Sample records for large arf1 guanine

  1. Role of protein-phospholipid interactions in the activation of ARF1 by the guanine nucleotide exchange factor Arno.


    Paris, S; Béraud-Dufour, S; Robineau, S; Bigay, J; Antonny, B; Chabre, M; Chardin, P


    Arno is a 47-kDa human protein recently identified as a guanine nucleotide exchange factor for ADP ribosylation factor 1 (ARF1) with a central Sec7 domain responsible for the exchange activity and a carboxyl-terminal pleckstrin homology (PH) domain (Chardin, P., Paris, S., Antonny, B., Robineau, S., Béraud-Dufour, S., Jackson, C. L., and Chabre, M. (1996) Nature 384, 481-484). Binding of the PH domain to phosphatidylinositol 4,5-bisphosphate (PIP2) greatly enhances Arno-mediated activation of myristoylated ARF1. We show here that in the absence of phospholipids, Arno promotes nucleotide exchange on [Delta17]ARF1, a soluble mutant of ARF1 lacking the first 17 amino acids. This reaction is unaffected by PIP2, which suggests that the PIP2-PH domain interaction does not directly regulate the catalytic activity of Arno but rather serves to recruit Arno to membranes. Arno catalyzes the release of GDP more efficiently than that of GTP from [Delta17]ARF1, and a stable complex between Arno Sec7 domain and nucleotide-free [Delta17]ARF1 can be isolated. In contrast to [Delta17]ARF1, full-length unmyristoylated ARF1 is not readily activated by Arno in solution. Its activation requires the presence of phospholipids and a reduction of ionic strength and Mg2+ concentration. PIP2 is strongly stimulatory, indicating that binding of Arno to phospholipids is involved, but in addition, electrostatic interactions between phospholipids and the amino-terminal portion of unmyristoylated ARF1GDP seem to be important. We conclude that efficient activation of full-length ARF1 by Arno requires a membrane surface and two distinct protein-phospholipid interactions: one between the PH domain of Arno and PIP2, and the other between amino-terminal cationic residues of ARF1 and anionic phospholipids. The latter interaction is normally induced by insertion of the amino-terminal myristate into the bilayer but can also be artificially facilitated by decreasing Mg2+ and salt concentrations.

  2. A glutamic finger in the guanine nucleotide exchange factor ARNO displaces Mg2+ and the beta-phosphate to destabilize GDP on ARF1.

    PubMed Central

    Béraud-Dufour, S; Robineau, S; Chardin, P; Paris, S; Chabre, M; Cherfils, J; Antonny, B


    The Sec7 domain of the guanine nucleotide exchange factor ARNO (ARNO-Sec7) is responsible for the exchange activity on the small GTP-binding protein ARF1. ARNO-Sec7 forms a stable complex with the nucleotide-free form of [Delta17]ARF1, a soluble truncated form of ARF1. The crystal structure of ARNO-Sec7 has been solved recently, and a site-directed mutagenesis approach identified a hydrophobic groove and an adjacent hydrophilic loop as the ARF1-binding site. We show that Glu156 in the hydrophilic loop of ARNO-Sec7 is involved in the destabilization of Mg2+ and GDP from ARF1. The conservative mutation E156D and the charge reversal mutation E156K reduce the exchange activity of ARNO-Sec7 by several orders of magnitude. Moreover, [E156K]ARNO-Sec7 forms a complex with the Mg2+-free form of [Delta17]ARF1-GDP without inducing the release of GDP. Other mutations in ARNO-Sec7 and in [Delta17]ARF1 suggest that prominent hydrophobic residues of the switch I region of ARF1 insert into the groove of the Sec7 domain, and that Lys73 of the switch II region of ARF1 forms an ion pair with Asp183 of ARNO-Sec7. PMID:9649435

  3. Structure and Membrane Interaction of Myristoylated ARF1

    PubMed Central

    Liu, Yizhou; Kahn, Richard A.; Prestegard, James H.


    Summary ADP-ribosylation factors (ARFs) are small (21 kDa), monomeric GTPases that are important regulators of membrane traffic. When membrane bound, they recruit soluble adaptors to membranes and trigger the assembly of coating complexes involved in cargo selection and vesicular budding. N-myristoylation is a conserved feature of all ARF proteins that is required for its biological functions, though the mechanism(s) by which the myristate acts in ARF functions is not fully understood. Here, we present the first structure of a myristoylated ARF1 protein, determined by solution NMR methods, and an assessment of the influence of myristoylation on association of ARF1·GDP and ARF1·GTP with lipid bilayers. A model in which myristoylation contributes to both the regulation of guanine nucleotide exchange and stable membrane association is supported. PMID:19141284

  4. The Sec7 N-terminal regulatory domains facilitate membrane-proximal activation of the Arf1 GTPase

    PubMed Central

    Richardson, Brian C; Halaby, Steve L; Gustafson, Margaret A; Fromme, J Christopher


    The Golgi complex is the central sorting compartment of eukaryotic cells. Arf guanine nucleotide exchange factors (Arf-GEFs) regulate virtually all traffic through the Golgi by activating Arf GTPase trafficking pathways. The Golgi Arf-GEFs contain multiple autoregulatory domains, but the precise mechanisms underlying their function remain largely undefined. We report a crystal structure revealing that the N-terminal DCB and HUS regulatory domains of the Arf-GEF Sec7 form a single structural unit. We demonstrate that the established role of the N-terminal region in dimerization is not conserved; instead, a C-terminal autoinhibitory domain is responsible for dimerization of Sec7. We find that the DCB/HUS domain amplifies the ability of Sec7 to activate Arf1 on the membrane surface by facilitating membrane insertion of the Arf1 amphipathic helix. This enhancing function of the Sec7 N-terminal domains is consistent with the high rate of Arf1-dependent trafficking to the plasma membrane necessary for maximal cell growth. DOI: PMID:26765562

  5. The Arf GAP Asap promotes Arf1 function at the Golgi for cleavage furrow biosynthesis in Drosophila

    PubMed Central

    Rodrigues, Francisco F.; Shao, Wei; Harris, Tony J. C.


    Biosynthetic traffic from the Golgi drives plasma membrane growth. For Drosophila embryo cleavage, this growth is rapid but regulated for cycles of furrow ingression and regression. The highly conserved small G protein Arf1 organizes Golgi trafficking. Arf1 is activated by guanine nucleotide exchange factors, but essential roles for Arf1 GTPase-activating proteins (GAPs) are less clear. We report that the conserved Arf GAP Asap is required for cleavage furrow ingression in the early embryo. Because Asap can affect multiple subcellular processes, we used genetic approaches to dissect its primary effect. Our data argue against cytoskeletal or endocytic involvement and reveal a common role for Asap and Arf1 in Golgi organization. Although Asap lacked Golgi enrichment, it was necessary and sufficient for Arf1 accumulation at the Golgi, and a conserved Arf1-Asap binding site was required for Golgi organization and output. Of note, Asap relocalized to the nuclear region at metaphase, a shift that coincided with subtle Golgi reorganization preceding cleavage furrow regression. We conclude that Asap is essential for Arf1 to function at the Golgi for cleavage furrow biosynthesis. Asap may recycle Arf1 to the Golgi from post-Golgi membranes, providing optimal Golgi output for specific stages of the cell cycle. PMID:27535433

  6. ARF1 and SAR1 GTPases in endomembrane trafficking in plants.


    Cevher-Keskin, Birsen


    Small GTPases largely control membrane traffic, which is essential for the survival of all eukaryotes. Among the small GTP-binding proteins, ARF1 (ADP-ribosylation factor 1) and SAR1 (Secretion-Associated RAS super family 1) are commonly conserved among all eukaryotes with respect to both their functional and sequential characteristics. The ARF1 and SAR1 GTP-binding proteins are involved in the formation and budding of vesicles throughout plant endomembrane systems. ARF1 has been shown to play a critical role in COPI (Coat Protein Complex I)-mediated retrograde trafficking in eukaryotic systems, whereas SAR1 GTPases are involved in intracellular COPII-mediated protein trafficking from the ER to the Golgi apparatus. This review offers a summary of vesicular trafficking with an emphasis on the ARF1 and SAR1 expression patterns at early growth stages and in the de-etiolation process.

  7. Arf1 and Arf6 Promote Ventral Actin Structures formed by acute Activation of Protein Kinase C and Src

    PubMed Central

    Caviston, Juliane P.; Cohen, Lee Ann; Donaldson, Julie G.


    Arf proteins regulate membrane traffic and organelle structure. Although Arf6 is known to initiate actin-based changes in cell surface architecture, Arf1 may also function at the plasma membrane. Here we show that acute activation of protein kinase C (PKC) induced by the phorbol ester PMA led to the formation of motile actin structures on the ventral surface of Beas-2b cells, a lung bronchial epithelial cell line. Ventral actin structures also formed in PMA-treated HeLa cells that had elevated levels of Arf activation. For both cell types, formation of the ventral actin structures was enhanced by expression of active forms of either Arf1 or Arf6, and by the expression of guanine nucleotide exchange factors that activate these Arfs. By contrast, formation of these structures was blocked by inhibitors of PKC and Src, and required phosphatidylinositol 4, 5-bisphosphate, Rac, Arf6 and Arf1. Furthermore, expression of ASAP1, an Arf1 GTPase activating protein (GAP) was more effective at inhibiting the ventral actin structures than was ACAP1, an Arf6 GAP. This study adds to the expanding role for Arf1 in the periphery and identifies a requirement for Arf1, a “Golgi Arf”, in the reorganization of the cortical actin cytoskeleton on ventral surfaces, against the substratum. PMID:24916416

  8. The small GTPase Arf1 modulates mitochondrial morphology and function.


    Ackema, Karin B; Hench, Jürgen; Böckler, Stefan; Wang, Shyi Chyi; Sauder, Ursula; Mergentaler, Heidi; Westermann, Benedikt; Bard, Frédéric; Frank, Stephan; Spang, Anne


    The small GTPase Arf1 plays critical roles in membrane traffic by initiating the recruitment of coat proteins and by modulating the activity of lipid-modifying enzymes. Here, we report an unexpected but evolutionarily conserved role for Arf1 and the ArfGEF GBF1 at mitochondria. Loss of function of ARF-1 or GBF-1 impaired mitochondrial morphology and activity in Caenorhabditis elegans. Similarly, mitochondrial defects were observed in mammalian and yeast cells. In Saccharomyces cerevisiae, aberrant clusters of the mitofusin Fzo1 accumulated in arf1-11 mutants and were resolved by overexpression of Cdc48, an AAA-ATPase involved in ER and mitochondria-associated degradation processes. Yeast Arf1 co-fractionated with ER and mitochondrial membranes and interacted genetically with the contact site component Gem1. Furthermore, similar mitochondrial abnormalities resulted from knockdown of either GBF-1 or contact site components in worms, suggesting that the role of Arf1 in mitochondrial functioning is linked to ER-mitochondrial contacts. Thus, Arf1 is involved in mitochondrial homeostasis and dynamics, independent of its role in vesicular traffic.

  9. Myristoylation-facilitated binding of the G protein ARF1GDP to membrane phospholipids is required for its activation by a soluble nucleotide exchange factor.


    Franco, M; Chardin, P; Chabre, M; Paris, S


    We have investigated the role of N-myristoylation in the activation of bovine ADP-ribosylation factor 1 (ARF1). We previously showed that myristoylation allows some spontaneous GDP-to-GTP exchange to occur on ARF1 at physiological Mg2+ levels in the presence of phospholipid vesicles (Franco, M., Chardin, P., Chabre, M., and Paris, S. (1995) J. Biol. Chem. 270, 1337-1341). Here, we report that this basal nucleotide exchange can be accelerated (by up to 5-fold) by addition of a soluble fraction obtained from bovine retinas. This acceleration is totally abolished by brefeldin A (IC50 = 2 microM) and by trypsin treatment of the retinal extract, as expected for an ARF-specific guanine nucleotide exchange factor. To accelerate GDP release from ARF1, this soluble exchange factor absolutely requires myristoylation of ARF1 and the presence of phospholipid vesicles. The retinal extract also stimulates guanosine 5'-3-O-(thio)-triphosphate (GTP gamma S) release from ARF1 in the presence of phospholipids, but in this case myristoylation of ARF is not required. These observations, together with our previous findings that both myristoylated and non-myristoylated forms of ARF GTP-gamma S but only the myristoylated form of ARFGDP bind to membrane phospholipids, suggest that (i) the retinal exchange factor acts only on membrane-bound ARF, (ii) the myristate is not involved in the protein-protein interaction between ARF1 and the exchange factor, and (iii) N-myristoylation facilitates both spontaneous and catalyzed GDP-to-GTP exchange on ARF1 simply by facilitating the binding of ARFGDP to membrane phospholipids.

  10. EFA6 controls Arf1 and Arf6 activation through a negative feedback loop.


    Padovani, Dominique; Folly-Klan, Marcia; Labarde, Audrey; Boulakirba, Sonia; Campanacci, Valérie; Franco, Michel; Zeghouf, Mahel; Cherfils, Jacqueline


    Guanine nucleotide exchange factors (GEFs) of the exchange factor for Arf6 (EFA6), brefeldin A-resistant Arf guanine nucleotide exchange factor (BRAG), and cytohesin subfamilies activate small GTPases of the Arf family in endocytic events. These ArfGEFs carry a pleckstrin homology (PH) domain in tandem with their catalytic Sec7 domain, which is autoinhibitory and supports a positive feedback loop in cytohesins but not in BRAGs, and has an as-yet unknown role in EFA6 regulation. In this study, we analyzed how EFA6A is regulated by its PH and C terminus (Ct) domains by reconstituting its GDP/GTP exchange activity on membranes. We found that EFA6 has a previously unappreciated high efficiency toward Arf1 on membranes and that, similar to BRAGs, its PH domain is not autoinhibitory and strongly potentiates nucleotide exchange on anionic liposomes. However, in striking contrast to both cytohesins and BRAGs, EFA6 is regulated by a negative feedback loop, which is mediated by an allosteric interaction of Arf6-GTP with the PH-Ct domain of EFA6 and monitors the activation of Arf1 and Arf6 differentially. These observations reveal that EFA6, BRAG, and cytohesins have unanticipated commonalities associated with divergent regulatory regimes. An important implication is that EFA6 and cytohesins may combine in a mixed negative-positive feedback loop. By allowing EFA6 to sustain a pool of dormant Arf6-GTP, such a circuit would fulfill the absolute requirement of cytohesins for activation by Arf-GTP before amplification of their GEF activity by their positive feedback loop.

  11. Effect of myristoylated N-terminus of Arf1 on the bending rigidity of phospholipid membranes

    NASA Astrophysics Data System (ADS)

    Burrola Gabilondo, Beatriz; Zhou, Hernan; Randazzo, Paul A.; Losert, Wolfgang


    The protein Arf1 is part of the COPI vesicle transport process from the Golgi to the ER. It binds to membranes via a myristoylated N-terminus and it has been shown to tubulate Large Unilamellar Vesicles. The effect of the N-terminus of Arf1 on physical properties of membranes has not been studied, with the exception of curvature. We previously found that the myristoylated N-terminus increases the packing of the lipid molecules, but has no effect on the lateral mobility. We tested the hypothesis that myristoylated peptides affect the bending rigidity of phospholipid Giant Unilamellar Vesicles (GUV). We use optical tweezers to pull tethers from GUV and measure the force of pulling the tether, as well as the retraction speed of the tether once it is released. We also used flicker spectroscopy to estimate the values of the mechanical properties of GUV. We will present results of the force and tether retraction measurements, as well as mechanical properties estimates from flicker, for GUV in the presence of varying concentrations of myristoylated and non-myristoylated N-terminus of Arf1, and compare these with measurements for GUV in the absence of peptide.

  12. The Drosophila Arf1 homologue Arf79F is essential for lamellipodium formation

    PubMed Central

    Humphreys, Daniel; Liu, Tao; Davidson, Anthony C.; Hume, Peter J.; Koronakis, Vassilis


    Summary The WAVE regulatory complex (WRC) drives the polymerisation of actin filaments located beneath the plasma membrane to generate lamellipodia that are pivotal to cell architecture and movement. By reconstituting WRC-dependent actin assembly at the membrane, we recently discovered that several classes of Arf family GTPases directly recruit and activate WRC in cell extracts, and that Arf cooperates with Rac1 to trigger actin polymerisation. Here, we demonstrate that the Class 1 Arf1 homologue Arf79F colocalises with the WRC at dynamic lamellipodia. We report that Arf79F is required for lamellipodium formation in Drosophila S2R+ cells, which only express one Arf isoform for each class. Impeding Arf function either by dominant-negative Arf expression or by Arf double-stranded RNA interference (dsRNAi)-mediated knockdown uncovered that Arf-dependent lamellipodium formation was specific to Arf79F, establishing that Class 1 Arfs, but not Class 2 or Class 3 Arfs, are crucial for lamellipodia. Lamellipodium formation in Arf79F-silenced cells was restored by expressing mammalian Arf1, but not by constitutively active Rac1, showing that Arf79F does not act via Rac1. Abolition of lamellipodium formation in Arf79F-silenced cells was not due to Golgi disruption. Blocking Arf79F activation with guanine nucleotide exchange factor inhibitors impaired WRC localisation to the plasma membrane and concomitant generation of lamellipodia. Our data indicate that the Class I Arf GTPase is a central component in WRC-driven lamellipodium formation. PMID:22992458

  13. BEX1/ARF1A1C is required for BFA-sensitive recycling of PIN auxin transporters and auxin-mediated development in Arabidopsis.


    Tanaka, Hirokazu; Nodzyłski, Tomasz; Kitakura, Saeko; Feraru, Mugurel I; Sasabe, Michiko; Ishikawa, Tomomi; Kleine-Vehn, Jürgen; Kakimoto, Tatsuo; Friml, Jiři


    Correct positioning of membrane proteins is an essential process in eukaryotic organisms. The plant hormone auxin is distributed through intercellular transport and triggers various cellular responses. Auxin transporters of the PIN-FORMED (PIN) family localize asymmetrically at the plasma membrane (PM) and mediate the directional transport of auxin between cells. A fungal toxin, brefeldin A (BFA), inhibits a subset of guanine nucleotide exchange factors for ADP-ribosylation factor small GTPases (ARF GEFs) including GNOM, which plays a major role in localization of PIN1 predominantly to the basal side of the PM. The Arabidopsis genome encodes 19 ARF-related putative GTPases. However, ARF components involved in PIN1 localization have been genetically poorly defined. Using a fluorescence imaging-based forward genetic approach, we identified an Arabidopsis mutant, bfa-visualized exocytic trafficking defective1 (bex1), in which PM localization of PIN1-green fluorescent protein (GFP) as well as development is hypersensitive to BFA. We found that in bex1 a member of the ARF1 gene family, ARF1A1C, was mutated. ARF1A1C localizes to the trans-Golgi network/early endosome and Golgi apparatus, acts synergistically to BEN1/MIN7 ARF GEF and is important for PIN recycling to the PM. Consistent with the developmental importance of PIN proteins, functional interference with ARF1 resulted in an impaired auxin response gradient and various developmental defects including embryonic patterning defects and growth arrest. Our results show that ARF1A1C is essential for recycling of PIN auxin transporters and for various auxin-dependent developmental processes.

  14. ARF1(2-17) does not specifically interact with ARF1-dependent pathways. Inhibition by peptide of phospholipases C beta, D and exocytosis in HL60 cells.


    Fensome, A; Cunningham, E; Troung, O; Cockcroft, S


    The small GTP-binding protein ARF has been shown recently to regulate phospholipase D (PLD). In order to investigate the role of ARF proteins in regulated exocytosis, we have used the N-terminal peptide ARF1(2-17) of the ARF1 protein. ARF1 reconstituted PLD activity in cytosol-depleted HL60 cells was inhibited by ARF1(2-17). In the presence of endogenous cytosol, ARF1(2-17) also inhibited GTP-gamma-S-stimulated PLD activity and exocytosis. Mastoparan Politses jadwagae and mastoparan Vespula lewisii which exhibit similar structural properties to ARF1(2-17) also inhibited GTP-gamma-S-stimulated PLD and exocytosis. GTP-gamma-S-stimulated phospholipase C-beta (PLC-beta) was also inhibited by ARF(2-17) and mastoparan. In cytosol-depleted HL60 cells, the ARF(2-17) inhibited the reconstitution of GTP-gamma-S-stimulated PLC-beta activity with exogenously-added PLC-beta 1 and phosphatidylinositol transfer protein. We conclude that the widely-used ARF1(2-17) peptide inhibits both ARF-independent (i.e. PLC-beta) and ARF-dependent pathways (i.e. PLD) and therefore cannot be regarded as a specific inhibitor of ARF function.

  15. IGF-1 drives chromogranin A secretion via activation of Arf1 in human neuroendocrine tumour cells

    PubMed Central

    Münzberg, Christin; Höhn, Katharina; Krndija, Denis; Maaß, Ulrike; Bartsch, Detlef K; Slater, Emily P; Oswald, Franz; Walther, Paul; Seufferlein, Thomas; von Wichert, Götz


    Hypersecretion is the major symptom of functional neuroendocrine tumours. The mechanisms that contribute to this excessive secretion of hormones are still elusive. A key event in secretion is the exit of secretory products from the Golgi apparatus. ADP-ribosylation factor (Arf) GTPases are known to control vesicle budding and trafficking, and have a leading function in the regulation of formation of secretory granula at the Golgi. Here, we show that Arf1 is the predominant Arf protein family member expressed in the neuroendocrine pancreatic tumour cell lines BON and QGP-1. In BON cells Arf1 colocalizes with Golgi markers as well as chromogranin A, and shows significant basal activity. The inhibition of Arf1 activity or expression significantly impaired secretion of chromogranin A. Furthermore, we show that the insulin-like growth factor 1 (IGF-1), a major regulator of growth and secretion in BON cells, induces Arf1 activity. We found that activation of Arf1 upon IGF-1 receptor stimulation is mediated by MEK/ERK signalling pathway in BON and QGP-1 cells. Moreover, the activity of Arf1 in BON cells is mediated by autocrinely secreted IGF-1, and concomitantly, autocrine IGF1 secretion is maintained by Arf1 activity. In summary, our data indicate an important regulatory role for Arf1 at the Golgi in hypersecretion in neuroendocrine cancer cells. PMID:25754106

  16. IGF-1 drives chromogranin A secretion via activation of Arf1 in human neuroendocrine tumour cells.


    Münzberg, Christin; Höhn, Katharina; Krndija, Denis; Maaß, Ulrike; Bartsch, Detlef K; Slater, Emily P; Oswald, Franz; Walther, Paul; Seufferlein, Thomas; von Wichert, Götz


    Hypersecretion is the major symptom of functional neuroendocrine tumours. The mechanisms that contribute to this excessive secretion of hormones are still elusive. A key event in secretion is the exit of secretory products from the Golgi apparatus. ADP-ribosylation factor (Arf) GTPases are known to control vesicle budding and trafficking, and have a leading function in the regulation of formation of secretory granula at the Golgi. Here, we show that Arf1 is the predominant Arf protein family member expressed in the neuroendocrine pancreatic tumour cell lines BON and QGP-1. In BON cells Arf1 colocalizes with Golgi markers as well as chromogranin A, and shows significant basal activity. The inhibition of Arf1 activity or expression significantly impaired secretion of chromogranin A. Furthermore, we show that the insulin-like growth factor 1 (IGF-1), a major regulator of growth and secretion in BON cells, induces Arf1 activity. We found that activation of Arf1 upon IGF-1 receptor stimulation is mediated by MEK/ERK signalling pathway in BON and QGP-1 cells. Moreover, the activity of Arf1 in BON cells is mediated by autocrinely secreted IGF-1, and concomitantly, autocrine IGF1 secretion is maintained by Arf1 activity. In summary, our data indicate an important regulatory role for Arf1 at the Golgi in hypersecretion in neuroendocrine cancer cells.

  17. Structural basis for recruitment and activation of the AP-1 clathrin adaptor complex by Arf1.


    Ren, Xuefeng; Farías, Ginny G; Canagarajah, Bertram J; Bonifacino, Juan S; Hurley, James H


    AP-1 is a clathrin adaptor complex that sorts cargo between the trans-Golgi network and endosomes. AP-1 recruitment to these compartments requires Arf1-GTP. The crystal structure of the tetrameric core of AP-1 in complex with Arf1-GTP, together with biochemical analyses, shows that Arf1 activates cargo binding by unlocking AP-1. Unlocking is driven by two molecules of Arf1 that bridge two copies of AP-1 at two interaction sites. The GTP-dependent switch I and II regions of Arf1 bind to the N terminus of the β1 subunit of one AP-1 complex, while the back side of Arf1 binds to the central part of the γ subunit trunk of a second AP-1 complex. A third Arf1 interaction site near the N terminus of the γ subunit is important for recruitment, but not activation. These observations lead to a model for the recruitment and activation of AP-1 by Arf1.

  18. Expression of a dominant allele of human ARF1 inhibits membrane traffic in vivo

    PubMed Central


    ADP-ribosylation factor (ARF) proteins and inhibitory peptides derived from ARFs have demonstrated activities in a number of in vitro assays that measure ER-to-Golgi and intra-Golgi transport and endosome fusion. To better understand the roles of ARF proteins in vivo, stable cell lines were obtained from normal rat kidney (NRK) cells transfected with either wild-type or a dominant activating allele ([Q71L]) of the human ARF1 gene under the control of the interferon-inducible mouse Mx1 promoter. Upon addition of interferon, expression of ARF1 proteins increased with a half-time of 7-8 h, as determined by immunoblot analysis. Induction of mutant ARF1, but not wild-type ARF1, led to an inhibition of protein secretion with kinetics similar to that observed for induction of protein expression. Examination of the Golgi apparatus and the ER by indirect immunofluorescence or transmission electron microscopy revealed that expression of low levels of mutant ARF1 protein correlated with a dramatic increase in vesiculation of the Golgi apparatus and expansion of the ER lumen, while expression of substantially higher levels of wild-type ARF1 had no discernible effect. Endocytosis was also inhibited by expression of mutant ARF1, but not by the wild-type protein. Finally, the expression of [Q71L]ARF1, but not wild-type ARF1, antagonized the actions of brefeldin A, as determined by the delayed loss of ARF and beta-COP from Golgi membranes and disruption of the Golgi apparatus. General models for the actions of ARF1 in membrane traffic events are discussed. PMID:8294513

  19. Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

    SciTech Connect

    Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.; Price, S.R.; Moss, J.; Vaughan, M. )


    ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A){sup +} RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A){sup +} RNA are consistent with the presence of at least two, and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs.

  20. The leukemia-associated Rho guanine nucleotide exchange factor LARG is required for efficient replication stress signaling.


    Beveridge, Ryan D; Staples, Christopher J; Patil, Abhijit A; Myers, Katie N; Maslen, Sarah; Skehel, J Mark; Boulton, Simon J; Collis, Spencer J


    We previously identified and characterized TELO2 as a human protein that facilitates efficient DNA damage response (DDR) signaling. A subsequent yeast 2-hybrid screen identified LARG; Leukemia-Associated Rho Guanine Nucleotide Exchange Factor (also known as Arhgef12), as a potential novel TELO2 interactor. LARG was previously shown to interact with Pericentrin (PCNT), which, like TELO2, is required for efficient replication stress signaling. Here we confirm interactions between LARG, TELO2 and PCNT and show that a sub-set of LARG co-localizes with PCNT at the centrosome. LARG-deficient cells exhibit replication stress signaling defects as evidenced by; supernumerary centrosomes, reduced replication stress-induced γH2AX and RPA nuclear foci formation, and reduced activation of the replication stress signaling effector kinase Chk1 in response to hydroxyurea. As such, LARG-deficient cells are sensitive to replication stress-inducing agents such as hydroxyurea and mitomycin C. Conversely we also show that depletion of TELO2 and the replication stress signaling kinase ATR leads to RhoA signaling defects. These data therefore reveal a level of crosstalk between the RhoA and DDR signaling pathways. Given that mutations in both ATR and PCNT can give rise to the related primordial dwarfism disorders of Seckel Syndrome and Microcephalic osteodysplastic primordial dwarfism type II (MOPDII) respectively, which both exhibit defects in ATR-dependent checkpoint signaling, these data also raise the possibility that mutations in LARG or disruption to RhoA signaling may be contributory factors to the etiology of a sub-set of primordial dwarfism disorders.

  1. The leukemia-associated Rho guanine nucleotide exchange factor LARG is required for efficient replication stress signaling

    PubMed Central

    Beveridge, Ryan D; Staples, Christopher J; Patil, Abhijit A; Myers, Katie N; Maslen, Sarah; Skehel, J Mark; Boulton, Simon J; Collis, Spencer J


    We previously identified and characterized TELO2 as a human protein that facilitates efficient DNA damage response (DDR) signaling. A subsequent yeast 2-hybrid screen identified LARG; Leukemia-Associated Rho Guanine Nucleotide Exchange Factor (also known as Arhgef12), as a potential novel TELO2 interactor. LARG was previously shown to interact with Pericentrin (PCNT), which, like TELO2, is required for efficient replication stress signaling. Here we confirm interactions between LARG, TELO2 and PCNT and show that a sub-set of LARG co-localizes with PCNT at the centrosome. LARG-deficient cells exhibit replication stress signaling defects as evidenced by; supernumerary centrosomes, reduced replication stress-induced γH2AX and RPA nuclear foci formation, and reduced activation of the replication stress signaling effector kinase Chk1 in response to hydroxyurea. As such, LARG-deficient cells are sensitive to replication stress-inducing agents such as hydroxyurea and mitomycin C. Conversely we also show that depletion of TELO2 and the replication stress signaling kinase ATR leads to RhoA signaling defects. These data therefore reveal a level of crosstalk between the RhoA and DDR signaling pathways. Given that mutations in both ATR and PCNT can give rise to the related primordial dwarfism disorders of Seckel Syndrome and Microcephalic osteodysplastic primordial dwarfism type II (MOPDII) respectively, which both exhibit defects in ATR-dependent checkpoint signaling, these data also raise the possibility that mutations in LARG or disruption to RhoA signaling may be contributory factors to the etiology of a sub-set of primordial dwarfism disorders. PMID:25485589

  2. Molecular analysis of ARF1 expression profiles during development of physic nut (Jatropha curcas L.).


    Qin, Xiaobo; Lin, Fanrong; Lii, Yifan; Gou, Chunbao; Chen, Fang


    A cDNA clone designated arf1 was isolated from a physic nut (Jatropha curcas L.) endosperm cDNA library which encodes a small GTP-binding protein and has significant homology to ADP-ribosylation factors (ARF) in plants, animals and microbes. The cDNA contains an open reading frame that encodes a polypeptide of 181 amino acids with a calculated molecular mass of 20.7 kDa. The deduced amino acid sequence showed high homology to known ARFs from other organisms. The products of the arf1 obtained by overexpression in E. coli revealed the specific binding activity toward GTP. The expression of arf1 was observed in flowers, roots, stems and leaves as analyzed by RT-PCR, and its transcriptional level was highest in flowers. In particular, the accumulation of arf1 transcripts was different under various environmental stresses in seedlings. The results suggest that arf1 plays distinct physiological roles in Jatropha curcas cells.

  3. HIV-1 Nef hijacks clathrin coats by stabilizing AP-1:Arf1 polygons.


    Shen, Qing-Tao; Ren, Xuefeng; Zhang, Rui; Lee, Il-Hyung; Hurley, James H


    The lentiviruses HIV and simian immunodeficiency virus (SIV) subvert intracellular membrane traffic as part of their replication cycle. The lentiviral Nef protein helps viruses evade innate and adaptive immune defenses by hijacking the adaptor protein 1 (AP-1) and AP-2 clathrin adaptors. We found that HIV-1 Nef and the guanosine triphosphatase Arf1 induced trimerization and activation of AP-1. Here we report the cryo-electron microscopy structures of the Nef- and Arf1-bound AP-1 trimer in the active and inactive states. A central nucleus of three Arf1 molecules organizes the trimers. We combined the open trimer with a known dimer structure and thus predicted a hexagonal assembly with inner and outer faces that bind the membranes and clathrin, respectively. Hexagons were directly visualized and the model validated by reconstituting clathrin cage assembly. Arf1 and Nef thus play interconnected roles in allosteric activation, cargo recruitment, and coat assembly, revealing an unexpectedly intricate organization of the inner AP-1 layer of the clathrin coat.

  4. Structural dynamics and cation interactions of DNA quadruplex molecules containing mixed guanine/cytosine quartets revealed by large-scale MD simulations.


    Spacková, N; Berger, I; Sponer, J


    Large-scale molecular dynamics (MD) simulations have been utilized to study G-DNA quadruplex molecules containing mixed GCGC and all-guanine GGGG quartet layers. Incorporation of mixed GCGC quartets into G-DNA stems substantially enhances their sequence variability. The mixed quadruplexes form rigid assemblies that require integral monovalent cations for their stabilization. The interaction of cations with the all-guanine quartets is the leading contribution for the stability of the four-stranded assemblies, while the mixed quartets are rather tolerated within the structure. The simulations predict that two cations are preferred to stabilize a four-layer quadruplex stem composed of two GCGC and two all-guanine quartets. The distribution of cations in the structure is influenced by the position of the GCGC quartets within the quadruplex, the presence and arrangement of thymidine loops connecting the guanine/cytosine stretches forming the stems, and the cation type present (Na(+) or K(+)). The simulations identify multiple nanosecond-scale stable arrangements of the thymidine loops present in the molecules investigated. In these thymidine loops, several structured pockets are identified capable of temporarily coordinating cations. However, no stable association of cations to a loop has been observed. The simulations reveal several paths through the thymidine loop regions that can be followed by the cations when exchanging between the central ion channel in the quadruplex stem and the surrounding solvent. We have carried out 20 independent simulations while the length of simulations reaches a total of 90 ns, rendering this study one of the most extensive MD investigations carried out on nucleic acids so far. The trajectories provide a largely converged characterization of the structural dynamics of these four-stranded G-DNA molecules.

  5. ARF1 controls Rac1 signaling to regulate migration of MDA-MB-231 invasive breast cancer cells.


    Lewis-Saravalli, Sebastian; Campbell, Shirley; Claing, Audrey


    ADP-ribosylation factors (ARFs) are monomeric G proteins that regulate many cellular processes such as reorganization of the actin cytoskeleton. We have previously shown that ARF1 is overexpressed in highly invasive breast cancer cells and contribute to their enhanced migration. In this study, we propose to define the molecular mechanism by which ARF1 regulates this complex cellular response by investigating the role of this ARF GTPase on the activation process of Rac1, a Rho GTPase, associated with lamellipodia formation during cell migration. Here, we first show that inhibition of ARF1 or Rac1 expression markedly impacts the ability of MDA-MB-231 cells to migrate upon EGF stimulation. However, the effect of ARF1 depletion can be reversed by overexpression of the Rac1 active mutant, Rac1 Q(61)L. Depletion of ARF1 also impairs the ability of EGF stimulation to promote GTP-loading of Rac1. To further investigate the possible cross-talk between ARF1 and Rac1, we next examined whether they could form a complex. We observed that the two GTPases could directly interact independently of the nature of the nucleotide bound to them. EGF treatment however resulted in the association of Rac1 with its effector IRSp53, which was completely abrogated in ARF1 depleted cells. We present evidences that this ARF isoform is responsible for the plasma membrane targeting of both Rac1 and IRSp53, a step essential for lamellipodia formation. In conclusion, this study provides a new mechanism by which ARF1 regulates cell migration and identifies this GTPase as a promising pharmacological target to reduce metastasis formation in breast cancer patients.

  6. [The structural characteristics, alternative splicing and genetic experession analysis of ADP-ribosylation-factor 1 (arf1) in cotton].


    Ren, Mao-Zhi; Chen, Quan-Jia; Zhang, Rui; Guo, San-Dui


    The full-length cDNA,DNA and promoter of ADP-ribosylation-factor 1 (arf1) was isolated from Gossypium hirsutum Y18 by means of isocaudarner inverse PCR (II-PCR) and rapid isolating cDNA 5' unknown sequence and promoter (RICUP) established in our lab. Results indicated that the gene is 4 360 bp in size, including seven exons and six introns. Interestingly, alterative splicing occurs at intron I. Differential processing of intron 1 yields three different transcripts with 1 026 bp, 1103 bp and 1 544 bp in sizes, respectively. Arf1 encodes 181 amino acids. Sequence analysis indicated that sequence upstream transcription initiation site of arf1 includes typical initiator, TATA box, CCAAT box, GC box and several forward and reverse repeat sequences. And typical promoter structures, such as AT-rich sequence and palindrome structure have been detected in the sequence downstream transcription initiation site. Southern blot analysis indicated that the gene has two copies in the genome of cotton. Northern blot confirmed the predominate expression of arf1 in reproductive organs of cotton, including bud, flower, fiber and boll. Also, the feature and character of arf1 and its promoter have been studied. This study will lay foundation for the other research on function of arf1 in the development of reproductive organs in cotton.

  7. The Qb-SNARE Memb11 interacts specifically with Arf1 in the Golgi apparatus of Arabidopsis thaliana.


    Marais, Claireline; Wattelet-Boyer, Valérie; Bouyssou, Guillaume; Hocquellet, Agnès; Dupuy, Jean-William; Batailler, Brigitte; Brocard, Lysiane; Boutté, Yohann; Maneta-Peyret, Lilly; Moreau, Patrick


    The SNARE (soluble N-ethylmaleimide-sensitive factor attachment protein receptor) proteins are critical for the function of the secretory pathway. The SNARE Memb11 is involved in membrane trafficking at the ER-Golgi interface. The aim of the work was to decipher molecular mechanisms acting in Memb11-mediated ER-Golgi traffic. In mammalian cells, the orthologue of Memb11 (membrin) is potentially involved in the recruitment of the GTPase Arf1 at the Golgi membrane. However molecular mechanisms associated to Memb11 remain unknown in plants. Memb11 was detected mainly at the cis-Golgi and co-immunoprecipitated with Arf1, suggesting that Arf1 may interact with Memb11. This interaction of Memb11 with Arf1 at the Golgi was confirmed by in vivo BiFC (Bimolecular Fluorescence Complementation) experiments. This interaction was found to be specific to Memb11 as compared to either Memb12 or Sec22. Using a structural bioinformatic approach, several sequences in the N-ter part of Memb11 were hypothesized to be critical for this interaction and were tested by BiFC on corresponding mutants. Finally, by using both in vitro and in vivo approaches, we determined that only the GDP-bound form of Arf1 interacts with Memb11. Together, our results indicate that Memb11 interacts with the GDP-bound form of Arf1 in the Golgi apparatus.

  8. ARAP1 regulates the ring size of circular dorsal ruffles through Arf1 and Arf5

    PubMed Central

    Hasegawa, Junya; Tsujita, Kazuya; Takenawa, Tadaomi; Itoh, Toshiki


    Small guanosine triphosphatase (GTPase) ADP-ribosylation factors (Arfs) regulate membrane traffic and actin reorganization under the strict control of GTPase-activating proteins (GAPs). ARAP1 (Arf GAP with Rho GAP domain, ankyrin repeat, and PH domain 1) is an Arf GAP molecule with multiple PH domains that recognize phosphatidylinositol 3,4,5-trisphosphate. We found that growth factor stimulation induced localization of ARAP1 to an area of the plasma membrane inside the ring structure of circular dorsal ruffles (CDRs). Moreover, expression of ARAP1 increased the size of the CDR filamentous-actin ring in an Arf GAP activity–dependent manner, whereas smaller CDRs were formed by ARAP1 knockdown. In addition, expression of a dominant-negative mutant of Arf1 and Arf5, the substrates of ARAP1, expanded the size of CDRs, suggesting that the two Arf isoforms regulate ring structure downstream of ARAP1. Therefore our results reveal a novel molecular mechanism of CDR ring size control through the ARAP1–Arf1/5 pathway. PMID:22573888

  9. Interaction of FAPP1 with ARF1 and PI4P at a membrane surface: an example of coincidence detection

    PubMed Central

    Liu, Yizhou; Kahn, Richard A.; Prestegard, James H.


    SUMMARY Interactions among ADP-ribosylation factors (ARFs), various adaptor proteins, and membrane lipids are essential for intracellular vesicle transport of a variety of cellular materials. Here we present NMR-based information on the nature of the interaction of yeast ARF1 (yARF1) and the pleckstrin homology (PH) domain of four-phosphate-adaptor protein 1 (FAPP1) as it occurs at a model membrane surface. Interactions favor a model in which FAPP1 is partially embedded in the membrane and interacts with a membrane-associated ARF1 molecule primarily through contacts between residues in switch I of ARF1 and regions near and under the solution exposed C-terminal extension of the PH domain. The ARF1 binding site on FAPP1-PH is distinct from a positively charged phosphatidylinositol-4-phosphate (PI4P) binding site. A structural model is constructed that supports coincidence detection of both activated ARF and PI4P as a mechanism facilitating FAPP1 recruitment to membranes. PMID:24462251

  10. Analysis of Arf1 GTPase-dependent membrane binding and remodeling using the exomer secretory vesicle cargo adaptor

    PubMed Central

    Paczkowski, Jon E.; Fromme, J. Christopher


    Summary Protein-protein and protein-membrane interactions play a critical role in shaping biological membranes through direct physical contact with the membrane surface. This is particularly evident in many steps of membrane trafficking, in which proteins deform the membrane and induce fission to form transport carriers. The small GTPase Arf1 and related proteins have the ability to remodel membranes by insertion of an amphipathic helix into the membrane. Arf1 and the exomer cargo adaptor coordinate cargo sorting into subset of secretory vesicle carriers in the model organism Saccharomyces cerevisiae. Here, we detail the assays we used to explore the cooperative action of Arf1 and exomer to bind and remodel membranes. We expect these methods are broadly applicable to other small GTPase/effector systems where investigation of membrane binding and remodeling is of interest. PMID:27632000

  11. The RhoA guanine nucleotide exchange factor, LARG, mediates ICAM-1-dependent mechanotransduction in endothelial cells to stimulate transendothelial migration.


    Lessey-Morillon, Elizabeth C; Osborne, Lukas D; Monaghan-Benson, Elizabeth; Guilluy, Christophe; O'Brien, E Timothy; Superfine, Richard; Burridge, Keith


    RhoA-mediated cytoskeletal rearrangements in endothelial cells (ECs) play an active role in leukocyte transendothelial cell migration (TEM), a normal physiological process in which leukocytes cross the endothelium to enter the underlying tissue. Although much has been learned about RhoA signaling pathways downstream from ICAM-1 in ECs, little is known about the consequences of the tractional forces that leukocytes generate on ECs as they migrate over the surface before TEM. We have found that after applying mechanical forces to ICAM-1 clusters, there is an increase in cellular stiffening and enhanced RhoA signaling compared with ICAM-1 clustering alone. We have identified that leukemia-associated Rho guanine nucleotide exchange factor (LARG), also known as Rho GEF 12 (ARHGEF12) acts downstream of clustered ICAM-1 to increase RhoA activity, and that this pathway is further enhanced by mechanical force on ICAM-1. Depletion of LARG decreases leukocyte crawling and inhibits TEM. To our knowledge, this is the first report of endothelial LARG regulating leukocyte behavior and EC stiffening in response to tractional forces generated by leukocytes.

  12. Recruitment of Arf1-GDP to Golgi by Glo3p-type ArfGAPs is crucial for golgi maintenance and plant growth.


    Min, Myung Ki; Jang, Mihue; Lee, Myounghui; Lee, Junho; Song, Kyungyoung; Lee, Yongjik; Choi, Kwan Yong; Robinson, David G; Hwang, Inhwan


    ADP-ribosylation factor1 (Arf1), a member of the small GTP-binding proteins, plays a pivotal role in protein trafficking to multiple organelles. In its GDP-bound form, Arf1 is recruited from the cytosol to organelle membranes, where it functions in vesicle-mediated protein trafficking. However, the mechanism of Arf1-GDP recruitment remains unknown. Here, we provide evidence that two Glo3p-type Arf GTPase-activating proteins (ArfGAPs), ArfGAP domain8 (AGD8) and AGD9, are involved in the recruitment of Arf1-GDP to the Golgi apparatus in Arabidopsis (Arabidopsis thaliana). RNA interference plants expressing low levels of AGD8 and AGD9 exhibited abnormal Golgi morphology, inhibition of protein trafficking, and arrest of plant growth and development. In RNA interference plants, Arf1 was poorly recruited to the Golgi apparatus. Conversely, high levels of AGD8 and AGD9 induced Arf1 accumulation at the Golgi and suppressed Golgi disruption and inhibition of vacuolar trafficking that was caused by overexpression of AGD7. Based on these results, we propose that the Glo3p-type ArfGAPs AGD8 and AGD9 recruit Arf1-GDP from the cytosol to the Golgi for Arf1-mediated protein trafficking, which is essential for plant development and growth.

  13. Molecular basis of phosphatidylinositol 4-phosphate and ARF1 GTPase recognition by the FAPP1 pleckstrin homology (PH) domain.


    He, Ju; Scott, Jordan L; Heroux, Annie; Roy, Siddhartha; Lenoir, Marc; Overduin, Michael; Stahelin, Robert V; Kutateladze, Tatiana G


    Four-phosphate-adaptor protein 1 (FAPP1) regulates secretory transport from the trans-Golgi network (TGN) to the plasma membrane. FAPP1 is recruited to the Golgi through binding of its pleckstrin homology (PH) domain to phosphatidylinositol 4-phosphate (PtdIns(4)P) and a small GTPase ADP-ribosylation factor 1 (ARF1). Despite the critical role of FAPP1 in membrane trafficking, the molecular basis of its dual function remains unclear. Here, we report a 1.9 Å resolution crystal structure of the FAPP1 PH domain and detail the molecular mechanisms of the PtdIns(4)P and ARF1 recognition. The FAPP1 PH domain folds into a seven-stranded β-barrel capped by an α-helix at one edge, whereas the opposite edge is flanked by three loops and the β4 and β7 strands that form a lipid-binding pocket within the β-barrel. The ARF1-binding site is located on the outer side of the β-barrel as determined by NMR resonance perturbation analysis, mutagenesis, and measurements of binding affinities. The two binding sites have little overlap, allowing FAPP1 PH to associate with both ligands simultaneously and independently. Binding to PtdIns(4)P is enhanced in an acidic environment and is required for membrane penetration and tubulation activity of FAPP1, whereas the GTP-bound conformation of the GTPase is necessary for the interaction with ARF1. Together, these findings provide structural and biochemical insight into the multivalent membrane anchoring by the PH domain that may augment affinity and selectivity of FAPP1 toward the TGN membranes enriched in both PtdIns(4)P and GTP-bound ARF1.

  14. Ribose 2'-O methylation of the vesicular stomatitis virus mRNA cap precedes and facilitates subsequent guanine-N-7 methylation by the large polymerase protein.


    Rahmeh, Amal A; Li, Jianrong; Kranzusch, Philip J; Whelan, Sean P J


    During conventional mRNA cap formation, two separate methyltransferases sequentially modify the cap structure, first at the guanine-N-7 (G-N-7) position and subsequently at the ribose 2'-O position. For vesicular stomatitis virus (VSV), a prototype of the nonsegmented negative-strand RNA viruses, the two methylase activities share a binding site for the methyl donor S-adenosyl-l-methionine and are inhibited by individual amino acid substitutions within the C-terminal domain of the large (L) polymerase protein. This led to the suggestion that a single methylase domain functions for both 2'-O and G-N-7 methylations. Here we report a trans-methylation assay that recapitulates both ribose 2'-O and G-N-7 modifications by using purified recombinant L and in vitro-synthesized RNA. Using this assay, we demonstrate that VSV L typically modifies the 2'-O position of the cap prior to the G-N-7 position and that G-N-7 methylation is diminished by pre-2'-O methylation of the substrate RNA. Amino acid substitutions in the C terminus of L that prevent all cap methylation in recombinant VSV (rVSV) partially retain the ability to G-N-7 methylate a pre-2'-O-methylated RNA, therefore uncoupling the effect of substitutions in the C terminus of the L protein on the two methylations. In addition, we show that the 2'-O and G-N-7 methylase activities act specifically on RNA substrates that contain the conserved elements of a VSV mRNA start at the 5' terminus. This study provides new mechanistic insights into the mRNA cap methylase activities of VSV L, demonstrates that 2'-O methylation precedes and facilitates subsequent G-N-7 methylation, and reveals an RNA sequence and length requirement for the two methylase activities. We propose a model of regulation of the activity of the C terminus of L protein in 2'-O and G-N-7 methylation of the cap structure.

  15. Interaction of ARF-1.1 and neuronal calcium sensor-1 in the control of the temperature-dependency of locomotion in Caenorhabditis elegans

    PubMed Central

    Todd, Paul A. C.; McCue, Hannah V.; Haynes, Lee P.; Barclay, Jeff W.; Burgoyne, Robert D.


    Neuronal calcium sensor-1 (NCS-1) mediates changes in cellular function by regulating various target proteins. Many potential targets have been identified but the physiological significance of only a few has been established. Upon temperature elevation, Caenorhabditis elegans exhibits reversible paralysis. In the absence of NCS-1, worms show delayed onset and a shorter duration of paralysis. This phenotype can be rescued by re-expression of ncs-1 in AIY neurons. Mutants with defects in four potential NCS-1 targets (arf-1.1, pifk-1, trp-1 and trp-2) showed qualitatively similar phenotypes to ncs-1 null worms, although the effect of pifk-1 mutation on time to paralysis was considerably delayed. Inhibition of pifk-1 also resulted in a locomotion phenotype. Analysis of double mutants showed no additive effects between mutations in ncs-1 and trp-1 or trp-2. In contrast, double mutants of arf-1.1 and ncs-1 had an intermediate phenotype, consistent with NCS-1 and ARF-1.1 acting in the same pathway. Over-expression of arf-1.1 in the AIY neurons was sufficient to rescue partially the phenotype of both the arf-1.1 and the ncs-1 null worms. These findings suggest that ARF-1.1 interacts with NCS-1 in AIY neurons and potentially pifk-1 in the Ca2+ signaling pathway that leads to inhibited locomotion at an elevated temperature. PMID:27435667

  16. Structure of an ADP-ribosylation factor, ARF1, from Entamoeba histolytica bound to Mg(2+)-GDP.


    Serbzhinskiy, Dmitry A; Clifton, Matthew C; Sankaran, Banumathi; Staker, Bart L; Edwards, Thomas E; Myler, Peter J


    Entamoeba histolytica is the etiological agent of amebiasis, a diarrheal disease which causes amoebic liver abscesses and amoebic colitis. Approximately 50 million people are infected worldwide with E. histolytica. With only 10% of infected people developing symptomatic amebiasis, there are still an estimated 100,000 deaths each year. Because of the emergence of resistant strains of the parasite, it is necessary to find a treatment which would be a proper response to this challenge. ADP-ribosylation factor (ARF) is a member of the ARF family of GTP-binding proteins. These proteins are ubiquitous in eukaryotic cells; they generally associate with cell membranes and regulate vesicular traffic and intracellular signalling. The crystal structure of ARF1 from E. histolytica has been determined bound to magnesium and GDP at 1.8 Å resolution. Comparison with other structures of eukaryotic ARF proteins shows a highly conserved structure and supports the interswitch toggle mechanism of communicating the conformational state to partner proteins.

  17. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2013 CFR


    ... 21 Food and Drugs 1 2013-04-01 2013-04-01 false Guanine. 73.1329 Section 73.1329 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine...

  18. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2014 CFR


    ... 21 Food and Drugs 1 2014-04-01 2014-04-01 false Guanine. 73.1329 Section 73.1329 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine...

  19. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2012 CFR


    ... 21 Food and Drugs 1 2012-04-01 2012-04-01 false Guanine. 73.1329 Section 73.1329 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine...

  20. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2010 CFR


    ... 21 Food and Drugs 1 2010-04-01 2010-04-01 false Guanine. 73.1329 Section 73.1329 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine...

  1. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2010 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The color additive guanine shall conform in identity and specifications to the requirements of § 73.1329 (a)(1) and (b). (2) Color additive mixtures of guanine may contain the following diluents: (i)...

  2. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2011 CFR


    ... eye, in amounts consistent with good manufacturing practice. (d) Labeling. The color additive and any... ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine is... derived. (2) Color additive mixtures for drug use made with guanine may contain only those diluents...

  3. Bacterial Ammeline Metabolism via Guanine Deaminase ▿

    PubMed Central

    Seffernick, Jennifer L.; Dodge, Anthony G.; Sadowsky, Michael J.; Bumpus, John A.; Wackett, Lawrence P.


