward creating DNA scaffolds for molecular wires. However, further research is needed to fully develop the process and successfully double tether DNA molecules between gold electrodes.

Somatic diversification of chicken immunoglobulin light chains by point mutations.

PubMed

Parvari, R; Ziv, E; Lantner, F; Heller, D; Schechter, I

1990-04-01

The light-chain locus of chicken has 1 functional V lambda 1 gene, 1 J gene, and 25 pseudo-V lambda-genes (where V = variable and J = joining). A major problem is which somatic mechanisms expand this extremely limited germ-line information to generate many different antibodies. Weill's group [Reynaud, C. A., Anquez, V., Grimal, H. & Weill, J. C. (1987) Cell 48, 379-388] has shown that the pseudo-V lambda-genes diversify the rearranged V lambda 1 by gene conversion. Here we demonstrate that chicken light chains are further diversified by somatic point mutations and by V lambda 1-J flexible joining. Somatic point mutations were identified in the J and 3' noncoding DNA of rearranged light-chain genes of chicken. These regions were analyzed because point mutations in V lambda 1 are obscured by gene conversion; the J and 3' noncoding DNA are presented in one copy per haploid genome and are not subject to gene conversion. In rodents point mutations occur as frequently in the V-J coding regions as in the adjacent flanking DNA. Therefore, we conclude that somatic point mutations diversify the V lambda 1 of chicken. The frequency (0-1%) and distribution of the mutations (decreasing in number with increased distance from the V lambda 1 segment) in chicken were as observed in rodents. Sequence variability at the V lambda 1-J junctions could be attributed to imprecise joining of the V lambda 1 and J genes. The modification by gene conversion of rearranged V lambda 1 genes in the bursa was similar in chicken aged 3 months (9.5%) or 3 weeks (9.1%)--i.e., gene conversion that generates the preimmune repertoire in the bursa seems to level off around 3 weeks of age. This preimmune repertoire can be further diversified by somatic point mutations that presumably lead to the formation of antibodies with increased affinity. A segment with structural features of a matrix association region [(A + T)-rich and four topoisomerase II binding sites] was identified in the middle of the J-C lambda intron (where C = constant).

Linkage map of the fragments of herpesvirus papio DNA.

PubMed Central

Lee, Y S; Tanaka, A; Lau, R Y; Nonoyama, M; Rabin, H

1981-01-01

Herpesvirus papio (HVP), an Epstein-Barr-like virus, causes lymphoblastoid disease in baboons. The physical map of HVP DNA was constructed for the fragments produced by cleavage of HVP DNA with restriction endonucleases EcoRI, HindIII, SalI, and PvuI, which produced 12, 12, 10, and 4 fragments, respectively. The total molecular size of HVP DNA was calculated as close to 110 megadaltons. The following methods were used for construction of the map; (i) fragments near the ends of HVP DNA were identified by treating viral DNA with lambda exonuclease before restriction enzyme digestion; (ii) fragments containing nucleotide sequences in common with fragments from the second enzyme digest of HVP DNA were examined by Southern blot hybridization; and (iii) the location of some fragments was determined by isolating individual fragments from agarose gels and redigesting the isolated fragments with a second restriction enzyme. Terminal heterogeneity and internal repeats were found to be unique features of HVP DNA molecule. One to five repeats of 0.8 megadaltons were found at both terminal ends. Although the repeats of both ends shared a certain degree of homology, it was not determined whether they were identical repeats. The internal repeat sequence of HVP DNA was found in the EcoRI-C region, which extended from 8.4 to 23 megadaltons from the left end of the molecule. The average number of the repeats was calculated to be seven, and the molecular size was determined to be 1.8 megadaltons. Similar unique features have been reported in EBV DNA (D. Given and E. Kieff, J. Virol. 28:524-542, 1978). Images PMID:6261015

Changes in brain cell shape create residual extracellular space volume and explain tortuosity behavior during osmotic challenge.

PubMed

Chen, K C; Nicholson, C

2000-07-18

Diffusion of molecules in brain extracellular space is constrained by two macroscopic parameters, tortuosity factor lambda and volume fraction alpha. Recent studies in brain slices show that when osmolarity is reduced, lambda increases while alpha decreases. In contrast, with increased osmolarity, alpha increases, but lambda attains a plateau. Using homogenization theory and a variety of lattice models, we found that the plateau behavior of lambda can be explained if the shape of brain cells changes nonuniformly during the shrinking or swelling induced by osmotic challenge. The nonuniform cellular shrinkage creates residual extracellular space that temporarily traps diffusing molecules, thus impeding the macroscopic diffusion. The paper also discusses the definition of tortuosity and its independence of the measurement frame of reference.

Tests of spool models for DNA packaging in phage lambda.

PubMed

Widom, J; Baldwin, R L

1983-12-25

Experiments are reported which bear on two spool models proposed for packaging the DNA of phage lambda. Both spool models fill an assumed spherical cavity with DNA wrapped in cylindrical or quasi-cylindrical layers composed of adjacent circular turns. In the curved-spool model, a single continuous segment of DNA, about 20% of the DNA length and probably located near the left end of the DNA, is in contact with the coat protein of the phage capsid. In the straight spool model, there are several DNA segments in contact with the capsid; they are concentrated in one half (probably the left half) of lambda DNA. We have identified the loci on the DNA which are in contact with the capsid by chemical crosslinking, induced by ultraviolet-irradiation of phage containing 5-bromodeoxyuridine in place of thymine. In an electron microscope experiment, phage are first lysed with EDTA, and then spread in a cytochrome c film by the formamide method. The disrupted capsid, which has the appearance of a phage ghost, serves as a marker showing where the DNA is crosslinked to the coat. The left end of the DNA is not distinguished from the right end, and so the map of DNA-capsid contacts is folded over on itself. Contacts are found nearly randomly over the entire map. In a second experiment, DNA from lysed, crosslinked phage is cut either with EcoRI or HindIII restriction endonucleases and the cut restriction fragments are labeled at their ends with 32P. Density centrifugation in a CsCl gradient separates free DNA from restriction fragments crosslinked to protein. After digestion with proteinase k, the DNA fragments previously crosslinked to protein are identified by size after agarose gel electrophoresis. DNA fragments from all parts of the genome are found. These two experiments show that, if the DNA of each phage is packaged identically, then the curved-spool model is ruled out and the straight spool model is unlikely. Alternatively, the manner of packaging the DNA may vary from one phage to the next. These results agree with other recent experiments on lambda DNA packaging by Hall & Schellman (1982a,b), and by Haas et al. (1982). A different experiment is also reported. The psoralen derivative aminomethyltrioxalen (AMT) is allowed to intercalate into lambda phage and then the DNA strands are crosslinked by ultraviolet-irradiation after the rapid phase of AMT intercalation is complete. The DNA is subsequently denatured by glyoxal modification and spread for electron microscopy in a cytochrome c film by the formamide method.(ABSTRACT TRUNCATED AT 400 WORDS)

Molecular epidemiology of Escherichia coli O157:H7 strains by bacteriophage lambda restriction fragment length polymorphism analysis: application to a multistate foodborne outbreak and a day-care center cluster.

PubMed

Samadpour, M; Grimm, L M; Desai, B; Alfi, D; Ongerth, J E; Tarr, P I

1993-12-01

Genomic DNAs prepared from 168 isolates of Escherichia coli O157:H7 were analyzed for restriction fragment length polymorphisms on Southern blots probed with bacteriophage lambda DNA. The isolates analyzed included strains from a recent large multistate outbreak of E. coli O157:H7 infection associated with consumption of poorly cooked beef in restaurants, a day-care center cluster, and temporally and geographically unrelated isolates. E. coli O157:H7 isolates recovered from the incriminated meat and from 61 (96.8%) of 63 patients from Washington and Nevada possessed identical lambda restriction fragment length patterns. The lambda restriction fragment length polymorphisms observed in 11 (91.7%) of 12 day-care center patients were identical, but they differed from that of the strain associated with the multistate outbreak. E. coli O157:H7 from 42 patients temporally or geographically unrelated to either cluster of infection possessed unique and different lambda restriction fragment length patterns, except for paired isolates from three separate clusters of infection. These data demonstrate that the hybridization of DNA digests of E. coli O157:H7 with radiolabelled bacteriophage lambda DNA can be a useful, stable, and discriminatory epidemiologic tool for analyzing the linkage between strains of E. coli O157:H7.

Homologous recombination between overlapping thymidine kinase gene fragments stably inserted into a mouse cell genome.

PubMed Central

Lin, F L; Sternberg, N

1984-01-01

We have constructed a substrate to study homologous recombination between adjacent segments of chromosomal DNA. This substrate, designated lambda tk2 , consists of one completely defective and one partially defective herpes simplex virus thymidine kinase (tk) gene cloned in bacteriophage lambda DNA. The two genes have homologous 984-base-pair sequences and are separated by 3 kilobases of largely vector DNA. When lambda tk2 DNA was transferred into mouse LMtk- cells by the calcium phosphate method, rare TK+ transformants were obtained that contained many (greater than 40) copies of the unrecombined DNA. Tk- revertants, which had lost most of the copies of unrecombined DNA, were isolated from these TK+-transformed lines. Two of these Tk- lines were further studied by analysis of their reversion back to the Tk+ phenotype. They generated ca. 200 Tk+ revertants per 10(8) cells after growth in nonselecting medium for 5 days. All of these Tk+ revertants have an intact tk gene reconstructed by homologous recombination; they also retain various amounts of unrecombined lambda tk2 DNA. Southern blot analysis suggested that at least some of the recombination events involve unequal sister chromatid exchanges. We also tested three agents, mitomycin C, 12-O-tetradecanoyl-phorbol-13-acetate, and mezerein, that are thought to stimulate recombination to determine whether they affect the reversion from Tk- to Tk+. Only mitomycin C increased the number of Tk+ revertants. Images PMID:6328272

Molecular cloning of a small prostate protein, known as beta-microsemenoprotein, PSP94 or beta-inhibin, and demonstration of transcripts in non-genital tissues.

PubMed

Ulvsbäck, M; Lindström, C; Weiber, H; Abrahamsson, P A; Lilja, H; Lundwall, A

1989-11-15

In order to study the gene expression of the seminal plasma protein beta-microseminoprotein, also known as PSP94 and beta-inhibin, clones encoding this protein were isolated from a cDNA library constructed in lambda gt11. Nucleotide sequencing confirmed the structure of a previously cloned cDNA. By northern blot analysis identical sized transcripts were demonstrated in the prostate, the respiratory (tracheal, bronchial and lung) tissues and the antrum part of the gastric mucosa. Thus, the protein is not primarily associated with male reproductive function. Although probably of no physiological significance, a slight structural similarity to the ovarian inhibin beta-chains was identified in the C-terminal half of the molecule.

Direct Cloning of Yeast Genes from an Ordered Set of Lambda Clones in Saccharomyces Cerevisiae by Recombination in Vivo

PubMed Central

Erickson, J. R.; Johnston, M.

1993-01-01

We describe a technique that facilitates the isolation of yeast genes that are difficult to clone. This technique utilizes a plasmid vector that rescues lambda clones as yeast centromere plasmids. The source of these lambda clones is a set of clones whose location in the yeast genome has been determined by L. Riles et al. in 1993. The Esherichia coli-yeast shuttle plasmid carries URA3, ARS4 and CEN6, and contains DNA fragments from the lambda vector that flank the cloned yeast insert. When yeast is cotransformed with linearized plasmid and lambda clone DNA, Ura(+) transformants are obtained by a recombination event between the lambda clone and the plasmid vector that generates an autonomously replicating plasmid containing the cloned yeast DNA sequences. Genes whose genetic map positions are known can easily be identified and recovered in this plasmid by testing only those lambda clones that map to the relevant region of the yeast genome for their ability to complement the mutant phenotype. This technique facilitates the isolation of yeast genes that resist cloning either because (1) they are underrepresented in yeast genomic libraries amplified in E. coli, (2) they provide phenotypes that are too marginal to allow selection of the gene by genetic complementation or (3) they provide phenotypes that are laborious to score. We demonstrate the utility of this technique by isolating three genes, GAL83, SSN2 and MAK7, each of which presents one of these problems for cloning. PMID:8514124

PCR amplification of up to 35-kb DNA with high fidelity and high yield from lambda bacteriophage templates.

PubMed Central

Barnes, W M

1994-01-01

A target length limitation to PCR amplification of DNA has been identified and addressed. Concomitantly, the base-pair fidelity, the ability to use PCR products as primers, and the maximum yield of target fragment were increased. These improvements were achieved by the combination of a high level of an exonuclease-free, N-terminal deletion mutant of Taq DNA polymerase, Klentaq1, with a very low level of a thermostable DNA polymerase exhibiting a 3'-exonuclease activity (Pfu, Vent, or Deep Vent). At least 35 kb can be amplified to high yields from 1 ng of lambda DNA template. Images PMID:8134376

The Lambda Select cII Mutation Detection System.

PubMed

Besaratinia, Ahmad; Tommasi, Stella

2018-04-26

A number of transgenic animal models and mutation detection systems have been developed for mutagenicity testing of carcinogens in mammalian cells. Of these, transgenic mice and the Lambda (λ) Select cII Mutation Detection System have been employed for mutagenicity experiments by many research groups worldwide. Here, we describe a detailed protocol for the Lambda Select cII mutation assay, which can be applied to cultured cells of transgenic mice/rats or the corresponding animals treated with a chemical/physical agent of interest. The protocol consists of the following steps: (1) isolation of genomic DNA from the cells or organs/tissues of transgenic animals treated in vitro or in vivo, respectively, with a test compound; (2) recovery of the lambda shuttle vector carrying a mutational reporter gene (i.e., cII transgene) from the genomic DNA; (3) packaging of the rescued vectors into infectious bacteriophages; (4) infecting a host bacteria and culturing under selective conditions to allow propagation of the induced cII mutations; and (5) scoring the cII-mutants and DNA sequence analysis to determine the cII mutant frequency and mutation spectrum, respectively.

Salt-Dependent DNA-DNA Spacings in Intact Bacteriophage lambda Reflect Relative Importance of DNA Self-Repulsion and Bending Energies

DOE Office of Scientific and Technical Information (OSTI.GOV)

X Qiu; D Rau; V Parsegian

2011-12-31

Using solution synchrotron x-ray scattering, we measure the variation of DNA-DNA d spacings in bacteriophage {lambda} with mono-, di-, and polyvalent salt concentrations, for wild-type [48.5 x 10{sup 3} base pairs (bp)] and short-genome-mutant (37.8 kbp) strains. From the decrease in d spacings with increasing salt, we deduce the relative contributions of DNA self-repulsion and bending to the energetics of packaged phage genomes. We quantify the DNA-DNA interaction energies within the intact phage by combining the measured d spacings in the capsid with measurements of osmotic pressure in DNA assemblies under the same salt conditions in bulk solution. In themore » commonly used Tris-Mg buffer, the DNA-DNA interaction energies inside the phage capsids are shown to be about 1 kT/bp, an order of magnitude larger than the bending energies.« less

Human placenta: relative content of antibodies of different classes and subclasses (IgG1-IgG4) containing lambda- and kappa-light chains and chimeric lambda-kappa-immunoglobulins.

PubMed

Lekchnov, Evgenii A; Sedykh, Sergey E; Dmitrenok, Pavel S; Buneva, Valentina N; Nevinsky, Georgy A

2015-06-01

The specific organ placenta is much more than a filter: it is an organ that protects, feeds and regulates the growth of the embryo. Affinity chromatography, ELISA, SDS-PAGE and matrix-assisted laser desorption ionization mass spectrometry were used. Using 10 intact human placentas deprived of blood, a quantitative analysis of average relative content [% of total immunoglobulins (Igs)] was carried out for the first time: (92.7), IgA (2.4), IgM (2.5), kappa-antibodies (51.4), lambda-antibodies (48.6), IgG1 (47.0), IgG2 (39.5), IgG3 (8.8) and IgG4 (4.3). It was shown for the first time that placenta contains sIgA (2.5%). In the classic paradigm, Igs represent products of clonal B-cell populations, each producing antibodies recognizing a single antigen. There is a common belief that IgGs in mammalian biological fluids are monovalent molecules having stable structures and two identical antigen-binding sites. However, similarly to human milk Igs, placenta antibodies undergo extensive half-molecule exchange and the IgG pool consists of 43.5 ± 15.0% kappa-kappa-IgGs and 41.6 ± 17.0% lambda-lambda-IgGs, while 15.0 ± 4.0% of the IgGs contained both kappa- and lambda-light chains. Kappa-kappa-IgGs and lambda-lambda-IgGs contained, respectively (%): IgG1 (47.7 and 34.4), IgG2 (36.3 and 44.5), IgG3 (7.4 and 11.8) and IgG4 (7.5 and 9.1), while chimeric kappa-lambda-IgGs consisted of (%): 43.5 IgG1, 41.0 IgG2, 5.6 IgG3 and 7.9 IgG4. Our data are indicative of the possibility of half-molecule exchange between placenta IgGs of various subclasses, raised against different antigens, which explains a very well-known polyspecificity and cross-reactivity of different human IgGs. © The Japanese Society for Immunology. 2015. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Nuclease-resistant double-stranded DNA controls or standards for hepatitis B virus nucleic acid amplification assays

PubMed Central

2009-01-01

Background Identical blood samples tested using different kits can give markedly different hepatitis B virus (HBV) DNA levels, which can cause difficulty in the interpretation of viral load. A universal double-stranded DNA control or standard that can be used in all commercial HBV DNA nucleic acid amplification assay kits is urgently needed. By aligning all HBV genotypes (A-H), we found that the surface antigen gene and precore-core gene regions of HBV are the most conserved regions among the different HBV genotypes. We constructed a chimeric fragment by overlapping extension polymerase chain reaction and obtained a 1,349-bp HBVC+S fragment. We then packaged the fragment into lambda phages using a traditional lambda phage cloning procedure. Results The obtained armored DNA was resistant to DNase I digestion and was stable, noninfectious to humans, and could be easily extracted using commercial kits. More importantly, the armored DNA may be used with all HBV DNA nucleic acid amplification assay kits. Conclusions The lambda phage packaging system can be used as an excellent expression platform for armored DNA. The obtained armored DNA possessed all characteristics of an excellent positive control or standard. In addition, this armored DNA is likely to be appropriate for all commercial HBV DNA nucleic acid amplification detection kits. Thus, the constructed armored DNA can probably be used as a universal positive control or standard in HBV DNA assays. PMID:20025781

Requirement for XLF/Cernunnos in alignment-based gap filling by DNA polymerases lambda and mu for nonhomologous end joining in human whole-cell extracts.

PubMed

Akopiants, Konstantin; Zhou, Rui-Zhe; Mohapatra, Susovan; Valerie, Kristoffer; Lees-Miller, Susan P; Lee, Kyung-Jong; Chen, David J; Revy, Patrick; de Villartay, Jean-Pierre; Povirk, Lawrence F

2009-07-01

XLF/Cernunnos is a core protein of the nonhomologous end-joining pathway of DNA double-strand break repair. To better define the role of Cernunnos in end joining, whole-cell extracts were prepared from Cernunnos-deficient human cells. These extracts effected little joining of DNA ends with cohesive 5' or 3' overhangs, and no joining at all of partially complementary 3' overhangs that required gap filling prior to ligation. Assays in which gap-filled but unligated intermediates were trapped using dideoxynucleotides revealed that there was no gap filling on aligned DSB ends in the Cernunnos-deficient extracts. Recombinant Cernunnos protein restored gap filling and end joining of partially complementary overhangs, and stimulated joining of cohesive ends more than twentyfold. XLF-dependent gap filling was nearly eliminated by immunodepletion of DNA polymerase lambda, but was restored by addition of either polymerase lambda or polymerase mu. Thus, Cernunnos is essential for gap filling by either polymerase during nonhomologous end joining, suggesting that it plays a major role in aligning the two DNA ends in the repair complex.

Cypermethrin and lambda-cyhalothrin induced alterations in nucleic acids and protein contents in a freshwater fish, Channa punctatus.

PubMed

Kumar, Amit; Sharma, Bechan; Pandey, Ravi Shankar

2008-12-01

In this study, a freshwater fish Channa punctatus was exposed to subacute concentrations of synthetic pyrethroid insecticides (cypermethrin and lambda-cyhalothrin) for 96 h to evaluate their impact on the levels of nucleic acids and protein in its different organs. Significant enhancement in the level of DNA was recorded in all tissues of the fish at high concentration of cypermethrin, whereas RNA and protein contents increased in tissues at all concentrations of cypermethrin tested. In contrast, lambda-cyhalothrin treatment caused an increase in the level of DNA only in liver and brain, whereas increase of RNA and protein varied to different levels in different tissues. Cypermethrin treatment induced RNA/DNA ratio in all fish organs tested, whereas lambda-cyhalothrin caused a sharp decrease in the ratio. Protein/DNA ratios were found to be tissue specific in treatments with both of the insecticides. The results clearly indicated that both of these pyrethroids exerted their effects in a similar manner in fish liver but differed in other tissues. These insecticides acted as potential biomodulators in C. punctatus, though following different routes. The results may be an indicator of aquatic pollution affecting freshwater fauna and flora and thus signaling the need for strict regulation on the indiscriminate input of pyrethroids from agricultural sites.

Perturbation theory corrections to the two-particle reduced density matrix variational method.

PubMed

Juhasz, Tamas; Mazziotti, David A

2004-07-15

In the variational 2-particle-reduced-density-matrix (2-RDM) method, the ground-state energy is minimized with respect to the 2-particle reduced density matrix, constrained by N-representability conditions. Consider the N-electron Hamiltonian H(lambda) as a function of the parameter lambda where we recover the Fock Hamiltonian at lambda=0 and we recover the fully correlated Hamiltonian at lambda=1. We explore using the accuracy of perturbation theory at small lambda to correct the 2-RDM variational energies at lambda=1 where the Hamiltonian represents correlated atoms and molecules. A key assumption in the correction is that the 2-RDM method will capture a fairly constant percentage of the correlation energy for lambda in (0,1] because the nonperturbative 2-RDM approach depends more significantly upon the nature rather than the strength of the two-body Hamiltonian interaction. For a variety of molecules we observe that this correction improves the 2-RDM energies in the equilibrium bonding region, while the 2-RDM energies at stretched or nearly dissociated geometries, already highly accurate, are not significantly changed. At equilibrium geometries the corrected 2-RDM energies are similar in accuracy to those from coupled-cluster singles and doubles (CCSD), but at nonequilibrium geometries the 2-RDM energies are often dramatically more accurate as shown in the bond stretching and dissociation data for water and nitrogen. (c) 2004 American Institute of Physics.

Tertiary structure of human {Lambda}6 light chains.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pokkuluri, P. R.; Solomon, A.; Weiss, D. T.

1999-01-01

AL amyloidosis is a disease process characterized by the pathologic deposition of monoclonal light chains in tissue. To date, only limited information has been obtained on the molecular features that render such light chains amyloidogenic. Although protein products of the major human V kappa and V lambda gene families have been identified in AL deposits, one particular subgroup--lambda 6--has been found to be preferentially associated with this disease. Notably, the variable region of lambda 6 proteins (V lambda 6) has distinctive primary structural features including the presence in the third framework region (FR3) of two additional amino acid residues thatmore » distinguish members of this subgroup from other types of light chains. However, the structural consequences of these alterations have not been elucidated. To determine if lambda 6 proteins possess unique tertiary structural features, as compared to light chains of other V lambda subgroups, we have obtained x-ray diffraction data on crystals prepared from two recombinant V lambda 6 molecules. These components, isolated from a bacterial expression system, were generated from lambda 6-related cDNAs cloned from bone marrow-derived plasma cells from a patient (Wil) who had documented AL amyloidosis and another (Jto) with multiple myeloma and tubular cast nephropathy, but no evident fibrillar deposits. The x-ray crystallographic analyses revealed that the two-residue insertion located between positions 68 and 69 (not between 66 and 67 as previously surmised) extended an existing loop region that effectively increased the surface area adjacent to the first complementarity determining region (CDR1). Further, an unusual interaction between the Arg 25 and Phe 2 residues commonly found in lambda 6 molecules was noted. However, the structures of V lambda 6 Wil and Jto also differed from each other, as evidenced by the presence in the latter of certain ionic and hydrophobic interactions that we posit increased protein stability and thus prevented amyloid formation.« less

Concentration methods for high-resolution THz spectroscopy of nucleic-acid biomolecules and crystals

NASA Astrophysics Data System (ADS)

Brown, E. R.; Zhang, W.; Mendoza, E. A.; Kuznetsova, Y.; Brueck, S. R. J.; Rahman, M.; Norton, M. L.

2012-03-01

Biomolecules can exhibit low-lying vibrational modes in the THz region which are detectable in transmission given a strong molecular dipole moment and optical depth, and a spectrometer of adequate sensitivity. The nucleic acids are particularly interesting because of applications such as label-free gene assay, bio-agent detection, etc. However for nucleic acids, sample preparation and THz coupling are of paramount importance because of the strong absorption by liquid water and the small concentration of molecules present in physiological solutions. Concentration methods become necessary to make the THz vibrational modes detectable, either by concentrating the nucleic-acid sample itself in a small volume but large area, or by concentrating the THz radiation down to the volume of the sample. This paper summarizes one type of the first method: nanofluidic channel arrays for biological nucleic acids; and two types of the second method: (1) a circular-waveguide pinhole, and (2) a circular-waveguide, conical-horn coupling structure, both for DNA crystals. The first method has been demonstrated on a very short artificial nucleic acid [small-interfering (si) RNA (17-to-25 bp)] and a much longer, biological molecule [Lambda-phage DNA (48.5 kbp)]. The second method has been demonstrated on small (~100 micron) single crystals of DNA grown by the sitting-drop method.

A new and fast method for preparing high quality lambda DNA suitable for sequencing.

PubMed Central

Manfioletti, G; Schneider, C

1988-01-01

A method is described for the rapid purification of high quality lambda DNA. The method can be used from either liquid or plate lysates and on a small scale or a large scale. It relies on the preadsobtion of all polyanions present in the lysate to an "insoluble" anion-exchange matrix (DEAE or TEAE). Phage particles are then disrupted by combined treatment with EDTA/proteinase K and the resulting DNA is precipitated by the addition of the cationic detergent cetyl (or hexadecyl)-trimethyl ammonium bromide-CTAB ("soluble" anion-exchange matrix). The precipitated CTAB-DNA complex is then exchanged to Na-DNA and ethanol precipitated. The resultant purified DNA is suitable for enzymatic reactions and provides a high quality template for dideoxy-sequence analysis. Images PMID:2966928

Serum free light chains, interferon-alpha, and interleukins in systemic lupus erythematosus.

PubMed

Jolly, M; Francis, S; Aggarwal, R; Mikolaitis, R A; Niewold, T B; Chubinskaya, S; Block, J A; Scanzello, C; Sequeira, W

2014-08-01

Interleukin-6 (IL-6), interleukin-10 (IL-10), interferon-alpha (IFN-α), and free light chains (FLCs: lambda, kappa) have all been noted to be of importance in systemic lupus erythematosus (SLE). Herein, we quantified and explored the relationship between these inflammatory mediators and disease activity in SLE; and stratified by their current anti-dsDNA antibody status. Seventy-seven SLE patients underwent assessment of disease activity using the SLE disease activity index (SLEDAI). Serum FLC (lambda, kappa, and total), IL-6, IL-10, and IFN-α were quantified. Demographics of disease characteristics were determined by chart reviews. Statistical analyses included Mann-Whitney test, chi square, and linear regression analyses. Mean (SD) age of the patients was 44.9 ± 12.7 years; SLEDAI (mean ± SD) was 3.4 ± 4.0. Serum lambda FLC levels had a moderate correlation (r = 0.46 with physician global assessment, 0.44 with SLEDAI) and the strongest correlation with disease activity as compared with other inflammatory mediators including current dsDNA antibody status. After adjusting for prednisone use, the correlation of lambda FLC with PGA (r = 0.48) and SLEDAI (r = 0.52) was better than of current dsDNA antibody status with PGA (r = 0.33) and adjusted SLEDAI (r = 0.24), respectively. IL-10 and IFN-α activity did not correlate with disease activity. Serum FLC and IL-6 levels could differentiate between active and inactive SLE patients. Serum lambda FLC and IL-6 levels differed significantly among patients with and without current dsDNA antibodies. Serum lambda FLC levels accounted for 31% of variance in SLEDAI scores. Serum FLC and IL-6 are potentially useful biomarkers of disease activity in SLE. Further studies, with larger study sample and longitudinal design, are indicated. © The Author(s) 2014 Reprints and permissions: sagepub.co.uk/journalsPermissions.nav.

Role of DNA-DNA Interactions on the Structure and Thermodynamics of Bacteriophages Lambda and P4

PubMed Central

Petrov, Anton S.; Harvey, Stephen C.

2010-01-01

Electrostatic interactions play an important role in both packaging of DNA inside bacteriophages and its release into bacterial cells. While at physiological conditions DNA strands repel each other, the presence of polyvalent cations such as spermine and spermidine in solutions leads to the formation of DNA condensates. In this study, we discuss packaging of DNA into bacteriophages P4 and Lambda under repulsive and attractive conditions using a coarse-grained model of DNA and capsids. Packaging under repulsive conditions leads to the appearance of the coaxial spooling conformations; DNA occupies all available space inside the capsid. Under the attractive potential both packed systems reveal toroidal conformations, leaving the central part of the capsids empty. We also present a detailed thermodynamic analysis of packaging and show that the forces required to pack the genomes in the presence of polyamines are significantly lower than those observed under repulsive conditions. The analysis reveals that in both the repulsive and attractive regimes the entropic penalty of DNA confinement has a significant non-negligible contribution into the total energy of packaging. Additionally we report the results of simulations of DNA condensation inside partially packed Lambda. We found that at low densities DNA behaves as free unconfined polymer and condenses into the toroidal structures; at higher densities rearrangement of the genome into toroids becomes hindered, and condensation results in the formation of non-equilibrium structures. In all cases packaging in a specific conformation occurs as a result of interplay between bending stresses experienced by the confined polymer and interactions between the strands. PMID:21074621

Sequences of heavy and light chain variable regions from four bovine immunoglobulins.

PubMed

Armour, K L; Tempest, P R; Fawcett, P H; Fernie, M L; King, S I; White, P; Taylor, G; Harris, W J

1994-12-01

Oligodeoxyribonucleotide primers based on the 5' ends of bovine IgG1/2 and lambda constant (C) region genes, together with primers encoding conserved amino acids at the N-terminus of mature variable (V) regions from other species, have been used in cDNA and polymerase chain reactions (PCRs) to amplify heavy and light chain V region cDNA from bovine heterohybridomas. The amino acid sequences of VH and V lambda from four bovine immunoglobulins of different specificities are presented.

Total enantioselectivity in the DNA binding of the dinuclear ruthenium(II) complex [[Ru(Me2bpy)2]2(mu-bpm)]4+ [bpm = 2,2'-bipyrimidine; Me2bpy = 4,4'-dimethyl-2,2'-bipyridine].

PubMed

Smith, Jayden A; Collins, J Grant; Patterson, Bradley T; Keene, F Richard

2004-05-07

The binding of the three stereoisomers (DeltaDelta-, LambdaLambda- and DeltaLambda-) of the dinuclear ruthenium(II) complex [[Ru(Me2bpy)2]2(mu-bpm)]4+ [Me2bpy = 4,4'-dimethyl-2,2'-bipyridine; bpm = 2,2'-bipyrimidine] to a tridecanucleotide containing a single adenine bulge has been studied by 1H NMR spectroscopy. The addition of the DeltaDelta-isomer to d(CCGAGAATTCCGG)2 induced significant chemical shift changes for the base and sugar resonances of the residues at the bulge site (G3A4G5/C11C10), whereas small shifts were observed upon addition of the enantiomeric LambdaLambda-form. NOESY spectra of the tridecanucleotide bound with the DeltaDelta-isomer revealed intermolecular NOE's between the metal complex and the nucleotide residues at the bulge site, while only weak NOE's were observed to terminal residues to the LambdaLambda-form. Competitive binding studies were performed where both enantiomers were simultaneously added to the tridecanucleotide, and for all ratios of the two stereoisomers the DeltaDelta-isomer remained selectively bound at the bulge site with the LambdaLambda-enantiomer localised at the terminal regions of the tridecanucleotide. The meso-diastereoisomer (DeltaLambda) was found to bind to the tridecanucleotide with characteristics intermediate between the DeltaDelta- and LambdaLambda-enantiomers of the rac form. Two distinct sets of metal complex resonances were observed, with one set having essentially the same shift as the free metal complex, whilst the other set of resonances exhibited significant shifts. The NOE data indicated that the meso-diastereoisomer does not bind as selectively as the DeltaDelta-isomer, with NOE's observed to a greater number of nucleotide residues compared to the DeltaDelta-form. This study provides a rare example of total enantioselectivity in the binding of an inert transition metal complex to DNA, produced by the shape recognition of both ruthenium(II) centres.

Bacteriophage lambda: early pioneer and still relevant

PubMed Central

Casjens, Sherwood R.; Hendrix, Roger W.

2015-01-01

Molecular genetic research on bacteriophage lambda carried out during its golden age from the mid 1950's to mid 1980's was critically important in the attainment of our current understanding of the sophisticated and complex mechanisms by which the expression of genes is controlled, of DNA virus assembly and of the molecular nature of lysogeny. The development of molecular cloning techniques, ironically instigated largely by phage lambda researchers, allowed many phage workers to switch their efforts to other biological systems. Nonetheless, since that time the ongoing study of lambda and its relatives have continued to give important new insights. In this review we give some relevant early history and describe recent developments in understanding the molecular biology of lambda's life cycle. PMID:25742714

A minimal kinetic model for a viral DNA packaging machine.

PubMed

Yang, Qin; Catalano, Carlos Enrique

2004-01-20

Terminase enzymes are common to both eukaryotic and prokaryotic double-stranded DNA viruses. These enzymes possess ATPase and nuclease activities that work in concert to "package" a viral genome into an empty procapsid, and it is likely that terminase enzymes from disparate viruses utilize a common packaging mechanism. Bacteriophage lambda terminase possesses a site-specific nuclease activity, a so-called helicase activity, a DNA translocase activity, and multiple ATPase catalytic sites that function to package viral DNA. Allosteric interactions between the multiple catalytic sites have been reported. This study probes these catalytic interactions using enzyme kinetic, photoaffinity labeling, and vanadate inhibition studies. The ensemble of data forms the basis for a minimal kinetic model for lambda terminase. The model incorporates an ADP-driven conformational reorganization of the terminase subunits assembled on viral DNA, which is central to the activation of a catalytically competent packaging machine. The proposed model provides a unifying mechanism for allosteric interaction between the multiple catalytic sites of the holoenzyme and explains much of the kinetic data in the literature. Given that similar packaging mechanisms have been proposed for viruses as dissimilar as lambda and the herpes viruses, the model may find general utility in our global understanding of the enzymology of virus assembly.

General transfer matrix formalism to calculate DNA-protein-drug binding in gene regulation: application to OR operator of phage lambda.

PubMed

Teif, Vladimir B

2007-01-01

The transfer matrix methodology is proposed as a systematic tool for the statistical-mechanical description of DNA-protein-drug binding involved in gene regulation. We show that a genetic system of several cis-regulatory modules is calculable using this method, considering explicitly the site-overlapping, competitive, cooperative binding of regulatory proteins, their multilayer assembly and DNA looping. In the methodological section, the matrix models are solved for the basic types of short- and long-range interactions between DNA-bound proteins, drugs and nucleosomes. We apply the matrix method to gene regulation at the O(R) operator of phage lambda. The transfer matrix formalism allowed the description of the lambda-switch at a single-nucleotide resolution, taking into account the effects of a range of inter-protein distances. Our calculations confirm previously established roles of the contact CI-Cro-RNAP interactions. Concerning long-range interactions, we show that while the DNA loop between the O(R) and O(L) operators is important at the lysogenic CI concentrations, the interference between the adjacent promoters P(R) and P(RM) becomes more important at small CI concentrations. A large change in the expression pattern may arise in this regime due to anticooperative interactions between DNA-bound RNA polymerases. The applicability of the matrix method to more complex systems is discussed.

[A case of IgA2-lambda type M-protein that IgA concentration differs from the values of M-protein by serum protein electrophoresis].

PubMed

Fukushima, M; Sugano, M; Ichikawa, T; Honda, T; Totsuka, M; Katsuyama, T; Fujita, K

2001-07-01

We report an IgA-lambda type M-protein in which the IgA concentration differed from the values of M-protein by serum protein electrophoresis found in a 53-year-old man with multiple myeloma. The M-protein value as determined by serum protein electrophoresis was 6,170 mg/dl. However, the serum IgA concentration was 3,052 mg/dl by turbidimetric immunoassay. Immuno-fixation electrophoresis using IgA subclass antisera revealed that this M-protein was the IgA2-lambda type. Western blotting analysis showed that the IgA2 molecules were composed of two approximately 68 kDa alpha 2 chains and two 28 kDa lambda chains. In addition the free lambda chain band was detected at the position of 28 kDa without 2-mercaptoethanol(2-ME) even though the patient IgA was purified. Since it is known that IgA2m(1) allotype easily release light chains from the IgA molecules in SDS-PAGE without 2-ME, we speculated that in this patient the IgA was the IgA2m(1) allotype. After peripheral blood stem cell transplantation(PBSCT), immunofixation electrophoresis of the patient serum revealed not only the bands of IgA2-lambda type M-protein, but also three bands of IgG1-kappa type M-protein in the gamma region.

A single amino acid substitution in the variable region of the light chain specifically blocks immunoglobulin secretion.

PubMed Central

Dul, J L; Argon, Y

1990-01-01

Although immunoglobulin light chains are usually secreted in association with heavy chains, free light chains can be secreted by lymphocytes. To identify the structural features of light chains that are essential for their secretion, we mutated a conserved sequence in the variable domain of a lambda I light chain. The effects of the mutations on secretion were assayed by transient expression in COS-1 cells. One mutant (AV60), which replaced Ala-60 with Val, was secreted as efficiently as wild-type lambda I by transfected COS-1 cells. This result was not surprising because secreted lambda II chains contain valine in this position. However, a second lambda I mutant (AV60FS62), which replaced Phe-62 with Ser as well as Ala-60 with Val, was not secreted. This mutant was arrested in the endoplasmic reticulum, as judged by immunofluorescence and by its association with a lumenal endoplasmic reticulum protein, immunoglobulin heavy chain binding protein (BiP). The defect in secretion was not due to gross misfolding of the lambda I chain, since cells cotransfected with AV60FS62 and an immunoglobulin heavy chain gene produced functional antigen-binding antibodies. These assembled IgM molecules were still not secreted. Hence, the replacement of Phe-62 with Ser specifically affects a determinant on the lambda I light chain that is necessary for the intracellular transport of this molecule. Images PMID:2122454

DNA unzipping phase diagram calculated via replica theory.

PubMed

Roland, C Brian; Hatch, Kristi Adamson; Prentiss, Mara; Shakhnovich, Eugene I

2009-05-01

We show how single-molecule unzipping experiments can provide strong evidence that the zero-force melting transition of long molecules of natural dsDNA should be classified as a phase transition of the higher-order type (continuous). Toward this end, we study a statistical-mechanics model for the fluctuating structure of a long molecule of dsDNA, and compute the equilibrium phase diagram for the experiment in which the molecule is unzipped under applied force. We consider a perfect-matching dsDNA model, in which the loops are volume-excluding chains with arbitrary loop exponent c . We include stacking interactions, hydrogen bonds, and main-chain entropy. We include sequence heterogeneity at the level of random sequences; in particular, there is no correlation in the base-pairing (bp) energy from one sequence position to the next. We present heuristic arguments to demonstrate that the low-temperature macrostate does not exhibit degenerate ergodicity breaking. We use this claim to understand the results of our replica-theoretic calculation of the equilibrium properties of the system. As a function of temperature, we obtain the minimal force at which the molecule separates completely. This critical-force curve is a line in the temperature-force phase diagram that marks the regions where the molecule exists primarily as a double helix versus the region where the molecule exists as two separate strands. We compare our random-sequence model to magnetic tweezer experiments performed on the 48 502 bp genome of bacteriophage lambda . We find good agreement with the experimental data, which is restricted to temperatures between 24 and 50 degrees C . At higher temperatures, the critical-force curve of our random-sequence model is very different for that of the homogeneous-sequence version of our model. For both sequence models, the critical force falls to zero at the melting temperature T_{c} like |T-T_{c}|;{alpha} . For the homogeneous-sequence model, alpha=1/2 almost exactly, while for the random-sequence model, alpha approximately 0.9 . Importantly, the shape of the critical-force curve is connected, via our theory, to the manner in which the helix fraction falls to zero at T_{c} . The helix fraction is the property that is used to classify the melting transition as a type of phase transition. In our calculation, the shape of the critical-force curve holds strong evidence that the zero-force melting transition of long natural dsDNA should be classified as a higher-order (continuous) phase transition. Specifically, the order is 3rd or greater.

Investigation of interaction between magnetic silica particles and lambda phage DNA fragment.

PubMed

Smerkova, Kristyna; Dostalova, Simona; Vaculovicova, Marketa; Kynicky, Jindrich; Trnkova, Libuse; Kralik, Miroslav; Adam, Vojtech; Hubalek, Jaromir; Provaznik, Ivo; Kizek, Rene

2013-12-01

Nucleic acids belong to the most important molecules and therefore the understanding of their properties, function and behavior is crucial. Even though a range of analytical and biochemical methods have been developed for this purpose, one common step is essential for all of them - isolation of the nucleic acid from the from complex sample matrix. The use of magnetic particles for the separation of nucleic acids has many advantages over other isolation methods. In this study, an isolation procedure for extraction of DNA was optimized. Each step of the isolation process including washing, immobilization and elution was optimized and therefore the efficiency was increased from 1.7% to 28.7% and the total time was shortened from 75 to 30min comparing to the previously described method. Quantification of the particular parameter influence was performed by square-wave voltammetry using hanging drop mercury electrode. Further, we compared the optimized method with standard chloroform extraction and applied on isolation of DNA from Staphylococcus aureus and Escherichia coli. Copyright © 2013 Elsevier B.V. All rights reserved.

[Excitation transfer between high-lying states in K2 in collisions with ground state K and H2 molecules].

PubMed

Shen, Xiao-Yan; Liu, Jing; Dai, Kang; Shen, Yi-Fan

2010-02-01

Pure potassium vapor or K-H2 mixture was irradiated in a glass fluorescence cell with pulses of 710 nm radiation from an OPO laser, populating K2 (1lambda(g)) state by two-photon absorption. Cross sections for 1lambda(g)-3lambda(g) transfer in K2 were determined using methods of molecular fluorescence. During the experiments with pure K vapor, the cell temperature was varied between 553 and 603 K. The K number density was determined spectroscopically by the white-light absorption measurement in the blue wing of the self-broadened resonance D2 line. The resulting fluorescence included a direct component emitted in the decay of the optically excitation and a sensitized component arising from the collisionally populated state. The decay signal of time-resolved fluorescence from1lambda(g) -->1 1sigma(u)+ transition was monitored. It was seen that just after the laser pulse the fluorescence of the photoexcited level decreased exponentially. The effective lifetimes of the 1lambda(g) state can be resolved. The plot of reciprocal of effective lifetimes of the 1lambda(g) state against K densities yielded the slope that indicated the total cross section for deactivation and the intercept that provided the radiative lifetime of the state. The radiative lifetime (20 +/- 2) ns was obtained. The cross section for deactivation of the K2(1lambda(g)) molecules by collisions with K is (2.5 +/- 0.3) x 10(-14) cm2. The time-resolved intensities of the K23lambda(g) --> 1 3sigma(u)+ (484 nm) line were measured. The radiative lifetime (16.0 +/- 3.2) ns and the total cross section (2.5 +/- 0.6) x 10(-14) cm2 for deactivation of the K2 (3lambda(g)) state can also be determined through the analogous procedure. The time-integrated intensities of 1lambda(g) --> 1 1sigma(u)+ and 3lambda(g) --> 1 3sigma(u)+ transitions were measured. The cross section (1.1 +/- 0.3) x10(-14) cm2 was obtained for K2 (1lambda(g))+ K --> K2 (3lambda(g)) + K collisions. During the experiments with K-H2 mixture, the cell temperature was kept constant at 553 K. The H2 pressure was varied between 40 and 400 Pa. The effects of K2-K collisions could not be neglected. These effects were subtracted out using the results of the pure K experiments. The cross section (2.7 +/- 1.1) x 10(-15) cm2 was obtained for K2 (1lambda(g)) + H2 --> K2 (3lambda(g))+H2 collisions. The cross section is (6.8 +/- 2.7) x 10(-15) cm2 for K2 (3lambda(g)) + H2 --> states out of K2 (3lambda(g)) + H2 collisions.

Study of the growth and pyroelectric properties of TGS crystals doped with aniline-family dipolar molecules

NASA Astrophysics Data System (ADS)

Zhang, Kecong; Song, Jiancheng; Wang, Min; Fang, Changshui; Lu, Mengkai

1987-04-01

TGS crystals doped with aniline-family dipolar molecules (aniline, 2-aminobenzoic acid, 3-aminobenzoic acid, 3-aminobenzene-sulphonic acid, 4-aminobenzenesulphonic acid and 4-nitroraniline) have been grown by the slow-cooling solution method. The influence of these dopants on the growth habits, crystal morphology pyroelectric properties, and structure parameters of TGS crystals has been systematically investigated. The effects of the domain structure of the seed crystal on the pyroelectric properties of the doped crystals have been studied. It is found that the spontaneous polarization (P), pyroelectric coefficient (lambda), and internal bias field of the doped crystals are slightly higher than those of the pure TGS, and the larger the dipole moment of the dopant molecule, the higher the P and lambda of the doped TGS crystal.

Improved Analysis of Nanopore Sequence Data and Scanning Nanopore Techniques

NASA Astrophysics Data System (ADS)

Szalay, Tamas

The field of nanopore research has been driven by the need to inexpensively and rapidly sequence DNA. In order to help realize this goal, this thesis describes the PoreSeq algorithm that identifies and corrects errors in real-world nanopore sequencing data and improves the accuracy of de novo genome assembly with increasing coverage depth. The approach relies on modeling the possible sources of uncertainty that occur as DNA advances through the nanopore and then using this model to find the sequence that best explains multiple reads of the same region of DNA. PoreSeq increases nanopore sequencing read accuracy of M13 bacteriophage DNA from 85% to 99% at 100X coverage. We also use the algorithm to assemble E. coli with 30X coverage and the lambda genome at a range of coverages from 3X to 50X. Additionally, we classify sequence variants at an order of magnitude lower coverage than is possible with existing methods. This thesis also reports preliminary progress towards controlling the motion of DNA using two nanopores instead of one. The speed at which the DNA travels through the nanopore needs to be carefully controlled to facilitate the detection of individual bases. A second nanopore in close proximity to the first could be used to slow or stop the motion of the DNA in order to enable a more accurate readout. The fabrication process for a new pyramidal nanopore geometry was developed in order to facilitate the positioning of the nanopores. This thesis demonstrates that two of them can be placed close enough to interact with a single molecule of DNA, which is a prerequisite for being able to use the driving force of the pores to exert fine control over the motion of the DNA. Another strategy for reading the DNA is to trap it completely with one pore and to move the second nanopore instead. To that end, this thesis also shows that a single strand of immobilized DNA can be captured in a scanning nanopore and examined for a full hour, with data from many scans at many different voltages obtained in order to detect a bound protein placed partway along the molecule.

Use of lambda pMu bacteriophages to isolate lambda specialized transducing bacteriophages carrying genes for bacterial chemotaxis.

PubMed

Kondoh, H; Paul, B R; Howe, M M

1980-09-01

A general method for constructing lambda specialized transducing phages is described. The method, which is potentially applicable to any gene of Escherichia coli, is based on using Mu DNA homology to direct the integration of a lambda pMu phage near the genes whose transduction is desired. With this method we isolated a lambda transducing phage carrying all 10 genes in the che gene cluster (map location, 41.5 to 42.5 min). The products of the cheA and tar genes were identified by using transducing phages with amber mutations in these genes. It was established that tar codes for methyl-accepting chemotaxis protein II (molecular weight, 62,000) and that cheA codes for two polypeptides (molecular weights, 76,000 and 66,000). Possible origins of the two cheA polypeptides are discussed.

Single Molecule Study of DNA Organization and Recombination

NASA Astrophysics Data System (ADS)

Xiao, Botao

We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force, which depends on salt concentration. We also report experiments with the recombinase Hin mutant H107Y. The synapse formation is demonstrated with single DNA containing two hix sites. We further show preliminary data for cleavage and subunit rotation from a braiding assay. These direct observations elucidate the recombination mechanism.

Cypermethrin and lambda-cyhalothrin induced in vivo alterations in nucleic acids and protein contents in a freshwater catfish, Clarias batrachus (Linnaeus; Family-Clariidae).

PubMed

Kumar, Amit; Sharma, Bechan; Pandey, Ravi S

2009-08-01

The fresh water fish, Clarias batrachus, were exposed to sub-acute concentrations of cypermethrin and lambda-cyhalothrin for 96 h to assess their impact on the levels of nucleic acids and protein in different organs of fish. DNA content was found almost unchanged with a single exception of liver, which showed significant increment in the levels of DNA in response to the separate treatments of both compounds. Both RNA and protein contents declined in brain, liver, and muscle while sharp increase was observed in gills. However, in kidney, RNA contents depicted significant enhancement only at higher concentrations, with initial decline at lower concentrations. The trends of alterations in RNA/DNA and protein/DNA ratios were quite similar to the corresponding results explained above for RNA and protein. The results clearly indicated that both of these pyrethroids exerted their effects at transcriptional and translational levels while DNA synthesis was found to be unaffected by these compounds with an exception of liver.

5' modification of duplex DNA with a ruthenium electron donor-acceptor pair using solid-phase DNA synthesis

NASA Technical Reports Server (NTRS)

Frank, Natia L.; Meade, Thomas J.

2003-01-01

Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.

Characterization of proviruses cloned from mink cell focus-forming virus-infected cellular DNA.

PubMed Central

Khan, A S; Repaske, R; Garon, C F; Chan, H W; Rowe, W P; Martin, M A

1982-01-01

Two proviruses were cloned from EcoRI-digested DNA extracted from mink cells chronically infected with AKR mink cell focus-forming (MCF) 247 murine leukemia virus (MuLV), using a lambda phage host vector system. One cloned MuLV DNA fragment (designated MCF 1) contained sequences extending 6.8 kilobases from an EcoRI restriction site in the 5' long terminal repeat (LTR) to an EcoRI site located in the envelope (env) region and was indistinguishable by restriction endonuclease mapping for 5.1 kilobases (except for the EcoRI site in the LTR) from the 5' end of AKR ecotropic proviral DNA. The DNA segment extending from 5.1 to 6.8 kilobases contained several restriction sites that were not present in the AKR ecotropic provirus. A 0.5-kilobase DNA segment located at the 3' end of MCF 1 DNA contained sequences which hybridized to a xenotropic env-specific DNA probe but not to labeled ecotropic env-specific DNA. This dual character of MCF 1 proviral DNA was also confirmed by analyzing heteroduplex molecules by electron microscopy. The second cloned proviral DNA (designated MCF 2) was a 6.9-kilobase EcoRI DNA fragment which contained LTR sequences at each end and a 2.0-kilobase deletion encompassing most of the env region. The MCF 2 proviral DNA proved to be a useful reagent for detecting LTRs electron microscopically due to the presence of nonoverlapping, terminally located LTR sequences which effected its circularization with DNAs containing homologous LTR sequences. Nucleotide sequence analysis demonstrated the presence of a 104-base-pair direct repeat in the LTR of MCF 2 DNA. In contrast, only a single copy of the reiterated component of the direct repeat was present in MCF 1 DNA. Images PMID:6281459

Gene doctoring: a method for recombineering in laboratory and pathogenic Escherichia coli strains.

PubMed

Lee, David J; Bingle, Lewis E H; Heurlier, Karin; Pallen, Mark J; Penn, Charles W; Busby, Stephen J W; Hobman, Jon L

2009-12-09

Homologous recombination mediated by the lambda-Red genes is a common method for making chromosomal modifications in Escherichia coli. Several protocols have been developed that differ in the mechanisms by which DNA, carrying regions homologous to the chromosome, are delivered into the cell. A common technique is to electroporate linear DNA fragments into cells. Alternatively, DNA fragments are generated in vivo by digestion of a donor plasmid with a nuclease that does not cleave the host genome. In both cases the lambda-Red gene products recombine homologous regions carried on the linear DNA fragments with the chromosome. We have successfully used both techniques to generate chromosomal mutations in E. coli K-12 strains. However, we have had limited success with these lambda-Red based recombination techniques in pathogenic E. coli strains, which has led us to develop an enhanced protocol for recombineering in such strains. Our goal was to develop a high-throughput recombineering system, primarily for the coupling of genes to epitope tags, which could also be used for deletion of genes in both pathogenic and K-12 E. coli strains. To that end we have designed a series of donor plasmids for use with the lambda-Red recombination system, which when cleaved in vivo by the I-SceI meganuclease generate a discrete linear DNA fragment, allowing for C-terminal tagging of chromosomal genes with a 6xHis, 3xFLAG, 4xProteinA or GFP tag or for the deletion of chromosomal regions. We have enhanced existing protocols and technologies by inclusion of a cassette conferring kanamycin resistance and, crucially, by including the sacB gene on the donor plasmid, so that all but true recombinants are counter-selected on kanamycin and sucrose containing media, thus eliminating the need for extensive screening. This method has the added advantage of limiting the exposure of cells to the potential damaging effects of the lambda-Red system, which can lead to unwanted secondary alterations to the chromosome. We have developed a counter-selective recombineering technique for epitope tagging or for deleting genes in E. coli. We have demonstrated the versatility of the technique by modifying the chromosome of the enterohaemorrhagic O157:H7 (EHEC), uropathogenic CFT073 (UPEC), enteroaggregative O42 (EAEC) and enterotoxigenic H10407 (ETEC) E. coli strains as well as in K-12 laboratory strains.

Content and persistence of extracellular DNA in native soils

NASA Astrophysics Data System (ADS)

Blagodatskaya, Evgenia; Blagodatsky, Sergey; Anderson, Traute-Heidi; Kuzyakov, Yakov

2014-05-01

The long-term persistence of soil extracellular DNA is questionable because of high potential activity of nucleases produced by soil microorganisms. By the other hand, the relative persistence of DNA-like biopolymers could be due to their adsorption on clay minerals and humus substances in soil. High-specific and ultra sensitive reagent PicoGreenTM (Molecular Probes) permits the quantitative assessment of microbial dsDNA in diluted soil extracts giving a good tool for tracing the DNA fate in soil. Our goal was to determine intracellular and extracellular DNA content in cambisol (loamy sand) and in chernozem (silty loam) soils and to investigate the possible adsorption and degradation of extracellular DNA in soil. Optimized procedure of mechanical and enzymatic destruction of cell walls was used for direct extraction of microbial DNA with Tris-EDTA buffer (Blagodatskaya et al., 2003). Extracellular dsDNA was determined in distilled water and in Tris-EDTA extracts without enzymatic or mechanical treatments. DNA content was determined after addition of PicoGreen to diluted soil extracts. Degradation of extracellular DNA was traced during 24 h incubation of 2 µg lambda-phage DNA in soil. Possible DNA adsorption to soil matrix was determined by recovery of lambda -phage DNA added to autoclaved soil. Extracellular dsDNA was absent in water extracts of both soils. The content of extracellular dsDNA extracted by Tris-EDTA buffer was 0.46 µg/g in chernozem and 1.59 µg/g in cambisol amounting 0.43 and 2.8% of total dsDNA content in these soils, respectively. 100% and 64.8% of added extracellular lambda -phage dsDNA was found in cambisol and chernozem soils, respectively, in 5 h after application. 39% and 73.5% of added DNA disappeared in cambisol and in chernozem, respectively, during 24 h incubation. Degradation rate of extracellular DNA depended on microbial biomass content, which was 2.5 times higher in chernozem as compared to cambisol. Maximum adsorption of DNA by soils was observed in cambisol and reached 2.7% of added amount. We speculate that probability of gene transfer could be rather high in soils, taking into account possible increase of extracellular DNA content after transient environmental events (i.e. drying - rewetting and freezing - thawing).

High-resolution hydrodynamic chromatographic separation of large DNA using narrow, bare open capillaries: a rapid and economical alternative technology to pulsed-field gel electrophoresis?

PubMed

Liu, Lei; Veerappan, Vijaykumar; Pu, Qiaosheng; Cheng, Chang; Wang, Xiayan; Lu, Liping; Allen, Randy D; Guo, Guangsheng

2014-01-07

A high-resolution, rapid, and economical hydrodynamic chromatographic (HDC) method for large DNA separations in free solution was developed using narrow (5 μm diameter), bare open capillaries. Size-based separation was achieved in a chromatographic format with larger DNA molecules being eluting faster than smaller ones. Lambda DNA Mono Cut Mix was baseline-separated with the percentage resolutions generally less than 9.0% for all DNA fragments (1.5 to 48.5 kbp) tested in this work. High efficiencies were achieved for large DNA from this chromatographic technique, and the number of theoretical plates reached 3.6 × 10(5) plates for the longest (48.5 kbp) and 3.7 × 10(5) plates for the shortest (1.5 kbp) fragments. HDC parameters and performances were also discussed. The method was further applied for fractionating large DNA fragments from real-world samples (SacII digested Arabidopsis plant bacterial artificial chromosome (BAC) DNA and PmeI digested Rice BAC DNA) to demonstrate its feasibility for BAC DNA finger printing. Rapid separation of PmeI digested Rice BAC DNA covering from 0.44 to 119.041 kbp was achieved in less than 26 min. All DNA fragments of these samples were baseline separated in narrow bare open capillaries, while the smallest fragment (0.44 kbp) was missing in pulsed-field gel electrophoresis (PFGE) separation mode. It is demonstrated that narrow bare open capillary chromatography can realize a rapid separation for a wide size range of DNA mixtures that contain both small and large DNA fragments in a single run.

Immobilization of lambda exonuclease onto polymer micropillar arrays for the solid-phase digestion of dsDNAs.

