Talking Books for Children's Home Use in a Minority Indigenous Australian Language Context

ERIC Educational Resources Information Center

Auld, Glenn

2007-01-01

Members of the Kunibidji community are the traditional owners of the lands and seas around Maningrida, a remote community in Northern Australia. Most of the 200 members of the Kunibidji Community speak Ndjebbana as their first language. This study reports on the complexities of transforming technology to provide Kunibidji children with access to…

Quantifying the relative importance of greenhouse gas emissions from current and future savanna land use change across northern Australia

NASA Astrophysics Data System (ADS)

Bristow, Mila; Hutley, Lindsay B.; Beringer, Jason; Livesley, Stephen J.; Edwards, Andrew C.; Arndt, Stefan K.

2016-11-01

The clearing and burning of tropical savanna leads to globally significant emissions of greenhouse gases (GHGs); however there is large uncertainty relating to the magnitude of this flux. Australia's tropical savannas occupy the northern quarter of the continent, a region of increasing interest for further exploitation of land and water resources. Land use decisions across this vast biome have the potential to influence the national greenhouse gas budget. To better quantify emissions from savanna deforestation and investigate the impact of deforestation on national GHG emissions, we undertook a paired site measurement campaign where emissions were quantified from two tropical savanna woodland sites; one that was deforested and prepared for agricultural land use and a second analogue site that remained uncleared for the duration of a 22-month campaign. At both sites, net ecosystem exchange of CO2 was measured using the eddy covariance method. Observations at the deforested site were continuous before, during and after the clearing event, providing high-resolution data that tracked CO2 emissions through nine phases of land use change. At the deforested site, post-clearing debris was allowed to cure for 6 months and was subsequently burnt, followed by extensive soil preparation for cropping. During the debris burning, fluxes of CO2 as measured by the eddy covariance tower were excluded. For this phase, emissions were estimated by quantifying on-site biomass prior to deforestation and applying savanna-specific emission factors to estimate a fire-derived GHG emission that included both CO2 and non-CO2 gases. The total fuel mass that was consumed during the debris burning was 40.9 Mg C ha-1 and included above- and below-ground woody biomass, course woody debris, twigs, leaf litter and C4 grass fuels. Emissions from the burning were added to the net CO2 fluxes as measured by the eddy covariance tower for other post-deforestation phases to provide a total GHG emission from this land use change. The total emission from this savanna woodland was 148.3 Mg CO2-e ha-1 with the debris burning responsible for 121.9 Mg CO2-e ha-1 or 82 % of the total emission. The remaining emission was attributed to CO2 efflux from soil disturbance during site preparation for agriculture (10 % of the total emission) and decay of debris during the curing period prior to burning (8 %). Over the same period, fluxes at the uncleared savanna woodland site were measured using a second flux tower and over the 22-month observation period, cumulative net ecosystem exchange (NEE) was a net carbon sink of -2.1 Mg C ha-1, or -7.7 Mg CO2-e ha-1. Estimated emissions for this savanna type were then extrapolated to a regional-scale to (1) provide estimates of the magnitude of GHG emissions from any future deforestation and (2) compare them with GHG emissions from prescribed savanna burning that occurs across the northern Australian savanna every year. Emissions from current rate of annual savanna deforestation across northern Australia was double that of reported (non-CO2 only) savanna burning. However, if the total GHG emission, CO2 plus non-CO2 emissions, is accounted for, burning emissions are an order of magnitude larger than that arising from savanna deforestation. We examined a scenario of expanded land use that required additional deforestation of savanna woodlands over and above current rates. This analysis suggested that significant expansion of deforestation area across the northern savanna woodlands could add an additional 3 % to Australia's national GHG account for the duration of the land use change. This bottom-up study provides data that can reduce uncertainty associated with land use change for this extensive tropical ecosystem and provide an assessment of the relative magnitude of GHG emissions from savanna burning and deforestation. Such knowledge can contribute to informing land use decision making processes associated with land and water resource development.

Indigenous values and water markets: Survey insights from northern Australia

NASA Astrophysics Data System (ADS)

Nikolakis, William D.; Grafton, R. Quentin; To, Hang

2013-09-01

Drawing upon on the literature on Indigenous values to water, water markets and the empirical findings from a survey of 120 Indigenous and non-Indigenous respondents across northern Australia, the paper makes important qualitative and statistical comparisons between Indigenous and non-Indigenous values to water markets. The study is the first comparison of Indigenous and non-Indigenous values to water markets based on the same survey instrument. Key results from Indigenous respondents include: (1) water markets are held to be an acceptable approach to managing water; (2) markets must be carefully designed to protect customary and ecological values; (3) the allocation of water rights need to encompass equity considerations; and (4) water and land rights should not be separated even if this enhances efficiency, as it runs counter to Indigenous holistic values. Overall, the survey results provide the basis for a proposed adaptive decision loop, which allows decision makers to incorporate stakeholder values in water markets.

An outline of the palaeogeographic evolution of the Australasian region since the beginning of the Neoproterozoic

NASA Astrophysics Data System (ADS)

Li, Z. X.; Powell, C. McA.

2001-04-01

In the last 1000 million years, Australia has been part of two supercontinents: Palaeozoic Gondwanaland and Neoproterozoic Rodinia. Neoproterozoic Australia was covered by shallow epicontinental seas, and, in the late Neoproterozoic, by low-latitude glaciers. The breakup of Rodinia along the Tasman Line occurred at the end of the Sturtian glaciation (760 Ma) giving rise to the Palaeo-Pacific Ocean. Gondwanaland formed in the Early Cambrian, at the same time as the Tarim block broke away from northwestern Australia. Westward subduction of the Palaeo-Pacific Ocean along the eastern margin of Australia-Antarctica commenced during the Early Cambrian in northern Victoria Land and in the Middle Cambrian in South Australia, and culminated to the Late Cambrian-Early Ordovician Ross-Delamerian Mountains. In the Ordovician, the magmatic arc retreated from Australia's then-eastern continental margin, forming a marginal sea and offshore island arc. A shallow seaway across Australia in the Late Cambrian and Ordovician gradually gave way to desert-like conditions in Central Australia and the adjacent Canning Basin by Silurian time. The Silurian to mid-Devonian was an interval of rapidly changing palaeogeography in eastern Australia with deep volcanogenic troughs formed in a dextral transtensional tectonic setting. Widespread deformation in the Tasman orogenic zone in the Middle Devonian to Early Carboniferous, was accompanied by the development of an Andean-style magmatic arc along the Pacific continental margin of Australia. The most widespread Phanerozoic mountain-building stage in Central Australia occurred in the Late Devonian to mid-Carboniferous, as part of a world-wide Variscan orogenic episode associated with the collision of Gondwanaland with Laurussia to form Pangea. In the late Visean, Australia drifted rapidly southward from previous low latitudes to a near-polar position. Glacial conditions dominated the Late Carboniferous and earliest Permian. Transtensional basins associated with dextral oroclinal shear along the Panthalassan eastern margin of Australia developed in the Late Carboniferous and persisted until the Late Permian, when an Andean-style magmatic arc was re-established. Large foreland basins inboard of the Late Permian to Early Triassic magmatic arc accumulated major coal deposits during Late Permian volcanic phases, but drastic climatic changes at the end of the Permian, possibly caused by global greenhouse conditions, led to red-bed deposition in the Early Triassic. Pangea began to rift in the mid-Triassic, and by the Late Triassic, the Cimmerian blocks, which lay off northwestern Australia throughout the Palaeozoic, had departed the northern margin of Gondwanaland. A new Andean-style continental magmatic arc became established along the Pacific Ocean margin of Australia. Breakup between Australia-Antarctica and the northern part of Greater India commenced ca. 130 Ma, and between Australia and Antarctica around 96 Ma. At the beginning of the Palaeogene, Australia commenced its northward drift towards its present position. Seafloor spreading between Australia and Antarctica was at first slow, but increased to ca. 5 cm per year around 45 Ma. By 35 Ma, the circum-Antarctic current became established, thereby triggering glaciation in Antarctica. Northern Australia reached the tropics by the beginning of the Miocene, and Australia has progressively moved northwards at 7 to 8 cm per year since.

Land application of mine water causes minimal uranium loss offsite in the wet-dry tropics: Ranger Uranium Mine, Northern Territory, Australia.

PubMed

Mumtaz, Saqib; Streten, Claire; Parry, David L; McGuinness, Keith A; Lu, Ping; Gibb, Karen S

2015-11-01

Ranger Uranium Mine (RUM) is situated in the wet-dry tropics of Northern Australia. Land application (irrigation) of stockpile (ore and waste) runoff water to natural woodland on the mine lease is a key part of water management at the mine. Consequently, the soil in these Land Application Areas (LAAs) presents a range of uranium (U) and other metals concentrations. Knowledge of seasonal and temporal changes in soil U and physicochemical parameters at RUM LAAs is important to develop suitable management and rehabilitation strategies. Therefore, soil samples were collected from low, medium, high and very high U sites at RUM LAAs for two consecutive years and the effect of time and season on soil physicochemical parameters particularly U and other major solutes applied in irrigation water was measured. Concentrations of some of the solutes applied in the irrigation water such as sulphur (S), iron (Fe) and calcium (Ca) showed significant seasonal and temporal changes. Soil S, Fe and Ca concentration decreased from year 1 to year 2 and from dry to wet seasons during both years. Soil U followed the same pattern except that we recorded an increase in soil U concentrations at most of the RUM LAAs after year 2 wet season compared to year 2 dry season. Thus, these sites did not show a considerable decrease in soil U concentration from year 1 to year 2. Sites which contained elevated U after wet season 2 also had higher moisture content which suggests that pooling of U containing rainwater at these sites may be responsible for elevated U. Thus, U may be redistributed within RUM LAAs due to surface water movement. The study also suggested that a decrease in U concentrations in LAA soils at very high U (>900 mg kg(-1)) sites is most likely due to transport of particulate matter bound U by surface runoff and U may not be lost from the surface soil due to vertical movement through the soil profile. Uranium attached to particulate matter may reduce its potential for environmental impact. These findings suggest that U is effectively adsorbed by the soils and thus land application may serve as a useful tool for U management in the wet-dry tropics of northern Australia. Copyright © 2015 Elsevier Ltd. All rights reserved.

The use of radiation for the study of material of cultural heritage significance

NASA Astrophysics Data System (ADS)

Creagh, D. C.; Otieno-Alego, V.

2004-01-01

For the indigenous people of Northern Australia the expression of their experience of life, their "dreaming", is in the form of painting, usually on the bark stripped from trees growing in their tribal lands. These are often works of great beauty and the major collecting institutions in Australia and elsewhere have significant holdings of Aboriginal bark paintings. A wide range of analytical techniques (optical microscopy, FTIR microscopy, Raman microscopy, scanning electron microscopy and energy dispersive X-ray spectroscopy, and synchrotron radiation X-ray diffraction) has been used in a project to determine how best to conserve Aboriginal bark paintings.

Characterization of mineral coatings associated with a Pleistocene-Holocene rock art style: The Northern Running Figures of the East Alligator River region, western Arnhem Land, Australia.

PubMed

King, Penelope L; Troitzsch, Ulrike; Jones, Tristen

2017-02-01

This data article contains mineralogic and chemical data from mineral coatings associated with rock art from the East Alligator River region. The coatings were collected adjacent to a rock art style known as the "Northern Running Figures" for the purposes of radiocarbon dating (doi:10.1016/j.jasrep.2016.11.016; (T. Jones, V. Levchenko, P.L. King, U. Troitzsch, D. Wesley, 2017) [1]). This contribution includes raw and processed powder X-ray Diffraction data, Scanning Electron Microscopy energy dispersive spectroscopy data, and Fourier Transform infrared spectral data.

ALOS PALSAR Applications in the Tropics and Subtropics: Characterisation, Mapping and Detecting Change in Forests and Coastal Wetlands

NASA Astrophysics Data System (ADS)

Lucas, Richard; Carreiras, Joao; Proisy, Christophe; Buniting, Peter

2008-11-01

Research undertaken as part of the Japanese Space Exploration Agency (JAXA) Principal Investigator (PI) and Kyoto and Carbon (K&C) programs has focused on the regional characterization (growth stage as a function of biomass and structure) and mapping of forests across northern Australia and mangroves (including wetlands) in selected tropical regions (northern Australia, Belize, French Guiana and Brazil) using Advanced Land Observing Satellite (ALOS) Phased Array L-band SAR (PALSAR) data, either singularly or in conjunction with other remote sensing (e.g., optical) data. Comparison against existing baseline datasets has allowed these data to be used for detecting change in these tropical and subtropical regions. Regional products (e.g., forest growth stage, mangrove/wetland extent and change) generated from the K&C dual polarimetric strip data are anticipated to benefit conservation of these ecosystems and allow better assessments of carbon stocks and changes in these as a function of natural and anthropogenic drivers, thereby supporting key international conventions.

Distribution and significance of dissolved organic carbon under three land-use systems, NSW, Australia

NASA Astrophysics Data System (ADS)

Fancy, Rubeca; Wilson, Brian R.; Daniel, Heiko; Osanai, Yui

2017-04-01

Carbon accumulation in surface soils is well documented but very little is known about the mechanisms and processes that result in carbon accumulation and long-term storage in the deeper soil profile. Understanding soil carbon storage and distribution mechanisms is critical to evaluate the sequestration potential of the soils of different land uses. Recent investigations have demonstrated that the movement of dissolved organic carbon (DOC) in the soil profile could contribute significantly to the carbon balance of terrestrial ecosystems. However, very little is known regarding the importance of DOC to vertical distribution of soil organic carbon (SOC) pool through the soil profile in different land-use systems, management practices and conditions prevalent in Australia. We investigated the quantity and distribution of SOC and DOC through the profile under three different land-use systems in northern NSW, Australia. A series of site clusters containing a representative range of land-uses (cultivated, improved pasture and woodland) were selected across the region. Within each land use, we determined SOC and DOC concentration and quantity down the soil profile to a depth of 0-100 cm using six soil depth increments. Here we discuss the distribution and relative importance of DOC down the soil profile to the storage and distribution of carbon. We compare and contrast the patterns associated with the different land use systems and explore potential mechanisms of carbon cycling in these soils. Near to the soil surface, SOC had larger concentrations in the order woodland>improved pasture>cropping at all sites studied. However, DOC was found in significantly larger concentrations in the woodland soils at all soil depths. The larger DOC:TOC ratio in woodland and improved pasture soils suggests a direct relationship between TOC and DOC but increased DOC:TOC ratio in deeper soil layers suggests an increasing importance of DOC in soil carbon cycling in these deeper soils under Australian conditions.

Origins of the Asian-Australian monsoons related to Cenozoic plate movement and Tibetan Plateau uplift - A modeling study

NASA Astrophysics Data System (ADS)

Liu, X.; Dong, B.; Yin, Z. Y.; Smith, R. S.; Guo, Q.

2017-12-01

The origin of monsoon is a subject that has attracted much attention in the scientific community and even today it is still controversial. According to geological records, there is conflicting evidence regarding the timings of establishment of the monsoon climates in South Asia, East Asia, and northern Australia. Additionally, different explanations for the monsoon origins have been derived from various numerical simulations. To further investigate the origin and evolution of the Asian and Australian monsoons, we designed a series of numerical experiments using a coupled atmospheric-oceanic general circulation model. Since the Indian-Australian plate has shifted its position significantly during the Cenozoic, together with the large-scale uplift of the Tibetan Plateau (TP), in these experiments we considered the configurations of ocean-land masses and large topographic features based on geological evidence of plate motion and TP uplift in 5 typical Cenozoic geological periods: mid-Paleocene ( 60Ma), late-Eocene ( 40Ma), late-Oligocene ( 25Ma), late-Miocene ( 10Ma), and present day. These experiments allowed us to examine the combined effects of the changes in the land-ocean configuration due to plate movement and TP uplift, they also provided insight into the effects of the high CO2 levels during the Eocene. The simulations revealed that during the Paleocene, the Indian Subcontinent was still positioned in the Southern Hemisphere (SH) and, therefore, its climate behaved as the SH tropical monsoon. By the late Eocene, it moved into the tropical Northern Hemisphere, which allowed the establishment of the South Asian monsoon. In contrast, the East Asian and Australian monsoon did not exist in the late Oligocene. These monsoon systems were established in the Miocene and then enhanced thereafter. Establishments of the low-latitude monsoons in South Asia and Australia were entirely determined by the position of the Indian-Australian plate and not related to the TP uplift. On the other hand, establishment of the mid-latitude East Asian monsoon was strongly dependent on the plateau uplift. These results suggest that the timings and causes of establishments of monsoon climates are different in South Asia, East Asia, and northern Australia.

A 20-year simulated climatology of global dust aerosol deposition.

PubMed

Zheng, Yu; Zhao, Tianliang; Che, Huizheng; Liu, Yu; Han, Yongxiang; Liu, Chong; Xiong, Jie; Liu, Jianhui; Zhou, Yike

2016-07-01

Based on a 20-year (1991-2010) simulation of dust aerosol deposition with the global climate model CAM5.1 (Community Atmosphere Model, version 5.1), the spatial and temporal variations of dust aerosol deposition were analyzed using climate statistical methods. The results indicated that the annual amount of global dust aerosol deposition was approximately 1161±31Mt, with a decreasing trend, and its interannual variation range of 2.70% over 1991-2010. The 20-year average ratio of global dust dry to wet depositions was 1.12, with interannual variation of 2.24%, showing the quantity of dry deposition of dust aerosol was greater than dust wet deposition. High dry deposition was centered over continental deserts and surrounding regions, while wet deposition was a dominant deposition process over the North Atlantic, North Pacific and northern Indian Ocean. Furthermore, both dry and wet deposition presented a zonal distribution. To examine the regional changes of dust aerosol deposition on land and sea areas, we chose the North Atlantic, Eurasia, northern Indian Ocean, North Pacific and Australia to analyze the interannual and seasonal variations of dust deposition and dry-to-wet deposition ratio. The deposition amounts of each region showed interannual fluctuations with the largest variation range at around 26.96% in the northern Indian Ocean area, followed by the North Pacific (16.47%), Australia (9.76%), North Atlantic (9.43%) and Eurasia (6.03%). The northern Indian Ocean also had the greatest amplitude of interannual variation in dry-to-wet deposition ratio, at 22.41%, followed by the North Atlantic (9.69%), Australia (6.82%), North Pacific (6.31%) and Eurasia (4.36%). Dust aerosol presented a seasonal cycle, with typically strong deposition in spring and summer and weak deposition in autumn and winter. The dust deposition over the northern Indian Ocean exhibited the greatest seasonal change range at about 118.00%, while the North Atlantic showed the lowest seasonal change at around 30.23%. The northern Indian Ocean had the greatest seasonal variation range of dry-to-wet deposition ratio, at around 74.57%, while Eurasia had the lowest, at around 12.14%. Copyright © 2016 Elsevier B.V. All rights reserved.

Can land use intensification in the Mallee, Australia increase the supply of soluble iron to the Southern Ocean?

PubMed Central

Bhattachan, Abinash; D'Odorico, Paolo

2014-01-01

The supply of soluble iron through atmospheric dust deposition limits the productivity of the Southern Ocean. In comparison to the Northern Hemisphere, the Southern Hemisphere exhibits low levels of dust activity. However, given their proximity to the Southern Ocean, dust emissions from continental sources in the Southern Hemisphere could have disproportionate impact on ocean productivity. Australia is the largest source of dust in the Southern Hemisphere and aeolian transport of dust has major ecological, economic and health implications. In the Mallee, agriculture is a major driver of dust emissions and dust storms that affect Southeastern Australia. In this study, we assess the dust generating potential of the sediment from the Mallee, analyze the sediment for soluble iron content and determine the likely depositional region of the emitted dust. Our results suggest that the Mallee sediments have comparable dust generating potential to other currently active dust sources in the Southern Hemisphere and the dust-sized fraction is rich in soluble iron. Forward trajectory analyses show that this dust will impact the Tasman Sea and the Australian section of the Southern Ocean. This iron-rich dust could stimulate ocean productivity in future as more areas are reactivated as a result of land-use and droughts. PMID:25109703

Flow characteristics of rivers in northern Australia: Implications for development

NASA Astrophysics Data System (ADS)

Petheram, Cuan; McMahon, Thomas A.; Peel, Murray C.

2008-07-01

SummaryAnnual, monthly and daily streamflows from 99 unregulated rivers across northern Australia were analysed to assess the general surface water resources of the region and their implications for development. The potential for carry-over storages was assessed using the Gould-Dincer Gamma method, which utilises the mean, standard deviation, skewness and lag-one serial correlation coefficient of annual flows. Runs Analysis was used to describe the characteristics of drought in northern Australia and the potential for 'active' water harvesting was evaluated by Base Flow Separation, Flow Duration Curves and Spells Analysis. These parameters for northern Australia were compared with data from southern Australia and data for similar Köppen class from around the world. Notably, the variability and seasonality of annual streamflow across northern Australia were observed to be high compared with that of similar Köppen classes from the rest of the world (RoW). The high inter-annual variability of runoff means that carry-over storages in northern Australia will need to be considerably larger than for rivers from the RoW (assuming similar mean annual runoff, yield and reliability). For example, in the three major Köppen zones across the North, it was possible (theoretically) to only exploit approximately 33% (Köppen Aw; n = 6), 25% (Köppen BSh; n = 12) and 13% (Köppen BWh; n = 11) of mean annual streamflow (assuming a hypothetical storage size equal to the mean annual flow). Over 90% of north Australian rivers had a Base Flow Index of less than 0.4, 72% had negative annual lag-one autocorrelation values and in half the rivers sampled greater than 80% of the total flow occurred during the 3-month peak period. These data confirm that flow in the rivers of northern Australia is largely event driven and that the north Australian environment has limited natural storage capacity. Hence, there is relatively little opportunity in many northern rivers to actively harvest water for on-farm storage, particularly under environmental flow rules that stipulate that water can only be extracted during the falling limb of a hydrograph. Streamflow drought severity, the product of drought length and magnitude, was found to be greater in northern Australia than in similar climatic regions of the RoW, due to higher inter-annual variability increasing the drought magnitude over the course of normal drought lengths. The high likelihood of severe drought means that agriculturalists seeking to irrigate from rivers in northern Australia should have especially well developed drought contingency plans.

Degradation of the Mitchell River fluvial megafan by alluvial gully erosion increased by post-European land use change, Queensland, Australia

NASA Astrophysics Data System (ADS)

Shellberg, J. G.; Spencer, J.; Brooks, A. P.; Pietsch, T. J.

2016-08-01

Along low gradient rivers in northern Australia, there is widespread gully erosion into unconfined alluvial deposits of active and inactive floodplains. On the Mitchell River fluvial megafan in northern Queensland, river incision and fan-head trenching into Pleistocene and Holocene megafan units with sodic soils created the potential energy for a secondary cycle of erosion. In this study, rates of alluvial gully erosion into incipiently-unstable channel banks and/or pre-existing floodplain features were quantified to assess the influence of land use change following European settlement. Alluvial gully scarp retreat rates were quantified at 18 sites across the megafan using recent GPS surveys and historic air photos, demonstrating rapid increases in gully area of 1.2 to 10 times their 1949 values. Extrapolation of gully area growth trends backward in time suggested that the current widespread phase of gullying initiated between 1880 and 1950, which is post-European settlement. This is supported by young optically stimulated luminescence (OSL) dates of gully inset-floodplain deposits, LiDAR terrain analysis, historic explorer accounts of earlier gully types, and archival records of cattle numbers and land management. It is deduced that intense cattle grazing and associated disturbance concentrated in the riparian zones during the dry season promoted gully erosion in the wet season along steep banks, adjacent floodplain hollows and precursor gullies. This is a result of reduced native grass cover, increased physical disturbance of soils, and the concentration of water runoff along cattle tracks, in addition to fire regime modifications, episodic drought, and the establishment of exotic weed and grass species. Geomorphic processes operating over geologic time across the fluvial megafan predisposed the landscape to being pushed by land used change across an intrinsically close geomorphic threshold towards instability. The evolution of these alluvial gullies is discussed in terms of their initiation, development, future growth, and stabilisation, and the numerous natural and anthropogenic factors influencing their erosion.

Landscape Changes Influence the Occurrence of the Melioidosis Bacterium Burkholderia pseudomallei in Soil in Northern Australia

PubMed Central

Kaestli, Mirjam; Mayo, Mark; Harrington, Glenda; Ward, Linda; Watt, Felicity; Hill, Jason V.; Cheng, Allen C.; Currie, Bart J.

2009-01-01

Background The soil-dwelling saprophyte bacterium Burkholderia pseudomallei is the cause of melioidosis, a severe disease of humans and animals in southeast Asia and northern Australia. Despite the detection of B. pseudomallei in various soil and water samples from endemic areas, the environmental habitat of B. pseudomallei remains unclear. Methodology/Principal Findings We performed a large survey in the Darwin area in tropical Australia and screened 809 soil samples for the presence of these bacteria. B. pseudomallei were detected by using a recently developed and validated protocol involving soil DNA extraction and real-time PCR targeting the B. pseudomallei–specific Type III Secretion System TTS1 gene cluster. Statistical analyses such as multivariable cluster logistic regression and principal component analysis were performed to assess the association of B. pseudomallei with environmental factors. The combination of factors describing the habitat of B. pseudomallei differed between undisturbed sites and environmentally manipulated areas. At undisturbed sites, the occurrence of B. pseudomallei was found to be significantly associated with areas rich in grasses, whereas at environmentally disturbed sites, B. pseudomallei was associated with the presence of livestock animals, lower soil pH and different combinations of soil texture and colour. Conclusions/Significance This study contributes to the elucidation of environmental factors influencing the occurrence of B. pseudomallei and raises concerns that B. pseudomallei may spread due to changes in land use. PMID:19156200

The dominant erosion processes supplying fine sediment to three major rivers in tropical Australia, the Daly (NT), Mitchell (Qld) and Flinders (Qld) Rivers

NASA Astrophysics Data System (ADS)

Caitcheon, Gary G.; Olley, Jon M.; Pantus, Francis; Hancock, Gary; Leslie, Christopher

2012-05-01

The tropics of northern Australia have received relatively little attention with regard to the impact of soil erosion on the many large river systems that are an important part of Australia's water resource, especially given the high potential for erosion when long dry seasons are followed by intense wet season rain. Here we use 137Cs concentrations to determine the erosion processes supplying sediment to two major northern Australian Rivers; the Daly River (Northern Territory), and the Mitchell River (Queensland). We also present data from five sediment samples collected from a 100 km reach of the Cloncurry River, a major tributary of the Flinders River (Queensland). Concentrations of 137Cs in the surface soil and subsurface (channel banks and gully) samples were used to derive 'best fit' probability density functions describing their distributions. These modelled distributions are then used to estimate the relative contribution of these two components to the river sediments. Our results are consistent with channel and gully erosion being the dominant source of sediment, with more than 90% of sediment transported along the main stem of these rivers originating from subsoil. We summarize the findings of similar studies on tropical Australian rivers and conclude that the primary source of sediment delivered to these systems is gully and channel bank erosion. Previously, as a result of catchment scale modelling, sheet-wash and rill erosion was considered to be the major sediment source in these rivers. Identifying the relative importance of sediment sources, as shown in this paper, will provide valuable information for land management planning in the region. This study also reinforces the importance of testing model predictions before they are used to target investment in remedial action.

The Ross Orogen and Lachlan Fold Belt in Marie Byrd Land, Northern Victoria Land and New Zealand: implication for the tectonic setting of the Lachlan Fold Belt in Antarctica

USGS Publications Warehouse

Bradshaw, J.D.

2007-01-01

Correlation of the Cambrian Delamerian Orogen of Australia and Ross Orogen of the Transantarctic Mountains widely accepted but the extension of the adjacent Lachlan Orogen into Antarctica is controversial. Outside the main Ross-Delamerian belt, evidence of this orogeny is preserved at Mt Murphy in Marie Byrd Land and the in Takaka Terrane of New Zealand. In all pre-break- configurations of the SW Pacific, these two areas are far removed from the Ross-Delamerian belt. Evidence from conglomerates in the Takaka Terrane, however, shows that in Late Cambrian times it was adjacent to the Ross Orogen. This indicates major tectonic displacements within Gondwana after the Cambrian and before break-up. The Lachlan Orogen formed in an extensional belt in a supra-subduction zone setting and the Cambrian rocks of Marie Byrd Land and New Zealand are interpreted as parts of a rifted continental ribbon on the outboard side of the Lachlan belt.

Enhancement of vegetation-rainfall feedbacks on the Australian summer monsoon by the Madden-Julian Oscillation

NASA Astrophysics Data System (ADS)

Notaro, Michael

2018-01-01

A regional climate modeling analysis of the Australian monsoon system reveals a substantial modulation of vegetation-rainfall feedbacks by the Madden Julian Oscillation (MJO), both of which operate at similar sub-seasonal time scales, as evidence that the intensity of land-atmosphere interactions is sensitive to the background atmospheric state. Based on ensemble experiments with imposed modification of northern Australian leaf area index (LAI), the atmospheric responses to LAI anomalies are composited for negative and positive modes of the propagating MJO. In the regional climate model (RCM), northern Australian vegetation feedbacks are characterized by evapotranspiration (ET)-driven rainfall responses, with the moisture feedback mechanism dominating over albedo and roughness feedback mechanisms. During November-April, both Tropical Rainfall Measuring Mission and RCM data reveal MJO's pronounced influence on rainfall patterns across northern Australia, tropical Indian Ocean, Timor Sea, Arafura Sea, and Gulf of Carpentaria, with the MJO dominating over vegetation feedbacks in terms of regulating monsoon rainfall variability. Convectively-active MJO phases support an enhancement of positive vegetation feedbacks on monsoon rainfall. While the MJO imposes minimal regulation of ET responses to LAI anomalies, the vegetation feedback-induced responses in precipitable water, cloud water, and rainfall are greatly enhanced during convectively-active MJO phases over northern Australia, which are characterized by intense low-level convergence and efficient precipitable water conversion. The sub-seasonal response of vegetation-rainfall feedback intensity to the MJO is complex, with significant enhancement of rainfall responses to LAI anomalies in February during convectively-active MJO phases compared to minimal modulation by the MJO during prior and subsequent calendar months.

Investigation into High Barmah Forest Virus Disease Case Numbers Reported in the Northern Territory, Australia in 2012-2013.

PubMed

Kurucz, Nina; Markey, Peter; Draper, Anthony; Melville, Lorna; Weir, Richard; Davis, Steven; Warchot, Allan; Boyd, Rowena; Stokeld, Danielle

2016-02-01

Between October 2012 and October 2013, unprecedented high numbers of Barmah Forest virus (BFV) disease cases were reported in the Northern Territory (NT). An investigation was launched by the NT Department of Health in cooperation with the Department of Primary Industry and Fisheries and the Department of Land Resource Management to investigate possible causes for this phenomenon. The investigation included virus isolations from mosquitoes collected in Darwin urban areas, BFV antibody testing in peri-urban small mammals and a human BFV disease case series investigation of recent cases. No BFV was isolated from the 4641 mosquitoes tested, none of the mammals tested positive for BFV antibodies, and the high BFV disease case numbers did not correlate with the relatively low mosquito vector numbers trapped in 2012-2013. It was estimated that up to 89% of the 79 human cases investigated did not have an acute arboviral illness and therefore had tested falsely positive. An Alere PanBio BFV immunoglobulin M enzyme-linked immunosorbent assay test kit is generally used to test for BFV, with the BFV disease case definition based on immunoglobulin M positives only. Other jurisdictions in Australia also reported high numbers of BFV disease cases, with the majority of the cases suspected to be false positives. Therefore, current testing methods need to be revised to reflect the true numbers of BFV disease cases occurring in Australia and to provide correct diagnoses for patients.

A revised climatology of SE Australia at the LGM

NASA Astrophysics Data System (ADS)

Shulmeister, James; Cohen, Tim; Kiernan, Kevin; Woodward, Craig; Clark, Doug; Fitzsimmons, Kat; Kemp, Justine; Gontz, Allen; Haworth, Robert; Moss, Patrick; Chang, Jie; Mueller, Daniela; Slee, Adrian; Ellerton, Dan

2015-04-01

This paper summarises some of the results of a recently completed project aimed at defining climate conditions at the LGM in south eastern Australia. We conclude that overall cooling on the SE mainland was 8-10°C but that cooling along the eastern coastal strip and in Tasmania was somewhat less (4-7°C). The persistence of a humid climate along the east coast and in the adjacent highlands allowed rivers to flow more strongly than during the Holocene. We suggest that onshore flow on the northern limbs of east coast high pressure cells, supplemented by moisture from east coast lows maintained this humid fringe. The processes were enhanced by increased sea-land temperature contrasts especially in winter and by reduced evapotranspiration under lower temperatures and altered vegetation cover. We can explain most of the paleoenvironmental observations in SE Australia at the LGM by invoking an enhanced high pressure cell over the modern SE mainland while westerly flow continued to dominate in Tasmania. At the true LGM westerly penetration of the SE mainland was reduced but east coast systems were either unaffected or enhanced.

Northern Australia

Atmospheric Science Data Center

2013-04-16

article title:  Tropical Northern Australia   ... view. Water appears in blue shades in the right image, for example, because glitter makes the water look brighter at the aft camera's view ... MD. The MISR data were obtained from the NASA Langley Research Center Atmospheric Science Data Center in Hampton, VA. Image ...

Using measures of wellbeing for impact evaluation: Proof of concept developed with an Indigenous community undertaking land management programs in northern Australia.

PubMed

Larson, Silva; Stoeckl, Natalie; Jarvis, Diane; Addison, Jane; Prior, Sharon; Esparon, Michelle

2018-05-05

Combining insights from literature on the Theory of Change, Impact Evaluation, and Wellbeing, we develop a novel approach to assessing impacts. Intended beneficiaries identify and rate factors that are important to their wellbeing, their satisfaction with those factors now, and before an intervention. Qualitative responses to questions about perceived changes and causes of change are linked to quantitative data to draw inferences about the existence and/or importance of impact(s). We use data from 67 Ewamian people, in a case study relating to Indigenous land management, to provide proof of concept. 'Knowing that country is being looked after' and 'Having legal right/access to the country' were identified as important to wellbeing, with perceptions that Native Title determination, declared Indigenous Protected Area and associated land management programs have had a significant and positive impact on them. Further method testing might determine the utility of this approach in a wide range of settings.

The characterisation and management of greenhouse gas emissions from fires in northern Australian savannas

NASA Astrophysics Data System (ADS)

Cook, G. D.; Liedloff, A. C.; Richards, A. E.; Meyer, M.

2016-12-01

Australia is the only OECD country with a significant area of tropical savannas within it borders. Approximately 220 000 km2 of these savannas burn every year releasing 2 to 4 % of Australia's accountable greenhouse gas emissions. Reduction in uncertainty in the quantification of these emissions of methane and nitrous has been fundamental to improving both the national GHG inventory and developing approaches to better manage land to reduce these emissions. Projects to reduce pyrogenic emissions have been adopted across 30% of Australia's high rainfall savannas. Recent work has focussed on quantifying the additional benefit of increased carbon stocks in fine fuel and coarse woody debris (CWD) resulting from improvements in fire management. An integrated set of equations have been developed to enable seemless quantification of emissions and sequestration in these frequently burnt savannas. These show that increases in carbon stored in fine fuel and CWD comprises about 3 times the emissions abatement from improvements in fire management that have been achieved in a project area of 28 000 km2. Future work is focussing on improving the understanding of spatial and temporal variation in fire behaviour across Australia's savanna biome, improvements in quantification of carbon dynamics of CWD and improved quantification of the effects of fire on carbon dynamics in soils of the savannas.

Cyanobacterial crusts linked to soil productivity under different grazing management practices in Northern Australia

NASA Astrophysics Data System (ADS)

Alchin, Bruce; Williams, Wendy

2015-04-01

In arid and semi-arid Australia, the central role of healthy soil ecosystems in broad-acre grazing lands may be attributed to the widespread presence of cyanobacterial crusts. In terms of soil nutrient cycling and stability their role is particularly crucial in a climate dominated by annual dry seasons and variable wet seasons. In this study, we aimed to measure the contribution of cyanobacteria to soil nutrient cycling under contrasting levels of disturbance associated with grazing management. Field sampling was carried out on six paired sites (twelve properties) located across an east-west 3,000 km transect that covered different rangeland types on grazing properties in northern Australia (Queensland, Northern Territory and Western Australia). At each location paired sites were established and two different management systems were assessed, cell-paddock rotations (25-400 ha) and continuous grazing (200-2,000 ha). Cyanobacterial soil crusts were recorded from all of the twelve sites and cyanobacteria with the capacity to fix nitrogen were found at ten of the twelve sites. The overall diversity of cyanobacteria varied from three to ten species under any type of grazing system. As field work was conducted in the dry season, it is likely that the diversity may be greater in the wet season than the initial data may indicate. The average cyanobacterial soil crust cover across soil surfaces, between grass tussocks, during the dry season was estimated to be 50.9% and, 42.6% in the early wet season. This reflected longer established crust cover (dry season) versus newly established crusts. There was a high level of variability in the biomass of cyanobacteria however; the grazing system did not have any marked effect on the biomass for any one rangeland type. The grazing system differences did not appear to significantly influence the diversity at any location except on a floodplain in the Pilbara (WA). Biological nitrogen fixation by cyanobacteria was recorded at all sites. Nitrogen fixation rates were significantly higher in the wet season samples compared to the dry season. Rates of nitrogen fixation, mineralisable nitrogen and cyanobacterial biomass were comparative to other studies both in Australia and globally. Eleven of the twelve sites had higher plant-available (mineralisable) nitrogen in the 0-1 cm depth compared to the 1-5 cm depth. Nitrogen isotopes showed that the nitrogen concentration found in the surface soils (0-1 cm) from five sites originated from cyanobacterial nitrogen fixation. At the remaining sites the isotopic signatures were slightly more positive, indicative of fractionation. The results have substantiated the link between cyanobacteria and their contribution to carbon and nitrogen cycling across the northern Australian rangelands. The data also highlights the variability between sites and management practices that influence biogeochemical processes that affect soil productivity.

Building a Continental Scale Land Cover Monitoring Framework for Australia

NASA Astrophysics Data System (ADS)

Thankappan, Medhavy; Lymburner, Leo; Tan, Peter; McIntyre, Alexis; Curnow, Steven; Lewis, Adam

2012-04-01

Land cover information is critical for national reporting and decision making in Australia. A review of information requirements for reporting on national environmental indicators identified the need for consistent land cover information to be compared against a baseline. A Dynamic Land Cover Dataset (DLCD) for Australia has been developed by Geoscience Australia and the Australian Bureau of Agriculture and Resource Economics and Sciences (ABARES) recently, to provide a comprehensive and consistent land cover information baseline to enable monitoring and reporting for sustainable farming practices, water resource management, soil erosion, and forests at national and regional scales. The DLCD was produced from the analysis of Enhanced Vegetation Index (EVI) data at 250-metre resolution derived from the Moderate Resolution Imaging Spectroradiometer (MODIS) for the period from 2000 to 2008. The EVI time series data for each pixel was modelled as 12 coefficients based on the statistical, phenological and seasonal characteristics. The time series were then clustered in coefficients spaces and labelled using ancillary information on vegetation and land use at the catchment scale. The accuracy of the DLCD was assessed using field survey data over 25,000 locations provided by vegetation and land management agencies in State and Territory jurisdictions, and by ABARES. The DLCD is seen as the first in a series of steps to build a framework for national land cover monitoring in Australia. A robust methodology to provide annual updates to the DLCD is currently being developed at Geoscience Australia. There is also a growing demand from the user community for land cover information at better spatial resolution than currently available through the DLCD. Global land cover mapping initiatives that rely on Earth observation data offer many opportunities for national and international programs to work in concert and deliver better outcomes by streamlining efforts on development and validation of land cover products. Among the upcoming missions, the Global Monitoring for Environment and Security (GMES) Sentinel-2 satellites are seen as an important source of optical data for updating land cover information in Australia. This paper outlines the DLCD development, key applications that inform nationally significant issues, further work on updating the DLCD that would enable transition to a national land cover monitoring framework, challenges and approaches to delivering land cover information at higher spatial resolutions on a continental scale, and the potential value of data from the Sentinel-2 mission in supporting land cover monitoring in Australia and globally.

Characterizing phenological vegetation dynamics amidst extreme climate variability in Australia with MODIS VI data

NASA Astrophysics Data System (ADS)

Broich, M.; Huete, A. R.; Xuanlon, M.; Davies, K.; Restrepo-Coupe, N.; Ratana, P.

2012-12-01

Australia's climate is extremely variable with inter-annual rainfall at any given site varying by 5- or 6-fold or more, across the continent. In addition to such inter-annual variability, there can be significant intra-annual variability, especially in monsoonal Australia (e.g. the wet tropical savannas) and Mediterranean climates in SW Australia where prolonged dry seasons occur each year. This presents unique challenges to the characterization of seasonal dynamics with satellite datasets. In contrast to annual reoccurring temperature-driven phenology of northern hemisphere mid-latitudes, vegetation dynamics of the vast and dry Australian interior are poorly quantified by existing remote sensing products. For example, in the current global-based MODIS phenology product, central Australia is covered by ~30% fill values for any given year. Two challenges are specific to Australian landscapes: first, the difficulty of characterizing seasonality of rainfall-driven ecosystems in interior Australia where duration and magnitude of green-up and brown down cycles show high inter annual variability; second, modeling two phenologic layers, the trees and the grass in savannas were the trees are evergreen but the herbaceous understory varies with rainfall. Savannas cover >50% of Australia. Australia's vegetation and climate are different from other continents. A MODIS phenology product capable of characterizing vegetation dynamics across the continent is being developed in this research as part of the AusCover national expert network aiming to provide Australian biophysical remote sensing data time-series and continental-scale map products. These products aim to support the Terrestrial Ecosystem Research Network (TERN) serving ecosystem research in Australia. The MODIS land surface product for Australia first searches the entire time series of each Climate Modeling Grid pixel for low-high-low extreme point sequences. A double logistic function is then fit to each of these sequences allowing identification of growth periods with different magnitudes and durations anywhere in the time series. Results show that the highest absolute variability in peak greenness occurred in cropped areas while the highest relative variability (coefficient of variation) occurred in interior Australia particularly around Lake Eyre, the center of a closed drainage basin in the dry interior of the continent. Across the desert interior, the timing of the green-up onset and the peak greenness was correlated with the landfall of cyclones and the inland penetration and strength of the north Australian summer monsoon (represented by TRMM data). The variability of Australian land surface phenology magnitude and timing was found to be strongly correlated with the swings between La Nina and El Nino events. The information on vegetation dynamics represented here is critical for land surface, fuel accumulation, agricultural production, and permanent ecosystem change modeling in relation to climate trends. A unique research opportunity is provided by recent climate variability: in 2010 a persistent El Nino has given way to a strong two-year La Nina breaking a decade long drought that was followed by record-breaking rainfall across most of the continent and extensive flooding followed by sustained greening.

Integrating deep Earth dynamics in paleogeographic reconstructions of Australia

NASA Astrophysics Data System (ADS)

Heine, Christian; Müller, R. Dietmar; Steinberger, Bernhard; DiCaprio, Lydia

2010-03-01

It is well documented that the Cenozoic progressive flooding of Australia, contemporaneous with a eustatic sea level fall, requires a downward tilting of the Australian Plate towards the SE Asian subduction system. Previously, this large-scale, mantle-convection driven dynamic topography effect has been approximated by computing the time-dependent vertical shifts and tilts of a plane, but the observed subsidence and uplift anomalies indicate a more complex interplay between time-dependent mantle convection and plate motion. We combine plate kinematics with a global mantle backward-advection model based on shear-wave mantle tomography, paleogeographic data, eustatic sea level estimates and basin stratigraphy to reconstruct the Australian flooding history for the last 70 Myrs on a continental scale. We compute time-dependent dynamic surface topography and continental inundation of a digital elevation model adjusted for sediment accumulation. Our model reveals two evolving dynamic topography lows, over which the Australian plate has progressively moved. We interpret the southern low to be caused by sinking slab material with an origin along the eastern Gondwana subduction zone in the Cretaceous, whereas the northern low, which first straddles northern Australia in the Oligocene, is mainly attributable to material subducted north and northeast of Australia. Our model accounts for the Paleogene exposure of the Gulf of Carpentaria region at a time when sea level was much higher than today, and explains anomalous Late Tertiary subsidence on Australia's northern, western and southern margins. The resolution of our model, which excludes short-wavelength mantle density anomalies and is restricted to depths larger than 220 km, is not sufficient to model the two well recorded episodes of major transgressions in South Australia in the Eocene and Miocene. However, the overall, long-wavelength spatio-temporal pattern of Australia's inundation record is well captured by combining our modelled dynamic topography with a recent eustatic sea level curve. We suggest that the apparent Late Cenozoic northward tilting of Australia was a stepwise function of South Australia first moving away northwards from the Gondwana subduction-related dynamic topography low in the Oligocene, now found under the Australian-Antarctic Discordance, followed by a drawing down of northern Australia as it overrode a slab burial ground now underlying much of the northern half of Australia, starting in the Miocene. Our model suggests that today's geography of Australia is strongly dependent on mantle forces. Without mantle convection, which draws Australia down by up to 300 m, nearly all of Australia's continental shelves would be exposed. We conclude that dissecting the interplay between eustasy and mantle-driven dynamic topography is critical for understanding hinterland uplift, basin subsidence, the formation and destruction of shallow epeiric seas and their facies distribution, but also for the evolution of petroleum systems.

Ecosystem Services in Agricultural Landscapes: A Spatially Explicit Approach to Support Sustainable Soil Management

PubMed Central

Crossman, Neville D.; MacEwan, Richard J.; Wallace, D. Dugal; Bennett, Lauren T.

2014-01-01

Soil degradation has been associated with a lack of adequate consideration of soil ecosystem services. We demonstrate a broadly applicable method for mapping changes in the supply of two priority soil ecosystem services to support decisions about sustainable land-use configurations. We used a landscape-scale study area of 302 km2 in northern Victoria, south-eastern Australia, which has been cleared for intensive agriculture. Indicators representing priority soil services (soil carbon sequestration and soil water storage) were quantified and mapped under both a current and a future 25-year land-use scenario (the latter including a greater diversity of land uses and increased perennial crops and irrigation). We combined diverse methods, including soil analysis using mid-infrared spectroscopy, soil biophysical modelling, and geostatistical interpolation. Our analysis suggests that the future land-use scenario would increase the landscape-level supply of both services over 25 years. Soil organic carbon content and water storage to 30 cm depth were predicted to increase by about 11% and 22%, respectively. Our service maps revealed the locations of hotspots, as well as potential trade-offs in service supply under new land-use configurations. The study highlights the need to consider diverse land uses in sustainable management of soil services in changing agricultural landscapes. PMID:24616632

Ecosystem services in agricultural landscapes: a spatially explicit approach to support sustainable soil management.

PubMed

Forouzangohar, Mohsen; Crossman, Neville D; MacEwan, Richard J; Wallace, D Dugal; Bennett, Lauren T

2014-01-01

Soil degradation has been associated with a lack of adequate consideration of soil ecosystem services. We demonstrate a broadly applicable method for mapping changes in the supply of two priority soil ecosystem services to support decisions about sustainable land-use configurations. We used a landscape-scale study area of 302 km(2) in northern Victoria, south-eastern Australia, which has been cleared for intensive agriculture. Indicators representing priority soil services (soil carbon sequestration and soil water storage) were quantified and mapped under both a current and a future 25-year land-use scenario (the latter including a greater diversity of land uses and increased perennial crops and irrigation). We combined diverse methods, including soil analysis using mid-infrared spectroscopy, soil biophysical modelling, and geostatistical interpolation. Our analysis suggests that the future land-use scenario would increase the landscape-level supply of both services over 25 years. Soil organic carbon content and water storage to 30 cm depth were predicted to increase by about 11% and 22%, respectively. Our service maps revealed the locations of hotspots, as well as potential trade-offs in service supply under new land-use configurations. The study highlights the need to consider diverse land uses in sustainable management of soil services in changing agricultural landscapes.

To Be Transformed: Emotions in Cross-Cultural, Field-Based Learning in Northern Australia

ERIC Educational Resources Information Center

Wright, Sarah; Hodge, Paul

2012-01-01

Students undertaking field-based learning, in which they work with Indigenous people in Northern Australia, describe a profound learning experience redolent with emotion. Inspired, challenged and transformed, the students are compelled in ways that require them to interrogate their own selves and taken-for-granted beliefs. In this paper, we draw…

Regional Disparities in Apprentice Attrition Rates: Heat and Quarter Four's Significance in Northern Australia

ERIC Educational Resources Information Center

Zoellner, Don; Brearley, Matt; Oppermann, Elspeth

2017-01-01

Apprenticeship completion rates have remained persistently low for decades in spite of broad agreement over the causes of non-completions. A possible factor missing from these explanations is climate, particularly in northern Australia where traditional trade apprentices are exposed to extreme conditions and exert themselves. We hypothesize that:…

Diabetic Foot Care: Developing Culturally Appropriate Educational Tools for Aboriginal and Torres Strait Islander Peoples in the Northern Territory, Australia.

ERIC Educational Resources Information Center

Watson, Jennifer; Obersteller, Elizabeth A.; Rennie, Linda; Whitbread, Cherie

2001-01-01

Participatory research in Australia's Northern Territory sought opinions from nurses, general practitioners, Aboriginal health workers, and Aboriginal and Torres Strait Islanders on the development of culturally relevant foot care education for Indigenous people with diabetes. They decided to use a visual approach (posters and flip charts) to…

Drinking & Congenital Birth Defects: Alcohol Awareness in the Northern Rivers Region of New South Wales, Australia

ERIC Educational Resources Information Center

Yeigh, Tony; Dip, Grad; Kean, Brian

2005-01-01

Purpose: Guidelines developed to minimise the risk of harm associated with alcohol consumption in Australia focus on promoting population health by changing cultural attitudes. This research study was conducted to uncover attitudes toward maternal drinking and awareness of alcohol-related birth defects within the semi-rural Northern Rivers area of…

Greenhouse gas network design using backward Lagrangian particle dispersion modelling - Part 1: Methodology and Australian test case

NASA Astrophysics Data System (ADS)

Ziehn, T.; Nickless, A.; Rayner, P. J.; Law, R. M.; Roff, G.; Fraser, P.

2014-09-01

This paper describes the generation of optimal atmospheric measurement networks for determining carbon dioxide fluxes over Australia using inverse methods. A Lagrangian particle dispersion model is used in reverse mode together with a Bayesian inverse modelling framework to calculate the relationship between weekly surface fluxes, comprising contributions from the biosphere and fossil fuel combustion, and hourly concentration observations for the Australian continent. Meteorological driving fields are provided by the regional version of the Australian Community Climate and Earth System Simulator (ACCESS) at 12 km resolution at an hourly timescale. Prior uncertainties are derived on a weekly timescale for biosphere fluxes and fossil fuel emissions from high-resolution model runs using the Community Atmosphere Biosphere Land Exchange (CABLE) model and the Fossil Fuel Data Assimilation System (FFDAS) respectively. The influence from outside the modelled domain is investigated, but proves to be negligible for the network design. Existing ground-based measurement stations in Australia are assessed in terms of their ability to constrain local flux estimates from the land. We find that the six stations that are currently operational are already able to reduce the uncertainties on surface flux estimates by about 30%. A candidate list of 59 stations is generated based on logistic constraints and an incremental optimisation scheme is used to extend the network of existing stations. In order to achieve an uncertainty reduction of about 50%, we need to double the number of measurement stations in Australia. Assuming equal data uncertainties for all sites, new stations would be mainly located in the northern and eastern part of the continent.

Reducing biting rates of Aedes aegypti with metofluthrin: investigations in time and space.

PubMed

Darbro, Jonathan M; Muzari, M Odwell; Giblin, Arthur; Adamczyk, Rebecca M; Ritchie, Scott A; Devine, Gregor J

2017-02-07

Indoor residual spraying is key to dengue control in Cairns and other parts of northern Queensland, Australia, where Aedes aegypti is prevalent, but the strategy faces challenges with regards to slow application time and, therefore, community coverage. A faster potential improvement might be the use of polyethylene netting impregnated with the volatile pyrethroid metofluthrin (SumiOne™). This formulation was assessed in rooms in three houses in Cairns, Australia. One emanator was placed in each room and cages of 10 female Aedes aegypti were exposed at distances of 1 and 3 m. Knockdown and landings on a human hand were counted before metofluthrin exposure and at 10, 30, 60, 90 and 120 min during exposure. In addition, two trials continued over 48 h of exposure to assess the long-term sublethal effects of metofluthrin on caged mosquitoes. Percentage landing rates fell to 0-2.5% in the first 10 min of exposure. Knockdown was most evident between 10 and 30 min (54% at 1 m and 33% at 3 m). Distance from the emanator strongly affected the results: mosquitoes at 3 m exhibited less knockdown and more landings than those at 1 m. As room volume increased, knockdown decreased and the number of landing increased. There is a cumulative mortality and landing inhibition and, for mosquitoes exposed to metofluthrin for > 48 h, mortality was 100% at 1 m and 90% at 3 m. Of those still alive, a small number continued to land and bite. After being removed from metofluthrin-treated rooms, exposed insect cages were found to reducing landing rates for up to 2 h. Despite only moderate levels of knockdown during the initial hours of exposure, metofluthrin emanators were effective in reducing mosquito landing rates, especially within 1 m, even when exposed on an open veranda. The evaluation methods and results described in this paper will help inform the optimal conditions of deployment of metofluthrin emanators. These devices have the potential to reduce contact between humans and urban disease vectors faster than indoor residual spraying so supplement our current arsenal of dengue control tools.

Examining the Impact of ABRACADABRA on Early Literacy in Northern Australia: An Implementation Fidelity Analysis

ERIC Educational Resources Information Center

Wolgemuth, Jennifer R.; Abrami, Philip C.; Helmer, Janet; Savage, Robert; Harper, Helen; Lea, Tess

2014-01-01

To address students' poor literacy outcomes, an intervention using a computer-based literacy tool, ABRACADABRA, was implemented in 6 Northern Australia primary schools. A pretest, posttest parallel group, single blind multisite randomized controlled trial was conducted with 308 students between the ages of 4 and 8 years old (M age = 5.8 years, SD…

Development and testing of transfer functions for generating quantitative climatic estimates from Australian pollen data

NASA Astrophysics Data System (ADS)

Cook, Ellyn J.; van der Kaars, Sander

2006-10-01

We review attempts to derive quantitative climatic estimates from Australian pollen data, including the climatic envelope, climatic indicator and modern analogue approaches, and outline the need to pursue alternatives for use as input to, or validation of, simulations by models of past, present and future climate patterns. To this end, we have constructed and tested modern pollen-climate transfer functions for mainland southeastern Australia and Tasmania using the existing southeastern Australian pollen database and for northern Australia using a new pollen database we are developing. After testing for statistical significance, 11 parameters were selected for mainland southeastern Australia, seven for Tasmania and six for northern Australia. The functions are based on weighted-averaging partial least squares regression and their predictive ability evaluated against modern observational climate data using leave-one-out cross-validation. Functions for summer, annual and winter rainfall and temperatures are most robust for southeastern Australia, while in Tasmania functions for minimum temperature of the coldest period, mean winter and mean annual temperature are the most reliable. In northern Australia, annual and summer rainfall and annual and summer moisture indexes are the strongest. The validation of all functions means all can be applied to Quaternary pollen records from these three areas with confidence. Copyright

Predicting bee community responses to land-use changes: Effects of geographic and taxonomic biases.

PubMed

De Palma, Adriana; Abrahamczyk, Stefan; Aizen, Marcelo A; Albrecht, Matthias; Basset, Yves; Bates, Adam; Blake, Robin J; Boutin, Céline; Bugter, Rob; Connop, Stuart; Cruz-López, Leopoldo; Cunningham, Saul A; Darvill, Ben; Diekötter, Tim; Dorn, Silvia; Downing, Nicola; Entling, Martin H; Farwig, Nina; Felicioli, Antonio; Fonte, Steven J; Fowler, Robert; Franzén, Markus; Goulson, Dave; Grass, Ingo; Hanley, Mick E; Hendrix, Stephen D; Herrmann, Farina; Herzog, Felix; Holzschuh, Andrea; Jauker, Birgit; Kessler, Michael; Knight, M E; Kruess, Andreas; Lavelle, Patrick; Le Féon, Violette; Lentini, Pia; Malone, Louise A; Marshall, Jon; Pachón, Eliana Martínez; McFrederick, Quinn S; Morales, Carolina L; Mudri-Stojnic, Sonja; Nates-Parra, Guiomar; Nilsson, Sven G; Öckinger, Erik; Osgathorpe, Lynne; Parra-H, Alejandro; Peres, Carlos A; Persson, Anna S; Petanidou, Theodora; Poveda, Katja; Power, Eileen F; Quaranta, Marino; Quintero, Carolina; Rader, Romina; Richards, Miriam H; Roulston, T'ai; Rousseau, Laurent; Sadler, Jonathan P; Samnegård, Ulrika; Schellhorn, Nancy A; Schüepp, Christof; Schweiger, Oliver; Smith-Pardo, Allan H; Steffan-Dewenter, Ingolf; Stout, Jane C; Tonietto, Rebecca K; Tscharntke, Teja; Tylianakis, Jason M; Verboven, Hans A F; Vergara, Carlos H; Verhulst, Jort; Westphal, Catrin; Yoon, Hyung Joo; Purvis, Andy

2016-08-11

Land-use change and intensification threaten bee populations worldwide, imperilling pollination services. Global models are needed to better characterise, project, and mitigate bees' responses to these human impacts. The available data are, however, geographically and taxonomically unrepresentative; most data are from North America and Western Europe, overrepresenting bumblebees and raising concerns that model results may not be generalizable to other regions and taxa. To assess whether the geographic and taxonomic biases of data could undermine effectiveness of models for conservation policy, we have collated from the published literature a global dataset of bee diversity at sites facing land-use change and intensification, and assess whether bee responses to these pressures vary across 11 regions (Western, Northern, Eastern and Southern Europe; North, Central and South America; Australia and New Zealand; South East Asia; Middle and Southern Africa) and between bumblebees and other bees. Our analyses highlight strong regionally-based responses of total abundance, species richness and Simpson's diversity to land use, caused by variation in the sensitivity of species and potentially in the nature of threats. These results suggest that global extrapolation of models based on geographically and taxonomically restricted data may underestimate the true uncertainty, increasing the risk of ecological surprises.

Genomic analysis of bluetongue virus episystems in Australia and Indonesia.

PubMed

Firth, Cadhla; Blasdell, Kim R; Amos-Ritchie, Rachel; Sendow, Indrawati; Agnihotri, Kalpana; Boyle, David B; Daniels, Peter; Kirkland, Peter D; Walker, Peter J

2017-11-23

The distribution of bluetongue viruses (BTV) in Australia is represented by two distinct and interconnected epidemiological systems (episystems)-one distributed primarily in the north and one in the east. The northern episystem is characterised by substantially greater antigenic diversity than the eastern episystem; yet the forces that act to limit the diversity present in the east remain unclear. Previous work has indicated that the northern episystem is linked to that of island South East Asia and Melanesia, and that BTV present in Indonesia, Papua New Guinea and East Timor, may act as source populations for new serotypes and genotypes of BTV to enter Australia's north. In this study, the genomes of 49 bluetongue viruses from the eastern episystem and 13 from Indonesia were sequenced and analysed along with 27 previously published genome sequences from the northern Australian episystem. The results of this analysis confirm that the Australian BTV population has its origins in the South East Asian/Melanesian episystem, and that incursions into northern Australia occur with some regularity. In addition, the presence of limited genetic diversity in the eastern episystem relative to that found in the north supports the presence of substantial, but not complete, barriers to gene flow between the northern and eastern Australian episystems. Genetic bottlenecks between each successive episystem are evident, and appear to be responsible for the reduction in BTV genetic diversity observed in the north to south-east direction.

Davenport Ranges, Northern Territory, Australia, SRTM Shaded Relief and Colored Height

NASA Image and Video Library

2005-01-06

The Davenport Ranges of central Australia have been inferred to be among the oldest persisting landforms on Earth, founded on the belief that the interior of Australia has been tectonically stable for at least 700 million years.

Developing a Model for the Measurement of Social Inclusion and Social Capital in Regional Australia

ERIC Educational Resources Information Center

Wilson, Lou

2006-01-01

This paper reviews the literature on social inclusion and social capital to develop a framework to guide the selection of items and measures for the forthcoming SA Department of Human Services Survey of Social Inclusion to be held in the region of Northern Adelaide in South Australia. Northern Adelaide is a region with areas of high socio-economic…

Sustainable Land Management and Adult Education: Issues for the Stakeholders of Australia's Tropical Savannas.

ERIC Educational Resources Information Center

Benson, Rebecca

1998-01-01

Sustainable land management is an important consideration for stakeholders in Australia's tropical savannas. Land-management-education providers must deal with issues of access and the impact of values and perceptions on behavior. Adult educators must take on the role of negotiating attitudes and beliefs among stakeholders. (SK)

Living on the edge: latitudinal variations in the reproductive biology of two coastal species of sharks.

PubMed

Taylor, S M; Harry, A V; Bennett, M B

2016-11-01

Differences in the reproductive biology of both the Australian weasel shark Hemigaleus australiensis and the Australian sharpnose shark Rhizoprionodon taylori were apparent between individuals from the southern-most extent of their range in eastern Australia (Moreton Bay) and those from northern Australia. For H. australiensis from Moreton Bay the total length (L T ) at which 50% of individuals were mature (L T50 ) was 759 mm for females and 756 mm for males, values that were respectively 17-26% larger than reported for the species in northern Australia. The relatively low percentage (63%) of pregnant mature females and presence of small, similar-sized, embryos in utero in both May and November suggested a semi-synchronous, annual reproductive cycle in Moreton Bay, whereas a synchronous, biannual reproductive cycle occurred in northern Australia. It is likely that H. australiensis has a resting phase between gestation cycles at the southern-most extent of its range. For R. taylori from Moreton Bay the L T50 s were 588 and 579 mm for females and males, respectively, values 2-3% larger than for individuals from the mid-Queensland coast and 31-35% larger than for individuals from northern Australia. The length at which 50% of the females were maternal (611 mm L T ) in Moreton Bay was greater than the L T50 , indicating that not all sharks mate immediately after maturing. Rhizoprionodon taylori in the south had an annual reproductive cycle incorporating a 7-8 month embryonic diapause, with pups probably born in February. A mean fecundity of 7·5 was almost double that reported from northern Australia. Regional variations in the reproductive characteristics of H. australiensis and R. taylori may influence their resilience to fishing and other anthropogenic pressures. The substantial differences reported here highlight the importance of region-specific life-history parameters to successful management and conservation. © 2016 The Fisheries Society of the British Isles.

Characterization of Fitzroy River Virus and Serologic Evidence of Human and Animal Infection.

PubMed

Johansen, Cheryl A; Williams, Simon H; Melville, Lorna F; Nicholson, Jay; Hall, Roy A; Bielefeldt-Ohmann, Helle; Prow, Natalie A; Chidlow, Glenys R; Wong, Shani; Sinha, Rohini; Williams, David T; Lipkin, W Ian; Smith, David W

2017-08-01

In northern Western Australia in 2011 and 2012, surveillance detected a novel arbovirus in mosquitoes. Genetic and phenotypic analyses confirmed that the new flavivirus, named Fitzroy River virus, is related to Sepik virus and Wesselsbron virus, in the yellow fever virus group. Most (81%) isolates came from Aedes normanensis mosquitoes, providing circumstantial evidence of the probable vector. In cell culture, Fitzroy River virus replicated in mosquito (C6/36), mammalian (Vero, PSEK, and BSR), and avian (DF-1) cells. It also infected intraperitoneally inoculated weanling mice and caused mild clinical disease in 3 intracranially inoculated mice. Specific neutralizing antibodies were detected in sentinel horses (12.6%), cattle (6.6%), and chickens (0.5%) in the Northern Territory of Australia and in a subset of humans (0.8%) from northern Western Australia.

Hammersley Range, northern Western Australia

NASA Image and Video Library

1990-04-29

The oval shaped basin of the sedimentary rocks of the Hammersley Range, northern Western Australia (23.0S, 119.0E) dominates the center of this near nadir view. The Fortescue River is the remarkably straight, fault controlled feature bordering the Hammersley on the north. Sand dunes are the main surface features in the northeast and southwest. Many dry lakebeds can be seen to the east as light grey colored patches along the watercourses.

Correlates of Recent Declines of Rodents in Northern and Southern Australia: Habitat Structure Is Critical

PubMed Central

Lawes, Michael J.; Fisher, Diana O.; Johnson, Chris N.; Blomberg, Simon P.; Frank, Anke S. K.; Fritz, Susanne A.; McCallum, Hamish; VanDerWal, Jeremy; Abbott, Brett N.; Legge, Sarah; Letnic, Mike; Thomas, Colette R.; Thurgate, Nikki; Fisher, Alaric; Gordon, Iain J.; Kutt, Alex

2015-01-01

Australia has experienced dramatic declines and extinctions of its native rodent species over the last 200 years, particularly in southern Australia. In the tropical savanna of northern Australia significant declines have occurred only in recent decades. The later onset of these declines suggests that the causes may differ from earlier declines in the south. We examine potential regional effects (northern versus southern Australia) on biological and ecological correlates of range decline in Australian rodents. We demonstrate that rodent declines have been greater in the south than in the tropical north, are strongly influenced by phylogeny, and are consistently greater for species inhabiting relatively open or sparsely vegetated habitat. Unlike in marsupials, where some species have much larger body size than rodents, body mass was not an important predictor of decline in rodents. All Australian rodent species are within the prey-size range of cats (throughout the continent) and red foxes (in the south). Contrary to the hypothesis that mammal declines are related directly to ecosystem productivity (annual rainfall), our results are consistent with the hypothesis that disturbances such as fire and grazing, which occur in non-rainforest habitats and remove cover used by rodents for shelter, nesting and foraging, increase predation risk. We agree with calls to introduce conservation management that limits the size and intensity of fires, increases fire patchiness and reduces grazing impacts at ecological scales appropriate for rodents. Controlling feral predators, even creating predator-free reserves in relatively sparsely-vegetated habitats, is urgently required to ensure the survival of rodent species, particularly in northern Australia where declines are not yet as severe as those in the south. PMID:26111037

Correlates of Recent Declines of Rodents in Northern and Southern Australia: Habitat Structure Is Critical.