    Melamine toxicity in mammals has been attributed to the blockage of kidney tubules by insoluble complexes of melamine with cyanuric acid or uric acid. Bacteria metabolize melamine via three consecutive deamination reactions to generate cyanuric acid. The second deamination reaction, in which ammeline is the substrate, is common to many bacteria, but the genes and enzymes responsible have not been previously identified. Here, we combined bioinformatics and experimental data to identify guanine deaminase as the enzyme responsible for this biotransformation. The ammeline degradation phenotype was demonstrated in wild-type Escherichia coli and Pseudomonas strains, including E. coli K12 and Pseudomonas putida KT2440. Bioinformatics analysis of these and other genomes led to the hypothesis that the ammeline deaminating enzyme was guanine deaminase. An E. coli guanine deaminase deletion mutant was deficient in ammeline deaminase activity, supporting the role of guanine deaminase in this reaction. Two guanine deaminases from disparate sources (Bradyrhizobium japonicum USDA 110 and Homo sapiens) that had available X-ray structures were purified to homogeneity and shown to catalyze ammeline deamination at rates sufficient to support bacterial growth on ammeline as a sole nitrogen source. In silico models of guanine deaminase active sites showed that ammeline could bind to guanine deaminase in a similar orientation to guanine, with a favorable docking score. Other members of the amidohydrolase superfamily that are not guanine deaminases were assayed in vitro, and none had substantial ammeline deaminase activity. The present study indicated that widespread guanine deaminases have a promiscuous activity allowing them to catalyze a key reaction in the bacterial transformation of melamine to cyanuric acid and potentially contribute to the toxicity of melamine. PMID:20023034

  4. AlFx affects the formation of focal complexes by stabilizing the Arf-GAP ASAP1 in a complex with Arf1.


    Klein, Stéphanie; Franco, Michel; Chardin, Pierre; Luton, Frédéric


    Aluminum fluoride (AlFx) is known to activate directly the alpha subunit of G-proteins but not the homologous small GTP-binding proteins. However, AlFx can stabilize complexes formed between Ras, RhoA or Cdc42 and their corresponding GTPase-activating proteins (GAPs). Here, we demonstrate that Arf1GDP can be converted into an active conformation by AlFx to form a complex with the Arf-GAP ASAP1 in vitro and in vivo. Within this complex ASAP1, which GAP activity is inoperative, can still alter the recruitment of paxillin to the focal complexes, thus indicating that ASAP1 interferes with focal complexes independently of its GAP activity.

  5. Guanine base stacking in G-quadruplex nucleic acids

    PubMed Central

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân


    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  6. ARF1 and ARF6 regulate recycling of GRASP/Tamalin and the Rac1-GEF Dock180 during HGF-induced Rac1 activation.


    Koubek, Emily J; Santy, Lorraine C


    Hepatocyte growth factor (HGF) is a potent signaling factor that acts on epithelial cells, causing them to dissociate and scatter. This migration is coordinated by a number of small GTPases, such as ARF6 and Rac1. Active ARF6 is required for HGF-stimulated migration and intracellular levels of ARF6-GTP and Rac1-GTP increase following HGF treatment. During migration, cross talk between ARF6 and Rac1 occurs through formation of a multi-protein complex containing the ARF-GEF cytohesin-2, the scaffolding protein GRASP/Tamalin, and the Rac1-GEF Dock180. Previously, the role of ARF6 in this process was unclear. We have now found that ARF6 and ARF1 regulate trafficking of GRASP and Dock180 to the plasma membrane following HGF treatment. Trafficking of GRASP and Dock180 is impaired by blocking ARF6-mediated recycling pathways and is required for HGF-stimulated Rac1 activation. Finally, HGF treatment stimulates association of GRASP and Dock180. Inhibition of ARF6 trafficking pathways traps GRASP and Dock180 as a complex in the cell.

  7. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2011 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The... coloring cosmetics generally, only those diluents listed under § 73.1001(a)(1); (ii) For coloring externally applied cosmetics, only those diluents listed in § 73.1001(b) and, in addition, nitrocellulose....

  8. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2012 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The... coloring cosmetics generally, only those diluents listed under § 73.1001(a)(1); (ii) For coloring externally applied cosmetics, only those diluents listed in § 73.1001(b) and, in addition, nitrocellulose....

  9. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2013 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The... coloring cosmetics generally, only those diluents listed under § 73.1001(a)(1); (ii) For coloring externally applied cosmetics, only those diluents listed in § 73.1001(b) and, in addition, nitrocellulose....

  10. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2014 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The... coloring cosmetics generally, only those diluents listed under § 73.1001(a)(1); (ii) For coloring externally applied cosmetics, only those diluents listed in § 73.1001(b) and, in addition, nitrocellulose....

  11. Calculation of the stabilization energies of oxidatively damaged guanine base pairs with guanine.


    Suzuki, Masayo; Kino, Katsuhito; Morikawa, Masayuki; Kobayashi, Takanobu; Komori, Rie; Miyazawa, Hiroshi


    DNA is constantly exposed to endogenous and exogenous oxidative stresses. Damaged DNA can cause mutations, which may increase the risk of developing cancer and other diseases. G:C-C:G transversions are caused by various oxidative stresses. 2,2,4-Triamino-5(2H)-oxazolone (Oz), guanidinohydantoin (Gh)/iminoallantoin (Ia) and spiro-imino-dihydantoin (Sp) are known products of oxidative guanine damage. These damaged bases can base pair with guanine and cause G:C-C:G transversions. In this study, the stabilization energies of these bases paired with guanine were calculated in vacuo and in water. The calculated stabilization energies of the Ia:G base pairs were similar to that of the native C:G base pair, and both bases pairs have three hydrogen bonds. By contrast, the calculated stabilization energies of Gh:G, which form two hydrogen bonds, were lower than the Ia:G base pairs, suggesting that the stabilization energy depends on the number of hydrogen bonds. In addition, the Sp:G base pairs were less stable than the Ia:G base pairs. Furthermore, calculations showed that the Oz:G base pairs were less stable than the Ia:G, Gh:G and Sp:G base pairs, even though experimental results showed that incorporation of guanine opposite Oz is more efficient than that opposite Gh/Ia and Sp.

  12. Chlorophyll fluorescence control in microalgae by biogenic guanine crystals

    NASA Astrophysics Data System (ADS)

    Miyashita, Yuito; Iwasaka, Masakazu; Endo, Hirotoshi


    Magnetic fields were applied to water suspensions of guanine crystals to induce changes in light scattering as a possible way to control photosynthesis in microalgae. The effect of guanine microcrystals with and without an applied magnetic field on the photosynthesis of a unicellular microalgae (plant), Pleurochrysis. carterae (P. carterae), was investigated by examining chlorophyll fluorescence. The fluorescence intensity at 600-700 nm of the photosynthetic cells increased remarkably when the concentration ratio of guanine microcrystals was 10 times larger than that of the cells. This increase in fluorescence occurred reproducibly and was proportional to the amount of guanine microcrystals added. It is speculated that the guanine microcrystals enhance the intensity of the excitation light on the cells by concentrating the excitation light or prolonging the time of light exposure to the cells. Moreover, applying a 500-mT magnetic field allowed modulation of the fluorescence intensity, depending on the direction of the fluorescence light.

  13. Identification, expression, and characterization of Escherichia coli guanine deaminase.


    Maynes, J T; Yuan, R G; Snyder, F F


    Using the human cDNA sequence corresponding to guanine deaminase, the Escherichia coli genome was scanned using the Basic Local Alignment Search Tool (BLAST), and a corresponding 439-residue open reading frame of unknown function was identified as having 36% identity to the human protein. The putative gene was amplified, subcloned into the pMAL-c2 vector, expressed, purified, and characterized enzymatically. The 50.2-kDa protein catalyzed the conversion of guanine to xanthine, having a K(m) of 15 microM with guanine and a k(cat) of 3.2 s(-1). The bacterial enzyme shares a nine-residue heavy metal binding site with human guanine deaminase, PG[FL]VDTHIH, and was found to contain approximately 1 mol of zinc per mol of subunit of protein. The E. coli guanine deaminase locus is 3' from an open reading frame which shows homology to a bacterial purine base permease.

  14. Identification, Expression, and Characterization of Escherichia coli Guanine Deaminase

    PubMed Central

    Maynes, Jason T.; Yuan, Richard G.; Snyder, Floyd F.


    Using the human cDNA sequence corresponding to guanine deaminase, the Escherichia coli genome was scanned using the Basic Local Alignment Search Tool (BLAST), and a corresponding 439-residue open reading frame of unknown function was identified as having 36% identity to the human protein. The putative gene was amplified, subcloned into the pMAL-c2 vector, expressed, purified, and characterized enzymatically. The 50.2-kDa protein catalyzed the conversion of guanine to xanthine, having a Km of 15 μM with guanine and a kcat of 3.2 s−1. The bacterial enzyme shares a nine-residue heavy metal binding site with human guanine deaminase, PG[FL]VDTHIH, and was found to contain approximately 1 mol of zinc per mol of subunit of protein. The E. coli guanine deaminase locus is 3′ from an open reading frame which shows homology to a bacterial purine base permease. PMID:10913105

  15. Experimental observation of guanine tautomers with VUV photoionization.


    Zhou, Jia; Kostko, Oleg; Nicolas, Christophe; Tang, Xiaonan; Belau, Leonid; de Vries, Mattanjah S; Ahmed, Musahid


    Two methods of preparing guanine in the gas phase, thermal vaporization and laser desorption, have been investigated. The guanine generated by each method is entrained in a molecular beam, single-photon ionized with tunable VUV synchrotron radiation, and analyzed using reflectron mass spectrometry. The recorded photoionization efficiency (PIE) curves show a dramatic difference for experiments performed via thermal vaporization compared to that with laser desorption. The calculated vertical and adiabatic ionization energies for the eight lowest-lying tautomers of guanine suggest that the experimental observations arise from different tautomers being populated in the two different experimental methods.

  16. Guanine oxidation: one- and two-electron reactions.


    Pratviel, Geneviève; Meunier, Bernard


    Guanine bases in DNA are the most sensitive to oxidation. A lot of effort has been devoted to the understanding of the chemical modifications of guanine under different oxidizing conditions, the final goal being to know which lesions in DNA can be expected in vivo and their biological consequences. This article analyses the mechanisms underlying guanine oxidation by the comparison between one- and two-electron transfer processes. The different oxidants used in vitro give complementary answers. This overview presents a choice of some key intermediates and the predictive description of G-oxidation products that can be generated from these intermediates depending on the reaction conditions.

  17. Experimental observation of guanine tautomers with VUV photoionization

    SciTech Connect

    Zhou, Jia; Kostko, Oleg; Nicolas, Christophe; Tang, Xiaonan; Belau, Leonid; de Vries, Mattanjah S.; Ahmed, Musahid


    Two methods of preparing guanine in the gas phase, thermal vaporization and laser desorption, have been investigated. The guanine generated by each method is entrained in a molecular beam, single photon ionized with tunable VUV synchrotron radiation, and analyzed using reflectron mass spectrometry. The recorded photoionization efficiency (PIE) curves show a dramatic difference for experiments performed via thermal vaporization compared to laser desorption. The calculated vertical and adiabatic ionization energies for the eight lowest lying tautomers of guanine suggest the experimental observations arise from different tautomers being populated in the two different experimental methods.

  18. Guanine- Formation During the Thermal Polymerization of Amino Acids

    NASA Technical Reports Server (NTRS)

    Mc Caw, B. K.; Munoz, E. F.; Ponnamperuma, C.; Young, R. S.


    The action of heat on a mixture of amino acids was studied as a possible abiological pathway for the synthesis of purines and pyrimidines. Guanine was detected. This result is significant in the context of chemical evolution.

  19. Studies on guanine deaminase and its inhibitors in rat tissue

    PubMed Central

    Kumar, S.; Josan, V.; Sanger, K. C. S.; Tewari, K. K.; Krishnan, P. S.


    1. In kidney, but not in rat whole brain and liver, guanine-deaminase activity was localized almost exclusively in the 15000g supernatant fraction of iso-osmotic sucrose homogenates. However, as in brain and liver, the enzymic activity recovered in the supernatant was higher than that in the whole homogenate. The particulate fractions of kidney, especially the heavy mitochondria, brought about powerful inhibition of the supernatant guanine-deaminase activity. 2. In spleen, as in kidney, guanine-deaminase activity was localized in the 15000g supernatant fraction of iso-osmotic sucrose homogenates. However, the particulate fractions did not inhibit the activity of the supernatant. 3. Guanine-deaminase activity in rat brain was absent from the cerebellum and present only in the cerebral hemispheres. The inhibitor of guanine deaminase was located exclusively in the cerebellum, where it was associated with the particles sedimenting at 5000g from sucrose homogenates. 4. Homogenates of cerebral hemispheres, the separated cortex or the remaining portion of the hemispheres had significantly higher guanine-deaminase activity than homogenates of whole brain. The enzymic activity of the subcellular particulate fractions was nearly the same. 5. Guanine deaminase was purified from the 15000g supernatant of sucrose homogenates of whole brain. The enzyme separated as two distinct fractions, A and B, on DEAE-cellulose columns. 6. The guanine-deaminase activity of the light-mitochondrial fraction of whole brain was fully exposed and solubilized by treatment with Triton X-100, and partially purified. 7. Tested in the form of crude preparations, the inhibitor from kidney did not act on the brain and liver supernatant enzymes and the inhibitor from cerebellum did not act on kidney enzyme, but the inhibitor from liver acted on both brain and kidney enzyme. 8. The inhibitor of guanine deaminase was purified from the heavy mitochondria of whole brain and liver and the 5000g residue of

  20. ESI-MS Characterization of a Novel Pyrrole-Inosine Nucleoside that Interacts with Guanine Bases

    PubMed Central

    Pierce, Sarah E.; Sherman, Courtney L.; Jayawickramarajah, Janarthanan; Lawrence, Candace M.; Sessler, Jonathan L.; Brodbelt, Jennifer S.


    Based on binding studies undertaken by electrospray ionization-mass spectrometry, a synthetic pyrrole-inosine nucleoside, 1, capable of forming an extended three-point Hoogsteen-type hydrogen-bonding interaction with guanine, is shown to form specific complexes with two different quadruplex DNA structures [dTG4T]4 and d(T2G4)4 as well as guanine rich duplex DNA. The binding interactions of two other analogs were evaluated in order to unravel the structural features that contribute to specific DNA recognition. The importance of the Hoogsteen interactions was confirmed through the absence of specific binding when the pyrrole NH hydrogen-bonding site was blocked or removed. While 2, with a large blocking group, was not found to interact with virtually any form of DNA, 3, with the pyrrole functionality missing, was found to interact non-specifically with several types of DNA. The specific binding of 1 to guanine rich DNA emphasizes the necessity of careful ligand design for specific sequence recognition. PMID:18790136

  1. Highly sensitive and synergistic detection of guanine and adenine based on poly(xanthurenic acid)-reduced graphene oxide interface.


    Yang, Tao; Kong, Qianqian; Li, Qianhe; Wang, Xinxing; Chen, Lihua; Jiao, Kui


    In order to achieve the large direct electrochemical signals of guanine and adenine, an urgent request to explore novel electrode materials and interfaces has been put forward. In this paper, a poly(xanthurenic acid, Xa)-reduced graphene oxide (PXa-ERGNO) interface, which has rich negatively charged active sites and accelerated electron transfer ability, was fabricated for monitoring the positively charged guanine and adenine. Scanning electron microscopy, Fourier transform infrared spectroscopy, Raman spectra, X-ray photoelectron spectroscopy, cyclic voltammetry, electrochemical impedance spectroscopy, and differential pulse voltammetry were adopted to characterize the morphology and prove the electrochemical properties of the prepared interface. The PXa-ERGNO interface with rich negative charge and large electrode surface area was an excellent sensing platform to prompt the adsorption of the positively charged guanine and adenine via strong π-π* interaction or electrostatic adsorption. The PXa-ERGNO interface exhibited prominent synergistic effect and good electrocatalytic activity for sensitive determination of guanine and adenine compared with sole PXa or ERGNO modified electrode. The sensing platform we built could be further applied in the adsorption and detection of other positively charged biomolecules or aromatic molecules.

  2. A 2-iminohydantoin from the oxidation of guanine.


    Ye, Wenjie; Sangaiah, R; Degen, Diana E; Gold, Avram; Jayaraj, K; Koshlap, Karl M; Boysen, Gunnar; Williams, Jason; Tomer, Kenneth B; Ball, Louise M


    The nucleobase guanine was oxidized with dimethyldioxirane (DMDO) to explore the role of epoxidizing agents in oxidative DNA damage. Treatment of guanine with 10% molar excess DMDO in aqueous solution at 0 degrees C and pH 7.5 followed by workup under mild conditions gave 5-carboxamido-5-formamido-2-iminohydantoin (1) as the sole isolable product in 71% yield. The structure of 1 was established on the basis of mass spectrometry and NMR studies on 1 and its isotopomers generated by the oxidation of [4-(13)C] and [7-(15)N]guanine, which yield [5-(13)C]1 and [7-(15)N]1. The distribution of 13C and 15N labels in the isotopomeric products supports initial epoxidation of the C4-C5 bond of guanine followed by a 1,2-acyl migration of guanine C6. Compound 1 is suggested as a possible primary DNA lesion from putative epoxidizing agents, including hydroperoxides present during biological processes such as lipid peroxidation.

  3. N-Sulfomethylation of guanine, adenine and cytosine with formaldehyde-bisulfite. A selective modification of guanine in DNA.


    Hayatsu, H; Yamashita, Y; Yui, S; Yamagata, Y; Tomita, K; Negishi, K


    When guanine-, adenine- and cytosine-nucleosides and nucleotides were treated with formaldehyde and then with bisulfite, stable N-sulfomethyl compounds were formed. N2-Sulfomethylguanine, N6-sulfomethyladenine, N4-sulfomthylcytosine and N6-sulfomethyl-9-beta-D-arabinofuranosyladenine were isolated as crystals and characterized. A guanine-specific sulfomethylation was brought about by treatment and denatured single-stranded DNA with formaldehyde and then with bisulfite at pH 7 and 4 degrees C. Since native double-stranded DNA was not modified by this treatment, this new method of modification is expected to be useful as a conformational probe for polynucleotides.

  4. N-Sulfomethylation of guanine, adenine and cytosine with formaldehyde-bisulfite. A selective modification of guanine in DNA.

    PubMed Central

    Hayatsu, H; Yamashita, Y; Yui, S; Yamagata, Y; Tomita, K; Negishi, K


    When guanine-, adenine- and cytosine-nucleosides and nucleotides were treated with formaldehyde and then with bisulfite, stable N-sulfomethyl compounds were formed. N2-Sulfomethylguanine, N6-sulfomethyladenine, N4-sulfomthylcytosine and N6-sulfomethyl-9-beta-D-arabinofuranosyladenine were isolated as crystals and characterized. A guanine-specific sulfomethylation was brought about by treatment and denatured single-stranded DNA with formaldehyde and then with bisulfite at pH 7 and 4 degrees C. Since native double-stranded DNA was not modified by this treatment, this new method of modification is expected to be useful as a conformational probe for polynucleotides. PMID:7177848

  5. Global deformation facilitates flipping of damaged 8-oxo-guanine and guanine in DNA

    PubMed Central

    La Rosa, Giuseppe; Zacharias, Martin


    Oxidation of guanine (Gua) to form 7,8-dihydro-8-oxoguanine (8oxoG) is a frequent mutagenic DNA lesion. DNA repair glycosylases such as the bacterial MutM can effciently recognize and eliminate the 8oxoG damage by base excision. The base excision requires a 8oxoG looping out (flipping) from an intrahelical base paired to an extrahelical state where the damaged base is in the enzyme active site. It is still unclear how the damage is identified and flipped from an energetically stable stacked and paired state without any external energy source. Free energy simulations have been employed to study the flipping process for globally deformed DNA conformational states. DNA deformations were generated by systematically untwisting the DNA to mimic its conformation in repair enzyme encounter complex. The simulations indicate that global DNA untwisting deformation toward the enzyme bound form alone (without protein) significantly reduces the penalty for damage flipping to about half of the penalty observed in regular DNA. The finding offers a mechanistic explanation how binding free energy that is transformed to binding induced DNA deformation facilitates flipping and helps to rapidly detect a damaged base. It is likely of general relevance since repair enzyme binding frequently results in significant deformation of the target DNA. PMID:27651459

  6. Camptothecins guanine interactions: mechanism of charge transfer reaction upon photoactivation

    NASA Astrophysics Data System (ADS)

    Steenkeste, K.; Guiot, E.; Tfibel, F.; Pernot, P.; Mérola, F.; Georges, P.; Fontaine-Aupart, M. P.


    The potent activity exhibited by the antitumoral camptothecin (CPT) and its analog irinotecan (CPT-11) is known to be related to a close contact between the drug and the nucleic acid base guanine. This specificity of interaction between these two chromophores was examined by following changes in the photophysical properties of the drug using steady-state as well as time-resolved absorption and fluorescence methods. The observed effects on absorption, fluorescence emission and singlet excited state lifetimes give evidence for the occurrence of a stacking complex formation restricted to the quinoline part of CPT or CPT-11 and the guanine base but also with the adenine base. The triplet excited state properties of the drugs have been also characterized in absence and in presence of guanosine monophosphate and reveal the occurrence of an electron transfer from the guanine base to the drug. Support for this conclusion was obtained from the studies of a set of biological targets of various oxido-reduction potentials, adenosine monophosphate, cytidine, cytosine, tryptophan, tyrosine and phenylalanine. This finding gives an interpretation of the CPT-induced guanine photolesions previously reported in the literature. These data taken together are discussed in connection with the drug activity. The stacking complex CPT/guanine is necessary but not sufficient to explain the role of the chirality and of the lactone structure in the function of the drug. A stereospecific interaction with the enzyme topoisomerase I seems necessary to stabilize the stacking complex. The first experiments using time-resolved fluorescence by two-photon excitation confirms that CPT does not bind to the isolated enzyme.

  7. Cloning and expression of the hypoxanthine-guanine phosphoribosyltransferase gene from Trypanosoma brucei.

    PubMed Central

    Allen, T E; Ullman, B


    The hypoxanthine-guanine phosphoribosyltransferase (HGPRT) enzyme of Trypanosoma brucei and related parasites provides a rational target for the treatment of African sleeping sickness and several other parasitic diseases. To characterize the T. brucei HGPRT enzyme in detail, the T. brucei hgprt was isolated within a 4.2 kb SalI-KpnI genomic insert and sequenced. Nucleotide sequence analysis revealed an open reading frame of 630 bp that encoded a protein of 210 amino acids with a M(r) = 23.4 kd. After gap alignment, the T. brucei HGPRT exhibited 21-23% amino acid sequence identity, mostly in three clustered regions, with the HGPRTs from human, S. mansoni, and P falciparum, indicating that the trypanosome enzyme was the most divergent of the group. Surprisingly, the T. brucei HGPRT was more homologous to the hypoxanthine phosphoribosyltransferase (HPRT) from the prokaryote V. harveyi than to the eukaryotic HGPRTs. Northern blot analysis revealed two trypanosome transcripts of 1.4 and 1.9 kb, each expressed to equivalent degrees in insect vector and mammalian forms of the parasite. The T. brucei hgprt was inserted into an expression plasmid and transformed into S phi 606 E. coli that are deficient in both HPRT and xanthine-guanine phosphoribosyltransferase activities. Soluble, enzymatically active recombinant T. brucei HGPRT was expressed to high levels and purified to homogeneity by GTP-agarose affinity chromatography. The purified recombinant enzyme recognized hypoxanthine, guanine, and allopurinol, but not xanthine or adenine, as substrates and was inhibited by a variety of nucleotide effectors. The availability of a molecular clone encoding the T. brucei hgprt and large quantities of homogeneous recombinant HGPRT enzyme provides an experimentally manipulable molecular and biochemical system for the rational design of novel therapeutic agents for the treatment of African sleeping sickness and other diseases of parasitic origin. Images PMID:8265360

  8. Effect O6-guanine alkylation on DNA flexibility studied by comparative molecular dynamics simulations.


    Kara, Mahmut; Drsata, Tomas; Lankas, Filip; Zacharias, Martin


    Alkylation of guanine at the O6 atom is a highly mutagenic DNA lesion because it alters the coding specificity of the base causing G:C to A:T transversion mutations. Specific DNA repair enzymes, e.g. O(6)-alkylguanin-DNA-Transferases (AGT), recognize and repair such damage after looping out the damaged base to transfer it into the enzyme active site. The exact mechanism how the repair enzyme identifies a damaged site within a large surplus of undamaged DNA is not fully understood. The O(6)-alkylation of guanine may change the deformability of DNA which may facilitate the initial binding of a repair enzyme at the damaged site. In order to characterize the effect of O(6)-methyl-guanine (O(6)-MeG) containing base pairs on the DNA deformability extensive comparative molecular dynamics (MD) simulations on duplex DNA with central G:C, O(6)-MeG:C or O(6)-MeG:T base pairs were performed. The simulations indicate significant differences in the helical deformability due to the presence of O(6)-MeG compared to regular undamaged DNA. This includes enhanced base pair opening, shear and stagger motions and alterations in the backbone fine structure caused in part by transient rupture of the base pairing at the damaged site and transient insertion of water molecules. It is likely that the increased opening motions of O(6)-MeG:C or O(6)-MeG:T base pairs play a decisive role for the induced fit recognition or for the looping out of the damaged base by repair enzymes.

  9. Impedimetric investigation of gold nanoparticles - guanine modified electrode

    SciTech Connect

    Vulcu, A.; Pruneanu, S.; Berghian-Grosan, C.; Olenic, L.; Muresan, L. M.; Barbu-Tudoran, L.


    In this paper we report the preparation of a modified electrode with gold nanoparticles and guanine. The colloidal suspension of gold nanoparticles was obtained by Turkevich method and was next analyzed by UV-Vis spectroscopy and Transmission Electron Microscopy (TEM). The gold electrode was modified by self-assembling the gold nanoparticles with guanine, the organic molecule playing also the role of linker. The electrochemical characteristics of the bare and modified electrode were investigated by Electrochemical Impedance Spectroscopy (EIS). A theoretical model was developed based on an electrical equivalent circuit which contain solution resistance (R{sub s}), charge transfer resistance (R{sub ct}), Warburg impedance (Z{sub W}) and double layer capacitance (C{sub dl})

  10. Guanine is a growth factor for Legionella species.

    PubMed Central

    Pine, L; Franzus, M J; Malcolm, G B


    Evaluation of previously described chemically defined media for the growth of Legionella pneumophila showed that these media supported poor growth of several strains of L. pneumophila and did not support growth of certain of the Legionella species described later. Growth was stimulated by the dialysate from yeast extract but not by the nondialyzable fraction. Further investigations indicated that the active factors from the yeast extract dialysate were purine or pyrimidine derivatives, and certain known purines and pyrimidines were found to stimulate growth. Of these, guanine universally stimulated growth of all Legionella strains and was a growth requirement for several of the species tested. A balanced, N-(2-acetamido)-2-aminoethanesulfonic acid-buffered, chemically defined medium having guanine or a purine-pyrimidine mix is presented for the general growth of Legionella species. PMID:3700600

  11. Fragmentation mechanisms of cytosine, adenine and guanine ionized bases.


    Sadr-Arani, Leila; Mignon, Pierre; Chermette, Henry; Abdoul-Carime, Hassan; Farizon, Bernadette; Farizon, Michel


    The different fragmentation channels of cytosine, adenine and guanine have been studied through DFT calculations. The electronic structure of bases, their cations, and the fragments obtained by breaking bonds provides a good understanding of the fragmentation process that can complete the experimental approach. The calculations allow assigning various fragments to the given peaks. The comparison between the energy required for the formation of fragments and the peak intensity in the mass spectrum is used. For cytosine and guanine the elimination of the HNCO molecule is a major route of dissociation, while for adenine multiple loss of HCN or HNC can be followed up to small fragments. For cytosine, this corresponds to the initial bond cleavage of N3-C4/N1-C2, which represents the main dissociation route. For guanine the release of HNCO is obtained through the N1-C2/C5-C6 bond cleavage (reverse order also possible) leading to the largest peak of the spectrum. The corresponding energies of 3.5 and 3.9 eV are typically in the range available in the experiments. The loss of NH3 or HCN is also possible but requires more energy. For adenine, fragmentation consists of multiple loss of the HCN molecule and the main route corresponding to HC8N9 loss is followed by the release of HC2N1.

  12. `Guanigma': the revised structure of biogenic anhydrous guanine

    NASA Astrophysics Data System (ADS)

    Hirsch, Anna; Gur, Dvir; Polishchuk, Iryna; Levy, Davide; Pokroy, Boaz; Cruz-Cabeza, Aurora J.; Addadi, Lia; Kronik, Leeor; Leiserowitz, Leslie

    Living organisms display a spectrum of colors, produced by pigmentation, structural coloration, or both. A relatively well-studied system, which produces colors via an array of alternating anhydrous guanine crystals and cytoplasm, is responsible for the metallic luster of many fish. The structure of biogenic anhydrous guanine was believed to be the same as that of the synthetic one - a monoclinic polymorph. Here we re-examine the structure of biogenic guanine, using experimental X-ray and electron diffraction (ED) data exposing troublesome inconsistencies - namely, a 'guanigma'. To address this, we sought alternative candidate polymorphs using symmetry and packing considerations, then used first principles calculations to determine whether the selected candidates could be energetically stable. We identified theoretically a different monoclinic polymorph, were able to synthesize it, and to confirm using X-ray diffraction that it is this polymorph that occurs in biogenic samples. However, the ED data were still not consistent with this polymorph, but rather with a theoretically generated orthorhombic polymorph. This apparent inconsistency was resolved by showing how the ED pattern could be affected by crystal structural faults composed of offset molecular layers.

  13. A three-state model for the photophysics of guanine.


    Serrano-Andrés, Luis; Merchán, Manuela; Borin, Antonio Carlos


    The nonadiabatic photochemistry of the guanine molecule (2-amino-6-oxopurine) and some of its tautomers has been studied by means of the high-level theoretical ab initio quantum chemistry methods CASSCF and CASPT2. Accurate computations, based by the first time on minimum energy reaction paths, states minima, transition states, reaction barriers, and conical intersections on the potential energy hypersurfaces of the molecules lead to interpret the photochemistry of guanine and derivatives within a three-state model. As in the other purine DNA nucleobase, adenine, the ultrafast subpicosecond fluorescence decay measured in guanine is attributed to the barrierless character of the path leading from the initially populated 1(pi pi* L(a)) spectroscopic state of the molecule toward the low-lying methanamine-like conical intersection (gs/pi pi* L(a))CI. On the contrary, other tautomers are shown to have a reaction energy barrier along the main relaxation profile. A second, slower decay is attributed to a path involving switches toward two other states, 1(pi pi* L(b)) and, in particular, 1(n(O) pi*), ultimately leading to conical intersections with the ground state. A common framework for the ultrafast relaxation of the natural nucleobases is obtained in which the predominant role of a pi pi*-type state is confirmed.

  14. Guanine oxidation by electron transfer: one- versus two-electron oxidation mechanism.


    Kupan, Adam; Saulière, Aude; Broussy, Sylvain; Seguy, Christel; Pratviel, Geneviève; Meunier, Bernard


    The degeneracy of the guanine radical cation, which is formed in DNA by oxidation of guanine by electron transfer, was studied by a detailed analysis of the oxidation products of guanine on oligonucleotide duplexes and by labeling experiments. It was shown that imidazolone, the major product of guanine oxidation, is formed through a one-electron oxidation process and incorporates one oxygen atom from O2. The formation of 8-oxo-7,8-dihydroguanine by a two-electron oxidation process was a minor pathway. The two-electron oxidation mechanism was also evidenced by the formation of a tris(hydroxymethyl)aminomethane adduct.

  15. Structure-Based Design of Trna-Guanine Transglycosylase Inhibitors

    NASA Astrophysics Data System (ADS)

    Klebe, Gerhard

    Taking the development of inhibitors for the tRNA-modifying enzyme tRNA-guanine transglycosylase (TGT) as an example, the scope of a structure-based drug development project will be demonstrated, performed via several cycles of iterative design. The described example is based on studies, performed at ETH-Zurich and University of Marburg in joint collaboration. As these studies have been executed in an academic environment, different tools of structure-based design have been applied and several issues of more fundamental interest to the methodological background of the project could be addressed.

  16. Production of guanine from NH(4)CN polymerizations

    NASA Technical Reports Server (NTRS)

    Levy, M.; Miller, S. L.; Oro, J.


    The synthesis of adenine from the polymerization of concentrated ammonium cyanide solutions is well known. We show here that guanine is also produced by this reaction but at yields ranging from 10 to 40 times less than that of adenine. This synthesis is effective at both +80 and -20 degrees C. Since high concentrations of NH(4)CN are obtainable only by freezing, this prebiotic synthesis would be applicable to frozen regions of the primitive Earth, the Jovian satellite Europa and other icy satellites, and the parent body of the Murchison meteorite.

  17. Guanine binding to gold nanoparticles through nonbonding interactions.


    Zhang, Xi; Sun, Chang Q; Hirao, Hajime


    Gold nanoparticles have been widely used as nanocarriers in gene delivery. However, the binding mechanism between gold nanoparticles and DNA bases remains a puzzle. We performed density functional theory calculations with and without dispersion correction on Au(N)( (N = 13, 55, or 147) nanoparticles in high-symmetry cuboctahedral structures to understand the mechanism of their binding with guanine at the under-coordinated sites. Our study verified that: (i) negative charges transfer from the inner area to the surface of a nanoparticle as a result of the surface quantum trapping effect; and (ii) the valence states shift up toward the Fermi level, and thereby participate more actively in the binding to guanine. These effects are more prominent in a smaller nanoparticle, which has a larger surface-to-volume ratio. Additional fragment orbital analysis revealed that: (i) electron donation from the lone-pair orbital of N to the unoccupied orbital of the Au cluster occurs in all complexes; (ii) π back-donation occurs from the polarized Au d(yz) orbital to the N p(y)-π* orbital when there is no Au···H-N hydrogen bond, and, (iii) depending on the configuration, Au···H-N hydrogen bonding can also exist, to which the Au occupied orbital and the H-N unoccupied orbital contribute.

  18. Molecular dynamics simulations reveal the balance of forces governing the formation of a guanine tetrad—a common structural unit of G-quadruplex DNA

    PubMed Central

    Kogut, Mateusz; Kleist, Cyprian; Czub, Jacek


    G-quadruplexes (G4) are nucleic acid conformations of guanine-rich sequences, in which guanines are arranged in the square-planar G-tetrads, stacked on one another. G4 motifs form in vivo and are implicated in regulation of such processes as gene expression and chromosome maintenance. The structure and stability of various G4 topologies were determined experimentally; however, the driving forces for their formation are not fully understood at the molecular level. Here, we used all-atom molecular dynamics to probe the microscopic origin of the G4 motif stability. By computing the free energy profiles governing the dissociation of the 3′-terminal G-tetrad in the telomeric parallel-stranded G4, we examined the thermodynamic and kinetic stability of a single G-tetrad, as a common structural unit of G4 DNA. Our results indicate that the energetics of guanine association alone does not explain the overall stability of the G-tetrad and that interactions involving sugar–phosphate backbone, in particular, the constrained minimization of the phosphate–phosphate repulsion energy, are crucial in providing the observed enthalpic stabilization. This enthalpic gain is largely compensated by the unfavorable entropy change due to guanine association and optimization of the backbone topology. PMID:26980278

  19. Translesion synthesis by human DNA polymerase eta across oxidative products of guanine.


    Kino, Katuhito; Ito, Nobutoshi; Sugasawa, Kaoru; Sugiyama, Hiroshi; Hanaoka, Fumio


    Guanine is the most oxidizable base among natural bases. 8-Oxoguanine (8-oxoG) is the typical oxidative product, but the amount of 8-oxoG does not directly reflect the strength of oxidative stress. Imidazolone, oxazolone and guanidinohydantoin are oxidative products of guanine and 8-oxoG. Here, we investigated enzymatic reactions with human DNA polymerase eta on these lesions.

  20. Mobility enhancement of organic field-effect transistor based on guanine trap-neutralizing layer

    NASA Astrophysics Data System (ADS)

    Shi, Wei; Zheng, Yifan; Yu, Junsheng; Taylor, André D.; Katz, Howard E.


    We introduced a nucleic acid component guanine as a trap-neutralizing layer between silicon dioxide gate dielectric and a pentacene semiconducting layer to obtain increased field-effect mobility in organic field-effect transistors (OFETs). A tripling of the field-effect mobility, from 0.13 to 0.42 cm2/V s, was achieved by introducing a 2 nm guanine layer. By characterizing the surface morphology of pentacene films grown on guanine, we found that the effect of guanine layer on the topography of pentacene film was not responsible for the mobility enhancement of the OFETs. The increased field-effect mobility was mainly attributed to the hydrogen bonding capacity of otherwise unassociated guanine molecules, which enabled them to neutralize trapping sites on the silicon dioxide surface.

  1. The synergism of nucleoside antibiotics combined with guanine 7-N-oxide against a rhabdovirus, infectious hematopoietic necrosis virus (IHNV).


    Hasobe, M; Saneyoshi, M; Isono, K


    Guanine 7-N-oxide was shown to have synergistic activity in combination with neplanocin A against a rhabdovirus, infectious hematopoietic necrosis virus (IHNV), as reported previously. We examined further the antiviral activity of guanine 7-N-oxide in combination with other nucleoside antibiotics against IHNV. Synergism was seen between guanine 7-N-oxide and D-eritadenine or cordycepin. It is considered that compounds inhibiting RNA methylation show synergism with guanine 7-N-oxide.

  2. Guanine- 5-carboxylcytosine base pairs mimic mismatches during DNA replication.


    Shibutani, Toshihiro; Ito, Shinsuke; Toda, Mariko; Kanao, Rie; Collins, Leonard B; Shibata, Marika; Urabe, Miho; Koseki, Haruhiko; Masuda, Yuji; Swenberg, James A; Masutani, Chikahide; Hanaoka, Fumio; Iwai, Shigenori; Kuraoka, Isao


    The genetic information encoded in genomes must be faithfully replicated and transmitted to daughter cells. The recent discovery of consecutive DNA conversions by TET family proteins of 5-methylcytosine into 5-hydroxymethylcytosine, 5-formylcytosine, and 5-carboxylcytosine (5caC) suggests these modified cytosines act as DNA lesions, which could threaten genome integrity. Here, we have shown that although 5caC pairs with guanine during DNA replication in vitro, G·5caC pairs stimulated DNA polymerase exonuclease activity and were recognized by the mismatch repair (MMR) proteins. Knockdown of thymine DNA glycosylase increased 5caC in genome, affected cell proliferation via MMR, indicating MMR is a novel reader for 5caC. These results suggest the epigenetic modification products of 5caC behave as DNA lesions.

  3. In vivo methylation of guanine by the organophosphorus insecticide tetrachlorvinphos.


    Zayed, S M; Mostafa, I Y; Adam, Y; Hegazi, B


    The in vivo methylating capability of the organophosphorus insecticide tetrachlorvinphos, assayed by the formation of 7-methyl-guanine in mouse liver, was investigated. Following intraperitoneal injection of male mice with different doses of the 14C-insecticide, labelled at the OCH3 groups, the total and specific radioactivity of nucleic acids and protein were determined. The 14C-labelling in the isolated macromolecules reached its maximum 24 hours following administration of the insecticide. Analysis of the acid hydrolysate of DNA and of RNA on Dowex-50 WX-12 revealed the presence of (7-14C) methylguanine. At maximum 14C-labelling, the amount of radioactive 7-MeGu, calculated as fraction of total dose, was around 9 X 10(-5) and 39 X 10(-5) for DNA and RNA, respectively.

  4. Lifetimes and reaction pathways of guanine radical cations and neutral guanine radicals in an oligonucleotide in aqueous solutions.


    Rokhlenko, Yekaterina; Geacintov, Nicholas E; Shafirovich, Vladimir


    The exposure of guanine in the oligonucleotide 5'-d(TCGCT) to one-electron oxidants leads initially to the formation of the guanine radical cation G(•+), its deptotonation product G(-H)(•), and, ultimately, various two- and four-electron oxidation products via pathways that depend on the oxidants and reaction conditions. We utilized single or successive multiple laser pulses (308 nm, 1 Hz rate) to generate the oxidants CO(3)(•-) and SO(4)(•-) (via the photolysis of S(2)O(8)(2-) in aqueous solutions in the presence and absence of bicarbonate, respectively) at concentrations/pulse that were ∼20-fold lower than the concentration of 5'-d(TCGCT). Time-resolved absorption spectroscopy measurements following single-pulse excitation show that the G(•+) radical (pK(a) = 3.9) can be observed only at low pH and is hydrated within 3 ms at pH 2.5, thus forming the two-electron oxidation product 8-oxo-7,8-dihydroguanosine (8-oxoG). At neutral pH, and single pulse excitation, the principal reactive intermediate is G(-H)(•), which, at best, reacts only slowly with H(2)O and lives for ∼70 ms in the absence of oxidants/other radicals to form base sequence-dependent intrastrand cross-links via the nucleophilic addition of N3-thymidine to C8-guanine (5'-G*CT* and 5'-T*CG*). Alternatively, G(-H)(•) can be oxidized further by reaction with CO(3)(•-), generating the two-electron oxidation products 8-oxoG (C8 addition) and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih, by C5 addition). The four-electron oxidation products, guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp), appear only after a second (or more) laser pulse. The levels of all products, except 8-oxoG, which remains at a low constant value, increase with the number of laser pulses.

  5. Guanine and 7,8-dihydro-8-oxo-guanine-specific oxidation in DNA by chromium(V).


    Sugden, Kent D; Martin, Brooke D


    The hexavalent oxidation state of chromium [Cr(VI)] is a well-established human carcinogen, although the mechanism of cancer induction is currently unknown. Intracellular reduction of Cr(VI) forms Cr(V), which is thought to play a fundamental role in the mechanism of DNA damage by this carcinogen. Two separate pathways of DNA damage, an oxidative pathway and a metal-binding pathway, have been proposed to account for the lesions observed in cell systems. We have used a model Cr(V) complex, N,N-ethylenebis(salicylidene-animato)oxochromium(V) [Cr(V)-Salen], to investigate the oxidative pathway of DNA damage and to elucidate the lesions generated from this oxidation process. Reaction of Cr(V)-Salen with synthetic oligonucleotides produced guanine-specific lesions that were not 8-oxo-2'-deoxyguanosine, based on the inability of iridium(IV) to further oxidize these sites. Oxidation products were identified using a 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxo-G) containing oligonucleotide to increase the yields of product for identification by electrospray ionization mass spectrometry. The guanine-based lesions observed by mass spectrometry corresponded to the lesions guanidinohydantoin and spiroiminodihydantoin. The effects of these Cr(V)-Salen-induced lesions on DNA replication fidelity was assayed using a polymerase-based misincorporation assay. These lesions produced G --> T transversion mutations and polymerase stops at levels greater than those observed for 8-oxo-G. These data suggest a model by which chromate can cause DNA damage leading to mutations and cancer.

  6. Guanine Oxidation in Double-stranded DNA by MnTMPyP/KHSO(5): At Least Three Independent Reaction Pathways.


    Lapi, A; Pratviel, G; Meunier, B


    In order to better define the mechanism and the products of guanine oxidation within DNA, we investigated the details of the mechanism of guanine oxidation by a metalloporphyrin, Mn-TMPyP, associated to KHSO(5) on oligonucleotides. We found that the three major products of guanine oxidation are formed by independent reaction routes. The oxidized guanidinohydantoin (1) and the proposed spiro compound 3 derivatives are not precursors of imidazolone lesion (Iz). These guanine lesions as well as their degradation products, may account for non-detected guanine oxidation products on oxidatively damaged DNA.

  7. Density Functional Study of the Influence of C5 Cytosine Substitution in Base Pairs with Guanine

    PubMed Central

    Moser, Adam; Guza, Rebecca; Tretyakova, Natalia; York, Darrin M.


    The present study employs density-functional electronic structure methods to investigate the effect of chemical modification at the C5 position of cytosine. A series of experimentally motivated chemical modifications are considered, including alkyl, halogen, aromatic, fused ring, and strong σ and π withdrawing functional groups. The effect of these modifications on cytosine geometry, electronic structure, proton affinities, gas phase basicities, cytosine-guanine base-pair hydrogen bond network and corresponding nucleophilicity at guanine are examined. Ultimately, these results play a part in dissecting the effect of endogenous cytosine methylation on the reactivity of neighboring guanine toward carcinogens and DNA alkylating agents. PMID:19890472

  8. Theoretical Study of Oxidation of Guanine by Singlet Oxygen (¹Δg) and Formation of Guanine:Lysine Cross-Links.


    Thapa, Bishnu; Munk, Barbara H; Burrows, Cynthia J; Schlegel, H Bernhard


    Oxidation of guanine in the presence of lysine can lead to guanine-lysine cross-links. The ratio of the C-4, C-5 and C-8 crosslinks depends on the manner of oxidation. Type II photosensitizers such as Rose Bengal and methylene blue can generate singlet oxygen, which leads to a different ratio of products than oxidation by type I photosensitizers or by one electron oxidants. Modeling reactions of singlet oxygen can be quite challenging. Reactions have been explored using CASSCF, NEVPT2, DFT, CCSD(T), BD(T) calculations with SMD implicit solvation. The spin contaminations in open-shell calculations were corrected by Yamaguchi's approximate spin projection method. The addition of singlet oxygen to guanine to form guanine endoperoxide proceeds step-wise via a zwitterionic peroxyl intermediate. The subsequent barrier for ring closure is smaller than the initial barrier for singlet oxygen addition. Ring opening of the endoperoxide by protonation at C4-O is followed by loss of a proton from C-8 and dehydration to produce 8-oxoGox. The addition of lysine (modelled by methylamine) or water across the C5-N7 double bond of 8-oxoGox is followed by acyl migration to form the final spiro products. The barrier for methylamine addition is significantly lower than for water addition and should be the dominant reaction channel. These results are in good agreement with the experimental results for the formation of guanine-lysine cross-links via oxidation by type II photosensitizers.

  9. Mechanistic aspects of hydration of guanine radical cations in DNA.


    Rokhlenko, Yekaterina; Cadet, Jean; Geacintov, Nicholas E; Shafirovich, Vladimir


    The mechanistic aspects of hydration of guanine radical cations, G(•+) in double- and single-stranded oligonucleotides were investigated by direct time-resolved spectroscopic monitoring methods. The G(•+) radical one-electron oxidation products were generated by SO4(•-) radical anions derived from the photolysis of S2O8(2-) anions by 308 nm laser pulses. In neutral aqueous solutions (pH 7.0), after the complete decay of SO4(•-) radicals (∼5 μs after the actinic laser flash) the transient absorbance of neutral guanine radicals, G(-H)(•) with maximum at 312 nm, is dominant. The kinetics of decay of G(-H)(•) radicals depend strongly on the DNA secondary structure. In double-stranded DNA, the G(-H)(•) decay is biphasic with one component decaying with a lifetime of ∼2.2 ms and the other with a lifetime of ∼0.18 s. By contrast, in single-stranded DNA the G(-H)(•) radicals decay monophasically with a ∼ 0.28 s lifetime. The ms decay component in double-stranded DNA is correlated with the enhancement of 8-oxo-7,8-dihydroguanine (8-oxoG) yields which are ∼7 greater than in single-stranded DNA. In double-stranded DNA, it is proposed that the G(-H)(•) radicals retain radical cation character by sharing the N1-proton with the N3-site of C in the [G(•+):C] base pair. This [G(-H)(•):H(+)C ⇆ G(•+):C] equilibrium allows for the hydration of G(•+) followed by formation of 8-oxoG. By contrast, in single-stranded DNA, deprotonation of G(•+) and the irreversible escape of the proton into the aqueous phase competes more effectively with the hydration mechanism, thus diminishing the yield of 8-oxoG, as observed experimentally.

  10. G-quartet type self-assembly of guanine functionalized single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Singh, Prabhpreet; Venkatesh, V.; Nagapradeep, N.; Verma, Sandeep; Bianco, Alberto


    The simple strategy of linking guanine to single-walled carbon nanotubes (CNTs) through covalent functionalization permitted generation of the alignment of the nanotubes into lozenges reminiscent of guanine quartets (G-quartets) in the presence of potassium ions as observed by atomic force microscopy.The simple strategy of linking guanine to single-walled carbon nanotubes (CNTs) through covalent functionalization permitted generation of the alignment of the nanotubes into lozenges reminiscent of guanine quartets (G-quartets) in the presence of potassium ions as observed by atomic force microscopy. Electronic supplementary information (ESI) available: Experimental procedures for the synthesis and characterization of the precursors and MWCNT conjugates. See DOI: 10.1039/c2nr11849a

  11. The intrinsic stabilities and structures of alkali metal cationized guanine quadruplexes.


    Azargun, M; Jami-Alahmadi, Y; Fridgen, T D


    The structures and stabilities of self-assembled guanine quadruplexes, M(9eG)8(+) (M = Na, K, Rb, Cs; 9eG = 9-ethylguanine), have been studied in the gas phase by blackbody infrared radiative dissociation to determine the difference in the stabilizing effect of the alkali metal cations. The order of stabilities to decomposition was determined to be K(+) > Rb(+) > Cs(+) ≫ Na(+), which is consistent with the observation of K(+) being the ion of choice in guanine quadruplexes in nucleic acids. In the gas phase, the sodiated quadruplex was found to lose one 9eG at a time, whereas the quadruplexes of the heavier cations lost a neutral guanine tetrad. Vibrational spectroscopy on the gas-phase quadruplex ions was consistent with the structures in which the metal cations were sandwiched between two guanine tetrads. Electronic structure calculations are also used to compare with the observed stabilities and vibrational spectra.

  12. Analysis of guanine oxidation products in double-stranded DNA and proposed guanine oxidation pathways in single-stranded, double-stranded or quadruplex DNA.


    Morikawa, Masayuki; Kino, Katsuhito; Oyoshi, Takanori; Suzuki, Masayo; Kobayashi, Takanobu; Miyazawa, Hiroshi


    Guanine is the most easily oxidized among the four DNA bases, and some guanine-rich sequences can form quadruplex structures. In a previous study using 6-mer DNA d(TGGGGT), which is the shortest oligomer capable of forming quadruplex structures, we demonstrated that guanine oxidation products of quadruplex DNA differ from those of single-stranded DNA. Therefore, the hotooxidation products of double-stranded DNA (dsDNA) may also differ from that of quadruplex or single-stranded DNA, with the difference likely explaining the influence of DNA structures on guanine oxidation pathways. In this study, the guanine oxidation products of the dsDNA d(TGGGGT)/d(ACCCCA) were analyzed using HPLC and electrospray ionization-mass spectrometry (ESI-MS). As a result, the oxidation products in this dsDNA were identified as 2,5-diamino-4H-imidazol-4-one (Iz), 8-oxo-7,8-dihydroguanine (8oxoG), dehydroguanidinohydantoin (Ghox), and guanidinohydantoin (Gh). The major oxidation products in dsDNA were consistent with a combination of each major oxidation product observed in single-stranded and quadruplex DNA. We previously reported that the kinds of the oxidation products in single-stranded or quadruplex DNA depend on the ease of deprotonation of the guanine radical cation (G•+) at the N1 proton. Similarly, this mechanism was also involved in dsDNA. Deprotonation in dsDNA is easier than in quadruplex DNA and more difficult in single-stranded DNA, which can explain the formation of the four oxidation products in dsDNA.

  13. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    SciTech Connect

    Boulias, C.; Moscarello, M.A. )


    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides.

  14. In vitro guanine nucleotide exchange activity of DHR-2/DOCKER/CZH2 domains.


    Côté, Jean-François; Vuori, Kristiina


    Rho family GTPases regulate a large variety of biological processes, including the reorganization of the actin cytoskeleton. Like other members of the Ras superfamily of small GTP-binding proteins, Rho GTPases cycle between a GDP-bound (inactive) and a GTP-bound (active) state, and, when active, the GTPases relay extracellular signals to a large number of downstream effectors. Guanine nucleotide exchange factors (GEFs) promote the exchange of GDP for GTP on Rho GTPases, thereby activating them. Most Rho-GEFs mediate their effects through their signature domain known as the Dbl Homology-Pleckstrin Homology (DH-PH) module. Recently, we and others identified a family of evolutionarily conserved, DOCK180-related proteins that also display GEF activity toward Rho GTPases. The DOCK180-family of proteins lacks the canonical DH-PH module. Instead, they rely on a novel domain, termed DHR-2, DOCKER, or CZH2, to exchange GDP for GTP on Rho targets. In this chapter, the experimental approach that we used to uncover the exchange activity of the DHR-2 domain of DOCK180-related proteins will be described.

  15. Theoretical investigation of hydrogen transfer mechanism in the guanine cytosine base pair

    NASA Astrophysics Data System (ADS)

    Villani, Giovanni


    We have studied the quantum-dynamics of the hydrogen bonds in the guanine-cytosine base pair. Due to the position of hydrogen atoms, different tautomers are possible: the stable Watson-Crick G-C, the imino-enol G*-C*, the imino-enol-imino-enol G #-C # and some zwitterionic structures. The common idea in the literature is that only the G-C and the G*-C* tautomers are stable with an estimate of G-C → G*-C* transition probability of 10 -6-10 -9 by the help of Boltzmann statistics. Here we show a detailed quantum theoretical study that suggests the following conclusion: G-C is the stablest tautomer, some partially charged systems (due to the movement of only one hydrogen atom) are important and a large amount of the imino-enol G*-C* (and less of the imino-enol-imino-enol G #-C # structure) tautomer is present at any time. The corresponding transition probabilities from different tautomers are not due to thermal passage, but they are a pure quantum phenomenon. These large probabilities definitively disprove the idea of these tautomers as mutation points. The mechanisms of passage from the G-C tautomer to the others have also been investigated.

  16. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.