PubMed

Oliver-Calixte, Nyoté J; Uba, Franklin I; Battle, Katrina N; Weerakoon-Ratnayake, Kumuditha M; Soper, Steven A

2014-05-06

The process of immobilizing enzymes onto solid supports for bioreactions has some compelling advantages compared to their solution-based counterpart including the facile separation of enzyme from products, elimination of enzyme autodigestion, and increased enzyme stability and activity. We report the immobilization of λ-exonuclease onto poly(methylmethacrylate) (PMMA) micropillars populated within a microfluidic device for the on-chip digestion of double-stranded DNA. Enzyme immobilization was successfully accomplished using 3-(3-dimethylaminopropyl) carbodiimide/N-hydroxysuccinimide (EDC/NHS) coupling to carboxylic acid functionalized PMMA micropillars. Our results suggest that the efficiency for the catalysis of dsDNA digestion using λ-exonuclease, including its processivity and reaction rate, were higher when the enzyme was attached to a solid support compared to the free solution digestion. We obtained a clipping rate of 1.0 × 10(3) nucleotides s(-1) for the digestion of λ-DNA (48.5 kbp) by λ-exonuclease. The kinetic behavior of the solid-phase reactor could be described by a fractal Michaelis-Menten model with a catalytic efficiency nearly 17% better than the homogeneous solution-phase reaction. The results from this work will have important ramifications in new single-molecule DNA sequencing strategies that employ free mononucleotide identification.

Packaging of a unit-length viral genome: the role of nucleotides and the gpD decoration protein in stable nucleocapsid assembly in bacteriophage lambda.

PubMed

Yang, Qin; Maluf, Nasib Karl; Catalano, Carlos Enrique

2008-11-28

The developmental pathways for a variety of eukaryotic and prokaryotic double-stranded DNA viruses include packaging of viral DNA into a preformed procapsid structure, catalyzed by terminase enzymes and fueled by ATP hydrolysis. In most instances, a capsid expansion process accompanies DNA packaging, which significantly increases the volume of the capsid to accommodate the full-length viral genome. "Decoration" proteins add to the surface of the expanded capsid lattice, and the terminase motors tightly package DNA, generating up to approximately 20 atm of internal capsid pressure. Herein we describe biochemical studies on genome packaging using bacteriophage lambda as a model system. Kinetic analysis suggests that the packaging motor possesses at least four ATPase catalytic sites that act cooperatively to effect DNA translocation, and that the motor is highly processive. While not required for DNA translocation into the capsid, the phage lambda capsid decoration protein gpD is essential for the packaging of the penultimate 8-10 kb (15-20%) of the viral genome; virtually no DNA is packaged in the absence of gpD when large DNA substrates are used, most likely due to a loss of capsid structural integrity. Finally, we show that ATP hydrolysis is required to retain the genome in a packaged state subsequent to condensation within the capsid. Presumably, the packaging motor continues to "idle" at the genome end and to maintain a positive pressure towards the packaged state. Surprisingly, ADP, guanosine triphosphate, and the nonhydrolyzable ATP analog 5'-adenylyl-beta,gamma-imidodiphosphate (AMP-PNP) similarly stabilize the packaged viral genome despite the fact that they fail to support genome packaging. In contrast, the poorly hydrolyzed ATP analog ATP-gammaS only partially stabilizes the nucleocapsid, and a DNA is released in "quantized" steps. We interpret the ensemble of data to indicate that (i) the viral procapsid possesses a degree of plasticity that is required to accommodate the packaging of large DNA substrates; (ii) the gpD decoration protein is required to stabilize the fully expanded capsid; and (iii) nucleotides regulate high-affinity DNA binding interactions that are required to maintain DNA in the packaged state.

Noncanonical substrate preference of lambda exonuclease for 5'-nonphosphate-ended dsDNA and a mismatch-induced acceleration effect on the enzymatic reaction.

PubMed

Wu, Tongbo; Yang, Yufei; Chen, Wei; Wang, Jiayu; Yang, Ziyu; Wang, Shenlin; Xiao, Xianjin; Li, Mengyuan; Zhao, Meiping

2018-04-06

Lambda exonuclease (λ exo) plays an important role in the resection of DNA ends for DNA repair. Currently, it is also a widely used enzymatic tool in genetic engineering, DNA-binding protein mapping, nanopore sequencing and biosensing. Herein, we disclose two noncanonical properties of this enzyme and suggest a previously undescribed hydrophobic interaction model between λ exo and DNA substrates. We demonstrate that the length of the free portion of the substrate strand in the dsDNA plays an essential role in the initiation of digestion reactions by λ exo. A dsDNA with a 5' non-phosphorylated, two-nucleotide-protruding end can be digested by λ exo with very high efficiency. Moreover, we show that when a conjugated structure is covalently attached to an internal base of the dsDNA, the presence of a single mismatched base pair at the 5' side of the modified base may significantly accelerate the process of digestion by λ exo. A detailed comparison study revealed additional π-π stacking interactions between the attached label and the amino acid residues of the enzyme. These new findings not only broaden our knowledge of the enzyme but will also be very useful for research on DNA repair and in vitro processing of nucleic acids.

A kinetic analysis of DNA ejection from tailed phages revealing the prerequisite activation energy.

PubMed

Raspaud, Eric; Forth, Thomas; São-José, Carlos; Tavares, Paulo; de Frutos, Marta

2007-12-01

All tailed bacteriophages follow the same general scheme of infection: they bind to their specific host receptor and then transfer their genome into the bacterium. DNA translocation is thought to be initiated by the strong pressure due to DNA packing inside the capsid. However, the exact mechanism by which each phage controls its DNA ejection remains unknown. Using light scattering, we analyzed the kinetics of in vitro DNA release from phages SPP1 and lambda (Siphoviridae family) and found a simple exponential decay. The ejection characteristic time was studied as a function of the temperature and found to follow an Arrhenius law, allowing us to determine the activation energy that governs DNA ejection. A value of 25-30 kcal/mol is obtained for SPP1 and lambda, comparable to the one measured in vitro for T5 (Siphoviridae) and in vivo for T7 (Podoviridae). This suggests similar mechanisms of DNA ejection control. In all tailed phages, the opening of the connector-tail channel is needed for DNA release and could constitute the limiting step. The common value of the activation energy likely reflects the existence for all phages of an optimum value, ensuring a compromise between efficient DNA delivery and high stability of the virus.

The protein interaction map of bacteriophage lambda

PubMed Central

2011-01-01

Background Bacteriophage lambda is a model phage for most other dsDNA phages and has been studied for over 60 years. Although it is probably the best-characterized phage there are still about 20 poorly understood open reading frames in its 48-kb genome. For a complete understanding we need to know all interactions among its proteins. We have manually curated the lambda literature and compiled a total of 33 interactions that have been found among lambda proteins. We set out to find out how many protein-protein interactions remain to be found in this phage. Results In order to map lambda's interactions, we have cloned 68 out of 73 lambda open reading frames (the "ORFeome") into Gateway vectors and systematically tested all proteins for interactions using exhaustive array-based yeast two-hybrid screens. These screens identified 97 interactions. We found 16 out of 30 previously published interactions (53%). We have also found at least 18 new plausible interactions among functionally related proteins. All previously found and new interactions are combined into structural and network models of phage lambda. Conclusions Phage lambda serves as a benchmark for future studies of protein interactions among phage, viruses in general, or large protein assemblies. We conclude that we could not find all the known interactions because they require chaperones, post-translational modifications, or multiple proteins for their interactions. The lambda protein network connects 12 proteins of unknown function with well characterized proteins, which should shed light on the functional associations of these uncharacterized proteins. PMID:21943085

Architecture of the 99 bp DNA-six-protein regulatory complex of the lambda att site.

PubMed

Sun, Xingmin; Mierke, Dale F; Biswas, Tapan; Lee, Sang Yeol; Landy, Arthur; Radman-Livaja, Marta

2006-11-17

The highly directional and tightly regulated recombination reaction used to site-specifically excise the bacteriophage lambda chromosome out of its E. coli host chromosome requires the binding of six sequence-specific proteins to a 99 bp segment of the phage att site. To gain structural insights into this recombination pathway, we measured 27 FRET distances between eight points on the 99 bp regulatory DNA bound with all six proteins. Triangulation of these distances using a metric matrix distance-geometry algorithm provided coordinates for these eight points. The resulting path for the protein-bound regulatory DNA, which fits well with the genetics, biochemistry, and X-ray crystal structures describing the individual proteins and their interactions with DNA, provides a new structural perspective into the molecular mechanism and regulation of the recombination reaction and illustrates a design by which different families of higher-order complexes can be assembled from different numbers and combinations of the same few proteins.

Phage-induced lysis enhances biofilm formation in Shewanella oneidensis MR-1

PubMed Central

Gödeke, Julia; Paul, Kristina; Lassak, Jürgen; Thormann, Kai M

2011-01-01

Shewanella oneidensis MR-1 is capable of forming highly structured surface-attached communities. By DNase I treatment, we demonstrated that extracellular DNA (eDNA) serves as a structural component in all stages of biofilm formation under static and hydrodynamic conditions. We determined whether eDNA is released through cell lysis mediated by the three prophages LambdaSo, MuSo1 and MuSo2 that are harbored in the genome of S. oneidensis MR-1. Mutant analyses and infection studies revealed that all three prophages may individually lead to cell lysis. However, only LambdaSo and MuSo2 form infectious phage particles. Phage release and cell lysis already occur during early stages of static incubation. A mutant devoid of the prophages was significantly less prone to lysis in pure culture. In addition, the phage-less mutant was severely impaired in biofilm formation through all stages of development, and three-dimensional growth occurred independently of eDNA as a structural component. Thus, we suggest that in S. oneidensis MR-1 prophage-mediated lysis results in the release of crucial biofilm-promoting factors, in particular eDNA. PMID:20962878

Antisense RNA: effect of ribosome binding sites, target location, size, and concentration on the translation of specific mRNA molecules.

PubMed

Daugherty, B L; Hotta, K; Kumar, C; Ahn, Y H; Zhu, J D; Pestka, S

1989-01-01

A series of plasmids were constructed to generate RNA complementary to the beta-galactosidase messenger RNA under control of the phage lambda PL promoter. These plasmids generate anti-lacZ mRNA bearing or lacking a synthetic ribosome binding site adjacent to the lambda PL promoter and/or the lacZ ribosome binding site in reverse orientation. Fragments of lacZ DNA from the 5' and/or the 3' region were used in these constructions. When these anti-mRNA molecules were produced in Escherichia coli 294, maximal inhibition of beta-galactosidase synthesis occurred when a functional ribosome binding site was present near the 5' end of the anti-mRNA and the anti-mRNA synthesized was complementary to the 5' region of the mRNA corresponding to the lacZ ribosome binding site and/or the 5'-coding sequence. Anti-mRNAs producing maximal inhibition of beta-galactosidase synthesis exhibited an anti-lacZ mRNA:normal lacZ mRNA ratio of 100:1 or higher. Those showing lower levels of inhibition exhibited much lower anti-lacZ mRNA:normal lacZ mRNA ratios. A functional ribosome binding site at the 5'-end was found to decrease the decay rate of the anti-lacZ mRNAs. In addition, the incorporation of a transcription terminator just downstream of the antisense segment provided for more efficient inhibition of lacZ mRNA translation due to synthesis of smaller and more abundant anti-lacZ mRNAs. The optimal constructions produced undetectable levels of beta-galactosidase synthesis.

Ordered shotgun sequencing of a 135 kb Xq25 YAC containing ANT2 and four possible genes, including three confirmed by EST matches.

PubMed Central

Chen, C N; Su, Y; Baybayan, P; Siruno, A; Nagaraja, R; Mazzarella, R; Schlessinger, D; Chen, E

1996-01-01

Ordered shotgun sequencing (OSS) has been successfully carried out with an Xq25 YAC substrate. yWXD703 DNA was subcloned into lambda phage and sequences of insert ends of the lambda subclones were used to generate a map to select a minimum tiling path of clones to be completely sequenced. The sequence of 135 038 nt contains the entire ANT2 cDNA as well as four other candidates suggested by computer-assisted analyses. One of the putative genes is homologous to a gene implicated in Graves' disease and it, ANT2 and two others are confirmed by EST matches. The results suggest that OSS can be applied to YACs in accord with earlier simulations and further indicate that the sequence of the YAC accurately reflects the sequence of uncloned human DNA. PMID:8918809

Creating Cost-Effective DNA Size Standards for Use in Teaching and Research Laboratories

ERIC Educational Resources Information Center

Shultz, Jeff

2011-01-01

I have devised a method with which a molecular size standard can be readily manufactured using Lambda DNA and PCR. This method allows the production of specific sized DNA fragments and is easily performed in a standard molecular biology laboratory. The material required to create these markers can also be used to provide a highly robust and…

Rifampin-stimulated uv resistance of phage lambda on Escherichia coli K12

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bronner, C.E.; Fluke, D.J.; Pollard, E.C.

1983-01-01

The plaque survival of uv-irradiated phage lambda on excision-proficient E.coli strain AB1157 is greater if the host cells are exposed to rifampin for 10 minutes prior to infection. This repair is accompanied by little or no clear-plaque mutagenesis. Host cells uv-irradiated and incubated for 30 minutes in growth medium prior to treatment with rifampin show some Weigle-reactivation in addition to the repair stimulated by rifampin. Some clear-plaque Weigle-mutagenesis is also observed in the presence of rifampin: however, the amount is less than that seen in the absence of rifampin treatment. In contrast, the uv sensitivity of lambda on strain AB1886,more » an excision-repair deficient mutant, is unchanged by pre-treating the cells with rifampin, and no Weigle-reactivation is observed. These results suggest that repair of lambda on unirradiated cells in the presence of rifampin is an excision-dependent, error-free phenomenon. Since initiation of replication of lambda DNA requires RNA polymerase, and since rifampin blocks transcription by that polymerase, the effect of rifampin on the survival of lambda may be to delay phage replication, thereby allowing more time for excision repair to operate. 6 figures.« less

Use of Lambda Phage DNA as a Hybrid Internal Control in a PCR-Enzyme Immunoassay To Detect Chlamydia pneumoniae

PubMed Central

Pham, Dien G.; Madico, Guillermo E.; Quinn, Thomas C.; Enzler, Mark J.; Smith, Thomas F.; Gaydos, Charlotte A.

1998-01-01

An inherent problem in the diagnostic PCR assay is the presence of ill-defined inhibitors of amplification which may cause false-negative results. Addition of an amplifiable fragment of foreign DNA in the PCR to serve as a hybrid internal control (HIC) would allow for a simple way to identify specimens containing inhibitors. Two oligonucleotide hybrid primers were synthesized to contain nucleic acid sequences of the Chlamydia pneumoniae 16S rRNA primers in a position flanking two primers that target the sequences of a 650-bp lambda phage DNA segment. By using the hybrid primers, hybrid DNA comprising a large sequence of lambda phage DNA flanked by short pieces of chlamydia DNA was subsequently generated by PCR, cloned into a plasmid vector, and purified. Plasmids containing the hybrid DNA were diluted and used as a HIC by adding them to each C. pneumoniae PCR test. Consequently, C. pneumoniae primers were able to amplify both chlamydia DNA and the HIC DNA. The production of a 689-bp HIC DNA band on an acrylamide gel indicated that the specimen contained no inhibitors and that internal conditions were compatible with PCR. Subsequently, a biotinylated RNA probe for the HIC was transcribed from a nested sequence of the HIC and was used for its hybridization. Detection of the HIC DNA-RNA hybrid was achieved by enzyme immunoassay (EIA). This PCR-EIA system with a HIC was initially tested with 12 previously PCR-positive and 14 previously PCR-negative specimens. Of the 12 PCR-positive specimens, 11 were reconfirmed as positive; 1 had a negative HIC value, indicating inhibition. Of the 14 previously PCR-negative specimens, 13 were confirmed as true negative; 1 had a negative HIC value, indicating inhibition. The assay was then used with 237 nasopharyngeal specimens from patients with pneumonia. Twenty-one of 237 (8.9%) were positive for C. pneumoniae, and 42 (17.7%) were found to inhibit the PCR. Specimens showing inhibitory activity were diluted 1:10 and were retested. Ten specimens were still inhibitory to the PCR and required further DNA purification. No additional positive samples were detected and 3 nasopharyngeal specimens remained inhibitory to PCR. Coamplification of a HIC DNA can help confirm true-negative PCR results by ruling out the presence of inhibitors of DNA amplification. PMID:9650936

High resolution resonance ionization imaging detector and method

DOEpatents

Winefordner, James D.; Matveev, Oleg I.; Smith, Benjamin W.

1999-01-01

A resonance ionization imaging device (RIID) and method for imaging objects using the RIID are provided, the RIID system including a RIID cell containing an ionizable vapor including monoisotopic atoms or molecules, the cell being positioned to intercept scattered radiation of a resonance wavelength .lambda..sub.1 from the object which is to be detected or imaged, a laser source disposed to illuminate the RIID cell with laser radiation having a wavelength .lambda..sub.2 or wavelengths .lambda..sub.2, .lambda..sub.3 selected to ionize atoms in the cell that are in an excited state by virtue of having absorbed the scattered resonance laser radiation, and a luminescent screen at the back surface of the RIID cell which presents an image of the number and position of charged particles present in the RIID cell as a result of the ionization of the excited state atoms. The method of the invention further includes the step of initially illuminating the object to be detected or imaged with a laser having a wavelength selected such that the object will scatter laser radiation having the resonance wavelength .lambda..sub.1.

Noncanonical substrate preference of lambda exonuclease for 5′-nonphosphate-ended dsDNA and a mismatch-induced acceleration effect on the enzymatic reaction

PubMed Central

Yang, Yufei; Chen, Wei; Wang, Jiayu; Yang, Ziyu; Wang, Shenlin; Xiao, Xianjin; Li, Mengyuan

2018-01-01

Abstract Lambda exonuclease (λ exo) plays an important role in the resection of DNA ends for DNA repair. Currently, it is also a widely used enzymatic tool in genetic engineering, DNA-binding protein mapping, nanopore sequencing and biosensing. Herein, we disclose two noncanonical properties of this enzyme and suggest a previously undescribed hydrophobic interaction model between λ exo and DNA substrates. We demonstrate that the length of the free portion of the substrate strand in the dsDNA plays an essential role in the initiation of digestion reactions by λ exo. A dsDNA with a 5′ non-phosphorylated, two-nucleotide-protruding end can be digested by λ exo with very high efficiency. Moreover, we show that when a conjugated structure is covalently attached to an internal base of the dsDNA, the presence of a single mismatched base pair at the 5′ side of the modified base may significantly accelerate the process of digestion by λ exo. A detailed comparison study revealed additional π–π stacking interactions between the attached label and the amino acid residues of the enzyme. These new findings not only broaden our knowledge of the enzyme but will also be very useful for research on DNA repair and in vitro processing of nucleic acids. PMID:29490081

Temperature-dependent absorption cross sections for hydrogen peroxide vapor

NASA Technical Reports Server (NTRS)

Nicovich, J. M.; Wine, P. H.

1988-01-01

Relative absorption cross sections for hydrogen peroxide vapor were measured over the temperature ranges 285-381 K for lambda = 230 nm-295 nm and 300-381 K for lambda = 193 nm-350 nm. The well established 298 K cross sections at 202.6 and 228.8 nm were used as an absolute calibration. A significant temperature dependence was observed at the important tropospheric photolysis wavelengths lambda over 300 nm. Measured cross sections were extrapolated to lower temperatures, using a simple model which attributes the observed temperature dependence to enhanced absorption by molecules possessing one quantum of O-O stretch vibrational excitation. Upper tropospheric photodissociation rates calculated using the extrapolated cross sections are about 25 percent lower than those calculated using currently recommended 298 K cross sections.

Lambda Red recombinase-mediated integration of the high molecular weight DNA into the Escherichia coli chromosome.

PubMed

Juhas, Mario; Ajioka, James W

2016-10-05

Escherichia coli K-12 is a frequently used host for a number of synthetic biology and biotechnology applications and chassis for the development of the minimal cell factories. Novel approaches for integrating high molecular weight DNA into the E. coli chromosome would therefore greatly facilitate engineering efforts in this bacterium. We developed a reliable and flexible lambda Red recombinase-based system, which utilizes overlapping DNA fragments for integration of the high molecular weight DNA into the E. coli chromosome. Our chromosomal integration strategy can be used to integrate high molecular weight DNA of variable length into any non-essential locus in the E. coli chromosome. Using this approach we integrated 15 kb DNA encoding sucrose catabolism and lactose metabolism and transport operons into the fliK locus of the flagellar region 3b in the E. coli K12 MG1655 chromosome. Furthermore, with this system we integrated 50 kb of Bacillus subtilis 168 DNA into two target sites in the E. coli K12 MG1655 chromosome. The chromosomal integrations into the fliK locus occurred with high efficiency, inhibited motility, and did not have a negative effect on the growth of E. coli. In addition to the rational design of synthetic biology devices, our high molecular weight DNA chromosomal integration system will facilitate metabolic and genome-scale engineering of E. coli.

Bacteriophage T5 DNA ejection under pressure.

PubMed

Leforestier, A; Brasilès, S; de Frutos, M; Raspaud, E; Letellier, L; Tavares, P; Livolant, F

2008-12-19

The transfer of the bacteriophage genome from the capsid into the host cell is a key step of the infectious process. In bacteriophage T5, DNA ejection can be triggered in vitro by simple binding of the phage to its purified Escherichia coli receptor FhuA. Using electrophoresis and cryo-electron microscopy, we measure the extent of DNA ejection as a function of the external osmotic pressure. In the high pressure range (7-16 atm), the amount of DNA ejected decreases with increasing pressure, as theoretically predicted and observed for lambda and SPP1 bacteriophages. In the low and moderate pressure range (2-7 atm), T5 exhibits an unexpected behavior. Instead of a unique ejected length, multiple populations coexist. Some phages eject their complete genome, whereas others stop at some nonrandom states that do not depend on the applied pressure. We show that contrarily to what is observed for the phages SPP1 and lambda, T5 ejection cannot be explained as resulting from a simple pressure equilibrium between the inside and outside of the capsid. Kinetics parameters and/or structural characteristics of the ejection machinery could play a determinant role in T5 DNA ejection.

Evaluation of humoral and cellular immune responses against HSV-1 using genetic immunization by filamentous phage particles: a comparative approach to conventional DNA vaccine.

PubMed

Hashemi, Hamidreza; Bamdad, Taravat; Jamali, Abbas; Pouyanfard, Somayeh; Mohammadi, Masoumeh Gorgian

2010-02-01

Phage display is based on expressing peptides as a fusion to one of the phage coat proteins. To date, many vaccine researches have been conducted to display immunogenic peptides or mimotopes of various pathogens and tumors on the surface of filamentous bacteriophages. In recent years as a new approach to application of phages, recombinant bacteriophage lambda particles were used as DNA delivery vehicles to mammalian cells. In this study, recombinant filamentous phage whole particles were used for vaccination of mice. BALB/c mice were inoculated with filamentous phage particles containing expression cassette of Herpes simplex virus 1 (HSV-1) glycoprotein D that has essential roles in the virus attachment and entry. Both humoral and cellular immune responses were measured in the immunized mice and compared to conventional DNA vaccination. A dose-response relationship was observed in both arms of immune responses induced by recombinant filamentous phage inoculation. The results were similar to those from DNA vaccination. Filamentous phages can be considered as suitable alternative candidate vaccines because of easier and more cost-effective production and purification over plasmid DNA or bacteriophage lambda particles. 2009 Elsevier B.V. All rights reserved.

Analysis of Endonuclease R·EcoRI Fragments of DNA from Lambdoid Bacteriophages and Other Viruses by Agarose-Gel Electrophoresis

PubMed Central

Helling, Robert B.; Goodman, Howard M.; Boyer, Herbert W.

1974-01-01

By means of agarose-gel electrophoresis, endonuclease R·EcoRI-generated fragments of DNA from various viruses were separated, their molecular weights were determined, and complete or partial fragment maps for lambda, φ80, and hybrid phages were constructed. Images PMID:4372397

The control of lambda DNA terminase synthesis.

PubMed Central

Murialdo, H; Davidson, A; Chow, S; Gold, M

1987-01-01

Nu1 and A, the genes coding for bacteriophage lambda DNA terminase, rank among the most poorly translated genes expressed in E. coli. To understand the reason for this low level of translation the genes were cloned into plasmids and their expression measured. In addition, the wild type DNA sequences immediately preceding the genes were reduced and modified. It was found that the elements that control translation are contained in the 100 base pairs upstream from the initiation codon. Interchanging these upstream sequences with those of an efficiently translated gene dramatically increased the translation of terminase subunits. It seems unlikely that the rare codons present in the genes, and any feature of their mRNA secondary structure play a role in the control of their translation. The elimination of cos from plasmids containing Nu1 and A also resulted in an increase in terminase production. This result suggests a role for cos in the control of late gene expression. The terminase subunit overproducer strains are potentially very useful for the design of improved DNA packaging and cosmid mapping techniques. Images PMID:3029667

In vitro expression of Escherichia coli ribosomal protein genes: autogenous inhibition of translation.

PubMed Central

Yates, J L; Arfsten, A E; Nomura, M

1980-01-01

Escherichia coli ribosomal protein L1 (0.5 micro M) was found to inhibit the synthesis of both proteins of the L11 operon, L11 and L1, but not the synthesis of other proteins directed by lambda rifd 18 DNA. Similarly, S4 (1 micro M) selectively inhibited the synthesis of three proteins of the alpha operon, S13, S11, and S4, directed by lambda spcI DNA or a restriction enzyme fragment obtained from this DNA. S8 (3.6 micro M) also showed preferential inhibitory effects on the synthesis of some proteins encoded in the spc operon, L24 and L5 (and probably S14 and S8), directed by lambda spcl DNA or a restriction enzyme fragment carrying the genes for these proteins. The inhibitory effect of L1 was observed only with L1 and not with other proteins examined, including S4 and S8. Similarly, the effect of S4 was not observed with L1 or S8, and that of S8 was not seen with L1 or S4. Inhibition was shown to take place at the level of translation rather than transcription. Thus, at least some ribosomal proteins (L1 S4, and S8) have the ability to cause selective translational inhibition of the synthesis of certain ribosomal proteins whose genes are in the same operon as their own. These results support the hypothesis that certain free ribosomal proteins not assembled into ribosomes act as "autogenous" feedback inhibitors to regulate the synthesis of ribosomal proteins. Images PMID:6445562

A verotoxin 1 B subunit-lambda CRO chimeric protein specifically binds both DNA and globotriaosylceramide (Gb(3)) to effect nuclear targeting of exogenous DNA in Gb(3) positive cells.

PubMed

Facchini, L M; Lingwood, C A

2001-09-10

Inefficient nuclear incorporation of foreign DNA remains a critical roadblock in the development of effective nonviral gene delivery systems. DNA delivered by traditional protocols remains within endosomal/lysosomal vesicles, or is rapidly degraded in the cytoplasm. Verotoxin I (VT), an AB(5) subunit toxin produced by enterohaemorrhagic Escherichia coli, binds to the cell surface glycolipid, globotriaosylceramide (Gb(3)) and is internalized into preendosomes. VT is then retrograde transported to the Golgi, endoplasmic reticulum (ER), and nucleus of highly VT-sensitive cells. We have utilized this nuclear targeting of VT to design a unique delivery system which transports exogenous DNA via vesicular traffic to the nucleus. The nontoxic VT binding subunit (VTB) was fused to the lambda Cro DNA-binding repressor, generating a 14-kDa VTB-Cro chimera. VTB-Cro binds specifically via the Cro domain to a 25-bp DNA fragment containing the consensus Cro operator. VTB-Cro demonstrates simultaneous specific binding to Gb(3). Treatment of Vero cells with fluorescent-labeled Cro operator DNA in the presence of VTB-Cro, results in DNA internalization to the Golgi, ER, and nucleus, whereas fluorescent DNA alone is incorporated poorly and randomly within the cytoplasm. VTB-Cro mediated nuclear DNA transport is prevented by brefeldin A, consistent with Golgi/ER intracellular routing. Pretreatment with filipin had no effect, indicating that caveoli are not involved. This novel VTB-Cro shuttle protein may find practical applications in the fields of intracellular targeting, gene delivery, and gene therapy. Copyright 2001 Academic Press.

Formation of intermediate products during the resonance stepwise polarization of dibenzyl ketone and benzil molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Polevoi, A.V.; Matyuk, V.M.; Grigor'eva, G.A.

1987-07-01

The processes resulting in the intramolecular redistribution of energy in electronically excited S/sub ..pi pi..*/ states of dibenzyl ketone and benzil molecules have been investigated by laser mass spectrometry. The decisive role of dissociation under the conditions of the resonance stepwise photoionization of these molecules upon excitation by radiation with lambda = 266 nm has been demonstrated. The ionization potentials of the molecules and the appearance potentials of fragment ions from dibenzyl ketone and benzil have been determined on the basis of an analysis of photoionization efficiency curves.

The DNA Maturation Domain of gpA, the DNA Packaging Motor Protein of Bacteriophage Lambda, Contains an ATPase Site Associated with Endonuclease Activity

PubMed Central

Ortega, Marcos E.; Gaussier, Helene; Catalano, Carlos E.

2007-01-01

Summary Terminase enzymes are common to double-stranded DNA (dsDNA) viruses and are responsible for packaging viral DNA into the confines of an empty capsid shell. In bacteriophage lambda the catalytic terminase subunit is gpA, which is responsible for maturation of the genome end prior to packaging and subsequent translocation of the matured DNA into the capsid. DNA packaging requires an ATPase catalytic site situated in the N-terminus of the protein. A second ATPase catalytic site associated with the DNA maturation activities of the protein has been proposed; however, direct demonstration of this putative second site is lacking. Here we describe biochemical studies that define protease-resistant peptides of gpA and expression of these putative domains in E. coli. Biochemical characterization of gpA-ΔN179, a construct in which the N-terminal 179 residues of gpA have been deleted, indicates that this protein encompasses the DNA maturation domain of gpA. The construct is folded, soluble and possesses an ATP-dependent nuclease activity. Moreover, the construct binds and hydrolyzes ATP despite the fact that the DNA packaging ATPase site in the N-terminus of gpA has been deleted. Mutation of lysine 497, which alters the conserved lysine in a predicted Walker A “P-loop” sequence, does not affect ATP binding but severely impairs ATP hydrolysis. Further, this mutation abrogates the ATP-dependent nuclease activity of the protein. These studies provide direct evidence for the elusive nucleotide-binding site in gpA that is directly associated with the DNA maturation activity of the protein. The implications of these results with respect to the two roles of the terminase holoenzyme – DNA maturation and DNA packaging – are discussed. PMID:17870092

Visualization of phage DNA degradation by a type I CRISPR-Cas system at the single-cell level.

PubMed

Guan, Jingwen; Shi, Xu; Burgos, Roberto; Zeng, Lanying

2017-03-01

The CRISPR-Cas system is a widespread prokaryotic defense system which targets and cleaves invasive nucleic acids, such as plasmids or viruses. So far, a great number of studies have focused on the components and mechanisms of this system, however, a direct visualization of CRISPR-Cas degrading invading DNA in real-time has not yet been studied at the single-cell level. In this study, we fluorescently label phage lambda DNA in vivo , and track the labeled DNA over time to characterize DNA degradation at the single-cell level. At the bulk level, the lysogenization frequency of cells harboring CRISPR plasmids decreases significantly compared to cells with a non-CRISPR control. At the single-cell level, host cells with CRISPR activity are unperturbed by phage infection, maintaining normal growth like uninfected cells, where the efficiency of our anti-lambda CRISPR system is around 26%. During the course of time-lapse movies, the average fluorescence of invasive phage DNA in cells with CRISPR activity, decays more rapidly compared to cells without, and phage DNA is fully degraded by around 44 minutes on average. Moreover, the degradation appears to be independent of cell size or the phage DNA ejection site suggesting that Cas proteins are dispersed in sufficient quantities throughout the cell. With the CRISPR-Cas visualization system we developed, we are able to examine and characterize how a CRISPR system degrades invading phage DNA at the single-cell level. This work provides direct evidence and improves the current understanding on how CRISPR breaks down invading DNA.

An ultrasensitive electrochemical biosensor for polynucleotide kinase assay based on gold nanoparticle-mediated lambda exonuclease cleavage-induced signal amplification.

PubMed

Cui, Lin; Li, Yueying; Lu, Mengfei; Tang, Bo; Zhang, Chun-Yang

2018-01-15

Polynucleotide kinase (PNK) plays an essential role in cellular nucleic acid metabolism and the cellular response to DNA damage. However, conventional methods for PNK assay suffer from low sensitivity and involve multiple steps. Herein, we develop a simply electrochemical method for sensitive detection of PNK activity on the basis of Au nanoparticle (AuNP)-mediated lambda exonuclease cleavage-induced signal amplification. We use [Ru(NH 3 ) 6 ] 3+ as the electrochemically active indicator and design two DNA strands (i.e., strand 1 and strand 2) to sense PNK. The assembly of strand 2 on the AuNP surface leads to the formation of AuNP-strand 2 conjugates which can be subsequently immobilized on the gold electrode through the hybridization of strand 1 with strand 2 for the generation of a high electrochemical signal. The presence of PNK induces the phosphorylation of the strand 2-strand 1 hybrid and the subsequent cleavage of double-stranded DNA (dsDNA) by lambda exonuclease, resulting in the release of AuNP-strand 2 conjugates and [Ru(NH 3 ) 6 ] 3+ from the gold electrode surface and consequently the decrease of electrochemical signal. The PNK activity can be simply monitored by the measurement of [Ru(NH 3 ) 6 ] 3+ peak current signal. This assay is very sensitive with a detection limit of as low as 7.762 × 10 -4 UmL -1 and exhibits a large dynamic range from 0.001 to 10UmL -1 . Moreover, this method can be used to screen the PNK inhibitors, and it shows excellent performance in real sample analysis, thus holding great potential for further applications in biological researches and clinic diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.

Cloning and sequence analysis of the human brain beta-adrenergic receptor. Evolutionary relationship to rodent and avian beta-receptors and porcine muscarinic receptors.

PubMed

Chung, F Z; Lentes, K U; Gocayne, J; Fitzgerald, M; Robinson, D; Kerlavage, A R; Fraser, C M; Venter, J C

1987-01-26

Two cDNA clones, lambda-CLFV-108 and lambda-CLFV-119, encoding for the beta-adrenergic receptor, have been isolated from a human brain stem cDNA library. One human genomic clone, LCV-517 (20 kb), was characterized by restriction mapping and partial sequencing. The human brain beta-receptor consists of 413 amino acids with a calculated Mr of 46480. The gene contains three potential glucocorticoid receptor-binding sites. The beta-receptor expressed in human brain was homology with rodent (88%) and avian (52%) beta-receptors and with porcine muscarinic cholinergic receptors (31%), supporting our proposal [(1984) Proc. Natl. Acad. Sci. USA 81, 272 276] that adrenergic and muscarinic cholinergic receptors are structurally related. This represents the first cloning of a neurotransmitter receptor gene from human brain.

Emission of a pulsed purely rotational transition chemical H{sub 2}-F{sub 2} laser

DOE Office of Scientific and Technical Information (OSTI.GOV)

Molevich, N E; Pichugin, S Yu

2008-04-30

The possibility of obtaining efficient emission at purely rotational transitions of HF molecules in a pulsed chemical hydrogen fluoride laser is studied theoretically. The operation of a H{sub 2}-F{sub 2} laser with a gas pressure of 1.1 atm emitting at the v, j {yields} v, j - 1 (v = 1 - 6, j = 10 - 14) transitions is simulated taking into account resonance VR processes. The total specific laser energy release calculated over all the vibrational levels is 5.5 J L{sup -1} on purely rotational transitions at {lambda}{approx}17 {mu}m (j = 14), 3.5 J L{sup -1} at {lambda}{approx}18.5more » {mu}m (j = 13), and 2.5 J L{sup -1} at {lambda}{approx}20 {mu}m (j = 12). (lasers and amplifiers)« less

Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

PubMed

Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

1987-12-01

Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene.

Purification of bacteriophage lambda repressor

PubMed Central

Gao, Ning; Shearwin, Keith; Mack, John; Finzi, Laura; Dunlap, David

2013-01-01

Bacteriophage lambda repressor controls the lysogeny/lytic growth switch after infection of E. coli by lambda phage. In order to study in detail the looping of DNA mediated by the protein, tag-free repressor and a loss-of-cooperativity mutant were expressed in E.coli and purified by (1) ammonium sulfate fractionation, (2) anion-exchange chromatography and (3) heparin affinity chromatography. This method employs more recently developed and readily available chromatography resins to produce highly pure protein in good yield. In tethered particle motion looping assays and atomic force microscopy “footprinting” assays, both the wild-type protein and a C-terminal His-tagged variant, purified using immobilized metal affinity chromatography, bound specifically to high affinity sites to mediate loop formation. In contrast the G147D loss-of-cooperativity mutant bound specifically but did not secure loops. PMID:23831434

Elementary kinematical model of thermal diffusion in liquids and gases.

PubMed

Brenner, Howard

2006-09-01

An elementary hydrodynamic and Brownian motion model of the thermal diffusivity D(T) of a restricted class of binary liquid mixtures, previously proposed by the author, is given a more transparent derivation than originally, exposing thereby the strictly kinematic-hydrodynamic nature of an important class of thermodiffusion separation phenomena. Moreover, it is argued that the solvent's thermometric diffusivity alpha appearing in that theory as one of the two fundamental parameters governing D(T) should be replaced by the solvent's (isothermal) self-diffusivity D(S). In addition, a corrective multiplier of O(1) is inserted to reflect the general physicochemical noninertness of the solute relative to the solvent, thus enhancing the applicability of the resulting formula D(T)=lambdaD(S)beta to "nonideal" solutions. Here, beta is the solvent's thermal expansivity and lambda is a term of O(1), insensitive to the physicochemical nature of the solute (thus rendering D(T) primarily dependent upon only the properties of the solvent). This formula is, on the basis of its derivation, presumably valid only under certain idealized, albeit well-defined, circumstances. This occurs when the solute molecules are: (i) large compared with those of the solvent; and (ii) present only in small proportions relative to those of the solvent. When the solute is physicochemically inert, it is expected that lambda=1. When these conditions are met, the resulting thermal diffusivity of the mixture is, in theory, independent of any and all properties of the solute. Moreover, because beta is algebraically signed, the thermal diffusivity can either by positive or negative, according as the solvent expands or contracts upon being heated. This formula for D(T) is compared with available experimental data for selected binary liquid mixtures. Reasonable agreement is found in almost all circumstances with lambda near unity, the more so the higher the temperature, especially when the solute-solvent mixture properties closely approximate those where agreement would be expected and conversely. Finally, it is pointed out that for the restricted circumstances described, the formula D(T)=lambdaD(S)beta is equally credible for gases. Here, based on gas-kinetic theory, it is possible to furnish the theoretical value of lambda. Overall, while spanning a range of about five orders of magnitude, the D(T) values given by this elementary formula are shown to apply with reasonable accuracy to: (i) liquids (including circumstances for which D(T) is negative) as well as gases; (ii) all combinations of solvents and solutes tested (the latter including, for example, polymer molecules and metallic colloidal particles); and (iii) all sizes of solute molecules, from angstroms to submicron.

Primary structure of prostaglandin G/H synthase from sheep vesicular gland determined from the complementary DNA sequence.

PubMed Central

DeWitt, D L; Smith, W L

1988-01-01

Prostaglandin G/H synthase (8,11,14-icosatrienoate, hydrogen-donor:oxygen oxidoreductase, EC 1.14.99.1) catalyzes the first step in the formation of prostaglandins and thromboxanes, the conversion of arachidonic acid to prostaglandin endoperoxides G and H. This enzyme is the site of action of nonsteroidal anti-inflammatory drugs. We have isolated a 2.7-kilobase complementary DNA (cDNA) encompassing the entire coding region of prostaglandin G/H synthase from sheep vesicular glands. This cDNA, cloned from a lambda gt 10 library prepared from poly(A)+ RNA of vesicular glands, hybridizes with a single 2.75-kilobase mRNA species. The cDNA clone was selected using oligonucleotide probes modeled from amino acid sequences of tryptic peptides prepared from the purified enzyme. The full-length cDNA encodes a protein of 600 amino acids, including a signal sequence of 24 amino acids. Identification of the cDNA as coding for prostaglandin G/H synthase is based on comparison of amino acid sequences of seven peptides comprising 103 amino acids with the amino acid sequence deduced from the nucleotide sequence of the cDNA. The molecular weight of the unglycosylated enzyme lacking the signal peptide is 65,621. The synthase is a glycoprotein, and there are three potential sites for N-glycosylation, two of them in the amino-terminal half of the molecule. The serine reported to be acetylated by aspirin is at position 530, near the carboxyl terminus. There is no significant similarity between the sequence of the synthase and that of any other protein in amino acid or nucleotide sequence libraries, and a heme binding site(s) is not apparent from the amino acid sequence. The availability of a full-length cDNA clone coding for prostaglandin G/H synthase should facilitate studies of the regulation of expression of this enzyme and the structural features important for catalysis and for interaction with anti-inflammatory drugs. Images PMID:3125548

Specific inhibitors of mammalian DNA polymerase species.

PubMed

Mizushina, Yoshiyuki

2009-06-01

In screening of selective inhibitors of eukaryotic DNA polymerases (pols) for 15 years, more than 100 inhibitors have been discovered from natural and chemical sources. Some compounds selectively inhibit the activities of mammalian pols, and in particular, dehydroaltenusin and curcumin derivatives, such as monoacetyl-curcumin, were found to be specific inhibitors of pol alpha and pol lambda, respectively. Dehydroaltenusin was isolated from a fungus (Alternaria tennuis), and this compound inhibited cell proliferation of human cancer cell lines by arresting the cells at the S-phase, and was effective in suppressing the growth on nude mice of solid tumors of human cervical cancer cell line HeLa. Curcumin derivatives had anti-12-O-tetradecanoylphorbol-13-acetate (TPA)-induced inflammatory activity with the same tendency as pol lambda inhibitory activity. These compounds might be useful not only as "molecular probes" for pol research, but also as biomedical and chemotherapeutic drugs for anti-cancer or anti-inflammation.

Chromosomal locations of mouse immunoglobulin genes.

PubMed Central

Valbuena, O; Marcu, K B; Croce, C M; Huebner, K; Weigert, M; Perry, R P

1978-01-01

The chromosomal locations of the structural genes coding for the constant portions of mouse heavy (H) and light chain immunoglobulins were studied by molecular hybridization techniques. Complementary DNA probes containing the constant-region sequences of kappa and lambdaI light chain and alpha, gamma2b, and mu heavy chain mRNAs were annealed to a large excess of DNA from a series of eight mouse-human hybrid cell lines that are deficient for various mouse chromosomes. The lines were scored as positive when a high proportion of a probe annealed and negative when an insignificant proportion annealed. Some lines were clearly negative for H and lambda and clearly positive for kappa. Others were positive or intermediate for lambda, positive for kappa and negative for H. Still others, including a line that was selected for the absence of the mouse X chromosome, were positive for all immunoglobulin species. These results demonstrate that the Clambda, Ckappa, and CH genes are located on different autosomes in the mouse. In contrast, the three heavy-chain families exhibited consistently uniform hybridization results, suggesting that the genes for Calpha, Cgamma, and Cmu are located on the same chromosome. A comparison of karyotypic data with hybridization data has limited the possible locations of the Ig genes to only a few chromosomes. PMID:96442

Acylamino acid chiral fungicides on toxiciepigenetics in lambda DNA methylation.

PubMed

Yin, Jing; Zhu, Feilong; Hao, Weiyu; Xu, Qi; Chang, Jin; Wang, Huili; Guo, Baoyuan

2017-11-01

Acylamino acid chiral fungicides (AACFs) are low-toxicity pesticides and considered as non-carcinogenic chemicals to laboratory animals. Though AACFs have potential toxicological effects on mammals by non-genotoxic mechanisms, the toxicoepigenomics of AACFs has not been documented. In this article, we explored toxiciepigenetics of metalaxyl, benalaxyl and furalaxyl through epigenetics research on lambda DNA under different concentration exposure. The toxicoepigenomic difference of stereoisomers was examined also. Our results showed that AACFs would affect methyltransferase activity resulting in modulating DNA methylation levels and pattern. The LOAEL of R-metalaxyl and S-metalaxyl were 30 mM and 0.3 mM, respectively. The LOAEL of (R, S)-benalaxyl and (R, S)-furalaxyl were 0.3 Mm and 30 mM, respectively. A significant dose-response effect between (R, S)-benalaxyl and global methylation level was observed. Global methylation level was more susceptible to S-enantiomer compared to R-enantiomer, which indicated enantiomers of AACFs have the enantioselectivity in toxiciepigenetics. Moreover, the dependence of the methylation inhibition on the chiral center of metalaxyl may suggest a considerable specificity of the compound of AACFs for DNA methyltransferases. The inhibition effect between R-enantiomer and S-enantiomer of AACFs on DNA methylation levels generated in this study is important for low-toxicity pesticides toxicoepigenomics evaluation. Copyright © 2017 Elsevier Ltd. All rights reserved.

T7 RNA polymerase-driven inducible cell lysis for DNA transfer from Escherichia coli to Bacillus subtilis.

PubMed

Juhas, Mario; Ajioka, James W

2017-11-01

The majority of the good DNA editing techniques have been developed in Escherichia coli; however, Bacillus subtilis is better host for a plethora of synthetic biology and biotechnology applications. Reliable and efficient systems for the transfer of synthetic DNA between E. coli and B. subtilis are therefore of the highest importance. Using synthetic biology approaches, such as streamlined lambda Red recombineering and Gibson Isothermal Assembly, we integrated genetic circuits pT7L123, Repr-ts-1 and pLT7pol encoding the lysis genes of bacteriophages MS2, ΦX174 and lambda, the thermosensitive repressor and the T7 RNA polymerase into the E. coli chromosome. In this system, T7 RNA polymerase regulated by the thermosensitive repressor drives the expression of the phage lysis genes. We showed that T7 RNA polymerase significantly increases efficiency of cell lysis and transfer of the plasmid and bacterial artificial chromosome-encoded DNA from the lysed E. coli into B. subtilis. The T7 RNA polymerase-driven inducible cell lysis system is suitable for the efficient cell lysis and transfer of the DNA engineered in E. coli to other naturally competent hosts, such as B. subtilis. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Primary structure of rat cardiac beta-adrenergic and muscarinic cholinergic receptors obtained by automated DNA sequence analysis: further evidence for a multigene family.

PubMed Central

Gocayne, J; Robinson, D A; FitzGerald, M G; Chung, F Z; Kerlavage, A R; Lentes, K U; Lai, J; Wang, C D; Fraser, C M; Venter, J C

1987-01-01

Two cDNA clones, lambda RHM-MF and lambda RHB-DAR, encoding the muscarinic cholinergic receptor and the beta-adrenergic receptor, respectively, have been isolated from a rat heart cDNA library. The cDNA clones were characterized by restriction mapping and automated DNA sequence analysis utilizing fluorescent dye primers. The rat heart muscarinic receptor consists of 466 amino acids and has a calculated molecular weight of 51,543. The rat heart beta-adrenergic receptor consists of 418 amino acids and has a calculated molecular weight of 46,890. The two cardiac receptors have substantial amino acid homology (27.2% identity, 50.6% with favored substitutions). The rat cardiac beta receptor has 88.0% homology (92.5% with favored substitutions) with the human brain beta receptor and the rat cardiac muscarinic receptor has 94.6% homology (97.6% with favored substitutions) with the porcine cardiac muscarinic receptor. The muscarinic cholinergic and beta-adrenergic receptors appear to be as conserved as hemoglobin and cytochrome c but less conserved than histones and are clearly members of a multigene family. These data support our hypothesis, based upon biochemical and immunological evidence, that suggests considerable structural homology and evolutionary conservation between adrenergic and muscarinic cholinergic receptors. To our knowledge, this is the first report utilizing automated DNA sequence analysis to determine the structure of a gene. Images PMID:2825184

[Construction and characterization of a cDNA library from human liver tissue of cirrhosis].

PubMed

Chen, Xiao-hong; Chen, Zhi; Chen, Feng; Zhu, Hai-hong; Zhou, Hong-juan; Yao, Hang-ping

2005-03-01

To construct a cDNA library from human liver tissue of cirrhosis. The total RNA from human liver tissue of cirrhosis was extracted using Trizol method, and the mRNA was purified using mRNA purification kit. SMART technique and CDSIII/3' primer were used for first-strand cDNA synthesis. Long distance PCR was then used to synthesize the double-strand cDNA that was then digested by proteinase K and Sfi I, and was fractionated by CHOMA SPIN-400 column. The cDNA fragments longer than 0.4 kb were collected and ligated to lambdaTripl Ex2 vector. Then lambda-phage packaging reaction and library amplification were performed. The qualities of both unamplified and amplified cDNA libraries was strictly checked by conventional titer determination. Eleven plaques were randomly picked and tested using PCR with universal primers derived from the sequence flanking the vector. The titers of unamplifed and amplified libraries were 1.03 x 10(6) pfu/ml and 1.36 x 10(9) pfu/ml respectively. The percentages of recombinants from both libraries were 97.24 % in unamplified library and 99.02 % in amplified library. The lengths of the inserts were 1.02 kb in average (36.36 % 1 approximately equals 2 kb and 63.64 % 0.5 approximately equals 1.0 kb). A high quality cDNA library from human liver tissue of cirrhosis was constructed successfully, which can be used for screening and cloning new special genes associated with the occurrence of cirrhosis.

Absorption Reveals and Hydrogen Addition Explains New Interstellar Aldehydes: Propenal and Propanal

NASA Technical Reports Server (NTRS)

Hollis, J. M.; Jewell, P. R.; Lovas, F. J.; Remijan, A.; Mollendal, H.

2004-01-01

New interstellar molecules propenal (CH2CHCHO) and propanal (CH3CH2CHO) have been detected largely in absorption toward the star-forming region Sagittarius B2(N) by means of rotational transitions observed with the 100-m Green Bank Telescope (GBT) operating in the range of 18 GHz (lambda approximately 1.7 cm) to 26 GHz (lambda approximately 1.2 cm). The GBT was also used to observe the previously reported interstellar aldehyde propynal (HC2CHO) in Sagittarius B2(N) which is known for large molecules believed to form on interstellar grains. The presence of these three interstellar aldehydes toward Sagittarius B2(N) strongly suggests that simple hydrogen addition on interstellar grains accounts for successively larger molecular species: from propynal to propenal and from propenal to propanal. Energy sources within Sagittarius B2(N) likely permit the hydrogen addition reactions on grain surfaces to proceed. This work demonstrates that successive hydrogen addition is probably an important chemistry route in the formation of a number of complex interstellar molecules. We also searched for but did not detect the three-carbon sugar glyceraldehyde (CH2OHCHOHCHO).

Model of DNA topology simplification has come full (supercoiled) circle after two decades of research. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Stasiak, Andrzej

2016-09-01

Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.

An Empirically Calibrated Model of Cell Fate Decision Following Viral Infection

NASA Astrophysics Data System (ADS)

Coleman, Seth; Igoshin, Oleg; Golding, Ido

The life cycle of the virus (phage) lambda is an established paradigm for the way genetic networks drive cell fate decisions. But despite decades of interrogation, we are still unable to theoretically predict whether the infection of a given cell will result in cell death or viral dormancy. The poor predictive power of current models reflects the absence of quantitative experimental data describing the regulatory interactions between different lambda genes. To address this gap, we are constructing a theoretical model that captures the known interactions in the lambda network. Model assumptions and parameters are calibrated using new single-cell data from our lab, describing the activity of lambda genes at single-molecule resolution. We began with a mean-field model, aimed at exploring the population averaged gene-expression trajectories under different initial conditions. Next, we will develop a stochastic formulation, to capture the differences between individual cells within the population. The eventual goal is to identify how the post-infection decision is driven by the interplay between network topology, initial conditions, and stochastic effects. The insights gained here will inform our understanding of cell fate choices in more complex cellular systems.

Recombineering Pseudomonas syringae

USDA-ARS?s Scientific Manuscript database

Here we report the identification of functions that promote genomic recombination of linear DNA introduced into Pseudomonas cells by electroporation. The genes encoding these functions were identified in Pseudomonas syringae pv. syringae B728a based on similarity to the lambda Red Exo/Beta and RecE...

qPCR-based mitochondrial DNA quantification: Influence of template DNA fragmentation on accuracy

DOE Office of Scientific and Technical Information (OSTI.GOV)

Jackson, Christopher B., E-mail: Christopher.jackson@insel.ch; Gallati, Sabina, E-mail: sabina.gallati@insel.ch; Schaller, Andre, E-mail: andre.schaller@insel.ch

2012-07-06

Highlights: Black-Right-Pointing-Pointer Serial qPCR accurately determines fragmentation state of any given DNA sample. Black-Right-Pointing-Pointer Serial qPCR demonstrates different preservation of the nuclear and mitochondrial genome. Black-Right-Pointing-Pointer Serial qPCR provides a diagnostic tool to validate the integrity of bioptic material. Black-Right-Pointing-Pointer Serial qPCR excludes degradation-induced erroneous quantification. -- Abstract: Real-time PCR (qPCR) is the method of choice for quantification of mitochondrial DNA (mtDNA) by relative comparison of a nuclear to a mitochondrial locus. Quantitative abnormal mtDNA content is indicative of mitochondrial disorders and mostly confines in a tissue-specific manner. Thus handling of degradation-prone bioptic material is inevitable. We established a serialmore » qPCR assay based on increasing amplicon size to measure degradation status of any DNA sample. Using this approach we can exclude erroneous mtDNA quantification due to degraded samples (e.g. long post-exicision time, autolytic processus, freeze-thaw cycles) and ensure abnormal DNA content measurements (e.g. depletion) in non-degraded patient material. By preparation of degraded DNA under controlled conditions using sonification and DNaseI digestion we show that erroneous quantification is due to the different preservation qualities of the nuclear and the mitochondrial genome. This disparate degradation of the two genomes results in over- or underestimation of mtDNA copy number in degraded samples. Moreover, as analysis of defined archival tissue would allow to precise the molecular pathomechanism of mitochondrial disorders presenting with abnormal mtDNA content, we compared fresh frozen (FF) with formalin-fixed paraffin-embedded (FFPE) skeletal muscle tissue of the same sample. By extrapolation of measured decay constants for nuclear DNA ({lambda}{sub nDNA}) and mtDNA ({lambda}{sub mtDNA}) we present an approach to possibly correct measurements in degraded samples in the future. To our knowledge this is the first time different degradation impact of the two genomes is demonstrated and which evaluates systematically the impact of DNA degradation on quantification of mtDNA copy number.« less

DR-78, a novel Drosophila melanogaster genomic DNA fragment highly homologous to the DNA-binding domain of thyroid hormone-retinoic acid-vitamin D receptor subfamily.

PubMed

Martín-Blanco, E; Kornberg, T B

1993-11-16

Degenerate oligodeoxyribonucleotides were designed for both ends of the DNA-binding domain of members of the nuclear receptor superfamily. PCR amplified Drosophila melanogaster DNA was purified and cloned (DR plasmids). Genomic lambda DASH clones were identified at high stringency with an amplified DR-78 plasmid DNA and isolated. The partial sequence shows a very probable open reading frame which would encode a peptide highly homologous to members of the thyroid hormone-retinoic acid-vitamin D receptor subfamily. The fragment corresponds to a single copy gene and was mapped at position 78D of chromosome three by in situ hybridization.

Cold molecule spectroscopy for constraining the evolution of the fine structure constant.

PubMed

Hudson, Eric R; Lewandowski, H J; Sawyer, Brian C; Ye, Jun

2006-04-14

We report precise measurements of ground-state, Lambda-doublet microwave transitions in the hydroxyl radical molecule (OH). Utilizing slow, cold molecules produced by a Stark decelerator we have improved over the precision of the previous best measurement 25-fold for the F'=2-->F=2 transition, yielding (1 667 358 996 +/- 4)Hz, and by tenfold for the F'=1-->F=1 transition, yielding (1 665 401 803 +/-12)Hz. Comparing these laboratory frequencies to those from OH megamasers in interstellar space will allow a sensitivity of 1 ppm for Delta(alpha/alpha) over approximately 10(10) yr.

Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins

PubMed Central

Foulk, Michael S.; Urban, John M.; Casella, Cinzia; Gerbi, Susan A.

2015-01-01

Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand–independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo–controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na+ instead of K+ in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. PMID:25695952

Characterizing and controlling intrinsic biases of lambda exonuclease in nascent strand sequencing reveals phasing between nucleosomes and G-quadruplex motifs around a subset of human replication origins.

PubMed

Foulk, Michael S; Urban, John M; Casella, Cinzia; Gerbi, Susan A

2015-05-01

Nascent strand sequencing (NS-seq) is used to discover DNA replication origins genome-wide, allowing identification of features for their specification. NS-seq depends on the ability of lambda exonuclease (λ-exo) to efficiently digest parental DNA while leaving RNA-primer protected nascent strands intact. We used genomics and biochemical approaches to determine if λ-exo digests all parental DNA sequences equally. We report that λ-exo does not efficiently digest G-quadruplex (G4) structures in a plasmid. Moreover, λ-exo digestion of nonreplicating genomic DNA (LexoG0) enriches GC-rich DNA and G4 motifs genome-wide. We used LexoG0 data to control for nascent strand-independent λ-exo biases in NS-seq and validated this approach at the rDNA locus. The λ-exo-controlled NS-seq peaks are not GC-rich, and only 35.5% overlap with 6.8% of all G4s, suggesting that G4s are not general determinants for origin specification but may play a role for a subset. Interestingly, we observed a periodic spacing of G4 motifs and nucleosomes around the peak summits, suggesting that G4s may position nucleosomes at this subset of origins. Finally, we demonstrate that use of Na(+) instead of K(+) in the λ-exo digestion buffer reduced the effect of G4s on λ-exo digestion and discuss ways to increase both the sensitivity and specificity of NS-seq. © 2015 Foulk et al.; Published by Cold Spring Harbor Laboratory Press.

DNA repair properties of Escherichia coli tif-1, recAo281 and lexA1 strains deficient in single-strand DNA binding protein.