PubMed

Lawes, Michael J; Fisher, Diana O; Johnson, Chris N; Blomberg, Simon P; Frank, Anke S K; Fritz, Susanne A; McCallum, Hamish; VanDerWal, Jeremy; Abbott, Brett N; Legge, Sarah; Letnic, Mike; Thomas, Colette R; Thurgate, Nikki; Fisher, Alaric; Gordon, Iain J; Kutt, Alex

2015-01-01

Australia has experienced dramatic declines and extinctions of its native rodent species over the last 200 years, particularly in southern Australia. In the tropical savanna of northern Australia significant declines have occurred only in recent decades. The later onset of these declines suggests that the causes may differ from earlier declines in the south. We examine potential regional effects (northern versus southern Australia) on biological and ecological correlates of range decline in Australian rodents. We demonstrate that rodent declines have been greater in the south than in the tropical north, are strongly influenced by phylogeny, and are consistently greater for species inhabiting relatively open or sparsely vegetated habitat. Unlike in marsupials, where some species have much larger body size than rodents, body mass was not an important predictor of decline in rodents. All Australian rodent species are within the prey-size range of cats (throughout the continent) and red foxes (in the south). Contrary to the hypothesis that mammal declines are related directly to ecosystem productivity (annual rainfall), our results are consistent with the hypothesis that disturbances such as fire and grazing, which occur in non-rainforest habitats and remove cover used by rodents for shelter, nesting and foraging, increase predation risk. We agree with calls to introduce conservation management that limits the size and intensity of fires, increases fire patchiness and reduces grazing impacts at ecological scales appropriate for rodents. Controlling feral predators, even creating predator-free reserves in relatively sparsely-vegetated habitats, is urgently required to ensure the survival of rodent species, particularly in northern Australia where declines are not yet as severe as those in the south.

Unprecedented Melioidosis Cases in Northern Australia Caused by an Asian Burkholderia pseudomallei Strain Identified by Using Large-Scale Comparative Genomics

PubMed Central

Smith, Emma J.; MacHunter, Barbara; Harrington, Glenda; Theobald, Vanessa; Hall, Carina M.; Hornstra, Heidie M.; McRobb, Evan; Podin, Yuwana; Mayo, Mark; Sahl, Jason W.; Wagner, David M.; Keim, Paul; Kaestli, Mirjam; Currie, Bart J.

2015-01-01

Melioidosis is a disease of humans and animals that is caused by the saprophytic bacterium Burkholderia pseudomallei. Once thought to be confined to certain locations, the known presence of B. pseudomallei is expanding as more regions of endemicity are uncovered. There is no vaccine for melioidosis, and even with antibiotic administration, the mortality rate is as high as 40% in some regions that are endemic for the infection. Despite high levels of recombination, phylogenetic reconstruction of B. pseudomallei populations using whole-genome sequencing (WGS) has revealed surprisingly robust biogeographic separation between isolates from Australia and Asia. To date, there have been no confirmed autochthonous melioidosis cases in Australia caused by an Asian isolate; likewise, no autochthonous cases in Asia have been identified as Australian in origin. Here, we used comparative genomic analysis of 455 B. pseudomallei genomes to confirm the unprecedented presence of an Asian clone, sequence type 562 (ST-562), in Darwin, northern Australia. First observed in Darwin in 2005, the incidence of melioidosis cases attributable to ST-562 infection has steadily risen, and it is now a common strain in Darwin. Intriguingly, the Australian ST-562 appears to be geographically restricted to a single locale and is genetically less diverse than other common STs from this region, indicating a recent introduction of this clone into northern Australia. Detailed genomic and epidemiological investigations of new clinical and environmental B. pseudomallei isolates in the Darwin region and ST-562 isolates from Asia will be critical for understanding the origin, distribution, and dissemination of this emerging clone in northern Australia. PMID:26607593

A Cruel Brown Land of Beauty.

ERIC Educational Resources Information Center

Dixon, Geoff

1984-01-01

Australia is the world's driest continent. One-third of the country's area is unsuitable for any land use, while another third is suitable only for cattle and sheep grazing. Australia's physical geography, weather conditions, wildflowers, and wildlife are discussed. (RM)

Using Optimal Land-Use Scenarios to Assess Trade-Offs between Conservation, Development, and Social Values.

PubMed

Adams, Vanessa M; Pressey, Robert L; Álvarez-Romero, Jorge G

2016-01-01

Development of land resources can contribute to increased economic productivity but can also negatively affect the extent and condition of native vegetation, jeopardize the persistence of native species, reduce water quality, and erode ecosystem services. Spatial planning must therefore balance outcomes for conservation, development, and social goals. One approach to evaluating these trade-offs is scenario planning. In this paper we demonstrate methods for incorporating stakeholder preferences into scenario planning through both defining scenario objectives and evaluating the scenarios that emerge. In this way, we aim to develop spatial plans capable of informing actual land-use decisions. We used a novel approach to scenario planning that couples optimal land-use design and social evaluation of environmental outcomes. Four land-use scenarios combined differences in total clearing levels (10% and 20%) in our study region, the Daly Catchment Australia, with the presence or absence of spatial precincts to concentrate irrigated agriculture. We used the systematic conservation planning tool Marxan with Zones to optimally plan for multiple land-uses that met objectives for both conservation and development. We assessed the performance of the scenarios in terms of the number of objectives met and the degree to which existing land-use policies were compromised (e.g., whether clearing limits in existing guidelines were exceeded or not). We also assessed the land-use scenarios using expected stakeholder satisfaction with changes in the catchment to explore how the scenarios performed against social preferences. There were a small fraction of conservation objectives with high conservation targets (100%) that could not be met due to current land uses; all other conservation and development objectives were met in all scenarios. Most scenarios adhered to the existing clearing guidelines with only marginal exceedances of limits, indicating that the scenario objectives were compatible with existing policy. We found that two key stakeholder groups, agricultural and Indigenous residents, had divergent satisfaction levels with the amount of clearing and agricultural development. Based on the range of benefits and potential adverse impacts of each scenario, we suggest that the 10% clearing scenarios are most aligned with stakeholder preferences and best balance preferences across stakeholder groups. Our approach to scenario planning is applicable generally to exploring the potential conflicts between goals for conservation and development. Our case study is particularly relevant to current discussion about increased agricultural and pastoral development in northern Australia.

Using Optimal Land-Use Scenarios to Assess Trade-Offs between Conservation, Development, and Social Values

PubMed Central

Pressey, Robert L.; Álvarez-Romero, Jorge G.

2016-01-01

Development of land resources can contribute to increased economic productivity but can also negatively affect the extent and condition of native vegetation, jeopardize the persistence of native species, reduce water quality, and erode ecosystem services. Spatial planning must therefore balance outcomes for conservation, development, and social goals. One approach to evaluating these trade-offs is scenario planning. In this paper we demonstrate methods for incorporating stakeholder preferences into scenario planning through both defining scenario objectives and evaluating the scenarios that emerge. In this way, we aim to develop spatial plans capable of informing actual land-use decisions. We used a novel approach to scenario planning that couples optimal land-use design and social evaluation of environmental outcomes. Four land-use scenarios combined differences in total clearing levels (10% and 20%) in our study region, the Daly Catchment Australia, with the presence or absence of spatial precincts to concentrate irrigated agriculture. We used the systematic conservation planning tool Marxan with Zones to optimally plan for multiple land-uses that met objectives for both conservation and development. We assessed the performance of the scenarios in terms of the number of objectives met and the degree to which existing land-use policies were compromised (e.g., whether clearing limits in existing guidelines were exceeded or not). We also assessed the land-use scenarios using expected stakeholder satisfaction with changes in the catchment to explore how the scenarios performed against social preferences. There were a small fraction of conservation objectives with high conservation targets (100%) that could not be met due to current land uses; all other conservation and development objectives were met in all scenarios. Most scenarios adhered to the existing clearing guidelines with only marginal exceedances of limits, indicating that the scenario objectives were compatible with existing policy. We found that two key stakeholder groups, agricultural and Indigenous residents, had divergent satisfaction levels with the amount of clearing and agricultural development. Based on the range of benefits and potential adverse impacts of each scenario, we suggest that the 10% clearing scenarios are most aligned with stakeholder preferences and best balance preferences across stakeholder groups. Our approach to scenario planning is applicable generally to exploring the potential conflicts between goals for conservation and development. Our case study is particularly relevant to current discussion about increased agricultural and pastoral development in northern Australia. PMID:27362347

Genetic analysis of Giardia and Cryptosporidium from people in Northern Australia using PCR-based tools.

PubMed

Ebner, Janine; Koehler, Anson V; Robertson, Gemma; Bradbury, Richard S; Jex, Aaron R; Haydon, Shane R; Stevens, Melita A; Norton, Robert; Joachim, Anja; Gasser, Robin B

2015-12-01

To date, there has been limited genetic study of the gastrointestinal pathogens Giardia and Cryptosporidium in northern parts of Australia. Here, PCR-based methods were used for the genetic characterization of Giardia and Cryptosporidium from 695 people with histories of gastrointestinal disorders from the tropical North of Australia. Genomic DNAs from fecal samples were subjected to PCR-based analyses of regions from the triose phosphate isomerase (tpi), small subunit (SSU) of the nuclear ribosomal RNA and/or the glycoprotein (gp60) genes. Giardia and Cryptosporidium were detected in 13 and four of the 695 samples, respectively. Giardia duodenalis assemblages A and B were found in 4 (31%) and 9 (69%) of the 13 samples in persons of <9 years of age. Cryptosporidium hominis (subgenotype IdA18), Cryptosporidium mink genotype (subgenotype IIA16R1) and C. felis were also identified in single patients of 11-21 years of age. Future studies might focus on a comparative study of these and other protists in rural communities in Northern Australia. Copyright © 2015 Elsevier B.V. All rights reserved.

Spatial and temporal patterns of locally-acquired dengue transmission in northern Queensland, Australia, 1993-2012.

PubMed

Naish, Suchithra; Dale, Pat; Mackenzie, John S; McBride, John; Mengersen, Kerrie; Tong, Shilu

2014-01-01

Dengue has been a major public health concern in Australia since it re-emerged in Queensland in 1992-1993. We explored spatio-temporal characteristics of locally-acquired dengue cases in northern tropical Queensland, Australia during the period 1993-2012. Locally-acquired notified cases of dengue were collected for northern tropical Queensland from 1993 to 2012. Descriptive spatial and temporal analyses were conducted using geographic information system tools and geostatistical techniques. 2,398 locally-acquired dengue cases were recorded in northern tropical Queensland during the study period. The areas affected by the dengue cases exhibited spatial and temporal variation over the study period. Notified cases of dengue occurred more frequently in autumn. Mapping of dengue by statistical local areas (census units) reveals the presence of substantial spatio-temporal variation over time and place. Statistically significant differences in dengue incidence rates among males and females (with more cases in females) (χ(2) = 15.17, d.f.  = 1, p<0.01). Differences were observed among age groups, but these were not statistically significant. There was a significant positive spatial autocorrelation of dengue incidence for the four sub-periods, with the Moran's I statistic ranging from 0.011 to 0.463 (p<0.01). Semi-variogram analysis and smoothed maps created from interpolation techniques indicate that the pattern of spatial autocorrelation was not homogeneous across the northern Queensland. Tropical areas are potential high-risk areas for mosquito-borne diseases such as dengue. This study demonstrated that the locally-acquired dengue cases have exhibited a spatial and temporal variation over the past twenty years in northern tropical Queensland, Australia. Therefore, this study provides an impetus for further investigation of clusters and risk factors in these high-risk areas.

Spatial and Temporal Patterns of Locally-Acquired Dengue Transmission in Northern Queensland, Australia, 1993–2012

PubMed Central

Naish, Suchithra; Dale, Pat; Mackenzie, John S.; McBride, John; Mengersen, Kerrie; Tong, Shilu

2014-01-01

Background Dengue has been a major public health concern in Australia since it re-emerged in Queensland in 1992–1993. We explored spatio-temporal characteristics of locally-acquired dengue cases in northern tropical Queensland, Australia during the period 1993–2012. Methods Locally-acquired notified cases of dengue were collected for northern tropical Queensland from 1993 to 2012. Descriptive spatial and temporal analyses were conducted using geographic information system tools and geostatistical techniques. Results 2,398 locally-acquired dengue cases were recorded in northern tropical Queensland during the study period. The areas affected by the dengue cases exhibited spatial and temporal variation over the study period. Notified cases of dengue occurred more frequently in autumn. Mapping of dengue by statistical local areas (census units) reveals the presence of substantial spatio-temporal variation over time and place. Statistically significant differences in dengue incidence rates among males and females (with more cases in females) (χ2 = 15.17, d.f. = 1, p<0.01). Differences were observed among age groups, but these were not statistically significant. There was a significant positive spatial autocorrelation of dengue incidence for the four sub-periods, with the Moran's I statistic ranging from 0.011 to 0.463 (p<0.01). Semi-variogram analysis and smoothed maps created from interpolation techniques indicate that the pattern of spatial autocorrelation was not homogeneous across the northern Queensland. Conclusions Tropical areas are potential high-risk areas for mosquito-borne diseases such as dengue. This study demonstrated that the locally-acquired dengue cases have exhibited a spatial and temporal variation over the past twenty years in northern tropical Queensland, Australia. Therefore, this study provides an impetus for further investigation of clusters and risk factors in these high-risk areas. PMID:24691549

Supporting the risk management process with land information: a case study of Australia.

PubMed

Potts, Katie Elizabeth; Rajabifard, Abbas; Bennett, Rohan Mark

2017-04-01

It is frequently argued that, at the parcel level, stakeholders are capable of and well supported in managing their land-related risks. Yet, evidence from the contemporary Australian context suggests otherwise: numerous large-scale disaster events have revealed that citizens are ill-prepared to respond and recover adequately. This paper begins with the premise that information, specifically land information, could better support parcel-level risk preparation, mitigation, response, and recovery. State land administration organisations in Australia primarily maintain this information and make it accessible. Land information is used regularly across all levels of government to support risk management activities; however, such application has not always occurred at the parcel and citizen level. Via a case study approach, this paper initially explores the land information available in Australia to stakeholders interested in parcel-level detail, and then goes on to propose how the utilisation of parcel-level land information could serve to enhance risk management practices. © 2017 The Author(s). Disasters © Overseas Development Institute, 2017.

Linking Observations of Dynamic Topography from Oceanic and Continental Realms around Australia

NASA Astrophysics Data System (ADS)

Czarnota, K.; Hoggard, M. J.; White, N.; Winterbourne, J.

2012-04-01

In the last decade, there has been growing interest in predicting the spatial and temporal evolution of dynamic topography (i.e. the surface manifestation of mantle convection). By directly measuring Neogene and Quaternary dynamic topography around Australia's passive margins we assess the veracity of these predictions and the interplay between mantle convection and plate motion. We mapped the present dynamic topography by carefully measuring residual topography of oceanic lithosphere adjacent to passive margins. This map provides a reference with respect to which the relative record of vertical motions, preserved within the stratigraphic architecture of the margins, can be interpreted. We carefully constrained the temporal record of vertical motions along Australia's Northwest Shelf by backstripping Neogene carbonate clinoform rollover trajectories in order to minimise paleobathymetric errors. Elsewhere, we compile temporal constraints from published literature. Three principal insights emerge from our analysis. First, the present-day drawn-down residual topography of Australia, cannot be approximated by a regional tilt down towards the northeast, as previously hypothesised. The south-western and south-eastern corners of Australia are at negligible to slightly positive residual topography which slopes down towards Australia's northern margin and the Great Australian Bight. Secondly, the record of passive margin subsidence suggests drawdown across northern Australia commenced synchronously at 8±2 Ma. The amplitude of this synchronous drawdown corresponds to the amplitude of oceanic residual topography, indicating northern Australia was at an unperturbed dynamic elevation until drawdown commenced. The synchronicity of this subsidence suggests that the Australian plate has not been affected by a southward propagating wave of drawdown, despite Australia's rapid northward motion towards the subduction realm in south-east Asia. In contrast, it appears the mantle anomaly responsible for this drawdown is a relatively young, long-wavelength feature. Thirdly, there is an apparent mismatch between the current drawdown of oceanic lithosphere observed along Australia's southern margin and the onshore record of Cenozoic uplift. This disparity we attribute to the region undergoing recent uplift from a position of dynamic drawdown.

Predicting bee community responses to land-use changes: Effects of geographic and taxonomic biases

PubMed Central

De Palma, Adriana; Abrahamczyk, Stefan; Aizen, Marcelo A.; Albrecht, Matthias; Basset, Yves; Bates, Adam; Blake, Robin J.; Boutin, Céline; Bugter, Rob; Connop, Stuart; Cruz-López, Leopoldo; Cunningham, Saul A.; Darvill, Ben; Diekötter, Tim; Dorn, Silvia; Downing, Nicola; Entling, Martin H.; Farwig, Nina; Felicioli, Antonio; Fonte, Steven J.; Fowler, Robert; Franzén, Markus; Goulson, Dave; Grass, Ingo; Hanley, Mick E.; Hendrix, Stephen D.; Herrmann, Farina; Herzog, Felix; Holzschuh, Andrea; Jauker, Birgit; Kessler, Michael; Knight, M. E.; Kruess, Andreas; Lavelle, Patrick; Le Féon, Violette; Lentini, Pia; Malone, Louise A.; Marshall, Jon; Pachón, Eliana Martínez; McFrederick, Quinn S.; Morales, Carolina L.; Mudri-Stojnic, Sonja; Nates-Parra, Guiomar; Nilsson, Sven G.; Öckinger, Erik; Osgathorpe, Lynne; Parra-H, Alejandro; Peres, Carlos A.; Persson, Anna S.; Petanidou, Theodora; Poveda, Katja; Power, Eileen F.; Quaranta, Marino; Quintero, Carolina; Rader, Romina; Richards, Miriam H.; Roulston, T’ai; Rousseau, Laurent; Sadler, Jonathan P.; Samnegård, Ulrika; Schellhorn, Nancy A.; Schüepp, Christof; Schweiger, Oliver; Smith-Pardo, Allan H.; Steffan-Dewenter, Ingolf; Stout, Jane C.; Tonietto, Rebecca K.; Tscharntke, Teja; Tylianakis, Jason M.; Verboven, Hans A. F.; Vergara, Carlos H.; Verhulst, Jort; Westphal, Catrin; Yoon, Hyung Joo; Purvis, Andy

2016-01-01

Land-use change and intensification threaten bee populations worldwide, imperilling pollination services. Global models are needed to better characterise, project, and mitigate bees' responses to these human impacts. The available data are, however, geographically and taxonomically unrepresentative; most data are from North America and Western Europe, overrepresenting bumblebees and raising concerns that model results may not be generalizable to other regions and taxa. To assess whether the geographic and taxonomic biases of data could undermine effectiveness of models for conservation policy, we have collated from the published literature a global dataset of bee diversity at sites facing land-use change and intensification, and assess whether bee responses to these pressures vary across 11 regions (Western, Northern, Eastern and Southern Europe; North, Central and South America; Australia and New Zealand; South East Asia; Middle and Southern Africa) and between bumblebees and other bees. Our analyses highlight strong regionally-based responses of total abundance, species richness and Simpson's diversity to land use, caused by variation in the sensitivity of species and potentially in the nature of threats. These results suggest that global extrapolation of models based on geographically and taxonomically restricted data may underestimate the true uncertainty, increasing the risk of ecological surprises. PMID:27509831

Multiple biogeographical barriers identified across the monsoon tropics of northern Australia: phylogeographic analysis of the brachyotis group of rock-wallabies.

PubMed

Potter, Sally; Eldridge, Mark D B; Taggart, David A; Cooper, Steven J B

2012-05-01

The monsoon tropics of northern Australia are a globally significant biodiversity hotspot, but its phylogeography is poorly known. A major challenge for this region is to understand the biogeographical processes that have shaped the distribution and diversity of taxa, without detailed knowledge of past climatic and environmental fluctuations. Although molecular data have great potential to address these questions, only a few species have been examined phylogeographically. Here, we use the widely distributed and abundant short-eared rock-wallaby (Petrogale brachyotis; n = 101), together with the sympatric monjon (P. burbidgei; n = 11) and nabarlek (P. concinna; n = 1), to assess historical evolutionary and biogeographical processes in northern Australia. We sequenced ∼1000 bp of mitochondrial DNA (control region, ND2) and ∼3000 bp of nDNA (BRCA1, ω-globin and two anonymous loci) to investigate phylogeographic structuring and delineate the time-scale of diversification within the region. Our results indicate multiple barriers between the Top End (Northern Territory) and Kimberley (Western Australia), which have caused divergence throughout the Plio-Pleistocene. Eight geographically discrete and genetically distinct lineages within the brachyotis group were identified, five of which are separated by major river valleys (Ord, Victoria, Daly), arid lowlands and discontinuous sandstone ranges. It is likely that these barriers have similarly influenced genetic structure in other monsoonal biota. © 2012 Blackwell Publishing Ltd.

Topographic Signatures in Aquarius Radiometer/Scatterometer Response: Initial Results

NASA Technical Reports Server (NTRS)

Utku, C.; LeVine, D. M.

2012-01-01

The effect of topography on remote sensing at L-band is examined using the co-located Aquarius radiometer and scatterometer observations over land. A correlation with slope standard deviation is demonstrated for both the radiometer and scatterometer at topographic scales. Although the goal of Aquarius is remote sensing of sea surface salinity, the radiometer and scatterometer are on continuously and collect data for remote sensing research over land. Research is reported here using the data over land to determine if topography could have impact on the passive remote sensing at L-band. In this study, we report observations from two study regions: North Africa between 15 deg and 30 deg Northern latitudes and Australia less the Tasmania Island. Common to these two regions are the semi-arid climate and low population density; both favorable conditions to isolate the effect of topography from other sources of scatter and emission such as vegetation and urban areas. Over these study regions, topographic scale slopes within each Aquarius pixel are computed and their standard deviations are compared with Aquarius scatterometer and radiometer observations over a 36 day period between days 275 and 311 of 2011.

Multi-temporal clustering of continental floods and associated atmospheric circulations

NASA Astrophysics Data System (ADS)

Liu, Jianyu; Zhang, Yongqiang

2017-12-01

Investigating clustering of floods has important social, economic and ecological implications. This study examines the clustering of Australian floods at different temporal scales and its possible physical mechanisms. Flood series with different severities are obtained by peaks-over-threshold (POT) sampling in four flood thresholds. At intra-annual scale, Cox regression and monthly frequency methods are used to examine whether and when the flood clustering exists, respectively. At inter-annual scale, dispersion indices with four-time variation windows are applied to investigate the inter-annual flood clustering and its variation. Furthermore, the Kernel occurrence rate estimate and bootstrap resampling methods are used to identify flood-rich/flood-poor periods. Finally, seasonal variation of horizontal wind at 850 hPa and vertical wind velocity at 500 hPa are used to investigate the possible mechanisms causing the temporal flood clustering. Our results show that: (1) flood occurrences exhibit clustering at intra-annual scale, which are regulated by climate indices representing the impacts of the Pacific and Indian Oceans; (2) the flood-rich months occur from January to March over northern Australia, and from July to September over southwestern and southeastern Australia; (3) stronger inter-annual clustering takes place across southern Australia than northern Australia; and (4) Australian floods are characterised by regional flood-rich and flood-poor periods, with 1987-1992 identified as the flood-rich period across southern Australia, but the flood-poor period across northern Australia, and 2001-2006 being the flood-poor period across most regions of Australia. The intra-annual and inter-annual clustering and temporal variation of flood occurrences are in accordance with the variation of atmospheric circulation. These results provide relevant information for flood management under the influence of climate variability, and, therefore, are helpful for developing flood hazard mitigation schemes.

Ross River virus and Barmah Forest virus infections: a review of history, ecology, and predictive models, with implications for tropical northern Australia.

PubMed

Jacups, Susan P; Whelan, Peter I; Currie, Bart J

2008-04-01

The purpose of the present article is to present a review of the Ross River virus (RRV) and Barmah Forest virus (BFV) literature in relation to potential implications for future disease in tropical northern Australia. Ross River virus infection is the most common and most widespread arboviral disease in Australia, with an average of 4,800 national notifications annually. Of recent concern is the sudden rise in BFV infections; the 2005-2006 summer marked the largest BFV epidemic on record in Australia, with 1,895 notifications. Although not life-threatening, infection with either virus can cause arthritis, myalgia, and fatigue for 6 months or longer, resulting in substantial morbidity and economic impact. The geographic distribution of mosquito species and their seasonal activity is determined in large part by temperature and rainfall. Predictive models can be useful tools in providing early warning systems for epidemics of RRV and BFV infection. Various models have been developed to predict RRV outbreaks, but these appear to be mostly only regionally valid, being dependent on local ecological factors. Difficulties have arisen in developing useful models for the tropical northern parts of Australia, and to date no models have been developed for the Northern Territory. Only one model has been developed for predicting BFV infections using climate and tide variables. It is predicted that the exacerbation of current greenhouse conditions will result in longer periods of high mosquito activity in the tropical regions where RRV and BFV are already common. In addition, the endemic locations may expand further within temperate regions, and epidemics may become more frequent in those areas. Further development of predictive models should benefit public health planning by providing early warning systems of RRV and BFV infection outbreaks in different geographical locations.

Local sea surface temperatures add to extreme precipitation in northeast Australia during La Niña

NASA Astrophysics Data System (ADS)

Evans, Jason P.; Boyer-Souchet, Irène

2012-05-01

This study examines the role played by high sea surface temperatures around northern Australia, in producing the extreme precipitation which occurred during the strong La Niña in December 2010. These extreme rains produced floods that impacted almost 1,300,000 km2, caused billions of dollars in damage, led to the evacuation of thousands of people and resulted in 35 deaths. Through the use of regional climate model simulations the contribution of the observed high sea surface temperatures to the rainfall is quantified. Results indicate that the large-scale atmospheric circulation changes associated with the La Niña event, while associated with above average rainfall in northeast Australia, were insufficient to produce the extreme rainfall and subsequent flooding observed. The presence of high sea surface temperatures around northern Australia added ˜25% of the rainfall total.

Comparison and assessment of coarse resolution land cover maps for Northern Eurasia

Treesearch

Dirk Pflugmacher; Olga N. Krankina; Warren B. Cohen; Mark A. Friedl; Damien Sulla-Menashe; Robert E. Kennedy; Peder Nelson; Tatiana V. Loboda; Tobias Kuemmerle; Egor Dyukarev; Vladimir Elsadov; Viacheslav I. Kharuk

2011-01-01

Information on land cover at global and continental scales is critical for addressing a range of ecological, socioeconomic and policy questions. Global land cover maps have evolved rapidly in the last decade, but efforts to evaluate map uncertainties have been limited, especially in remote areas like Northern Eurasia. Northern Eurasia comprises a particularly diverse...

Changing Land Use: The Back Lachlan District of Australia. A Case Study of Land Use in a Semi-Arid Area [And] Student Work Book.

ERIC Educational Resources Information Center

Laws, Kevin

A social studies unit and student workbook explore changes in land use that have occurred over time in a semiarid area of eastern Australia, the Back Lachlan District. Part of the "outback," the District consists of a huge level plain with low rainfall, only one river, and vegetation ranging from timber to grass and shrub. Chapter I…

Fires in Australia's Northern Territory and Bathurst Island

NASA Image and Video Library

2017-12-08

The Aqua satellite collected this natural-color image of fires in Australia with the Moderate Resolution Imaging Spectroradiometer (MODIS) instrument on June 30, 2017. The image looks at multiple fires and smoke from those fires burning in northern Australia and the island of Bathurst on June 30, 2017. The Northern Territory fire incident map does show some incidents of grass and shrub fires, in the past 24 hours, but it also shows areas of what are called "strategic fires" which are those set by fire experts to rid an area of overgrowth, brush, dead grass and shrubs to prevent fires from spreading in the event of a lightning strike. NASA image courtesy Jeff Schmaltz, MODIS Rapid Response Team NASA image use policy. NASA Goddard Space Flight Center enables NASA’s mission through four scientific endeavors: Earth Science, Heliophysics, Solar System Exploration, and Astrophysics. Goddard plays a leading role in NASA’s accomplishments by contributing compelling scientific knowledge to advance the Agency’s mission. Follow us on Twitter Like us on Facebook Find us on Instagram

Photochemical production of O3 in biomass burning plumes in the boundary layer over northern Australia

NASA Astrophysics Data System (ADS)

Takegawa, N.; Kondo, Y.; Ko, M.; Koike, M.; Kita, K.; Blake, D. R.; Hu, W.; Scott, C.; Kawakami, S.; Miyazaki, Y.; Russell-Smith, J.; Ogawa, T.

2003-05-01

In situ aircraft measurements of ozone (O3) and its precursors were made over northern Australia in August-September 1999 during the Biomass Burning and Lightning Experiment Phase B (BIBLE-B). A clear positive correlation of O3 with carbon monoxide (CO) was found in biomass burning plumes in the boundary layer (<3 km). The ΔO3/ΔCO ratio (linear regression slope of O3-CO correlation) is found to be 0.12 ppbv/ppbv, which is comparable to the ratio of 0.15 ppbv/ppbv observed at 0-4 km over the Amazon and Africa in previous studies. The net flux of O3 exported from northern Australia during BIBLE-B is estimated to be 0.3 Gmol O3/day. In the biomass burning region, large enhancements of O3 were coincident with the locations of biomass burning hot spots, suggesting that major O3 production occurred near fires (horizontal scale <50 km).

Qualitative Research to Design Sustainable Community-Based Surveillance for Rabies in Northern Australia and Papua New Guinea.

PubMed

Brookes, Victoria J; Kennedy, Emma; Dhagapan, Phillipa; Ward, Michael P

2017-01-01

Given the proximity and recent spread of rabies in Indonesia, effective rabies surveillance in dogs is a priority in Northern Australia and Papua New Guinea (PNG). Reporting of potential cases requires community engagement; therefore, the value and acceptability of such a system is critical to ensure sustainable surveillance. We used qualitative research methods to identify factors that influence the acceptability and value of community-based rabies surveillance. Thirty-two semi-structured interviews were conducted with informants in 16 communities in East Arnhem, the Northern Peninsula Area, the Torres Strait in Australia, and in Western Province, PNG. Thematic analysis identified common themes including the importance of verbal communication, particularly via radio, community meetings, and direct conversation. We also found that dogs have high value to community members through connection to culture, economic (especially hunting), and companionship. The greatest barrier to the reporting of sick dogs was insufficient veterinary services and the subsequent lack of treatment response. In some regions, acceptance that sick dogs are a normal daily occurrence and lack of trust of authorities were also barriers to reporting. The findings from this study will be used to design sustainable rabies surveillance in Northern Australia and PNG by utilizing traditional communication channels and building on existing and valued animal-management services. The methods and findings of this study complement previous quantitative research, so as to target surveillance to high-risk areas within these regions.

Extreme weather events and environmental contamination are associated with case-clusters of melioidosis in the Northern Territory of Australia.

PubMed

Cheng, Allen C; Jacups, Susan P; Gal, Daniel; Mayo, Mark; Currie, Bart J

2006-04-01

Melioidosis, the infection due to the environmental organism Burkholderia pseudomallei, is endemic to northern Australia and South East Asia. It is associated with exposure to mud and pooled surface water, but environmental determinants of this disease are poorly understood. We defined case-clusters in northern Australia, determined their contribution to the observed rate of melioidosis, and explored clinical features and associated environmental factors. Using geographical information systems data, we examined clustering of melioidosis cases in time and geographical space in the Top End of the Northern Territory of Australia between 1990 and 2002 using a scan statistic. DNA macrorestriction analysis, resolved by pulsed field gel electrophoresis, was performed on isolates from patients. We defined five case-clusters involving 27 patients that occurred within 7-28 days and/or a radius of 100-300 km. Clustered cases were associated with extreme weather events or environmental contamination; no difference in the clinical pattern of disease was noted from other patients not involved in clusters. Isolates from patients linked to environmental contamination were caused by isolates with similar DNA macrorestriction patterns, but isolates from patients linked to severe weather events had more diverse DNA macrorestriction patterns. Case-clusters of melioidosis where isolates exhibit diverse DNA macrorestriction patterns in our region are linked to extreme weather events and outbreaks where isolates are predominantly of the same DNA macrorestriction pattern are linked with contamination of an environmental source.

Applicability of market-based instruments for safeguarding water quality in coastal waterways: Case study for Darwin Harbour, Australia

NASA Astrophysics Data System (ADS)

Greiner, Romy

2014-02-01

Water pollution of coastal waterways is a complex problem due to the cocktail of pollutants and multiplicity of polluters involved and pollution characteristics. Pollution control therefore requires a combination of policy instruments. This paper examines the applicability of market-based instruments to achieve effective and efficient water quality management in Darwin Harbour, Northern Territory, Australia. Potential applicability of instruments is examined in the context of biophysical and economic pollution characteristics, and experience with instruments elsewhere. The paper concludes that there is potential for inclusion of market-based instruments as part of an instrument mix to safeguard water quality in Darwin Harbour. It recommends, in particular, expanding the existing licencing system to include quantitative pollution limits for all significant point polluters; comprehensive and independent pollution monitoring across Darwin Harbour; public disclosure of water quality and emissions data; positive incentives for landholders in the Darwin Harbour catchment to improve land management practices; a stormwater offset program for greenfield urban developments; adoption of performance bonds for developments and operations which pose a substantial risk to water quality, including port expansion and dredging; and detailed consideration of a bubble licensing scheme for nutrient pollution. The paper offers an analytical framework for policy makers and resource managers tasked with water quality management in coastal waterways elsewhere in Australia and globally, and helps to scan for MBIs suitable in any given environmental management situation.

A revision of the Australian species of Trimma (Actinopterygii, Gobiidae), with descriptions of six new species and redescriptions of twenty-three valid species.

PubMed

Winterbottom, Richard; Hoese, Douglass F

2015-03-17

The gobiid genus Trimma currently contains 75 valid species, with another 20-30 known but undescribed species. There are 29 species in Australian waters (six undescribed). This paper describes the six new species, and provides redescriptions of most of the 23 previously described species known from the region, as well as a key for all the species. The six new species are: T. insularum (endemic to Cocos (Keeling) Islands), T. kitrinum (Fiji to Great Barrier Reef), T. meristum (Cape York to the Bismark Archipelago and Fiji), T. pentherum (Great Barrier Reef to Fiji and the South-West Islands of Palau), T. readerae (Australia to Japan), and T. xanthum (Palau to Fiji, Great Barrier Reef to Christmas Island). The following 23 species have been recorded from Australian waters, and most are redescribed here: T. anaima (Comores to Fiji), T. annosum (Maldives to the Phoenix Islands, Taiwan to the southern Great Barrier Reef), T. benjamini (southern Vietnam to the Marshall Islands, Samoa and southern Barrier Reef), T. caesiura (Ryukyus through the Marshall Islands to Samoa and Elizabeth Reef on the Lord Howe Rise), T. capostriatum (New Caledonia to eastern Australia and Papua New Guinea), T. maiandros (Java to the Ryukyus, Marshalls to Great Barrier Reef), T. emeryi (Comores to Ryukyus and Samoa), T. fangi (western South China Sea through to the Solomons), T. flavatrum (Ryukyu Islands to Western Australia and Samoa), T. hoesei (Chagos Archipelago, central Indian Ocean to Palau and Solomons), T. lantana (Australia, Solomons, northern New Guinea, South-West Islands of Palau), T. macrophthalmus (Ryukyu Islands to Cocos (Keeling) Islands and Samoa), T. milta (Taiwan to Western Australia, Society Islands and Hawaii), T. nasa (Sumbawa, Indonesia to Fiji), T. necopinum (northern tip of Cape York to Sydney), T. nomurai (Japan to northern Australia and New Caledonia), T. okinawae (western Thailand to Japan and the Phoenix Islands, north-west Australia to the Great Barrier Reef), T. preclarum (Palau to Fiji, Great Barrier Reef), T. stobbsi (Maldives to New Caledonia), T. striatum (Maldives to Palau, to northern Australia), T. taylori (Red Sea to Hawaii and Society Islands), T. tevegae (Red Sea to Ryukyu Islands, Marshall Islands to Samoa), and T. unisquame (Comores to Hawaii and Easter Island).

Monitoring Spatial Patterns of Vegetation Phenology in AN Australian Tropical Transect Using Modis Evi

NASA Astrophysics Data System (ADS)

Ma, X.; Huete, A.; Yu, Q.; Davies, K.; Coupe, N. R.

2012-07-01

Phenology is receiving increasing interest in the area of climate change and vegetation adaptation to climate. The phenology of a landscape can be used as a key parameter in land surface models and dynamic global vegetation models to more accurately simulate carbon, water and energy exchanges between land cover and atmosphere. However, the characterisation of phenology is lacking in tropical savannas which cover more than 30% of global land area, and are highly vulnerable to climate change. The objective of this study is to investigate the spatial pattern of vegetation phenology along the Northern Australia Tropical Transect (NATT) where the major biomes are wet and dry tropical savannas. For this analysis we used more than 11 years Moderate Resolution Imaging Spectroradiometer (MODIS) Enhanced Vegetation Index (EVI) product from 2000 to 2011. Eight phenological metrics were derived: Start of Season (SOS), End of Season (EOS), Length of Season (LOS), Maximum EVI (MaxG), Minimum EVI (MinG), annual amplitude (AMP), large integral (LIG), and small integral (SIG) were generated for each year and each pixel. Our results showed there are significant spatial patterns and considerable interannual variations of vegetation phenology along the NATT study area. Generally speaking, vegetation growing season started and ended earlier in the north, and started and ended later in the south, resulting in a southward decrease of growing season length (LOS). Vegetation productivity, which was represented by annual integral EVI (LIG), showed a significant descending trend from the northern part of NATT to the southern part. Segmented regression analysis showed that there exists a distinguishable breakpoint along the latitudinal gradient, at least in terms of annual minimum EVI (EVI), which is located between 18.84°S to 20.04°S.

Propagation measurements for an Australian land mobile satellite system

NASA Technical Reports Server (NTRS)

Bundrock, Anthony J.; Harvey, Robert

1988-01-01

Measurements of attenuation statistics using a helicopter and an instrumented van are discussed. Results are given for two different tree densities, for elevation angles of 30, 45 and 60 degrees and for frequencies of 893, 1550 and 2660 MHz. These results show that at 1550 MHz and 45 degrees elevation angle, attenuation values of 5.0 and 8.6 dB were exceeded 10 percent of the time for roadside tree densities of 35 percent and 85 percent respectively. Comparisons with other results made in the Northern Hemisphere are made and show general agreement. The implication of the measured values on system design are discussed, and it is shown that, for Australia, an adaptive margin allocation scheme would require an average margin of approximately 5 dB.

Land grants and the U.S. Forest Service

Treesearch

Carol Raish; Alice M. McSweeney

2008-01-01

The U.S. Forest Service (Forest Service) has a long, shared history with the land grants of northern New Mexico. During the land grant adjudication process after U.S. conquest, much common land from both Spanish and Mexican land grants was declared public domain, eventually becoming part of the northern and central New Mexico National Forests. These forests were...

Drinking and Smoking Habits of Students at Northern Territory University.

ERIC Educational Resources Information Center

Roberts, Kathryn L.; Jackson, Adrian S.

Persons in the Northern Territory who drink have the highest per capita daily consumption of alcohol and the highest rate of tobacco smoking in Australia. This study identifies the drinking patterns and demographic and personal variables that might predict risk levels for Northern Territory University (NTU) students and therefore give direction to…

Water, land, fire, and forest: Multi-scale determinants of rainforests in the Australian monsoon tropics.

PubMed

Ondei, Stefania; Prior, Lynda D; Williamson, Grant J; Vigilante, Tom; Bowman, David M J S

2017-03-01

The small rainforest fragments found in savanna landscapes are powerful, yet often overlooked, model systems to understand the controls of these contrasting ecosystems. We analyzed the relative effect of climatic variables on rainforest density at a subcontinental level, and employed high-resolution, regional-level analyses to assess the importance of landscape settings and fire activity in determining rainforest density in a frequently burnt Australian savanna landscape. Estimates of rainforest density (ha/km 2 ) across the Northern Territory and Western Australia, derived from preexisting maps, were used to calculate the correlations between rainforest density and climatic variables. A detailed map of the northern Kimberley (Western Australia) rainforests was generated and analyzed to determine the importance of geology and topography in controlling rainforests, and to contrast rainforest density on frequently burnt mainland and nearby islands. In the northwestern Australian, tropics rainforest density was positively correlated with rainfall and moisture index, and negatively correlated with potential evapotranspiration. At a regional scale, rainforests showed preference for complex topographic positions and more fertile geology. Compared with mainland areas, islands had significantly lower fire activity, with no differences between terrain types. They also displayed substantially higher rainforest density, even on level terrain where geomorphological processes do not concentrate nutrients or water. Our multi-scale approach corroborates previous studies that suggest moist climate, infrequent fires, and geology are important stabilizing factors that allow rainforest fragments to persist in savanna landscapes. These factors need to be incorporated in models to predict the future extent of savannas and rainforests under climate change.

Three new species of the sucking louse genus Hoplopleura (Phthiraptera: Anoplura: Hoplopleuridae) from rodents (Mammalia: Rodentia: Muridae) in northern Australia.

PubMed

Weaver, Haylee J

2017-03-23

Three new species of the rodent louse genus Hoplopleura (Anoplura: Hoplopleuridae) are described and illustrated from Australia: H. melomydis new species from Melomys burtoni (Muridae: Hydromyini, grassland melomys) and M. capensis (Muridae: Hydromyini, Cape York melomys) from Queensland; H. notomydis new species and H. setosa new species from Notomys alexis (Muridae: Hydromyini, spinifex hopping mouse) from the Northern Territory. These new louse species are the first lice recorded from each of the three host rodent species.

Assessing the Risk of a Canine Rabies Incursion in Northern Australia

PubMed Central

Hudson, Emily G.; Brookes, Victoria J.; Ward, Michael P.

2017-01-01

Rabies is a globally distributed virus that causes approximately 60,00 human deaths annually with >99% of cases caused by dog bites. Australia is currently canine rabies free. However, the recent eastward spread of rabies in the Indonesian archipelago has increased the probability of rabies entry into northern Australian communities. In addition, many northern Australian communities have large populations of free-roaming dogs, capable of maintaining rabies should an incursion occur. A risk assessment of rabies entry and transmission into these communities is needed to target control and surveillance measures. Illegal transportation of rabies-infected dogs via boat landings is a high-risk entry pathway and was the focus of the current study. A quantitative, stochastic, risk assessment model was developed to evaluate the risk of rabies entry into north-west Cape York Peninsula, Australia, and rabies introduction to resident dogs in one of the communities via transport of rabies-infected dogs on illegal Indonesian fishing boats. Parameter distributions were derived from expert opinion, literature, and analysis of field studies. The estimated median probability of rabies entry into north-west Cape York Peninsula and into Seisia from individual fishing boats was 1.9 × 10−4/boat and 8.7 × 10−6/boat, respectively. The estimated annual probability that at least one rabies-infected dog enters north-west Cape York Peninsula and into Seisia was 5.5 × 10−3 and 3.5 × 10−4, respectively. The estimated median probability of rabies introduction into Seisia was 4.7 × 10−8/boat, and the estimated annual probability that at least one rabies-infected dog causes rabies transmission in a resident Seisia dog was 8.3 × 10−5. Sensitivity analysis using the Sobol method highlighted some parameters as influential, including but not limited to the prevalence of rabies in Indonesia, the probability of a dog on board an Indonesian fishing boat, and the probability of a Seisia dog being on the beach. Overall, the probabilities of rabies entry into north-west Cape York Peninsula and rabies introduction into Seisia are low. However, the potential devastating consequences of a rabies incursion in this region make this a non-negligible risk. PMID:28913341

Fires Down Under

NASA Technical Reports Server (NTRS)

2002-01-01

This true-color image was taken over northern Australia on October 2, 2000, by the Moderate-resolution Imaging Spectroradiometer (MODIS), flying aboard NASA's Terra spacecraft. There are roughly a dozen wildfires visible in the scene, which spans from Western Australia , across the Northern Territory, and into Queensland. In this image, clouds appear bright white and smoke plume appear darker and greyish. The pixels containing the wildfires are colored red (hot) and yellow (hotter). There are quite a few large burn scars from previous wildfires, which appear as black splotches across the landscape. The large bay along northern shore is the Gulf of Carpentaria (visible in the full size image), which is roughly 400 miles (about 640 km) wide. Image by Brian Montgomery and Robert Simmon; Data courtesy MODIS Science Team, NASA GSFC

Burkholderia pseudomallei Genotype Distribution in the Northern Territory, Australia

PubMed Central

Chapple, Stephanie N. J.; Price, Erin P.; Sarovich, Derek S.; McRobb, Evan; Mayo, Mark; Kaestli, Mirjam; Spratt, Brian G.; Currie, Bart J.

2016-01-01

Melioidosis is a tropical disease of high mortality caused by the environmental bacterium, Burkholderia pseudomallei. We have collected clinical isolates from the highly endemic Northern Territory of Australia routinely since 1989, and animal and environmental B. pseudomallei isolates since 1991. Here we provide a complete record of all B. pseudomallei multilocus sequence types (STs) found in the Northern Territory to date, and distribution maps of the eight most common environmental STs. We observed surprisingly restricted geographic distributions of STs, which is contrary to previous reports suggesting widespread environmental dissemination of this bacterium. Our data suggest that B. pseudomallei from soil and water does not frequently disperse long distances following severe weather events or by migration of infected animals. PMID:26526925

Biomass burning emissions in north Australia during the early dry season: an overview of the 2014 SAFIRED campaign

NASA Astrophysics Data System (ADS)

Mallet, Marc D.; Desservettaz, Maximilien J.; Miljevic, Branka; Milic, Andelija; Ristovski, Zoran D.; Alroe, Joel; Cravigan, Luke T.; Rohan Jayaratne, E.; Paton-Walsh, Clare; Griffith, David W. T.; Wilson, Stephen R.; Kettlewell, Graham; van der Schoot, Marcel V.; Selleck, Paul; Reisen, Fabienne; Lawson, Sarah J.; Ward, Jason; Harnwell, James; Cheng, Min; Gillett, Rob W.; Molloy, Suzie B.; Howard, Dean; Nelson, Peter F.; Morrison, Anthony L.; Edwards, Grant C.; Williams, Alastair G.; Chambers, Scott D.; Werczynski, Sylvester; Williams, Leah R.; Winton, V. Holly L.; Atkinson, Brad; Wang, Xianyu; Keywood, Melita D.

2017-11-01

The SAFIRED (Savannah Fires in the Early Dry Season) campaign took place from 29 May until 30 June 2014 at the Australian Tropical Atmospheric Research Station (ATARS) in the Northern Territory, Australia. The purpose of this campaign was to investigate emissions from fires in the early dry season in northern Australia. Measurements were made of biomass burning aerosols, volatile organic compounds, polycyclic aromatic carbons, greenhouse gases, radon, speciated atmospheric mercury and trace metals. Aspects of the biomass burning aerosol emissions investigated included; emission factors of various species, physical and chemical aerosol properties, aerosol aging, micronutrient supply to the ocean, nucleation, and aerosol water uptake. Over the course of the month-long campaign, biomass burning signals were prevalent and emissions from several large single burning events were observed at ATARS.Biomass burning emissions dominated the gas and aerosol concentrations in this region. Dry season fires are extremely frequent and widespread across the northern region of Australia, which suggests that the measured aerosol and gaseous emissions at ATARS are likely representative of signals across the entire region of north Australia. Air mass forward trajectories show that these biomass burning emissions are carried north-west over the Timor Sea and could influence the atmosphere over Indonesia and the tropical atmosphere over the Indian Ocean. Here we present characteristics of the biomass burning observed at the sampling site and provide an overview of the more specific outcomes of the SAFIRED campaign.

Closing the Gap: Force Expansion in an Age of ’Come-As-You-Are’ Conflict

DTIC Science & Technology

2016-03-29

monograph argues that in order to expand the land force to face an existential threat, Australia must be capable of raising, training and sustaining...a corps in combat as part ofa coalition. The purpose of this study was to add to the body ofknowledge relating to how Australia can expand the land ...expansion to fulfill obligations to allies or defend Australian territory and regional interests. This monograph argues that in order to expand the land

Tropospheric O3 over Indonesia during biomass burning events measured with GOME (Global Ozone Monitoring Experiment) and compared with backtrajectory calculation

NASA Astrophysics Data System (ADS)

Ladstaetter-Weissenmayer, A.; Meyer-Arnek, J.; Burrows, J. P.

During the dry season, biomass burning is an important source of ozone precursors for the tropical troposphere, and ozone formation can occur in biomass burning plumes originating in Indonesia and northern Australia. Satellite based GOME (Global Ozone Measuring experiment) data are used to characterize the amount of tropospheric ozone production over this region during the El Niño event in September 1997 compared to a so called "normal" year 1998. Large scale biomass burning occurred over Kalimantan in 1997 caused by the absence of the northern monsoon rains, leading to significant increases in tropospheric ozone. Tropospheric ozone was determined from GOME data using the Tropospheric Excess Method (TEM). Backtrajectory calculations show that Indonesia is influenced every summer by the emissions of trace gases from biomass buring over northern Australia. But in 1997 over Indonesia an increasing of tropospheric ozone amounts can be observed caused by the fires over Indonesia itself as well as by northern Australia. The analysis of the measurements of BIBLE-A (Biomass Burning and Lightning Experiment) and using ATSR (Along the Track Scanning Radiometer) data show differences in the view to the intensity of fire counts and therefore in the amount of the emission of precursors of tropospheric ozone comparing September 1997 to September 1998.

Revision of the water-holding frogs, Cyclorana platycephala (Anura: Hylidae), from arid Australia, including a description of a new species.

PubMed

Anstis, Marion; Price, Luke C; Roberts, J Dale; Catalano, Sarah R; Hines, Harry B; Doughty, Paul; Donnellan, Stephen C

2016-06-21

The water-holding frog, Cyclorana platycephala, occurs in the Australian arid and semi-arid zones but not in the central Australian deserts. Recent inspection of morphological variation in adults and larvae suggests that the taxon comprises three regional populations: eastern, northern and western that may each represent separate species. To assess the systematic status of these populations, we documented phylogenetic relationships using mitochondrial and nuclear DNA markers, divergence in adult and larval morphology and male advertisement call. Our molecular genetic data demonstrates that the western population of C. platycephala is not the sister taxon of eastern and northern representatives of this nominate species, as the latter two are more closely related to another morphologically distinct species, C. verrucosa. Discriminant Function Analysis of 14 morphological traits in adults and 15 in larvae showed a high degree of morphological differentiation of western versus eastern/northern C. platycephala. Calls of eastern and western populations differed in duration, pulse rate, frequency and especially in amplitude modulation pattern across the call duration. We describe the western population as a new species, whose range is contained entirely within Western Australia. In addition, we redescribe Cyclorana platycephala, quantify morphological and genetic differences between the eastern and northern populations, and conclude that these data support recognition of a single species, Cyclorana platycephala, for populations found in New South Wales, the Barkly Tablelands and south-eastern Northern Territory, Queensland and South Australia.

The Northern Territory Teaching Schools Program: Exploring the Promise of Partnerships in Regional Professional Experience

ERIC Educational Resources Information Center

Buckworth, Jenny

2012-01-01

One of the key challenges for education in Northern Australia is attracting and recruiting teachers who can respond to the challenges of the region at the start of their careers through professional experience in the region. For pre-service students in regional locations such as the Northern Territory these challenges include coping with the…

Northern forest lands: resident attitudes and resource use

Treesearch

Herbert E. Echelberger; Albert E. Luloff; Frederick E. Schmidt; Frederick E. Schmidt

1991-01-01

Describes socioeconomic characteristics of residents of northern New Hampshire and northeastern Vermont; their level of participation in outdoor recreational activities; perceptions of community problems; and attitudes concerning local versus regional planning, public ownership of northern forest lands, and other pertinent issues with respect to changes in patterns of...

Mosquito Larval Habitats, Land Use, and Potential Malaria Risk in Northern Belize from Satellite Image Analyses

NASA Technical Reports Server (NTRS)

Pope, Kevin; Masuoka, Penny; Rejmankova, Eliska; Grieco, John; Johnson, Sarah; Roberts, Donald

2004-01-01

The distribution of Anopheles mosquito habitats and land use in northern Belize is examined with satellite data. -A land cover classification based on multispectral SPOT and multitemporal Radarsat images identified eleven land cover classes, including agricultural, forest, and marsh types. Two of the land cover types, Typha domingensis marsh and flooded forest, are Anopheles vestitipennis larval habitats. Eleocharis spp. marsh is the larval habitat for Anopheles albimanus. Geographic Information Systems (GIS) analyses of land cover demonstrate that the amount of T-ha domingensis in a marsh is positively correlated with the amount of agricultural land in the adjacent upland, and negatively correlated with the amount of adjacent forest. This finding is consistent with the hypothesis that nutrient (phosphorus) runoff from agricultural lands is causing an expansion of Typha domingensis in northern Belize. This expansion of Anopheles vestitipennis larval habitat may in turn cause an increase in malaria risk in the region.

17 CFR Appendix E to Part 43 - Other Commodity Geographic Identification for Public Dissemination Pursuant to § 43.4(d)(4)(iii)

Code of Federal Regulations, 2014 CFR

2014-04-01

... Russia) Russia Africa Northern Africa Western Africa Eastern Africa Central Africa Southern Africa Asia-Pacific Northern Asia (excluding Russia) Central Asia Eastern Asia Western Asia Southeast Asia Australia...

MARS-OZ - A Design for a Simulated Mars Base in the Australian Outback

NASA Astrophysics Data System (ADS)

Willson, D.; Clarke, J. D. A.; Murphy, G.

Mars Society Australia has developed the design of a simulated Mars base, MARS-OZ, for deployment in outback Australia. MARS-OZ will provide a platform for a diverse range of Mars analogue research in Australia. The simulated base consists of two mobile modules whose dimensions and shape approximate those of horizontally landed bent biconic spacecraft described in an earlier paper. The modules are designed to support field engineering, robotics, architectural, geological, biological and human factors research at varying levels of simulation fidelity. Non-Mars related research can also be accommodated, for example general field geology and biology, and engineering research associated with sustainable, low impact architecture. Crews of up to eight can be accommodated. In addition to its research function, the base also will serve as a centre of space education and outreach activities. The prime site for the MARS-OZ simulated base is located in the northern Flinders Ranges near Arkaroola in South Australia. This region contains many features that provide useful scientific analogues to known or possible past and present conditions on Mars from both a geological and biological perspective. The features will provide a wealth of study opportunities for crews. The very diverse terrain and regolith materials will provide ideal opportunities to field trial a range of equipment, sensors and exploration strategies. If needed, the prime site can be secured from casual visitors, allowing research into human interaction in isolation. Despite its relative isolation, the site is readily accessible by road and air from major Australian centres. This paper provides description of the configuration, design and construction of the proposed facility, its interior layout, equipment and systems fitouts, a detailed cost estimate, and its deployment. We estimate that the deployment of MARS-OZ could occur within nine months of securing funding.

The legislation of active voluntary euthanasia in Australia: will the slippery slope prove fatal?

PubMed Central

Kerridge, I H; Mitchell, K R

1996-01-01

At 2.00 am on the morning of May 24, 1995 the Northern Territory Legislative Assembly Australia passed the Rights of the Terminally Ill Act by the narrow margin of 15 votes to 10. The act permits a terminally ill patient of sound mind and over the age of 18 years, and who is either in pain or suffering, or distress, to request a medical practitioner to assist the patient to terminate his or her life. Thus, Australia can lay claim to being the first country in the world to legalise voluntary active euthanasia. The Northern Territory's act has prompted Australia-wide community reaction, particularly in South Australia, Tasmania and the Australian Capital Territory where proposals to legalise euthanasia have already been defeated on the floor of parliament. In New South Wales (NSW) the AIDS Council of NSW has prepared draft euthanasia legislation to be introduced into the Upper House as a Private Member's Bill some time in 1996. In this paper, we focus on a brief description of events as they occurred and on the arguments for and against the legalisation of euthanasia which have appeared in the media. PMID:8910778

The legislation of active voluntary euthanasia in Australia: will the slippery slope prove fatal?

PubMed

Kerridge, I H; Mitchell, K R

1996-10-01

At 2.00 am on the morning of May 24, 1995 the Northern Territory Legislative Assembly Australia passed the Rights of the Terminally Ill Act by the narrow margin of 15 votes to 10. The act permits a terminally ill patient of sound mind and over the age of 18 years, and who is either in pain or suffering, or distress, to request a medical practitioner to assist the patient to terminate his or her life. Thus, Australia can lay claim to being the first country in the world to legalise voluntary active euthanasia. The Northern Territory's act has prompted Australia-wide community reaction, particularly in South Australia, Tasmania and the Australian Capital Territory where proposals to legalise euthanasia have already been defeated on the floor of parliament. In New South Wales (NSW) the AIDS Council of NSW has prepared draft euthanasia legislation to be introduced into the Upper House as a Private Member's Bill some time in 1996. In this paper, we focus on a brief description of events as they occurred and on the arguments for and against the legalisation of euthanasia which have appeared in the media.

Pneumonia risk stratification in tropical Australia: does the SMART-COP score apply?

PubMed

Davis, Joshua S; Cross, Gail B; Charles, Patrick G P; Currie, Bart J; Anstey, Nicholas M; Cheng, Allen C

2010-02-01

To examine the performance in tropical northern Australia of SMART-COP, a simple scoring system developed in temperate Australia to predict the need for intensive respiratory or vasopressor support (IRVS) in pneumonia patients. A prospective observational study of patients admitted to Royal Darwin Hospital in the Northern Territory with sepsis between August 2007 and May 2008. Chest x-rays were reviewed to confirm pneumonia, and each patient's SMART-COP score was assessed against the need for IRVS. Of 206 patients presenting with radiologically confirmed pneumonia, 184 were eligible for inclusion. The mean age of patients was 50.1 years, 65% were Indigenous and 56% were men. Overall, 38 patients (21%) required IRVS, and 18 patients (10%) died by Day 30. A SMART-COP score of >or= 3 had a sensitivity of only 71% for predicting the need for IRVS and 67% for 30-day mortality. As the variables most strongly associated with IRVS were serum albumin level < 35 g/L (odds ratio, 6.8) and Indigenous status (odds ratio, 2.3), we tested a modified scoring system (SMART-COP) that used a higher weighting for albumin and included Indigenous status. A SMART-COP score of >or= 3 had a sensitivity of 97% for IRVS and 100% for 30-day mortality. The SMART-COP score underestimates the severity of pneumonia in tropical northern Australia, but can be improved by using locally relevant additions.

Curriculum Policies for Students with Special Needs in Australia

ERIC Educational Resources Information Center

Aspland, Tania; Datta, Poulomee; Talukdar, Joy

2012-01-01

The curriculum policies for students with special needs across Australia have been reviewed. The Curriculum Framework in the Australian Capital Territory is used to inform their school based curriculum. The Northern Territory Curriculum Framework describes what learners are expected to achieve and what learners have achieved. The New South Wales…

Potential conflict between the coal and arable land resources in australia: A case for corporate responsiveness

NASA Astrophysics Data System (ADS)

Langkamp, Peter J.

1985-01-01

Background information on possible surface-coal-mining operations in arable agricultural areas in Australia is provided. The major co-occurrence of the coal and arable land resources was in the Darling Downs region of Queensland and the Liverpool Plains region of New South Wales; however, coal development will probably only occur in the former region over the next decade. Analysis of the situation in the Darling Downs region, which consists of 11 Shires, found five companies conducting prefeasibility projects for surface-coal development and the size of exploration areas concerned far exceeding final mined-land disturbance estimates. Most of the land included in the prefeasibility studies was classified as “arable with moderate crop restrictions requiring intensive management” (classes II IV). The total area of land that may be disturbed at some time in the future was less than 2% of the arable land in the Shires concerned. Project mutual exclusivity and ongoing rehabilitation of disturbed areas further reduce arable land out of production at any one time. It is suggested that, if self-regulation by the coal industry in Australia on rehabilitation issues is to remain a viable option in these areas, an understanding between the corporate and public sectors on the extent and limitations of its responsibilities must be obtained. The current development of a National Conservation Strategy for Australia should assist this to proceed. Research on various rehabilitation issues may be required prior to project commitment to ensure the responsibilities identified are realizable. Integrative problem-solving, incorporating audit procedures, was suggested as a suitable method to achieve these aims and corporate responsiveness was seen as a necessary first step.

Modelling seasonal habitat suitability for wide-ranging species: Invasive wild pigs in northern Australia.

PubMed

Froese, Jens G; Smith, Carl S; Durr, Peter A; McAlpine, Clive A; van Klinken, Rieks D

2017-01-01

Invasive wildlife often causes serious damage to the economy and agriculture as well as environmental, human and animal health. Habitat models can fill knowledge gaps about species distributions and assist planning to mitigate impacts. Yet, model accuracy and utility may be compromised by small study areas and limited integration of species ecology or temporal variability. Here we modelled seasonal habitat suitability for wild pigs, a widespread and harmful invader, in northern Australia. We developed a resource-based, spatially-explicit and regional-scale approach using Bayesian networks and spatial pattern suitability analysis. We integrated important ecological factors such as variability in environmental conditions, breeding requirements and home range movements. The habitat model was parameterized during a structured, iterative expert elicitation process and applied to a wet season and a dry season scenario. Model performance and uncertainty was evaluated against independent distributional data sets. Validation results showed that an expert-averaged model accurately predicted empirical wild pig presences in northern Australia for both seasonal scenarios. Model uncertainty was largely associated with different expert assumptions about wild pigs' resource-seeking home range movements. Habitat suitability varied considerably between seasons, retracting to resource-abundant rainforest, wetland and agricultural refuge areas during the dry season and expanding widely into surrounding grassland floodplains, savanna woodlands and coastal shrubs during the wet season. Overall, our model suggested that suitable wild pig habitat is less widely available in northern Australia than previously thought. Mapped results may be used to quantify impacts, assess risks, justify management investments and target control activities. Our methods are applicable to other wide-ranging species, especially in data-poor situations.

Seven new species of Paleanotus (Annelida: Chrysopetalidae) described from Lizard Island, Great Barrier Reef, and coral reefs of northern Australia and the Indo-Pacific: two cryptic species pairs revealed between western Pacific Ocean and the eastern Indian Ocean.

PubMed

Watson, Charlotte

2015-09-18

Morphological investigation into the paleate genus Paleanotus Schmarda 1861 of the family Chrysopetalidae from northern Australian coral reefs, primarily Lizard Island and outlying reefs, included a complex of very small, slender individuals (length < 5 mm). This complex resolved into 7 new species, described herein: Paleanotus inornatus n. sp., P. adornatus n. sp., P. chrysos n. sp., P. aquifolia n. sp., P. latifolia n. sp., P. silus n. sp., and P. silopsis n. sp. A key is provided to the new species and Paleanotus distinguished from Treptopale and Hyalopale, two closely related genera. Diagnostic features of the apical structure and shape of the notochaetal main paleae plus median paleae shape and raised rib pattern, differentiates each species from the other. Gametous states are described. Two cryptic species pairs (Paleanotus silopsis n. sp. and P. silus n. sp.; Paleanotus aquifolia n. sp. and P. latifolia n. sp.) were identified. In each case one species is restricted to either the NE or NW Australian coast. In each pair the most eastern point for the NW Australian species range occurs at Darwin, western Arnhemland, Northern Territory. Additional material for each species pair extends their respective ranges northwards: NW Australia to Thailand, Andaman Sea, eastern Indian Ocean or NE Australia, Great Barrier Reef to the Philippines, western Pacific Ocean. Cryptic morphology and potential genetic diversity is discussed in Paleanotus inornatus n. sp. and P. adornatus n. sp. that possess overlapping widespread distribution patterns across northern Australia and Indo-Pacific reefs. The smallest bodied taxon, Paleanotus chrysos n. sp. is the only species with a Coral Sea range encompassing Lizard Island, Heron Island and New Caledonia.

Modelling seasonal habitat suitability for wide-ranging species: Invasive wild pigs in northern Australia

PubMed Central

2017-01-01

Invasive wildlife often causes serious damage to the economy and agriculture as well as environmental, human and animal health. Habitat models can fill knowledge gaps about species distributions and assist planning to mitigate impacts. Yet, model accuracy and utility may be compromised by small study areas and limited integration of species ecology or temporal variability. Here we modelled seasonal habitat suitability for wild pigs, a widespread and harmful invader, in northern Australia. We developed a resource-based, spatially-explicit and regional-scale approach using Bayesian networks and spatial pattern suitability analysis. We integrated important ecological factors such as variability in environmental conditions, breeding requirements and home range movements. The habitat model was parameterized during a structured, iterative expert elicitation process and applied to a wet season and a dry season scenario. Model performance and uncertainty was evaluated against independent distributional data sets. Validation results showed that an expert-averaged model accurately predicted empirical wild pig presences in northern Australia for both seasonal scenarios. Model uncertainty was largely associated with different expert assumptions about wild pigs’ resource-seeking home range movements. Habitat suitability varied considerably between seasons, retracting to resource-abundant rainforest, wetland and agricultural refuge areas during the dry season and expanding widely into surrounding grassland floodplains, savanna woodlands and coastal shrubs during the wet season. Overall, our model suggested that suitable wild pig habitat is less widely available in northern Australia than previously thought. Mapped results may be used to quantify impacts, assess risks, justify management investments and target control activities. Our methods are applicable to other wide-ranging species, especially in data-poor situations. PMID:28472113

Public recreation on private forests: no more guarantees

Treesearch

Barry McPhee

1998-01-01

Studies across the U.S. have found that nontraditional ownership of Non-Industrial Private Forest-land (NIPF) ownership, centered on residential and recreational rather than timber production objectives, is gaining prevalence. Recent NIPF conversion in the Northern Forest of Northern New England and New York came under scrutiny by the Northern Forest Lands Council. A...