    Lane, B Josh; Mutchler, Charla; Al Khodor, Souhaila; Grieshaber, Scott S; Carabeo, Rey A


    Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein). TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs), Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K), appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  17. Fluorescence enhancement of DNA-silver nanoclusters from guanine proximity

    SciTech Connect

    Yeh, Hsin-chih; Sharma, Jaswinder; Yoo, Hyojong; Martinez, Jennifer S


    Oligonucleotide-templated, silver nanoclusters (DNA/Ag NCs) are a versatile set of fluorophores and have already been used for live cell imaging, detection of specific metal ions, and single-nucleotide variation identification. Compared to commonly used organic dyes, these fluorescent nanoclusters have much better photostability and are often a few times brighter. Owing to their small size, simple preparation, and biocompatibility (i.e. made of nontoxic metals), DNA/Ag NCs should find more applications in biological imaging and chemical detection in the years to come. While clearly promising as new fluorophores, DNA/Ag NCs possess a unique and poorly understood dynamic process not shared by organic dyes or photoluminescent nanocrystals - the conversion among different NC species due to silver oxidation/reduction or NC regrouping. While this environmental sensitivity can be viewed as a drawback, in the appropriate context, it can be used as a sensor or reporter. Often reversible, conversions among different NC species have been found to depend upon a number of factors, including time, temperature, oxygen and salt content. In this communication, we report significant fluorescence enhancement of DNA/Ag NCs via interactions with guanine-rich DNA sequences. Moreover, we demonstrated this property can be used for sensitive detection of specific target DNA from a human oncogene (i.e. Braf gene).

  18. Mechanisms involved in the antinociception induced by spinal administration of inosine or guanine in mice.


    de Oliveira, Enderson D; Schallenberger, Cristhine; Böhmer, Ana Elisa; Hansel, Gisele; Fagundes, Aécio C; Milman, Michael; Silva, Marcos D P; Oses, Jean P; Porciúncula, Lisiane O; Portela, Luís V; Elisabetsky, Elaine; Souza, Diogo O; Schmidt, André P


    It is well known that adenine-based purines exert multiple effects on pain transmission. Recently, we have demonstrated that guanine-based purines may produce some antinociceptive effects against chemical and thermal pain in mice. The present study was designed to investigate the antinociceptive effects of intrathecal (i.t.) administration of inosine or guanine in mice. Additionally, investigation into the mechanisms of action of these purines, their general toxicity and measurements of CSF purine levels were performed. Animals received an i.t. injection of vehicle (30mN NaOH), inosine or guanine (up to 600nmol) and submitted to several pain models and behavioural paradigms. Guanine and inosine produced dose-dependent antinociceptive effects in the tail-flick, hot-plate, intraplantar ( glutamate, capsaicin and acetic acid pain models. Additionally, i.t. inosine inhibited the biting behaviour induced by spinal injection of capsaicin and i.t. guanine reduced the biting behaviour induced by spinal injection of glutamate or AMPA. Intrathecal administration of inosine (200nmol) induced an approximately 115-fold increase on CSF inosine levels. This study provides new evidence on the mechanism of action of extracellular guanine and inosine presenting antinociceptive effects following spinal administration. These effects seem to be related, at least partially, to the modulation of A1 adenosine receptors.

  19. Photoirradiation products of flavin derivatives, and the effects of photooxidation on guanine.


    Kino, Katsuhito; Kobayashi, Teruhiko; Arima, Eiji; Komori, Rie; Kobayashi, Takanobu; Miyazawa, Hiroshi


    Photoirradiation in the presence of riboflavin led to guanine oxidation and the formation of imidazolone. Meanwhile, riboflavin itself was degraded by ultraviolet light A (UV-A) and visible light (VIS) radiation, and the end product was lumichrome. VIS radiation in the presence of riboflavin oxidized guanine similarly to UV-A radiation. Although UV-A radiation with lumichrome oxidized guanine, VIS radiation with lumichrome did not. Thus, UV-A radiation with riboflavin can oxidize guanine even if riboflavin is degraded to lumichrome. In contrast, following VIS radiation degradation of riboflavin to lumichrome, VIS radiation with riboflavin is hardly capable of oxidizing guanine. The consequences of riboflavin degradation and guanine photooxidation can be extended to flavin mononucleotide and flavin adenine dinucleotide. In addition, we report advanced synthesis; carboxymethylflavin was obtained by oxidation of formylmethylflavin with chlorite and hydrogen peroxide; lumichrome was obtained by heating of formylmethylflavin in 50% AcOH; lumiflavin was obtained by incubation of formylmethylflavin in 2 M NaOH, followed by isolation by step-by-step concentration.

  20. Effect of ionic strength and cationic DNA affinity binders on the DNA sequence selective alkylation of guanine N7-positions by nitrogen mustards

    SciTech Connect

    Hartley, J.A.; Forrow, S.M.; Souhami, R.L. )


    Large variations in alkylation intensities exist among guanines in a DNA sequence following treatment with chemotherapeutic alkylating agents such as nitrogen mustards, and the substituent attached to the reactive group can impose a distinct sequence preference for reaction. In order to understand further the structural and electrostatic factors which determine the sequence selectivity of alkylation reactions, the effect of increase ionic strength, the intercalator ethidium bromide, AT-specific minor groove binders distamycin A and netropsin, and the polyamine spermine on guanine N7-alkylation by L-phenylalanine mustard (L-Pam), uracil mustard (UM), and quinacrine mustard (QM) was investigated with a modification of the guanine-specific chemical cleavage technique for DNA sequencing. The result differed with both the nitrogen mustard and the cationic agent used. The effect, which resulted in both enhancement and suppression of alkylation sites, was most striking in the case of netropsin and distamycin A, which differed from each other. DNA footprinting indicated that selective binding to AT sequences in the minor groove of DNA can have long-range effects on the alkylation pattern of DNA in the major groove.

  1. Design and synthesis of novel adenine fluorescence probe based on Eu(III) complexes with dtpa-bis(guanine) ligand.


    Tian, Fengyun; Jiang, Xiaoqing; Dou, Xuekai; Wu, Qiong; Wang, Jun; Song, Youtao


    A novel adenine (Ad) fluorescence probe (Eu(III)-dtpa-bis(guanine)) was designed and synthesized by improving experimental method based on the Eu(III) complex and dtpa-bis(guanine) ligand. The dtpa-bis(guanine) ligand was first synthesized by the acylation action between dtpaa and guanine (Gu), and the corresponding Eu(III) complex was successfully prepared through heat-refluxing method with dtpa-bis(guanine) ligand. As a novel fluorescence probe, the Eu(III)-dtpa-bis(guanine) complex can detect adenine (Ad) with characteristics of strong targeting, high specificity and high recognition ability. The detection mechanism of the adenine (Ad) using this probe in buffer solution was studied by ultraviolet-visible (UV-vis) and fluorescence spectroscopy. When the Eu(III)-dtpa-bis(guanine) was introduced to the adenine (Ad) solution, the fluorescence emission intensity was significantly enhanced. However, adding other bases such as guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) with similar composition and structure to that of adenine (Ad) to the Eu(III)-dtpa-bis(guanine) solution, the fluorescence emission intensities are nearly invariable. Meanwhile, the interference of guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) on the detection of the adenine using Eu(III)-dtpa-bis(guanine) probe was also studied. It was found that presence of these bases does not affect the detection of adenine (Ad). A linear response of fluorescence emission intensities of Eu(III)-dtpa-bis(guanine) at 570nm as a function of adenine (Ad) concentration in the range of 0.00-5.00×10(-5)molL(-1) was observed. The detection limit is about 4.70×10(-7)molL(-1).

  2. Identification of N2-(1-carboxyethyl)guanine (CEG) as a guanine advanced glycosylation end product.


    Papoulis, A; al-Abed, Y; Bucala, R


    Reducing sugars such as glucose react nonenzymatically with protein amino groups to initiate a posttranslational modification process known as advanced glycosylation. Nucleotide bases also participate in advanced glycosylation reactions, producing DNA-linked advanced glycosylation endproducts (AGEs) that cause mutations and DNA transposition. Although several protein-derived AGEs have been isolated and structurally characterized, AGE-modified nucleotides have not yet been reported. We systematically examined the reactivities of the model nucleotide bases 9-methylguanine (9-mG), 9-methyladenine (9-mA), and 1-methylcytosine (1-mC) toward glucose and several glucose-derived reactants. In "fast" reactions performed at refluxing temperature and physiological pH, 1 equiv of nucleotide base was reacted with 10 equiv of D-glucose, D-glucose 6-phosphate (G-6-P), D-glucose 6-phosphate/lysine (G-6-P/Lys), the Schiff base 1-n-propylamino-N-D-glucoside (SB), or the Amadori product 1-n-propylamino-N-D-fructose (AP). In every reaction involving 9-mG, N2-(1-carboxyethyl)-9-methylguanine (CEmG) was a major product which was produced. N2-(1-carboxyethyl)-9-methylguanine also formed from 9-mG and AP in long-term incubations performed at 37 degrees C. Direct treatment of 9-mG with methylglyoxal (MG), a Maillard reaction propagator that forms from the decomposition of AP, also produced CEmG in high yield. N2-(1-Carboxyethyl)-9-methylguanine appears to result from the nucleophilic addition of the primary amino group of guanine to the ketone group of MG followed by an intramolecular rearrangement. Methylglyoxal is a known prokaryotic mutagen and was shown additionally to be mutagenic in a eukaryotic shuttle vector assay system.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. Regulation of IMP dehydrogenase gene expression by its end products, guanine nucleotides.

    PubMed Central

    Glesne, D A; Collart, F R; Huberman, E


    To study the regulation of IMP dehydrogenase (IMPDH), the rate-limiting enzyme of guanine nucleotide biosynthesis, we examined the effects of nucleosides, nucleotides, nucleotide analogs, or the IMPDH inhibitor mycophenolic acid (MPA) on the steady-state levels of IMPDH mRNA. The results indicated that IMPDH gene expression is regulated inversely by the intracellular level of guanine ribonucleotides. We have shown that treatment with guanosine increased the level of cellular guanine ribonucleotides and subsequently reduced IMPDH steady-state mRNA levels in a time- and dose-dependent manner. Conversely, MPA treatment diminished the level of guanine ribonucleotides and increased IMPDH mRNA levels. Both of these effects on the steady-state level of IMPDH mRNA could be negated by cotreatment with guanosine and MPA. The down regulation of IMPDH gene expression by guanosine or its up regulation by MPA was not due to major changes in transcriptional initiation and elongation or mRNA stability in the cytoplasm but rather was due to alterations in the levels of the IMPDH mRNA in the nucleus. These results suggest that IMPDH gene expression is regulated by a posttranscriptional, nuclear event in response to fluctuations in the intracellular level of guanine ribonucleotides. Images PMID:1717828

  4. Theoretical Study of the Photophysics of 8-Vinylguanine, an Isomorphic Fluorescent Analogue of Guanine.


    Kochman, Michał A; Pola, Martina; Miller, R J Dwayne


    Paving the way for the application of the algebraic-diagrammatic construction scheme of second-order (ADC(2)) to systems based on the guanine chromophore, we demonstrate the this excited-state electronic structure method provides a realistic description of the photochemistry of 9H-guanine, in close agreement with the benchmark provided by the CASPT2 method. We then proceed to apply the ADC(2) method to the photochemistry of 8-vinylguanine (8vG), a minimally modified analogue of guanine which, unlike the naturally occurring nucleobase, displays intense fluorescence, indicative of a much longer-lived excited electronic state. The emissive electronic state of 8vG is identified as an ππ*-type intramolecular charge transfer (ICT) state, in which a charge of roughly -0.2 e is transferred from the guanine moiety onto the vinyl substituent. The main radiationless deactivation pathway competing with fluorescence is predicted to involve the molecule leaving the minimum on the ICT ππ* state, and reaching a region of the S1 adiabatic state where it resembles the La ππ* state of unmodified 9H-guanine. The topology of the La ππ* region of the S1 state favors subsequent internal conversion at a crossing seam with the ground electronic state. The sensitivity of this process to environment polarity may explain the experimentally observed fluorescence quenching of 8vG upon incorporation in single- and double-stranded DNA.

  5. Control of self-assembled 2D nanostructures by methylation of guanine.


    Bald, Ilko; Wang, Yao-guang; Dong, Mingdong; Rosen, Christian B; Ravnsbaek, Jens B; Zhuang, Gui-lin; Gothelf, Kurt V; Wang, Jian-guo; Besenbacher, Flemming


    Methylation of DNA nucleobases is an important control mechanism in biology applied, for example, in the regulation of gene expression. The effect of methylation on the intermolecular interactions between guanine molecules is studied through an interplay between scanning tunneling microscopy (STM) and density functional theory with empirical dispersion correction (DFT-D). The present STM and DFT-D results show that methylation of guanine can have subtle effects on the hydrogen-bond strength with a strong dependence on the position of methylation. It is demonstrated that the methylation of DNA nucleobases is a precise means to tune intermolecular interactions and consequently enables very specific recognition of DNA methylation by enzymes. This scheme is used to generate four different types of artificial 2D nanostructures from methylated guanine. For instance, a 2D guanine windmill motif that is stabilized by cooperative hydrogen bonding is revealed. It forms by self-assembly on a graphite surface under ambient conditions at the liquid-solid interface when the hydrogen-bonding donor at the N1 site of guanine is blocked by a methyl group.

  6. Guanine-based structural coloration as an indicator of oxidative stress in a cichlid fish.


    Cahn, Matthew D; Brown, Alexandria C; Clotfelter, Ethan D


    Vertebrate pigmentation is known to be influenced by oxidative stress, but few studies have tested the hypothesis that structural coloration can be similarly affected. We tested whether fish iridophores, which produce structural color using guanine stacks, might be affected by the prooxidant-antioxidant balance of the animal. Specifically, we hypothesized that convict cichlids (Amatitlania nigrofasciata) metabolize guanine present in iridophores to uric acid, an antioxidant, in response to oxidative damage. We used Hunter's contrast gloss and high performance liquid chromatography to determine whether dietary guanine supplementation allows fish to maintain their structural coloration despite oxidative stress induced via ultraviolet-B (UV-B) radiation. We found that dietary guanine was associated with greater skin gloss, and that exposure to UV-B light reduced glossiness. UV-B exposure did not increase oxidative damage (acrolein) or total antioxidant capacity in the skin or liver. Our experiment did not detect effects of dietary guanine or UV-B light on uric acid, but uric acid was positively related to antioxidant capacity. Our results support the hypothesis that structural color in fish may be altered by environmental stressors such as exposure to UV light, and highlight the need for future studies to consider the role of iridophores in condition-dependent visual signaling.

  7. Label-free detection of telomerase activity using guanine electrochemical oxidation signal.


    Eskiocak, Ugur; Ozkan-Ariksoysal, Dilsat; Ozsoz, Mehmet; Oktem, Huseyin Avni


    Telomerase is an important biomarker for cancer cells and its activation in 85% of all cancer types confers a clinical diagnostic value. A label-free electrochemical assay based on guanine oxidation signal to measure telomerase activity is described. This developed technology combined with a disposable sensor, carbon graphite electrode (CGE), and differential pulse voltammetry (DPV) was performed by using PCR amplicons with/without telomeric repeats as the guanine oxidation signal observed at +1.0 V measured after the immobilization of PCR products. Guanine oxidation signal was chosen as a measure of telomerase activity because a substantial increase in the number of guanines was introduced by the action of telomerase which adds hexameric repeats (TTAGGG)n that contain 50% guanine. The developed assay was shown to specifically measure telomerase activity from cell extracts, and elongation rates increased linearly in a concentration dependent manner. Telomerase activity could be detected in cell extracts containing as low as 100 ng/microL of protein. All of the electrochemical measurements were also confirmed with the conventional TRAP-silver staining assay. Rapidity, simplicity, and the label-free nature of the developed assay make it suitable for practical use in quantitative determination of telomerase activity from clinical samples for diagnosis of cancer.

  8. Reduction of electron deficient guanine radical species in plasmid DNA by tyrosine derivatives.


    Tsoi, Mandi; Do, Trinh T; Tang, Vicky J; Aguilera, Joseph A; Milligan, Jamie R


    Guanine bases are the most easily oxidized sites in DNA and therefore electron deficient guanine radical species are major intermediates in the direct effect of ionizing radiation (ionization of the DNA itself) on DNA as a consequence of hole migration to guanine. As a model for this process we have used gamma-irradiation in the presence of thiocyanate ions to generate single electron oxidized guanine radicals in a plasmid target in aqueous solution. The stable species formed from these radicals can be detected and quantified by the formation of strand breaks in the plasmid after a post-irradiation incubation using a suitable enzyme. If a tyrosine derivative is also present during irradiation, the production of guanine oxidation products is decreased by electron transfer from tyrosine to the intermediate guanyl radical species. By using cationic tyrosine containing ligands we are able to observe this process when the tyrosine is electrostatically bound to the plasmid. The driving force dependence of this reaction was determined by comparing the reactivity of tyrosine with its 3-nitro analog. The results imply that the electron transfer reaction is coupled to a proton transfer. The experimental conditions used in this model system provide a reasonable approximation to those involved in the radioprotection of DNA by tightly bound proteins in chromatin.

  9. Electrochemical studies on the oxidation of guanine and adenine at cyclodextrin modified electrodes.


    Abbaspour, Abdolkarim; Noori, Abolhassan


    An electrochemical sensor for guanine and adenine using cyclodextrin-modified poly(N-acetylaniline) (PNAANI) on a carbon paste electrode has been developed. The oxidation mechanism of guanine and adenine on the surface of the electrode was investigated by cyclic voltammetry. It was found that the electrode processes are irreversible, pH dependent, and involve several reaction products. The electron transfer process occurs in consecutive steps with the formation of a strongly adsorbed intermediate on the electrode surface. Also, a new method for estimating the apparent formation constants of guanine and adenine with the immobilized cyclodextrins, through the change of surface coverage of studied analytes has been reported. Both guanine and adenine showed linear concentrations in the range of 0.1-10 microM by using differential pulse voltammetry, with an experimental limit of detection down to 0.05 microM. Linear concentration ranges of 2-150 microM for guanine and 6-104 microM for adenine have been found when cyclic voltammetry was used for determination of both analytes.

  10. Guanine derivatives modulate L-glutamate uptake into rat brain synaptic vesicles.


    Tasca, Carla I; Santos, Tiago G; Tavares, Rejane G; Battastini, Ana M O; Rocha, João B T; Souza, Diogo O


    Glutamate uptake into synaptic vesicles is driven by a proton electrochemical gradient generated by a vacuolar H(+)-ATPase and stimulated by physiological concentrations of chloride. This uptake plays an important role in glutamatergic transmission. We show here that vesicular glutamate uptake is selectively inhibited by guanine derivatives, in a time- and concentration-dependent manner. Guanosine, GMP, GDP, guanosine-5'-O-2-thiodiphosphate, GTP, or 5'-guanylylimidodiphosphate (GppNHp) inhibited glutamate uptake in 1.5 and 3 min incubations, however, when incubating for 10 min, only GTP or GppNHp displayed such inhibition. By increasing ATP concentrations, the inhibitory effect of GTP was no longer observed, but GppNHp still inhibited glutamate uptake. In the absence of ATP, vesicular ATPase can hydrolyze GTP in order to drive glutamate uptake. However, 5mM GppNHp inhibited ATP hydrolysis by synaptic vesicle preparations. GTP or GppNHp decreased the proton electrochemical gradient, whereas the other guanine derivatives did not. Glutamate saturation curves were assayed in order to evaluate the specificity of inhibition of the vesicular glutamate carrier by the guanine derivatives. The maximum velocity of the initial rate of glutamate uptake was decreased by all guanine derivatives. These results indicate that, although GppNHp can inhibit ATPase activity, guanine derivatives are more likely to be acting through interaction with vesicular glutamate carrier.

  11. Effect of intense magnetic fields on the convection of biogenic guanine crystals in aqueous solution

    NASA Astrophysics Data System (ADS)

    Iwasaka, M.; Mizukawa, Y.


    In this study, the basic magneto-optic properties of biogenic microcrystals in aqueous media were investigated. Microcrystals, mica plates, silica, and microcrystals from a diatom cell and biogenic guanine crystals from goldfish showed light scattering inhibition when the crystals were observed in water under a 5 T magnetic field and dark-field illumination. In particular, in 50% ethanol/water medium, convection of the biogenic guanine particle aggregates was reversibly inhibited when the microcrystal suspension was exposed to a 5 T magnetic field. Microscopic observation comparing the biogenic guanine crystals in water with 95% ethanol or 99% acetone revealed that light flickering on the surface of the crystals was affected by the surface interaction of the crystal with the surrounding medium. By considering both the magnetic orientation of the microcrystals and the possible interactions of crystals with the surrounding medium, a magnetically controllable fluidic tracer was suggested.

  12. Formation of the carboxamidine precursor of cyanuric acid from guanine oxidative lesion dehydro-guanidinohydantoin.


    Irvoas, Joris; Trzcionka, Jérôme; Pratviel, Geneviève


    DNA damage under oxidative stress leads to oxidation of guanine base. The identification of the resulting guanine lesions in cellular DNA is difficult due to the sensitivity of the primary oxidation products to hydrolysis and/or further oxidation. We isolated dehydroguanidino-hydantoin (DGh) (or oxidized guanidinohydantoin), a secondary oxidation product of guanine, and showed that this lesion reacts readily with nucleophiles such as asymmetric peroxides and transforms to 2,4,6-trioxo-1,3,5-triazinane-1-carboxamidine residue. Further hydrolysis of this intermediate leads to cyanuric acid and finally to urea residue. This work demonstrates a new possible pathway for the formation of the well-known carboxamidine precursor of cyanuric acid lesion.

  13. Rapid and simple G-quadruplex DNA aptasensor with guanine chemiluminescence detection.


    Cho, Sandy; Park, Lucienne; Chong, Richard; Kim, Young Teck; Lee, Ji Hoon


    Cost-effective and sensitive aptasensor with guanine chemiluminescence detection capable of simply quantifying thrombin in human serum was developed using thrombin aptamer (TBA), one of the G-quadruplex DNA aptamers, without expensive nanoparticles and complicated procedures. Guanines of G-quadruplex TBA-conjugated carboxyfluorescein (6-FAM) bound with thrombin do not react with 3,4,5-trimethoxylphenylglyoxal (TMPG) in the presence of tetra-n-propylammonium hydroxide (TPA), whereas guanines of free TBA- and TBA-conjugated 6-FAM immobilized on the surface of graphene oxide rapidly react with TMPG to emit light. Thus, guanine chemiluminescence in 5% human serum with thrombin was lower than that without thrombin when TBA-conjugated 6-FAM was added in two samples and incubated for 20 min. In other words, the brightness of guanine chemiluminescence was quenched due to the formation of G-quadruplex TBA-conjugated 6-FAM bound with thrombin in a sample. High-energy intermediate, capable of emitting dim light by itself, formed from the reaction between guanines of TBA and TMPG in the presence of TPA, transfers energy to 6-FAM to emit bright light based on the principle of chemiluminescence energy transfer (CRET). G-quadruplex TBA aptasensor devised using the rapid interaction between TBA-conjugated 6-FAM and thrombin quantified trace levels of thrombin without complicated procedures. The limit of detection (LOD = background + 3 × standard deviation) of G-quadruplex TBA aptasensor with good linear calibration curve, accuracy, precision, and recovery was as low as 12.3 nM in 5% human serum. Using the technology reported in this research, we expect that various types of G-quadruplex DNA aptasensors capable of specifically sensing a target molecule such as ATP, HIV, ochratoxin, potassium ions, and thrombin can be developed.

  14. Mechanisms of oxidation of guanine in DNA by carbonate radical anion, a decomposition product of nitrosoperoxycarbonate.


    Lee, Young Ae; Yun, Byeong Hwa; Kim, Seog K; Margolin, Yelena; Dedon, Peter C; Geacintov, Nicholas E; Shafirovich, Vladimir


    Peroxynitrite is produced during inflammation and combines rapidly with carbon dioxide to yield the unstable nitrosoperoxycarbonate, which decomposes (in part) to CO(3) (.-) and (.)NO(2) radicals. The CO(3) (.-) radicals oxidize guanine bases in DNA through a one-electron transfer reaction process that ultimately results in the formation of stable guanine oxidation products. Here we have explored these mechanisms, starting with a spectroscopic study of the kinetics of electron transfer from 20-22mer double-stranded oligonucleotides to CO(3) (.-) radicals, together with the effects of base sequence on the formation of the end-products in runs of one, two, or three contiguous guanines. The distributions of these alkali-labile lesions were determined by gel electrophoresis methods. The cascade of events was initiated through the use of 308 nm XeCl excimer laser pulses to generate CO(3) (.-) radicals by an established method based on the photodissociation of persulfate to sulfate radicals and the oxidation of bicarbonate. Although the Saito model (Saito et al., J. Am. Chem. Soc. 1995, 117, 6406-6407) predicts relative ease of one-electron oxidations in DNA, following the trend 5'-GGG > 5'-GG > 5'-G, we found that the rate constants for CO(3) (.-)-mediated oxidation of guanines in these sequence contexts (k(5)) showed only small variation within a narrow range [(1.5-3.0)x10(7) M(-1) s(-1)]. In contrast, the distributions of the end-products are dependent on the base sequence context and are higher at the 5'-G in 5'-GG sequences and at the first two 5'-guanines in the 5'-GGG sequences. These effects are attributed to a combination of initial hole distributions among the contiguous guanines and the subsequent differences in chemical reaction yields at each guanine. The lack of dependence of k(5) on sequence context indicates that the one-electron oxidation of guanine in DNA by CO(3) (.-) radicals occurs by an inner-sphere mechanism.

  15. Alkylation of urinary guanine in mice by the organophosphorus insecticide tetrachlorvinphos.


    Zayed, S M; Mostafa, I Y; Hegazi, B


    The methylating capability of tetrachlorvinphos on urinary guanine in mice has been investigated using an insecticide labeled at both O-CH3 groups. Following intraperitoneal administration of the 14C-labeled insecticide to mice, about 0.57% of the radioactivity in the O- to 24-hr samples was associated with the purine fraction. The amount of [7-14C]methylguanine in 0- to 48-hr urine samples, estimated as fraction of applied dose, was 26-31 X 10(-5). The results obtained indicate possible chemical alkylation of urinary guanine. On the other hand, a considerable portion of radioactivity is probably incorporated via the C-1 pool.

  16. Transcription profiling of guanine nucleotide binding proteins during developmental regulation, and pesticide response in Solenopsis invicta (Hymenoptera: Formicidae)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Guanine nucleotide binding proteins (GNBP or G-protein) are glycoproteins anchored on the cytoplasmic cell membrane, and are mediators for many cellular processes. Complete cDNA of guanine nucleotide-binding protein gene ß-subunit (SiGNBP) was cloned and sequenced from S. invicta workers. To detect ...

  17. Exploring the Use of a Guanine-Rich Catalytic DNA for Sulfoxide Preparation.


    Dellafiore, María A; Montserrat, Javier M; Iribarren, Adolfo M


    A guanine-rich DNA oligonucleotide complexed with hemin was used to catalyze controlled oxygen transfer reactions to different sulfides for sulfoxide preparation in the presence of H2O2. Comparable activities were obtained when using fully modified L-DNA. In addition, oligonucleotide immobilization led to an active catalyst which could be successfully recovered and reused without loss of activity.

  18. Vibrational investigations of guanine, thioguanine and their singly charged cations and anions

    NASA Astrophysics Data System (ADS)

    Singh, R.; Yadav, R. A.


    The complete vibrational studies have been done with help of quantum mechanics for the neutral Guanine (Gua) and Thioguanine (TGua) molecules and their singly charged cations and anions employing the B3LYP/6-311++G** method. Neutral Thioguanine and cations of Guanine and Thioguanine show planar structures and belong to Cs point group symmetry while the neutral Guanine and anions of Guanine and Thioguanine possess non-planar structure with C1 point group symmetry. Vibrational studies of ionic radicals of Gua and its thio- derivative are not available in literatures. Such extensive studies have been attempted for the first time. The normal modes of all the species have been assigned on the basis using potential energy distributions (PEDs) using GAR2PED software. The PEDs have also been calculated to make a conspicuous assignment as animation available in GaussView is not a guarantee for correct normal mode assignment. Charge transfer occurs in the molecule have been shown by the calculated highest occupied molecular orbital—lowest unoccupied molecular orbital (HOMO-LUMO) energies. The mapping of electron density iso-surface with electrostatic potential, has been carried out to get the information about the size, shape, charge density distribution and site of chemical reactivity of the molecule. The electronic properties HOMO and LUMO energies have been measured. The energy gap from HOMO to LUMO of the Gua is 5.0547 eV and TGua 4.0743 eV.

  19. Human Sos1: a guanine nucleotide exchange factor for Ras that binds to GRB2.


    Chardin, P; Camonis, J H; Gale, N W; van Aelst, L; Schlessinger, J; Wigler, M H; Bar-Sagi, D


    A human complementary DNA was isolated that encodes a widely expressed protein, hSos1, that is closely related to Sos, the product of the Drosophila son of sevenless gene. The hSos1 protein contains a region of significant sequence similarity to CDC25, a guanine nucleotide exchange factor for Ras from yeast. A fragment of hSos1 encoding the CDC25-related domain complemented loss of CDC25 function in yeast. This hSos1 domain specifically stimulated guanine nucleotide exchange on mammalian Ras proteins in vitro. Mammalian cells overexpressing full-length hSos1 had increased guanine nucleotide exchange activity. Thus hSos1 is a guanine nucleotide exchange factor for Ras. The hSos1 interacted with growth factor receptor-bound protein 2 (GRB2) in vivo and in vitro. This interaction was mediated by the carboxyl-terminal domain of hSos1 and the Src homology 3 (SH3) domains of GRB2. These results suggest that the coupling of receptor tyrosine kinases to Ras signaling is mediated by a molecular complex consisting of GRB2 and hSos1.

  20. Theoretical and Experimental Study of Valence-Shell Ionization Spectra of Guanine

    NASA Astrophysics Data System (ADS)

    Zaytseva, Irina L.; Trofimov, Alexander B.; Schirmer, Jochen; Plekan, Oksana; Feyer, Vitaliy; Richter, Robert; Coreno, Marcello; Prince, Kevin C.


    The full valence-shell ionization spectra of the four most stable guanine tautomers were studied theoretically. The third-order algebraic-diagrammatic construction (ADC(3)) method for the one-particle Green's function was used to calculate the energies and relative intensities of the vertical ionization transitions. For low-lying transitions, the influence of planar and nonplanar guanine configurations on the ionization energies, as well as the convergence of the results with respect to basis set was studied at the level of the outer-valence Green's function (OVGF) approximation scheme. The results of the calculations were used to interpret recent synchrotron radiation valence-shell photoionization spectra of guanine in the gas phase under thermal equilibrium conditions. The photoelectron spectrum was modeled by summing individual tautomer spectra weighted by Boltzmann population ratios (BPR) of tautomers from our previous high-level ab initio thermochemical calculations. The theoretical spectra are in good agreement with the experimental results, providing assignments of most observed structures and offering insight into tautomerism of guanine in the gas phase. The first six molecular orbitals give rise to single-hole states with a binding energy of about 7-12 eV. At higher binding energy the spectral features are mainly due to satellite states.

  1. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    SciTech Connect

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.


    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced /sup 125/I-(Tyr/sup 1/)somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate (Gpp(NH)p)>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg/sup 2 +/. When pancreatic acini were treated with 1 pertussis toxin for 4 h, subsequent /sup 125/I-(Tyr/sup 1/)somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor.

  2. Extracellular conversion of guanine-based purines to guanosine specifically enhances astrocyte glutamate uptake.


    Frizzo, Marcos Emílio dos Santos; Antunes Soares, Félix Alexandre; Dall'Onder, Leonara Patrícia; Lara, Diogo Rizzato; Swanson, Raymond A; Souza, Diogo Onofre


    Guanosine (GUO) has been shown to stimulate glutamate uptake in primary astrocyte cultures. The purpose of this study was to determine the effect and specificity of guanine- or adenine-based purines on glutamate and GABA uptake in cultured astrocytes. Stimulatory effect on glutamate uptake was observed with GUO, GMP or GTP. Simultaneous exposure with these guanine-based purines did not show an additive effect. We also investigated a possible interconversion of guanine-based purines during incubation time. Action by GTP was excluded since the hydrolysis resistant GTP analog, GMP-PNP did not stimulate glutamate uptake. Addition of an ecto-5'-nucleotidase inhibitor abolished GMP-stimulatory effect on glutamate uptake, without affecting GUO action. Taken together, these results suggest that GUO is the guanine-based purines responsible for glutamate uptake activation. In addition, the stimulatory effect on glutamate uptake was not observed with adenine-based purines. Moreover, GABA uptake was not activated by GUO. These results point to specificity in the interaction between GUO and the astrocyte glutamate uptake system.

  3. Successive attachment of electrons to protonated Guanine: (G+H)* radicals and (G+H)- anions.


    Zhang, Jun D; Xie, Yaoming; Schaefer, Henry F


    The structures, energetics, and vibrational frequencies of nine hydrogenated 9H-keto-guanine radicals (G+H)(*) and closed-shell anions (G+H)(-) are predicted using the carefully calibrated (Chem. Rev. 2002, 102, 231) B3LYP density functional method in conjunction with a DZP++ basis set. These radical and anionic species come from consecutive electron attachment to the corresponding protonated (G+H)(+) cations in low pH environments. The (G+H)(+) cations are studied using the same level of theory. The proton affinity (PA) of guanine computed in this research (228.1 kcal/mol) is within 0.7 kcal/mol of the latest experiment value. The radicals range over 41 kcal/mol in relative energy, with radical r1, in which H is attached at the C8 site of guanine, having the lowest energy. The lowest energy anion is a2, derived by hydride ion attachment at the C2 site of guanine. No stable N2-site hydride should exist in the gas phase. Structure a9 was predicted to be dissociative in this research. The theoretical adiabatic electron affinities (AEA), vertical electron affinities, and vertical detachment energies were computed, with AEAs ranging from 0.07 to 3.12 eV for the nine radicals.

  4. Defective Guanine Nucleotide Exchange in the Elongation Factor-like 1 (EFL1) GTPase by Mutations in the Shwachman-Diamond Syndrome Protein*

    PubMed Central

    García-Márquez, Adrián; Gijsbers, Abril; de la Mora, Eugenio; Sánchez-Puig, Nuria


    Ribosome biogenesis is orchestrated by the action of several accessory factors that provide time and directionality to the process. One such accessory factor is the GTPase EFL1 involved in the cytoplasmic maturation of the ribosomal 60S subunit. EFL1 and SBDS, the protein mutated in the Shwachman-Diamond syndrome (SBDS), release the anti-association factor eIF6 from the surface of the ribosomal subunit 60S. Here we report a kinetic analysis of fluorescent guanine nucleotides binding to EFL1 alone and in the presence of SBDS using fluorescence stopped-flow spectroscopy. Binding kinetics of EFL1 to both GDP and GTP suggests a two-step mechanism with an initial binding event followed by a conformational change of the complex. Furthermore, the same behavior was observed in the presence of the SBDS protein irrespective of the guanine nucleotide evaluated. The affinity of EFL1 for GTP is 10-fold lower than that calculated for GDP. Association of EFL1 to SBDS did not modify the affinity for GTP but dramatically decreased that for GDP by increasing the dissociation rate of the nucleotide. Thus, SBDS acts as a guanine nucleotide exchange factor (GEF) for EFL1 promoting its activation by the release of GDP. Finally, fluorescence anisotropy measurements showed that the S143L mutation present in the Shwachman-Diamond syndrome altered a surface epitope for EFL1 and largely decreased the affinity for it. These results suggest that loss of interaction between these proteins due to mutations in the disease consequently prevents the nucleotide exchange regulation the SBDS exerts on EFL1. PMID:25991726

  5. Finding Adiabatically Bound Anions of Guanine through a Combinatorial Computational Approach

    SciTech Connect

    Haranczyk, Maciej; Gutowski, Maciej S.


    In summary, guanine supports many adiabatically bound valence anions, which result from enamine-imine transformations of the most stable neutral tautomers. These stable anionic tautomers have been found using combinatorial-computational prescreening at the B3LYP level of theory followed by CCSD(T)/aug-cc-pVDZ calculations. The new anionic tautomers contradict a common opinion that guanine has the lowest electron affinity among nucleobases. The new anionic tautomers might be formed in the course of dissociative electron attachment followed by a hydrogen atom attachment to a carbon atom. They might affect the structure and properties of DNA and RNA exposed to low-energy electrons. Chemical transformations of DNA triggered by the new anionic tautomers will be explored in our future studies.

  6. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    NASA Astrophysics Data System (ADS)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.


    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  7. Guanine-based amphiphiles: synthesis, ion transport properties and biological activity.


    Musumeci, Domenica; Irace, Carlo; Santamaria, Rita; Milano, Domenico; Tecilla, Paolo; Montesarchio, Daniela


    Novel amphiphilic guanine derivatives, here named Gua1 and Gua2, have been prepared through few, simple and efficient synthetic steps. In ion transport experiments through phospholipid bilayers, carried out to evaluate their ability to mediate H(+) transport, Gua2 showed high activity. When this compound was investigated for ion-selective transport activities, no major differences were observed in the behaviour with cations while, in the case of anions, selective activity was observed in the series I(-)>Br(-)>Cl(-)>F(-). The bioactivity of these guanine analogues has been evaluated on a panel of human tumour and non-tumour cell lines in preliminary in vitro cytotoxicity assays, showing a relevant antiproliferative profile for Gua2.

  8. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    PubMed Central

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.


    Inosine-5′-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches. PMID:26558346

  9. Structure-wise discrimination of adenine and guanine by proteins on the basis of their nonbonded interactions.


    Usha, S; Selvaraj, S


    We have analyzed the nonbonded interactions of the structurally similar moieties, adenine and guanine forming complexes with proteins. The results comprise (a) the amino acid-ligand atom preferences, (b) solvent accessibility of ligand atoms before and after complex formation with proteins, and (c) preferred amino acid residue atoms involved in the interactions. We have observed that the amino acid preferences involved in the hydrogen bonding interactions vary for adenine and guanine. The structural variation between the purine atoms is clearly reflected by their burial tendency in the solvent environment. Correlation of the mean amino acid preference values show the variation that exists between adenine and guanine preferences of all the amino acid residues. All our observations provide evidence for the discriminating nature of the proteins in recognizing adenine and guanine.

  10. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    SciTech Connect

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.


    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-((3-cholamidopropyl)dimethylammonio)-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity (/sup 3/H)fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity (/sup 3/H)fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils.

  11. Mutations in the guanine nucleotide exchange factor gene IQSEC2 cause nonsyndromic intellectual disability

    PubMed Central

    Shoubridge, Cheryl; Tarpey, Patrick S; Abidi, Fatima; Ramsden, Sarah L; Rujirabanjerd, Sinitdhorn; Murphy, Jessica A; Boyle, Jackie; Shaw, Marie; Gardner, Alison; Proos, Anne; Puusepp, Helen; Raymond, F Lucy; Schwartz, Charles E; Stevenson, Roger E; Turner, Gill; Field, Michael; Walikonis, Randall S; Harvey, Robert J; Hackett, Anna; Futreal, P Andrew; Stratton, Michael R; Gécz, Jozef


    The first family identified as having a nonsyndromic intellectual disability was mapped in 1988. Here we show that a mutation of IQSEC2, encoding a guanine nucleotide exchange factor for the ADP-ribosylation factor family of small GTPases, caused this disorder. In addition to MRX1, IQSEC2 mutations were identified in three other families with X-linked intellectual disability. This discovery was made possible by systematic and unbiased X chromosome exome resequencing. PMID:20473311

  12. Protein–DNA charge transport: Redox activation of a DNA repair protein by guanine radical

    PubMed Central

    Yavin, Eylon; Boal, Amie K.; Stemp, Eric D. A.; Boon, Elizabeth M.; Livingston, Alison L.; O'Shea, Valerie L.; David, Sheila S.; Barton, Jacqueline K.


    DNA charge transport (CT) chemistry provides a route to carry out oxidative DNA damage from a distance in a reaction that is sensitive to DNA mismatches and lesions. Here, DNA-mediated CT also leads to oxidation of a DNA-bound base excision repair enzyme, MutY. DNA-bound Ru(III), generated through a flash/quench technique, is found to promote oxidation of the [4Fe-4S]2+ cluster of MutY to [4Fe-4S]3+ and its decomposition product [3Fe-4S]1+. Flash/quench experiments monitored by EPR spectroscopy reveal spectra with g = 2.08, 2.06, and 2.02, characteristic of the oxidized clusters. Transient absorption spectra of poly(dGC) and [Ru(phen)2dppz]3+ (dppz = dipyridophenazine), generated in situ, show an absorption characteristic of the guanine radical that is depleted in the presence of MutY with formation instead of a long-lived species with an absorption at 405 nm; we attribute this absorption also to formation of the oxidized [4Fe-4S]3+ and [3Fe-4S]1+ clusters. In ruthenium-tethered DNA assemblies, oxidative damage to the 5′-G of a 5′-GG-3′ doublet is generated from a distance but this irreversible damage is inhibited by MutY and instead EPR experiments reveal cluster oxidation. With ruthenium-tethered assemblies containing duplex versus single-stranded regions, MutY oxidation is found to be mediated by the DNA duplex, with guanine radical as an intermediate oxidant; guanine radical formation facilitates MutY oxidation. A model is proposed for the redox activation of DNA repair proteins through DNA CT, with guanine radicals, the first product under oxidative stress, in oxidizing the DNA-bound repair proteins, providing the signal to stimulate DNA repair. PMID:15738421

  13. Benchmark Theoretical and Experimental Study on (15)N NMR Shifts of Oxidatively Damaged Guanine.


    Dračínský, Martin; Šála, Michal; Klepetářová, Blanka; Šebera, Jakub; Fukal, Jiří; Holečková, Veronika; Tanaka, Yoshiyuki; Nencka, Radim; Sychrovský, Vladimír


    The (15)N NMR shifts of 9-ethyl-8-oxoguanine (OG) were calculated and measured in liquid DMSO and in crystal. The OG molecule is a model for oxidatively damaged 2'-deoxyguanosine that occurs owing to oxidative stress in cell. The DNA lesion is repaired with human 8-oxoguanine glycosylase 1 (hOGG1) base-excision repair enzyme, however, the exact mechanism of excision of damaged nucleobase with hOGG1 is currently unknown. This benchmark study on (15)N NMR shifts of OG aims their accurate structural interpretation and calibration of the calculation protocol utilizable in future studies on mechanism of hOGG1 enzyme. The effects of NMR reference, DFT functional, basis set, solvent, structure, and dynamics on calculated (15)N NMR shifts were first evaluated for OG in crystal to calibrate the best performing calculation method. The effect of large-amplitude motions on (15)N NMR shifts of OG in liquid was calculated employing molecular dynamics. The B3LYP method with Iglo-III basis used for B3LYP optimized geometry with 6-311++G(d,p) basis and including effects of solvent and molecular dynamic was the calculation protocol used for calculation of (15)N NMR shifts of OG. The NMR shift of N9 nitrogen of OG was particularly studied because the atom is involved in an N-glycosidic bond that is cleaved with hOGG1. The change of N9 NMR shift owing to oxidation of 9-ethylguanine (G) measured in liquid was -27.1 ppm. The calculated N9 NMR shift of OG deviated from experiment in crystal and in liquid by 0.45 and 0.65 ppm, respectively. The calculated change of N9 NMR shift owing to notable N9-pyramidalization of OG in one previously found polymorph was 20.53 ppm. We therefore assume that the pyramidal geometry of N9 nitrogen that could occur for damaged DNA within hOGG1 catalytic site might be detectable with (15)N NMR spectroscopy. The calculation protocol can be used for accurate structural interpretation of (15)N NMR shifts of oxidatively damaged guanine DNA residue.

  14. A Rab1 mutant affecting guanine nucleotide exchange promotes disassembly of the Golgi apparatus

    PubMed Central


    The Golgi apparatus is a dynamic organelle whose structure is sensitive to vesicular traffic and to cell cycle control. We have examined the potential role for rab1a, a GTPase previously associated with ER to Golgi and intra-Golgi transport, in the formation and maintenance of Golgi structure. Bacterially expressed, recombinant rab1a protein was microinjected into rat embryonic fibroblasts, followed by analysis of Golgi morphology by fluorescence and electron microscopy. Three recombinant proteins were tested: wild-type rab, mutant rab1a(S25N), a constitutively GDP-bound form (Nuoffer, C., H. W. Davidson, J. Matteson, J. Meinkoth, and W. E. Balch, 1994. J. Cell Biol. 125: 225- 237), and mutant rab1a(N124I) defective in guanine nucleotide binding. Microinjection of wild-type rab1a protein or a variety of negative controls (injection buffer alone or activated ras protein) did not affect the appearance of the Golgi, as visualized by immunofluorescence of alpha-mannosidase II (Man II), used as a Golgi marker. In contrast, microinjection of the mutant forms promoted the disassembly of the Golgi stacks into dispersed vesicular structures visualized by immunofluorescence. When S25N-injected cells were analyzed by EM after immunoperoxidase labeling, Man II was found in isolated ministacks and large vesicular elements that were often surrounded by numerous smaller unlabeled vesicles resembling carrier vesicles. Golgi disassembly caused by rab1a mutants differs from BFA-induced disruption, since beta- COP remains membrane associated, and Man II does not redistribute to the ER. BFA can still cause these residual Golgi elements to fuse and disperse, albeit at a slower rate. Moreover, BFA recovery is incomplete in the presence of rab1 mutants or GTP gamma S. We conclude that GTP exchange and hydrolysis by GTPases, specifically rab1a, are required to form and maintain normal Golgi stacks. The similarity of Golgi disassembly seen with rab1a mutants to that occurring during

  15. Guanine nucleotide-induced polymerization of actin in electropermeabilized human neutrophils

    PubMed Central


    The effects of exogenous guanine nucleotides on the polymerization of actin in human neutrophils were tested in an electropermeabilized cell preparation. Close to 40% permeabilization was achieved with a single electric discharge as measured by nucleic acid staining with ethidium bromide or propidium iodide with minimal (less than 2%) release of the cytoplasmic marker lactate dehydrogenase. In addition, electropermeabilized neutrophils retained their capacity to produce superoxide anions and to sustain a polymerization of actin in response to surface-receptor dependent stimuli such as chemotactic factors. Electropermeabilization produced a rapid and transient permeabilization that allowed the entry of guanine nucleotides into the cells. GTP and, to a larger extent, its nonhydrolyzable analog guanosine 5'-O-2- thiotriphosphate (GTP[S]), induced a time- and concentration-dependent polymerization of actin, as determined by increased staining with 7- nitrobenz-2-oxa-1,3-diazolylphallacidin. The effects of the aforementioned guanine nucleotides were antagonized by GDP[S], but were insensitive to pertussis toxin. Cholera toxin potentiated to a small degree the amount of actin polymerization induced by GTP[S]. These results provided direct evidence for the involvement of GTP-binding proteins in the regulation of the organization of the cytoskeleton of neutrophils, an event that is of crucial importance to the performance of the defense-oriented functions of these cells. PMID:2768336

  16. Non-covalent functionalization of hexagonal boron nitride nanosheets with guanine.


    Anota, E Chigo; Tlapale, Y; Villanueva, M Salazar; Márquez, J A Rivera


    Density functional theory (DFT) calculations were performed to analyze changes in the structural and electronic properties generated by the interaction of a single nucleobase group (guanine) with the surface of boron nitride nanosheets with hexagonal symmetry (hBNNs). Nanosheets in two contexts were tested: pristine sheets and with point defects (doped with carbon atoms). The criterion of energy minimum was used to find the ground state of the nine possible isomers generated by the hBNNs-guanine interaction. The phenomenon of physisorption is known to occur at values less than 1.0 eV; the adsorption energy results revealed that the preferential geometry was a parallel arrangement between the two partners, with van der Waals-type bonds generated for the hBNNs doped with two carbon atoms. This was the only energetically stable configuration, thus revealing a vibrational mode rather than imaginaries. Furthermore, the hBNNs/C-guanine system has a low value for work function, and therefore could be used in health applications such drug transport and delivery. The increased polarity values suggest that these nanosheets could be solubilized in common solvents used in experimental processes.

  17. Geometrical Characterization of Adenine And Guanine on Cu(110) By NEXAFS, XPS, And DFT Calculation

    SciTech Connect

    Furukawa, M.; Yamada, T.; Katano, S.; Kawai, M.; Ogasawara, H.; Nilsson, A.; /SLAC, SSRL /Stockholm U.


    Adsorption of purine DNA bases (guanine and adenine) on Cu(1 1 0) was studied by X-ray photoelectron spectroscopy (XPS), near-edge X-ray absorption fine-structure spectroscopy (NEXAFS), and density-functional theory (DFT) calculation. At coverages near 0.2 monolayers, Angular-resolved NEXAFS analysis revealed that adenine adsorbates lie almost flat and that guanine adsorbates are tilted up on the surface with the purine ring parallel to the atom rows of Cu(1 1 0). Referring to the previous studies on pyrimidine DNA bases [M. Furukawa, H. Fujisawa, S. Katano, H. Ogasawara, Y. Kim, T. Komeda, A. Nilsson, M. Kawai, Surf. Sci. 532-535 (2003) 261], the isomerization of DNA bases on Cu(1 1 0) was found to play an important role in the adsorption geometry. Guanine, thymine and cytosine adsorption have an amine-type nitrogen next to a carbonyl group, which is dehydrogenated into imine nitrogen on Cu(1 1 0). These bases are bonded by the inherent portion of - NH-CO - altered by conversion into enolic form and dehydrogenation. Adenine contains no CO group and is bonded to Cu(1 1 0) by participation of the inherent amine parts, resulting in nearly flatly-lying position.

  18. Thiol-modifying phenylarsine oxide inhibits guanine nucleotide binding of Rho but not of Rac GTPases.


    Gerhard, Ralf; John, Harald; Aktories, Klaus; Just, Ingo


    Phenylarsine oxide (PAO) is a phosphotyrosine phosphatase inhibitor that cross-links vicinal thiol groups, thereby inactivating phosphatases possessing XCysXXCysX motifs. The RhoA-GTPase, but not the Rac1-GTPase, also possesses vicinal cysteines within the guanine nucleotide-binding region (aa 13-20) and the phosphohydrolase activity site. Treatment of Caco-2 cells with PAO showed a dose-dependent reorganization of the actin cytoskeleton, indicating involvement of Rho GTPases. As tested by pull-down experiments, RhoA, but not Rac1, from cell lysates was inactivated by PAO in a concentration-dependent manner. Modification of RhoA by PAO resulted in altered mobility on SDS-polyacrylamide gel electrophoresis, and PAO-modified RhoA was no longer substrate for C3-catalyzed ADP-ribosylation. Furthermore, RhoA treated with PAO, but not Rac1 treated with PAO, lost its property to bind to guanine nucleotides. Matrix-assisted laser desorption ionization-mass analysis of PAO-modified RhoA showed a mass shift according to an adduction of a single PAO molecule per molecule RhoA. Further analysis of Glu-C-generated RhoA peptides confirmed binding of PAO to a peptide harboring the guanine nucleotide binding region. Thus, PAO does not exclusively inhibit phosphotyrosine phosphatases but also inactivates RhoA by alteration of nucleotide binding.

  19. Oxidative modification of guanine bases initiated by oxyl radicals derived from photolysis of azo compounds.


    Shao, Jie; Geacintov, Nicholas E; Shafirovich, Vladimir


    Oxidative damage to guanine bases initiated by photolysis of the water-soluble radical generator 2,2'-azobis(2-amidinopropane) dihydrochloride (AAPH) has been investigated by laser kinetic spectroscopy. In the neutral oxygenated aqueous solutions, 355 nm laser flash photolysis of AAPH generates a whole spectrum of free radicals including 2-amidinoprop-2-peroxyl (ROO(*)), 2-amidinoprop-2-oxyl (RO(*)), and superoxide (O(2)(*-)) radicals. These oxyl radicals with negligible absorption in a near UV-visible range were monitored in the reactions leading to the products with characteristic absorption spectra. This approach reveals that RO(*) radicals induce fast one-electron oxidation of 2'-deoxyguanosine (dG) to form guanine neutral radicals, dG(-H)(*). In contrast, ROO(*) radicals do not react at observable rates with dG. The O(2)(*-) radicals were detected using a classical test reaction with tetranitromethane to form nitroform. The major pathway for formation of the end-products of guanine oxidation is the combination of the G(-H)(*) and O(2)(*-) radicals to form 2,5-diamino-4H-imidazolone (Iz). This mechanism was confirmed by analysis of the end-products produced by oxidation of two substrates: (1) the guanosine derivative 2',3',5'-tri-O-acetylguanosine (tri-O-Ac-G) and (2) the 5'-d(CCATCGCTACC) sequence. The major products isolated by HPLC and identified by mass spectrometry methods were the tri-O-Ac-Iz and 5'-d(CCATC[Iz]CTACC products.

  20. DNA polymerase V allows bypass of toxic guanine oxidation products in vivo.


    Neeley, William L; Delaney, Sarah; Alekseyev, Yuriy O; Jarosz, Daniel F; Delaney, James C; Walker, Graham C; Essigmann, John M


    Reactive oxygen and nitrogen radicals produced during metabolic processes, such as respiration and inflammation, combine with DNA to form many lesions primarily at guanine sites. Understanding the roles of the polymerases responsible for the processing of these products to mutations could illuminate molecular mechanisms that correlate oxidative stress with cancer. Using M13 viral genomes engineered to contain single DNA lesions and Escherichia coli strains with specific polymerase (pol) knockouts, we show that pol V is required for efficient bypass of structurally diverse, highly mutagenic guanine oxidation products in vivo. We also find that pol IV participates in the bypass of two spiroiminodihydantoin lesions. Furthermore, we report that one lesion, 5-guanidino-4-nitroimidazole, is a substrate for multiple SOS polymerases, whereby pol II is necessary for error-free replication and pol V for error-prone replication past this lesion. The results spotlight a major role for pol V and minor roles for pol II and pol IV in the mechanism of guanine oxidation mutagenesis.