PubMed

Whittier, R F; Chase, J W

1983-01-01

Mutations affecting single-strand DNA binding protein (SSB) impair induction of mutagenic (SOS) repair. To further investigate the role of SSB in SOS induction and DNA repair, isogenic strains were constructed combining the ssb+, ssb-1 or ssb-113 alleles with one or more mutations known to alter regulation of damage inducible functions. As is true in ssb+ strains tif-1 (recA441) was found to allow thermal induction of prophage lambda + and Weigle reactivation in ssb-1 and ssb-113 strains. Furthermore, tif-1 decreased the UV sensitivity of the ssb-113 strain slightly and permitted UV induction of prophage lambda + at 30 degrees C. Strains carrying the recAo281 allele were also constructed. This mutation causes high constitutive levels of RecA protein synthesis and relieves much of the UV sensitivity conferred by lexA- alleles without restoring SOS (error-prone) repair. In contrast, the recAo281 allele failed to alleviate the UV sensitivity associated with either ssb- mutation. In a lexA1 recAo281 background the ssb-1 mutation increased the extent of postirradiation DNA degradation and concommitantly increased UV sensitivity 20-fold to the level exhibited by a recA1 strain. The ssb-113 mutation also increased UV sensitivity markedly in this background but did so without greatly increasing postirradiation DNA degradation. These results suggest a direct role for SSB in recombinational repair apart from and in addition to its role in facilitating induction of the recA-lexA regulon.

Switch from hapten-specific immunoglobulin M to immunoglobulin D secretion in a hybrid mouse cell line.

PubMed Central

Neuberger, M S; Rajewsky, K

1981-01-01

From a hybrid mouse cell line (B1-8) that secreted an IgM, lambda 1 anti-(4-hydroxy-3-nitrophenyl)acetyl antibody but that had no detectable surface IgM, selection for a variant with lambda 1 chains on the surface resulted in the isolation of a line that had switched from mu to delta expression. The surface and secreted Igs of this line were typed as IgD with two monoclonal antibodies, and the parental IgM and variant IgD molecules carried the same variable regions as judged by hapten-binding and idiotypic analysis. The surface and secreted delta chains of the IgD variant have apparent molecular weights of 64,000 and 61,000, respectively. However, the unglycosylated secreted delta polypeptide chain has a molecular weight of only 44,000. The secreted IgD exists predominantly in the delta 2 lambda A2 form, does not contain J protein, is relatively stable in serum, and does not fix complement. Images PMID:6940132

Analyses of chicken immunoglobulin light chain cDNA clones indicate a few germline V lambda genes and allotypes of the C lambda locus.

PubMed

Parvari, R; Ziv, E; Lentner, F; Tel-Or, S; Burstein, Y; Schechter, I

1987-01-01

cDNA libraries of chicken spleen and Harder gland (a gland enriched with immunocytes) constructed in pBR322 were screened by differential hybridization and by mRNA hybrid-selected translation. Eleven L-chain cDNA clones were identified from which VL probes were prepared and each was annealed with kidney DNA restriction digests. All VL probes revealed the same set of bands, corresponding to about 15 germline VL genes of one subgroup. The nucleotide sequences of six VL clones showed greater than or equal to 85% homology, and the predicted amino acid sequences were identical or nearly identical to the major N-terminal sequence of L-chains in chicken serum. These findings, and the fact that the VL clones were randomly selected from normal lymphoid tissues, strongly indicate that the bulk of chicken L-chains is encoded by a few germline VL genes, probably much less than 15 since many of the VL genes are known to be pseudogenes. Therefore, it is likely that somatic mechanisms operating prior to specific triggering by antigen play a major role in the generation of antibody diversity in chicken. Analysis of the constant region locus (sequencing of CL gene and cDNAs) demonstrate a single CL isotype and suggest the presence of CL allotypes.

Recombineering using RecET from Pseudomonas syringae

USDA-ARS?s Scientific Manuscript database

Here we report the identification of functions that promote genomic recombination of linear DNA introduced into Pseudomonas cells by electroporation. The genes encoding these functions were identified in Pseudomonas syringae pv. syringae B728a based on similarity to the lambda Red Exo/Beta and RecE...

Incorporation of a lambda phage recombination system and EGFP detection to simplify mutagenesis of Herpes simplex virus bacterial artificial chromosomes

PubMed Central

Schmeisser, Falko; Weir, Jerry P

2007-01-01

Background Targeted mutagenesis of the herpesvirus genomes has been facilitated by the use of bacterial artificial chromosome (BAC) technology. Such modified genomes have potential uses in understanding viral pathogenesis, gene identification and characterization, and the development of new viral vectors and vaccines. We have previously described the construction of a herpes simplex virus 2 (HSV-2) BAC and the use of an allele replacement strategy to construct HSV-2 recombinants. While the BAC mutagenesis procedure is a powerful method to generate HSV-2 recombinants, particularly in the absence of selective marker in eukaryotic culture, the mutagenesis procedure is still difficult and cumbersome. Results Here we describe the incorporation of a phage lambda recombination system into an allele replacement vector. This strategy enables any DNA fragment containing the phage attL recombination sites to be efficiently inserted into the attR sites of the allele replacement vector using phage lambda clonase. We also describe how the incorporation of EGFP into the allele replacement vector can facilitate the selection of the desired cross-over recombinant BACs when the allele replacement reaction is a viral gene deletion. Finally, we incorporate the lambda phage recombination sites directly into an HSV-2 BAC vector for direct recombination of gene cassettes using the phage lambda clonase-driven recombination reaction. Conclusion Together, these improvements to the techniques of HSV BAC mutagenesis will facilitate the construction of recombinant herpes simplex viruses and viral vectors. PMID:17501993

Simple method of DNA stretching on glass substrate for fluorescence image and spectroscopy

NASA Astrophysics Data System (ADS)

Neupane, Guru P.; Dhakal, Krishna P.; Lee, Hyunsoo; Guthold, Martin; Joseph, Vincent S.; Hong, Jong-Dal; Kim, Jeongyong

2013-05-01

Study of biological molecule DNA has contributed to developing many breaking thoughts and wide applications in multidisciplinary fields, such as genomic, medical, sensing and forensic fields. Stretching of DNA molecules is an important supportive tool for AFM or spectroscopic studies of DNA in a single molecular level. In this article, we established a simple method of DNA stretching (to its full length) that occurred on a rotating negatively-charged surface of glass substrate. The isolation of a single DNA molecule was attained by the two competitive forces on DNA molecules, that is, the electrostatic attraction developed between the positively charged YOYO-1 stained DNA and the negatively charged substrate, and the centrifugal force of the rotating substrate, which separates the DNA aggregates into the single molecule. Density of stretched DNA molecules was controlled by selecting the specific parameters such as spinning time and rates, loading volume of DNA-dye complex solution etc. The atomic force microscopy image exhibited a single DNA molecule on the negatively-charged substrate in an isolated state. Further, the photoluminescence spectra of a single DNA molecule stained with YOYO-1 were achieved using the method developed in the present study, which is strongly believed to effectively support the spectroscopic analysis of DNA in a single molecular level.

A gene cassette for adapting Escherichia coli strains as hosts for att-Int-mediated rearrangement and pL expression vectors.

PubMed

Balakrishnan, R; Bolten, B; Backman, K C

1994-01-28

A cassette of genes from bacteriophage lambda, when carried on a derivative of bacteriophage Mu, renders strains of Escherichia coli (and in principle other Mu-sensitive bacteria) capable of supporting lambda-based expression vectors, such as rearrangement vectors and pL vectors. The gene cassette contains a temperature-sensitive allele of the repressor gene, cIts857, and a shortened leftward operon comprising, oLpL, N, xis and int. Transfection and lysogenization of this cassette into various host bacteria is mediated by phage Mu functions. Examples of regulated expression of the gene encoding T4 DNA ligase are presented.

Fluctuating micro-heterogeneity in water-tert-butyl alcohol mixtures and lambda-type divergence of the mean cluster size with phase transition-like multiple anomalies

NASA Astrophysics Data System (ADS)

Banerjee, Saikat; Furtado, Jonathan; Bagchi, Biman

2014-05-01

Water-tert-butyl alcohol (TBA) binary mixture exhibits a large number of thermodynamic and dynamic anomalies. These anomalies are observed at surprisingly low TBA mole fraction, with xTBA ≈ 0.03-0.07. We demonstrate here that the origin of the anomalies lies in the local structural changes that occur due to self-aggregation of TBA molecules. We observe a percolation transition of the TBA molecules at xTBA ≈ 0.05. We note that "islands" of TBA clusters form even below this mole fraction, while a large spanning cluster emerges above that mole fraction. At this percolation threshold, we observe a lambda-type divergence in the fluctuation of the size of the largest TBA cluster, reminiscent of a critical point. Alongside, the structure of water is also perturbed, albeit weakly, by the aggregation of TBA molecules. There is a monotonic decrease in the tetrahedral order parameter of water, while the dipole moment correlation shows a weak nonlinearity. Interestingly, water molecules themselves exhibit a reverse percolation transition at higher TBA concentration, xTBA ≈ 0.45, where large spanning water clusters now break-up into small clusters. This is accompanied by significant divergence of the fluctuations in the size of largest water cluster. This second transition gives rise to another set of anomalies around. Both the percolation transitions can be regarded as manifestations of Janus effect at small molecular level.

Fluctuating micro-heterogeneity in water-tert-butyl alcohol mixtures and lambda-type divergence of the mean cluster size with phase transition-like multiple anomalies.

PubMed

Banerjee, Saikat; Furtado, Jonathan; Bagchi, Biman

2014-05-21

Water-tert-butyl alcohol (TBA) binary mixture exhibits a large number of thermodynamic and dynamic anomalies. These anomalies are observed at surprisingly low TBA mole fraction, with x(TBA) ≈ 0.03-0.07. We demonstrate here that the origin of the anomalies lies in the local structural changes that occur due to self-aggregation of TBA molecules. We observe a percolation transition of the TBA molecules at x(TBA) ≈ 0.05. We note that "islands" of TBA clusters form even below this mole fraction, while a large spanning cluster emerges above that mole fraction. At this percolation threshold, we observe a lambda-type divergence in the fluctuation of the size of the largest TBA cluster, reminiscent of a critical point. Alongside, the structure of water is also perturbed, albeit weakly, by the aggregation of TBA molecules. There is a monotonic decrease in the tetrahedral order parameter of water, while the dipole moment correlation shows a weak nonlinearity. Interestingly, water molecules themselves exhibit a reverse percolation transition at higher TBA concentration, x(TBA) ≈ 0.45, where large spanning water clusters now break-up into small clusters. This is accompanied by significant divergence of the fluctuations in the size of largest water cluster. This second transition gives rise to another set of anomalies around. Both the percolation transitions can be regarded as manifestations of Janus effect at small molecular level.

A novel mechanism of sugar selection utilized by a human X-family DNA polymerase.

PubMed

Brown, Jessica A; Fiala, Kevin A; Fowler, Jason D; Sherrer, Shanen M; Newmister, Sean A; Duym, Wade W; Suo, Zucai

2010-01-15

During DNA synthesis, most DNA polymerases and reverse transcriptases select against ribonucleotides via a steric clash between the ribose 2'-hydroxyl group and the bulky side chain of an active-site residue. In this study, we demonstrated that human DNA polymerase lambda used a novel sugar selection mechanism to discriminate against ribonucleotides, whereby the ribose 2'-hydroxyl group was excluded mostly by a backbone segment and slightly by the side chain of Y505. Such steric clash was further demonstrated to be dependent on the size and orientation of the substituent covalently attached at the ribonucleotide C2'-position. Copyright 2009 Elsevier Ltd. All rights reserved.

Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.

PubMed

Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero

2003-09-01

The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.

Elevated expression of esterase and cytochrome P450 are related with lambda-cyhalothrin resistance and lead to cross resistance in Aphis glycines Matsumura.

PubMed

Xi, Jinghui; Pan, Yiou; Bi, Rui; Gao, Xiwu; Chen, Xuewei; Peng, Tianfei; Zhang, Min; Zhang, Hua; Hu, Xiaoyue; Shang, Qingli

2015-02-01

A resistant strain of the Aphis glycines Matsumura (CRR) has developed 76.67-fold resistance to lambda-cyhalothrin compared with the susceptible (CSS) strain. Synergists piperonyl butoxide (PBO), S,S,S-Tributyltrithiophosphate (DEF) and triphenyl phosphate (TPP) dramatically increased the toxicity of lambda-cyhalothrin to the resistant strain. Bioassay results indicated that the CRR strain had developed high levels of cross-resistance to chlorpyrifos (11.66-fold), acephate (8.20-fold), cypermethrin (53.24-fold), esfenvalerate (13.83-fold), cyfluthrin (9.64-fold), carbofuran (14.60-fold), methomyl (9.32-fold) and bifenthrin (4.81-fold), but did not have cross-resistance to chlorfenapyr, imidacloprid, diafenthiuron, abamectin. The transcriptional levels of CYP6A2-like, CYP6A14-like and cytochrome b-c1 complex subunit 9-like increased significantly in the resistant strain than that in the susceptible. Similar trend were observed in the transcripts and DNA copy number of CarE and E4 esterase. Overall, these results demonstrate that increased esterase hydrolysis activity, combined with elevated cytochrome P450 monooxygenase detoxicatication, plays an important role in the high levels of lambda-cyhalothrin resistance and can cause cross-resistance to other insecticides in the CRR strain. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular long-wavelength lasers and their future prospects (review)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Molevich, N.E.; Oraevskii, A.N.

A review is given of the main types of molecular lasers emitting at wavelengths lambda> or =15 ..mu.. as a result of electric-discharge, optical, or chemical excitation. Attention is drawn to new developments in long-wavelength lasers based on the VRT relaxation mechanism of a series of diatomic molecules containing hydrogen.

Deformation of DNA molecules by hydrodynamic focusing

NASA Astrophysics Data System (ADS)

Wong, Pak Kin; Lee, Yi-Kuen; Ho, Chih-Ming

2003-12-01

The motion of a DNA molecule in a solvent flow reflects the deformation of a nano/microscale flexible mass spring structure by the forces exerted by the fluid molecules. The dynamics of individual molecules can reveal both fundamental properties of the DNA and basic understanding of the complex rheological properties of long-chain molecules. In this study, we report the dynamics of isolated DNA molecules under homogeneous extensional flow. Hydrodynamic focusing generates homogeneous extensional flow with uniform velocity in the transverse direction. The deformation of individual DNA molecules in the flow was visualized with video fluorescence microscopy. A coil stretch transition was observed when the Deborah number (De) is larger than 0.8. With a sudden stopping of the flow, the DNA molecule relaxes and recoils. The longest relaxation time of T2 DNA was determined to be 0.63 s when scaling viscosity to 0.9 cP.

DNA Molecules Adsorbed on Rippled Supported Cationic Lipid Membranes -- A new way to stretch DNAs

NASA Astrophysics Data System (ADS)

Golubovic, Leonardo

2005-03-01

We discuss a novel approach to control to shapes of DNA molecules. We elucidate the recent experimental work of M. Hochrein, L. Golubovic and J. Raedler, on the conformational behavior of DNA molecules adsorbed on lipid membranes that are supported on grooved micro-structured surfaces. We explain the striking ability of the edges formed on these supported membranes to adsorb and completely orient (stretch) very long DNA molecules. Here we explain the experimentally observed DNA stretching effect in terms of the surface curvature dependent electrostatic potential seen by the adsorbed DNA molecules. On the curved, rippled membrane, we show that the DNA molecules undergo localization transitions causing them to stretch by binding to the ripple edges of the supported membrane. In the future, this stretching will allow to directly image, by the common fluorescence microscopy, fundamental biological processes of the interactions between DNA and single protein molecules.

Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

PubMed

Yadav, Hemendra; Sharma, Pulkit

2017-11-01

Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

Non-Intrusive Optical Diagnostic Methods for Flowfield Characterization

NASA Technical Reports Server (NTRS)

Tabibi, Bagher M.; Terrell, Charles A.; Spraggins, Darrell; Lee, Ja. H.; Weinstein, Leonard M.

1997-01-01

Non-intrusive optical diagnostic techniques such as Electron Beam Fluorescence (EBF), Laser-Induced Fluorescence (LIF), and Focusing Schlieren (FS) have been setup for high-speed flow characterization and large flowfield visualization, respectively. Fluorescence emission from the First Negative band of N2(+) with the (0,0) vibration transition (at lambda =391.44 nm) was obtained using the EBF technique and a quenching rate of N2(+)* molecules by argon gas was reported. A very high sensitivity FS system was built and applied in the High-Speed Flow Generator (HFG) at NASA LaRC. A LIF system is available at the Advanced Propulsion Laboratory (APL) on campus and a plume exhaust velocity measurement, measuring the Doppler shift from lambda = 728.7 nm of argon gas, is under way.

Methods of DNA methylation detection

NASA Technical Reports Server (NTRS)

Maki, Wusi Chen (Inventor); Filanoski, Brian John (Inventor); Mishra, Nirankar (Inventor); Rastogi, Shiva (Inventor)

2010-01-01

The present invention provides for methods of DNA methylation detection. The present invention provides for methods of generating and detecting specific electronic signals that report the methylation status of targeted DNA molecules in biological samples.Two methods are described, direct and indirect detection of methylated DNA molecules in a nano transistor based device. In the direct detection, methylated target DNA molecules are captured on the sensing surface resulting in changes in the electrical properties of a nano transistor. These changes generate detectable electronic signals. In the indirect detection, antibody-DNA conjugates are used to identify methylated DNA molecules. RNA signal molecules are generated through an in vitro transcription process. These RNA molecules are captured on the sensing surface change the electrical properties of nano transistor thereby generating detectable electronic signals.

A mathematical model for DNA

NASA Astrophysics Data System (ADS)

Sepehri, Alireza

Recently, some authors have shown that a DNA molecule produces electromagnetic signals and communicates with other DNA molecules or other molecules. In fact, a DNA acts like a receiver or transmitter of radio waves. In this paper, we suggest a mathematical model for the DNA molecule and use of its communication to cure some diseases like cancer. In this model, first, by using concepts from string theory and M-theory, we calculate the energy of a DNA in terms of interactions between free electrons and bound electrons. We show that when a DNA is damaged, its energy changes and an extra current is produced. This extra current causes the electromagnetic signals of a damaged DNA molecule to be different when compared to the electromagnetic signals of a normal DNA molecule. The electromagnetic signals of a damaged DNA molecule induce an extra current in a normal DNA molecule and lead to its destruction. By sending crafted electromagnetic signals to normal DNA molecules and inducing an opposite current with respect to this extra current, we can prevent the destruction of normal DNA. Finally, we argue that the type of packing of DNA in chromosomes of men and women is different. This causes radiated waves from DNAs of men and women to have opposite signs and cancel the effect of each other in a pair. Using this property, we suggest another mechanism to cancel the effect of extra waves, which are produced by DNAs in cancer cells of a male or a female, by extra waves which are produced by DNAs in similar cells of a female or a male and prevent the progression of the disease.

Lambda Red Mediated Gap Repair Utilizes a Novel Replicative Intermediate in Escherichia coli

PubMed Central

Reddy, Thimma R.; Fevat, Léna M. S.; Munson, Sarah E.; Stewart, A. Francis; Cowley, Shaun M.

2015-01-01

The lambda phage Red recombination system can mediate efficient homologous recombination in Escherichia coli, which is the basis of the DNA engineering technique termed recombineering. Red mediated insertion of DNA requires DNA replication, involves a single-stranded DNA intermediate and is more efficient on the lagging strand of the replication fork. Lagging strand recombination has also been postulated to explain the Red mediated repair of gapped plasmids by an Okazaki fragment gap filling model. Here, we demonstrate that gap repair involves a different strand independent mechanism. Gap repair assays examining the strand asymmetry of recombination did not show a lagging strand bias. Directly testing an ssDNA plasmid showed lagging strand recombination is possible but dsDNA plasmids did not employ this mechanism. Insertional recombination combined with gap repair also did not demonstrate preferential lagging strand bias, supporting a different gap repair mechanism. The predominant recombination route involved concerted insertion and subcloning though other routes also operated at lower frequencies. Simultaneous insertion of DNA resulted in modification of both strands and was unaffected by mutations to DNA polymerase I, responsible for Okazaki fragment maturation. The lower efficiency of an alternate Red mediated ends-in recombination pathway and the apparent lack of a Holliday junction intermediate suggested that gap repair does not involve a different Red recombination pathway. Our results may be explained by a novel replicative intermediate in gap repair that does not involve a replication fork. We exploited these observations by developing a new recombineering application based on concerted insertion and gap repair, termed SPI (subcloning plus insertion). SPI selected against empty vector background and selected for correct gap repair recombinants. We used SPI to simultaneously insert up to four different gene cassettes in a single recombineering reaction. Consequently, our findings have important implications for the understanding of E. coli replication and Red recombination. PMID:25803509

DNA molecule stretching through thermo-electrophoresis and thermal convection in a heated converging-diverging microchannel.

PubMed

Hsieh, Shou-Shing; Chen, Jyun-Hong; Tsai, Cheng-Fung

2013-02-18

A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements.

DNA aptamers for the detection of Haemophilus influenzae type b by cell SELEX.

PubMed

Bitaraf, F S; Rasooli, I; Mousavi Gargari, S L

2016-03-01

Haemophilus influenzae type b (Hib) causes acute bacterial meningitis (ABM) in children, with a mortality rate of about 3-6 % of the affected patients. ABM can lead to death during a period of hours to several days and, hence, rapid and early detection of the infection is crucial. Aptamers, the short single-stranded DNA or RNA with high affinity to target molecules, are selected by a high-flux screening technique known as in vitro screening and systematic evolution of ligands by exponential enrichment technology (SELEX). In this study, whole-cell SELEX was applied for the selection of target-specific aptamers with high affinity to Hib. ssDNA aptamers prepared by lambda exonuclease were incubated with the target cells (Hib). The aptameric binding rate to Hib was characterized for binding affinity after seven SELEX rounds by flow cytometry. The aptamers with higher binding affinity were cloned. Four of 68 aptamer clones were selected for sequencing. The dissociation constant (Kd) of the high-affinity aptamer clones 45 and 63 were 47.10 and 28.46 pM, respectively. These aptamers did not bind to other bacterial species, including the seven meningitis-causing bacteria. They showed distinct affinity to various H. influenzae strains only. These aptamers showed the highest affinity to Hib and the lowest affinity to H. influenzae type c and to other meningitis-causing bacteria. Clone 63 could detect Hib in patients' cerebrospinal fluid (CSF) samples at 60 colony-forming units (CFU)/mL. The results indicate applicability of the aptamers for rapid and early detection of infections brought about by Hib.

Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

PubMed

Park, Suehyun; Joo, Heesun; Kim, Jun Soo

2018-01-31

Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

Caffeic acid and quercetin protect erythrocytes against the oxidative stress and the genotoxic effects of lambda-cyhalothrin in vitro.

PubMed

Abdallah, Fatma Ben; Fetoui, H; Fakhfakh, F; Keskes, L

2012-01-01

Lambda-cyhalothrin (LTC) is a synthetic pyrethroid with a broad spectrum of insecticidal and acaricidal activities used to control wide range of insect pests in a variety of applications. The aim of this study was to examine (i) the potency of LTC to induce oxidative stress response in rat erythrocytes in vitro and (ii) the role of caffeic acid (20 μM) and/or quercetin (10 μM) in preventing the cytotoxic effects. Erythrocytes were divided into four portions. The erythrocytes of the first portion were incubated for 4 h at 37°C with different concentrations (0, 50 and 100 μM) of LTC. The others portions were pretreated with caffeic acid and/or quercetin for 30 min prior to LTC incubation. Lipid peroxidation, protein oxidation, antioxidant enzyme activities and DNA damage were examined. LTC at different concentrations causes increased levels of lipid peroxidation, protein oxidation, DNA damage and decreased antioxidant enzyme activities. Combined caffeic acid and quercetin pretreatments significantly reduced the levels of lipid peroxidation markers, that is thiobarbituric acid reactive substance (TBARS), protein carbonyls (PCO) and decreased DNA damage in LTC portion. Further, combined caffeic acid and quercetin pretreatment maintain antioxidant enzyme activities and glutathione content near to normal values. These results suggest that LTC exerts its toxic effect by increasing lipid peroxidation, altering the antioxidant enzyme activities and DNA damage. Caffeic acid and quercetin pretreatments prevent the toxic effects of LTC, suggesting their role as a potential antioxidant.

Novel DNA packaging recognition in the unusual bacteriophage N15

DOE Office of Scientific and Technical Information (OSTI.GOV)

Feiss, Michael; Geyer, Henriette, E-mail: henriettegeyer@gmail.com; Division of Viral Infections, Robert Koch Institute, Berlin

Phage lambda's cosB packaging recognition site is tripartite, consisting of 3 TerS binding sites, called R sequences. TerS binding to the critical R3 site positions the TerL endonuclease for nicking cosN to generate cohesive ends. The N15 cos (cos{sup N15}) is closely related to cos{sup λ}, but whereas the cosB{sup N15} subsite has R3, it lacks the R2 and R1 sites and the IHF binding site of cosB{sup λ}. A bioinformatic study of N15-like phages indicates that cosB{sup N15} also has an accessory, remote rR2 site, which is proposed to increase packaging efficiency, like R2 and R1 of lambda. N15more » plus five prophages all have the rR2 sequence, which is located in the TerS-encoding 1 gene, approximately 200 bp distal to R3. An additional set of four highly related prophages, exemplified by Monarch, has R3 sequence, but also has R2 and R1 sequences characteristic of cosB–λ. The DNA binding domain of TerS-N15 is a dimer. - Highlights: • There are two classes of DNA packaging signals in N15-related phages. • Phage N15's TerS binding site: a critical site and a possible remote accessory site. • Viral DNA recognition signals by the λ-like bacteriophages: the odd case of N15.« less

Ultrafast photo-initiated molecular quantum dynamics in the DNA dinucleotide d(ApG) revealed by broadband transient absorption spectroscopy.

PubMed

Stuhldreier, Mayra C; Temps, Friedrich

2013-01-01

The ultrafast photo-initiated quantum dynamics of the adenine-guanine dinucleotide d(ApG) in aqueous solution (pH 7) has been studied by femtosecond time-resolved spectroscopy after excitation at lambda = 260 nm. The results reveal a hierarchy of processes on time scales from tau < 100 fs to tau > 100 ps. Characteristic spectro-temporal signatures are observed indicating the transformation of the molecules in the electronic relaxation from the photo-excited state to a long-lived exciplex. In particular, broadband UV/VIS excited-state absorption (ESA) measurements detected a distinctive absorption by the excited dinucleotide around lambda = 335 nm, approximately 0.5 eV to the blue compared to the maximum of the broad and unstructured ESA spectrum after excitation of an equimolar mixture of the mononucleotides dAMP and dGMP. A similar feature has been identified as signature of the excimer in the dynamics of the adenine dinucleotide d(ApA). The lifetime of the d(ApG) exciplex was found to be tau = 124 +/- 4 ps both from the ESA decay time and from the ground-state recovery time, far longer than the sub-picosecond lifetimes of excited dAMP or dGMP. Fluorescence-time profiles measured by the up-conversion technique indicate that the exciplex state is reached around approximately 6 ps after excitation. Very weak residual fluorescence at longer times red-shifted to the emission from the photo-excited state shows that the exciplex is almost optically dark, but still has enough oscillator strength to give rise to the dual fluorescence of the dinucleotide in the static fluorescence spectrum.

Binding of transcription termination protein nun to nascent RNA and template DNA.

PubMed

Watnick, R S; Gottesman, M E

1999-12-17

The amino-terminal arginine-rich motif of coliphage HK022 Nun binds phage lambda nascent transcript, whereas the carboxyl-terminal domain interacts with RNA polymerase (RNAP) and blocks transcription elongation. RNA binding is inhibited by zinc (Zn2+) and stimulated by Escherichia coli NusA. To study these interactions, the Nun carboxyl terminus was extended by a cysteine residue conjugated to a photochemical cross-linker. The carboxyl terminus contacted NusA and made Zn2+-dependent intramolecular contacts. When Nun was added to a paused transcription elongation complex, it cross-linked to the DNA template. Nun may arrest transcription by anchoring RNAP to DNA.

Nucleic Acid Nanostructures: Bottom-Up Control of Geometry on the Nanoscale

PubMed Central

Seeman, Nadrian C.; Lukeman, Philip S.

2012-01-01

DNA may seem an unlikely molecule from which to build nanostructures, but this is not correct. The specificity of interaction that enables DNA to function so successfully as genetic material also enables its use as a smart molecule for construction on the nanoscale. The key to using DNA for this purpose is the design of stable branched molecules, which expand its ability to interact specifically with other nucleic acid molecules. The same interactions used by genetic engineers can be used to make cohesive interactions with other DNA molecules that lead to a variety of new species. Branched DNA molecules are easy to design, and the can assume a variety of structural motifs. These can be used for purposes both of specific construction, such as polyhedra, and for the assembly of topological targets. A variety of two-dimensional periodic arrays with specific patterns have been made. DNA nanomechanical devices have been built with a series of different triggers, small molecules, nucleic acid molecules and proteins. Recently, progress has been made in self-replication of DNA nano-constructs, and in the scaffolding of other species into DNA arrangements. PMID:25152542

Cytotoxicity of lambda-cyhalothrin on the macrophage cell line RAW 264.7.

PubMed

Zhang, Quan; Wang, Cui; Sun, Liwei; Li, Ling; Zhao, Meirong

2010-01-01

The wide use and wide-spectrum toxicity of synthetic pyrethroids (SPs) insecticides make them an emerging ecotoxicological concern. Some previous studies showed that SPs possessed cytotoxicity in some immune cells such as human lymphocytes and rat bone marrow. However, the cytotoxicity of SPs to macrophages, which are crucial to innate immunity, has not been explored. In the present report, we investigated a new pyrethroid insecticide, lambda-cyhalothrin (LCT), which may increase the generation of reactive oxygen species (ROS) and DNA damage levels and cause cytotoxicity in RAW 264.7 cells in dose- and time-dependent manners. The results for the first time implicated increased endogenous ROS and DNA damage as co-mediators of LCT-induced cytotoxicity in macrophages. Our results also suggested that macrophages were involved in synthetic pyrethroid-induced adverse immune effects. Considering the ubiquitous environmental presence of SPs, this study provided new information relative to the potential long-term physiological and immunological effects associated with chronic exposure to SPs. Hence, the potential immunotoxicity of SPs should be considered in assessing the safety of these compounds in sensitive environmental compartments.

Evaluation of Acute toxicity of Lambda Cyhalothrin in Mus musculus L.

PubMed

Tomar, Monika; Kumar, Ajay; Kataria, Sudhir Kumar

2015-08-01

Lambda Cyhalothrin (LCT) is a type II synthetic pyrethroid widely used in agriculture, home pest control and protection of food stuff. Here, we evaluated its toxicity on biochemical parameters (Total protein, Acetyl cholinesterase, RNA and DNA) and liver histological alteration in mice after 24 h of oral administration @ 25, 50 and 75% of LD50 i.e.; 26.49 mg/kg/body wt. Distilled water (DW) and Cyclophosphamide (CP @ 40 mg/kg/body wt.) were used as negative and positive control; respectively. LCT treated mice showed significant decrease in total protein (P < 0.01), acetyl cholinesterase (P < 0.001) and DNA (P < 0.001) in a dose dependent manner. On the contrary, RNA content showed significant increase (P < 0.01) at 50% of LD50 of LCT. Histological observations of the mice liver showed vascular congestion and hepatocyte degeneration with 6.63 mg/kg/body wt. of LCT; and accumulation of RBCs with sinusoid degeneration and wide necrotic area with pyknosis with 13.25 and 19.88 mg/kg/body wt., respectively. The results demonstrated LCT induced biochemical changes and hepatotoxicity in female mice.

Theoretical electrical conductivity of hydrogen-bonded benzamide-derived molecules and single DNA bases.

PubMed

Chen, Xiang

2013-09-01

A benzamide molecule is used as a "reader" molecule to form hydrogen bonds with five single DNA bases, i.e., four normal single DNA bases A,T,C,G and one for 5methylC. The whole molecule is then attached to the gold surface so that a meta-molecule junction is formed. We calculate the transmission function and conductance for the five metal-molecule systems, with the implementation of density functional theory-based non-equilibrium Green function method. Our results show that each DNA base exhibits a unique conductance and most of them are on the pS level. The distinguishable conductance of each DNA base provides a way for the fast sequencing of DNA. We also investigate the dependence of conductivity of such a metal-molecule system on the hydrogen bond length between the "reader" molecule and DNA base, which shows that conductance follows an exponential decay as the hydrogen bond length increases, i.e., the conductivity is highly sensitive to the change in hydrogen bond length.

The shear flow processing of controlled DNA tethering and stretching for organic molecular electronics.

PubMed

Yu, Guihua; Kushwaha, Amit; Lee, Jungkyu K; Shaqfeh, Eric S G; Bao, Zhenan

2011-01-25

DNA has been recently explored as a powerful tool for developing molecular scaffolds for making reproducible and reliable metal contacts to single organic semiconducting molecules. A critical step in the process of exploiting DNA-organic molecule-DNA (DOD) array structures is the controlled tethering and stretching of DNA molecules. Here we report the development of reproducible surface chemistry for tethering DNA molecules at tunable density and demonstrate shear flow processing as a rationally controlled approach for stretching/aligning DNA molecules of various lengths. Through enzymatic cleavage of λ-phage DNA to yield a series of DNA chains of various lengths from 17.3 μm down to 4.2 μm, we have investigated the flow/extension behavior of these tethered DNA molecules under different flow strengths in the flow-gradient plane. We compared Brownian dynamic simulations for the flow dynamics of tethered λ-DNA in shear, and found our flow-gradient plane experimental results matched well with our bead-spring simulations. The shear flow processing demonstrated in our studies represents a controllable approach for tethering and stretching DNA molecules of various lengths. Together with further metallization of DNA chains within DOD structures, this bottom-up approach can potentially enable efficient and reliable fabrication of large-scale nanoelectronic devices based on single organic molecules, therefore opening opportunities in both fundamental understanding of charge transport at the single molecular level and many exciting applications for ever-shrinking molecular circuits.

Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

NASA Astrophysics Data System (ADS)

Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

2016-03-01

We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed

Horn, T; Chang, C A; Urdea, M S

1997-12-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed Central

Horn, T; Chang, C A; Urdea, M S

1997-01-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266

DNA of a Human Hepatitis B Virus Candidate

PubMed Central

Robinson, William S.; Clayton, David A.; Greenman, Richard L.

1974-01-01

Particles containing DNA polymerase (Dane particles) were purified from the plasma of chronic carriers of hepatitis B antigen. After a DNA polymerase reaction with purified Dane particle preparations treated with Nonidet P-40 detergent, Dane particle core structures containing radioactive DNA product were isolated by sedimentation in a sucrose density gradient. The radioactive DNA was extracted with sodium dodecyl sulfate and isolated by band sedimentation in a preformed CsCl gradient. Examination of the radioactive DNA band by electron microscopy revealed exclusively circular double-stranded DNA molecules approximately 0.78 μm in length. Identical circular molecules were observed when DNA was isolated by a similar procedure from particles that had not undergone a DNA polymerase reaction. The molecules were completely degraded by DNase 1. When Dane particle core structures were treated with DNase 1 before DNA extraction, only 0.78-μm circular DNA molecules were detected. Without DNase treatment of core structures, linear molecules with lengths between 0.5 and 12 μm, in addition to the 0.78-μm circles were found. These results suggest that the 0.78-μm circular molecules were in a protected position within Dane particle cores and the linear molecules were not within core structures. Length measurements on 225 circular molecules revealed a mean length of 0.78 ± 0.09 μm which would correspond to a molecular weight of around 1.6 × 106. The circular molecules probably serve as primer-template for the DNA polymerase reaction carried out by Dane particle cores. Thermal denaturation and buoyant density measurements on the Dane particle DNA polymerase reaction product revealed a guanosine plus cytosine content of 48 to 49%. Images PMID:4847328

Heterogeneous and monoclonal helper T cells induce similar anti-(4-hydroxy-3-nitrophenyl)acetyl (NP) antibody populations in the primary adoptive response. II. Lambda light chain dominance and idiotope expression.

PubMed

Smith, F I; Tesch, H; Rajewsky, K

1984-02-01

When the hapten (4-hydroxy-3-nitrophenyl)acetyl (NP) is presented on different carrier molecules, different anti-NP antibody responses are stimulated. On stimulation with NP-lipopolysaccharide (LPS) [T-independent type 1 (TI-1) antigen] kappa + antibodies are the major population, whereas on stimulation with NP-Ficoll [T-independent type 2 (TI-2) antigen], NP-keyhole limpet hemocyanin (KLH) or NP-chicken gamma globulin (CG) [T-dependent (TD) antigens], lambda 1+ antibodies dominate. The relative contribution of idiotopes Ac38 or Ac146 to the lambda 1+ anti-NP response was also different on comparison of TI-1 with TI-2 or TD anti-NP responses. We investigated whether light chain- or idiotype-specific T cells are responsible for these differences. Analysis of the anti-NP response of nude mice after immunization with NP-Ficoll showed lambda 1 dominance. Likewise primary adoptive transfer experiments using carrier-specific T cell lines to reconstitute the TD anti-NP response to NP-KLH or NP-CG, showed that help from carrier-specific T cells alone is capable of stimulating the characteristic lambda 1 dominant response. No significant difference could be found in the levels of Ac38 and Ac146 idiotope expression between mice reconstituted with splenic T cells and those reconstituted with T cell lines. These results suggest that light chain- or idiotype-specific T cells are required neither for the production of lambda 1 light chain dominance, nor for the appearance of idiotopes characteristic of the primary anti-NP response. The possible reasons for differences seen in both light chain and idiotope expression between primary anti-NP responses to the TI-1 antigen NP-LPS and those to TD or TI-2 antigens are discussed.

Using Synthetic Nanopores for Single-Molecule Analyses: Detecting SNPs, Trapping DNA Molecules, and the Prospects for Sequencing DNA

ERIC Educational Resources Information Center

Dimitrov, Valentin V.

2009-01-01

This work focuses on studying properties of DNA molecules and DNA-protein interactions using synthetic nanopores, and it examines the prospects of sequencing DNA using synthetic nanopores. We have developed a method for discriminating between alleles that uses a synthetic nanopore to measure the binding of a restriction enzyme to DNA. There exists…

Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).

PubMed

Schneider, Uffe Vest

2012-01-01

This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA molecules and other nucleic acid stabilizing molecules can increase analytical sensitivity whilst maintaining nucleobase mismatch discrimination in triplex helix based diagnostic assays.

One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

PubMed

Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

2015-01-31

A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

DNA origami as biocompatible surface to match single-molecule and ensemble experiments

PubMed Central

Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

2012-01-01

Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

The unusual and dynamic character of PX-DNA

DOE PAGES

Niu, Dong; Jiang, Hualin; Sha, Ruojie; ...

2015-07-15

PX-DNA is a four-stranded DNA structure that has been implicated in the recognition of homology, either continuously, or in an every-other-half-turn fashion. Some of the structural features of the molecule have been noted previously, but the structure requires further characterization. Here, we report atomic force microscopic characterization of PX molecules that contain periodically placed biotin groups, enabling the molecule to be labeled by streptavidin molecules at these sites. In comparison with conventional double stranded DNA and with antiparallel DNA double crossover molecules, it is clear that PX-DNA is a more dynamic structure. Moreover, the spacing between the nucleotide pairs alongmore » the helix axis is shorter, suggesting a mixed B/A structure. Circular dichroism spectroscopy indicates unusual features in the PX molecule that are absent in both the molecules to which it is compared.« less

Purification, cDNA cloning, and regulation of lysophospholipase from rat liver.

PubMed

Sugimoto, H; Hayashi, H; Yamashita, S

1996-03-29

A lysophospholipase was purified 506-fold from rat liver supernatant. The preparation gave a single 24-kDa protein band on SDS-polyacrylamide gel electrophoresis. The enzyme hydrolyzed lysophosphatidylcholine, lysophosphatidylethanolamine, lysophosphatidylinositol, lysophosphatidylserine, and 1-oleoyl-2-acetyl-sn-glycero-3-phosphocholine at pH 6-8. The purified enzyme was used for the preparation of antibody and peptide sequencing. A cDNA clone was isolated by screening a rat liver lambda gt11 cDNA library with the antibody, followed by the selection of further extended clones from a lambda gt10 library. The isolated cDNA was 2,362 base pairs in length and contained an open reading frame encoding 230 amino acids with a Mr of 24,708. The peptide sequences determined were found in the reading frame. When the cDNA was expressed in Escherichia coli cells as the beta-galactosidase fusion, lysophosphatidylcholine-hydrolyzing activity was markedly increased. The deduced amino acid sequence showed significant similarity to Pseudomonas fluorescence esterase A and Spirulina platensis esterase. The three sequences contained the GXSXG consensus at similar positions. The transcript was found in various tissues with the following order of abundance: spleen, heart, kidney, brain, lung, stomach, and testis = liver. In contrast, the enzyme protein was abundant in the following order: testis, liver, kidney, heart, stomach, lung, brain, and spleen. Thus the mRNA abundance disagreed with the level of the enzyme protein in liver, testis, and spleen. When HL-60 cells were induced to differentiate into granulocytes with dimethyl sulfoxide, the 24-kDa lysophospholipase protein increased significantly, but the mRNA abundance remained essentially unchanged. Thus a posttranscriptional control mechanism is present for the regulation of 24-kDa lysophospholipase.

Quantum scattering studies of spin-orbit effects in the Cl({sup 2}P) + HCl {yields} ClH + Cl({sup 2}P) reaction

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schatz, G.C.; McCabe, P.; Connor, J.N.L.

1998-07-01

The authors present quantum scattering calculations for the Cl + HCl {yields} ClH + Cl reaction in which they include the three electronic states that correlate asymptotically to the ground state of Cl({sup 2}P) + HCl(X{sup 1}{Sigma}{sup +}). The potential surfaces and couplings are taken from the recent work of C.S. Maierle, G.C. Schatz, M.S. Gordon, P. McCabe and J.N.L. Connor, J. Chem. Soc. Farad. Trans. (1997). They are based on extensive ab initio calculations for geometries in the vicinity of the lowest energy saddle point, and on an electrostatic expansion (plus empirical dispersion and repulsion) for long range geometriesmore » including the van der Waals wells. Spin-orbit coupling has been included using a spin-orbit coupling parameter {lambda} that is assumed to be independent of nuclear geometry, and Coriolis interactions are incorporated accurately. The scattering calculations use a hyperspherical coordinate coupled channel method in full dimensionality. AJ-shifting approximation is employed to convert cumulative reaction probabilities for total angular momentum quantum number J = 1/2 into state selected and thermal rate coefficients. Two issues have been studied: (a) the influence of the magnitude of {lambda} on the fine-structure resolved cumulative probabilities and rate coefficients (the authors consider {lambda}`s that vary from 0 to {+-}100% of the true Cl value), and (b) the transition state resonance spectrum, and its variation with {lambda} and with other parameters in the calculations. Cl + HCl is a simple hydrogen transfer reaction which serves as a canonical model both for heavy-light-heavy atom reactions, and for the reactions of halogen atoms with closed shell molecules.« less

Visualization of yeast chromosomal DNA

NASA Technical Reports Server (NTRS)

Lubega, Seth

1990-01-01

The DNA molecule is the most significant life molecule since it codes the blue print for other structural and functional molecules of all living organisms. Agarose gel electrophoresis is now being widely used to separate DNA of virus, bacteria, and lower eukaryotes. The task was undertaken of reviewing the existing methods of DNA fractionation and microscopic visualization of individual chromosonal DNA molecules by gel electrophoresis as a basis for a proposed study to investigate the feasibility of separating DNA molecules in free fluids as an alternative to gel electrophoresis. Various techniques were studied. On the molecular level, agarose gel electrophoresis is being widely used to separate chromosomal DNA according to molecular weight. Carl and Olson separate and characterized the entire karyotype of a lab strain of Saccharomyces cerevisiae. Smith et al. and Schwartz and Koval independently reported the visualization of individual DNA molecules migrating through agarose gel matrix during electrophoresis. The techniques used by these researchers are being reviewed in the lab as a basis for the proposed studies.

Transformation of Escherichia coli with large DNA molecules by electroporation.

PubMed Central

Sheng, Y; Mancino, V; Birren, B

1995-01-01

We have examined bacterial electroporation with a specific interest in the transformation of large DNA, i.e. molecules > 100 kb. We have used DNA from bacterial artificial chromosomes (BACs) ranging from 7 to 240 kb, as well as BAC ligation mixes containing a range o different sized molecules. The efficiency of electroporation with large DNA is strongly dependent on the strain of Escherichia coli used; strains which offer comparable efficiencies for 7 kb molecules differ in their uptake of 240 kb DNA by as much as 30-fold. Even with a host strain that transforms relatively well with large DNA, transformation efficiency drops dramatically with increasing size of the DNA. Molecules of 240 kb transform approximately 30-fold less well, on a molar basis, than molecules of 80 kb. Maximum transformation of large DNA occurs with different voltage gradients and with different time constants than are optimal for smaller DNA. This provides the opportunity to increase the yield of transformants which have taken up large DNA relative to the number incorporating smaller molecules. We have demonstrated that conditions may be selected which increase the average size of BAC clones generated by electroporation and compare the overall efficiency of each of the conditions tested. Images PMID:7596828

The study of electrical conductivity of DNA molecules by scanning tunneling spectroscopy

NASA Astrophysics Data System (ADS)

Sharipov, T. I.; Bakhtizin, R. Z.

2017-10-01

An interest to the processes of charge transport in DNA molecules is very high, due to perspective of their using in nanoelectronics. The original sample preparation for studying electrical conductivity of DNA molecules by scanning tunneling spectroscopy has been proposed and tested. The DNA molecules immobilized on gold surface have been imaged clearly and their current-voltage curves have been measured.

The Kinetic Mechanism for DNA Unwinding by Multiple Molecules of Dda Helicase Aligned on DNA†

PubMed Central

Eoff, Robert L.; Raney, Kevin D.

2010-01-01

Helicases catalyze the separation of double-stranded nucleic acids to form single-stranded intermediates. Using transient state kinetic methods we have determined the kinetic properties of DNA unwinding under conditions that favor a monomeric form of the Dda helicase as well as conditions that allow multiple molecules to function on the same substrate. Multiple helicase molecules can align like a train on the DNA track. The number of base pairs unwound in a single binding event for Dda is increased from ~19 bp for the monomeric form to ~64 bp when as many as four Dda molecules are aligned on the same substrate, while the kinetic step-size (3.2 ± 0.7 bp) and unwinding rate (242 ± 25 bp s−1) appear to be independent of the number of Dda molecules present on a given substrate. The data support a model in which the helicase molecules bound to the same substrate move along the DNA track independently during DNA unwinding. The observed increase in processivity arises from the increased probability that at least one of the helicases will completely unwind the DNA prior to dissociation. These results are in contrast to previous reports in which multiple Dda molecules on the same track greatly enhanced the rate and amplitude for displacement of protein blocks on the track. Therefore, only when the progress of the lead molecule in the train is impeded by some type of block, such as a protein bound to DNA, do the trailing molecules interact with the lead molecule in order to overcome the block. The fact that trailing helicase molecules have little impact on the lead molecule in the train during routine DNA unwinding suggests that the trailing molecules are moving at similar rates as the lead molecule. This result implicates a step in the translocation mechanism as contributing greatly to the overall rate-limiting step for unwinding of duplex DNA. PMID:20408588

Torsional mechanics of DNA are regulated by small-molecule intercalation.

PubMed

Celedon, Alfredo; Wirtz, Denis; Sun, Sean

2010-12-23

Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

1999-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Miniaturized reaction vessel system, method for performing site-specific biochemical reactions and affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, Andrei Darievich; Lysov, Yuri Petrovich; Dubley, Svetlana A.

2000-01-01

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between said cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting said extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to said extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from said array.

Method for performing site-specific affinity fractionation for use in DNA sequencing

DOEpatents

Mirzabekov, A.D.; Lysov, Y.P.; Dubley, S.A.

1999-05-18

A method for fractionating and sequencing DNA via affinity interaction is provided comprising contacting cleaved DNA to a first array of oligonucleotide molecules to facilitate hybridization between the cleaved DNA and the molecules; extracting the hybridized DNA from the molecules; contacting the extracted hybridized DNA with a second array of oligonucleotide molecules, wherein the oligonucleotide molecules in the second array have specified base sequences that are complementary to the extracted hybridized DNA; and attaching labeled DNA to the second array of oligonucleotide molecules, wherein the labeled re-hybridized DNA have sequences that are complementary to the oligomers. The invention further provides a method for performing multi-step conversions of the chemical structure of compounds comprising supplying an array of polyacrylamide vessels separated by hydrophobic surfaces; immobilizing a plurality of reactants, such as enzymes, in the vessels so that each vessel contains one reactant; contacting the compounds to each of the vessels in a predetermined sequence and for a sufficient time to convert the compounds to a desired state; and isolating the converted compounds from the array. 14 figs.

Nanopore DNA Sequencing and Genome Assembly on the International Space Station.

PubMed

Castro-Wallace, Sarah L; Chiu, Charles Y; John, Kristen K; Stahl, Sarah E; Rubins, Kathleen H; McIntyre, Alexa B R; Dworkin, Jason P; Lupisella, Mark L; Smith, David J; Botkin, Douglas J; Stephenson, Timothy A; Juul, Sissel; Turner, Daniel J; Izquierdo, Fernando; Federman, Scot; Stryke, Doug; Somasekar, Sneha; Alexander, Noah; Yu, Guixia; Mason, Christopher E; Burton, Aaron S

2017-12-21

We evaluated the performance of the MinION DNA sequencer in-flight on the International Space Station (ISS), and benchmarked its performance off-Earth against the MinION, Illumina MiSeq, and PacBio RS II sequencing platforms in terrestrial laboratories. Samples contained equimolar mixtures of genomic DNA from lambda bacteriophage, Escherichia coli (strain K12, MG1655) and Mus musculus (female BALB/c mouse). Nine sequencing runs were performed aboard the ISS over a 6-month period, yielding a total of 276,882 reads with no apparent decrease in performance over time. From sequence data collected aboard the ISS, we constructed directed assemblies of the ~4.6 Mb E. coli genome, ~48.5 kb lambda genome, and a representative M. musculus sequence (the ~16.3 kb mitochondrial genome), at 100%, 100%, and 96.7% consensus pairwise identity, respectively; de novo assembly of the E. coli genome from raw reads yielded a single contig comprising 99.9% of the genome at 98.6% consensus pairwise identity. Simulated real-time analyses of in-flight sequence data using an automated bioinformatic pipeline and laptop-based genomic assembly demonstrated the feasibility of sequencing analysis and microbial identification aboard the ISS. These findings illustrate the potential for sequencing applications including disease diagnosis, environmental monitoring, and elucidating the molecular basis for how organisms respond to spaceflight.

DNA molecules on periodically microstructured lipid membranes: Localization and coil stretching

NASA Astrophysics Data System (ADS)

Hochrein, Marion B.; Leierseder, Judith A.; Golubović, Leonardo; Rädler, Joachim O.

2007-02-01

We explore large scale conformations of DNA molecules adsorbed on curved surfaces. For that purpose, we investigate the behavior of DNA adsorbed on periodically shaped cationic lipid membranes. These unique membrane morphologies are supported on grooved, one-dimensionally periodic microstructured surfaces. Strikingly, we find that these periodically structured membranes are capable to stretch DNA coils. We elucidate this phenomenon in terms of surface curvature dependent potential energy attained by the adsorbed DNA molecules. Due to it, DNA molecules undergo a localization transition causing them to stretch by binding to highly curved sections (edges) of the supported membranes. This effect provides a new venue for controlling conformations of semiflexible polymers such as DNA by employing their interactions with specially designed biocompatible surfaces. We report the first experimental observation of semiflexible polymers unbinding transition in which DNA molecules unbind from one-dimensional manifolds (edges) while remaining bound to two-dimensional manifolds (cationic membranes).

Observation of DNA Molecules Using Fluorescence Microscopy and Atomic Force Microscopy

ERIC Educational Resources Information Center

Ito, Takashi

2008-01-01

This article describes experiments for an undergraduate instrumental analysis laboratory that aim to observe individual double-stranded DNA (dsDNA) molecules using fluorescence microscopy and atomic force microscopy (AFM). dsDNA molecules are observed under several different conditions to discuss their chemical and physical properties. In…

A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

NASA Astrophysics Data System (ADS)

Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels, creating molecular barcodes, which are efficiently read using fluorescence resonance energy transfer techniques for minimizing noise from unincorporated labels. As such, our integrative approach for the realization of genomic analysis through nanoconfinement, named nanocoding, was demonstrated through the barcoding and mapping of bacterial artificial chromosomal molecules, thereby providing the basis for a high-throughput platform competent for whole genome investigations.

Enhanced detection and identification of Shiga toxin 1 and 2 from pathogenic bacteria by MALDI-TOF-TOF-MS/MS-PSD and top-down proteomic analysis

USDA-ARS?s Scientific Manuscript database

Shiga toxin producing Escherichia coli (STEC) represent a continuing threat to the Nation’s food supply and public health. Shiga toxin genes (stx) are encoded in lambda-like bacteriophages whose genome is inserted into the bacterial DNA. Environmental stress can trigger bacteriophage replication a...

A fine structure genomic map of the region of 12q13 containing SAS and CDK4

DOE Office of Scientific and Technical Information (OSTI.GOV)

Linder, C.Y.; Elkahloun, A.G.; Su, Y.A.

1994-09-01

We have recently adapted a method, originally described by Rackwitz, to the rapid restriction mapping of multiple cosmid DNA samples. Linearization of the cosmids at the lambda cohesive site using lambda terminase is followed by partial digestion with selected restriction enzymes and hybridization to oligonucleotides specific for the right or left hand termini. Partial digestions are performed in a microtiter plate thus allowing up to 12 cosmid clones to be digested with one restriction enzyme. We have applied this rapid restriction mapping method to cosmids derived from a region of chromosome 12q13 that has recently been shown to be amplifiedmore » in a variety of cancers including malignant fibrous histiocytoma, fibrosarcoma, liposarcoma, osteosarcoma and brain tumors. A small segment of this amplification unit containing three genes, SAS (a membrane protein), CDK4 (a cyclin dependent kinase) and OS-9 (a recently described cDNA) has been analyzed with the system described above. This fine structure genomic map will be useful for completing the expression map of this region as well as characterizing its pattern of amplification in tumor specimens.« less

Visualization of DNA molecules in time during electrophoresis

NASA Technical Reports Server (NTRS)

Lubega, Seth

1991-01-01

For several years individual DNA molecules have been observed and photographed during agarose gel electrophoresis. The DNA molecule is clearly the largest molecule known. Nevertheless, the largest molecule is still too small to be seen using a microscope. A technique developed by Morikawa and Yanagida has made it possible to visualize individual DNA molecules. When these long molecules are labeled with appropriate fluorescence dyes and observed under a fluorescence microscope, although it is not possible to directly visualize the local ultrastructure of the molecules, yet because they are long light emitting chains, their microscopic dynamical behavior can be observed. This visualization works in the same principle that enables one to observe a star through a telescope because it emits light against a dark background. The dynamics of individual DNA molecules migrating through agarose matrix during electrophoresis have been described by Smith et al. (1989), Schwartz and Koval (1989), and Bustamante et al. (1990). DNA molecules during agarose gel electrophoresis advance lengthwise thorough the gel in an extended configuration. They display an extension-contraction motion and tend to bunch up in their leading ends as the 'heads' find new pores through the gel. From time to time they get hooked on obstacles in the gel to form U-shaped configurations before they resume their linear configuration.

Single molecule characterization of DNA binding and strand displacement reactions on lithographic DNA origami microarrays.

PubMed

Scheible, Max B; Pardatscher, Günther; Kuzyk, Anton; Simmel, Friedrich C

2014-03-12

The combination of molecular self-assembly based on the DNA origami technique with lithographic patterning enables the creation of hierarchically ordered nanosystems, in which single molecules are positioned at precise locations on multiple length scales. Based on a hybrid assembly protocol utilizing DNA self-assembly and electron-beam lithography on transparent glass substrates, we here demonstrate a DNA origami microarray, which is compatible with the requirements of single molecule fluorescence and super-resolution microscopy. The spatial arrangement allows for a simple and reliable identification of single molecule events and facilitates automated read-out and data analysis. As a specific application, we utilize the microarray to characterize the performance of DNA strand displacement reactions localized on the DNA origami structures. We find considerable variability within the array, which results both from structural variations and stochastic reaction dynamics prevalent at the single molecule level.

Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work

NASA Astrophysics Data System (ADS)

Kowalczykowski, Stephen

2013-03-01

We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.

Long-range correlations and charge transport properties of DNA sequences

NASA Astrophysics Data System (ADS)

Liu, Xiao-liang; Ren, Yi; Xie, Qiong-tao; Deng, Chao-sheng; Xu, Hui

2010-04-01

By using Hurst's analysis and transfer approach, the rescaled range functions and Hurst exponents of human chromosome 22 and enterobacteria phage lambda DNA sequences are investigated and the transmission coefficients, Landauer resistances and Lyapunov coefficients of finite segments based on above genomic DNA sequences are calculated. In a comparison with quasiperiodic and random artificial DNA sequences, we find that λ-DNA exhibits anticorrelation behavior characterized by a Hurst exponent 0.5

Global structure of forked DNA in solution revealed by high-resolution single-molecule FRET.

PubMed

Sabir, Tara; Schröder, Gunnar F; Toulmin, Anita; McGlynn, Peter; Magennis, Steven W

2011-02-09

Branched DNA structures play critical roles in DNA replication, repair, and recombination in addition to being key building blocks for DNA nanotechnology. Here we combine single-molecule multiparameter fluorescence detection and molecular dynamics simulations to give a general approach to global structure determination of branched DNA in solution. We reveal an open, planar structure of a forked DNA molecule with three duplex arms and demonstrate an ion-induced conformational change. This structure will serve as a benchmark for DNA-protein interaction studies.

Five-Body Cluster Structure of the Double-{Lambda} Hypernucleus {sub {Lambda}{Lambda}}{sup 11}Be

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hiyama, E.; Kamimura, M.; Yamamoto, Y.

2010-05-28

Energy levels of the double {Lambda} hypernucleus, {sub {Lambda}{Lambda}}{sup 11}Be are calculated within the framework of a {alpha}{alpha}n{Lambda}{Lambda} five-body model. Interactions between constituent particles are determined so as to reproduce reasonably the observed low-energy properties of the {alpha}{alpha}, {alpha}{alpha}n nuclei and the existing data for {Lambda}-binding energies of the {alpha}{Lambda}, {alpha}{alpha}{Lambda}, {alpha}n{Lambda}, and {alpha}{alpha}n{Lambda} systems. An effective {Lambda}{Lambda} interaction is constructed so as to reproduce, within the {alpha}{Lambda}{Lambda} three-body model, the B{sub {Lambda}{Lambda}}of {sub {Lambda}{Lambda}}{sup 6}He, which was extracted from the emulsion experiment, the NAGARA event. With no adjustable parameters for the {alpha}{alpha}n{Lambda}{Lambda} system, B{sub {Lambda}{Lambda}}of the ground and boundmore » excited states of {sub {Lambda}{Lambda}}{sup 11}Be are calculated with the Gaussian expansion method. The Hida event, recently observed at KEK-E373 experiment, is interpreted as an observation of the ground state of the {sub {Lambda}{Lambda}}{sup 11}Be.« less

[SOS-repair--60 years].