Handbook on Australia.

ERIC Educational Resources Information Center

Texas Education Agency, Austin.

A study unit on Australia for secondary students is divided into eight sections. Section 1 introduces students to the states, territories, and capitals of the country. Section two, land and people, discusses the size, location, geology, climate, flora and fauna, and population of Australia. Sections 3 and 4 outline Australian history and include…

Private forest-land owners of the Northern United States, 1994

Treesearch

Thomas W. Birch; Thomas W. Birch

1996-01-01

A statistical analytical report on mail canvass of private forest-land owners in the Northern United States. Landowner characteristics attitudes harvesting experience tenure and management planning are discussed.

Drought Rapidly Diminishes the Large Net CO2 Uptake in 2011 Over Semi-Arid Australia

NASA Technical Reports Server (NTRS)

Ma, Xuanlong; Huete, Alfredo; Cleverly, James; Eamus, Derek; Chevallier, Frederic; Joiner, Joanna; Poulter, Benjamin; Zhang, Yongguang; Guanter, Luis; Meyer, Wayne;

Drought rapidly diminishes the large net CO2 uptake in 2011 over semi-arid Australia

NASA Astrophysics Data System (ADS)

Ma, Xuanlong; Huete, Alfredo; Cleverly, James; Eamus, Derek; Chevallier, Frédéric; Joiner, Joanna; Poulter, Benjamin; Zhang, Yongguang; Guanter, Luis; Meyer, Wayne; Xie, Zunyi; Ponce-Campos, Guillermo

2016-11-01

Each year, terrestrial ecosystems absorb more than a quarter of the anthropogenic carbon emissions, termed as land carbon sink. An exceptionally large land carbon sink anomaly was recorded in 2011, of which more than half was attributed to Australia. However, the persistence and spatially attribution of this carbon sink remain largely unknown. Here we conducted an observation-based study to characterize the Australian land carbon sink through the novel coupling of satellite retrievals of atmospheric CO2 and photosynthesis and in-situ flux tower measures. We show the 2010-11 carbon sink was primarily ascribed to savannas and grasslands. When all biomes were normalized by rainfall, shrublands however, were most efficient in absorbing carbon. We found the 2010-11 net CO2 uptake was highly transient with rapid dissipation through drought. The size of the 2010-11 carbon sink over Australia (0.97 Pg) was reduced to 0.48 Pg in 2011-12, and was nearly eliminated in 2012-13 (0.08 Pg). We further report evidence of an earlier 2000-01 large net CO2 uptake, demonstrating a repetitive nature of this land carbon sink. Given a significant increasing trend in extreme wet year precipitation over Australia, we suggest that carbon sink episodes will exert greater future impacts on global carbon cycle.

Drought rapidly diminishes the large net CO2 uptake in 2011 over semi-arid Australia.

PubMed

Ma, Xuanlong; Huete, Alfredo; Cleverly, James; Eamus, Derek; Chevallier, Frédéric; Joiner, Joanna; Poulter, Benjamin; Zhang, Yongguang; Guanter, Luis; Meyer, Wayne; Xie, Zunyi; Ponce-Campos, Guillermo

2016-11-25

Each year, terrestrial ecosystems absorb more than a quarter of the anthropogenic carbon emissions, termed as land carbon sink. An exceptionally large land carbon sink anomaly was recorded in 2011, of which more than half was attributed to Australia. However, the persistence and spatially attribution of this carbon sink remain largely unknown. Here we conducted an observation-based study to characterize the Australian land carbon sink through the novel coupling of satellite retrievals of atmospheric CO 2 and photosynthesis and in-situ flux tower measures. We show the 2010-11 carbon sink was primarily ascribed to savannas and grasslands. When all biomes were normalized by rainfall, shrublands however, were most efficient in absorbing carbon. We found the 2010-11 net CO 2 uptake was highly transient with rapid dissipation through drought. The size of the 2010-11 carbon sink over Australia (0.97 Pg) was reduced to 0.48 Pg in 2011-12, and was nearly eliminated in 2012-13 (0.08 Pg). We further report evidence of an earlier 2000-01 large net CO 2 uptake, demonstrating a repetitive nature of this land carbon sink. Given a significant increasing trend in extreme wet year precipitation over Australia, we suggest that carbon sink episodes will exert greater future impacts on global carbon cycle.

Optimising the Design of Land Force C2 Architectures

DTIC Science & Technology

2002-06-13

5624 Email: brendan.kirby@dsto.defence.gov.au and David Cropley, Systems Engineering & Evaluation Centre University of South Australia, Mawson Lakes...Campus, Mawson Lakes, SA 5095, Australia. Report Documentation Page Form ApprovedOMB No. 0704-0188 Public reporting burden for the collection of...Australia. Email: brendan.kirby@dsto.defence.gov.au *Systems Engineering & Evaluation Centre, University of South Australia, Mawson Lakes Campus, Mawson

Arboviral diseases and malaria in Australia, 2008-09: annual report of the National Arbovirus and Malaria Advisory Committee.

PubMed

Fitzsimmons, Gerard J; Wright, Phil; Johansen, Cheryl A; Whelan, Peter I

2010-09-01

The National Notifiable Diseases Surveillance System received 8,677 notifications of diseases transmitted by mosquitoes in Australia from 1 July 2008 to 30 June 2009. The alphaviruses, Barmah Forest and Ross River, accounted for 6,574 (78%) of these notifications during 2008-09. There were 1,009 notifications of dengue virus infection locally-acquired in North Queensland and 484 notified cases resulted from overseas travel. Notification rates of dengue virus infection for 2008-09, regardless of where infection was acquired, exceeded the five-year mean rate and may be attributed to increased disease activity in the Asia-Pacific region. North Queensland was the site of several outbreaks of locally-acquired dengue virus infection involving all 4 serotypes. These dengue outbreaks affected several locations with over 1,000 notifications. Detection of flavivirus seroconversions in sentinel chicken flocks across Australia provides an early warning of increased levels of Murray Valley encephalitis virus and Kunjin virus activity. Increased levels of flavivirus activity were detected in western and northern Australia, which prompted public health action. This action preceded 4 notifications of Murray Valley encephalitis infections, 2 (fatal) cases acquired in the Northern Territory and two in Western Australia. There were no notifications of locally-acquired malaria in Australia and 567 notifications of overseas-acquired malaria during 2008-09. This annual report presents information of diseases transmitted by mosquitoes in Australia and notified to the National Notifiable Diseases Surveillance System.

The effect of carbon credits on savanna land management and priorities for biodiversity conservation.

PubMed

Douglass, Lucinda L; Possingham, Hugh P; Carwardine, Josie; Klein, Carissa J; Roxburgh, Stephen H; Russell-Smith, Jeremy; Wilson, Kerrie A

2011-01-01

Carbon finance offers the potential to change land management and conservation planning priorities. We develop a novel approach to planning for improved land management to conserve biodiversity while utilizing potential revenue from carbon biosequestration. We apply our approach in northern Australia's tropical savanna, a region of global significance for biodiversity and carbon storage, both of which are threatened by current fire and grazing regimes. Our approach aims to identify priority locations for protecting species and vegetation communities by retaining existing vegetation and managing fire and grazing regimes at a minimum cost. We explore the impact of accounting for potential carbon revenue (using a carbon price of US$14 per tonne of carbon dioxide equivalent) on priority areas for conservation and the impact of explicitly protecting carbon stocks in addition to biodiversity. Our results show that improved management can potentially raise approximately US$5 per hectare per year in carbon revenue and prevent the release of 1-2 billion tonnes of carbon dioxide equivalent over approximately 90 years. This revenue could be used to reduce the costs of improved land management by three quarters or double the number of biodiversity targets achieved and meet carbon storage targets for the same cost. These results are based on generalised cost and carbon data; more comprehensive applications will rely on fine scale, site-specific data and a supportive policy environment. Our research illustrates that the duel objective of conserving biodiversity and reducing the release of greenhouse gases offers important opportunities for cost-effective land management investments.

The Effect of Carbon Credits on Savanna Land Management and Priorities for Biodiversity Conservation

PubMed Central

Douglass, Lucinda L.; Possingham, Hugh P.; Carwardine, Josie; Klein, Carissa J.; Roxburgh, Stephen H.; Russell-Smith, Jeremy; Wilson, Kerrie A.

2011-01-01

Carbon finance offers the potential to change land management and conservation planning priorities. We develop a novel approach to planning for improved land management to conserve biodiversity while utilizing potential revenue from carbon biosequestration. We apply our approach in northern Australia's tropical savanna, a region of global significance for biodiversity and carbon storage, both of which are threatened by current fire and grazing regimes. Our approach aims to identify priority locations for protecting species and vegetation communities by retaining existing vegetation and managing fire and grazing regimes at a minimum cost. We explore the impact of accounting for potential carbon revenue (using a carbon price of US$14 per tonne of carbon dioxide equivalent) on priority areas for conservation and the impact of explicitly protecting carbon stocks in addition to biodiversity. Our results show that improved management can potentially raise approximately US$5 per hectare per year in carbon revenue and prevent the release of 1–2 billion tonnes of carbon dioxide equivalent over approximately 90 years. This revenue could be used to reduce the costs of improved land management by three quarters or double the number of biodiversity targets achieved and meet carbon storage targets for the same cost. These results are based on generalised cost and carbon data; more comprehensive applications will rely on fine scale, site-specific data and a supportive policy environment. Our research illustrates that the duel objective of conserving biodiversity and reducing the release of greenhouse gases offers important opportunities for cost-effective land management investments. PMID:21935363

Sporotrichosis from the Northern Territory of Australia

PubMed Central

Subedi, Shradha; Kidd, Sarah E.; Baird, Robert W.; Coatsworth, Nicholas; Ralph, Anna P.

2014-01-01

We report three cases of lymphocutaneous infection caused by the thermally dimorphic fungus, Sporothrix schenckii from Australia's tropical Northern Territory. Two cases were acquired locally, making them the first to be reported from this region. All three cases presented with ulceration in the limb; however, the classical sporotrichoid spread was present only in the first two cases. Their occurrence within several weeks of each other was suggestive of a common source of environmental contamination such as hay used as garden mulch. Diagnoses were delayed in each case, with each patient having substantial exposure to ineffective antibiotics before the correct diagnosis was made. These cases bring the total number of reported sporotrichosis cases in Australia since 1951 to 199. Lessons from these cases are to consider the diagnosis of sporotrichosis in lesions of typical appearance, even in geographical settings from where this pathogen has not previously been reported. PMID:25200259

Case report: Sporotrichosis from the Northern Territory of Australia.

PubMed

Subedi, Shradha; Kidd, Sarah E; Baird, Robert W; Coatsworth, Nicholas; Ralph, Anna P

2014-12-01

We report three cases of lymphocutaneous infection caused by the thermally dimorphic fungus, Sporothrix schenckii from Australia's tropical Northern Territory. Two cases were acquired locally, making them the first to be reported from this region. All three cases presented with ulceration in the limb; however, the classical sporotrichoid spread was present only in the first two cases. Their occurrence within several weeks of each other was suggestive of a common source of environmental contamination such as hay used as garden mulch. Diagnoses were delayed in each case, with each patient having substantial exposure to ineffective antibiotics before the correct diagnosis was made. These cases bring the total number of reported sporotrichosis cases in Australia since 1951 to 199. Lessons from these cases are to consider the diagnosis of sporotrichosis in lesions of typical appearance, even in geographical settings from where this pathogen has not previously been reported. © The American Society of Tropical Medicine and Hygiene.

Socio-hydrology and integrated water resources management in northern Australia

NASA Astrophysics Data System (ADS)

Douglas, Michael; Jackson, Sue

2017-04-01

Australia's tropical rivers account for more than half of the nation's freshwater resources. Nearly all of these rivers flow freely to the sea, with less than 0. 01% of river flows diverted for human use, but there is increasing interest in developing the region's water resources for irrigated agriculture. Interdisciplinary research conducted over the past decade has demonstrated the reliance of biodiversity on free-flowing rivers and has also identified a broad range of benefits that people derive from these river systems including irrigated agriculture, tourism, commercial and recreational fishing and Indigenous subsistence harvesting. This has revealed the highly coupled nature of the socio-hydrological system in northern Australia's catchments and the trade-offs among different water users. This paper provides an overview of past and current research with a focus on how socio-hydrology may assist in undertaking integrated water resource management in this region.

Our Stories: Innovation and Excellence in Rural Education. Proceedings of National Rural Education Conference of the Society for the Provision of Education in Rural Australia (21st, Darwin, Northern Territory, Australia, October 2005)

ERIC Educational Resources Information Center

Boylan, Colin, Ed.

2005-01-01

The papers contained in this document represent the keynote addresses, refereed and non-refereed conference papers from the 21st National Conference of the Society for the Provision of Education in Rural Australia (SPERA). The theme for this national annual conference was: Our Stories: Innovation and Excellence in Rural Education. Keynote…

Salinity monitoring in Western Australia using remotely sensed and other spatial data.

PubMed

Furby, Suzanne; Caccetta, Peter; Wallace, Jeremy

2010-01-01

The southwest of Western Australia is affected by dryland salinity that results in the loss of previously productive agricultural land, damage to buildings, roads, and other infrastructure, decline in pockets of remnant vegetation and biodiversity, and reduction in water quality. Accurate information on the location and rate of change of the extent of saline land over the region is required by resource managers. For the first time, comprehensive, spatially explicit maps of dryland salinity and its change over approximately 10 yr for the southwest agricultural region of Western Australia have been produced operationally in the 'Land Monitor' project. The methods rely on an integrated analysis of long-term sequences of Landsat TM satellite image data together with variables derived from digital elevation models (DEMs). Understanding of the physical process and surface expression of salinity provided by experts was used to guide the analyses. Ground data-the delineation of salt-affected land by field experts-was collected for training and validation. The results indicate that the land area currently affected by salinity in Western Australia's southwest is about 1 million hectares (in 1996) and the annual rate of increase is about 14,000 ha. This is a lesser extent than many previous estimates and lower rate of change than generally predicted from limited hydrological data. The results are widely distributed and publicly available. The key to providing accurate mapping and monitoring information was the incorporation of time series classification of a sequence of images over several years combined with landform information.

Revision of the genus Hydroides (Annelida: Serpulidae) from Australia.

PubMed

Sun, Yanan; Wong, Eunice; ten Hove, Harry A; Hutchings, Pat A; Williamson, Jane E; Kupriyanova, Elena K

2015-09-01

Hydroides Gunnerus, 1768 is the largest and one of the economically most important genera of calcareous tubeworms (Serpulidae, Annelida) that includes a number of notorious fouling and bioinvading species. Although the representatives of the genus are typically found in shallow waters of tropical and subtropical areas worldwide, the species composition of the genus in Australia has never been revised. We conducted the first detailed regional taxonomic revision of Hydroides species based both on the historical collections from Australian museums (Australian Museum, Museum Victoria, South Australian Museum, Western Australian Museum, Queensland Museum, and Museum and Art Gallery of Northern Territory) and newly collected material from New South Wales, Victoria, Queensland, Northern Territory, and Western Australia. In total, 25 species are currently considered valid in Australia, including three new species: H. amri n. sp. from NSW, SA, and Vic (previously referred to as H. cf. brachyacantha), as well as H. glasbyi n. sp. and H. qiui n. sp., both from NT, and two new records of H. furcifera and H. multispinosa for Australia. We have synonymised H. spiratubus with H. albiceps, and H. spiculitubus with H. tambalagamensis in this study. The status of the taxon H. cf. recta remains undecided. An identification key and diagnoses accompanied by original high-quality photographs for all species recorded in Australia are provided. Application of molecular genetics is needed to resolve the status of some problematic species.

Assessing the health equity impacts of regional land-use plan making: An equity focussed health impact assessment of alternative patterns of development of the Whitsunday Hinterland and Mackay Regional Plan, Australia (Short report)

DOE Office of Scientific and Technical Information (OSTI.GOV)

Gunning, Colleen, E-mail: Colleen_Gunning@health.qld.gov.a; Harris, Patrick; Mallett, John

2011-07-15

Health service and partners completed an equity focussed health impact assessment to influence the consideration of health and equity within regional land-use planning in Queensland, Australia. This project demonstrated how an equity oriented assessment matrix can assist in testing regional planning scenarios. It is hoped that this HIA will contribute to the emerging interest in ensuring that potential differential health impacts continue to be considered as part of land-use planning processes.

An Emerging Global Aerosol Climatology from the MODIS Satellite Sensors

NASA Technical Reports Server (NTRS)

Remer, Lorraine A.; Kleidman, Richard G.; Levy, Robert C.; Kaufman, Yoram J.; Tanre, Didier; Mattoo, Shana; Martins, J. Vandelei; Ichoku, Charles; Koren, Ilan; Hongbin, Yu;

The driving forces of land change in the Northern Piedmont of the United States

USGS Publications Warehouse

Auch, Roger F.; Napton, Darrell E.; Kambly, Steven; Moreland, Thomas R.; Sayler, Kristi L.

2012-01-01

Driving forces facilitate or inhibit land-use/land-cover change. Human driving forces include political, economic, cultural, and social attributes that often change across time and space. Remotely sensed imagery provides regional land-change data for the Northern Piedmont, an ecoregion of the United States that continued to urbanize after 1970 through conversion of agricultural and forest land covers to developed uses. Eight major driving forces facilitated most of the land conversion; other drivers inhibited or slowed change. A synergistic web of drivers may be more important in understanding land change than individual drivers by themselves.

Indigenous Gambling Motivations, Behaviour and Consequences in Northern New South Wales, Australia

ERIC Educational Resources Information Center

Breen, Helen M.; Hing, Nerilee; Gordon, Ashley

2011-01-01

Against a background of public health, we sought to examine and explain gambling behaviours, motivations and consequences of Indigenous Australians in northern New South Wales. Adhering to national Aboriginal and ethical guidelines and using qualitative methods, 169 Indigenous Australians were interviewed individually and in small groups using…

Learning Lessons: An Independent Review of Indigenous Education in the Northern Territory.

ERIC Educational Resources Information Center

Northern Territory Dept. of Education, Darwin (Australia).

A review of Indigenous education was undertaken in the Northern Territory, Australia, to determine the educational views of Indigenous communities, key issues affecting educational outcomes for Indigenous children, and supportable actions to improve those outcomes. Data collection included 126 targeted interviews, 40 public meetings, 106 formal…

Estimating potential wind erosion of agricultural lands in northern China using the Revised Wind Erosion Equation (RWEQ) and GIS

USDA-ARS?s Scientific Manuscript database

Fine materials emissions from severe wind-induced soil erosion have multiple impacts on land degradation and environmental pollution in the agro-pastoral ecotone in northern China (APEC). Assessment of wind erosion for the agricultural land management systems in APEC are needed to determine which sy...

Non-growing season soil CO2 efflux patterns in five land-use types in northern China

USDA-ARS?s Scientific Manuscript database

Overgrazing and unsuitable farming practices have led to grassland degradation in northern China. This studhy examined soil CO2 efflux (Fc) from five land-use types during the non-growing season on the southeastern edge of the Mongolian Plateau in China. The land-use types included three native v...

Reading, Learning and Enacting: Interpretation at Visitor Sites in the Wet Tropics Rainforest of Australia

ERIC Educational Resources Information Center

McNamara, Karen Elizabeth; Prideaux, Bruce

2010-01-01

The northern Wet Tropics rainforest of Australia was declared a world heritage site in 1988 and now supports an extensive tourism industry that attracts an estimated 2.5 million local and international visits annually. As part of the visitor experience, many sites include both environmental and cultural interpretation experiences, which range from…

A Northern Territory Approach to Quantifying "Access Disadvantage" to Educational Services in Remote and Rural Australia.

ERIC Educational Resources Information Center

Griffith, D. A.

The Griffith Service Access Frame (GSAF) is a model used for quantifying the access disadvantage to educational services of remote and rural areas in Australia. The model was specifically developed to assist policymakers and administrators in allocating resources. The problem with the current funding formula used by the Australian federal…

Key factors impacting on diagnosis and treatment for vulvar cancer for Indigenous women: findings from Australia.

PubMed

McGrath, Pam; Rawson, Nicole

2013-10-01

To date, there has been limited research on the topic of vulvar cancer. This paper provides findings from a qualitative study conducted with Indigenous women in East Arnhem Land, Northern Territory, Australia on the psychosocial impact of diagnosis and treatment for vulvar cancer. The insights from the study outlined in this paper not only make a contribution to deepening our understanding of the experience of vulvar cancer for Indigenous women, but provide practical recommendations to ensure effective and early engagement for diagnosis and treatment. A qualitative research method was employed through in-depth, open-ended interviews. The participants of the study were a purposive sample of Indigenous women with the condition, health professionals, and Aboriginal health workers. There were a total of 40 participants; with twelve (n = 12) Indigenous women affected with the condition, fourteen (n = 14) Aboriginal Health Workers, ten (n = 10) nurses, three (n = 3) doctors, and one (n = 1) community member. This paper addresses three key issues highlighted by the participants which include the fact that the private nature of the disease makes the condition 'women's business', that there is a sense of shame associated with the condition, and that there is fear and worry generated by the seriousness of the condition. The private nature of the disease and the sense of shame associated with the condition impact upon the diagnosis and treatment for many Indigenous women. In addition, the limitation of resources for health service delivery for East Arnhem Land exacerbates the problems faced by these communities. This paper puts forward suggestions to facilitate early diagnosis and treatment for women affected with the condition.

Understanding Land System Change Through Scenario-Based Simulations: A Case Study from the Drylands in Northern China

NASA Astrophysics Data System (ADS)

Liu, Zhifeng; Verburg, Peter H.; Wu, Jianguo; He, Chunyang

2017-03-01

The drylands in northern China are expected to face dramatic land system change in the context of socioeconomic development and environmental conservation. Recent studies have addressed changes of land cover with socioeconomic development in the drylands in northern China. However, the changes in land use intensity and the potential role of environmental conservation measures have yet to be adequately examined. Given the importance of land management intensity to the ecological conditions and regional sustainability, our study projected land system change in Hohhot city in the drylands in northern China from 2013 to 2030. Here, land systems are defined as combinations of land cover and land use intensity. Using the CLUMondo model, we simulated land system change in Hohhot under three scenarios: a scenario following historical trends, a scenario with strong socioeconomic and land use planning, and a scenario focused on achieving environmental conservation targets. Our results showed that Hohhot is likely to experience agricultural intensification and urban growth under all three scenarios. The agricultural intensity and the urban growth rate were much higher under the historical trend scenario compared to those with more planning interventions. The dynamics of grasslands depend strongly on projections of livestock and other claims on land resources. In the historical trend scenario, intensively grazed grasslands increase whereas a large amount of the current area of grasslands with livestock converts to forest under the scenario with strong planning. Strong conversion from grasslands with livestock and extensive cropland to semi-natural grasslands was estimated under the conservation scenario. The findings provide an input into discussions about environmental management, planning and sustainable land system design for Hohhot.

Drought rapidly diminishes the large net CO2 uptake in 2011 over semi-arid Australia

PubMed Central

Ma, Xuanlong; Huete, Alfredo; Cleverly, James; Eamus, Derek; Chevallier, Frédéric; Joiner, Joanna; Poulter, Benjamin; Zhang, Yongguang; Guanter, Luis; Meyer, Wayne; Xie, Zunyi; Ponce-Campos, Guillermo

2016-01-01

Each year, terrestrial ecosystems absorb more than a quarter of the anthropogenic carbon emissions, termed as land carbon sink. An exceptionally large land carbon sink anomaly was recorded in 2011, of which more than half was attributed to Australia. However, the persistence and spatially attribution of this carbon sink remain largely unknown. Here we conducted an observation-based study to characterize the Australian land carbon sink through the novel coupling of satellite retrievals of atmospheric CO2 and photosynthesis and in-situ flux tower measures. We show the 2010–11 carbon sink was primarily ascribed to savannas and grasslands. When all biomes were normalized by rainfall, shrublands however, were most efficient in absorbing carbon. We found the 2010–11 net CO2 uptake was highly transient with rapid dissipation through drought. The size of the 2010–11 carbon sink over Australia (0.97 Pg) was reduced to 0.48 Pg in 2011–12, and was nearly eliminated in 2012–13 (0.08 Pg). We further report evidence of an earlier 2000–01 large net CO2 uptake, demonstrating a repetitive nature of this land carbon sink. Given a significant increasing trend in extreme wet year precipitation over Australia, we suggest that carbon sink episodes will exert greater future impacts on global carbon cycle. PMID:27886216

Teachers' Learning in Online Communities of Practice: Two Case Studies from Australia

ERIC Educational Resources Information Center

Hanewald, Ria

2013-01-01

Australia is a vast land with a dispersed population especially in rural or remote areas, which is geographically located in the Asian region. This has a strong bearing on its initial education (pre-service) and the ongoing professional development (in-service) of teachers. The vastness of Australia causes professional isolation and a lack of…

Taxonomic revision of Phascogale tapoatafa (Meyer, 1793) (Dasyuridae; Marsupialia), including descriptions of two new subspecies and confirmation of P. pirata Thomas, 1904 as a ‘Top End’ endemic

USGS Publications Warehouse

Aplin, K. P.; Rhind, S. G.; Ten Have, J.; Chesser, R. Terry

2015-01-01

The Australian Brush-tailed Phascogale (Phascogale tapoatafa sensu lato) has a broad but highly fragmented distribution around the periphery of the Australian continent and all populations are under significant ongoing threat to survival. A new appraisal of morphological and molecular diversity within the group reveals that the population in the ‘Top End’ of the Northern Territory is specifically distinct from all others, including those in the Kimberley region of Western Australia to the west and on Cape York of Queensland to the east. The name P. pirata Thomas, 1904 is available for the ‘Top End’ taxon. Three geographically disjunct populations are distinguished at subspecies level within P. tapoatafa on a suite of external and cranio-dental features; these are found in southeast Australia from South Australia to mid-coastal Queensland (nominotypical tapoatafa), southwest Western Australia (wambenger subsp. nov.), and the Kimberley region of Western Australia (kimberleyensis subsp. nov.). A potential fourth subspecies occurs on Cape York but remains too poorly represented in collections for adequate characterization. Molecular divergence estimates based on partial sequences of the mitochondrial cytochrome b gene indicate that the range disjunction across southern Australia probably dates from the Late Pliocene, with the multiple disjunctions across northern Australia being more recent though almost certainly exceeding 400,000 years. An argument is made for the continued use of the subspecies rank in Australian mammalogy, despite a general lack of consistency in its current application.

Soil respiration patterns for four major land-use types of the agro-pastoral region of northern China

USDA-ARS?s Scientific Manuscript database

Land-use types and management practices are critical factors that affect soil CO2 efflux (Rs). In the agro-pastoral area of northern China, land-use types have changed considerably during the last 60 years due to changes in the social-economic status of the human population and associated changes i...

"Boys Business": An Unusual Northern Australian Music Program for Boys in the Middle Years of Schooling

ERIC Educational Resources Information Center

Smith, Bob

2004-01-01

The Northern Territory's population commingles Anglo, European and Asian cultural communities. At over 25 percent, it also has Australia's proportionately largest indigenous population. Consequently it presents an amazing proving ground for people-related research projects. One such project is "Boys Business", involving middle years'…

Greenhouse gas network design using backward Lagrangian particle dispersion modelling - Part 1: Methodology and Australian test case

NASA Astrophysics Data System (ADS)

Ziehn, T.; Nickless, A.; Rayner, P. J.; Law, R. M.; Roff, G.; Fraser, P.

2014-03-01

This paper describes the generation of optimal atmospheric measurement networks for determining carbon dioxide fluxes over Australia using inverse methods. A Lagrangian particle dispersion model is used in reverse mode together with a Bayesian inverse modelling framework to calculate the relationship between weekly surface fluxes and hourly concentration observations for the Australian continent. Meteorological driving fields are provided by the regional version of the Australian Community Climate and Earth System Simulator (ACCESS) at 12 km resolution at an hourly time scale. Prior uncertainties are derived on a weekly time scale for biosphere fluxes and fossil fuel emissions from high resolution BIOS2 model runs and from the Fossil Fuel Data Assimilation System (FFDAS), respectively. The influence from outside the modelled domain is investigated, but proves to be negligible for the network design. Existing ground based measurement stations in Australia are assessed in terms of their ability to constrain local flux estimates from the land. We find that the six stations that are currently operational are already able to reduce the uncertainties on surface flux estimates by about 30%. A candidate list of 59 stations is generated based on logistic constraints and an incremental optimization scheme is used to extend the network of existing stations. In order to achieve an uncertainty reduction of about 50% we need to double the number of measurement stations in Australia. Assuming equal data uncertainties for all sites, new stations would be mainly located in the northern and eastern part of the continent.

Designing optimal greenhouse gas monitoring networks for Australia

NASA Astrophysics Data System (ADS)

Ziehn, T.; Law, R. M.; Rayner, P. J.; Roff, G.

2016-01-01

Atmospheric transport inversion is commonly used to infer greenhouse gas (GHG) flux estimates from concentration measurements. The optimal location of ground-based observing stations that supply these measurements can be determined by network design. Here, we use a Lagrangian particle dispersion model (LPDM) in reverse mode together with a Bayesian inverse modelling framework to derive optimal GHG observing networks for Australia. This extends the network design for carbon dioxide (CO2) performed by Ziehn et al. (2014) to also minimise the uncertainty on the flux estimates for methane (CH4) and nitrous oxide (N2O), both individually and in a combined network using multiple objectives. Optimal networks are generated by adding up to five new stations to the base network, which is defined as two existing stations, Cape Grim and Gunn Point, in southern and northern Australia respectively. The individual networks for CO2, CH4 and N2O and the combined observing network show large similarities because the flux uncertainties for each GHG are dominated by regions of biologically productive land. There is little penalty, in terms of flux uncertainty reduction, for the combined network compared to individually designed networks. The location of the stations in the combined network is sensitive to variations in the assumed data uncertainty across locations. A simple assessment of economic costs has been included in our network design approach, considering both establishment and maintenance costs. Our results suggest that, while site logistics change the optimal network, there is only a small impact on the flux uncertainty reductions achieved with increasing network size.

Global surface temperature change analysis based on MODIS data in recent twelve years

NASA Astrophysics Data System (ADS)

Mao, K. B.; Ma, Y.; Tan, X. L.; Shen, X. Y.; Liu, G.; Li, Z. L.; Chen, J. M.; Xia, L.

2017-01-01

Global surface temperature change is one of the most important aspects in global climate change research. In this study, in order to overcome shortcomings of traditional observation methods in meteorology, a new method is proposed to calculate global mean surface temperature based on remote sensing data. We found that (1) the global mean surface temperature was close to 14.35 °C from 2001 to 2012, and the warmest and coldest surface temperatures of the global in the recent twelve years occurred in 2005 and 2008, respectively; (2) the warmest and coldest surface temperatures on the global land surface occurred in 2005 and 2001, respectively, and on the global ocean surface in 2010 and 2008, respectively; and (3) in recent twelve years, although most regions (especially the Southern Hemisphere) are warming, global warming is yet controversial because it is cooling in the central and eastern regions of Pacific Ocean, northern regions of the Atlantic Ocean, northern regions of China, Mongolia, southern regions of Russia, western regions of Canada and America, the eastern and northern regions of Australia, and the southern tip of Africa. The analysis of daily and seasonal temperature change indicates that the temperature change is mainly caused by the variation of orbit of celestial body. A big data model based on orbit position and gravitational-magmatic change of celestial body with the solar or the galactic system should be built and taken into account for climate and ecosystems change at a large spatial-temporal scale.

Land Ethics--Who Needs Them?

ERIC Educational Resources Information Center

Roberts, B.

1985-01-01

Identifies land degradation as Australia's most urgent environmental problem and recommends the development of a land ethic for soil conservation. Presents a 15-point conservation education plan that encourages a sustainable ecological basis for rural production and also cultivates ecologically sound habits toward nature. (ML)

Implementing guideline based heart failure care in the Northern Territory: challenges and solutions.

PubMed

Iyngkaran, Pupalan; Harris, Melanie; Ilton, Marcus; Kangaharan, Nadarajan; Battersby, Malcolm; Stewart, Simon; Brown, Alex

2014-05-01

The Northern Territory of Australia is a vast area serviced by two major tertiary hospitals. It has both a unique demography and geography, which pose challenges for delivering optimal heart failure services. The prevalence of congestive heart failure continues to increase, imposing a significant burden on health infrastructure and health care costs. Specific patient groups suffer disproportionately from increased disease severity or service related issues often represented as a "health care gap". The syndrome itself is characterised by ongoing symptoms interspersed with acute decompensation requiring lifelong therapy and is rarely reversible. For the individual client the overwhelming attention to heart failure care and the impact of health care gaps can be devastating. This gap may also contribute to widening socio-economic differentials for families and communities as they seek to take on some of the care responsibilities. This review explores the challenges of heart failure best practice in the Northern Territory and the opportunities to improve on service delivery. The discussions highlighted could have implications for health service delivery throughout regional centres in Australia and health systems in other countries. Copyright © 2014 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). All rights reserved.

Wilderness and wild lands in the Northern Appalachian Region of North America: An ecological perspective

Treesearch

Stephen C. Trombulak

2007-01-01

The ecological context of the Northern Appalachian region of North America is reviewed and general patterns of ownership and protection status of land discussed. Although there is wide variability among the states and provinces in the proportion of their land that is publicly owned, only a very small proportion, ranging from 0.1 percent to 8.0 percent, anywhere is...

MOBILESAT: Australia's own

NASA Technical Reports Server (NTRS)

Wagg, Michael

1990-01-01

Australia will be introducing a dedicated Mobile Satellite Communications System following the launch of the AUSSAT-B satellites late in 1991. The Mobile Satellite System, MOBILESAT, will provide circuit switched voice/data services and packet-switched data services for land, aeronautical and maritime users. Here, an overview is given of the development program being undertaken within Australia to enable a fully commercial service to be introduced in 1992.

Fusarium agapanthi sp. nov, a novel bikaverin and fusarubin-producing leaf and stem spot pathogen of Agapanthus praecox (African lily) from Australia and Italy

USDA-ARS?s Scientific Manuscript database

This study was conducted to characterize a novel Fusarium species that caused leaf and stem spot on Agapanthus praecox (Agapanthus, African lily) in northern Italy and leaf rot and spot on the same host in Melbourne, Australia. Formally described as Fusarium agapanthi, this pathogen was analyzed usi...

Five-year field trials using preservative-treated, second-growth Douglas-fir exposed in ground contact in Australia

Treesearch

Rodney C. De Groot; Douglas M. Crawford; Jack Norton; John Keith

2000-01-01

The durability of preservative-treated stakes of second-growth Coastal Douglas-fir was evaluated in a field plot in northern Queensland, Australia. Results from this field trial indicate that second-growth Douglas-fir can be treated with preservatives to meet Australian standards and will provide long-term durability in adverse environments. Data presented indicate...

Professional Development Programmes for Teachers in the Northern Territory of Australia: Enablers and Inhibiters for Success in Two Aspirant Leadership Programmes

ERIC Educational Resources Information Center

Speering, Glen

2016-01-01

Professional development programmes for teachers have become an increasing focus in the quest to improve teacher quality. In regional and remote areas of Australia the delivery of professional development programmes can become problematic. This study compares and contrasts the two separate professional development programmes evaluated (Programme A…

Reclaiming Indigenous Youth in Australia: Families and Schools Together

ERIC Educational Resources Information Center

Mechielsen,Jack; Galbraith, Mal; White, Andrew

2014-01-01

Australia's Northern Territory is twice the size of Texas, with only 230,000 people living in its enormous space. About half reside in the capital Darwin in the tropical far north; the next biggest town with a population of 25,000 people is Alice Springs, 1600 kilometers south in the central desert. Some 70,000 Indigenous people form 30% of the…

Understanding the sources and effects of abandoned, lost, and discarded fishing gear on marine turtles in northern Australia.

PubMed

Wilcox, Chris; Heathcote, Grace; Goldberg, Jennifer; Gunn, Riki; Peel, David; Hardesty, Britta Denise

2015-02-01

Globally, 6.4 million tons of fishing gear are lost in the oceans annually. This gear (i.e., ghost nets), whether accidently lost, abandoned, or deliberately discarded, threatens marine wildlife as it drifts with prevailing currents and continues to entangle marine organisms indiscriminately. Northern Australia has some of the highest densities of ghost nets in the world, with up to 3 tons washing ashore per kilometer of shoreline annually. This region supports globally significant populations of internationally threatened marine fauna, including 6 of the 7 extant marine turtles. We examined the threat ghost nets pose to marine turtles and assessed whether nets associated with particular fisheries are linked with turtle entanglement by analyzing the capture rates of turtles and potential source fisheries from nearly 9000 nets found on Australia's northern coast. Nets with relatively larger mesh and smaller twine sizes (e.g., pelagic drift nets) had the highest probability of entanglement for marine turtles. Net size was important; larger nets appeared to attract turtles, which further increased their catch rates. Our results point to issues with trawl and drift-net fisheries, the former due to the large number of nets and fragments found and the latter due to the very high catch rates resulting from the net design. Catch rates for fine-mesh gill nets can reach as high as 4 turtles/100 m of net length. We estimated that the total number of turtles caught by the 8690 ghost nets we sampled was between 4866 and 14,600, assuming nets drift for 1 year. Ghost nets continue to accumulate on Australia's northern shore due to both legal and illegal fishing; over 13,000 nets have been removed since 2005. This is an important and ongoing transboundary threat to biodiversity in the region that requires attention from the countries surrounding the Arafura and Timor Seas. © 2014 Society for Conservation Biology.

Land use in the Northern Great Plains region of the U.S. influences the survival and productivity of honey bee colonies

USGS Publications Warehouse

Smart, Matthew; Pettis, Jeff S.; Euliss, Ned H. Jr.; Spivak, Marla S.

2016-01-01

The Northern Great Plains region of the US annually hosts a large portion of commercially managed U.S. honey bee colonies each summer. Changing land use patterns over the last several decades have contributed to declines in the availability of bee forage across the region, and the future sustainability of the region to support honey bee colonies is unclear. We examined the influence of varying land use on the survivorship and productivity of honey bee colonies located in six apiaries within the Northern Great Plains state of North Dakota, an area of intensive agriculture and high density of beekeeping operations. Land use surrounding the apiaries was quantified over three years, 2010–2012, and survival and productivity of honey bee colonies were determined in response to the amount of bee forage land within a 3.2-km radius of each apiary. The area of uncultivated forage land (including pasture, USDA conservation program fields, fallow land, flowering woody plants, grassland, hay land, and roadside ditches) exerted a positive impact on annual apiary survival and honey production. Taxonomic diversity of bee-collected pollen and pesticide residues contained therein varied seasonally among apiaries, but overall were not correlated to large-scale land use patterns or survival and honey production. The predominant flowering plants utilized by honey bee colonies for pollen were volunteer species present in unmanaged (for honey bees), and often ephemeral, lands; thus placing honey bee colonies in a precarious situation for acquiring forage and nutrients over the entire growing season. We discuss the implications for land management, conservation, and beekeeper site selection in the Northern Great Plains to adequately support honey bee colonies and insure long term security for pollinator-dependent crops across the entire country.

Identification of unusual Chlamydia pecorum genotypes in Victorian koalas (Phascolarctos cinereus) and clinical variables associated with infection.

PubMed

Legione, Alistair R; Patterson, Jade L S; Whiteley, Pam L; Amery-Gale, Jemima; Lynch, Michael; Haynes, Leesa; Gilkerson, James R; Polkinghorne, Adam; Devlin, Joanne M; Sansom, Fiona M

2016-05-01

Chlamydia pecorum infection is a threat to the health of free-ranging koalas (Phascolarctos cinereus) in Australia. Utilizing an extensive sample archive we determined the prevalence of C. pecorum in koalas within six regions of Victoria, Australia. The ompA genotypes of the detected C. pecorum were characterized to better understand the epidemiology of this pathogen in Victorian koalas. Despite many studies in northern Australia (i.e. Queensland and New South Wales), prior Chlamydia studies in Victorian koalas are limited. We detected C. pecorum in 125/820 (15 %) urogenital swabs, but in only one ocular swab. Nucleotide sequencing of the molecular marker C. pecorum ompA revealed that the majority (90/114) of C. pecorum samples typed were genotype B. This genotype has not been reported in northern koalas. In general, Chlamydia infection in Victorian koalas is associated with milder clinical signs compared with infection in koalas in northern populations. Although disease pathogenesis is likely to be multifactorial, the high prevalence of genotype B in Victoria may suggest it is less pathogenic. All but three koalas had C. pecorum genotypes unique to southern koala populations (i.e. Victoria and South Australia). These included a novel C. pecorum ompA genotype and two genotypes associated with livestock. Regression analysis determined that significant factors for the presence of C. pecorum infection were sex and geographical location. The presence of 'wet bottom' in males and the presence of reproductive tract pathology in females were significantly associated with C. pecorum infection, suggesting variation in clinical disease manifestations between sexes.

Beyond the Barcoo--probable human tropical cyanobacterial poisoning in outback Australia.

PubMed

Hayman, J

To determine the cause of a disease known variously as "Barcoo fever, Barcoo spews, Barcoo sickness", or simply "the Barcoo", once prevalent in outback northern and central Australia. Comparison of the recorded symptoms with those of known infectious diseases and gastrointestinal illness; consideration of the epidemiology, including times and places of occurrence and the population affected. The disease had features of a toxic rather than an infectious illness and had the characteristics of poisoning by toxic cyanobacteria (blue-green algae). In particular the symptoms were similar to those shown to be due to the hepatotoxin of the tropical cyanobacterium Cylindrospermopsis raciborskii (Woloszynska). Poisoning by cyanobacterial toxins was once widespread in outback northern Australia and toxic cyanobacteria must still be present in many areas. Although not reported and probably not diagnosed as such, the disease still occurs in mild form. Widespread illness does not occur but individuals still experience symptoms similar to those described a century ago. Precautions are necessary to prevent algal contamination or proliferation in domestic or communal water supplies.

A new species of freshwater eel-tailed catfish of the genus Tandanus (Teleostei: Plotosidae) from coastal rivers of mid-northern New South Wales, Australia

USGS Publications Warehouse

Welsh, Stuart A.; Jerry, Dean R.; Burrows, Damien; Rourke, Meaghan L.

2017-01-01

Tandanus bellingerensis, new species, is described based on specimens from four river drainages (Bellinger, Macleay, Hastings, and Manning rivers) of the mid-northern coast of New South Wales, Australia. Previously, three species were recognized in the genus Tandanus: T. tropicanus of the wet tropics region of northeast Queensland, T. tandanus of the Murray-Darling drainage and coastal streams of central-southern Queensland and New South Wales, and T. bostocki of southwestern Western Australia. The new species is distinguished from all congeners by a combination of the following morphologic characters: a high count of rays in the continuous caudodorsal and anal fins (range 153–169, mode 159), a high count of gill rakers on the first arch (range 35–39, mode 36), and strongly recurved posterior serrae of the pectoral-fin spine. Additionally, results from previously conducted genetic studies corroborate morphologic and taxonomic distinctness of the new species.

Northern Territory perspectives on heart failure with comorbidities – understanding trial validity and exploring collaborative opportunities to broaden the evidence base.

PubMed

Iyngkaran, P; Majoni, W; Cass, A; Sanders, Prashanthan; Ronco, C; Brady, S; Kangaharan, N; Ilton, M; Hare, D L; Thomas, M C

2015-06-01

Congestive Heart Failure (CHF) is an ambulatory care sensitive condition, associated with significant morbidity and mortality, rarely with cure. Outpatient based pharmacological management represents the main and most important aspect of care, and is usually lifelong. This narrative styled opinion review looks at the pharmacological agents recommended in the guidelines in context of the Northern Territory (NT) of Australia. We explore the concept of validity, a term used to describe the basis of standardising a particular trial or study and the population to which it is applicable. We aim to highlight the problems of the current guidelines based approach. We also present alternatives that could utilise the core principles from major trials, while incorporating regional considerations, which could benefit clients living in the NT and remote Australia. Copyright © 2015 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). Published by Elsevier B.V. All rights reserved.

Patient satisfaction with musculoskeletal physiotherapy care in Australia: an international comparison.

PubMed

Hush, Julia M; Yung, Vivian; Mackey, Martin; Adams, Roger; Wand, Benedict M; Nelson, Roger; Beattie, Paul

2012-11-01

(1) To attain a quantitative estimate of patient satisfaction with physiotherapy care for musculoskeletal conditions in Australia; (2) to compare the observed level of patient satisfaction with care in Australia with those from other countries; and (3) to compare factors contributing to patient satisfaction between Australia and the United States (US). We conducted a prospective study of 274 patients presenting for physiotherapy treatment of a musculoskeletal disorder in Australian clinics. Patient satisfaction was measured using the 20-item MedRisk Instrument for Measuring Patient Satisfaction with Physical Therapy Care (MRPS) and satisfaction scores were compared with those from Northern Europe, North America, the United Kingdom, and Ireland. To investigate factors contributing to patient satisfaction between Australia and the US, we compared 20-item MRPS data from Australian and Spanish-speaking US cohorts. Mean Australian MRPS satisfaction score was 4.55 (95% confidence interval: 4.51-4.59) on a scale of 1 to 5, where 1 indicates high dissatisfaction and 5 indicates high satisfaction. This high level of patient satisfaction is consistent with international data. Australian respondents specifically valued interpersonal aspects of care, including advice and information about their condition and an explanation about self-management. The correlation between treatment outcomes and global patient satisfaction was low (r = -0.22). A comparison of data collected from Australia and the US showed that MRPS items regarding interpersonal aspects of care, such as the therapists' communication skills, correlated strongly with global satisfaction in both countries. However, there were other questionnaire items for which the correlation with global satisfaction was significantly different between Australia and the US. Patient satisfaction with musculoskeletal physiotherapy care in Australia is high and comparable with Northern Europe, North America, the United Kingdom and Ireland. Comparison of data between Australia and the US indicates that while some determinants of patient satisfaction are common, country-specific differences also exist.

Patient satisfaction with musculoskeletal physiotherapy care in Australia: an international comparison

PubMed Central

Hush, Julia M; Yung, Vivian; Mackey, Martin; Adams, Roger; Wand, Benedict M; Nelson, Roger; Beattie, Paul

2012-01-01

Objectives: (1) To attain a quantitative estimate of patient satisfaction with physiotherapy care for musculoskeletal conditions in Australia; (2) to compare the observed level of patient satisfaction with care in Australia with those from other countries; and (3) to compare factors contributing to patient satisfaction between Australia and the United States (US). Methods: We conducted a prospective study of 274 patients presenting for physiotherapy treatment of a musculoskeletal disorder in Australian clinics. Patient satisfaction was measured using the 20-item MedRisk Instrument for Measuring Patient Satisfaction with Physical Therapy Care (MRPS) and satisfaction scores were compared with those from Northern Europe, North America, the United Kingdom, and Ireland. To investigate factors contributing to patient satisfaction between Australia and the US, we compared 20-item MRPS data from Australian and Spanish-speaking US cohorts. Results: Mean Australian MRPS satisfaction score was 4.55 (95% confidence interval: 4.51–4.59) on a scale of 1 to 5, where 1 indicates high dissatisfaction and 5 indicates high satisfaction. This high level of patient satisfaction is consistent with international data. Australian respondents specifically valued interpersonal aspects of care, including advice and information about their condition and an explanation about self-management. The correlation between treatment outcomes and global patient satisfaction was low (r = −0.22). A comparison of data collected from Australia and the US showed that MRPS items regarding interpersonal aspects of care, such as the therapists’ communication skills, correlated strongly with global satisfaction in both countries. However, there were other questionnaire items for which the correlation with global satisfaction was significantly different between Australia and the US. Conclusions: Patient satisfaction with musculoskeletal physiotherapy care in Australia is high and comparable with Northern Europe, North America, the United Kingdom and Ireland. Comparison of data between Australia and the US indicates that while some determinants of patient satisfaction are common, country-specific differences also exist. PMID:24179328

Remote and Invisible: The Voices of Female Indigenous Educational Leaders in Northern Territory Remote Community Schools in Australia

ERIC Educational Resources Information Center

Kamara, Martha

2017-01-01

While the literature on women and educational leadership has been addressed in substantive ways in recent years, the experiences that reflect female Australian educational leaders are rare. This article reports findings from a study of five female Indigenous principals in the Northern Territory utilising biographic narratives and foregrounds their…

Not an ancient relic: the endemic Livistona palms of arid central Australia could have been introduced by humans

PubMed Central

Kondo, Toshiaki; Crisp, Michael D.; Linde, Celeste; Bowman, David M. J. S.; Kawamura, Kensuke; Kaneko, Shingo; Isagi, Yuji

2012-01-01

Livistona mariae is an endemic palm localized in arid central Australia. This species is separated by about 1000 km from its congener L. rigida, which grows distantly in the Roper River and Nicholson–Gregory River catchments in northern Australia. Such an isolated distribution of L. mariae has been assumed to have resulted from contraction of ancestral populations as Australia aridified from the Mid-Miocene (ca 15 Ma). To test this hypothesis at the population level, we examined the genetic relationships among 14 populations of L. mariae and L. rigida using eight nuclear microsatellite loci. Our population tree and Bayesian clustering revealed that these populations comprised two genetically distinct groups that did not correspond to the current classification at species rank, and L. mariae showed closest affinity with L. rigida from Roper River. Furthermore, coalescent divergence-time estimations suggested that the disjunction between the northern populations (within L. rigida) could have originated by intermittent colonization along an ancient river that has been drowned repeatedly by marine transgression. During that time, L. mariae populations could have been established by opportunistic immigrants from Roper River about 15 000 years ago, concurrently with the settlement of indigenous Australians in central Australia, who are thus plausible vectors. Thus, our results rule out the ancient relic hypothesis for the origin of L. mariae. PMID:22398168

Investigation of land use of northern megalopolis using ERTS-1 imagery

NASA Technical Reports Server (NTRS)

Simpson, R. B.; Lindgren, D. T.; Ruml, D. J.; Goldstein, W.

1974-01-01

Primary objective was to produce a color-coded land use map and digital data base for the northern third of Megalopolis. Secondary objective was to investigate possible applications of ERTS products to land use planning. Many of the materials in this report already have received national, dissemination as a result of unexpected interest in land use surveys from ERTS. Of special historical interest is the first comprehensive urban-type land use map from space imagery, which covered the entire state of Rhode Island and was made from a single image taken on 28 July 1972.

Importance of Nitrogen Availability on Land Carbon Sequestration in Northern Eurasia during the 21st Century

NASA Astrophysics Data System (ADS)

Kicklighter, D. W.; Melillo, J. M.; Monier, E.; Sokolov, A. P.; Lu, X.; Zhuang, Q.

2015-12-01

Atmospheric nitrogen deposition, nitrogen fixation, and the application of nitrogen fertilizers provide subsidies to land ecosystems that can increase nitrogen availability for vegetation production and thereby influence land carbon dynamics. In addition, enhanced decomposition of soil organic matter (SOM) from warming soils and permafrost degradation may also increase nitrogen availability in Northern Eurasia. Here, we examine how changes in nitrogen availability may influence land carbon dynamics in Northern Eurasia during the 21st century by comparing results for a "business as usual" scenario (the IPCC Representative Concentration Pathways or RCP 8.5) and a stabilization scenario (RCP 4.5) between a version of the Terrestrial Ecosystem Model that does not consider the effects of atmospheric nitrogen deposition, nitrogen fixation and soil thermal dynamics on land carbon dynamics (TEM 4.4) and a version that does consider these dynamics (TEM 6.0). In these simulations, atmospheric nitrogen deposition, nitrogen fixation, and fertilizer applications provide an additional 3.3 Pg N (RCP 4.5) to 3.9 Pg N (RCP 8.5) to Northern Eurasian ecosystems over the 21st century. Land ecosystems retain about 38% (RCP4.5) to 48% (RCP 8.5) of this nitrogen subsidy. Net nitrogen mineralization estimated by TEM 6.0 provide an additional 1.0 Pg N to vegetation than estimated by TEM 4.4 over the 21st century from enhanced decomposition of SOM including SOM formerly protected by permafrost. The enhanced nitrogen availability in TEM 6.0 allows Northern Eurasian ecosystems to sequester 1.8x (RCP 8.5) to 2.4x (RCP 4.5) more carbon over the 21st century than estimated by TEM 4.4. Our results indicate that consideration of nitrogen subsidies and soil thermal dynamics have a large influence on how simulated land carbon dynamics in Northern Eurasia will respond to future changes in climate, atmospheric chemistry, and disturbances.

Abortion rights down under.

PubMed

Kirkby, M

1994-08-01

State and federal governments in Australia fear actively trying to ensure access to abortion. No federal abortion law in Australia exists. Abortion is a state matter. The federal government's health care system does reimburse women for abortion services, however. State laws prohibit unlawful abortions but they do not define what they mean by unlawful abortion. Victoria, New South Wales, and Queensland have had common law interpretations of their Crimes Acts, which allow greater access to abortion. Tasmania and Western Australia have not had common law interpretations. Thus, even though abortion is available, women and providers are not secure. Abortion reform in South Australia and the Northern Territory has made access to abortion more difficult. A woman must be a resident in South Australia for 2 months before she can obtain an abortion. Abortions are allowed only in a clinic or a hospital. Women in metropolitan Melbourne and Sydney have good access to abortion services, while those in the country or in an isolated part of NSW or Victoria may have an antiabortion physician serving their area. Women in Queensland, Tasmania, and Western Australia pay a lot for an abortion because they also have to pay for airfare to a large city. Only a gynecologist can perform abortions in the Northern Territory. Social workers often coerce Aboriginal women into an abortion. The few antiabortion physicians have a big impact on whether women receive abortion information or not. Research at Adelaide and Flinders Universities show that abortion-related trauma is linked to obtaining information and access to abortion services. Physicians are nervous about performing abortions because abortion is still in the Crimes Acts and Criminal Codes, making it difficult to recruit high quality and empathetic practitioners. Antiabortion groups are small and tend not to adopt extreme tactics. The Abortion Rights Network of Australia has recently been formed.

Phylogeography of an Australian termite, Amitermes laurensis (Isoptera, Termitidae), with special reference to the variety of mound shapes.

PubMed

Ozeki, Masato; Isagi, Yuji; Tsubota, Hiromi; Jacklyn, Peter; Bowman, David M J S

2007-01-01

In northern Australia, the debris-feeding termite Amitermes laurensis builds tall, wedge-shaped mounds in the northern part of Cape York Peninsula and Arnhem Land, where their habitats are seasonally flooded, and small dome shaped mounds in the southeastern part of Cape York Peninsula, where their habitats are well-drained. Phylogeographic analyses were conducted in 238 individuals from 30 populations using the mitochondrial cytochrome oxidase II (COII) gene. DNA sequences of 50 haplotypes were used to construct NJ, MP and ML trees. Phylogenetic trees for 16 Amitermes species showed monophyly of A. laurensis and the variation of A. laurensis mounds did not strongly correspond to the intraspecific phylogeny. It was observed that mounds with the same shape were constructed by phylogenetically different groups under similar environmental conditions and different mounds shapes were built by phylogenetically closely related groups under the different environmental conditions. Thus, phylogenetically close groups of A. laurensis, in different habitats, may adapt to environmental conditions by constructing different mound shapes. We also investigated the phylogeographic structure of A. laurensis. The significant positive correlation between genetic and geographic distances indicated isolation by distance, reflecting restricted dispersal ability of alates. Although the overall genetic structure of A. laurensis showed isolation by distance, we also identified two exceptions: (i) secondary contacts of genetically divergent lineages in southern Cape York Peninsula, and (ii) low genetic differences between geographically separated populations of Cape York Peninsula and Arnhem Land. Therefore, the phylogeography of A. laurensis may reflect continuous gene flow restricted to short distances and past changes of gene flow associated with the fluctuation of environmental conditions accompanying the changing sea levels in the Quaternary.

Heron Island, Australia

NASA Technical Reports Server (NTRS)

2002-01-01

The skies over Northern India are filled with a thick soup of aerosol particles all along the southern edge of the Himalayan Mountains, and streaming southward over Bangladesh and the Bay of Bengal. Notice that the air over the Tibetan Plateau to the north of the Himalayas is very clear, whereas the view of the land surface south of the mountains is obstructed by the brownish haze. Most of this air pollution comes from human activities. The aerosol over this region is notoriously rich in sulfates, nitrates, organic and black carbon, and fly ash. These particles not only represent a health hazard to those people living in the region, but scientists have also recently found that they can have a significant impact on the region's hydrological cycle and climate (click to read the relevant NASA press release). This true-color image was acquired on December 4, 2001, by the Moderate-resolution Imaging Spectroradiometer (MODIS), flying aboard NASA's Terra satellite. It is interesting to compare the image above with this earlier MODIS image over the region, acquired on October 23, 2001. Notice the difference in the clarity of the air over the region in the earlier image. Under the thick plume of aerosol, the Brahmaputra (upper right) and Ganges Rivers are still visible. The many mouths of the Ganges have turned the northern waters of the Bay of Bengal a murky brown as they empty their sediment-laden waters into the bay. Toward the upper lefthand corner of the image, there appears to be a fresh swath of snow on the ground just south of the Himalayas. Image courtesy Jacques Descloitres, MODIS Land Rapid Response Team at NASA GSFC

Evaluating trans-tethys migration: an example using acrodont lizard phylogenetics.

PubMed

Macey, J R; Schulte, J A; Larson, A; Ananjeva, N B; Wang, Y; Pethiyagoda, R; Rastegar-Pouyani, N; Papenfuss, T J

2000-06-01

A phylogenetic tree for acrodont lizards (Chamaeleonidae and Agamidae) is established based on 1434 bases (1041 informative) of aligned DNA positions from a 1685-1778 base pair region of the mitochondrial genome. Sequences from three protein-coding genes (ND1, ND2, and COI) are combined with sequences from eight intervening tRNA genes for samples of 70 acrodont taxa and two outgroups. Parsimony analysis of nucleotide sequences identifies eight major clades in the Acrodonta. Most agamid lizards are placed into three distinct clades. One clade is composed of all taxa occurring in Australia and New Guinea; Physignathus cocincinus from Southeast Asia is the sister taxon to the Australia-New Guinea clade. A second clade is composed of taxa occurring from Tibet and the Indian Subcontinent east through South and East Asia. A third clade is composed of taxa occurring from Africa east through Arabia and West Asia to Tibet and the Indian Subcontinent. These three clades contain all agamid lizards except Uromastyx, Leiolepis, and Hydrosaurus, which represent three additional clades of the Agamidae. The Chamaeleonidae forms another clade weakly supported as the sister taxon to the Agamidae. All eight clades of the Acrodonta contain members occurring on land masses derived from Gondwanaland. A hypothesis of agamid lizards rafting with Gondwanan plates is examined statistically. This hypothesis suggests that the African/West Asian clade is of African or Indian origin, and the South Asian clade is either of Indian or Southeast Asian origin. The shortest tree suggests a possible African origin for the former and an Indian origin for the latter, but this result is not statistically robust. The Australia-New Guinea clade rafted with the Australia-New Guinea plate and forms the sister group to a Southeast Asian taxon that occurs on plates that broke from northern Australia-New Guinea. Other acrodont taxa are inferred to be associated with the plates of Afro-Arabia and Madagascar (Chameleonidae), India (Uromastyx), or southeast Asia (Hydrosaurus and Leiolepis). Introduction of different biotic elements to Asia by way of separate Gondwanan plates may be a major theme of Asian biogeography. Three historical events may be responsible for the sharp faunal barrier between Southeast Asia and Australia-New Guinea, known as Wallace's line: (1) primary vicariance caused by plate separations; (2) secondary contact of Southeast Asian plates with Eurasia, leading to dispersal from Eurasia into Southeast Asia, and (3) dispersal of the Indian fauna (after collision of that subcontinent) to Southeast Asia. Acrodont lizards show the first and third of these biogeographic patterns and anguid lizards exhibit the second pattern. Modern faunal diversity may be influenced primarily by historical events such as tectonic collisions and land bridge connections, which are expected to promote episodic turnover of continental faunas by introducing new faunal elements into an area. Repeated tectonic collisions may be one of the most important phenomena promoting continental biodiversity. Phylogenetics is a powerful method for investigating these processes.

Information Online 89. Selected Papers from the Australasian Online Information Conference and Exhibition (4th, Sydney, Australia, January 17-19, 1989).

ERIC Educational Resources Information Center

Lowry, Glenn R.; And Others

1989-01-01

The 10 papers in this collection discuss the database industry in Australia and New Zealand, networking activities in the ASEAN (Association of Southeast Asian Nations) region, intellectual property protection of databases, the development of land information systems in Australia, the development of expert systems, the use of optical data disks,…

Application of Scan Statistics to Detect Suicide Clusters in Australia

PubMed Central

Cheung, Yee Tak Derek; Spittal, Matthew J.; Williamson, Michelle Kate; Tung, Sui Jay; Pirkis, Jane

2013-01-01

Background Suicide clustering occurs when multiple suicide incidents take place in a small area or/and within a short period of time. In spite of the multi-national research attention and particular efforts in preparing guidelines for tackling suicide clusters, the broader picture of epidemiology of suicide clustering remains unclear. This study aimed to develop techniques in using scan statistics to detect clusters, with the detection of suicide clusters in Australia as example. Methods and Findings Scan statistics was applied to detect clusters among suicides occurring between 2004 and 2008. Manipulation of parameter settings and change of area for scan statistics were performed to remedy shortcomings in existing methods. In total, 243 suicides out of 10,176 (2.4%) were identified as belonging to 15 suicide clusters. These clusters were mainly located in the Northern Territory, the northern part of Western Australia, and the northern part of Queensland. Among the 15 clusters, 4 (26.7%) were detected by both national and state cluster detections, 8 (53.3%) were only detected by the state cluster detection, and 3 (20%) were only detected by the national cluster detection. Conclusions These findings illustrate that the majority of spatial-temporal clusters of suicide were located in the inland northern areas, with socio-economic deprivation and higher proportions of indigenous people. Discrepancies between national and state/territory cluster detection by scan statistics were due to the contrast of the underlying suicide rates across states/territories. Performing both small-area and large-area analyses, and applying multiple parameter settings may yield the maximum benefits for exploring clusters. PMID:23342098

Natural radionuclides and stable elements in weaver ants (Oecophylla smaragdina) from tropical northern Australia.

PubMed

Medley, Peter; Doering, Che; Evans, Fiona; Bollhöfer, Andreas

2017-11-01

Natural radionuclides and stable elements were measured in weaver ants, leaves and soils collected from three sites in tropical northern Australia. Radionuclide concentration ratios for ants relative to soil were derived from the measurements and used to refine the current environmental radiological assessment for remediation of Ranger uranium mine. Use of site-specific concentration ratios for weaver ants gave a more conservative estimate of environmental exposure to the arthropod wildlife group than use of default concentration ratios in the ERICA Tool. This was primarily because the 226 Ra concentration ratio for weaver ants was more than 7 times greater than for generic arthropods. Crown Copyright © 2017. Published by Elsevier Ltd. All rights reserved.

Indigenous Tertiary Education--We Are All Learning: Both-Ways Pedagogy in the Northern Territory of Australia

ERIC Educational Resources Information Center

Bat, Melodie; Kilgariff, Claire; Doe, Tina

2014-01-01

In this new era in tertiary education in Australia, the opportunity exists not only to meet the needs of Aboriginal and Torres Strait Islander students and thus redress low access and participation rates, but also to build a system that privileges Aboriginal and Torres Strait Islander knowledges and ways of learning. To be able to do such a thing…

Sludge fertilization of State Forest land in northern Michigan

Treesearch

D.G. Brockway

1991-01-01

A five-year research-demonstration project to examine the logistic, economic, environmental and sociological aspects of municipal wastewater sludge application was conducted on State Forest land occupied by forest types of major commercial importance in northern Michigan. The procedures utilized for site preparation, sludge transportation and sludge application proved...

Evaluating the sufficiency of protected lands for maintaining wildlife population connectivity in the northern Rocky Mountains

Treesearch

Samuel A. Cushman; Erin L. Landguth; Curtis H. Flather

2012-01-01

Aim: The goal of this study was to evaluate the sufficiency of the network of protected lands in the U.S. northern Rocky Mountains in providing protection for habitat connectivity for 105 hypothetical organisms. A large proportion of the landscape...

Virulence and Evolution of West Nile Virus, Australia, 1960-2012.

PubMed

Prow, Natalie A; Edmonds, Judith H; Williams, David T; Setoh, Yin X; Bielefeldt-Ohmann, Helle; Suen, Willy W; Hobson-Peters, Jody; van den Hurk, Andrew F; Pyke, Alyssa T; Hall-Mendelin, Sonja; Northill, Judith A; Johansen, Cheryl A; Warrilow, David; Wang, Jianning; Kirkland, Peter D; Doggett, Stephen; Andrade, Christy C; Brault, Aaron C; Khromykh, Alexander A; Hall, Roy A

2016-08-01

Worldwide, West Nile virus (WNV) causes encephalitis in humans, horses, and birds. The Kunjin strain of WNV (WNVKUN) is endemic to northern Australia, but infections are usually asymptomatic. In 2011, an unprecedented outbreak of equine encephalitis occurred in southeastern Australia; most of the ≈900 reported cases were attributed to a newly emerged WNVKUN strain. To investigate the origins of this virus, we performed genetic analysis and in vitro and in vivo studies of 13 WNVKUN isolates collected from different regions of Australia during 1960-2012. Although no disease was recorded for 1984, 2000, or 2012, isolates collected during those years (from Victoria, Queensland, and New South Wales, respectively) exhibited levels of virulence in mice similar to that of the 2011 outbreak strain. Thus, virulent strains of WNVKUN have circulated in Australia for >30 years, and the first extensive outbreak of equine disease in Australia probably resulted from a combination of specific ecologic and epidemiologic conditions.