  1. Rates of chemical cleavage of DNA and RNA oligomers containing guanine oxidation products.


    Fleming, Aaron M; Alshykhly, Omar; Zhu, Judy; Muller, James G; Burrows, Cynthia J


    The nucleobase guanine in DNA (dG) and RNA (rG) has the lowest standard reduction potential of the bases, rendering it a major site of oxidative damage in these polymers. Mapping the sites at which oxidation occurs in an oligomer via chemical reagents utilizes hot piperidine for cleaving oxidized DNA and aniline (pH 4.5) for cleaving oxidized RNA. In the present studies, a series of time-dependent cleavages of DNA and RNA strands containing various guanine lesions were examined to determine the strand scission rate constants. The guanine base lesions 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), 5-guanidinohydantoin (Gh), 2,2,4-triamino-2H-oxazol-5-one (Z), and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih) were evaluated in piperidine-treated DNA and aniline-treated RNA. These data identified wide variability in the chemical lability of the lesions studied in both DNA and RNA. Further, the rate constants for cleaving lesions in RNA were generally found to be significantly smaller than for lesions in DNA. The OG nucleotides were poorly cleaved in DNA and RNA; Sp nucleotides were slowly cleaved in DNA and did not cleave significantly in RNA; Gh and Z nucleotides cleaved in both DNA and RNA at intermediate rates; and 2Ih oligonucleotides cleaved relatively quickly in both DNA and RNA. The data are compared and contrasted with respect to future experimental design.

  2. Formation of ring-opened and rearranged products of guanine: mechanisms and biological significance.


    Jena, N R; Mishra, P C


    DNA damage by endogenous and exogenous agents is a serious concern, as the damaged products can affect genome integrity severely. Damage to DNA may arise from various factors such as DNA base modifications, strand break, inter- and intrastrand crosslinks, and DNA-protein crosslinks. Among these factors, DNA base modification is a common and important form of DNA damage that has been implicated in mutagenesis, carcinogenesis, and many other pathological conditions. Among the four DNA bases, guanine (G) has the smallest oxidation potential, because of which it is frequently modified by reactive species, giving rise to a plethora of lethal lesions. Similarly, 8-oxo-7,8-dihydroguanine (8-oxoG), an oxidatively damaged guanine lesion, also undergoes various degradation reactions giving rise to several mutagenic species. The various products formed from reactions of G or 8-oxoG with different reactive species are mainly 2,6-diamino-4-oxo-5-formamidopyrimidine, 2,5-diamino-4H-imidazolone, 2,2,4-triamino-5-(2H)-oxazolone, 5-guanidino-4-nitroimidazole, guanidinohydantoin, spiroiminodihydantoin, cyanuric acid, parabanic acid, oxaluric acid, and urea, among others. These products are formed from either ring opening or ring opening and subsequent rearrangement. The main aim of this review is to provide a comprehensive overview of various possible reactions and the mechanisms involved, after which these ring-opened and rearranged products of guanine would be formed in DNA. The biological significance of oxidatively damaged products of G is also discussed.

  3. Magnetic Control of the Light Reflection Anisotropy in a Biogenic Guanine Microcrystal Platelet.


    Iwasaka, Masakazu; Mizukawa, Yuri; Roberts, Nicholas W


    Bioinspired but static optical devices such as lenses, retarders, and reflectors have had a significant impact on the designs of many man-made optical technologies. However, while numerous adaptive and flexible optical mechanisms are found throughout the animal kingdom, highly desirable biomimetic copies of these remarkable smart systems remain, in many cases, a distant dream. Many aquatic animals have evolved highly efficient reflectors based on multilayer stacks of the crystallized nucleic acid base guanine. With exceptional levels of spectral and intensity control, these reflectors represent an interesting design pathway towards controllable micromirror structures. Here we show that individual guanine crystals, with dimensions of 5 μm × 20 μm × 70 nm, can be magnetically controlled to act as individual micromirrors. By applying magnetic fields of 500 mT, the reflectivity of these crystals can be switched off and on for the change in reflectivity. Overall, the use of guanine represents a novel design scheme for a highly efficient and controllable synthetic organic micromirror array.

  4. Activation of G Proteins by Guanine Nucleotide Exchange Factors Relies on GTPase Activity

    PubMed Central

    Stanley, Rob J.; Thomas, Geraint M. H.


    G proteins are an important family of signalling molecules controlled by guanine nucleotide exchange and GTPase activity in what is commonly called an ‘activation/inactivation cycle’. The molecular mechanism by which guanine nucleotide exchange factors (GEFs) catalyse the activation of monomeric G proteins is well-established, however the complete reversibility of this mechanism is often overlooked. Here, we use a theoretical approach to prove that GEFs are unable to positively control G protein systems at steady-state in the absence of GTPase activity. Instead, positive regulation of G proteins must be seen as a product of the competition between guanine nucleotide exchange and GTPase activity—emphasising a central role for GTPase activity beyond merely signal termination. We conclude that a more accurate description of the regulation of G proteins via these processes is as a ‘balance/imbalance’ mechanism. This result has implications for the understanding of intracellular signalling processes, and for experimental strategies that rely on modulating G protein systems. PMID:26986850

  5. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte

    NASA Astrophysics Data System (ADS)

    Dutta, Dipak; Nagapradeep, N.; Zhu, Haijin; Forsyth, Maria; Verma, Sandeep; Bhattacharyya, Aninda J.


    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it’s in-built supply of Li+-ions, exhibited remarkably high lithium-ion transference number (= 0.75) and tunable room temperature ionic conductivity spanning three decades (≈10‑7 to 10‑3 Ω‑1 cm‑1) as a function of moisture content. The ionic conductivity show a distinct reversible transition around 80–100 °C, from a dual Li+ and H+ (<100 °C) to a pure Li+ conductor (>100 °C). Systematic studies reveal a transition from water-assisted Li-ion transport to Li hopping-like mechanism involving guanine-Li coordination. While as-synthesized G7Li has potential in humidity sensors, the anhydrous G7Li is attractive for rechargeable batteries.

  6. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte

    PubMed Central

    Dutta, Dipak; Nagapradeep, N.; Zhu, Haijin; Forsyth, Maria; Verma, Sandeep; Bhattacharyya, Aninda J.


    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it’s in-built supply of Li+-ions, exhibited remarkably high lithium-ion transference number (= 0.75) and tunable room temperature ionic conductivity spanning three decades (≈10−7 to 10−3 Ω−1 cm−1) as a function of moisture content. The ionic conductivity show a distinct reversible transition around 80–100 °C, from a dual Li+ and H+ (<100 °C) to a pure Li+ conductor (>100 °C). Systematic studies reveal a transition from water-assisted Li-ion transport to Li hopping-like mechanism involving guanine-Li coordination. While as-synthesized G7Li has potential in humidity sensors, the anhydrous G7Li is attractive for rechargeable batteries. PMID:27091631

  7. Lead(II)-catalyzed oxidation of guanine in solution studied with electrospray ionization mass spectrometry.


    Banu, Laura; Blagojevic, Voislav; Bohme, Diethard K


    The oxidation of guanine was investigated in water/methanol solution both in the absence and in the presence of Pb(II) with a variable temperature reactor coupled to a tandem mass spectrometer that allowed signature ions of solution reagents and products to be monitored by electrospray ionization (ESI). Two different oxidizing agents were employed, one strong (peroxymonosulfuric acid) and one weaker (hydrogen peroxide). Peroxymonosulfuric acid was observed to oxidize guanine rapidly at room temperature, k(app) > 10(-2) s(-1), whether in the absence or in the presence of Pb(II), to produce spiroiminohydantoin. Guanine did not show measurable oxidation by hydrogen peroxide in the absence of Pb(II) at concentrations of H(2)O(2) up to 1 M at temperatures up to 333 K (k(app) < 3 × 10(-8) s(-1) at 298 K), but in the presence of Pb(II), it was observed to produce both 5-carboxamido-5-formamido-2-iminohydantoin (2-Ih) and imidazolone (Iz) in a ratio of 2.3 ± 0.1 with a total rate enhancement of more than 4 × 10(3). The activation energy was measured to be 82 ± 11 kJ mol(-1) and is more than 120 kJ mol(-1) lower than that for the uncatalyzed oxidation with hydrogen peroxide measured to be at least 208 ± 26 kJ mol(-1). An activation energy of 113 ± 9 kJ mol(-1) has been reported by Bruskov et al. (Nucleic Acids Res.2002, 30, 1354) for the heat-induced oxidation by hydrogen peroxide of guanine embedded as guanosine in DNA which leads to the production of 8-oxo-7,8-dihydro-guanine (8-oxo-Gua). The atomic lead dication lowers the activation energy by activating the hydrogen peroxide oxidant, possibly by O-O bond activation, and by directing the oxidation, possibly through coordination to the functional groups adjacent to the carbon C5: the C6 carbonyl group and the N7 nitrogen. The coupling of tandem mass spectrometry (MS(2)) with a simple variable temperature reactor by ESI proved to be very effective for measuring reaction kinetics and activation energies in solution

  8. Detection of Benzo[a]pyrene-Guanine Adducts in Single-Stranded DNA using the α-Hemolysin Nanopore

    PubMed Central

    Perera, Rukshan T.; Fleming, Aaron M.; Johnson, Robert P.; Burrows, Cynthia J.; White, Henry S.


    The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2′-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5′ or 3′ directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples. PMID:25629967

  9. Detection of benzo[a]pyrene-guanine adducts in single-stranded DNA using the α-hemolysin nanopore.


    Perera, Rukshan T; Fleming, Aaron M; Johnson, Robert P; Burrows, Cynthia J; White, Henry S


    The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2'-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5' or 3' directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples.

  10. Detection of benzo[a]pyrene-guanine adducts in single-stranded DNA using the α-hemolysin nanopore

    NASA Astrophysics Data System (ADS)

    Perera, Rukshan T.; Fleming, Aaron M.; Johnson, Robert P.; Burrows, Cynthia J.; White, Henry S.


    The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2‧-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5‧ or 3‧ directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples.

  11. Enforced Presentation of an Extrahelical Guanine to the Lesion Recognition Pocket of Human 8-Oxoguanine Glycosylase, hOGG1

    SciTech Connect

    Crenshaw, Charisse M.; Nam, Kwangho; Oo, Kimberly; Kutchukian, Peter S.; Bowman, Brian R.; Karplus, Martin; Verdine, Gregory L.


    A poorly understood aspect of DNA repair proteins is their ability to identify exceedingly rare sites of damage embedded in a large excess of nearly identical undamaged DNA, while catalyzing repair only at the damaged sites. Progress toward understanding this problem has been made by comparing the structures and biochemical behavior of these enzymes when they are presented with either a target lesion or a corresponding undamaged nucleobase. Trapping and analyzing such DNA-protein complexes is particularly difficult in the case of base extrusion DNA repair proteins because of the complexity of the repair reaction, which involves extrusion of the target base from DNA followed by its insertion into the active site where glycosidic bond cleavage is catalyzed. Here we report the structure of a human 8-oxoguanine (oxoG) DNA glycosylase, hOGG1, in which a normal guanine from DNA has been forcibly inserted into the enzyme active site. Although the interactions of the nucleobase with the active site are only subtly different for G versus oxoG, hOGG1 fails to catalyze excision of the normal nucleobase. This study demonstrates that even if hOGG1 mistakenly inserts a normal base into its active site, the enzyme can still reject it on the basis of catalytic incompatibility.

  12. Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

    SciTech Connect

    Edenbrandt, C.M.; Murphy, S. )


    Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation.

  13. Guanine nucleotide exchange factor Dock7 mediates HGF-induced glioblastoma cell invasion via Rac activation

    PubMed Central

    Murray, D W; Didier, S; Chan, A; Paulino, V; Van Aelst, L; Ruggieri, R; Tran, N L; Byrne, A T; Symons, M


    Background: Glioblastoma multiforme (GBM), a highly invasive primary brain tumour, remains an incurable disease. Rho GTPases and their activators, guanine nucleotide exchange factors (GEFs), have central roles in GBM invasion. Anti-angiogenic therapies may stimulate GBM invasion via HGF/c-Met signalling. We aim to identify mediators of HGF-induced GBM invasion that may represent targets in a combination anti-angiogenic/anti-invasion therapeutic paradigm. Methods: Guanine nucleotide exchange factor expression was measured by microarray analysis and western blotting. Specific depletion of proteins was accomplished using siRNA. Cell invasion was determined using matrigel and brain slice assays. Cell proliferation and survival were monitored using sulforhodamine B and colony formation assays. Guanine nucleotide exchange factor and GTPase activities were determined using specific affinity precipitation assays. Results: We found that expression of Dock7, a GEF, is elevated in human GBM tissue in comparison with non-neoplastic brain. We showed that Dock7 mediates serum- and HGF-induced glioblastoma cell invasion. We also showed that Dock7 co-immunoprecipitates with c-Met and that this interaction is enhanced upon HGF stimulation in a manner that is dependent on the adaptor protein Gab1. Dock7 and Gab1 also co-immunoprecipitate in an HGF-dependent manner. Furthermore, Gab1 is required for HGF-induced Dock7 and Rac1 activation and glioblastoma cell invasion. Conclusions: Dock7 mediates HGF-induced GBM invasion. Targeting Dock7 in GBM may inhibit c-MET-mediated invasion in tumours treated with anti-angiogenic regimens. PMID:24518591

  14. Fragmentation of the adenine and guanine molecules induced by electron collisions

    SciTech Connect

    Minaev, B. F. E-mail:; Shafranyosh, M. I.; Svida, Yu. Yu; Sukhoviya, M. I.; Shafranyosh, I. I.; Baryshnikov, G. V.; Minaeva, V. A.


    Secondary electron emission is the most important stage in the mechanism of radiation damage to DNA biopolymers induced by primary ionizing radiation. These secondary electrons ejected by the primary electron impacts can produce further ionizations, initiating an avalanche effect, leading to genome damage through the energy transfer from the primary objects to sensitive biomolecular targets, such as nitrogenous bases, saccharides, and other DNA and peptide components. In this work, the formation of positive and negative ions of purine bases of nucleic acids (adenine and guanine molecules) under the impact of slow electrons (from 0.1 till 200 eV) is studied by the crossed electron and molecular beams technique. The method used makes it possible to measure the molecular beam intensity and determine the total cross-sections for the formation of positive and negative ions of the studied molecules, their energy dependences, and absolute values. It is found that the maximum cross section for formation of the adenine and guanine positive ions is reached at about 90 eV energy of the electron beam and their absolute values are equal to 2.8 × 10{sup −15} and 3.2 × 10{sup −15} cm{sup 2}, respectively. The total cross section for formation of the negative ions is 6.1 × 10{sup −18} and 7.6 × 10{sup −18} cm{sup 2} at the energy of 1.1 eV for adenine and guanine, respectively. The absolute cross-section values for the molecular ions are measured and the cross-sections of dissociative ionization are determined. Quantum chemical calculations are performed for the studied molecules, ions and fragments for interpretation of the crossed beams experiments.

  15. Interactions of. beta. -adrenergic receptors with guanine nucleotide-binding proteins

    SciTech Connect

    Abramson, S.N.


    The properties of ..beta..-adrenergic receptors were investigated with radioligand binding assays using the agonists (/sup 3/H)hydroxybenzyl-isoproterenol (/sup 3/H-HBI) and (/sup 3/H)epinephrine (/sup 3/H-EPI), and the antagonist (/sup 125/I)iodopindolol (/sup 125/I-IPIN). Membranes prepared from L6 myoblasts bound (/sup 3/H)HBI, (/sup 3/H)EPI, and (/sup 125/I)IPIN with high affinity and Scatchard plots revealed densities of 222 +/- 23, 111 +/- 7, and 325 +/- 37 fmol/mg of protein, respectively. Binding of (/sup 3/H)HBI and (/sup 3/H)EPI was inhibited allosterically by guanine nucleotides. Membranes prepared from wild-type S49 lymphoma cells bound (/sup 3/H)HBI and (/sup 125/I)IPIN with high affinity and Scatchard plots revealed densities of 48.9 +/- 7.1 and 196 +/- 29 fmol/mg of protein, respectively. Binding of (/sup 3/H)HBI was inhibited allosterically by GTP. Similar results were obtained with membranes prepared from the adenylate cyclase deficient variant of S49 lymphoma cells (cyc-), which does not contain a functional stimulatory guanine nucleotide-binding protein (N/sub s/), but does contain a functional inhibitory guanine nucleotide-binding protein (N/sub i/). Binding of (/sup 3/H)HBI to membranes prepared from cyc- S49 cells was inhibited by pretreatment of cells with pertussis toxin. These results suggest that ..beta..-adrenergic receptors on membranes prepared from cyc- S49 cells interact with N/sub i/ to form a ternary complex composed of agonist, receptor, and N/sub i/.

  16. Effect of hydration on the lowest singlet PiPi* excited-state geometry of guanine: a theoretical study.


    Shukla, M K; Leszczynski, Jerzy


    An ab-initio computational study was performed to investigate the effect of explicit hydration on the ground and lowest singlet PiPi* excited-state geometry and on the selected stretching vibrational frequencies corresponding to the different NH sites of the guanine acting as hydrogen-bond donors. The studied systems consisted of guanine interacting with one, three, five, six, and seven water molecules. Ground-state geometries were optimized at the HF level, while excited-state geometries were optimized at the CIS level. The 6-311G(d,p) basis set was used in all calculations. The nature of potential energy surfaces was ascertained via the harmonic vibrational frequency analysis; all structures were found minima at the respective potential energy surfaces. The changes in the geometry and the stretching vibrational frequencies of hydrogen-bond-donating sites of the guanine in the ground and excited state consequent to the hydration are discussed. It was found that the first solvation shell of the guanine can accommodate up to six water molecules. The addition of the another water molecule distorts the hydrogen-bonding network by displacing other neighboring water molecules away from the guanine plane.

  17. Simultaneous Determination of Adenine and Guanine Using Cadmium Selenide Quantum Dots-Graphene Oxide Nanocomposite Modified Electrode.


    Kalaivani, Arumugam; Narayanan, Sangilimuthu Sriman


    A novel electrochemical sensor was fabricated by immobilizing Cadmium Selenide Quantum Dots (CdSe QDs)-Graphene Oxide (GO) nanocomposite on a paraffin wax impregnated graphite electrode (PIGE) and was used for the simultaneous determination of adenine and guanine. The CdSe QDs-GO nanocomposite was prepared by ultrasonication and was characterized with spectroscopic and microscopic techniques. The nanocomposite modified electrode was characterized by cyclic voltammetry (CV). The modified electrode showed excellent electrocatalytic activity towards the oxidative determination of adenine and guanine with a good peak separation of 0.31 V. This may be due to the high surface area and fast electron transfer kinetics of the nanocomposite. The modified electrode exhibited wide linear ranges from 0.167 μM to 245 μM for Guanine and 0.083 μM to 291 μM for Adenine with detection limits of 0.055 μM Guanine and 0.028 μM of Adenine (S/N = 3) respectively. Further, the modified electrode was used for the quantitative determination of adenine and guanine in herring sperm DNA with satisfactory results. The modified electrode showed acceptable selectivity, reproducibility and stability under optimal conditions.

  18. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    NASA Astrophysics Data System (ADS)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.


    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  19. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.


    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G


    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  20. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.


    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  1. Acyclic phosph(on)ate inhibitors of Plasmodium falciparum hypoxanthine-guanine-xanthine phosphoribosyltransferase

    PubMed Central

    Clinch, Keith; Crump, Douglas R.; Evans, Gary B.; Hazleton, Keith Z.; Mason, Jennifer M.; Schramm, Vern L.


    The pathogenic protozoa responsible for malaria lack enzymes for the de novo synthesis of purines and rely on purine salvage from the host. In Plasmodium falciparum (Pf), hypoxanthine-guanine-xanthine phosphoribosyltransferase (HGXPRT) converts hypoxanthine to inosine monophosphate and is essential for purine salvage making the enzyme an anti-malarial drug target. We have synthesized a number of simple acyclic aza-C- nucleosides and shown that some are potent inhibitors of Pf HGXPRT while showing excellent selectivity for the Pf versus the human enzyme. PMID:23810424

  2. Fluorescent Sensing of Guanine and Guanosine Monophosphate with Conjugated Receptors Incorporating Aniline and Naphthyridine Moieties.


    Lu, Shao-Hung; Phang, Riping; Fang, Jim-Min


    Ethyne-linked naphthyridine-aniline conjugated molecules are selective sensors of decylguanine in dichloromethane and guanosine monophosphate in water (Kass = 16,000 M(-1)). The 2-acetamido-1,8-naphthyridine moiety binds with guanine in a DAA-ADD triply hydrogen-bonded motif. The aniline moiety enhances an electron-donating effect, and the substituent is tuned to attain extra hydrogen bonds, π-π stacking, and electrostatic interactions. The proposed binding modes are supported by a Job plot, ESI-MS, (1)H NMR, UV-vis, and fluorescence spectral analyses.

  3. Electron and hole transfer from DNA base radicals to oxidized products of guanine in DNA.


    Cai, Zhongli; Sevilla, Michael D


    An investigation of electron and hole transfer to oxidized guanine bases in DNA is reported. Guanine in DNA was preferentially oxidized by Br(2)(*-) at 298 K to 8-oxo-7,8-dihydro-guanine (8-oxo-G) and higher oxidation products. HPLC-EC analysis of irradiated DNA shows that the formation of 8-oxo-G could not be increased above the ratio of one 8-oxo-G to 127 +/- 6 bp regardless of dose. 8-oxo-G can be produced only at low levels because it is further oxidized to other species. These oxidation products of guanine have been extensively investigated and identified by others. Our electron spin resonance studies suggest that at 77 K 8-oxo-G is a trap for radiation-produced holes, but certain further oxidation products of 8-oxo-G (G(ox)) are found to be efficient electron traps. Gamma irradiation of oxidized DNA samples in frozen (D(2)O) aqueous ices and glassy 7 M LiBr solutions resulted in radicals formed by electron attachment to the G(ox) sites that were monitored by electron spin resonance spectroscopy (ESR) at 77 K. These ESR spectra suggest that those oxidation products of 8-oxo-G containing alpha-diketo groups account for the electron traps (G(ox)) in oxidized DNA with oxaluric acid a likely major trap. Electron transfer from DNA anion radicals to G(ox) was followed by monitoring of their ESR signals with time at 77 K. Using typical values for the tunneling constant beta estimates of the relative amount of G(ox) to base pairs were obtained. Radicals formed by UV photolysis of oxidized DNA in 8 M NaClO(4) glassy aqueous solutions were also investigated. The 8-oxo-G cation accounts for less than 10% of all the radicals observed after either gamma irradiation of oxidized DNA in frozen (D(2)O) aqueous solution or UV photolysis of oxidized DNA in 8 M NaClO(4) glassy aqueous solutions. We estimate hole transfer distances of about 7 +/- 1 bp at 1 min from G(*+) to 8-oxo-G.

  4. Generation of guanine-thymidine cross-links in DNA by peroxynitrite/carbon dioxide.


    Yun, Byeong Hwa; Geacintov, Nicholas E; Shafirovich, Vladimir


    Nitrosoperoxycarbonate derived from the combination of carbon dioxide and peroxynitrite is an important chemical mediator of inflammation. In aqueous solutions, it rapidly decomposes to the reactive species CO(3)(•-) and (•)NO(2) radicals that are known to initiate the selective oxidation and nitration of guanine in DNA. We have previously demonstrated that the reactions of carbonate radical anions with guanine in 2'-deoxyoligoribonucleotides generate a previously unknown intrastrand cross-linked guanine-thymine product G*-T* with a covalent bond between the C8 (G*) and the thymine N3 (T*) atoms (Crean Nucleic Acids Res. 2008, 36, 742-755). In this work, we demonstrate that G*-T* cross-linked products are also formed when peroxynitrite (0.1 mM) reacts with native DNA in aqueous solutions (pH 7.5-7.7) containing 25 mM carbon dioxide/bicarbonate, in addition to the well-known nitration/oxidation products of guanine such as 8-nitroguanine (8-nitro-G), 5-guanidino-4-nitroimidazole (NIm), 8-oxo-7,8-dehydroguanine (8-oxo-G), and spiroiminodihydantoin (Sp). The yields of these products, after enzymatic digestion with P1 nuclease and alkaline phosphatase to the nucleotide level and reversed phase HPLC separation, were compared with those obtained with the uniformly, isotopically labeled (15)N,(13)C-labeled 2'-deoxy oligoribonucleotides 5'-dGpT and 5'-dGpCpT. The d(G*pT*) and d(G*-T*) cross-linked products derived from the di- and trioligonucleotides, respectively, were used as standards for identifying the analogous lesions in calf thymus DNA by isotope dilution LC-MS/MS methods in the selected reaction monitoring mode. The NIm and 8-nitro-G are the major products formed (∼0.05% each), and lesser amounts of 8-oxo-G (∼0.02%) and d(G*pT*) and d(G*-T*) enzymatic digestion products (∼0.002% each) were found. It is shown that the formation of d(G*pT*) enzyme digestion product can arise only from intrastrand cross-links, whereas d(G*-T*) can arise from both interstrand

  5. Purine salvage pathways of Bacillus subtilis and effect of guanine on growth of GMP reductase mutants.

    PubMed Central

    Endo, T; Uratani, B; Freese, E


    We have isolated numerous mutants containing mutations in the salvage pathways of purine synthesis. The mutations cause deficiencies in adenine phosphoribosyltransferase (adeF), in hypoxanthine-guanine phosphoribosyltransferase (guaF), in adenine deaminase (adeC), in inosine-guanosine phosphorylase, (guaP), and in GMP reductase (guaC). The physiological properties of mutants containing one or more of these mutations and corresponding enzyme measurements have been used to derive a metabolic chart of the purine salvage pathway of Bacillus subtilis. PMID:6408059

  6. Solvent effect on the anharmonic vibrational frequencies in guanine-cytosine base pair

    NASA Astrophysics Data System (ADS)

    Bende, A.; Muntean, C. M.


    We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by considering the DFT method together with the Polarizable Continuum Model (PCM) using PBE and B3PW91 exchange-correlation functionals and triple-ζ valence basis set. We investigate the importance of anharmonic corrections for the vibrational modes taking into account the solvent effect of the water environment. In particular, the unusual anharmonic effect of the H+ vibration in the case of the Hoogsteen base pair configuration is discussed.

  7. Experimental treatment of Staphylococcus aureus bovine intramammary infection using a guanine riboswitch ligand analog.


    Ster, C; Allard, M; Boulanger, S; Lamontagne Boulet, M; Mulhbacher, J; Lafontaine, D A; Marsault, E; Lacasse, P; Malouin, F


    Staphylococcus aureus is a leading cause of intramammary infections (IMI). We recently demonstrated that Staph. aureus strains express the gene guaA during bovine IMI. This gene codes for a guanosine monophosphate synthetase and its expression is regulated by a guanine riboswitch. The guanine analog 2,5,6-triaminopyrimidine-4-one (PC1) is a ligand of the guanine riboswitch. Interactions between PC1 and its target result in inhibition of guanosine monophosphate synthesis and subsequent death of the bacterium. The present study describes the investigational use of PC1 for therapy of Staph. aureus IMI in lactating cows. The in vitro minimal inhibitory concentration of PC1 ranged from 0.5 to 4 μg/mL for a variety of Staph. aureus and Staphylococcus epidermidis strains and required a reducing agent for stability and full potency. A safety assessment study was performed, whereby the healthy quarters of 4 cows were infused with increasing doses of PC1 (0, 150, 250, and 500 mg). Over the 44 h following infusions, no obvious adverse effect was observed. Ten Holstein multiparous cows in mid lactation were then experimentally infused into 3 of the quarters with approximately 50 cfu of Staph. aureus strain SHY97-3906 and infection was allowed to progress for 2 wk before starting PC1 treatment. Bacterial counts reached then about 10(3) to 10(4) cfu/mL of milk. Infected quarters were treated with 1 of 3 doses of PC1 (0, 250, or 500 mg) after each morning and evening milking for 7d (i.e., 14 intramammary infusions of PC1). During the treatment period, milk from PC1-treated quarters showed a significant reduction in bacterial concentrations. However, this reduction of Staph. aureus count in milk was not maintained during the 4 wk following the end of the treatment and only 15% of the PC1-treated quarters underwent bacteriological cure. The somatic cell count and the quarter milk production were not affected by treatments. Although bacterial clearance was not achieved following

  8. Electrocatalytic activity of molybdenum disulfide nanosheets enhanced by self-doped polyaniline for highly sensitive and synergistic determination of adenine and guanine.


    Yang, Tao; Yang, Ruirui; Chen, Huaiyin; Nan, Fuxin; Ge, Tong; Jiao, Kui


    Recently, easy, green, and low-cost liquild exfoliation of bulk materials to obtain thin-layered nanostructure significantly emerged. In this work, thin-layered molybdenum disulfide (MoS2) nanosheets were fabricated through intercalation of self-doped polyaniline (SPAN) to layer space of bulk MoS2 by ultrasonic exfoliating method to effectively prevent reaggregation of MoS2 nanosheets. The obtained hybrid showed specific surface area, a large number of electroactive species, and open accessible space, accompanied by rich negative charged and special conjugated structure, which was applied to adopt positively charged guanine and adenine, based on their strong π-π* interactions and electrostatic adsorption. Also, the SPAN-MoS2 interface exhibited the synergistic effect and good electrocatalytic activity compared with the sole SPAN or MoS2 modified electrode.

  9. Human Rho Guanine Nucleotide Exchange Factor 11 (ARHGEF11) Regulates Dendritic Morphogenesis

    PubMed Central

    Mizuki, Yutaka; Takaki, Manabu; Sakamoto, Shinji; Okamoto, Sojiro; Kishimoto, Makiko; Okahisa, Yuko; Itoh, Masahiko; Yamada, Norihito


    Disturbances of synaptic connectivity during perinatal and adolescent periods have been hypothesized to be related to the pathophysiology of schizophrenia. Rho guanine nucleotide exchange factor 11 (ARHGEF11) is a specific guanine nucleotide exchange factors (GEF) for RhoA, which is a critical regulator of actin cytoskeleton dynamics and organization of dendritic spines and inhibitor of spine maintenance. ARHGEF11 variants are reported to be associated with a higher risk for the onset of schizophrenia in a Japanese population; however, how ARHGEF11 contributes to the pathogenesis of schizophrenia in dendritic spines is unknown. Therefore, we first studied the distribution, binding, and function of ARHGEF11 in the dendritic spines of the rat cerebral cortex. After subcellular fractionation of the rat cerebral cortex, ARHGEF11 was detected with synaptophysin and post-synaptic density protein 95 (PSD-95) in the P2 fractions including synaptosomal fractions containing presynaptic and postsynaptic density proteins. Endogenous ARHGEF11 was coimmunoprecipitated with synaptophysin or PSD-95. In cortical primary neurons at 28 days in vitro, immunostaining revealed that ARHGEF11 located in the dendrites and dendritic spines and colocalized with PSD-95 and synaptophysin. Overexpression of exogenous ARHGEF11 significantly decreased the number of spines (p = 0.008). These results indicate that ARHGEF11 is likely to be associated with synaptic membranes and regulation of spine. PMID:28036092

  10. Guanine nucleotide exchange factors for RhoGTPases: good therapeutic targets for cancer therapy?


    Lazer, Galit; Katzav, Shulamit


    Rho guanosine triphosphatases (GTPases) are a family of small proteins which function as molecular switches in a variety of signaling pathways following stimulation of cell surface receptors. RhoGTPases regulate numerous cellular processes including cytoskeleton organization, gene transcription, cell proliferation, migration, growth and cell survival. Because of their central role in regulating processes that are dysregulated in cancer, it seems reasonable that defects in the RhoGTPase pathway may be involved in the development of cancer. RhoGTPase activity is regulated by a number of protein families: guanine nucleotide exchange factors (GEFs), GTPase activating proteins (GAPs) and guanine nucleotide-dissociation inhibitors (GDIs). This review discusses the participation of RhoGTPases and their regulators, especially GEFs in human cancers. In particular, we focus on the involvement of the RhoGTPase GEF, Vav1, a hematopoietic specific signal transducer which is involved in human neuroblastoma, pancreatic ductal carcinoma and lung cancer. Finally, we summarize recent advances in the design and application of a number of molecules that specifically target individual RhoGTPases or their regulators or effectors, and discuss their potential for cancer therapy.

  11. Cytosolic Na+ Controls an Epithelial Na+ Channel Via the Go Guanine Nucleotide-Binding Regulatory Protein

    NASA Astrophysics Data System (ADS)

    Komwatana, P.; Dinudom, A.; Young, J. A.; Cook, D. I.


    In tight Na+-absorbing epithelial cells, the rate of Na+ entry through amiloride-sensitive apical membrane Na+ channels is matched to basolateral Na+ extrusion so that cell Na+ concentration and volume remain steady. Control of this process by regulation of apical Na+ channels has been attributed to changes in cytosolic Ca2+ concentration or pH, secondary to changes in cytosolic Na+ concentration, although cytosolic Cl- seems also to be involved. Using mouse mandibular gland duct cells, we now demonstrate that increasing cytosolic Na+ concentration inhibits apical Na+ channels independent of changes in cytosolic Ca2+, pH, or Cl-, and the effect is blocked by GDP-β -S, pertussis toxin, and antibodies against the α -subunits of guanine nucleotide-binding regulatory proteins (Go). In contrast, the inhibitory effect of cytosolic anions is blocked by antibodies to inhibitory guanine nucleotide-binding regulatory proteins (Gi1/Gi2. It thus appears that apical Na+ channels are regulated by Go and Gi proteins, the activities of which are controlled, respectively, by cytosolic Na+ and Cl-.

  12. The NEIL glycosylases remove oxidized guanine lesions from telomeric and promoter quadruplex DNA structures

    PubMed Central

    Zhou, Jia; Fleming, Aaron M.; Averill, April M.; Burrows, Cynthia J.; Wallace, Susan S.


    G-quadruplex is a four-stranded G-rich DNA structure that is highly susceptible to oxidation. Despite the important roles that G-quadruplexes play in telomere biology and gene transcription, neither the impact of guanine lesions on the stability of quadruplexes nor their repair are well understood. Here, we show that the oxidized guanine lesions 8-oxo-7,8-dihydroguanine (8-oxoG), guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp) reduce the thermostability and alter the folding of telomeric quadruplexes in a location-dependent manner. Also, the NEIL1 and NEIL3 DNA glycosylases can remove hydantoin lesions but none of the glycosylases, including OGG1, are able to remove 8-oxoG from telomeric quadruplexes. Interestingly, a hydantoin lesion at the site most prone to oxidation in quadruplex DNA is not efficiently removed by NEIL1 or NEIL3. However, NEIL1, NEIL2 and NEIL3 remove hydantoins from telomeric quadruplexes formed by five TTAGGG repeats much more rapidly than the commonly studied four-repeat quadruplex structures. We also show that APE1 cleaves furan in selected positions in Na+-coordinated telomeric quadruplexes. In promoter G-quadruplex DNA, the NEIL glycosylases primarily remove Gh from Na+-coordinated antiparallel quadruplexes but not K+-coordinated parallel quadruplexes containing VEGF or c-MYC promoter sequences. Thus, the NEIL DNA glycosylases may be involved in both telomere maintenance and in gene regulation. PMID:25813041

  13. Base and Nucleotide Excision Repair of Oxidatively Generated Guanine Lesions in DNA.


    Shafirovich, Vladimir; Kropachev, Konstantin; Anderson, Thomas; Liu, Zhi; Kolbanovskiy, Marina; Martin, Brooke D; Sugden, Kent; Shim, Yoonjung; Chen, Xuejing; Min, Jung-Hyun; Geacintov, Nicholas E


    The well known biomarker of oxidative stress, 8-oxo-7,8-dihydroguanine, is more susceptible to further oxidation than the parent guanine base and can be oxidatively transformed to the genotoxic spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) lesions. Incubation of 135-mer duplexes with single Sp or Gh lesions in human cell extracts yields a characteristic nucleotide excision repair (NER)-induced ladder of short dual incision oligonucleotide fragments in addition to base excision repair (BER) incision products. The ladders were not observed when NER was inhibited either by mouse monoclonal antibody (5F12) to human XPA or in XPC(-/-) fibroblast cell extracts. However, normal NER activity appeared when the XPC(-/-) cell extracts were complemented with XPC-RAD23B proteins. The Sp and Gh lesions are excellent substrates of both BER and NER. In contrast, 5-guanidino-4-nitroimidazole, a product of the oxidation of guanine in DNA by peroxynitrite, is an excellent substrate of BER only. In the case of mouse embryonic fibroblasts, BER of the Sp lesion is strongly reduced in NEIL1(-/-) relative to NEIL1(+/+) extracts. In summary, in human cell extracts, BER and NER activities co-exist and excise Gh and Sp DNA lesions, suggesting that the relative NER/BER product ratios may depend on competitive BER and NER protein binding to these lesions.

  14. Cytosolic Na+ controls and epithelial Na+ channel via the Go guanine nucleotide-binding regulatory protein.

    PubMed Central

    Komwatana, P; Dinudom, A; Young, J A; Cook, D I


    In tight Na+-absorbing epithelial cells, the fate of Na+ entry through amiloride-sensitive apical membrane Na+ channels is matched to basolateral Na+ extrusion so that cell Na+ concentration and volume remain steady. Control of this process by regulation of apical Na+ channels has been attributed to changes in cytosolic Ca2+ concentration or pH, secondary to changes in cytosolic Na+ concentration, although cytosolic Cl- seems also to be involved. Using mouse mandibular gland duct cells, we now demonstrate that increasing cytosolic Na+ concentration inhibits apical Na+ channels independent of changes in cytosolic Ca2+, pH, or Cl-, and the effect is blocked by GDP-beta-S, pertussis toxin, and antibodies against the alpha-subunits of guanine nucleotide-binding regulatory proteins (Go). In contrast, the inhibitory effect of cytosolic anions is blocked by antibodies to inhibitory guanine nucleotide-binding regulatory proteins (Gi1/Gi2. It thus appears that apical Na+ channels are regulated by Go and Gi proteins, the activities of which are controlled, respectively, by cytosolic Na+ and Cl-. Images Fig. 4 PMID:8755611

  15. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human

    SciTech Connect

    Blatt, C.; Eversole-Cire, P.; Cohn, V.H.; Zollman, S.; Fournier, R.E.K.; Mohandas, L.T.; Nesbitt, M.; Lugo, T.; Jones, D.T.; Reed, R.R.; Weiner, L.P.; Sparkes, R.S.; Simon, M.I. )


    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding {alpha}-subunit proteins, two different {beta} subunits, and one {gamma} subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The {beta} subunits were also assigned-GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extend of the G{alpha} gene family and may help in attempts to correlate specific genetic diseases and with genes corresponding to G proteins.

  16. New investigations of the guanine trichloro cuprate(II) complex crystal

    NASA Astrophysics Data System (ADS)

    Fabijanić, Ivana; Matković-Čalogović, Dubravka; Pilepić, Viktor; Ivanišević, Irena; Mohaček-Grošev, Vlasta; Sanković, Krešimir


    Crystals of the guanine trichloro cuprate(II) complex, (HGua)2[Cu2Cl6]·2H2O (HGua = protonated guanine), were prepared and analysed by spectroscopic (IR, Raman) and computational methods. A new single-crystal X-ray diffraction analysis was conducted to obtain data with lower standard uncertainties than those in the previously published structure. Raman and IR spectroscopy and quantum-mechanical analysis gave us new insight into the vibrational states of the (HGua)2[Cu2Cl6]·2H2O crystal. The vibrational spectra of the crystal were assigned by performing a normal coordinate analysis for a free dimer with a centre of inversion as the only symmetry element. The stretching vibration observed at 279 cm-1 in the infrared spectrum corresponds to the N-Cu bond. The noncovalent interaction (NCI) plots and quantum theory of atoms in molecules (QTAIM) analysis of the electron density obtained from periodic DFT calculations elucidated the interactions that exist within the crystal structure. Closed-shell ionic attractions, as well as weak and medium strength hydrogen bonds, prevailed in the crystal packing.

  17. Monitoring one-electron photo-oxidation of guanine in DNA crystals using ultrafast infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Hall, James P.; Poynton, Fergus E.; Keane, Páraic M.; Gurung, Sarah P.; Brazier, John A.; Cardin, David J.; Winter, Graeme; Gunnlaugsson, Thorfinnur; Sazanovich, Igor V.; Towrie, Michael; Cardin, Christine J.; Kelly, John M.; Quinn, Susan J.


    To understand the molecular origins of diseases caused by ultraviolet and visible light, and also to develop photodynamic therapy, it is important to resolve the mechanism of photoinduced DNA damage. Damage to DNA bound to a photosensitizer molecule frequently proceeds by one-electron photo-oxidation of guanine, but the precise dynamics of this process are sensitive to the location and the orientation of the photosensitizer, which are very difficult to define in solution. To overcome this, ultrafast time-resolved infrared (TRIR) spectroscopy was performed on photoexcited ruthenium polypyridyl-DNA crystals, the atomic structure of which was determined by X-ray crystallography. By combining the X-ray and TRIR data we are able to define both the geometry of the reaction site and the rates of individual steps in a reversible photoinduced electron-transfer process. This allows us to propose an individual guanine as the reaction site and, intriguingly, reveals that the dynamics in the crystal state are quite similar to those observed in the solvent medium.

  18. Adenine and guanine 8CH exchange in nucleic acids: resolution and measurement by Raman optical multichannel analysis.


    Lamba, O P; Becka, R; Thomas, G J

    Deuterium exchange of 8C protons of adenine and guanine in nucleic acids is conveniently monitored by laser Raman spectrophotometry, and the average exchange rate so determined [kA + kG] can be exploited as a dynamic probe of the secondary structure of DNA or RNA [J. M. Benevides and G. J. Thomas, Jr. (1985) Biopolymers 24, 667-682]. The present work describes a rapid Raman procedure, based upon optical multichannel analysis, which permits discrimination of the different 8CH exchange rates, kA of adenine and kG of guanine, in a single experimental protocol. For this procedure, simultaneous measurements are made of the intensity decay or frequency shift in separately resolved Raman bands of adenine and guanine, each of which is sensitive only to 8C deuteration of its respective purine. Resolution of the rates kA and kG is demonstrated for the mononucleotide mixtures, 5'-rAMP + 5'-rGMP and 5'-dAMP + 5'-dGMP, for the polynucleotides poly(dA-dT).poly(dA-dT) and poly(dG-dC).poly(dG-dC), for calf thymus DNA, and for the 17 base-pair operator OR3. We show that the different exchange rates of adenine and guanine, in nucleotide mixtures and in DNA, may also be calculated independently from intensity decay of the composite 1481-cm-1 band, comprising overlapped adenine and guanine components, over a time domain that encompasses two distinct regimes: (1) a relatively more rapid exchange of guanine, and (2) a concurrent slower exchange of adenine. Both methods developed here yield consistent results. We find, first, that exchange of guanine is approximately twofold more rapid than that of adenine when both purines are present in the same structure and solvent environment, presumably a consequence of the greater basicity of the 7N site of guanine. Second, we find that adenine suffers greater retardation of exchange than guanine when both purines are incorporated into a "classical" B-DNA secondary structure, such as that of calf thymus DNA. This finding suggests different

  19. Hydroxyl Radical (OH•) Reaction with Guanine in an Aqueous Environment: A DFT Study

    PubMed Central

    Kumar, Anil; Pottiboyina, Venkata; Sevilla, Michael D.


    The reaction of hydroxyl radical (OH•) with DNA accounts for about half of radiation-induced DNA damage in living systems. Previous literature reports point out that the reaction of OH• with DNA proceeds mainly through the addition of OH• to the C=C bond of the DNA bases. However, recently it has been reported that the principal reaction of OH• with dGuo (deoxyguanosine) is the direct hydrogen atom abstraction from its exocyclic amine group rather than addition of OH• to the C=C bond. In the present work, these two reaction pathways of OH• attack on guanine (G) in the presence of water molecules (aqueous environment) are investigated using the density functional theory (DFT) B3LYP method with 6-31G* and 6-31++G** basis sets. The calculations show that the initial addition of the OH• at C4=C5 double bond of guanine is barrier free and the adduct radical (G-OH•) has only a small activation barrier of ca. 1 – 6 kcal/mol leading to the formation of a metastable ion-pair intermediate (G•+---OH−). The formation of ion-pair is a result of the highly oxidizing nature of the OH• in aqueous media. The resulting ion-pair (G•+---OH−) deprotonates to form H2O and neutral G radicals favoring G(N1-H)• with an activation barrier of ca. 5 kcal/mol. The overall process from the G(C4)-OH• (adduct) to G(N1-H)• and water is found to be exothermic in nature by more than 13 kcal/mol. (G-OH•), (G•+---OH−), and G(N1-H)• were further characterized by the CAM-B3LYP calculations of their UV-visible spectra and good agreement between theory and experiment is achieved. Our calculations for the direct hydrogen abstraction pathway from N1 and N2 sites of guanine by the OH• show that this is also a competitive route to produce G(N2-H)•, G(N1-H)• and H2O. PMID:22050033

  20. Pathways of arachidonic acid peroxyl radical reactions and product formation with guanine radicals.


    Crean, Conor; Geacintov, Nicholas E; Shafirovich, Vladimir


    Peroxyl radicals were derived from the one-electron oxidation of polyunsaturated fatty acids by sulfate radicals that were generated by the photodissociation of peroxodisulfate anions in air-equilibrated aqueous solutions. Reactions of these peroxyl and neutral guanine radicals, also generated by oxidation with sulfate radicals, were investigated by laser kinetic spectroscopy, and the guanine oxidation products were identified by HPLC and mass spectrometry methods. Sulfate radicals rapidly oxidize arachidonic (ArAc), linoleic (LnAc), and palmitoleic (PmAc) acids with similar rate constants, (2-4) x 10 (9) M (-1) s (-1). The C-centered radicals derived from the oxidation of ArAc and LnAc include nonconjugated Rn(.) ( approximately 80%) and conjugated bis-allylic Rba(.) ( approximately 20%) radicals. The latter were detectable in the absence of oxygen by their prominent, narrow absorption band at 280 nm. The Rn(.) radicals of ArAc (containing three bis-allylic sites) transform to the Rba(.) radicals via an intramolecular H-atom abstraction [rate constant (7.5 +/- 0.7) x 10 (4) s (-1)]. In contrast, the Rn(.) radicals of LnAc that contain only one bis-allylic site do not transform intramolecularly to the Rba(.) radicals. In the case of PmAc, which contains only one double bond, the Rba(.) radicals are not observed. The Rn(.) radicals of PmAc rapidly combine with oxygen with a rate constant of (3.8 +/- 0.4) x 10(9) M(-1) s(-1). The Rba(.) radicals of ArAc are less reactive and react with oxygen with a rate constant of (2.2 +/- 0.2) x 10 (8) M (-1) s (-1). The ArAc peroxyl radicals formed spontaneously eliminate superoxide radical anions [rate constant = (3.4 +/- 0.3) x 10 (4) M (-1) s (-1)]. The stable oxidative lesions derived from the 2',3',5'-tri- O-acetylguanosine or 2',3',5'-tri- O-acetyl-8-oxo-7,8-dihydroguanosine radicals and their subsequent reactions with ArAc peroxyl radicals were also investigated. The major products found were the 2,5-diamino-4 H

  1. Biologically relevant oxidants cause bound proteins to readily oxidatively cross-link at Guanine.


    Solivio, Morwena J; Nemera, Dessalegn B; Sallans, Larry; Merino, Edward J


    Oxidative DNA-protein cross-links have received less attention than other types of DNA damage and remain as one of the least understood types of oxidative lesion. A model system using ribonuclease A and a 27-nucleotide DNA was used to determine the propensity of oxidative cross-linking to occur in the presence of oxidants. Cross-link formation was examined using four different oxidation systems that generate singlet oxygen, superoxide, and metal-based Fenton reactions. It is shown that oxidative cross-linking occurs in yields ranging from 14% to a maximal yield of 61% in all oxidative systems when equivalent concentrations of DNA and protein are present. Because singlet oxygen is the most efficient oxidation system in generating DNA-protein cross-links, it was chosen for further analyses. Cross-linking occurred with single-stranded DNA binding protein and not with bovine serum albumin. Addition of salt lowered nonspecific binding affinity and lowered cross-link yield by up to 59%. The yield of cross-linking increased with increased ratios of protein compared with DNA. Cross-linking was highly dependent on the number of guanines in a DNA sequence. Loss of guanine content on the 27-nucleotide DNA led to nearly complete loss in cross-linking, while primer extension studies showed cross-links to predominantly occur at guanine base on a 100-nucleotide DNA. The chemical species generated were examined using two peptides derived from the ribonuclease A sequence, N-acetyl-AAAKF and N-acetyl-AYKTT, which were cross-linked to 2'-deoxyguanosine. The cross-link products were spiroiminodihydantoin, guanidinohydantoin, and tyrosyl-based adducts. Formation of tyrosine-based adducts may be competitive with the more well-studied lysine-based cross-links. We conclude that oxidative cross-links may be present at high levels in cells since the propensity to oxidatively cross-link is high and so much of the genomic DNA is coated with protein.

  2. UVA-visible photo-excitation of guanine radical cations produces sugar radicals in DNA and model structures

    PubMed Central

    Adhikary, Amitava; Malkhasian, Aramice Y. S.; Collins, Sean; Koppen, Jessica; Becker, David; Sevilla, Michael D.


    This work presents evidence that photo-excitation of guanine radical cations results in high yields of deoxyribose sugar radicals in DNA, guanine deoxyribonucleosides and deoxyribonucleotides. In dsDNA at low temperatures, formation of C1′• is observed from photo-excitation of G•+ in the 310–480 nm range with no C1′• formation observed ≥520 nm. Illumination of guanine radical cations in 2′dG, 3′-dGMP and 5′-dGMP in aqueous LiCl glasses at 143 K is found to result in remarkably high yields (∼85–95%) of sugar radicals, namely C1′•, C3′• and C5′•. The amount of each of the sugar radicals formed varies dramatically with compound structure and temperature of illumination. Radical assignments were confirmed using selective deuteration at C5′ or C3′ in 2′-dG and at C8 in all the guanine nucleosides/tides. Studies of the effect of temperature, pH, and wavelength of excitation provide important information about the mechanism of formation of these sugar radicals. Time-dependent density functional theory calculations verify that specific excited states in G•+ show considerable hole delocalization into the sugar structure, in accord with our proposed mechanism of action, namely deprotonation from the sugar moiety of the excited molecular radical cation. PMID:16204456

  3. Solution structures of oligonucleotides containing either a guanine or a cytosine in front of a gap of one nucleotide

    NASA Astrophysics Data System (ADS)

    Boulard, Y.; Faibis, V.; Fazakerley, G. V.


    We report NMR and molecular modelling studies on two DNA duplexes containing a gap of one nucleotides. The difference between the two oligonucleotides lies in the central base face to the gap, a guanine or a cytosine. For the gapG, we observed in solution a B-form conformation where the guanine stacks in the helix. For the gapC, we reveal the existence of two species, one majority where the cytosine is inside the helix and a second for which the cytosine is extrahelical. Nous présentons une étude par RMN et modélisation moléculaire sur deux duplexes d'ADN contenant une lacune de un nucléotide. La différence entre les deux oligonucléotides réside dans la base centrale en face de la lacune, une guanine ou une cytosine. Pour le duplex appelé gapG, nous observons en solution une hélice de type B dans laquelle la guanine est empilée à l'intérieur de l'hélice. Dans le cas du duplex gapC, nous montrons l'existence de deux formes, l'une où la cytosine est à l'intérieur de l'hélice; la seconde où la cytosine est extra hélicale.

  4. Targeting of Polycomb Repressive Complex 2 to RNA by Short Repeats of Consecutive Guanines.


    Wang, Xueyin; Goodrich, Karen J; Gooding, Anne R; Naeem, Haroon; Archer, Stuart; Paucek, Richard D; Youmans, Daniel T; Cech, Thomas R; Davidovich, Chen


    Polycomb repressive complex 2 (PRC2) is a histone methyltransferase that trimethylates H3K27, a mark of repressed chromatin. Mammalian PRC2 binds RNA promiscuously, with thousands of target transcripts in vivo. But what does PRC2 recognize in these RNAs? Here we show that purified human PRC2 recognizes G > C,U ≫ A in single-stranded RNA and has a high affinity for folded guanine quadruplex (G4) structures but little binding to duplex RNAs. Importantly, G-tract motifs are significantly enriched among PRC2-binding transcripts in vivo. DNA sequences coding for PRC2-binding RNA motifs are enriched at PRC2-binding sites on chromatin and H3K27me3-modified nucleosomes. Collectively, the abundance of PRC2-binding RNA motifs rationalizes the promiscuous RNA binding of PRC2, and their enrichment at Polycomb target genes provides a means for RNA-mediated regulation.