PubMed

Zavil'gel'skiĭ, G B

2013-01-01

This review integrates 60 years of research on SOS-repair and SOS-mutagenesis in procaryotes and eucaryotes, from Jean Weigle experiment in 1953 year (mutagenesis of lambda bacteriophage in UV-irradiated bacteria) to the latest achievements in studying SOS-mutagenesis on all living organisms--Eukarya, Archaea and Bacteria. A key role in establishing of a biochemical basis for SOS-mutagenesis belonges to the finding in 1998-1999 years that specific error-prone DNA polymerases (PolV and others) catalysed translesion synthesis on damaged DNA. This review focuses on recent studies addressing the new models for SOS-induced mutagenesis in Escherichia coli and Home sapiens cells.

tif-1 mutation alters polynucleotide recognition by the recA protein of Escherichia coli.

PubMed Central

McEntee, K; Weinstock, G M

1981-01-01

The requirements for polynucleotide-dependent hydrolysis of ATP and for proteolytic cleavage of phage lambda repressor have been examined for both the wild-type (recA+ protein) and the tif-1 mutant form [tif(recA) protein] of the recA gene product. The recA+ and tif(recA) proteins catalyze both reactions in the presence of long single-stranded DNAs or certain deoxyhomopolymers. However, short oligonucleotides [(dT)12, (dA)14] stimulate neither the protease nor the ATPase activities of the recA+ protein. In contrast, these short oligonucleotides activate tif(recA) protein to cleave lambda repressor without stimulating its ATPase activity. Moreover, both the ATPase and protease activities of the tif(recA) protein are stimulated by poly(rU) and poly(rC) whereas the recA+ protein does not respond to these ribopolymers. We have purified the recA protein from a strain in which the tif mutation is intragenically suppressed. This mutant protein (recA629) is inactive in the presence of (dT)12, (dA)14, poly(rU), and poly(rC) for lambda repressor cleavage and ATP hydrolysis. These results argue that the tif-1 mutation (or mutations) alters the DNA binding site of the recA protein. We suggest that in vivo the tif(recA) protein is activated for cleaving repressors of SOS genes by complex formation with short single-stranded regions or gaps that normally occur near the growing fork of replicating chromosomes and are too short for activating the recA+ enzyme. This mechanism can account for the expression of SOS functions in the absence of DNA damage in tif mutant strains. Images PMID:7031642

Application of differential scanning calorimetry to measure the differential binding of ions, water and protons in the unfolding of DNA molecules.

PubMed

Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A

2016-05-01

The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright © 2015. Published by Elsevier B.V.

UVB-induced mutagenesis in hairless {lambda}lacZ-transgenic mice

DOE Office of Scientific and Technical Information (OSTI.GOV)

Frijhoff, A.F.W.; Rebel, H.; Mientjes, E.J.

UVB-induced mutagenesis was studied in hairless 40.6 transgenic mice (Muta{trademark}Mouse), which contain the {lambda}gt1OlacZ shuttle vector as a target for mutagenesis. Mice were exposed at the dorsal side to either single doses of 200, 500, 800, or 1000 J/m{sup 2} UVB or to two successive irradiations of either 200 and 800 J/m{sup 2} UVB, with intervals of 1,3, or 5 days, or to 800 and 200 J/m{sup 2} UVB with a 5-day interval. At 23 days after the last exposure, lacZ mutant frequencies (MF) were determined in the epidermis. The lacZ MF increased linearly with increasing dose of UVB. Themore » mutagenic effect of two successive irradiations appeared to be additive. The UV-induced mutation spectrum was dominated by G:C{r_arrow}A:T transitions at dipyrimidine sites. DNA-sequence analysis of spontaneously mutated phages showed a diverse spectrum consisting of insertions, deletions and G:C {r_arrow} A:T transitions at CpG sites. the results indicate that the hairless {lambda}lacZ-transgenic mouse is a suitable in vivo model for studying UVB-induced mutations. 29 refs., 5 tabs.« less

DNA-Based Single-Molecule Electronics: From Concept to Function.

PubMed

Wang, Kun

2018-01-17

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

DNA-Based Single-Molecule Electronics: From Concept to Function

PubMed Central

2018-01-01

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

Logic Gate Operation by DNA Translocation through Biological Nanopores.

PubMed

Yasuga, Hiroki; Kawano, Ryuji; Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji

2016-01-01

Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs "1" and "0" as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment.

Logic Gate Operation by DNA Translocation through Biological Nanopores

PubMed Central

Takinoue, Masahiro; Tsuji, Yutaro; Osaki, Toshihisa; Kamiya, Koki; Miki, Norihisa; Takeuchi, Shoji

2016-01-01

Logical operations using biological molecules, such as DNA computing or programmable diagnosis using DNA, have recently received attention. Challenges remain with respect to the development of such systems, including label-free output detection and the rapidity of operation. Here, we propose integration of biological nanopores with DNA molecules for development of a logical operating system. We configured outputs “1” and “0” as single-stranded DNA (ssDNA) that is or is not translocated through a nanopore; unlabeled DNA was detected electrically. A negative-AND (NAND) operation was successfully conducted within approximately 10 min, which is rapid compared with previous studies using unlabeled DNA. In addition, this operation was executed in a four-droplet network. DNA molecules and associated information were transferred among droplets via biological nanopores. This system would facilitate linking of molecules and electronic interfaces. Thus, it could be applied to molecular robotics, genetic engineering, and even medical diagnosis and treatment. PMID:26890568

Study of {Lambda}-{Lambda} oscillation in quantum coherent {Lambda}{Lambda} by using J/{psi}{yields}{Lambda}{Lambda} decay

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kang Xianwei; Department of Physics, Henan Normal University, Xinxiang 453007; Li Haibo

2010-03-01

We discuss the possibility of searching for the {Lambda}-{Lambda} oscillations for coherent {Lambda}{Lambda} production in the J/{psi}{yields}{Lambda}{Lambda} decay process. The sensitivity of measurement of {Lambda}-{Lambda} oscillation in the external field at BES-III experiment is considered. These considerations indicate an alternative way to probe the {Delta}B=2 amplitude in addition to neutron oscillation experiments. Both coherent and time-dependent information can be used to extract the {Lambda}-{Lambda} oscillation parameter. With one year's luminosity at BES-III, we can set an upper limit of {delta}m{sub {Lambda}{Lambda}<}10{sup -15} MeV at 90% confidence level, corresponding to about 10{sup -6} s of {Lambda}-{Lambda} oscillation time.

Supramolecular gel electrophoresis of large DNA fragments.

PubMed

Tazawa, Shohei; Kobayashi, Kazuhiro; Oyoshi, Takanori; Yamanaka, Masamichi

2017-10-01

Pulsed-field gel electrophoresis is a frequent technique used to separate exceptionally large DNA fragments. In a typical continuous field electrophoresis, it is challenging to separate DNA fragments larger than 20 kbp because they migrate at a comparable rate. To overcome this challenge, it is necessary to develop a novel matrix for the electrophoresis. Here, we describe the electrophoresis of large DNA fragments up to 166 kbp using a supramolecular gel matrix and a typical continuous field electrophoresis system. C 3 -symmetric tris-urea self-assembled into a supramolecular hydrogel in tris-boric acid-EDTA buffer, a typical buffer for DNA electrophoresis, and the supramolecular hydrogel was used as a matrix for electrophoresis to separate large DNA fragments. Three types of DNA marker, the λ-Hind III digest (2 to 23 kbp), Lambda DNA-Mono Cut Mix (10 to 49 kbp), and Marker 7 GT (10 to 165 kbp), were analyzed in this study. Large DNA fragments of greater than 100 kbp showed distinct mobility using a typical continuous field electrophoresis system. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

An evolution based biosensor receptor DNA sequence generation algorithm.

PubMed

Kim, Eungyeong; Lee, Malrey; Gatton, Thomas M; Lee, Jaewan; Zang, Yupeng

2010-01-01

A biosensor is composed of a bioreceptor, an associated recognition molecule, and a signal transducer that can selectively detect target substances for analysis. DNA based biosensors utilize receptor molecules that allow hybridization with the target analyte. However, most DNA biosensor research uses oligonucleotides as the target analytes and does not address the potential problems of real samples. The identification of recognition molecules suitable for real target analyte samples is an important step towards further development of DNA biosensors. This study examines the characteristics of DNA used as bioreceptors and proposes a hybrid evolution-based DNA sequence generating algorithm, based on DNA computing, to identify suitable DNA bioreceptor recognition molecules for stable hybridization with real target substances. The Traveling Salesman Problem (TSP) approach is applied in the proposed algorithm to evaluate the safety and fitness of the generated DNA sequences. This approach improves efficiency and stability for enhanced and variable-length DNA sequence generation and allows extension to generation of variable-length DNA sequences with diverse receptor recognition requirements.

Purification of circular DNA using benzoylated naphthoylated DEAE-cellulose.

PubMed

Gamper, H; Lehman, N; Piette, J; Hearst, J E

1985-04-01

Un-nicked circular DNA can be separated from protein, RNA, and other DNA in a simple three-step protocol consisting of exonuclease III digestion, extraction with benzoylated naphthoylated DEAE-cellulose (BND cellulose) in 1 M NaCl, and alcohol precipitation of the remaining supercoiled DNA. Exonuclease III treatment introduces single-stranded regions into contaminating linear and nicked circular DNA. This DNA, together with most RNA and protein, is adsorbed onto BND cellulose leaving form I DNA in solution. The protocol can be used to purify analytical as well as preparative amounts of supercoiled DNA. This procedure is a substitute for cesium chloride-ethidium bromide gradient ultracentrifugation and gives a comparable yield of pure form I DNA. Other classes of DNA can be isolated by changing the pretreatment step. Selective digestion of linear DNA with lambda exonuclease permits the isolation of both nicked circular and supercoiled DNA while brief heat-induced or alkali-induced denaturation leads to the recovery of rapidly reannealing DNA. In large-scale purifications, the basic protocol is usually preceded by one or more BND cellulose extractions in 1 M NaCl to remove contaminants absorbing UV or inhibiting exonuclease III.

Basic quantitative polymerase chain reaction using real-time fluorescence measurements.

PubMed

Ares, Manuel

2014-10-01

This protocol uses quantitative polymerase chain reaction (qPCR) to measure the number of DNA molecules containing a specific contiguous sequence in a sample of interest (e.g., genomic DNA or cDNA generated by reverse transcription). The sample is subjected to fluorescence-based PCR amplification and, theoretically, during each cycle, two new duplex DNA molecules are produced for each duplex DNA molecule present in the sample. The progress of the reaction during PCR is evaluated by measuring the fluorescence of dsDNA-dye complexes in real time. In the early cycles, DNA duplication is not detected because inadequate amounts of DNA are made. At a certain threshold cycle, DNA-dye complexes double each cycle for 8-10 cycles, until the DNA concentration becomes so high and the primer concentration so low that the reassociation of the product strands blocks efficient synthesis of new DNA and the reaction plateaus. There are two types of measurements: (1) the relative change of the target sequence compared to a reference sequence and (2) the determination of molecule number in the starting sample. The first requires a reference sequence, and the second requires a sample of the target sequence with known numbers of the molecules of sequence to generate a standard curve. By identifying the threshold cycle at which a sample first begins to accumulate DNA-dye complexes exponentially, an estimation of the numbers of starting molecules in the sample can be extrapolated. © 2014 Cold Spring Harbor Laboratory Press.

Topological events in single molecules of E. coli DNA confined in nanochannels

PubMed Central

Reifenberger, Jeffrey G.; Dorfman, Kevin D.; Cao, Han

2015-01-01

We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the ‘GCTCTTC’ sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189,153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (~7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels. PMID:25991508

Direct observation of λ-DNA molecule reversal movement within microfluidic channels under electric field with single molecule imaging technique

NASA Astrophysics Data System (ADS)

Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai

2016-07-01

The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).

Nanopore detection of DNA molecules in crowded neutral polymer solutions

NASA Astrophysics Data System (ADS)

Sharma, Rajesh Kumar; Dai, Liang; Doyle, Patrick; Garaj, Slaven

Nanopore sensing is a precise technique for analysis of the structure and dynamics of individual biomolecules in different environments, and has even become a prominent technique for next-gen DNA sequencing. In the nanopore sensor, an individual DNA molecule is electrophoretically translocated through a single, nanometer-scaled pore in a solid-state membrane separating two chambers filled with electrolyte. The conformation of the molecule is deduced from modulations in the ionic current through the pore during the translocation event. Using nanopores, we investigated the dynamics of the DNA molecules in a crowded solution of neutral polymers of different sizes and concentrations. The translocation dynamics depends significantly on the size and concentration of the polymers, as different contributions to the electrophoretic and entropic forces on the DNA molecules come into play. This setup offers an excellent, tuneable model-system for probing biologically relevant questions regarding the behaviour of DNA molecules in highly confined and crowded environments. Singapore-MIT Alliance for Research and Technology.

Single molecule techniques in DNA repair: A primer

PubMed Central

Hughes, Craig D.; Simons, Michelle; Mackenzie, Cassidy E.; Van Houten, Bennett; Kad, Neil M.

2016-01-01

A powerful new approach has become much more widespread and offers insights into aspects of DNA repair unattainable with billions of molecules. Single molecule techniques can be used to image, manipulate or characterize the action of a single repair protein on a single strand of DNA. This allows search mechanisms to be probed, and the effects of force to be understood. These physical aspects can dominate a biochemical reaction, where at the ensemble level their nuances are obscured. In this paper we discuss some of the many technical advances that permit study at the single molecule level. We focus on DNA repair to which these techniques are actively being applied. DNA repair is also a process that encompasses so much of what single molecule studies benefit – searching for targets, complex formation, sequential biochemical reactions and substrate hand-off to name just a few. We discuss how single molecule biophysics is poised to transform our understanding of biological systems, in particular DNA repair. PMID:24819596

Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules

NASA Astrophysics Data System (ADS)

Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh

2017-05-01

We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.

Fluorescence Microscopy of Nanochannel-Confined DNA.

PubMed

Westerlund, Fredrik; Persson, Fredrik; Fritzsche, Joachim; Beech, Jason P; Tegenfeldt, Jonas O

2018-01-01

Stretching of DNA in nanoscale confinement allows for several important studies. The genetic contents of the DNA can be visualized on the single DNA molecule level and both the polymer physics of confined DNA and also DNA/protein and other DNA/DNA-binding molecule interactions can be explored. This chapter describes the basic steps to fabricate the nanostructures, perform the experiments and analyze the data.

Genetics Home Reference: mitochondrial neurogastrointestinal encephalopathy disease

MedlinePlus

... modification) is used as a building block of DNA . Thymidine phosphorylase breaks down thymidine into smaller molecules, ... molecule is damaging to a particular kind of DNA known as mitochondrial DNA or mtDNA. Mitochondria are ...

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

DNA recombination activity in soybean mitochondria.

PubMed

Manchekar, Medha; Scissum-Gunn, Karyn; Song, Daqing; Khazi, Fayaz; McLean, Stephanie L; Nielsen, Brent L

2006-02-17

Mitochondrial genomes in higher plants are much larger and more complex as compared to animal mitochondrial genomes. There is growing evidence that plant mitochondrial genomes exist predominantly as a collection of linear and highly branched DNA molecules and replicate by a recombination-dependent mechanism. However, biochemical evidence of mitochondrial DNA (mtDNA) recombination activity in plants has previously been lacking. We provide the first report of strand-invasion activity in plant mitochondria. Similar to bacterial RecA, this activity from soybean is dependent on the presence of ATP and Mg(2+). Western blot analysis using an antibody against the Arabidopsis mitochondrial RecA protein shows cross-reaction with a soybean protein of about 44 kDa, indicating conservation of this protein in at least these two plant species. mtDNA structure was analyzed by electron microscopy of total soybean mtDNA and molecules recovered after field-inversion gel electrophoresis (FIGE). While most molecules were found to be linear, some molecules contained highly branched DNA structures and a small but reproducible proportion consisted of circular molecules (many with tails) similar to recombination intermediates. The presence of recombination intermediates in plant mitochondria preparations is further supported by analysis of mtDNA molecules by 2-D agarose gel electrophoresis, which indicated the presence of complex recombination structures along with a considerable amount of single-stranded DNA. These data collectively provide convincing evidence for the occurrence of homologous DNA recombination in plant mitochondria.

Recombinant DNA encoding a desulfurization biocatalyst

DOEpatents

Rambosek, John; Piddington, Chris S.; Kovacevich, Brian R.; Young, Kevin D.; Denome, Sylvia A.

1994-01-01

This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous.

Functional helicoidal model of DNA molecule with elastic nonlinearity

NASA Astrophysics Data System (ADS)

Tseytlin, Y. M.

2013-06-01

We constructed a functional DNA molecule model on the basis of a flexible helicoidal sensor, specifically, a pretwisted hollow nano-strip. We study in this article the helicoidal nano- sensor model with a pretwisted strip axial extension corresponding to the overstretching transition of DNA from dsDNA to ssDNA. Our model and the DNA molecule have similar geometrical and nonlinear mechanical features unlike models based on an elastic rod, accordion bellows, or an imaginary combination of "multiple soft and hard linear springs", presented in some recent publications.

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, Huamin; Smith, Lloyd M.

1997-01-01

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support.

Linearisation of λDNA molecules by instantaneous variation of the trapping electrode voltage inside a micro-channel

NASA Astrophysics Data System (ADS)

Hanasaki, Itsuo; Yukimoto, Naoya; Uehara, Satoshi; Shintaku, Hirofumi; Kawano, Satoyuki

2015-04-01

Because long DNA molecules usually exist in random coil states due to the entropic effect, linearisation is required for devices equipped with nanopores where electrical sequencing is necessary during single-file translocation. We present a novel technique for linearising DNA molecules in a micro-channel. In our device, electrodes are embedded in the bottom surface of the channel. The application of a voltage induces the trapping of λDNA molecules on the positive electrode. An instantaneous voltage drop is used to put the λDNA molecules in a partly released state and the hydrodynamic force of the solution induces linearisation. Phenomena were directly observed using an optical microscopy system equipped with a high-speed camera and the linearisation principle was explored in detail. Furthermore, we estimate the tensile characteristics produced by the flow of the solution through a numerical model of a tethered polymer subject to a Poiseuille flow. The mean tensile force is in the range of 0.1-1 pN. This is sufficiently smaller than the structural transition point of λDNA but counterbalances the entropic elasticity that causes the random coil shape of λDNA molecules in solution. We show the important role of thermal fluctuation in the manipulation of molecules in solution and clarify the tensile conditions required for DNA linearisation using a combination of solution flow and voltage variation in a microchannel.

Single-Molecule Electrical Random Resequencing of DNA and RNA

NASA Astrophysics Data System (ADS)

Ohshiro, Takahito; Matsubara, Kazuki; Tsutsui, Makusu; Furuhashi, Masayuki; Taniguchi, Masateru; Kawai, Tomoji

2012-07-01

Two paradigm shifts in DNA sequencing technologies--from bulk to single molecules and from optical to electrical detection--are expected to realize label-free, low-cost DNA sequencing that does not require PCR amplification. It will lead to development of high-throughput third-generation sequencing technologies for personalized medicine. Although nanopore devices have been proposed as third-generation DNA-sequencing devices, a significant milestone in these technologies has been attained by demonstrating a novel technique for resequencing DNA using electrical signals. Here we report single-molecule electrical resequencing of DNA and RNA using a hybrid method of identifying single-base molecules via tunneling currents and random sequencing. Our method reads sequences of nine types of DNA oligomers. The complete sequence of 5'-UGAGGUA-3' from the let-7 microRNA family was also identified by creating a composite of overlapping fragment sequences, which was randomly determined using tunneling current conducted by single-base molecules as they passed between a pair of nanoelectrodes.

Simulation experiments of the effect of space environment on bacteriophage and DNA thin films

NASA Technical Reports Server (NTRS)

Fekete, A.; Ronto, Gy; Hegedus, M.; Modos, K.; Berces, A.; Kovacs, G.; Lammer, H.; Panitz, C.

2004-01-01

The main goal of PUR experiment (phage and uracil response) is to examine and quantify the effect of specific space conditions on nucleic acid models. To achieve this an improved method was elaborated for the preparation of DNA and bacteriophage thin films. The homogeneity of the films was controlled by UV spectroscopy and microscopy. To provide experimental evidence for the hypothesis that interplanetary transfer of the genetic material is possible, phage T7 and isolated T7 DNA thin films have been exposed to selected space conditions: intense UVC radiation (lambda=254 nm) and high vacuum (10(-4) Pa). The effects of DNA hydration, conformation and packing on UV radiation damage were examined. Characteristic changes in the absorption spectrum, in the electrophoretic pattern of DNA and the decrease of the amount of PCR products have been detected indicating the photodamage of isolated and intraphage DNA. c2004 COSPAR. Published by Elsevier Ltd. All rights reserved.

Identifying DNA methylation in a nanochannel

NASA Astrophysics Data System (ADS)

Sun, Xiaoyin; Yasui, Takao; Yanagida, Takeshi; Kaji, Noritada; Rahong, Sakon; Kanai, Masaki; Nagashima, Kazuki; Kawai, Tomoji; Baba, Yoshinobu

2016-01-01

DNA methylation is a stable epigenetic modification, which is well known to be involved in gene expression regulation. In general, however, analyzing DNA methylation requires rather time consuming processes (24-96 h) via DNA replication and protein modification. Here we demonstrate a methodology to analyze DNA methylation at a single DNA molecule level without any protein modifications by measuring the contracted length and relaxation time of DNA within a nanochannel. Our methodology is based on the fact that methylation makes DNA molecules stiffer, resulting in a longer contracted length and a longer relaxation time (a slower contraction rate). The present methodology offers a promising way to identify DNA methylation without any protein modification at a single DNA molecule level within 2 h.

Recombinant DNA encoding a desulfurization biocatalyst

DOEpatents

Rambosek, J.; Piddington, C.S.; Kovacevich, B.R.; Young, K.D.; Denome, S.A.

1994-10-18

This invention relates to a recombinant DNA molecule containing a gene or genes which encode a biocatalyst capable of desulfurizing a fossil fuel which contains organic sulfur molecules. For example, the present invention encompasses a recombinant DNA molecule containing a gene or genes of a strain of Rhodococcus rhodochrous. 13 figs.

Photoinduced Oxidative DNA Damage Revealed by an Agarose Gel Nicking Assay: A Biophysical Chemistry Laboratory Experiment

NASA Astrophysics Data System (ADS)

Shafirovich, Vladimir; Singh, Carolyn; Geacintov, Nicholas E.

2003-11-01

Oxidative damage of DNA molecules associated with electron-transfer reactions is an important phenomenon in living cells, which can lead to mutations and contribute to carcinogenesis and the aging processes. This article describes the design of several simple experiments to explore DNA damage initiated by photoinduced electron-transfer reactions sensitized by the acridine derivative, proflavine (PF). A supercoiled DNA agarose gel nicking assay is employed as a sensitive probe of DNA strand cleavage. A low-cost experimental and computer-interfaced imaging apparatus is described allowing for the digital recording and analysis of the gel electrophoresis results. The first experiment describes the formation of direct strand breaks in double-stranded DNA induced by photoexcitation of the intercalated PF molecules. The second experiment demonstrates that the addition of the well-known electron acceptor, methylviologen, gives rise to a significant enhancement of the photochemical DNA strand cleavage effect. This occurs by an electron transfer step to methylviologen that renders the inital photoinduced charge separation between photoexcited PF and DNA irreversible. The third experiment demonstrates that the action spectrum of the DNA photocleavage matches the absorption spectrum of DNA-bound, intercalated PF molecules, which differs from that of free PF molecules. This result demonstrates that the photoinduced DNA strand cleavage is initiated by intercalated rather than free PF molecules.

CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

NASA Astrophysics Data System (ADS)

Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

2018-03-01

CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of <220>. Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

Parallel Arrays of Geometric Nanowells for Assembling Curtains of DNA with Controlled Lateral Dispersion

PubMed Central

Visnapuu, Mari-Liis; Fazio, Teresa; Wind, Shalom; Greene, Eric C.

2009-01-01

The analysis of individual molecules is evolving into an important tool for biological research, and presents conceptually new ways of approaching experimental design strategies. However, more robust methods are required if these technologies are to be made broadly available to the biological research community. To help achieve this goal we have combined nanofabrication techniques with single-molecule optical microscopy for assembling and visualizing curtains comprised of thousands of individual DNA molecules organized at engineered diffusion barriers on a lipid bilayer-coated surface. Here we present an important extension of this technology that implements geometric barrier patterns comprised of thousands of nanoscale wells that can be loaded with single molecules of DNA. We show that these geometric nanowells can be used to precisely control the lateral distribution of the individual DNA molecules within curtains assembled along the edges of the engineered barrier patterns. The individual molecules making up the DNA curtain can be separated from one another by a user-defined distance dictated by the dimensions of the nanowells. We demonstrate the broader utility of these patterned DNA curtains in a novel, real time restriction assay that we refer to as dynamic optical restriction mapping, which can be used to rapidly identify entire sets of cleavage sites within a large DNA molecule. PMID:18788761

Agarose gel electrophoresis for the separation of DNA fragments.

PubMed

Lee, Pei Yun; Costumbrado, John; Hsu, Chih-Yuan; Kim, Yong Hoon

2012-04-20

Agarose gel electrophoresis is the most effective way of separating DNA fragments of varying sizes ranging from 100 bp to 25 kb(1). Agarose is isolated from the seaweed genera Gelidium and Gracilaria, and consists of repeated agarobiose (L- and D-galactose) subunits(2). During gelation, agarose polymers associate non-covalently and form a network of bundles whose pore sizes determine a gel's molecular sieving properties. The use of agarose gel electrophoresis revolutionized the separation of DNA. Prior to the adoption of agarose gels, DNA was primarily separated using sucrose density gradient centrifugation, which only provided an approximation of size. To separate DNA using agarose gel electrophoresis, the DNA is loaded into pre-cast wells in the gel and a current applied. The phosphate backbone of the DNA (and RNA) molecule is negatively charged, therefore when placed in an electric field, DNA fragments will migrate to the positively charged anode. Because DNA has a uniform mass/charge ratio, DNA molecules are separated by size within an agarose gel in a pattern such that the distance traveled is inversely proportional to the log of its molecular weight(3). The leading model for DNA movement through an agarose gel is "biased reptation", whereby the leading edge moves forward and pulls the rest of the molecule along(4). The rate of migration of a DNA molecule through a gel is determined by the following: 1) size of DNA molecule; 2) agarose concentration; 3) DNA conformation(5); 4) voltage applied, 5) presence of ethidium bromide, 6) type of agarose and 7) electrophoresis buffer. After separation, the DNA molecules can be visualized under uv light after staining with an appropriate dye. By following this protocol, students should be able to: Understand the mechanism by which DNA fragments are separated within a gel matrix Understand how conformation of the DNA molecule will determine its mobility through a gel matrix Identify an agarose solution of appropriate concentration for their needs Prepare an agarose gel for electrophoresis of DNA samples Set up the gel electrophoresis apparatus and power supply Select an appropriate voltage for the separation of DNA fragments Understand the mechanism by which ethidium bromide allows for the visualization of DNA bands Determine the sizes of separated DNA fragments.

Drug-DNA interactions at single molecule level: A view with optical tweezers

NASA Astrophysics Data System (ADS)

Paramanathan, Thayaparan

Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by stretching the DNA molecule to a certain force and holding it at constant force while adding the drug and then while washing off the drug. Our finding resolves the long lasting controversy of ActD binding modes, clearly showing that both the dsDNA binding and ssDNA binding converge to the same single mode. The result supports the hypothesis that the primary characteristic of ActD that contributes to its biological activity is its ability to inhibit cellular replication by binding to transcription bubbles and causing cell death.

Interferon-Lambda: A Potent Regulator of Intestinal Viral Infections.

PubMed

Lee, Sanghyun; Baldridge, Megan T

2017-01-01

Interferon-lambda (IFN-λ) is a recently described cytokine found to be of critical importance in innate immune regulation of intestinal viruses. Endogenous IFN-λ has potent antiviral effects and has been shown to control multiple intestinal viruses and may represent a factor that contributes to human variability in response to infection. Importantly, recombinant IFN-λ has therapeutic potential against enteric viral infections, many of which lack other effective treatments. In this mini-review, we describe recent advances regarding IFN-λ-mediated regulation of enteric viruses with important clinical relevance including rotavirus, reovirus, and norovirus. We also briefly discuss IFN-λ interactions with other cytokines important in the intestine, and how IFN-λ may play a role in regulation of intestinal viruses by the commensal microbiome. Finally, we indicate currently outstanding questions regarding IFN-λ control of enteric infections that remain to be explored to enhance our understanding of this important immune molecule.

Interferon-Lambda: A Potent Regulator of Intestinal Viral Infections

PubMed Central

Lee, Sanghyun; Baldridge, Megan T.

2017-01-01

Interferon-lambda (IFN-λ) is a recently described cytokine found to be of critical importance in innate immune regulation of intestinal viruses. Endogenous IFN-λ has potent antiviral effects and has been shown to control multiple intestinal viruses and may represent a factor that contributes to human variability in response to infection. Importantly, recombinant IFN-λ has therapeutic potential against enteric viral infections, many of which lack other effective treatments. In this mini-review, we describe recent advances regarding IFN-λ-mediated regulation of enteric viruses with important clinical relevance including rotavirus, reovirus, and norovirus. We also briefly discuss IFN-λ interactions with other cytokines important in the intestine, and how IFN-λ may play a role in regulation of intestinal viruses by the commensal microbiome. Finally, we indicate currently outstanding questions regarding IFN-λ control of enteric infections that remain to be explored to enhance our understanding of this important immune molecule. PMID:28713375

Increasing the Analytical Sensitivity by Oligonucleotides Modified with Para- and Ortho-Twisted Intercalating Nucleic Acids – TINA

PubMed Central

Schneider, Uffe V.; Géci, Imrich; Jøhnk, Nina; Mikkelsen, Nikolaj D.; Pedersen, Erik B.; Lisby, Gorm

2011-01-01

The sensitivity and specificity of clinical diagnostic assays using DNA hybridization techniques are limited by the dissociation of double-stranded DNA (dsDNA) antiparallel duplex helices. This situation can be improved by addition of DNA stabilizing molecules such as nucleic acid intercalators. Here, we report the synthesis of a novel ortho-Twisted Intercalating Nucleic Acid (TINA) amidite utilizing the phosphoramidite approach, and examine the stabilizing effect of ortho- and para-TINA molecules in antiparallel DNA duplex formation. In a thermal stability assay, ortho- and para-TINA molecules increased the melting point (Tm) of Watson-Crick based antiparallel DNA duplexes. The increase in Tm was greatest when the intercalators were placed at the 5′ and 3′ termini (preferable) or, if placed internally, for each half or whole helix turn. Terminally positioned TINA molecules improved analytical sensitivity in a DNA hybridization capture assay targeting the Escherichia coli rrs gene. The corresponding sequence from the Pseudomonas aeruginosa rrs gene was used as cross-reactivity control. At 150 mM ionic strength, analytical sensitivity was improved 27-fold by addition of ortho-TINA molecules and 7-fold by addition of para-TINA molecules (versus the unmodified DNA oligonucleotide), with a 4-fold increase retained at 1 M ionic strength. Both intercalators sustained the discrimination of mismatches in the dsDNA (indicated by ΔTm), unless placed directly adjacent to the mismatch – in which case they partly concealed ΔTm (most pronounced for para-TINA molecules). We anticipate that the presented rules for placement of TINA molecules will be broadly applicable in hybridization capture assays and target amplification systems. PMID:21673988

Shell-model predictions for Lambda Lambda hypernuclei

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gal, A.; Millener, D.

2011-06-02

It is shown how the recent shell-model determination of {Lambda}N spin-dependent interaction terms in {Lambda} hypernuclei allows for a reliable deduction of {Lambda}{Lambda} separation energies in {Lambda}{Lambda} hypernuclei across the nuclear p shell. Comparison is made with the available data, highlighting {sub {Lambda}{Lambda}}{sup 11}Be and {sub {Lambda}{Lambda}}{sup 12}Be which have been suggested as possible candidates for the KEK-E373 HIDA event.

Detecting the Length of Double-stranded DNA with Solid State Nanopores

NASA Astrophysics Data System (ADS)

Li, Jiali; Gershow, Marc; Stein, Derek; Qun, Cai; Brandin, Eric; Wang, Hui; Huang, Albert; Branton, Dan; Golovchenko, Jene

2003-03-01

We report on the use of nanometer scale diameter, solid-state nanopores as single molecule detectors of double stranded DNA molecules. These solid-state nanopores are fabricated in thin membranes of silicon nitride, by ion beam sculpting 1. They produce discrete electronic signals: current blockages, when an electrically biased nanopore is exposed to DNA molecules in aqueous salt solutions. We demonstrate examples of such electronic signals for 3k base pairs (bp) and 10k bp double stranded DNA molecules, which suggest that these molecules are individually translocating through the nanopore during the detection process. The translocating time for the 10k bp double stranded DNA is about 3 times longer than the 3k bp, demonstrating that a solid-state nanopore device can be used to detect the lengths of double stranded DNA molecules. Similarities and differences with signals obtained from single stranded DNA in a biological nanopores are discussed 2. 1. Li, J., Stein, D., McMullan, C., Branton, D. Aziz, M. J. and Golovchenko, J. Ion Beam Sculpting at nanometer length scales. Nature 412, 166-169 (2001). 2. Meller, A., L. Nivon, E. Brandin, Golovchenko, J. & Branton, D. Proc. Natl. Acad. Sci. USA 97, 1079-1084 (2000).

Effects of electrostatic screening on the conformation of single DNA molecules confined in a nanochannel

NASA Astrophysics Data System (ADS)

Zhang, Ce; Zhang, Fang; van Kan, Jeroen A.; van der Maarel, Johan R. C.

2008-06-01

Single T4-DNA molecules were confined in rectangular-shaped channels with a depth of 300 nm and a width in the range of 150-300 nm casted in a poly(dimethylsiloxane) nanofluidic chip. The extensions of the DNA molecules were measured with fluorescence microscopy as a function of the ionic strength and composition of the buffer as well as the DNA intercalation level by the YOYO-1 dye. The data were interpreted with the scaling theory for a wormlike polymer in good solvent, including the effects of confinement, charge, and self-avoidance. It was found that the elongation of the DNA molecules with decreasing ionic strength can be interpreted in terms of an increase of the persistence length. Self-avoidance effects on the extension are moderate, due to the small correlation length imposed by the channel cross-sectional diameter. Intercalation of the dye results in an increase of the DNA contour length and a partial neutralization of the DNA charge, but besides effects of electrostatic origin it has no significant effect on the bare bending rigidity. In the presence of divalent cations, the DNA molecules were observed to contract, but they do not collapse into a condensed structure. It is proposed that this contraction results from a divalent counterion mediated attractive force between the segments of the DNA molecule.

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

PubMed

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

Nanofabricated Racks of Aligned and Anchored DNA Substrates for Single-Molecule Imaging

PubMed Central

2009-01-01

Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This “double-tethered” DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein−DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA. PMID:19736980

Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

PubMed

Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

2010-01-19

Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

Binding mechanism of PicoGreen to DNA characterized by magnetic tweezers and fluorescence spectroscopy.

PubMed

Wang, Ying; Schellenberg, Helene; Walhorn, Volker; Toensing, Katja; Anselmetti, Dario

2017-09-01

Fluorescent dyes are broadly used in many biotechnological applications to detect and visualize DNA molecules. However, their binding to DNA alters the structural and nanomechanical properties of DNA and, thus, interferes with associated biological processes. In this work we employed magnetic tweezers and fluorescence spectroscopy to investigate the binding of PicoGreen to DNA at room temperature in a concentration-dependent manner. PicoGreen is an ultrasensitive quinolinium nucleic acid stain exhibiting hardly any background signal from unbound dye molecules. By means of stretching and overwinding single, torsionally constrained, nick-free double-stranded DNA molecules, we acquired force-extension and supercoiling curves which allow quantifying DNA contour length, persistence length and other thermodynamical binding parameters, respectively. The results of our magnetic tweezers single-molecule binding study were well supported through analyzing the fluorescent spectra of stained DNA. On the basis of our work, we could identify a concentration-dependent bimodal binding behavior, where, apparently, PicoGreen associates to DNA as an intercalator and minor-groove binder simultaneously.

Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

PubMed

Hengel, Sarah R; Spies, M Ashley; Spies, Maria

2017-09-21

To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

NASA Astrophysics Data System (ADS)

Buyukdagli, Sahin

2017-02-01

We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016), 10.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.

Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations

PubMed Central

Dressman, Devin; Yan, Hai; Traverso, Giovanni; Kinzler, Kenneth W.; Vogelstein, Bert

2003-01-01

Many areas of biomedical research depend on the analysis of uncommon variations in individual genes or transcripts. Here we describe a method that can quantify such variation at a scale and ease heretofore unattainable. Each DNA molecule in a collection of such molecules is converted into a single magnetic particle to which thousands of copies of DNA identical in sequence to the original are bound. This population of beads then corresponds to a one-to-one representation of the starting DNA molecules. Variation within the original population of DNA molecules can then be simply assessed by counting fluorescently labeled particles via flow cytometry. This approach is called BEAMing on the basis of four of its principal components (beads, emulsion, amplification, and magnetics). Millions of individual DNA molecules can be assessed in this fashion with standard laboratory equipment. Moreover, specific variants can be isolated by flow sorting and used for further experimentation. BEAMing can be used for the identification and quantification of rare mutations as well as to study variations in gene sequences or transcripts in specific populations or tissues. PMID:12857956

DNA combing on low-pressure oxygen plasma modified polysilsesquioxane substrates for single-molecule studies

PubMed Central

Sriram, K. K.; Chang, Chun-Ling; Rajesh Kumar, U.; Chou, Chia-Fu

2014-01-01

Molecular combing and flow-induced stretching are the most commonly used methods to immobilize and stretch DNA molecules. While both approaches require functionalization steps for the substrate surface and the molecules, conventionally the former does not take advantage of, as the latter, the versatility of microfluidics regarding robustness, buffer exchange capability, and molecule manipulation using external forces for single molecule studies. Here, we demonstrate a simple one-step combing process involving only low-pressure oxygen (O2) plasma modified polysilsesquioxane (PSQ) polymer layer to facilitate both room temperature microfluidic device bonding and immobilization of stretched single DNA molecules without molecular functionalization step. Atomic force microscopy and Kelvin probe force microscopy experiments revealed a significant increase in surface roughness and surface potential on low-pressure O2 plasma treated PSQ, in contrast to that with high-pressure O2 plasma treatment, which are proposed to be responsible for enabling effective DNA immobilization. We further demonstrate the use of our platform to observe DNA-RNA polymerase complexes and cancer drug cisplatin induced DNA condensation using wide-field fluorescence imaging. PMID:25332730

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Single-molecule dilution and multiple displacement amplification for molecular haplotyping.

PubMed

Paul, Philip; Apgar, Josh

2005-04-01

Separate haploid analysis is frequently required for heterozygous genotyping to resolve phase ambiguity or confirm allelic sequence. We demonstrate a technique of single-molecule dilution followed by multiple strand displacement amplification to haplotype polymorphic alleles. Dilution of DNA to haploid equivalency, or a single molecule, is a simple method for separating di-allelic DNA. Strand displacement amplification is a robust method for non-specific DNA expansion that employs random hexamers and phage polymerase Phi29 for double-stranded DNA displacement and primer extension, resulting in high processivity and exceptional product length. Single-molecule dilution was followed by strand displacement amplification to expand separated alleles to microgram quantities of DNA for more efficient haplotype analysis of heterozygous genes.

Rapid purification of circular DNA by triplex-mediated affinity capture

DOEpatents

Ji, H.; Smith, L.M.

1997-01-07

A single-step capture of a target supercoiled double-stranded DNA molecule is accomplished by forming a local triple-helix among two strands of the supercoiled circular DNA and an oligonucleotide probe. The oligonucleotide is bound to an immobilizing support which facilitates the immobilization and purification of target DNA molecules. Non-target DNA molecules and other contaminating cellular material are easily removed by washing. The triple-helical structure is destabilized by raising the pH, leaving purified target DNA in the supernatant and reusable affinity capture oligonucleotide secured to the immobilizing support. 3 figs.

Disentangling DNA molecules

NASA Astrophysics Data System (ADS)

Vologodskii, Alexander

2016-09-01

The widespread circular form of DNA molecules inside cells creates very serious topological problems during replication. Due to the helical structure of the double helix the parental strands of circular DNA form a link of very high order, and yet they have to be unlinked before the cell division. DNA topoisomerases, the enzymes that catalyze passing of one DNA segment through another, solve this problem in principle. However, it is very difficult to remove all entanglements between the replicated DNA molecules due to huge length of DNA comparing to the cell size. One strategy that nature uses to overcome this problem is to create the topoisomerases that can dramatically reduce the fraction of linked circular DNA molecules relative to the corresponding fraction at thermodynamic equilibrium. This striking property of the enzymes means that the enzymes that interact with DNA only locally can access their topology, a global property of circular DNA molecules. This review considers the experimental studies of the phenomenon and analyzes the theoretical models that have been suggested in attempts to explain it. We describe here how various models of enzyme action can be investigated computationally. There is no doubt at the moment that we understand basic principles governing enzyme action. Still, there are essential quantitative discrepancies between the experimental data and the theoretical predictions. We consider how these discrepancies can be overcome.

Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

NASA Astrophysics Data System (ADS)

Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

2006-09-01

In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

Development of Ultrasensitive Plasmonic Nanosensors

NASA Astrophysics Data System (ADS)

Joshi, Gayatribahen K.

Nanostructures (NSs) based localized surface plasmon resonance (LSPR) sensors have brought a transformation in development of sensing devices due to their ability to detect extremely small changes in surrounding refractive index (R.I.). NS-based LSPR sensing approaches have been employed to enhance the sensitivity for a variety of applications, such as diagnosis of disease, food and environmental analysis, and chemical and biological threat detection. Generally in LSPR spectroscopy, absorption and scattering of light is greatly enhanced at a frequency that excites the NS's LSPR and results in well-defined LSPR extinction peak (lambdaLSPR). This lambdaLSPR is highly dependent on the size, shape, and surrounding R.I. of NSs. Compositional and confirmational change within the surrounding R.I. near the NS could be detected by monitoring the shifts in lambdaLSPR. This thesis specifically focuses on the rational development of the plasmonic nanosensors for various sensing applications by utilizing the LSPR properties of Au NS with prismatic shape. First the chemical synthetic approach that can produce Au nanoprisms, which displayed lambdaLSPR in 650-850 nm range corresponding to 20-50 nm edge lengths has been developed. The chemically synthesized Au nanoprisms were attached to silanized glass substrate and employed as a solid-state sensing platform for the development of label-free plasmonic nanosensors. The size, shape, and surface of nanoprisms were characterized through transmission electron microscopy (TEM), scanning electron microscopy (SEM), atomic force microscopy (AFM), and UV-visible spectroscopy. Further, the influence of the structure, size and surface ligand chemistry onto the lambda LSPR of nanoprisms were investigated in detail. Both bulk and local R.I. sensitivity, and the electromagnetic-field (EM-field) decay length were derived for various edge lengths of nanoprisms through measuring the lambda LSPR shifts by UV-visible spectroscopy. Finally, nanoprisms-based LSPR nanosensors ("plasmonic nanosensors") have been developed for different sensing applications. Specifically, these plasmonic nanosensors displayed capacity to detect streptavidine, glucose, microRNA (cancer biomarker), as well as molecular and stimuli-responsive polymers conformational changes. In this study we found that the plasmonic nanosensors are exceptionally sensitive compared to other NSs and the sensitivity is highly edge length dependent. An ultrasensitive plasmonic nanosensor has been developed for the detection of microRNAs in crude plasma collected from pancreatic cancer patients. It shows that the LSPR-based nanosensor has the ability to detect and quantify the microRNA concentrations in clinical samples without any purification. The results presented here show potential for patients to commence treatment in early stage cancer diagnosis. The effect of various physiological medias and edge length of nanoprisms on the sensitivity of this nanosensor has been discussed. Second, molecular sensors have been developed by functionalization of azobenzene molecule contain alkanethiols onto the nanoprisms surface. Molecular conformational changes basis on a very less dielectric thickness changes have been detected through lambdaLSPR shift of nanoprisms and confirmed through surface enhanced Raman spectroscopy (SERS). In this study, the influence of resonance energy transfer between the molecule and nanoprisms onto the lambda LSPR shift and Raman intensity has been investigated by changing the distance between them. Finally, utilization of stimuli-responsive polymers structural change in the development of stimuli-responsive such as pH and temperature-responsive plasmonic nanosensors has been demonstrated. It was found that the stimuli-responsive nanosensors were able to detect very small R.I. change due to the polymers structural change. The enzymatic reaction between glucose and glucose oxidase has been used to detect glucose in bovine plasma using pH-responsive nanosensor. Results of this work displays potential of replacing finger prick methodology in glucose self-monitoring for diabetes patients with use of plasma/urine samples. Overall, the research work demonstrated here provides a significant progress in the development of LSPR-based plasmonic nanosensors and addresses the resolution of many scientific complications, fundamental, chemical, and biological.

Measurement of the forward-backward asymmetry of $$\\Lambda$$ and $$\\bar{\\Lambda}$$ production in $$p \\bar{p}$$ collisions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Abazov, Victor Mukhamedovich

Here, we studymore » $$\\Lambda$$ and $$\\bar{\\Lambda}$$ production asymmetries in $$p \\bar{p} \\rightarrow \\Lambda (\\bar{\\Lambda}) X$$, $$p \\bar{p} \\rightarrow J/\\psi \\Lambda (\\bar{\\Lambda}) X$$, and $$p \\bar{p} \\rightarrow \\mu^\\pm \\Lambda (\\bar{\\Lambda}) X$$ events recorded by the D0 detector at the Fermilab Tevatron collider at $$\\sqrt{s} = 1.96$$ TeV. We find an excess of $$\\Lambda$$'s ($$\\bar{\\Lambda}$$'s) produced in the proton (antiproton) direction. This forward-backward asymmetry is measured as a function of rapidity. We confirm that the $$\\bar{\\Lambda}/\\Lambda$$ production ratio, measured by several experiments with various targets and a wide range of energies, is a universal function of "rapidity loss", i.e., the rapidity difference of the beam proton and the lambda.« less

Measurement of the forward-backward asymmetry of $$\\Lambda$$ and $$\\bar{\\Lambda}$$ production in $$p \\bar{p}$$ collisions

DOE PAGES

Abazov, Victor Mukhamedovich

2016-02-09

Here, we studymore » $$\\Lambda$$ and $$\\bar{\\Lambda}$$ production asymmetries in $$p \\bar{p} \\rightarrow \\Lambda (\\bar{\\Lambda}) X$$, $$p \\bar{p} \\rightarrow J/\\psi \\Lambda (\\bar{\\Lambda}) X$$, and $$p \\bar{p} \\rightarrow \\mu^\\pm \\Lambda (\\bar{\\Lambda}) X$$ events recorded by the D0 detector at the Fermilab Tevatron collider at $$\\sqrt{s} = 1.96$$ TeV. We find an excess of $$\\Lambda$$'s ($$\\bar{\\Lambda}$$'s) produced in the proton (antiproton) direction. This forward-backward asymmetry is measured as a function of rapidity. We confirm that the $$\\bar{\\Lambda}/\\Lambda$$ production ratio, measured by several experiments with various targets and a wide range of energies, is a universal function of "rapidity loss", i.e., the rapidity difference of the beam proton and the lambda.« less

Single molecule fluorescence burst detection of DNA fragments separated by capillary electrophoresis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haab, B.B.; Mathies, R.A.

A method has been developed for detecting DNA separated by capillary gel electrophoresis (CGE) using single molecule photon burst counting. A confocal fluorescence microscope was used to observe the fluorescence bursts from single molecules of DNA multiply labeled with the thiazole orange derivative TO6 as they passed through the nearly 2-{mu}m diameter focused laser beam. Amplified photo-electron pulses from the photomultiplier are grouped into bins of 360-450 {mu}s in duration, and the resulting histogram is stored in a computer for analysis. Solutions of M13 DNA were first flowed through the capillary at various concentrations, and the resulting data were usedmore » to optimize the parameters for digital filtering using a low-pass Fourier filter, selecting a discriminator level for peak detection, and applying a peak-calling algorithm. The optimized single molecule counting method was then applied to an electrophoretic separation of M13 DNA and to a separation of pBR 322 DNA from pRL 277 DNA. Clusters of discreet fluorescence bursts were observed at the expected appearance time of each DNA band. The auto-correlation function of these data indicated transit times that were consistent with the observed electrophoretic velocity. These separations were easily detected when only 50-100 molecules of DNA per band traveled through the detection region. This new detection technology should lead to the routine analysis of DNA in capillary columns with an on-column sensitivity of nearly 100 DNA molecules/band or better. 45 refs., 10 figs.« less

Winding single-molecule double-stranded DNA on a nanometer-sized reel

PubMed Central

You, Huijuan; Iino, Ryota; Watanabe, Rikiya; Noji, Hiroyuki

2012-01-01

A molecular system of a nanometer-sized reel was developed from F1–ATPase, a rotary motor protein. By combination with magnetic tweezers and optical tweezers, single-molecule double-stranded DNA (dsDNA) was wound around the molecular reel. The bending stiffness of dsDNA was determined from the winding tension (0.9–6.0 pN) and the diameter of the wound loop (21.4–8.5 nm). Our results were in good agreement with the conventional worm-like chain model and a persistence length of 54 ± 9 nm was estimated. This molecular reel system offers a new platform for single-molecule study of micromechanics of sharply bent DNA molecules and is expected to be applicable to the elucidation of the molecular mechanism of DNA-associating proteins on sharply bent DNA strands. PMID:22772992

DNA intermediates and telomere addition during genome reorganization in Euplotes crassus.

PubMed

Roth, M; Prescott, D M

1985-06-01

Three gene-sized molecules cloned intact from macronuclear DNA served as hybridization probes to study excision of these molecules from chromosomes and their processing during macronuclear development in the hypotrich Euplotes crassus. These molecules occur in integrated forms within polytene chromosomal DNA during macronuclear developmental. After transection of the polytene chromosomes, the three molecules occur in intermediate forms. One of the three molecules first appeared in a large intermediate that was subsequently replaced by a second intermediate, approximately 140 bp larger than the final molecule. The other two macronuclear molecules were detected only in intermediates approximately 140 bp larger than the mature form. These penultimate intermediates are larger by virtue of oversized telomeres, which are pared to yield the mature gene-sized molecules.

High-throughput DNA separation in nanofilter arrays.

PubMed

Choi, Sungup; Kim, Ju Min; Ahn, Kyung Hyun; Lee, Seung Jong

2014-08-01

We numerically investigated the dynamics of short double-stranded DNA molecules moving through a deep-shallow alternating nanofilter, by utilizing Brownian dynamics simulation. We propose a novel mechanism for high-throughput DNA separation with a high electric field, which was originally predicted by Laachi et al. [Phys. Rev. Lett. 2007, 98, 098106]. In this work, we show that DNA molecules deterministically move along different electrophoretic streamlines according to their length, owing to geometric constraint at the exit of the shallow region. Consequently, it is more probable that long DNA molecules pass over a deep well region without significant lateral migration toward the bottom of the deep well, which is in contrast to the long dwelling time for short DNA molecules. We investigated the dynamics of DNA passage through a nanofilter facilitating electrophoretic field kinematics. The statistical distribution of the DNA molecules according to their size clearly corroborates our assumption. On the other hand, it was also found that the tapering angle between the shallow and deep regions significantly affects the DNA separation performance. The current results show that the nonuniform field effect combined with geometric constraint plays a key role in nanofilter-based DNA separation. We expect that our results will be helpful in designing and operating nanofluidics-based DNA separation devices and in understanding the polymer dynamics in confined geometries. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular cloning and expression of Corynebacterium glutamicum genes for amino acid synthesis in Escherichia coli cells

DOE Office of Scientific and Technical Information (OSTI.GOV)

Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.

1989-01-01

Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector /lambda/pSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB/sup +/ clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA/sup +/ transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmidsmore » consistently transduced the markers thrB/sup +/ and lysA/sup +/. The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes.« less

Fluctuation Pressure Assisted Ejection of DNA From Bacteriophage

NASA Astrophysics Data System (ADS)

Harrison, Michael J.

2011-03-01

The role of thermal pressure fluctuations excited within tightly packaged DNA while it is ejected from protein capsid shells is discussed in a model calculation. At equilibrium before ejection we assume the DNA is folded many times into a bundle of parallel segments that forms an equilibrium conformation at minimum free energy, which presses tightly against capsid walls. Using a canonical ensemble at temperature T we calculate internal pressure fluctuations against a slowly moving or static capsid mantle for an elastic continuum model of the folded DNA bundle. It is found that fluctuating pressures on the capsid from thermal excitation of longitudinal acoustic vibrations in the bundle whose wavelengths are exceeded by the bend persistence length may have root-mean-square values that are several tens of atmospheres for typically small phage dimensions. Comparisons are given with measured data on three mutants of lambda phage with different base pair lengths and total genome ejection pressures.

Blocking by the carcinogen, L-ethionine, of SOS functions in a tif-1 mutant of Escherichia coli B/r.

PubMed

Wiesner, R; Troll, W

1981-11-01

In Escherichia coli, DNA damage by carcinogenic agents results in the coordinate expression of a diversity of functions (SOS functions), many of which are thermally inducible without any damage to DNA in a tif-1 mutant. These include prophage induction, filamentous growth, and an error-prone DNA repair activity, which is responsible for ultraviolet-induced mutagenesis. Ethionine causes hepatic carcinoma in rats after prolonged feeding but is not a mutagen in the Ames test. The present study shows that 10 mM ethionine prevents the thermal induction of lambda-prophage in a tif-1 derivative of E. coli. The enhancement of mutation, which normally occurs at high temperature after a low dose of ultraviolet light, is also blocked by ethionine. Ethionine does not block, to any appreciable extent, the incorporation of radioactive precursors into RNA, DNA, or protein.

Compilation of DNA sequences of Escherichia coli (update 1991)

PubMed Central

Kröger, Manfred; Wahl, Ralf; Rice, Peter

1991-01-01

We have compiled the DNA sequence data for E.coli available from the GENBANK and EMBL data libraries and over a period of several years independently from the literature. This is the third listing replacing and increasing the former listing roughly by one fifth. However, in order to save space this printed version contains DNA sequence information only. The complete compilation is now available in machine readable form from the EMBL data library (ECD release 6). After deletion of all detected overlaps a total of 1 492 282 individual bp is found to be determined till the beginning of 1991. This corresponds to a total of 31.62% of the entire E.coli chromosome consisting of about 4,720 kbp. This number may actually be higher by some extra 2,5% derived from lysogenic bacteriophage lambda and various DNA sequences already received for statistical purposes only. PMID:2041799

Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

PubMed Central

Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

2012-01-01

Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

DNA mechanics as a tool to probe helicase and translocase activity.

PubMed

Lionnet, Timothée; Dawid, Alexandre; Bigot, Sarah; Barre, François-Xavier; Saleh, Omar A; Heslot, François; Allemand, Jean-François; Bensimon, David; Croquette, Vincent

2006-01-01

Helicases and translocases are proteins that use the energy derived from ATP hydrolysis to move along or pump nucleic acid substrates. Single molecule manipulation has proved to be a powerful tool to investigate the mechanochemistry of these motors. Here we first describe the basic mechanical properties of DNA unraveled by single molecule manipulation techniques. Then we demonstrate how the knowledge of these properties has been used to design single molecule assays to address the enzymatic mechanisms of different translocases. We report on four single molecule manipulation systems addressing the mechanism of different helicases using specifically designed DNA substrates: UvrD enzyme activity detection on a stretched nicked DNA molecule, HCV NS3 helicase unwinding of a RNA hairpin under tension, the observation of RecBCD helicase/nuclease forward and backward motion, and T7 gp4 helicase mediated opening of a synthetic DNA replication fork. We then discuss experiments on two dsDNA translocases: the RuvAB motor studied on its natural substrate, the Holliday junction, and the chromosome-segregation motor FtsK, showing its unusual coupling to DNA supercoiling.

Assessment of renal response with urinary exosomes in patients with AL amyloidosis: A proof of concept.

PubMed

Ramirez-Alvarado, Marina; Barnidge, David R; Murray, David L; Dispenzieri, Angela; Marin-Argany, Marta; Dick, Christopher J; Cooper, Shawna A; Nasr, Samih H; Ward, Christopher J; Dasari, Surendra; Jiménez-Zepeda, Víctor H; Leung, Nelson

2017-06-01

Immunoglobulin light chain (AL) amyloidosis is a fatal complication of B-cell proliferation secondary to deposition of amyloid fibrils in various organs. Urinary exosomes (UEX) are the smallest of the microvesicles excreted in the urine. Previously, we found UEX of patients with AL amyloidosis contained immunoglobulin light chain (LC) oligomers that patients with multiple myeloma did not have. To further explore the role of the LC oligomers, UEX was isolated from an AL amyloidosis patient with progressive renal disease despite achieving a complete response. LC oligomers were identified. Mass spectrometry (MS) of the UEX and serum identified two monoclonal lambda LCs. Proteomics of the trypsin digested amyloid fragments in the kidney by laser microdissection and MS analysis identified a λ6 LC. The cDNA from plasma cell clone was from the IGLV- 6-57 family and it matched the amino acid sequences of the amyloid peptides. The predicted mass of the peptide product of the cDNA matched the mass of one of the two LCs identified in the UEX and serum. UEX combined with MS were able to identify 2 monoclonal lambda LCs that current clinical methods could not. It also identified the amyloidogenic LC which holds potential for response assessment in the future. © 2017 Wiley Periodicals, Inc.

Induction of lambda prophage by 213 nm laser radiation: a quantitative comparison with 193 nm excimer radiation using image analysis.