Rapid dissipation of semi-arid carbon sink with drought and shift in rainfall sensitivity across Australia over past three decades

NASA Astrophysics Data System (ADS)

Ma, X.; Huete, A. R.; Xie, Z.; Giovannini, L.; Eamus, D.; Poulter, B.; Ponce-Campos, G. E.; Guanter, L.; Cleverly, J. R.

2016-12-01

An exceptionally large global land sink anomaly was recorded in 2011, of which more than half was attributed to Australia. However, the fate, persistence and spatially explicit attribution of this carbon sink remain unknown. Meanwhile, recent studies have identified semi-arid ecosystems to be particularly sensitive to hydroclimatic variability, and there is some debate whether ecosystem sensitivity to rainfall has increased or been altered. To address these questions, we conducted an observation-based study to characterise the link between hydroclimatic variations and the Australian carbon sink using a novel coupling of satellite retrievals of atmospheric CO2 and photosynthetic activity (grenness and chlorophyll fluorescence), with in-situ flux tower measurement of net ecosystem exchange. We further quantified spatial variations and temporal shift in rainfall sensitivity across Australia over the past three decades. Our results show the 2010-11 La Niña induced land carbon sink was primarily ascribed to savannas and grasslands. However, when all biomes were normalised by their respective areas and rainfall, shrublands were found to be most efficient in taking up carbon in 2010-11. We found the 2010-11 land sink was highly transient and rapidly dissipated through subsequent drought and enhanced fire emission. The size of the 2010-11 carbon sink (0.97 Pg) was reduced by 51% in 2011-12 (0.48 Pg), and was nearly eliminated in 2012-13 (0.08 Pg). We further report evidence of an earlier 21st-century land carbon sink from La Niña-induced wet pulses in 2000-01, demonstrating a repetitive nature of this land sink. Given a significant increasing trend in extreme wet year precipitation, we predict that carbon sink episodes over Australia will exert greater future impacts on global carbon cycle-climate feedback in the coming decades. In addition, we found semi-arid eastern Australia not only exhibited amplified response to rainfall variability, but also experienced a large increase in rainfall sensitivity since 1980s. By contrast, a decline in sensitivity of vegetation to rainfall over arid central Australia is recorded. Further studies are needed to attribute these shifts in sensitivity to environmental changes, such as CO2 fertilisation, or changes in vegetation structure and species composition.

Using Computer-Based Instruction to Improve Indigenous Early Literacy in Northern Australia: A Quasi-Experimental Study

ERIC Educational Resources Information Center

Wolgemuth, Jennifer; Savage, Robert; Helmer, Janet; Lea, Tess; Harper, Helen; Chalkiti, Kalotina; Bottrell, Christine; Abrami, Phil

2011-01-01

The effectiveness of a web-based reading support tool, ABRACADABRA, to improve the literacy outcomes of Indigenous and non-Indigenous students was evaluated over one semester in several Northern Territory primary schools in 2009. ABRACADABRA is intended as a support for teachers in the early years of schooling, giving them a friendly, game and…

Breakup of pangaea and isolation of relict mammals in australia, South america, and madagascar.

PubMed

Fooden, J

1972-02-25

The composition of aboriginal land mammal faunas in Australia and New Guinea (prototherians and metatherians), South America (metatherians and eutherians) and Madagascar (eutherians only) is reconsidered in light of continental drift reconstructions of Mesozoic-Tertiary world paleogeography It is proposed that these three faunas represent successively detached samples of the evolving world mammal fauna as it existed when each of these land masses became faunally isolated from the rest of the world as a result of the progressive fragmentation of Pangaea. Isolation of aboriginal prototherians and metatherians in Australia and New Guinea may date from the Upper JurassicLower Cretaceous; isolation of aboriginal metatherians and eutherians in South America may date from the Middle Cretaceous-Upper Cretaceous; isolation of aboriginal eutherians in Madagascar may date from the Paleocene-Eocene.

Understanding the Relationship between Social Change and Its Impacts: The Experience of Rural Land Use Change in South-Eastern Australia

ERIC Educational Resources Information Center

Williams, Kathryn J. H.; Schirmer, Jacki

2012-01-01

This study investigated socio-economic impacts of land use change, giving explicit attention to the relationships between independently observed land use change and associated socio-economic changes, perceived land use change and socio-economic change, attributed cause of change, and experienced impacts of change. Using a case study region in…

Microclimate and limits to photosynthesis in a diverse community of hypolithic cyanobacteria in northern Australia.

PubMed

Tracy, Christopher R; Streten-Joyce, Claire; Dalton, Robert; Nussear, Kenneth E; Gibb, Karen S; Christian, Keith A

2010-03-01

Hypolithic microbes, primarily cyanobacteria, inhabit the highly specialized microhabitats under translucent rocks in extreme environments. Here we report findings from hypolithic cyanobacteria found under three types of translucent rocks (quartz, prehnite, agate) in a semiarid region of tropical Australia. We investigated the photosynthetic responses of the cyanobacterial communities to light, temperature and moisture in the laboratory, and we measured the microclimatic variables of temperature and soil moisture under rocks in the field over an annual cycle. We also used molecular techniques to explore the diversity of hypolithic cyanobacteria in this community and their phylogenetic relationships within the context of hypolithic cyanobacteria from other continents. Based on the laboratory experiments, photosynthetic activity required a minimum soil moisture of 15% (by mass). Peak photosynthetic activity occurred between approximately 8 degrees C and 42 degrees C, though some photosynthesis occurred between -1 degrees C and 51 degrees C. Maximum photosynthesis rates also occurred at light levels of approximately 150-550 micromol m(-2) s(-1). We used the field microclimatic data in conjunction with these measurements of photosynthetic efficiency to estimate the amount of time the hypolithic cyanobacteria could be photosynthetically active in the field. Based on these data, we estimated that conditions were appropriate for photosynthetic activity for approximately 942 h (approximately 75 days) during the year. The hypolithic cyanobacteria community under quartz, prehnite and agate rocks was quite diverse both within and between rock types. We identified 115 operational taxonomic units (OTUs), with each rock hosting 8-24 OTUs. A third of the cyanobacteria OTUs from northern Australia grouped with Chroococcidiopsis, a genus that has been identified from hypolithic and endolithic communities from the Gobi, Mojave, Atacama and Antarctic deserts. Several OTUs identified from northern Australia have not been reported to be associated with hypolithic communities previously.

Wholesale data for surveillance of Australian Aboriginal tobacco consumption in the Northern Territory.

PubMed

Thomas, David P; Fitz, Joseph W; Johnston, Vanessa; Townsend, Joanne; Kneebone, Warwick

2011-07-01

Effective monitoring of trends in tobacco use is an essential element of tobacco control policy. Monitoring tobacco consumption using tobacco wholesale data has advantages over other methods of surveillance. In the present work, a research project that monitored tobacco consumption in 25 remote Aboriginal communities and its translation to a policy to implement this monitoring routinely in the entire Northern Territory of Australia is described. Tobacco consumption and trends were estimated using wholesale (or occasionally sales) data from all retail outlets in 25 remote Aboriginal communities. Self-reported consumption was estimated from the National Aboriginal and Torres Strait Islander Social Survey in 2008. Local consumption results were fed back in posters to local organisations and health staff. Estimates of consumption from wholesale data and self-report were similar (6.8 and 6.7 cigarettes/day/person aged 15 and over). Consumption was higher in the tropical Top End than in arid Central Australia, and 24% of tobacco was consumed as loose tobacco. The overall trend in monthly consumption was not significantly different from 0. Local communities could be ranked by their local trends in monthly consumption. Monitoring tobacco consumption using wholesale tobacco data is a practical and unobtrusive surveillance method that is being introduced as a new condition of tobacco retail licenses in the Northern Territory of Australia. It overcomes some problems with consumption estimates from routine surveys, enables rapid feedback and use of results and is particularly well suited for hard-to-reach discrete populations, such as remote Aboriginal communities in Australia. It has already been used to evaluate the impact of local tobacco control activities.

Melioidosis

MedlinePlus

... pseudomallei. It is predominately a disease of tropical climates, especially in Southeast Asia and northern Australia where it is widespread. The bacteria causing melioidosis are found in contaminated water and ... For Public Health Planners ...

Melville Island, Australia

NASA Technical Reports Server (NTRS)

1992-01-01

Melville Island, just off the coast of Darwin, Northern Territory, Australia (11.5S, 131.0E) is a sparsely inhabited tropical island with heavy woodland concentrations. The widespread and prominant smoke plumes were most likely set to renew pasture under open canopy woodland. Soil erosion is almost non- existant as can be seen by the clear and clean river flow. The offshore sediments are coastal current borne deposits from King Sound to the west.

Climate and soil properties limit the positive effects of land use reversion on carbon storage in Eastern Australia

NASA Astrophysics Data System (ADS)

Rabbi, S. M. F.; Tighe, Matthew; Delgado-Baquerizo, Manuel; Cowie, Annette; Robertson, Fiona; Dalal, Ram; Page, Kathryn; Crawford, Doug; Wilson, Brian R.; Schwenke, Graeme; McLeod, Malem; Badgery, Warwick; Dang, Yash P.; Bell, Mike; O'Leary, Garry; Liu, De Li; Baldock, Jeff

2015-12-01

Australia’s “Direct Action” climate change policy relies on purchasing greenhouse gas abatement from projects undertaking approved abatement activities. Management of soil organic carbon (SOC) in agricultural soils is an approved activity, based on the expectation that land use change can deliver significant changes in SOC. However, there are concerns that climate, topography and soil texture will limit changes in SOC stocks. This work analyses data from 1482 sites surveyed across the major agricultural regions of Eastern Australia to determine the relative importance of land use vs. other drivers of SOC. Variation in land use explained only 1.4% of the total variation in SOC, with aridity and soil texture the main regulators of SOC stock under different land uses. Results suggest the greatest potential for increasing SOC stocks in Eastern Australian agricultural regions lies in converting from cropping to pasture on heavy textured soils in the humid regions.

Climate and soil properties limit the positive effects of land use reversion on carbon storage in Eastern Australia

PubMed Central

Rabbi, S.M.F.; Tighe, Matthew; Delgado-Baquerizo, Manuel; Cowie, Annette; Robertson, Fiona; Dalal, Ram; Page, Kathryn; Crawford, Doug; Wilson, Brian R.; Schwenke, Graeme; Mcleod, Malem; Badgery, Warwick; Dang, Yash P.; Bell, Mike; O’Leary, Garry; Liu, De Li; Baldock, Jeff

2015-01-01

Australia’s “Direct Action” climate change policy relies on purchasing greenhouse gas abatement from projects undertaking approved abatement activities. Management of soil organic carbon (SOC) in agricultural soils is an approved activity, based on the expectation that land use change can deliver significant changes in SOC. However, there are concerns that climate, topography and soil texture will limit changes in SOC stocks. This work analyses data from 1482 sites surveyed across the major agricultural regions of Eastern Australia to determine the relative importance of land use vs. other drivers of SOC. Variation in land use explained only 1.4% of the total variation in SOC, with aridity and soil texture the main regulators of SOC stock under different land uses. Results suggest the greatest potential for increasing SOC stocks in Eastern Australian agricultural regions lies in converting from cropping to pasture on heavy textured soils in the humid regions. PMID:26639009

Salmonella infections in Antarctic fauna and island populations of wildlife exposed to human activities in coastal areas of Australia.

PubMed

Iveson, J B; Shellam, G R; Bradshaw, S D; Smith, D W; Mackenzie, J S; Mofflin, R G

2009-06-01

Salmonella infections in Antarctic wildlife were first reported in 1970 and in a search for evidence linking isolations with exposure to human activities, a comparison was made of serovars reported from marine fauna in the Antarctic region from 1982-2004 with those from marine mammals in the Northern hemisphere. This revealed that 10 (83%) Salmonella enterica serovars isolated from Antarctic penguins and seals were classifiable in high-frequency (HF) quotients for serovars prevalent in humans and domesticated animals. In Australia, 16 (90%) HF serovars were isolated from marine birds and mammals compared with 12 (86%) HF serovars reported from marine mammals in the Northern hemisphere. In Western Australia, HF serovars from marine species were also recorded in humans, livestock, mussels, effluents and island populations of wildlife in urban coastal areas. Low-frequency S. enterica serovars were rarely detected in humans and not detected in seagulls or marine species. The isolation of S. Enteritidis phage type 4 (PT4), PT8 and PT23 strains from Adélie penguins and a diversity of HF serovars reported from marine fauna in the Antarctic region and coastal areas of Australia, signal the possibility of transient serovars and endemic Salmonella strains recycling back to humans from southern latitudes in marine foodstuffs and feed ingredients.

Cryptic species in the nuisance midge Polypedilum nubifer (Skuse (Diptera: Chironomidae) and the status of Tripedilum Kieffer.

PubMed

Cranston, Peter S; Martin, Jon; Spies, Martin

2016-02-15

Polypedilum nubifer (Skuse, 1889), originally described from Australia, is an apparently widespread species of Chironomidae (Diptera) that can attain nuisance densities in some eutrophic water bodies. Appropriate management depends upon the identity and ability to distinguish from potential cryptic taxa. A morphological study of larvae, pupae and adults of both sexes confirmed P. nubifer as widely distributed and frequently abundant, but also revealed two previously cryptic species of limited distribution in northern Australia. These species are described as new and illustrated in all stages here. Polypedilum quasinubifer Cranston sp. n. is described from north-west Queensland, Australia and also from Thailand and Singapore. Polypedilum paranubifer Cranston sp. n. is known only from retention ponds of a uranium mine in Northern Territory, Australia. Unusual morphological features of P. nubifer including alternate Lauterborn organs on the larval antenna, cephalic tubules on the pupa and frontal tubercles on the adult head are present in both new species as well. Newly slide-mounted types of Polypedilum pelostolum Kieffer, 1912 (lectotype designated here) confirm synonymy to Chironomus nubifer Skuse, 1889, examined also as newly-slide mounted types. Reviewed plus new evidence does not support recognition of Tripedilum Kieffer, 1921 as a separate taxon; therefore, Tripedilum is returned to junior synonymy with Polypedilum s. str.

Effects of land use/cover change and harvests on forest carbon dynamics in northern states of the United States from remote sensing and inventory data: 1992-2001

Treesearch

Daolan Zheng; Linda S. Heath; Mark J. Ducey; James E. Smith

2011-01-01

We examined spatial patterns of changes in forest area and nonsoil carbon (C) dynamics affected by land use/cover change (LUC) and harvests in 24 northern states of the United States using an integrated methodology combining remote sensing and ground inventory data between 1992 and 2001. We used the Retrofit Change Product from the Multi-Resolution Land Characteristics...

Is the northern high-latitude land-based CO2 sink weakening?

Treesearch

D.J. Hayes; A.D. McGuire; D.W. Kicklighter; K.R. Gurney; T.J. Burnside; J.M. Melillo

2011-01-01

Studies indicate that, historically, terrestrial ecosystems of the northern high-latitude region may have been responsible for up to 60% of the global net land-based sink for atmospheric C02. However, these regions have recently experienced remarkable modification of the major driving forces of the carbon cycle, including surface air temperature...

Land claims as a mechanism for wilderness protection in the Canadian Arctic

Treesearch

Vicki Sahanatien

2007-01-01

Northern land claims agreements support establishing national parks and wilderness protection but are not prescriptive on wilderness management or what wilderness values should be protected. Parks Canada does not have strong wilderness policy or guidelines, which hampers development of management plans for northern national parks and progress on legislation of...

Patterns of weak, near-surface winds at Melbourne, Australia

NASA Astrophysics Data System (ADS)

Tapp, R. G.

1985-12-01

Up to 30 months of near-surface anemograph records have been examined from 13 locations in and near Melbourne, Australia, to determine the wind patterns which existed during prolonged periods of light winds (at least 3 hours at 2 m s-1 or less). A coherent katabatic wind system was found to develop in at least part of the monitored region on approximately 30% of nights. The flow broadly followed the slope of the basin surrounding the city, with a strong flow down the main river valley, and was partly reinforced by a land breeze in bayside areas. Other valleys also acted as channels for these winds. The general tendency of these katabatic winds was to converge towards the central business district and the northern part of Port Phillip Bay adjacent to the city centre. Where winds from different directions interacted, one of the winds dominated or successive replacement occurred causing the wind direction to vary considerably during a period. There were indications that in the presence of low-level stability with a synoptic gradient wind between east and north, the gradient flow may be deflected around the major topographic barrier to the northeast of the city. The existence of such a situation would have major implications in terms of air quality due to the possibility of pollutants being recirculated in conditions when vertical diffusion was very limited.

KSC00pp0682

NASA Image and Video Library

2000-05-29

To; Kwiatkowski, Vehicle Integration Team Lead, recovers a replica of the Olympic torch after its journey on Space Shuttle Atlantis on mission STS-101. The addition of the torch to the payload was coordinated by astronaut Andy Thomas, who is from Australia. The torch will travel to Australia for the 2000 Olympic games being held there in September. STS-101 was the third flight to the International Space Station and included repairs to the Station plus transfer of equipment and supplies to the Station for future missions. The landing of Atlantis completed a 9-day, 20-hour, 9-minute-long mission. It was the 98th flight in the Space Shuttle program and the 21st for Atlantis. The landing was the 51st at KSC, the 22nd consecutive landing at KSC and the 29th in the last 30 Shuttle flights, plus the 14th nighttime landing in Shuttle history

KSC-00pp0682

NASA Image and Video Library

2000-05-29

To; Kwiatkowski, Vehicle Integration Team Lead, recovers a replica of the Olympic torch after its journey on Space Shuttle Atlantis on mission STS-101. The addition of the torch to the payload was coordinated by astronaut Andy Thomas, who is from Australia. The torch will travel to Australia for the 2000 Olympic games being held there in September. STS-101 was the third flight to the International Space Station and included repairs to the Station plus transfer of equipment and supplies to the Station for future missions. The landing of Atlantis completed a 9-day, 20-hour, 9-minute-long mission. It was the 98th flight in the Space Shuttle program and the 21st for Atlantis. The landing was the 51st at KSC, the 22nd consecutive landing at KSC and the 29th in the last 30 Shuttle flights, plus the 14th nighttime landing in Shuttle history

Snow Cover and Vegetation-Induced Decrease in Global Albedo From 2002 to 2016

NASA Astrophysics Data System (ADS)

Li, Qiuping; Ma, Mingguo; Wu, Xiaodan; Yang, Hong

2018-01-01

Land surface albedo is an essential parameter in regional and global climate models, and it is markedly influenced by land cover change. Variations in the albedo can affect the surface radiation budget and further impact the global climate. In this study, the interannual variation of albedo from 2002 to 2016 was estimated on the global scale using Moderate Resolution Imaging Spectroradiometer (MODIS) datasets. The presence and causes of the albedo changes for each specific region were also explored. From 2002 to 2016, the MODIS-based albedo decreased globally, snow cover declined by 0.970 (percent per pixel), while the seasonally integrated normalized difference vegetation index increased by 0.175. Some obvious increases in the albedo were detected in Central Asia, northeastern China, parts of the boreal forest in Canada, and the temperate steppe in North America. In contrast, noticeable decreases in the albedo were found in the Siberian tundra, Europe, southeastern Australia, and northeastern regions of North America. In the Northern Hemisphere, the greening trend at high latitudes made more contribution to the decline in the albedo. However, the dramatic fluctuation of snow-cover at midlatitudes predominated in the change of albedo. Our analysis can help to understand the roles that vegetation and snow cover play in the variation of albedo on global and regional scales.

Tropical Cyclone Paul

NASA Image and Video Library

2010-03-30

NASA image March 29, 2010 Tropical Cyclone Paul spanned the ocean waters between Australia and New Guinea on March 29, 2010. The MODIS on NASA’s Terra satellite captured this natural-color image the same day. The center of the cyclone is along the coast of Northern Territory’s Arnhem Land. Clouds run counter-clockwise across the Gulf of Carpentaria and Cape York Peninsula, over New Guinea’s Pulau Dolok, and over the Arafura Sea. On March 29, 2010, the U.S. Navy’s Joint Typhoon Warning Center (JTWC) reported that Tropical Cyclone Paul storm had maximum sustained winds of 60 knots (110 kilometers per hour) and gusts up to 75 knots (140 kilometers per hour). The storm was located roughly 315 nautical miles (585 kilometers) east of Darwin. The storm had moved slowly toward the southwest over the previous several hours. The JTWC forecast that the storm would likely maintain its current intensity for several more hours before slowly dissipating over land. Credit: NASA/GSFC/Jeff Schmaltz/MODIS To learn more about this image go to: modis.gsfc.nasa.gov/gallery/individual.php?db_date=2010-0... NASA Goddard Space Flight Center is home to the nation's largest organization of combined scientists, engineers and technologists that build spacecraft, instruments and new technology to study the Earth, the sun, our solar system, and the universe.

The surface of the ice-age Earth.

PubMed

1976-03-19

In the Northern Hemisphere the 18,000 B.P. world differed strikingly from the present in the huge land-based ice sheets, reaching approximately 3 km in thickness, and in a dramatic increase in the extent of pack ice and marine-based ice sheets. In the Southern Hemisphere the most striking contrast was the greater extent of sea ice. On land, grasslands, steppes, and deserts spread at the expense of forests. This change in vegetation, together with extensive areas of permanent ice and sandy outwash plains, caused an increase in global surface albedo over modern values. Sea level was lower by at least 85 m. The 18,000 B.P. oceans were characterized by: (i) marked steepening of thermal gradients along polar frontal systems, particularly in the North Atlantic and Antarctic; (ii) an equatorward displacement of polar frontal systems; (iii) general cooling of most surface waters, with a global average of -2.3 degrees C; (iv) increased cooling and up-welling along equatorial divergences in the Pacific and Atlantic; (v) low temperatures extending equatorward along the western coast of Africa, Australia, and South America, indicating increased upwelling and advection of cool waters; and (vi) nearly stable positions and temperatures of the central gyres in the subtropical Atlantic, Pacific, and Indian oceans.

Reliability of biomass burning estimates from savanna fires: Biomass burning in northern Australia during the 1999 Biomass Burning and Lightning Experiment B field campaign

NASA Astrophysics Data System (ADS)

Russell-Smith, Jeremy; Edwards, Andrew C.; Cook, Garry D.

2003-02-01

This paper estimates the two-daily extent of savanna burning and consumption of fine (grass and litter) fuels from an extensive 230,000 km2 region of northern Australia during August-September 1999 encompassing the Australian continental component of the Biomass Burning and Lightning Experiment B (BIBLE B) campaign [, 2002]. The extent of burning for the study region was derived from fire scar mapping of imagery from the advanced very high resolution radiometer (AVHRR) on board the National Oceanic and Atmospheric Administration (NOAA) satellite. The mapping was calibrated and verified with reference to one Landsat scene and associated aerial transect validation data. Fine fuel loads were estimated using published fuel accumulation relationships for major regional fuel types. It is estimated that more than 43,000 km2 was burnt during the 25 day study period, with about 19 Mt of fine (grass and litter) fuels. This paper examines assumptions and errors associated with these estimates. It is estimated from uncalibrated fire mapping derived from AVHRR imagery that 417,500 km2 of the northern Australian savanna was burnt in 1999, of which 136,405 km2, or 30%, occurred in the Northern Territory study region. Using generalized fuel accumulation equations, such biomass burning consumed an estimated 212.3 Mt of fine fuels, but no data are available for consumption of coarse fuels. This figure exceeds a recent estimate, based on fine fuels only, for the combined Australian savanna and temperate grassland biomass burning over the period 1990-1999 but is lower than past estimates derived from classification approaches. We conclude that (1) fire maps derived from coarse-resolution optical imagery can be applied relatively reliably to estimate the extent of savanna fires, generally with 70-80% confidence using the approach adopted here, over the major burning period in northern Australia and (2) substantial further field assessment and associated modeling of fuel accumulation, especially of coarse fuels, is required.

Using Land Surface Phenology to Detect Land Use Change in the Northern Great Plains

NASA Astrophysics Data System (ADS)

Nguyen, L. H.; Henebry, G. M.

2017-12-01

The Northern Great Plains of the US have been undergoing many types of land cover / land use change over the past two decades, including expansion of irrigation, conversion of grassland to cropland, biofuels production, urbanization, and fossil fuel mining. Much of the literature on these changes has relied on post-classification change detection based on a limited number of observations per year. Here we demonstrate an approach to characterize land dynamics through land surface phenology (LSP) by synergistic use of image time series at two scales. Our study areas include regions of interest (ROIs) across the Northern Great Plains located within Landsat path overlap zones to boost the number of valid observations (free of clouds or snow) each year. We first compute accumulated growing degree-days (AGDD) from MODIS 8-day composites of land surface temperature (MOD11A2 and MYD11A2). Using Landsat Collection 1 surface reflectance-derived vegetation indices (NDVI, EVI), we then fit at each pixel a downward convex quadratic model linking the vegetation index to each year's progression of AGDD. This quadratic equation exhibits linearity in a mathematical sense; thus, the fitted models can be linearly mixed and unmixed using a set of LSP endmembers (defined by the fitted parameter coefficients of the quadratic model) that represent "pure" land cover types with distinct seasonal patterns found within the region, such as winter wheat, spring wheat, maize, soybean, sunflower, hay/pasture/grassland, developed/built-up, among others. Information about land cover corresponding to each endmember are provided by the NLCD (National Land Cover Dataset) and CDL (Cropland Data Layer). We use linear unmixing to estimate the likely proportion of each LSP endmember within particular areas stratified by latitude. By tracking the proportions over the 2001-2011 period, we can quantify various types of land transitions in the Northern Great Plains.

Impact of the spatial resolution of satellite remote sensing sensors in the quantification of total suspended sediment concentration: A case study in turbid waters of Northern Western Australia.

PubMed

Dorji, Passang; Fearns, Peter

2017-01-01

The impact of anthropogenic activities on coastal waters is a cause of concern because such activities add to the total suspended sediment (TSS) budget of the coastal waters, which have negative impacts on the coastal ecosystem. Satellite remote sensing provides a powerful tool in monitoring TSS concentration at high spatiotemporal resolution, but coastal managers should be mindful that the satellite-derived TSS concentrations are dependent on the satellite sensor's radiometric properties, atmospheric correction approaches, the spatial resolution and the limitations of specific TSS algorithms. In this study, we investigated the impact of different spatial resolutions of satellite sensor on the quantification of TSS concentration in coastal waters of northern Western Australia. We quantified the TSS product derived from MODerate resolution Imaging Spectroradiometer (MODIS)-Aqua, Landsat-8 Operational Land Image (OLI), and WorldView-2 (WV2) at native spatial resolutions of 250 m, 30 m and 2 m respectively and coarser spatial resolution (resampled up to 5 km) to quantify the impact of spatial resolution on the derived TSS product in different turbidity conditions. The results from the study show that in the waters of high turbidity and high spatial variability, the high spatial resolution WV2 sensor reported TSS concentration as high as 160 mg L-1 while the low spatial resolution MODIS-Aqua reported a maximum TSS concentration of 23.6 mg L-1. Degrading the spatial resolution of each satellite sensor for highly spatially variable turbid waters led to variability in the TSS concentrations of 114.46%, 304.68% and 38.2% for WV2, Landsat-8 OLI and MODIS-Aqua respectively. The implications of this work are particularly relevant in the situation of compliance monitoring where operations may be required to restrict TSS concentrations to a pre-defined limit.

Impact of the spatial resolution of satellite remote sensing sensors in the quantification of total suspended sediment concentration: A case study in turbid waters of Northern Western Australia

PubMed Central

Fearns, Peter

2017-01-01

The impact of anthropogenic activities on coastal waters is a cause of concern because such activities add to the total suspended sediment (TSS) budget of the coastal waters, which have negative impacts on the coastal ecosystem. Satellite remote sensing provides a powerful tool in monitoring TSS concentration at high spatiotemporal resolution, but coastal managers should be mindful that the satellite-derived TSS concentrations are dependent on the satellite sensor’s radiometric properties, atmospheric correction approaches, the spatial resolution and the limitations of specific TSS algorithms. In this study, we investigated the impact of different spatial resolutions of satellite sensor on the quantification of TSS concentration in coastal waters of northern Western Australia. We quantified the TSS product derived from MODerate resolution Imaging Spectroradiometer (MODIS)-Aqua, Landsat-8 Operational Land Image (OLI), and WorldView-2 (WV2) at native spatial resolutions of 250 m, 30 m and 2 m respectively and coarser spatial resolution (resampled up to 5 km) to quantify the impact of spatial resolution on the derived TSS product in different turbidity conditions. The results from the study show that in the waters of high turbidity and high spatial variability, the high spatial resolution WV2 sensor reported TSS concentration as high as 160 mg L-1 while the low spatial resolution MODIS-Aqua reported a maximum TSS concentration of 23.6 mg L-1. Degrading the spatial resolution of each satellite sensor for highly spatially variable turbid waters led to variability in the TSS concentrations of 114.46%, 304.68% and 38.2% for WV2, Landsat-8 OLI and MODIS-Aqua respectively. The implications of this work are particularly relevant in the situation of compliance monitoring where operations may be required to restrict TSS concentrations to a pre-defined limit. PMID:28380059

Molecular Studies of Alphavirus Immunogenicity

DTIC Science & Technology

1992-12-03

RNAs. These include Ockelbo virus, a virus causing epidemic polyarthritis .n northern Europe , strains of Sindbis virus from Africa, India, Australia...TD TL A VA VAT R YE VDNI T 3421 GGUGUGGUGGIJGGCAUUGAGAACUUUUGCGGAGAGCAAAJAGAGCAUUUGAAGCGAUCAGA 3480 P VL LA L RT F A QS KRA F QA I R 3481...alphaviruses. The Sindbis-like viruses, which are found throughout the Old World from Northern Europe to Africa, India, the Philippines and the Australasian

How can general practitioners establish 'place attachment' in Australia's Northern Territory? Adjustment trumps adaptation.

PubMed

Auer, K; Carson, D

2010-01-01

Retention of GPs in the more remote parts of Australia remains an important issue in workforce planning. The Northern Territory of Australia experiences very high rates of staff turnover. This research examined how the process of forming 'place attachment' between GP and practice location might influence prospects for retention. It examines whether GPs use 'adjustment' (short term trade-offs between work and lifestyle ambitions) or 'adaptation' (attempts to change themselves and their environment to fulfil lifestyle ambitions) strategies to cope with the move to new locations. 19 semi-structured interviews were conducted mostly with GPs who had been in the Northern Territory for less than 3 years. Participants were asked about the strategies they used in an attempt to establish place attachment. Strategies could be structural (work related), personal, social or environmental. There were strong structural motivators for GPs to move to the Northern Territory. These factors were seen as sufficiently attractive to permit the setting aside of other lifestyle ambitions for a short period of time. Respondents found the environmental aspects of life in remote areas to be the most satisfying outside work. Social networks were temporary and the need to re-establish previous networks was the primary driver of out migration. GPs primarily use adjustment strategies to temporarily secure their position within their practice community. There were few examples of adaptation strategies that would facilitate a longer term match between the GPs' overall life ambitions and the characteristics of the community. While this suggests that lengths of stay will continue to be short, better adjustment skills might increase the potential for repeat service and limit the volume of unplanned early exits.

A New Strategy to Land Precisely on the Northern Plains of Mars

NASA Technical Reports Server (NTRS)

Cheng, Yang; Huertas, Andres

2010-01-01

During the Phoenix mission landing site selection process, the Mars Reconnaissance Orbiter (MRO) High Resolution Imaging Science Experiment (HiRISE) images revealed widely spread and dense rock fields in the northern plains. Automatic rock mapping and subsequent statistical analyses showed 30-90% CFA (cumulative fractional area) covered by rocks larger than 1 meter in dense rock fields around craters. Less dense rock fields had 5-30% rock coverage in terrain away from craters. Detectable meter-scale boulders were found nearly everywhere. These rocks present a risk to spacecraft safety during landing. However, they are the most salient topographic features in this region, and can be good landmarks for spacecraft localization during landing. In this paper we present a novel strategy that uses abundance of rocks in northern plains for spacecraft localization. The paper discusses this approach in three sections: a rock-based landmark terrain relative navigation (TRN) algorithm; the TRN algorithm feasibility; and conclusions.

Managing smoke from wildfires and prescribed burning in southern Australia

Treesearch

Alan Wain; Graham Mills; Lachlan McCaw; Timothy Brown

2009-01-01

In Australia the responsibility for management of forests and other public lands rests largely with state governments, and multiple government agencies may be involved in fire management. Whether resulting from wildfire, fuel reduction, or silvicultural operations, biomass burning often stimulates community concerns about hazards from fine particulates and chemical...

50 CFR Table 6 to Part 226 - Hydrologic Units and Counties Containing Critical Habitat for Southern Oregon/Northern California...

Code of Federal Regulations, 2010 CFR

2010-10-01

... Critical Habitat for Southern Oregon/Northern California Coasts Coho Salmon, Tribal Lands Within the Range... California Coasts Coho Salmon, Tribal Lands Within the Range of the ESU, and Dams/Reservoirs Representing the... (CA), Trinity (CA)—Hoopa Valley Reservation Lewiston Dam (Lewiston Reservoir). Salmon 18010210...

50 CFR Table 6 to Part 226 - Hydrologic Units and Counties Containing Critical Habitat for Southern Oregon/Northern California...

Code of Federal Regulations, 2011 CFR

2011-10-01

... Critical Habitat for Southern Oregon/Northern California Coasts Coho Salmon, Tribal Lands Within the Range... California Coasts Coho Salmon, Tribal Lands Within the Range of the ESU, and Dams/Reservoirs Representing the... (CA), Trinity (CA)—Hoopa Valley Reservation Lewiston Dam (Lewiston Reservoir). Salmon 18010210...

Spatially differentiated trends in urbanization, agricultural land abandonment and reclamation, and woodland recovery in Northern China.

PubMed

Wang, Chao; Gao, Qiong; Wang, Xian; Yu, Mei

2016-11-22

Uncovering magnitude, trend, and spatial pattern of land cover/land use changes (LCLUC) is crucial for understanding mechanisms of LCLUC and assisting land use planning and conservation. China has been undergoing unprecedented economic growth, massive rural-to-urban migration, and large-scale policy-driven ecological restoration, and therefore encountering enormous LCLUC in recent decades. However, comprehensive understandings of spatiotemporal LCLUC dynamics and underlying mechanisms are still lacking. Based on classification of annual LCLU maps from MODIS satellite imagery, we proposed a land change detection method to capture significant land change hotspots over Northern China during 2001-2013, and further analyzed temporal trends and spatial patterns of LCLUC. We found rapid decline of agricultural land near urban was predominantly caused by urban expansion. The process was especially strong in North China Plain with 14,057 km 2 of urban gain and -21,017 km 2 of agricultural land loss. To offset the loss of agricultural land, Northeast China Plain and Xinjiang were reclaimed. Substantial recovery of forests (49,908 km 2 ) and closed shrubland (60,854 km 2 ) occurred in mountainous regions due to abandoned infertile farmland, secondary succession, and governmental conservation policies. The spatial patterns and trends of LCLUC in Northern China provide information to support effective environmental policies towards sustainable development.

Spatially differentiated trends in urbanization, agricultural land abandonment and reclamation, and woodland recovery in Northern China

PubMed Central

Wang, Chao; Gao, Qiong; Wang, Xian; Yu, Mei

2016-01-01

Uncovering magnitude, trend, and spatial pattern of land cover/land use changes (LCLUC) is crucial for understanding mechanisms of LCLUC and assisting land use planning and conservation. China has been undergoing unprecedented economic growth, massive rural-to-urban migration, and large-scale policy-driven ecological restoration, and therefore encountering enormous LCLUC in recent decades. However, comprehensive understandings of spatiotemporal LCLUC dynamics and underlying mechanisms are still lacking. Based on classification of annual LCLU maps from MODIS satellite imagery, we proposed a land change detection method to capture significant land change hotspots over Northern China during 2001–2013, and further analyzed temporal trends and spatial patterns of LCLUC. We found rapid decline of agricultural land near urban was predominantly caused by urban expansion. The process was especially strong in North China Plain with 14,057 km2 of urban gain and −21,017 km2 of agricultural land loss. To offset the loss of agricultural land, Northeast China Plain and Xinjiang were reclaimed. Substantial recovery of forests (49,908 km2) and closed shrubland (60,854 km2) occurred in mountainous regions due to abandoned infertile farmland, secondary succession, and governmental conservation policies. The spatial patterns and trends of LCLUC in Northern China provide information to support effective environmental policies towards sustainable development. PMID:27874092

Spatially differentiated trends in urbanization, agricultural land abandonment and reclamation, and woodland recovery in Northern China

NASA Astrophysics Data System (ADS)

Wang, Chao; Gao, Qiong; Wang, Xian; Yu, Mei

2016-11-01

Uncovering magnitude, trend, and spatial pattern of land cover/land use changes (LCLUC) is crucial for understanding mechanisms of LCLUC and assisting land use planning and conservation. China has been undergoing unprecedented economic growth, massive rural-to-urban migration, and large-scale policy-driven ecological restoration, and therefore encountering enormous LCLUC in recent decades. However, comprehensive understandings of spatiotemporal LCLUC dynamics and underlying mechanisms are still lacking. Based on classification of annual LCLU maps from MODIS satellite imagery, we proposed a land change detection method to capture significant land change hotspots over Northern China during 2001-2013, and further analyzed temporal trends and spatial patterns of LCLUC. We found rapid decline of agricultural land near urban was predominantly caused by urban expansion. The process was especially strong in North China Plain with 14,057 km2 of urban gain and -21,017 km2 of agricultural land loss. To offset the loss of agricultural land, Northeast China Plain and Xinjiang were reclaimed. Substantial recovery of forests (49,908 km2) and closed shrubland (60,854 km2) occurred in mountainous regions due to abandoned infertile farmland, secondary succession, and governmental conservation policies. The spatial patterns and trends of LCLUC in Northern China provide information to support effective environmental policies towards sustainable development.

The impacts of grazing land management on the wind erodibility of the Mulga Lands of western Queensland, Australia

USDA-ARS?s Scientific Manuscript database

An estimated 100 Mt of dust is eroded by wind from the Australian land surface each year. Wind erosion may be widespread across the arid and semi-arid rangelands, with impacts on soil nutrients, carbon and ecosystem services, human health, and climate. The susceptibility of landscapes to wind erosio...

Mobilesat (tm): A world first

NASA Technical Reports Server (NTRS)

Cooper, Paul; Crawley, Linda

1993-01-01

Mobilesat will be the world's first truly mobile satellite telephony service to be offered in the land mobile market. Essentially a car phone which will be offered as a fixed service at a later date, mobilesat will bring circuit switched voice communications to remote and rural areas of Australia. This paper outlines where mobilesat fits as part of Optus, Australia's new telecommunications carrier, and briefly discuss the mobilesat system, its market, and the future of mobile communications in Australia.

Tick-borne infectious diseases in Australia.

PubMed

Graves, Stephen R; Stenos, John

2017-04-17

Tick bites in Australia can lead to a variety of illnesses in patients. These include infection, allergies, paralysis, autoimmune disease, post-infection fatigue and Australian multisystem disorder. Rickettsial (Rickettsia spp.) infections (Queensland tick typhus, Flinders Island spotted fever and Australian spotted fever) and Q fever (Coxiella burnetii) are the only systemic bacterial infections that are known to be transmitted by tick bites in Australia. Three species of local ticks transmit bacterial infection following a tick bite: the paralysis tick (Ixodes holocyclus) is endemic on the east coast of Australia and causes Queensland tick typhus due to R. australis and Q fever due to C. burnetii; the ornate kangaroo tick (Amblyomma triguttatum) occurs throughout much of northern, central and western Australia and causes Q fever; and the southern reptile tick (Bothriocroton hydrosauri) is found mainly in south-eastern Australia and causes Flinders Island spotted fever due to R. honei. Much about Australian ticks and the medical outcomes following tick bites remains unknown. Further research is required to increase understanding of these areas.

Integrated water resource assessment for the Adelaide region, South Australia

NASA Astrophysics Data System (ADS)

Cox, James W.; Akeroyd, Michele; Oliver, Danielle P.

2016-10-01

South Australia is the driest state in the driest inhabited country in the world, Australia. Consequently, water is one of South Australia's highest priorities. Focus on water research and sources of water in the state became more critical during the Millenium drought that occurred between 1997 and 2011. In response to increased concern about water sources the South Australian government established The Goyder Institute for Water Research - a partnership between the South Australian State Government, the Commonwealth Scientific and Industrial Research Organisation (CSIRO), Flinders University, University of Adelaide and University of South Australia. The Goyder Institute undertakes cutting-edge science to inform the development of innovative integrated water management strategies to ensure South Australia's ongoing water security and enhance the South Australian Government's capacity to develop and deliver science-based policy solutions in water management. This paper focuses on the integrated water resource assessment of the northern Adelaide region, including the key research investments in water and climate, and how this information is being utilised by decision makers in the region.

"Only your blood can tell the story"--a qualitative research study using semi-structured interviews to explore the hepatitis B related knowledge, perceptions and experiences of remote dwelling Indigenous Australians and their health care providers in northern Australia.

PubMed

Davies, Jane; Bukulatjpi, Sarah; Sharma, Suresh; Davis, Joshua; Johnston, Vanessa

2014-11-28

Hepatitis B is endemic in the Indigenous communities of the Northern Territory of Australia and significantly contributes to liver-related morbidity and mortality. It is recognised that low health literacy levels, different worldviews and English as a second language all contribute to the difficulties health workers often have in explaining biomedical health concepts, relevant to hepatitis B infection, to patients. The aim of this research project was to explore the knowledge, perceptions and experiences of remote dwelling Indigenous adults and their health care providers relating to hepatitis B infection with a view to using this as the evidence base to develop a culturally appropriate educational tool. The impetus for this project came from health clinic staff at a remote community in Arnhem Land in the Northern Territory, in partnership with a visiting specialist liver clinic from the Royal Darwin Hospital. Participants were clinic patients with hepatitis B (n = 12), community members (n = 9) and key informants (n = 13); 25 were Indigenous individuals.A participatory action research project design was used with purposive sampling to identify participants. Semi-structured interviews were undertaken to explore: current understanding of hepatitis B, desire for knowledge, and perspectives on how people could acquire the information needed. All individuals were offered the use of an interpreter. The data were examined using deductive and inductive thematic analysis. Low levels of biomedical knowledge about Hepatitis B, negative perceptions of Hepatitis B, communication (particularly language) and culture were the major themes that emerged from the data. Accurate concepts grounded in Indigenous culture such as "only your blood can tell the story" were present but accompanied by a feeling of disempowerment due to perceived lack of "medical" understanding, and informed partnerships between caregiver and patient. Culturally appropriate discussions in a patient's first language using visual aids were identified as vital to improving communication. Having an educational tool in Indigenous patient's first language is crucial in developing treatment partnerships for Indigenous patients with hepatitis B. Using a culturally appropriate worldview as the foundation for development should help to reduce disempowerment and improve health literacy.

Paleomagnetic study of the northern Ford Ranges, western Marie Byrd Land, West Antarctica: Motion between West and East Antarctica

USGS Publications Warehouse

Luyendyk, B.; Cisowski, S.; Smith, C.; Richard, S.; Kimbrough, D.

1996-01-01

A paleomagnetic study of Paleozoic and Mesozoic crystalline rocks in the northern Ford Ranges of Marie Byrd Land, West Antarctica, has determined a middle Cretaceous (circa 100 Ma) paleomagnetic pole and provided constraints on possible clockwise rotation of these ranges and on the rifting of east Gondwana. The 40Ar/39Ar thermochronology data from the Fosdick Mountains record a period of rapid cooling from ???700??C beginning at ???100 Ma. We relate this to extension, intrusion, and uplift associated with the beginning of rifting between Campbell Plateau and Marie Byrd Land. All rocks from the Fosdick and Chester Mountains are normally polarized. We interpret thermochronology and paleomagnetic data to infer that the region was extensively remagnetized in middle Cretaceous time. Inclinations in samples from the Chester Mountains are less steep than those from the Fosdick Mountains, which we interpret as ???25?? of south tilting of the Chesters. We interpret cooling age data for the time of magnetization to infer that the tilting began after 105 Ma and ended prior to 103 Ma. We further interpret this as constraining the beginning of extension between the Campbell Plateau and western Marie Byrd Land to the interval 105 to 103 Ma. Virtual geomagnetic poles from samples of Early Carboniferous age granodiorite from the western Phillips Mountains lie on the late Paleozoic apparent polar wander path for Australia transferred to Antarctica. Directions from 29 sites in the central and eastern Phillips and Fosdick Mountains give a Middle Cretaceous paleomagnetic pole at 222.3?? E, 70.5?? S (A95 6.1??, KAPPA 20.0). This pole is indistinguishable from other Middle Cretaceous poles for studies further east in Marie Byrd Land. Combining middle Cretaceous poles determined for three other studies of the Antarctic Peninsula. Thurston Island, and the Ruppert-Hobbs coasts with ours gives a Pacific West Antarctic pole at 215.2?? E, 73.5?? S (A95 4.0??, KAPPA 528.9). This pole is discordant by 5?? to 10?? from synthetic mid-Cretaceous East Antarctic reference poles, but the degree of discordance is very sensitive to the choice of the specific reference pole. The lack of native East Antarctic reference poles leaves this analysis inconclusive. Accepting 10?? of discordance, we favor an interpretation where Pacific West Antarctic crustal domains or microplates have rotated clockwise 40?? to 90?? and translated a few degrees away from East Antarctica during Late Cretaceous time.

LAND COVER ASSESSMENT OF INDIGENOUS COMMUNITIES IN THE BOSAWAS REGION OF NICARAGUA

EPA Science Inventory

Data derived from remotely sensed images were utilized to conduct land cover assessments of three indigenous communities in northern Nicaragua. Historical land use, present land cover and land cover change processes were all identified through the use of a geographic informat...

Global and continental changes of arid areas using the FAO Aridity Index over the periods 1951-1980 and 1981-2010

NASA Astrophysics Data System (ADS)

Spinoni, Jonathan; Micale, Fabio; Carrao, Hugo; Naumann, Gustavo; Barbosa, Paulo; Vogt, Jürgen

2013-04-01

An increase in arid areas and progressing land degradation are two of the main consequences of global climate change. In the 2nd edition of the World Atlas of Desertification (WAD), published by the United Nation Environment Program (UNEP) in 1997, a global aridity map was presented. This map was based on the Food and Agriculture Organization (FAO) Aridity Index (AI) that takes into account the annual ratio between precipitation (RR) and Potential Evapo-Transpiration (PET). According to the long-term mean value of this ratio, climate is therefore classified in hyper-arid (<0.05), arid (0.05-0.2), semi-arid (0.2-0.5), dry sub-humid (0.5-0.65), and humid (>0.65); a special case are cold climates, which occur if the mean annual PET is below 400 mm. In the framework of the 3rd edition of the WAD, we computed new global aridity maps to improve and update the old version that was based on a single dataset (CRU dataset, Climate Research Unit of University of East Anglia) related to the 1951-80 period only. We computed the AI on two different time intervals (1951-80 and 1981-2010) in order to account for shifts in classes between the two periods and we used two different datasets: PET from CRU (version 3.2), and precipitation from the global 0.5˚x0.5˚ gridded monthly precipitation of the Global Precipitation Climatology Center (GPCC) of the Deutscher Wetterdienst (DWD). We used the GPCC Full Data Reanalysis Version 6.0, which showed a high reliability during many quality checks and is based on more stations than the CRU's precipitation counterpart. The results show that the "arid areas" (i.e. AI <0.5) globally increased from 28.4% to 29.6% and in Northern Hemisphere the cold climate areas decreased from 26.6% to 25.4%. Comparing the aridity maps of the two periods, the areas which most remarkably moved to lower AI values ("more arid" conditions) are: Canada, Brazil, the Mediterranean Region, Eastern Europe, almost all of Africa, the Middle East, Eastern China, Borneo, and Australia. At regional or country level, a shift of one class towards a "more arid" class can be found in Alaska (U.S.), Alberta (Canada), Patagonia (Argentina), Pernambuco (Brazil), Western Peru, Spain, the Southern Sahara and North-Eastern Kalahari deserts, Rajasthan and Madhya Pradesh (India), Mongolia, the Yang-Tze Basin (China), and the North-Eastern and South-Western Australian coasts. On the other hand, Central U.S., Paraguay and Northern Argentina, Scandinavia, Northern Australia, and Western China moved to a wetter climate in the last period. Due to the low data availability, we assumed that no changes took place in Antarctica, which is meant to be under a permanent ice cap, excluding the northernmost Graham Land.

Product recovery from tree grade 1 northern red oak on Menominee tribal lands

Treesearch

John P. Dwyer; Daniel C. Dey

2007-01-01

Since 1854 the Menominee Tribal people have practiced some level of forest management on their lands. In April of 2000, Menominee Tribal Enterprises (MTE) forestry staff along with federal, state, and university researchers began a comprehensive study of value in northern red oak (Quercus rubra L.). One of the objectives of this study was to relate...

Development of second-growth northern hardwoods on Bartlett Experimental Forest - a 25-year record

Treesearch

William B. Leak

1961-01-01

Second-growth timber occupies more than one-third of the commercial northern hardwood forest land in New England. The origin of these stands - clearcutting, or land abandonment with or without fire - determined their present characteristics; they are essentially even-aged, with a high proportion of intolerant and intermediate species and many stems of sprout origin (...

Recreational aspects of forestland easements in the northern forest region of New York State

Treesearch

Steven Beck; Harry L., Jr. Haney; Chad P. Dawson

1998-01-01

Forestland easements are the subset of conservation easements encumbering forested properties. These less than fee interests in private land are flexible legal mechanisms that contribute to a diverse collection of land use influences. This study of forestland easements and their grantors in the northern forest region of New York State revealed that recreation rights...

Seed dispersal turns an experimental plantation on degraded land into a novel forest in urban northern Puerto Rico

Treesearch

Oscar Abelleira; Elvia J. Meléndez Ackerman; Diana García Montiel; John A. Parrotta

2015-01-01

Planting tree species with desirable traits may catalyze forest regeneration in increasingly common degraded lands by restoring soil properties and attracting seed dispersers. We sampled forest regeneration in an experimental plantation of Albizia lebbek, an introduced N-fixing species, on a degraded pasture in northern Puerto Rico, 27 years after its establishment. We...

Housing growth, forests, and public lands in Northern Wisconsin form 1940 to 2000

Treesearch

Roger B. Hammer; Susan I. Stewart; Todd J. Hawbaker; Volker C. Radeloff

2009-01-01

Rural, forested areas throughout the United States are experiencing strong housing growth with potentially detrimental impacts on the environment. In this paper, we quantify housing growth in Northern Wisconsin over the last sixty years to determine if growth rates were higher near public lands, which may represent an important recreational amenity. We used data from...

DISCUSSION OF PLANNING AND IMPLEMENTATION OF GOVERNMENT AND PRIVATE AGENCY PROGRAMS IN NORTHERN NEW MEXICO.

ERIC Educational Resources Information Center

KNOWLTON, CLARK S.

THE MEXICAN AMERICAN POPULATION IN NORTHERN NEW MEXICO ORIGINALLY HAD LAND GRANTS FROM THE SPANISH CROWN. LACK OF UNDERSTANDING OR ACCEPTANCE OF THE AMERICAN SYSTEM OF INDIVIDUAL OWNERSHIP HAS CAUSED THE MEXICAN AMERICAN TO LOSE MUCH OF THE ORIGINAL GRANT LANDS. THE MEXICAN AMERICAN SOCIAL ORGANIZATION, ORIGINALLY STRUCTURED UPON THE FARM VILLAGE,…

Dracunculus mulbus n. sp. (Nematoda: Spirurida) from the water python Liasis fuscus (Serpentes: Boidae) in northern Australia.

PubMed

Jones, Hugh I; Mulder, Eridani

2007-03-01

A new species of Dracunculus Reichard, 1759 (Nematoda: Spirurida) is described from the tissues surrounding organs in the body-cavity of the water python Liasis fuscus Peters in northern Australia. One to 14 worms were recovered from 22% (27/120) of pythons examined. Males were located principally around the lungs, liver and heart of the hosts, and females were recovered from peritoneal tissue surrounding the intestines and lining the body-cavity. This species differs from previously described species of Dracunculus in the position of the papillae at the posterior end in males, and in the possession of thick, narrow caudal alae. Submedian cephalic papillae are single in both sexes. Dorsal and ventral anterior cephalic papillae are absent in males. This is the first report of a species of Dracunculus from the Australian region.

"Magnetic" termite mound surfaces are oriented to suit wind and shade conditions.

PubMed

Jacklyn, Peter M

1992-09-01

The termites Amitermes meridionalis and A. laurensis construct remarkable meridional or "magnetic" mounds in northern Australia. These mounds vary geographically in mean orientation in a manner that suggests such variation is an adaptive response to local environmental conditions. Theoretical modelling of solar irradiance and mound rotation experiments show that maintenance of an eastern face temperature plateau during the dry season is the most likely physical basis for the mound orientation response. Subsequent heat transfer analysis shows that habitat wind speed and shading conditions also affect face temperature gradients such as the rate of eastern face temperature change. It is then demonstrated that the geographic variation in mean mound orientation follows the geographic variation in long-term wind speed and shading conditions across northern Australia such that an eastern face temperature plateau is maintained in all locations.

Seismicity of the Earth 1900-2010 New Guinea and vicinity

USGS Publications Warehouse

Benz, Harley M.; Herman, Matthew; Tarr, Arthur C.; Hayes, Gavin P.; Furlong, Kevin P.; Villaseñor, Antonio; Dart, Richard L.; Rhea, Susan

2011-01-01

There have been 22 M7.5+ earthquakes recorded in the New Guinea region since 1900. The dominant earthquake mechanisms are thrust and strike slip, associated with the arc-continent collision and the relative motions between numerous local microplates. The largest earthquake in the region was a M8.2 shallow thrust fault event in the northern Papua province of Indonesia that killed 166 people in 1996. The Australia-Pacific plate boundary is over 4,000 km long on the northern margin, from the Sunda (Java) trench in the west to the Solomon Islands in the east. The eastern section is over 2,300 km long, extending west from northeast of the Australian continent and the Coral Sea until it intersects the east coast of Papua New Guinea. The boundary is dominated by the general northward subduction of the Australia plate.

Testing ore deposit models using in situ U-Pb geochronology of hydrothermal monazite: Paleoproterozoic gold mineralization in northern Australia

NASA Astrophysics Data System (ADS)

Rasmussen, Birger; Sheppard, Stephen; Fletcher, Ian R.

2006-02-01

The inability to establish absolute ages for gold deposition in the Pine Creek orogen of northern Australia has led to conflicting ore deposit models, ranging from intrusion related, which predict that gold mineralization was synchronous with granite magmatism (ca. 1835 1820 Ma), to orogenic, which place ore deposition nearly 100 m.y. later. Here we present ion microprobe U-Pb geochronology for a mineralized quartz reef from Tom's Gully mine, Mount Bundey, Northern Territory, Australia, and nearby granitic rocks and associated contact aureoles. Isotopic dating of zircon and monazite indicates that intrusion and contact metamorphism occurred ca. 1825 Ma, whereas hydrothermal monazite from the auriferous quartz reef gives a mean 207Pb/206Pb age of 1780 ± 10 Ma, interpreted as the time of gold mineralization. Mineralization therefore postdated intrusion by ˜45 m.y. and preceded a postulated ca. 1740 1730 Ma cratonwide orogenic gold event by ˜50 m.y. Hence, neither the intrusion-related model nor the recently proposed orogenic model is applicable. Combined with a reevaluation of age data from the nearby Goodall gold deposit, our data suggest that mineralization coincides with, and may be related to, an episode of regional low-grade metamorphism, deformation, and fluid circulation (Shoobridge event). Our results demonstrate the importance of high-precision in situ geochronology and detailed petrography for deciphering age relationships in ore deposits, and of testing the veracity of models for ore formation.

Communications: Mosquito Habitats, Land Use, and Malaria Risk in Belize from Satellite Imagery

NASA Technical Reports Server (NTRS)

Pope, Kevin; Masuoka, Penny; Rejmankova, Eliska; Grieco, John; Johnson, Sarah; Roberts, Donald

2004-01-01

Satellite imagery of northern Belize is used to examine the distribution of land use and breeding habitats of the malaria vector the Anopheles mosquito. A land cover classification based on multispectral SPOT and multitemporal Radarsat images identified eleven land cover classes, including agricultural, forest, and marsh types. Two of the land cover types, Typha domingensis marsh and flooded forest, are Anopheles vestitipennis larval habitats, and one, Eleocharis spp. marsh, is the larval habitat for Anopheles albimanus. Geographic Information Systems (GIS) analyses of land cover demonstrate that the amount of Typha domingensis in a marsh is positively correlated with the amount of agricultural land in the adjacent upland, and negatively correlated with the amount of adjacent forest. This finding is consistent with the hypothesis that nutrient (phosphorus) runoff from agricultural lands is causing an expansion of Typha domingensis in northern Belize. Thus, land use induced expansion of Anopheles vestitipennis larval habitat is potentially increasing malaria risk in Belize, and in other regions where Anopheles vestitipennis is a major malaria vector.

Considerations for Royal Australian Air Force Operations in the North of Australia

DTIC Science & Technology

1990-05-01

which insulates the nation from those who would wish it harm. Recognition of this fact in terms of strategic thinking was slow to eventuate this century...much of northern Australia has had a detrimental effect on population growth throughout the region. An overwhelming majority of people dwell in the...entirely comfortable. Contrasts between the two countries are much more pronounced than similarities. Indonesia’s 175 million people make it the fifth

Frequency and distribution of forest, savanna, and crop fires over tropical regions during PEM-Tropics A

NASA Astrophysics Data System (ADS)

Olson, Jennifer R.; Baum, Bryan A.; Cahoon, Donald R.; Crawford, James H.

1999-03-01

Advanced very high resolution radiometer 1.1 km resolution satellite radiance data were used to locate active fires throughout much of the tropical region during NASA's Global Tropospheric Experiment (GTE) Pacific Exploratory Mission-Tropics (PEM-Tropics A) aircraft campaign, held in September and October 1996. The spatial and temporal distributions of the fires in Australia, southern Africa, and South America are presented here. The number of fires over northern Australia, central Africa, and South America appeared to decrease toward the end of the mission period. Fire over eastern Australia was widespread, and temporal patterns showed a somewhat consistent amount of burning with periodic episodes of enhanced fire counts observed. At least one episode of enhanced fire counts corresponded to the passage of a frontal system which brought conditions conducive to fire to the region, with strong westerlies originating over the hot, dry interior continent. Regions that were affected by lower than normal rainfall during the previous wet season (e.g., northern Australia and southwestern Africa) showed relatively few fires during this period. This is consistent with a drought-induced decrease in vegetation and therefore a decreased availability of fuel for burning. Alternatively, a heavier than normal previous wet season along the southeastern coast of South Africa may have contributed to high fuel loading and an associated relatively heavy amount of burning compared to data from previous years.

Using Data Assimilation Diagnostics to Assess the SMAP Level-4 Soil Moisture Product

NASA Technical Reports Server (NTRS)

Reichle, Rolf; Liu, Qing; De Lannoy, Gabrielle; Crow, Wade; Kimball, John; Koster, Randy; Ardizzone, Joe

2018-01-01

The Soil Moisture Active Passive (SMAP) mission Level-4 Soil Moisture (L4_SM) product provides 3-hourly, 9-km resolution, global estimates of surface (0-5 cm) and root-zone (0-100 cm) soil moisture and related land surface variables from 31 March 2015 to present with approx.2.5-day latency. The ensemble-based L4_SM algorithm assimilates SMAP brightness temperature (Tb) observations into the Catchment land surface model. This study describes the spatially distributed L4_SM analysis and assesses the observation-minus-forecast (O-F) Tb residuals and the soil moisture and temperature analysis increments. Owing to the climatological rescaling of the Tb observations prior to assimilation, the analysis is essentially unbiased, with global mean values of approx. 0.37 K for the O-F Tb residuals and practically zero for the soil moisture and temperature increments. There are, however, modest regional (absolute) biases in the O-F residuals (under approx. 3 K), the soil moisture increments (under approx. 0.01 cu m/cu m), and the surface soil temperature increments (under approx. 1 K). Typical instantaneous values are approx. 6 K for O-F residuals, approx. 0.01 (approx. 0.003) cu m/cu m for surface (root-zone) soil moisture increments, and approx. 0.6 K for surface soil temperature increments. The O-F diagnostics indicate that the actual errors in the system are overestimated in deserts and densely vegetated regions and underestimated in agricultural regions and transition zones between dry and wet climates. The O-F auto-correlations suggest that the SMAP observations are used efficiently in western North America, the Sahel, and Australia, but not in many forested regions and the high northern latitudes. A case study in Australia demonstrates that assimilating SMAP observations successfully corrects short-term errors in the L4_SM rainfall forcing.

Global Assessment of the SMAP Level-4 Soil Moisture Product Using Assimilation Diagnostics

NASA Technical Reports Server (NTRS)

Reichle, Rolf; Liu, Qing; De Lannoy, Gabrielle; Crow, Wade; Kimball, John; Koster, Randy; Ardizzone, Joe

2018-01-01

The Soil Moisture Active Passive (SMAP) mission Level-4 Soil Moisture (L4_SM) product provides 3-hourly, 9-km resolution, global estimates of surface (0-5 cm) and root-zone (0-100 cm) soil moisture and related land surface variables from 31 March 2015 to present with approx. 2.5-day latency. The ensemble-based L4_SM algorithm assimilates SMAP brightness temperature (Tb) observations into the Catchment land surface model. This study describes the spatially distributed L4_SM analysis and assesses the observation-minus-forecast (O-F) Tb residuals and the soil moisture and temperature analysis increments. Owing to the climatological rescaling of the Tb observations prior to assimilation, the analysis is essentially unbiased, with global mean values of approx. 0.37 K for the O-F Tb residuals and practically zero for the soil moisture and temperature increments. There are, however, modest regional (absolute) biases in the O-F residuals (under approx. 3 K), the soil moisture increments (under approx. 0.01 cu m/cu m), and the surface soil temperature increments (under approx. 1 K). Typical instantaneous values are approx. 6 K for O-F residuals, approx. 0.01 (approx. 0.003) cu m/cu m for surface (root-zone) soil moisture increments, and approx. 0.6 K for surface soil temperature increments. The O-F diagnostics indicate that the actual errors in the system are overestimated in deserts and densely vegetated regions and underestimated in agricultural regions and transition zones between dry and wet climates. The O-F auto-correlations suggest that the SMAP observations are used efficiently in western North America, the Sahel, and Australia, but not in many forested regions and the high northern latitudes. A case study in Australia demonstrates that assimilating SMAP observations successfully corrects short-term errors in the L4_SM rainfall forcing.

Assessment of the Utility of the Advanced Himawari Imager to Detect Active Fire Over Australia

NASA Astrophysics Data System (ADS)

Hally, B.; Wallace, L.; Reinke, K.; Jones, S.

2016-06-01

Wildfire detection and attribution is an issue of importance due to the socio-economic impact of fires in Australia. Early detection of fires allows emergency response agencies to make informed decisions in order to minimise loss of life and protect strategic resources in threatened areas. Until recently, the ability of land management authorities to accurately assess fire through satellite observations of Australia was limited to those made by polar orbiting satellites. The launch of the Japan Meteorological Agency (JMA) Himawari-8 satellite, with the 16-band Advanced Himawari Imager (AHI-8) onboard, in October 2014 presents a significant opportunity to improve the timeliness of satellite fire detection across Australia. The near real-time availability of images, at a ten minute frequency, may also provide contextual information (background temperature) leading to improvements in the assessment of fire characteristics. This paper investigates the application of the high frequency observation data supplied by this sensor for fire detection and attribution. As AHI-8 is a new sensor we have performed an analysis of the noise characteristics of the two spectral bands used for fire attribution across various land use types which occur in Australia. Using this information we have adapted existing algorithms, based upon least squares error minimisation and Kalman filtering, which utilise high frequency observations of surface temperature to detect and attribute fire. The fire detection and attribution information provided by these algorithms is then compared to existing satellite based fire products as well as in-situ information provided by land management agencies. These comparisons were made Australia-wide for an entire fire season - including many significant fire events (wildfires and prescribed burns). Preliminary detection results suggest that these methods for fire detection perform comparably to existing fire products and fire incident reporting from relevant fire authorities but with the advantage of being near-real time. Issues remain for detection due to cloud and smoke obscuration, along with validation of the attribution of fire characteristics using these algorithms.

Mapping large-area landscape suitability for honey bees to assess the influence of land-use change on sustainability of national pollination services.

PubMed

Gallant, Alisa L; Euliss, Ned H; Browning, Zac

2014-01-01

Pollination is a critical ecosystem service affected by various drivers of land-use change, such as policies and programs aimed at land resources, market values for crop commodities, local land-management decisions, and shifts in climate. The United States is the world's most active market for pollination services by honey bees, and the Northern Great Plains provide the majority of bee colonies used to meet the Nation's annual pollination needs. Legislation requiring increased production of biofuel crops, increasing commodity prices for crops of little nutritional value for bees in the Northern Great Plains, and reductions in government programs aimed at promoting land conservation are converging to alter the regional landscape in ways that challenge beekeepers to provide adequate numbers of hives for national pollination services. We developed a spatially explicit model that identifies sites with the potential to support large apiaries based on local-scale land-cover requirements for honey bees. We produced maps of potential apiary locations for North Dakota, a leading producer of honey, based on land-cover maps representing (1) an annual time series compiled from existing operational products and (2) a realistic scenario of land change. We found that existing land-cover products lack sufficient local accuracy to monitor actual changes in landscape suitability for honey bees, but our model proved informative for evaluating effects on suitability under scenarios of land change. The scenario we implemented was aligned with current drivers of land-use change in the Northern Great Plains and highlighted the importance of conservation lands in landscapes intensively and extensively managed for crops.