  5. Particular behavior of the adenine and guanine ring-breathing modes upon the DNA conformational transitions.


    Ghomi, M; Letellier, R; Taillandier, E


    Harmonic dynamics calculations performed on the deoxyguanosine (dG) and deoxyadenosine (dA) residues, based on a reliable force field, show that the breathing motions of both guanine and adenine residues are involved in two different vibration modes (750-500 cm-1 spectral region). The calculated results reveal a strong coupling of these modes with the sugar pucker motions. This effect has been verified for the dG residue by the Raman spectra of polyd(G-C). As far as the dA residue is concerned, the particular behavior of the adenine residue breathing mode predicted by these calculations, has been confirmed by Raman spectra of polyd(A-T) undergoing a B----Z conformational transition.

  6. Structural and thermodynamic studies on the adenine.guanine mismatch in B-DNA.

    PubMed Central

    Leonard, G A; Booth, E D; Brown, T


    The structure of the synthetic dodecamer d(CGCAAATTGGCG) has been shown by single crystal X-ray diffraction methods to be that of a B-DNA helix containing two A(anti).G(syn) base pairs. The refinement, based on data to a resolution of 2.25 A shows that the mismatch base pairs are held together by two hydrogen bonds. The syn-conformation of the guanine base of the mismatch is stabilised by hydrogen bonding to a network of solvent molecules in both the major and minor grooves. A pH-dependent ultraviolet melting study indicates that the duplex is stabilised by protonation, suggesting that the bases of the A.G mispair are present in their most common tautomeric forms and that the N(1)-atom of adenine is protonated. The structure refinement shows that there is some disorder in the sugar-phosphate backbone. PMID:2216754

  7. Identification of 17 independent mutations responsible for human hypoxanthine-guanine phosphoribosyltransferase (HPRT) deficiency.

    PubMed Central

    Davidson, B L; Tarlé, S A; Van Antwerp, M; Gibbs, D A; Watts, R W; Kelley, W N; Palella, T D


    Complete hypoxanthine-guanine phosphoribosyltransferase (HPRT) deficiency causes the Lesch-Nyhan syndrome, an X-linked, purine metabolism disorder manifested by hyperuricemia, hyperuricaciduria, and neurologic dysfunction. Partial HPRT deficiency causes hyperuricemia and gout. One requirement for understanding the molecular basis of HPRT deficiency is the determination of which amino acids in this salvage enzyme are necessary for structural or catalytic competence. In this study we have used the PCR coupled with direct sequencing to determine the nucleotide and subsequent amino acid changes in 22 subjects representing 17 unrelated kindreds from the United Kingdom. These mutations were confirmed by using either RNase mapping or Southern analyses. In addition, experiments were done to determine enzyme activity and electrophoretic mobility, and predictive paradigms were used to study the impact of these amino acid substitutions on secondary structure. Images Figure 2 Figure 3 Figure 4 PMID:2018042

  8. Simultaneous determination of adenine and guanine in ruminant bacterial pellets by ion-pair HPLC.


    García del Moral, Pilar; Arín, María Jesús; Resines, José Antonio; Díez, María Teresa


    An ion-pair reversed-phase high-performance liquid chromatography with gradient elution and UV detection was used to measure adenine (A) and guanine (G) in lyophilized bacterial pellets from ruminants using allopurinol as internal standard. The separation was performed on a Symmetry C18 column and the detection was monitored at 280 nm. Calibration curves were found to be linear in the concentration range from 5 to 50 mg/l with correlation coefficients (r2)>0.999. Mean recoveries of A and G standards added to bacterial samples were 102.2 and 98.2, respectively. The method proposed yielded sharp, well-resolved peaks within 25 min and was successfully applied for the determination of A and G in bacterial pellets.

  9. A direct-dynamics study of proton transfer through water bridges in guanine and 7-azaindole

    NASA Astrophysics Data System (ADS)

    Smedarchina, Zorka; Siebrand, Willem; Fernández-Ramos, Antonio; Gorb, Leonid; Leszczynski, Jerzy


    To evaluate the efficiency of bridges of water molecules as proton conduits, multidimensional ab initio proton transfer rate constants are reported for complexes of guanine and 7-azaindole with one and two water molecules. These water molecules form hydrogen-bonded bridges between functional groups involved in tautomerization via proton transfer and catalyze this transfer. Structures and energies of the relevant stationary configurations are optimized at the second-order Møller-Plesset level and vibrational force fields are evaluated at the Hartree-Fock level. The proton transfer rate constants, calculated with the instanton method, show the effect of the structure and strength of the hydrogen bonds, reflected in couplings between the tunneling mode and the other vibrations of the complexes. The results indicate that strongly hydrogen-bonded, strain-free water bridges can serve as very efficient proton conduits.

  10. Surface-Enhanced Hyper-Raman Spectra of Adenine, Guanine, Cytosine, Thymine, and Uracil

    PubMed Central


    Using picosecond excitation at 1064 nm, surface-enhanced hyper-Raman scattering (SEHRS) spectra of the nucleobases adenine, guanine, cytosine, thymine, and uracil with two different types of silver nanoparticles were obtained. Comparing the SEHRS spectra with SERS data from the identical samples excited at 532 nm and with known infrared spectra, the major bands in the spectra are assigned. Due to the different selection rules for the one- and two-photon excited Raman scattering, we observe strong variation in relative signal strengths of many molecular vibrations obtained in SEHRS and SERS spectra. The two-photon excited spectra of the nucleobases are found to be very sensitive with respect to molecule–nanoparticle interactions. Using both the SEHRS and SERS data, a comprehensive vibrational characterization of the interaction of nucleobases with silver nanostructures can be achieved. PMID:28077982

  11. Novel designed enediynes: molecular design, chemical synthesis, mode of cycloaromatization and guanine-specific DNA cleavage.


    Toshima, K; Ohta, K; Kano, T; Nakamura, T; Nakata, M; Kinoshita, M; Matsumura, S


    The molecular design and chemical synthesis of novel enediyne molecules related to the neocarzinostatin chromophore (1), and their chemical and DNA cleaving properties are described. The 10-membered enediyne triols 16-18 were effectively synthesized from xylitol (10) in a short step, and found to be quite stable when handled at room temperature. The representative and acylated enediyne 16 was cycloaromatized by 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in cyclohexa-1,4-diene-benzene to give the benzenoid product 21 through a radical pathway. On the other hand, the enediyne 16 was cycloaromatized by diethylamine in dimethyl sulfoxide-Tris-HCl, pH 8.5 buffer to afford another benzenoid product 22 as a diethylamine adduct through a polar pathway. Furthermore, the enediynes 16-18 were found to exhibit guanine-specific DNA cleavage under weakly basic conditions with no additive.

  12. Acyclic Immucillin Phosphonates. Second-Generation Inhibitors of Plasmodium falciparum Hypoxanthine- Guanine-Xanthine Phosphoribosyltransferase

    SciTech Connect

    Hazelton, Keith Z.; Ho, Meng-Chaio; Cassera, Maria B.; Clinch, Keith; Crump, Douglas R.; Rosario Jr., Irving; Merino, Emilio F.; Almo, Steve C.; Tyler, Peter C.; Schramm, Vern L.


    We found that Plasmodium falciparum is the primary cause of deaths from malaria. It is a purine auxotroph and relies on hypoxanthine salvage from the host purine pool. Purine starvation as an antimalarial target has been validated by inhibition of purine nucleoside phosphorylase. Hypoxanthine depletion kills Plasmodium falciparum in cell culture and in Aotus monkey infections. Hypoxanthine-guanine-xanthine phosphoribosyltransferase (HGXPRT) from P. falciparum is required for hypoxanthine salvage by forming inosine 5'-monophosphate, a branchpoint for all purine nucleotide synthesis in the parasite. We present a class of HGXPRT inhibitors, the acyclic immucillin phosphonates (AIPs), and cell permeable AIP prodrugs. The AIPs are simple, potent, selective, and biologically stable inhibitors. The AIP prodrugs block proliferation of cultured parasites by inhibiting the incorporation of hypoxanthine into the parasite nucleotide pool and validates HGXPRT as a target in malaria.

  13. Synaptic functions of the IQSEC family of ADP-ribosylation factor guanine nucleotide exchange factors.


    Um, Ji Won


    Postsynaptic scaffolding proteins interact with numerous synaptic proteins to ensure the organization and specialization of functional excitatory and inhibitory synapses. IQSECs (IQ motif and SEC7 domain-containing proteins) are a class of ADP ribosylation factor-guanine nucleotide exchange factors (ARF-GEFs), whose functions are beginning to be understood as both scaffolding and signaling proteins. Specifically, IQSEC1 binds to PSD-95, and IQSEC2 functions as a regulator of AMPA receptor trafficking at excitatory synapses, whereas IQSEC3 interacts with gephyrin to promote inhibitory synapse development. Here, I review the currently known findings on IQSECs and discuss the possible relations between dysfunctions of IQSECs and the pathophysiology of brain disorders.

  14. Herpes simplex virus-mediated human hypoxanthine-guanine phosphoribosyltransferase gene transfer into neuronal cells

    SciTech Connect

    Palella, T.D.; Silverman, L.J.; Schroll, C.T.; Homa, F.L.; Levine, M.; Kelley, W.N.


    The virtually complete deficiency of the purine salvage enzyme hypoxanthine-guanine phosphoribosyltransferase (HPRT) results in a devastating neurological disease, Lesch-Nyhan syndrome. Transfer of the HPRT gene into fibroblasts and lymphoblasts in vitro and into hematopoietic cells in vivo has been accomplished by other groups with retroviral-derived vectors. It appears to be necessary, however, to transfer the HPRT gene into neuronal cells to correct the neurological dysfunction of this disorder. The neurotropic virus herpes simplex virus type 1 has features that make it suitable for use as a vector to transfer the HPRT gene into neuronal tissue. This report describes the isolation of an HPRT-deficient rat neuroma cell line, designated B103-4C, and the construction of a recombinant herpes simplex virus type 1 that contained human HPRT cDNA. These recombinant viruses were used to infect B103-4C cells. Infected cells expressed HPRT activity which was human in origin.

  15. Recognition and activation of Rho GTPases by Vav1 and Vav2 guanine nucleotide exchange factors.


    Heo, Jongyun; Thapar, Roopa; Campbell, Sharon L


    Vav proteins are Rho GTPase-specific guanine nucleotide exchange factors (GEFs) that are distinguished by the tandem arrangement of Dbl homology (DH), Pleckstrin homology (PH), and cysteine rich domains (CRD). Whereas the tandem DH-PH arrangement is conserved among Rho GEFs, the presence of the CRD is unique to Vav family members and is required for efficient nucleotide exchange. We provide evidence that Vav2-mediated nucleotide exchange of Rho GTPases follows the Theorell-Chance mechanism in which the Vav2.Rho GTPase complex is the major species during the exchange process and the Vav2.GDP-Mg(2+).Rho GTPase ternary complex is present only transiently. The GTPase specificity for the DH-PH-CRD Vav2 in vitro follows this order: Rac1 > Cdc42 > RhoA. Results obtained from fluorescence anisotropy and NMR chemical shift mapping experiments indicate that the isolated Vav1 CRD is capable of directly associating with Rac1, and residues K116 and S83 that are in the proximity of the P-loop and the guanine base either are part of this binding interface or undergo a conformational change in response to CRD binding. The NMR studies are supported by kinetic measurements on Rac1 mutants S83A, K116A, and K116Q and Vav2 CRD mutant K533A in that these mutants affect both the initial binding event of Vav2 with Rac1 (k(on)) and the rate-limiting dissociation of Vav2 from the Vav2.Rac1 binary complex (thereby influencing the enzyme turnover number, k(cat)). The results suggest that the CRD domain in Vav proteins plays an active role, affecting both the k(on) and the k(cat) for Vav-mediated nucleotide exchange on Rho GTPases.

  16. Guanine nucleotide regulatory protein co-purifies with the D/sub 2/-dopamine receptor

    SciTech Connect

    Senogles, S.E.; Caron, M.G.


    The D/sub 2/-dopamine receptor from bovine anterior pituitary was purified approx.1000 fold by affinity chromatography on CMOS-Sepharose. Reconstitution of the affinity-purified receptor into phospholipid vesicles revealed the presence of high and low affinity agonist sites as detected by N-n-propylnorapomorphine (NPA) competition experiments with /sup 3/H-spiperone. High affinity agonist binding could be converted to the low affinity form by guanine nucleotides, indicating the presence of an endogenous guanine nucleotide binding protein (N protein) in the affinity-purified D/sub 2/ receptor preparations. Furthermore, this preparation contained an agonist-sensitive GTPase activity which was stimulated 2-3 fold over basal by 10 NPA. /sup 35/S-GTP..gamma..S binding to these preparations revealed a stoichiometry of 0.4-0.7 mole N protein/mole receptor, suggesting the N protein may be specifically coupled with the purified D/sub 2/-dopamine receptor and not present as a contaminant. Pertussis toxin treatment of the affinity purified receptor preparations prevented high affinity agonist binding, as well as agonist stimulation of the GTPase activity, presumably by inactivating the associated N protein. Pertussis toxin lead to the ADP-ribosylation of a protein of 39-40K on SDS-PAGE. These findings indicate that an endogenous N protein, N/sub i/ or N/sub o/, co-purifies with the D/sub 2/-dopamine receptor which may reflect a precoupling of this receptor with an N protein within the membranes.

  17. QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA.


    Weisman-Shomer, P; Fry, M


    The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.

  18. Investigation of base pairs containing oxidized guanine using ab initio method and ABEEMσπ polarizable force field.


    Liu, Cui; Wang, Yang; Zhao, Dongxia; Gong, Lidong; Yang, Zhongzhi


    The integrity of the genetic information is constantly threatened by oxidizing agents. Oxidized guanines have all been linked to different types of cancers. Theoretical approaches supplement the assorted experimental techniques, and bring new sight and opportunities to investigate the underlying microscopic mechanics. Unfortunately, there is no specific force field to DNA system including oxidized guanines. Taking high level ab initio calculations as benchmark, we developed the ABEEMσπ fluctuating charge force field, which uses multiple fluctuating charges per atom. And it was applied to study the energies, structures and mutations of base pairs containing oxidized guanines. The geometries were obtained in reference to other studies or using B3LYP/6-31+G* level optimization, which is more rational and timesaving among 24 quantum mechanical methods selected and tested by this work. The energies were determined at MP2/aug-cc-pVDZ level with BSSE corrections. Results show that the constructed potential function can accurately simulate the change of H-bond and the buckled angle formed by two base planes induced by oxidized guanine, and it provides reliable information of hydrogen bonding, stacking interaction and the mutation processes. The performance of ABEEMσπ polarizable force field in predicting the bond lengths, bond angles, dipole moments etc. is generally better than those of the common force fields. And the accuracy of ABEEMσπ PFF is close to that of the MP2 method. This shows that ABEEMσπ model is a reliable choice for further research of dynamics behavior of DNA fragment including oxidized guanine.

  19. Electrochemical oxidation of guanine: electrode reaction mechanism and tailoring carbon electrode surfaces to switch between adsorptive and diffusional responses.


    Li, Qian; Batchelor-McAuley, Christopher; Compton, Richard G


    The electrochemical oxidation of guanine is studied in aqueous media at various carbon electrodes. Specifically edge plane pyrolytic graphite (EPPG), basal plane pyrolytic graphite (BPPG), and highly ordered pyrolytic graphite (HOPG) were used, and the voltammetry was found to vary significantly. In all cases, signals characteristic of adsorbed guanine were seen and the total charge passed varied from surface to surface in the order roughened BPPG > EPPG > BPPG > HOPG. It is of note that the peak height for the EPPG electrode is less than that found for roughened BPPG; furthermore, across the series of electrodes, there is a significant decrease in peak potential with increasing density of edge plane sites present at the electrode surface. This leads us to conclude that there are two dominating and controlling factors present: (i) the density of basal plane sites on which guanine can adsorb and (ii) the density of edge plane sites necessary for the electro-oxidation of the analyte. This conclusion is corroborated through further experiments with multi- and single-walled carbon nanotubes. Adsorption was seen to be enhanced by modification of the EPPG surface with alumina particles, and as such, increased peak signals were observed in their presence. It is further reported that via the pre-adsorption of acetone onto the graphite surface that the adsorption of guanine may be blocked, resulting in a diffusional voltammetric signal. This diffusional response has been successfully modeled and gives insight into the complex -4e(-), -4H(+) oxidation mechanism; specifically, it enables explanation of the observed change in rate-determining step with scan rate. The oxidation of guanine first proceeds via a two-electron oxidation followed by a chemical step to form 8-oxoguanine, then 8-oxoguanine is then further oxidized to form nonelectroactive products. The change is mechanism is attributed to the variation in potential of the first and second electron transfer with scan

  20. Molecular mechanism of the effects of guanine nucleotide and sulfhydryl reagent on muscarinic receptors in smooth muscles studied by radiation inactivation

    SciTech Connect

    Uchida, S.; Matsumoto, K.; Takeyasu, K.; Higuchi, H.; Yoshida, H.


    The molecular sizes of the units concerned in 3-quinuclidinyl benzilate (QNB) binding and in the effects of guanine nucleotide and sulfhydryl reagent on the inhibition of QNB binding by carbachol in smooth muscle of guinea pig ileum were determined to be 76,000, 179,000 and 107,000, respectively by the radiation inactivation method. One or more subunits (GTP subunit) other than the receptor subunit in a muscarinic receptor appeared to be involved in the effect of guanine nucleotide. When guanine nucleotide was present, the receptor subunit seemed to be dissociated from the GTP subunit.

  1. A human exchange factor for ARF contains Sec7- and pleckstrin-homology domains.


    Chardin, P; Paris, S; Antonny, B; Robineau, S; Béraud-Dufour, S; Jackson, C L; Chabre, M


    The small G protein ARF1 is involved in the coating of vesicles that bud from the Golgi compartments. Its activation is controlled by as-yet unidentified guanine-nucleotide exchange factors. Gea1, the first ARF exchange factor to be discovered in yeast, is a large protein containing a domain of homology with Sec7, another yeast protein that is also involved in secretion. Here we characterized a smaller human protein (relative molecular mass 47K) named ARNO, which contains a central Sec7 domain that promotes guanine-nucleotide exchange on ARF1. ARNO also contains an amino-terminal coiled-coil motif and a carboxy-terminal pleckstrin-homology (PH) domain. The PH domain mediates an enhancement of ARNO exchange activity by negatively charged phospholipid vesicles supplemented with phosphatidylinositol bisphosphate. The exchange activity of ARNO is not inhibited by brefeldin A, an agent known to block vesicular transport and inhibit the exchange activity on ARF1 in cell extracts. This suggests that a regulatory component which is sensitive to brefeldin A associates with ARNO in vivo, possibly through the amino-terminal coiled-coil. We propose that other proteins with a Sec7 domain regulate different members of the ARF family.

  2. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.


    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana


    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

  3. DNA lesions derived from the site selective oxidation of Guanine by carbonate radical anions.


    Joffe, Avrum; Geacintov, Nicholas E; Shafirovich, Vladimir


    Carbonate radical anions are potentially important oxidants of nucleic acids in physiological environments. However, the mechanisms of action are poorly understood, and the end products of oxidation of DNA by carbonate radicals have not been characterized. These oxidation pathways were explored in this work, starting from the laser pulse-induced generation of the primary radical species to the identification of the stable oxidative modifications (lesions). The cascade of events was initiated by utilizing 308 nm XeCl excimer laser pulses to generate carbonate radical anions on submicrosecond time scales. This laser flash photolysis method involved the photodissociation of persulfate to sulfate radical anions and the one electron oxidation of bicarbonate anions by the sulfate radicals to yield the carbonate radical anions. The latter were monitored by their characteristic transient absorption band at 600 nm. The rate constants of reactions of carbonate radicals with oligonucleotides increase in the ascending order: 5'-d(CCATCCTACC) [(5.7 +/- 0.6) x 10(6) M(-)(1) s(-)(1)] < 5'-d(TATAACGTTATA), self-complementary duplex [(1.4 +/- 0.2) x 10(7) M(-)(1) s(-)(1)] < 5'-d(CCATCGCTACC [(2.4 +/- 0.3) x 10(7) M(-)(1) s(-)(1)] < 5'-d(CCATC[8-oxo-G]CTACC) [(3.2 +/- 0.4) x 10(8) M(-)(1) s(-)(1)], where 8-oxo-G is 8-oxo-7,8-dihydroguanine, the product of a two electron oxidation of guanine. This remarkable enhancement of the rate constants is correlated with the presence of either G or 8-oxo-G bases in the oligonucleotides. The rate constant for the oxidation of G in a single-stranded oligonuclotide is faster by a factor of approximately 2 than in the double-stranded form. The site selective oxidation of G and 8-oxo-G residues by carbonate radicals results in the formation of unique end products, the diastereomeric spiroiminodihydantoin (Sp) lesions, the products of a four electron oxidation of guanine. These lesions, formed in high yields (40-60%), were isolated by reversed phase

  4. Highly Sensitive Bacteria Quantification Using Immunomagnetic Separation and Electrochemical Detection of Guanine-Labeled Secondary Beads

    PubMed Central

    Jayamohan, Harikrishnan; Gale, Bruce K.; Minson, Bj; Lambert, Christopher J.; Gordon, Neil; Sant, Himanshu J.


    In this paper, we report the ultra-sensitive indirect electrochemical detection of E. coli O157:H7 using antibody functionalized primary (magnetic) beads for capture and polyguanine (polyG) oligonucleotide functionalized secondary (polystyrene) beads as an electrochemical tag. Vacuum filtration in combination with E. coli O157:H7 specific antibody modified magnetic beads were used for extraction of E. coli O157:H7 from 100 mL samples. The magnetic bead conjugated E. coli O157:H7 cells were then attached to polyG functionalized secondary beads to form a sandwich complex (magnetic bead/E. coli/ secondary bead). While the use of magnetic beads for immuno-based capture is well characterized, the use of oligonucleotide functionalized secondary beads helps combine amplification and potential multiplexing into the system. The antibody functionalized secondary beads can be easily modified with a different antibody to detect other pathogens from the same sample and enable potential multiplexing. The polyGs on the secondary beads enable signal amplification up to 108 guanine tags per secondary bead (7.5 × 106 biotin-FITC per secondary bead, 20 guanines per oligonucleotide) bound to the target (E. coli). A single-stranded DNA probe functionalized reduced graphene oxide modified glassy carbon electrode was used to bind the polyGs on the secondary beads. Fluorescent imaging was performed to confirm the hybridization of the complex to the electrode surface. Differential pulse voltammetry (DPV) was used to quantify the amount of polyG involved in the hybridization event with tris(2,2′-bipyridine)ruthenium(II) ( Ru(bpy)32+) as the mediator. The amount of polyG signal can be correlated to the amount of E. coli O157:H7 in the sample. The method was able to detect concentrations of E. coli O157:H7 down to 3 CFU/100 mL, which is 67 times lower than the most sensitive technique reported in literature. The signal to noise ratio for this work was 3. We also demonstrate the use of the

  5. Oxidation of guanine by carbonate radicals derived from photolysis of carbonatotetramminecobalt(III) complexes and the pH dependence of intrastrand DNA cross-links mediated by guanine radical reactions.


    Crean, Conor; Lee, Young Ae; Yun, Byeong Hwa; Geacintov, Nicholas E; Shafirovich, Vladimir


    The carbonate radical anion CO(3)(*-) is a decomposition product of nitrosoperoxycarbonate derived from the combination of carbon dioxide and peroxynitrite, an important biological byproduct of the inflammatory response. The selective oxidation of guanine in DNA by CO(3)(*-) radicals is known to yield spiroiminodihydantoin (Sp) and guanidinohydantoin (Gh) products, and also a novel intrastrand cross-linked product: 5'-d(CCATCG*CT*ACC), featuring a linkage between guanine C8 (G*) and thymine N3 (T*) atoms in the oligonucleotide (Crean et al., Nucleic Acids Res. 2008, 36, 742-755). Involvement of the T-N3 (pK(a) of N3-H is 9.67) suggests that the formation of 5'-d(CCATCG*CT*ACC) might be pH-dependent. This hypothesis was tested by generating CO(3)(*-) radicals through the photodissociation of carbonatotetramminecobalt(III) complexes by steady-state UV irradiation, which allowed for studies of product yields in the pH 5.0-10.0 range. The yield of 5'-d(CCATCG*CT*ACC) at pH 10.0 is approximately 45 times greater than at pH 5.0; this is consistent with the proposed mechanism, which requires N3(H) thymine proton dissociation followed by nucleophilic addition to the C8 guanine radical.

  6. Direct demonstration of guanine nucleotide sensitive receptors for vasoactive intestinal peptide in the anterior lobe of the rat pituitary gland

    SciTech Connect

    Agui, T.; Matsumoto, K. )


    The vasoactive intestinal peptide (VIP) receptors were identified on the membranes from the rat anterior pituitary gland with ({sup 125}I)VIP. The dissociation constant (Kd) and the maximal binding capacity (Bmax) values were estimated from the competitive inhibition data. The Kd and Bmax values were 1.05 +/- 0.75 nM and 103 +/- 11 fmol/mg protein, respectively. The order of molar potency of related peptides to inhibit ({sup 125}I)VIP binding was VIP greater than peptide histidine isoleucine (PHI) greater than secretin greater than glucagon. Glucagon was not effective to inhibit the binding. ({sup 125}I)VIP binding was effectively inhibited by the addition of guanine nucleotides. The order of molar potency to inhibit the binding was Gpp(NH)p greater than GTP greater than GDP greater than GMP greater than ATP. These results directly suggest the coupling of VIP receptors with guanine nucleotide binding proteins in the anterior pituitary gland.

  7. Automated quantum chemistry based molecular dynamics simulations of electron ionization induced fragmentations of the nucleobases Uracil, Thymine, Cytosine, and Guanine.


    Grimme, Stefan; Bauer, Christopher Alexander


    The gas-phase decomposition pathways of electron ionization (EI)-induced radical cations of the nucleobases uracil, thymine, cytosine, and guanine are investigated by means of mixed quantum-classical molecular dynamics. No preconceived fragmentation channels are used in the calculations. The results compare well to a plethora of experimental and theoretical data for these important biomolecules. With our combined stochastic and dynamic approach, one can access in an unbiased way the energetically available decomposition mechanisms. Additionally, we are able to separate the EI mass spectra of different tautomers of cytosine and guanine. Our method (previously termed quantum chemistry electron ionization mass spectra) reproduces free nucleobase experimental mass spectra well and provides detailed mechanistic in-sight into high-energy unimolecular decomposition processes.

  8. Ruthenation of Non‐stacked Guanines in DNA G‐Quadruplex Structures: Enhancement of c‐MYC Expression

    PubMed Central

    Rodríguez, Jéssica; Mosquera, Jesús; Couceiro, José R.


    Abstract Guanine quadruplexes (GQs) are compact four‐stranded DNA structures that play a key role in the control of a variety of biological processes, including gene transcription. Bulky ruthenium complexes featuring a bipyridine, a terpyridine, and one exchangeable ligand ([Ru(terpy)(bpy)X]n+) are able to metalate exposed guanines present in the GQ of the c‐MYC promoter region that are not involved in quadruplex base pairing. qRT‐PCR and western‐blot experiments indicated that the complexes promote a remarkable increase in the expression of this oncogene. We also show that exchangeable thioether ligands (X=RSR′, Met) allow regulation of the metalating activity of the complex with visible light. PMID:27860057

  9. Synthesis of adenine, guanine, cytosine, and other nitrogen organic compounds by a Fischer-Tropsch-like process.

    NASA Technical Reports Server (NTRS)

    Yang, C. C.; Oro, J.


    Study of the formation of purines, pyrimidines, and other bases from CO, H2, and NH3 under conditions similar to those used in the Fischer-Tropsch process. It is found that industrial nickel/iron alloy catalyzes the synthesis of adenine, guanine, cytosine, and other nitrogenous compounds from mixtures of CO, H2, and NH3 at temperatures of about 600 C. Sufficient sample was accumulated to isolate as solid products adenine, guanine, and cytosine, which were identified by infrared spectrophotometry. In the absence of nickel/iron catalyst, at 650 C, or in the presence of this catalyst, at 450 C, no purines or pyrimidines were synthesized. These results confirm and extend some of the work reported by Kayatsu et al. (1968).

  10. A Cu(II) complex of an imidazolium-based ionic liquid: synthesis, X-ray structure and application in the selective electrochemical sensing of guanine.


    Singh, Amanpreet; Singh, Ajnesh; Singh, Narinder


    An imidazolium-based ionic liquid containing a carboxylic acid group was synthesized and complexed with Cu(II). The resulting complex R1 was fully characterized using various techniques, including IR spectroscopy and X-ray crystallography. Binding studies of the complex R1 were performed with anions and biomolecules using cyclic voltammetry, which showed no change in its voltammogram upon the addition of various anions and most biomolecules. However, a shift in the reduction peak from +0.20 to -0.15 was observed upon the addition of guanine. This selective determination of guanine by R1 was extended by using R1 as an electrochemical sensor for guanine in various voltammetric techniques, including cyclic voltammetry, LSV and DPV. The proposed sensor showed excellent reproducibility and high selectivity and sensitivity towards guanine, with a linear range of 0-20 μM and a detection limit of 45 nM.

  11. Cap analog substrates reveal three clades of cap guanine-N2 methyltransferases with distinct methyl acceptor specificities.


    Benarroch, Delphine; Jankowska-Anyszka, Marzena; Stepinski, Janusz; Darzynkiewicz, Edward; Shuman, Stewart


    The Tgs proteins are structurally homologous AdoMet-dependent eukaryal enzymes that methylate the N2 atom of 7-methyl guanosine nucleotides. They have an imputed role in the synthesis of the 2,2,7-trimethylguanosine (TMG) RNA cap. Here we exploit a collection of cap-like substrates to probe the repertoire of three exemplary Tgs enzymes, from mammalian, protozoan, and viral sources, respectively. We find that human Tgs (hTgs1) is a bona fide TMG synthase adept at two separable transmethylation steps: (1) conversion of m(7)G to m(2,7)G, and (2) conversion of m(2,7)G to m(2,2,7)G. hTgs1 is unable to methylate G or m(2)G, signifying that both steps require an m(7)G cap. hTgs1 utilizes a broad range of m(7)G nucleotides, including mono-, di-, tri-, and tetraphosphate derivatives as well as cap dinucleotides with triphosphate or tetraphosphate bridges. In contrast, Giardia lamblia Tgs (GlaTgs2) exemplifies a different clade of guanine-N2 methyltransferase that synthesizes only a dimethylguanosine (DMG) cap structure and cannot per se convert DMG to TMG under any conditions tested. Methylation of benzyl(7)G and ethyl(7)G nucleotides by hTgs1 and GlaTgs2 underscored the importance of guanine N7 alkylation in providing a key pi-cation interaction in the methyl acceptor site. Mimivirus Tgs (MimiTgs) shares with the Giardia homolog the ability to catalyze only a single round of methyl addition at guanine-N2, but is distinguished by its capacity for guanine-N2 methylation in the absence of prior N7 methylation. The relaxed cap specificity of MimiTgs is revealed at alkaline pH. Our findings highlight both stark and subtle differences in acceptor specificity and reaction outcomes among Tgs family members.

  12. Guanine Deaminase Functions as Dihydropterin Deaminase in the Biosynthesis of Aurodrosopterin, a Minor Red Eye Pigment of Drosophila*

    PubMed Central

    Kim, Jaekwang; Park, Sang Ick; Ahn, Chiyoung; Kim, Heuijong; Yim, Jeongbin


    Dihydropterin deaminase, which catalyzes the conversion of 7,8-dihydropterin to 7,8-dihydrolumazine, was purified 5850-fold to apparent homogeneity from Drosophila melanogaster. Its molecular mass was estimated to be 48 kDa by gel filtration and SDS-PAGE, indicating that it is a monomer under native conditions. The pI value, temperature, and optimal pH of the enzyme were 5.5, 40 °C, and 7.5, respectively. Interestingly the enzyme had much higher activity for guanine than for 7,8-dihydropterin. The specificity constant (kcat/Km) for guanine (8.6 × 106 m−1·s−1) was 860-fold higher than that for 7,8-dihydropterin (1.0 × 104 m−1·s−1). The structural gene of the enzyme was identified by matrix-assisted laser desorption/ionization time-of-flight mass spectrometry analysis as CG18143, located at region 82A1 on chromosome 3R. The cloned and expressed CG18143 exhibited both 7,8-dihydropterin and guanine deaminase activities. Flies with mutations in CG18143, SUPor-P/Df(3R)A321R1 transheterozygotes, had severely decreased activities in both deaminases compared with the wild type. Among several red eye pigments, the level of aurodrosopterin was specifically decreased in the mutant, and the amount of xanthine and uric acid also decreased considerably to 76 and 59% of the amounts in the wild type, respectively. In conclusion, dihydropterin deaminase encoded by CG18143 plays a role in the biosynthesis of aurodrosopterin by providing one of its precursors, 7,8-dihydrolumazine, from 7,8-dihydropterin. Dihydropterin deaminase also functions as guanine deaminase, an important enzyme for purine metabolism. PMID:19567870

  13. Quantum-chemical study of interactions of trans-resveratrol with guanine-thymine dinucleotide and DNA-nucleobases.


    Mikulski, Damian; Szeląg, Małgorzata; Molski, Marcin


    Trans-resveratrol, a natural phytoalexin present in red wine and grapes, has gained considerable attention because of its antiproliferative, chemopreventive and proapoptotic activity against human cancer cells. The accurate quantum-chemical computations based on the density functional theory (DFT) and ab initio second-order Møller-Plesset perturbation method (MP2) have been performed for the first time to study interactions of trans-resveratrol with guanine-thymine dinucleotide and DNA-derived nitrogenous bases: adenine, guanine, cytosine and thymine in vacuum and water medium. This compound is found to show high affinity to nitrogenous bases and guanine-thymine dinucleotide. The electrostatic interactions from intermolecular hydrogen bonding increase the stability of complexes studied. In particular, significantly strong hydrogen bonds between 4'-H atom of trans-resveratrol and imidazole nitrogen as well as carbonyl oxygen atoms of nucleobases studied stabilize these systems. The stabilization energies computed reveal that the negatively charged trans-resveratrol-dinucleotide complex is more energetically stable in water medium than in vacuum. MP2 method gives more reliable and significantly high values of stabilization energy of trans-resveratrol-dinucleotide, trans-resveratrol-guanine and trans-resveratrol-thymine complexes than B3LYP exchange-correlation functional because it takes into account London dispersion energy. According to the results, in the presence of trans-resveratrol the 3'-5' phosphodiester bond in dinucleotide can be cleaved and the proton from 4'-OH group of trans-resveratrol migrates to the 3'-O atom of dinucleotide. It is concluded that trans-resveratrol is able to break the DNA strand. Hence, the findings obtained help understand antiproliferative and anticancer properties of this polyphenol.

  14. Structure of radicals from X-irradiated guanine derivatives: an experimental and computational study of sodium guanosine dihydrate single crystals.


    Jayatilaka, Nayana; Nelson, William H


    In sodium guanosine dihydrate single crystals, the guanine moiety is deprotonated at N1 due to growth from high-pH (>12) solutions. Electron paramagnetic resonance (EPR) and electron-nuclear double resonance (ENDOR) studies of crystals X-irradiated at 10 K detected evidence for three radical forms. Radical R1, characterized by two proton and two nitrogen hyperfine interactions, was identified as the product of net hydrogenation at N7 of the N1-deprotonated guanine unit. R1 exhibited an unusually distorted structure leading to net positive isotropic components of the hydrogen alpha-couplings. Radical R2, characterized by one proton and one nitrogen hyperfine coupling, was identified as the primary electron-loss product. This product is equivalent to that of deprotonation at N1 by the guanine cation and represents the first ENDOR characterization of that product. Radical R3, characterized by a single hydrogen hyperfine coupling, was identified as the product of net dehydrogenation at C1' of the ribose moiety. The identification of radicals R1-R3 was supported by density functional theory (DFT) calculations on several possible structures using the B3LYP/6-311G(2df,p)//6-31G(d,p) approach. Radical R4, detected after warming the crystals to room temperature, was identified as the well-known product of net hydrogenation of C8 of the (N1-deprotonated) guanine component. Radical R1, evidently formed by protonation of the primary electron addition product, was present as roughly 60% of the total radicals detected at 10 K. Radical R2 was present as roughly 27% of the total yield, and the concentration of R3 contributed the remaining 13%. R3 is evidently the product of one-electron oxidation followed by deprotonation; thus, the balance of oxidation and reduction products is approximately equal within experimental uncertainty.

  15. Computational prediction of one-electron reduction potentials and acid dissociation constants for guanine oxidation intermediates and products.


    Psciuk, Brian T; Schlegel, H Bernhard


    Reduction potentials and pK(a) values were calculated for intermediates and products along three major pathways for guanine oxidation using the B3LYP and CBS-QB3 levels of theory with the SMD implicit solvation model. N-methylated nucleobases were used as models for nucleoside species. Ensemble averaged reduction potentials at pH 7 (E7) were obtained by combining calculated standard reduction potentials with calculated pKa values in addition to accounting for tautomerization energies. Calculated pK(a) values are reasonable based on experimental estimates and chemical intuition. Pathway A leads to guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp). The first step is the oxidation of 8-oxoguanine which proceeds by the loss of an electron followed by the loss of two protons and loss of another electron, yielding 8-oxopurine. The calculated E7 values for the remaining intermediates and products are at least 0.3 V higher than that of guanine, indicating that further oxidation of these species is unlikely. Pathway B leads to two formamidopyrimidine isomers (FAPyG and 2,5FAPyG). Species along this pathway have calculated reduction potentials that are much lower than the oxidation potential for guanine and would likely be very short-lived in an oxidatively stressed environment. Pathway C leads to reduced spiroiminodihydantoin and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih). Similar to pathway A, the calculated reduction potentials for species along this pathway are at least 0.4 V higher than that of guanine.

  16. Rational design of hetero-ring-expanded guanine analogs with enhanced properties for modified DNA building blocks.


    Zhang, Jinmei; Cukier, Robert I; Bu, Yuxiang


    The properties and modes of recognition of physiological DNAs associated with the four natural nucleobases might be extended, in principle, by the design of non-natural nucleobase derivatives. The goal is an expansion of the genetic alphabet, with the possible outcome of producing new DNAs with improved physical or biological properties. In this work, a new series of hetero-ring-expanded guanine analogs are proposed, and their relevant structural characteristics and electronic properties are determined by density functional theory. The stabilities of the decamer DNA duplexes (dn.dC)10 (where n represents the corresponding expanded guanine analog designed here) are also examined, using molecular dynamics. The simulations show that the designed motifs can form stable DNA-like structures. We determined the pairing energies for the Watson-Crick (WC) hydrogen-bonded dimers between the expanded G-analogs and the natural C, and found that the pairing energies are close to those of the natural GC pair. The calculated adiabatic ionization potentials (IPs) of the size-expanded guanine analogs and their base pairs, and the corresponding vertical ionization potentials, show that some are distinctly smaller than the corresponding natural versions. The HOMO-LUMO energy gaps for most of the size-expanded guanine analogs and their WC base pairs are considerably lower than those of the corresponding natural base and base pairs. Thus, the expanded G bases may be considered as DNA genetic motifs, and they may serve as building blocks for potential biological applications and the development of molecular electronic devices.

  17. Influence of gamma subunit prenylation on association of guanine nucleotide-binding regulatory proteins with membranes.

    PubMed Central

    Muntz, K H; Sternweis, P C; Gilman, A G; Mumby, S M


    Two approaches were taken to address the possible role of gamma-subunit prenylation in dictating the cellular distribution of guanine nucleotide-binding regulatory proteins. Prenylation of gamma subunits was prevented by site-directed mutagenesis or by inhibiting the synthesis of mevalonate, the precursor of cellular isoprenoids. When beta or gamma subunits were transiently expressed in COS-M6 simian kidney cells (COS) cells, the proteins were found in the membrane fraction by immunoblotting. Immunofluorescence experiments indicated that the proteins were distributed to intracellular structures in addition to plasma membranes. Replacement of Cys68 of gamma with Ser prevented prenylation of the mutant protein and association of the protein with the membrane fraction of COS cells. Immunoblotting results demonstrated that some of the beta subunits were found in the cytoplasm when coexpressed with the nonprenylated mutant gamma subunit. When Neuro 2A cells were treated with compactin to inhibit protein prenylation, a fraction of endogenous beta and gamma was distributed in the cytoplasm. It is concluded that prenylation facilitates association of gamma subunits with membranes, that the cellular location of gamma influences the distribution of beta, and that prenylation is not an absolute requirement for interaction of beta and gamma. Images PMID:1550955

  18. Molecular basis of RNA guanine-7 methyltransferase (RNMT) activation by RAM.


    Varshney, Dhaval; Petit, Alain-Pierre; Bueren-Calabuig, Juan A; Jansen, Chimed; Fletcher, Dan A; Peggie, Mark; Weidlich, Simone; Scullion, Paul; Pisliakov, Andrei V; Cowling, Victoria H


    Maturation and translation of mRNA in eukaryotes requires the addition of the 7-methylguanosine cap. In vertebrates, the cap methyltransferase, RNA guanine-7 methyltransferase (RNMT), has an activating subunit, RNMT-Activating Miniprotein (RAM). Here we report the first crystal structure of the human RNMT in complex with the activation domain of RAM. A relatively unstructured and negatively charged RAM binds to a positively charged surface groove on RNMT, distal to the active site. This results in stabilisation of a RNMT lobe structure which co-evolved with RAM and is required for RAM binding. Structure-guided mutagenesis and molecular dynamics simulations reveal that RAM stabilises the structure and positioning of the RNMT lobe and the adjacent α-helix hinge, resulting in optimal positioning of helix A which contacts substrates in the active site. Using biophysical and biochemical approaches, we observe that RAM increases the recruitment of the methyl donor, AdoMet (S-adenosyl methionine), to RNMT. Thus we report the mechanism by which RAM allosterically activates RNMT, allowing it to function as a molecular rheostat for mRNA cap methylation.

  19. Guanine and inosine nucleotides, nucleosides and oxypurines in snail muscles as potential biomarkers of fluoride toxicity.


    Rać, Monika E; Safranow, Krzysztof; Dołegowska, Barbara; Machoy, Zygmunt


    The aim of the present study was to determine the toxicity of fluorides on energy metabolism in muscles of the Helix aspersa maxima snail. Qualitative and quantitative analysis of purine compounds was performed in slices of foot from mature snails with high-performance liquid chromatography. Fluoride concentrations were measured using an ion-selective electrode and gas chromatography. The results show that exposure to fluoride pollution was accompanied by a statistically significant increase in fluoride concentrations in soft tissues. This effect was already noticeable with the smallest fluoride dose. Accumulation was greatest in the shell. There is a significant and positive correlation between fluoride concentrations in foot muscles and guanine and inosine nucleotides or uridine content. The content of low-energy guanylate, inosylate and oxypurine in foot muscles significantly increased with rising dose of fluoride. The difference as compared with controls was significant only for the highest dose of fluoride. Interestingly, uric acid, the final product of purine catabolism, dominated quantitatively in the foot muscles of snails. In conclusion, increased low-energy guanylate and inosylate as well as decreased xanthine concentrations in snail muscle can be indicators of the toxic influence of fluoride on the organism. The measuring of fluoride accumulation in the shell is the most suitable bioindicator of fluoride pollution in the environment.

  20. The Guanine-Based Purinergic System: The Tale of An Orphan Neuromodulation

    PubMed Central

    Garozzo, Roberta; Frinchi, Monica; Fernandez-Dueñas, Víctor; Di Iorio, Patrizia; Ciccarelli, Renata; Caciagli, Francesco; Condorelli, Daniele F.; Ciruela, Francisco; Belluardo, Natale


    Guanine-based purines (GBPs) have been recently proposed to be not only metabolic agents but also extracellular signaling molecules that regulate important functions in the central nervous system. In such way, GBPs-mediated neuroprotection, behavioral responses and neuronal plasticity have been broadly described in the literature. However, while a number of these functions (i.e., GBPs neurothophic effects) have been well-established, the molecular mechanisms behind these GBPs-dependent effects are still unknown. Furthermore, no plasma membrane receptors for GBPs have been described so far, thus GBPs are still considered orphan neuromodulators. Interestingly, an intricate and controversial functional interplay between GBPs effects and adenosine receptors activity has been recently described, thus triggering the hypothesis that GBPs mechanism of action might somehow involve adenosine receptors. Here, we review recent data describing the GBPs role in the brain. We focus on the involvement of GBPs regulating neuronal plasticity, and on the new hypothesis based on putative GBPs receptors. Overall, we expect to shed some light on the GBPs world since although these molecules might represent excellent candidates for certain neurological diseases management, the lack of putative GBPs receptors precludes any high throughput screening intent for the search of effective GBPs-based drugs. PMID:27378923

  1. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization.


    Dhapola, Parashar; Chowdhury, Shantanu


    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 ( presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way.

  2. How not to do kinetics: examples involving GTPases and guanine nucleotide exchange factors.


    Goody, Roger S


    Guanine nucleotide exchange factors (GEFs) are crucial regulators of the action of GTPases in signal transduction and cellular regulation. Although their basic mechanism of action has been apparent for almost 20 years, there are still misconceptions concerning their properties, and these are confounded by superficial or incorrect interpretation of experimental results in individual cases. Here, an example is described in which an incorrect mechanism was derived because of an inadequate analysis of kinetic results. In a second example, a case is discussed where certain GTP analogs were erroneously described as being able to function as low molecular mass GEFs. In both cases, a lack of distinction between rates, rate constants, and apparent rate constants, together with a disregard of relative signal amplitudes, led to the misinterpretations. In a final example, it is shown how the lack of an appropriate kinetic investigation led to the false conclusion that a secreted protein from Legionella pneumophila can act not only as a GEF towards eukaryotic Rab1 but also as a factor that is able to actively dissociate the stable complex between Rab1 and GDP dissociation inhibitor.

  3. Identification of guanine exchange factor key residues involved in exchange activity and Ras interaction.


    Camus, C; Hermann-Le Denmat, S; Jacquet, M


    We have carried out a functional analysis of the human HGRF55 exchange factor in the yeast Saccharomyces cerevisiae. Twelve residues conserved among most of all known guanine exchange factors (GEFs) have been independently changed to alanine. Taking advantage of the ability of Hgrf55p to replace the yeast Cdc25p exchange factor, and using the two-hybrid system with RAS2ala22 allele, we have identified key residues for the interaction with Ras and/or its activation. Substitution of arginine 392 to alanine leads to a complete loss of interaction with Ras, though the protein remains stable. Substitution of Asp266 or Arg359 to alanine results in inactive proteins at 39 degrees C, still able however to interact with Ras. The other charged-to-alanine substitutions led to no detectable phenotype when present alone but most of them dramatically increased the temperature sensitive phenotype observed with [Asp266Ala] substitution. Surprisingly, the cysteine to alanine substitution in the highly conserved PCVPF/Y motif proved to be without effect, suggesting that the sulfhydryl group is not essential for stability or interaction with Ras.

  4. Guanine nucleotide exchange factor RABGEF1 regulates keratinocyte-intrinsic signaling to maintain skin homeostasis

    PubMed Central

    Marichal, Thomas; El Abbas, Sophie; Sibilano, Riccardo; Zurek, Oliwia; Reber, Laurent L.; Pirottin, Dimitri; Kim, Jinah; Chambon, Pierre; Roers, Axel; Antoine, Nadine; Kawakami, Yuko; Bureau, Fabrice; Tam, See-Ying; Tsai, Mindy


    Epidermal keratinocytes form a structural and immune barrier that is essential for skin homeostasis. However, the mechanisms that regulate epidermal barrier function are incompletely understood. Here we have found that keratinocyte-specific deletion of the gene encoding RAB guanine nucleotide exchange factor 1 (RABGEF1, also known as RABEX-5) severely impairs epidermal barrier function in mice and induces an allergic cutaneous and systemic phenotype. RABGEF1-deficient keratinocytes exhibited aberrant activation of the intrinsic IL-1R/MYD88/NF-κB signaling pathway and MYD88-dependent abnormalities in expression of structural proteins that contribute to skin barrier function. Moreover, ablation of MYD88 signaling in RABGEF1-deficient keratinocytes or deletion of Il1r1 restored skin homeostasis and prevented development of skin inflammation. We further demonstrated that epidermal RABGEF1 expression is reduced in skin lesions of humans diagnosed with either atopic dermatitis or allergic contact dermatitis as well as in an inducible mouse model of allergic dermatitis. Our findings reveal a key role for RABGEF1 in dampening keratinocyte-intrinsic MYD88 signaling and sustaining epidermal barrier function in mice, and suggest that dysregulation of RABGEF1 expression may contribute to epidermal barrier dysfunction in allergic skin disorders in mice and humans. Thus, RABGEF1-mediated regulation of IL-1R/MYD88 signaling might represent a potential therapeutic target. PMID:27820702

  5. Crystal Structure of a Replicative DNA Polymerase Bound to the Oxidized Guanine Lesion Guanidinohydantoin

    SciTech Connect

    Aller, Pierre; Ye, Yu; Wallace, Susan S.; Burrows, Cynthia J.; Doubli, Sylvie


    The oxidation of guanine generates one of the most common DNA lesions, 8-oxo-7,8-dihydroguanine (8-oxoG). The further oxidation of 8-oxoG can produce either guanidinohydantoin (Gh) in duplex DNA or spiroiminodihydantoin (Sp) in nucleosides and ssDNA. Although Gh can be a strong block for replicative DNA polymerases such as RB69 DNA polymerase, this lesion is also mutagenic: DNA polymerases bypass Gh by preferentially incorporating a purine with a slight preference for adenine, which results in G {center_dot} C {yields} T {center_dot} A or G {center_dot} C {yields} C {center_dot} G transversions. The 2.15 {angstrom} crystal structure of the replicative RB69 DNA polymerase in complex with DNA containing Gh reveals that Gh is extrahelical and rotated toward the major groove. In this conformation Gh is no longer in position to serve as a templating base for the incorporation of an incoming nucleotide. This work also constitutes the first crystallographic structure of Gh, which is stabilized in the R configuration in the two polymerase/DNA complexes present in the crystal asymmetric unit. In contrast to 8-oxoG, Gh is found in a high syn conformation in the DNA duplex and therefore presents the same hydrogen bond donor and acceptor pattern as thymine, which explains the propensity of DNA polymerases to incorporate a purine opposite Gh when bypass occurs.

  6. Guanine nucleotide binding protein-like 3 is a potential prognosis indicator of gastric cancer.


    Chen, Jing; Dong, Shuang; Hu, Jiangfeng; Duan, Bensong; Yao, Jian; Zhang, Ruiyun; Zhou, Hongmei; Sheng, Haihui; Gao, Hengjun; Li, Shunlong; Zhang, Xianwen


    Guanine nucleotide binding protein-like 3 (GNL3) is a GIP-binding nuclear protein that has been reported to be involved in various biological processes, including cell proliferation, cellular senescence and tumorigenesis. This study aimed to investigate the expression level of GNL3 in gastric cancer and to evaluate the relationship between its expression and clinical variables and overall survival of gastric cancer patients. The expression level of GNL3 was examined in 89 human gastric cancer samples using immunohistochemistry (IHC) staining. GNL3 in gastric cancer tissues was significantly upregulated compared with paracancerous tissues. GNL3 expression in adjacent non-cancerous tissues was associated with sex and tumor size. Survival analyses showed that GNL3 expression in both gastric cancer and adjacent non-cancerous tissues were not related to overall survival. However, in the subgroup of patients with larger tumor size (≥ 6 cm), a close association was found between GNL3 expression in gastric cancer tissues and overall survival. GNL3-positive patients had a shorter survival than GNL3-negative patients. Our study suggests that GNL3 might play an important role in the progression of gastric cancer and serve as a biomarker for poor prognosis in gastric cancer patients.

  7. Crystal structures and inhibition of Trypanosoma brucei hypoxanthine-guanine phosphoribosyltransferase.


    Terán, David; Hocková, Dana; Česnek, Michal; Zíková, Alena; Naesens, Lieve; Keough, Dianne T; Guddat, Luke W


    Human African Trypanosomiasis (HAT) is a life-threatening infectious disease caused by the protozoan parasite, Trypanosoma brucei (Tbr). Due to the debilitating side effects of the current therapeutics and the emergence of resistance to these drugs, new medications for this disease need to be developed. One potential new drug target is 6-oxopurine phosphoribosyltransferase (PRT), an enzyme central to the purine salvage pathway and whose activity is critical for the production of the nucleotides (GMP and IMP) required for DNA/RNA synthesis within this protozoan parasite. Here, the first crystal structures of this enzyme have been determined, these in complex with GMP and IMP and with three acyclic nucleoside phosphonate (ANP) inhibitors. The Ki values for GMP and IMP are 30.5 μM and 77 μM, respectively. Two of the ANPs have Ki values considerably lower than for the nucleotides, 2.3 μM (with guanine as base) and 15.8 μM (with hypoxanthine as base). The crystal structures show that when two of the ANPs bind, they induce an unusual conformation change to the loop where the reaction product, pyrophosphate, is expected to bind. This and other structural differences between the Tbr and human enzymes suggest selective inhibitors for the Tbr enzyme can be designed.