PubMed

Matchette, L S; Grossman, L W; Hahn, D W; Cooney, C

1996-03-01

We compared the DNA damage produced by radiation from two UV laser wavelengths, 213 nm and 193 nm, with that produced by noncoherent 254 nm radiation. Following irradiation of Escherichia coli BR339, a bacteriophage lambda lysogen containing the lacZ gene, pro-phage induction was measured by assaying for beta-galactosidase. Because of the limited penetration by UV laser wavelengths an agar overlay of the lysogen was used as the irradiation target. Irradiation of 254 nm was performed in buffer suspension followed by transfer of 5 microL spots onto assay plants. Computer image analysis was used to monitor the rate of product formation, observed as an increase in optical density of the irradiated zones on assay plates. We found that the rate of product formation was a more reproducible unit of comparison than the optical density present at the end of the reaction. Although the rate of product formation was not linearly related to enzyme concentration, the data could be fit to a simple logarithmic function. Using this method, we concluded that the DNA damaging ability of 213 nm radiation was 10 times more efficient than 193 nm radiation and about 100 times less efficient than 254 nm noncoherent radiation.

Enhancement of the thermoelectric figure of merit in DNA-like systems induced by Fano and Dicke effects.

PubMed

Fu, Hua-Hua; Gu, Lei; Wu, Dan-Dan; Zhang, Zu-Quan

2015-04-28

We report a theoretical study highlighting the thermoelectric properties of biological and synthetic DNA molecules. Based on an effective tight-binding model of duplex DNA and by using the nonequilibrium Green's function technique, the thermal conductance, electrical conductance, Seebeck coefficient and thermoelectric figure of merit in the system are numerically calculated by varying the asymmetries of energies and electronic hoppings in the backbone sites to simulate the environmental complications and fluctuations. We find that due to the multiple transport paths in the DNA molecule, the Fano antiresonance occurs, and enhances the Seebeck coefficient and the figure of merit. When the energy difference is produced in every opposite backbone site, the Dicke effect appears. This effect gives rise to a semiconducting-metallic transition, and enhances the thermoelectric efficiency of the DNA molecule remarkably. Moreover, as the Fano antiresonance point is close to the Dicke resonance one, a giant enhancement in the thermoelectric figure of merit in the DNA molecule has been found. These results provide a scenario to obtain effective routes to enhance the thermoelectric efficiency in the DNA molecules, and suggest perspectives for future experiments intending to control the thermoelectric transport in DNA-like nanodevices.

Development of a reference material of a single DNA molecule for the quality control of PCR testing.

PubMed

Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi

2014-09-02

We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.

Cell-targetable DNA nanocapsules for spatiotemporal release of caged bioactive small molecules

NASA Astrophysics Data System (ADS)

Veetil, Aneesh T.; Chakraborty, Kasturi; Xiao, Kangni; Minter, Myles R.; Sisodia, Sangram S.; Krishnan, Yamuna

2017-12-01

Achieving triggered release of small molecules with spatial and temporal precision at designated cells within an organism remains a challenge. By combining a cell-targetable, icosahedral DNA-nanocapsule loaded with photoresponsive polymers, we show cytosolic delivery of small molecules with the spatial resolution of single endosomes in specific cells in Caenorhabditis elegans. Our technology can report on the extent of small molecules released after photoactivation as well as pinpoint the location at which uncaging of the molecules occurred. We apply this technology to release dehydroepiandrosterone (DHEA), a neurosteroid that promotes neurogenesis and neuron survival, and determined the timescale of neuronal activation by DHEA, using light-induced release of DHEA from targeted DNA nanocapsules. Importantly, sequestration inside the DNA capsule prevents photocaged DHEA from activating neurons prematurely. Our methodology can in principle be generalized to diverse neurostimulatory molecules.

Design of stapled DNA-minor-groove-binding molecules with a mutable atom simulated annealing method

NASA Astrophysics Data System (ADS)

Walker, Wynn L.; Kopka, Mary L.; Dickerson, Richard E.; Goodsell, David S.

1997-11-01

We report the design of optimal linker geometries for the synthesis of stapledDNA-minor-groove-binding molecules. Netropsin, distamycin, and lexitropsinsbind side-by-side to mixed-sequence DNA and offer an opportunity for thedesign of sequence-reading molecules. Stapled molecules, with two moleculescovalently linked side-by-side, provide entropic gains and restrain theposition of one molecule relative to its neighbor. Using a free-atom simulatedannealing technique combined with a discrete mutable atom definition, optimallengths and atomic composition for covalent linkages are determined, and anovel hydrogen bond `zipper' is proposed to phase two molecules accuratelyside-by-side.

Single-Molecule Denaturation Mapping of Genomic DNA in Nanofluidic Channels

NASA Astrophysics Data System (ADS)

Reisner, Walter; Larsen, Niels; Kristensen, Anders; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

2009-03-01

We have developed a new DNA barcoding technique based on the partial denaturation of extended fluorescently labeled DNA molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions and can be explained by calculations of sequence-dependent melting probability. We believe this melting mapping technology is the first optically based single molecule technique sensitive to genome wide sequence variation that does not require an additional enzymatic labeling or restriction scheme.

Gating electrical transport through DNA molecules that bridge between silicon nanogaps.

PubMed

Takagi, Shogo; Takada, Tadao; Matsuo, Naoto; Yokoyama, Shin; Nakamura, Mitsunobu; Yamana, Kazushige

2012-03-21

DNA electronic devices were prepared on silicon-based three-terminal electrodes. Both ends of DNA molecules (400 bp long, mixed sequences) were bridged via chemical bonds between the source-drain nanogap (120 nm) electrodes. S-Shaped I-V curves were obtained and the electric current can be modulated by the gate voltage. The DNA molecules act as semiconducting p-type nanowires in the three-terminal device. This journal is © The Royal Society of Chemistry 2012

Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

NASA Astrophysics Data System (ADS)

Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

2018-02-01

Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

Antibody-Mediated Small Molecule Detection Using Programmable DNA-Switches.

PubMed

Rossetti, Marianna; Ippodrino, Rudy; Marini, Bruna; Palleschi, Giuseppe; Porchetta, Alessandro

2018-06-13

The development of rapid, cost-effective, and single-step methods for the detection of small molecules is crucial for improving the quality and efficiency of many applications ranging from life science to environmental analysis. Unfortunately, current methodologies still require multiple complex, time-consuming washing and incubation steps, which limit their applicability. In this work we present a competitive DNA-based platform that makes use of both programmable DNA-switches and antibodies to detect small target molecules. The strategy exploits both the advantages of proximity-based methods and structure-switching DNA-probes. The platform is modular and versatile and it can potentially be applied for the detection of any small target molecule that can be conjugated to a nucleic acid sequence. Here the rational design of programmable DNA-switches is discussed, and the sensitive, rapid, and single-step detection of different environmentally relevant small target molecules is demonstrated.

Counterion accumulation effects on a suspension of DNA molecules: Equation of state and pressure-driven denaturation

NASA Astrophysics Data System (ADS)

Nicasio-Collazo, Luz Adriana; Delgado-González, Alexandra; Hernández-Lemus, Enrique; Castañeda-Priego, Ramón

2017-04-01

The study of the effects associated with the electrostatic properties of DNA is of fundamental importance to understand both its molecular properties at the single molecule level, like the rigidity of the chain, and its interaction with other charged bio-molecules, including other DNA molecules; such interactions are crucial to maintain the thermodynamic stability of the intra-cellular medium. In the present work, we combine the Poisson-Boltzmann mean-field theory with an irreversible thermodynamic approximation to analyze the effects of counterion accumulation inside DNA on both the denaturation profile of the chain and the equation of state of the suspension. To this end, we model the DNA molecule as a porous charged cylinder immersed in an aqueous solution. These thermo-electrostatic effects are explicitly studied in the particular case of some genes for which damage in their sequence is associated with diffuse large B-cell lymphoma.

Measurements of J/{psi} and {psi}(2S) decays into {lambda}{lambda}{pi}{sup 0} and {lambda}{lambda}{eta}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ablikim, M.; Bai, J. Z.; Cai, X.

2007-11-01

Using 58x10{sup 6} J/{psi} and 14x10{sup 6} {psi}(2S) events collected by the BESII detector at the BEPC, branching fractions or upper limits for the decays J/{psi} and {psi}(2S){yields}{lambda}{lambda}{pi}{sup 0} and {lambda}{lambda}{eta} are measured. For the isospin violating decays, the upper limits are determined to be B(J/{psi}{yields}{lambda}{lambda}{pi}{sup 0})<6.4x10{sup -5} and B[{psi}(2S){yields}{lambda}{lambda}{pi}{sup 0}]<4.9x10{sup -5} at the 90% confidence level. The isospin conserving process J/{psi}{yields}{lambda}{lambda}{eta} is observed for the first time, and its branching fraction is measured to be B(J/{psi}{yields}{lambda}{lambda}{eta})=(2.62{+-}0.60{+-}0.44)x10{sup -4}, where the first error is statistical and the second one is systematic. No {lambda}{lambda}{eta} signal is observed in {psi}(2S) decays, and B[{psi}(2S){yields}{lambda}{lambda}{eta}]<1.2x10{supmore » -4} is set at the 90% confidence level. Branching fractions of J/{psi} decays into {sigma}{sup +}{pi}{sup -}{lambda} and {sigma}{sup -}{pi}{sup +}{lambda} are also reported, and the sum of these branching fractions is determined to be B(J/{psi}{yields}{sigma}{sup +}{pi}{sup -}{lambda}+c.c.)=(1.52{+-}0.08{+-}0.16)x10{sup -3}.« less

Allosteric analysis of glucocorticoid receptor-DNA interface induced by cyclic Py-Im polyamide: a molecular dynamics simulation study.

PubMed

Wang, Yaru; Ma, Na; Wang, Yan; Chen, Guangju

2012-01-01

It has been extensively developed in recent years that cell-permeable small molecules, such as polyamide, can be programmed to disrupt transcription factor-DNA interfaces and can silence aberrant gene expression. For example, cyclic pyrrole-imidazole polyamide that competes with glucocorticoid receptor (GR) for binding to glucocorticoid response elements could be expected to affect the DNA dependent binding by interfering with the protein-DNA interface. However, how such small molecules affect the transcription factor-DNA interfaces and gene regulatory pathways through DNA structure distortion is not fully understood so far. In the present work, we have constructed some models, especially the ternary model of polyamides+DNA+GR DNA-binding domain (GRDBD) dimer, and carried out molecular dynamics simulations and free energy calculations for them to address how polyamide molecules disrupt the GRDBD and DNA interface when polyamide and protein bind at the same sites on opposite grooves of DNA. We found that the cyclic polyamide binding in minor groove of DNA can induce a large structural perturbation of DNA, i.e. a >4 Å widening of the DNA minor groove and a compression of the major groove by more than 4 Å as compared with the DNA molecule in the GRDBD dimer+DNA complex. Further investigations for the ternary system of polyamides+DNA+GRDBD dimer and the binary system of allosteric DNA+GRDBD dimer revealed that the compression of DNA major groove surface causes GRDBD to move away from the DNA major groove with the initial average distance of ∼4 Å to the final average distance of ∼10 Å during 40 ns simulation course. Therefore, this study straightforward explores how small molecule targeting specific sites in the DNA minor groove disrupts the transcription factor-DNA interface in DNA major groove, and consequently modulates gene expression.

Development of novel vaccines using DNA shuffling and screening strategies.

PubMed

Locher, Christopher P; Soong, Nay Wei; Whalen, Robert G; Punnonen, Juha

2004-02-01

DNA shuffling and screening technologies recombine and evolve genes in vitro to rapidly obtain molecules with improved biological activity and fitness. In this way, genes from related strains are bred like plants or livestock and their successive progeny are selected. These technologies have also been called molecular breeding-directed molecular evolution. Recent developments in bioinformatics-assisted computer programs have facilitated the design, synthesis and analysis of DNA shuffled libraries of chimeric molecules. New applications in vaccine development are among the key features of DNA shuffling and screening technologies because genes from several strains or antigenic variants of pathogens can be recombined to create novel molecules capable of inducing immune responses that protect against infections by multiple strains of pathogens. In addition, molecules such as co-stimulatory molecules and cytokines have been evolved to have improved T-cell proliferation and cytokine production compared with the wild-type human molecules. These molecules can be used to immunomodulate vaccine responsiveness and have multiple applications in infectious diseases, cancer, allergy and autoimmunity. Moreover, DNA shuffling and screening technologies can facilitate process development of vaccine manufacturing through increased expression of recombinant polypeptides and viruses. Therefore, DNA shuffling and screening technologies can overcome some of the challenges that vaccine development currently faces.

Measurement of the branching fraction $${\\mathcal{B}}(\\Lambda^0_b\\rightarrow \\Lambda^+_c\\pi^-\\pi^+\\pi^-)$$ at CDF

DOE Office of Scientific and Technical Information (OSTI.GOV)

Aaltonen, T.; /Helsinki Inst. of Phys.; Alvarez Gonzalez, B.

We report an analysis of the {Lambda}{sub b}{sup 0} {yields} {Lambda}{sub c}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -} decay in a data sample collected by the CDF II detector at the Fermilab Tevatron corresponding to 2.4 fb{sup -1} of integrated luminosity. We reconstruct the currently largest samples of the decay modes {Lambda}{sub b}{sup 0} {yields} {Lambda}{sub c}(2595){sup +}{pi}{sup -} (with {Lambda}{sub c}(2595){sup +} {yields} {Lambda}{sub c}{sup +}{pi}{sup +}{pi}{sup -}), {Lambda}{sub b}{sup 0} {yields} {Lambda}{sub c}(2625){sup +}{pi}{sup -} (with {Lambda}{sub c}(2625){sup +} {yields} {Lambda}{sub c}{sup +}{pi}{sup +}{pi}{sup -}), {Lambda}{sub b}{sup 0} {yields} {Sigma}{sub c}(2455){sup ++}{pi}{sup -}{pi}{sup -} (with {Sigma}{sub c}(2455){sup ++} {yields} {Lambda}{submore » c}{sup +}{pi}{sup +}), and {Lambda}{sub b}{sup 0} {yields} {Sigma}{sub c}(2455)0{pi}{sup +}{pi}{sup -} (with {Sigma}{sub c}(2455)0 {yields} {Lambda}{sub c}{sup +}{pi}{sup -}) and measure the branching fractions relative to the {Lambda}{sub b}{sup 0} {yields} {Lambda}{sub c}{sup +}{pi}{sup -} branching fraction. We measure the ratio {Beta}({Lambda}{sub b}{sup 0} {yields} {Lambda}{sub c}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -})/ {Beta}({Lambda}{sub b}{sup 0} {yields} {Lambda}{sub c}{sup +}{pi}{sup -})=3.04 {+-} 0.33(stat){sub -0.55}{sup +0.70}(syst) which is used to derive {Beta}({Lambda}{sub b}{sup 0} {yields} {Lambda}{sub c}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -})=(26.8{sub -11.2}{sup +11.9}) x 10{sup -3}.« less

Molecular structure of r/GCG/d/TATACGC/ - A DNA-RNA hybrid helix joined to double helical DNA

NASA Technical Reports Server (NTRS)

Wang, A. H.-J.; Fujii, S.; Rich, A.; Van Boom, J. H.; Van Der Marel, G. A.; Van Boeckel, S. A. A.

1982-01-01

The molecule r(GCG)d(TATACGC) is self-complementary and forms two DNA-RNA hybrid segments surrounding a central region of double helical DNA; its molecular structure has been solved by X-ray analysis. All three parts of the molecule adopt a conformation which is close to that seen in the 11-fold RNA double helix. The conformation of the ribonucleotides is partly determined by water molecules bridging between the ribose O2' hydroxyl group and cytosine O2. The hybrid-DNA duplex junction contains no structural discontinuities. However, the central DNA TATA sequence has some structural irregularities.

DNA confinement in nanochannels: physics and biological applications

NASA Astrophysics Data System (ADS)

Reisner, Walter; Pedersen, Jonas N.; Austin, Robert H.

2012-10-01

DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement—including the effect of varying ionic strength—and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.

DNA confinement in nanochannels: physics and biological applications.

PubMed

Reisner, Walter; Pedersen, Jonas N; Austin, Robert H

2012-10-01

DNA is the central storage molecule of genetic information in the cell, and reading that information is a central problem in biology. While sequencing technology has made enormous advances over the past decade, there is growing interest in platforms that can readout genetic information directly from long single DNA molecules, with the ultimate goal of single-cell, single-genome analysis. Such a capability would obviate the need for ensemble averaging over heterogeneous cellular populations and eliminate uncertainties introduced by cloning and molecular amplification steps (thus enabling direct assessment of the genome in its native state). In this review, we will discuss how the information contained in genomic-length single DNA molecules can be accessed via physical confinement in nanochannels. Due to self-avoidance interactions, DNA molecules will stretch out when confined in nanochannels, creating a linear unscrolling of the genome along the channel for analysis. We will first review the fundamental physics of DNA nanochannel confinement--including the effect of varying ionic strength--and then discuss recent applications of these systems to genomic mapping. Apart from the intense biological interest in extracting linear sequence information from elongated DNA molecules, from a physics view these systems are fascinating as they enable probing of single-molecule conformation in environments with dimensions that intersect key physical length-scales in the 1 nm to 100 µm range.

DNA Binding Peptide Directed Synthesis of Continuous DNA Nanowires for Analysis of Large DNA Molecules by Scanning Electron Microscope.

PubMed

Kim, Kyung-Il; Lee, Seonghyun; Jin, Xuelin; Kim, Su Ji; Jo, Kyubong; Lee, Jung Heon

2017-01-01

Synthesis of smooth and continuous DNA nanowires, preserving the original structure of native DNA, and allowing its analysis by scanning electron microscope (SEM), is demonstrated. Gold nanoparticles densely assembled on the DNA backbone via thiol-tagged DNA binding peptides work as seeds for metallization of DNA. This method allows whole analysis of DNA molecules with entangled 3D features. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Study of B{yields}{lambda}{sub c}{lambda}{sub c} and B{yields}{lambda}{sub c}{lambda}{sub c}K

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, H.-Y.; Hsiao, Y.-K.; Chua, C.-K.

2009-06-01

We study the doubly charmful two-body and three-body baryonic B decays B{yields}{lambda}{sub c}{sup +}{lambda}{sub c}{sup -} and B{yields}{lambda}{sub c}{sup +}{lambda}{sub c}{sup -}K. As pointed out before, a naive estimate of the branching ratio O(10{sup -8}) for the latter decay is too small by 3 to 4 orders of magnitude compared to experiment. Previously, it has been shown that a large enhancement for the {lambda}{sub c}{sup +}{lambda}{sub c}{sup -}K production can occur due to a charmoniumlike resonance (e.g. X(4630) discovered by Belle) with a mass near the {lambda}{sub c}{lambda}{sub c} threshold. Motivated by the BABAR's observation of a resonance in themore » {lambda}{sub c}K system with a mass of order 2930 MeV, we study in this work the contribution to B{yields}{lambda}{sub c}{sup +}{lambda}{sub c}{sup -}K from the intermediate state {xi}{sub c}(2980) which is postulated to be a first positive-parity excited D-wave charmed baryon state. Assuming that a soft qq quark pair is produced through the {sigma} and {pi} meson exchanges in the configuration for B{yields}{xi}{sub c}(2980){lambda}{sub c} and {lambda}{sub c}{lambda}{sub c}, it is found that branching ratios of B{yields}{lambda}{sub c}{sup +}{lambda}{sub c}{sup -}K and B{yields}{lambda}{sub c}{sup +}{lambda}{sub c}{sup -} are of order 3.5x10{sup -4} and 5x10{sup -5}, respectively, in agreement with experiment except that the prediction for the {lambda}{sub c}{lambda}{sub c}K{sup -} is slightly smaller. In conjunction with our previous analysis, we conclude that the enormously large rate of B{yields}{lambda}{sub c}{sup +}{lambda}{sub c}{sup -}K arises from the resonances {xi}{sub c}(2980) and X(4630)« less

Plasmid DNA production combining antibiotic-free selection, inducible high yield fermentation, and novel autolytic purification.

PubMed

Carnes, Aaron E; Hodgson, Clague P; Luke, Jeremy M; Vincent, Justin M; Williams, James A

2009-10-15

DNA vaccines and gene medicines, derived from bacterial plasmids, are emerging as an important new class of pharmaceuticals. However, the challenges of performing cell lysis processes for plasmid DNA purification at an industrial scale are well known. To address downstream purification challenges, we have developed autolytic Escherichia coli host strains that express endolysin (phage lambdaR) in the cytoplasm. Expression of the endolysin is induced during fermentation by a heat inducible promoter. The endolysin remains in the cytoplasm, where it is separated from its peptidoglycan substrate in the cell wall; hence the cells remain alive and intact and can be harvested by the usual methods. The plasmid DNA is then recovered by autolytic extraction under slightly acidic, low salt buffer conditions and treatment with a low concentration of non-ionic detergent. Under these conditions the E. coli genomic DNA remains associated with the insoluble cell debris and is removed by a solid-liquid separation. Here, we report fermentation, lysis methods, and plasmid purification using autolytic hosts.

The effects of temperature and magnetic flux on electron transport through a four-channel DNA model

NASA Astrophysics Data System (ADS)

Lee, Sunhee; Hedin, Eric; Joe, Yong

2010-03-01

The temperature dependence of the conductivity of lambda phage DNA has been measured by Tran et al [1] experimentally, where the conductivity displayed strong (weak) temperature dependence above (below) a threshold temperature. In order to understand the temperature effects of electron transport theoretically, we study a two-dimensional and four-channel DNA model using a tight-binding (TB) Hamiltonian. The thermal effects within a TB model are incorporated into the hopping integral and the relative twist angle from its equilibrium value between base-pairs. Since these thermal structural fluctuations localize the electronic wave functions in DNA, we examine a temperature-dependent localization length, a temperature-driven transmission, and current-voltage characteristics in this system. In addition, we incorporate magnetic field effects into the analysis of the transmission through DNA in order to modulate the quantum interference between the electron paths that comprise the 4-channel structure. [1] P. Tran, B. Alavi, and G. Gruner, PRL 85, 1564 (2000).

A CI-Independent Form of Replicative Inhibition: Turn Off of Early Replication of Bacteriophage Lambda

PubMed Central

Hayes, Sidney; Horbay, Monique A.; Hayes, Connie

2012-01-01

Several earlier studies have described an unusual exclusion phenotype exhibited by cells with plasmids carrying a portion of the replication region of phage lambda. Cells exhibiting this inhibition phenotype (IP) prevent the plating of homo-immune and hybrid hetero-immune lambdoid phages. We have attempted to define aspects of IP, and show that it is directed to repλ phages. IP was observed in cells with plasmids containing a λ DNA fragment including oop, encoding a short OOP micro RNA, and part of the lambda origin of replication, oriλ, defined by iteron sequences ITN1-4 and an adjacent high AT-rich sequence. Transcription of the intact oop sequence from its promoter, pO is required for IP, as are iterons ITN3–4, but not the high AT-rich portion of oriλ. The results suggest that IP silencing is directed to theta mode replication initiation from an infecting repλ genome, or an induced repλ prophage. Phage mutations suppressing IP, i.e., Sip, map within, or adjacent to cro or in O, or both. Our results for plasmid based IP suggest the hypothesis that there is a natural mechanism for silencing early theta-mode replication initiation, i.e. the buildup of λ genomes with oop + oriλ+ sequence. PMID:22590552

Synthesis, DNA binding and cytotoxic activity of pyrimido[4',5':4,5]thieno(2,3-b)quinoline with 9-hydroxy-4-(3-diethylaminopropylamino) and 8-methoxy-4-(3-diethylaminopropylamino) substitutions.

PubMed

KiranKumar, Hulihalli N; RohitKumar, Heggodu G; Advirao, Gopal M

2018-01-01

Two new derivatives of pyrimido[4',5';4,5]thieno(2,3-b)quinoline (PTQ), 9-hydroxy-4-(3-diethylaminopropylamino)pyrimido[4',5';4,5]thieno(2,3-b)quinoline (Hydroxy-DPTQ) and 8-methoxy-4-(3-diethylaminopropylamino)pyrimido[4',5';4,5]thieno(2,3-b)quinoline (Methoxy-DPTQ) were synthesized and their DNA binding ability was analyzed using spectroscopy (UV-visible, fluorescence and circular dichroism), ethidium bromide dye displacement assay, melting temperature (T m ) analysis and computational docking studies. The hypochromism in UV-visible spectrum and increased fluorescence emission of Hydroxy-DPTQ and Methoxy-DPTQ in the presence of DNA suggested the molecule-DNA interaction. The association constants calculated from UV-visible and spectral titrations were of the order 10 4 to 10 6 M -1 . Circular dichroism studies corroborated the induced conformational changes in DNA upon addition of molecules. The change in the ellipticity was observed both in negative and positive peak of DNA, thus, suggesting the intercalation of molecules. The observed displacement of ethidium bromide from the DNA and increased T m , upon addition of DNA confirmed the intercalative mode of binding. This was further validated by computational docking, which showed clear intercalation of molecules into the d(GpC)-d(CpG) site of the receptor DNA. Anticancer activities of these molecules are evaluated by using MTT assay. Both molecules showed antiproliferative activity against all the three cancer cells studied, with Hydroxy-DPTQ being more potential molecule among the two. IC 50 value of Hydroxy-DPTQ and Methoxy-DPTQ were in the range of 3-5μM and 130-250μM, respectively. Copyright © 2017 Elsevier B.V. All rights reserved.

Measurement of the $$\\Lambda_b$$ cross section and the $$_{\\bar{\\Lambda}_b}$$ to $$\\Lambda_b$$ ratio with $$J/\\Psi \\Lambda$$ decays in $pp$ collisions at $$\\sqrt{s}=7$$ TeV

DOE PAGES

Chatrchyan, Serguei; et al.

2013-07-16

The Lambda(b) differential production cross section and the cross section ratio anti-Lambda(b)/Lambda(b) are measured as functions of transverse momentum pt(Lambda(b)) and rapidity abs(y(Lambda(b))) in pp collisions at sqrt(s) = 7 TeV using data collected by the CMS experiment at the LHC. The measurements are based on Lambda(b) decays reconstructed in the exclusive final state J/Psi Lambda, with the subsequent decays J/Psi to an opposite-sign muon pair and Lambda to proton pion, using a data sample corresponding to an integrated luminosity of 1.9 inverse femtobarns. The product of the cross section times the branching ratio for Lambda(b) to J/Psi Lambda versusmore » pt(Lambda(b)) falls faster than that of b mesons. The measured value of the cross section times the branching ratio for pt(Lambda(b)) > 10 GeV and abs(y(Lambda(b))) < 2.0 is 1.06 +/- 0.06 +/- 0.12 nb, and the integrated cross section ratio for anti-Lambda(b)/Lambda(b) is 1.02 +/- 0.07 +/- 0.09, where the uncertainties are statistical and systematic, respectively.« less

A sulfhydryl-rich IgM protein with multiple serological specificities.

PubMed Central

Merlini, G; Zettervall, O; Forsgren, A; Galliano, M; Lindberg, A A; Svenson, S B; Pavesi, F; Turesson, I

1987-01-01

A monoclonal IgM lambda protein from a patient (E.T.) suffering from a lymphocytic lymphoma agglutinated Salmonella typhi bacteria and uncoated acryl particles. The antigenic determinant on Salmonella typhi bacteria was found to be 0-12 (alpha-D-Galp-(1-2)-alpha-D-Manp) while the structure on acryl particles recognized by IgM ET has not been defined. Both binding sites for bacteria and acryl particle determinants are localized on the same IgM molecule. The uncommon affinity of this IgM protein for some divalent heavy metal ions led to the finding of an unusually high content of sulfhydryl groups in the Fab portion of the molecule. PMID:2443287

Single-molecule analysis of DNA uncoiling by a type II topoisomerase

NASA Astrophysics Data System (ADS)

Strick, Terence R.; Croquette, Vincent; Bensimon, David

2000-04-01

Type II DNA topoisomerases are ubiquitous ATP-dependent enzymes capable of transporting a DNA through a transient double-strand break in a second DNA segment. This enables them to untangle DNA and relax the interwound supercoils (plectonemes) that arise in twisted DNA. In vivo, they are responsible for untangling replicated chromosomes and their absence at mitosis or meiosis ultimately causes cell death. Here we describe a micromanipulation experiment in which we follow in real time a single Drosophila melanogaster topoisomerase II acting on a linear DNA molecule which is mechanically stretched and supercoiled. By monitoring the DNA's extension in the presence of ATP, we directly observe the relaxation of two supercoils during a single catalytic turnover. By controlling the force pulling on the molecule, we determine the variation of the reaction rate with the applied stress. Finally, in the absence of ATP, we observe the clamping of a DNA crossover by a single topoisomerase on at least two different timescales (configurations). These results show that single molecule experiments are a powerful new tool for the study of topoisomerases.

Single DNA molecule detection using nanopipettes and nanoparticles.

PubMed

Karhanek, Miloslav; Kemp, Jennifer T; Pourmand, Nader; Davis, Ronald W; Webb, Chris D

2005-02-01

Single DNA molecules labeled with nanoparticles can be detected by blockades of ionic current as they are translocated through a nanopipette tip formed by a pulled glass capillary. The nanopipette detection technique can provide not only tools for detection and identification of single DNA and protein molecules but also deeper insight and understanding of stochastic interactions of various biomolecules with their environment.

Second-generation DNA-templated macrocycle libraries for the discovery of bioactive small molecules.

PubMed

Usanov, Dmitry L; Chan, Alix I; Maianti, Juan Pablo; Liu, David R

2018-07-01

DNA-encoded libraries have emerged as a widely used resource for the discovery of bioactive small molecules, and offer substantial advantages compared with conventional small-molecule libraries. Here, we have developed and streamlined multiple fundamental aspects of DNA-encoded and DNA-templated library synthesis methodology, including computational identification and experimental validation of a 20 × 20 × 20 × 80 set of orthogonal codons, chemical and computational tools for enhancing the structural diversity and drug-likeness of library members, a highly efficient polymerase-mediated template library assembly strategy, and library isolation and purification methods. We have integrated these improved methods to produce a second-generation DNA-templated library of 256,000 small-molecule macrocycles with improved drug-like physical properties. In vitro selection of this library for insulin-degrading enzyme affinity resulted in novel insulin-degrading enzyme inhibitors, including one of unusual potency and novel macrocycle stereochemistry (IC 50  = 40 nM). Collectively, these developments enable DNA-templated small-molecule libraries to serve as more powerful, accessible, streamlined and cost-effective tools for bioactive small-molecule discovery.

Method for in vitro recombination

DOEpatents

Gibson, Daniel Glenn; Smith, Hamilton O

2013-05-07

The present invention relates to an in vitro method, using isolated protein reagents, for joining two double-stranded (ds) DNA molecules of interest, wherein the distal region of the first DNA molecule and the proximal region of the second DNA molecule share a region of sequence identity. The method allows the joining of a number of DNA fragments, in a predetermined order and orientation, without the use of restriction enzymes. It can be used, e.g., to join synthetically produced sub-fragments of a gene or genome of interest.

Study of genetic effects of high energy radiations with different ionizing capacities on extracellular phages.

PubMed

Bresler, S E; Kalinin, V L; Kopylova, Y U; Krivisky, A S; Rybchin, V N; Shelegedin, V N

1975-07-01

The inactivating and mutagenic action of high-energy radiations with different ionizing capacities (gamma-rays, protons, alpha-particles and accelerated ions of 12C and 20Ne) was studied by using coliphages lambda11 and SD as subjects. In particular the role of irradiation conditions (broth suspension, pure buffer, dry samples) and of the host functions recA, exrA and polA was investigated. The dose-response curve of induced mutagenesis was studied by measuring the yield of vir mutants in lambda11 and plaque mutants in SD. The following results were obtained. (1) The inactivation kinetics of phages under the action of gamma-rays and protons was first order to a survival of 10(-7). Heavy ions also showed exponential inactivation kinetics to a survival of 10(-4). At higher doses of 20Ne ion bombardment some deviation from one-hit kinetics was observed. For dry samples of phages the dimensions of targets for all types of radiation were approximately proportional to the molecular weights of phage DNA's. For densely ionizing radiation (heavy ions) the inactivating action was 3-5 times weaker than for gamma-rays and protons. (2) Mutagenesis was observed for all types of radiation, but heavy ions were 1-5-2 times less efficient than gamma-rays. For both phages studied the dose-response curve of mutagenesis was non-linear. The dependence on the dose was near to parabolic for lambda11. For SD a plateau or maximum of mutagenesis was observed for the relative number of mutants at a survival of about 10(-4). (3) Host-cell functions recA and exrA were practically indifferent for survival of gamma-irradiated phage lambda11, but indispensable for mutagenesis. Mutation recAI3 abolished induced vir mutations totally and exrA- reduced them significantly. The absence of the function polA had a considerable influence on phage survival, but no effect on vir mutation yield (if compared at the same survival level). (4) In conditions of indirect action of gamma-rays no vir mutations were induced. This is regarded as evidence that the single-strand breaks formed under indirect action conditions cannot serve as pre-mutational damage in DNA.

Factors affecting expression of the recF gene of Escherichia coli K-12.

PubMed

Sandler, S J; Clark, A J

1990-01-31

This report describes four factors which affect expression of the recF gene from strong upstream lambda promoters under temperature-sensitive cIAt2-encoded repressor control. The first factor was the long mRNA leader sequence consisting of the Escherichia coli dnaN gene and 95% of the dnaA gene and lambda bet, N (double amber) and 40% of the exo gene. When most of this DNA was deleted, RecF became detectable in maxicells. The second factor was the vector, pBEU28, a runaway replication plasmid. When we substituted pUC118 for pBEU28, RecF became detectable in whole cells by the Coomassie blue staining technique. The third factor was the efficiency of initiation of translation. We used site-directed mutagenesis to change the mRNA leader, ribosome-binding site and the 3 bp before and after the translational start codon. Monitoring the effect of these mutational changes by translational fusion to lacZ, we discovered that the efficiency of initiation of translation was increased 30-fold. Only an estimated two- or threefold increase in accumulated levels of RecF occurred, however. This led us to discover the fourth factor, namely sequences in the recF gene itself. These sequences reduce expression of the recF-lacZ fusion genes 100-fold. The sequences responsible for this decrease in expression occur in four regions in the N-terminal half of recF. Expression is reduced by some sequences at the transcriptional level and by others at the translational level.

Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

PubMed

Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

1977-04-01

Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained.

Preliminary morphological and X-ray diffraction studies of the crystals of the DNA cetyltrimethylammonium salt.

PubMed Central

Osica, V D; Pyatigorskaya, T L; Polyvtsev, O F; Dembo, A T; Kliya, M O; Vasilchenko, V N; Verkin, B I; Sukharevskya, B Y

1977-01-01

Double-stranded DNA molecules (molecular weight 2.5 X 10(5) - 5 X 10(5) daltons) have been crystallized from water-salt solutions as cetyltrimethylammonium salts (CTA-DNA). Variation of crystallization conditions results in a production of different types of CTA-DNA crystals: spherulits, dendrites, needle-shaped and faceted rhombic crystals, the latter beeing up to 0.3 mm on a side. X-ray diffraction data indicate that DNA molecules in the crystals form a hexagonal lattice which parameters vary slightly with the morphological type of the crystal. Comparison of the melting curves of the DNA preparation before and after crystallization suggests that DNA molecules are partially fractionated in the course of crystallization. Crystals of the CTA-DNA-proflavine complex have also been obtained. Images PMID:866188

[The expression of interferon-lambda1 in CHO cell].

PubMed

Yuan, Wu-Mei; Ma, Fen-Lian; Zhang, Qian; Zheng, Wen-Zhi; Zheng, Li-Shu

2013-06-01

To construct the eukaryotic expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which linked the enhancer SP163 with interferon lambda1. Then express the interferon lambda1 in CHO (dhfr-) cells. Using PCR method to introduce the restriction enzyme sites and through the fusion PCR binding the enhancer with the interferon Lambda1. After sequenced, lambda1 and SP163-lambda1 was inserted into PCI-dhfr forming the expression vector PCI-dhfr-lambda1 and PCI-dhfr-SP163-lambda1 which was constructed successfully confirming by sequencing. Then the expressing vectors were transfected into CHO (dhfr-) cells using liposome transfection method and interferon lambda1 protein was assayed with indirect immunofluorescence and Western Blot. Using cytopathic effect inhibition evaluated the antiviral activity of interferon lambda1. Successfully constructing the eukaryotic expression vectors of interferon lambda and the vectors could express interferon lambda1. The result of immunofluorescence showed the enhancer developed the expression of interferon lambda1. Detecting the interferon lambda1 in CHO (dhfr-) cells after transfecting 48 hour using Western Blot. The cytopathic effect inhibition showed the expressed interferon lambda1 has the antiviral activity. Successfully expressed the interferon lambda1 in CHO (dhfr-) cells and the protein possesses antiviral activity, which may supply a valuable basis for building the stable cell line of interferon lambda1.

Energy of the ground and 2{sup +} excited states of {sub {lambda}}{sub {lambda}}{sup 10}Be: A partial ten-body model

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shoeb, Mohammad; Sonika

2009-08-15

The energies of the ground and excited 2{sup +} states of {sub {lambda}}{sub {lambda}}{sup 10}Be have been calculated variationally in the Monte Carlo framework. The hypernucleus is treated as a partial ten-body problem in the {lambda}{lambda}+{alpha}{alpha} model where nucleonic degrees of freedom of {alpha}'s are taken into consideration ignoring the antisymmetrization between two {alpha}'s. The central two-body {lambda}N and {lambda}{lambda} and the three-body dispersive and two-pion exchange {lambda}NN forces, constrained by the {lambda}p scattering data and the observed ground state energies of {sub {lambda}}{sup 5}He and {sub {lambda}}{sub {lambda}}{sup 6}He, are employed. The product-type trial wave function predicts binding energymore » for the ground state considerably less than for the event reported by Danysz et al.; however, it is consistent with the value deduced assuming a {gamma} ray of 3.04 MeV must have escaped undetected in the decay of the product {sub {lambda}}{sup 9}Be* {yields} {sub {lambda}}{sup 9}Be+{gamma} of the emulsion event {sub {lambda}}{sub {lambda}}{sup 10}Be{yields} {pi}{sup -}+p+{sub {lambda}}{sup 9}Be* and for the excited 2{sup +} state closer to the value measured in the Demachi-Yanagi event. The hypernucleus {sub {lambda}}{sub {lambda}}{sup 10}Be has an oblate shape in the excited state. These results are consistent with the earlier four-body {alpha} cluster model approach where {alpha}'s are assumed to be structureless entities.« less

How to read and write mechanical information in DNA molecules

NASA Astrophysics Data System (ADS)

Schiessel, Helmut

In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

Spontaneous Transport of Single-Stranded DNA through Graphene-MoS2 Heterostructure Nanopores.

PubMed

Luan, Binquan; Zhou, Ruhong

2018-04-24

The effective transport of a single-stranded DNA (ssDNA) molecule through a solid-state nanopore is essential to the future success of high-throughput and low-cost DNA sequencing. Compatible with current electric sensing technologies, here, we propose and demonstrate by molecular dynamics simulations the ssDNA transport through a quasi-two-dimensional nanopore in a heterostructure stacked together with different 2D materials, such as graphene and molybdenum disulfide (MoS 2 ). Due to different chemical potentials, U, of DNA bases on different 2D materials, it is energetically favorable for a ssDNA molecule to move from the low- U MoS 2 surface to the high- U graphene surface through a nanopore. With the proper attraction between the negatively charged phosphate group in each nucleotide and the positively charged Mo atoms exposed on the pore surface, the ssDNA molecule can be temporarily seized and released thereafter through a thermal activation, that is, a slow and possible nucleotide-by-nucleotide transport. A theoretical formulation is then developed for the free energy of the ssDNA transiting a heterostructure nanopore to properly characterize the non-equilibrium stick-slip-like motion of a ssDNA molecule.

Heterologous mitochondrial DNA recombination in human cells.

PubMed

D'Aurelio, Marilena; Gajewski, Carl D; Lin, Michael T; Mauck, William M; Shao, Leon Z; Lenaz, Giorgio; Moraes, Carlos T; Manfredi, Giovanni

2004-12-15

Inter-molecular heterologous mitochondrial DNA (mtDNA) recombination is known to occur in yeast and plants. Nevertheless, its occurrence in human cells is still controversial. To address this issue we have fused two human cytoplasmic hybrid cell lines, each containing a distinct pathogenic mtDNA mutation and specific sets of genetic markers. In this hybrid model, we found direct evidence of recombination between these two mtDNA haplotypes. Recombinant mtDNA molecules in the hybrid cells were identified using three independent experimental approaches. First, recombinant molecules containing genetic markers from both parental alleles were demonstrated with restriction fragment length polymorphism of polymerase chain reaction products, by measuring the relative frequencies of each marker. Second, fragments of recombinant mtDNA were cloned and sequenced to identify the regions involved in the recombination events. Finally, recombinant molecules were demonstrated directly by Southern blot using appropriate combinations of polymorphic restriction sites and probes. This combined approach confirmed the existence of heterogeneous species of recombinant mtDNA molecules in the hybrid cells. These findings have important implications for mtDNA-related diseases, the interpretation of human evolution and population genetics and forensic analyses based on mtDNA genotyping.

Single Molecule Study of Metalloregulatory Protein-DNA Interactions

NASA Astrophysics Data System (ADS)

Sarkar, Susanta; Benitez, Jaime; Huang, Zhengxi; Wang, Qi; Chen, Peng

2007-03-01

Control of metal concentrations is essential for living body. Metalloregulatory proteins respond to metal concentrations by regulating transcriptions of metal resistance genes via protein-DNA interactions. It is thus necessary to understand interactions of metalloregulatory proteins with DNA. Ensemble measurements provide average behavior of a vast number of biomolecules. In contrast, single molecule spectroscopy can track single molecules individually and elucidate dynamics of processes of short time scales and intermediate structures not revealed by ensemble measurements. Here we present single molecule study of interactions between PbrR691, a MerR-family metalloregulatory protein and DNA. We presume that the dynamics of protein/DNA conformational changes and interactions are important for the transcription regulation and kinetics of these dynamic processes can provide useful information about the mechanisms of these metalloregulatory proteins.

Electron transport properties in fluorinated copper-phthalocyanine films: importance of vibrational reorganization energy and molecular microstructure.

PubMed

Wu, Fu-Chiao; Cheng, Horng-Long; Yen, Chen-Hsiang; Lin, Jyu-Wun; Liu, Shyh-Jiun; Chou, Wei-Yang; Tang, Fu-Ching

2010-03-07

Electron transport (ET) properties of a series of fluorinated copper-phthalocyanine (F(16)CuPc) thin films, which were deposited at different substrate temperatures (T(sub)) ranging from 30 to 150 degrees C, have been investigated by quantum mechanical calculations of the reorganization energy (lambda(reorg)), X-ray diffraction (XRD), atomic force microscopy (AFM), and microRaman spectroscopy. Density functional theory calculations were used to predict the vibrational frequencies, normal mode displacement vectors, and electron-vibrational lambda(reorg) for the F(16)CuPc molecule. The electron mobilities (mu(e)) of F(16)CuPc thin films are strongly dependent on the T(sub), and the value of mu(e) increases with increasing T(sub) from 30 to 120 degrees C, at which point it reaches its maximum value. The importance of electron-vibrational coupling and molecular microstructures for ET properties in F(16)CuPc thin films are discussed on the basis of theoretical vibrational lambda(reorg) calculations and experimental observations of resonance Raman spectra. We observed a good correlation between mu(e) and the full-width-at-half-maximum of the vibrational bands, which greatly contributed to lambda(reorg) and/or which reflects the molecular microstructural quality of the active channel. In contrast, the crystal size analysis by XRD and surface grain morphology by AFM did not reveal a clear correlation with the ET behaviours for these different F(16)CuPc thin films. Therefore, we suggest that for organic films with weak intermolecular interactions, such as F(16)CuPc, optimized microscopic molecular-scale parameters are highly important for efficient long-range charge transport in the macroscopic devices.

Synthetic-Molecule/Protein Hybrid Probe with Fluorogenic Switch for Live-Cell Imaging of DNA Methylation.

PubMed

Hori, Yuichiro; Otomura, Norimichi; Nishida, Ayuko; Nishiura, Miyako; Umeno, Maho; Suetake, Isao; Kikuchi, Kazuya

2018-02-07

Hybrid probes consisting of synthetic molecules and proteins are powerful tools for detecting biological molecules and signals in living cells. To date, most targets of the hybrid probes have been limited to pH and small analytes. Although biomacromolecules are essential to the physiological function of cells, the hybrid-probe-based approach has been scarcely employed for live-cell detection of biomacromolecules. Here, we developed a hybrid probe with a chemical switch for live-cell imaging of methylated DNA, an important macromolecule in the repression of gene expression. Using a protein labeling technique, we created a hybrid probe containing a DNA-binding fluorogen and a methylated-DNA-binding domain. The hybrid probe enhanced fluorescence intensity upon binding to methylated DNA and successfully monitored methylated DNA during mitosis. The hybrid probe offers notable advantages absent from probes based on small molecules or fluorescent proteins and is useful for live-cell analyses of epigenetic phenomena and diseases related to DNA methylation.

Synthesis of surface-anchored DNA-polymer bioconjugates using reversible addition-fragmentation chain transfer polymerization.

PubMed

He, Peng; He, Lin

2009-07-13

We report here an approach to grafting DNA-polymer bioconjugates on a planar solid support using reversible addition-fragmentation chain transfer (RAFT) polymerization. In particular, a trithiocarbonate compound as the RAFT chain transfer agent (CTA) is attached to the distal point of a surface-immobilized oligonucleotide. Initiation of RAFT polymerization leads to controlled growth of polymers atop DNA molecules on the surface. Growth kinetics of poly(monomethoxy-capped oligo(ethylene glycol) methacrylate) atop DNA molecules is investigated by monitoring the change of polymer film thickness as a function of reaction time. The reaction conditions, including the polymerization temperature, the initiator concentration, the CTA surface density, and the selection of monomers, are varied to examine their impacts on the grafting efficiency of DNA-polymer conjugates. Comparing to polymer growth atop small molecules, the experimental results suggest that DNA molecules significantly accelerate polymer growth, which is speculated as a result of the presence of highly charged DNA backbones and purine/pyrimidine moieties surrounding the reaction sites.

Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

PubMed

Gahlon, Hailey L; Romano, Louis J; Rueda, David

2017-11-20

Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

Small Molecule Protection of Bone Marrow Hematopoietic Stem Cells

DTIC Science & Technology

2015-10-01

several recently identified small molecules can protect hematopoietic stem cells (HSCs) from damage or killing by endogenous aldehydes . Proof-of-concept...anemia bone marrow failure CD34+ hematopoietic stem cells aldehydes formaldehyde DNA damage DNA base adduct DNA-protein crosslink mass...below. Revised Specific Aim 1: Small molecule protection of human cells from aldehyde - induced killing (in vitro studies - no mice or human subjects

C60 fullerene binding to DNA

NASA Astrophysics Data System (ADS)

Alshehri, Mansoor H.; Cox, Barry J.; Hill, James M.

2014-09-01

Fullerenes have attracted considerable attention in various areas of science and technology. Owing to their exceptional physical, chemical, and biological properties, they have many applications, particularly in cosmetic and medical products. Using the Lennard-Jones 6-12 potential function and the continuum approximation, which assumes that intermolecular interactions can be approximated by average atomic surface densities, we determine the binding energies of a C60 fullerene with respect to both single-strand and double-strand DNA molecules. We assume that all configurations are in a vacuum and that the C60 fullerene is initially at rest. Double integrals are performed to determine the interaction energy of the system. We find that the C60 fullerene binds to the double-strand DNA molecule, at either the major or minor grooves, with binding energies of -4.7 eV or -2.3 eV, respectively, and that the C60 molecule binds to the single-strand DNA molecule with a binding energy of -1.6 eV. Our results suggest that the C60 molecule is most likely to be linked to the major groove of the dsDNA molecule.

DNA-length-dependent quenching of fluorescently labeled iron oxide nanoparticles with gold, graphene oxide and MoS2 nanostructures.

PubMed

Balcioglu, Mustafa; Rana, Muhit; Robertson, Neil; Yigit, Mehmet V

2014-08-13

We controlled the fluorescence emission of a fluorescently labeled iron oxide nanoparticle using three different nanomaterials with ultraefficient quenching capabilities. The control over the fluorescence emission was investigated via spacing introduced by the surface-functionalized single-stranded DNA molecules. DNA molecules were conjugated on different templates, either on the surface of the fluorescently labeled iron oxide nanoparticles or gold and nanographene oxide. The efficiency of the quenching was determined and compared with various fluorescently labeled iron oxide nanoparticle and nanoquencher combinations using DNA molecules with three different lengths. We have found that the template for DNA conjugation plays significant role on quenching the fluorescence emission of the fluorescently labeled iron oxide nanoparticles. We have observed that the size of the DNA controls the quenching efficiency when conjugated only on the fluorescently labeled iron oxide nanoparticles by setting a spacer between the surfaces and resulting change in the hydrodynamic size. The quenching efficiency with 12mer, 23mer and 36mer oligonucleotides decreased to 56%, 54% and 53% with gold nanoparticles, 58%, 38% and 32% with nanographene oxide, 46%, 38% and 35% with MoS2, respectively. On the other hand, the presence, not the size, of the DNA molecules on the other surfaces quenched the fluorescence significantly with different degrees. To understand the effect of the mobility of the DNA molecules on the nanoparticle surface, DNA molecules were attached to the surface with two different approaches. Covalently immobilized oligonucleotides decreased the quenching efficiency of nanographene oxide and gold nanoparticles to ∼22% and ∼21%, respectively, whereas noncovalently adsorbed oligonucleotides decreased it to ∼25% and ∼55%, respectively. As a result, we have found that each nanoquencher has a powerful quenching capability against a fluorescent nanoparticle, which can be tuned with surface functionalized DNA molecules.

Beauty Baryons at CDF and DO

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kryemadhi, Abaz

The results from Tevatron in the baryonic sector are presented. The lifetime of {lambda}b {yields} J/{psi}{lambda}, the observation of hadronic decay of {lambda}b {yields} {lambda}c{pi}, the semileptonic decays of {lambda}b {yields} {lambda}c{mu}{nu}, the hadronization of the b-baryons, and the {lambda}b decays to {lambda}b {yields} p{pi} and {lambda}b {yields} pK are discussed. These measurements paint a nice picture of our understanding of the beauty baryons.

Promoter binding, initiation, and elongation by bacteriophage T7 RNA polymerase. A single-molecule view of the transcription cycle.

PubMed

Skinner, Gary M; Baumann, Christoph G; Quinn, Diana M; Molloy, Justin E; Hoggett, James G

2004-01-30

A single-molecule transcription assay has been developed that allows, for the first time, the direct observation of promoter binding, initiation, and elongation by a single RNA polymerase (RNAP) molecule in real-time. To promote DNA binding and transcription initiation, a DNA molecule tethered between two optically trapped beads was held near a third immobile surface bead sparsely coated with RNAP. By driving the optical trap holding the upstream bead with a triangular oscillation while measuring the position of both trapped beads, we observed the onset of promoter binding, promoter escape (productive initiation), and processive elongation by individual RNAP molecules. After DNA template release, transcription re-initiation on the same DNA template is possible; thus, multiple enzymatic turnovers by an individual RNAP molecule can be observed. Using bacteriophage T7 RNAP, a commonly used RNAP paradigm, we observed the association and dissociation (k(off)= 2.9 s(-1)) of T7 RNAP and promoter DNA, the transition to the elongation mode (k(for) = 0.36 s(-1)), and the processive synthesis (k(pol) = 43 nt s(-1)) and release of a gene-length RNA transcript ( approximately 1200 nt). The transition from initiation to elongation is much longer than the mean lifetime of the binary T7 RNAP-promoter DNA complex (k(off) > k(for)), identifying a rate-limiting step between promoter DNA binding and promoter escape.

Improved measurement of the form factors in the decay lambda+c-->lambda + nue.

PubMed

Hinson, J W; Huang, G S; Lee, J; Miller, D H; Pavlunin, V; Rangarajan, R; Sanghi, B; Shibata, E I; Shipsey, I P J; Cronin-Hennessy, D; Park, C S; Park, W; Thayer, J B; Thorndike, E H; Coan, T E; Gao, Y S; Liu, F; Stroynowski, R; Artuso, M; Boulahouache, C; Blusk, S; Dambasuren, E; Dorjkhaidav, O; Mountain, R; Muramatsu, H; Nandakumar, R; Skwarnicki, T; Stone, S; Wang, J C; Csorna, S E; Danko, I; Bonvicini, G; Cinabro, D; Dubrovin, M; McGee, S; Bornheim, A; Lipeles, E; Pappas, S P; Shapiro, A; Sun, W M; Weinstein, A J; Briere, R A; Chen, G P; Ferguson, T; Tatishvili, G; Vogel, H; Watkins, M E; Adam, N E; Alexander, J P; Berkelman, K; Boisvert, V; Cassel, D G; Duboscq, J E; Ecklund, K M; Ehrlich, R; Galik, R S; Gibbons, L; Gittelman, B; Gray, S W; Hartill, D L; Heltsley, B K; Hsu, L; Jones, C D; Kandaswamy, J; Kreinick, D L; Magerkurth, A; Mahlke-Krüger, H; Meyer, T O; Mistry, N B; Patterson, J R; Peterson, D; Pivarski, J; Richichi, S J; Riley, D; Sadoff, A J; Schwarthoff, H; Shepherd, M R; Thayer, J G; Urner, D; Wilksen, T; Warburton, A; Weinberger, M; Athar, S B; Avery, P; Breva-Newell, L; Potlia, V; Stoeck, H; Yelton, J; Benslama, K; Cawlfield, C; Eisenstein, B I; Gollin, G D; Karliner, I; Lowrey, N; Plager, C; Sedlack, C; Selen, M; Thaler, J J; Williams, J; Edwards, K W; Besson, D; Anderson, S; Frolov, V V; Gong, D T; Kubota, Y; Li, S Z; Poling, R; Smith, A; Stepaniak, C J; Urheim, J; Metreveli, Z; Seth, K K; Tomaradze, A; Zweber, P; Ahmed, S; Alam, M S; Ernst, J; Jian, L; Saleem, M; Wappler, F; Arms, K; Eckhart, E; Gan, K K; Gwon, C; Honscheid, K; Kagan, H; Kass, R; Pedlar, T K; von Toerne, E; Severini, H; Skubic, P; Dytman, S A; Mueller, J A; Nam, S; Savinov, V

2005-05-20

Using the CLEO detector at the Cornell Electron Storage Ring, we have studied the distribution of kinematic variables in the decay lambda(+)(c)lambda--> e(+)nu(e). By performing a four-dimensional maximum likelihood fit, we determine the form factor ratio, R= f(2)/f(1) = -0.31 +/- 0.05(stat) +/- 0.04(syst), the pole mass, M(pole) = [2.21 +/- 0.08(stat) +/- 0.14(syst)] GeV/c(2), and the decay asymmetry parameter of the lambda(+)(c), alpha (lambda(c)) = -0.86 +/-0.03(stat) +/- 0.02(syst), for q(2) = 0.67 (GeV/c(2))(2). We compare the angular distributions of the lambda(+)(c) and lambda(-)(c) and find no evidence for CP violation: A(lambda(c)) = (alpha(lambda(c)) + alpha (lambda(c)))/(alpha(lambda(c))-alpha(lambda(c))) = 0.00 +/- 0.03(stat) +/- 0.01(syst) +/- 0.02, where the third error is from the uncertainty in the world average of the CP-violating parameter, A(lambda), for ppi(-).

Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

NASA Astrophysics Data System (ADS)

Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

2018-06-01

It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

[Synthesis of Circular DNA Templates with T4 RNA Ligase for Rolling Circle Amplification].

PubMed

Sakhabutdinova, A R; Maksimova, M A; Garafutdinov, R R

2017-01-01

Currently, isothermal methods of nucleic acid amplification have been well established; in particular, rolling circle amplification is of great interest. In this approach, circular ssDNA molecules have been used as a target that can be obtained by the intramolecular template-dependent ligation of an oligonucleotide C-probe. Here, a new method of synthesizing small circular DNA molecules via the cyclization of ssDNA based on T4 RNA ligase has been proposed. Circular ssDNA is further used as the template for the rolling circle amplification. The maximum yield of the cyclization products was observed in the presence of 5-10% polyethylene glycol 4000, and the optimum DNA length for the cyclization constituted 50 nucleotides. This highly sensitive method was shown to detect less than 10^(2) circular DNA molecules. The method reliability was proved based on artificially destroyed dsDNA, which suggests its implementation for analyzing any significantly fragmented dsDNA.

Microarray Detection of Duplex and Triplex DNA Binders with DNA-Modified Gold Nanoparticles

PubMed Central

Lytton-Jean, Abigail K. R.; Han, Min Su; Mirkin, Chad A.

2008-01-01

We have designed a chip-based assay, using microarray technology, for determining the relative binding affinities of duplex and triplex DNA binders. This assay combines the high discrimination capabilities afforded by DNA-modified Au nanoparticles with the high-throughput capabilities of DNA microarrays. The detection and screening of duplex DNA binders are important because these molecules, in many cases, are potential anticancer agents as well as toxins. Triplex DNA binders are also promising drug candidates. These molecules, in conjunction with triplex forming oligonucleotides, could potentially be used to achieve control of gene expression by interfering with transcription factors that bind to DNA. Therefore, the ability to screen for these molecules in a high-throughput fashion could dramatically improve the drug screening process. The assay reported here provides excellent discrimination between strong, intermediate, and weak duplex and triplex DNA binders in a high-throughput fashion. PMID:17614366

Single helically folded aromatic oligoamides that mimic the charge surface of double-stranded B-DNA

NASA Astrophysics Data System (ADS)

Ziach, Krzysztof; Chollet, Céline; Parissi, Vincent; Prabhakaran, Panchami; Marchivie, Mathieu; Corvaglia, Valentina; Bose, Partha Pratim; Laxmi-Reddy, Katta; Godde, Frédéric; Schmitter, Jean-Marie; Chaignepain, Stéphane; Pourquier, Philippe; Huc, Ivan

2018-05-01

Numerous essential biomolecular processes require the recognition of DNA surface features by proteins. Molecules mimicking these features could potentially act as decoys and interfere with pharmacologically or therapeutically relevant protein-DNA interactions. Although naturally occurring DNA-mimicking proteins have been described, synthetic tunable molecules that mimic the charge surface of double-stranded DNA are not known. Here, we report the design, synthesis and structural characterization of aromatic oligoamides that fold into single helical conformations and display a double helical array of negatively charged residues in positions that match the phosphate moieties in B-DNA. These molecules were able to inhibit several enzymes possessing non-sequence-selective DNA-binding properties, including topoisomerase 1 and HIV-1 integrase, presumably through specific foldamer-protein interactions, whereas sequence-selective enzymes were not inhibited. Such modular and synthetically accessible DNA mimics provide a versatile platform to design novel inhibitors of protein-DNA interactions.