Mapping large-area landscape suitability for honey bees to assess the influence of land-use change on sustainability of national pollination services

USGS Publications Warehouse

Gallant, Alisa L.; Euliss, Ned H.; Browning, Zac

2014-01-01

Pollination is a critical ecosystem service affected by various drivers of land-use change, such as policies and programs aimed at land resources, market values for crop commodities, local land-management decisions, and shifts in climate. The United States is the world's most active market for pollination services by honey bees, and the Northern Great Plains provide the majority of bee colonies used to meet the Nation's annual pollination needs. Legislation requiring increased production of biofuel crops, increasing commodity prices for crops of little nutritional value for bees in the Northern Great Plains, and reductions in government programs aimed at promoting land conservation are converging to alter the regional landscape in ways that challenge beekeepers to provide adequate numbers of hives for national pollination services. We developed a spatially explicit model that identifies sites with the potential to support large apiaries based on local-scale land-cover requirements for honey bees. We produced maps of potential apiary locations for North Dakota, a leading producer of honey, based on land-cover maps representing (1) an annual time series compiled from existing operational products and (2) a realistic scenario of land change. We found that existing land-cover products lack sufficient local accuracy to monitor actual changes in landscape suitability for honey bees, but our model proved informative for evaluating effects on suitability under scenarios of land change. The scenario we implemented was aligned with current drivers of land-use change in the Northern Great Plains and highlighted the importance of conservation lands in landscapes intensively and extensively managed for crops.

Mapping Large-Area Landscape Suitability for Honey Bees to Assess the Influence of Land-Use Change on Sustainability of National Pollination Services

PubMed Central

Gallant, Alisa L.; Euliss, Ned H.; Browning, Zac

2014-01-01

Pollination is a critical ecosystem service affected by various drivers of land-use change, such as policies and programs aimed at land resources, market values for crop commodities, local land-management decisions, and shifts in climate. The United States is the world's most active market for pollination services by honey bees, and the Northern Great Plains provide the majority of bee colonies used to meet the Nation's annual pollination needs. Legislation requiring increased production of biofuel crops, increasing commodity prices for crops of little nutritional value for bees in the Northern Great Plains, and reductions in government programs aimed at promoting land conservation are converging to alter the regional landscape in ways that challenge beekeepers to provide adequate numbers of hives for national pollination services. We developed a spatially explicit model that identifies sites with the potential to support large apiaries based on local-scale land-cover requirements for honey bees. We produced maps of potential apiary locations for North Dakota, a leading producer of honey, based on land-cover maps representing (1) an annual time series compiled from existing operational products and (2) a realistic scenario of land change. We found that existing land-cover products lack sufficient local accuracy to monitor actual changes in landscape suitability for honey bees, but our model proved informative for evaluating effects on suitability under scenarios of land change. The scenario we implemented was aligned with current drivers of land-use change in the Northern Great Plains and highlighted the importance of conservation lands in landscapes intensively and extensively managed for crops. PMID:24919181

Global atmospheric carbon budget: results from an ensemble of atmospheric CO2 inversions

NASA Astrophysics Data System (ADS)

Peylin, P.; Law, R. M.; Gurney, K. R.; Chevallier, F.; Jacobson, A. R.; Maki, T.; Niwa, Y.; Patra, P. K.; Peters, W.; Rayner, P. J.; Rödenbeck, C.; Zhang, X.

2013-03-01

Atmospheric CO2 inversions estimate surface carbon fluxes from an optimal fit to atmospheric CO2 measurements, usually including prior constraints on the flux estimates. Eleven sets of carbon flux estimates are compared, generated by different inversions systems that vary in their inversions methods, choice of atmospheric data, transport model and prior information. The inversions were run for at least 5 yr in the period between 1990 and 2009. Mean fluxes for 2001-2004, seasonal cycles, interannual variability and trends are compared for the tropics and northern and southern extra-tropics, and separately for land and ocean. Some continental/basin-scale subdivisions are also considered where the atmospheric network is denser. Four-year mean fluxes are reasonably consistent across inversions at global/latitudinal scale, with a large total (land plus ocean) carbon uptake in the north (-3.3 Pg Cy-1 (±0.6 standard deviation)) nearly equally spread between land and ocean, a significant although more variable source over the tropics (1.6 ± 1.0 Pg Cy-1) and a compensatory sink of similar magnitude in the south (-1.4 ± 0.6 Pg Cy-1) corresponding mainly to an ocean sink. Largest differences across inversions occur in the balance between tropical land sources and southern land sinks. Interannual variability (IAV) in carbon fluxes is larger for land than ocean regions (standard deviation around 1.05 versus 0.34 Pg Cy-1 for the 1996-2007 period), with much higher consistency amoung the inversions for the land. While the tropical land explains most of the IAV (stdev ∼ 0.69 Pg Cy-1), the northern and southern land also contribute (stdev ∼ 0.39 Pg Cy-1). Most inversions tend to indicate an increase of the northern land carbon uptake through the 2000s (around 0.11 Pg Cy-1), shared by North America and North Asia. The mean seasonal cycle appears to be well constrained by the atmospheric data over the northern land (at the continental scale), but still highly dependent on the prior flux seasonality over the ocean. Finally we provide recommendations to interpret the regional fluxes, along with the uncertainty estimates.

Geology based planning and the aggregate industry -Perspectives from opposite sides of the globe

USGS Publications Warehouse

Stephens, A.W.; Langer, W.H.

2005-01-01

In Australia and America, encroachment by conflicting land uses, zoning restrictions, and the "not in my backyard" syndrome make it increasingly difficult to access high-quality aggregate resources located near the market areas. Attempts by government agencies in America to protect aggregate resources for future development have met with varying degrees of success. The State of Queensland, Australia, designates aggregate resource areas as Key Resource Areas, which protect the resource and the routes to transport the resource, provide a separation area from incompatible land uses, and indicate the likelihood that the area is free from conflicting social or environmental issues. Copyright ?? 2005 by SME.

Geology-based planning and the aggregate industry - Perspectives from opposite sides of the globe

USGS Publications Warehouse

Stephens, A.W.; Langer, W.H.

2006-01-01

In Australia and in the United States, encroachment by conflicting land uses, zoning restrictions and the "not-in-my-backyard" syndrome make it increasingly difficult to access high-quality aggregate resources located near their market areas. Attempts by government agencies in the United States to protect aggregate resources for future development have met with varying degrees of success. The State of Queensland, Australia, designates aggregate resource areas as Key Resource Areas. These protect the resource and the routes to transport the resource, provide a separation area from incompatible land uses and indicate the likelihood that the area is free from conflicting social or environmental issues.

Two species in one ecosystem: management of northern bobwhite and red-cockaded woodpecker in the Red Hills

Treesearch

R. Todd Engstrom; William E. Palmer

2005-01-01

Sport hunting for Northern Bobwhites (Colinus virginianus) is the reason that approximately 300,000 acres of semi-wild lands still exist in the Red Hills region of north Florida and south Georgia. Use of fire for management and relatively large (400 to 4,000 ha), contiguous land ownerships permitted populations of bobwhite and Red-cockaded Woodpecker...

Influence of forest management alternatives and land type on susceptibility to fire in northern Wisconsin, USA

Treesearch

Eric J. Gustafson; Patrick A. Zollner; Brian R. Sturtevant; S. He Hong; David J. Mladenoff

2004-01-01

We used the LANDIS disturbance and succession model to study the effects of six alternative vegetation management scenarios on forest succession and the subsequent risk of canopy fire on a 2791 km2 landscape in northern Wisconsin, USA. The study area is a mix of fire-prone and fire-resistant land types. The alternatives vary the spatial...

On the relative role of fire and rainfall in determining vegetation patterns in tropical savannas: a simulation study

NASA Astrophysics Data System (ADS)

Spessa, Allan; Fisher, Rosie

2010-05-01

Tropical savannas cover 18% of the world's land surface and are amongst the most productive terrestrial systems in the world. They comprise 15% of the total terrestrial carbon stock, with an estimated mean net primary productivity (NPP) of 7.2 tCha-1yr-1 or two thirds of NPP in tropical forests. Tropical savannas are the most frequently burnt biome, with fire return intervals in highly productive areas being typically 1-2 years. Fires shape vegetation species composition, tree to grass ratios and nutrient redistribution, as well as the biosphere-atmosphere exchange of trace gases, momentum and radiative energy. Tropical savannas are a major source of emissions, contributing 38 % of total annual CO2 from biomass burning, 30% CO, 19 % CH4 and 59 % NOx. Climatically, they occur in regions subject to a strongly seasonal ‘wet-dry' regime, usually under monsoonal control from the movement of the inter-tropical convergence zone. In general, rainfall during the prior wet season(s) determines the amount of grass fuel available for burning while the length of the dry season influences fuel moisture content. Rainfall in tropical savannas exhibits high inter-annual variability, and under future climate change, is projected to change significantly in much of Africa, South America and northern Australia. Process-based simulation models of fire-vegetation dynamics and feedbacks are critical for determining the impacts of wildfires under projected future climate change on i) ecosystem structure and function, and ii) emissions of trace gases and aerosols from biomass burning. A new mechanistic global fire model SPITFIRE (SPread and InTensity of FIRE) has been designed to overcome many of the limitations in existing fire models set within Dynamic Global Vegetation Models (DGVMs). SPITFIRE has been applied in coupled mode globally and southern Africa, both as part of the LPJ DGVM. It has also been driven with MODIS burnt area data applied to sub-Saharan Africa, while coupled to the LPJ-GUESS vegetation model. Recently, SPIFTIRE has been coupled to the Ecosystem Demography (ED) model, which simulates global vegetation dynamics as part of the new land surface scheme JULES (Joint UK Environment Simulator) within the QUEST Earth System Model (http://www.quest-esm.ac.uk/). This study forms part of on-going work to further improve and test the ability of JULES to accurately simulate the terrestrial carbon cycle and land-atmosphere exchanges under different climates. Using the JULES (ED-SPITFIRE) model driven by observed climate (1901-2002), and focusing on large-scale rainfall gradients in the tropical savannas of west Africa, the Northern Territory (Australia) and central-southern Brazil, this study assesses: i) simulated versus observed vegetation dynamics and distributions, and ii) the relative importance of fire versus rainfall in determining vegetation patterns. A sensitivity analysis approach was used.

A Global Assessment of Long-Term Greening and Browning Trends in Pasture Lands Using the GIMMS LAI3g Dataset

NASA Technical Reports Server (NTRS)

Cook, Benjamin I.; Pau, Stephanie

2013-01-01

Pasture ecosystems may be particularly vulnerable to land degradation due to the high risk of human disturbance (e.g., overgrazing, burning, etc.), especially when compared with natural ecosystems (non-pasture, non-cultivated) where direct human impacts are minimal. Using maximum annual leaf area index (LAImax) as a proxy for standing biomass and peak annual aboveground productivity, we analyze greening and browning trends in pasture areas from 1982-2008. Inter-annual variability in pasture productivity is strongly controlled by precipitation (positive correlation) and, to a lesser extent, temperature (negative correlation). Linear temporal trends are significant in 23% of pasture cells, with the vast majority of these areas showing positive LAImax trends. Spatially extensive productivity declines are only found in a few regions, most notably central Asia, southwest North America, and southeast Australia. Statistically removing the influence of precipitation reduces LAImax trends by only 13%, suggesting that precipitation trends are only a minor contributor to long-term greening and browning of pasture lands. No significant global relationship was found between LAImax and pasture intensity, although the magnitude of trends did vary between cells classified as natural versus pasture. In the tropics and Southern Hemisphere, the median rate of greening in pasture cells is significantly higher than for cells dominated by natural vegetation. In the Northern Hemisphere extra-tropics, conversely, greening of natural areas is 2-4 times the magnitude of greening in pasture areas. This analysis presents one of the first global assessments of greening and browning trends in global pasture lands, including a comparison with vegetation trends in regions dominated by natural ecosystems. Our results suggest that degradation of pasture lands is not a globally widespread phenomenon and, consistent with much of the terrestrial biosphere, there have been widespread increases in pasture productivity over the last 30 years.

Mapping the Educational Work of Governesses on Australia's Remote Stations

ERIC Educational Resources Information Center

Newman, Sally

2014-01-01

This article is about the educational work of governesses on Australia's remote cattle and sheep stations. These stations occupy vast tracts of land in the outback, and form part of global food supply chains exporting meat to countries around the world. The article explores the nature of governesses' work, the boundaries they negotiate to perform…

Australian developments in marine science

NASA Astrophysics Data System (ADS)

Coffin, Millard F.

2012-07-01

Australia is an island nation with about two thirds of its jurisdiction underwater. On 25 May 2012, Australia instituted the Seas and Submerged Lands (Limits of Continental Shelf) Proclamation 2012, confirming areas of seabed where Australia has exclusive rights to explore and exploit marine resources. This proclamation follows recommendations by the Commission on the Limits of the Continental Shelf, a body established under the United Nations Convention on the Law of the Sea, confirming Australia's entitlement to extended continental shelf, i.e., that beyond 200 nautical miles from the coastline, of some 2.56 million square kilometers, excluding Australian Antarctic Territory [Symonds et al., 2009] (Figure 1a).

Impact of Land Cover Characterization and Properties on Snow Albedo in Climate Models

NASA Astrophysics Data System (ADS)

Wang, L.; Bartlett, P. A.; Chan, E.; Montesano, P.

2017-12-01

The simulation of winter albedo in boreal and northern environments has been a particular challenge for land surface modellers. Assessments of output from CMIP3 and CMIP5 climate models have revealed that many simulations are characterized by overestimation of albedo in the boreal forest. Recent studies suggest that inaccurate representation of vegetation distribution, improper simulation of leaf area index, and poor treatment of canopy-snow processes are the primary causes of albedo errors. While several land cover datasets are commonly used to derive plant functional types (PFT) for use in climate models, new land cover and vegetation datasets with higher spatial resolution have become available in recent years. In this study, we compare the spatial distribution of the dominant PFTs and canopy cover fractions based on different land cover datasets, and present results from offline simulations of the latest version Canadian Land Surface Scheme (CLASS) over the northern Hemisphere land. We discuss the impact of land cover representation and surface properties on winter albedo simulations in climate models.

Safety and Efficacy of Warfarin Therapy in Remote Communities of the Top End of Northern Australia.

PubMed

Dennis, Jahde; Majoni, William; Tinsley, Jeffrey; Kangaharan, Nadarajah

2017-12-01

Warfarin remains a widely used anticoagulant but application in the remote context is not well documented. This study aimed to assess in more detail whether warfarin is being utilised effectively in Australia's most isolated and remote areas. Retrospective cohort analysis of 2013 captured international normalised ratio (INR) results from people engaged in long term warfarin usage within a number of remote Northern Australian communities. Assessment of monitoring, effectiveness of dosing and complication rates was undertaken. A cohort of 167 patients was established. On average, warfarin was utilised within therapeutic range 52% of the time. Monitoring frequency averaged 16 days. Major bleeding and thrombo-embolism occurred at rates of 5.8 and 4.1 per 100 patient years respectively. Therapeutic utilisation of warfarin in this setting is close to accepted rates but has room for improvement. Monitoring was acceptable and complication rates were not disproportionately high. This study indicates that warfarin is being used with reasonable safety and efficacy in remote regions, but further research is needed. Copyright © 2017 Australian and New Zealand Society of Cardiac and Thoracic Surgeons (ANZSCTS) and the Cardiac Society of Australia and New Zealand (CSANZ). All rights reserved.

Development and evaluation of a species diagnostic polymerase chain reaction-restriction fragment-length polymorphism procedure for cryptic members of the Culex sitiens (Diptera: Culicidae) subgroup in Australia and the southwest Pacific.

PubMed

Beebe, N W; van den Hurk, A F; Chapman, H F; Frances, S P; Williams, C R; Cooper, R D

2002-03-01

Members of the Culex sitiens subgroup are important vectors of arboviruses, including Japanese encephalitis virus, Murray Valley encephalitis virus and Ross River virus. Of the eight described species, Cx. annulirostris Skuse, Cx. sitiens Wiedemann, and Cx. palpalis Taylor appear to be the most abundant and widespread throughout northern Australia and Papua New Guinea (PNG). Recent investigations using allozymes have shown this subgroup to contain cryptic species that possess overlapping adult morphology. We report the development of a polymerase chain reaction-restriction fragment-length polymorphism (PCR-RFLP) procedure that reliably separates these three species. This procedure utilizes the sequence variation in the ribosomal DNA ITS1 and demonstrates species-specific PCR-RFLP profiles from both colony and field collected material. Assessment of the consistency of this procedure was undertaken on mosquitoes sampled from a wide geographic area including Australia, PNG, and the Solomon Islands. Overlapping adult morphology was observed for Cx. annulirostris and Cx. palpalis in both northern Queensland and PNG and for all three species at one site in northwest Queensland.

Field evaluation of repellent formulations containing deet and picaridin against mosquitoes in Northern Territory, Australia.

PubMed

Frances, S P; Waterson, D G E; Beebe, N W; Cooper, R D

2004-05-01

Field efficacy of repellent formulations containing picaridin (1-methyl-propyl 2-(2-hydroxyethyl)-1-piperidinecarboxylate) or deet (N,N,-diethyl-3-methylbenzamide) against mosquitoes in Northern Territory, Australia, was evaluated. The following repellent treatments were evaluated: 19.2% picaridin (Autan Repel Army 20), a solution of 20% deet in ethanol, and 35% deet in a gel (Australian Defense Force [ADF]). The predominant mosquito species were Culex annulirostris Skuse (57.8%), Anopheles merankensis Venhuis (15.4%), and Anopheles bancroftii Giles (13.2%). The protection provided by repellents against Anopheles spp. was relatively poor, with 19.2% picaridin and ADF deet providing >95% protection for only 1 h, whereas 20% deet provided <95% protection at 1 h after repellent application. In contrast, the repellents provided good protection against Cx. annulirostris, with 19.2% picaridin providing >95% protection for 5 h and both deet formulations providing >95% protection for 7 h when collections ceased. This study provides additional field data showing tolerance of Anopheles spp. for repellents. The response of field populations of Cx. annulirostris, an important vector of arboviruses in Australia, to repellents containing deet and picaridin is reported for the first time.

On the Origin of Monsoon

NASA Technical Reports Server (NTRS)

Chao, Winston C.; Chen, Baode

2000-01-01

The notion that the continental-scale land-sea contrast is the main reason that monsoon circulation exists has been a long-held belief. The purpose of this paper is to point out that this notion should be substantially modified. The central idea of this notion states that in summer, radiative heating of the continent, say Asia, gives rise to a continental-scale thermal low and surrounding the thermal low in its southeast direction the low level wind flows in from south-west. This low-level inflow creates a convergence of moisture, which maintains the cumulus convection. And in winter, radiative cooling of continent gives rise to a thermal high and to its southeast the low-level wind is from northeast. The mechanism in this interpretation does undoubtedly exist. However, this mechanism, though believed to be the main driving force of monsoon, has not been tested in numerical experiments. There has been an increasing recognition in the recent years that monsoon is inextricably tied to the heating in the intertropical convergence zone (ITCZ). We propose that the main cause of monsoon is ITCZ's being substantially away from the equator. A brief qualitative explanation of why the ITCZ can be a source of monsoon circulation can be offered based on the circulation field forced by the ITCZ heating. The existence of the ITCZ's does not always have to rely on land-sea contrast on the continental scale. This is hinted in the fact that in February the ITCZ close to Australia (and its associated monsoon circulation) covers a longitudinal range several times as long as that of Australia and thus cannot possibly be caused mainly by the land-sea contrast associated with Australia. Yet, this cannot be used as a proof that the ITCZ in the Asian summer monsoon is not mainly due to land-sea contrast. One of the purposes of this work is to provide a convincing proof. In this work the role of land-sea contrast in the origin of monsoon is examined through numerical simulation with the Goddard general circulation model. The Asian and Australian monsoon circulations are obtained in a four-year integration and then the integration is repeated with Asia, the maritime continent, and Australia replaced by ocean. The sea surface temperature (SST) at each affected grid is specified as the SST at the first grid to the east that is an ocean grid in the first experiment. The latter integration shows that the monsoon circulation pattern over where south Asia and Australia were and the surrounding region has largely remained. The results discount land-sea contrast as the main cause of Asian monsoon. A third experiment is the same as the first except that the topography of Asia, the maritime continent, and Australia is reduced to zero. This experiment reveals that the difference between the first two experiments is due more to the removal of topography than to the removal of land-sea contrast. August precipitation is shown averaged over the last three years of each of the three experiments. They show that the Asian monsoon rainy region is largely intact in the second experiment and the difference between the second and the third experiment is mainly in the longitudinal location of the maximum precipitation. Additionally, in Asian and Australian winter monsoons land-sea contrast also plays only a modifying role. Although land-sea contrast plays only a modifying role in Asian and Australian (and Central American including Mexican) monsoons, it is the main reason that ITCZ (and thus monsoon) exists in Africa and South America. Thus, monsoons can be classified into two groups depending on whether land-sea contrast plays a major role.

From rum jungle to Wismut-reducing the environmental impact of uranium mining and milling

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zuk, W.M.; Jeffree, R.A.; Levins, D.M.

1994-12-31

Australia has a long history of uranium mining. In the early days, little attention was given to environmental matters and considerable pollution occurred. Ansto has been involved in rehabilitation of a number of the early uranium mining sites, from Rum Jungle in Australia`s Northern Territory to Wismut in Germany, and is working with current producers to minimise the environmental impact of their operations. Ansto`s expertise is extensive and includes, inter alia, amelioration of acid mine drainage, radon measurement and control, treatment of mill wastes, management of tailings, monitoring of seepage plumes, mathematical modelling of pollutant transport and biological impacts inmore » a tropical environment.« less

How willing are landowners to supply land for bioenergy crops in the Northern Great Lakes Region?

DOE PAGES

Swinton, Scott M.; Tanner, Sophia; Barham, Bradford L.; ...

2016-04-30

Land to produce biomass is essential if the United States is to expand bioenergy supply. Use of agriculturally marginal land avoids the food vs. fuel problems of food price rises and carbon debt that are associated with crop and forestland. Recent remote sensing studies have identified large areas of US marginal land deemed suitable for bioenergy crops. Yet the sustainability benefits of growing bioenergy crops on marginal land only pertain if land is economically available. Scant attention has been paid to the willingness of landowners to supply land for bioenergy crops. Focusing on the northern tier of the Great Lakes,more » where grassland transitions to forest and land prices are low, this contingent valuation study reports on the willingness of a representative sample of 1124 private, noncorporate landowners to rent land for three bioenergy crops: corn, switchgrass, and poplar. Of the 11% of land that was agriculturally marginal, they were willing to make available no more than 21% for any bioenergy crop (switchgrass preferred on marginal land) at double the prevailing land rental rate in the region. At the same generous rental rate, of the 28% that is cropland, they would rent up to 23% for bioenergy crops (corn preferred), while of the 55% that is forestland, they would rent up to 15% for bioenergy crops (poplar preferred). Regression results identified deterrents to land rental for bioenergy purposes included appreciation of environmental amenities and concern about rental disamenities. In sum, like landowners in the southern Great Lakes region, landowners in the Northern Tier are reluctant to supply marginal land for bioenergy crops. If rental markets existed, they would rent more crop and forestland for bioenergy crops than they would marginal land, which would generate carbon debt and opportunity costs in wood product and food markets.« less

How willing are landowners to supply land for bioenergy crops in the Northern Great Lakes Region?

DOE Office of Scientific and Technical Information (OSTI.GOV)

Swinton, Scott M.; Tanner, Sophia; Barham, Bradford L.

Land to produce biomass is essential if the United States is to expand bioenergy supply. Use of agriculturally marginal land avoids the food vs. fuel problems of food price rises and carbon debt that are associated with crop and forestland. Recent remote sensing studies have identified large areas of US marginal land deemed suitable for bioenergy crops. Yet the sustainability benefits of growing bioenergy crops on marginal land only pertain if land is economically available. Scant attention has been paid to the willingness of landowners to supply land for bioenergy crops. Focusing on the northern tier of the Great Lakes,more » where grassland transitions to forest and land prices are low, this contingent valuation study reports on the willingness of a representative sample of 1124 private, noncorporate landowners to rent land for three bioenergy crops: corn, switchgrass, and poplar. Of the 11% of land that was agriculturally marginal, they were willing to make available no more than 21% for any bioenergy crop (switchgrass preferred on marginal land) at double the prevailing land rental rate in the region. At the same generous rental rate, of the 28% that is cropland, they would rent up to 23% for bioenergy crops (corn preferred), while of the 55% that is forestland, they would rent up to 15% for bioenergy crops (poplar preferred). Regression results identified deterrents to land rental for bioenergy purposes included appreciation of environmental amenities and concern about rental disamenities. In sum, like landowners in the southern Great Lakes region, landowners in the Northern Tier are reluctant to supply marginal land for bioenergy crops. If rental markets existed, they would rent more crop and forestland for bioenergy crops than they would marginal land, which would generate carbon debt and opportunity costs in wood product and food markets.« less

Microclimate and limits to photosynthesis in a diverse community of hypolithic cyanobacteria in northern Australia

USGS Publications Warehouse

Tracy, Christopher R.; Streten-Joyce, Claire; Dalton, Robert; Nussear, Kenneth E.; Gibb, Karen S.; Christian, Keith A.

2010-01-01

Hypolithic microbes, primarily cyanobacteria, inhabit the highly specialized microhabitats under translucent rocks in extreme environments. Here we report findings from hypolithic cyanobacteria found under three types of translucent rocks (quartz, prehnite, agate) in a semiarid region of tropical Australia. We investigated the photosynthetic responses of the cyanobacterial communities to light, temperature and moisture in the laboratory, and we measured the microclimatic variables of temperature and soil moisture under rocks in the field over an annual cycle. We also used molecular techniques to explore the diversity of hypolithic cyanobacteria in this community and their phylogenetic relationships within the context of hypolithic cyanobacteria from other continents. Based on the laboratory experiments, photosynthetic activity required a minimum soil moisture of 15% (by mass). Peak photosynthetic activity occurred between approximately 8°C and 42°C, though some photosynthesis occurred between −1°C and 51°C. Maximum photosynthesis rates also occurred at light levels of approximately 150–550 μmol m−2 s−1. We used the field microclimatic data in conjunction with these measurements of photosynthetic efficiency to estimate the amount of time the hypolithic cyanobacteria could be photosynthetically active in the field. Based on these data, we estimated that conditions were appropriate for photosynthetic activity for approximately 942 h (∼75 days) during the year. The hypolithic cyanobacteria community under quartz, prehnite and agate rocks was quite diverse both within and between rock types. We identified 115 operational taxonomic units (OTUs), with each rock hosting 8–24 OTUs. A third of the cyanobacteria OTUs from northern Australia grouped with Chroococcidiopsis, a genus that has been identified from hypolithic and endolithic communities from the Gobi, Mojave, Atacama and Antarctic deserts. Several OTUs identified from northern Australia have not been reported to be associated with hypolithic communities previously.

Occupancy of the Invasive Feral Cat Varies with Habitat Complexity

PubMed Central

Hohnen, Rosemary; Tuft, Katherine; McGregor, Hugh W.; Legge, Sarah; Radford, Ian J.; Johnson, Christopher N.

2016-01-01

The domestic cat (Felis catus) is an invasive exotic in many locations around the world and is thought to be a key factor driving recent mammal declines across northern Australia. Many mammal species native to this region now persist only in areas with high topographic complexity, provided by features such as gorges or escarpments. Do mammals persist in these habitats because cats occupy them less, or despite high cat occupancy? We show that occupancy of feral cats was lower in mammal-rich habitats of high topographic complexity. These results support the idea that predation pressure by feral cats is a factor contributing to the collapse of mammal communities across northern Australia. Managing impacts of feral cats is a global conservation challenge. Conservation actions such as choosing sites for small mammal reintroductions may be more successful if variation in cat occupancy with landscape features is taken into account. PMID:27655024

Integrated Taxonomy Reveals Hidden Diversity in Northern Australian Fishes: A New Species of Seamoth (Genus Pegasus)

PubMed Central

Osterhage, Deborah; Pogonoski, John J.; Appleyard, Sharon A.; White, William T.

2016-01-01

Fishes are one of the most intensively studied marine taxonomic groups yet cryptic species are still being discovered. An integrated taxonomic approach is used herein to delineate and describe a new cryptic seamoth (genus Pegasus) from what was previously a wide-ranging species. Preliminary mitochondrial DNA barcoding indicated possible speciation in Pegasus volitans specimens collected in surveys of the Torres Strait and Great Barrier Reef off Queensland in Australia. Morphological and meristic investigations found key differences in a number of characters between P. volitans and the new species, P. tetrabelos. Further mt DNA barcoding of both the COI and the slower mutating 16S genes of additional specimens provided strong support for two separate species. Pegasus tetrabelos and P. volitans are sympatric in northern Australia and were frequently caught together in trawls at the same depths. PMID:26934529

Changing values and the impact on land use and social networks in the northern forest region: a qualitative examination

Treesearch

Jean Dedam; Rodney Zwick

2007-01-01

Patterns of land ownership and economics are changing in the Northern Forest Region of New York, Vermont, New Hampshire, and Maine. The percentage of people living in the region who work in the resource extraction industry has become much smaller. Tourism and outdoor recreation are promoted as economic substitutes that will provide an alternate use of the natural...

Age classes of western white pine planting stock in relation to aspect of planting site in northern Idaho

Treesearch

W. G. Wahlenberg

1926-01-01

In the northern Rocky Mountain region there are vast areas of forest land denuded by fire, which will remain virtually unproductive for generations to come unless planted by hand with nursery-grown trees. After the first sweep of fire through the original stands of western white pine timber (Pinus monticola) on these lands, the forest in most instances started to come...

Paleomagnetic study of the northern Ford Ranges, western Marie Byrd Land, West Antarctica: Motion between West and East Antarctica

NASA Astrophysics Data System (ADS)

Luyendyk, Bruce; Cisowski, Stan; Smith, Christine; Richard, Steve; Kimbrough, David

1996-02-01

A paleomagnetic study of Paleozoic and Mesozoic crystalline rocks in the northern Ford Ranges of Marie Byrd Land, West Antarctica, has determined a middle Cretaceous (circa 100 Ma) paleomagnetic pole and provided constraints on possible clockwise rotation of these ranges and on the rifting of east Gondwana. The 40Ar/39Ar thermochronology data from the Fosdick Mountains record a period of rapid cooling from ˜700°C beginning at ˜100 Ma. We relate this to extension, intrusion, and uplift associated with the beginning of rifting between Campbell Plateau and Marie Byrd Land. All rocks from the Fosdick and Chester Mountains are normally polarized. We interpret thermochronology and paleomagnetic data to infer that the region was extensively remagnetized in middle Cretaceous time. Inclinations in samples from the Chester Mountains are less steep than those from the Fosdick Mountains, which we interpret as ˜25° of south tilting of the Chesters. We interpret cooling age data for the time of magnetization to infer that the tilting began after 105 Ma and ended prior to 103 Ma. We further interpret this as constraining the beginning of extension between the Campbell Plateau and western Marie Byrd Land to the interval 105 to 103 Ma. Virtual geomagnetic poles from samples of Early Carboniferous age granodiorite from the western Phillips Mountains lie on the late Paleozoic apparent polar wander path for Australia transferred to Antarctica. Directions from 29 sites in the central and eastern Phillips and Fosdick Mountains give a Middle Cretaceous paleomagnetic pole at 222.3° E, 70.5° S (A95 6.1°, KAPPA 20.0). This pole is indistinguishable from other Middle Cretaceous poles for studies further east in Marie Byrd Land. Combining middle Cretaceous poles determined for three other studies of the Antarctic Peninsula, Thurston Island, and the Ruppert-Hobbs coasts with ours gives a Pacific West Antarctic pole at 215.2° E, 73.5° S (A95 4.0°, KAPPA 528.9). This pole is discordant by 5° to 10° from synthetic mid-Cretaceous East Antarctic reference poles, but the degree of discordance is very sensitive to the choice of the specific reference pole. The lack of native East Antarctic reference poles leaves this analysis inconclusive. Accepting 10° of discordance, we favor an interpretation where Pacific West Antarctic crustal domains or microplates have rotated clockwise 40° to 90° and translated a few degrees away from East Antarctica during Late Cretaceous time. An electronic supplement of this material may be obtained on a diskette or Anonymous FFP from KOSMOS.AGU.ORG. (LOGIN to AGU's FTP account using ANONYMOUS as the user name and GUEST as the password. Go to the right directory by typing CD APEND. Type LS to see what files are available. Type GET and the name of the file to get it. Finally, type EXIT to leave the system.) (Paper 95TC02524, Paleomagnetic study of the northern Ford Ranges, western Marie Byrd Land, West Antarctica: Motion between West and East Antarctica, Bruce Luyendyk, Stan Cisowski, Christine Smith, Steve Richard, and David Kimbrough). Diskette may be ordered from American Geophysical Union, 2000 Florida Avenue, N.W., Washington, DC 20009; $15.00. Payment must accompany order.

Age-Specific Cluster of Cases of Serotype 1 Streptococcus pneumoniae Carriage in Remote Indigenous Communities in Australia ▿

PubMed Central

Smith-Vaughan, H.; Marsh, R.; Mackenzie, G.; Fisher, J.; Morris, P. S.; Hare, K.; McCallum, G.; Binks, M.; Murphy, D.; Lum, G.; Cook, H.; Krause, V.; Jacups, S.; Leach, A. J.

2009-01-01

Seven-valent pneumococcal conjugate vaccination commenced in 2001 for Australian indigenous infants. Pneumococcal carriage surveillance detected substantial replacement with nonvaccine serotypes and a cluster of serotype 1 carriage. Our aim was to review Streptococcus pneumoniae serotype 1 carriage and invasive pneumococcal disease (IPD) data for this population and to analyze serotype 1 isolates. Carriage data were collected between 1992 and 2004 in the Darwin region, one of the five regions in the Northern Territory. Carriage data were also collected in 2003 and 2005 from four regions in the Northern Territory. Twenty-six cases of serotype 1 IPD were reported from 1994 to 2007 in the Northern Territory. Forty-four isolates were analyzed by BOX typing and 11 by multilocus sequence typing. In the Darwin region, 26 children were reported carrying serotype 1 (ST227) in 2002 but not during later surveillance. Scattered cases of serotype 1 carriage were noted in two other regions. Cocolonization of serotype 1 with other pneumococcal serotypes was common (34% serotype 1-positive swabs). In conclusion, pneumococcal carriage studies detected intermittent serotype 1 carriage and an ST227 cluster in children in indigenous communities in the Northern Territory of Australia. There was no apparent increase in serotype 1 IPD during this time. The rate of serotype 1 cocolonization with other pneumococcal serotypes suggests that carriage of this serotype may be underestimated. PMID:19091995

Fire assisted pastoralism vs. sustainable forestry--the implications of missing markets for carbon in determining optimal land use in the wet-dry tropics of Australia.

PubMed

Ockwell, David; Lovett, Jon C

2005-04-01

Using Cape York Peninsula, Queensland, Australia as a case study, this paper combines field sampling of woody vegetation with cost-benefit analysis to compare the social optimality of fire-assisted pastoralism with sustainable forestry. Carbon sequestration is estimated to be significantly higher in the absence of fire. Integration of carbon sequestration benefits for mitigating future costs of climate change into cost-benefit analysis demonstrates that sustainable forestry is a more socially optimal land use than fire-assisted pastoralism. Missing markets for carbon, however, imply that fire-assisted pastoralism will continue to be pursued in the absence of policy intervention. Creation of markets for carbon represents a policy solution that has the potential to drive land use away from fire-assisted pastoralism towards sustainable forestry and environmental conservation.

Prevalence of koala retrovirus in geographically diverse populations in Australia.

PubMed

Simmons, G S; Young, P R; Hanger, J J; Jones, K; Clarke, D; McKee, J J; Meers, J

2012-10-01

To determine the prevalence of koala retrovirus (KoRV) in selected koala populations and to estimate proviral copy number in a subset of koalas. Blood or tissue samples from 708 koalas in Queensland, New South Wales, Victoria and South Australia were tested for KoRV pol provirus gene using standard polymerase chain reaction (PCR), nested PCR and real-time PCR (qPCR). Prevalence of KoRV provirus-positive koalas was 100% in four regions of Queensland and New South Wales, 72.2% in mainland Victoria, 26.6% on four Victorian islands and 14.8% on Kangaroo Island, South Australia. Estimated proviral copy number per cell in four groups of koalas from Queensland and Victoria showed marked variation, ranging from a mean of 165 copies per cell in the Queensland group to 1.29 × 10(-4) copies per cell in one group of Victorian koalas. The higher prevalence of KoRV-positive koalas in the north of Australia and high proviral loads in Queensland koalas may indicate KoRV entered and became endogenous in the north and is spreading southwards. It is also possible there are genetic differences between koalas in northern and southern Australia that affect susceptibility to KoRV infection or endogenisation, or that environmental factors affecting transmission in northern states are absent or uncommon in southern regions. Although further studies are required, the finding of proviral copy numbers orders of magnitude lower than what would be expected for the presence of a single copy in every cell for many Victorian animals suggests that KoRV is not endogenous in these animals and likely reflects ongoing exogenous infection. © 2012 The Authors. Australian Veterinary Journal © 2012 Australian Veterinary Association.

Accretion of the southern Banda arc to the Australian plate margin determined by Global Positioning System measurements

NASA Astrophysics Data System (ADS)

Genrich, Joachim F.; Bock, Yehuda; McCaffrey, Robert; Calais, Eric; Stevens, Colleen W.; Subarya, Cecep

1996-04-01

Global Positioning System geodetic measurements at thirteen locations in Indonesia and four in Australia reveal that the Australian continent has accreted the Banda island arc to its margin. Small relative velocities of five sites on west Java, south Kalimantan, Bali, and south Sulawesi define a rigid Sunda shelf that moves relative to northern Australia in a manner consistent with pole locations from NUVEL-1 Australia-Eurasia but at a rate that is about 7% slower. Block-like northward motion of the southern Banda arc toward the Sunda shelf at nearly the same rate as Australia suggests that the Timor trough is now inactive as a thrust. Little of the convergence of Australia with Eurasia is accommodated by strain within the Banda arc structure. Most of the convergence appears to occur as northward translation of the rigid arc with shortening on the Flores and Wetar thrusts and possibly on faults within the back arc basin.

[Application of Landsat ETM+ in monitoring of desertification in agro-pastoral ecotone of northern China].

PubMed

Mi, Jia; Wang, Kun; Wang, Hong-mei

2011-03-01

Agro-pastoral ecotone of northern China is a transitional and interlaced zone of agricultural cultivation region and grazing region The ecotone is a complex containing several ecosystems. Soil desertification has become a serious problem that endangered sustainable development in the ecotone. The area of desertification land has been increasing year after year in agro-pastoral ecotone of northern China. This problem concerns the ecological environment, economic development and living quality of people in northern and central eastern of China. For these reasons, ecotone has recently become a focus of research of restoration ecology and global climate change. Remote sensing monitoring of desertification land is a key technique to collect the status and development of sandy land, providing scientific bases for the national desertification control. Landsat ETM+ is an advanced multispectral remote sensing system for the research of regional scale and has been widely used in many fields, such as geologic surveys, mapping, vegetation monitoring, etc. In the present, the authors introduce that spectral characteristics, desertification information extraction, desertification classification and development analyses in detail, and summarizes the study progresses discusses the problems and trends.

Parallel evolution of angiosperm colour signals: common evolutionary pressures linked to hymenopteran vision

PubMed Central

Dyer, Adrian G.; Boyd-Gerny, Skye; McLoughlin, Stephen; Rosa, Marcello G. P.; Simonov, Vera; Wong, Bob B. M.

2012-01-01

Flowering plants in Australia have been geographically isolated for more than 34 million years. In the Northern Hemisphere, previous work has revealed a close fit between the optimal discrimination capabilities of hymenopteran pollinators and the flower colours that have most frequently evolved. We collected spectral data from 111 Australian native flowers and tested signal appearance considering the colour discrimination capabilities of potentially important pollinators. The highest frequency of flower reflectance curves is consistent with data reported for the Northern Hemisphere. The subsequent mapping of Australian flower reflectances into a bee colour space reveals a very similar distribution of flower colour evolution to the Northern Hemisphere. Thus, flowering plants in Australia are likely to have independently evolved spectral signals that maximize colour discrimination by hymenoptera. Moreover, we found that the degree of variability in flower coloration for particular angiosperm species matched the range of reflectance colours that can only be discriminated by bees that have experienced differential conditioning. This observation suggests a requirement for plasticity in the nervous systems of pollinators to allow generalization of flowers of the same species while overcoming the possible presence of non-rewarding flower mimics. PMID:22673351

The comparative cost of food and beverages at remote Indigenous communities, Northern Territory, Australia.

PubMed

Ferguson, Megan; O'Dea, Kerin; Chatfield, Mark; Moodie, Marjory; Altman, Jon; Brimblecombe, Julie

2016-04-01

To determine the average price difference between foods and beverages in remote Indigenous community stores and capital city supermarkets and explore differences across products. A cross-sectional survey compared prices derived from point-of-sale data in 20 remote Northern Territory stores with supermarkets in capital cities of the Northern Territory and South Australia for groceries commonly purchased in remote stores. Average price differences for products, supply categories and food groups were examined. The 443 products examined represented 63% of food and beverage expenditure in remote stores. Remote products were, on average, 60% and 68% more expensive than advertised prices for Darwin and Adelaide supermarkets, respectively. The average price difference for fresh products was half that of packaged groceries for Darwin supermarkets and more than 50% for food groups that contributed most to purchasing. Strategies employed by manufacturers and supermarkets, such as promotional pricing, and supermarkets' generic products lead to lower prices. These opportunities are not equally available to remote customers and are a major driver of price disparity. Food affordability for already disadvantaged residents of remote communities could be improved by policies targeted at manufacturers, wholesalers and/or major supermarket chains. © 2015 The Authors.

New genotypes of Liao ning virus (LNV) in Australia exhibit an insect-specific phenotype.

PubMed

Prow, Natalie A; Mah, Marcus G; Deerain, Joshua M; Warrilow, David; Colmant, Agathe M G; O'Brien, Caitlin A; Harrison, Jessica J; McLean, Breeanna J; Hewlett, Elise K; Piyasena, Thisun B H; Hall-Mendelin, Sonja; van den Hurk, Andrew F; Watterson, Daniel; Huang, Bixing; Schulz, Benjamin L; Webb, Cameron E; Johansen, Cheryl A; Chow, Weng K; Hobson-Peters, Jody; Cazier, Chris; Coffey, Lark L; Faddy, Helen M; Suhrbier, Andreas; Bielefeldt-Ohmann, Helle; Hall, Roy A

2018-04-01

Liao ning virus (LNV) was first isolated in 1996 from mosquitoes in China, and has been shown to replicate in selected mammalian cell lines and to cause lethal haemorrhagic disease in experimentally infected mice. The first detection of LNV in Australia was by deep sequencing of mosquito homogenates. We subsequently isolated LNV from mosquitoes of four genera (Culex, Anopheles, Mansonia and Aedes) in New South Wales, Northern Territory, Queensland and Western Australia; the earliest of these Australian isolates were obtained from mosquitoes collected in 1988, predating the first Chinese isolates. Genetic analysis revealed that the Australian LNV isolates formed two new genotypes: one including isolates from eastern and northern Australia, and the second comprising isolates from the south-western corner of the continent. In contrast to findings reported for the Chinese LNV isolates, the Australian LNV isolates did not replicate in vertebrate cells in vitro or in vivo, or produce signs of disease in wild-type or immunodeficient mice. A panel of human and animal sera collected from regions where the virus was found in high prevalence also showed no evidence of LNV-specific antibodies. Furthermore, high rates of virus detection in progeny reared from infected adult female mosquitoes, coupled with visualization of the virus within the ovarian follicles by immunohistochemistry, suggest that LNV is transmitted transovarially. Thus, despite relatively minor genomic differences between Chinese and Australian LNV strains, the latter display a characteristic insect-specific phenotype.

Biogeography of Burkholderia pseudomallei in the Torres Strait Islands of Northern Australia

PubMed Central

Baker, Anthony; Mayo, Mark; Owens, Leigh; Burgess, Graham; Norton, Robert; McBride, William John Hannan; Currie, Bart J.

2013-01-01

It has been hypothesized that biogeographical boundaries are a feature of Burkholderia pseudomallei ecology, and they impact the epidemiology of melioidosis on a global scale. This study examined the relatedness of B. pseudomallei sourced from islands in the Torres Strait of Northern Australia to determine if the geography of isolated island communities is a determinant of the organisms' dispersal. Environmental sampling on Badu Island in the Near Western Island cluster recovered a single clone. An additional 32 clinical isolates from the region were sourced. Isolates were characterized using multilocus sequence typing and a multiplex PCR targeting the flagellum gene cluster. Gene cluster analysis determined that 69% of the isolates from the region encoded the ancestral Burkholderia thailandensis-like flagellum and chemotaxis gene cluster, a proportion significantly lower than that reported from mainland Australia and consistent with observations of isolates from southern Papua New Guinea. A goodness-of-fit test indicated that there was geographic localization of sequence types throughout the archipelago, with the exception of Thursday Island, the economic and cultural hub of the region. Sequence types common to mainland Australia and Papua New Guinea were identified. These findings demonstrate for the first time an environmental reservoir for B. pseudomallei in the Torres Strait, and multilocus sequence typing suggests that the organism is not randomly distributed throughout this region and that seawater may provide a barrier to dispersal of the organism. Moreover, these findings support an anthropogenic dispersal hypothesis for the spread of B. pseudomallei throughout this region. PMID:23698533

Vulnerability of native savanna trees and exotic Khaya senegalensis to seasonal drought.

PubMed

Arndt, Stefan K; Sanders, Gregor J; Bristow, Mila; Hutley, Lindsay B; Beringer, Jason; Livesley, Stephen J

2015-07-01

Seasonally dry ecosystems present a challenge to plants to maintain water relations. While native vegetation in seasonally dry ecosystems have evolved specific adaptations to the long dry season, there are risks to introduced exotic species. African mahogany, Khaya senegalensis Desr. (A. Juss.), is an exotic plantation species that has been introduced widely in Asia and northern Australia, but it is unknown if it has the physiological or phenotypic plasticity to cope with the strongly seasonal patterns of water availability in the tropical savanna climate of northern Australia. We investigated the gas exchange and water relations traits and adjustments to seasonal drought in K. senegalensis and native eucalypts (Eucalyptus tetrodonta F. Muell. and Corymbia latifolia F. Muell.) in a savanna ecosystem in northern Australia. The native eucalypts did not exhibit any signs of drought stress after 3 months of no rainfall and probably had access to deeper soil moisture late into the dry season. Leaf water potential, stomatal conductance, transpiration and photosynthesis all remained high in the dry season but osmotic adjustment was not observed. Overstorey leaf area index (LAI) was 0.6 in the native eucalypt savanna and did not change between wet and dry seasons. In contrast, the K. senegalensis plantation in the wet season was characterized by a high water potential, high stomatal conductance and transpiration and a high LAI of 2.4. In the dry season, K. senegalensis experienced mild drought stress with a predawn water potential -0.6 MPa. Overstorey LAI was halved, and stomatal conductance and transpiration drastically reduced, while minimum leaf water potentials did not change (-2 MPa) and no osmotic adjustment occurred. Khaya senegalensis exhibited an isohydric behaviour and also had a lower hydraulic vulnerability to cavitation in leaves, with a P50 of -2.3 MPa. The native eucalypts had twice the maximum leaf hydraulic conductance but a much higher P50 of -1.5 MPa. Khaya senegalensis has evolved in a wet-dry tropical climate in West Africa (600-800 mm) and appears to be well suited to the seasonal savanna climate of northern Australia. The species exhibited a large phenotypic plasticity through leaf area adjustments and conservative isohydric behaviour in the 6 months dry season while operating well above its critical hydraulic threshold. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

Queensland 2010-2011: A Summer of Extremes

NASA Astrophysics Data System (ADS)

Maroulis, J.

2012-04-01

"I love a sunburnt country, A land of sweeping plains, Of ragged mountain ranges, Of droughts and flooding rains. I love her far horizons, I love her jewel-sea, Her beauty and her terror, The wide brown land for me." (Dorothea Mackellar OBE, 1885-1968). This second stanza from Mackellar's famous poem "My Country", beautifully sums up the Australian environment. In late 2010-early 2011, the "droughts and flooding rains" were the perfect terms to describe the climatic variability and the resulting flooding impacts experienced in many parts of Queensland under an enhanced La Niña as part of the ENSO (El Niño-Southern Oscillation) climate pattern, with over 75% of Queensland being declared a disaster zone. This contrasts with the severe drought that had gripped many parts of Australia over the previous 8 years which saw water storage levels plummet, and resulted in 35% of Queensland being 'drought declared' as at April 2010. On the Darling Downs in southern Queensland, over 100,000 ha of land was inundated by the Condamine River due to flooding in early 2011. The river which is generally <100 m wide was seven kilometres wide at the widest point during the floods. However, the erosive impacts of the floods on largely tilled floodplains was relatively low with most erosion confined to the bed and banks of the river. In Grantham, where 13 lives were lost, flooding was especially hazardous because of the combined depth and velocity of floodwaters and the rapid rise of floodwaters across the floodplain. Floodwaters were ~2.0-2.5 m deep across the northern parts of the floodplain with a maximum velocity of ~2-3 m/s. The rate of rise was estimated at ~12 m/hour, indicating that it would have taken only 10-15 minutes to rise to full depth. However, despite detailed river and flood gauging in the more urbanised catchments such as the Brisbane River valley, this is by far the exception rather than the rule throughout mainland Australia. The Queensland floods highlight the pressing and urgent need for an accurate and more intensive network of river gauging and sediment monitoring. In a country of "droughts and flooding rains" and in the face of climate change, this need is now imperative.

Past and prospective carbon stocks in forests of northern Wisconsin: a report from the Chequamegon-Nicolet National Forest Climate Change Response Framework

Treesearch

Richard Birdsey; Yude Pan; Maria Janowiak; Susan Stewart; Sarah Hines; Linda Parker; Stith Gower; Jeremy Lichstein; Kevin McCullough; Fangmin Zhang; Jing Chen; David Mladenoff; Craig Wayson; Chris Swanston

2014-01-01

This report assesses past and prospective carbon stocks for 4.5 million ha of forest land in northern Wisconsin, including a baseline assessment and analysis of the impacts of disturbance and management on carbon stocks. Carbon density (amount of carbon stock per unit area) averages 237 megagrams (Mg) per ha, with the National Forest lands having slightly higher carbon...

Habitat use and movement patterns of Northern Pintails during spring in northern Japan: the importance of agricultural lands

USGS Publications Warehouse

Yamaguchi, Noriyuki M.; Hupp, Jerry W.; Flint, Paul L.; Pearce, John M.; Shigeta, Yusuke; Shimada, Tetsuo; Hiraoka, Emiko N.; Higuchi, Hiroyoshi

2012-01-01

From 2006 to 2009, we marked 198 Northern Pintails (Anas acuta) with satellite transmitters on their wintering areas in Japan to study their migration routes and habitat use in spring staging areas. We hypothesized that the distribution of pintails during spring staging was influenced by patterns of land use and expected that the most frequently used areas would have more agricultural habitat than lesser-used areas. We obtained 3031 daily locations from 163 migrant pintails marked with satellite transmitters and identified 524 stopover sites. Based on a fixed kernel home range analysis of stopover utilization distribution (UD), core staging areas (areas within the 50% UD) were identified in northern Honshu and western Hokkaido, and were used by 71% of marked pintails. Core staging areas had a greater proportion of rice fields than peripheral (51–95% UD) and rarely used (outside the 95% UD) staging areas. Stopover sites also contained more rice fields and other agricultural land than were available at regional scales, indicating that pintails selected rice and other agricultural habitats at regional and local scales. Pintails remained at spring staging areas an average of 51 d. Prolonged staging in agricultural habitats of northern Japan was likely necessary for pintails to prepare for transoceanic migration to Arctic nesting areas in eastern Russia.

Plectorhinchus caeruleonothus, a new species of sweetlips (Perciformes:
Haemulidae) from northern Australia and the resurrection of P. unicolor (Macleay, 1883), species previously confused with P. schotaf (Forsskål, 1775).

PubMed

Johnson, Jeffrey W; Wilmer, Jessica Worthington

2015-07-14

Two distinct haemulid fishes from Australia and the Indo-Australian Archipelago respectively have long been confused with Plectorhinchus schotaf (Forsskål, 1775). Plectorhinchus caeruleonothus sp. nov. is described from 17 specimens collected off western and far northern Australia, between the Monte Bello Islands, Western Australia and Torres Strait, Queensland. It has also been confirmed outside this range by photographs taken at Ningaloo Reef and Exmouth Gulf, Western Australia, and at Claremont Isles and Lizard Island, Queensland. The new species is unique among the genus in having a combination of dorsal-fin rays XII, 18-20, lateral-line scales 56-61, gill rakers 7-9 on the upper limb and 18-20 on the lower limb of the first arch, nostrils minute, and fresh colouration in adults including body uniformly grey, cheek, opercles and posterior margin of the opercular membrane uniformly blue-grey, and rim of orbit and upper edge of maxilla dusky yellow. In contrast to its closest congeners, the juveniles have a distinctive pattern of narrow creamish-white to pale grey stripes on a dark grey to chocolate brown background on the head and body, and oblique dark stripes progressing with growth to spots on the caudal fin. Plectorhinchus unicolor (Macleay, 1883) from Japan to northern Australia is resurrected from the synonomy of P. schotaf and redescribed on the basis of the holotype and 24 non-type specimens. Plectorhinchus unicolor is most similar to P. schotaf, but can be distinguished by fresh colouration, modal dorsal and pectoral-fin ray counts and DNA barcoding. Plectorhinchus schotaf appears to be restricted to the region from southeast Africa to the Arabian Sea, including the Red Sea and Persian Gulf. Plectorhinchus griseus (Cuvier in Cuvier & Valenciennes, 1830) from Indian and Sri Lankan Seas has previously been treated as a junior synonym of P. schotaf, but in accordance with Smith (1962), is here confirmed as a valid species, readily distinguished from the latter by a concavity in the lateral profile of the snout in adults, deep body and high soft dorsal-fin ray count. Comparison of the CO1 genetic marker utilised in DNA barcoding also resulted in significant genetic divergences between the new species, P. unicolor and their closest sampled congeners. Some behavioural observations are also presented for the species treated, including aggressive interactions between individuals of the new species, the likes of which have not previously been recorded among species of Plectorhinchus.

Impact of Land Surface Initialization Approach on Subseasonal Forecast Skill: a Regional Analysis in the Southern Hemisphere

NASA Technical Reports Server (NTRS)

Hirsch, Annette L.; Kala, Jatin; Pitman, Andy J.; Carouge, Claire; Evans, Jason P.; Haverd, Vanessa; Mocko, David

2014-01-01

The authors use a sophisticated coupled land-atmosphere modeling system for a Southern Hemisphere subdomain centered over southeastern Australia to evaluate differences in simulation skill from two different land surface initialization approaches. The first approach uses equilibrated land surface states obtained from offline simulations of the land surface model, and the second uses land surface states obtained from reanalyses. The authors find that land surface initialization using prior offline simulations contribute to relative gains in subseasonal forecast skill. In particular, relative gains in forecast skill for temperature of 10%-20% within the first 30 days of the forecast can be attributed to the land surface initialization method using offline states. For precipitation there is no distinct preference for the land surface initialization method, with limited gains in forecast skill irrespective of the lead time. The authors evaluated the asymmetry between maximum and minimum temperatures and found that maximum temperatures had the largest gains in relative forecast skill, exceeding 20% in some regions. These results were statistically significant at the 98% confidence level at up to 60 days into the forecast period. For minimum temperature, using reanalyses to initialize the land surface contributed to relative gains in forecast skill, reaching 40% in parts of the domain that were statistically significant at the 98% confidence level. The contrasting impact of the land surface initialization method between maximum and minimum temperature was associated with different soil moisture coupling mechanisms. Therefore, land surface initialization from prior offline simulations does improve predictability for temperature, particularly maximum temperature, but with less obvious improvements for precipitation and minimum temperature over southeastern Australia.

A land cover change study in the Highlands of Northern Ethiopia using a flight of aerial photographs dating back to the 1930s

NASA Astrophysics Data System (ADS)

Guyassa, Etefa; Frankl, Amaury; Zenebe, Amanuel; Lanckriet, Sil; Demissie, Biadgilgn; Zenebe, Gebreyohanis; Poesen, Jean; Nyssen, Jan

2016-04-01

In the Highlands of Northern Ethiopia, land degradation is claimed to have occurred over a long time mainly due agricultural practices and lack of land management. However, quantitative information on the long term land use, cover and management change is rare. The knowledge of such historical changes is essential for the present and future land management for sustainable development, especially in an agriculture-based economy. Hence, this study aimed to investigate the changes of land use, cover and management around Hagere Selam, Northern Ethiopia, over the last 80 years (1935 - 2014). We recovered a flight of ten aerial photographs at an approximate scale of 1:11,500, realized by the Italian Military Geographical Institute in 1935, along a mountain ridge between 13.6490°N, 39.1848°E and 13.6785°N, 39.2658°E. Jointly with Google Earth images (2014), the historical aerial photographs were used to compare changes over the long time. The point-count technique was used by overlaying a grid of 18 x 15 points (small squares) on 20 cm x 15 cm aerial photographs and on Google Earth images representing the same area. Occurrence of major land cover types (cropland, forest, grassland, shrubland, bare land, built-up areas and water body) was counted to compute their proportion in 1935 and 2014. In 1935, cropland, shrubland and built-up areas were predominant while other land cover types were not observed. On the Google Earth images, all categories were observed except forest. The results show that in both times cropland was the dominant land cover followed by shrubland. The proportion of cropland at present (70.5%) is approximately the same as in the 1930s (72%), but shrubland decreased and bare land, grassland and built-up areas have increased. Hence, the large share of cropland was maintained over the past long period without allowing for woody vegetation to expand its area, while some cropland was abandoned and converted to grassland and bare land. The increased proportion of built-up areas also explains the shrinking of shrubland. On the studied flight of aerial photographs, forests were not existing in 1935 and have not been restored until present. The increased area of open water, on the other hand, is related to the ongoing land rehabilitation activities carried out in the region. These results confirm previous studies that severe land degradation has occurred in the Highlands of Northern Ethiopia over a long time, due to early (pre-1935) cropland expansion and deforestation.

The curious case of the date of introduction of leaded fuel to Australia: Implications for the history of Southern Hemisphere atmospheric lead pollution

NASA Astrophysics Data System (ADS)

Cook, D. E.; Gale, S. J.

By comparison with the Northern Hemisphere, the history of atmospheric lead pollution in the Southern Hemisphere is still poorly understood. Until recently, the main source of atmospheric lead fallout in the Southern Hemisphere was tetraethyl lead from motor fuel and for most of the 20th century the most important single source of this pollutant was Australia. Yet there is little agreement over when leaded fuel made its first appearance in Australia. Reported dates range from the early 1920s to the late 1940s. A study of oil company advertisements and reports in motoring and oil company journals shows that leaded petrol first became available in Australia in August 1932. This date is important both for the reconstruction of lead pollution histories and in the use of lead stratigraphies to determine chronology.

Quality failures in residential aged care in Australia: The relationship between structural factors and regulation imposed sanctions.

PubMed

Baldwin, Richard; Chenoweth, Lynnette; Dela Rama, Marie; Liu, Zhixin

2015-12-01

To examine the relationship between structural factors and the imposition of sanctions on residential aged care services across Australia for regulatory compliance failure. Poisson Regression analysis was used to examine the association between the number of sanctions imposed and the structural characteristics of residential aged care services in Australia. Residential aged care services that have a greater likelihood of having government sanctions imposed on them are operated by for-profit providers and located in remote locations and in Victoria, Queensland, South Australia, Northern Territory and the Australian Capital Territory. The findings confirm the international literature on the relationship between residential aged care service location, ownership type and the likelihood of sanctions. In the light of the predicted expansion of residential aged care services, policy makers should give consideration to structural elements most likely to be associated with a failure to meet and maintain service standards. © 2014 ACOTA.

Effects of alluvial knickpoint migration on floodplain ecology and geomorphology

NASA Astrophysics Data System (ADS)

Larsen, Annegret; May, Jan-Hendrick

2016-04-01

Alluvial knickpoints are well described as erosional mechanism within discontinuous ephemeral streams in the semi-arid SW USA. However, alluvial knickpoints occur globally in a wide range of settings and of climate zones, including temperate SE Australia, subtropical Africa, and tropical Australia. Much attention has been given in the scientific literature to the trigger mechanisms of alluvial knickpoints, which can be summarized as: i) threshold phenomena, ii) climate variability and iii) land-use change, or to a combination of these factors. Recently, studies have focused on the timescale of alluvial knickpoint retreat, and the processes, mechanisms and feedbacks with ecology, geomorphology and hydrology. In this study, we compile data from a global literature review with a case study on a tropical river system in Australia affected by re-occurring, fast migrating (140 myr-1) alluvial knickpoint. We highlight the importance of potential water table declines due to channel incision following knickpoint migration, which in turn leads to the destabilization of river banks, and a shift in floodplain vegetation and fire incursion. We hypothesize that the observed feedbacks might also help to understand the broader impacts of alluvial knickpoint migration in other regions, and might explain the drastic effects of knickpoint migration on land cover and land-use in semi-arid areas.

Ohio forests: 2006

Treesearch

Richard H. Widmann; Dan Balser; Charles Barnett; Brett J. Butler; Douglas M. Griffith; Tonya W. Lister; W. Keith Moser; Charles H. Perry; Rachel Riemann; Christopher W. Woodall

2009-01-01

This report summarizes annual forest inventories conducted in Ohio from 2001 to 2006 by the Northern Research Station's Forest Inventory and Analysis unit. Ohio's forest land covers 7.9 million acres or 30 percent of the State's land area, changing little in forest land area since 1991. Of this land, 5.8 million acres (73 percent) are held by family...

Global atmospheric carbon budget: results from an ensemble of atmospheric CO2 inversions

NASA Astrophysics Data System (ADS)

Peylin, P.; Law, R. M.; Gurney, K. R.; Chevallier, F.; Jacobson, A. R.; Maki, T.; Niwa, Y.; Patra, P. K.; Peters, W.; Rayner, P. J.; Rödenbeck, C.; van der Laan-Luijkx, I. T.; Zhang, X.

2013-10-01

Atmospheric CO2 inversions estimate surface carbon fluxes from an optimal fit to atmospheric CO2 measurements, usually including prior constraints on the flux estimates. Eleven sets of carbon flux estimates are compared, generated by different inversions systems that vary in their inversions methods, choice of atmospheric data, transport model and prior information. The inversions were run for at least 5 yr in the period between 1990 and 2010. Mean fluxes for 2001-2004, seasonal cycles, interannual variability and trends are compared for the tropics and northern and southern extra-tropics, and separately for land and ocean. Some continental/basin-scale subdivisions are also considered where the atmospheric network is denser. Four-year mean fluxes are reasonably consistent across inversions at global/latitudinal scale, with a large total (land plus ocean) carbon uptake in the north (-3.4 Pg C yr-1 (±0.5 Pg C yr-1 standard deviation), with slightly more uptake over land than over ocean), a significant although more variable source over the tropics (1.6 ± 0.9 Pg C yr-1) and a compensatory sink of similar magnitude in the south (-1.4 ± 0.5 Pg C yr-1) corresponding mainly to an ocean sink. Largest differences across inversions occur in the balance between tropical land sources and southern land sinks. Interannual variability (IAV) in carbon fluxes is larger for land than ocean regions (standard deviation around 1.06 versus 0.33 Pg C yr-1 for the 1996-2007 period), with much higher consistency among the inversions for the land. While the tropical land explains most of the IAV (standard deviation ~ 0.65 Pg C yr-1), the northern and southern land also contribute (standard deviation ~ 0.39 Pg C yr-1). Most inversions tend to indicate an increase of the northern land carbon uptake from late 1990s to 2008 (around 0.1 Pg C yr-1, predominantly in North Asia. The mean seasonal cycle appears to be well constrained by the atmospheric data over the northern land (at the continental scale), but still highly dependent on the prior flux seasonality over the ocean. Finally we provide recommendations to interpret the regional fluxes, along with the uncertainty estimates.

Ecoregional differences in late-20th-century land-use and land-cover change in the U.S. northern great plains

USGS Publications Warehouse

Auch, Roger F.; Sayler, K. L.; Napton, D.E.; Taylor, Janis L.; Brooks, M.S.

2011-01-01

Land-cover and land-use change usually results from a combination of anthropogenic drivers and biophysical conditions found across multiple scales, ranging from parcel to regional levels. A group of four Level 111 ecoregions located in the U.S. northern Great Plains is used to demonstrate the similarities and differences in land change during nearly a 30-year period (1973-2000) using results from the U.S. Geological Survey's Land Cover Trends project. There were changes to major suites of land-cover; the transitions between agriculture and grassland/shrubland and the transitions among wetland, water, agriculture, and grassland/ shrubland were affected by different factors. Anthropogenic drivers affected the land-use tension (or land-use competition) between agriculture and grassland/shrubland land-covers, whereas changes between wetland and water land-covers, and their relationship to agriculture and grassland/shrubland land-covers, were mostly affected by regional weather cycles. More land-use tension between agriculture and grassland/shrubland landcovers occurred in ecoregions with greater amounts of economically marginal cropland. Land-cover change associated with weather variability occurred in ecoregions that had large concentrations of wetlands and water impoundments, such as the Missouri River reservoirs. The Northwestern Glaciated Plains ecoregion had the highest overall estimated percentage of change because it had both land-use tension between agriculture and grassland/shrubland land-covers and wetland-water changes. 

Fences and grazing management in northern Namibia

NASA Astrophysics Data System (ADS)

Prudat, Brice; Bloemertz, Lena; Kuhn, Nikolaus J.