  8. How Does Guanine-Cytosine Base Pair Affect Excess-Electron Transfer in DNA?


    Lin, Shih-Hsun; Fujitsuka, Mamoru; Majima, Tetsuro


    Charge transfer and proton transfer in DNA have attracted wide attention due to their relevance in biological processes and so on. Especially, excess-electron transfer (EET) in DNA has strong relation to DNA repair. However, our understanding on EET in DNA still remains limited. Herein, by using a strongly electron-donating photosensitizer, trimer of 3,4-ethylenedioxythiophene (3E), and an electron acceptor, diphenylacetylene (DPA), two series of functionalized DNA oligomers were synthesized for investigation of EET dynamics in DNA. The transient absorption measurements during femtosecond laser flash photolysis showed that guanine:cytosine (G:C) base pair affects EET dynamics in DNA by two possible mechanisms: the excess-electron quenching by proton transfer with the complementary G after formation of C(•-) and the EET hindrance by inserting a G:C base pair as a potential barrier in consecutive thymines (T's). In the present paper, we provided useful information based on the direct kinetic measurements, which allowed us to discuss EET through oligonucleotides for the investigation of DNA damage/repair.

  9. Electron correlation effects and density analysis of the first-order hyperpolarizability of neutral guanine tautomers.


    Alparone, Andrea


    Dipole moments (μ), charge distributions, and static electronic first-order hyperpolarizabilities (β(μ)) of the two lowest-energy keto tautomers of guanine (7H and 9H) were determined in the gas phase using Hartree-Fock, Møller-Plesset perturbation theory (MP2 and MP4), and DFT (PBE1PBE, B97-1, B3LYP, CAM-B3LYP) methods with Dunning's correlation-consistent aug-cc-pVDZ and d-aug-cc-pVDZ basis sets. The most stable isomer 7H exhibits a μ value smaller than that of the 9H form by a factor of ca. 3.5. The β μ value of the 9H tautomer is strongly dependent on the computational method employed, as it dramatically influences the β(μ) (9H)/β(μ) (7H) ratio, which at the highest correlated MP4/aug-cc-pVDZ level is predicted to be ca. 5. The Coulomb-attenuating hybrid exchange-correlation CAM-B3LYP method is superior to the conventional PBE1PBE, B3LYP, and B97-1 functionals in predicting the β(μ) values. Differences between the largest diagonal hyperpolarizability components were clarified through hyperpolarizability density analyses. Dipole moment and first-order hyperpolarizability are molecular properties that are potentially useful for distinguishing the 7H from the 9H tautomer.

  10. Self-catalyzed site-specific depurination of guanine residues within gene sequences.


    Amosova, Olga; Coulter, Richard; Fresco, Jacques R


    A self-catalyzed, site-specific guanine-depurination activity has been found to occur in short gene sequences with a potential to form a stem-loop structure. The critical features of that catalytic intermediate are a 5'-G-T-G-G-3' loop and an adjacent 5'-T.A-3' base pair of a short duplex stem stable enough to fix the loop structure required for depurination of its 5'-G residue. That residue is uniquely depurinated with a rate some 5 orders of magnitude faster than that of random "spontaneous" depurination. In contrast, all other purine residues in the sequence depurinate at the spontaneous background rate. The reaction requires no divalent cations or other cofactors and occurs under essentially physiological conditions. Such stem-loops can form in duplex DNA under superhelical stress, and their critical sequence features have been found at numerous sites in the human genome. Self-catalyzed stem-loop-mediated depurination leading to flexible apurinic sites may therefore serve some important biological role, e.g., in nucleosome positioning, genetic recombination, or chromosome superfolding.

  11. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

    PubMed Central

    Dhapola, Parashar; Chowdhury, Shantanu


    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 ( presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

  12. EspM2 is a RhoA guanine nucleotide exchange factor

    PubMed Central

    Arbeloa, Ana; Garnett, James; Lillington, James; Bulgin, Richard R; Berger, Cedric N; Lea, Susan M; Matthews, Steve; Frankel, Gad


    We investigated how the type III secretion system WxxxE effectors EspM2 of enterohaemorrhagic Escherichia coli, which triggers stress fibre formation, and SifA of Salmonella enterica serovar Typhimurium, which is involved in intracellular survival, modulate Rho GTPases. We identified a direct interaction between EspM2 or SifA and nucleotide-free RhoA. Nuclear Magnetic Resonance Spectroscopy revealed that EspM2 has a similar fold to SifA and the guanine nucleotide exchange factor (GEF) effector SopE. EspM2 induced nucleotide exchange in RhoA but not in Rac1 or H-Ras, while SifA induced nucleotide exchange in none of them. Mutating W70 of the WxxxE motif or L118 and I127 residues, which surround the catalytic loop, affected the stability of EspM2. Substitution of Q124, located within the catalytic loop of EspM2, with alanine, greatly attenuated the RhoA GEF activity in vitro and the ability of EspM2 to induce stress fibres upon ectopic expression. These results suggest that binding of SifA to RhoA does not trigger nucleotide exchange while EspM2 is a unique Rho GTPase GEF. PMID:20039879

  13. Crystal structures and inhibition of Trypanosoma brucei hypoxanthine–guanine phosphoribosyltransferase

    PubMed Central

    Terán, David; Hocková, Dana; Česnek, Michal; Zíková, Alena; Naesens, Lieve; Keough, Dianne T.; Guddat, Luke W.


    Human African Trypanosomiasis (HAT) is a life-threatening infectious disease caused by the protozoan parasite, Trypanosoma brucei (Tbr). Due to the debilitating side effects of the current therapeutics and the emergence of resistance to these drugs, new medications for this disease need to be developed. One potential new drug target is 6-oxopurine phosphoribosyltransferase (PRT), an enzyme central to the purine salvage pathway and whose activity is critical for the production of the nucleotides (GMP and IMP) required for DNA/RNA synthesis within this protozoan parasite. Here, the first crystal structures of this enzyme have been determined, these in complex with GMP and IMP and with three acyclic nucleoside phosphonate (ANP) inhibitors. The Ki values for GMP and IMP are 30.5 μM and 77 μM, respectively. Two of the ANPs have Ki values considerably lower than for the nucleotides, 2.3 μM (with guanine as base) and 15.8 μM (with hypoxanthine as base). The crystal structures show that when two of the ANPs bind, they induce an unusual conformation change to the loop where the reaction product, pyrophosphate, is expected to bind. This and other structural differences between the Tbr and human enzymes suggest selective inhibitors for the Tbr enzyme can be designed. PMID:27786284

  14. Molecular basis of RNA guanine-7 methyltransferase (RNMT) activation by RAM

    PubMed Central

    Varshney, Dhaval; Petit, Alain-Pierre; Bueren-Calabuig, Juan A.; Jansen, Chimed; Fletcher, Dan A.; Peggie, Mark; Weidlich, Simone; Scullion, Paul; Pisliakov, Andrei V.; Cowling, Victoria H.


    Maturation and translation of mRNA in eukaryotes requires the addition of the 7-methylguanosine cap. In vertebrates, the cap methyltransferase, RNA guanine-7 methyltransferase (RNMT), has an activating subunit, RNMT-Activating Miniprotein (RAM). Here we report the first crystal structure of the human RNMT in complex with the activation domain of RAM. A relatively unstructured and negatively charged RAM binds to a positively charged surface groove on RNMT, distal to the active site. This results in stabilisation of a RNMT lobe structure which co-evolved with RAM and is required for RAM binding. Structure-guided mutagenesis and molecular dynamics simulations reveal that RAM stabilises the structure and positioning of the RNMT lobe and the adjacent α-helix hinge, resulting in optimal positioning of helix A which contacts substrates in the active site. Using biophysical and biochemical approaches, we observe that RAM increases the recruitment of the methyl donor, AdoMet (S-adenosyl methionine), to RNMT. Thus we report the mechanism by which RAM allosterically activates RNMT, allowing it to function as a molecular rheostat for mRNA cap methylation. PMID:27422871

  15. The Guanine-Nucleotide Exchange Factor SGEF Plays a Crucial Role in the Formation of Atherosclerosis

    PubMed Central

    Kroon, Jeffrey; Welch, Christopher; Bakker, Erik N.; Matlung, Hanke L.; van den Berg, Timo K.; Sharek, Lisa; Doerschuk, Claire; Hahn, Klaus; Burridge, Keith


    The passage of leukocytes across the endothelium and into arterial walls is a critical step in the development of atherosclerosis. Previously, we showed in vitro that the RhoG guanine nucleotide exchange factor SGEF (Arhgef26) contributes to the formation of ICAM-1-induced endothelial docking structures that facilitate leukocyte transendothelial migration. To further explore the in vivo role of this protein during inflammation, we generated SGEF-deficient mice. When crossed with ApoE null mice and fed a Western diet, mice lacking SGEF showed a significant decrease in the formation of atherosclerosis in multiple aortic areas. A fluorescent biosensor revealed local activation of RhoG around bead-clustered ICAM-1 in mouse aortic endothelial cells. Notably, this activation was decreased in cells from SGEF-deficient aortas compared to wild type. In addition, scanning electron microscopy of intimal surfaces of SGEF−/− mouse aortas revealed reduced docking structures around beads that were coated with ICAM-1 antibody. Similarly, under conditions of flow, these beads adhered less stably to the luminal surface of carotid arteries from SGEF−/− mice. Taken together, these results show for the first time that a Rho-GEF, namely SGEF, contributes to the formation of atherosclerosis by promoting endothelial docking structures and thereby retention of leukocytes at athero-prone sites of inflammation experiencing high shear flow. SGEF may therefore provide a novel therapeutic target for inhibiting the development of atherosclerosis. PMID:23372835

  16. Guanine nucleotide exchange factor H1 can be a new biomarker of melanoma

    PubMed Central

    Shi, Jie; Guo, Bingyu; Zhang, Yu; Hui, Qiang; Chang, Peng; Tao, Kai


    Guanine nucleotide exchange factor H1 (GEF-H1), which couples microtubule dynamics to RhoA activation, is a microtubule-regulated exchange factor. Studies have shown that GEF-H1 can be involved in various cancer pathways; however, the clinical significance of GEF-H1 expression and functions in melanoma has not been established. In this study, we investigated the relationship between clinical outcomes and GEF-H1 functions in melanoma. A total of 60 cases of different grades of melanoma samples were used to detect the expression of GEF-H1. Results showed that both messenger RNA and protein levels of GEF-H1 were significantly higher in high-grade melanomas. Furthermore, patients with high GEF-H1 expression had a shorter overall survival (22 months) than patients with low level of GEF-H1 expression (33.38 months). We also found that GEF-H1 can promote the proliferation and metastasis of melanoma cells. In summary, these results suggested that GEF-H1 may be a valuable biomarker for assessing the degree and prognosis of melanoma following surgery. PMID:27462139

  17. Overoxidized polypyrrole/graphene nanocomposite with good electrochemical performance as novel electrode material for the detection of adenine and guanine.


    Gao, Yan-Sha; Xu, Jing-Kun; Lu, Li-Min; Wu, Li-Ping; Zhang, Kai-Xin; Nie, Tao; Zhu, Xiao-Fei; Wu, Yao


    Most conducting polymer/graphene composites have excellent electrical conductivity. However, the background currents of these composites modified electrodes are much larger. In order to improve the sensitivities of these methods, it is necessary to decrease the background signal. In this paper, porous structure films of overoxidized polypyrrole/graphene (PPyox/GR) have been electrochemically coated onto glassy carbon electrode (GCE) and successfully utilized as an efficient electrode material for the quantitive detection of adenine and guanine, two of the most important components of DNA and RNA. The permselective polymer coatings with low background current could improve the selectivity and sensitivity of microelectrodes for the electropositive purine bases. The GRs into these polymers would further improve sensitivity by increasing the electroactive surface area. The electrochemical sensor can be applied to the quantification of adenine and guanine with a linear range covering 0.06-100 µM and 0.04-100 µM, and a low detection limit of 0.02 μM and 0.01 μM, respectively. More importantly, the proposed method was applied to quantify adenine and guanine in calf thymus DNA with satisfactory results.

  18. Electrochemical biosensor based on silver nanoparticles-polydopamine-graphene nanocomposite for sensitive determination of adenine and guanine.


    Huang, Ke-Jing; Wang, Lan; Wang, Hai-Bo; Gan, Tian; Wu, Ying-Ying; Li, Jing; Liu, Yan-Ming


    A multifunctional Ag nanoparticles (AgNPs)-polydopamine (Pdop)@graphene (Gr) composite was prepared by a simple and mild procedure. Gr was easily coated with Pdop at room temperature and then AgNPs was deposited by mildly stirring. The nanocomposite was characterized by scanning electron microscope (SEM) and transmission electron microscope (TEM). Guanine and adenine as model moleculars were employed to study their electrochemical responses at the Ag-Pdop@Gr composite modified electrode, which showed more favorable electron transfer kinetics than Gr modified glassy carbon and AgNPs modified glassy carbon electrodes. The Ag-Pdop@Gr modified electrode exhibited linear ranges of 0.04-50 μM and 0.02-40 μM with detection limits of 4.0 nM and 2.0 nM for guanine and adenine, respectively. The developed method was applied for simultaneous determination of trace-level adenine and guanine in fish sperm. The results demonstrated that the AgNPs-Pdop@Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for biosensing.

  19. DNA oxidation in anionic reverse micelles: ruthenium-mediated damage at Guanine in single- and double-stranded DNA.


    Evans, Sarah E; Mon, Soe; Singh, Robinder; Ryzhkov, Lev R; Szalai, Veronika A


    One-electron guanine oxidation in DNA has been investigated in anionic reverse micelles (RMs). A photochemical method for generating Ru3+ from the ruthenium polypyridyl complex tris(2-2'-bipyridine)ruthenium(II) chloride ([Ru(bpy)3]Cl2) is combined with high-resolution polyacrylamide gel electrophoresis (PAGE) to quantify piperidine-labile guanine oxidation products. As characterized by emission spectroscopy of Ru(bpy)3(2+), the addition of DNA to RMs containing Ru(bpy)3(2+) does not perturb the environment of Ru(bpy)3(2+). The steady-state quenching efficiency of Ru(bpy)3(2+) with K3[Fe(CN)6] in buffer solution is approximately 2-fold higher than that observed in RMs. Consistent with the difference in quenching efficiency in the two media, a 1.5-fold higher yield of piperidine-labile damage products as monitored by PAGE is observed for duplex oligonucleotide in buffer vs RMs. In contrast, a 13-fold difference in the yield of PAGE-detected G oxidation products is observed when single-stranded DNA is the substrate. Circular dichroism spectra showed that single-stranded DNA undergoes a structural change in anionic RMs. This structural change is potentially due to cation-mediated adsorption of the DNA phosphates on the anionic headgroups of the RMs, leading to protection of the guanine from oxidatively generated damage.

  20. Mapping structurally defined guanine oxidation products along DNA duplexes: influence of local sequence context and endogenous cytosine methylation.


    Ming, Xun; Matter, Brock; Song, Matthew; Veliath, Elizabeth; Shanley, Ryan; Jones, Roger; Tretyakova, Natalia


    DNA oxidation by reactive oxygen species is nonrandom, potentially leading to accumulation of nucleobase damage and mutations at specific sites within the genome. We now present the first quantitative data for sequence-dependent formation of structurally defined oxidative nucleobase adducts along p53 gene-derived DNA duplexes using a novel isotope labeling-based approach. Our results reveal that local nucleobase sequence context differentially alters the yields of 2,2,4-triamino-2H-oxal-5-one (Z) and 8-oxo-7,8-dihydro-2'-deoxyguanosine (OG) in double stranded DNA. While both lesions are overproduced within endogenously methylated (Me)CG dinucleotides and at 5' Gs in runs of several guanines, the formation of Z (but not OG) is strongly preferred at solvent-exposed guanine nucleobases at duplex ends. Targeted oxidation of (Me)CG sequences may be caused by a lowered ionization potential of guanine bases paired with (Me)C and the preferential intercalation of riboflavin photosensitizer adjacent to (Me)C:G base pairs. Importantly, some of the most frequently oxidized positions coincide with the known p53 lung cancer mutational "hotspots" at codons 245 (GGC), 248 (CGG), and 158 (CGC) respectively, supporting a possible role of oxidative degradation of DNA in the initiation of lung cancer.

  1. Structural outline of the detailed mechanism for elongation factor Ts-mediated guanine nucleotide exchange on elongation factor Tu.


    Thirup, Søren S; Van, Lan Bich; Nielsen, Tine K; Knudsen, Charlotte R


    Translation elongation factor EF-Tu belongs to the superfamily of guanine-nucleotide binding proteins, which play key cellular roles as regulatory switches. All G-proteins require activation via exchange of GDP for GTP to carry out their respective tasks. Often, guanine-nucleotide exchange factors are essential to this process. During translation, EF-Tu:GTP transports aminoacylated tRNA to the ribosome. GTP is hydrolyzed during this process, and subsequent reactivation of EF-Tu is catalyzed by EF-Ts. The reaction path of guanine-nucleotide exchange is structurally poorly defined for EF-Tu and EF-Ts. We have determined the crystal structures of the following reaction intermediates: two structures of EF-Tu:GDP:EF-Ts (2.2 and 1.8Å resolution), EF-Tu:PO4:EF-Ts (1.9Å resolution), EF-Tu:GDPNP:EF-Ts (2.2Å resolution) and EF-Tu:GDPNP:pulvomycin:Mg(2+):EF-Ts (3.5Å resolution). These structures provide snapshots throughout the entire exchange reaction and suggest a mechanism for the release of EF-Tu in its GTP conformation. An inferred sequence of events during the exchange reaction is presented.

  2. Guanine nucleotide regulation of receptor binding of thyrotropin-releasing hormone (TRH) in rat brain regions, retina and pituitary.


    Sharif, N A; Burt, D R


    Guanine nucleotides inhibited the specific binding of [3H](3-Me-His2)thyrotropin-releasing hormone ([3H]MeTRH) to receptors for TRH in washed homogenates of rat anterior pituitary gland in a dose-related manner. The order of potency (at 100 and 500 microM final) was Gpp(NH)p (a stable analog of GTP) greater than GTP much greater than GDP much greater than cGMP (with the adenine nucleotides being inactive) in the pituitary and various brain regions. Gpp(NH)p at 1 mM caused 17-35% inhibition of [3H]MeTRH binding to different tissues including the pituitary, hypothalamus, retina and nucleus accumbens. A statistically significant nucleotide effect was not observed, however, in the olfactory bulb and medulla/pons membranes. Gpp(NH)p (1 mM) increased the dissociation constants for [3H]MeTRH binding by 1.9- to 2.4-fold in the pituitary, n. accumbens and retinal preparations without altering the apparent binding capacity. These data suggest that TRH receptor binding can be allosterically regulated by guanine nucleotides and provide further evidence for the existence of guanine nucleotide binding protein(s) coupled to the TRH receptor.

  3. Multisite-specific archaeosine tRNA-guanine transglycosylase (ArcTGT) from Thermoplasma acidophilum, a thermo-acidophilic archaeon

    PubMed Central

    Kawamura, Takuya; Hirata, Akira; Ohno, Satoshi; Nomura, Yuichiro; Nagano, Tomoko; Nameki, Nobukazu; Yokogawa, Takashi; Hori, Hiroyuki


    Archaeosine (G+), which is found only at position 15 in many archaeal tRNA, is formed by two steps, the replacement of the guanine base with preQ0 by archaeosine tRNA-guanine transglycosylase (ArcTGT) and the subsequent modification of preQ0 to G+ by archaeosine synthase. However, tRNALeu from Thermoplasma acidophilum, a thermo-acidophilic archaeon, exceptionally has two G+13 and G+15 modifications. In this study, we focused on the biosynthesis mechanism of G+13 and G+15 modifications in this tRNALeu. Purified ArcTGT from Pyrococcus horikoshii, for which the tRNA recognition mechanism and structure were previously characterized, exchanged only the G15 base in a tRNALeu transcript with 14C-guanine. In contrast, T. acidophilum cell extract exchanged both G13 and G15 bases. Because T. acidophilum ArcTGT could not be expressed as a soluble protein in Escherichia coli, we employed an expression system using another thermophilic archaeon, Thermococcus kodakarensis. The arcTGT gene in T. kodakarensis was disrupted, complemented with the T. acidophilum arcTGT gene, and tRNALeu variants were expressed. Mass spectrometry analysis of purified tRNALeu variants revealed the modifications of G+13 and G+15 in the wild-type tRNALeu. Thus, T. acidophilum ArcTGT has a multisite specificity and is responsible for the formation of both G+13 and G+15 modifications. PMID:26721388

  4. Identification of aflatoxin M1-N7-guanine in liver and urine of tree shrews and rats following administration of aflatoxin B1.


    Egner, Patricia A; Yu, Xiang; Johnson, Jesse K; Nathasingh, Christopher K; Groopman, John D; Kensler, Thomas W; Roebuck, Bill D


    Epidemiological studies have shown that exposure to aflatoxin B(1) (AFB(1)) and concurrent infection with hepatitis B lead to a multiplicative risk of developing liver cancer. This chemical-viral interaction can be recapitulated in the tree shrew (Tupia belangeri chinensis). As an initial characterization of this model, the metabolism of AFB(1) in tree shrews has been examined and compared to a sensitive bioassay species, the rat. Utilizing LC/MS/MS, an unreported product, aflatoxin M(1)-N(7)-guanine (AFM(1)-N(7)-guanine), was detected in urine and hepatic DNA samples 24 h after administration of 400 microg/kg AFB(1). In hepatic DNA isolated from tree shrews, AFM(1)-N(7)-guanine was the predominant adduct, 0.74 +/- 0.14 pmol/mg DNA, as compared to 0.37 +/- 0.07 pmol/mg DNA of AFB(1)-N(7)-guanine. Conversely, in rat liver, 6.56 +/- 2.41 pmol/mg DNA of AFB(1)-N(7)-guanine and 0.42 +/- 0.13 pmol/mg DNA of AFM(1)-N(7)-guanine were detected. Rats excreted 1.00 +/- 0.21 pmol AFB(1)-N(7)-guanine/mg creatinine and 0.29 +/- 0.10 pmol AFM(1)-N(7)-guanine/mg creatinine as compared to 0.60 +/- 0.12 pmol AFB(1)-N(7)-guanine/mg creatinine and 0.69 +/- 0.16 pmol AFM(1)-N(7)-guanine/mg creatinine excreted by the tree shrew. Furthermore, tree shrew urine contained 40 times more of the hydroxylated metabolite, AFM(1), than was excreted by rats. In vitro experiments confirmed this difference in oxidative metabolism. Hepatic microsomes isolated from tree shrews failed to produce aflatoxin Q(1) or aflatoxin P(1) but formed a significantly greater amount of AFM(1) than rat microsomes. Bioassays indicated that the tree shrew was considerably more resistant than the rat to AFB(1) hepatocarcinogenesis, which may reflect the significant differences in metabolic profiles of the two species.

  5. De Novo Guanine Biosynthesis but Not the Riboswitch-Regulated Purine Salvage Pathway Is Required for Staphylococcus aureus Infection In Vivo

    PubMed Central

    Yan, Donghong; Katakam, Anand K.; Reichelt, Mike; Lin, Baiwei; Kim, Janice; Park, Summer; Date, Shailesh V.; Monk, Ian R.; Xu, Min; Austin, Cary D.; Maurer, Till


    ABSTRACT De novo guanine biosynthesis is an evolutionarily conserved pathway that creates sufficient nucleotides to support DNA replication, transcription, and translation. Bacteria can also salvage nutrients from the environment to supplement the de novo pathway, but the relative importance of either pathway during Staphylococcus aureus infection is not known. In S. aureus, genes important for both de novo and salvage pathways are regulated by a guanine riboswitch. Bacterial riboswitches have attracted attention as a novel class of antibacterial drug targets because they have high affinity for small molecules, are absent in humans, and regulate the expression of multiple genes, including those essential for cell viability. Genetic and biophysical methods confirm the existence of a bona fide guanine riboswitch upstream of an operon encoding xanthine phosphoribosyltransferase (xpt), xanthine permease (pbuX), inosine-5′-monophosphate dehydrogenase (guaB), and GMP synthetase (guaA) that represses the expression of these genes in response to guanine. We found that S. aureus guaB and guaA are also transcribed independently of riboswitch control by alternative promoter elements. Deletion of xpt-pbuX-guaB-guaA genes resulted in guanine auxotrophy, failure to grow in human serum, profound abnormalities in cell morphology, and avirulence in mouse infection models, whereas deletion of the purine salvage genes xpt-pbuX had none of these effects. Disruption of guaB or guaA recapitulates the xpt-pbuX-guaB-guaA deletion in vivo. In total, the data demonstrate that targeting the guanine riboswitch alone is insufficient to treat S. aureus infections but that inhibition of guaA or guaB could have therapeutic utility. IMPORTANCE De novo guanine biosynthesis and purine salvage genes were reported to be regulated by a guanine riboswitch in Staphylococcus aureus. We demonstrate here that this is not true, because alternative promoter elements that uncouple the de novo pathway from

  6. Stability of low concentrations of guanine-based antivirals in sucrose or maltitol solutions.


    Desai, D; Rao, V; Guo, H; Li, D; Bolgar, M


    Three guanine-based antiviral drugs, entecavir, lobucavir, and acyclovir showed degradation in presence of sucrose in ready-to-use solutions held at 50 degrees C, with more degradation at pH 4 than at pH 6 or 7. LC/MS analysis of the solutions showed isomeric adducts of the drugs and reducing sugars. Sucrose, a disaccharide and a non-reducing sugar, was the source of monosaccharides, the reducing sugars. Sucrose showed pH-dependent hydrolysis at 50 degrees C into two monosaccharides, fructose and glucose, with more sucrose hydrolyzing at pH 4 than pH 6 or 7. Additionally, the three drugs showed pH-dependent degradation at 50 degrees C in fructose and glucose solutions with the following rank order: pH 7>pH 6>pH 4. This indicated that the increased degradation of the drugs in sucrose solutions at pH 4 was mainly due to more hydrolysis of sucrose into fructose and glucose compared to pH 6 or 7, and subsequent reactions of the fructose and glucose with the drugs. Based on structures of the major degradants, it is proposed that the main cause of the degradation was nucleophilic addition of the primary amine group of the drugs to the carbonyl group of the fructose and glucose. This reaction was facilitated as the solution pH increased from 4 to 7. All the drugs showed satisfactory stability regardless of the storage temperature or solution pH in maltitol, an alternate sweetener. The free aldehyde or ketone group in maltitol precursors is reduced to a hydroxyl group after the hydrogenation process making maltitol less susceptible to nucleophilic addition.

  7. Giardia lamblia RNA cap guanine-N2 methyltransferase (Tgs2).


    Hausmann, Stéphane; Shuman, Stewart


    Tgs1 is the enzyme responsible for converting 7-methylguanosine RNA caps to the 2,2,7-trimethylguanosine cap structures of small nuclear and small nucleolar RNAs. Whereas budding yeast Saccharomyces cerevisiae and fission yeast Schizosaccharomyces pombe encode a single Tgs1 protein, the primitive eukaryote Giardia lamblia encodes two paralogs, Tgs1 and Tgs2. Here we show that purified Tgs2 is a monomeric enzyme that catalyzes methyl transfer from AdoMet (K(m) of 6 microm) to m(7)GDP (K(m) of 65 microm; k(cat) of 14 min(-1)) to form m(2,7)GDP. Tgs2 also methylates m(7)GTP (K(m) of 30 microm; k(cat) of 13 min(-1)) and m(7)GpppA (K(m) of 7 microm; k(cat)) of 14 min(-1) but is unreactive with GDP, GTP, GpppA, ATP, CTP, or UTP. We find that the conserved residues Asp-68, Glu-91, and Trp-143 are essential for Tgs2 methyltransferase activity in vitro. The m(2,7)GDP product formed by Tgs2 can be converted to m(2,2,7)GDP by S. pombe Tgs1 in the presence of excess AdoMet. However, Giardia Tgs2 itself is apparently unable to add a second methyl group at guanine-N2. This result implies that 2,2,7-trimethylguanosine caps in Giardia are either synthesized by Tgs1 alone or by the sequential action of Tgs2 and Tgs1. The specificity of Tgs2 raises the prospect that some Giardia mRNAs might contain dimethylguanosine caps.

  8. A Minimal Rac Activation Domain in the Unconventional Guanine Nucleotide Exchange Factor Dock180†

    PubMed Central

    Wu, Xin; Ramachandran, Sekar; Cerione, Richard A.; Erickson, Jon W.


    Guanine nucleotide exchange factors (GEFs) activate Rho GTPases by catalyzing the exchange of bound GDP for GTP, thereby resulting in downstream effector recognition. Two metazoan families of GEFs have been described: Dbl-GEF family members that share conserved Dbl homology (DH) and Pleckstrin homology (PH) domains and the more recently described Dock180 family members that share little sequence homology with the Dbl family and are characterized by conserved Dock homology regions 1 and 2 (DHR-1 and -2). While extensive characterization of the Dbl family has been performed, less is known about how Dock180 family members act as GEFs, with only a single x-ray structure having recently been reported for the Dock9-Cdc42 complex. In order to learn more about the mechanisms used by the founding member of the family, Dock180, to act as a Rac-specific GEF, we set out to identify and characterize its limit functional GEF domain. A C-terminal portion of the DHR-2 domain, composed of approximately 300 residues (designated as Dock180DHR-2c), is shown to be necessary and sufficient for robust Rac-specific GEF activity both in vitro and in vivo. We further show that Dock180DHR-2c binds to Rac in a manner distinct from Rac-GEFs of the Dbl family. Specifically, Ala27 and Trp56 of Rac appear to provide a bipartite binding site for the specific recognition of Dock180DHR-2c, whereas, for Dbl family Rac-GEFs, Trp56 of Rac is the sole primary determinant of GEF specificity. Based on our findings, we are able to define the core of Dock180 responsible for its Rac-GEF activity as well as highlight key recognition sites that distinguish different Dock180 family members and determine their corresponding GTPase specificities. PMID:21033699

  9. Guanine nucleotide binding properties of the mammalian RalA protein produced in Escherichia coli.


    Frech, M; Schlichting, I; Wittinghofer, A; Chardin, P


    The simian ralA cDNA was inserted in a ptac expression vector, and high amounts of soluble ral protein were expressed in Escherichia coli. The purified p24ral contains 1 mol of bound nucleotide/mol of protein that can be exchanged against external nucleotide. The ral protein exchanges GDP with a t 1/2 of 90 min at 37 degrees C in the presence of Mg2+, and has a low GTPase activity (0.07 min-1 at 37 degrees C). We have also studied its affinity for various guanine nucleotides and analogs. NMR measurements show that the three-dimensional environment around the nucleotide is similar in p21ras and p24ral. In addition to these studies on the wild-type ral protein, we used in vitro mutagenesis to introduce substitutions corresponding to the Val12, Val12 + Thr59, and Leu61 substitutions of p21ras. These mutant ral proteins display altered nucleotide exchange kinetics and GTPase activities, however, the effects of the substitutions are less pronounced than in the ras proteins. p24ralVal12 + Thr59 autophosphorylates on the substituted Thr, as a side reaction of the GTP hydrolysis, but the rate is much lower than those of the Thr59 mutants of p21ras. These results show that ras and ral proteins have similar structures and biochemical properties. Significant differences are found, however, in the contribution of the Mg2+ ion to GDP binding, in the rate of the GTPase reaction and in the sensitivity of these two proteins to substitutions around the phosphate-binding site, suggesting that the various "small G-proteins" of the ras family perform different functions.

  10. Pre-thymic somatic mutation leads to high mutant frequency at hypoxanthine-guanine phosphoribosyltransferase gene

    SciTech Connect

    Jett, J.


    While characterizing the background mutation spectrum of the Hypoxathine-guanine phosphoribosyltransferase (HPRT) gene in a healthy population, an outlier with a high mutant frequency of thioguanine resistant lymphocytes was found. When studied at the age of 46, this individual had been smoking 60 cigarettes per day for 38 years. His mutant frequency was calculated at 3.6 and 4.2x10{sup {minus}4} for two sampling periods eight months apart. Sequencing analysis of the HPRT gene in his mutant thioguanine resistant T lymphocytes was done to find whether the cells had a high rate of mutation, or if the mutation was due to a single occurrence of mutation and, if so, when in the T lymphocyte development the mutation occurred. By T-cell receptor analysis it has been found that out of 35 thioguanine resistant clones there was no dominant gamma T cell receptor gene rearrangement. During my appointment in the Science & Engineering Research Semester, I found that 34 of those clones have the same base substitution of G{yields}T at cDNA position 197. Due to the consistent mutant frequency from both sampling periods and the varying T cell receptors, the high mutant frequency cannot be due to recent proliferation of a mature mutant T lymphocyte. From the TCR and DNA sequence analysis we conclude that the G{yields}T mutation must have occurred in a T lymphocyte precursor before thymic differentiation so that the thioguanine resistant clones share the same base substitution but not the same gamma T cell receptor gene.

  11. Vacuum-Ultraviolet photoionization studies of the microhydrationof DNA bases (Guanine, Cytosine, Adenine and Thymine)

    SciTech Connect

    Belau, L.; Wilson, K.R.; Leone, S.R.; Musahid, Ahmed


    In this work, we report on a photoionization study of the microhydration of the four DNA bases. Gas-phase clusters of water with DNA bases [guanine (G), cytosine (C), adenine (A), and thymine (T)] are generated via thermal vaporization of the bases and expansion of the resultant vapor in a continuous supersonic jet expansion of water seeded in Ar. The resulting clusters are investigated by single-photon ionization with tunable vacuum-ultraviolet synchrotron radiation and mass analyzed using reflectron mass spectrometry. Photoionization efficiency (PIE) curves are recorded for the DNA bases and the following water (W) clusters: G, GW{sub n} (n = 1-3); C, CW{sub n} (n = 1-3); A, AW{sub n} (n = 1,2); and T, TW{sub n} (n = 1-3). Appearance energies (AE) are derived from the onset of these PIE curves (all energies in eV): G (8.1 {+-} 0.1), GW (8.0 {+-} 0.1), GW{sub 2} (8.0 {+-} 0.1), and GW{sub 3} (8.0); C (8.65 {+-} 0.05), CW (8.45 {+-} 0.05), CW{sub 2} (8.4 {+-} 0.1), and CW{sub 3} (8.3 {+-} 0.1); A (8.30 {+-} 0.05), AW (8.20 {+-} 0.05), and AW{sub 2} (8.1 {+-} 0.1); T (8.90 {+-} 0.05); and TW (8.75 {+-} 0.05), TW{sub 2} (8.6 {+-} 0.1), and TW{sub 3} (8.6 {+-} 0.1). The AEs of the DNA bases decrease slightly with the addition of water molecules (up to three) but do not converge to values found for photoinduced electron removal from DNA bases in solution.

  12. Deciphering the photochemical mechanisms describing the UV-induced processes occurring in solvated guanine monophosphate

    PubMed Central

    Altavilla, Salvatore F.; Segarra-Martí, Javier; Nenov, Artur; Conti, Irene; Rivalta, Ivan; Garavelli, Marco


    The photophysics and photochemistry of water-solvated guanine monophosphate (GMP) are here characterized by means of a multireference quantum-chemical/molecular mechanics theoretical approach (CASPT2//CASSCF/AMBER) in order to elucidate the main photo-processes occurring upon UV-light irradiation. The effect of the solvent and of the phosphate group on the energetics and structural features of this system are evaluated for the first time employing high-level ab initio methods and thoroughly compared to those in vacuo previously reported in the literature and to the experimental evidence to assess to which extent they influence the photoinduced mechanisms. Solvated electronic excitation energies of solvated GMP at the Franck-Condon (FC) region show a red shift for the ππ* La and Lb states, whereas the energy of the oxygen lone-pair nπ* state is blue-shifted. The main photoinduced decay route is promoted through a ring-puckering motion along the bright lowest-lying La state toward a conical intersection (CI) with the ground state, involving a very shallow stationary point along the minimum energy pathway in contrast to the barrierless profile found in gas-phase, the point being placed at the end of the minimum energy path (MEP) thus endorsing its ultrafast deactivation in accordance with time-resolved transient and photoelectron spectroscopy experiments. The role of the nπ* state in the solvated system is severely diminished as the crossings with the initially populated La state and also with the Lb state are placed too high energetically to partake prominently in the deactivation photo-process. The proposed mechanism present in solvated and in vacuo DNA/RNA chromophores validates the intrinsic photostability mechanism through CI-mediated non-radiative processes accompanying the bright excited-state population toward the ground state and subsequent relaxation back to the FC region. PMID:25941671

  13. Spiroiminodihydantoin lesions derived from guanine oxidation: structures, energetics, and functional implications.


    Jia, Lei; Shafirovich, Vladimir; Shapiro, Robert; Geacintov, Nicholas E; Broyde, Suse


    Reactive oxygen species present in the cell generate DNA damage. One of the major oxidation products of guanine in DNA, 8-oxo-7,8-dihydroguanine, formed by loss of two electrons, is among the most extensively studied base lesions. The further removal of two electrons from this product can yield spiroiminodihydantoin (Sp) R and S stereoisomers. Both in vitro and in vivo experiments have shown that the Sp stereoisomers are highly mutagenic, causing G --> T and G --> C transversions. Hence, they are of interest as examples of endogenous DNA damage that may initiate cancer. To interpret the mutagenic properties of the Sp lesions, an understanding of their structural properties is needed. To elucidate these structural effects, we have carried out computational investigations at the level of the Sp-modified base and nucleoside. At the base level, quantum mechanical geometry optimization studies have revealed exact mirror image symmetry of the R and S stereoisomers, with a near-perpendicular geometry of the two rings. At the nucleoside level, an extensive survey of the potential energy surface by molecular mechanics calculations using AMBER has provided three-dimensional potential energy maps. These maps reveal that the range and flexibility of the glycosidic torsion angles are significantly more restricted in both stereoisomeric adducts than in unmodified 2'-deoxyguanosine. The structural and energetic results suggest that the unusual geometric, steric, and hydrogen bonding properties of these lesions underlie their mutagenicity. In addition, stereoisomer-specific differences indicate the possibility that their processing by cellular replication and repair enzymes may be differentially affected by their absolute configuration.

  14. Elimination and utilization of oxidized guanine nucleotides in the synthesis of RNA and its precursors.


    Sekiguchi, Takeshi; Ito, Riyoko; Hayakawa, Hiroshi; Sekiguchi, Mutsuo


    Reactive oxygen species are produced as side products of oxygen utilization and can lead to the oxidation of nucleic acids and their precursor nucleotides. Among the various oxidized bases, 8-oxo-7,8-dihydroguanine seems to be the most critical during the transfer of genetic information because it can pair with both cytosine and adenine. During the de novo synthesis of guanine nucleotides, GMP is formed first, and it is converted to GDP by guanylate kinase. This enzyme hardly acts on an oxidized form of GMP (8-oxo-GMP) formed by the oxidation of GMP or by the cleavage of 8-oxo-GDP and 8-oxo-GTP by MutT protein. Although the formation of 8-oxo-GDP from 8-oxo-GMP is thus prevented, 8-oxo-GDP itself may be produced by the oxidation of GDP by reactive oxygen species. The 8-oxo-GDP thus formed can be converted to 8-oxo-GTP because nucleoside-diphosphate kinase and adenylate kinase, both of which catalyze the conversion of GDP to GTP, do not discriminate 8-oxo-GDP from normal GDP. The 8-oxo-GTP produced in this way and by the oxidation of GTP can be used for RNA synthesis. This misincorporation is prevented by MutT protein, which has the potential to cleave 8-oxo-GTP as well as 8-oxo-GDP to 8-oxo-GMP. When (14)C-labeled 8-oxo-GTP was applied to CaCl2-permeabilized cells of a mutT(-) mutant strain, it could be incorporated into RNA at 4% of the rate for GTP. Escherichia coli cells appear to possess mechanisms to prevent misincorporation of 8-oxo-7,8-dihydroguanine into RNA.

  15. Activation of Ras in vitro and in intact fibroblasts by the Vav guanine nucleotide exchange protein.

    PubMed Central

    Gulbins, E; Coggeshall, K M; Langlet, C; Baier, G; Bonnefoy-Berard, N; Burn, P; Wittinghofer, A; Katzav, S; Altman, A


    We recently identified Vav, the product of the vav proto-oncogene, as a guanine nucleotide exchange factor (GEF) for Ras. Vav is enzymatically activated by lymphocyte antigen receptor-coupled protein tyrosine kinases or independently by diglycerides. To further evaluate the physiological role of Vav, we assessed its GDP-GTP exchange activity against several Ras-related proteins in vitro and determined whether Vav activation in transfected NIH 3T3 fibroblasts correlates with the activity status of Ras and mitogen-activated protein (MAP) kinases. In vitro translated purified Vav activated by phorbol myristate acetate (PMA) or phosphorylation with recombinant p56lck displayed GEF activity against Ras but not against recombinant RacI, RacII, Ral, or RhoA proteins. Expression of vav or proto-vav in stably transfected NIH 3T3 cells led to a approximately 10-fold increase in basal or PMA-stimulated Ras exchange activity, respectively, in total-cell lysates and Vav immunoprecipitates. Elevated GEF activity was paralleled in each case by a significant increase in the proportion of active, GTP-bound Ras. PMA had a minimal effect on the low Ras. GTP level in untransfected control fibroblasts but increased it from 20 to 37% in proto-vav-transfected cells. vav-transfected cells displayed a constitutively elevated Ras. GTP level (35%), which was not increased further by PMA treatment. MAP kinases, known downstream intermediates in Ras-dependent signaling pathways, similarly exhibited increased basal or PMA-stimulated activity in Vav-expressing cells by comparison with normal NIH 3T3 cells. These results demonstrate a physiologic interaction between Vav and its target, Ras, leading to MAP kinase activation. Images PMID:8289830

  16. Double proton transfer in the isolated and DNA-embedded guanine-cytosine base pair

    NASA Astrophysics Data System (ADS)

    Zoete, Vincent; Meuwly, Markus


    The energetics and dynamics of double proton transfer (DPT) is investigated theoretically for the Watson-Crick conformation of the guanine-cytosine (GC) base pair. Using semiempirical density functional theory the isolated and DNA-embedded GC pair is considered. Differences in the energetics and dynamics of DPT thus addresses the question of how relevant studies of isolated base pairs are for the understanding of processes occurring in DNA. Two-dimensional potential energy surfaces involving the transferring hydrogen atoms and the proton donors and acceptors are presented for both systems. The DPT reaction is accompanied by a contraction of the distance between the two bases with virtually identical energetic barriers being 18.8 and 18.7 kcal/mol for the isolated and DNA-embedded system, respectively. However, the transition state for DPT in the DNA-embedded GC pair is offset by 0.1 Å to larger N-H separation compared to the isolated GC pair. Using activated ab initio molecular dynamics, DPT is readily observed for the isolated base pair with a minimal amount of 21.4 kcal/mol of initial average kinetic energy along the DPT normal mode vector. On a time scale of ≈100 fs DPT has occurred and the excess energy is redistributed. For the DNA-embedded GC pair considerably more kinetic energy is required (30.0 kcal/mol) for DPT and the process is completed within one hydrogen vibration. The relevance of studies of isolated base pairs and base pair analogs in regard of reactions or properties involving DNA is discussed.

  17. Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.


    Crenshaw, Ezekiel; Leung, Brian P; Kwok, Chun Kit; Sharoni, Michal; Olson, Kalee; Sebastian, Neeraj P; Ansaloni, Sara; Schweitzer-Stenner, Reinhard; Akins, Michael R; Bevilacqua, Philip C; Saunders, Aleister J


    A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ) peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP). APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes), non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region) at residues 3008-3027 (NM_201414.2). This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.

  18. The atypical Guanine-nucleotide exchange factor, dock7, negatively regulates schwann cell differentiation and myelination.


    Yamauchi, Junji; Miyamoto, Yuki; Hamasaki, Hajime; Sanbe, Atsushi; Kusakawa, Shinji; Nakamura, Akane; Tsumura, Hideki; Maeda, Masahiro; Nemoto, Noriko; Kawahara, Katsumasa; Torii, Tomohiro; Tanoue, Akito


    In development of the peripheral nervous system, Schwann cells proliferate, migrate, and ultimately differentiate to form myelin sheath. In all of the myelination stages, Schwann cells continuously undergo morphological changes; however, little is known about their underlying molecular mechanisms. We previously cloned the dock7 gene encoding the atypical Rho family guanine-nucleotide exchange factor (GEF) and reported the positive role of Dock7, the target Rho GTPases Rac/Cdc42, and the downstream c-Jun N-terminal kinase in Schwann cell migration (Yamauchi et al., 2008). We investigated the role of Dock7 in Schwann cell differentiation and myelination. Knockdown of Dock7 by the specific small interfering (si)RNA in primary Schwann cells promotes dibutyryl cAMP-induced morphological differentiation, indicating the negative role of Dock7 in Schwann cell differentiation. It also results in a shorter duration of activation of Rac/Cdc42 and JNK, which is the negative regulator of myelination, and the earlier activation of Rho and Rho-kinase, which is the positive regulator of myelination. To obtain the in vivo evidence, we generated Dock7 short hairpin (sh)RNA transgenic mice. They exhibited a decreased expression of Dock7 in the sciatic nerves and enhanced myelin thickness, consistent with in vitro observation. The effects of the in vivo knockdown on the signals to Rho GTPases are similar to those of the in vitro knockdown. Collectively, the signaling through Dock7 negatively regulates Schwann cell differentiation and the onset of myelination, demonstrating the unexpected role of Dock7 in the interplay between Schwann cell migration and myelination.

  19. Guanine nucleotide induced conformational change of Cdc42 revealed by hydrogen/deuterium exchange mass spectrometry.


    Yang, Sheng-Wei; Ting, Hsiu-Chi; Lo, Yi-Ting; Wu, Ting-Yuan; Huang, Hung-Wei; Yang, Chia-Jung; Chan, Jui-Fen Riva; Chuang, Min-Chieh; Hsu, Yuan-Hao Howard


    Cdc42 regulates pathways related to cell division. Dysregulation of Cdc42 can lead to cancer, cardiovascular diseases and neurodegenerative diseases. GTP induced activation mechanism plays an important role in the activity and biological functions of Cdc42. P-loop, Switch I and Switch II are critical regions modulating the enzymatic activity of Cdc42. We applied amide hydrogen/deuterium exchange coupled with liquid chromatography mass spectrometry (HDXMS) to investigate the dynamic changes of apo-Cdc42 after GDP, GTP and GMP-PCP binding. The natural substrate GTP induced significant decreases of deuteration in P-loop and Switch II, moderate changes of deuteration in Switch I and significant changes of deuteration in the α7 helix, a region far away from the active site. GTP binding induced similar effects on H/D exchange to its non-hydrolysable analog, GMP-PCP. HDXMS results indicate that GTP binding blocked the solvent accessibility in the active site leading to the decrease of H/D exchange rate surrounding the active site, and further triggered a conformational change resulting in the drastic decrease of H/D exchange rate at the remote α7 helix. Comparing the deuteration levels in three activation states of apo-Cdc42, Cdc42-GDP and Cdc42-GMP-PCP, the apo-Cdc42 has the most flexible structure, which can be stabilized by guanine nucleotide binding. The rates of H/D exchange of Cdc42-GDP are between the GMP-PCP-bound and the apo form, but more closely to the GMP-PCP-bound form. Our results show that the activation of Cdc42 is a process of conformational changes involved with P-loop, Switch II and α7 helix for structural stabilization.

  20. Guanine nucleotide-binding protein regulation of melatonin receptors in lizard brain

    SciTech Connect

    Rivkees, S.A.; Carlson, L.L.; Reppert, S.M. )


    Melatonin receptors were identified and characterized in crude membrane preparations from lizard brain by using {sup 125}I-labeled melatonin ({sup 125}I-Mel), a potent melatonin agonist. {sup 125}I-Mel binding sites were saturable; Scatchard analysis revealed high-affinity and lower affinity binding sites, with apparent K{sub d} of 2.3 {plus minus} 1.0 {times} 10{sup {minus}11} M and 2.06 {plus minus} 0.43 {times} 10{sup {minus}10} M, respectively. Binding was reversible and inhibited by melatonin and closely related analogs but not by serotonin or norepinephrine. Treatment of crude membranes with the nonhydrolyzable GTP analog guanosine 5{prime}-({gamma}-thio)triphosphate (GTP({gamma}S)), significantly reduced the number of high-affinity receptors and increased the dissociation rate of {sup 125}I-Mel from its receptor. Furthermore, GTP({gamma}S) treatment of ligand-receptor complexes solubilized by Triton X-100 also led to a rapid dissociation of {sup 125}I-Mel from solubilized ligand-receptor complexes. Gel filtration chromatography of solubilized ligand-receptor complexes revealed two major peaks of radioactivity corresponding to M{sub r} > 400,000 and M{sub r} ca. 110,000. This elution profile was markedly altered by pretreatment with GTP({gamma}S) before solubilization; only the M{sub r} 110,000 peak was present in GTP({gamma}S)-pretreated membranes. The results strongly suggest that {sup 125}I-mel binding sites in lizard brain are melatonin receptors, with agonist-promoted guanine nucleotide-binding protein (G protein) coupling and that the apparent molecular size of receptors uncoupled from G proteins is about 110,000.

  1. Deciphering the photochemical mechanisms describing the UV-induced processes occurring in solvated guanine monophosphate

    NASA Astrophysics Data System (ADS)

    Altavilla, Salvatore; Segarra-Martí, Javier; Nenov, Artur; Conti, Irene; Rivalta, Ivan; Garavelli, Marco


    The photophysics and photochemistry of water-solvated guanine monophosphate (GMP) are here characterized by means of a multireference quantum-chemical/molecular mechanics theoretical approach (CASPT2//CASSCF/AMBER) in order to elucidate the main photo-processes occurring upon UV-light irradiation. The effect of the solvent and of the phosphate group on the energetics and structural features of this system are evaluated for the first time employing high-level ab initio methods and thoroughly compared to those in vacuo previously reported in the literature and to the experimental evidence to assess to which extent they influence the photoinduced mechanisms. Solvated electronic excitation energies of solvated GMP at the Franck-Condon (FC) region show a red shift for the ππ* La and Lb states, whereas the energy of the oxygen lone-pair nπ* state is blue-shifted. The main photoinduced decay route is promoted through a ring-puckering motion along the bright lowest-lying La state towards a conical intersection (CI) with the ground state, involving a very shallow stationary point along the minimum energy pathway in contrast to the barrierless profile found in gas-phase, the point being placed at the end of the minimum energy path (MEP) thus endorsing its ultrafast deactivation in accordance with time-resolved transient and photoelectron spectroscopy experiments. The role of the nπ* state in the solvated system is severely diminished as the crossings with the initially populated La state and also with the Lb state are placed too high energetically to partake prominently in the deactivation photo-process. The proposed mechanism present in solvated and in vacuo DNA/RNA chromophores validates the intrinsic photostability mechanism through CI-mediated non-radiative processes accompanying the bright excited-state population towards the ground state and subsequent relaxation back to the FC region.

  2. Assessment of roles for the Rho-specific guanine nucleotide dissociation inhibitor (RhoGDI) Ly-GDI in platelet function: a spatial systems approach.


    Ngo, Anh T P; Thierheimer, Marisa L D; Babur, Özgün; Rocheleau, Anne D; Huang, Tao; Pang, Jiaqing; Rigg, Rachel A; Mitrugno, Annachiara; Theodorescu, Dan; Burchard, Julja; Nan, Xiaolin; Demir, Emek; McCarty, Owen J T; Aslan, Joseph E


    Upon activation at sites of vascular injury, platelets undergo morphological alterations essential to hemostasis via cytoskeletal reorganizations driven by the Rho GTPases Rac1, Cdc42 and RhoA. Here we investigate roles for Rho-specific guanine nucleotide dissociation inhibitor proteins (RhoGDIs) in platelet function. We find that platelets express two RhoGDI family members, RhoGDI and Ly-GDI. While RhoGDI localizes throughout platelets in a granule-like manner, Ly-GDI shows an asymmetric, polarized localization that largely overlaps with Rac1 and Cdc42 as well as microtubules and protein kinase C (PKC) in platelets adherent to fibrinogen. Antibody interference and platelet spreading experiments suggest a specific role for Ly-GDI in platelet function. Intracellular signaling studies based on interactome and pathways analyses also support a regulatory role for Ly-GDI, which is phosphorylated at PKC substrate motifs in a PKC-dependent manner in response to the platelet collagen receptor glycoprotein (GP)VI-specific agonist collagen-related peptide. Additionally, PKC inhibition diffuses the polarized organization of Ly-GDI in spread platelets relative to its colocalization with Rac1 and Cdc42. Together our results suggest a role for Ly-GDI in the localized regulation of Rho GTPases in platelets and hypothesize a link between the PKC and Rho GTPase signaling systems in platelet function.

  3. Quantification of 8-oxo-guanine and guanine as the nucleobase, nucleoside and deoxynucleoside forms in human urine by high-performance liquid chromatography-electrospray tandem mass spectrometry.