Nanomaterials Based on DNA

PubMed Central

Seeman, Nadrian C.

2012-01-01

The combination of synthetic stable branched DNA and sticky ended cohesion has led to the development of structural DNA nanotechnology over the past 30 years. The basis of this enterprise is that it is possible to construct novel DNA-based materials by combining these features in a self-assembly protocol. Thus, simple branched molecules lead directly to the construction of polyhedra whose edges consist of double helical DNA, and whose vertices correspond to the branch points. Stiffer branched motifs can be used to produce self-assembled two-dimensional and three-dimensional periodic lattices of DNA (crystals). DNA has also been used to make a variety of nanomechanical devices, including molecules that change their shapes, and molecules that can walk along a DNA sidewalk. Devices have been incorporated into two-dimensional DNA arrangements; sequence-dependent devices are driven by increases in nucleotide pairing at each step in their machine cycles. PMID:20222824

Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy

PubMed Central

Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.

2016-01-01

There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806

Efficient 'Foton' electric-discharge KrCl laser

DOE Office of Scientific and Technical Information (OSTI.GOV)

Panchenko, Aleksei N; Tarasenko, Viktor F

The design of the 'Foton' electric-discharge laser, optimised for operation on the basis of KrCl* molecules, and its energy parameters were investigated. At {lambda} = 222 nm the radiation energy was up to 250 mJ per pulse. The specific output radiation energy was 2.5 J litre{sup -1} and the laser efficiency was in excess of 0.8%. The possibility of further improvement of the characteristics of electric-discharge KrCl lasers are discussed. (lasers)

Enzymatic DNA molecules

NASA Technical Reports Server (NTRS)

Joyce, Gerald F. (Inventor); Breaker, Ronald R. (Inventor)

1998-01-01

The present invention discloses deoxyribonucleic acid enzymes--catalytic or enzymatic DNA molecules--capable of cleaving nucleic acid sequences or molecules, particularly RNA, in a site-specific manner, as well as compositions including same. Methods of making and using the disclosed enzymes and compositions are also disclosed.

Preparation and self-folding of amphiphilic DNA origami.

PubMed

Zhou, Chao; Wang, Dianming; Dong, Yuanchen; Xin, Ling; Sun, Yawei; Yang, Zhongqiang; Liu, Dongsheng

2015-03-01

Amphiphilic DNA origami is prepared by dressing multiple hydrophobic molecules on a rectangular single layer DNA origami, which is then folded or coupled in sandwich-like structures with two outer DNA origami layer and one inner hydrophobic molecules layer. The preference to form different kinds of structures could be tailored by rational design of DNA origami. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Use of RecA protein to enrich for homologous genes in a genomic library

DOE Office of Scientific and Technical Information (OSTI.GOV)

Taidi-Laskowski, B.; Grumet, F.C.; Tyan, D.

1988-08-25

RecA protein-coated probe has been utilized to enrich genomic digests for desired genes in order to facilitate cloning from genomic libraries. Using a previously cloned HLA-B27 gene as the recA-coated enrichment probe, the authors obtained a mean 108x increase in the ratio of specific to nonspecific plaques in lambda libraries screened for B27 variant alleles of estimated 99% homology to the probe. Class I genes of lesser homology were less enriched. Loss of genomic DNA during the enrichment procedure can, however, restrict application of this technique whenever starting genomic DNA is very limited. Nevertheless, the impressive reduction in cloning effortmore » and material makes recA enrichment a useful new tool for cloning homologous genes from genomic DNA.« less

Observation of B{sup 0}{yields}{lambda}{lambda}K{sup 0} and B{sup 0}{yields}{lambda}{lambda}K*{sup 0} at Belle

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chang, Y.-W.; Wang, M.-Z.; Chao, Y.

2009-03-01

We study the charmless decays B{yields}{lambda}{lambda}h, where h stands for {pi}{sup +}, K{sup +}, K{sup 0},K*{sup +}, or K*{sup 0}, using a 605 fb{sup -1} data sample collected at the {upsilon}(4S) resonance with the Belle detector at the KEKB asymmetric energy e{sup +}e{sup -} collider. We observe B{sup 0}{yields}{lambda}{lambda}K{sup 0} and B{sup 0}{yields}{lambda}{lambda}K*{sup 0} with branching fractions of (4.76{sub -0.68}{sup +0.84}(stat){+-}0.61(syst))x10{sup -6} and (2.46{sub -0.72}{sup +0.87}{+-}0.34)x10{sup -6}, respectively. The significances of these signals in the threshold-mass enhanced mass region, M{sub {lambda}}{sub {lambda}}<2.85 GeV/c{sup 2}, are 12.4{sigma} and 9.3{sigma}, respectively. We also update the branching fraction B(B{sup +}{yields}{lambda}{lambda}K{sup +})=(3.38{sub -0.36}{sup +0.41}{+-}0.41)x10{supmore » -6} with better accuracy, and report the following measurement or 90% confidence level upper limit in the threshold-mass-enhanced region: B(B{sup +}{yields}{lambda}{lambda}K*{sup +})=(2.19{sub -0.88}{sup +1.13}{+-}0.33)x10{sup -6} with 3.7{sigma} significance; B(B{sup +}{yields}{lambda}{lambda}{pi}{sup +})<0.94x10{sup -6}. A related search for B{sup 0}{yields}{lambda}{lambda}D{sup 0} yields a branching fraction B(B{sup 0}{yields}{lambda}{lambda}D{sup 0})=(1.05{sub -0.44}{sup +0.57}{+-}0.14)x10{sup -5}. This may be compared with the large, {approx}10{sup -4}, branching fraction observed for B{sup 0}{yields}ppD{sup 0}. The M{sub {lambda}}{sub {lambda}} enhancements near threshold and related angular distributions for the observed modes are also reported.« less

End labeling procedures: an overview.

PubMed

Hilario, Elena

2004-09-01

There are two ways to label a DNA molecular; by the ends or all along the molecule. End labeling can be performed at the 3'- or 5'-end. Labeling at the 3' end is performed by filling 3'-end recessed ends with a mixture or labeled and unlabeled dNTPs using Klenow or T4 DNA polymerases. Both reactions are template dependent. Terminal deoxynucleotide transferase incorporates dNTPs at the 3' end of any kind of DNA molecule or RNA. Labels incorporated at the 3'-end of the DNA molecule prevent any further extension or ligation to any other molecule, but this can be overcome by labeling the 5'-end of the desired DNA molecule. 5'-end labeling is performed by enzymatic methods (T4 polynucleotide kinase exchange and forward reactions), by chemical modification of sensitized oligonucleotides with phosphoroamidite, or by combined methods. Probe cleanup is recommended when high background problems occur, but caution should be taken not to damage the attached probe with harsh chemicals or by light exposure.

Elongated unique DNA strand deposition on microstructured substrate by receding meniscus assembly and capillary force

PubMed Central

Charlot, B.; Bardin, F.; Sanchez, N.; Roux, P.; Teixeira, S.; Schwob, E.

2014-01-01

Ordered deposition of elongated DNA molecules was achieved by the forced dewetting of a DNA solution droplet over a microstructured substrate. This technique allows trapping, uncoiling, and deposition of DNA fragments without the need of a physicochemical anchoring of the molecule and results in the combing of double stranded DNA from the edge of microwells on a polydimethylsiloxane (PDMS) substrate. The technique involves scanning a droplet of DNA solution caught between a movable blade and a PDMS substrate containing an array of microwells. The deposition and elongation appears when the receding meniscus dewets microwells, the latter acting here as a perturbation in the dewetting line forcing the water film to break locally. Thus, DNA molecules can be deposited in an ordered manner and elongated conformation based solely on a physical phenomenon, allowing uncoiled DNA molecules to be observed in all their length. However, the exact mechanism that governs the deposition of DNA strands is not well understood. This paper is an analysis of the physical phenomenon occurring in the deposition process and is based on observations made with the use of high frame/second rate video microscopy. PMID:24753724

Discriminating Intercalative Effects of Threading Intercalator Nogalamycin, from Classical Intercalator Daunomycin, Using Single Molecule Atomic Force Spectroscopy.

PubMed

Banerjee, T; Banerjee, S; Sett, S; Ghosh, S; Rakshit, T; Mukhopadhyay, R

2016-01-01

DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA-the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA-the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sagan, C.; Salpeter, E.E.

The eddy diffusion coefficient is estimated as a function of altitude, separately for the Jovian troposphere and mesosphere. The growth-rate and motion of particles is estimated for various substances: the water clouds are probably nucleated by NH/sub 4/Cl and sodium compunds are likely to be absent at and above the levels of the water clouds. Complex organic molecules produced by the L..cap alpha.. photolysis of methane may possibly be the absorbers in the lower mesosphere which account for the low reflectivity of Jupiter in the near-ultraviolet. The optical frequency chromophores are localized at or just below the Jovian tropopause. Candidatemore » chromophore molecules must satisfy the condition that they are produced sufficiently rapidly that convective pyrolysis maintains the observed chromophore optical depth. Organic molecules and polymeric sulfur produced through H/sub 2/S photolysis at lambda>2300 A probably fail this test, even if a slow, deep circulation pattern, driven by latent heat, is present. The condition may be satisfied if complex organic chromophores are produced with high quantum yield by NH/sub 3/ photolysis at lambda<2300 A. However, Jovian photoautotrophs in the upper troposphere satisfy this condition well, even with fast circulation, only biochemical properties of comparable terrestrial organisms are assured. Unless buoyancy can be achieved, a hypothetical organism drifts downward and is pyralyzed. An organism in the form of a thin, gas-filled balloon can grow fast enough to replicate if (i) it can survive at the low mesospheric temperatures, or if (ii) photosynthesis occurs in the troposphere. If hypothetical organisms are capable of slow, powered locomotion and coalescence, they can grow large enough to achieve buoyancy. Ecological niches for sinkers, floaters, and hunters appear to exist in the Jovian atmosphere.« less

3D DNA Crystals and Nanotechnology

DOE Office of Scientific and Technical Information (OSTI.GOV)

Paukstelis, Paul; Seeman, Nadrian

DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

3D DNA Crystals and Nanotechnology

DOE PAGES

Paukstelis, Paul; Seeman, Nadrian

2016-08-18

DNA's molecular recognition properties have made it one of the most widely used biomacromolecular construction materials. The programmed assembly of DNA oligonucleotides has been used to create complex 2D and 3D self-assembled architectures and to guide the assembly of other molecules. The origins of DNA nanotechnology are rooted in the goal of assembling DNA molecules into designed periodic arrays, i.e., crystals. Here, we highlight several DNA crystal structures, the progress made in designing DNA crystals, and look at the current prospects and future directions of DNA crystals in nanotechnology.

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules.

PubMed

Li, Yueqi; Xiang, Limin; Palma, Julio L; Asai, Yoshihiro; Tao, Nongjian

2016-04-15

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models.

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules

PubMed Central

Li, Yueqi; Xiang, Limin; Palma, Julio L.; Asai, Yoshihiro; Tao, Nongjian

2016-01-01

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models. PMID:27079152

Recycling of protein subunits during DNA translocation and cleavage by Type I restriction-modification enzymes

PubMed Central

Simons, Michelle; Szczelkun, Mark D.

2011-01-01

The Type I restriction-modification enzymes comprise three protein subunits; HsdS and HsdM that form a methyltransferase (MTase) and HsdR that associates with the MTase and catalyses Adenosine-5′-triphosphate (ATP)-dependent DNA translocation and cleavage. Here, we examine whether the MTase and HsdR components can ‘turnover’ in vitro, i.e. whether they can catalyse translocation and cleavage events on one DNA molecule, dissociate and then re-bind a second DNA molecule. Translocation termination by both EcoKI and EcoR124I leads to HsdR dissociation from linear DNA but not from circular DNA. Following DNA cleavage, the HsdR subunits appear unable to dissociate even though the DNA is linear, suggesting a tight interaction with the cleaved product. The MTases of EcoKI and EcoAI can dissociate from DNA following either translocation or cleavage and can initiate reactions on new DNA molecules as long as free HsdR molecules are available. In contrast, the MTase of EcoR124I does not turnover and additional cleavage of circular DNA is not observed by inclusion of RecBCD, a helicase–nuclease that degrades the linear DNA product resulting from Type I cleavage. Roles for Type I restriction endonuclease subunit dynamics in restriction alleviation in the cell are discussed. PMID:21712244

Multiplexed Sequence Encoding: A Framework for DNA Communication.

PubMed

Zakeri, Bijan; Carr, Peter A; Lu, Timothy K

2016-01-01

Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication-data encoding, data transfer & data extraction-and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system-Multiplexed Sequence Encoding (MuSE)-that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA.

Development of a simulation method for dynamics of electrons ejected from DNA molecules irradiated with X-rays.

PubMed

Kai, Takeshi; Higuchi, Mariko; Fujii, Kentaro; Watanabe, Ritsuko; Yokoya, Akinari

2012-12-01

To develop a method for simulating the dynamics of the photoelectrons and Auger electrons ejected from DNA molecules irradiated with pulsed monochromatic X-rays. A 30-base-pair (bp) DNA molecule was used as the target model, and the X-rays were assumed to have a Gaussian-shaped time distribution. Photoionization and Auger decay were considered as the atomic processes. The atoms from which the photoelectrons or Auger electrons were emitted were specified in the DNA molecule (or DNA ion) using the Monte Carlo method, and the trajectory of each electron in the electric field formed around the positively charged DNA molecule was calculated with a Newtonian equation. The kinetics of the electrons produced by irradiation with X-rays at an intensity ranging from 1 × 10(12) to 1 × 10(16) photons/mm(2) and energies of 380 eV (below the carbon K-edge), 435 eV (above the nitrogen K-edge), and 560 eV (above the oxygen K-edge) were evaluated. It was found that at an X-ray intensity of 1 × 10(14) photons/mm(2) or less, all the produced electrons escaped from the target. However, above an X-ray intensity of 1 × 10(15) photons/mm(2) and an energy of 560 eV, some photoelectrons that were ejected from the oxygen atoms were trapped near the target DNA. A simulation method for studying the trajectories of electrons ejected from a 30-bp DNA molecule irradiated with pulsed monochromatic X-rays has been developed. The present results show that electron dynamics are strongly dependent on the charged density induced in DNA by pulsed X-ray irradiation.

Biophysics of protein-DNA interactions and chromosome organization

PubMed Central

Marko, John F.

2014-01-01

The function of DNA in cells depends on its interactions with protein molecules, which recognize and act on base sequence patterns along the double helix. These notes aim to introduce basic polymer physics of DNA molecules, biophysics of protein-DNA interactions and their study in single-DNA experiments, and some aspects of large-scale chromosome structure. Mechanisms for control of chromosome topology will also be discussed. PMID:25419039

Supercoiled circular DNA of an insect granulosis virus

PubMed Central

Tweeten, Kathleen A.; Bulla, Lee A.; Consigli, Richard A.

1977-01-01

The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of 3H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 × 106 by sedimentation in neutral sucrose and 78 × 106 by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 × 106. The buoyant density of the granulosis virus DNA was 1.703 g/cm3 and that of its insect host DNA was 1.697 g/cm3. Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively. Images PMID:198791

Supercoiled circular DNA of an insect granulosis virus.

PubMed

Tweeten, K A; Bulla, L A; Consigli, R A

1977-08-01

The DNA of the granulosis virus of the Indian meal moth, Plodia interpunctella, was characterized by physical chemical and electron microscopic techniques. Twenty-five percent of the DNA extracted from purified virus was isolated as supercoiled circular molecules. The remaining 75% consisted of relaxed circular molecules. These molecular forms were indicated by the production of two radioactive bands during sedimentation of (3)H-labeled granulosis virus DNA in alkaline sucrose gradients or in equilibrium density gradients of neutral cesium chloride/propidium iodide. Electron microscopic visualization of the DNA that banded at the higher density in the latter gradients revealed supercoiled structures whereas that of DNA that banded at the lower density demonstrated relaxed circular molecules. The superhelical molecules were converted to relaxed circles by treatment with pancreatic DNase. The molecular weight of the viral DNA was calculated to be 81 x 10(6) by sedimentation in neutral sucrose and 78 x 10(6) by sedimentation in alkaline sucrose. The molecular weight estimated from length measurements in electron micrographs was 76 x 10(6). The buoyant density of the granulosis virus DNA was 1.703 g/cm(3) and that of its insect host DNA was 1.697 g/cm(3). Equilibrium sedimentation in cesium chloride and thermal denaturation indicated G + C contents of 44% and 39% for the viral and host DNA, respectively.

Mitochondrial genome of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa): A linear DNA molecule encoding a putative DNA-dependent DNA polymerase.

PubMed

Shao, Zhiyong; Graf, Shannon; Chaga, Oleg Y; Lavrov, Dennis V

2006-10-15

The 16,937-nuceotide sequence of the linear mitochondrial DNA (mt-DNA) molecule of the moon jelly Aurelia aurita (Cnidaria, Scyphozoa) - the first mtDNA sequence from the class Scypozoa and the first sequence of a linear mtDNA from Metazoa - has been determined. This sequence contains genes for 13 energy pathway proteins, small and large subunit rRNAs, and methionine and tryptophan tRNAs. In addition, two open reading frames of 324 and 969 base pairs in length have been found. The deduced amino-acid sequence of one of them, ORF969, displays extensive sequence similarity with the polymerase [but not the exonuclease] domain of family B DNA polymerases, and this ORF has been tentatively identified as dnab. This is the first report of dnab in animal mtDNA. The genes in A. aurita mtDNA are arranged in two clusters with opposite transcriptional polarities; transcription proceeding toward the ends of the molecule. The determined sequences at the ends of the molecule are nearly identical but inverted and lack any obvious potential secondary structures or telomere-like repeat elements. The acquisition of mitochondrial genomic data for the second class of Cnidaria allows us to reconstruct characteristic features of mitochondrial evolution in this animal phylum.

Assembling of G-strands into novel tetra-molecular parallel G4-DNA nanostructures using avidin-biotin recognition.

PubMed

Borovok, Natalia; Iram, Natalie; Zikich, Dragoslav; Ghabboun, Jamal; Livshits, Gideon I; Porath, Danny; Kotlyar, Alexander B

2008-09-01

We describe a method for the preparation of novel long (hundreds of nanometers), uniform, inter-molecular G4-DNA molecules composed of four parallel G-strands. The only long continuous G4-DNA reported so far are intra-molecular structures made of a single G-strand. To enable a tetra-molecular assembly of the G-strands we developed a novel approach based on avidin-biotin biological recognition. The steps of the G4-DNA production include: (i) Enzymatic synthesis of long poly(dG)-poly(dC) molecules with biotinylated poly(dG)-strand; (ii) Formation of a complex between avidin-tetramer and four biotinylated poly(dG)-poly(dC) molecules; (iii) Separation of the poly(dC) strands from the poly(dG)-strands, which are connected to the avidin; (iv) Assembly of the four G-strands attached to the avidin into tetra-molecular G4-DNA. The average contour length of the formed structures, as measured by AFM, is equal to that of the initial poly(dG)-poly(dC) molecules, suggesting a tetra-molecular mechanism of the G-strands assembly. The height of tetra-molecular G4-nanostructures is larger than that of mono-molecular G4-DNA molecules having similar contour length. The CD spectra of the tetra- and mono-molecular G4-DNA are markedly different, suggesting different structural organization of these two types of molecules. The tetra-molecular G4-DNA nanostructures showed clear electrical polarizability. This suggests that they may be useful for molecular electronics.

DNA nanotechnology-enabled biosensors.

PubMed

Chao, Jie; Zhu, Dan; Zhang, Yinan; Wang, Lianhui; Fan, Chunhai

2016-02-15

Biosensors employ biological molecules to recognize the target and utilize output elements which can translate the biorecognition event into electrical, optical or mass-sensitive signals to determine the quantities of the target. DNA-based biosensors, as a sub-field to biosensor, utilize DNA strands with short oligonucleotides as probes for target recognition. Although DNA-based biosensors have offered a promising alternative for fast, simple and cheap detection of target molecules, there still exist key challenges including poor stability and reproducibility that hinder their competition with the current gold standard for DNA assays. By exploiting the self-recognition properties of DNA molecules, researchers have dedicated to make versatile DNA nanostructures in a highly rigid, controllable and functionalized manner, which offers unprecedented opportunities for developing DNA-based biosensors. In this review, we will briefly introduce the recent advances on design and fabrication of static and dynamic DNA nanostructures, and summarize their applications for fabrication and functionalization of DNA-based biosensors. Copyright © 2015 Elsevier B.V. All rights reserved.

Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

NASA Astrophysics Data System (ADS)

Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

DNA Motion Capture Reveals the Mechanical Properties of DNA at the Mesoscale

PubMed Central

Price, Allen C.; Pilkiewicz, Kevin R.; Graham, Thomas G.W.; Song, Dan; Eaves, Joel D.; Loparo, Joseph J.

2015-01-01

Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. PMID:25992731

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

PubMed Central

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

On pulse duration of self-terminating lasers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bokhan, P A

2011-02-28

The problem of the maximum pulse duration {tau}{sub max} of self-terminating lasers is considered. It is shown that the duration depends on the transition probability in the laser channel, on the decay rate of the resonant state in all other channels, and on the excitation rate of the metastable state. As a result, {tau}{sub max} is found to be significantly shorter than previously estimated. The criteria for converting the 'self-terminating' lasing to quasi-cw lasing are determined. It is shown that in the case of nonselective depopulation of the metastable state, for example in capillary lasers or in a fast flowmore » of the active medium gas, it is impossible to obtain continuous lasing. Some concrete examples are considered. It is established that in several studies of barium vapour lasers ({lambda} = 1.5 {mu}m) and nitrogen lasers ({lambda} = 337 nm), collisional lasing is obtained by increasing the relaxation rate of the metastable state in collisions with working particles (barium atoms and nitrogen molecules). (lasers)« less

Structure and Environment Influence in DNA Conduction

NASA Technical Reports Server (NTRS)

Adessi, C.; Walch, S.; Anantram, M. P.; Biegel, Bryan A. (Technical Monitor)

2002-01-01

Results for transmission through a poly(G) DNA molecule are presented. We show that a modification of the rise of a B-DNA form can induce a shift of the conduction channel toward the valence one. We clearly prove that deformation of the backbone of the molecule has a significant influence on hole transport. Finally, we observe that the presence of ionic species, such Na, near the molecule can create new conduction channels.

DNA interactions with a Methylene Blue redox indicator depend on the DNA length and are sequence specific.

PubMed

Farjami, Elaheh; Clima, Lilia; Gothelf, Kurt V; Ferapontova, Elena E

2010-06-01

A DNA molecular beacon approach was used for the analysis of interactions between DNA and Methylene Blue (MB) as a redox indicator of a hybridization event. DNA hairpin structures of different length and guanine (G) content were immobilized onto gold electrodes in their folded states through the alkanethiol linker at the 5'-end. Binding of MB to the folded hairpin DNA was electrochemically studied and compared with binding to the duplex structure formed by hybridization of the hairpin DNA to a complementary DNA strand. Variation of the electrochemical signal from the DNA-MB complex was shown to depend primarily on the DNA length and sequence used: the G-C base pairs were the preferential sites of MB binding in the duplex. For short 20 nts long DNA sequences, the increased electrochemical response from MB bound to the duplex structure was consistent with the increased amount of bound and electrochemically readable MB molecules (i.e. MB molecules that are available for the electron transfer (ET) reaction with the electrode). With longer DNA sequences, the balance between the amounts of the electrochemically readable MB molecules bound to the hairpin DNA and to the hybrid was opposite: a part of the MB molecules bound to the long-sequence DNA duplex seem to be electrochemically mute due to long ET distance. The increasing electrochemical response from MB bound to the short-length DNA hybrid contrasts with the decreasing signal from MB bound to the long-length DNA hybrid and allows an "off"-"on" genosensor development.

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2010 CFR

2010-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2010 CFR

2010-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2011 CFR

2011-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2011 CFR

2011-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2013 CFR

2013-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2012 CFR

2012-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2012 CFR

2012-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 602.10 - Additional requirements.

Code of Federal Regulations, 2014 CFR

2014-01-01

... conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2013 CFR

2013-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

10 CFR 605.11 - Additional requirements.

Code of Federal Regulations, 2014 CFR

2014-01-01

... Conditions of an award. (b) A recipient performing research involving recombinant DNA molecules and/or organisms and viruses containing recombinant DNA molecules shall comply with the National Institutes of Health “Guidelines for Research Involving Recombinant DNA Molecules” (51 FR 16958, May 7, 1986), or such...

Imaging and sizing of single DNA molecules on a mobile phone.

PubMed

Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

2014-12-23

DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.

Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

PubMed

Paximadis, M; Rey, M E

2001-12-01

The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

Tables of Transition Probabilities and Branching Ratios for Electric Dipole Transitions Between Arbitrary Levels of Hydrogen-Like Atoms

NASA Technical Reports Server (NTRS)

Omidvar, K.

1980-01-01

Branching ratios in hydrogen-like atoms due to electric-dipole transitions are tabulated for the initial principal and angular momentum quantum number n, lambda, and final principal and angular momentum quantum numbers n, lambda. In table 1, transition probabilities are given for transitions n, lambda, yields n, where sums have been made with respect to lambda. In this table, 2 or = n' or = 10, o or = lambda' or = n'-1, and 1 or = n or = n'-1. In addition, averages with respect to lambda' and sums with respect to n, and lifetimes are given. In table 2, branching ratios are given for transitions n' lambda' yields ni, where sums have been made with respect to lambda. In these tables, 2 or = n' or = 10, 0 or = lambda', n'-1, and 1 or = n or = n'-1. Averages with respect to lambda' are also given. In table 3, branching ratios are given for transitions n' lambda' yields in lambda, where 1 or = n or = 5, 0 or = lambda or = n-1, n n' or = 15, and 0 or = lambda' or = n(s), where n(s), is the smaller of the two numbers n'-1 and 6. Averages with respect to lambda' are given.

Measurement of the Λ b cross section and the Λ ¯ b to Λ b ratio with J / ψ Λ decays in pp collisions at s = 7 TeV

DOE PAGES

Chatrchyan, S.; Khachatryan, V.; Sirunyan, A. M.; ...

2012-05-31

The Lambda(b) differential production cross section and the cross section ratio anti-Lambda(b)/Lambda(b) are measured as functions of transverse momentum pt(Lambda(b)) and rapidity abs(y(Lambda(b))) in pp collisions at sqrt(s) = 7 TeV using data collected by the CMS experiment at the LHC. The measurements are based on Lambda(b) decays reconstructed in the exclusive final state J/Psi Lambda, with the subsequent decays J/Psi to an opposite-sign muon pair and Lambda to proton pion, using a data sample corresponding to an integrated luminosity of 1.9 inverse femtobarns. The product of the cross section times the branching ratio for Lambda(b) to J/Psi Lambda versusmore » pt(Lambda(b)) falls faster than that of b mesons. The measured value of the cross section times the branching ratio for pt(Lambda(b)) > 10 GeV and abs(y(Lambda(b))) < 2.0 is 1.06 +/- 0.06 +/- 0.12 nb, and the integrated cross section ratio for anti-Lambda(b)/Lambda(b) is 1.02 +/- 0.07 +/- 0.09, where the uncertainties are statistical and systematic, respectively.« less

{lambda}{sub b}{yields}p, {lambda} transition form factors from QCD light-cone sum rules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wang Yuming; Lue Caidian; Shen Yuelong

2009-10-01

Light-cone sum rules for the {lambda}{sub b}{yields}p, {lambda} transition form factors are derived from the correlation functions expanded by the twist of the distribution amplitudes of the {lambda}{sub b} baryon. In terms of the {lambda}{sub b} three-quark distribution amplitude models constrained by the QCD theory, we calculate the form factors at small momentum transfers and compare the results with those estimated in the conventional light-cone sum rules (LCSR) and perturbative QCD approaches. Our results indicate that the two different versions of sum rules can lead to the consistent numbers of form factors responsible for {lambda}{sub b}{yields}p transition. The {lambda}{sub b}{yields}{lambda}more » transition form factors from LCSR with the asymptotic {lambda} baryon distribution amplitudes are found to be almost 1 order larger than those obtained in the {lambda}{sub b}-baryon LCSR, implying that the preasymptotic corrections to the baryonic distribution amplitudes are of great importance. Moreover, the SU(3) symmetry breaking effects between the form factors f{sub 1}{sup {lambda}{sub b}}{sup {yields}}{sup p} and f{sub 1}{sup {lambda}{sub b}}{sup {yields}}{sup {lambda}} are computed as 28{sub -8}{sup +14}% in the framework of {lambda}{sub b}-baryon LCSR.« less

Simple horizontal magnetic tweezers for micromanipulation of single DNA molecules and DNA–protein complexes

PubMed Central

McAndrew, Christopher P.; Tyson, Christopher; Zischkau, Joseph; Mehl, Patrick; Tuma, Pamela L.; Pegg, Ian L.; Sarkar, Abhijit

2016-01-01

We report the development of a simple-to-implement magnetic force transducer that can apply a wide range of piconewton (pN) scale forces on single DNA molecules and DNA–protein complexes in the horizontal plane. The resulting low-noise force-extension data enable very high-resolution detection of changes in the DNA tether’s extension: ~0.05 pN in force and <10 nm change in extension. We have also verified that we can manipulate DNA in near equilibrium conditions through the wide range of forces by ramping the force from low to high and back again, and observing minimal hysteresis in the molecule’s force response. Using a calibration technique based on Stokes’ drag law, we have confirmed our force measurements from DNA force-extension experiments obtained using the fluctuation-dissipation theorem applied to transverse fluctuations of the magnetic microsphere. We present data on the force-distance characteristics of a DNA molecule complexed with histones. The results illustrate how the tweezers can be used to study DNA binding proteins at the single molecule level. PMID:26757808

MobB protein stimulates nicking at the R1162 origin of transfer by increasing the proportion of complexed plasmid DNA.

PubMed Central

Perwez, T; Meyer, R

1996-01-01

An essential early step in conjugal mobilization of R1162, nicking of the DNA strand that is subsequently transferred, is carried out in the relaxosome, a complex of two plasmid-encoded proteins and DNA at the origin of transfer (oriT). A third protein, MobB, is also required for efficient mobilization. We show that in the cell this protein increases the proportion of molecules specifically nicked at oriT, resulting in lower yields of covalently closed molecules after alkaline extraction. These nicked molecules largely remain supercoiled, with unwinding presumably constrained by the relaxosome. MobB enhances the sensitivity of the oriT DNA to oxidation by permanganate, indicating that the protein acts by increasing the fraction of complexed molecules. Mutations that significantly reduce the amount of complexed DNA in the cell were isolated. However, plasmids with these mutations were mobilized at nearly the normal frequency, were nicked at a commensurate level, and still required MobB. Our results indicate that the frequency of transfer is determined both by the amount of time each molecule is in the nicked form and by the proportion of complexed molecules in the total population. PMID:8824623

Chemical and Molecular Biological Aspects of Alkylhydrazine-Induced Carcinogenesis in Human Cells in Vitro. Revised

DTIC Science & Technology

1984-04-01

weights using the following phage DNA markers : lambda, T2 and T7. The number of alkaline labile sites (breaks due to apurinic sites and phosphotriesters...exhibit cell invasiveness in chick embryo skin, human malignancy specific cell- surface antigenic determinants (19), and produce tumors in pre...they eluted from the column, were identified by co-chromatographed markers , (Chart 2). When randomly proliferating cells were treated with either 1,1-DMH

First observation and measurement of the resonant structure of the lambda_b->lambda_c pi-pi+pi- decay mode

DOE Office of Scientific and Technical Information (OSTI.GOV)

Azzurri, P.; Barria, P.; Ciocci, M.A.

The authors present the first observation of the {Lambda}{sub b}{sup 0} {yields} {Lambda}{sub c}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -} decay using data from an integrated luminosity of approximately 2.4 fb{sup -1} of p{bar p} collisions at {radical}s = 1.96 TeV, collected with the CDF II detector at the Fermilab Tevatron. They also present the first observation of the resonant decays {Lambda}{sub b}{sup 0} {yields} {Sigma}{sub c}(2455){sup 0} {pi}{sup +}{pi}{sup -} {yields} {Lambda}{sub c}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -}, {Lambda}{sub b}{sup 0} {yields} {Sigma}{sub c}(2455){sup ++}{pi}{sup -}{pi}{sup -} {yields} {Lambda}{sub c}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -}, {Lambda}{sub b}{sup 0} {yields} {Lambda}{sub c}(2595){sup +}{pi}{sup -}more » {yields} {Lambda}{sub c}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -} and {Lambda}{sub b}{sup 0} {yields} {Lambda}{sub c}(2625){sup +}{pi}{sup -} {yields} {Lambda}{sub c}{sup +}{pi}{sup -}{pi}{sup +}{pi}{sup -}, and measure their relative branching ratios.« less

Spin correlations in the {Lambda}{Lambda} and {Lambda}{Lambda}-bar systems generated in relativistic heavy-ion collisions

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lyuboshitz, V. L.; Lyuboshitz, V. V., E-mail: Valery.Lyuboshitz@jinr.r

2010-05-15

Spin correlations for the {Lambda}{Lambda} and {Lambda}{Lambda}-bar pairs, generated in relativistic heavy-ion collisions, and related angular correlations at the joint registration of hadronic decays of two hyperons, in which space parity is not conserved, are analyzed. The correlation tensor components can be derived from the double angular distribution of products of two decays by the method of 'moments'. The properties of the 'trace' of the correlation tensor (a sum of three diagonal components), determining the relative fractions of the triplet states and singlet state of respective pairs, are discussed. Spin correlations for two identical particles ({Lambda}{Lambda}) and two nonidentical particlesmore » ({Lambda}{Lambda}-bar) are considered from the viewpoint of the conventional model of one-particle sources. In the framework of this model, correlations vanish at sufficiently large relative momenta. However, under these conditions, in the case of two nonidentical particles ({Lambda}{Lambda}-bar) a noticeable role is played by two-particle annihilation (two-quark, two-gluon) sources, which lead to the difference of the correlation tensor from zero. In particular, such a situation may arise when the system passes through the 'mixed phase.'« less

Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

PubMed

Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

2018-03-05

Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Microfluidic DNA sample preparation method and device

DOEpatents

Krulevitch, Peter A.; Miles, Robin R.; Wang, Xiao-Bo; Mariella, Raymond P.; Gascoyne, Peter R. C.; Balch, Joseph W.

2002-01-01

Manipulation of DNA molecules in solution has become an essential aspect of genetic analyses used for biomedical assays, the identification of hazardous bacterial agents, and in decoding the human genome. Currently, most of the steps involved in preparing a DNA sample for analysis are performed manually and are time, labor, and equipment intensive. These steps include extraction of the DNA from spores or cells, separation of the DNA from other particles and molecules in the solution (e.g. dust, smoke, cell/spore debris, and proteins), and separation of the DNA itself into strands of specific lengths. Dielectrophoresis (DEP), a phenomenon whereby polarizable particles move in response to a gradient in electric field, can be used to manipulate and separate DNA in an automated fashion, considerably reducing the time and expense involved in DNA analyses, as well as allowing for the miniaturization of DNA analysis instruments. These applications include direct transport of DNA, trapping of DNA to allow for its separation from other particles or molecules in the solution, and the separation of DNA into strands of varying lengths.

Exploring protein-DNA interactions in 3D using in situ construction, manipulation, and visualization of individual DNA-dumbbells with optical traps, microfluidics, and fluorescence microscopy

PubMed Central

Forget, Anthony L.; Dombrowski, Christopher C.; Amitani, Ichiro; Kowalczykowski, Stephen C.

2015-01-01

In this Protocol, we describe a procedure to generate ‘DNA-dumbbells’ — single molecules of DNA with a microscopic bead attached at each end — and techniques for manipulating individual DNA-dumbbells. We also detail the design and fabrication of a microfluidic device (flow cell) used in conjunction with dual optical trapping to manipulate DNA-dumbbells and to visualize individual protein–DNA complexes by single-molecule epifluorescence microscopy. Our design of the flow cell enables the rapid movement of trapped molecules between laminar flow channels and a flow-free ‘reservoir’. The reservoir provides the means to examine formation of DNA–protein complexes in solution in the absence of external flow forces, while still maintaining a predetermined end-to-end extension of the DNA. These features facilitate examination of the role of three-dimensional DNA conformation and dynamics in protein–DNA interactions. Preparation of flow cells and reagents requires two days each; in situ DNA-dumbbell assembly and imaging of single protein–DNA complexes requires another day. PMID:23411634

End-to-end distance and contour length distribution functions of DNA helices

NASA Astrophysics Data System (ADS)

Zoli, Marco

2018-06-01

I present a computational method to evaluate the end-to-end and the contour length distribution functions of short DNA molecules described by a mesoscopic Hamiltonian. The method generates a large statistical ensemble of possible configurations for each dimer in the sequence, selects the global equilibrium twist conformation for the molecule, and determines the average base pair distances along the molecule backbone. Integrating over the base pair radial and angular fluctuations, I derive the room temperature distribution functions as a function of the sequence length. The obtained values for the most probable end-to-end distance and contour length distance, providing a measure of the global molecule size, are used to examine the DNA flexibility at short length scales. It is found that, also in molecules with less than ˜60 base pairs, coiled configurations maintain a large statistical weight and, consistently, the persistence lengths may be much smaller than in kilo-base DNA.

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

NASA Astrophysics Data System (ADS)

Zhang, Yuning; Reisner, Walter

2013-03-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

A 3D-DNA Molecule Made of PlayMais

ERIC Educational Resources Information Center

Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

2015-01-01

More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Building block synthesis using the polymerase chain assembly method.

PubMed

Marchand, Julie A; Peccoud, Jean

2012-01-01

De novo gene synthesis allows the creation of custom DNA molecules without the typical constraints of traditional cloning assembly: scars, restriction site incompatibility, and the quest to find all the desired parts to name a few. Moreover, with the help of computer-assisted design, the perfect DNA molecule can be created along with its matching sequence ready to download. The challenge is to build the physical DNA molecules that have been designed with the software. Although there are several DNA assembly methods, this section presents and describes a method using the polymerase chain assembly (PCA).

SINGLE STRAND-CONTAINING REPLICATING MOLECULES OF CIRCULAR MITOCHONDRIAL DNA

PubMed Central

Wolstenholme, David R.; Koike, Katsuro; Cochran-Fouts, Patricia

1973-01-01

Mitochondrial DNAs (mtDNAs) from Chang rat solid hepatomas and Novikoff rat ascites hepatomas were examined in the electron microscope after preparation by the aqueous and by the formamide protein monolayer techniques. MtDNAs from both tumors were found to include double-forked circular molecules with a form and size suggesting they were replicative intermediates. These molecules were of two classes. In molecules of one class, all three segments were apparently totally double stranded. Molecules of the second class were distinguished by the fact that one of the segments spanning the region between the forks in which replication had occurred (the daughter segments) was either totally single stranded, or contained a single-stranded region associated with one of the forks. Daughter segments of both totally double-stranded and single strand-containing replicating molecules varied in length from about 3 to about 80% of the circular contour length of the molecule. Similar classes of replicating molecules were found in mtDNA from regenerating rat liver and chick embryos, indicating them to be normal intermediates in the replication of mtDNA All of the mtDNAs examined included partially single-stranded simple (nonforked) circular molecules. A possible scheme for the replication of mtDNA is presented, based on the different molecular forms observed PMID:4345165

UTILIZING SYNTHETIC UV SPECTRA TO EXPLORE THE PHYSICAL BASIS FOR THE CLASSIFICATION OF LAMBDA BOÖTIS STARS

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cheng, Kwang-Ping; Johnson, Dustin M.; Tarbell, Erik S.

2016-04-15

Lambda Boo-type stars are a group of late B to early F-type Population I dwarfs that show mild to extreme deficiencies of iron-peak elements (up to 2 dex), but their C, N, O, and S abundances are near solar. This intriguing stellar class has recently regained the spotlight because of the directly imaged planets around a confirmed Lambda Boo star, HR 8799, and a suggested Lambda Boo star, Beta Pictoris. The discovery of a giant asteroid belt around Vega, another possible Lambda Boo star, also suggests hidden planets. The possible link between Lambda Boo stars and planet-bearing stars motivates usmore » to study Lambda Boo stars systematically. Since the peculiar nature of the prototype Lambda Boötis was first noticed in 1943, Lambda Boo candidates published in the literature have been selected using widely different criteria. In order to determine the origin of Lambda Boo stars’ unique abundance pattern and to better discriminate between theories explaining the Lambda Boo phenomenon, a consistent working definition of Lambda Boo stars is needed. We have re-evaluated all published Lambda Boo candidates and their available ultraviolet and visible spectra. In this paper, using observed and synthetic spectra, we explore the physical basis for the classification of Lambda Boo stars, and develop quantitative criteria that discriminate metal-poor stars from bona fide Lambda Boo stars. Based on these stricter Lambda Boo classification criteria, we conclude that neither Beta Pictoris nor Vega should be classified as Lambda Boo stars.« less

Localization microscopy of DNA in situ using Vybrant{sup ®} DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution

DOE Office of Scientific and Technical Information (OSTI.GOV)

Żurek-Biesiada, Dominika; Szczurek, Aleksander T.; Prakash, Kirti

Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant{sup ®} DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei ofmore » fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10{sup 6} signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100 nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. - Highlights: • Super-resolution imaging of nuclear DNA with Vybrant Violet and blue excitation. • 90nm resolution images of DNA structures in optically thick eukaryotic nuclei. • Enhanced resolution confirms the existence of DNA-free regions inside the nucleus. • Optimized imaging conditions enable multicolor super-resolution imaging.« less

Immobilization of proteins onto microbeads using a DNA binding tag for enzymatic assays.

PubMed

Kojima, Takaaki; Mizoguchi, Takuro; Ota, Eri; Hata, Jumpei; Homma, Keisuke; Zhu, Bo; Hitomi, Kiyotaka; Nakano, Hideo

2016-02-01

A novel DNA-binding protein tag, scCro-tag, which is a single-chain derivative of the bacteriophage lambda Cro repressor, has been developed to immobilize proteins of interest (POI) on a solid support through binding OR consensus DNA (ORC) that is tightly bound by the scCro protein. The scCro-tag successfully bound a transglutaminase 2 (TGase 2) substrate and manganese peroxidase (MnP) to microbeads via scaffolding DNA. The resulting protein-coated microbeads can be utilized for functional analysis of the enzymatic activity using flow cytometry. The quantity of bead-bound proteins can be enhanced by increasing the number of ORCs. In addition, proteins with the scCro-tag that were synthesized using a cell-free protein synthesis system were also immobilized onto the beads, thus indicating that this bead-based system would be applicable to high-throughput analysis of various enzymatic activities. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

NASA Technical Reports Server (NTRS)

Vercoutere, Wenonah; DeGuzman, Veronica

2003-01-01

The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

Replication of each copy of the yeast 2 micron DNA plasmid occurs during the S phase.

PubMed

Zakian, V A; Brewer, B J; Fangman, W L

1979-08-01

Saccharomyces cerevisiae contains 50-100 copies per cell of a circular plasmid called 2 micron DNA. Replication of this DNA was studied in two ways. The distribution of replication events among 2 micron DNA molecules was examined by density transfer experiments with asynchronous cultures. The data show that 2 micron DNA replication is similar to chromosomal DNA replication: essentially all 2 micron duplexes were of hybrid density at one cell doubling after the density transfer, with the majority having one fully dense strand and one fully light strand. The results show that replication of 2 micron DNA occurs by a semiconservative mechanism where each of the plasmid molecules replicates once each cell cycle. 2 micron DNA is the only known example of a multiple-copy, extrachromosomal DNA in which every molecule replicates in each cell cycle. Quantitative analysis of the data indicates that 2 micron DNA replication is limited to a fraction of the cell cycle. The period in the cell cycle when 2 micron DNA replicates was examined directly with synchronous cell cultures. Synchronization was accomplished by sequentially arresting cells in G1 phase using the yeast pheromone alpha-factor and incubating at the restrictive temperature for a cell cycle (cdc 7) mutant. Replication was monitored by adding 3H-uracil to cells previously labeled with 14C-uracil, and determining the 3H/14C ratio for purified DNA species. 2 micron DNA replication did not occur during the G1 arrest periods. However, the population of 2 micron DNA doubled during the synchronous S phase at the permissive temperature, with most of the replication occurring in the first third of S phase. Our results indicate that a mechanism exists which insures that the origin of replication of each 2 micron DNA molecule is activated each S phase. As with chromosomal DNA, further activation is prevented until the next cell cycle. We propose that the mechanism which controls the replication initiation of each 2 micron DNA molecule is identical to that which controls the initiation of chromosomal DNA.

Bivariate- distribution for transition matrix elements in Breit-Wigner to Gaussian domains of interacting particle systems.

PubMed

Kota, V K B; Chavda, N D; Sahu, R

2006-04-01

Interacting many-particle systems with a mean-field one-body part plus a chaos generating random two-body interaction having strength lambda exhibit Poisson to Gaussian orthogonal ensemble and Breit-Wigner (BW) to Gaussian transitions in level fluctuations and strength functions with transition points marked by lambda = lambda c and lambda = lambda F, respectively; lambda F > lambda c. For these systems a theory for the matrix elements of one-body transition operators is available, as valid in the Gaussian domain, with lambda > lambda F, in terms of orbital occupation numbers, level densities, and an integral involving a bivariate Gaussian in the initial and final energies. Here we show that, using a bivariate-t distribution, the theory extends below from the Gaussian regime to the BW regime up to lambda = lambda c. This is well tested in numerical calculations for 6 spinless fermions in 12 single-particle states.

Sequential addition of short DNA oligos in DNA-polymerase-based synthesis reactions

DOEpatents

Gardner, Shea N [San Leandro, CA; Mariella, Jr., Raymond P.; Christian, Allen T [Tracy, CA; Young, Jennifer A [Berkeley, CA; Clague, David S [Livermore, CA

2011-01-18

A method of fabricating a DNA molecule of user-defined sequence. The method comprises the steps of preselecting a multiplicity of DNA sequence segments that will comprise the DNA molecule of user-defined sequence, separating the DNA sequence segments temporally, and combining the multiplicity of DNA sequence segments with at least one polymerase enzyme wherein the multiplicity of DNA sequence segments join to produce the DNA molecule of user-defined sequence. Sequence segments may be of length n, where n is an even or odd integer. In one embodiment the length of desired hybridizing overlap is specified by the user and the sequences and the protocol for combining them are guided by computational (bioinformatics) predictions. In one embodiment sequence segments are combined from multiple reading frames to span the same region of a sequence, so that multiple desired hybridizations may occur with different overlap lengths. In one embodiment starting sequence fragments are of different lengths, n, n+1, n+2, etc.

Prominent mitochondrial DNA recombination intermediates in human heart muscle.

PubMed

Kajander, O A; Karhunen, P J; Holt, I J; Jacobs, H T

2001-11-01

Recombination intermediates containing four-way (Holliday) junctions are generated during DNA repair and replication in many systems, including yeast mitochondrial DNA (mtDNA). In contrast, convincing evidence for recombination in mammalian mtDNA is lacking. We have used two-dimensional agarose-gel electrophoresis to analyse non-linear forms of mtDNA in human heart muscle. Replication intermediates from both the coupled and strand-asynchronous mtDNA replication pathways were detected. An additional class of non-linear molecules, with the electrophoretic properties of four-way junctions, was also prominent. These molecules were insensitive to topoisomerase I or RNase H, but were diminished by branch migration or RuvC treatment. Junctional molecules were detected in all regions of the mitochondrial genome, were found in myocardial DNA from young and old adults, but were present at lower levels in skeletal muscle and placenta. We suggest that they could represent intermediates of mtDNA repair, given their prevalence in the oxyradical-rich environment of heart muscle mitochondria.

Secondary structure prediction and structure-specific sequence analysis of single-stranded DNA.

PubMed

Dong, F; Allawi, H T; Anderson, T; Neri, B P; Lyamichev, V I

2001-08-01

DNA sequence analysis by oligonucleotide binding is often affected by interference with the secondary structure of the target DNA. Here we describe an approach that improves DNA secondary structure prediction by combining enzymatic probing of DNA by structure-specific 5'-nucleases with an energy minimization algorithm that utilizes the 5'-nuclease cleavage sites as constraints. The method can identify structural differences between two DNA molecules caused by minor sequence variations such as a single nucleotide mutation. It also demonstrates the existence of long-range interactions between DNA regions separated by >300 nt and the formation of multiple alternative structures by a 244 nt DNA molecule. The differences in the secondary structure of DNA molecules revealed by 5'-nuclease probing were used to design structure-specific probes for mutation discrimination that target the regions of structural, rather than sequence, differences. We also demonstrate the performance of structure-specific 'bridge' probes complementary to non-contiguous regions of the target molecule. The structure-specific probes do not require the high stringency binding conditions necessary for methods based on mismatch formation and permit mutation detection at temperatures from 4 to 37 degrees C. Structure-specific sequence analysis is applied for mutation detection in the Mycobacterium tuberculosis katG gene and for genotyping of the hepatitis C virus.

Estrogen Drives Cellular Transformation and Mutagenesis in Cells Expressing the Breast Cancer-Associated R438W DNA Polymerase Lambda Protein.

PubMed

Nemec, Antonia A; Bush, Korie B; Towle-Weicksel, Jamie B; Taylor, B Frazier; Schulz, Vincent; Weidhaas, Joanne B; Tuck, David P; Sweasy, Joann B

2016-11-01

Repair of DNA damage is critical for maintaining the genomic integrity of cells. DNA polymerase lambda (POLL/Pol λ) is suggested to function in base excision repair (BER) and nonhomologous end-joining (NHEJ), and is likely to play a role in damage tolerance at the replication fork. Here, using next-generation sequencing, it was discovered that the POLL rs3730477 single-nucleotide polymorphism (SNP) encoding R438W Pol λ was significantly enriched in the germlines of breast cancer patients. Expression of R438W Pol λ in human breast epithelial cells induces cellular transformation and chromosomal aberrations. The role of estrogen was assessed as it is commonly used in hormone replacement therapies and is a known breast cancer risk factor. Interestingly, the combination of estrogen treatment and the expression of the R438W Pol λ SNP drastically accelerated the rate of transformation. Estrogen exposure produces 8-oxoguanine lesions that persist in cells expressing R438W Pol λ compared with wild-type (WT) Pol λ-expressing cells. Unlike WT Pol λ, which performs error-free bypass of 8-oxoguanine lesions, expression of R438W Pol λ leads to an increase in mutagenesis and replicative stress in cells treated with estrogen. Together, these data suggest that individuals who carry the rs3730477 POLL germline variant have an increased risk of estrogen-associated breast cancer. The Pol λ R438W mutation can serve as a biomarker to predict cancer risk and implicates that treatment with estrogen in individuals with this mutation may further increase their risk of breast cancer. Mol Cancer Res; 14(11); 1068-77. ©2016 AACR. ©2016 American Association for Cancer Research.

DNA conformation on surfaces measured by fluorescence self-interference.

PubMed

Moiseev, Lev; Unlü, M Selim; Swan, Anna K; Goldberg, Bennett B; Cantor, Charles R

2006-02-21

The conformation of DNA molecules tethered to the surface of a microarray may significantly affect the efficiency of hybridization. Although a number of methods have been applied to determine the structure of the DNA layer, they are not very sensitive to variations in the shape of DNA molecules. Here we describe the application of an interferometric technique called spectral self-interference fluorescence microscopy to the precise measurement of the average location of a fluorescent label in a DNA layer relative to the surface and thus determine specific information on the conformation of the surface-bound DNA molecules. Using spectral self-interference fluorescence microscopy, we have estimated the shape of coiled single-stranded DNA, the average tilt of double-stranded DNA of different lengths, and the amount of hybridization. The data provide important proofs of concept for the capabilities of novel optical surface analytical methods of the molecular disposition of DNA on surfaces. The determination of DNA conformations on surfaces and hybridization behavior provide information required to move DNA interfacial applications forward and thus impact emerging clinical and biotechnological fields.

Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

PubMed Central

Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

2003-01-01

We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

Structural Transitions in Supercoiled Stretched DNA

NASA Astrophysics Data System (ADS)

v, Croquette

1998-03-01

Using magnetic micromanipulation techniques [Strick 96]( uc(T.R.) Strick, J.-F. Allemand, D. Bensimon, A. Bensimon) and uc(V.) Croquette, "The elasticity of a single supercoiled DNA molecule", Science, 271, 1835 (1996)., we have studied the mechanical properties (force versus extension) of single DNA molecules under a wide range of torsional stresses (supercoiling). We show that unwinding the DNA double helix leads to a phase separation between regular B-DNA and denaturation bubbles. The fraction of denatured molecule increases linearly with the degree of unwinding, beginning at a value of 1% unwinding. We have confirmed this denatured state by hybridization of homologous single-stranded DNA probes and by a chemical attack of the exposed bases. Surprisingly, when we overwind the molecule, the elasticity curves we obtain may also be interpreted by the coexistence of two phases, B-DNA and a new phase which we note P-DNA. The fraction of this new phase increases smoothly with overwinding, beginning at 3 % and continuing up to 300 %. Our results indicate that this new phase is four times more twisted that the standard B-DNA and is 1.75 times longer. Although the structure of this phase is not yet known, such a high twisting can only be attained if the sugar-phosphate backbones of the two strands are twisted closely while the bases are expelled outside of the molecule's core, in a structure reminiscent of the one proposed by Pauling. Indeed we have shown that this new phase is sensitive to chemical attack whereas the B-DNA is not. This new phase begins to appear on a molecule overwound by 3 % and stretched by a force of 5 pN, conditions typically encountered in vivo during gene transcription. This new phase may thus play a biological role (for more details).

Radiation damage and repair in cells and cell components. Progress report, 1980-1981

DOE Office of Scientific and Technical Information (OSTI.GOV)

Not Available

1981-01-01

One aim has been to see whether, in E.coli, the various phenomena which were ascribed to the induction of the recA gene produce (p-recA) are really manifestations of one process. It was concluded that this is true for septum inhibition, Weigle-reactivation, induced inhibition of post radiation DNA degradation, and with the additional concept of a premutational lesion, for uv mutagenesis. lambda prophage induction may perhaps be brought into line with p-recA induction with the consideration of the additional secondary aspects of (a) activation of p-recA to make it enzymatically active and (b) the need to have the concentration of activatedmore » p-recA high enough to keep up with the rate of production of lambda-repressors. Revertants seem to be in more than one class and two of these can not easily be explained by the idea that p-recA contains an error-prone repair enzyme that makes errors at mutagenic lesions.« less

The Alarmin Properties of DNA and DNA-associated Nuclear Proteins.

PubMed

Magna, Melinda; Pisetsky, David S

2016-05-01

The communication of cell injury and death is a critical element in host defense. Although immune cells can serve this function by elaborating cytokines and chemokines, somatic cells can repurpose nuclear macromolecules to function as damage-associated molecular patterns (DAMPs) or alarmins to exert similar activity. Among these molecules, DNA, high-mobility group box-1, and histone proteins can all act as DAMPs once they are in an extracellular location. This review describes current information on the role of the nuclear DAMPs, their translocation to the outside of cells, and pathways of activation after uptake into the inside of immune cells. MEDLINE and PubMed databases were searched for citations (1990-2016) in English related to the following terms: DAMPs, high-mobility group box-1, DNA, histones, cell death, danger, and immune activation. Selected articles with the most relevant studies were included for a more detailed consideration. Although nuclear molecules have important structural and genetic regulatory roles inside the cell nucleus, when released into the extracellular space during cell death, these molecules can acquire immune activity and serve as alarmins or DAMPs. Although apoptosis is generally considered the source of extracellular nuclear material, other cell death pathways such as necroptosis, NETosis, and pyroptosis can contribute to the release of nuclear molecules. Importantly, the release of nuclear DAMPs occurs with both soluble and particulate forms of these molecules. The activity of nuclear molecules may depend on posttranslational modifications, redox changes, and the binding of other molecules. Once in an extracellular location, nuclear DAMPs can engage the same pattern recognition receptors as do pathogen-associated molecular patterns. These interactions can activate immune cells and lead to cytokine and chemokine production. Among these receptors, internal receptors for DNA are key to the response to this molecule; the likely function of these internal sensors is the recognition of DNA from intracellular infection by bacteria or viruses. Activation of these receptors requires translocation of extracellular DNA into specialized compartments. In addition to nuclear DNA, mitochondrial DNA can also serve as a DAMP. The communication of cell injury and death is a critical element in host defense and involves the repurposing of nuclear molecules as immune triggers. As such, the presence of extracellular nuclear material can serve as novel biomarkers for conditions involving cell injury and death. Targeting of these molecules may also represent an important new approach to therapy. Published by Elsevier Inc.

DNA under Force: Mechanics, Electrostatics, and Hydration.

PubMed

Li, Jingqiang; Wijeratne, Sithara S; Qiu, Xiangyun; Kiang, Ching-Hwa

2015-02-25

Quantifying the basic intra- and inter-molecular forces of DNA has helped us to better understand and further predict the behavior of DNA. Single molecule technique elucidates the mechanics of DNA under applied external forces, sometimes under extreme forces. On the other hand, ensemble studies of DNA molecular force allow us to extend our understanding of DNA molecules under other forces such as electrostatic and hydration forces. Using a variety of techniques, we can have a comprehensive understanding of DNA molecular forces, which is crucial in unraveling the complex DNA functions in living cells as well as in designing a system that utilizes the unique properties of DNA in nanotechnology.

Characterization of embryo-specific genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Sung, Z.R.