2016-04-01

Since Namibian independence, many fences have been erected in the communal land of the Ohangwena region in northern Namibia. Most fencing issues discussed so far in the region concern large-scale fencing of communal land by the new Namibian elite. Rarely discussed are the fences erected around small-scale farmers' parcels. This paper will discuss the impact of such increased small-scale fencing activities in northern Namibia. Fencing of land has different functions, including protection of fields against livestock and securing property rights. However, not all community members can afford the monetary and labor costs involved. In the annual agricultural cycle of the study area, livestock is left un-herded after the harvest of most crops. They can then feed on available crop remains and grass on the fields. The livestock then freely utilizes unfenced and unprotected land. This system has the advantage to accelerate crop degradation and fertilize the soils. However, by erecting efficient fences, the new middle-class community members concentrate fertility in their own field, thereby degrading agricultural soils of poorer farmers. Potentially, such small-scale fencing of land has therefore an impact on sol quality and thus fosters degradation of unfenced cropland. By using fences as features to determine the limits of the new land rights, the ongoing Communal Land Reform may not only promote the erection of fences, but may also have a negative impact on soil quality and potentially food security of small-scale farmers without cattle.

High-temperature flooding injury

USDA-ARS?s Scientific Manuscript database

This problem, also called scald, is most serious in the hot desert valleys of the southwestern United States, subtropical regions in eastern Australia, and western Asia and northern Africa (Middle East) where fields are established and irrigated under high temperatures. The disorder also occurs to...

Fuel Management-An Integral Part of Fire Management: Trans-Tasman Perspective

Treesearch

Jim Gould

2006-01-01

Although Australia and New Zealand have quite different fire climates and fuels, the common understanding of fire behaviour underlies many facets of fire management in both countries. Fire management is the legal responsibility of various government land management agencies that manage public lands and individuals, local governments or corporations that manage private...

Identifying Centres of Plant Biodiversity in South Australia

PubMed Central

Guerin, Greg R.; Biffin, Ed; Baruch, Zdravko; Lowe, Andrew J.

2016-01-01

We aimed to identify regional centres of plant biodiversity in South Australia, a sub-continental land area of 983,482 km2, by mapping a suite of metrics. Broad-brush conservation issues associated with the centres were mapped, specifically climate sensitivity, exposure to habitat fragmentation, introduced species and altered fire regimes. We compiled 727,417 plant species records from plot-based field surveys and herbarium records and mapped the following: species richness (all species; South Australian endemics; conservation-dependent species; introduced species); georeferenced weighted endemism, phylogenetic diversity, georeferenced phylogenetic endemism; and measures of beta diversity at local and state-wide scales. Associated conservation issues mapped were: climate sensitivity measured via ordination and non-linear modelling; habitat fragmentation represented by the proportion of remnant vegetation within a moving window; fire prone landscapes assessed using fire history records; invasive species assessed through diversity metrics, species distribution and literature. Compared to plots, herbarium data had higher spatial and taxonomic coverage but records were more biased towards major transport corridors. Beta diversity was influenced by sampling intensity and scale of comparison. We identified six centres of high plant biodiversity for South Australia: Western Kangaroo Island; Southern Mount Lofty Ranges; Anangu Pitjantjatjara Yankunytjatjara lands; Southern Flinders Ranges; Southern Eyre Peninsula; Lower South East. Species composition in the arid-mediterranean ecotone was the most climate sensitive. Fragmentation mapping highlighted the dichotomy between extensive land-use and high remnancy in the north and intensive land-use and low remnancy in the south. Invasive species were most species rich in agricultural areas close to population centres. Fire mapping revealed large variation in frequency across the state. Biodiversity scores were not always congruent between metrics or datasets, notably for categorical endemism to South Australia versus georeferenced weighted endemism, justifying diverse approaches and cautious interpretation. The study could be extended to high resolution assessments of biodiversity centres and cost:benefit analysis for interventions. PMID:26735131

Conserving forest biodiversity across multiple land ownerships: lessons from the Northwest Forest Plan and the Southeast Queensland Regional Forests Agreement (Australia).

Treesearch

C.A. McAlpine; T.A. Spies; P. Norman; A. Peterson

2007-01-01

As the area of the world's forests shrinks, the management of production forests is becoming increasingly paramount for biodiversity conservation. In the United States and Australia, public debate and controversy about the management of production forests during the later decades of the 20th century resulted in governments adopting sweeping top-down changes to...

Socio-demographic, ecological factors and dengue infection trends in Australia.

PubMed

Akter, Rokeya; Naish, Suchithra; Hu, Wenbiao; Tong, Shilu

2017-01-01

Dengue has been a major public health concern in Australia. This study has explored the spatio-temporal trends of dengue and potential socio- demographic and ecological determinants in Australia. Data on dengue cases, socio-demographic, climatic and land use types for the period January 1999 to December 2010 were collected from Australian National Notifiable Diseases Surveillance System, Australian Bureau of Statistics, Australian Bureau of Meteorology, and Australian Bureau of Agricultural and Resource Economics and Sciences, respectively. Descriptive and linear regression analyses were performed to observe the spatio-temporal trends of dengue, socio-demographic and ecological factors in Australia. A total of 5,853 dengue cases (both local and overseas acquired) were recorded across Australia between January 1999 and December 2010. Most the cases (53.0%) were reported from Queensland, followed by New South Wales (16.5%). Dengue outbreak was highest (54.2%) during 2008-2010. A highest percentage of overseas arrivals (29.9%), households having rainwater tanks (33.9%), Indigenous population (27.2%), separate houses (26.5%), terrace house types (26.9%) and economically advantage people (42.8%) were also observed during 2008-2010. Regression analyses demonstrate that there was an increasing trend of dengue incidence, potential socio-ecological factors such as overseas arrivals, number of households having rainwater tanks, housing types and land use types (e.g. intensive uses and production from dryland agriculture). Spatial variation of socio-demographic factors was also observed in this study. In near future, significant increase of temperature was also projected across Australia. The projected increased temperature as well as increased socio-ecological trend may pose a future threat to the local transmission of dengue in other parts of Australia if Aedes mosquitoes are being established. Therefore, upgraded mosquito and disease surveillance at different ports should be in place to reduce the chance of mosquitoes and dengue cases being imported into all over Australia.

Pollen evidence for a mid-Holocene East Asian summer monsoon maximum in northern China

NASA Astrophysics Data System (ADS)

Wen, Ruilin; Xiao, Jule; Fan, Jiawei; Zhang, Shengrui; Yamagata, Hideki

2017-11-01

There is a controversy regarding whether the high precipitation delivered by an intensified East Asian summer monsoon occurred during the early Holocene, or during the middle Holocene, especially in the context of the monsoonal margin region. The conflicting views on the subject may be caused by chronological uncertainties and ambiguities in the interpretation of different climate proxies measured in different sedimentary sequences. Here, we present a detailed record of the Holocene evolution of vegetation in northern China based on a high-resolution pollen record from Dali Lake, located near the modern summer monsoon limit. From 12,000-8300 cal BP, the sandy land landscape changed from desert to open elm forest and shrubland, while dry steppe dominated the hilly lands and patches of birch forest developed in the mountains. Between 8300 and 6000 cal BP, elm forest was extensively distributed in the sandy lands, while typical steppe covered the hilly lands and mixed coniferous-broadleaved forests expanded in the mountains. Our pollen evidence contradicts the view that the monsoonal rainfall increased during the early Holocene; rather, it indicates that the East Asian summer monsoon did not become intensified until ∼8000 cal BP in northern China. The low precipitation during the early Holocene can be attributed to the boundary conditions, i.e., to the remnant high-latitude Northern Hemisphere ice sheets and the relatively low global sea level.

Multi-Scalar Land Cover Influences on Benthic Invertebrate Assemblages in Agricultural Streams. F.B. Daniel, M.B. Griffith, M.E. Troyer, and J.E. Lazorchak Office of Research and Development, U.S. Environmental Protection Agency, Cincinnati, OH 45268

NASA Astrophysics Data System (ADS)

Daniel, F. B.; Griffith, M. B.; Troyer, M. E.; Lazorchak, J. E.

2005-05-01

The northern half of the Little Miami River watershed (LMRW) was graded by the Wisconsinan glacier; the southern half lies beyond the glacier terminus and is set in an older, Illinoisan landscape. Benthic invertebrates were collected in 35 headwater streams (sub-watersheds) in the LMRW for four consecutive years and the land cover was quantified at three spatial scales (the catchment, the riparian corridor, and sampled reach) for each sub-watershed. In the northern sub-watersheds (N=19) a significantly greater percentage of land surface is committed to row crop agriculture and significantly lesser percent is covered in permanent grasses or forest relative to those in the south (N=16). Analysis of the invertebrate samples showed that Ephemeroptera, Plecoptera, and Trichoptera (EPT) constituted a significantly greater proportion of those assemblages collected from the southern sub-watersheds compared to those from the northern section In contrast, Coleoptera (Cole) and Odonata (Odon) were significantly increased in the northern streams. Approximately 60 % of the variation in the invertebrate assemblages, e.g., the ratio of EPT/(EPT+Cole+Odon), at these sites can be accounted for by consideration of land cover at either the catchment or riparian scale but not at the reach scale.

Tritium in Australian Precipitation: a 40 Year Record

NASA Astrophysics Data System (ADS)

Tadros, C. V.; Stone, D. J.; Hill, D. M.; Henderson-Sellers, A.

2004-12-01

Tritium, the radioisotope of hydrogen, directly incorporated into water molecules in the global hydrological system, is the most commonly used radioisotope indicator of groundwater recharge. Tritium in precipitation has been measured in Australia over the past 40 years, as an essential research tool in hydro-climate studies and to contribute to the Global Network for Isotopes in Precipitation (GNIP). Tritium, which as tritiated water (3H 1H O) is very mobile in the environment, delivers the benefit of tracing groundwater systems in a 10 - 20 year timeframe as a result of last century's atmospheric thermonuclear testing. The concentration of tritium in Australian precipitation reached a maximum level of 160 TU in 1963, during one of the most intense periods of nuclear testing. Our data reveal Australia experienced a `minor' bomb pulse compared to the Northern Hemisphere eg. in Ottawa, Canada a value of 6000 TU was recorded in 1963 for tritium in precipitation. From 1963 to 1980 we observe a rapid drop in the concentration of tritium, more than expected from natural decay, mainly due to the wash out of tritium into the oceans and groundwater. Since 1990 the levels of tritium have stabilised globally and regionally. Currently the levels of tritium in Australia have stabilised to 2 to 3 TU latitudinally across the continent, a factor of 10 lower than values observed at stations in the Northern Hemisphere. At present, levels of tritium in Australia appear to have ceased declining and our analyses suggest that today the tritium in precipitation is predominantly natural. We believe that it may be possible that the increased levels observed in the Northern Hemisphere, due to nuclear power generation [1] could `leak' into the Southern Hemisphere. This is important for research in Australia because it could hinder the exploitation of tritium in providing information on the origin and mechanism of recharge of shallow groundwaters and rivers [2]. 1. J.D. Happell, et al. A history of atmospheric tritium gas (HT) 1950-2002. Tellus(2004) 56B, 183-193. 2. D.J.M. Stone, et al. Investigation of Groundwater-Streamflow interactions in the Bega alluvial aquifer using tritium and stable isotopic ratios. ANA 2001, 4th Conference on Nuclear Science and Engineering in Australasia, pp 191-197, Sydney, NSW.

A new `bio-comfort' perspective for Melbourne based on heat stress, air pollution and pollen

NASA Astrophysics Data System (ADS)

Jacobs, Stephanie J.; Pezza, Alexandre B.; Barras, Vaughan; Bye, John

2014-03-01

Humans are at risk from exposure to extremes in their environment, yet there is no consistent way to fully quantify and understand the risk when considering more than just meteorological variables. An outdoor `bio-comfort' threshold is defined for Melbourne, Australia using a combination of heat stress, air particulate concentration and grass pollen count, where comfortable conditions imply an ideal range of temperature, humidity and wind speed, acceptable levels of air particulates and a low pollen count. This is a new approach to defining the comfort of human populations. While other works have looked into the separate impacts of different variables, this is the first time that a unified bio-comfort threshold is suggested. Composite maps of surface pressure are used to illustrate the genesis and evolution of the atmospheric structures conducive to an uncomfortable day. When there is an uncomfortable day due to heat stress conditions in Melbourne, there is a high pressure anomaly to the east bringing warm air from the northern interior of Australia. This anomaly is part of a slow moving blocking high originating over the Indian Ocean. Uncomfortable days due to high particulate levels have an approaching cold front. However, for air particulate cases during the cold season there are stable atmospheric conditions enhanced by a blocking high emanating from Australia and linking with the Antarctic continent. Finally, when grass pollen levels are high, there are northerly winds carrying the pollen from rural grass lands to Melbourne, due to a stationary trough of low pressure inland. Analysis into days with multiple types of stress revealed that the atmospheric signals associated with each type of discomfort are present regardless of whether the day is uncomfortable due to one or multiple variables. Therefore, these bio-comfort results are significant because they offer a degree of predictability for future uncomfortable days in Melbourne.

A new 'bio-comfort' perspective for Melbourne based on heat stress, air pollution and pollen.

PubMed

Jacobs, Stephanie J; Pezza, Alexandre B; Barras, Vaughan; Bye, John

2014-03-01

Humans are at risk from exposure to extremes in their environment, yet there is no consistent way to fully quantify and understand the risk when considering more than just meteorological variables. An outdoor 'bio-comfort' threshold is defined for Melbourne, Australia using a combination of heat stress, air particulate concentration and grass pollen count, where comfortable conditions imply an ideal range of temperature, humidity and wind speed, acceptable levels of air particulates and a low pollen count. This is a new approach to defining the comfort of human populations. While other works have looked into the separate impacts of different variables, this is the first time that a unified bio-comfort threshold is suggested. Composite maps of surface pressure are used to illustrate the genesis and evolution of the atmospheric structures conducive to an uncomfortable day. When there is an uncomfortable day due to heat stress conditions in Melbourne, there is a high pressure anomaly to the east bringing warm air from the northern interior of Australia. This anomaly is part of a slow moving blocking high originating over the Indian Ocean. Uncomfortable days due to high particulate levels have an approaching cold front. However, for air particulate cases during the cold season there are stable atmospheric conditions enhanced by a blocking high emanating from Australia and linking with the Antarctic continent. Finally, when grass pollen levels are high, there are northerly winds carrying the pollen from rural grass lands to Melbourne, due to a stationary trough of low pressure inland. Analysis into days with multiple types of stress revealed that the atmospheric signals associated with each type of discomfort are present regardless of whether the day is uncomfortable due to one or multiple variables. Therefore, these bio-comfort results are significant because they offer a degree of predictability for future uncomfortable days in Melbourne.

Southern Appalachian Case Study

Treesearch

Charles C. van Sickle

1999-01-01

The Southern Appalachian study covers a region of 37.4 million acres. Its mountains, foothills, and valleys stretch from northern Virginia and northern West Virginia to northern Georgia and Alabama. When Native Americans came to the region, forests dominated the landscape and they still do, covering 70% of the land (Figure 32.1). Terrain characteristics are...

Assisting Australian indigenous resource management and sustainable utilization of species through the use of GIS and environmental modeling techniques.

PubMed

Gorman, Julian; Pearson, Diane; Whitehead, Peter

2008-01-01

Information on distribution and relative abundance of species is integral to sustainable management, especially if they are to be harvested for subsistence or commerce. In northern Australia, natural landscapes are vast, centers of population few, access is difficult, and Aboriginal resource centers and communities have limited funds and infrastructure. Consequently defining distribution and relative abundance by comprehensive ground survey is difficult and expensive. This highlights the need for simple, cheap, automated methodologies to predict the distribution of species in use, or having potential for use, in commercial enterprise. The technique applied here uses a Geographic Information System (GIS) to make predictions of probability of occurrence using an inductive modeling technique based on Bayes' theorem. The study area is in the Maningrida region, central Arnhem Land, in the Northern Territory, Australia. The species examined, Cycas arnhemica and Brachychiton diversifolius, are currently being 'wild harvested' in commercial trials, involving sale of decorative plants and use as carving wood, respectively. This study involved limited and relatively simple ground surveys requiring approximately 7 days of effort for each species. The overall model performance was evaluated using Cohen's kappa statistics. The predictive ability of the model for C. arnhemica was classified as moderate and for B. diversifolius as fair. The difference in model performance can be attributed to the pattern of distribution of these species. C. arnhemica tends to occur in a clumped distribution due to relatively short distance dispersal of its large seeds and vegetative growth from long-lived rhizomes, while B. diversifolius seeds are smaller and more widely dispersed across the landscape. The output from analysis predicts trends in species distribution that are consistent with independent on-site sampling for each species and therefore should prove useful in gauging the extent of resource availability. However, some caution needs to be applied as the models tend to over predict presence which is a function of distribution patterns and of other variables operating in the landscape such as fire histories which were not included in the model due to limited availability of data.

A Lesson from Mangroves.

ERIC Educational Resources Information Center

Davis, Stephen

1987-01-01

Discusses the importance of interpretive programs in the Northern Territory of Australia. Describes the typical interpretive approach of local school science curricula, which serve 20,000 Aboriginal children. Addresses the curriculum framework, learning strategies, and process skill development, illustrating them through a lesson on mangroves. (TW)

Tests of 36 Eucalyptus species in northern California

Treesearch

James P. King; Stanley L. Krugmanand

1980-01-01

A trial of 36 species of Eucalyptus near Concord, California, found species of sufficiently rapid growth and good survival to merit further screening. Species from western Australia and of the subgenus Monocalyprus all failed on the site. E. camaldulensis, E. dalrympleana, E....

Expedition 9 Landing

NASA Image and Video Library

2004-10-24

An inflatable medical tent stands in the foreground of the Expedition 9 landing site, while an incoming Russian Search and Rescue helicopter lands. The Soyuz capsule, which carried Expedition 9 Flight Engineer Michael Fincke, Commander Gennady Padalka and Russian Space Forces cosmonaut Yuri Shargin landed approximately 85 kilometers northeast of Arkalyk in northern Kazakhstan, Sunday, October 24, 2004. Photo Credit: (NASA/Bill Ingalls)

Land use change and its driving forces toward mutual conversion in Zhangjiakou City, a farming-pastoral ecotone in Northern China.

PubMed

Liu, Chao; Xu, Yueqing; Sun, Piling; Huang, An; Zheng, Weiran

2017-09-14

Land use/cover change (LUCC), a local environmental issue of global importance, and its driving forces have been crucial issues in geography and environmental research. Previous studies primarily focused on major driving factors in various land use types, with few explorations of differences between driving forces of mutual land use type conversions, especially in fragile eco-environments. In this study, Zhangjiakou City, in a farming-pastoral ecotone in Northern China, was taken as an example to analyze land use change between 1989 and 2015, and explore the driving forces of mutual land use type conversions using canonical correlation analysis. Satellite images and government statistics, including social-economic and natural data, were used as sources. Arable land, forestland, and grassland formed the main land use structure. From 1989 to 2015 forestland, orchard land, and construction land significantly increased, while arable land, grassland, unused land, and water areas decreased. Conversions from grassland to forestland; from arable land to orchard land, forestland and construction land; and from unused land to grassland and forestland were the primary land use changes. Among these, the conversion from grassland to forestland had the highest ranking. Average annual precipitation and per capita net income of rural residents positively affected the conversion of arable land to forestland and unused land to grassland. GDP, total population, and urbanization rate contributed most significantly to converting arable land to construction land; total retail sales of social consumer goods, average annual temperature, and GDP had important positive influences in converting arable land to orchard land.

Rheumatic heart disease in Indigenous children in northern Australia: differences in prevalence and the challenges of screening.

PubMed

Roberts, Kathryn V; Maguire, Graeme P; Brown, Alex; Atkinson, David N; Remenyi, Bo; Wheaton, Gavin; Ilton, Marcus; Carapetis, Jonathan

2015-09-07

To compare regional differences in the prevalence of rheumatic heart disease (RHD) detected by echocardiographic screening in high-risk Indigenous Australian children, and to describe the logistical and other practical challenges of RHD screening. Cross-sectional screening survey performed between September 2008 and November 2010. Thirty-two remote communities in four regions of northern and central Australia. 3946 Aboriginal or Torres Strait Islander children aged 5-15 years. Portable echocardiography was performed by cardiac sonographers. Echocardiograms were recorded and reported offsite by a pool of cardiologists. RHD was diagnosed according to 2012 World Heart Federation criteria. The prevalence of definite RHD differed between regions, from 4.7/1000 in Far North Queensland to 15.0/1000 in the Top End of the Northern Territory. The prevalence of definite RHD was greater in the Top End than in other regions (odds ratio, 2.3; 95% CI, 1.2-4.6, P = 0.01). Fifty-three per cent of detected cases of definite RHD were new cases; the prevalence of new cases of definite RHD was 4.6/1000 for the entire sample and 7.0/1000 in the Top End. Evaluation of socioeconomic data suggests that the Top End group was the most disadvantaged in our study population. The prevalence of definite RHD in remote Indigenous Australian children is significant, with a substantial level of undetected disease. Important differences were noted between regions, with the Top End having the highest prevalence of definite RHD, perhaps explained by socioeconomic factors. Regional differences must be considered when evaluating the potential benefit of widespread echocardiographic screening in Australia.

Cost savings from a telemedicine model of care in northern Queensland, Australia.

PubMed

Thaker, Darshit A; Monypenny, Richard; Olver, Ian; Sabesan, Sabe

2013-09-16

To conduct a cost analysis of a telemedicine model for cancer care (teleoncology) in northern Queensland, Australia, compared with the usual model of care from the perspective of the Townsville and other participating hospital and health services. Retrospective cost-savings analysis; and a one-way sensitivity analysis performed to test the robustness of findings in net savings. Records of all patients managed by means of teleoncology at the Townsville Cancer Centre (TCC) and its six rural satellite centres in northern Queensland, Australia between 1 March 2007 and 30 November 2011. Costs for set-up and staffing to manage the service, and savings from avoidance of travel expenses for specialist oncologists, patients and their escorts, and for aeromedical retrievals. There were 605 teleoncology consultations with 147 patients over 56 months, at a total cost of $442 276. The cost for project establishment was $36 000, equipment/maintenance was $143 271, and staff was $261 520. The estimated travel expense avoided was $762 394; this figure included the costs of travel for patients and escorts of $658 760, aeromedical retrievals of $52 400 and travel for specialists of $47 634, as well as an estimate of accommodation costs for a proportion of patients of $3600. This resulted in a net saving of $320 118. Costs would have to increase by 72% to negate the savings. The teleoncology model of care at the TCC resulted in net savings, mainly due to avoidance of travel costs. Such savings could be redirected to enhancing rural resources and service capabilities. This teleoncology model is applicable to geographically distant areas requiring lengthy travel.

Issues related to incorporating northern peatlands into global climate models

NASA Astrophysics Data System (ADS)

Frolking, Steve; Roulet, Nigel; Lawrence, David

Northern peatlands cover ˜3-4 million km2 (˜10% of the land north of 45°N) and contain ˜200-400 Pg carbon (˜10-20% of total global soil carbon), almost entirely as peat (organic soil). Recent developments in global climate models have included incorporation of the terrestrial carbon cycle and representation of several terrestrial ecosystem types and processes in their land surface modules. Peatlands share many general properties with upland, mineral-soil ecosystems, and general ecosystem carbon, water, and energy cycle functions (productivity, decomposition, water infiltration, evapotranspiration, runoff, latent, sensible, and ground heat fluxes). However, northern peatlands also have several unique characteristics that will require some rethinking or revising of land surface algorithms in global climate models. Here we review some of these characteristics, deep organic soils, a significant fraction of bryophyte vegetation, shallow water tables, spatial heterogeneity, anaerobic biogeochemistry, and disturbance regimes, in the context of incorporating them into global climate models. With the incorporation of peatlands, global climate models will be able to simulate the fate of northern peatland carbon under climate change, and estimate the magnitude and strength of any climate system feedbacks associated with the dynamics of this large carbon pool.

Australian net (1950s-1990) soil organic carbon erosion: implications for CO2 emission and land-atmosphere modelling

USDA-ARS?s Scientific Manuscript database

The debate remains unresolved about soil erosion substantially offsetting fossil fuel emissions and acting as an important source or sink of CO2. There is little historical land use and management context to this debate, which is central to Australia's recent past of European settlement, agricultura...

Thematic Synthesis of Post Activity Reviews: Lessons Relating to Management of the Simulation Environment Supporting Activity Vital Fire in May 2014

DTIC Science & Technology

2015-03-01

Supporting Activity Vital Fire in May 2014 Glen Pearce Land Division Defence Science and Technology Organisation DSTO-TN-1408...UNCLASSIFIED Published by Land Division DSTO Defence Science and Technology Organisation 506 Lorimer St Fishermans Bend Victoria 3207 Australia...REQUIREMENTS .............................................................................. 1 2.1 Cognitive and metacognitive performance

Utilizing wide area maritime domain awareness (MDA) data to cue a remote surveillance system

NASA Astrophysics Data System (ADS)

Isenor, Anthony W.; Cross, Richard; Webb, Sean; Lapinski, Anna-Liesa S.

2013-10-01

Defence Research and Development Canada - Atlantic (DRDC Atlantic) is currently involved in research on the topic of northern Maritime Domain Awareness (MDA). One project, entitled Situational Information for Enabling Development of Northern Awareness (SEDNA), includes research on the exploitation of MDA data in northern areas. One aspect of this research is to utilize wide area MDA data to provide awareness to an unattended, land-based system. Wide area MDA is attained through the use of space-based AIS (SAIS) data, a data feed used by the Canadian Department of National Defence and supplied by the commercial provider exactEarth Ltd. The land-based surveillance system used is the remote northern system constructed within the DRDC Northern Watch Technology Demonstration Project. Northern Watch is a multi-year project intended to show state-of-the-art, unattended, surveillance capabilities in the Canadian north. The link between the SAIS and Northern Watch is provided by a research infrastructure that consists of an assembly of data sources, users, applications, and product management techniques that collectively support research in areas such as information management and MDA data exploitation. High-level descriptions of the systems are provided along with elaboration on the alerting algorithm, the notifications that would be sent to the Northern Watch southern command site, and the resulting actions that could be taken by the Northern Watch surveillance system.

Great Barrier Reef, Queensland, Australia

NASA Technical Reports Server (NTRS)

1991-01-01

Along the coast of Queensland, Australia (18.0S, 147.5E), timbered foothills of the Great Dividing Range separate the semi-arid interior of Queensland from the farmlands of the coastal plains. Prominent cleared areas in the forest indicate deforestation for farm and pasture lands. Offshore, islands and the Great Barrier Reef display sand banks along the southern sides of the structures indicating a dominant southerly wind and current direction.

New constraints on the spatial distribution and morphology of the Halimeda bioherms of the Great Barrier Reef, Australia

NASA Astrophysics Data System (ADS)

McNeil, Mardi A.; Webster, Jody M.; Beaman, Robin J.; Graham, Trevor L.

2016-12-01

Halimeda bioherms occur as extensive geological structures on the northern Great Barrier Reef (GBR), Australia. We present the most complete, high-resolution spatial mapping of the northern GBR Halimeda bioherms, based on new airborne lidar and multibeam echosounder bathymetry data. Our analysis reveals that bioherm morphology does not conform to the previous model of parallel ridges and troughs, but is far more complex than previously thought. We define and describe three morphological sub-types: reticulate, annulate, and undulate, which are distributed in a cross-shelf pattern of reduced complexity from east to west. The northern GBR bioherms cover an area of 6095 km2, three times larger than the original estimate, exceeding the area and volume of calcium carbonate in the adjacent modern shelf-edge barrier reefs. We have mapped a 1740 km2 bioherm complex north of Raine Island in the Cape York region not previously recorded, extending the northern limit by more than 1° of latitude. Bioherm formation and distribution are controlled by a complex interaction of outer-shelf geometry, regional and local currents, coupled with the morphology and depth of continental slope submarine canyons determining the delivery of cool, nutrient-rich water upwelling through inter-reef passages. Distribution and mapping of Halimeda bioherms in relation to Great Barrier Reef Marine Park Authority bioregion classifications and management zones are inconsistent and currently poorly defined due to a lack of high-resolution data not available until now. These new estimates of bioherm spatial distribution and morphology have implications for understanding the role these geological features play as structurally complex and productive inter-reef habitats, and as calcium carbonate sinks which record a complete history of the Holocene post-glacial marine transgression in the northern GBR.

Thinning of young Douglas-fir forests decreases density of northern flying squirrels in the Oregon Cascades

Treesearch

T. Manning; J.C. Hagar; B.C. McComb

2011-01-01

Large-scale commercial thinning of young forests in the Pacific Northwest is currently promoted on public lands to accelerate the development of late-seral forest structure for the benefit of wildlife species such as northern spotted owls (Strix occidentalis caurina) and their prey, including the northern flying squirrel (Glaucomys...

Effects of climate change on recreation in the Northern Rockies Region [Chapter 10

Treesearch

Michael S. Hand; Megan Lawson

2018-01-01

Outdoor recreation is an important benefit provided by Federally managed and other public lands throughout the Rocky Mountains. National forests in the Forest Service, U.S. Department of Agriculture (USFS) Northern Region and Greater Yellowstone Area (a region hereafter called the Northern Rockies region) have an estimated 13.3 million visits per year; Yellowstone,...

Towards protecting the Great Barrier Reef from land-based pollution.

PubMed

Kroon, Frederieke J; Thorburn, Peter; Schaffelke, Britta; Whitten, Stuart

2016-06-01

The Great Barrier Reef (GBR) is an iconic coral reef system extending over 2000 km along the north-east coast of Australia. Global recognition of its Outstanding Universal Value resulted in the listing of the 348 000 km(2) GBR World Heritage Area (WHA) by UNESCO in 1981. Despite various levels of national and international protection, the condition of GBR ecosystems has deteriorated over the past decades, with land-based pollution from the adjacent catchments being a major and ongoing cause for this decline. To reduce land-based pollution, the Australian and Queensland Governments have implemented a range of policy initiatives since 2003. Here, we evaluate the effectiveness of existing initiatives to reduce discharge of land-based pollutants into the waters of the GBR. We conclude that recent efforts in the GBR catchments to reduce land-based pollution are unlikely to be sufficient to protect the GBR ecosystems from declining water quality within the aspired time frames. To support management decisions for desired ecological outcomes for the GBR WHA, we identify potential improvements to current policies and incentives, as well as potential changes to current agricultural land use, based on overseas experiences and Australia's unique potential. The experience in the GBR may provide useful guidance for the management of other marine ecosystems, as reducing land-based pollution by better managing agricultural sources is a challenge for coastal communities around the world. © 2016 John Wiley & Sons Ltd.

Water resource protection in Australia: Links between land use and river health with a focus on stubble farming systems

NASA Astrophysics Data System (ADS)

Bowmer, Kathleen H.

2011-06-01

SummaryStubble farming (conservation farming, minimum tillage, zero tillage) has increased in Australia over several decades with claims of improved productivity, landscape stability and environmental benefit including ecosystem services downstream, yet recent audits show a dramatic and general decline in river health. This review explores explanations for this apparent anomaly. Many confounding factors complicate interactions between land use and river condition and may disguise or over-ride the potential benefits of adoption of stubble systems or other improvements in agricultural land use practice. These factors include climate change and variability; land use changes including an increase in bushfires, growth of farm dams and afforestation; lag times between land use change and expression of benefits in river systems; use of inappropriate scale that disguises local benefit; variations in the extent of ecosystem resilience; impacts of river regulation; and impacts of introduced species. Additionally, the value of river condition and utility is complicated by different local or regional perceptions and by contrasting rural and urban outlooks. The use of indicators, risk frameworks and biophysical modelling may help elucidate the complex relationships between land use and downstream ecosystem impact. The strengthening of local, regional and catchment scale approaches is advocated. This includes the re-integration of land management and governance with water management and planning. It is encouraging that farmers are themselves developing systems to optimise trade-offs between on-farm activities and ecosystem service benefits. This approach needs to be supported and extended.

Spatial pattern of soil organic carbon and total nitrogen, and analysis of related factors in an agro-pastoral zone in Northern China

PubMed Central

Wang, Xuyang; Chen, Yinping; Lian, Jie; Luo, Yongqing; Niu, Yayi; Gong, Xiangwen

2018-01-01

The spatial pattern of soil organic carbon (SOC) and total nitrogen (TN) densities plays a profound important role in estimating carbon and nitrogen budgets. Naiman Banner located in northern China was chosen as research site, a total of 332 soil samples were taken in a depth of 100 cm from the low hilly land in the southern part, sandy land in the middle part and an alluvial plain in the northern part of the county. The results showed that SOC and TN density initially decreased and then increased from the north to the south, The highest densities, were generally in the south, with the lowest generally in the middle part. The SOC and TN densities in cropland were significantly greater than those in woodland and grassland in the alluvial plains and for Naiman as a whole. The woodland SOC and TN density were higher than those of grassland in the low hilly land, and higher densities of SOC and TN in grassland than woodland in the sandy land and low hilly land. There were significant differences in SOC and TN densities among the five soil types of Cambisols, Arenosols, Gleysols, Argosols, and Kastanozems. In addition, SOC and TN contents generally decreased with increasing soil depth, but increased below a depth of 40 cm in the Cambisols and became roughly constant at this depth in the Kastanozems. There is considerable potential to sequester carbon and nitrogen in the soil via the conversion of degraded sandy land into woodland and grassland in alluvial plain, and more grassland should be established in sandy land and low hilly land. PMID:29771979

Body Size of Contemporary Youth in Different Parts of the World

ERIC Educational Resources Information Center

Meredith, Howard V.

1969-01-01

Based on body size measurements accumulated between 1950-1960, comparisons were made of 13-year-old girls and 15-year-old boys from North and South America, northern, central, and southwest Asia, Oceania, Australia, Africa, the Near East, and Europe. (DO)

Pathological Features of Fatal Crocodile Attacks in Northern Australia, 2005-2014.

PubMed

Sinton, Terence J; Byard, Roger W

2016-11-01

Eleven deaths from crocodile attacks in the Northern Territory, Australia were reviewed. The male:female ratio was 8:3; age range-10-62 years, average 29.4 years. Four children were included (one boy and three girls, aged 10, 11, and two at 12 years), and there were seven aboriginal victims (64%). The attacks were witnessed in eight cases with the victims swimming in freshwater N = 5, standing on a river bank N = 1, fishing in fresh water N = 1, or diving in the sea N = 1. At autopsy, several distinct patterns of injury were observed ranging from complete traumatic disruption of the body with only incomplete remains for examination (N = 5), to crushing of the head with fractures of the skull (N = 4), crushing of the chest with fractures of the ribs and sternum (N = 2), and avulsion of limbs (N = 4). In one case, there was decapitation. Autopsy evaluations were complicated by decomposition and loss of body parts. © 2016 American Academy of Forensic Sciences.

Ngaingan virus, a macropod-associated rhabdovirus, contains a second glycoprotein gene and seven novel open reading frames.

PubMed

Gubala, Aneta; Davis, Steven; Weir, Richard; Melville, Lorna; Cowled, Chris; Walker, Peter; Boyle, David

2010-03-30

Ngaingan virus (NGAV) was isolated from a pool of biting midges that were collected in the tropics of northern Australia. Reported here is the full-length sequence of the NGAV genome, which, at over 15.7 kb, is the largest in any rhabdovirus described to date and contains 13 genes, the highest number of genes observed in any (-) ssRNA virus. Seven of these putative genes show no significant homology to known proteins. Like viruses in the genus Ephemerovirus, NGAV possesses a second glycoprotein gene (G(NS)). Phylogenetic analyses, however, place NGAV within the yet to be classified "Hart Park" group containing Wongabel and Flanders viruses, which do not contain a second glycoprotein gene. Screening of various animal sera from northern Australia has indicated that NGAV is currently circulating in macropods (wallabies, wallaroos and kangaroos), highlighting the need for further studies to determine its potential to cause disease in these species. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.

Preferred temperature correlates with evaporative water loss in hylid frogs from northern Australia.

PubMed

Tracy, Christopher R; Christian, Keith A

2005-01-01

We measured temperature preferences of 12 species of hylid frogs (Litoria and Cyclorana) from northern Australia in a laboratory thermal gradient. These species represented a range of ecological habitat use (aquatic, terrestrial, arboreal), adult body size (0.5-60 g), and cutaneous resistance to water loss (Rc=0.6-63.1 s cm-1). We found significant differences among species in selected skin temperature and gradient temperature but not in the variances of these measures (an index of precision of temperature selection). The species' differences correlated significantly with cutaneous resistance to water loss, with more-resistant frogs selecting higher skin and substrate temperatures in the thermal gradient, even after phylogenetic relationships are taken into account. Because cutaneous resistance to water loss also correlates with ecological habit (arboreal>terrestrial>aquatic), we suggest that their higher resistance to water loss allows arboreal and terrestrial species better ability to tolerate high temperatures, where growth or locomotory speed may be higher, without the associated risk of desiccation.

Molecular Antimicrobial Resistance Surveillance for Neisseria gonorrhoeae, Northern Territory, Australia.

PubMed

Whiley, David M; Trembizki, Ella; Buckley, Cameron; Freeman, Kevin; Baird, Robert W; Beaman, Miles; Chen, Marcus; Donovan, Basil; Kundu, Ratan L; Fairley, Christopher K; Guy, Rebecca; Hogan, Tiffany; Kaldor, John M; Karimi, Mahdad; Limnios, Athena; Regan, David G; Ryder, Nathan; Su, Jiunn-Yih; Ward, James; Lahra, Monica M

2017-09-01

Neisseria gonorrhoeae antimicrobial resistance (AMR) is a globally recognized health threat; new strategies are needed to enhance AMR surveillance. The Northern Territory of Australia is unique in that 2 different first-line therapies, based primarily on geographic location, are used for gonorrhea treatment. We tested 1,629 N. gonorrhoeae nucleic acid amplification test-positive clinical samples, collected from regions where ceftriaxone plus azithromycin or amoxicillin plus azithromycin are recommended first-line treatments, by using 8 N. gonorrhoeae AMR PCR assays. We compared results with those from routine culture-based surveillance data. PCR data confirmed an absence of ceftriaxone resistance and a low level of azithromycin resistance (0.2%), and that penicillin resistance was <5% in amoxicillin plus azithromycin regions. Rates of ciprofloxacin resistance and penicillinase-producing N. gonorrhoeae were lower when molecular methods were used. Molecular methods to detect N. gonorrhoeae AMR can increase the evidence base for treatment guidelines, particularly in settings where culture-based surveillance is limited.

Two gonad-infecting species of Philometra (Nematoda: Philometridae) from marine fishes off the northern coast of Australia

PubMed Central

Moravec, František; Barton, Diane P.

2015-01-01

Two different gonad-infecting species of Philometra Costa, 1845 were collected from the ovary of marine perciform fishes, the blackspotted croaker Protonibea diacanthus (Sciaenidae) and the John’s snapper Lutjanus johnii (Lutjanidae), from off the northern coast of Australia. Nematodes (males and females) from P. diacanthus represent a new taxon, Philometra protonibeae n. sp., which is mainly characterized by the body length of the males (3.37–3. 90 mm), broad, equally long spicules (length 126–141 μm) and the shape and structure of the gubernaculum with a dorsally lamellate distal tip. The nematodes (only females) from L. johnii may represent an undescribed species, but, because of the absence of conspecific males, they could not be specifically identified. Philometra protonibeae is the fifth nominal gonad-infecting species of this genus recorded from marine fishes in Australian waters and the seventh species of these parasites described from fishes of the family Sciaenidae. PMID:25654578

Evolution of the intercontinental disjunctions in six continents in the Ampelopsis clade of the grape family (Vitaceae)

PubMed Central

2012-01-01

Background The Ampelopsis clade (Ampelopsis and its close allies) of the grape family Vitaceae contains ca. 43 species disjunctly distributed in Asia, Europe, North America, South America, Africa, and Australia, and is a rare example to study both the Northern and the Southern Hemisphere intercontinental disjunctions. We reconstruct the temporal and spatial diversification of the Ampelopsis clade to explore the evolutionary processes that have resulted in their intercontinental disjunctions in six continents. Results The Bayesian molecular clock dating and the likelihood ancestral area analyses suggest that the Ampelopsis clade most likely originated in North America with its crown group dated at 41.2 Ma (95% HPD 23.4 - 61.0 Ma) in the middle Eocene. Two independent Laurasian migrations into Eurasia are inferred to have occurred in the early Miocene via the North Atlantic land bridges. The ancestor of the Southern Hemisphere lineage migrated from North America to South America in the early Oligocene. The Gondwanan-like pattern of intercontinental disjunction is best explained by two long-distance dispersals: once from South America to Africa estimated at 30.5 Ma (95% HPD 16.9 - 45.9 Ma), and the other from South America to Australia dated to 19.2 Ma (95% HPD 6.7 - 22.3 Ma). Conclusions The global disjunctions in the Ampelopsis clade are best explained by a diversification model of North American origin, two Laurasian migrations, one migration into South America, and two post-Gondwanan long-distance dispersals. These findings highlight the importance of both vicariance and long distance dispersal in shaping intercontinental disjunctions of flowering plants. PMID:22316163

A population-based spatio-temporal analysis of Clostridium difficile infection in Queensland, Australia over a 10-year period.

PubMed

Furuya-Kanamori, Luis; Robson, Jenny; Soares Magalhães, Ricardo J; Yakob, Laith; McKenzie, Samantha J; Paterson, David L; Riley, Thomas V; Clements, Archie C A

2014-11-01

To identify the spatio-temporal patterns and environmental factors associated with Clostridium difficile infection (CDI) in Queensland, Australia. Data from patients tested for CDI were collected from 392 postcodes across Queensland between May 2003 and December 2012. A binomial logistic regression model, with CDI status as the outcome, was built in a Bayesian framework, incorporating fixed effects for sex, age, source of the sample (healthcare facility or community), elevation, rainfall, land surface temperature, seasons of the year, time in months and spatially unstructured random effects at the postcode level. C. difficile was identified in 13.1% of the samples, the proportion significantly increased over the study period from 5.9% in 2003 to 18.8% in 2012. CDI peaked in summer (14.6%) and was at its lowest in autumn (10.1%). Other factors significantly associated with CDI included female sex (OR: 1.08; 95%CI: 1.01-1.14), community source samples (OR: 1.12; 95%CI: 1.05-1.20), and higher rainfall (OR: 1.09; 95%CI: 1.02-1.17). There was no significant spatial variation in CDI after accounting for the fixed effects in the model. There was an increasing annual trend in CDI in Queensland from 2003 to 2012. Peaks of CDI were found in summer (December-February), which is at odds with the current epidemiological pattern described for northern hemisphere countries. Epidemiologically plausible explanations for this disparity require further investigation. Copyright © 2014 The British Infection Association. Published by Elsevier Ltd. All rights reserved.

Biomass burning fuel consumption dynamics in the tropics and subtropics assessed from satellite

NASA Astrophysics Data System (ADS)

Andela, Niels; van der Werf, Guido R.; Kaiser, Johannes W.; van Leeuwen, Thijs T.; Wooster, Martin J.; Lehmann, Caroline E. R.

2016-06-01

Landscape fires occur on a large scale in (sub)tropical savannas and grasslands, affecting ecosystem dynamics, regional air quality and concentrations of atmospheric trace gasses. Fuel consumption per unit of area burned is an important but poorly constrained parameter in fire emission modelling. We combined satellite-derived burned area with fire radiative power (FRP) data to derive fuel consumption estimates for land cover types with low tree cover in South America, Sub-Saharan Africa, and Australia. We developed a new approach to estimate fuel consumption, based on FRP data from the polar-orbiting Moderate Resolution Imaging Spectroradiometer (MODIS) and the geostationary Spinning Enhanced Visible and Infrared Imager (SEVIRI) in combination with MODIS burned-area estimates. The fuel consumption estimates based on the geostationary and polar-orbiting instruments showed good agreement in terms of spatial patterns. We used field measurements of fuel consumption to constrain our results, but the large variation in fuel consumption in both space and time complicated this comparison and absolute fuel consumption estimates remained more uncertain. Spatial patterns in fuel consumption could be partly explained by vegetation productivity and fire return periods. In South America, most fires occurred in savannas with relatively long fire return periods, resulting in comparatively high fuel consumption as opposed to the more frequently burning savannas in Sub-Saharan Africa. Strikingly, we found the infrequently burning interior of Australia to have higher fuel consumption than the more productive but frequently burning savannas in northern Australia. Vegetation type also played an important role in explaining the distribution of fuel consumption, by affecting both fuel build-up rates and fire return periods. Hummock grasslands, which were responsible for a large share of Australian biomass burning, showed larger fuel build-up rates than equally productive grasslands in Africa, although this effect might have been partially driven by the presence of grazers in Africa or differences in landscape management. Finally, land management in the form of deforestation and agriculture also considerably affected fuel consumption regionally. We conclude that combining FRP and burned-area estimates, calibrated against field measurements, is a promising approach in deriving quantitative estimates of fuel consumption. Satellite-derived fuel consumption estimates may both challenge our current understanding of spatiotemporal fuel consumption dynamics and serve as reference datasets to improve biogeochemical modelling approaches. Future field studies especially designed to validate satellite-based products, or airborne remote sensing, may further improve confidence in the absolute fuel consumption estimates which are quickly becoming the weakest link in fire emission estimates.

Biodiverse planting for carbon and biodiversity on indigenous land.

PubMed

Renwick, Anna R; Robinson, Catherine J; Martin, Tara G; May, Tracey; Polglase, Phil; Possingham, Hugh P; Carwardine, Josie

2014-01-01

Carbon offset mechanisms have been established to mitigate climate change through changes in land management. Regulatory frameworks enable landowners and managers to generate saleable carbon credits on domestic and international markets. Identifying and managing the associated co-benefits and dis-benefits involved in the adoption of carbon offset projects is important for the projects to contribute to the broader goal of sustainable development and the provision of benefits to the local communities. So far it has been unclear how Indigenous communities can benefit from such initiatives. We provide a spatial analysis of the carbon and biodiversity potential of one offset method, planting biodiverse native vegetation, on Indigenous land across Australia. We discover significant potential for opportunities for Indigenous communities to achieve carbon sequestration and biodiversity goals through biodiverse plantings, largely in southern and eastern Australia, but the economic feasibility of these projects depend on carbon market assumptions. Our national scale cost-effectiveness analysis is critical to enable Indigenous communities to maximise the benefits available to them through participation in carbon offset schemes.

Biodiverse Planting for Carbon and Biodiversity on Indigenous Land

PubMed Central

Renwick, Anna R.; Robinson, Catherine J.; Martin, Tara G.; May, Tracey; Polglase, Phil; Possingham, Hugh P.; Carwardine, Josie

2014-01-01

Carbon offset mechanisms have been established to mitigate climate change through changes in land management. Regulatory frameworks enable landowners and managers to generate saleable carbon credits on domestic and international markets. Identifying and managing the associated co-benefits and dis-benefits involved in the adoption of carbon offset projects is important for the projects to contribute to the broader goal of sustainable development and the provision of benefits to the local communities. So far it has been unclear how Indigenous communities can benefit from such initiatives. We provide a spatial analysis of the carbon and biodiversity potential of one offset method, planting biodiverse native vegetation, on Indigenous land across Australia. We discover significant potential for opportunities for Indigenous communities to achieve carbon sequestration and biodiversity goals through biodiverse plantings, largely in southern and eastern Australia, but the economic feasibility of these projects depend on carbon market assumptions. Our national scale cost-effectiveness analysis is critical to enable Indigenous communities to maximise the benefits available to them through participation in carbon offset schemes. PMID:24637736

"We need our own food, to grow our own veggies…" Remote Aboriginal food gardens in the Top End of Australia's Northern Territory.

PubMed

Hume, Andrew; O'Dea, Kerin; Brimblecombe, Julie

2013-10-01

Remote Aboriginal community gardens (gardens) frequently operate below their full potential. A set of gardening sustainability principles may improve their planning, operation and long-term sustainability. This paper aims to document the principles of sustainability of non-profit remote Aboriginal community gardens in the Top End of the Northern Territory. Throughout 2011, gardens in the Top End of the Northern Territory were visited. Interviews and observational data were used to explore the principles of garden sustainability with participants. Subsequent iterative thematic analysis informed development of a set of gardening sustainability principles. Principles of sustainability included effective garden planning; community autonomy, consultation and engagement; growing community vetted crops; employing long-term, effective, culturally sensitive managers; long-term, transparent funding organisations and cycles; garden integration into existing food supply chains; culturally appropriate employment arrangements; and physical aspects of successful gardening. This work uniquely consults gardeners, managers and Aboriginal and non-Aboriginal people of both genders in the largest reported study of its type, resulting in new and expanded findings, particularly including new social factors for gardening success. Expanding the understanding of what makes gardens work to include the important social factors identified here may have merit. © 2013 The Authors. ANZJPH © 2013 Public Health Association of Australia.

Implications of land rights reform for Indigenous health.

PubMed

Watson, Nicole L

2007-05-21

In August 2006, the Aboriginal Land Rights (Northern Territory) Amendment Bill 2006 (Cwlth) was passed into law, introducing, among other things, a system of 99-year leases over Indigenous townships. The leasing scheme will diminish the control that traditional owners previously exercised over their lands. This is at odds with research indicating that control over land is a positive influence on Indigenous health.

9. Historic American Buildings Survey U.S. Land Commission, Clerk Records ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

9. Historic American Buildings Survey U.S. Land Commission, Clerk Records of Northern California Original: August 1854 Re-photo: April 1938 - Mission San Rafael Archangel, San Rafael, Marin County, CA

Quantifying the synergistic effect of the precipitation and land use on sandy desertification at county level: a case study in Naiman Banner, Northern China.

PubMed

Xiaodong, Ge; Jinren, Ni; Zhenshan, Li; Ronggui, Hu; Xin, Ming; Qing, Ye

2013-07-15

Assessing the driving forces of sandy desertification is fundamental and important for its control. It has been widely accepted that both climatic conditions and land use have great impact on sandy desertification in northern China. However, the relative role and synergistic effect of each driving force of sandy desertification are still not clear. In this paper, an indicator named as SI was defined to represent the integrated probability of sandy desertification caused by land use. A quantitative method was developed for characterizing the relative roles of annual precipitation and land use to sandy desertification in both spatial and temporal dimensions at county level. Results showed that, at county level, land use was the main cause of sandy desertification for Naiman Banner since 1987-2009. In the case of spatial dimension, the different combination of land use types decided the distribution of sandy desertification probability and finally decided the spatial pattern of bared sand land. In the case of temporal dimension, the synergistic effect of land use and precipitation highly influenced the spatial distribution of sandy desertification. Copyright © 2013 Elsevier Ltd. All rights reserved.

The effects of land cover and land use change on the contemporary carbon balance of the arctic and boreal terrestrial ecosystems of northern Eurasia

USGS Publications Warehouse

Hayes, Daniel J.; McGuire, A. David; Kicklighter, David W.; Burnside , Todd J.; Melillo, Jerry M.

2010-01-01

Recent changes in climate, disturbance regimes and land use and management systems in Northern Eurasia have the potential to disrupt the terrestrial sink of atmospheric CO2 in a way that accelerates global climate change. To determine the recent trends in the carbon balance of the arctic and boreal ecosystems of this region, we performed a retrospective analysis of terrestrial carbon dynamics across northern Eurasia over a recent 10-year period using a terrestrial biogeochemical process model. The results of the simulations suggest a shift in direction of the net flux from the terrestrial sink of earlier decades to a net source on the order of 45 Tg C year−1between 1997 and 2006. The simulation framework and subsequent analyses presented in this study attribute this shift to a large loss of carbon from boreal forest ecosystems, which experienced a trend of decreasing precipitation and a large area burned during this time period.

Multiple shallow level sill intrusions coupled with hydromagmatic explosive eruptions marked the initial phase of Ferrar large igneous province magmatism in northern Victoria Land, Antarctica

USGS Publications Warehouse

Viereck-Goette, L.; Schöner, R.; Bomfleur, B.; Schneider, J.

2007-01-01

Field data gathered during GANOVEX IX (2005/2006) in Northern Victoria Land, Antarctica, indicate that volcaniclastic deposits of phreatomagmatic eruptions (so-called Exposure Hill Type events) are intercalated with fluvial deposits of Triassic-Jurassic age at two stratigraphic levels. Abundant scoriaceous spatter (locally welded) indicates a hawaiian/strombolian component. Breccia-filled diatremes, from which volcaniclastic deposits were sourced, are rooted in sills which intruded wet sediments. The deposits are thus subaerial expressions of initial Ferrar magmatism involving intrusion of multiple shallow-level sills. Due to magma-sediment interaction abundant clastic dikes are developed that intrude the sediments and sills. All igneous components in the volcaniclastic deposits are andesitic in composition, as are the chilled margins of the sills. They are more differentiated than the basaltic andesites of the younger effusive section of Kirkpatrick plateau lavas which in northern Victoria Land start with pillow lavas and small volume lava flows from volcanic necks.

Can Geoengineering Effectively Reduce the Land Warming?

NASA Astrophysics Data System (ADS)

Wang, W.; MacMartin, D.; Moore, J. C.; Ji, D.

2017-12-01

Permafrost, defined as ground that remains at or below 0 C for two or more consecutive years, underlies 24% of the land in the Northern Hemisphere. Under recent climate warming, permafrost has begun to thaw, causing changes in ecosystems and impacting northern communities. Using the multiple land model output from the Permafrost Carbon Network and applying 5 commonly used permafrost diagnostic methods, we assess the projected Northern Hemisphere permafrost area under RCP 8.5 scenario. Both the air and soil relative warming change is compared to highlight the soil warming pattern and intensity. Using the multiple Earth System Models output under abrupt 4×CO2, G1, PI-control, G3, G4, and RCP4.5 experiments, a preliminary attempt is also performed to examine the effectiveness of geoengineering schemes on reducing the land warming. Although there is uncertainty in the projected results due to model and method difference, the soil temperature based methods derived permafrost all present an intense decrease by 48% - 68% until 2100. The projected soil temperature by the more physically complicated model shows a different warming pattern compared with the air, which indicates that some potential land process intervene with the land response to atmospheric change. The simulated soil temperature can be effectively cooled down by 2 - 9 degree under G1 compared with abrupt 4×CO2, and by less than 4 degree under G3 and G4 compared with RCP4.5.

How second-growth northern hardwoods develop after thinning

Treesearch

Robert W., Jr. Wilson

1953-01-01

In the northern hardwood region, second-growth stands occupy thousands of acres. These stands are of all ages, in all conditions. They were brought about by fire, charcoal and fuelwood cuttings, land abandonment, or a combination of these causes.

A management guide for northern hardwoods in New England

Treesearch

Adrian M. Gilbert; Victor S. Jensen

1958-01-01

Northern hardwood forests occupy about 9 million acres of land in New England. In recent years, these hardwood forests have made increasing contributions to the economy of this region. Their future management should be even more rewarding.

Training the Trainers in Technology.

ERIC Educational Resources Information Center

Burgan, Owen

The key to successful harnessing of the power and potential of new educational technologies lies in appropriate training of teachers. An educational technology joint venture was created at the Northern Territory University in Darwin (Australia) in which the Institute of Technical and Further Education provided the equipment, the Computing Services…

Melioidosis in New Caledonia

PubMed Central

Currie, Bart J.; Godoy, Daniel; Spratt, Brian G.; Mikulski, Marc; Lacassin, Flore; Garin, Benoit

2005-01-01

Recognized melioidosis-endemic areas are widening. In the South Pacific, melioidosis is endemic in New Caledonia, northern Australia, and Papua New Guinea. We report the first 4 documented cases of human melioidosis from New Caledonia. Molecular typing of 2 Burkholderia pseudomallei isolates suggests a link to Australian strains. PMID:16318706

Assessing the potential for Burkholderia pseudomallei in the southeastern United States

USDA-ARS?s Scientific Manuscript database

Burkholderia pseudomallei, the causative agent of melioidosis, is an underreported zoonosis in many countries where environmental conditions may be favorable for B. pseudomallei. This soil saprophyte is most often detected in tropical areas such as Southeast Asia and Northern Australia where the cas...

Imagination "First": Unleash the Power of Possibility

ERIC Educational Resources Information Center

Handa, Manoj Chandra

2015-01-01

The creativity program, "imagination 'first': unleash the power of possibility," implemented in public primary and secondary schools in Northern Sydney, New South Wales, Australia, deals with the power of imagination in unleashing creativity among gifted students and teachers. Following an in-depth literature review on creativity for…

Post-retirement intentions of nurses and midwives living and working in the Northern Territory of Australia.

PubMed

Voit, Katharina; Carson, D B

2014-01-01

Previous research undertaken in the Northern Territory of Australia has identified interest among nurses in engaging in the active workforce post-retirement. Relatively little is known about which nurses are interested in such engagement, and the types of work arrangements that might be of interest. This study aims to provide an enhanced understanding of the retirement plans and post-retirement employment intentions of nurses and midwives living and working in the Northern Territory (NT) of Australia. An online survey was developed to examine retirement intentions, and investigate the types and facilitators significant for post-retirement engagement. The results indicated a strong interest among nurses and midwives in engaging in post-retirement work, with 73.2% of respondents (n=207) having considered continuing in the active workforce. The most preferred types of engagement included the gradual reduction of hours in current workplaces, part-year or seasonal employment, short-term placements, job-sharing or job-rotation, mentoring, research and policy development or acting as 'Northern Territory representatives' promoting jobs to prospective nurses and midwives elsewhere in Australia. A range of facilitators for post-retirement engagement was found, including for nurses who had not currently considered such engagement. The data collected from this research also identified barriers to post-retirement employment. The most favoured facilitators were financial incentives (90.0% of respondents identified it as a facilitator for post-retirement engagement), followed by support from line management (82.0%). Regardless of whether they had considered engaging post-retirement, the largest proportion of respondents intended to leave the NT for the time of their retirement (33.7%). The most prominent barrier to post-retirement engagement was that only a smaller proportion intended to retire in the NT (24.1%). Importantly, many nurses who had not currently considered post-retirement engagement were interested in some of the opportunities listed in the survey, and may therefore be tempted to consider continued engagement in the future. This study has provided an enhanced understanding of the retirement intentions of nurses and midwives living and working in the NT, and the significant types and facilitators of post-retirement engagement. The barriers arising from the inability of workplaces to cater to the needs of older workers potentially continuing their employment post-retirement are consistent with previous research. The types and facilitators of engagement presented in this study might assist in overcoming these barriers.

Having a baby in the new land: a qualitative exploration of the experiences of Asian migrants in rural Tasmania, Australia.

PubMed

Hoang, H T; Le, Q; Kilpatrick, S

2009-01-01

Australia is a land of cultural diversity. Cultural differences in maternity care may result in conflict between migrants and healthcare providers, especially when migrants have minimal English language knowledge. The aim of the study was to investigate Asian migrant women's child-birth experiences in a rural Australian context. The study consisted of semi-structured interviews conducted with 10 Asian migrant women living in rural Tasmania to explore their childbirth experiences and the barriers they faced in accessing maternal care in the new land. The data were analysed using grounded theory and three main categories were identified: 'migrants with traditional practices in the new land', 'support and postnatal experiences' and 'barriers to accessing maternal care'. The findings revealed that Asian migrants in Tasmania faced language and cultural barriers when dealing with the new healthcare system. Because some Asian migrants retain traditional views and practices for maternity care, confusion and conflicting expectations may occur. Family and community play an important role in supporting migrant women through their maternity care. Providing interpreting services, social support for migrant women and improving the cross-cultural training for healthcare providers were recommended to improve available maternal care services.

The Impact of Insects in the Northern Hardwoods Type

Treesearch

H. J. Macaloney

1966-01-01

The northern hardwoods type occupies about 16 percent -- 8.2 million acres -- of the commercial forest land in the Lake States. The timber has high unit values and represents about 42 percent of the total value of all the commercial forest in the region. Increasing values and markets for northern hardwoods in recent years have stressed the need for better quality in...

Severe wind and fire regimes in northern forests: historical variability at the regional scale

Treesearch

Lisa A. Schulte; David J. Mladenoff

2005-01-01

Within the northern Great Lakes region, mesoscale (10s to 100s of km2) forest patterning is driven by disturbance dynamics. Using original Public Land Survey (PLS) records in northern Wisconsin, USA, we study spatial patterns of wind and fire disturbances during the pre-Euroamerican settlement period (ca. 1850). Our goals were: (1) to...

Effects of climate change on ecosystem services in the Northern Rockies Region [Chapter 11

Treesearch

Travis Warziniack; Megan Lawson; S. Karen Dante-Wood

2018-01-01

In this chapter, we focus on the ecosystem services provided to people who visit, live adjacent to, or otherwise benefit from natural resources on public lands. Communities in the Forest Service, U.S. Department of Agriculture (USFS) Northern Region and the Greater Yellowstone Area (GYA), hereafter called the Northern Rockies region, are highly dependent on ecosystem...

Temporal Tendencies of River Discharge of Five Watersheds of Northern Mexico

Treesearch

José Návar; Humberto Hernández; Julio Ríos

2006-01-01

The watersheds of northern Mexico that encompasses the Rio San Pedro, Sinaloa, Nazas, Aguanaval, San Juan, and San Fernando-Soto La Marina are located within the main mountain ranges of northern Mexico and within the zone of large deserts of the boreal hemisphere. The hydro-climate variations, the management of forest soils and land use changes are shaping the supply...

A Silvicultural Evaluation of Four Methods of Marking Second-growth Northern Hardwood Stands

Treesearch

Rodney D. Jacobs

1966-01-01

Second-growth northern hardwood stands occupy an important segment of the commercial forest land of Upper Michigan and northern Wisconsin. The size- and age-class distributions and species composition of these stands vary considerably, but under all conditions most of the trees are highly defective or poorly formed or of an undesirable species. Forest managers...

Potential Influence of Climate-Induced Vegetation Shifts on Future Land Use and Associated Land Carbon Fluxes in Northern Eurasia

NASA Astrophysics Data System (ADS)

Kicklighter, D. W.; Cai, Y.; Zhuang, Q.; Parfenova, E. I.; Paltsev, S.; Sokolov, A. P.; Melillo, J. M.; Reilly, J. M.; Tchebakova, N. M.; Lu, X.

2014-12-01

Climate change will alter ecosystem metabolism and may lead to a redistribution of vegetation and changes in fire regimes in Northern Eurasia over the 21st century. Land management decisions will interact with these climate-driven changes to reshape the region's landscape. Here we present an assessment of the potential consequences of climate change on land use and associated land carbon sink activity for Northern Eurasia in the context of climate-induced vegetation shifts. Under a 'business-as-usual' scenario, climate-induced vegetation shifts allow expansion of areas devoted to food crop production (15%) and pastures (39%) over the 21st century. Under a climate stabilization scenario, climate-induced vegetation shifts permit expansion of areas devoted to cellulosic biofuel production (25%) and pastures (21%), but reduce the expansion of areas devoted to food crop production by 10%. In both climate scenarios, vegetation shifts further reduce the areas devoted to timber production by 6-8% over this same time period. Fire associated with climate-induced vegetation shifts causes the region to become more of a carbon source than if no vegetation shifts occur. Consideration of the interactions between climate-induced vegetation shifts and human activities through a modeling framework has provided clues to how humans may be able to adapt to a changing world and identified the tradeoffs, including unintended consequences, associated with proposed climate/energy policies.

[Spatiotemporal dynamics of land cover in northern Tibetan Plateau with responses to climate change].

PubMed

Song, Chun-qiao; You, Song-cai; Ke, Ling-hong; Liu, Gao-huan; Zhong, Xin-ke

2011-08-01

By using the 2001-2008 MOMS land cover products (MCDl2Ql) and based on the modified classification scheme embodied the characteristics of land cover in northern Tibetan Plateau, the annual land cover type maps of the Plateau were drawn, with the dynamic changes of each land cover type analyzed by classification statistics, dynamic transfer matrix, and landscape pattern indices. In 2001-2008, due to the acceleration of global climate warming, the areas of glacier and snow-covered land in the Plateau decreased rapidly, and the melted snow water gathered into low-lying valley or basin, making the lake level raised and the lake area enlarged. Some permanent wetlands were formed because of partially submersed grassland. The vegetation cover did not show any evident meliorated or degraded trend. From 2001 to 2004, as the climate became warmer and wetter, the spatial distribution of desert began to shrink, and the proportions of sparse grassland and grassland increased. From 2006 to 2007, due to the warmer and drier climate, the desert bare land increased, and the sparse grassland decreased. From 2001 to 2008, both the landscape fragmentation degree and the land cover heterogeneity decreased, and the differences in the proportions of all land cover types somewhat enlarged.

Estimation of Surface Air Temperature from MODIS 1km Resolution Land Surface Temperature Over Northern China

NASA Technical Reports Server (NTRS)

Shen, Suhung; Leptoukh, Gregory G.; Gerasimov, Irina

2010-01-01

Surface air temperature is a critical variable to describe the energy and water cycle of the Earth-atmosphere system and is a key input element for hydrology and land surface models. It is a very important variable in agricultural applications and climate change studies. This is a preliminary study to examine statistical relationships between ground meteorological station measured surface daily maximum/minimum air temperature and satellite remotely sensed land surface temperature from MODIS over the dry and semiarid regions of northern China. Studies were conducted for both MODIS-Terra and MODIS-Aqua by using year 2009 data. Results indicate that the relationships between surface air temperature and remotely sensed land surface temperature are statistically significant. The relationships between the maximum air temperature and daytime land surface temperature depends significantly on land surface types and vegetation index, but the minimum air temperature and nighttime land surface temperature has little dependence on the surface conditions. Based on linear regression relationship between surface air temperature and MODIS land surface temperature, surface maximum and minimum air temperatures are estimated from 1km MODIS land surface temperature under clear sky conditions. The statistical errors (sigma) of the estimated daily maximum (minimum) air temperature is about 3.8 C(3.7 C).

Shark Bay, Australia as seen from STS-67 Endeavour

NASA Technical Reports Server (NTRS)

1995-01-01

An oblique view of the Shark Bay complex from the east. Hamelin Pool at the center of the photo and Shark Bay proper are separated from Freycinet Estuary and Denham Sound by the Peron Peninsula. These, in turn, are separated from the Indian Ocean by Edel Land Peninsula and Dirk Hartog Island. This arid western coast of western Australia is very sparsely populated, but a few roads can be seen. A complex set of lime-sediment shoals and tidal passes forms the Disappointment Reach shallows. Some red, land-derived mud does make its way into the inter tidal zone along the coast north of the reach. The clouds of light-colored water in Shark Bay and Denham Sound may either be lime sediment, perhaps percipitated from sea water (whitings), or a plankton bloom.