    Weimann, Allan; Belling, Dorthe; Poulsen, Henrik E


    Oxidative DNA damage, linked pathogenically to a variety of diseases such as cancer and ageing, can be investigated by measuring specific DNA repair products in urine. Within the last decade, since it was established that such products were excreted into urine, progress in their analysis in urine has been limited. Guanine is the DNA base most prone to oxidation. We present a method for determination of the urinary 8-hydroxylated species of guanine, based on direct injection of urine onto a high-performance liquid chromatography (HPLC)-tandem mass spectrometry system. The analysis covers the 8-hydroxylated base, ribonucleoside and deoxynucleoside, and the corresponding non-oxidised species. Without pre-treatment of urine the detection limits for the nucleobases are approximately 2 nM (50 fmol injected) and for the nucleosides approximately 0.5 nM (12.5 fmol injected). Previously, liquid chromatography of the nucleobases has been problematic but is made possible by low-temperature reverse-phase C18 chromatography, a method that increases retention on the column. In the case of the nucleosides, retention was almost total and provides a means for on-column concentration of larger urine samples and controlled high peak gradient elution. The total excretion of 8-hydroxylated guanine species was 212 nmol/24 h. The oxidised base accounted for 64%, the ribonucleoside for 23% and the deoxynucleoside for 13%, indicating substantial oxidation of RNA in humans. In rat urine, excretion of the oxidised base was more dominant, the percentages of the oxidised base, ribonucleoside and deoxynucleosides being 89, 8 and 3%. This finding is at odds with previous reports using immunoaffinity pre-purification and HPLC-electrochemical detection analysis. The developed method now makes it possible to measure oxidative nucleic acid stress to both RNA and DNA in epidemiological and intervention settings, and our findings indicate a substantial RNA oxidation in addition to DNA oxidation. The

  4. Induction of unique structural changes in guanine-rich DNA regions by the triazoloacridone C-1305, a topoisomerase II inhibitor with antitumor activities

    PubMed Central

    Lemke, Krzysztof; Wojciechowski, Marcin; Laine, William; Bailly, Christian; Colson, Pierre; Baginski, Maciej; Larsen, Annette K.; Skladanowski, Andrzej


    We recently reported that the antitumor triazoloacridone, compound C-1305, is a topoisomerase II poison with unusual properties. In this study we characterize the DNA interactions of C-1305 in vitro, in comparison with other topoisomerase II inhibitors. Our results show that C-1305 binds to DNA by intercalation and possesses higher affinity for GC- than AT-DNA as revealed by surface plasmon resonance studies. Chemical probing with DEPC indicated that C-1305 induces structural perturbations in DNA regions with three adjacent guanine residues. Importantly, this effect was highly specific for C-1305 since none of the other 22 DNA interacting drugs tested was able to induce similar structural changes in DNA. Compound C-1305 induced stronger structural changes in guanine triplets at higher pH which suggested that protonation/deprotonation of the drug is important for this drug-specific effect. Molecular modeling analysis predicts that the zwitterionic form of C-1305 intercalates within the guanine triplet, resulting in widening of both DNA grooves and aligning of the triazole ring with the N7 atoms of guanines. Our results show that C-1305 binds to DNA and induces very specific and unusual structural changes in guanine triplets which likely plays an important role in the cytotoxic and antitumor activity of this unique compound. PMID:16254080

  5. The role of topoisomerase I in suppressing genome instability associated with a highly transcribed guanine-rich sequence is not restricted to preventing RNA:DNA hybrid accumulation.


    Yadav, Puja; Owiti, Norah; Kim, Nayun


    Highly transcribed guanine-run containing sequences, in Saccharomyces cerevisiae, become unstable when topoisomerase I (Top1) is disrupted. Topological changes, such as the formation of extended RNA:DNA hybrids or R-loops or non-canonical DNA structures including G-quadruplexes has been proposed as the major underlying cause of the transcription-linked genome instability. Here, we report that R-loop accumulation at a guanine-rich sequence, which is capable of assembling into the four-stranded G4 DNA structure, is dependent on the level and the orientation of transcription. In the absence of Top1 or RNase Hs, R-loops accumulated to substantially higher extent when guanine-runs were located on the non-transcribed strand. This coincides with the orientation where higher genome instability was observed. However, we further report that there are significant differences between the disruption of RNase Hs and Top1 in regards to the orientation-specific elevation in genome instability at the guanine-rich sequence. Additionally, genome instability in Top1-deficient yeasts is not completely suppressed by removal of negative supercoils and further aggravated by expression of mutant Top1. Together, our data provide a strong support for a function of Top1 in suppressing genome instability at the guanine-run containing sequence that goes beyond preventing the transcription-associated RNA:DNA hybrid formation.

  6. Effect of x irradiation on the capacity of transfer RNA to act as substrate for guanine-tRNA transferase

    SciTech Connect

    Walden, T.; Farkas, W.R.


    Observation on the guanine-accepting ability of x-irradiated wheat germ tRNA shows 50% inactivation at 57,000 rad with an unusual sawtooth pattern at low doses. The sawtooth has peaks at 1330 and 3300 rad and can be modified by bovine serum albumin. RPC-5 profiles of guanylated irradiated and unirradiated tRNA are identical, indicating that irradiation does not result in abnormal tRNA species, that ordinarily are not substrates for this enzyme, becoming substrates.

  7. The electrochemical reduction of the purines guanine and adenine at platinum electrodes in several room temperature ionic liquids.


    Zanoni, Maria Valnice Boldrin; Rogers, Emma I; Hardacre, Christopher; Compton, Richard G


    The reduction of guanine was studied by microelectrode voltammetry in the room temperature ionic liquids (RTILs) N-hexyltriethylammonium bis (trifluoromethanesulfonyl) imide [N(6,2,2,2)][N(Tf)(2)], 1-butyl-3-methylimidazolium hexafluorosphosphate [C(4)mim][PF(6)], N-butyl-N-methyl-pyrrolidinium bis(trifluoromethanesulfonyl)imide [C(4)mpyrr][N(Tf)(2)], 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide [C(4)mim][N(Tf)(2)], N-butyl-N-methyl-pyrrolidinium dicyanamide [C(4)mpyrr][N(NC)(2)] and tris(P-hexyl)-tetradecylphosphonium trifluorotris(pentafluoroethyl)phosphate [P(14,6,6,6)][FAP] on a platinum microelectrode. In [N(6,2,2,2)][NTf(2)] and [P(14,6,6,6)][FAP], but not in the other ionic liquids studied, guanine reduction involves a one-electron, diffusion-controlled process at very negative potential to produce an unstable radical anion, which is thought to undergo a dimerization reaction, probably after proton abstraction from the cation of the ionic liquid. The rate of this subsequent reaction depends on the nature of the ionic liquid, and it is faster in the ionic liquid [P(14,6,6,6)][FAP], in which the formation of the resulting dimer can be voltammetrically monitored at less negative potentials than required for the reduction of the parent molecule. Adenine showed similar behaviour to guanine but the pyrimidines thymine and cytosine did not; thymine was not reduced at potentials less negative than required for solvent (RTIL) decomposition while only a poorly defined wave was seen for cytosine. The possibility for proton abstraction from the cation in [N(6,2,2,2)][NTf(2)] and [P(14,6,6,6)][FAP] is noted and this is thought to aid the electrochemical dimerization process. The resulting rapid reaction is thought to shift the reduction potentials for guanine and adenine to lower values than observed in RTILs where the scope for proton abstraction is not present. Such shifts are characteristic of so-called EC processes where reversible electron transfer

  8. Combined Monte Carlo and quantum mechanics study of the hydration of the guanine-cytosine base pair.


    Coutinho, Kaline; Ludwig, Valdemir; Canuto, Sylvio


    We present a computer simulation study of the hydration of the guanine-cytosine (GC) hydrogen-bonded complex. Using first principles density-functional theory, with gradient-corrected exchange-correlation and Monte Carlo simulation, we include thermal contribution, structural effects, solvent polarization, and the water-water and water-GC hydrogen bond interaction to show that the GC interaction in an aqueous environment is weakened to about 70% of the value obtained for an isolated complex. We also analyze in detail the preferred hydration sites of the GC pair and show that on the average it makes around five hydrogen bonds with water.

  9. The Rho guanine nucleotide exchange factor ARHGEF5 promotes tumor malignancy via epithelial–mesenchymal transition

    PubMed Central

    Komiya, Y; Onodera, Y; Kuroiwa, M; Nomimura, S; Kubo, Y; Nam, J-M; Kajiwara, K; Nada, S; Oneyama, C; Sabe, H; Okada, M


    Epithelial tumor cells often acquire malignant properties, such as invasion/metastasis and uncontrolled cell growth, by undergoing epithelial–mesenchymal transition (EMT). However, the mechanisms by which EMT contributes to malignant progression remain elusive. Here we show that the Rho guanine nucleotide exchange factor (GEF) ARHGEF5 promotes tumor malignancy in a manner dependent on EMT status. We previously identified ARHGEF5, a member of the Dbl family of GEFs, as a multifunctional mediator of Src-induced cell invasion and tumor growth. In the present study, ARHGEF5 was upregulated during tumor growth factor-β-induced EMT in human epithelial MCF10A cells, and promoted cell migration by activating the Rho-ROCK pathway. ARHGEF5 was necessary for the invasive and in vivo metastatic activity of human colorectal cancer HCT116 cells. These findings underscore the crucial role of ARHGEF5 in cell migration and invasion/metastasis. An in vivo tumorigenesis assay revealed that ARHGEF5 had the potential to promote tumor growth via the phosphatidylinositol 3-kinase (PI3K) pathway. However, ARHGEF5 was not required for tumor growth in epithelial-like human colorectal cancer HCT116 and HT29 cells, whereas the growth of mesenchymal-like SW480 and SW620 cells depended on ARHGEF5. Induction of EMT by tumor necrosis factor-α or Slug in HCT116 cells resulted in the dependence of tumor growth on ARHGEF5. In these mesenchymal-like cells, Akt was activated via ARHGEF5 and its activity was required for tumor growth. Analysis of a transcriptome data set revealed that the combination of ARHGEF5 upregulation and E-cadherin downregulation or Snail upregulation was significantly correlated with poor prognosis in patients with colorectal cancers. Taken together, our findings suggest that EMT-induced ARHGEF5 activation contributes to the progression of tumor malignancy. ARHGEF5 may serve as a potential therapeutic target in a subset of malignant tumors that have undergone EMT. PMID

  10. Genetic interactions in yeast between Ypt GTPases and Arf guanine nucleotide exchangers.

    PubMed Central

    Jones, S; Jedd, G; Kahn, R A; Franzusoff, A; Bartolini, F; Segev, N


    Two families of GTPases, Arfs and Ypt/rabs, are key regulators of vesicular transport. While Arf proteins are implicated in vesicle budding from the donor compartment, Ypt/rab proteins are involved in the targeting of vesicles to the acceptor compartment. Recently, we have shown a role for Ypt31/32p in exit from the yeast trans-Golgi, suggesting a possible function for Ypt/rab proteins in vesicle budding as well. Here we report the identification of a new member of the Sec7-domain family, SYT1, as a high-copy suppressor of a ypt31/32 mutation. Several proteins that belong to the Sec7-domain family, including the yeast Gea1p, have recently been shown to stimulate nucleotide exchange by Arf GTPases. Nucleotide exchange by Arf GTPases, the switch from the GDP- to the GTP-bound form, is thought to be crucial for their function. Sec7p itself has an important role in the yeast secretory pathway. However, its mechanism of action is not yet understood. We show that all members of the Sec7-domain family exhibit distinct genetic interactions with the YPT genes. Biochemical assays demonstrate that, although the homology between the members of the Sec7-domain family is relatively low (20-35%) and limited to a small domain, they all can act as guanine nucleotide exchange factors (GEFs) for Arf proteins, but not for Ypt GTPases. The Sec7-domain of Sec7p is sufficient for this activity. Interestingly, the Sec7 domain activity is inhibited by brefeldin A (BFA), a fungal metabolite that inhibits some of the Arf-GEFs, indicating that this domain is a target for BFA. These results demonstrate that the ability to act as Arf-GEFs is a general property of all Sec7-domain proteins in yeast. The genetic interactions observed between Arf GEFs and Ypt GTPases suggest the existence of a Ypt-Arf GTPase cascade in the secretory pathway. PMID:10430582

  11. Proton transfer in guanine-cytosine radical anion embedded in B-form DNA.


    Chen, Hsing-Yin; Kao, Chai-Lin; Hsu, Sodio C N


    The electron-attachment-induced proton transfer in the guanine-cytosine (G:C) base pair is thought to be relevant to the issues of charge transport and radiation damage in DNA. However, our understanding on the reaction mainly comes from the data of isolated bases and base pairs, and the behavior of the reaction in the DNA duplex is not clear. In the present study, the proton-transfer reaction in reduced G:C stacks is investigated by quantum mechanical calculations with the aim to clarify how each environmental factor affects the proton transfer in G:C(*-). The calculations show that while the proton transfer in isolated G:C(*-) is exothermic with a small energetic barrier, it becomes endothermic with a considerably enhanced energetic barrier in G:C stacks. The substantial effect of G:C stacking is proved to originate from the electrostatic interactions between the dipole moments of outer G:C base pairs and the middle G:C(*-) base-pair radical anion; the extent of charge delocalization is very small and plays little role in affecting the proton transfer in G:C(*-). On the basis of the electrostatic model, the sequence dependence of the proton transfer in the ionized G:C base pair is predicted. In addition, the water molecules in the first hydration shell around G:C(*-) display a pronounced effect that facilitates the proton-transfer reaction; further consideration of bulk hydration only slightly lowers the energetic barrier and reaction energy. We also notice that the water arrangement around an embedded G:C(*-) is different from that around an isolated G:C(*-), which could result in a very different solvent effect on the energetics of the proton transfer. In contrast to the important influences of base stacking and hydration, the effects of sugar-phosphate backbone and counterions are found to be minor. Our calculations also reveal that a G:C base pair embedded in DNA is capable of accommodating two excess electrons only in bulk hydration; the resultant G(N1-H

  12. Simultaneous protection of organic p- and n-channels in complementary inverter from aging and bias-stress by DNA-base guanine/Al2O3 double layer.


    Lee, Junyeong; Hwang, Hyuncheol; Min, Sung-Wook; Shin, Jae Min; Kim, Jin Sung; Jeon, Pyo Jin; Lee, Hee Sung; Im, Seongil


    Although organic field-effect transistors (OFETs) have various advantages of lightweight, low-cost, mechanical flexibility, and nowadays even higher mobility than amorphous Si-based FET, stability issue under bias and ambient condition critically hinder its practical application. One of the most detrimental effects on organic layer comes from penetrated atmospheric species such as oxygen and water. To solve such degradation problems, several molecular engineering tactics are introduced: forming a kinetic barrier, lowering the level of molecule orbitals, and increasing the band gap. However, direct passivation of organic channels, the most promising strategy, has not been reported as often as other methods. Here, we resolved the ambient stability issues of p-type (heptazole)/or n-type (PTCDI-C13) OFETs and their bias-stability issues at once, using DNA-base small molecule guanine (C5H5N5O)/Al2O3 bilayer. The guanine protects the organic channels as buffer/and H getter layer between the channels and capping Al2O3, whereas the oxide capping resists ambient molecules. As a result, both p-type and n-type OFETs are simultaneously protected from gate-bias stress and 30 days-long ambient aging, finally demonstrating a highly stable, high-gain complementary-type logic inverter.

  13. Selective amplification of an mRNA and related pseudogene for a human ADP-ribosylation factor, a guanine nucleotide-dependent protein activator of cholera toxin

    SciTech Connect

    Monaco, L.; Murtagh, J.J.; Newman, K.B.; Tsai, Su-Chen; Moss, J.; Vaughan, M. )


    ADP-ribosylation factors (ARFs) are {approx}20-kDa proteins that act as GTP-dependent allosteric activators of cholera toxin. With deoxyinosine-containing degenerate oligonucleotide primers corresponding to conserved GTP-binding domains in ARFs, the polymerase chain reaction (PCR) was used to amplify simultaneously from human DNA portions of three ARF genes that include codons for 102 amino acids, with intervening sequences. Amplification products that differed in size because of differences in intron sizes were separated by agarose gel electrophoresis. One amplified DNA contained no introns and had a sequence different from those of known AFRs. Based on this sequence, selective oligonucleotide probes were prepared and used to isolate clone {Psi}ARF 4, a putative ARF pseudogene, from a human genomic library in {lambda} phage EMBL3. Reverse transcription-PCR was then used to clone from human poly(A){sup +} RNA the cDNA corresponding to the expressed homolog of {Psi}ARF 4, referred to as human ARF 4. It appears that {Psi}ARF 4 arose during human evolution by integration of processed ARF 4 mRNA into the genome. Human ARF 4 differs from previously identified mammalian ARFs 1, 2, and 3. Hybridization of ARF 4-specific oligonucleotide probes with human, bovine, and rat RNA revealed a single 1.8-kilobase mRNA, which was clearly distinguished from the 1.9-kilobase mRNA for ARF 1 in these tissues. The PCR provides a powerful tool for investigating diversity in this and other multigene families, especially with primers targeted at domains believed to have functional significance.

  14. Nature of guanine oxidation in RNA via the flash-quench technique versus direct oxidation by a metal oxo complex

    PubMed Central

    Holcomb, Dana R.; Ropp, Patricia A.; Theil, Elizabeth C.; Thorp, H. Holden


    Oxidation of RNA can be effected by two different techniques: a photochemical, electron-transfer method termed “flash-quench” and direct oxidation by metal oxo complexes. The flash-quench method produces selective oxidation using a metal photosensitizer, tris(bipyridyl)ruthenium(III) trichloride (Ru(bpy)33+), and quencher, pentaamminechlorocobalt(III) chloride (Co(NH3)5Cl2+). We have optimized the flash-quench technique for the following RNAs: tRNAPhe, human ferritin iron-responsive element (IRE), and a mutated human ferritin IRE. We have also employed a chemical footprinting technique involving the oxoruthenium(IV) complex (Ru(tpy)(bpy)O2+ (tpy = 2,2′,2″-terpyridine; bpy = 2,2′-bipyridine)) to oxidize guanine. Comparison of the two methods shows that the flash-quench technique provides a visualization of nucleotide accessibility for a static conformation of RNA while the Ru(tpy)(bpy)O2+ complex selectively oxidizes labile guanines and gives a visualization of a composite of multiple conformations of the RNA structure. PMID:20038124

  15. Higher order structural effects stabilizing the reverse Watson-Crick Guanine-Cytosine base pair in functional RNAs.


    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi


    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch.

  16. Mutagenic effects induced by the attack of NO2 radical to the guanine-cytosine base pair

    PubMed Central

    Cerón-Carrasco, José P.; Requena, Alberto; Zúñiga, José; Jacquemin, Denis


    We investigate the attack of the nitrogen dioxide radical (NO•2) to the guanine—cytosine (GC) base pair and the subsequent tautomeric reactions able to induce mutations, by means of density functional theory (DFT) calculations. The conducted simulations allow us to identify the most reactive sites of the GC base pair. Indeed, the computed relative energies demonstrate that the addition of the NO•2 radical to the C8 position of the guanine base forms to the most stable adduct. Although the initial adducts might evolve to non-canonical structures via inter-base hydrogen bonds rearrangements, the probability for the proton exchange to occur lies in the same range as that observed for undamaged DNA. As a result, tautomeric errors in NO2-attacked DNA arises at the same rate as in canonical DNA, with no macroscopic impact on the overall stability of DNA. The potential mutagenic effects of the GC–NO•2 radical adducts likely involve side reactions, e.g., the GC deprotonation to the solvent, rather than proton exchange between guanine and cytosine basis. PMID:25798437

  17. ERK1/2 phosphorylate GEF-H1 to enhance its guanine nucleotide exchange activity toward RhoA

    SciTech Connect

    Fujishiro, Shuh-hei; Tanimura, Susumu; Mure, Shogo; Kashimoto, Yuji; Watanabe, Kazushi; Kohno, Michiaki


    Rho GTPases play an essential role in the regulation of many cellular processes. Although various guanine nucleotide exchange factors (GEFs) are involved in the activation of Rho GTPases, the precise mechanism regulating such activity remains unclear. We have examined whether ERK1/2 are involved in the phosphorylation of GEF-H1, a GEF toward RhoA, to modulate its activity. Expression of GEF-H1 in HT1080 cells with constitutive ERK1/2 activation induced its phosphorylation at Thr{sup 678}, which was totally abolished by treating the cells with PD184352, an ERK pathway inhibitor. Stimulation of HeLa S3 cells with 12-O-tetradecanoyl-phorbol-13-acetate induced the phosphorylation of GEF-H1 in an ERK-dependent manner. ERK1/2-mediated Thr{sup 678}-phosphorylation enhanced the guanine nucleotide exchange activity of GEF-H1 toward RhoA. These results suggest that the ERK pathway, by enhancing the GEF-H1 activity, contributes to the activation of RhoA to regulate the actin assembly, a necessary event for the induction of cellular responses including proliferation and motility.

  18. Quadruplexes of human telomere dG{sub 3}(TTAG{sub 3}){sub 3} sequences containing guanine abasic sites

    SciTech Connect

    Skolakova, Petra; Bednarova, Klara; Vorlickova, Michaela; Sagi, Janos


    Research highlights: {yields} Loss of a guanine base does not hinder the formation of G-quadruplex of human telomere sequence. {yields} Each depurination strongly destabilizes the quadruplex of dG{sub 3}(TTAG{sub 3}){sub 3} in NaCl and KCl. {yields} Conformational change of the abasic analogs of dG{sub 3}(TTAG{sub 3}){sub 3} is inhibited in KCl. {yields} The effects abasic sites may affect telomere-end structures in vivo. -- Abstract: This study was performed to evaluate how the loss of a guanine base affects the structure and stability of the three-tetrad G-quadruplex of 5'-dG{sub 3}(TTAG{sub 3}){sub 3}, the basic quadruplex-forming unit of the human telomere DNA. None of the 12 possible abasic sites hindered the formation of quadruplexes, but all reduced the thermodynamic stability of the parent quadruplex in both NaCl and KCl. The base loss did not change the Na{sup +}-stabilized intramolecular antiparallel architecture, based on CD spectra, but held up the conformational change induced in dG{sub 3}(TTAG{sub 3}){sub 3} in physiological concentration of KCl. The reduced stability and the inhibited conformational transitions observed here in vitro for the first time may predict that unrepaired abasic sites in G-quadruplexes could lead to changes in the chromosome's terminal protection in vivo.

  19. Constructing a novel 8-hydroxy-2'-deoxyguanosine electrochemical sensor and application in evaluating the oxidative damages of DNA and guanine.


    Guo, Zhipan; Liu, Xiuhui; Liu, Yuelin; Wu, Guofan; Lu, Xiaoquan


    8-Hydroxy-2'-deoxyguanosine (8-OHdG) is commonly identified as a biomarker of oxidative DNA damage. In this work, a novel and facile 8-OHdG sensor was developed based on the multi-walled carbon nanotubes (MWCNTs) modified glassy carbon electrode (GCE). It exhibited good electrochemical responses toward the oxidation of 8-OHdG, and the linear ranges were 5.63×10(-8)-6.08×10(-6)M and 6.08×10(-6)-1.64×10(-5)M, with the detection limit of 1.88×10(-8)M (S/N=3). Moreover, the fabricated sensor was applied for the determination of 8-OHdG generated from damaged DNA and guanine, respectively, and the oxidation currents of 8-OHdG increased along with the damaged DNA and guanine within certain concentrations. These results could be used to evaluate the DNA damage, and provide useful information on diagnosing diseases caused by mutation and deficiency of the immunity system.

  20. Role of guanine nucleotide binding protein(s) in vasopressin-induced responses of a vascular smooth muscle cell line

    SciTech Connect

    Nambi, P.; Aiyar, N.; Whitman, M.; Stassen, F.L.; Crooke, S.T.


    Rat aortic smooth muscle cells (A-10) carry vascular V1 vasopressin receptors. In these cells, vasopressin inhibits isoproterenol-induced cAMP accumulation and stimulates phosphatidylinositol turnover and Ca/sup 2 +/ mobilization. Pretreatment of the cells with phorbol esters resulted in inhibition of the vasopressin-induced responses. The inactive phorbol ester aPDD was ineffective. These data suggested that phorbol ester might cause phosphorylation of the vasopressin receptor and/or coupling protein(s). Here, they studied the role of guanine nucleotide binding proteins by employing the novel radiolabeled vasopressin antagonist (/sup 3/H)-SKF 101926. In competition experiments with cell membranes, Gpp(NH)p shifted the vasopressin curve to the right indicating decreased agonist affinity. Phorbol ester pretreatment abolished the Gpp(NH)p effect. Pretreatment of the cells with N-ethylmaleimide (NEM) resulted in inhibition of vasopressin-induced phosphatidyinositol turnover. NEM also abolished the decrease in agonist affinity caused by Gpp(NH)p. These data showed that NEM and phorbol ester pretreatment of smooth muscle cells functionally uncoupled the vasopressin receptors and suggested that vasopressin V1 receptor responses are mediated through guanine nucleotide binding protein(s).

  1. The guanine nucleotide exchange factor Vav3 regulates differentiation of progenitor cells in the developing mouse retina.


    Luft, Veronika; Reinhard, Jacqueline; Shibuya, Masabumi; Fischer, Klaus D; Faissner, Andreas


    The seven main cell types in the mammalian retina arise from multipotent retinal progenitor cells, a process that is tightly regulated by intrinsic and extrinsic signals. However, the molecular mechanisms that control proliferation, differentiation and cell-fate decisions of retinal progenitor cells are not fully understood yet. Here, we report that the guanine nucleotide exchange factor Vav3, a regulator of Rho-GTPases, is involved in retinal development. We demonstrate that Vav3 is expressed in the mouse retina during the embryonic period. In order to study the role of Vav3 in the developing retina, we generate Vav3-deficient mice. The loss of Vav3 results in an accelerated differentiation of retinal ganglion cells and cone photoreceptors during early and late embryonic development. We provide evidence that more retinal progenitor cells express the late progenitor marker Sox9 in Vav3-deficient mice than in wild-types. This premature differentiation is compensated during the postnatal period and late-born cell types such as bipolar cells and Müller glia display normal numbers. Taken together, our data imply that Vav3 is a regulator of retinal progenitor cell differentiation, thus highlighting a novel role for guanine nucleotide exchange factors in retinogenesis.

  2. ARHGEF7 (BETA-PIX) Acts as Guanine Nucleotide Exchange Factor for Leucine-Rich Repeat Kinase 2

    PubMed Central

    Haebig, Karina; Gloeckner, Christian Johannes; Miralles, Marta Garcia; Gillardon, Frank; Schulte, Claudia; Riess, Olaf; Ueffing, Marius; Biskup, Saskia; Bonin, Michael


    Background Mutations within the leucine-rich repeat kinase 2 (LRRK2) gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. Methodology/Principal Findings Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. Conclusions/Significance Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i) a feedback control mechanism for LRRK2 activity as well as (ii) an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis. PMID:21048939

  3. The Role of Aspartic Acid 143 in E. coli tRNA-Guanine Transglycosylase: Insights from Mutagenesis Studies and Computational Modeling

    PubMed Central

    Todorov, Katherine Abold; Tan, Xiao-Jian; Nonekowski, Susanne T.; Garcia, George A.; Carlson, Heather A.


    tRNA guanine transglycosylase (TGT) is a tRNA-modifying enzyme which catalyzes the posttranscriptional exchange of guanine in position 34 of tRNAY,H,N,D with the modified base queuine in eukaryotes or its precursor, preQ1 base, in eubacteria. Thus, TGT must recognize the guanine in tRNA and the free base queuine or preQ1 to catalyze this exchange. The crystal structure of Zymomonas mobilis TGT with preQ1 bound suggests that a key aspartate is critically involved in substrate recognition. To explore this, a series of site-directed mutants of D143 in Escherichia coli TGT were made and characterized to investigate heterocyclic substrate recognition. Our data confirm that D143 has significant impact on KM of guanine; however, the trend in the KM data (D143A < D143N < D143S < D143T) is unexpected. Computational studies were used to further elucidate the interactions between guanine and the D143 mutants. A homology model of E. coli TGT was created, and the role of D143 was investigated by molecular dynamic simulations of guanine bound to the wild-type and D143-mutant TGTs. To validate the model systems against our kinetic data, free energies of binding were fit using the linear interaction energy (LIE) method. This is a unique application of the LIE method because the same ligand is bound to several mutant proteins rather than one protein binding several ligands. The atomic detail gained from the simulations provided a better understanding of the binding affinities of guanine with the mutant TGTs, revealing that water molecules enter the active site and hydrogen bond to the ligand and compensate for lost protein-ligand interactions. The trend of binding affinity for wild-type > D143A > D143N > D143S > D143T appears to be directly related to the degree of hydrogen bonding available to guanine in the binding site. PMID:15951383

  4. Escherichia coli MutY protein has a guanine-DNA glycosylase that acts on 7,8-dihydro-8-oxoguanine:guanine mispair to prevent spontaneous G:C-->C:G transversions.


    Zhang, Q M; Ishikawa, N; Nakahara, T; Yonei, S


    Low rates of spontaneous G:C-->C:G transversions would be achieved not only by the correction of base mismatches during DNA replication but also by the prevention and removal of oxidative base damage in DNA. Escherichia coli must have several pathways to repair such mismatches and DNA modifications. In this study, we attempted to identify mutator loci leading to G:C-->C:G transversions in E.coli. The strain CC103 carrying a specific mutation in lacZ was mutagenized by random miniTn 10 insertion mutagenesis. In this strain, only the G:C-->C:G change can revert the glutamic acid at codon 461, which is essential for sufficient beta-galactosidase activity to allow growth on lactose. Mutator strains were detected as colonies with significantly increased rates of papillae formation on glucose minimal plates containing P-Gal and X-Gal. We screened approximately 40 000 colonies and selected several mutator strains. The strain GC39 showed the highest mutation rate to Lac+. The gene responsible for the mutator phenotypes, mut39 , was mapped at around 67 min on the E.coli chromosome. The sequencing of the miniTn 10 -flanking DNA region revealed that the mut39 was identical to the mutY gene of E.coli. The plasmid carrying the mutY + gene reduced spontaneous G:C-->T:A and G:C-->C:G mutations in both mutY and mut39 strains. Purified MutY protein bound to the oligonucleotides containing 7,8-dihydro-8-oxo-guanine (8-oxoG):G and 8-oxoG:A. Furthermore, we found that the MutY protein had a DNA glycosylase activity which removes unmodified guanine from the 8-oxoG:G mispair. These results demonstrate that the MutY protein prevents the generation of G:C-->C:G transversions by removing guanine from the 8-oxoG:G mispair in E.coli.

  5. The product of the hypB gene, which is required for nickel incorporation into hydrogenases, is a novel guanine nucleotide-binding protein.

    PubMed Central

    Maier, T; Jacobi, A; Sauter, M; Böck, A


    The products of the hyp operon genes are essential for the formation of catalytically active hydrogenases in Escherichia coli. At least one of these auxiliary proteins, HYPB, appears to be involved in nickel liganding to the hydrogenase apoprotein, since mutations in hypB can be phenotypically suppressed by high nickel concentrations in the medium (R. Waugh and D. H. Boxer, Biochimie 68:157-166, 1986). To approach the identification of the specific function of HYPB, we overexpressed the hypB gene and purified and characterized the gene product. HYPB is a homodimer of 31.6-kDa subunits, and it binds guanine nucleotides, with a Kd for GDP of 1.2 microM. The protein displays a low level of GTPase activity, with a kcat of 0.17 min-1. The apparent Km for GTP, as measured in the GTP hydrolysis reaction, was determined to be 4 microM. A chromatography system was established to measure nickel insertion into hydrogenase 3 from E. coli and to determine the effects of lesions in hypB. Nickel appears to be associated only with the processed large subunit of hydrogenase 3 in the wild type, and hypB mutants accumulate the precursor form of this subunit, which is devoid of nickel. The results are discussed in terms of a model in which HYPB is involved in nickel donation to the hydrogenase apoprotein and in which GTP hydrolysis is thought to reverse the interaction between either HYPB or another nickel-binding protein and the hydrogenase apoprotein after the nickel has been released. Images PMID:8423137

  6. Cloning and characterization of mouse UBPy, a deubiquitinating enzyme that interacts with the ras guanine nucleotide exchange factor CDC25(Mm)/Ras-GRF1.


    Gnesutta, N; Ceriani, M; Innocenti, M; Mauri, I; Zippel, R; Sturani, E; Borgonovo, B; Berruti, G; Martegani, E


    We used yeast "two-hybrid" screening to isolate cDNA-encoding proteins interacting with the N-terminal domain of the Ras nucleotide exchange factor CDC25(Mm). Three independent overlapping clones were isolated from a mouse embryo cDNA library. The full-length cDNA was cloned by RACE-polymerase chain reaction. It encodes a large protein (1080 amino acids) highly homologous to the human deubiquitinating enzyme hUBPy and contains a well conserved domain typical of ubiquitin isopeptidases. Therefore we called this new protein mouse UBPy (mUBPy). Northern blot analysis revealed a 4-kilobase mRNA present in several mouse tissues and highly expressed in testis; a good level of expression was also found in brain, where CDC25(Mm) is exclusively expressed. Using a glutathione S-transferase fusion protein, we demonstrated an "in vitro" interaction between mUBPy and the N-terminal half (amino acids 1-625) of CDC25(Mm). In addition "in vivo" interaction was demonstrated after cotransfection in mammalian cells. We also showed that CDC25(Mm), expressed in HEK293 cells, is ubiquitinated and that the coexpression of mUBPy decreases its ubiquitination. In addition the half-life of CDC25Mm protein was considerably increased in the presence of mUBPy. The specific function of the human homolog hUBPy is not defined, although its expression was correlated with cell proliferation. Our results suggest that mUBPy may play a role in controlling degradation of CDC25(Mm), thus regulating the level of this Ras-guanine nucleotide exchange factor.

  7. Mapping the binding site of aflatoxin B/sub 1/ in DNA: systematic analysis of the reactivity of aflatoxin B/sub 1/ with guanines in different DNA sequences

    SciTech Connect

    Benasutti, M.; Ejadi, S.; Whitlow, M.D.; Loechler, E.L.


    The mutagenic and carcinogenic chemical aflatoxin B/sub 1/ (AFB/sub 1/) reacts almost exclusively at the N(7)-position of guanine following activation to its reactive form, the 8,9-epoxide (AFB/sub 1/ oxide). In general N(7)-guanine adducts yield DNA strand breaks when heated in base, a property that serves as the basis for the Maxam-Gilbert DNA sequencing reaction specific for guanine. Using DNA sequencing methods, other workers have shown that AFB/sub 1/ oxide gives strand breaks at positions of guanines; however, the guanine bands varied in intensity. This phenomenon has been used to infer that AFB/sub 1/ oxide prefers to react with guanines in some sequence contexts more than in others and has been referred to as sequence specificity of binding. Herein, data on the reaction of AFB/sub 1/ oxide with several synthetic DNA polymers with different sequences are presented, and (following hydrolysis) adduct levels are determine by high-pressure liquid chromatography. These results reveal that for AFB/sub 1/ oxide (1) the N(7)-guanine adduct is the major adduct found in all of the DNA polymers, (2) adduct levels vary in different sequences, and, thus, sequence specificity is also observed by this more direct method, and (3) the intensity of bands in DNA sequencing gels is likely to reflect adduct levels formed at the N(7)-position of guanine. Knowing this, a reinvestigation of the reactivity of guanines in different DNA sequences using DNA sequencing methods was undertaken. Methods are developed to determine the X (5'-side) base and the Y (3'-side) base are most influential in determining guanine reactivity. These rules in conjunction with molecular modeling studies were used to assess the binding sites that might be utilized by AFB/sub 1/ oxide in its reaction with DNA.

  8. The Shizosaccharomyces pombe homolog (SpMYH) of the Escherichia coli MutY is required for removal of guanine from 8-oxoguanine/guanine mispairs to prevent G:C to C:G transversions.


    Doi, Takashi; Yonekura, Shin-Ichiro; Tano, Keizo; Yasuhira, Shinji; Yonei, Shuji; Zhang, Qiu-Mei


    The frequency of G:C-->C:G transversions significantly increases upon exposure of cells to ionizing radiation or reactive oxygen species. Transversions can be prevented by base excision repair, which removes the causative modified bases from DNA. Our previous studies revealed that MutY is responsible for removing guanine from 7,8-dihydro-8-oxoguanine/guanine mispairs (8-oxoG/G) and prevents the generation of G:C-->C:G transversions in E. coli. SpMYH, a homolog of E. coli MutY, had been identified and characterized in the fission yeast S. pombe. Purified SpMYH has adenine DNA glycosylase activity on A/8-oxoG and A/G mismatch-containing oligonucleotides. In this study, we examined whether SpMYH has a similar activity allowing it to remove G from 8-oxoG/G in DNA. The purified SpMYH tightly bound to duplex oligonucleotides containing 8-oxoG/G and removed the unmodified G from 8-oxoG/G as efficiently as A from 8-oxoG/A. The activity was absent in the cell extract prepared from an SpMYH-knockout strain of S. pombe. The expression of SpMYH markedly reduced the frequency of spontaneous G:C-->C:G transversions in the E. coli mutY mutant. These results demonstrate that SpMYH is involved in the repair of 8-oxoG/G, by which it prevents mutations induced by oxidative stress in S. pombe.

  9. Metal-organic frameworks and β-cyclodextrin-based composite electrode for simultaneous quantification of guanine and adenine in a lab-on-valve manifold.


    Wang, Yang; Chen, Huanhuan; Wu, Yichun; Ge, Huali; Ye, Guiqin; Hu, Xiaoya


    In this work, a novel chemically modified electrode is constructed based on metal-organic frameworks and β-cyclodextrin (Cu3(BTC)2/β-CD, BTC = benzene-1,3,5-tricarboxylate) composite material. The electrode was used for simultaneous determination of guanine and adenine in a sequential injection lab-on-valve format and exhibited sensitive responses to guanine and adenine oxidation due to the π-π stacking interaction of Cu3(BTC)2 and the inclusion behavior of β-CD. The analytical performance was assessed with respect to the supporting electrolyte and its pH, accumulation time and accumulation potential, and the fluid flow rates. Under optimal conditions, linear calibration ranges for both guanine and adenine were from 1.0 × 10(-7) to 1.0 × 10(-5) mol L(-1), and detection limits (S/N = 3) were found to be 5.2 × 10(-8) and 2.8 × 10(-8) mol L(-1), respectively. The proposed sensor showed advantages of high sensitivity, simple sample preparation protocol, enhanced throughput and good reproducibility. Finally, the practical application of the proposed sensor has been performed for the determination of guanine and adenine in real samples with satisfactory results.

  10. Major and minor groove conformations of DNA trimers modified on guanine or adenine by 4-aminobiphenyl: Adenine adducts favor the minor groove

    SciTech Connect

    Shapiro, R.; Ellis, S.; Hingerty, B.E.


    We have studied the conformational effects of 4-aminobiphenyl modification at C-8 of guanine or adenine on double-stranded DNA trimers. We used sequences with the modified purine at the central base pair and all 16 possible neighboring sequences at the outer pairs. Minimized potential energy calculations were carried out using the molecular mechanics program DUPLEX to survey the conformation space of these adducts, using a total of 1280 starting structures both in the modified guanine series and in the modified adenine series. Conformer families in which the bound 4-aminobiphenyl was located in the DNA major groove, and in the minor groove, were located for both adenine and guanine modification. In the modified guanine series, the major and minor groove families were roughly comparable in energy, and the sequence context determined which was more stable in a particular case. In the modified adenine series, however, the minor groove structure was more that 10 kcal/mol more stable than the major groove for all sequences. As a result, minor groove adducts provided most of the global minima in the adenine-modified series. This result may be relevant to a previous mutagenesis study [Lasko et al. (1988) J. Biol. Chem. 263, 15429-15435] in which the hot spot of most frequent occurrence was located at an adenine, in the sequence GAT. 25 refs., 9 figs., 4 tabs.

  11. Stability of guanine adsorbed in a clay mineral under gamma irradiation at temperatures (77 and 298 K): Implications for chemical evolution studies

    NASA Astrophysics Data System (ADS)

    Meléndez-López, A. L.; Ramos-Bernal, S.; Ramírez-Vázquez, M. L.


    Chemical evolution is a physical and chemical preamble prior the appearance of life. In these processes, clay minerals might have played an important role on the early Earth. The relevance of these solids in the emergence of life is due to their ancient origin, wide distribution, and especially, their physico-chemical properties. Clays, therefore, are considered the most likely inorganic materials to promote organic reactions in the primitive Earth. John D. Bernal suggested clays as concentrators of biological precursor molecules, as catalysis and clays might protect these molecules from high-energy radiation. On the other hand, nucleic acid bases and their derivatives are important compounds in biological systems. Their synthesis and stability in environmental conditions are of paramount importance in chemical evolution. The aim of this work is to extend the knowledge of the role of clays in the prebiotic epoch in relation to the behavior of guanine, a nucleic acid base, adsorbed in a clay mineral. To this end, we studied its adsorption in clays, its site of binding, and its survival under a high radiation field and at different temperatures and pH. The results showed guanine adsorption onto clays increased with the decreasing of the pH. This result could be explained by electrostatic forces between guanine positively charged at an acid pH and the negatively charged interlamellar channel of the clay. X-ray diffractograms showed that guanine is adsorbed onto the clay at the interlayer channel. To study the survival of guanine in a high radiation field, the system guanine-clay was irradiated under different irradiation doses, temperatures, and pH. The results showed that more than 90% of the guanine survives, and when the radiolysis is made without clay, the decomposition of this molecule occurs at low irradiation doses. The radiolysis performed at 77 K showed very low decomposition, which is important in cometary chemistry. These results show the protection role of

  12. Guanine-specific oxidation of double-stranded DNA by Cr(VI) and ascorbic acid forms spiroiminodihydantoin and 8-oxo-2'-deoxyguanosine.


    Slade, Peter G; Hailer, M Katie; Martin, Brooke D; Sugden, Kent D


    7,8-dihydro-8-oxoguanine (8-oxoG) is thought to be a major lesion formed in DNA by oxidative attack at the nucleobase guanine. Recent studies have shown that 8-oxoG has a lower reduction potential than the parent guanine and is a hot spot for further oxidation. Spiroiminodihydantoin (Sp) has been identified as one of these further oxidation products. Chromium(VI) is a human carcinogen that, when reduced by a cellular reductant such as ascorbate, can oxidize DNA. In this study, duplex DNA was reacted with Cr(VI) and ascorbate to identify and quantify the base lesions formed. Guanine bases were observed to be preferentially oxidized with 5' guanines within purine repeats showing enhanced oxidation. Trapping of the guanine lesions by the base excision repair enzymes hOGG1 and mNEIL2 showed nearly exclusive trapping by mNEIL2, suggesting that 8-oxoG was not the major lesion but rather a lesion recognized by mNEIL2 such as Sp. Formation of the Sp lesion in the Cr(VI)/Asc oxidation reaction with DNA was confirmed by LC-ESI-MS detection. HPLC-ECD was used to identify and quantify any 8-oxoG arising from Cr(VI)/Asc oxidation of DNA. Concentrations of Cr(VI) (3.1-50 microM) with a corresponding 1:10 ratio of Asc oxidized between 0.3% and 1.5% of all guanines within the duplex DNA strand to Sp. 8-oxoG was also identified but with the highest Cr(VI) concentration converting approximately 0.1% of all guanines to 8-oxoG. These results show that Sp was present in concentrations approximately 20 times greater than that of 8-oxoG in this system. The results indicate that 8-oxoG, while present, was not the major product of Cr(VI)/Asc oxidation of DNA and that Sp predominates under these conditions. These results further imply that Sp may be the lesion that accounts for the carcinogenicity of this metal in cellular systems.

  13. "False" thymine-1H-Enol guanine base pair. low misinsertion rate by DNA polymerase explained by computational chemistry consideration.


    Seclaman, E; Kurunczi, L; Simon, Z


    Formation of correct TA and GC and "false" thymine-1H-enol guanine (TGenol) base pairs is here considered to control nucleotide insertion into DNA via low substrate concentration Michaelis-Menten controlled kinetics. Contributions of base pairing to formation of Gibbs free energies in water solution, DeltaDeltaG, are calculated for the correct and false base pairs with the semi-empiric MNDO/PM3 method for base pairing energies in vacuum and the BEM method for hydration effects. The results for DeltaDeltaG indicate equal insertion rates for correct base pairing and a 10(-3)-10(-4) error probability for false insertion controlled by the TGenol false pair.

  14. Evidence for a class of very small introns in the gene for hypoxanthine-guanine phosphoribosyltransferase in Schistosoma mansoni.

    PubMed Central

    Craig, S P; Muralidhar, M G; McKerrow, J H; Wang, C C


    The single copy gene for the hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) of the parasitic trematode, Schistosoma mansoni, contains seven introns, the first four of which are only 31, 33, 42, and 32 bases in length. These are the smallest introns ever discovered in a non-viral nuclear gene coding for protein. These very small introns possess the canonical GT...AG splice site sequences but lack the branching sequence, the secondary structure, and the minimum size of approximately 50 bases believed to be required for the splicing of eucaryotic mRNA precursors. Evidently, a somewhat different splicing mechanism for the transcripts of these very small introns is necessary. Their discovery within the genes of helminths raises theoretical considerations for the evolution of introns in eucaryotes. Images PMID:2701934

  15. Analysis of cDNA encoding the hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) of Schistosoma mansoni; a putative target for chemotherapy.

    PubMed Central

    Craig, S P; McKerrow, J H; Newport, G R; Wang, C C


    Because of the lack of de novo purine biosynthesis, hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) is a critical enzyme in the purine metabolic pathway of the human parasite, Schistosoma mansoni. Using a cDNA clone encoding mouse HGPRTase and subsequently a synthetic oligonucleotide derived from sequencing a clone of genomic DNA, two clones were isolated from an adult schistosome cDNA library. One clone is 1.374 Kilobases (Kb) long and has an open reading frame of 693 bases. The deduced 231 amino acid sequence has 47.9% identity in a 217 amino acid overlap with human HGPRTase. Northern blot analysis indicates that the full length of mRNA for the S. mansoni HGPRTase is 1.45-1.6 Kb. Analysis of the primary structures of the putative active site for human and parasite enzymes reveal specific differences which may eventually be exploitable in the design of drugs for the treatment of schistosomiasis. Images PMID:3136439

  16. Comparison of Transition Metal-Mediated Oxidation Reactions of Guanine in Nucleoside and Single-Stranded Oligodeoxynucleotide Contexts.


    Ghude, Pranjali; Schallenberger, Mark A; Fleming, Aaron M; Muller, James G; Burrows, Cynthia J


    As the most readily oxidized of DNA's four natural bases, guanine is a prime target for attack by reactive oxygen species (ROS) and transition metal-mediated oxidants. The oxidation products of a modified guanosine nucleoside and of a single-stranded oligodeoxynucleotide, 5'-d(TTTTTTTGTTTTTTT)-3' have been studied using oxidants that include Co(II), Ni(II), and Ir(IV) compounds as well as photochemically generated oxidants such as sulphate radical, electron-transfer agents (riboflavin) and singlet oxygen. The oxidized lesions formed include spiroiminodihydantoin (Sp), guanidinohydantoin (Gh), imidazolone (Iz), oxazolone (Z) and 5-carboxamido-5-formamido-2-iminohydantion (2-Ih) nucleosides with a high degree of dependence on the exact oxidation system employed. Interestingly, a nickel(II) macrocyclic complex in conjunction with KHSO(5) leads to the recently reported 2-Ih heterocycle as the major product in both the nucleoside and oligonucleotide contexts.

  17. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field

    PubMed Central

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah


    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds’ vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field. PMID:26999445

  18. The 4-nitroquinoline 1-oxide mutational spectrum in single stranded DNA is characterized by guanine to pyrimidine transversions.


    Fronza, G; Campomenosi, P; Iannone, R; Abbondandolo, A


    4-Nitroquinoline-1-oxide is a potent mutagen and carcinogen which induces two main guanine adducts at positions C8 and N2. In ds or ss damaged DNA the ratio C8/N2 adducts is 1:2 and 8-10:1, respectively. In bacteria and yeast 4NQO has been shown to be a base substitution mutagen acting at G residues inducing mainly G to A transitions. We determined the mutational spectrum induced by the 4NQO metabolite, acetoxy-4-aminoquinoline 1-oxide, in the M13lacZ'/E. coli lacZ delta M15 alpha complementation assay using ssDNA. Among 68 Ac-4HAQO induced mutants, G to Pyr transversion was the most frequent base substitution observed. By comparison with dsDNA based systems, our data suggest that dGuo-C8-AQO induces G to Pyr transversions. A mechanism to explain how this lesion may induce transversions is proposed.

  19. Differential Rac1 signalling by guanine nucleotide exchange factors implicates FLII in regulating Rac1-driven cell migration

    PubMed Central

    Marei, Hadir; Carpy, Alejandro; Woroniuk, Anna; Vennin, Claire; White, Gavin; Timpson, Paul; Macek, Boris; Malliri, Angeliki


    The small GTPase Rac1 has been implicated in the formation and dissemination of tumours. Upon activation by guanine nucleotide exchange factors (GEFs), Rac1 associates with a variety of proteins in the cell thereby regulating various functions, including cell migration. However, activation of Rac1 can lead to opposing migratory phenotypes raising the possibility of exacerbating tumour progression when targeting Rac1 in a clinical setting. This calls for the identification of factors that influence Rac1-driven cell motility. Here we show that Tiam1 and P-Rex1, two Rac GEFs, promote Rac1 anti- and pro-migratory signalling cascades, respectively, through regulating the Rac1 interactome. In particular, we demonstrate that P-Rex1 stimulates migration through enhancing the interaction between Rac1 and the actin-remodelling protein flightless-1 homologue, to modulate cell contraction in a RhoA-ROCK-independent manner. PMID:26887924

  20. Protein Kinase A (PKA) Type I Interacts with P-Rex1, a Rac Guanine Nucleotide Exchange Factor

    PubMed Central

    Chávez-Vargas, Lydia; Adame-García, Sendi Rafael; Cervantes-Villagrana, Rodolfo Daniel; Castillo-Kauil, Alejandro; Bruystens, Jessica G. H.; Fukuhara, Shigetomo; Taylor, Susan S.; Mochizuki, Naoki; Reyes-Cruz, Guadalupe; Vázquez-Prado, José


    Morphology of migrating cells is regulated by Rho GTPases and fine-tuned by protein interactions and phosphorylation. PKA affects cell migration potentially through spatiotemporal interactions with regulators of Rho GTPases. Here we show that the endogenous regulatory (R) subunit of type I PKA interacts with P-Rex1, a Rac guanine nucleotide exchange factor that integrates chemotactic signals. Type I PKA holoenzyme interacts with P-Rex1 PDZ domains via the CNB B domain of RIα, which when expressed by itself facilitates endothelial cell migration. P-Rex1 activation localizes PKA to the cell periphery, whereas stimulation of PKA phosphorylates P-Rex1 and prevents its activation in cells responding to SDF-1 (stromal cell-derived factor 1). The P-Rex1 DEP1 domain is phosphorylated at Ser-436, which inhibits the DH-PH catalytic cassette by direct interaction. In addition, the P-Rex1 C terminus is indirectly targeted by PKA, promoting inhibitory interactions independently of the DEP1-PDZ2 region. A P-Rex1 S436A mutant construct shows increased RacGEF activity and prevents the inhibitory effect of forskolin on sphingosine 1-phosphate-dependent endothelial cell migration. Altogether, these results support the idea that P-Rex1 contributes to the spatiotemporal localization of type I PKA, which tightly regulates this guanine exchange factor by a multistep mechanism, initiated by interaction with the PDZ domains of P-Rex1 followed by direct phosphorylation at the first DEP domain and putatively indirect regulation of the C terminus, thus promoting inhibitory intramolecular interactions. This reciprocal regulation between PKA and P-Rex1 might represent a key node of integration by which chemotactic signaling is fine-tuned by PKA. PMID:26797121

  1. Biochemical and genetic analysis of RNA cap guanine-N2 methyltransferases from Giardia lamblia and Schizosaccharomyces pombe.


    Hausmann, Stéphane; Ramirez, Alejandro; Schneider, Susanne; Schwer, Beate; Shuman, Stewart


    RNA cap guanine-N2 methyltransferases such as Schizosaccharomyces pombe Tgs1 and Giardia lamblia Tgs2 catalyze methylation of the exocyclic N2 amine of 7-methylguanosine. Here we performed a mutational analysis of Giardia Tgs2, entailing an alanine scan of 17 residues within the minimal active domain. Alanine substitutions at Phe18, Thr40, Asp76, Asn103 and Asp140 reduced methyltransferase specific activity to <3% of wild-type Tgs2, thereby defining these residues as essential. Alanines at Pro142, Tyr148 and Pro185 reduced activity to 7-12% of wild-type. Structure-activity relationships at Phe18, Thr40, Asp76, Asn103, Asp140 and Tyr148, and at three other essential residues defined previously (Asp68, Glu91 and Trp143) were gleaned by testing the effects of 18 conservative substitutions. Our results engender a provisional map of the Tgs2 active site, which we discuss in light of crystal structures of related methyltransferases. A genetic analysis of S. pombe Tgs1 showed that it is nonessential. An S. pombe tgs1Delta strain grows normally, notwithstanding the absence of 2,2,7-trimethylguanosine caps on its U1, U2, U4 and U5 snRNAs. However, we find that S. pombe requires cap guanine-N7 methylation catalyzed by the enzyme Pcm1. Deletion of the pcm1(+) gene was lethal, as were missense mutations in the Pcm1 active site. Thus, whereas m(7)G caps are essential in both S. pombe and S. cerevisiae, m(2,2,7)G caps are not.