1988-01-01

The objective of the proposed research is to characterize the structure and function of a set of genes whose expression is regulated in embryo development, and that are not expressed in mature tissues -- the embryogenic genes. In order to isolate these genes, we immunized a rabbit with total extracts of somatic embryos of carrot, and enriched the anti-embryo antiserum for antibodies reacting with extracts of carrot somatic embryos. Using this enriched antiserum, we screened a lambda gt11 cDNA library constructed from embryo poly A{sup +} RNA, and isolated 10 cDNA clones that detect embryogenic mRNAs. Monospecific antibodies have beenmore » purified for proteins corresponding to each cDNA sequence. Four cDNA clones were further characterized in terms of the expression of their corresponding mRNA and protein in somatic embryos of carrot. In some cases, comparable gene sequences or products have been detected in somatic and zygotic embryos of other plant species. The characteristics of these 4 cDNA clones -- clone Nos. 8, 59, and 66 -- are described in this report. 3 figs.« less

Substrate preparation for reliable imaging of DNA molecules with the scanning force microscope.

PubMed

Vesenka, J; Guthold, M; Tang, C L; Keller, D; Delaine, E; Bustamante, C

1992-07-01

A simple method of substrate preparation for imaging circular DNA molecules with the scanning force microscope (SFM) is presented. These biomolecules are adsorbed onto mica that has been soaked in magnesium acetate, sonicated and glow-discharged. The stylus-sample forces that may be endured before sample damage occurs depends on the ambient relative humidity. Images of circular DNA molecules have been obtained routinely using tips specially modified by an electron beam with a radius of curvature, Rc, of about 10 nm [D. Keller and C. Chih-Chung, Surf. Sci. 268 (1992) 333]. The resolution of these adsorbed biomolecules is determined by the Rc. At higher forces individual circular DNA molecules can be manipulated with the SFM stylus. Strategies to develop still sharper probes will be discussed.

Reversible Condensation of DNA using a Redox-Active Surfactant

PubMed Central

Hays, Melissa E.; Jewell, Christopher M.; Lynn, David M.; Abbott, Nicholas L.

2008-01-01

We report characterization of aqueous solutions of dilute Lambda phage DNA containing the redox-active surfactant (11-ferrocenylundecyl)trimethylammonium bromide (FTMA) as a function of the oxidation state of the FTMA. FTMA undergoes a reversible one-electron oxidation from a reduced state that forms micelles in aqueous solution to an oxidized state (containing the ferrocenium cation) that does not selfassociate in solution. This investigation sought to test the hypothesis that FTMA can be used to achieve reversible control over the conformation of DNA-surfactant complexes in solution. Whereas DNA adopts extended coil conformations in aqueous solutions, our measurements revealed that addition of reduced FTMA (2–5μM) to aqueous solutions of DNA (5 μM in nucleotide units) resulted in coexistence of extended coils and compact globules in solution. At higher concentrations of reduced FTMA (up to 30μM), the DNA was present as compact globules only. In contrast, oxidized FTMA had no measurable effect on the conformation of DNA, allowing DNA to maintain an extended coil state up to a concentration of 75μM oxidized FTMA. We further demonstrate that it is possible to chemically or electrochemically transform the oxidation state of FTMA in preformed complexes of FTMA and DNA, thus achieving in situ control over the conformations of the DNA in solution. These results provide guidance for the design of surfactant systems that permit active control of DNA-surfactant interactions. PMID:17428073

DNA and RNA sequencing by nanoscale reading through programmable electrophoresis and nanoelectrode-gated tunneling and dielectric detection

DOEpatents

Lee, James W.; Thundat, Thomas G.

2005-06-14

An apparatus and method for performing nucleic acid (DNA and/or RNA) sequencing on a single molecule. The genetic sequence information is obtained by probing through a DNA or RNA molecule base by base at nanometer scale as though looking through a strip of movie film. This DNA sequencing nanotechnology has the theoretical capability of performing DNA sequencing at a maximal rate of about 1,000,000 bases per second. This enhanced performance is made possible by a series of innovations including: novel applications of a fine-tuned nanometer gap for passage of a single DNA or RNA molecule; thin layer microfluidics for sample loading and delivery; and programmable electric fields for precise control of DNA or RNA movement. Detection methods include nanoelectrode-gated tunneling current measurements, dielectric molecular characterization, and atomic force microscopy/electrostatic force microscopy (AFM/EFM) probing for nanoscale reading of the nucleic acid sequences.

Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

PubMed Central

Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

2011-01-01

DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

Correlation Measurement of Lambda-anti-Lambda, Lambda-Lambda and anti-Lambda-anti-Lambda with the ATLAS detector at s=7 TeV

NASA Astrophysics Data System (ADS)

Cheng, Hok-Chuen

This thesis summaries the measurements of correlations between Lambda 0Lambda0, Lambda0Lambda 0, and Lambda0Lambda 0 hyperon pairs produced inclusively at the LHC, which are useful for a better understanding of the quark-antiquark pair production and jet fragmentation and hadronization processes. The analysis is based on hyperon pairs selected using the muon and minimum bias data samples collected at the ATLAS experiment from proton-proton collisions at a center-of-mass energy of 7 TeV in 2010. Excess Lambda0Lambda 0 are observed near the production threshold and are identified to be originated from the parton system in the string model in the MC sample, decaying either directly or through heavy strange resonances such as Sigma0 and Sigma*(1385). Dynamical correlations have been explored through a correlation function defined as the ratio of two-particle to single-particle densities. Positive correlation is observed for Lambda0Lambda0 and anticorrelation is observed for Lambda0Lambda 0 and Lambda0Lambda 0 for Q in [0,2] GeV. The structure replicates similar correlations in pp, pp, and pppp events in PYTHIA generator as predicted by the Lund string fragmentation model. Parameters of the "popcorn" mechanism implemented in the PYTHIA generator are tuned and are found to have little impact on the structure observed. The spin composition of the sample is extracted using a data-driven reference sample built by event mixing. Appropriate corrections have been made to the kinematic distributions in the reference sample by kinematic weighting to make sure that the detector effects are well modeled. A modified Pearson's chi2 test statistics is calculated for the costheta* distribution to determine the best-fitted A-value for data. The results are consistent with zero for both like-type and unlike-type hyperon pairs in Q ∈ [0,10] GeV and Q ∈ [1,10] GeV respectively. The data statistics in the range of Q ∈ [0, 1] GeV is currently too low for the estimation of the emitter size for Fermi-Dirac correlation.

Analysis of autoimmune bone marrow by antibody-phage display: somatic mutations and third complementarity-determining region arginines in anti-DNA gamma and kappa V genes.

PubMed

Seal, S N; Hoet, R M; Raats, J M; Radic, M Z

2000-09-01

To examine anti-double-stranded DNA (anti-dsDNA) IgG autoantibodies from the bone marrow of individuals with systemic lupus erythematosus (SLE). A library of single-chain variable fragments (scFv) was constructed from SLE bone marrow complementary DNA of gamma, kappa, and lambda isotype by cloning into the pHENIX phagemid vector. The library was screened with dsDNA in solution, and 2 anti-DNA phage, DNA1 and DNA4, were isolated and their Ig V genes sequenced. Soluble scFv corresponding to DNA1 and DNA4, and their heavy (H)- and light (L)-chain recombinants, were prepared, purified, and analyzed for binding to DNA by enzyme-linked immunosorbent assay. DNA1 and DNA4 used different Ig H-chain (3-30 and 5-51, respectively) and L-chain (DPK15 and DPK22, respectively) V genes. The ratios of replacement mutations to silent mutations in DNA1 and DNA4 suggest that their V genes were selected for improved antigen binding in vivo. The recombinant between DNA4VH and DNA1VL showed the highest relative affinity for both single-stranded DNA and dsDNA. These 2 Ig subunits contained third complementarity-determining region arginines and had acquired the majority of replacement mutations. Anti-dsDNA IgG autoantibodies from the bone marrow of SLE patients exploit diverse V genes and cationic V-D-J and V-J junctions for DNA binding, and accumulate replacement mutations that enhance binding.

[Single-molecule detection and characterization of DNA replication based on DNA origami].

PubMed

Wang, Qi; Fan, Youjie; Li, Bin

2014-08-01

To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

NASA Astrophysics Data System (ADS)

Zhang, Yuning; Reisner, Walter

2012-02-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We will discuss our recent progress on device fabrication and characterization. In particular, we demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the embedded pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule.

Multiplexed Sequence Encoding: A Framework for DNA Communication

PubMed Central

Zakeri, Bijan; Carr, Peter A.; Lu, Timothy K.

2016-01-01

Synthetic DNA has great propensity for efficiently and stably storing non-biological information. With DNA writing and reading technologies rapidly advancing, new applications for synthetic DNA are emerging in data storage and communication. Traditionally, DNA communication has focused on the encoding and transfer of complete sets of information. Here, we explore the use of DNA for the communication of short messages that are fragmented across multiple distinct DNA molecules. We identified three pivotal points in a communication—data encoding, data transfer & data extraction—and developed novel tools to enable communication via molecules of DNA. To address data encoding, we designed DNA-based individualized keyboards (iKeys) to convert plaintext into DNA, while reducing the occurrence of DNA homopolymers to improve synthesis and sequencing processes. To address data transfer, we implemented a secret-sharing system—Multiplexed Sequence Encoding (MuSE)—that conceals messages between multiple distinct DNA molecules, requiring a combination key to reveal messages. To address data extraction, we achieved the first instance of chromatogram patterning through multiplexed sequencing, thereby enabling a new method for data extraction. We envision these approaches will enable more widespread communication of information via DNA. PMID:27050646

Localization microscopy of DNA in situ using Vybrant(®) DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution.

PubMed

Żurek-Biesiada, Dominika; Szczurek, Aleksander T; Prakash, Kirti; Mohana, Giriram K; Lee, Hyun-Keun; Roignant, Jean-Yves; Birk, Udo J; Dobrucki, Jurek W; Cremer, Christoph

2016-05-01

Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant(®) DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10(6) signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. Copyright © 2016. Published by Elsevier Inc.

A single molecule study of G-quadruplex and short duplex DNA structures

NASA Astrophysics Data System (ADS)

Roy, William A., Jr.

Given that certain conditions are met, a single stranded DNA/RNA (ssDNA/RNA) structure called G-quadruplex (GQ) can form in regions throughout the genome, including at the telomeres and internal regions of the chromosomes. These structures serve various functions depending on the region in which they form which include protecting the chromosome ends, interfering with telomere elongation in cancer cells, and regulating transcription and translation level gene expression. Due to their high stability, various cellular mechanisms, such as GQ destabilizing proteins, are employed to unfold these structures during DNA replication or repair. Yet, their distinct layered structure has made GQs an attractive drug target in cancer treatment as GQ stabilizing molecules could inhibit telomerase dependent telomere elongation, a mechanism occurring in the majority of cancer cells to avoid senescence and apoptosis. However, proteins or small molecules interact with GQ that is under the influence of various cellular tension mechanisms, including the tension applied by other nearby molecules or the tension due to DNA structure within the chromatin context. Therefore, it is important to characterize the stability of various GQs and their response to interacting molecules when subjected to a tensile force. We employed a novel DNA-based nano tension generator that utilizes the elastic properties of circularized short double-stranded DNA (dsDNA) oligonucleotides to apply tension on the GQ. Since this is a completely new approach, the majority of this thesis was dedicated to proof-of-principle studies that demonstrated the feasibility and functionality of the method.

Contactless experiments on individual DNA molecules show no evidence for molecular wire behavior.

PubMed

Gómez-Navarro, C; Moreno-Herrero, F; de Pablo, P J; Colchero, J; Gómez-Herrero, J; Baró, A M

2002-06-25

A fundamental requirement for a molecule to be considered a molecular wire (MW) is the ability to transport electrical charge with a reasonably low resistance. We have carried out two experiments that measure first, the charge transfer from an electrode to the molecule, and second, the dielectric response of the MW. The latter experiment requires no contacts to either end of the molecule. From our experiments we conclude that adsorbed individual DNA molecules have a resistivity similar to mica, glass, and silicon oxide substrates. Therefore adsorbed DNA is not a conductor, and it should not be considered as a viable candidate for MW applications. Parallel studies on other nanowires, including single-walled carbon nanotubes, showed conductivity as expected.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Akaishi, Yoshinori; College of Science and Technology, Nihon University, Funabashi 274-8501; Myint, Khin Swe

The overbinding problem of {sub {lambda}}{sup 5}He is solved by introducing a concept of coherent {lambda}-{sigma} coupling which is equivalent to a {lambda}NN three-body force. This three-body force is coherently enhanced in the 0{sup +} states of {sub {lambda}}{sup 4}H and {sub {lambda}}{sup 4}He. The 0{sup +}-1{sup +} splitting in these hypernuclei is mainly due to coherent {lambda}-{sigma} coupling and partly due to the {lambda}N spin-spin interaction. A {lambda}NN three-body potential is derived from the coupled-channel treatment. The origin of the repulsive and attractive nature of the three-body force is discussed. Coherent {lambda}-{sigma} coupling becomes more important in neutron-rich hypernucleimore » and especially in neutron-star matter at high densities. The possible existence of ''hyperheavy hydrogen'', {sub {lambda}}{sup 6}H, is suggested.« less

Mapping of IgE-binding regions on recombinant Cyn d 1, a major allergen from Bermuda Grass Pollen (BGP).

PubMed

Tiwari, Ruby; Bhalla, Prem L; Singh, Mohan B

2009-02-02

Bermuda grass (Cynodon dactylon; subfamily Chloridoideae) is an important source of seasonal aeroallergens in warm tropical and sub-tropical areas worldwide. Improved approaches to diagnosis and therapy of allergic diseases require a thorough understanding of the structure and epitopes on the allergen molecule that are crucial for the antigen-antibody interaction. This study describes the localization of the human IgE-binding regions of the major group 1 pollen allergen Cyn d 1 from Bermuda grass. A cDNA library was constructed from Bermuda grass pollen (BGP) using a Lambda gt11 expression vector. The gene encoding the Cyn d 1 allergen was isolated by screening the library with a mouse monoclonal antibody raised against grass group 1 allergen. In order to characterize the IgE epitopes on Cyn d 1, seven overlapping fragments and three deletion mutants were cloned and over-expressed in E. coli. The recombinant fragments and deletion mutants were evaluated for their comparative IgE reactivity with sera of non atopic individuals and grass pollen allergic patients by ELISA and a dot-blot assay. Analysis of IgE binding regions by overlapping fragments and deletion mutants identified two major allergenic regions corresponding to amino acids 120-170 and 224-244. Deletion of either or both regions led to a significant reduction in IgE binding, emphasizing the importance of the C-terminal region on Cyn d 1 in epitope-IgE interaction. Anti-Cyn d 1 IgE antibodies from allergic human sera recognize two epitopes located at the C-terminal end of the molecule. These data will enable the design of improved diagnostic and therapeutic approaches for BGP hypersensitivity.

Molecular threading: mechanical extraction, stretching and placement of DNA molecules from a liquid-air interface.

PubMed

Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William

2013-01-01

We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.

Molecule counting with alkanethiol and DNA immobilized on gold microplates for extended gate FET.

PubMed

Cao, Zhong; Xiao, Zhong-Liang; Zhang, Ling; Luo, Dong-Mei; Kamahori, Masao; Shimoda, Maki

2013-04-01

Several molecule counting methods based on electrochemical characterization of alkanethiol and thiolated single-stranded oligonucleotide (HS-ssDNA) immobilized on gold microplates, which were used as extended gates of field effect transistors (FETs), have been investigated in this paper. The surface density of alkanethiol and DNA monolayers on gold microplates were quantitatively evaluated from the reductive desorption charge by using cyclic voltammetry (CV) and fast CV (FCV) methods in strong alkali solution. Typically, the surface density of 6-hydroxy-1-hexanethiol (6-HHT) was evaluated to be 4.639 molecules/nm(2), and the 28 base-pair dsDNA about 1.226-4.849 molecules/100 nm(2) on Au microplates after post-treatment with 6-HHT. The behaviors on surface potential and capacitance of different aminoalkanethiols on Au microplates were measured in 0.1 mol/L Na2SO4 and 10 mmol/L Tris-HCl (pH=7.4) solutions, indicating that the surface potential increases and the double-layer capacitance decreases with the length of carbon chain increased for the thiol monolayers, which obey a physics relationship for a capacitor. Comparably, a simple sensing method based on the electronic signals of biochemical reaction events on DNA immobilization and hybridization at the Au surface of the extended gate FET (EGFET) was developed, with which the surface density of the hybridized dsDNA on the gold surface of the EGFET was evaluated to be 1.36 molecules per 100 nm(2), showing that the EGFET is a promising sensing biochip for DNA molecule counting. Copyright © 2012 Elsevier B.V. All rights reserved.

Measurement of sigma Lambda b0/sigma B0 x B(Lambda b0-->Lambda c+pi-)/B(B0-->D+pi-) in pp collisions at square root s=1.96 TeV.

PubMed

Abulencia, A; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J-F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Budroni, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carillo, S; Carlsmith, D; Carosi, R; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Cyr, D; DaRonco, S; D'Auria, S; Davies, T; D'Onofrio, M; Dagenhart, D; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, M; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; DiTuro, P; Dörr, C; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garcia, J E; Garberson, F; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kovalev, A; Kraan, A C; Kraus, J; Kravchenko, I; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kusakabe, Y; Kwang, S; Laasanen, A T; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; Le, Y; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Manca, G; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Nachtman, J; Nagano, A; Naganoma, J; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Nurse, E; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Oldeman, R; Orava, R; Osterberg, K; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prakoshyn, F; Pronko, A; Proudfoot, J; Ptohos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ranjan, N; Rappoccio, S; Reisert, B; Rekovic, V; Renton, P; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Sabik, S; Safonov, A; Sakumoto, W K; Salamanna, G; Saltó, O; Saltzberg, D; Sánchez, C; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfyrla, A; Shapiro, M D; Shears, T; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakyan, A; Sjolin, J; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sun, H; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tseng, J; Tsuchiya, R; Tsuno, S; Turini, N; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vallecorsa, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Veramendi, G; Veszpremi, V; Vidal, R; Vila, I; Vilar, R; Vine, T; Vollrath, I; Volobouev, I; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, J; Wagner, W; Wallny, R; Wang, S M; Warburton, A; Waschke, S; Waters, D; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zhang, X; Zhou, J; Zucchelli, S

2007-03-23

We present the first observation of the baryon decay Lambda b0-->Lambda c+pi- followed by Lambda c+-->pK-pi+ in 106 pb-1 pp collisions at square root s=1.96 TeV in the CDF experiment. In order to reduce systematic error, the measured rate for Lambda b0 decay is normalized to the kinematically similar meson decay B0-->D+pi- followed by D+-->pi+K-pi+. We report the ratio of production cross sections (sigma) times the ratio of branching fractions (B) for the momentum region integrated above pT>6 GeV/c and pseudorapidity range |eta|<1.3: sigma(pp-->Lambda b0X)/sigma(pp-->B0X)xB(Lambda b0-->Lambda c+pi-)/B(B0-->D+pi-)=0.82+/-0.08(stat)+/-0.11(syst)+/-0.22[B(Lambda c+-->pK-pi+)].

DNA binding sites characterization by means of Rényi entropy measures on nucleotide transitions.

PubMed

Perera, Alexandre; Vallverdu, Montserrat; Claria, Francesc; Soria, José Manuel; Caminal, Pere

2006-01-01

In this work, parametric information-theory measures for the characterization of binding sites in DNA are extended with the use of transitional probabilities on the sequence. We propose the use of parametric uncertainty measure such as Renyi entropies obtained from the transition probabilities for the study of the binding sites, in addition to nucleotide frequency based Renyi measures. Results are reported in this manuscript comparing transition frequencies (i.e. dinucelotides) and base frequencies for Shannon and parametric Renyi for a number of binding sites found in E. Coli, lambda and T7 organisms. We observe that, for the evaluated datasets, the information provided by both approaches is not redundant, as they evolve differently under increasing Renyi orders.

Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.

PubMed

Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis

2017-12-01

Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.

Live-Cell Imaging of DNA Methylation Based on Synthetic-Molecule/Protein Hybrid Probe.

PubMed

Kumar, Naresh; Hori, Yuichiro; Kikuchi, Kazuya

2018-06-04

The epigenetic modification of DNA involves the conversion of cytosine to 5-methylcytosine, also known as DNA methylation. DNA methylation is important in modulating gene expression and thus, regulating genome and cellular functions. Recent studies have shown that aberrations in DNA methylation are associated with various epigenetic disorders or diseases including cancer. This stimulates great interest in the development of methods that can detect and visualize DNA methylation. For instance, fluorescent proteins (FPs) in conjugation with methyl-CpG-binding domain (MBD) have been employed for live-cell imaging of DNA methylation. However, the FP-based approach showed fluorescence signals for both the DNA-bound and -unbound states and thus differentiation between these states is difficult. Synthetic-molecule/protein hybrid probes can provide an alternative to overcome this restriction. In this article, we discuss the synthetic-molecule/protein hybrid probe that we developed recently for live-cell imaging of DNA methylation, which exhibited fluorescence enhancement only after binding to methylated DNA. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Of Molecules and Models.

ERIC Educational Resources Information Center

Brinner, Bonnie

1992-01-01

Presents an activity in which models help students visualize both the DNA process and transcription. After constructing DNA, RNA messenger, and RNA transfer molecules; students model cells, protein synthesis, codons, and RNA movement. (MDH)

Light-Triggered Release of DNA from Plasmon-Resonant Nanoparticles

NASA Astrophysics Data System (ADS)

Huschka, Ryan

Plasmon-resonant nanoparticle complexes show promising potential for lighttriggered, controllable delivery of deoxyribonucleic acids (DNA) for research and therapeutic purposes. For example, the approach of RNA interference (RNAi) . using antisense DNA or RNA oligonucleotides to silence activity of a specific pathogenic gene transcript and reduce expression of the encoded protein . is very useful in dissecting genetic function and holds promise as a molecular therapeutic. Herein, we investigate the mechanism and probe the in vitro therapeutic potential of DNA light-triggered release from plasmonic nanoparticles. First, we investigate the mechanism of light-triggered release by dehybridizing double-stranded (dsDNA) via laser illumination from two types of nanoparticle substrates: gold (Au) nanoshells and Au nanorods. Both light-triggered and thermally induced releases are distinctly observable from nanoshell-based complexes. Surprisingly, no analogous measurable light-triggered release was observable from nanorod-based complexes below the DNA melting temperature. These results suggest that a nonthermal mechanism may play a role in light-triggered DNA release. Second, we demonstrate the in vitro light-triggered release of molecules noncovalently attached within dsDNA bound to the Au nanoshell surface. DAPI (4',6- diamidino-2-phenylindole), a bright blue fluorescent molecule that binds reversibly to double-stranded DNA, was chosen to visualize this intracellular light-induced release process. Illumination through the cell membrane of the nanoshell-dsDNA-DAPI complexes dehybridizes the DNA and releases the DAPI molecules within living cells. The DAPI molecules diffuse to the nucleus and associate with the cell's endogenous DNA. This work could have future applications towards drug delivery of molecules that associate with dsDNA. Finally, we demonstrate an engineered Au nanoshell (AuNS)-based therapeutic oligonucleotide delivery vehicle, designed to release its cargo on demand upon illumination with a near-infrared (NIR) laser. A poly(L)lysine peptide (PLL) epilayer coated onto the AuNS surface (AuNS-PLL) is used to capture intact, single-stranded antisense DNA oligonucleotide, or alternatively, double-stranded short-interfering RNA (siRNA) molecules. A green fluorescent protein (GFP)-expressing human lung cancer H1299 cell line was used to determine cellular uptake and GFP gene silencing mediated by AuNS-PLL delivery vector. The light-triggered release of oligonucleotides could have broad applications in the study of cellular processes and in the development of intracellular targeted therapies.

Cooperative Assembly of Co-Smad4 MH1 with R-Smad1/3 MH1 on DNA: A Molecular Dynamics Simulation Study

PubMed Central

Wang, Guihong; Li, Chaoqun; Wang, Yan; Chen, Guangju

2013-01-01

Background Smads, the homologs of Sma and MAD proteins, play a key role in gene expression regulation in the transforming growth factor-β (TGF-β) signaling pathway. Recent experimental studies have revealed that Smad4/R-Smad heterodimers bound on DNA are energetically more favorable than homodimeric R-Smad/R-Smad complexes bound on DNA, which indicates that Smad4 might act as binding vehicle to cooperatively assemble with activated R-Smads on DNA in the nucleus. However, the details of interaction mechanism for cooperative recruitment of Smad4 protein to R-Smad proteins on DNA, and allosteric communication between the Smad4-DNA and R-Smad-DNA interfaces via DNA mediating are not yet clear so far. Methodology In the present work, we have constructed a series of Smadn+DNA+Smadn (n = 1, 3, 4) models and carried out molecular dynamics simulations, free energy calculations and DNA dynamics analysis for them to study the interaction properties of Smadn (n = 1, 3, 4) with DNA molecule. Results The results revealed that the binding of Smad4 protein to DNA molecule facilitates energetically the formation of the heteromeric Smad4+DNA+Smad1/3 complex by increasing the affinity of Smad1/3 with DNA molecule. Further investigations through the residue/base motion correlation and DNA dynamics analyses predicted that the binding of Smad4 protein to DNA molecule in the heteromeric Smad4+DNA+Smad1/3 model induces an allosteric communication from the Smad4-DNA interface to Smad1/Smad3-DNA interface via DNA base-pair helical motions, surface conformation changes and new hydrogen bond formations. The present work theoretically explains the mechanism of cooperative recruitment of Smad4 protein to Smad1/3 protein via DNA-mediated indirect readout mode in the nucleus. PMID:23326519

The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae).

PubMed

Pan, Hong-Chun; Fang, Hong-Yan; Li, Shi-Wei; Liu, Jun-Hong; Wang, Ying; Wang, An-Tai

2014-12-01

The complete mitochondrial genome of Hydra vulgaris (Hydroida: Hydridae) is composed of two linear DNA molecules. The mitochondrial DNA (mtDNA) molecule 1 is 8010 bp long and contains six protein-coding genes, large subunit rRNA, methionine and tryptophan tRNAs, two pseudogenes consisting respectively of a partial copy of COI, and terminal sequences at two ends of the linear mtDNA, while the mtDNA molecule 2 is 7576 bp long and contains seven protein-coding genes, small subunit rRNA, methionine tRNA, a pseudogene consisting of a partial copy of COI and terminal sequences at two ends of the linear mtDNA. COI gene begins with GTG as start codon, whereas other 12 protein-coding genes start with a typical ATG initiation codon. In addition, all protein-coding genes are terminated with TAA as stop codon.

Homebuilt single-molecule scanning confocal fluorescence microscope studies of single DNA/protein interactions.

PubMed

Zheng, Haocheng; Goldner, Lori S; Leuba, Sanford H

2007-03-01

Many technical improvements in fluorescence microscopy over the years have focused on decreasing background and increasing the signal to noise ratio (SNR). The scanning confocal fluorescence microscope (SCFM) represented a major improvement in these efforts. The SCFM acquires signal from a thin layer of a thick sample, rejecting light whose origin is not in the focal plane thereby dramatically decreasing the background signal. A second major innovation was the advent of high quantum-yield, low noise, single-photon counting detectors. The superior background rejection of SCFM combined with low-noise, high-yield detectors makes it possible to detect the fluorescence from single-dye molecules. By labeling a DNA molecule or a DNA/protein complex with a donor/acceptor dye pair, fluorescence resonance energy transfer (FRET) can be used to track conformational changes in the molecule/complex itself, on a single molecule/complex basis. In this methods paper, we describe the core concepts of SCFM in the context of a study that uses FRET to reveal conformational fluctuations in individual Holliday junction DNA molecules and nucleosomal particles. We also discuss data processing methods for SCFM.

Single-molecule DNA detection with an engineered MspA protein nanopore

PubMed Central

Butler, Tom Z.; Pavlenok, Mikhail; Derrington, Ian M.; Niederweis, Michael; Gundlach, Jens H.

2008-01-01

Nanopores hold great promise as single-molecule analytical devices and biophysical model systems because the ionic current blockades they produce contain information about the identity, concentration, structure, and dynamics of target molecules. The porin MspA of Mycobacterium smegmatis has remarkable stability against environmental stresses and can be rationally modified based on its crystal structure. Further, MspA has a short and narrow channel constriction that is promising for DNA sequencing because it may enable improved characterization of short segments of a ssDNA molecule that is threaded through the pore. By eliminating the negative charge in the channel constriction, we designed and constructed an MspA mutant capable of electronically detecting and characterizing single molecules of ssDNA as they are electrophoretically driven through the pore. A second mutant with additional exchanges of negatively-charged residues for positively-charged residues in the vestibule region exhibited a factor of ≈20 higher interaction rates, required only half as much voltage to observe interaction, and allowed ssDNA to reside in the vestibule ≈100 times longer than the first mutant. Our results introduce MspA as a nanopore for nucleic acid analysis and highlight its potential as an engineerable platform for single-molecule detection and characterization applications. PMID:19098105

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, M.D.; Soares, M.B.

1997-12-30

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

Definition of the persistence length in the coarse-grained models of DNA elasticity.

PubMed

Fathizadeh, A; Eslami-Mossallam, B; Ejtehadi, M R

2012-11-01

By considering the detailed structure of DNA in the base pair level, two possible definitions of the persistence length are compared. One definition is related to the orientation of the terminal base pairs, and the other is based on the vectors which connect two adjacent base pairs at each end of the molecule. It is shown that although these definitions approach each other for long DNA molecules, they are dramatically different on short length scales. We show analytically that the difference mostly comes from the shear flexibility of the molecule and can be used to measure the shear modulus of DNA.

DNA motion capture reveals the mechanical properties of DNA at the mesoscale.

PubMed

Price, Allen C; Pilkiewicz, Kevin R; Graham, Thomas G W; Song, Dan; Eaves, Joel D; Loparo, Joseph J

2015-05-19

Single-molecule studies probing the end-to-end extension of long DNAs have established that the mechanical properties of DNA are well described by a wormlike chain force law, a polymer model where persistence length is the only adjustable parameter. We present a DNA motion-capture technique in which DNA molecules are labeled with fluorescent quantum dots at specific sites along the DNA contour and their positions are imaged. Tracking these positions in time allows us to characterize how segments within a long DNA are extended by flow and how fluctuations within the molecule are correlated. Utilizing a linear response theory of small fluctuations, we extract elastic forces for the different, ∼2-μm-long segments along the DNA backbone. We find that the average force-extension behavior of the segments can be well described by a wormlike chain force law with an anomalously small persistence length. Copyright © 2015 Biophysical Society. Published by Elsevier Inc. All rights reserved.

Effect of DNA-CTMA complex on optical properties of LDS 821 dye

NASA Astrophysics Data System (ADS)

Udayan, Sony; Ramachandran, Vijesh Kavumoottil; Sebastian, Mathew; Chandran, Pradeep; Nampoori, Vadakkedath Parameswaran Narayanan; Thomas, Sheenu

2017-07-01

We have investigated the fluorescence behavior of LDS 821 dye (Styryl 9 M) with deoxyribonucleic acid attached with cetyltrimethyl-ammonium (DNA-CTMA). Optical absorption studies confirm the intercalation of the dye molecules with DNA-CTMA. Fluorescence studies show an enhancement of fluorescence intensity of dye with DNA-CTMA, which suggest the reduction of TICT states of the dye molecule. The FWHM of the fluorescence spectrum increases from 95 nm to 161 nm indicating the formation of new energy levels when DNA-CTMA forms a complex with LDS 821 dye. Fluorescence lifetime measurements shows that lifetime of LDS 821 varies from 507ps to 953 ps with the addition of DNA-CTMA, which also confirms the deactivation of TICT states of dye molecule. Results show that the incorporation of DNA-CTMA with LDS 821 dye improves the optical characteristics of LDS 821 dye and therefore, can be used as a good fluorescence probe for DNA visualization as well as in lasing applications.

Digital DNA detection based on a compact optofluidic laser with ultra-low sample consumption.

PubMed

Lee, Wonsuk; Chen, Qiushu; Fan, Xudong; Yoon, Dong Ki

2016-11-29

DNA lasers self-amplify optical signals from a DNA analyte as well as thermodynamic differences between sequences, allowing quasi-digital DNA detection. However, these systems have drawbacks, such as relatively large sample consumption and complicated dye labelling. Moreover, although the lasing signal can detect the target DNA, it is superimposed on an unintended fluorescence background, which persists for non-target DNA samples as well. From an optical point of view, it is thus not truly digital detection and requires spectral analysis to identify the target. In this work, we propose and demonstrate an optofluidic laser that has a single layer of DNA molecules as the gain material. A target DNA produces intensive laser emission comparable to existing DNA lasers, while any unnecessary fluorescence background is successfully suppressed. As a result, the target DNA can be detected with a single laser pulse, in a truly digital manner. Since the DNA molecules cover only a single layer on the surface of the laser microcavity, the DNA sample consumption is a few orders of magnitude lower than that of existing DNA lasers. Furthermore, the DNA molecules are stained by simply immersing the microcavity in the intercalating dye solution, and thus the proposed DNA laser is free of any complex dye-labelling process prior to analysis.

A Novel Approach to the Elucidation of the Mechanism of Development of Androgen-Independent Growth of Prostate Cancer

DTIC Science & Technology

2001-01-01

with 1.0 with differential hybridization to the two probes. Phage plaques corresponding ml of RIPA buffer with protease inhibitors (PBS, 1% NP40, 0.5...hybridized to radiolabeled probe prepared from plaque-purified phage . at 10,000 X g for 20 min; supernatants were collected and centrifuged again to...Screening. Lambda phage plaques from the primary unamplified Differential expression screening of cDNA libraries constructed CWR22 library were plated

Nano-funnels as electro-osmotic ``tweezers and pistons''

NASA Astrophysics Data System (ADS)

Wang, Yanqian; Panyukov, Sergey; Zhou, Jinsheng; Menard, Laurent D.; Ramsey, J. Michael; Rubinstien, Michael

2014-03-01

An electric field is used to force a DNA molecule into a nano-channel by compensating the free energy penalty that results from the reduced conformational entropy of the confined macromolecule. Narrow nano-channels require high critical electric fields to achieve DNA translocation, leading to short dwell times of DNA in these channels. We demonstrate that nano-funnels integrated with nano-channels reduce the free energy barrier and lower the critical electric field required for DNA translocation. A focused electric field within the funnel increases the electric force on the DNA, compresses the molecule, and increases the osmotic pressure at the nano-channel entrance. This ``electro-osmotic piston'' forces the molecule into the nano-channel at lower electric fields than those observed without the funnel. Appropirately designed nano-funnels can also function as tweezers that allow manipulation of the position of the DNA molecule. The predictions of our theory describing double-stranded DNA behavior in nano-funnel - nano-channel devices are consistent with experimental results. Thanks for the financial support from NSF (DMR-1309892, DMR-1121107, DMR-1122483), NIH (1-P50-HL107168, 1-P01-HL108808-01A1, R01HG02647), NHGRI and CF Foundation.

Model systems for single molecule polymer dynamics

PubMed Central

Latinwo, Folarin

2012-01-01

Double stranded DNA (dsDNA) has long served as a model system for single molecule polymer dynamics. However, dsDNA is a semiflexible polymer, and the structural rigidity of the DNA double helix gives rise to local molecular properties and chain dynamics that differ from flexible chains, including synthetic organic polymers. Recently, we developed single stranded DNA (ssDNA) as a new model system for single molecule studies of flexible polymer chains. In this work, we discuss model polymer systems in the context of “ideal” and “real” chain behavior considering thermal blobs, tension blobs, hydrodynamic drag and force–extension relations. In addition, we present monomer aspect ratio as a key parameter describing chain conformation and dynamics, and we derive dynamical scaling relations in terms of this molecular-level parameter. We show that asymmetric Kuhn segments can suppress monomer–monomer interactions, thereby altering global chain dynamics. Finally, we discuss ssDNA in the context of a new model system for single molecule polymer dynamics. Overall, we anticipate that future single polymer studies of flexible chains will reveal new insight into the dynamic behavior of “real” polymers, which will highlight the importance of molecular individualism and the prevalence of non-linear phenomena. PMID:22956980

Discriminating Intercalative Effects of Threading Intercalator Nogalamycin, from Classical Intercalator Daunomycin, Using Single Molecule Atomic Force Spectroscopy

PubMed Central

Sett, S.; Ghosh, S.; Rakshit, T.; Mukhopadhyay, R.

2016-01-01

DNA threading intercalators are a unique class of intercalating agents, albeit little biophysical information is available on their intercalative actions. Herein, the intercalative effects of nogalamycin, which is a naturally-occurring DNA threading intercalator, have been investigated by high-resolution atomic force microscopy (AFM) and spectroscopy (AFS). The results have been compared with those of the well-known chemotherapeutic drug daunomycin, which is a non-threading classical intercalator bearing structural similarity to nogalamycin. A comparative AFM assessment revealed a greater increase in DNA contour length over the entire incubation period of 48 h for nogalamycin treatment, whereas the contour length increase manifested faster in case of daunomycin. The elastic response of single DNA molecules to an externally applied force was investigated by the single molecule AFS approach. Characteristic mechanical fingerprints in the overstretching behaviour clearly distinguished the nogalamycin/daunomycin-treated dsDNA from untreated dsDNA—the former appearing less elastic than the latter, and the nogalamycin-treated DNA distinguished from the daunomycin-treated DNA—the classically intercalated dsDNA appearing the least elastic. A single molecule AFS-based discrimination of threading intercalation from the classical type is being reported for the first time. PMID:27183010

Histone H3 phosphorylation near the nucleosome dyad alters chromatin structure

PubMed Central

North, Justin A.; Šimon, Marek; Ferdinand, Michelle B.; Shoffner, Matthew A.; Picking, Jonathan W.; Howard, Cecil J.; Mooney, Alex M.; van Noort, John; Poirier, Michael G.; Ottesen, Jennifer J.

2014-01-01

Nucleosomes contain ∼146 bp of DNA wrapped around a histone protein octamer that controls DNA accessibility to transcription and repair complexes. Posttranslational modification (PTM) of histone proteins regulates nucleosome function. To date, only modest changes in nucleosome structure have been directly attributed to histone PTMs. Histone residue H3(T118) is located near the nucleosome dyad and can be phosphorylated. This PTM destabilizes nucleosomes and is implicated in the regulation of transcription and repair. Here, we report gel electrophoretic mobility, sucrose gradient sedimentation, thermal disassembly, micrococcal nuclease digestion and atomic force microscopy measurements of two DNA–histone complexes that are structurally distinct from nucleosomes. We find that H3(T118ph) facilitates the formation of a nucleosome duplex with two DNA molecules wrapped around two histone octamers, and an altosome complex that contains one DNA molecule wrapped around two histone octamers. The nucleosome duplex complex forms within short ∼150 bp DNA molecules, whereas altosomes require at least ∼250 bp of DNA and form repeatedly along 3000 bp DNA molecules. These results are the first report of a histone PTM significantly altering the nucleosome structure. PMID:24561803

Model Checking Temporal Logic Formulas Using Sticker Automata

PubMed Central

Feng, Changwei; Wu, Huanmei

2017-01-01

As an important complex problem, the temporal logic model checking problem is still far from being fully resolved under the circumstance of DNA computing, especially Computation Tree Logic (CTL), Interval Temporal Logic (ITL), and Projection Temporal Logic (PTL), because there is still a lack of approaches for DNA model checking. To address this challenge, a model checking method is proposed for checking the basic formulas in the above three temporal logic types with DNA molecules. First, one-type single-stranded DNA molecules are employed to encode the Finite State Automaton (FSA) model of the given basic formula so that a sticker automaton is obtained. On the other hand, other single-stranded DNA molecules are employed to encode the given system model so that the input strings of the sticker automaton are obtained. Next, a series of biochemical reactions are conducted between the above two types of single-stranded DNA molecules. It can then be decided whether the system satisfies the formula or not. As a result, we have developed a DNA-based approach for checking all the basic formulas of CTL, ITL, and PTL. The simulated results demonstrate the effectiveness of the new method. PMID:29119114

DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

PubMed

Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

2018-06-27

DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

Conjugates of classical DNA/RNA binder with nucleobase: chemical, biochemical and biomedical applications.

PubMed

Saftic, Dijana; Ban, Zeljka; Matic, Josipa; Tumir, Lidija-Marija; Piantanida, Ivo

2018-05-07

Among the most intensively studied classes of small molecules (molecular weight < 650) in biomedical research are small molecules that non-covalently bind to DNA/RNA, and another intensively studied class are nucleobase derivatives. Both classes have been intensively elaborated in many books and reviews. However, conjugates consisting of DNA/RNA binder covalently linked to nucleobase are much less studied and have not been reviewed in the last two decades. Therefore, this review summarized reports on the design of classical DNA/RNA binder - nucleobase conjugates, as well as data about their interactions with various DNA or RNA targets, and even in some cases protein targets involved. According to these data, the most important structural aspects of selective or even specific recognition between small molecule and target are proposed, and where possible related biochemical and biomedical aspects were discussed. The general conclusion is that this, rather new class of molecules showed an amazing set of recognition tools for numerous DNA or RNA targets in the last two decades, as well as few intriguing in vitro and in vivo selectivities. Several lead research lines show promising advancements toward either novel, highly selective markers or bioactive, potentially druggable molecules. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Single-molecule study of thymidine glycol and i-motif through the alpha-hemolysin ion channel

NASA Astrophysics Data System (ADS)

He, Lidong

Nanopore-based devices have emerged as a single-molecule detection and analysis tool for a wide range of applications. Through electrophoretically driving DNA molecules across a nanosized pore, a lot of information can be received, including unfolding kinetics and DNA-protein interactions. This single-molecule method has the potential to sequence kilobase length DNA polymers without amplification or labeling, approaching "the third generation" genome sequencing for around $1000 within 24 hours. alpha-Hemolysin biological nanopores have the advantages of excellent stability, low-noise level, and precise site-directed mutagenesis for engineering this protein nanopore. The first work presented in this thesis established the current signal of the thymidine glycol lesion in DNA oligomers through an immobilization experiment. The thymidine glycol enantiomers were differentiated from each other by different current blockage levels. Also, the effect of bulky hydrophobic adducts to the current blockage was investigated. Secondly, the alpha-hemolysin nanopore was used to study the human telomere i-motif and RET oncogene i-motif at a single-molecule level. In Chapter 3, it was demonstrated that the alpha-hemolysin nanopore can differentiate an i-motif form and single-strand DNA form at different pH values based on the same sequence. In addition, it shows potential to differentiate the folding topologies generated from the same DNA sequence.

DNA curtains for high-throughput single-molecule optical imaging.

PubMed

Greene, Eric C; Wind, Shalom; Fazio, Teresa; Gorman, Jason; Visnapuu, Mari-Liis

2010-01-01

Single-molecule approaches provide a valuable tool in the arsenal of the modern biologist, and new discoveries continue to be made possible through the use of these state-of-the-art technologies. However, it can be inherently difficult to obtain statistically relevant data from experimental approaches specifically designed to probe individual reactions. This problem is compounded with more complex biochemical reactions, heterogeneous systems, and/or reactions requiring the use of long DNA substrates. Here we give an overview of a technology developed in our laboratory, which relies upon simple micro- or nanofabricated structures in combination with "bio-friendly" lipid bilayers, to align thousands of long DNA molecules into defined patterns on the surface of a microfluidic sample chamber. We call these "DNA curtains," and we have developed several different versions varying in complexity and DNA substrate configuration, which are designed to meet different experimental needs. This novel approach to single-molecule imaging provides a powerful experimental platform that offers the potential for concurrent observation of hundreds or even thousands of protein-DNA interactions in real time. Copyright 2010 Elsevier Inc. All rights reserved.

Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

PubMed Central

LaPolla, R J; Mayne, K M; Davidson, N

1984-01-01

A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.

PubMed

Ozsolak, Fatih

2016-01-01

With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.

Molecular modelling study of changes induced by netropsin binding to nucleosome core particles.

PubMed Central

Pérez, J J; Portugal, J

1990-01-01

It is well known that certain sequence-dependent modulators in structure appear to determine the rotational positioning of DNA on the nucleosome core particle. That preference is rather weak and could be modified by some ligands as netropsin, a minor-groove binding antibiotic. We have undertaken a molecular modelling approach to calculate the relative energy of interaction between a DNA molecule and the protein core particle. The histones particle is considered as a distribution of positive charges on the protein surface that interacts with the DNA molecule. The molecular electrostatic potentials for the DNA, simulated as a discontinuous cylinder, were calculated using the values for all the base pairs. Computing these parameters, we calculated the relative energy of interaction and the more stable rotational setting of DNA. The binding of four molecules of netropsin to this model showed that a new minimum of energy is obtained when the DNA turns toward the protein surface by about 180 degrees, so a new energetically favoured structure appears where netropsin binding sites are located facing toward the histones surface. The effect of netropsin could be explained in terms of an induced change in the phasing of DNA on the core particle. The induced rotation is considered to optimize non-bonded contacts between the netropsin molecules and the DNA backbone. PMID:2165249

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

Stable carbon isotope fractionation during the biodegradation of lambda-cyhalothrin.

PubMed

Shen, Xiaoli; Xu, Zemin; Zhang, Xichang; Yang, Fangxing

2015-11-01

In this study, the microbial degradation of lambda-cyhalothrin in soil was investigated using compound-specific stable isotope analysis. The results revealed that lambda-cyhalothrin was biodegraded in soil under laboratory conditions. The half-lives of lambda-cyhalothrin were determined to be 49 and 161 days in non-sterile and sterile soils spiked with 2mg/kg lambda-cyhalothrin and 84 and 154 days in non-sterile and sterile soils spiked with 10mg/kg lambda-cyhalothrin, respectively. The biodegradation of lambda-cyhalothrin resulted in carbon isotope fractionation, which shifted from -29.0‰ to -26.5‰ in soil spiked with 2mg/kg lambda-cyhalothrin, and to -27.5‰ with 10mg/kg lambda-cyhalothrin. A relationship was established between the stable carbon isotope fraction and the residual concentrations of lambda-cyhalothrin by the Rayleigh equation in which the carbon isotope enrichment factor ε of the microbial degradation of lambda-cyhalothrin in the soil was calculated as -2.53‰. This study provides an approach to quantitatively evaluate the biodegradation of lambda-cyhalothrin in soil in field studies. Copyright © 2015 Elsevier B.V. All rights reserved.

42 CFR 66.207 - Other HHS regulations and policies that apply.

Code of Federal Regulations, 2011 CFR

2011-10-01

... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...

42 CFR 66.207 - Other HHS regulations and policies that apply.

Code of Federal Regulations, 2010 CFR

2010-10-01

... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...

42 CFR 66.207 - Other HHS regulations and policies that apply.

Code of Federal Regulations, 2013 CFR

2013-10-01

... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...

42 CFR 66.207 - Other HHS regulations and policies that apply.

Code of Federal Regulations, 2012 CFR

2012-10-01

... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...

42 CFR 66.207 - Other HHS regulations and policies that apply.

Code of Federal Regulations, 2014 CFR

2014-10-01

... Federal financial assistance 48 FR 24556—Guidelines for Research Involving Recombinant DNA Molecules... Involving Recombinant DNA Molecules. Note: This policy is subject to change, and interested persons should...

Fixed-Gap Tunnel Junction for Reading DNA Nucleotides

PubMed Central

2015-01-01

Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505

Programmed self-assembly of DNA/RNA for biomedical applications

NASA Astrophysics Data System (ADS)

Wang, Pengfei

Three self-assembly strategies were utilized for assembly of novel functional DNA/RNA nanostructures. RNA-DNA hybrid origami method was developed to fabricate nano-objects (ribbon, rectangle, and triangle) with precisely controlled geometry. Unlike conventional DNA origami which use long DNA single strand as scaffold, a long RNA single strand was used instead, which was folded by short DNA single strands (staples) into prescribed objects through sequence specific hybridization between RNA and DNA. Single stranded tiles (SST) and RNA-DNA hybrid origami were utilized to fabricate a variety of barcode-like nanostructures with unique patterns by expanding a plain rectangle via introducing spacers (10-bp dsDNA segment) between parallel duplexes. Finally, complex 2D array and 3D polyhedrons with multiple patterns within one structure were assembled from simple DNA motifs. Two demonstrations of biomedical applications of DNA nanotechnology were presented. Firstly, lambda-DNA was used as template to direct the fabrication of multi-component magnetic nanoparticle chains. Nuclear magnetic relaxation (NMR) characterization showed superb magnetic relaxativity of the nanoparticle chains which have large potential to be utilized as MRI contrast agents. Secondly, DNA nanotechnology was introduced into the conformational study of a routinely used catalytic DNAzyme, the RNA-cleaving 10-23 DNAzyme. The relative angle between two flanking duplexes of the catalytic core was determined (94.8°), which shall be able to provide a clue to further understanding of the cleaving mechanism of this DNAzyme from a conformational perspective.

Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

NASA Astrophysics Data System (ADS)

Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

2013-03-01

The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

Application of encoded library technology (ELT) to a protein-protein interaction target: discovery of a potent class of integrin lymphocyte function-associated antigen 1 (LFA-1) antagonists.

PubMed

Kollmann, Christopher S; Bai, Xiaopeng; Tsai, Ching-Hsuan; Yang, Hongfang; Lind, Kenneth E; Skinner, Steven R; Zhu, Zhengrong; Israel, David I; Cuozzo, John W; Morgan, Barry A; Yuki, Koichi; Xie, Can; Springer, Timothy A; Shimaoka, Motomu; Evindar, Ghotas

2014-04-01

The inhibition of protein-protein interactions remains a challenge for traditional small molecule drug discovery. Here we describe the use of DNA-encoded library technology for the discovery of small molecules that are potent inhibitors of the interaction between lymphocyte function-associated antigen 1 and its ligand intercellular adhesion molecule 1. A DNA-encoded library with a potential complexity of 4.1 billion compounds was exposed to the I-domain of the target protein and the bound ligands were affinity selected, yielding an enriched small-molecule hit family. Compounds representing this family were synthesized without their DNA encoding moiety and found to inhibit the lymphocyte function-associated antigen 1/intercellular adhesion molecule-1 interaction with submicromolar potency in both ELISA and cell adhesion assays. Re-synthesized compounds conjugated to DNA or a fluorophore were demonstrated to bind to cells expressing the target protein. Copyright © 2014 Elsevier Ltd. All rights reserved.

Integrity and Biological Activity of DNA after UV Exposure

NASA Astrophysics Data System (ADS)

Lyon, Delina Y.; Monier, Jean-Michel; Dupraz, Sébastien; Freissinet, Caroline; Simonet, Pascal; Vogel, Timothy M.

2010-04-01

The field of astrobiology lacks a universal marker with which to indicate the presence of life. This study supports the proposal to use nucleic acids, specifically DNA, as a signature of life (biosignature). In addition to its specificity to living organisms, DNA is a functional molecule that can confer new activities and characteristics to other organisms, following the molecular biology dogma, that is, DNA is transcribed to RNA, which is translated into proteins. Previous criticisms of the use of DNA as a biosignature have asserted that DNA molecules would be destroyed by UV radiation in space. To address this concern, DNA in plasmid form was deposited onto different surfaces and exposed to UVC radiation. The surviving DNA was quantified via the quantitative polymerase chain reaction (qPCR). Results demonstrate increased survivability of DNA attached to surfaces versus non-adsorbed DNA. The DNA was also tested for biological activity via transformation into the bacterium Acinetobacter sp. and assaying for antibiotic resistance conferred by genes encoded by the plasmid. The success of these methods to detect DNA and its gene products after UV exposure (254 nm, 3.5 J/m2s) not only supports the use of the DNA molecule as a biosignature on mineral surfaces but also demonstrates that the DNA retained biological activity.

An isolated Hda-clamp complex is functional in the regulatory inactivation of DnaA and DNA replication.

PubMed

Kawakami, Hironori; Su'etsugu, Masayuki; Katayama, Tsutomu

2006-10-01

In Escherichia coli, a complex consisting of Hda and the DNA-loaded clamp-subunit of the DNA polymerase III holoenzyme promotes hydrolysis of DnaA-ATP. The resultant ADP-DnaA is inactive for initiation of chromosomal DNA replication, thereby repressing excessive initiations. As the cellular content of the clamp is 10-100 times higher than that of Hda, most Hda molecules might be complexed with the clamp in vivo. Although Hda predominantly forms irregular aggregates when overexpressed, in the present study we found that co-overexpression of the clamp with Hda enhances Hda solubility dramatically and we efficiently isolated the Hda-clamp complex. A single molecule of the complex appears to consist of two Hda molecules and a single clamp. The complex is competent in DnaA-ATP hydrolysis and DNA replication in the presence of DNA and the clamp deficient subassembly of the DNA polymerase III holoenzyme (pol III*). These findings indicate that the clamp contained in the complex is loaded onto DNA through an interaction with the pol III* and that the Hda activity is preserved in these processes. The complex consisting of Hda and the DNA-unloaded clamp may play a specific role in a process proceeding to the DnaA-ATP hydrolysis in vivo.

Cell-Based Selection Expands the Utility of DNA-Encoded Small-Molecule Library Technology to Cell Surface Drug Targets: Identification of Novel Antagonists of the NK3 Tachykinin Receptor.

PubMed

Wu, Zining; Graybill, Todd L; Zeng, Xin; Platchek, Michael; Zhang, Jean; Bodmer, Vera Q; Wisnoski, David D; Deng, Jianghe; Coppo, Frank T; Yao, Gang; Tamburino, Alex; Scavello, Genaro; Franklin, G Joseph; Mataruse, Sibongile; Bedard, Katie L; Ding, Yun; Chai, Jing; Summerfield, Jennifer; Centrella, Paolo A; Messer, Jeffrey A; Pope, Andrew J; Israel, David I

2015-12-14

DNA-encoded small-molecule library technology has recently emerged as a new paradigm for identifying ligands against drug targets. To date, this technology has been used with soluble protein targets that are produced and used in a purified state. Here, we describe a cell-based method for identifying small-molecule ligands from DNA-encoded libraries against integral membrane protein targets. We use this method to identify novel, potent, and specific inhibitors of NK3, a member of the tachykinin family of G-protein coupled receptors (GPCRs). The method is simple and broadly applicable to other GPCRs and integral membrane proteins. We have extended the application of DNA-encoded library technology to membrane-associated targets and demonstrate the feasibility of selecting DNA-tagged, small-molecule ligands from complex combinatorial libraries against targets in a heterogeneous milieu, such as the surface of a cell.

Single-molecule live-cell imaging of bacterial DNA repair and damage tolerance.

PubMed

Ghodke, Harshad; Ho, Han; van Oijen, Antoine M

2018-02-19

Genomic DNA is constantly under threat from intracellular and environmental factors that damage its chemical structure. Uncorrected DNA damage may impede cellular propagation or even result in cell death, making it critical to restore genomic integrity. Decades of research have revealed a wide range of mechanisms through which repair factors recognize damage and co-ordinate repair processes. In recent years, single-molecule live-cell imaging methods have further enriched our understanding of how repair factors operate in the crowded intracellular environment. The ability to follow individual biochemical events, as they occur in live cells, makes single-molecule techniques tremendously powerful to uncover the spatial organization and temporal regulation of repair factors during DNA-repair reactions. In this review, we will cover practical aspects of single-molecule live-cell imaging and highlight recent advances accomplished by the application of these experimental approaches to the study of DNA-repair processes in prokaryotes. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

An effective model of DNA like helicoidal structure: with length fluctuation nonlinearity

NASA Astrophysics Data System (ADS)

Tseytlin, Y. M.

2011-03-01

One of the natural helicoidal nanostructure, which thermomechanical features are studied carefully with the help of different mechanical models, is a DNA cell / molecule. Our study proves that the experimentally determined nonlinear fluctuations of the molecular length of DNA can be better understood by modeling the molecule as a helicoidal pretwisted nanostrip sensor with nonlinear function. The calculations presented here are in good agreement with the experimental data within 10%. Other used by many researchers mechanical models such as an elastic rod, wormlike chain (WLC), accordion bellows, or an elastic core wrapped with rigid wires do not show the possible variance nonlinearity of thermomechanical DNA molecular length fluctuations. We have found that the nonlinear variance of the length fluctuations is an intrinsic property of the micro-nano-sensors with helicoidal shape. This model allows us to estimate the persistence length and twist-stretch coupling of a DNA molecule as well. It also shows the molecule's overwinding possibility at initial stretching with correct numerical representation.

Dynamics of a family of transcendental meromorphic functions having rational Schwarzian derivative

NASA Astrophysics Data System (ADS)

Sajid, M.; Kapoor, G. P.

2007-02-01

In the present paper, a class of critically finite transcendental meromorphic functions having rational Schwarzian derivative is introduced and the dynamics of functions in one parameter family is investigated. It is found that there exist two parameter values [lambda]*=[phi](0)>0 and , where and is the real root of [phi]'(x)=0, such that the Fatou sets of f[lambda](z) for [lambda]=[lambda]* and [lambda]=[lambda]** contain parabolic domains. A computationally useful characterization of the Julia set of the function f[lambda](z) as the complement of the basin of attraction of an attracting real fixed point of f[lambda](z) is established and applied for the generation of the images of the Julia sets of f[lambda](z). Further, it is observed that the Julia set of explodes to whole complex plane for [lambda]>[lambda]**. Finally, our results found in the present paper are compared with the recent results on dynamics of one parameter families [lambda]tanz, [R.L. Devaney, L. Keen, Dynamics of meromorphic maps: Maps with polynomial Schwarzian derivative, Ann. Sci. Ecole Norm. Sup. 22 (4) (1989) 55-79; L. Keen, J. Kotus, Dynamics of the family [lambda]tan(z), Conform. Geom. Dynam. 1 (1997) 28-57; G.M. Stallard, The Hausdorff dimension of Julia sets of meromorphic functions, J. London Math. Soc. 49 (1994) 281-295] and , [lambda]>0 [G.P. Kapoor, M. Guru Prem Prasad, Dynamics of : The Julia set and bifurcation, Ergodic Theory Dynam. Systems 18 (1998) 1363-1383].

Unraveling DNA dynamics using atomic force microscopy.

PubMed

Suzuki, Yuki; Yoshikawa, Yuko; Yoshimura, Shige H; Yoshikawa, Kenichi; Takeyasu, Kunio

2011-01-01

The elucidation of structure-function relationships of biological samples has become important issue in post-genomic researches. In order to unveil the molecular mechanisms controlling gene regulations, it is essential to understand the interplay between fundamental DNA properties and the dynamics of the entire molecule. The wide range of applicability of atomic force microscopy (AFM) has allowed us to extract physicochemical properties of DNA and DNA-protein complexes, as well as to determine their topographical information. Here, we review how AFM techniques have been utilized to study DNA and DNA-protein complexes and what types of analyses have accelerated the understanding of the DNA dynamics. We begin by illustrating the application of AFM to investigate the fundamental feature of DNA molecules; topological transition of DNA, length dependent properties of DNA molecules, flexibility of double-stranded DNA, and capability of the formation of non-Watson-Crick base pairing. These properties of DNA are critical for the DNA folding and enzymatic reactions. The technical advancement in the time-resolution of AFM and sample preparation methods enabled visual analysis of DNA-protein interactions at sub-second time region. DNA tension-dependent enzymatic reaction and DNA looping dynamics by restriction enzymes were examined at a nanoscale in physiological environments. Contribution of physical properties of DNA to dynamics of nucleosomes and transition of the higher-order structure of reconstituted chromatin are also reviewed. Copyright © 2011 John Wiley & Sons, Inc.