Rabies disease dynamics in naïve dog populations in Australia.

PubMed

Sparkes, Jessica; McLeod, Steven; Ballard, Guy; Fleming, Peter J S; Körtner, Gerhard; Brown, Wendy Y

2016-09-01

Currently, Australia is free from terrestrial rabies but an incursion from nearby Indonesia, where the virus is endemic, is a feasible threat. Here, we aimed to determine whether the response to a simulated rabies incursion would vary between three extant Australian dog populations; free-roaming domestic dogs from a remote indigenous community in northern Australia, and free-roaming domestic and wild dogs in peri-urban areas of north-east New South Wales. We further sought to predict how different management strategies impacted disease dynamics in these populations. We used simple stochastic state-transition models and dog demographic and contact rate data from the three dog populations to simulate rabies spread, and used global and local sensitivity analyses to determine effects of model parameters. To identify the most effective control options, dog removal and vaccination strategies were also simulated. Responses to simulated rabies incursions varied between the dog populations. Free-roaming domestic dogs from north-east New South Wales exhibited the lowest risk for rabies maintenance and spread. Due to low containment and high contact rates, rabies progressed rapidly through free-roaming dogs from the remote indigenous community in northern Australia. In contrast, rabies remained at relatively low levels within the north-east New South Wales wild dog population for over a year prior to an epidemic. Across all scenarios, sensitivity analyses revealed that contact rates and the probability of transmission were the most important drivers of the number of infectious individuals within a population. The number of infectious individuals was less sensitive to birth and death rates. Removal of dogs as a control strategy was not effective for any population modelled, while vaccination rates in excess of 70% of the population resulted in significant reductions in disease progression. The variability in response between these distinct dog groups to a rabies incursion, suggests that a blanket approach to management would not be effective or feasible to control rabies in Australia. Control strategies that take into account the different population and behavioural characteristics of these dog groups will maximise the likelihood of effective and efficient rabies control in Australia. Crown Copyright © 2016. Published by Elsevier B.V. All rights reserved.

Flame retardants (PBDEs) in marine turtles, dugongs and seafood from Queensland, Australia.

PubMed

Hermanussen, S; Matthews, V; Päpke, O; Limpus, C J; Gaus, C

2008-01-01

Polybrominated diphenyl ethers (PBDEs) are used as flame retardants in numerous products. These compounds have been found to enter the marine environment where they have the potential to bioaccumulate in biota. Limited information is currently available concerning the levels of PBDEs in Australian marine wildlife. This study presents baseline information on PBDE levels in a variety of marine species from Queensland, Australia and considers the influence of species-specific factors on contaminant levels and tissue distribution in marine turtles. Overall, the PBDE levels measured in this study are relatively low compared to marine biota from the northern hemisphere, indicating low level input into the marine system of Queensland. This is in general agreement with global estimates which suggest low PBDE usage in Australia. Previous studies, however, have found relatively high PBDE levels in Australian human milk and sera. This discrepancy in contamination trends between terrestrial and marine biota suggests that future transport of PBDEs may occur to the marine system in Australia.

Enhanced performance of the Westinghouse Series 1000 Mobile Satellite Telephone System

NASA Technical Reports Server (NTRS)

Martinson, Richard E.

1995-01-01

The Westinghouse Series 1000 Mobile Satellite Telephone System is designed for land mobile, maritime, and fixed site land applications. The product currently operates on the Optus Mobilesat system in Australia and will operate on American Mobile Satellite Corporation's (AMSC) Skycell service in the U.S. and TMI Communications' (TMIC) MSAT service in Canada. The architecture allows the same transceiver electronics to be used for diverse mobile applications. Advanced antenna designs have made land mobile satellite communications a reality. This paper details the unique high performance product and its configuration for the vehicle mounted land mobile application.

A preliminary investigation of forest carbon changes associated with land-use change in northern New England

Treesearch

Daolan Zheng; Linda S. Heath; Mark J. Ducey; James E. Smith

2009-01-01

Maine (ME), New Hampshire (NH), and Vermont (VT) are three of the four most heavily forested states in the United States. In these states, we examined how land-use change, at the Anderson Level I classification, affected regional forest carbon using the 30-m Multi-Resolution Land Characteristics Consortium 1992/2001 Retrofit Land Cover Change product coupled with...

Provenance of Permian-Triassic Gondwana Sequence Units Accreted to the Banda Arc: Constraints from U/Pb and Hf Analysis of Zircons and Igneous Geochemistry

NASA Astrophysics Data System (ADS)

Flores, J. A.; Spencer, C. J.; Harris, R. A.; Hoiland, C.

2011-12-01

Analysis of zircons from Australian affinity Permo-Triassic units of the Timor region yield age distributions with large peaks at 230-400 Ma and 1750-1900 Ma (n=435). Similar zircon age peaks are also found in rocks from NE Australia and the eastern Cimmerian block. It is likely that these terranes, which are now widely separated, were once part of the northern edge of Gondwana near what is now the NW margin of Australia. The Cimmerian Block was removed from Gondwana during Early Permian rifting and initiation of the Neo-Tethys Ocean. Hf analysis of zircon from the Aileu Complex in Timor and Kisar shows bimodal (juvenial and evolved) magmatism in the Gondwana Sequence of NW Australia at ~300 Ma. The magmatic event produced basalt with rift valley and ocean floor geochemical affinities, and rhyolite. Similar rock types and isotopic signatures are also found in Permo-Triassic igneous units throughout the Cimmerian continental block. The part of the Cimmerian Block with zircon distributions most like the Gondwana Sequence of NW Australia is the terranes of northern Tibet and Malaysia. The large 1750-1900 Ma zircon peak is much more wide spread, and appears in terranes from Baoshan (SW China) to Borneo. The Permo-Triassic rocks of the Timor region fill syn-rift intracratonic basins that successfully rifted in the Jurassic to form the NW margin of Australia. This passive continental margin first entered the Sunda Trench in the Timor region at around 8 Ma causing the Permo-Triassic rocks to accrete to the edge of the Asian Plate and emerge as a series of mountainous islands in the young collision zone. Eventually, the Australian continental margin will collide with the southern edge of the Asian plate and these Gondwana terranes will rejoin. However, it may be difficult to reconstruct the various ventures of they made over the past 300 Ma.

Expedition 9 Landing

NASA Image and Video Library

2004-10-24

Expedition 9 Flight Engineer Michael Fincke shows his happiness with the successful landing in the Syouz spacecraft with fellow crew members, Expedition 9 Commander Gennady Padalka and Russian Space Forces cosmonaut Yuri Shargin. The crew landed in their Soyuz capsule approximately 85 kilometers northeast of Arkalyk in northern Kazakhstan, Sunday, October 24, 2004. Photo Credit: (NASA/Bill Ingalls)

Expedition 9 Landing

NASA Image and Video Library

2004-10-24

An inflatable medical tent stands in the foreground of the Expedition 9 landing site, while in the background the Soyuz capsule lays on its side after landing approximately 85 kilometers northeast of Arkalyk in northern Kazakhstan with Expedition 9 crew members Flight Engineer Michael Fincke, Commander Gennady Padalka and Russian Space Forces cosmonaut Yuri Shargin, Sunday, October 24, 2004.

Forest land application of municipal sludge.

Treesearch

D.G. Brockway

1988-01-01

In Michigan, 199 municipal and numerous industrial wastewater treatment facilities annually generate 222,750 dry tons of sludge, most of which is recycled on farmland. Substantial potential exists, however, to increase application on forest land in the northern two-thirds of the state (Brockway and Nguyen 1986). Although sludge application on agricultural land has...

Habitat selection, movement patterns, and hazards encountered by northern leopard frogs (Lithobates pipiens) in an agricultural landscape

USGS Publications Warehouse

Knutson, Melinda G.; Herner-Thogmartin, Jennifer H.; Thogmartin, Wayne E.; Kapfer, Joshua M.; Nelson, John

2018-01-01

Telemetry data for 59 Northern Leopard Frogs (Lithobates pipiens) breeding in ponds in Houston and Winona Counties, MN; 2001-2002. Agricultural intensification is causing declines in many wildlife species, including Northern Leopard Frogs (Lithobates pipiens). Specific information about frog movements, habitat selection, and sources of mortality can be used to inform conservation-focused land management and acquisition. We studied Northern Leopard Frogs in southeastern Minnesota, part of the Driftless Area ecoregion, characterized by hills and valleys and a mix of agriculture, forests, small towns and farmsteads. In this area, small farm ponds, originally built to control soil erosion are used by the species for breeding and wintering in addition to riparian wetlands. But, this agricultural landscape may be hazardous for frogs moving between breeding, feeding, and wintering habitats. We surgically implanted transmitters into the peritoneal cavity of 59 Northern Leopard Frogs and tracked them from May to October 2001-2002. The total distance traveled by radio-tagged frogs ranged from 12 to 3316 m, the 95% home range averaged 5.3 ± 1.2 (SE) ha, and the 50% core area averaged 1.05 ± 0.3 (SE) ha. As expected, Northern Leopard Frogs selected wetlands over all other land cover classes and row crops were generally avoided at all levels of selection. Only a few tracked frogs were successful at dispersing (n = 6). Most frogs attempting to disperse (n =31) ended up missing (n = 14), died due to mowing (n = 8), or were recorded as transmitter failure (n = 2) or unknown mortalities (n = 1). For the conservation of Northern Leopard Frogs in this agricultural setting, we must consider both the aquatic and the terrestrial needs of this species. Conservation agencies that restore, manage, and acquire wetlands should consider the hazards posed by land uses adjacent to frog breeding and wintering sites and plan for movement corridors between these locations. For example, grasslands that are mowed or hayed between April and October in the north central U.S. and are adjacent to wetlands, pose a direct threat to frogs because these cultivated grasslands are primary locations for summer occupancy. When conservation land managers are selecting sites for acquisition or restoration they should avoid investments that will situate the wetland adjacent to heavily travelled roads and agricultural lands likely to be mowed or hayed. Increasing habitat amount and quality at amphibian breeding, feeding and wintering sites should reduce the energy required and hazards associated with moving long distances. Large, diverse wetlands probably provide all of the requirements needed by Northern Leopard Frogs for survival including food, shelter, breeding and overwintering areas.

Seasonally asymmetric enhancement of northern vegetation productivity

NASA Astrophysics Data System (ADS)

Park, T.; Myneni, R.

2017-12-01

Multiple evidences of widespread greening and increasing terrestrial carbon uptake have been documented. In particular, enhanced gross productivity of northern vegetation has been a critical role leading to observed carbon uptake trend. However, seasonal photosynthetic activity and its contribution to observed annual carbon uptake trend and interannual variability are not well understood. Here, we introduce a multiple-source of datasets including ground, atmospheric and satellite observations, and multiple process-based global vegetation models to understand how seasonal variation of land surface vegetation controls a large-scale carbon exchange. Our analysis clearly shows a seasonally asymmetric enhancement of northern vegetation productivity in growing season during last decades. Particularly, increasing gross productivity in late spring and early summer is obvious and dominant driver explaining observed trend and variability. We observe more asymmetric productivity enhancement in warmer region and this spatially varying asymmetricity in northern vegetation are likely explained by canopy development rate, thermal and light availability. These results imply that continued warming may facilitate amplifying asymmetric vegetation activity and cause these trends to become more pervasive, in turn warming induced regime shift in northern land.

Baseline map of organic carbon in Australian soil to support national carbon accounting and monitoring under climate change

PubMed Central

Viscarra Rossel, Raphael A; Webster, Richard; Bui, Elisabeth N; Baldock, Jeff A

2014-01-01

We can effectively monitor soil condition—and develop sound policies to offset the emissions of greenhouse gases—only with accurate data from which to define baselines. Currently, estimates of soil organic C for countries or continents are either unavailable or largely uncertain because they are derived from sparse data, with large gaps over many areas of the Earth. Here, we derive spatially explicit estimates, and their uncertainty, of the distribution and stock of organic C in the soil of Australia. We assembled and harmonized data from several sources to produce the most comprehensive set of data on the current stock of organic C in soil of the continent. Using them, we have produced a fine spatial resolution baseline map of organic C at the continental scale. We describe how we made it by combining the bootstrap, a decision tree with piecewise regression on environmental variables and geostatistical modelling of residuals. Values of stock were predicted at the nodes of a 3-arc-sec (approximately 90 m) grid and mapped together with their uncertainties. We then calculated baselines of soil organic C storage over the whole of Australia, its states and territories, and regions that define bioclimatic zones, vegetation classes and land use. The average amount of organic C in Australian topsoil is estimated to be 29.7 t ha−1 with 95% confidence limits of 22.6 and 37.9 t ha−1. The total stock of organic C in the 0–30 cm layer of soil for the continent is 24.97 Gt with 95% confidence limits of 19.04 and 31.83 Gt. This represents approximately 3.5% of the total stock in the upper 30 cm of soil worldwide. Australia occupies 5.2% of the global land area, so the total organic C stock of Australian soil makes an important contribution to the global carbon cycle, and it provides a significant potential for sequestration. As the most reliable approximation of the stock of organic C in Australian soil in 2010, our estimates have important applications. They could support Australia's National Carbon Accounting System, help guide the formulation of policy around carbon offset schemes, improve Australia's carbon balances, serve to direct future sampling for inventory, guide the design of monitoring networks and provide a benchmark against which to assess the impact of changes in land cover, land management and climate on the stock of C in Australia. In this way, these estimates would help us to develop strategies to adapt and mitigate the effects of climate change. PMID:24599716

Baseline map of organic carbon in Australian soil to support national carbon accounting and monitoring under climate change.

PubMed

Viscarra Rossel, Raphael A; Webster, Richard; Bui, Elisabeth N; Baldock, Jeff A

2014-09-01

We can effectively monitor soil condition-and develop sound policies to offset the emissions of greenhouse gases-only with accurate data from which to define baselines. Currently, estimates of soil organic C for countries or continents are either unavailable or largely uncertain because they are derived from sparse data, with large gaps over many areas of the Earth. Here, we derive spatially explicit estimates, and their uncertainty, of the distribution and stock of organic C in the soil of Australia. We assembled and harmonized data from several sources to produce the most comprehensive set of data on the current stock of organic C in soil of the continent. Using them, we have produced a fine spatial resolution baseline map of organic C at the continental scale. We describe how we made it by combining the bootstrap, a decision tree with piecewise regression on environmental variables and geostatistical modelling of residuals. Values of stock were predicted at the nodes of a 3-arc-sec (approximately 90 m) grid and mapped together with their uncertainties. We then calculated baselines of soil organic C storage over the whole of Australia, its states and territories, and regions that define bioclimatic zones, vegetation classes and land use. The average amount of organic C in Australian topsoil is estimated to be 29.7 t ha(-1) with 95% confidence limits of 22.6 and 37.9 t ha(-1) . The total stock of organic C in the 0-30 cm layer of soil for the continent is 24.97 Gt with 95% confidence limits of 19.04 and 31.83 Gt. This represents approximately 3.5% of the total stock in the upper 30 cm of soil worldwide. Australia occupies 5.2% of the global land area, so the total organic C stock of Australian soil makes an important contribution to the global carbon cycle, and it provides a significant potential for sequestration. As the most reliable approximation of the stock of organic C in Australian soil in 2010, our estimates have important applications. They could support Australia's National Carbon Accounting System, help guide the formulation of policy around carbon offset schemes, improve Australia's carbon balances, serve to direct future sampling for inventory, guide the design of monitoring networks and provide a benchmark against which to assess the impact of changes in land cover, land management and climate on the stock of C in Australia. In this way, these estimates would help us to develop strategies to adapt and mitigate the effects of climate change. © 2014 The Authors. Global Change Biology Published by John Wiley & Sons Ltd.

Adaptation with climate uncertainty: An examination of agricultural land use in the United States

USGS Publications Warehouse

Mu, Jianhong E.; McCarl, Bruce A.; Sleeter, Benjamin M.; Abatzoglou, John T.; Zhang, Hongliang

2018-01-01

This paper examines adaptation responses to climate change through adjustment of agricultural land use. The climate drivers we examine are changes in long-term climate normals (e.g., 10-year moving averages) and changes in inter-annual climate variability. Using US county level data over 1982 to 2012 from Census of Agriculture, we find that impacts of long-term climate normals are as important as that of inter-annual climate variability. Projecting into the future, we find projected climate change will lead to an expansion in crop land share across the northern and interior western United States with decreases in the south. We also find that grazing land share increases in southern regions and Inland Pacific Northwest and declines in the northern areas. However, the extent to which the adaptation potential would be is dependent on the climate model, emission scenario and time horizon under consideration.

Martian Sunrise at Phoenix Landing Site, Sol 101

NASA Technical Reports Server (NTRS)

2008-01-01

This sequence of nine images taken by the Surface Stereo Imager on NASA's Phoenix Mars Lander shows the sun rising on the morning of the lander's 101st Martian day after landing.

The images were taken on Sept. 5, 2008. The local solar times at the landing site for the nine images were between 1:23 a.m. and 1:41 a.m.

The landing site is on far-northern Mars, and the mission started in late northern spring. For nearly the entire first 90 Martian days of the mission, the sun never set below the horizon. As the amount of sunshine each day declined steadily after that, so has the amount of electricity available for the solar-powered spacecraft.

The Phoenix Mission is led by the University of Arizona, Tucson, on behalf of NASA. Project management of the mission is by JPL, Pasadena, Calif. Spacecraft development was by Lockheed Martin Space Systems, Denver.

Melioidosis, Singapore, 2003–2014

PubMed Central

Pang, Long; Harris, Patrick N.A.; Seiler, Rachel L.; Ooi, Peng Lim; Cutter, Jeffrey; Goh, Kee Tai; Cook, Alex R.; Fisher, Dale

2018-01-01

In contrast with northern Australia and Thailand, in Singapore the incidence of melioidosis and co-incidence of melioidosis and pneumonia have declined. Burkholderia pseudomallei deep abscesses increased 20.4% during 2003–2014. These trends could not be explained by the environmental and climatic factors conventionally ascribed to melioidosis. PMID:29260679

Phomopsis Stem Canker: A reemerging threat to sunflower (Helianthus annuus) in the United States

USDA-ARS?s Scientific Manuscript database

Phomopsis stem canker causes yield reductions on sunflower (Helianthus annuus L.) on several continents, including Australia, Europe, and North America. In the United States, Phomopsis stem canker incidence has increased 16-fold in the Northern Great Plains between 2001 and 2012. Although Diaporthe ...

Degrees of Debt: Funding and Finance for Undergraduates in Anglophone Countries

ERIC Educational Resources Information Center

Kirby, Philip

2016-01-01

This study compares tuition funding arrangements, debt at graduation, and earnings outcomes for full-time domestic undergraduates in eight Anglophone countries: the United Kingdom (England, Wales, Northern Ireland, and Scotland), United States, Canada, Australia, and New Zealand. According to multiple estimates, the average English student faces…

INFO RELEASE. National Information Network for Recreation, Leisure and Sport.

ERIC Educational Resources Information Center

Sharma, Vidya S.

A study by the Northern Territories Department of Community Development systematically and specifically identified information needs and categories of clients through a set of intellectual concepts in the fields of sport, recreation, and leisure. A survey of Australia's serials holdings was conducted to assess the country's existing information…

"Capitalising" on Community? Understanding and Critiquing Instrumentalist Approaches to Indigenous Schooling

ERIC Educational Resources Information Center

Hardy, Ian

2016-01-01

This paper provides insights into non-Indigenous teachers' efforts to engage proactively and productively with students to enhance their learning in a predominantly Indigenous community in northern Queensland, Australia. Drawing upon notions of "funds of knowledge", forms of capital as part of community cultural wealth, Critical Race…

Subverting the Hegemony of Risk: Vulnerability and Transformation among Australian Show Children

ERIC Educational Resources Information Center

Danaher, P. A.; Danaher, Geoff; Moriarty, Beverley

2007-01-01

Background: Australian show people traverse extensive coastal and inland circuits in eastern and northern Australia, bringing the delights of "sideshow alley" to annual agricultural shows. The show people's mobility for most of the school year makes it difficult for their school-age children to attend "regular" schools…

From Telling, to Teaching, towards Learning: A New Approach to Nitrogen Fertility Management of Cereals in Northern Australia.

ERIC Educational Resources Information Center

Lawrence, David; Cawley, Scott

1999-01-01

An agricultural extension workshop on nitrogen use was evaluated by 75% of Australian farmers participating. Use of action learning and adult learning principles helped make the issues presented meaningful and influenced 67% of the respondents' fertilizer decisions. (SK)

Phomopsis stem canker: a re-emerging threat to sunflowers (Helianthus annuus) in the United States

USDA-ARS?s Scientific Manuscript database

Phomopsis stem canker frequently causes yield reductions on sunflowers (Helianthus annuus L.) on several continents, including Australia, Russia, Europe and North America. Between 2001 and 2012, the incidence of Phomopsis stem canker has increased 16 fold in the Northern Great Plains of the United...

Challenges of Conducting Systematic Research in Australia's Northern Territory

ERIC Educational Resources Information Center

Helmer, Janet; Harper, Helen; Lea, Tess; Wolgemuth, Jennifer R.; Chalkiti, Kalotina

2014-01-01

This paper explores the challenges of conducting systematic research, using our experiences of conducting a study to evaluate the effectiveness of ABRACADABRA, an online tool for early childhood literacy instruction as the contextual framework. By discussing how the research team resolved such perennial issues as high teacher turnover, low or…

Working from Our Strengths: Partnerships in Learning

ERIC Educational Resources Information Center

Wallace, Ruth; Manado, Mark; Curry, Cathy; Agar, Richard

2008-01-01

Over the past four years a team of Indigenous and non-Indigenous partners in learning research across Northern Australia have identified many of the issues that underpin the implementation of training and investment through enterprise development to improve economic and community outcomes of Indigenous partners. This paper provides an overview of…

Fire, hypogeous fungi and mycophagous marsupials

Treesearch

James M. Trappe; Andrew W. Claridge; Ari Jumpponen

2005-01-01

In their interesting research on post-fire foraging behaviour of northern bettongs (Bettongia tropica) in tropical Queensland, Australia, Vernes et al. (2004) used forage-diggings of their study animals to locate plots for estimating biomass of hypogeous fungi on prescribed-burnt sites in comparison with unburnt control sites. They concluded that...

Sustaining Education for Sustainability in Turbulent Times

ERIC Educational Resources Information Center

Smith, Gregory A.; Stevenson, Robert B.

2017-01-01

A study of two schools in northern Australia demonstrated the impact on Education for Sustainability (EfS) initiatives of a disruptive policy environment set in motion by neoliberal reforms focused on standards, accountability, and international competitiveness. In one of the schools, a culture characterized by trust and an emphasis on cultivating…

Towed Array Performance in the Littoral Waters of Northern Australia

DTIC Science & Technology

1997-06-01

utilization of inverse beamforming. 14. SUBJECT TERMS Oceanography, Pasive Sonar, Inital Detection Ranges, Arafura Sea, 15. NUMBER OF Beamforming PAGES 121...therefore of interest to ascertain how towed arrays designed in this matter perform in specific areas of operation. The Arafura Sea, shown at Figure 2

The Association of Attention Deficit Hyperactivity Disorder with Socioeconomic Disadvantage: Alternative Explanations and Evidence

ERIC Educational Resources Information Center

Russell, Ginny; Ford, Tamsin; Rosenberg, Rachel; Kelly, Susan

2014-01-01

Background: Studies throughout Northern Europe, the United States and Australia have found an association between childhood attention deficit hyperactivity disorder (ADHD) and family socioeconomic disadvantage. We report further evidence for the association and review potential causal pathways that might explain the link. Methods: Secondary…

Potential impacts on Colorado Rocky Mountain weather due to land use changes on the adjacent Great Plains

USGS Publications Warehouse

Chase, T.N.; Pielke, R.A.; Kittel, T.G.F.; Baron, Jill S.; Stohlgren, T.J.

1999-01-01

Evidence from both meteorological stations and vegetational successional studies suggests that summer temperatures are decreasing in the mountain-plain system in northeast Colorado, particularly since the early 1980s. These trends are coincident with large changes in regional land cover. Trends in global, Northern Hemisphere and continental surface temperatures over the same period are insignificant. These observations suggest that changes in the climate of this mountain-plain system may be, in some part, a result of localized forcing mechanisms. In this study the effects of land use change on the northern Colorado plains, where large regions of grasslands have been transformed into both dry and irrigated agricultural lands, on regional weather is examined in an effort to understand this local deviation from larger-scale trends. We find with high-resolution numerical simulations of a 3-day summer period using a regional atmospheric-land surface model that replacing grasslands with irrigated and dry farmland can have impacts on regional weather and therefore climate which are not limited to regions of direct forcing. Higher elevations remote from regions of land use change are affected as well. Specifically, cases with altered landcover had cooler, moister boundary layers, and diminished low-level upslope winds over portions of the plains. At higher elevations, temperatures also were lower as was low-level convergence. Precipitation and cloud cover were substantially affected in mountain regions. We advance the hypothesis that observed land use changes may have already had a role in explaining part of the observed climate record in the northern Colorado mountain-plain system. Copyright 1999 by the American Geophysical Union.

Removal of NOx and NOy in biomass burning plumes in the boundary layer over northern Australia

NASA Astrophysics Data System (ADS)

Takegawa, N.; Kondo, Y.; Koike, M.; Ko, M.; Kita, K.; Blake, D. R.; Nishi, N.; Hu, W.; Liley, J. B.; Kawakami, S.; Shirai, T.; Miyazaki, Y.; Ikeda, H.; Russel-Smith, J.; Ogawa, T.

2003-05-01

The Biomass Burning and Lightning Experiment Phase B (BIBLE-B) aircraft measurement campaign was conducted over the western Pacific and Australia in August and September 1999. In situ aircraft measurements of carbon monoxide (CO), nitric oxide (NO), total reactive nitrogen (NOy), ozone (O3), nonmethane hydrocarbons (NMHCs), and other species were made during BIBLE-B. Meteorological analysis shows that the trace gases emitted from biomass burning in northern Australia were mostly confined within the planetary boundary layer (below ˜3 km) by strong subsidence in the free troposphere. Removal processes of NOx (equal to measured NO + calculated NO2) and NOy in biomass burning plumes in the boundary layer are examined on the basis of correlation analysis. The photochemical lifetime of NOx in biomass burning plumes during the daytime is estimated to be 0.1 to 0.3 days using the correlations of NOx with short-lived NMHCs and hydroxyl radical (OH) concentration calculated from a constrained photochemical model. Correlation of NOy with CO shows that ˜60% of the NOy molecules originating from biomass burning were removed in the boundary layer within 2-3 days. This result is consistent with dry deposition of nitric acid (HNO3) in the plumes. It is likely that only a small fraction of NOy emitted from biomass burning was exported from the boundary layer to the free troposphere during the BIBLE-B period.

Natural outbreak of Streptococcus agalactiae (GBS) infection in wild giant Queensland grouper, Epinephelus lanceolatus (Bloch), and other wild fish in northern Queensland, Australia.

PubMed

Bowater, R O; Forbes-Faulkner, J; Anderson, I G; Condon, K; Robinson, B; Kong, F; Gilbert, G L; Reynolds, A; Hyland, S; McPherson, G; Brien, J O'; Blyde, D

2012-03-01

Ninety-three giant Queensland grouper, Epinephelus lanceolatus (Bloch), were found dead in Queensland, Australia, from 2007 to 2011. Most dead fish occurred in northern Queensland, with a peak of mortalities in Cairns in June 2008. In 2009, sick wild fish including giant sea catfish, Arius thalassinus (Rüppell), and javelin grunter, Pomadasys kaakan (Cuvier), also occurred in Cairns. In 2009 and 2010, two disease epizootics involving wild stingrays occurred at Sea World marine aquarium. Necropsy, histopathology, bacteriology and PCR determined that the cause of deaths of 12 giant Queensland grouper, three wild fish, six estuary rays, Dasyatis fluviorum (Ogilby), one mangrove whipray, Himantura granulata (Macleay), and one eastern shovelnose ray, Aptychotrema rostrata (Shaw), was Streptococcus agalactiae septicaemia. Biochemical testing of 34 S. agalactiae isolates from giant Queensland grouper, wild fish and stingrays showed all had identical biochemical profiles. The 16S rRNA gene sequences of isolates confirmed all isolates were S. agalactiae; genotyping of selected S. agalactiae isolates showed the isolates from giant Queensland grouper were serotype Ib, whereas isolates from wild fish and stingrays closely resembled serotype II. This is the first report of S. agalactiae from wild giant Queensland grouper and other wild tropical fish and stingray species in Queensland, Australia. © 2012 Blackwell Publishing Ltd and State of Queensland.

Algal bioremediation of waste waters from land-based aquaculture using ulva: selecting target species and strains.

PubMed

Lawton, Rebecca J; Mata, Leonardo; de Nys, Rocky; Paul, Nicholas A

2013-01-01

The optimised reduction of dissolved nutrient loads in aquaculture effluents through bioremediation requires selection of appropriate algal species and strains. The objective of the current study was to identify target species and strains from the macroalgal genus Ulva for bioremediation of land-based aquaculture facilities in Eastern Australia. We surveyed land-based aquaculture facilities and natural coastal environments across three geographic locations in Eastern Australia to determine which species of Ulva occur naturally in this region and conducted growth trials at three temperature treatments on a subset of samples from each location to determine whether local strains had superior performance under local environmental conditions. DNA barcoding using the markers ITS and tufA identified six species of Ulva, with U. ohnoi being the most common blade species and U. sp. 3 the most common filamentous species. Both species occurred at multiple land-based aquaculture facilities in Townsville and Brisbane and multiple strains of each species grew well in culture. Specific growth rates of U. ohnoi and U. sp. 3 were high (over 9% and 15% day(-1) respectively) across temperature treatments. Within species, strains of U. ohnoi had higher growth in temperatures corresponding to local conditions, suggesting that strains may be locally adapted. However, across all temperature treatments Townsville strains had the highest growth rates (11.2-20.4% day(-1)) and Sydney strains had the lowest growth rates (2.5-8.3% day(-1)). We also found significant differences in growth between strains of U. ohnoi collected from the same geographic location, highlighting the potential to isolate and cultivate fast growing strains. In contrast, there was no clearly identifiable competitive strain of filamentous Ulva, with multiple species and strains having variable performance. The fast growth rates and broad geographical distribution of U. ohnoi make this an ideal species to target for bioremediation activities at land-based aquaculture facilities in Eastern Australia.

Managing perennial revegetation in a changing climate: some lessons from ecohydrology.

NASA Astrophysics Data System (ADS)

Smettem, K. R.; Waring, R.; Harper, R. J.; Callow, J. N.

2011-12-01

Interest in understanding the impacts of land use and climate change on ecosystem processes has emerged as a major area of research spanning the biological and physical sciences. South-West Australia faces a drying climate under all Global Climate Model (GCM) scenarios and over the last three decades there has already been a major decline in the volume of surface water resources available for the metropolitan water supply of the region. Climate change has been superimposed on major land use changes that have altered the water and salt balances of many catchments in this part of Australia. In the drier agricultural regions of South-West Australia that experience an annual water deficit, land clearing has resulted in increased groundwater recharge and there has been ongoing interest in the use of perennial vegetation to control groundwater rise by enhancing transpiration losses. Ecological optimality provides a first-order framework for understanding the relation between climate, leaf area index and biomass, which in turn influences catchment evapotranspiration (ET) and carbon sequestration. We review the results from a number of revegetation studies to understand the factors limiting the growth and survival of woody perennials in the landscape. By examining the inter-annual variations in leaf area index of native forested catchments using data from NASA's MODIS Moderate Resolution Imaging Spectroradiometer, we first relate LAI to climate indices and then develop allometric equations to estimate wood mass and carbon storage. Assuming that native perennial vegetation is in dynamic equilibrium with climate and provides a 'reference' state , we identify conditions under which perennial revegetation schemes can be deliberately designed to move outside the ecologically optimal range to achieve specific land management objectives.

LAND STREAMER SEISMIC DATA FROM NORTHERN DELAWARE: A VIABLE ALTERNATIVE FOR IMAGING AQUIFERS IN SUBURBAN AREAS

NASA Astrophysics Data System (ADS)

Velez, C. C.; McLaughlin, P. P.; McGeary, S. E.; Sargent, S. L.

2009-12-01

The Potomac Formation includes the most important confined aquifers in the Coastal Plain of northern Delaware. Development and a growing suburban population are increasing demand for groundwater in the area, making accurate assessment of groundwater water supply increasingly important. Previous studies of subsurface geology indicate that the Potomac Formation is characterized by laterally discontinuous fluvial sand bodies, making it difficult to precisely delineate the distribution and geometry of the aquifer facies based on well correlations alone. A 20-km high-resolution seismic reflection dataset was collected using a land-streamer system in 2008 to constrain subsurface stratigraphy between disparate well locations. The data were collected along roadways in an area of mixed development that includes suburban housing tracts, farmlands, and large industry. A 152-m-deep continuous-cored test hole was drilled in the summer of 2009 adjacent to one of the lines and a full suite of borehole geophysical logs obtained. The land-streamer data are compared to a 3-km dataset collected also in 2008 using conventional methods on farmland in the northern part of the study area. The land streamer system proved to be more effective than conventional seismic reflection methods in this area. Several advantages are evident for the land streamer: 1) overall, the conventional dataset has a higher S/N, 2) on average, collecting data with the land streamer system is four times faster, and 3) the land streamer lines can be longer and therefore more continuous than the conventional lines in a developed area. The land-streamer system has minor disadvantages: traffic control, traffic noise, and in some cases a need for larger crews. Regardless, the land streamer dataset is easier to process, of higher quality, and more cost effective. The final depth images from the land streamer data indicate that the minimum and maximum depths imaged are ~18 m and ~ 268m, with a resolution of ~4 m. This is more than sufficient to resolve aquifer sands in the Potomac Formation ranging from 10 to 20 m thick. The depths of individual reflections are in good agreement with the depths of main lithologic changes seen in cores and geophysical logs at the test hole. The core, geophysical log, and seismic data are being integrated to make a facies classification and facies maps which will contribute to better understand the geometry and distribution of fluid flow pathways, barriers, and ground water resources in northern Delaware.

Biomass burning and biogenic aerosols in northern Australia during the SAFIRED campaign

NASA Astrophysics Data System (ADS)

Milic, Andelija; Mallet, Marc D.; Cravigan, Luke T.; Alroe, Joel; Ristovski, Zoran D.; Selleck, Paul; Lawson, Sarah J.; Ward, Jason; Desservettaz, Maximilien J.; Paton-Walsh, Clare; Williams, Leah R.; Keywood, Melita D.; Miljevic, Branka

2017-03-01

There is a lack of knowledge of how biomass burning aerosols in the tropics age, including those in the fire-prone Northern Territory in Australia. This paper reports chemical characterization of fresh and aged aerosols monitored during the 1-month-long SAFIRED (Savannah Fires in the Early Dry Season) field study, with an emphasis on the chemical signature and aging of organic aerosols. The campaign took place in June 2014 during the early dry season when the surface measurement site, the Australian Tropical Atmospheric Research Station (ATARS), located in the Northern Territory, was heavily influenced by thousands of wild and prescribed bushfires. ATARS was equipped with a wide suite of instrumentation for gaseous and aerosol characterization. A compact time-of-flight aerosol mass spectrometer was deployed to monitor aerosol chemical composition. Approximately 90 % of submicron non-refractory mass was composed of organic material. Ozone enhancement in biomass burning plumes indicated increased air mass photochemistry. The diversity in biomass burning emissions was illustrated through variability in chemical signature (e.g. wide range in f44, from 0.06 to 0.18) for five intense fire events. The background particulate loading was characterized using positive matrix factorization (PMF). A PMF-resolved BBOA (biomass burning organic aerosol) factor comprised 24 % of the submicron non-refractory organic aerosol mass, confirming the significance of fire sources. A dominant PMF factor, OOA (oxygenated organic aerosol), made up 47 % of the sampled aerosol, illustrating the importance of aerosol aging in the Northern Territory. Biogenic isoprene-derived organic aerosol factor was the third significant fraction of the background aerosol (28 %).

Comparative adoption of cone beam computed tomography and panoramic radiography machines across Australia.

PubMed

Zhang, A; Critchley, S; Monsour, P A

2016-12-01

The aim of the present study was to assess the current adoption of cone beam computed tomography (CBCT) and panoramic radiography (PR) machines across Australia. Information regarding registered CBCT and PR machines was obtained from radiation regulators across Australia. The number of X-ray machines was correlated with the population size, the number of dentists, and the gross state product (GSP) per capita, to determine the best fitting regression model(s). In 2014, there were 232 CBCT and 1681 PR machines registered in Australia. Based on absolute counts, Queensland had the largest number of CBCT and PR machines whereas the Northern Territory had the smallest number. However, when based on accessibility in terms of the population size and the number of dentists, the Australian Capital Territory had the most CBCT machines and Western Australia had the most PR machines. The number of X-ray machines correlated strongly with both the population size and the number of dentists, but not with the GSP per capita. In 2014, the ratio of PR to CBCT machines was approximately 7:1. Projected increases in either the population size or the number of dentists could positively impact on the adoption of PR and CBCT machines in Australia. © 2016 Australian Dental Association.

Conclusions [Chapter 13

Treesearch

S. Karen Dante-Wood; Linh Hoang

2018-01-01

The Northern Rockies Adaptation Partnership (NRAP) provided significant contributions to assist climate change response in national forests and national parks of the Northern Rockies region. The effort synthesized the best available scientific information to assess climate change vulnerability, develop adaptation options, and catalyze a collaboration of land management...

Future climate and land uses effects on flow and nutrient loads of a Mediterranean catchment in South Australia.

PubMed

Shrestha, Manoj K; Recknagel, Friedrich; Frizenschaf, Jacqueline; Meyer, Wayne

2017-07-15

Mediterranean catchments experience already high seasonal variability alternating between dry and wet periods, and are more vulnerable to future climate and land use changes. Quantification of catchment response under future changes is particularly crucial for better water resources management. This study assessed the combined effects of future climate and land use changes on water yield, total nitrogen (TN) and total phosphorus (TP) loads of the Mediterranean Onkaparinga catchment in South Australia by means of the eco-hydrological model SWAT. Six different global climate models (GCMs) under two representative concentration pathways (RCPs) and a hypothetical land use change were used for future simulations. The climate models suggested a high degree of uncertainty, varying seasonally, in both flow and nutrient loads; however, a decreasing trend was observed. Average monthly TN and TP load decreased up to -55% and -56% respectively and were found to be dependent on flow magnitude. The annual and seasonal water yield and nutrient loads may only slightly be affected by envisaged land uses, but significantly altered by intermediate and high emission scenarios, predominantly during the spring season. The combined scenarios indicated the possibility of declining flow in future but nutrient enrichment in summer months, originating mainly from the land use scenario, that may elevate the risk of algal blooms in downstream drinking water reservoir. Hence, careful planning of future water resources in a Mediterranean catchment requires the assessment of combined effects of multiple climate models and land use scenarios on both water quantity and quality. Copyright © 2017 Elsevier B.V. All rights reserved.

Outlook for outdoor recreation in the northern United States. A technical document supporting the Northern Forest Futures Project with projections through 2060

Treesearch

J.M. Bowker; Ashley E. Askew

2013-01-01

We develop projections of participation and use for 17 nature-based outdoor recreation activities through 2060 for the Northern United States. Similar to the 2010 Resources Planning Act (RPA) assessment, this report develops recreation projections under futures wherein population growth, socioeconomic conditions, land use changes, and climate are allowed to change over...

Five centuries of climate change in Australia: the view from underground

NASA Astrophysics Data System (ADS)

Pollack, Henry N.; Huang, Shaopeng; Smerdon, Jason E.

2006-10-01

Fifty-seven borehole temperature profiles from across Australia are analysed to reconstruct a ground surface temperature history for the past five centuries. The five-hundred-year reconstruction is characterised by a temperature increase of approximately 0.5 K, with most of the warming occurring in the 19th and 20th centuries. The 17th century was the coolest interval of the five-century reconstruction. Comparison of the geothermal reconstruction to the Australian annual surface air temperature time series in their period of overlap shows excellent agreement. The full geothermal reconstruction also agrees well with the low-frequency component of dendroclimatic reconstructions from Tasmania and New Zealand. The warming of Australia over the past five centuries is only about half that experienced by the continents of the Northern Hemisphere in the same time interval. Copyright

Will the world run out of land? A Kaya-type decomposition to study past trends of cropland expansion

NASA Astrophysics Data System (ADS)

Huber, Veronika; Neher, Ina; Bodirsky, Benjamin L.; Höfner, Kathrin; Schellnhuber, Hans Joachim

2014-01-01

Globally, the further expansion of cropland is limited by the availability of adequate land and by the necessity to spare land for nature conservation and carbon sequestration. Analyzing the causes of past land-use changes can help to better understand the potential drivers of land scarcities of the future. Using the FAOSTAT database, we quantify the contribution of four major factors, namely human population growth, rising per-capita caloric consumption (including food intake and household waste), processing losses (including conversion of vegetal into animal products and non-food use of crops), and yield gains, to cropland expansion rates of the past (1961-2007). We employ a Kaya-type decomposition method that we have adapted to be applicable to drivers of cropland expansion at global and national level. Our results indicate that, all else equal, without the yield gains observed globally since 1961, additional land of the size of Australia would have been put under the plough by 2007. Under this scenario the planetary boundary on global cropland use would have already been transgressed today. By contrast, without rising per-capita caloric consumption and population growth since 1961, an area as large as nearly half and all of Australia could have been spared, respectively. Yield gains, with strongest contributions from maize, wheat and rice, have approximately offset the increasing demand of a growing world population. Analyses at the national scale reveal different modes of land-use transitions dependent on development stage, dietary standards, and international trade intensity of the countries. Despite some well-acknowledged caveats regarding the non-independence of decomposition factors, these results contribute to the empirical ranking of different drivers needed to set research priorities and prepare well-informed projections of land-use change until 2050 and beyond.

NORTHERN OHIO AEROSOL STUDY: STAPHYLOCOCCUS AUREUS EVALUATION

EPA Science Inventory

A consortium of Universities, located in northwest Ohio have received funds to conduct a comprehensive evaluation of land applied biosolids in that state. This USDA funded study includes observing land application practices and evaluating biosolids, soils, runoff water and bioaer...

Pennsylvania's Forests, 2009

Treesearch

George L. McCaskill; William H. McWilliams; Carol A. Alerich; Brett J. Butler; Susan J. Crocker; Grant M. Domke; Doug Griffith; Cassandra M. Kurtz; Shawn Lehman; Tonya W. Lister; Randall S. Morin; W. Keith Moser; Paul Roth; Rachel Riemann; James A. Westfall

2013-01-01

The second full annual inventory of Pennsylvania's forests reports a stable base of 16.7 million acres of forest land. Northern hardwoods and mixed-oak forest-type groups account for 54 and 32 percent of the forest land, respectively. The State's forest land averages about 61 dry tons of wood per acre and almost 6,500 board feet (International ¼-inch...

Integrating single-species management and landscape conservation using regional habitat occurrence models: The northern goshawk in the Southwest, USA

Treesearch

Brett G. Dickson; Thomas D. Sisk; Steven E. Sesnie; Richard T. Reynolds; Steven S. Rosenstock; Christina D. Vojta; Michael F. Ingraldi; Jill M. Rundall

2014-01-01

Conservation planners and land managers are often confronted with scale-associated challenges when assessing the relationship between land management objectives and species conservation. Conservation of individual species typically involves site-level analyses of habitat, whereas land management focuses on larger spatial extents. New models are needed to more...

Homogenization of northern U.S. Great Lakes forests due to land use

Treesearch

Lisa A. Schulte; David J. Mladenoff; Thomas R. Crow; Laura C. Merrick; David T. Cleland

2007-01-01

Human land use of forested regions has intensified worldwide in recent decades, threatening long-term sustainability. Primary effects include conversion of land cover or reversion to an earlier stage of successional development. Both types of change can have cascading effects through ecosystems; however, the longterm effects where forests are allowed to regrow are...

Theoretical Accuracy of Global Snow-Cover Mapping Using Satellite Data in the Earth Observing System (EOS) Era

NASA Technical Reports Server (NTRS)

Hall, D. K.; Foster, J. L.; Salomonson, V. V.; Klein, A. G.; Chien, J. Y. L.

1998-01-01

Following the launch of the Earth Observing System first morning (EOS-AM1) satellite, daily, global snow-cover mapping will be performed automatically at a spatial resolution of 500 m, cloud-cover permitting, using Moderate Resolution Imaging Spectroradiometer (MODIS) data. A technique to calculate theoretical accuracy of the MODIS-derived snow maps is presented. Field studies demonstrate that under cloud-free conditions when snow cover is complete, snow-mapping errors are small (less than 1%) in all land covers studied except forests where errors are greater and more variable. The theoretical accuracy of MODIS snow-cover maps is largely determined by percent forest cover north of the snowline. Using the 17-class International Geosphere-Biosphere Program (IGBP) land-cover maps of North America and Eurasia, the Northern Hemisphere is classified into seven land-cover classes and water. Snow-mapping errors estimated for each of the seven land-cover classes are extrapolated to the entire Northern Hemisphere for areas north of the average continental snowline for each month. Average monthly errors for the Northern Hemisphere are expected to range from 5 - 10%, and the theoretical accuracy of the future global snow-cover maps is 92% or higher. Error estimates will be refined after the first full year that MODIS data are available.

A socioeconomic profile of vulnerable land to desertification in Italy.

PubMed

Salvati, Luca

2014-01-01

Climate changes, soil vulnerability, loss in biodiversity, and growing human pressure are threatening Mediterranean-type ecosystems which are increasingly considered as a desertification hotspot. In this region, land vulnerability to desertification strongly depends on the interplay between natural and anthropogenic factors. The present study proposes a multivariate exploratory analysis of the relationship between the spatial distribution of land vulnerability to desertification and the socioeconomic contexts found in three geographical divisions of Italy (north, center and south) based on statistical indicators. A total of 111 indicators describing different themes (demography, human settlements, labor market and human capital, rural development, income and wealth) were used to discriminate vulnerable from non-vulnerable areas. The resulting socioeconomic profile of vulnerable areas in northern and southern Italy diverged significantly, the importance of demographic and economic indicators being higher in southern Italy than in northern Italy. On the contrary, human settlement indicators were found more important to discriminate vulnerable and non-vulnerable areas in northern Italy, suggesting a role for peri-urbanization in shaping the future vulnerable areas. An in-depth knowledge of the socioeconomic characteristics of vulnerable land may contribute to scenarios' modeling and the development of more effective policies to combat desertification. © 2013 Elsevier B.V. All rights reserved.

Forest Statistics for Minnesota's Northern Pine Unit.

Treesearch

Pat Murray

1991-01-01

The fifth inventory of Minnesota's Northern Pine Unit reports 11.1 million acres of land, of which 6.3 million acres are forested. This bulletin presents statistical highlights and contains detailed tables of forest area, as well as timber volume, growth, removals, mortality, and ownership.

Estimating inbreeding rates in Northern Spotted Owls: insights from pedigrees and spatio-demographic models

EPA Science Inventory

The federally-threatened Northern Spotted Owl (Strix occidentalis caurina) has a substantial influence on management of federal lands. Despite decades of investigation, important details about its status and habits remain unknown. In particular, determining the frequency of inbre...

Agroforestry programs and issues in the northern Marianas Islands

Treesearch

Anthony Paul Tudela

1993-01-01

Agroforestry is an important land-use in the Commonwealth of the Northern Marianas (CNMI) and provides many benefits. Various agencies are involved in forestry and agroforestry, and their programs are summarized in this paper. Major issues involving agroforestry in the CNMI are also discussed.

Balloon exploration of the northern plains of Mars near and north of the Viking 2 landing site

NASA Technical Reports Server (NTRS)

West, Frederick R.

1993-01-01

The next stage of exploratory surveying of the northern plains of Mars after the Mars Observer mission may best be done by Mars Balloon Exploration Vehicles (MBEV's) deployed in the atmosphere above the northern plains near and north of the Viking 2 lander (VL-2) landing site. This region of Mars is favorable for exploration by MBEV's for the following reasons: (1) the low surface elevation (approximately 2km, lower than the standard (zero) elevation of the Martian surface) provides atmospheric pressure sufficient to allow a MBEV to successfully operate and explore this region at the present stage of MBEV design and development; and (2) the relatively smooth nature of the northern plains terrain (few mountains, ridges, valleys, and craters) indicated so far by Mariner 9 and Viking Orbiter data seems adequate for operation of a MBEV when its SNAKE extension is in contact with the surface of one of these plains. The science objectives are presented.

Consensus recommendations on the use of daylight photodynamic therapy with methyl aminolevulinate cream for actinic keratoses in Australia

PubMed Central

Shumack, Stephen; Murrell, Dedee F; Rubel, Diana M; Fernández‐Peñas, Pablo; Salmon, Robert; Hewitt, Daniel; Foley, Peter; Spelman, Lynda

2015-01-01

Abstract Australia has the highest prevalence of actinic keratoses (AK) worldwide. Because of the risk of transformation of AK to invasive squamous cell carcinomas, consensus guidelines recommend that AK are removed using appropriate therapies to prevent progression to invasive disease. Daylight photodynamic therapy (PDT) is emerging as an efficacious treatment for AK, particularly for patients who require treatment of large areas of chronic actinic damage that can be exposed easily to daylight. Daylight PDT with methyl aminolevulinate (MAL) cream is a simple treatment for AK, almost painless, well tolerated and convenient, requiring minimal time in the clinic. Randomised controlled studies from northern Europe and Australia support the use of daylight PDT as an effective therapy for grade I and II AK on the face and scalp. There is sufficient daylight to conduct daylight PDT in Australia at any time of the year and during most weather conditions. Hence, daylight PDT with MAL can be included as an effective and well‐tolerated new treatment option for the treatment of AK in Australia. These consensus recommendations provide guidelines for Australian clinicians on the use of daylight PDT in the treatment of diagnosed AK. PMID:26033230

Intraplate deformation on north-dipping basement structures in the Northern Gawler Craton, Australia: reactivation of original terrane boundaries or later intra-cratonic thrusts?

NASA Astrophysics Data System (ADS)

Baines, G.; Giles, D.; Betts, P. G.; Backé, G.

2007-12-01

Multiple intraplate orogenic events have deformed Neoproterozoic to Carboniferous sedimentary sequences that cover the Archean to Mesoproterozoic basement of the northern Gawler Craton, Australia. These intraplate orogenies reactivated north-dipping basement penetrating faults that are imaged on seismic reflection profiles. These north-dipping structures pre-date Neoproterozoic deposition but their relationships to significant linear magnetic and gravity anomalies that delineate unexposed Archean to Early Mesoproterozoic basement terranes are unclear. The north-dipping structures are either terrane boundaries that formed during continental amalgamation or later faults, which formed during a mid- to late-Mesoproterozoic transpressional orogeny and cross-cut the original lithological terrane boundaries. We model magnetic and gravity data to determine the 3D structure of the unexposed basement of the northern Gawler Craton. These models are constrained by drill hole and surface observations, seismic reflection profiles and petrophysical data, such that geologically reasonable models that can satisfy the data are limited. The basement structures revealed by this modelling approach constrain the origin and significance of the north-dipping structures that were active during the later intraplate Petermann, Delamerian and Alice Springs Orogenies. These results have bearing on which structures are likely to be active during present-day intraplate deformation in other areas, including, for example, current seismic activity along similar basement structures in the Adelaide "Geosyncline".

Minnesota Land Ownership Trends, 1962-1977

Treesearch

Pamela J. Jakes; Alexander Vasilevsky

1980-01-01

The distribution of Minnesota's commercial forest land among ownership classes has remained stable between 1962 and 1977. This note summarizes commercial forest ownership data by Forest Survey Unit for 1962 and 1977 and presents more detailed area statistics for Minnesota's 17 northern countries.

Modelling land cover change in the Ganga basin

NASA Astrophysics Data System (ADS)

Moulds, S.; Tsarouchi, G.; Mijic, A.; Buytaert, W.

2013-12-01

Over recent decades the green revolution in India has driven substantial environmental change. Modelling experiments have identified northern India as a 'hot spot' of land-atmosphere coupling strength during the boreal summer. However, there is a wide range of sensitivity of atmospheric variables to soil moisture between individual climate models. The lack of a comprehensive land cover change dataset to force climate models has been identified as a major contributor to model uncertainty. In this work a time series dataset of land cover change between 1970 and 2010 is constructed for northern India to improve the quantification of regional hydrometeorological feedbacks. The MODIS instrument on board the Aqua and Terra satellites provides near-continuous remotely sensed datasets from 2000 to the present day. However, the quality of satellite products before 2000 is poor. To complete the dataset MODIS images are extrapolated back in time using the Conversion of Land Use and its Effects at small regional extent (CLUE-s) modelling framework. Non-spatial estimates of land cover area from national agriculture and forest statistics, available on a state-wise, annual basis, are used as a direct model input. Land cover change is allocated spatially as a function of biophysical and socioeconomic drivers identified using logistic regression. This dataset will provide an essential input to a high resolution, physically based land surface model to generate the lower boundary condition to assess the impact of land cover change on regional climate.

Northern Region Landbird Monitoring Program: A USFS-University of Montana Partnership Designed to Provide Both Short-term and Long-term Feedback for Land Managers

Treesearch

R. Hutto; Skip Kowalski

2006-01-01

The Northern Region Landbird Monitoring Program (NRLMP) began in 1990 as a cooperative effort between the United States Forest Service (USFS) and the University of Montana. The combination of a research-oriented perspective from the University and a management-needs perspective from the National Forests within the Northern Region led to the realization that landbirds...

Developing and Testing a 3d Cadastral Data Model a Case Study in Australia

NASA Astrophysics Data System (ADS)

Aien, A.; Kalantari, M.; Rajabifard, A.; Williamson, I. P.; Shojaei, D.

2012-07-01

Population growth, urbanization and industrialization place more pressure on land use with the need for increased space. To extend the use and functionality of the land, complex infrastructures are being built, both vertically and horizontally, layered and stacked. These three-dimensional (3D) developments affect the interests (Rights, Restrictions, and Responsibilities (RRRs)) attached to the underlying land. A 3D cadastre will assist in managing the effects of 3D development on a particular extent of land. There are many elements that contribute to developing a 3D cadastre, such as existing of 3D property legislations, 3D DBMS, 3D visualization. However, data modelling is one of the most important elements of a successful 3D cadastre. As architectural models of houses and high rise buildings help their users visualize the final product, 3D cadastre data model supports 3D cadastre users to understand the structure or behavior of the system and has a template that guides them to construct and implement the 3D cadastre. Many jurisdictions, organizations and software developers have built their own cadastral data model. Land Administration Domain Model (DIS-ISO 19152, The Netherlands) and ePlan (Intergovernmental Committee on Surveying and Mapping, Australia) are examples of existing data models. The variation between these data models is the result of different attitudes towards cadastres. However, there is a basic common thread among them all. Current cadastral data models use a 2D land-parcel concept and extend it to support 3D requirements. These data models cannot adequately manage and represent the spatial extent of 3D RRRs. Most of the current cadastral data models have been influenced by a very broad understanding of 3D cadastral concepts because better clarity in what needs to be represented and analysed in the cadastre needs to be established. This paper presents the first version of a 3D Cadastral Data Model (3DCDM_Version 1.0). 3DCDM models both the legal and physical extent of 3D properties and associated interests. The data model extends the traditional cadastral requirements to cover other applications such as urban planning and land valuation and taxation. A demonstration of a test system on the proposed data model is also presented. The test is based on a case study in Victoria, Australia to evaluate the effectiveness of the data model.

Mapping dominant annual land cover from 2009 to 2013 across Victoria, Australia using satellite imagery

PubMed Central

Sheffield, Kathryn; Morse-McNabb, Elizabeth; Clark, Rob; Robson, Susan; Lewis, Hayden

2015-01-01

There is a demand for regularly updated, broad-scale, accurate land cover information in Victoria from multiple stakeholders. This paper documents the methods used to generate an annual dominant land cover (DLC) map for Victoria, Australia from 2009 to 2013. Vegetation phenology parameters derived from an annual time series of the Moderate Resolution Imaging Spectroradiometer Vegetation Indices 16-day 250 m (MOD13Q1) product were used to generate annual DLC maps, using a three-tiered hierarchical classification scheme. Classification accuracy at the broadest (primary) class level was over 91% for all years, while it ranged from 72 to 81% at the secondary class level. The most detailed class level (tertiary) had accuracy levels ranging from 61 to 68%. The approach used was able to accommodate variable climatic conditions, which had substantial impacts on vegetation growth patterns and agricultural production across the state between both regions and years. The production of an annual dataset with complete spatial coverage for Victoria provides a reliable base data set with an accuracy that is fit-for-purpose for many applications. PMID:26602009

Discovery of a novel iflavirus sequence in the eastern paralysis tick Ixodes holocyclus.

PubMed

O'Brien, Caitlin A; Hall-Mendelin, Sonja; Hobson-Peters, Jody; Deliyannis, Georgia; Allen, Andy; Lew-Tabor, Ala; Rodriguez-Valle, Manuel; Barker, Dayana; Barker, Stephen C; Hall, Roy A

2018-05-11

Ixodes holocyclus, the eastern paralysis tick, is a significant parasite in Australia in terms of animal and human health. However, very little is known about its virome. In this study, next-generation sequencing of I. holocyclus salivary glands yielded a full-length genome sequence which phylogenetically groups with viruses classified in the Iflaviridae family and shares 45% amino acid similarity with its closest relative Bole hyalomma asiaticum virus 1. The sequence of this virus, provisionally named Ixodes holocyclus iflavirus (IhIV) has been identified in tick populations from northern New South Wales and Queensland, Australia and represents the first virus sequence reported from I. holocyclus.

Development and Evaluation of a Novel Method for Basic Marksmanship Training on an Australian Army Course

DTIC Science & Technology

2014-02-01

in DSTO’s Land Division. He holds a Bachelor of Science Degree and First Class Honours Degree in Psychology from the University of Adelaide. He...also holds a Master of Psychology Degree from the University of South Australia and is a Registered Psychologist in Australia. He joined DSTO in 2002...including LF6 qualification. There was no evidence of negative training associated with using different colour targets in the simulator and live-fire

GPS NAVSTAR-4 and NTS-2 Long Term Frequency Stability and Time Transfer Analysis.

DTIC Science & Technology

1980-06-30

delta pseudo-range, are taken every 6 s. NTS Tracking Network Figure 4 presents the four station network employed for tracking the NTS spacecraft. Thc ...limits of visibility for the NRL CBD (Chesapeake Bay Division), Panama, Australia, and Eng- land tracking stations are depicted by the symbols C, P...GIAT and, in Australia, with the Division of National Mapping. The CBD tracking station had port- able clock and TV links to the U.S. Naval Observatory

Natural Setting and Vegetation of the Florida Panhandle. An Account of the Environments and Plant Communities of Northern Florida, West of the Suwannee River.

DTIC Science & Technology

1986-01-01

interpreting vegetational processes, then the predictions of environmental impacts with regard to proposed land uses or resource management may be in error...34 Cotton Era........................................ 37 4. LAND USE AND LAN~D MANAGEMENT ............................ 40 Grazing...Setting; Vegetatio1Tt~lants; Eco logy;. 7 ommunities; *History; Land ’ Use ; Enviro mental Setting; Geology; rIhysiography; Rivers; Lakes; Aquifers;.Soils

A bill to convey certain submerged lands to the Commonwealth of the Northern Mariana Islands in order to give that territory the same benefits in its submerged lands as Guam, the Virgin Islands, and American Samoa have in their submerged lands.

THOMAS, 112th Congress

Sen. Bingaman, Jeff [D-NM

2011-03-15

Senate - 05/18/2011 Committee on Energy and Natural Resources Subcommittee on Public Lands and Forests. Hearings held. With printed Hearing: S.Hrg. 112-39. (All Actions) Tracker: This bill has the status IntroducedHere are the steps for Status of Legislation:

Lake Characteristics Influencing Spawning Success of Muskellunge in Northern Wisconsin Lakes

Treesearch

Ashley J. Rust; James S. Diana; Terry L. Margenau; Clayton J. Edwards

2002-01-01

We determined the physical, chemical, biological, and land use characteristics that distinguish northern Wisconsin lakes with self-sustaining populations of muskellunge Esox masquinongy from lakes where stocking is required to maintain populations. Lakes that supported self-sustaining muskellunge populations were characterized by fewer shoreline...

Impact Assessment of the Virginia Railway Express Commuter Rail on Land Use Development Patterns in Northern Virginia

DOT National Transportation Integrated Search

1993-12-01

A new commuter rail system - the Virginia Railway Express (VRE) - began operations in Northern Virginia in mid-1992. The new VRE operated four trains each over two existing rail lines running through metropolitan fringe areas to downtown Washington, ...

Applied Indigenous Studies at Northern Arizona University.

ERIC Educational Resources Information Center

Trosper, Ronald L.

2001-01-01

The Applied Indigenous Studies program at Northern Arizona University aims to prepare American Indian students to assume tribal leadership roles. Its location in the College of Ecosystem Science and Management emphasizes its land-oriented and applied focus. The program's development, core courses, and academic requirements for bachelors degrees…

Magmatic origin and fluid alteration versus inheritance: Complex history of accessory minerals from I-type granites from northern Victoria Land (Antarctica)

NASA Astrophysics Data System (ADS)

Menneken, M.; John, T.; Läufer, A.; Berndt, J.; Henjes-Kunst, F.; Giese, J.

2016-12-01

When reconstructing the formation and evolution of Earths earliest crust, one is still heavily reliant on information that can be gathered from detrital zircon grains, which have been proven to be a useful tool concerning the various isotopic, chemical, and mineralogical features that can be utilized within. However, detailed investigations have shown that some of these tracers might be prone to alteration and will not necessarily reflect conditions during formation [1, 2]. In this study, zircons and their host rocks from the Granite Harbour Intrusives (GHI) of northern Victoria Land, Antarctica, have been investigated with respect to regional evolution of continental crust as well as the reliability of zircon as a recorder of crustal formation. Here we present U-Pb, δ18O, trace element and inclusion data of zircons from Cambro-Ordovician granitoids, as well as geochemical analyses of accessory apatites. Our initial results show that even in I-type granitoids with a presumably simple formation history, U-Pb-age data and related isotopic, chemical, or mineralogical features have to be evaluated carefully in order to constrain the timing of magmatic events, inheritance or fluid alteration events. They do, for example, incorporate a large portion of recycled material, which is clearly reflected by a strong component of inherited U-Pb-zircon ages, but can also be inferred by comparing main- and trace-element compositions of apatite inclusions in zircon with accessory apatites. Apatite inclusions from all investigated samples for example, are clearly higher in F concentration, than their accessory counterparts. However, not all zircon grains record the youngest event, emphasizing that not only alteration might be a key factor to consider when evaluating zircon characteristics with respect to their host rock, but also, the timing and preservation of predating features. [1] Rasmussen et al. (2011) Metamorphic replacement of mineral inclusions in detrital zircon from Jack Hills, Australia: Implications for the Hadean Earth: Geology 39, 1143-1146. [2] Nemchin et al. (2006) Re-evaluation of the origin and evolution of > 4.2 Ga zircons from the Jack Hills metasedimentary rocks: Earth and Planetary Science Letters, v. 244, p. 218-233.

Sex Differences in Occupational Attainment: A Twelve-Nation Study.

ERIC Educational Resources Information Center

Roos, Patricia A.

Differences in the occupational attainment patterns of men and women were investigated by using data from 12 industrial societies. The sample consisted of employed persons 20 to 64 years of age working full- or part-time in the United States, Australia, Denmark, Finland, West Germany, Great Britain, Netherlands, Northern Ireland, Norway, Sweden,…

Cyclone Tracy and the Darwin Educators: A Case in Crisis Management.

ERIC Educational Resources Information Center

Beare, Hedley

The story of successful crisis management teaches some lessons applicable not only to surmounting crises but to everyday management decisions as well. On Christmas eve, 1974, a cyclone demolished 90 percent of the city of Darwin in Australia's Northern Territory. As thousands gathered in neighborhood schools, a team of educational administrators…

Consensus guidelines for dosing of amoxicillin-clavulanate in melioidosis.

PubMed

Cheng, Allen C; Chierakul, Wirongrong; Chaowagul, Wipada; Chetchotisakd, Ploenchan; Limmathurotsakul, Direk; Dance, David A B; Peacock, Sharon J; Currie, Bart J

2008-02-01

Melioidosis is an infectious disease endemic to northern Australia and Southeast Asia. In response to clinical confusion regarding the appropriate dose of amoxicillin-clavulanate, we have developed guidelines for the appropriate dosing of this second-line agent. For eradication therapy for melioidosis, we recommend 20/5 mg/kg orally, three times daily.

Pheromone of the banana-spotting bug, amblypelta lutescens lutescens Distant (Hemiptera: Coreidae): identification, synthesis and field bioassay

USDA-ARS?s Scientific Manuscript database

The banana spotting bug Amblypelta lutescens lutescens Distant (Hemiptera: Coreidae) is one of the principal pests of tree fruits and nuts across northern and eastern Australia. Apart from damage assessments in orchards, there are currently no other methods for monitoring bug activity to aid manage...

Shifting Tides: Reflecting on Regional Aspects of Our Roles as Comparative and International Educators

ERIC Educational Resources Information Center

Shah, Ritesh; McCormick, Alexander; Thomas, Matthew A. M.

2017-01-01

In this paper, we critically interrogate the way in which comparative and international education coursework at two large institutions in Australia and New Zealand embody or challenge teleological, colonial, and Western/Northern-centric perspectives on education and development. Embedded within a broader and introspective examination of our roles…

Polycyclic selection system for the tropical rainforests of northern Australia

Treesearch

Glen T. Dale; Grahame B. Applegate

1992-01-01

The polycyclic selection logging system developed and practiced for many years in the tropical rainforests of north Queensland has been successful in integrating timber production with the protection of conservation values. The system has been used by the Queensland Forest Service to manage north Queensland rainforests. The Queensland system has considerable potential...