Jovian Chromophore Characteristics from Multispectral HST Images

NASA Technical Reports Server (NTRS)

Strycker, Paul D.; Chanover, Nancy J.; Simon-Miller, Amy A.; Banfield, Don; Gierasch, Peter J.

2011-01-01

The chromophores responsible for coloring the jovian atmosphere are embedded within Jupiter's vertical aerosol structure. Sunlight propagates through this vertical distribution of aerosol particles, whose colors are defined by omega-bar (sub 0)(lambda), and we remotely observe the culmination of the radiative transfer as I/F(lambda). In this study, we employed a radiative transfer code to retrieve omega-bar (sub 0)(lambda) for particles in Jupiter's tropospheric haze at seven wavelengths in the near-UV and visible regimes. The data consisted of images of the 2008 passage of Oval BA to the south of the Great Red Spot obtained by the Wide Field Planetary Camera 2 on-board the Hubble Space Telescope. We present derived particle colors for locations that were selected from 14 weather regions, which spanned a large range of observed colors. All omega-bar (sub 0)(lambda) curves were absorbing in the blue, and omega-bar (sub 0)(lambda) increased monotonically to approximately unity as wavelength increased. We found accurate fits to all omega-bar (sub 0)(lambda) curves using an empirically derived functional form: omega-bar (sub 0)(lambda) = 1 A exp(-B lambda). The best-fit parameters for the mean omega-bar (sub 0)(lambda) curve were A = 25.4 and B = 0.0149 for lambda in units of nm. We performed a principal component analysis (PCA) on our omega-bar (sub 0)(lambda) results and found that one or two independent chromophores were sufficient to produce the variations in omega-bar (sub 0)(lambda). A PCA of I/F(lambda) for the same jovian locations resulted in principal components (PCs) with roughly the same variances as the omega-bar (sub 0)(lambda) PCA, but they did not result in a one-to-one mapping of PC amplitudes between the omega-bar (sub 0)(lambda) PCA and I/F(lambda) PCA. We suggest that statistical analyses performed on I/ F(lambda) image cubes have limited applicability to the characterization of chromophores in the jovian atmosphere due to the sensitivity of 1/ F(lambda) to horizontal variations in the vertical aerosol distribution.

Single molecule fluorescence microscopy for ultra-sensitive RNA expression profiling

NASA Astrophysics Data System (ADS)

Hesse, Jan; Jacak, Jaroslaw; Regl, Gerhard; Eichberger, Thomas; Aberger, Fritz; Schlapak, Robert; Howorka, Stefan; Muresan, Leila; Frischauf, Anna-Maria; Schütz, Gerhard J.

2007-02-01

We developed a microarray analysis platform for ultra-sensitive RNA expression profiling of minute samples. It utilizes a novel scanning system for single molecule fluorescence detection on cm2 size samples in combination with specialized biochips, optimized for low autofluorescence and weak unspecific adsorption. 20 μg total RNA was extracted from 10 6 cells of a human keratinocyte cell line (HaCaT) and reversely transcribed in the presence of Alexa647-aha-dUTP. 1% of the resulting labeled cDNA was used for complex hybridization to a custom-made oligonucleotide microarray representing a set of 125 different genes. For low abundant genes, individual cDNA molecules hybridized to the microarray spots could be resolved. Single cDNA molecules hybridized to the chip surface appeared as diffraction limited features in the fluorescence images. The à trous wavelet method was utilized for localization and counting of the separated cDNA signals. Subsequently, the degree of labeling of the localized cDNA molecules was determined by brightness analysis for the different genes. Variations by factors up to 6 were found, which in conventional microarray analysis would result in a misrepresentation of the relative abundance of mRNAs.

Mechanisms of Hyperbilirubinemia During Peginterferon Lambda-1a Therapy for Chronic Hepatitis C Infection: A Retrospective Investigation.

PubMed

Zwirtes, Ricardo; Narasimhan, Premkumar; Wind-Rotolo, Megan M; Xu, Dong; Hruska, Matthew W; Kishnani, Narendra; Colston, Elizabeth M; Srinivasan, Subasree

2016-11-01

The phase 2b EMERGE study compared the efficacy/safety of peginterferon lambda-1a (Lambda) and peginterferon alfa-2a (Alfa), both with ribavirin (RBV), for treatment of chronic hepatitis C virus (HCV) infection. A key safety finding was a higher frequency of hyperbilirubinemia with Lambda/RBV versus Alfa/RBV. To characterize mechanisms of hyperbilirubinemia associated with Lambda/RBV, we conducted a retrospective analysis of safety data from the HCV genotype 1 and genotype 4 cohort of the EMERGE study. Subjects were randomized to once-weekly Lambda (120/180/240 μg) or Alfa (180 μg), with daily RBV, for 48 weeks. Early-onset Lambda/RBV-related hyperbilirubinemia events (6-12 weeks) resulted mostly from RBV-induced hemolysis evidenced by sustained reticulocytosis and a predominantly unconjugated pattern of hyperbilirubinemia. The higher hyperbilirubinemia frequency with Lambda/RBV versus Alfa/RBV was attributed to bone marrow suppression known to occur with Alfa but not Lambda. Late-onset (>12 weeks) Lambda/RBV-related hyperbilirubinemia events occurred most frequently with higher Lambda doses and were associated with increased levels of hepatic transaminase and direct bilirubin fractions compared with early events. This dual pattern of hyperbilirubinemia observed while on Lambda/RBV treatment is thought to be caused by exaggerated RBV-induced hemolysis in early-onset events compared with possible direct Lambda-induced hepatocellular toxicity in late-onset events.

Immature surface Ig+ B cells can continue to rearrange kappa and lambda L chain gene loci

PubMed Central

1993-01-01

Pro and pre B cells possess the long-term capacity to proliferate in vitro on stromal cells and interleukin 7 (IL-7) and can differentiate to surface immunoglobulin (sIg+) cells upon removal of IL-7 from the cultures. A key event in this differentiation is the extensive cell loss due to apoptosis. Because the proto-oncogene bcl-2 can promote cell survival, we established pre-B cell lines from E mu-bcl-2 transgenic mice. These pre-B cells have the same properties as those derived from non-bcl-2 transgenic mice except that they do not die by apoptosis. This allowed us to study the fate of newly formed B cells in vitro for a longer period of time. Here we show that early during the differentiation of pre-B cells, upregulation of RAG-1 and RAG-2 expression go hand in hand with rearrangements of the Ig gene loci. Moreover, the newly formed sIg+ B cells continue to express RAG-1 and RAG-2 and continue to rearrange L chain gene loci, even in the absence of proliferation, in an orderly fashion, so that kappa L+ sIg+ cells can become lambda L+ sIg+ or sIg- cells, whereas lambda L+ sIg+ cells can become sIg-, but not kappa L+ sIg+ cells. Thus, deposition of a complete Ig molecule on the surface of a B cell does not automatically stop the Ig-rearrangement machinery. PMID:8376934

Analysis of branched DNA replication and recombination intermediates from prokaryotic cells by two-dimensional (2D) native-native agarose gel electrophoresis.

PubMed

Robinson, Nicholas P

2013-01-01

Branched DNA molecules are generated by the essential processes of replication and recombination. Owing to their distinctive extended shapes, these intermediates migrate differently from linear double-stranded DNA under certain electrophoretic conditions. However, these branched species exist in the cell at much low abundance than the bulk linear DNA. Consequently, branched molecules cannot be visualized by conventional electrophoresis and ethidium bromide staining. Two-dimensional native-native agarose electrophoresis has therefore been developed as a method to facilitate the separation and visualization of branched replication and recombination intermediates. A wide variety of studies have employed this technique to examine branched molecules in eukaryotic, archaeal, and bacterial cells, providing valuable insights into how DNA is duplicated and repaired in all three domains of life.

Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

PubMed Central

Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

2016-01-01

Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

Rearrangement and expression of the human {Psi}C{lambda}6 gene segment results in a surface Ig receptor with a truncated light chain constant region

DOE Office of Scientific and Technical Information (OSTI.GOV)

Stiernholm, N.B.J.; Verkoczy, L.K.; Berinstein, N.L.

1995-05-01

The constant region of the human Ig{lambda} locus consists of seven tandemly organized J-C gene segments. Although it has been established that the J-C{lambda}1, J-C{lambda}2, J-C{lambda}3, and J-C{lambda}7 gene segments are functional, and code for the four distinct Ig{lambda} isotypes found in human serum, the J-C{lambda}4, J-C{lambda}5, and J-C{lambda}6 gene segments are generally considered to be pseudogenes. Although one example of a functional J-C{lambda}6 gene segment has been documented, in the majority of cases, J-C{lambda}6 is rendered nonfunctional by virtue of a single duplication of four nucleotides, creating a premature translational arrest. We show here that rearrangements to the J-C{lambda}6more » gene segment do occur, and that such a rearrangement encodes an Ig{lambda} protein that lacks the terminal end of the constant region. We also show that this truncated protein is expressed on the surface with the IgH chain, creating an unusual surface Ig (sIg) receptor (sIg{triangle}CL). Cells that express this receptor on the surface do so at significantly reduced levels compared with clonally related variants, which express sIg receptors with conventional Ig{lambda} L chains. However, the effects of sIg cross-linking on tyrosine phosphorylation and surface expression of the CD25 and CD71 Ags are similar in cells that express conventional sIg receptors and in those that express sIg{triangle}CL receptors, suggesting that the latter could possibly function as an Ag receptor. 35 refs., 7 figs.« less

Protein Detection via Direct Enzymatic Amplification of Short DNA Aptamers

PubMed Central

Fischer, Nicholas O.; Tarasow, Theodore M.; Tok, Jeffrey B.-H.

2008-01-01

Aptamers are single-stranded nucleic acids that fold into defined tertiary structures to bind target molecules with high specificities and affinities. DNA aptamers have garnered much interest as recognition elements for biodetection and diagnostic applications due to their small size, ease of discovery and synthesis, and chemical and thermal stability. Herein, we describe the design and application of a short DNA molecule capable of both protein target binding and amplifiable bioreadout processes. As both recognition and readout capabilities are incorporated into a single DNA molecule, tedious conjugation procedures required for protein-DNA hybrids can be omitted. The DNA aptamer is designed to be amplified directly by either the polymerase chain reaction (PCR) or rolling circle amplification (RCA) processes, taking advantage of real-time amplification monitoring techniques for target detection. A combination of both RCA and PCR provides a wide protein target dynamic range (1 μM to 10 pM). PMID:17980857

DNA Structure and Supercoiling: Ribbons and a Yo-Yo Model

ERIC Educational Resources Information Center

Van Horn, J. David

2011-01-01

The double-helical structure of DNA is a pop cultural icon. Images of the DNA molecule appear in newspapers, popular journals, and advertisements. In addition to scientific instrument sales, the aura surrounding the central molecule of life has been used to sell everything from perfume to beverages and is the inspiration of items ranging from…

Existence and non-uniqueness of similarity solutions of a boundary-layer problem

NASA Technical Reports Server (NTRS)

Hussaini, M. Y.; Lakin, W. D.

1986-01-01

A Blasius boundary value problem with inhomogeneous lower boundary conditions f(0) = 0 and f'(0) = - lambda with lambda strictly positive was considered. The Crocco variable formulation of this problem has a key term which changes sign in the interval of interest. It is shown that solutions of the boundary value problem do not exist for values of lambda larger than a positive critical value lambda. The existence of solutions is proven for 0 lambda lambda by considering an equivalent initial value problem. It is found however that for 0 lambda lambda, solutions of the boundary value problem are nonunique. Physically, this nonuniqueness is related to multiple values of the skin friction.

Existence and non-uniqueness of similarity solutions of a boundary layer problem

NASA Technical Reports Server (NTRS)

Hussaini, M. Y.; Lakin, W. D.

1984-01-01

A Blasius boundary value problem with inhomogeneous lower boundary conditions f(0) = 0 and f'(0) = - lambda with lambda strictly positive was considered. The Crocco variable formulation of this problem has a key term which changes sign in the interval of interest. It is shown that solutions of the boundary value problem do not exist for values of lambda larger than a positive critical value lambda. The existence of solutions is proven for 0 lambda lambda by considering an equivalent initial value problem. It is found however that for 0 lambda lambda, solutions of the boundary value problem are nonunique. Physically, this nonuniqueness is related to multiple values of the skin friction.

Measurement of the Lambda b0 lifetime in Lambda b0-->J/psi Lambda 0 in pp collisions at square root s=1.96 TeV.

PubMed

Abulencia, A; Adelman, J; Affolder, T; Akimoto, T; Albrow, M G; Ambrose, D; Amerio, S; Amidei, D; Anastassov, A; Anikeev, K; Annovi, A; Antos, J; Aoki, M; Apollinari, G; Arguin, J-F; Arisawa, T; Artikov, A; Ashmanskas, W; Attal, A; Azfar, F; Azzi-Bacchetta, P; Azzurri, P; Bacchetta, N; Badgett, W; Barbaro-Galtieri, A; Barnes, V E; Barnett, B A; Baroiant, S; Bartsch, V; Bauer, G; Bedeschi, F; Behari, S; Belforte, S; Bellettini, G; Bellinger, J; Belloni, A; Benjamin, D; Beretvas, A; Beringer, J; Berry, T; Bhatti, A; Binkley, M; Bisello, D; Blair, R E; Blocker, C; Blumenfeld, B; Bocci, A; Bodek, A; Boisvert, V; Bolla, G; Bolshov, A; Bortoletto, D; Boudreau, J; Boveia, A; Brau, B; Brigliadori, L; Bromberg, C; Brubaker, E; Budagov, J; Budd, H S; Budd, S; Budroni, S; Burkett, K; Busetto, G; Bussey, P; Byrum, K L; Cabrera, S; Campanelli, M; Campbell, M; Canelli, F; Canepa, A; Carrillo, S; Carlsmith, D; Carosi, R; Carron, S; Casarsa, M; Castro, A; Catastini, P; Cauz, D; Cavalli-Sforza, M; Cerri, A; Cerrito, L; Chang, S H; Chen, Y C; Chertok, M; Chiarelli, G; Chlachidze, G; Chlebana, F; Cho, I; Cho, K; Chokheli, D; Chou, J P; Choudalakis, G; Chuang, S H; Chung, K; Chung, W H; Chung, Y S; Ciljak, M; Ciobanu, C I; Ciocci, M A; Clark, A; Clark, D; Coca, M; Compostella, G; Convery, M E; Conway, J; Cooper, B; Copic, K; Cordelli, M; Cortiana, G; Crescioli, F; Cuenca Almenar, C; Cuevas, J; Culbertson, R; Cully, J C; Cyr, D; DaRonco, S; D'Auria, S; Davies, T; D'Onofrio, M; Dagenhart, D; de Barbaro, P; De Cecco, S; Deisher, A; De Lentdecker, G; Dell'Orso, M; Delli Paoli, F; Demortier, L; Deng, J; Deninno, M; De Pedis, D; Derwent, P F; Di Giovanni, G P; Dionisi, C; Di Ruzza, B; Dittmann, J R; DiTuro, P; Dörr, C; Donati, S; Donega, M; Dong, P; Donini, J; Dorigo, T; Dube, S; Efron, J; Erbacher, R; Errede, D; Errede, S; Eusebi, R; Fang, H C; Farrington, S; Fedorko, I; Fedorko, W T; Feild, R G; Feindt, M; Fernandez, J P; Field, R; Flanagan, G; Foland, A; Forrester, S; Foster, G W; Franklin, M; Freeman, J C; Furic, I; Gallinaro, M; Galyardt, J; Garcia, J E; Garberson, F; Garfinkel, A F; Gay, C; Gerberich, H; Gerdes, D; Giagu, S; Giannetti, P; Gibson, A; Gibson, K; Gimmell, J L; Ginsburg, C; Giokaris, N; Giordani, M; Giromini, P; Giunta, M; Giurgiu, G; Glagolev, V; Glenzinski, D; Gold, M; Goldschmidt, N; Goldstein, J; Gomez, G; Gomez-Ceballos, G; Goncharov, M; González, O; Gorelov, I; Goshaw, A T; Goulianos, K; Gresele, A; Griffiths, M; Grinstein, S; Grosso-Pilcher, C; Group, R C; Grundler, U; Guimaraes da Costa, J; Gunay-Unalan, Z; Haber, C; Hahn, K; Hahn, S R; Halkiadakis, E; Hamilton, A; Han, B-Y; Han, J Y; Handler, R; Happacher, F; Hara, K; Hare, M; Harper, S; Harr, R F; Harris, R M; Hartz, M; Hatakeyama, K; Hauser, J; Heijboer, A; Heinemann, B; Heinrich, J; Henderson, C; Herndon, M; Heuser, J; Hidas, D; Hill, C S; Hirschbuehl, D; Hocker, A; Holloway, A; Hou, S; Houlden, M; Hsu, S-C; Huffman, B T; Hughes, R E; Husemann, U; Huston, J; Incandela, J; Introzzi, G; Iori, M; Ishizawa, Y; Ivanov, A; Iyutin, B; James, E; Jang, D; Jayatilaka, B; Jeans, D; Jensen, H; Jeon, E J; Jindariani, S; Jones, M; Joo, K K; Jun, S Y; Jung, J E; Junk, T R; Kamon, T; Karchin, P E; Kato, Y; Kemp, Y; Kephart, R; Kerzel, U; Khotilovich, V; Kilminster, B; Kim, D H; Kim, H S; Kim, J E; Kim, M J; Kim, S B; Kim, S H; Kim, Y K; Kimura, N; Kirsch, L; Klimenko, S; Klute, M; Knuteson, B; Ko, B R; Kondo, K; Kong, D J; Konigsberg, J; Korytov, A; Kotwal, A V; Kovalev, A; Kraan, A C; Kraus, J; Kravchenko, I; Kreps, M; Kroll, J; Krumnack, N; Kruse, M; Krutelyov, V; Kubo, T; Kuhlmann, S E; Kuhr, T; Kusakabe, Y; Kwang, S; Laasanen, A T; Labarga, L; Lai, S; Lami, S; Lammel, S; Lancaster, M; Lander, R L; Lannon, K; Lath, A; Latino, G; Lazzizzera, I; LeCompte, T; Lee, J; Lee, J; Lee, Y J; Lee, S W; Lefèvre, R; Leonardo, N; Leone, S; Levy, S; Lewis, J D; Lin, C; Lin, C S; Lindgren, M; Lipeles, E; Liss, T M; Lister, A; Litvintsev, D O; Liu, T; Lockyer, N S; Loginov, A; Loreti, M; Loverre, P; Lu, R-S; Lucchesi, D; Lujan, P; Lukens, P; Lungu, G; Lyons, L; Lys, J; Lysak, R; Lytken, E; Mack, P; MacQueen, D; Madrak, R; Maeshima, K; Makhoul, K; Maki, T; Maksimovic, P; Malde, S; Manca, G; Margaroli, F; Marginean, R; Marino, C; Marino, C P; Martin, A; Martin, M; Martin, V; Martínez, M; Maruyama, T; Mastrandrea, P; Masubuchi, T; Matsunaga, H; Mattson, M E; Mazini, R; Mazzanti, P; McFarland, K S; McIntyre, P; McNulty, R; Mehta, A; Mehtala, P; Menzemer, S; Menzione, A; Merkel, P; Mesropian, C; Messina, A; Miao, T; Miladinovic, N; Miles, J; Miller, R; Mills, C; Milnik, M; Mitra, A; Mitselmakher, G; Miyamoto, A; Moed, S; Moggi, N; Mohr, B; Moore, R; Morello, M; Movilla Fernandez, P; Mülmenstädt, J; Mukherjee, A; Muller, Th; Mumford, R; Murat, P; Nachtman, J; Nagano, A; Naganoma, J; Nahn, S; Nakano, I; Napier, A; Necula, V; Neu, C; Neubauer, M S; Nielsen, J; Nigmanov, T; Nodulman, L; Norniella, O; Nurse, E; Oh, S H; Oh, Y D; Oksuzian, I; Okusawa, T; Oldeman, R; Orava, R; Osterberg, K; Pagliarone, C; Palencia, E; Papadimitriou, V; Paramonov, A A; Parks, B; Pashapour, S; Patrick, J; Pauletta, G; Paulini, M; Paus, C; Pellett, D E; Penzo, A; Phillips, T J; Piacentino, G; Piedra, J; Pinera, L; Pitts, K; Plager, C; Pondrom, L; Portell, X; Poukhov, O; Pounder, N; Prokoshin, F; Pronko, A; Proudfoot, J; Ptochos, F; Punzi, G; Pursley, J; Rademacker, J; Rahaman, A; Ranjan, N; Rappoccio, S; Reisert, B; Rekovic, V; Renton, P; Rescigno, M; Richter, S; Rimondi, F; Ristori, L; Robson, A; Rodrigo, T; Rogers, E; Rolli, S; Roser, R; Rossi, M; Rossin, R; Ruiz, A; Russ, J; Rusu, V; Saarikko, H; Sabik, S; Safonov, A; Sakumoto, W K; Salamanna, G; Saltó, O; Saltzberg, D; Sánchez, C; Santi, L; Sarkar, S; Sartori, L; Sato, K; Savard, P; Savoy-Navarro, A; Scheidle, T; Schlabach, P; Schmidt, E E; Schmidt, M P; Schmitt, M; Schwarz, T; Scodellaro, L; Scott, A L; Scribano, A; Scuri, F; Sedov, A; Seidel, S; Seiya, Y; Semenov, A; Sexton-Kennedy, L; Sfyrla, A; Shapiro, M D; Shears, T; Shepard, P F; Sherman, D; Shimojima, M; Shochet, M; Shon, Y; Shreyber, I; Sidoti, A; Sinervo, P; Sisakyan, A; Sjolin, J; Slaughter, A J; Slaunwhite, J; Sliwa, K; Smith, J R; Snider, F D; Snihur, R; Soderberg, M; Soha, A; Somalwar, S; Sorin, V; Spalding, J; Spinella, F; Spreitzer, T; Squillacioti, P; Stanitzki, M; Staveris-Polykalas, A; St Denis, R; Stelzer, B; Stelzer-Chilton, O; Stentz, D; Strologas, J; Stuart, D; Suh, J S; Sukhanov, A; Sun, H; Suzuki, T; Taffard, A; Takashima, R; Takeuchi, Y; Takikawa, K; Tanaka, M; Tanaka, R; Tecchio, M; Teng, P K; Terashi, K; Tesarek, R J; Thom, J; Thompson, A S; Thomson, E; Tipton, P; Tiwari, V; Tkaczyk, S; Toback, D; Tokar, S; Tollefson, K; Tomura, T; Tonelli, D; Torre, S; Torretta, D; Tourneur, S; Trischuk, W; Tsuchiya, R; Tsuno, S; Turini, N; Ukegawa, F; Unverhau, T; Uozumi, S; Usynin, D; Vallecorsa, S; van Remortel, N; Varganov, A; Vataga, E; Vázquez, F; Velev, G; Veramendi, G; Veszpremi, V; Vidal, R; Vila, I; Vilar, R; Vine, T; Vollrath, I; Volobouev, I; Volpi, G; Würthwein, F; Wagner, P; Wagner, R G; Wagner, R L; Wagner, J; Wagner, W; Wallny, R; Wang, S M; Warburton, A; Waschke, S; Waters, D; Weinberger, M; Wester, W C; Whitehouse, B; Whiteson, D; Wicklund, A B; Wicklund, E; Williams, G; Williams, H H; Wilson, P; Winer, B L; Wittich, P; Wolbers, S; Wolfe, C; Wright, T; Wu, X; Wynne, S M; Yagil, A; Yamamoto, K; Yamaoka, J; Yamashita, T; Yang, C; Yang, U K; Yang, Y C; Yao, W M; Yeh, G P; Yoh, J; Yorita, K; Yoshida, T; Yu, G B; Yu, I; Yu, S S; Yun, J C; Zanello, L; Zanetti, A; Zaw, I; Zhang, X; Zhou, J; Zucchelli, S

2007-03-23

We report a measurement of the Lambda b0 lifetime in the exclusive decay Lambda b0-->J/psi Lambda 0 in pp collisions at square root s=1.96 TeV using an integrated luminosity of 1.0 fb-1 of data collected by the CDF II detector at the Fermilab Tevatron. Using fully reconstructed decays, we measure tau(Lambda b0)=1.593(-0.078)(+0.083)(stat)+/-0.033(syst) ps. This is the single most precise measurement of tau(Lambda b0) and is 3.2sigma higher than the current world average.

Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

PubMed

Izanloo, Cobra

2017-09-02

An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

Single molecule analysis of Thermus thermophilus SSB protein dynamics on single-stranded DNA.

PubMed

Zhang, Jichuan; Zhou, Ruobo; Inoue, Jin; Mikawa, Tsutomu; Ha, Taekjip

2014-04-01

Single-stranded (ss) DNA binding (SSB) proteins play central roles in DNA replication, recombination and repair in all organisms. We previously showed that Escherichia coli (Eco) SSB, a homotetrameric bacterial SSB, undergoes not only rapid ssDNA-binding mode transitions but also one-dimensional diffusion (or migration) while remaining bound to ssDNA. Whereas the majority of bacterial SSB family members function as homotetramers, dimeric SSB proteins were recently discovered in a distinct bacterial lineage of extremophiles, the Thermus-Deinococcus group. Here we show, using single-molecule fluorescence resonance energy transfer (FRET), that homodimeric bacterial SSB from Thermus thermophilus (Tth) is able to diffuse spontaneously along ssDNA over a wide range of salt concentrations (20-500 mM NaCl), and that TthSSB diffusion can help transiently melt the DNA hairpin structures. Furthermore, we show that two TthSSB molecules undergo transitions among different DNA-binding modes while remaining bound to ssDNA. Our results extend our previous observations on homotetrameric SSBs to homodimeric SSBs, indicating that the dynamic features may be shared among different types of SSB proteins. These dynamic features of SSBs may facilitate SSB redistribution and removal on/from ssDNA, and help recruit other SSB-interacting proteins onto ssDNA for subsequent DNA processing in DNA replication, recombination and repair.

Observation of the baryonic B decay B{sup 0}{yields}{Lambda}{sub c}{sup +}{Lambda}K{sup -}

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lees, J. P.; Poireau, V.; Tisserand, V.

2011-10-01

We report the observation of the baryonic B decay B{sup 0}{yields}{Lambda}{sub c}{sup +}{Lambda}K{sup -} with a significance larger than 7 standard deviations based on 471x10{sup 6} BB pairs collected with the BABAR detector at the PEP-II storage ring at SLAC. We measure the branching fraction for the decay B{sup 0}{yields}{Lambda}{sub c}{sup +}{Lambda}K{sup -} to be (3.8{+-}0.8{sub stat}{+-}0.2{sub sys}{+-}1.0{sub {Lambda}}{sub c}{sup +})x10{sup -5}. The uncertainties are statistical, systematic, and due to the uncertainty in the {Lambda}{sub c}{sup +} branching fraction. We find that the {Lambda}{sub c}{sup +}K{sup -} invariant-mass distribution shows an enhancement above 3.5 GeV/c{sup 2}.

Periodic Assembly of Nanospecies on Repetitive DNA Sequences Generated on Gold Nanoparticles by Rolling Circle Amplification

NASA Astrophysics Data System (ADS)

Zhao, Weian; Brook, Michael A.; Li, Yingfu

Periodical assembly of nanospecies is desirable for the construction of nanodevices. We provide a protocol for the preparation of a gold nanoparticle (AuNP)/DNA scaffold on which nanospecies can be assembled in a periodical manner. AuNP/DNA scaffold is prepared by growing long single-stranded DNA (ssDNA) molecules (typically hundreds of nanometers to a few microns in length) on AuNPs via rolling circle amplification (RCA). Since these long ssDNA molecules contain many repetitive sequence units, complementary DNA-attached nanospecies can be assembled through specific hybridization in a controllable and periodical manner.

Doublet-spacing enhancement caused by {Lambda}N-{Sigma}N coupling in {sub {Lambda}L}i hypernuclear isotopes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Umeya, Atsushi; Harada, Toru; Research Center for Physics and Mathematics, Osaka Electro-Communication University, Neyagawa, Osaka 572-8530

2011-03-15

We theoretically investigate energy spacings of doublets in {sub {Lambda}L}i hypernuclear isotopes with A=7-10 in shell-model calculations with a {Lambda}N-{Sigma}N coupling effect. The calculated results show that the energy shifts are {Delta}{epsilon}=0.09-0.28 MeV and the {Sigma}-mixing probabilities are P{sub {Sigma}}=0.10%-0.34% in {Lambda} ground states for the isotopes because of the {Lambda}N-{Sigma}N coupling in the first-order perturbation. It is found that the energy spacing of the doublet is enhanced as a neutron number N increases; the contribution of the {Lambda}N-{Sigma}N coupling interaction is comparable to that of the {Lambda}N interaction in the neutron-rich {Lambda} hypernuclei. The coherent mechanism of this doublet-spacingmore » enhancement is also discussed in terms of Fermi-type and Gamow-Teller-type {Lambda}N-{Sigma}N couplings.« less

Single DNA molecules on freestanding and supported cationic lipid bilayers: diverse conformational dynamics controlled by the local bilayer properties

NASA Astrophysics Data System (ADS)

Herold, Christoph; Schwille, Petra; Petrov, Eugene P.

2016-02-01

We present experimental results on the interaction of DNA macromolecules with cationic lipid membranes with different properties, including freestanding membranes in the fluid and gel state, and supported lipid membranes in the fluid state and under conditions of fluid-gel phase coexistence. We observe diverse conformational dynamics of membrane-bound DNA molecules controlled by the local properties of the lipid bilayer. In case of fluid-state freestanding lipid membranes, the behaviour of DNA on the membrane is controlled by the membrane charge density: whereas DNA bound to weakly charged membranes predominantly behaves as a 2D random coil, an increase in the membrane charge density leads to membrane-driven irreversible DNA collapse and formation of subresolution-sized DNA globules. On the other hand, electrostatic binding of DNA macromolecules to gel-state freestanding membranes leads to completely arrested diffusion and conformational dynamics of membrane-adsorbed DNA. A drastically different picture is observed in case of DNA interaction with supported cationic lipid bilayers: When the supported bilayer is in the fluid state, membrane-bound DNA molecules undergo 2D translational Brownian motion and conformational fluctuations, irrespectively of the charge density of the supported bilayer. At the same time, when the supported cationic membrane shows fluid-gel phase coexistence, membrane-bound DNA molecules are strongly attracted to micrometre-sized gel-phase domains enriched with the cationic lipid, which results in 2D compaction of the membrane-bound macromolecules. This DNA compaction, however, is fully reversible, and disappears as soon as the membrane is heated above the fluid-gel coexistence. We also discuss possible biological implications of our experimental findings.

Complexation between carrageenan and methylene blue for sensor design

NASA Astrophysics Data System (ADS)

Ling, Yew Pei; Heng, Lee Yook

2013-11-01

Theoretical studies on the methylene blue (MB)-carrageenans complexation at solution and solid states have been carried out via ultraviolet spectrophotoscopy and reflectometry methods. The equilibrium constant (Ka) of the MBcarrageenans complexation follows the order of Iota > Lambda > Kappa carrageenans, which indicated Iota-carrageenan forms a stable complex. MB-carrageenan complexation reaction showed decrease in Ka value from 210.71 ppm-1 to 114.57 ppm-1 when the reaction temperature increased from 298 K to 323 K. Le Chatelier's principle and mass action law explained that the MB-carrageenan complexation was an exothermic reaction (ΔH=-18.54 kJmol-1) that release heat. Thus MB-carrageenan complex was less stable at high temperature and tend to dissociate into free MB and carrageenan molecules. It was also supported by the van't Hoff equation. The reaction is a spontaneous process (ΔG=-13.23 kJmol-1) where the randomness of the molecules reduced (ΔS=-17.83 Jmol-1K-1) due to complexation. Besides, linear regression of the concentration and absorption of the MB-carrageenan reaction obeys the Beer Lambert law, which elucidated that the complexation process was not affected by any concentration dependent factors such as aggregation and self-quenching. Moreover, linear Benesi Hilderbrend plot revealed that the interaction between MB and carrageenan was a reversible and stoichiometric reaction with 1:1 ratio. However, the molar extinction coefficient (ɛ) and molar adsorption coefficient (μa) of the MB-carrageenan complex were lower compared to free MB, described that the complex was less adsorptive. The sensor constructed based on these theoretical investigations showed response behavior that was similar with solution test as both have attraction for carrageenans in the sequence of Iota-, Lambda-, Kappa- carrageenans. Likewise, carrageenan sensor was more selective towards Iota-carrageenan than to Lambda- and Kappa-carrageenans, and no response observed when tested with agar, alginate and glucose. Therefore the sensor is able to detect carrageenans specifically and offers rapid detection without the need of sample pretreatment when compared to conventional methods.

An introduction to the mechanics of DNA.

PubMed

Travers, A A; Thompson, J M T

2004-07-15

This article gives an overview of recent research on the mechanical properties and spatial deformations of the DNA molecule. Globally the molecule behaves like a uniform elastic rod, and its twisting and writhing govern its compaction and packaging within a cell. Meanwhile high mechanical stresses can induce structural transitions of DNA giving, for example, a phase diagram in the space of the applied tension and torque. Locally, the mechanical properties vary according to the local sequence organization. These variations play a vital role in the biological functioning of the molecule.

Characterization of individual polynucleotide molecules using a membrane channel

NASA Technical Reports Server (NTRS)

Kasianowicz, J. J.; Brandin, E.; Branton, D.; Deamer, D. W.

1996-01-01

We show that an electric field can drive single-stranded RNA and DNA molecules through a 2.6-nm diameter ion channel in a lipid bilayer membrane. Because the channel diameter can accommodate only a single strand of RNA or DNA, each polymer traverses the membrane as an extended chain that partially blocks the channel. The passage of each molecule is detected as a transient decrease of ionic current whose duration is proportional to polymer length. Channel blockades can therefore be used to measure polynucleotide length. With further improvements, the method could in principle provide direct, high-speed detection of the sequence of bases in single molecules of DNA or RNA.

Surface Biology of DNA by Atomic Force Microscopy

NASA Astrophysics Data System (ADS)

Hansma, Helen G.

2001-10-01

The atomic force microscope operates on surfaces. Since surfaces occupy much of the space in living organisms, surface biology is a valid and valuable form of biology that has been difficult to investigate in the past owing to a lack of good technology. Atomic force microscopy (AFM) of DNA has been used to investigate DNA condensation for gene therapy, DNA mapping and sizing, and a few applications to cancer research and to nanotechnology. Some of the most exciting new applications for atomic force microscopy of DNA involve pulling on single DNA molecules to obtain measurements of single-molecule mechanics and thermodynamics.

Direct Observation of Azimuthal Correlations between DNA in Hydrated Aggregates

DOE Office of Scientific and Technical Information (OSTI.GOV)

Kornyshev, Alexei A.; Lee, Dominic J.; Wynveen, Aaron

2005-09-30

This study revisits the classical x-ray diffraction patterns from hydrated, noncrystalline fibers originally used to establish the helical structure of DNA. We argue that changes in these diffraction patterns with DNA packing density reveal strong azimuthally dependent interactions between adjacent molecules up to {approx}40 A interaxial or {approx}20 A surface-to-surface separations. These interactions appear to force significant torsional 'straightening' of DNA and strong azimuthal alignment of nearest neighbor molecules. The results are in good agreement with the predictions of recent theoretical models relating DNA-DNA interactions to the helical symmetry of their surface charge patterns.

Coaxial atomic force microscope probes for dielectrophoresis of DNA under different buffer conditions

NASA Astrophysics Data System (ADS)

Tao, Yinglei; Kumar Wickramasinghe, H.

2017-02-01

We demonstrate a coaxial AFM nanoprobe device for dielectrophoretic (DEP) trapping of DNA molecules in Tris-EDTA (TE) and phosphate-buffered saline (PBS) buffers. The DEP properties of 20 nm polystyrene beads were studied with coaxial probes in media with different conductivities. Due to the special geometry of our DEP probe device, sufficiently high electric fields were generated at the probe end to focus DNA molecules with positive DEP. DEP trapping for both polystyrene beads and DNA molecules was quantitatively analyzed over the frequency range from 100 kHz to 50 MHz and compared with the Clausius-Mossotti theory. Finally, we discussed the negative effect of medium salinity during DEP trapping.

Probing the size of proteins with glass nanopores

NASA Astrophysics Data System (ADS)

Steinbock, L. J.; Krishnan, S.; Bulushev, R. D.; Borgeaud, S.; Blokesch, M.; Feletti, L.; Radenovic, A.

2014-11-01

Single molecule studies using nanopores have gained attention due to the ability to sense single molecules in aqueous solution without the need to label them. In this study, short DNA molecules and proteins were detected with glass nanopores, whose sensitivity was enhanced by electron reshaping which decreased the nanopore diameter and created geometries with a reduced sensing length. Further, proteins having molecular weights (MW) ranging from 12 kDa to 480 kDa were detected, which showed that their corresponding current peak amplitude changes according to their MW. In the case of the 12 kDa ComEA protein, its DNA-binding properties to an 800 bp long DNA molecule was investigated. Moreover, the influence of the pH on the charge of the protein was demonstrated by showing a change in the translocation direction. This work emphasizes the wide spectrum of detectable molecules using nanopores from glass nanocapillaries, which stand out because of their inexpensive, lithography-free, and rapid manufacturing process.Single molecule studies using nanopores have gained attention due to the ability to sense single molecules in aqueous solution without the need to label them. In this study, short DNA molecules and proteins were detected with glass nanopores, whose sensitivity was enhanced by electron reshaping which decreased the nanopore diameter and created geometries with a reduced sensing length. Further, proteins having molecular weights (MW) ranging from 12 kDa to 480 kDa were detected, which showed that their corresponding current peak amplitude changes according to their MW. In the case of the 12 kDa ComEA protein, its DNA-binding properties to an 800 bp long DNA molecule was investigated. Moreover, the influence of the pH on the charge of the protein was demonstrated by showing a change in the translocation direction. This work emphasizes the wide spectrum of detectable molecules using nanopores from glass nanocapillaries, which stand out because of their inexpensive, lithography-free, and rapid manufacturing process. Electronic supplementary information (ESI) available. See DOI: 10.1039/c4nr05001k

Micromanipulation by laser microbeam and optical tweezers: from plant cells to single molecules.

PubMed

Greulich, K O; Pilarczyk, G; Hoffmann, A; Meyer Zu Hörste, G; Schäfer, B; Uhl, V; Monajembashi, S

2000-06-01

Complete manipulation by laser light allows precise and gentle treatment of plant cells, subcellular structures, and even individual DNA molecules. Recently, affordable lasers have become available for the construction of microbeams as well as for optical tweezers. This may generate new interest in these tools for plant biologists. Early experiments, reviewed in this journal, showed that laser supported microinjection of material into plant cells or tissues circumvents mechanical problems encountered in microinjection by fragile glass capillaries. Plant protoplasts could be fused with each other when under microscopical observation, and it was no major problem to generate a triple or quadruple fusion product. In the present paper we review experiments where membrane material was prepared from root hair tips and microgravity was simulated in algae. As many plant cells are transparent, it is possible to work inside living, intact cells. New experiments show that it is possible to release by optical micromanipulation, with high spatial resolutions, intracellular calcium from caged compounds and to study calcium oscillations. An example for avian cardiac tissue is given, but the technique is also suitable for plant cell research. As a more technical tool, optical tweezers can be used to spatially fix subcellular structures otherwise moving inside a cell and thus make them available for investigation with a confocal microscope even when the time for image formation is extended (for example at low fluorescence emission). A molecular biological example is the handling of chromosomes and isolated individual DNA molecules by laser microtools. For example, chromosomes can be cut along complex trajectories, not only perpendicular to their long axis. Single DNA molecules are cut by the laser microbeam and, after coupling such a molecule to a polystrene microbead, are handled in complex geometries. Here, the individual DNA molecules are made visible with a conventional fluorescence microscope by fluorescent dyes such as SYBRGreen. The cutting of a single DNA molecule by molecules of the restriction endonuclease EcoRI can be observed directly, i.e. a type of single molecule restriction analysis is possible. Finally, mechanical properties of individual DNA molecules can be observed directly.

[Microbial community structure in bio-ceramics and biological activated carbon analyzed by PCR-SSCP technique].

PubMed

Liu, Xiao-Lin; Liu, Wen-Jun

2007-04-01

Analyses of microbial community structure in bio-ceramics (BC) and biological activated carbon (BAC), which widely used in drinking water treatment were performed by polymerase-chain-reaction-single-strand-conformation-polymorphism (PCR-SSCP) targeted eubacterial 16S ribosomal RNA gene. Microorganisms on bio-ceramics and biological activated carbon were detached by ultrasonic, culturing on R2A and LB agar, respectively, followed by genome DNA extracting. Results show that larger than 10 kb genome DNA could be extracted from all the samples except the BAC samples processed by ultrasonic. However, quantities of the extracted DNA were different. 408 bp gene fragments were observed after PCR using the extracted genome DNA as templates. These gene fragments were digested with lambda exonuclease followed by SSCP electrophoresis. Same SSCP profiles were observed between ultrasonic eluting, R2A and LB agar culturing. The identity of the segment from bio-ceramics with uncultured Pseudomonas sp. Clone FTL201 16S rDNA (GenBank, AF509293.1) fragment was 92%, and identities of the two segments from BAC with Bacillus sp. JH19 16S rDNA (GenBank , DQ232748.1) fragment and Bacterium VA-S-11 16S rDNA (GenBank, AY395279.1) fragment were 100% and 99%, respectively.

Methods for immobilizing nucleic acids on a gel substrate

DOEpatents

Mirzabekov, Andrei Darievich; Proudnikov, Dimitri Y.; Timofeev, Edward N.; Kochetkova, Svetlana V.; Florentiev, Vladimir L.; Shick, Valentine V.

1999-01-01

A method for labeling oligonucleotide molecules, and for immobilizing oligonucleotide and DNA molecules is provided comprising modifying the molecules to create a chemically active group, and contacting activated fluorescent dyes to the region. A method for preparing an immobilization substrate is also provided comprising modifying a gel to contain desired functional groups which covalently interact with certain moieties of the oligonucleotide molecules. A method for immobilizing biomolecules and other molecules within a gel by copolymerization of allyl-substituted oligonucleotides, DNA and proteins with acrylamide is also provided.

Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

NASA Astrophysics Data System (ADS)

Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

2018-04-01

We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

Laser microtreatment for genetic manipulations and DNA diagnostics by a combination of microbeam and photonic tweezers (laser microbeam trap)

NASA Astrophysics Data System (ADS)

Greulich, Karl-Otto; Monajembashi, Shamci; Celeda, D.; Endlich, N.; Eickhoff, Holger; Hoyer, Carsten; Leitz, G.; Weber, Gerd; Scheef, J.; Rueterjans, H.

1994-12-01

Genomes of higher organisms are larger than one typically expects. For example, the DNA of a single human cell is almost two meters long, the DNA in the human body covers the distance Earth-Sun approximately 140 times. This is often not considered in typical molecular biological approaches for DNA diagnostics, where usually only DNA of the length of a gene is investigated. Also, one basic aspect of sequencing the human genome is not really solved: the problem how to prepare the huge amounts of DNA required. Approaches from biomedical optics combined with new developments in single molecule biotechnology may at least contribute some parts of the puzzle. A large genome can be partitioned into portions comprising approximately 1% of the whole DNA using a laser microbeam. The single DNA fragment can be amplified by the polymerase chain reaction in order to obtain a sufficient amount of molecules for conventional DNA diagnostics or for analysis by octanucleotide hybridization. When not amplified by biotechnological processes, the individual DNA molecule can be visualized in the light microscope and can be manipulated and dissected with the laser microbeam trap. The DNA probes obtained by single molecule biotechnology can be employed for fluorescence in situ introduced into plant cells and subcellular structures even when other techniques fail. Since the laser microbeam trap allows to work in the interior of a cell without opening it, subcellular structures can be manipulated. For example, in algae, such structures can be moved out of their original position and used to study intracellular viscosities.

Multicopy Single-Stranded DNA Directs Intestinal Colonization of Enteric Pathogens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.

Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore » retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less

Multicopy single-stranded DNA directs intestinal colonization of enteric pathogens

DOE Office of Scientific and Technical Information (OSTI.GOV)

Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.

Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore » retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate, but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less

Multicopy single-stranded DNA directs intestinal colonization of enteric pathogens

DOE PAGES

Elfenbein, Johanna R.; Knodler, Leigh A.; Nakayasu, Ernesto S.; ...

2015-09-14

Multicopy single-stranded DNAs (msDNAs) are hybrid RNA-DNA molecules encoded on retroelements called retrons and produced by the action of retron reverse transcriptases. Retrons are widespread in bacteria but the natural function of msDNA has remained elusive despite 30 years of study. The major roadblock to elucidation of the function of these unique molecules has been the lack of any identifiable phenotypes for mutants unable to make msDNA. We report that msDNA of the zoonotic pathogen Salmonella Typhimurium is necessary for colonization of the intestine. Similarly, we observed a defect in intestinal persistence in an enteropathogenic E. coli mutant lacking itsmore » retron reverse transcriptase. Under anaerobic conditions in the absence of msDNA, proteins of central anaerobic metabolism needed for Salmonella colonization of the intestine are dysregulated. We show that the msDNA-deficient mutant can utilize nitrate, but not other alternate electron acceptors in anaerobic conditions. Consistent with the availability of nitrate in the inflamed gut, a neutrophilic inflammatory response partially rescued the ability of a mutant lacking msDNA to colonize the intestine. These findings together indicate that the mechanistic basis of msDNA function during Salmonella colonization of the intestine is proper production of proteins needed for anaerobic metabolism. We further conclude that a natural function of msDNA is to regulate protein abundance, the first attributable function for any msDNA. Our data provide novel insight into the function of this mysterious molecule that likely represents a new class of regulatory molecules.« less

Selective inhibition of c-Myc/Max dimerization and DNA binding by small molecules.

PubMed

Kiessling, Anke; Sperl, Bianca; Hollis, Angela; Eick, Dirk; Berg, Thorsten

2006-07-01

bZip and bHLHZip protein family members comprise a large fraction of eukaryotic transcription factors and need to bind DNA in order to exert most of their fundamental biological roles. Their binding to DNA requires homo- or heterodimerization via alpha-helical domains, which generally do not contain obvious binding sites for small molecules. We have identified two small molecules, dubbed Mycro1 and Mycro2, which inhibit the protein-protein interactions between the bHLHZip proteins c-Myc and Max. Mycros are the first inhibitors of c-Myc/Max dimerization, which have been demonstrated to inhibit DNA binding of c-Myc with preference over other dimeric transcription factors in vitro. Mycros inhibit c-Myc-dependent proliferation, gene transcription, and oncogenic transformation in the low micromolar concentration range. Our data support the idea that dimeric transcription factors can be druggable even in the absence of obvious small-molecule binding pockets.

Adaptive resolution simulation of oligonucleotides

NASA Astrophysics Data System (ADS)

Netz, Paulo A.; Potestio, Raffaello; Kremer, Kurt

2016-12-01

Nucleic acids are characterized by a complex hierarchical structure and a variety of interaction mechanisms with other molecules. These features suggest the need of multiscale simulation methods in order to grasp the relevant physical properties of deoxyribonucleic acid (DNA) and RNA using in silico experiments. Here we report an implementation of a dual-resolution modeling of a DNA oligonucleotide in physiological conditions; in the presented setup only the nucleotide molecule and the solvent and ions in its proximity are described at the atomistic level; in contrast, the water molecules and ions far from the DNA are represented as computationally less expensive coarse-grained particles. Through the analysis of several structural and dynamical parameters, we show that this setup reliably reproduces the physical properties of the DNA molecule as observed in reference atomistic simulations. These results represent a first step towards a realistic multiscale modeling of nucleic acids and provide a quantitatively solid ground for their simulation using dual-resolution methods.

Targeting of loaded Sendai virus envelopes by covalently attached insulin molecules to virus receptor-depleted cells: fusion-mediated microinjection of ricin A and simian virus 40 DNA.

PubMed

Gitman, A G; Graessmann, A; Loyter, A

1985-11-01

Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA.

Targeting of loaded Sendai virus envelopes by covalently attached insulin molecules to virus receptor-depleted cells: fusion-mediated microinjection of ricin A and simian virus 40 DNA.

PubMed Central

Gitman, A G; Graessmann, A; Loyter, A

1985-01-01

Insulin molecules were covalently attached to detergent-solubilized Sendai virus envelope glycoproteins (HN and F polypeptides) by the use of the crosslinking reagent succinimidyl 4-(p-maleimidophenyl)butyrate (SMPB). Reconstitution of modified viral glycoproteins (carrying covalently attached insulin) together with unmodified viral glycoproteins resulted in the formation of "fusogenic" viral envelopes bearing insulin molecules. Reconstitution of such fusogenic viral envelopes in the presence of ricin A or simian virus 40 (SV40) DNA resulted in the formation of viral envelopes bearing insulin molecules and loaded with ricin A or SV40 DNA. Such viral envelopes were able to bind to hepatoma tissue culture cells (HTCC) from which Sendai virus receptors were removed by treatment with neuraminidase. Incubation of viral envelopes loaded with ricin A with virus receptor-depleted HTCC resulted in fusion-mediated injection of the toxin, as inferred from inhibition of protein synthesis and decrease in cell viability of the microinjected cells. Fusion-mediated injection of SV40 DNA was inferred from the appearance of SV40 tumor antigen in microinjected cells. Binding and fusion of the loaded viral envelopes to neuraminidase-treated HTCC was mediated solely by the virus-associated insulin molecules. Addition of free insulin molecules inhibited binding of the viral envelopes and, consequently, the microinjection of ricin A and SV40 DNA. PMID:2997783

In vitro selection of shape-changing DNA nanostructures capable of binding-induced cargo release.

PubMed

Oh, Seung Soo; Plakos, Kory; Xiao, Yi; Eisenstein, Michael; Soh, H Tom

2013-11-26

Many biological systems employ allosteric regulatory mechanisms, which offer a powerful means of directly linking a specific binding event to a wide spectrum of molecular functionalities. There is considerable interest in generating synthetic allosteric regulators that can perform useful molecular functions for applications in diagnostics, imaging and targeted therapies, but generating such molecules through either rational design or directed evolution has proven exceptionally challenging. To address this need, we present an in vitro selection strategy for generating conformation-switching DNA nanostructures that selectively release a small-molecule payload in response to binding of a specific trigger molecule. As an exemplar, we have generated a DNA nanostructure that hybridizes with a separate 'cargo strand' containing an abasic site. This abasic site stably sequesters a fluorescent cargo molecule in an inactive state until the DNA nanostructure encounters an ATP trigger molecule. This ATP trigger causes the nanostructure to release the cargo strand, thereby liberating the fluorescent payload and generating a detectable fluorescent readout. Our DNA nanostructure is highly sensitive, with an EC50 of 30 μM, and highly specific, releasing its payload in response to ATP but not to other chemically similar nucleotide triphosphates. We believe that this selection approach could be generalized to generate synthetic nanostructures capable of selective and controlled release of other small-molecule cargos in response to a variety of triggers, for both research and clinical applications.

Galaxy formation in Lambda greater than 0 Friedmann models: Consequences for the number counts versus redshift test

NASA Technical Reports Server (NTRS)

Martel, Hugo

1994-01-01

We study the effect of the cosmological constant Lambda on galaxy formation using a simple spherical top-hat overdensity model. We consider models with Omega(sub 0) = 0.2, lambda(sub 0) = 0, and Omega(sub 0) = 0.2, lambda(sub 0) = 0.8 (where Omega(sub 0) is the density parameter, and lambda(sub 0) identically equal Lambda/3 H(sub 0 exp 2) where H(sub 0) is the Hubble constant). We adjust the initial power spectrum amplitude so that both models reproduce the same large-scale structures. The galaxy formation era in the lambda(sub 0) = 0 model occurs early (z approximately 6) and is very short, whereas in the lambda(sub 0) = 0.8 model the galaxy formation era starts later (z approximately 4), and last much longer, possibly all the way to the present. Consequently, galaxies at low redshift (z less than 1) are significantly more evolved in the lambda(sub 0) = 0 model than in the lambda(sub 0) = 0.8 model. This result implies that previous attempts to determine Lambda using the number counts versus redshift test are probably unreliable.

Extracellular Mitochondria and Mitochondrial Components Act as Damage-Associated Molecular Pattern Molecules in the Mouse Brain.

PubMed

Wilkins, Heather M; Koppel, Scott J; Weidling, Ian W; Roy, Nairita; Ryan, Lauren N; Stanford, John A; Swerdlow, Russell H

2016-12-01

Mitochondria and mitochondrial debris are found in the brain's extracellular space, and extracellular mitochondrial components can act as damage associated molecular pattern (DAMP) molecules. To characterize the effects of potential mitochondrial DAMP molecules on neuroinflammation, we injected either isolated mitochondria or mitochondrial DNA (mtDNA) into hippocampi of C57BL/6 mice and seven days later measured markers of inflammation. Brains injected with whole mitochondria showed increased Tnfα and decreased Trem2 mRNA, increased GFAP protein, and increased NFκB phosphorylation. Some of these effects were also observed in brains injected with mtDNA (decreased Trem2 mRNA, increased GFAP protein, and increased NFκB phosphorylation), and mtDNA injection also caused several unique changes including increased CSF1R protein and AKT phosphorylation. To further establish the potential relevance of this response to Alzheimer's disease (AD), a brain disorder characterized by neurodegeneration, mitochondrial dysfunction, and neuroinflammation we also measured App mRNA, APP protein, and Aβ 1-42 levels. We found mitochondria (but not mtDNA) injections increased these parameters. Our data show that in the mouse brain extracellular mitochondria and its components can induce neuroinflammation, extracellular mtDNA or mtDNA-associated proteins can contribute to this effect, and mitochondria derived-DAMP molecules can influence AD-associated biomarkers.

Integration of single-molecule detection with magnetic separation for multiplexed detection of DNA glycosylases.

PubMed

Li, Chen-Chen; Zhang, Yan; Tang, Bo; Zhang, Chun-Yang

2018-06-05

We combine single-molecule detection with magnetic separation for simultaneous measurement of human 8-oxoG DNA glycosylase 1 (hOGG1) and uracil DNA glycosylase (UDG) based on excision repair-initiated endonuclease IV (Endo IV)-assisted signal amplification. This method can sensitively detect multiple DNA glycosylases, and it can be further applied for the simultaneous measurement of enzyme kinetic parameters and screening of both hOGG1 and UDG inhibitors.

Biomedical Requirements for High Productivity Computing Systems

DTIC Science & Technology

2005-04-01

server at http://www.ncbi.nlm.nih.gov/BLAST/. There are many variants of BLAST, including: 1. BLASTN - Compares a DNA query to a DNA database. Searches ...database (3 reading frames from each strand of the DNA) searching . 13 4. TBLASTN - Compares a protein query to a DNA database, in the 6 possible...the molecular during this phase. After eliminating molecules that could not match the query , an atom-by-atom search for the molecules in conducted

Electrophoresis of DNA in agarose gels, polyacrylamide gels and in free solution

PubMed Central

Stellwagen, Nancy C.

2009-01-01

This review describes the electrophoresis of curved and normal DNA molecules in agarose gels, polyacrylamide gels and in free solution. These studies were undertaken to clarify why curved DNA molecules migrate anomalously slowly in polyacrylamide gels but not in agarose gels. Two milestone papers are cited, in which Ferguson plots were used to estimate the effective pore size of agarose and polyacrylamide gels. Subsequent studies on the effect of the electric field on agarose and polyacrylamide gel matrices, DNA interactions with the two gel matrices, and the effect of curvature on the free solution mobility of DNA are also described. The combined results suggest that the anomalously slow mobilities observed for curved DNA molecules in polyacrylamide gels are due primarily to preferential interactions of curved DNAs with the polyacrylamide gel matrix; the restrictive pore size of the matrix is of lesser importance. In free solution, DNA mobilities increase with increasing molecular mass until leveling off at a plateau value of (3.17 ± 0.01) × 10-4 cm2/Vs in 40 mM Tris-acetate-EDTA buffer at 20°C. Curved DNA molecules migrate anomalously slowly in free solution as well as in polyacrylamide gels, explaining why the Ferguson plots of curved and normal DNAs containing the same number of base pairs extrapolate to different mobilities at zero gel concentration. PMID:19517510

A point mutation (L1015F) of the voltage-sensitive sodium channel gene associated with lambda-cyhalothrin resistance in Apolygus lucorum (Meyer-Dür) population from the transgenic Bt cotton field of China.

PubMed

Zhen, Congai; Gao, Xiwu

2016-02-01

In China, the green mirid bug, Apolygus lucorum (Meyer-Dür), has caused severe economic damage to many kinds of crops, especially the cotton and jujubes. Pyrethroid insecticides have been widely used for controlling this pest in the transgenic Bt cotton field. Five populations of A. lucorum collected from cotton crops at different locations in China were evaluated for lambda-cyhalothrin resistance. The results showed that only the population collected from Shandong Province exhibited 30-fold of resistance to lambda-cyhalothrin. Neither PBO nor DEF had obvious synergism when compared the synergistic ratio between SS and RR strain which was originated from the Shandong population. Besides, there were no statistically significant differences (p>0.05) in the carboxylesterase, glutathione S-transferase, or 7-ethoxycoumarin O-deethylase activities between the Shandong population and the laboratory susceptible strain (SS). The full-length sodium channel gene named AlVSSC encoding 2028 amino acids was obtained by RT-PCR and rapid amplification of cDNA ends (RACE). One single point mutation L1015F in the AlVSSC was detected only in the Shandong population. Our results revealed that the L1015F mutation associated with pyrethroid resistance was identified in A. lucorum populations in China. These results will be useful for the rational chemical control of A. lucorum in the transgenic Bt cotton field. Copyright © 2015 Elsevier Inc. All rights reserved.