77 FR 66850 - Public Workshop on Burkholderia: Exploring Current Issues and Identifying Regulatory Science Gaps

Federal Register 2010, 2011, 2012, 2013, 2014

2012-11-07

...; the U.S. Army Medical Research Institute of Infectious Diseases; the Biomedical Advanced Research and... research needed to advance animal model development and to advance candidate medical countermeasures (MCMs... antibiotics. For example, a 20-year prospective study of melioidosis in northern Australia found an overall...

Influences of Indigenous Language on Spatial Frames of Reference in Aboriginal English

ERIC Educational Resources Information Center

Edmonds-Wathen, Cris

2014-01-01

The Aboriginal English spoken by Indigenous children in remote communities in the Northern Territory of Australia is influenced by the home languages spoken by themselves and their families. This affects uses of spatial terms used in mathematics such as "in front" and "behind." Speakers of the endangered Indigenous Australian…

Sustainable Living on the Tiwi Islands

ERIC Educational Resources Information Center

Burne, Cris; McKaige, Barbie

2016-01-01

This article reports on how the people of the Tiwi Islands (which lie in the Arafura Sea located off the coast of Darwin in Australia's Northern Territory) have carefully observed the rhythms and patterns of their country, developing a complex and precise way of living sustainably in their island environment. In 2015, the Tiwi people shared their…

Swimming with Crocs: Professional Development in a Northern Context

ERIC Educational Resources Information Center

Reedy, Alison; Boitshwarelo, Bopelo; Barnes, Joshua; Billany, Trevor

2015-01-01

Professional development for teacher educators is critical in a rapidly changing environment where graduate teachers are expected to have 21st Century skills and knowledge. As made explicit in a recent report on teacher education in Australia, "the evidence is clear: enhancing the capability of teachers is vital to raising the overall quality…

Interactive Distance e-Learning for Isolated Communities: The Policy Footprint

ERIC Educational Resources Information Center

Crump, Stephen; Twyford, Kylie; Littler, Margaret

2008-01-01

This paper provides information on the policy strand of an investigation into the Australian Research Council Linkage research project into "interactive distance e-learning" [IDeL] following the introduction in New South Wales and in the Northern Territory of Australia of satellite-supported two-way broad-band internet services for…

Developing, Approving and Maintaining Qualifications: Selected International Approaches. Research Report

ERIC Educational Resources Information Center

Misko, Josie

2015-01-01

There are lessons for Australia in the key approaches to the development, approval, maintenance and quality assurance of qualifications adopted in countries overseas. This research takes into account a range of approaches used in selected European Union (EU) member states (Germany, Finland and Sweden), the United Kingdom (England, Northern Ireland…

Increasing Interactive Activity: Using Technology to Enhance Interaction between Teachers, Students and Learning Material.

ERIC Educational Resources Information Center

Bucknall, Ruary

1996-01-01

Overview of the interactive technologies used by the Northern Territory Secondary Correspondence School in Australia: print media utilizing desktop publishing and electronic transfer; telephone or H-F radio; interactive television; and interactive computing. More fully describes its interactive CD-ROM courses. Emphasizes that the programs are…

Role of nonmarket economic values in benefit-cost analysis of public forest management.

Treesearch

Cindy Sorg Swanson; John B. Loomis

1996-01-01

Recreation in the Pacific Northwest is a valuable resource. A method is described that translates recreation on USDA Forest Service and U.S. Department of Interior Bureau of Land Management lands in northern California, western Oregon, and western Washington into economic value. By assigning recreation to land use type (using the Forest Service recreation opportunity...

Forest Area in Michigan Counties, 1966

Treesearch

Arnold J. Ostrom

1967-01-01

In 1966, Michigan had 19.4 million acres of forest land. Almost half of the 18.9 million acres classified as commercial forest land was in Upper Michigan. Since 1955 commercial forest land has increased from 2.4 million to 2.8 million acres in Southern Lower Michigan, and decreased from 7.7 million to 7.0 million acres in Northern Lower Michigan.

The dawn of sustainable forestry in the South

Treesearch

James P. Barnett; Mason C. Carter

2017-01-01

In the late 19th century, virgin southern pine forests in the West Gulf Coast Region remained virtually untouched. After the Civil War, this land was made available by the government for homesteading and sale. Pine timberland was offered for sale at $1.25 per acre. Primarily northern lumbermen and land speculators purchased the land. Lumbering then became the economic...

Diablo trust pinon-juniper restoration sites: Restoring structure to woodlands and savannas

Treesearch

Andrew Gascho Landis; John Duff Bailey

2008-01-01

(Please note, this is an abstract only) Pinon-juniper restoration sites are being implemented in northern Arizona on lands managed by the Diablo Trust that have experienced increased pinon and juniper densities. Such land managers want to restore basic ecosystem structure and function to their lands in a way that preserves their livelihoods and open space in the region...

Climate change impacts on selected global rangeland ecosystem services.

PubMed

Boone, Randall B; Conant, Richard T; Sircely, Jason; Thornton, Philip K; Herrero, Mario

2018-03-01

Rangelands are Earth's dominant land cover and are important providers of ecosystem services. Reliance on rangelands is projected to grow, thus understanding the sensitivity of rangelands to future climates is essential. We used a new ecosystem model of moderate complexity that allows, for the first time, to quantify global changes expected in rangelands under future climates. The mean global annual net primary production (NPP) may decline by 10 g C m -2  year -1 in 2050 under Representative Concentration Pathway (RCP) 8.5, but herbaceous NPP is projected to increase slightly (i.e., average of 3 g C m -2  year -1 ). Responses vary substantially from place-to-place, with large increases in annual productivity projected in northern regions (e.g., a 21% increase in productivity in the US and Canada) and large declines in western Africa (-46% in sub-Saharan western Africa) and Australia (-17%). Soil organic carbon is projected to increase in Australia (9%), the Middle East (14%), and central Asia (16%) and decline in many African savannas (e.g., -18% in sub-Saharan western Africa). Livestock are projected to decline 7.5 to 9.6%, an economic loss of from $9.7 to $12.6 billion. Our results suggest that forage production in Africa is sensitive to changes in climate, which will have substantial impacts on the livelihoods of the more than 180 million people who raise livestock on those rangelands. Our approach and the simulation tool presented here offer considerable potential for forecasting future conditions, highlight regions of concern, and support analyses where costs and benefits of adaptations and policies may be quantified. Otherwise, the technical options and policy and enabling environment that are needed to facilitate widespread adaptation may be very difficult to elucidate. © 2017 John Wiley & Sons Ltd.

The evolution and biogeography of the austral horse fly tribe Scionini (Diptera: Tabanidae: Pangoniinae) inferred from multiple mitochondrial and nuclear genes.

PubMed

Lessard, B D; Cameron, S L; Bayless, K M; Wiegmann, B M; Yeates, D K

2013-09-01

Phylogenetic relationships within the Tabanidae are largely unknown, despite their considerable medical and ecological importance. The first robust phylogenetic hypothesis for the horse fly tribe Scionini is provided, completing the systematic placement of all tribes in the subfamily Pangoniinae. The Scionini consists of seven mostly southern hemisphere genera distributed in Australia, New Guinea, New Zealand and South America. A 5757 bp alignment of 6 genes, including mitochondrial (COI and COII), ribosomal (28S) and nuclear (AATS and CAD regions 1, 3 and 4) genes, was analysed for 176 taxa using both Bayesian and maximum likelihood approaches. Results indicate the Scionini are strongly monophyletic, with the exclusion of the only northern hemisphere genus Goniops. The South American genera Fidena, Pityocera and Scione were strongly monophyletic, corresponding to current morphology-based classification schemes. The most widespread genus Scaptia was paraphyletic and formed nine strongly supported monophyletic clades, each corresponding to either the current subgenera or several previously synonymised genera that should be formally resurrected. Molecular results also reveal a newly recognised genus endemic to New Zealand, formerly placed within Scaptia. Divergence time estimation was employed to assess the global biogeographical patterns in the Pangoniinae. These analyses demonstrated that the Scionini are a typical Gondwanan group whose diversification was influenced by the fragmentation of that ancient land mass. Furthermore, results indicate that the Scionini most likely originated in Australia and subsequently radiated to New Zealand and South American by both long distance dispersal and vicariance. The phylogenetic framework of the Scionini provided herein will be valuable for taxonomic revisions of the Tabanidae. Copyright © 2013 Elsevier Inc. All rights reserved.

Land cover change and water vapour flows: learning from Australia.

PubMed Central

Gordon, Line; Dunlop, Michael; Foran, Barney

2003-01-01

Australia is faced with large-scale dryland salinization problems, largely as a consequence of the clearing of native vegetation for cropland and grassland. We estimate the change in continental water vapour flow (evapotranspiration) of Australia during the past 200 years. During this period there has been a substantial decrease in woody vegetation and a corresponding increase in croplands and grasslands. The shift in land use has caused a ca. 10% decrease in water vapour flows from the continent. This reduction corresponds to an annual freshwater flow of almost 340 km(3). The society-induced alteration of freshwater flows is estimated at more than 15 times the volume of run-off freshwater that is diverted and actively managed in the Australian society. These substantial water vapour flow alterations were previously not addressed in water management but are now causing serious impacts on the Australian society and local economies. Global and continental freshwater assessments and policy often neglects the interplay between freshwater flows and landscape dynamics. Freshwater issues on both regional and global levels must be rethought and the interplay between terrestrial ecosystems and freshwater better incorporated in freshwater and ecosystem management. PMID:14728792

Carpenters Gap 1: A 47,000 year old record of indigenous adaption and innovation

NASA Astrophysics Data System (ADS)

Maloney, Tim; O'Connor, Sue; Wood, Rachel; Aplin, Ken; Balme, Jane

2018-07-01

Here we present the first detailed analysis of the archaeological finds from Carpenters Gap 1 rockshelter, one of the oldest radiocarbon dated sites in Australia and one of the few sites in the Sahul region to preserve both plant and animal remains down to the lowest Pleistocene aged deposits. Occupation at the site began between 51,000 and 45,000 cal BP and continued into the Last Glacial Maximum, and throughout the Holocene. While CG1 has featured in several studies, the full complement of 100 radiocarbon dates is presented here for the first time in stratigraphic context, and a Bayesian model is used to evaluate the age sequence. We present analyses of the stone artefact and faunal assemblages from Square A2, the oldest and deepest square excavated. These data depict a remarkable record of adaptation in technology, mobility, and diet breadth spanning 47,000 years. We discuss the dating and settlement record from CG1 and other northern Australian sites within the context of the new dates for occupation of Madjedbebe in Arnhem Land at 65,000 years (±5700), and implications for colonisation and dispersal within Sahul.

Windblown Dust and Air Quality Under a Changing Climate in the Pacific Northwest

NASA Astrophysics Data System (ADS)

Sharratt, B. S.; Tatarko, J.; Abatzoglou, J. T.; Fox, F.; Huggins, D. R.

2016-12-01

Wind erosion is a concern for sustainable agriculture and societal health in the US Pacific Northwest. Indeed, wind erosion continues to cause exceedances of the National Ambient Air Quality Standard for PM10 in the region. Can we expect air quality to deteriorate or improve as climate changes? Will wind erosion escalate in the future under a warmer and drier climate as forecast for Australia, southern prairies of Canada, northern China, and United States Corn Belt and Colorado Plateau? To answer these questions, we used 18 global climate models, cropping systems simulation model (CropSyst), and the Wind Erosion Prediction System (WEPS) to simulate the complex interactions among climate, crop production, and wind erosion. These simulations were carried out in eastern Washington where wind erosion of agricultural lands contribute to poor air quality in the region. Our results suggest that an increase in temperature and CO2 concentration, coupled with nominal increases in precipitation, will enhance biomass production and reduce soil and PM10 losses by the mid-21st century. This study reveals that climate change may reduce the risk of wind erosion and improve air quality in the Inland Pacific Northwest.

Karst Aquifer in Qatar and its bearing on Natural Rainfall Recharge

NASA Astrophysics Data System (ADS)

Baalousha, Husam; Ackerer, Philippe

2017-04-01

Qatar is an arid country with little rainfall and high evaporation. Surface water is non-existent so aquifer is the only source of natural water. The annual long-term averages of rainfall and evaporation are 80 mm and more than 2000 mm, respectively. Despite the low rainfall and high evaporation, natural recharge from rainfall occurs at an average of approximately 50 million m3 per year. Rainfall recharge in Qatar takes in land depressions that occur all over the country. These depressions are a result of land collapse due to sinkholes and cavity in the limestone formation. In the northern part of the country, karst features occur as a result of dissolution of limestone, which leads to land depressions. Results of this study shows groundwater recharge occurs in land depression areas, especially in the northern part of the country, where surface runoff accumulates in these land depressions and recharges the aquifer. This paper was made possible by NPRP grant # [NPRP 9-030-1-008] from the Qatar National Research Fund (a member of Qatar Foundation). The findings achieved herein are solely the responsibility of the author[s]."

NEESPI focus issues in Environmental Research Letters

NASA Astrophysics Data System (ADS)

Norman, Julian; Groisman, Pavel; Soja, Amber J.

2010-05-01

In 2007 and 2009 Environmental Research Letters published focus issues (edited by Pavel Groisman and Amber J Soja) made up of work carried out by NEESPI participants. Here, we present the content of those focus issues as an invaluable resource for researchers working in the NEESPI study area. The first of the two issues, published in 2007 with title 'Northern Hemisphere High Latitude Climate and Environmental Change', presents a diverse collection of articles that are assembled into five groups devoted to studies of climate and hydrology, land cover and land use, the biogeochemical cycle and its feedbacks, the cryosphere, and human dimensions. The second issue, published in 2009, with title 'Climatic and Environmental Change in Northern Eurasia' presents diverse, assorted studies of different aspects of contemporary change, representing the diversity of climates and ecosystems across Northern Eurasia.

Widespread land surface wind decline in the Northern Hemisphere partly attributed to land surface changes

NASA Astrophysics Data System (ADS)

Thepaut, J.; Vautard, R.; Cattiaux, J.; Yiou, P.; Ciais, P.

2010-12-01

The decline of surface wind observed in many regions of the world is a potential source of concern for wind power electricity generation. It is also suggested as the main cause of decreasing pan evaporation. In China, a persistent and significant decrease of monsoon winds was observed in all seasons. Surface wind declines were also evidenced in several regions of the world (U.S., Australia, several European countries). Except over China, no clear explanation was given for the wind decrease in the regions studied. Whether surface winds decrease is due to changes in the global atmospheric circulation or its variability, in surface processes or to observational trends has therefore not been elucidated. The identification of the drivers of such a decline requires a global investigation of available surface and upper-air wind data, which has not been conducted so far. Here we use global datasets of in-situ wind measurements that contain surface weather stations wind data (hourly or three-hourly data acquisition time step) and rawinsonde vertical wind data profiles (monthly time step) prepared by the NCAR. A set of 822 worldwide surface stations with continuous wind records was selected after a careful elimination of stations with obvious breaks and large gaps. This dataset mostly covers the Northern mid latitudes over the period 1979-2008. Using this data set, we found that annual mean wind speeds have declined at 73% of the surface stations over the past 30 years. In the Northern Hemisphere, positive wind trends are found only in a few places. In Europe, Central Asia, Eastern Asia and in North America the annual mean surface wind speed has decreased on average at a rate of -2.9, -5.9, -4.2, and -1.8 %/decade respectively, i.e. a decrease of about 10% in 30 years and up to about 20% in Central Asia. These results are robust to changes in the station selection method and parameters. By contrast, upper-air winds observed from rawinsondes, geostrophic winds deduced from pressure gradients, and modeled winds from weather re-analyses do not exhibit any comparable stilling trends than at surface stations. For instance, large-scale circulation changes captured in the most recent European Centre for Medium Range Weather Forecast re-analysis (ERA-interim) can only explain only up to 10-50% of the wind stilling, depending on the region. In addition, a significant amount of the slow-down could originate from a generalized increase in surface roughness, due for instance to forest growth and expansion, and urbanization. This hypothesis, which could explain up to 60% of the decline, is supported by remote sensing observations and theoretical calculations combined with meso-scale model simulations. For future wind power energy resource, the part of wind decline due to land cover changes is easier to cope with than that due to global atmospheric circulation slow down.

Testing the usefulness of ERTS-1 imagery for inventorying wildland resources in northern California

NASA Technical Reports Server (NTRS)

Lauer, D. T.; Krumpe, P. F.

1973-01-01

The usefulness of ERTS-1 imagery for inventorying wildland resources in northern California is discussed. Studies are being conducted in two large wildland areas, namely, the Feather River Watershed and the Northern Coastal Zone. The 2.5 million-acre Feather River headwaters area in northern California is the keystone watershed for the California Water Project, one of the most extensive and ambitious water resource developments ever attempted. Consequently, accurate and timely information on the quantity, quality and distribution of timber, forage, water and recreational resources is of immediate importance to each public agency and private group managing this vast, but inaccessible, wildland area. The Northern Coastal Zone (consisting of the counties of Marin, Sonoma, Mendicino, Humbolt and Del Norte) is relatively rural, with an economy based on agriculture, timber, commercial fishing and tourism. However, it is expected that intensive resource use resulting from increasing population will soon become a serious problem unless wise land use planning is undertaken. Thus, this coastal region is particularly well suited to investigations of the ways in which ERTS-1 imagery and other supporting data may be used in conducting land use evaluations.

The effect of ankle bracing on lower extremity biomechanics during landing: A systematic review.

PubMed

Mason-Mackay, A R; Whatman, C; Reid, D

2016-07-01

To examine the evidence for effect of ankle bracing on lower-extremity landing biomechanics. Literature review. Systematic search of the literature on EBSCO health databases. Articles critiqued by two reviewers. Ten studies were identified which investigated the effect of ankle bracing on landing biomechanics. Overall results suggest that landing biomechanics are altered with some brace types but studies disagree as to the particular variables affected. There is evidence that ankle bracing may alter lower-extremity landing biomechanics in a manner which predisposes athletes to injury. The focus of studies on specific biomechanical variables rather than biomechanical patterns, analysis of pooled data means in the presence of differing landing styles between participants, variation in landing-tasks investigated in different studies, and lack of studies investigating goal-directed sport-specific landing tasks creates difficulty in interpreting results. These areas require further research. Copyright © 2015 Sports Medicine Australia. Published by Elsevier Ltd. All rights reserved.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Barton, C.; Vowinkel, E.F.; Nawyn, J.P.

The relation of water quality to hydrogeology and land use was evaluated using analysis of water samples from 71 wells in the northern part of the Potomac-Raritan-Magothy aquifer system in New Jersey. The sampling network was evaluated for variations in hydrogeology. Well depths, pumping rates, and the number of wells in the confined and unconfined parts of the aquifer system did not differ among land-use groups. The influences of hydrogeologic factors on water quality were evaluated without considering land use. Shallow wells had the highest specific conductance and major ion concentrations. Water from wells in the unconfined part of themore » aquifer system had the highest dissolved organic carbon concentration. Dissolved oxygen and nitrate concentrations were lowest, trace metals concentrations were highest, and phenols were detected most frequently in groundwater from undeveloped land. Major ions and trace metals concentrations were lowest, dissolved oxygen and copper concentrations were highest, and pesticides were most frequently detected in groundwater from agricultural land. Nitrate concentrations were highest and orthophosphate, nitrite, and purgeable organics were detected most frequently in groundwater from urban land. These water quality data were compared to data from the same aquifer system in southern New Jersey. Frequencies of detection of purgeable organics among land-use groups were similar in the northern and southern areas. 69 refs., 23 figs., 16 tab.« less

Baobabopsis, a new genus of graminicolous downy mildews from tropical Australia, with an updated key to the genera of downy mildews.

PubMed

Thines, Marco; Telle, Sabine; Choi, Young-Joon; Tan, Yu Pei; Shivas, Roger G

2015-12-01

So far 19 genera of downy mildews have been described, of which seven are parasitic to grasses. Here, we introduce a new genus, Baobabopsis, to accommodate two distinctive downy mildews, B. donbarrettii sp. nov., collected on Perotis rara in northern Australia, and B. enneapogonis sp. nov., collected on Enneapogon spp. in western and central Australia. Baobabopsis donbarrettii produced both oospores and sporangiospores that are morphologically distinct from other downy mildews on grasses. Molecular phylogenetic analyses showed that the two species of Baobabopsis occupied an isolated position among the known genera of graminicolous downy mildews. The importance of the Poaceae for the evolution of downy mildews is highlighted by the observation that more than a third of the known genera of downy mildews occur on grasses, while more than 90 % of the known species of downy mildews infect eudicots.

VLUIS, a land use data product for Victoria, Australia, covering 2006 to 2013

PubMed Central

Morse-McNabb, Elizabeth; Sheffield, Kathryn; Clark, Rob; Lewis, Hayden; Robson, Susan; Cherry, Don; Williams, Steve

2015-01-01

Land Use Information is a key dataset required to enable an understanding of the changing nature of our landscapes and the associated influences on natural resources and regional communities. The Victorian Land Use Information System (VLUIS) data product has been created within the State Government of Victoria to support land use assessments. The project began in 2007 using stakeholder engagement to establish product requirements such as format, classification, frequency and spatial resolution. Its genesis is significantly different to traditional methods, incorporating data from a range of jurisdictions to develop land use information designed for regular on-going creation and consistency. Covering the entire landmass of Victoria, the dataset separately describes land tenure, land use and land cover. These variables are co-registered to a common spatial base (cadastral parcels) across the state for the period 2006 to 2013; biennially for land tenure and land use, and annually for land cover. Data is produced as a spatial GIS feature class. PMID:26602150

VLUIS, a land use data product for Victoria, Australia, covering 2006 to 2013.

PubMed

Morse-McNabb, Elizabeth; Sheffield, Kathryn; Clark, Rob; Lewis, Hayden; Robson, Susan; Cherry, Don; Williams, Steve

2015-11-24

Land Use Information is a key dataset required to enable an understanding of the changing nature of our landscapes and the associated influences on natural resources and regional communities. The Victorian Land Use Information System (VLUIS) data product has been created within the State Government of Victoria to support land use assessments. The project began in 2007 using stakeholder engagement to establish product requirements such as format, classification, frequency and spatial resolution. Its genesis is significantly different to traditional methods, incorporating data from a range of jurisdictions to develop land use information designed for regular on-going creation and consistency. Covering the entire landmass of Victoria, the dataset separately describes land tenure, land use and land cover. These variables are co-registered to a common spatial base (cadastral parcels) across the state for the period 2006 to 2013; biennially for land tenure and land use, and annually for land cover. Data is produced as a spatial GIS feature class.

Observed contrast changes in snow cover phenology in northern middle and high latitudes from 2001–2014

PubMed Central

Chen, Xiaona; Liang, Shunlin; Cao, Yunfeng; He, Tao; Wang, Dongdong

2015-01-01

Quantifying and attributing the phenological changes in snow cover are essential for meteorological, hydrological, ecological, and societal implications. However, snow cover phenology changes have not been well documented. Evidence from multiple satellite and reanalysis data from 2001 to 2014 points out that the snow end date (De) advanced by 5.11 (±2.20) days in northern high latitudes (52–75°N) and was delayed by 3.28 (±2.59) days in northern mid-latitudes (32–52°N) at the 90% confidence level. Dominated by changes in De, snow duration days (Dd) was shorter in duration by 5.57 (±2.55) days in high latitudes and longer by 9.74 (±2.58) days in mid-latitudes. Changes in De during the spring season were consistent with the spatiotemporal pattern of land surface albedo change. Decreased land surface temperature combined with increased precipitation in mid-latitudes and significantly increased land surface temperature in high latitudes, impacted by recent Pacific surface cooling, Arctic amplification and strengthening westerlies, result in contrasting changes in the Northern Hemisphere snow cover phenology. Changes in the snow cover phenology led to contrasting anomalies of snow radiative forcing, which is dominated by De and accounts for 51% of the total shortwave flux anomalies at the top of the atmosphere. PMID:26581632

The historical and palaeoflood record of Katherine river, northern Australia: evaluating the likelihood of extreme discharge events in the context of the 1998 flood

NASA Astrophysics Data System (ADS)

Sandercock, Peter; Wyrwoll, Karl-Heinz

2005-12-01

The discharge regimes of the large rivers of northern Australia are characterized by the occurrence of extreme flood events with far-reaching environmental and societal impacts. In January 1998 the largest flood ever recorded on the Katherine River, northern Australia, resulted in widespread inundation and resultant damage to the town of Katherine. The occurrence of the flood emphasized the unreliability of the then available flood probability estimates and prompted a palaeoflood approach to estimate the recurrence interval of the event. The location of Katherine is ideal for such a study, as the town is located immediately downstream from Katherine Gorge, which provides the necessary bedrock-confined channel required for such an approach. In addition, previous work in Katherine Gorge had demonstrated that the gorge sections hold suitable deposits for palaeoflood stage reconstruction. The results of the present study show that at least two flow events with discharges similar to the 1998 flood have occurred within the last 600 years, and that high-magnitude floods are a general feature of the discharge record of the Katherine River over the last c. 2000 years. Furthermore, because the study was undertaken within a few months of the occurrence of the 1998 flood, it provided the opportunity to evaluate the previously obtained flood discharge estimates and draw attention to the general uncertainties associated with palaeoflood studies. Our results emphasize that palaeoflood stage estimates based on slackwater deposits need to be treated as conservative estimates only. More specifically, with respect to the 1998 event, our study demonstrates that the controls of flood peak were more complex than simply flood routing through the gorge sections. It is clear that the areas downstream from Katherine Gorge made an important contribution to the flood peak of the 1998 event. Copyright

Assessing gully widening and its control in the Debri-Mawi Watershed, northern Ethiopia

USDA-ARS?s Scientific Manuscript database

The highlands of northern Ethiopia suffer from severe land degradation manifested by widespread gully and channel erosion and network development. Research on the geomorphic adjustment of similar landscapes in the midcontinental United States has resulted in the development of the computer models BS...

Land Managers' Perceptions of Risk Recreation in the Northern Rockies.

ERIC Educational Resources Information Center

Allen, Stewart D.

This survey was conducted to determine the frequency of participation in high-risk recreation activities in the Northern Rocky Mountains and to identify how wildland managers perceive the presence of these sports and the problems associated with them. Managers rated perceived risk, management difficulty, and appropriateness given management…

Forest statistics for Michigan's Northern Lower Peninsula Unit, 1993.

Treesearch

Earl C. Leatherberry

1994-01-01

The fifth inventory of Michigan's Northern Lower Peninsula forests reports 11,345.1 thousand acres of land, of which 7,415.2 thousand acres are forested. This bulletin presents statistical highlights and contains detailed tables of forest area, as well as timber volume, growth, removals, mortality, and ownership.

Catchment land use predicts benthic vegetation in small estuaries

PubMed Central

Warry, Fiona Y.; Reich, Paul; Mac Nally, Ralph; Woodland, Ryan J.

2018-01-01

Many estuaries are becoming increasingly eutrophic from human activities within their catchments. Nutrient loads often are used to assess risk of eutrophication to estuaries, but such data are expensive and time consuming to obtain. We compared the percent of fertilized land within a catchment, dissolved inorganic nitrogen loads, catchment to estuary area ratio and flushing time as predictors of the proportion of macroalgae to total vegetation within 14 estuaries in south-eastern Australia. The percent of fertilized land within the catchment was the best predictor of the proportion of macroalgae within the estuaries studied. There was a transition to a dominance of macroalgae once the proportion of fertilized land in the catchment exceeded 24%, highlighting the sensitivity of estuaries to catchment land use. PMID:29473004

Climate change science applications and needs in forest ecosystem management: a workshop organized as part of the northern Wisconsin Climate Change Response Framework Project

Treesearch

Leslie Brandt; Chris Swanston; Linda Parker; Maria Janowiak; Richard Birdsey; Louis Iverson; David Mladenoff; Patricia Butler

2012-01-01

Climate change is leading to direct and indirect impacts on forest tree species and ecosystems in northern Wisconsin. Land managers will need to prepare for and respond to these impacts, so we designed a workshop to identify forest management approaches that can enhance the ability of ecosystems in northern Wisconsin to cope with climate change and address how National...

Historic change in catchment land use and metal loading to Sydney estuary, Australia (1788-2010).

PubMed

Birch, G F; Lean, J; Gunns, T

2015-09-01

Sydney estuary has a long history of environmental degradation and is one of the most modified water ways in Australia due to a highly urbanised catchment (~77 %) and a high population (4.6 million). The objectives of the present study were to map historical land use change from European settlement (1788) to 2010 to determine catchment evolutionary pathways and to estimate catchment loading (total suspended solids, Cu, Pb and Zn) to the estuary over this period. Land use distribution in Sydney catchment, determined for seven time horizons over this period, indicated that a substantial increase in residential land use through subdivision of large estates and an increase in road area resulted in a marked increase in metal loading to Sydney estuary between 1892 and 1936. The decline in industrial activity from a maximum in 1978 (3.9 %) to 1.8 % in 2010 and the introduction of unleaded fuel during this time was accompanied by reduction in metal loading to the estuary. Land use time horizon maps enabled the creation of novel, ternary diagrams to represent temporal evolution in catchment land use. The 15 sub-catchments of Sydney estuary were combined into three major catchment categories, i.e., urban, dense urban and commercial. Present-day annual discharge of stormwater from the Sydney catchment was calculated to be 466,000 ML and annual loadings of total suspended sediment (TSS), Cu, Pb and Zn in tonnes were 49,239, 27, 37 and 57, respectively. Stormwater has superseded industry as the main source of anthropogenic metals to this estuary in recent times.

GEMAS - Tin and Tungsten: possible sources of enriched concentrations in soils in European countries

NASA Astrophysics Data System (ADS)

João Batista, Maria; Filipe, Augusto; Reimann, Clemens

2014-05-01

Tin and tungsten occur related with magmatic differentiation and can be installed in fissures and veins of magmatic rocks or in the neighbor metasediments. Generally, both elements have low chemical mobility in the superficial environment although effectively mobile in detrital media such as stream sediments and deposited in alluvial soils. The most important tin-tungsten deposits in Europe are in Variscides. From the northern Europe, 985 samples and from southern Europe 1123 samples were collected both in agricultural and grazing lands. Analysis were made of Sn , W, pH, TOC, SiO2 from the upper 20 and 10 cm of agricultural and grazing soils, respectively. The present study is part of the GEMAS project a joint project of European geochemical mapping between the EuroGeoSurvey Geochemical Expert Group and EuroMetaux. The results show that in general, at the European (continental) scale natural processes are dominant. It is clear the distinction between NE Europe and SW European tin and tungsten concentrations in soils. Tin geometric mean concentrations in the northern Europe is 0.57 mg kg-1 in agricultural soils and 0.62 mg kg-1 in grazing land; southern Europe 0.91 mg kg-1 in agricultural soils and 0.95 mg kg-1 in grazing land. Tungsten geometric mean concentrations in northern Europe is 0.067 mg kg-1 in agricultural soils and 0.073 mg kg-1 in grazing land and in southern Europe is 0.085 mg kg-1 in agricultural soils and 0.090 mg kg-1 in grazing land. Limit between north and south is the maximum extent of the last glaciation. Grazing land, undisturbed soils for a period of several years, have higher concentrations of Sn and W than agricultural soils which raises the question that if only natural processes are observed. Parent material seems to be the main source of Sn and W to soil. Sn-W rich Variscan granitic intrusions of Central Iberian Zone, Massif Central, Brittany, Cornwall and Bohemia are reflected in soil concentrations. TOC is higher in northern than in southern soils and SiO2 is higher in loess sediments region, in the North German-Poland basin and in the Paris basin. Organic matter may immobilise these metals and silica content influences metallic elements concentrations in soils. Natural processes of soil development, land management of agricultural soils and population density all together may be responsible for higher concentrations of W in the soils of Netherlands Germany, Belgium, Switzerland and northeast France which seems not related with Sn-W mineral provinces. Tin and tungsten are enriched in the Precambrian shields compared to the Caledonian shields soils in the northern countries, although in northern countries climatic conditions may play the most important role in these elements concentrations. Tin and tungsten and tin or tungsten alone or in association of precious metals, copper, uranium, niobium, beryllium, titanium altogether were extracted in 650 small or median size mines in Portugal. Except tin in Neves Corvo mine of the Iberian Pyrite Belt the rest of these mines occurred in the Variscides granitic intrusions region. Tin and tungsten concentrations are therefore well reflected in the northern Portugal soils. At the GEMAS density of sampling pollution and local natural phenomena are not reflected in mapping but this important province is well delimited.

Magnetotelluric characterization of the northern margin of the Yilgarn Craton (Western Australia)

NASA Astrophysics Data System (ADS)

Piña-Varas, Perla; Dentith, Michael

2017-04-01

The northern margin of the Yilgarn Craton (Western Australia) was deformed during the convergence and collision with the Pilbara Craton and the intervening Glenburgh Terrain that created the Capricorn Orogen. The Yilgarn Craton is one of the most intensively mineralised areas of continental crust with world class deposits of gold and nickel. However, the region to its north has surprisingly few deposits. Cratonic margins are considered to be key indicators of prospectivity at a regional scale. The northern limit of the Yilgarn Craton within the Capricorn Orogen is not well resolved at date because of overlying Proterozoic sedimentary basins. We present here some of the results of an extensive magnetotelluric (MT) study that is being performed in the area. This study is a component of large multi-disciplinary geoscience project on the 'Distal Footprints of Giant Ore Systems' in the Capricorn Orogen. The MT dataset consists of a total of 240 broadband magnetotelluric stations (BBMT) and 84 long period stations (LMT). Analysis of the dataset reveals a clear 3-D geoelectrical behaviour and extreme complexity for most of the sites, including an extremely high number of sites with phases out-of-quadrant at long periods. 3-D inverse modelling of the MT data shows high resistivity Archean units and low resistivity Paleoproterozoic basins, including very low resistivity structures at depth. These strong resistivity contrasts allow us to successfully map northern margin of the Yilgarn Craton beneath basin cover, as well as identifying major lateral conductivity changes in the deep crust suggestive of different tectonic blocks. Upper crustal conductive zones can be correlated with faults on seismic reflection data. Our results suggest MT surveys are a useful tool for regional-scale exploration in the study area and in area of thick cover in general.

Anabranching rivers on the Northern Plains of arid central Australia

NASA Astrophysics Data System (ADS)

Tooth, Stephen; Nanson, Gerald C.

1999-09-01

Anabranching rivers are a widespread feature of the Northern Plains in the Alice Springs region of central Australia but their unusual characteristics previously have not been described. On the Northern Plains, anabranching occurs on rivers transporting bedloads of coarse sand and gravel and is characterised by channels of variable size and shape which occur within a broader, typically well-defined, channel-train. Channels are separated by channel-train ridges—narrow, flow-aligned, vegetated features—or by wider islands. Ridges and islands are either depositional features (formed in situ by accretionary processes) or erosional features (formed by excision from once-continuous areas of floodplain). Vegetation plays a key role in the initiation, survival and growth of depositional forms through its influence on flow, sediment transport and ridge and island stability. Anabranching is also related to the influence of tributaries, for some large rivers alternate from single-thread to anabranching along their length in response to tributary inputs of water and sediment. Tributary inputs occur during flow events that are either independent from, or in concert with, floods in the trunk channel. Ridges and islands form in association with tributaries as a result of various hydrological, depositional and erosional processes, including irrigation of enhanced numbers of in-channel trees and resulting lee-side sediment accretion, floodplain scour, and the formation and maintenance of deferred-junction tributaries. The change from single-thread to anabranching downstream of tributary junctions occurs in the absence of any significant change in channel gradient or degree of channel confinement. On the Northern Plains, anabranching appears to be a stable river pattern that helps to maintain the throughput of relatively coarse sediment in low-gradient (typically 0.0005-0.002) channels characterised by an abundance of within-channel vegetation and subject to declining downstream discharges.

Species delimitation in the Gehyra nana (Squamata: Gekkonidae) complex: cryptic and divergent morphological evolution in the Australian Monsoonal Tropics, with the description of four new species.

PubMed

Doughty, Paul; Bourke, Gayleen; Tedeschi, Leonardo G; Pratt, Renae C; Oliver, Paul M; Palmer, Russell A; Moritz, Craig

2018-04-04

Recent advances in molecular genetic techniques and increased fine scale sampling in the Australian Monsoonal Tropics (AMT) have provided new impetus to reassess species boundaries in the Gehyra nana species complex, a clade of small-bodied, saxicolous geckos which are widely distributed across northern Australia. A recent phylogenomic analysis revealed eight deeply divergent lineages that occur as a series of overlapping distributions across the AMT and which, as a whole, are paraphyletic with four previously described species. Several of these lineages currently included in G. nana are phenotypically distinct, while others are highly conservative morphologically. Here we use an integrated approach to explore species delimitation in this complex. We redefine G. nana as a widespread taxon with complex genetic structure across the Kimberley of Western Australia and Top End of the Northern Territory, including a lineage with mtDNA introgressed from the larger-bodied G. multiporosa. We describe four new species with more restricted distributions within the G. nana complex. The new species are phylogenetically divergent and morphologically diagnosable, and include the relatively cryptic G. paranana sp. nov. from the western Northern Territory, the large-bodied G. pseudopunctata sp. nov. from the southern Kimberley ranges, G. granulum sp. nov., a small-bodied form with granules on the proximal lamellae from the north-west and southern Kimberley ranges and the small-bodied G. pluraporosa sp. nov. restricted to the northern Kimberley. Our revision largely stabilises the taxonomy of the G. nana complex, although further analyses of species limits among the remaining mostly parapatric lineages of G. nana sensu stricto are warranted.

Importance of soil thermal dynamics on land carbon sequestration in Northern Eurasia during the 21st century

NASA Astrophysics Data System (ADS)

Kicklighter, David; Monier, Erwan; Sokolov, Andrei; Zhuang, Qianlai; Melillo, Jerry

2015-04-01

Recent modeling studies have suggested that carbon sinks in pan-arctic ecosystems may be weakening partially as a result of warming-induced increases in soil organic matter (SOM) decomposition and the exposure of previously frozen SOM to decomposition. This weakening of carbon sinks is likely to continue in the future as vast amount of carbon in permafrost soils is vulnerable to thaw. Here, we examine the importance of considering soil thermal dynamics when determining the effects of climate change and land-use change on carbon dynamics in Northern Eurasia during the 21st century. This importance is assessed by comparing results for a "business as usual" scenario between a version of the Terrestrial Ecosystem Model that does not consider soil thermal dynamics (TEM 4.4) and a version that does consider these dynamics (TEM 6.0). In this scenario, which is similar to the IPCC Representative Concentration Pathways (RCP) 8.5 scenario, the net area covered by food crops and pastures in Northern Eurasia is assumed to remain relatively constant over the 21st century, but the area covered by secondary forests is projected to double as a result of timber harvest and the abandonment of land associated with displacement of agricultural land. Enhanced decomposition from the newly exposed SOM from permafrost thaw also increases nitrogen availability for plant production so that the loss of carbon from the enhanced decomposition is partially compensated by enhanced uptake and storage of atmospheric carbon dioxide in vegetation. Our results indicate that consideration of soil thermal dynamics have a large influence on how simulated terrestrial carbon dynamics in Northern Eurasia respond to changes in climate, atmospheric chemistry (e.g., carbon dioxide fertilization, ozone pollution, nitrogen deposition) and disturbances.

Understanding coastal processes to assist with coastal erosion management in Darwin Harbour, Northern Territory, Australia

NASA Astrophysics Data System (ADS)

Tonyes, S. G.; Wasson, R. J.; Munksgaard, N. C.; Evans, K. G.; Brinkman, R.; Williams, D. K.

2017-02-01

Sand transport pathways in Darwin Harbour, Northern Territory, Australia, are being investigated to assist with coastal management. Coastal erosion, which threatens public and private infrastructure, is one of the major problems along the harbour beaches. A study of sediment transport is essential to identify the challenges encountered by the stakeholders in coastal management. Darwin Harbour, located in the tropical, cyclone prone area of Australia, was, until recently, considered a near pristine estuary. A semi-diurnal macro-tidal embayment, the tidal variation in the harbour reaches up to 8 m with a mean tidal range of 3.7 m. The beach morphology consists of sandy pocket beaches between coastal cliffs, sandbars, rocky shore platforms, tidal flats and mangrove fringes. A two-dimensional depth averaged finite-element hydrodynamic model (RMA-2), coupled with a sediment transport model (RMA-11) from Resource Modelling Associates, has been used to infer the sources and the depositional areas of sand in the harbour. Grain size distributions and geochemical analysis are also used to characterize the sand and its source(s). Initial results show that the beach sand is mostly of offshore origin with small sand input from the rivers. Potential supplementary sand sources are the eroded materials from the shore platforms and the rocky cliffs. Due to the rapid development in Darwin Harbour, this study is fundamental in understanding coastal processes to support decision making in coastal management, particularly in a macro-tidal, tropical estuary.

Acute Post-Streptococcal Glomerulonephritis in the Northern Territory of Australia: A Review of 16 Years Data and Comparison with the Literature

PubMed Central

Marshall, Catherine S.; Cheng, Allen C.; Markey, Peter G.; Towers, Rebecca J.; Richardson, Leisha J.; Fagan, Peter K.; Scott, Lesley; Krause, Vicki L.; Currie, Bart J.

2011-01-01

Data relating to acute post-streptococcal glomerulonephritis (APSGN) from the notifiable diseases surveillance system in the Northern Territory of Australia was extracted and analyzed. Isolates of Streptococcus pyogenes from confirmed cases were emm sequence typed. From 1991 to July 2008, there were 415 confirmed cases and 23 probable cases of APSGN notified. Four hundred fifteen (94.7%) of these were Indigenous Australians and 428 (97.7%) were people living in remote or very remote locations. The median age of cases was 7 years (range 0–54). The incidence of confirmed cases was 12.5/100,000 person-years, with an incidence in Indigenous Australian children younger than 15 years of age of 94.3 cases/100,000 person-years. The overall rate ratio of confirmed cases in Indigenous Australians to non-Indigenous Australians was 53.6 (95% confidence interval 32.6–94.8). Outbreaks of disease across multiple communities occurred in 1995 (N = 68), 2000 (N = 55), and 2005 (N = 87 [confirmed cases]). Various emm types of S. pyogenes were isolated from cases of APSGN including some types not previously recognized to be nephritogenic. The widespread outbreak in 2005 was caused by emm55.0 S. pyogenes. Acute post-streptococcal glomerulonephritis continues to occur in remote Indigenous communities in Australia at rates comparable to or higher than those estimated in developing countries. Improvements in preventative and outbreak control strategies are needed. PMID:21976576

Acute post-streptococcal glomerulonephritis in the Northern Territory of Australia: a review of 16 years data and comparison with the literature.

PubMed

Marshall, Catherine S; Cheng, Allen C; Markey, Peter G; Towers, Rebecca J; Richardson, Leisha J; Fagan, Peter K; Scott, Lesley; Krause, Vicki L; Currie, Bart J

2011-10-01

Data relating to acute post-streptococcal glomerulonephritis (APSGN) from the notifiable diseases surveillance system in the Northern Territory of Australia was extracted and analyzed. Isolates of Streptococcus pyogenes from confirmed cases were emm sequence typed. From 1991 to July 2008, there were 415 confirmed cases and 23 probable cases of APSGN notified. Four hundred fifteen (94.7%) of these were Indigenous Australians and 428 (97.7%) were people living in remote or very remote locations. The median age of cases was 7 years (range 0-54). The incidence of confirmed cases was 12.5/100,000 person-years, with an incidence in Indigenous Australian children younger than 15 years of age of 94.3 cases/100,000 person-years. The overall rate ratio of confirmed cases in Indigenous Australians to non-Indigenous Australians was 53.6 (95% confidence interval 32.6-94.8). Outbreaks of disease across multiple communities occurred in 1995 (N = 68), 2000 (N = 55), and 2005 (N = 87 [confirmed cases]). Various emm types of S. pyogenes were isolated from cases of APSGN including some types not previously recognized to be nephritogenic. The widespread outbreak in 2005 was caused by emm55.0 S. pyogenes. Acute post-streptococcal glomerulonephritis continues to occur in remote Indigenous communities in Australia at rates comparable to or higher than those estimated in developing countries. Improvements in preventative and outbreak control strategies are needed.

Water Ecosystem Services in Northern Australia—How Much Are They Worth and Who Should Pay for Their Provision?

PubMed Central

Zander, Kerstin K.; Parkes, Rowena; Straton, Anna; Garnett, Stephen T.

2013-01-01

There is ongoing pressure to develop the largely unaltered Daly River catchment in northern Australia for agriculture. However, a choice experiment among people in the region and in Australia’s largest city, Sydney, shows that people are prepared to pay substantial amounts to maintain the quality of its ecosystem services. The total stated willingness-to-pay (WTP) for a Daly River conservation programme was about $300, of which people would be willing to pay over half ($161) if the programme retained waterholes for Aboriginal people in good condition. The WTP for high quality recreational fishing and biodiversity values was $120 and $91 respectively. Using the average cost of a recreational fishing license in Australia ($35) as a basis for grounding the stated preferences in empirical values, as well as the cost of park entry fees and the amount of support society provides to agriculture in Australia, the total amount that the 110,000 people in the region are likely to be willing to pay for the retention of the values in the Daly River catchment is about $6 million, while the 4.5 million people in Sydney would be willing to pay about $81 million. A significant finding in this research is that, while fishing, biodiversity and agricultural values all have equivalents in the market economy, the value for which people were willing to pay most, the cultural value, has no equivalent at all and is thus receives almost no investment. PMID:23717611

Differential heating in the Indian Ocean differentially modulates precipitation in the Ganges and Brahmaputra basins

USGS Publications Warehouse

Pervez, Md Shahriar; Henebry, Geoffrey M.

2016-01-01

Indo-Pacific sea surface temperature dynamics play a prominent role in Asian summer monsoon variability. Two interactive climate modes of the Indo-Pacific—the El Niño/Southern Oscillation (ENSO) and the Indian Ocean dipole mode—modulate the amount of precipitation over India, in addition to precipitation over Africa, Indonesia, and Australia. However, this modulation is not spatially uniform. The precipitation in southern India is strongly forced by the Indian Ocean dipole mode and ENSO. In contrast, across northern India, encompassing the Ganges and Brahmaputra basins, the climate mode influence on precipitation is much less. Understanding the forcing of precipitation in these river basins is vital for food security and ecosystem services for over half a billion people. Using 28 years of remote sensing observations, we demonstrate that (i) the tropical west-east differential heating in the Indian Ocean influences the Ganges precipitation and (ii) the north-south differential heating in the Indian Ocean influences the Brahmaputra precipitation. The El Niño phase induces warming in the warm pool of the Indian Ocean and exerts more influence on Ganges precipitation than Brahmaputra precipitation. The analyses indicate that both the magnitude and position of the sea surface temperature anomalies in the Indian Ocean are important drivers for precipitation dynamics that can be effectively summarized using two new indices, one tuned for each basin. These new indices have the potential to aid forecasting of drought and flooding, to contextualize land cover and land use change, and to assess the regional impacts of climate change.

Gaseous Nitrogen Losses from Tropical Savanna Soils of Northern Australia: Dynamics, Controls and Magnitude of N2O, NO, and N2 emissions

NASA Astrophysics Data System (ADS)

Werner, C.; Hickler, T.; Hutley, L. B.; Butterbach-Bahl, K.

2014-12-01

Tropical savanna covers a large fraction of the global land area and thus may have a substantial effect on the global soil-atmosphere exchange of nitrogen. The pronounced seasonality of hygric conditions in this ecosystem affects strongly microbial process rates in the soil. As these microbial processes control the uptake, production, and release of nitrogen compounds, it is thought that this seasonality finally leads to strong temporal dynamics and varying magnitudes of gaseous losses to the atmosphere. However, given their areal extent and in contrast to other ecosystems, still few in-situ or laboratory studies exist that assess the soil-atmosphere exchange of nitrogen. We present laboratory incubation results from intact soil cores obtained from a natural savanna site in Northern Australia, where N2O, NO, and N2 emissions under controlled environmental conditions were investigated. Furthermore, in-situ measurements of high temporal resolution at this site recorded with automated static and dynamic chamber systems are discussed (N2O, NO). This data is then used to assess the performance of a process-based biogeochemical model (LandscapeDNDC), and the potential magnitude and dynamics of components of the site-scale nitrogen cycle where no measurements exist (biological nitrogen fixation and nitrate leaching). Our incubation results show that severe nutrient limitation of the soil only allows for very low N2O emissions (0.12 kg N ha-1 yr-1) and even a periodic N2O uptake. Annual NO emissions were estimated at 0.68 kg N ha-1 yr-1, while the release of inert nitrogen (N2) was estimated at 6.75 kg N ha-1 yr-1 (data excl. contribution by pulse emissions). We observed only minor N2O pulse emissions after watering the soil cores and initial rain events of the dry to wet season transition in-situ, but short-lived NO pulse emissions were substantial. Interestingly, some cores exhibited a very different N2O emission potential, indicating a substantial spatial variability of potential N release. For most soil moisture and temperature settings, N2 emissions dominated the release of gaseous nitrogen loss (82-99% of total gaseous N loss).

Estimating fine-scale land use change dynamics using an expedient photointerpretation-based method

Treesearch

Tonya Lister; Andrew Lister; Eunice Alexander

2009-01-01

Population growth and urban expansion have resulted in the loss of forest land. With growing concerns about this loss and its implications for global processes and carbon budgets, there is a great need for detailed and reliable land use change data. Currently, the Northern Research Station uses an Annual Inventory design whereby all plots are revisited every 5 years...

To convey certain submerged lands to the Commonwealth of the Northern Mariana Islands in order to give that territory the same benefits in its submerged lands as Guam, the Virgin Islands, and American Samoa have in their submerged lands.

THOMAS, 111th Congress

Rep. Sablan, Gregorio Kilili Camacho [D-MP-At Large

2009-02-10

Senate - 05/24/2010 Placed on Senate Legislative Calendar under General Orders. Calendar No. 405. (All Actions) Tracker: This bill has the status Passed HouseHere are the steps for Status of Legislation:

Land use in the northern Coachella Valley

NASA Technical Reports Server (NTRS)

Bale, J. B.; Bowden, L. W.

1973-01-01

Satellite imagery has proved to have great utility for monitoring land use change and as a data source for regional planning. In California, open space desert resources are under severe pressure to serve as a source for recreational gratification to individuals living in the heavily populated southern coastal plain. Concern for these sensitive arid environments has been expressed by both federal and state agencies. The northern half of the Coachella Valley has historically served as a focal point for weekend recreational activity and second homes. Since demand in this area has remained high, land use change from rural to urban residential has been occurring continuously since 1968. This area of rapid change is an ideal site to illustrate the utility of satellite imagery as a data source for planning information, and has served as the areal focus of this investigation.

An overview of occupational health and safety in Australia.

PubMed

Smith, Derek Richard; Yamagata, Zentaro

2002-03-01

Australia is a developed country with a high standard of living, small population and large land area. Manufacturing is currently the largest economic contributor, although mining and agriculture are also significant industries. There are around 10 million employees in total, with retail trade and manufacturing being the largest employers. Manufacturing currently has the highest incidence of workplace injury, although around 5% of all Australian workers suffer from some kind of occupational disease or injury every year. Occupational Health and Safety (OHS) legislation is individually managed and enforced by the 8 states and territories. Training and registration for OHS professionals varies between the speciaities and usually requires a combination of academic qualifications and workplace experience. Non-medical personnel constitute a large proportion of OHS professionals in Australia.

Contrasting landscape influences on sediment supply and stream restoration priorities in northern Fennoscandia (Sweden and Finland) and coastal British Columbia.

PubMed

Rosenfeld, Jordan; Hogan, Daniel; Palm, Daniel; Lundquist, Hans; Nilsson, Christer; Beechie, Timothy J

2011-01-01

Sediment size and supply exert a dominant control on channel structure. We review the role of sediment supply in channel structure, and how regional differences in sediment supply and land use affect stream restoration priorities. We show how stream restoration goals are best understood within a common fluvial geomorphology framework defined by sediment supply, storage, and transport. Land-use impacts in geologically young landscapes with high sediment yields (e.g., coastal British Columbia) typically result in loss of in-stream wood and accelerated sediment inputs from bank erosion, logging roads, hillslopes and gullies. In contrast, northern Sweden and Finland are landscapes with naturally low sediment yields caused by low relief, resistant bedrock, and abundant mainstem lakes that act as sediment traps. Land-use impacts involved extensive channel narrowing, removal of obstructions, and bank armouring with boulders to facilitate timber floating, thereby reducing sediment supply from bank erosion while increasing export through higher channel velocities. These contrasting land-use impacts have pushed stream channels in opposite directions (aggradation versus degradation) within a phase-space defined by sediment transport and supply. Restoration in coastal British Columbia has focused on reducing sediment supply (through bank and hillslope stabilization) and restoring wood inputs. In contrast, restoration in northern Fennoscandia (Sweden and Finland) has focused on channel widening and removal of bank-armouring boulders to increase sediment supply and retention. These contrasting restoration priorities illustrate the consequences of divergent regional land-use impacts on sediment supply, and the utility of planning restoration activities within a mechanistic sediment supply-transport framework.

Thinking Big Picture: Meeting the Needs of Researchers in Northern Australia

ERIC Educational Resources Information Center

Mamtora, Jayshree

2011-01-01

Due to the increase in research activity at Charles Darwin University in recent years, the Library created the position of Research Services Coordinator to meet researcher needs. Eighteen months after the new staff member was in place, an online survey was carried out to gauge the success of the new services and resources provided, and thereby…

Short Report: Consensus Guidelines for Dosing of Amoxicillin-Clavulanate in Melioidosis

PubMed Central

Cheng, Allen C.; Chierakul, Wirongrong; Chaowagul, Wipada; Chetchotisakd, Ploenchan; Limmathurotsakul, Direk; Dance, David A. B.; Peacock, Sharon J.; Currie, Bart J.

2009-01-01

Melioidosis is an infectious disease endemic to northern Australia and Southeast Asia. In response to clinical confusion regarding the appropriate dose of amoxicillin-clavulanate, we have developed guidelines for the appropriate dosing of this second-line agent. For eradication therapy for melioidosis, we recommend 20/5 mg/kg orally, three times daily. PMID:18256414

Context, Diversity and Engagement: Early Intervention with Australian Aboriginal Families in Urban and Remote Contexts

ERIC Educational Resources Information Center

Robinson, Gary; Tyler, William; Jones, Yomei; Silburn, Sven; Zubrick, Stephen R.

2012-01-01

This article describes challenges met implementing an early intervention programme for Aboriginal parents and their children in the NT (Northern Territory) of Australia in the context of efforts to remediate Aboriginal disadvantage. The intervention is an adaptation of an 8- to 10-week, manualised parenting programme designed for four- to…

Tolerance of Serpula lacrymans to copper-based wood preservatives

Treesearch

Anne Christine Steenkjaer Hastrup; Frederick Green; Carol A. Clausen; Bo Jensen

2005-01-01

Serpula lacrymans, the dry rot fungus, is considered the most economically important wood decay fungus in certain temperate regions of the world, namely northern Europe, Japan, and Australia. Previously, copper-based wood preservatives were commonly used for pressure treatment of wood for building construction, but some decay fungi are known to be copper tolerant. In...

Burkholderia pseudomallei infection in a cystic fibrosis patient from the Caribbean: A case report

PubMed Central

Corral, Dimas Mateos; Coates, Allan L; Yau, Yvonne CW; Tellier, Raymond; Glass, Mindy; Jones, Steven M; Waters, Valerie J

2008-01-01

Burkholderia pseudomallei is a pathogen identified with increasing frequency in the respiratory tracts of cystic fibrosis (CF) patients from endemic areas such as Southeast Asia and northern Australia. The following report describes the first known reported case in a CF patient from the Caribbean attending a North American CF clinic. PMID:18716683

Interactive Distance e-Learning for Isolated Communities: Starting and Finishing the Jigsaw

ERIC Educational Resources Information Center

Crump, Stephen; Boylan, Colin

2008-01-01

This paper provides information on the background to the two pilot investigations into "interactive distance e-learning" [IDeL] following the introduction in New South Wales and in the Northern Territory of Australia of satellite-supported two-way broad-band internet services for school-age and adult distance education. The context is…

Children of an Earth to Come: Speculative Fiction, Geophilosophy and Climate Change Education Research

ERIC Educational Resources Information Center

Rousell, David; Cutter-Mackenzie, Amy; Foster, Jasmyne

2017-01-01

Over the last 3 years, the "Climate Change and Me" project has mapped children and young people's affective, creative, and ontological relationships with climate change through an emergent and child-framed research methodology. The project has involved working with 135 children and young people from across Northern NSW, Australia, as…

Multicultural Education and Racism: The Case of Arab-Australian Students in Contemporary Australia

ERIC Educational Resources Information Center

Mansouri, Fethi; Trembath, Anna

2005-01-01

This paper discusses the social and cultural dimensions of the educational experiences of Arab-Australian students. It seeks to explore the cultural attitudes and the social experiences of Arab-Australian secondary school students from two schools situated in Melbourne's northern region. The paper seeks to examine how Arab-Australian students and…

Establishing a Mathematics-Enrichment Community in a Multi-School Environment

ERIC Educational Resources Information Center

Thomson, Ian

2005-01-01

Trinity College is a low-fee independent school in Gawler, South Australia. The college has an enrolment of 3500 students of varied socioeconomic mix, drawn from the northern suburbs of Adelaide. Trinity has recently been restructured into four R-10 schools and one senior school for Years 11-13. The schools share a common mathematics curriculum.…

Primary Distance Education Population: Problems and Prospects. Research Series No. 2.

ERIC Educational Resources Information Center

Taylor, Peter; Tomlinson, Derrick

Extensive fieldwork and a questionnaire were used to study the population served by primary distance education (k-6), the perceived needs of home tutors, and the adequacy of support services provided by distance primary schools in New South Wales, Queensland, Western Australia, and the Northern Territory. The fieldwork phase found two major types…

Principals as Literacy Leaders with Indigenous Communities (PALLIC) Building Relationships: One School's Quest to Raise Indigenous Learners' Literacy

ERIC Educational Resources Information Center

Riley, Tasha; Webster, Amanda

2016-01-01

In 2011 to 2012, 48 schools in the Northern Territory, South Australia and Queensland participated in the Principals as Literacy Leaders with Indigenous Communities (PALLIC) project. Central to this project was the establishment of positive working relationships between school principals and Indigenous community leaders in order to improve…

Australasian sequestrate fungi 18: Solioccasus polychromus gen. & sp. nov., a richly colored, tropical to subtropical, hypogeous fungus

Treesearch

J. M. Trappe; M. A. Castellano; R. E. Halling; T. W. Osmundson; M. Binder; N. Fechner; N. Malajczuk

2013-01-01

Solioccasus polychromus gen. & sp. nov., the most brightly colored hypogeous fungus known, is described from Papua New Guinea and tropical northern Australia south into subtropical forests along the Queensland coast and coastal mountains to near Brisbane. Phylogenetic analysis of molecular data places it as a sister genus to Bothia...

High-Resolution View of Fires and Smoke near Sydney, Australia

NASA Technical Reports Server (NTRS)

2002-01-01

Smoke obscures much of the landscape near Sydney, Australia, in the true-color image above (top). However, the areas with active fires are revealed by the false-color image (bottom), which was made using shortwave infrared data that are sensitive to heat and provide the ability to 'see' through smoke. In the bottom scene, the black areas show fresh burn scars, while greens show landscape untouched by fire. Apparently, the fire burned up to the edge of a road (the thin black line snaking from the lefthand side of the image and disappearing off the bottom) and was unable to jump across. The thick dark line along the bottom of the scene is a river. Both images were made using data acquired on December 28, 2001, by the Advanced Land Imager (ALI), flying aboard NASA's Earth Observing-1 (EO-1) satellite. For more images of the recent fires in Australia, read Smoke Blankets New South Wales, Australia, Fires Continue to Rage Near Sydney, Australia, and Severe Bush Fires Near Sydney, Australia. For more information about the effects of fire on the environment, read the Biomass Burning fact sheet. Images by Robert Simmon, based on data provided by Lawrence Ong, EO-1 Science Team

4. Photocopy of plat (from U.S. Land Commission, U.S. District ...

Library of Congress Historic Buildings Survey, Historic Engineering Record, Historic Landscapes Survey

4. Photocopy of plat (from U.S. Land Commission, U.S. District Court, Northern District of California, G. Black, Surveyor, 1854) SITE PLAN OF MISSION SAN FRANCISCO SOLANO DE SONOMA - Mission San Francisco Solano de Sonoma, First & Spain Streets, Sonoma, Sonoma County, CA

Investigations using data from LANDSAT-2. [Bangladesh

NASA Technical Reports Server (NTRS)

Hossain, A. (Principal Investigator)

1976-01-01

The author has identified the following significant results.Preliminary land use maps of Sunamgonj, Baniachong, and Srimongal areas in the Sylhet districts were prepared. Indication of new land in the southern Patuakhali district and Hatiya Island were found, and erosion in northern Hatiya Island is also indicated.

Expedition 9 Landing

NASA Image and Video Library

2004-10-24

A Russian nurse sits next to Expedition 9 Flight Engineer Michael Fincke, while he sleeps inside a Russian search and rescue helicopter on his way to Kustanay, Kazakhstan after landing in a Soyuz capsule 85 kilometers northeast of Arkalyk in northern Kazakhstan, Sunday, October 24, 2004. Photo Credit: (NASA/Bill Ingalls)

Northern Victoria Land (western Ross Sea-Antarctica): inner shelf fine sedimentation

NASA Astrophysics Data System (ADS)

Colizza, E.; Finocchiaro, F.; Ivaldi, R.; Pittà, A.; Tolotti, R.; Brambati, A.

2003-04-01

The Holocene sedimentation conditions are represented, in the western Ross Sea, by diatomaceous ooze in the uppermost part of sedimentary sequences, while diamicton deposited during Last Glacial Maximum are the basal unit of most cores. Thick layer (> 2 m) of diatomaceous ooze were sampled in the northern Joides Basin and into Granite Harbour. In Drygalski Ice Tongue area and along the coasts of northern Victoria Land, prevails coarse sedimentation, due to seaward flowing of large outlet glacier that drain the Transantarctic Mountain. During 1998-99 and 2001-02 PNRA antarctic cruises, favourable sea ice conditions, has allowed to sample inner shelf area, both in Wood Bay and south of Drygalski ice tongue (Nordenskjold basin). In both sites fine laminated diatomaceous mud are present. Preliminary seismostratigraphy and sedimentological data are here reported. This is the first note of new sites of fine sedimentation in the Ross Sea inner shelf.

Winter food habits and preferences of northern bobwhites in east Texas

Treesearch

Donald R. Dietz; R. Montague Whiting; Nancy E. Koerth

2009-01-01

During late winter, 1994 and 1995, we investigated food habits and preferences of northern bobwhites (Colinus virginianus; hereafter, bobwhites) collected on forested lands in east Texas. Crops for bobwhites were collected from areas under 3 management regimes, namely intensively managed for bobwhites (QMA) (i.e., tree basal area reduced...

Determinants of forest land prices in northern Minnesota: a hedonic pricing approach

Treesearch

Stephanie A. Snyder; Michael A. Kilgore; Rachel Hudson; Jacob Donnay

2007-01-01

A hedonic price model was developed to analyze the market for undeveloped forestland in northern Minnesota. The data included 387 forestland parcels purchased in 2001 or 2002. Information describing parcel physical characteristics, amenity features, merchantable timber volume, development trends, terms of financing, and several proximity, distance, and adjacency...

Seasonal homes and natural resources: patterns of use and impact in Michigan.

Treesearch

Daniel J. Stynes; JiaJia Zheng; Susan I. Stewart

1997-01-01

Describes patterns of seasonal home ownerships and use in northern lower Michigan, including recreational use of nearby public and private lands and potential use of the seasonal home as a retirement home. Estimates economic impacts associated with seasonal home related spending in the 33 counties of northern lower Michigan.

An assessment of multiflora rose in northern U.S. forests

Treesearch

Cassandra M. Kurtz; Mark H. Hansen

2013-01-01

This publication provides an overview of multiflora rose (Rosa multiflora) on forest land across the 24 states of the midwestern and northeastern United States based on an extensive systematic network of plots measured by the Forest Inventory and Analysis (FIA) program of the U.S. Forest Service, Northern Research Station (NRS).

75 FR 3917 - Notice of Partial Cancellation of Proposed Withdrawal; California

Federal Register 2010, 2011, 2012, 2013, 2014

2010-01-25

.... 16 E., Sec. 29, that portion lying westerly of the Old Woman Mountains Wilderness Area. Northern... southwesterly of the Old Woman Mountains Wilderness Area. Northern Expansion Area. T. 6 N., R. 7 E., Secs. 1 and... land laws generally, subject to valid existing rights, the provisions of existing withdrawals, other...

Forest adaptation resources: Climate change tools and approaches for land managers

Treesearch

Chris Swanston; Maria, eds. Janowiak

2012-01-01

The forests of northern Wisconsin, a defining feature of the region's landscape, are expected to undergo numerous changes in response to the changing climate. This document provides a collection of resources designed to help forest managers incorporate climate change considerations into management and devise adaptation tactics. It was developed in northern...

Assessing the cocmpatibility of fuel treatments, wildfire risk, and conservation of Northern Spotted Owl habitats and populations in the eastern Cascades

EPA Science Inventory

Land managers are faced with conundrum when tasked with maintaining populations of threatened Northern Spotted Owl (NSO; Strix occidentalis caurina) while reducing wildfire risk in dry, fire-prone forests of the inland northwest. The USDI Fish and Wildlife Service Final Recovery...

Ecological principles: climate, physiography, soil, and vegetation

Treesearch

George R. Parker; George T. Weaver

1989-01-01

The central hardwood region is a land of transitions in climate, physiography, soils, plants, and animals. Winter temperature and drought are the two most important climatic variables operating on plants and animals. Occasional severe periods of low winter temperatures in the northern half of the region restrict the northern occurrence of many plant and animal species...