  2. Crystal structure of a chimera of human and Plasmodium falciparum hypoxanthine guanine phosphoribosyltransferases provides insights into oligomerization.


    Gayathri, P; Sujay Subbayya, I N; Ashok, Chethan S; Selvi, T Senthamizh; Balaram, Hemalatha; Murthy, M R N


    The crystal structure of a chimera of Plasmodium falciparum (Pf) and human hypoxanthine guanine phosphoribosyltransferases (HGPRT), which consists of the core of the protein from the human enzyme and the hood region from the Pf enzyme, has been determined as a complex with the product guanosine monophosphate (GMP). The chimera can utilize hypoxanthine, guanine, and xanthine as substrates, similar to the Pf enzyme. It exists as a monomer-dimer mixture in solution, but shifts to a tetramer on addition of phosphoribosyl pyrophosphate (PRPP). The structural studies reveal that the asymmetric unit of the crystal consists of two monomers of the chimeric HGPRT. Surprisingly, the dimer interface of the chimera is the less extensive AC interface of the parent HGPRTs. An analysis of the crystal structures of the various human HGPRTs provides an explanation for the oligomeric characteristics of the chimera. Pro93 and Tyr197 form part of crucial interactions holding together the AB interface in the unliganded or GMP-bound forms of HGPRT, while Pro93 and His26 interact at the interface after binding of PRPP. Replacement of Tyr197 of human HGPRT by Ile207 in the chimera disrupts the interaction at the AB interface in the absence of PRPP. In the presence of PRPP, the interaction between Pro93 and His26 could restore the AB interface, shifting the chimeric enzyme to a tetrameric state. The structure provides valuable insights into the differences in the AB interface between Pf and human HGPRTs, which may be useful for designing selective inhibitors against the parasite enzyme.

  3. Superoxide Inhibits Guanine Nucleotide Exchange Factor (GEF) Action on Ras, but not on Rho, through Desensitization of Ras to GEF

    PubMed Central


    Ras and Rho GTPases are molecular switches for various vital cellular signaling pathways. Overactivation of these GTPases often causes development of cancer. Guanine nucleotide exchange factors (GEFs) and oxidants function to upregulate these GTPases through facilitation of guanine nucleotide exchange (GNE) of these GTPases. However, the effect of oxidants on GEF functions, or vice versa, has not been known. We show that, via targeting Ras Cys51, an oxidant inhibits the catalytic action of Cdc25—the catalytic domain of RasGEFs—on Ras. However, the enhancement of Ras GNE by an oxidant continues regardless of the presence of Cdc25. Limiting RasGEF action by an oxidant may function to prevent the pathophysiological overactivation of Ras in the presence of both RasGEFs and oxidants. The continuous exposure of Ras to nitric oxide and its derivatives can form S-nitrosated Ras (Ras-SNO). This study also shows that an oxidant not only inhibits the catalytic action of Cdc25 on Ras-SNO but also fails to enhance Ras-SNO GNE. This lack of enhancement then populates the biologically inactive Ras-SNO in cells, which may function to prevent the continued redox signaling of the Ras pathophysiological response. Finally, this study also demonstrates that, unlike the case with RasGEFs, an oxidant does not inhibit the catalytic action of RhoGEF—Vav or Dbs—on Rho GTPases such as Rac1, RhoA, RhoC, and Cdc42. This result explains the results of the previous study in which, despite the presence of an oxidant, the catalytic action of Dbs in cells continued to enhance RhoC GNE. PMID:24422478

  4. DNA damage by the sulfate radical anion: hydrogen abstraction from the sugar moiety versus one-electron oxidation of guanine.


    Roginskaya, Marina; Mohseni, Reza; Ampadu-Boateng, Derrick; Razskazovskiy, Yuriy


    The products of oxidative damage to double-stranded (ds) DNA initiated by photolytically generated sulfate radical anions SO4(•-) were analyzed using reverse-phase (RP) high-performance liquid chromatography (HPLC). Relative efficiencies of two major pathways were compared: production of 8-oxoguanine (8oxoG) and hydrogen abstraction from the DNA 2-deoxyribose moiety (dR) at C1,' C4,' and C5' positions. The formation of 8oxoG was found to account for 87% of all quantified lesions at low illumination doses. The concentration of 8oxoG quickly reaches a steady state at about one 8oxoG per 100 base pairs due to further oxidation of its products. It was found that another guanine oxidation product identified as 2-amino-5-(2'-alkylamino)-4H-imidazol-4-one (X) was released in significant quantities from its tentative precursor 2-amino-5-[(2'-deoxy-β-d-erythro-pentofuranosyl)amino]-4H-imidazol-4-one (dIz) upon treatment with primary amines in neutral solutions. The linear dose dependence of X release points to the formation of dIz directly from guanine and not through oxidation of 8oxoG. The damage to dR was found to account for about 13% of the total damage, with majority of lesions (33%) originating from the C4' oxidation. The contribution of C1' oxidation also turned out to be significant (17% of all dR damages) despite of the steric problems associated with the abstraction of the C1'-hydrogen. However, no evidence of base-to-sugar free valence transfer as a possible alternative to direct hydrogen abstraction at C1' was found.

  5. Substrate orientation and specificity in xanthine oxidase: crystal structures of the enzyme in complex with indole-3-acetaldehyde and guanine.


    Cao, Hongnan; Hall, James; Hille, Russ


    Xanthine oxidase is a molybdenum-containing hydroxylase that catalyzes the hydroxylation of sp(2)-hybridized carbon centers in a variety of aromatic heterocycles as well as aldehydes. Crystal structures of the oxidase form of the bovine enzyme in complex with a poor substrate indole-3-acetaldehyde and the nonsubstrate guanine have been determined, both at a resolution of 1.6 Å. In each structure, a specific and unambiguous orientation of the substrate in the active site is observed in which the hydroxylatable site is oriented away from the active site molybdenum center. The orientation seen with indole-3-acetaldehyde has the substrate positioned with the indole ring rather than the exocyclic aldehyde nearest the molybdenum center, indicating that the substrate must rotate some 30° in the enzyme active site to permit hydroxylation of the aldehyde group (as observed experimentally), accounting for the reduced reactivity of the enzyme toward this substrate. The principal product of hydroxylation of indole-3-acetaldehyde by the bovine enzyme is confirmed to be indole-3-carboxylic acid based on its characteristic UV-vis spectrum, and the kinetics of enzyme reduction are reported. With guanine, the dominant orientation seen crystallographically has the C-8 position that might be hydroxylated pointed away from the active site molybdenum center, in a configuration resembling that seen previously with hypoxanthine (a substrate that is effectively hydroxylated at position 2). The ∼180° reorientation required to permit reaction is sterically prohibited, indicating that substrate (mis)orientation in the active site is a major factor precluding formation of the highly mutagenic 8-hydroxyguanine.

  6. Fluorescence properties of 8-(2-pyridyl)guanine "2PyG" as compared to 2-aminopurine in DNA.


    Dumas, Anaëlle; Luedtke, Nathan W


    Because of their environment-sensitive fluorescence quantum yields, base analogues such as 2-aminopurine (2AP), 6-methylisoxanthopterin (6-MI), and 3-methylisoxanthopterin (3-MI) are widely used in nucleic-acid folding and catalysis assays. Emissions from these guanine mimics are quenched by base-stacking interactions and collisions with purine residues. Fluorescent base analogues that remain highly emissive in folded nucleic acids can provide sensitive means to differentiate DNA/RNA structures by participating in energy transfer from proximal ensembles of unmodified nucleobases. The development of new, highly emissive guanine mimics capable of proper base stacking and base-pairing interactions is an important prerequisite to this approach. Here we report a comparison of the most commonly used probe, 2-aminopurine (2AP), to 8-(2-pyridyl)-2'-deoxyguanosine (2PyG). The photophysical properties of these purine derivatives are very different. 2PyG exhibits enhanced fluorescence quantum yields upon its incorporation into folded nucleic acids--approximately 50-fold brighter fluorescence intensity than 2AP in the context of duplex DNA. Due to its bright fluorescence and compatibility with proper DNA folding, 2PyG can be used to accurately quantify energy-transfer efficiencies, whereas 2AP is much less sensitive to structure-specific trends in energy transfer. When using nucleoside monomers, Stern-Volmer plots of 2AP fluorescence revealed upward curvature of F(0) /F upon titration of guanosine monophoshate (GMP), whereas 2PyG exhibited unusual downward curvature of F(0) /F that resulted in a recovery of fluorescence at high GMP concentrations. These results are consistent with the trends observed for 2PyG- and 2AP-containing oligonucleotides, and furthermore suggest that solutions containing high concentrations of GMP can, in some ways, mimic the high local nucleobase densities of folded nucleic acids.

  7. Guanine-nucleotide exchange on ribosome-bound elongation factor G initiates the translocation of tRNAs

    PubMed Central

    Zavialov, Andrey V; Hauryliuk, Vasili V; Ehrenberg, Måns


    Background During the translation of mRNA into polypeptide, elongation factor G (EF-G) catalyzes the translocation of peptidyl-tRNA from the A site to the P site of the ribosome. According to the 'classical' model, EF-G in the GTP-bound form promotes translocation, while hydrolysis of the bound GTP promotes dissociation of the factor from the post-translocation ribosome. According to a more recent model, EF-G operates like a 'motor protein' and drives translocation of the peptidyl-tRNA after GTP hydrolysis. In both the classical and motor protein models, GDP-to-GTP exchange is assumed to occur spontaneously on 'free' EF-G even in the absence of a guanine-nucleotide exchange factor (GEF). Results We have made a number of findings that challenge both models. First, free EF-G in the cell is likely to be in the GDP-bound form. Second, the ribosome acts as the GEF for EF-G. Third, after guanine-nucleotide exchange, EF-G in the GTP-bound form moves the tRNA2-mRNA complex to an intermediate translocation state in which the mRNA is partially translocated. Fourth, subsequent accommodation of the tRNA2-mRNA complex in the post-translocation state requires GTP hydrolysis. Conclusion These results, in conjunction with previously published cryo-electron microscopy reconstructions of the ribosome in various functional states, suggest a novel mechanism for translocation of tRNAs on the ribosome by EF-G. Our observations suggest that the ribosome is a universal guanosine-nucleotide exchange factor for EF-G as previously shown for the class-II peptide-release factor 3. PMID:15985150

  8. New Dihydro OO'Bis(Salicylidene) 2,2' Aminobenzothiazolyl Borate Complexes: Kinetic and Voltammetric Studies of Dimethyltin Copper Complex with Guanine, Adenine, and Calf Thymus DNA.


    Arjmand, Farukh; Mohani, Bhawana; Parveen, Shamima


    The newly synthesized ligand, dihydro OO'bis(salicylidene) 2,2' aminobenzothiazolyl borate (2), was derived from the reaction of Schiff base of 2-aminobenzothiazole and salicylaldehyde with KBH(4). Cu(II) (3) and Zn(II) (4) complexes of (2) were synthesized and further metallated with dimethyltindichloride to yield heterobimetallic complexes (5) and (6). All complexes have been thoroughly characterized by elemental analysis, and IR, NMR, EPR, and UV-Vis spectroscopy and conductance measurements. The spectroscopic data support square planar environment around the Cu(II) atom, while the Sn(IV) atom acquires pentacoordinate geometry. The interaction of complex (5) with guanine, adenine, and calf thymus DNA was studied by spectrophotometric, electrochemical, and kinetic methods. The absorption spectra of complex (5) exhibit a remarkable "hyperchromic effect" in the presence of guanine and calf thymus DNA. Indicative of strong binding of the complex to calf thymus DNA preferentially binds through N(7) position of guanine base, while the adenine shows binding to a lesser extent. The kinetic data were obtained from the rate constants, k(obs), values under pseudo-first-order conditions. Cyclic voltammetry was employed to study the interaction of complex (5) with guanine, adenine, and calf thymus DNA. The CV of complex (5) in the absence and in the presence of guanine and calf thymus DNA altered drastically, with a positive shift in formal peak potential E(pa) and E(pc) values and a significant increase in peak current. The positive shift in formal potentials with increase in peak current favours strong interaction of complex (5) with calf thymus DNA. The net shift in E(1/2) has been used to estimate the ratio of equilibrium constants for the binding of Cu(II) and Cu(I) complexes to calf thymus DNA.

  9. 32P-post-labelling of 7-(3-chloro-2-hydroxypropyl)guanine in white blood cells of workers occupationally exposed to epichlorohydrin.


    Plna, K; Osterman-Golkar, S; Nogradi, E; Segerbäck, D


    Epichlorohydrin (ECH) is a simple 3-carbon epoxide of industrial importance. It has been shown to be genotoxic in several systems and carcinogenic in experimental animals. The aim of the present investigation was to study DNA adducts of ECH as a biomarker of occupational exposure to this chemical. 7-(3-Chloro-2-hydroxypropyl)guanine (7-CHP-guanine) was analysed in DNA from white blood cells using an anion exchange-based adduct enrichment protocol of the (32)P-post-labelling/HPLC-based assay. Blood samples were collected from seven workers handling ECH (exposed), nine workers not handling ECH but normally present in the premises where this chemical is used (potentially exposed) and 13 office and factory workers from locations in the plant where ECH is not handled (controls). 7-CHP-guanine was detected in five of the seven workers exposed to ECH (1.6-7.1 mol/10(9) mol nucleotides) and in two of the nine workers potentially exposed to ECH (0.8-1.5 mol/10(9) mol nucleotides). This adduct was not detected in any of the 13 controls. The difference in adduct levels between exposed workers and controls was statistically significant (Mann-Whitney test, P < 0.001), as was the difference between exposed workers and potentially exposed workers (P = 0.017). The recovery of 7-CHP-guanine in the (32)P-post-labelling assay was on average 48 +/- 7%, which is considerably higher than previously reported for other 7-alkylguanines. The method used had a limit of detection of approximately 0.4 mol adduct/10(9) mol nucleotides using 20 microg DNA. This study shows for the first time ECH-induced DNA adducts in humans and suggests that 7-CHP-guanine may be used as a biomarker of occupational exposure to ECH.

  10. Intrastrand G-U cross-links generated by the oxidation of guanine in 5'-d(GCU) and 5'-r(GCU).


    Crean, Conor; Geacintov, Nicholas E; Shafirovich, Vladimir


    It has been suggested that carbonate radical anions are biologically important because they may be produced during the inflammatory response. The carbonate radicals can selectively oxidize guanine in DNA and RNA by one-electron transfer mechanisms and the guanine radicals thus formed decay by diverse competing pathways with other free radicals or nucleophiles. Using a photochemical method to generate CO(3)(-) radicals in vitro, we compare the distributions of products initiated by the one-electron oxidation of guanine in the trinucleotides 5'-r(GpCpU) and 5'-d(GpCpU) in aqueous buffer solutions (pH 7.5). Similar distributions of stable end products identified by LC-MS/MS methods were found in both cases. The guanine oxidation products include the diastereomeric pair of spiroiminodihydantoin (Sp) and 2,5-diamino-4H-imidazolone (Iz). In addition, intrastrand cross-linked products involving covalent bonds between the G and the U bases (GCU) were also found, although with different relative yields in the 2'-deoxy- and the ribotrinucleotides. The positive-ion MS/MS spectra of the 5'-r(GpCpU) and 5'-d(GpCpU) products clearly indicate the presence of covalently linked G-U products that have a mass smaller by 2 Da than the sum of the G and U bases in both types of trinucleotides. The 5'-d(GCU) cross-linked product was further characterized by 1D and 2D NMR methods that confirm its cyclic structure in which the guanine C8 atom is covalently linked to the uracil N3 atom.

  11. Performance characteristics of guanine incorporated PVDF-HFP/PEO polymer blend electrolytes with binary iodide salts for dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Senthil, R. A.; Theerthagiri, J.; Madhavan, J.; Arof, A. K.


    In this work, we have investigated the influence of guanine as an organic dopant in dye-sensitized solar cell (DSSC) based on poly(vinylidinefluoride-co-hexafluoropropylene) (PVDF-HFP)/polyethylene oxide (PEO) polymer blend electrolyte along with binary iodide salts (potassium iodide (KI) and tetrabutylammonium iodide (TBAI)) and iodine (I2). The PVDF-HFP/KI + TBAI/I2, PVDF-HFP/PEO/KI + TBAI/I2 and guanine incorporated PVDF-HFP/PEO/KI + TBAI/I2 electrolytes were prepared by solution casting technique using DMF as solvent. The PVDF-HFP/KI + TBAI/I2 electrolyte showed an ionic conductivity value of 9.99 × 10-5 Scm-1, whereas, it was found to be increased to 4.53 × 10-5 Scm-1 when PEO was blended with PVDF-HFP/KI + TBAI/I2 electrolyte. However, a maximum ionic conductivity value of 3.67 × 10-4 Scm-1 was obtained for guanine incorporated PVDF-HFP/PEO/KI + TBAI/I2 blend electrolyte. The photovoltaic properties of all these polymer electrolytes in DSSCs were characterized. As a consequence, the power conversion efficiency of the guanine incorporated PVDF-HFP/PEO/KI + TBAI/I2 electrolyte based DSSC was significantly improved to 4.98% compared with PVDF-HFP/PEO/KI + TBAI/I2 electrolyte based DSSC (2.46%). These results revealed that the guanine can be an effective organic dopant to enhance the performance of DSSCs.

  12. G-quadruplexes with (4n - 1) guanines in the G-tetrad core: formation of a G-triad·water complex and implication for small-molecule binding

    PubMed Central

    Heddi, Brahim; Martín-Pintado, Nerea; Serimbetov, Zhalgas; Kari, Teuku Mahfuzh Aufar; Phan, Anh Tuân


    G-quadruplexes are non-canonical structures of nucleic acids, in which guanine bases form planar G-tetrads (G·G·G·G) that stack on each other in the core of the structure. G-quadruplexes generally contain multiple times of four (4n) guanines in the core. Here, we study the structure of G-quadruplexes with only (4n - 1) guanines in the core. The solution structure of a DNA sequence containing 11 guanines showed the formation of a parallel G-quadruplex involving two G-tetrads and one G-triad with a vacant site. Molecular dynamics simulation established the formation of a stable G-triad·water complex, where water molecules mimic the position of the missing guanine in the vacant site. The concept of forming G-quadruplexes with missing guanines in the core broadens the current definition of G-quadruplex-forming sequences. The potential ability of such structures to bind different metabolites, including guanine, guanosine and GTP, in the vacant site, could have biological implications in regulatory functions. Formation of this unique binding pocket in the G-triad could be used as a specific target in drug design. PMID:26673723

  13. Detection of C8-(1-hydroxyethyl)guanine in liver RNA and DNA from control and ethanol-treated rats.


    Nakao, Lia S; Fonseca, Elaine; Augusto, Ohara


    Alcohol consumption is associated with an increased risk of cancer by mechanisms that remain unknown but have been suggested to involve radical metabolites. We have previously shown that the 1-hydroxyethyl radical produced from ethanol oxidation in vitro is able to alkylate nucleic acids to produce C8-(1-hydroxyethyl)guanine [C8-(1-HE)gua] among other products. To assess if this adduct is produced in vivo, we developed a sensitive HPLC-MS/MS method for its detection and analyzed hydrolysates of liver RNA and DNA from control and ethanol-treated rats. Unexpectedly, C8-(1-HE)gua was found to be present in both RNA and DNA from the liver of control Sprague-Dawley rats, and its levels increased slightly, but not significantly, after an acute ethanol dose (5 g/kg). In rat liver, C8-(1-HE)gua endogenous levels were about 10 times higher in RNA (35 +/- 5/10(7) guanine) than DNA (3.7 +/- 1.1/10(7) guanine). These levels were also found in commercial RNA (calf liver and yeast) and DNA (calf thymus), further indicating the endogenous source of the adduct. DNA basal levels of C8-(1-HE)gua were similar to those reported for other 2C guanine adducts such as N7-(2-hydroxyethyl)guanine and N2-ethyl-2'-deoxyguanosine. We speculate that all of these adducts may be generated from DNA attack by products of basal lipid peroxidation. The higher RNA levels of C8-(1-HE)gua are in agreement with the higher accessibility of RNA and nucleotides to reactive intermediates because they are not as protected or as localized as DNA. Chemical modification of RNA has been receiving increasingly attention as an important event in genotoxic mechanisms. Comparison of RNA basal levels of C8-(1-HE)gua, N7-(2-hydroxyethyl)guanine, and N2-ethyl-2'-deoxyguanosine may provide clues about their endogenous sources and biological significance. Yet, the marginal increase of DNA C8-(1-HE)gua upon ethanol administration argues against this adduct playing a major role in the carcinogenic effects of ethanol.

  14. DNA sequence context as a determinant of the quantity and chemistry of guanine oxidation produced by hydroxyl radicals and one-electron oxidants.


    Margolin, Yelena; Shafirovich, Vladimir; Geacintov, Nicholas E; DeMott, Michael S; Dedon, Peter C


    DNA sequence context has emerged as a critical determinant of the location and quantity of nucleobase damage caused by many oxidizing agents. However, the complexity of nucleobase and 2-deoxyribose damage caused by strong oxidants such as ionizing radiation and the Fenton chemistry of Fe2+-EDTA/H2O2 poses a challenge to defining the location of nucleobase damage and the effects of sequence context on damage chemistry in DNA. To address this problem, we developed a gel-based method that allows quantification of nucleobase damage in oxidized DNA by exploiting Escherichia coli exonuclease III to remove fragments containing direct strand breaks and abasic sites. The rigor of the method was verified in studies of guanine oxidation by photooxidized riboflavin and nitrosoperoxycarbonate, for which different effects of sequence context have been demonstrated by other approaches (Margolin, Y., Cloutier, J. F., Shafirovich, V., Geacintov, N. E., and Dedon, P. C. (2006) Nat. Chem. Biol. 2, 365-366). Using duplex oligodeoxynucleotides containing all possible three-nucleotide sequence contexts for guanine, the method was used to assess the role of DNA sequence context in hydroxyl radical-induced guanine oxidation associated with gamma-radiation and Fe2+-EDTA/H2O2. The results revealed both differences and similarities for G oxidation by hydroxyl radicals and by one-electron oxidation by riboflavin-mediated photooxidation, which is consistent with the predominance of oxidation pathways for hydroxyl radicals other than one-electron oxidation to form guanine radical cations. Although the relative quantities of G oxidation produced by hydroxyl radicals were more weakly correlated with sequence-specific ionization potential than G oxidation produced by riboflavin, damage produced by both hydroxyl radical generators and riboflavin within two- and three-base runs of G showed biases in location that are consistent with a role for electron transfer in defining the location of the damage

  15. Competition between glutathione and guanine for a ruthenium(II) arene anticancer complex: detection of a sulfenato intermediate.


    Wang, Fuyi; Xu, Jingjing; Habtemariam, Abraha; Bella, Juraj; Sadler, Peter J


    The organometallic anticancer complex [(eta6-bip)Ru(en)Cl]+ (1; bip = biphenyl, en = ethylenediamine) selectively binds to guanine (N7) bases of DNA (Novakova, O.; Chen, H.; Vrana, O.; Rodger, A.; Sadler, P. J.; Brabec, V. Biochemistry 2003, 42, 11544-11554). In this work, competition between the tripeptide glutathione (gamma-L-Glu-L-Cys-Gly; GSH) and guanine (as guanosine 3',5'-cyclic monophosphate, cGMP) for complex 1 was investigated using HPLC, LC-MS and 1H,15N NMR spectroscopy. In unbuffered solution (pH ca. 3), the reaction of 1 with GSH gave rise to three intermediates: an S-bound thiolato adduct [(eta6-bip)Ru(en)(GS-S)] (4) and two carboxylate-bound glutathione products [(eta6-bip)Ru(en)(GSH-O)]+ (5, 6) during the early stages (<6 h), followed by en displacement and formation of a tri-GS-bridged dinuclear Ru(II) complex [((eta6-bip)Ru)2(GS-mu-S)3]2- (7). Under physiologically relevant conditions (micromolar Ru concentrations, pH 7, 22 mM NaCl, 310 K), the thiolato complex 4 was unexpectedly readily oxidized by dioxygen to the sulfenato complex [(eta6-bip)Ru(en)(GS(O)-S)] (8) instead of forming the dinuclear complex 7. Under these conditions, competitive reaction of complex 1 with GSH and cGMP gave rise to the cGMP adduct [(eta6-bip)Ru(en)(cGMP-N7)]+ (10) as the major product, accounting for ca. 62% of total Ru after 72 h, even in the presence of a 250-fold molar excess of GSH. The oxidation of coordinated glutathione in the thiolato complex 4 to the sulfenate in 8 appears to provide a facile route for displacement of S-bound glutathione by G N7. Redox reactions of cysteinyl adducts of these Ru(II) arene anticancer complexes could therefore play a significant role in their biological activity.

  16. Targeted guanine oxidation by a dinuclear copper(II) complex at single stranded/double stranded DNA junctions.


    Li, Lei; Murthy, Narasimha N; Telser, Joshua; Zakharov, Lev N; Yap, Glenn P A; Rheingold, Arnold L; Karlin, Kenneth D; Rokita, Steven E


    A dinuclear copper(II) complex [Cu(II)2(PD'O-)(H2O)2](ClO4)3 (5) with terminal Cu(II)-H(2)O moieties and a Cu...Cu distance of 4.13 A (X-ray structure) has been synthesized and characterized by EPR spectroscopy (ferromagnetic coupling observed) and cyclic voltammetry. Dizinc(II) and mononuclear copper(II) analogues [Zn(II)2(PD'O-)(H2O)2]3+ (7) and [Cu(II)(mPD'OH)(H2O)]2+ (6), respectively, have also been synthesized and structurally characterized. Reacting 5/MPA/O(2) (MPA = 3-mercaptopropionic acid) with DNA leads to a highly specific oxidation of guanine (G) at a junction between single- and double-stranded DNA. Mass spectrometric analysis of the major products indicates a gain of +18 and +34 amu relative to initial DNA strands. The most efficient reaction requires G at the first and second unpaired positions of each strand extending from the junction. Less reaction is observed for analogous targets in which the G cluster is farther from the junction or contains less than four Gs. Consistent with our previous systems, the multinuclear copper center is required for selective reaction; mononuclear complex 6 is not effective. Hydrogen peroxide as a substitute for MPA/O2 also does not lead to activity. Structural analysis of a [Cu(II)2(PD'O-)(G)]3+ complex (8) and dizinc analogue [Zn(II)(2)(PD'O-)(G)](ClO4)3 (9) (G = guanosine) reveals coordination of the G O6 and N7 atoms with the two copper (or zinc) centers and suggests that copper-G coordination likely plays a role in recognition of the DNA target. The Cu2-O2 intermediate responsible for guanine oxidation appears to be different from that responsible for direct-strand scission induced by other multinuclear copper complexes; the likely course of reaction is discussed.

  17. Time-resolved probes based on guanine/thymine-rich DNA-sensitized luminescence of terbium(III).


    Zhang, Min; Le, Huynh-Nhu; Jiang, Xiao-Qin; Yin, Bin-Cheng; Ye, Bang-Ce


    In this study, we have developed a novel strategy to highly sensitize the luminescence of terbium(III) (Tb(3+)) using a designed guanine/thymine-rich DNA (5'-[G3T]5-3') as an antenna ligand, in which [G3T]5 improved the luminescence of Tb(3+) by 3 orders of magnitude due to energy transfer from nucleic acids to Tb(3+) (i.e., antenna effect). Furthermore, label-free probes for the luminescent detection of biothiols, Ag(+), and sequence-specific DNA in an inexpensive, simple, and mix-and-read format are presented based on the [G3T]5-sensitized luminescence of Tb(3+) (GTSLT). The long luminescence lifetime of the probes readily enables time-resolved luminescence (TRL) experiments. Hg(2+) can efficiently quench the luminescence of Tb(3+) sensitized by [G3T]5 (Tb(3+)/[G3T]5); however, biothiols are readily applicable to selectively grab Hg(2+) for restoration of the luminescence of Tb(3+)/[G3T]5 initially quenched by Hg(2+), which can be used for "turn on" detection of biothiols. With the use of cytosine (C)-rich oligonucleotide c[G3T]5 complementary to [G3T]5, the formed [G3T]5/c[G3T]5 duplex cannot sensitize the luminescence of Tb(3+). However, in the presence of Ag(+), Ag(+) can combine the C base of c[G3T]5 to form C-Ag(+)-C complexes, leading to the split of the [G3T]5/c[G3T]5 duplex and then release of [G3T]5. The released [G3T]5 acts as an antenna ligand for sensitizing the luminescence of Tb(3+). Therefore, the Tb(3+)/[G3T]5/c[G3T]5 probe can be applied to detect Ag(+) in a "turn on" format. Moreover, recognition of target DNA via hybridization to a molecular beacon (MB)-like probe (MB-[G3T]5) can unfold the MB-[G3T]5 to release the [G3T]5 for sensitizing the luminescence of Tb(3+), producing a detectable signal directly proportional to the amount of target DNA of interest. This allows the development of a fascinating label-free MB probe for DNA sensing based on the luminescence of Tb(3+). Results and methods reported here suggest that a guanine/thymine-rich DNA

  18. Exploring non-covalent interactions in guanine- and xanthine-based model DNA quadruplex structures: a comprehensive quantum chemical approach.


    Yurenko, Yevgen P; Novotný, Jan; Sklenář, Vladimir; Marek, Radek


    The study aimed to cast light on the structure and internal energetics of guanine- and xanthine-based model DNA quadruplexes and the physico-chemical nature of the non-covalent interactions involved. Several independent approaches were used for this purpose: DFT-D3 calculations, Quantum Theory of Atoms in Molecules, Natural Bond Orbital Analysis, Energy Decomposition Analysis, Compliance Constant Theory, and Non-Covalent Interaction Analysis. The results point to an excellent degree of structural and energetic compatibility between the two types of model quadruplexes. This fact stems from both the structural features (close values of van der Waals volumes, pore radii, geometrical parameters of the H-bonds) and the energetic characteristics (comparable values of the energies of formation). It was established that hydrogen bonding makes the greatest (∼50%) contribution to the internal stability of the DNA quadruplexes, whereas the aromatic base stacking and ion coordination terms are commensurable and account for the rest. Energy decomposition analysis performed for guanine (Gua) and xanthine (Xan) quartets B4 and higher-order structures consisting of two or three stacked quartets indicates that whereas Gua structures benefit from a high degree of H-bond cooperativity, Xan models are characterized by a more favorable and cooperative π-π stacking. The results of electron density topological analysis show that Na(+)/K(+) ion coordination deeply affects the network of non-covalent interactions in Gua models due to the change in the twist angle between the stacked tetrads. For Xan models, ion coordination makes tetrads in stacks more planar without changing the twist angle. Therefore, the presence of the ion seems to be essential for the formation of planar stacks in Xan-based DNA quadruplexes. Detailed study of the nature of ion-base coordination suggests that this interaction has a partially covalent character and cannot be considered as purely electrostatic

  19. DNA Lesions Caused by ROS and RNOS: A Review of Interactions and Reactions Involving Guanine

    NASA Astrophysics Data System (ADS)

    Shukla, P. K.; Mishra, P. C.

    DNA is constantly attacked by a large number of endogenous and exogenous reactive oxygen species (ROS), reactive nitrogen oxide species (RNOS), and alkylating agents which produce a wide variety of modifications of its constituents, particularly the bases. Some of these modifications (lesions) are hazardous to normal cell functioning, and are implicated in several lethal conditions including chronic inflammatory diseases, atherosclerosis, aging, mutation, cancer, and neurodegenerative disorders, such as the Alzheimer's and Parkinson's diseases.

  20. VUV and mid-UV photoabsorption cross sections of thin films of guanine and uracil: application on their photochemistry in the solar system.


    Saïagh, Kafila; Cottin, Hervé; Aleian, Aicha; Fray, Nicolas


    We present a photostability study of two nucleobases, guanine and uracil. For the first time, the photoabsorption cross-section spectra of these molecules in the solid phase were measured in the VUV and mid-UV domain (115≤λ≤300 nm). They show a quite similar absorption level throughout this wavelength range, highlighting the importance of considering the whole VUV and UV domain during photolysis experiments in the laboratory. Their photolysis constant (J) can be estimated from those measurements as follows: 2.2×10(-2) s(-1)±11% for guanine and 5.3×10(-2) s(-1)±14% for uracil. This work shows that (i) measuring kinetic constants from a direct and "traditional" photolysis of a thin sample in the laboratory suffers strong limitations and (ii) achieving this measurement requires comprehensive modeling of the radiative transfer that occurs in any sample not optically thin (i.e.,≤2 nm). Moreover, this work has provided other data of interest: the refractive index of solid guanine and of uracil at 650 nm are 1.52 (±0.01) and 1.39 (±0.02), respectively, and the integrated IR band strengths (A) of solid guanine between 3700 and 2120 cm(-1) (3.4×10(-16) cm·molecule(-1)±13%) and of solid uracil between 3400 and 1890 cm(-1) (2.1×10(-16) cm·molecule(-1)±21%).

  1. Frequency and effect of the binding of Mg2+, Mn2+, and Co2+ ions on the guanine base in Watson-Crick and reverse Watson-Crick base pairs.


    Oliva, Romina; Cavallo, Luigi


    We performed MP2 calculations to elucidate the structure and energetics of the Mg(2+), Mn(2+), and Co(2+) hexahydrated aquaions, and the effect of the metal binding to the N7 atom of (i) a single guanine, (ii) a guanine involved in a Watson-Crick pair, and (iii) a guanine involved in a reverse Watson-Crick base pair. Our comparative analysis of the three aquaions indicates a clear inverse correlation between the radius of the cation and the binding energy, that indeed increases in the order Mn(2+) < Co(2+) < Mg(2+). The trend in the binding energies of the pentahydrated cations to the N7 atom of the guanine is instead Mg(2+) < Mn(2+) < Co(2+), suggesting a rather different bonding scheme that, for the two transition metals, involves back-donation from the aromatic ring of the guanine to their empty d orbitals. In the gas phase, the three hydrated metals significantly stabilize both G-C base pair geometries, Watson-Crick and reverse Watson-Crick, we investigated. Inclusion of a continuous solvent model, however, remarkably reduces this additional stabilization, which becomes almost negligible in the case of the Mg(2+) cation coordinated to the guanine in the standard Watson-Crick geometry. Conversely, all three metal ions sensibly stabilize the reverse Watson-Crick geometry, also in water. Our results are supported by a screening of the structures available in the Protein Data Bank, which clearly indicates that the two transition metals we investigated have a tendency greater than Mg(2+) to coordinate to the N7 atom of guanines, and that there is no clear correlation between the number of guanines in experimental structures with a metal bound to N7 atom and their involvement in Watson-Crick base pairs.

  2. A new rapid amplification of cDNA ends method for extremely guanine plus cytosine-rich genes.


    Shi, Xianzong; Jarvis, Donald L


    Rapid amplification of cDNA ends (RACE) is widely used to determine the 5'- and 3'-terminal nucleotide sequences of genes. Many different RACE methods have been developed to meet various requirements, but none addresses the difficult problems that arise when trying to isolate the ends of extremely guanine plus cytosine (GC)-rich genes. In this study, we found that we were unable to isolate the correct 5' or 3' end of an insect gene, which appeared to include extremely GC-rich sequences, using current RACE methods. Thus, we developed a new RACE method that can be used for this purpose. This new method entails first-strand cDNA synthesis at 70 degrees C with Thermo-X reverse transcriptase in the presence of homoectoine, followed by a polymerase chain reaction with 98 degrees C denaturation steps and Phusion DNA polymerase in the presence of 1M betaine and 5% dimethyl sulfoxide (DMSO). The use of these conditions yielded 5'- and 3'-RACE products that were approximately 80% GC over 213 and 162bp, respectively, and included shorter internal regions of 82 to 89% GC.

  3. A novel oncogene, ost, encodes a guanine nucleotide exchange factor that potentially links Rho and Rac signaling pathways.

    PubMed Central

    Horii, Y; Beeler, J F; Sakaguchi, K; Tachibana, M; Miki, T


    Transfection of NIH3T3 cells with an osteosarcoma expression cDNA library led to the appearance of foci of morphologically transformed cells which were found to harbor a novel oncogene, ost. The ost product was activated by truncation of the N-terminal domain of the ost proto-oncogene and was highly tumorigenic in nude mouse assays. The proto-ost cDNA, isolated subsequently, encodes a predicted protein of 100 kDa containing DH (Db1 homology) and PH (pleckstrin homology) domains. Ost is mainly phosphorylated on serine and localized in the cytoplasm. Purified Ost protein catalyzed guanine nucleotide exchange on RhoA and Cdc42 among the Rho and Ras family members tested, indicating that Ost can activate these small GTP-binding proteins. Ost did not detectably associate with RhoA or Cdc42, but interacted specifically with the GTP-bound form of Rac1, suggesting that Ost can function as an effector of Rac1. These results suggest that Ost is a critical regulatory component which links pathways that signal through Rac1, RhoA and Cdc42. Of the tissues examined, expression of ost was the highest in brain and could be localized to neurons and alpha-tanycytes, suggesting that Ost may participate in axonal transport in these specialized cells. Images PMID:7957046

  4. Guanine Nucleotide Exchange Factor OSG-1 Confers Functional Aging via Dysregulated Rho Signaling in Caenorhabditis elegans Neurons

    PubMed Central

    Duan, Zhibing; Sesti, Federico


    Rho signaling regulates a variety of biological processes, but whether it is implicated in aging remains an open question. Here we show that a guanine nucleotide exchange factor of the Dbl family, OSG-1, confers functional aging by dysregulating Rho GTPases activities in C. elegans. Thus, gene reporter analysis revealed widespread OSG-1 expression in muscle and neurons. Loss of OSG-1 gene function was not associated with developmental defects. In contrast, suppression of OSG-1 lessened loss of function (chemotaxis) in ASE sensory neurons subjected to conditions of oxidative stress generated during natural aging, by oxidative challenges, or by genetic mutations. RNAi analysis showed that OSG-1 was specific toward activation of RHO-1 GTPase signaling. RNAi further implicated actin-binding proteins ARX-3 and ARX-5, thus the actin cytoskeleton, as one of the targets of OSG-1/RHO-1 signaling. Taken together these data suggest that OSG-1 is recruited under conditions of oxidative stress, a hallmark of aging, and contributes to promote loss of neuronal function by affecting the actin cytoskeleton via altered RHO-1 activity. PMID:25527286

  5. A High-Throughput Assay for Rho Guanine Nucleotide Exchange Factors Based on the Transcreener GDP Assay.


    Reichman, Melvin; Schabdach, Amanda; Kumar, Meera; Zielinski, Tom; Donover, Preston S; Laury-Kleintop, Lisa D; Lowery, Robert G


    Ras homologous (Rho) family GTPases act as molecular switches controlling cell growth, movement, and gene expression by cycling between inactive guanosine diphosphate (GDP)- and active guanosine triphosphate (GTP)-bound conformations. Guanine nucleotide exchange factors (GEFs) positively regulate Rho GTPases by accelerating GDP dissociation to allow formation of the active, GTP-bound complex. Rho proteins are directly involved in cancer pathways, especially cell migration and invasion, and inhibiting GEFs holds potential as a therapeutic strategy to diminish Rho-dependent oncogenesis. Methods for measuring GEF activity suitable for high-throughput screening (HTS) are limited. We developed a simple, generic biochemical assay method for measuring GEF activity based on the fact that GDP dissociation is generally the rate-limiting step in the Rho GTPase catalytic cycle, and thus addition of a GEF causes an increase in steady-state GTPase activity. We used the Transcreener GDP Assay, which relies on selective immunodetection of GDP, to measure the GEF-dependent stimulation of steady-state GTP hydrolysis by small GTPases using Dbs (Dbl's big sister) as a GEF for Cdc42, RhoA, and RhoB. The assay is well suited for HTS, with a homogenous format and far red fluorescence polarization (FP) readout, and it should be broadly applicable to diverse Rho GEF/GTPase pairs.

  6. RIC8 is a guanine-nucleotide exchange factor for Galpha subunits that regulates growth and development in Neurospora crassa.


    Wright, Sara J; Inchausti, Regina; Eaton, Carla J; Krystofova, Svetlana; Borkovich, Katherine A


    Heterotrimeric (αβγ) G proteins are crucial components of eukaryotic signal transduction pathways. G-protein-coupled receptors (GPCRs) act as guanine nucleotide exchange factors (GEFs) for Gα subunits. Recently, facilitated GDP/GTP exchange by non-GPCR GEFs, such as RIC8, has emerged as an important mechanism for Gα regulation in animals. RIC8 is present in animals and filamentous fungi, such as the model eukaryote Neurospora crassa, but is absent from the genomes of baker's yeast and plants. In Neurospora, deletion of ric8 leads to profound defects in growth and asexual and sexual development, similar to those observed for a mutant lacking the Gα genes gna-1 and gna-3. In addition, constitutively activated alleles of gna-1 and gna-3 rescue many defects of Δric8 mutants. Similar to reports in Drosophila, Neurospora Δric8 strains have greatly reduced levels of G-protein subunits. Effects on cAMP signaling are suggested by low levels of adenylyl cyclase protein in Δric8 mutants and suppression of Δric8 by a mutation in the protein kinase A regulatory subunit. RIC8 acts as a GEF for GNA-1 and GNA-3 in vitro, with the strongest effect on GNA-3. Our results support a role for RIC8 in regulating GNA-1 and GNA-3 in Neurospora.

  7. Plasma Hypoxanthine-Guanine Phosphoribosyl Transferase Activity in Bottlenose Dolphins Contributes to Avoiding Accumulation of Non-recyclable Purines

    PubMed Central

    López-Cruz, Roberto I.; Crocker, Daniel E.; Gaxiola-Robles, Ramón; Bernal, Jaime A.; Real-Valle, Roberto A.; Lugo-Lugo, Orlando; Zenteno-Savín, Tania


    Marine mammals are exposed to ischemia/reperfusion and hypoxia/reoxygenation during diving. During oxygen deprivation, adenosine triphosphate (ATP) breakdown implies purine metabolite accumulation, which in humans is associated with pathological conditions. Purine recycling in seals increases in response to prolonged fasting and ischemia. Concentrations of metabolites and activities of key enzymes in purine metabolism were examined in plasma and red blood cells from bottlenose dolphins (Tursiops truncatus) and humans. Hypoxanthine and inosine monophosphate concentrations were higher in plasma from dolphins than humans. Plasma hypoxanthine-guanine phosphoribosyl transferase (HGPRT) activity in dolphins suggests an elevated purine recycling rate, and a mechanism for avoiding accumulation of non-recyclable purines (xanthine and uric acid). Red blood cell concentrations of hypoxanthine, adenosine diphosphate, ATP and guanosine triphosphate were lower in dolphins than in humans; adenosine monophosphate and nicotinamide adenine dinucleotide concentrations were higher in dolphins. HGPRT activity in red blood cells was higher in humans than in dolphins. The lower concentrations of purine catabolism and recycling by-products in plasma from dolphins could be beneficial in providing substrates for recovery of ATP depleted during diving or vigorous swimming. These results suggest that purine salvage in dolphins could be a mechanism for delivering nucleotide precursors to tissues with high ATP and guanosine triphosphate requirements. PMID:27375492

  8. The Guanine Nucleotide Exchange Factor Brx: A Link between Osmotic Stress, Inflammation and Organ Physiology and Pathophysiology

    PubMed Central

    Kino, Tomoshige; Segars, James H.; Chrousos, George P.


    SUMMARY Dehydration, and consequent intracellular hyperosmolarity, is a major challenge to land organisms, as it is associated with extraction of water from cells and disturbance of global cellular function. Organisms have thus developed a highly conserved regulatory mechanism that transduces the hyperosmolarity signal from the cell surface to the cell nucleus and adjusts the expression of cellular osmolarity-regulating genes. We recently found that the Rho-type guanine nucleotide exchange factor Brx, or AKAP13, is essential for osmotic stress-stimulated expression of nuclear factor of activated T-cells 5 (NFAT5), a key transcription factor of intracellular osmolarity. It accomplishes this by first attracting cJun kinase (JNK)-interacting protein (JIP) 4 and then coupling activated Rho-type small G-proteins to cascade components of the p38 MAPK signaling pathway, ultimately activating NFAT5. We describe the potential implications of osmotic stress and Brx activation in organ physiology and pathophysiology and connect activation of this system to key human homeostatic states. PMID:21037977

  9. Peroxynitrite-induced oxidation and nitration products of guanine and 8-oxoguanine: structures and mechanisms of product formation.


    Niles, Jacquin C; Wishnok, John S; Tannenbaum, Steven R


    Peroxynitrite induces DNA base damage predominantly at guanine (G) and 8-oxoguanine (8-oxoG) nucleobases via oxidation reactions. Nitration products are also observed, consistent with the generation of radical intermediates that can recombine with the (.)NO(2) formed during peroxynitrite degradation. The neutral G radical, G(.), reacts with (.)NO(2) to yield 8-nitroguanine (8-nitroG) and 5-nitro-4-guanidinohydantoin (NI), while for 8-oxoG we have proposed a reactive guanidinylidene radical intermediate. The products generated during peroxynitrite-mediated 8-oxoG oxidation depend on oxidant flux, with dehydroguanidinohydantoin (DGh), 2,4,6-trioxo-[1,3,5]triazinane-1-carboxamidine (CAC) and NO(2)-DGh predominating at high fluxes and spiroiminodihydantoin (Sp), guanidinohydantoin (Gh) and 4-hydroxy-2,5-dioxo-imidazolidine-4-carboxylic acid (HICA) predominating at low fluxes. Both product sets are observed at intermediate fluxes. It is therefore important in model systems to ensure that the relative concentrations are well controlled to minimize competing reactions that may not be relevant in vivo. Increasingly sophisticated systems for modeling peroxynitrite production in vivo are being developed and these should help with predicting the products most likely to be formed in vivo. Together with the emerging information on the genotoxic and mutational characteristics of the individual oxidation products, it may be found that the extent of tissue damage, mutational spectra and, hence, cancer risk may change as a function of peroxynitrite fluxes as different product combinations predominate.

  10. Molecular nature of spontaneous mutations at the hypoxanthine-guanine phosphoribosyltransferase (hprt) locus in Chinese hamster ovary cells.


    Xu, Z; Yu, Y; Schwartz, J L; Meltz, M L; Hsie, A W


    The hypoxanthine-guanine phosphoribosyltransferase (hprt) locus has been widely used as a selectable genetic marker for studies of mammalian cell mutagenesis. We report here the spontaneous mutation spectrum at the hprt locus in 64 independently isolated mutants of Chinese hamster ovary (CHO) cells. All nine hprt exons were simultaneously analyzed via multiplex polymerase chain reaction (PCR) for rapid detection of gene deletions or insertions. Structural point mutations were identified by direct sequence analysis of the PCR amplified cDNA. The molecular nature of RNA splicing errors and insertions was analyzed by solid-phase direct exon sequencing. Single base substitutions were found in 24 mutants (38%), of which 21 were missense and 3 were nonsense mutations. Transversions were about twice as frequent as transitions. Fifteen mutants (23%) had deletions involving either intragenic small fragments (2), single exons (9), or multiple exons (4). The majority of deletion breakpoints (71%) were located in regions surrounding exons 4, 5, and 6. RNA splicing mutations were observed in 15 mutants (23%) and affected exons 3-8; most (6/15) resulted in the loss of exon 7. Two insertion mutants, one with a 209 bp insert in exon 4 and the other with a 88 bp insert accompanied by a 24 bp deletion in exon 6, represent novel mutations reported for the first time in spontaneous mutants of the mammalian hprt gene.

  11. Assay of Rab17 and its guanine nucleotide exchange factor Rabex-5 in the dendrites of hippocampal neurons.


    Mori, Yasunori; Fukuda, Mitsunori


    Neurons are functionally and morphologically compartmentalized into axons and dendrites, and the localization of specific proteins within these compartments is critical to the proper formation of neuronal networks, which includes neurite morphogenesis and synapse formation. The small GTPase Rab17 is specifically localized in dendrites and is not found in axons, and it regulates the dendrite morphogenesis and postsynaptic development of mouse hippocampal neurons. However, the spatiotemporal regulation of Rab17 is poorly understood. We recently identified Rabex-5, originally described as a Rab5-guanine nucleotide exchange factor (GEF), as a physiological Rab17-GEF that promotes translocation of Rab17 from the cell body to the dendrites of developing hippocampal neurons. Knockdown of Rab17 in mouse hippocampal neurons resulted in reductions in dendrite growth, branch numbers, filopodium density, and active synapse numbers. Knockdown of Rab17-GEF Rabex-5 in hippocampal neurons resulted in decreased targeting of Rab17 to the dendrites, which led to a reduction in dendrite growth. In this chapter we describe the assay procedures for analyzing Rab17 and Rabex-5 in cultured mouse hippocampal neurons, and we particularly focus on the measurement of total dendrite (or axon) length and total dendrite (or axon) branch numbers, filopodium density, number of active synapses, and dendritic Rab17 signals.

  12. Activation of ras p21 transforming properties associated with an increase in the release rate of bound guanine nucleotide.

    PubMed Central

    Lacal, J C; Aaronson, S A


    An Ala-to-Thr substitution at position 59 activates the transforming properties of the p21ras protein without impairment of GTPase activity, a biochemical alteration associated with other activating mutations. To investigate the basis for the transforming properties of the Thr-59 mutant, we characterized guanine nucleotide release. This reaction exhibited a slow rate and stringent temperature requirements. To further dissect the release reaction, we used monoclonal antibodies directed against different epitopes of the p21 molecule. One monoclonal specifically interfered with nucleotide release, while others which recognized different regions of the molecule blocked nucleotide binding. Mutants with the Thr-59 substitution exhibited a three- to ninefold-higher rate of GDP and GTP release than normal p21 or mutants with other activating lesions. This alteration in the Thr-59 mutant would have the effect of increasing its rate of nucleotide exchange. In an intracellular environment with a high GTP/GDP ratio, this would favor the association of GTP with the Thr-59 mutant. Consistent with knowledge of known G-regulatory proteins, these findings support a model in which the p21-GTP complex is the biologically active form of the p21 protein. PMID:3540608

  13. DPT tautomerisation of the wobble guanine·thymine DNA base mispair is not mutagenic: QM and QTAIM arguments.


    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M


    We have shown for the first time, connecting QM methods with QTAIM analysis and using the methodology of the sweeps of the energetical, electron-topological and geometrical parameters, that the tautomerisation of the wobble guanine·thymine (wG·T) DNA base mispair into the wG(*)·T(*) base mispair induced by the double proton transfer (DPT), which undergoes a concerted asynchronous pathway, is not mutagenic. The wG·T → wG(*)·T(*) DPT tautomerisation does not result in the transition of the G base into its mutagenic tautomeric form G(*) able to mispair with the T base within the Watson-Crick base pairing scheme. This observation is explained by the so-called quantum protection of the wG·T DNA base mispair from its mutagenic tautomerisation - the dynamical non-stability of the tautomerised wG(*)·T(*) base mispair and significantly negative value of the Gibbs free energy of activation for the reverse reaction of the wG·T → wG(*)·T(*) DPT tautomerisation.

  14. Functional characterization of the guanine nucleotide exchange factor (GEF) motif of GIV protein reveals a threshold effect in signaling.


    Garcia-Marcos, Mikel; Kietrsunthorn, Patrick S; Pavlova, Yelena; Adia, Michelle A; Ghosh, Pradipta; Farquhar, Marilyn G


    Heterotrimeric G proteins are critical signal-transducing molecules controlled by a complex network of regulators. GIV (a.k.a. Girdin) is a unique component of this network and a nonreceptor guanine nucleotide exchange factor (GEF) that functions via a signature motif. GIV's GEF motif is involved in the regulation of critical biological processes such as phosphoinositide 3 kinase (PI3K)-Akt signaling, actin cytoskeleton remodeling, cell migration, and cancer metastasis. Here we investigated how the GEF function of GIV affects the wiring of its signaling pathway to shape different biological responses. Using a structure-guided approach, we designed a battery of GIV mutants with different Gαi-binding and -activating properties and used it to dissect the specific impact of changes in GIV's GEF activity on several cellular responses. In vivo signaling assays revealed a threshold effect of GEF activity for the activation of Akt by GIV in different cell lines and by different stimuli. Akt signaling is minimal at low GEF activity and is sharply increased to reach a maximum above a threshold of GEF activity, suggesting that GIV is a critical signal amplifier and that activation of Akt is ultrasensitive to changes in GIV's GEF activity. A similar threshold dependence was observed for other biological functions promoted by GIV such as remodeling of the actin cytoskeleton and cell migration. This functional characterization of GIV's GEF motif provides insights into the molecular interactions between nonreceptor GEFs and G proteins and the mechanisms that govern this signal transduction pathway.

  15. The Rho-guanine nucleotide exchange factor Trio controls leukocyte transendothelial migration by promoting docking structure formation.


    van Rijssel, Jos; Kroon, Jeffrey; Hoogenboezem, Mark; van Alphen, Floris P J; de Jong, Renske J; Kostadinova, Elena; Geerts, Dirk; Hordijk, Peter L; van Buul, Jaap D


    Leukocyte transendothelial migration involves the active participation of the endothelium through the formation of apical membrane protrusions that embrace adherent leukocytes, termed docking structures. Using live-cell imaging, we find that prior to transmigration, endothelial docking structures form around 80% of all neutrophils. Previously we showed that endothelial RhoG and SGEF control leukocyte transmigration. In this study, our data reveal that both full-length Trio and the first DH-PH (TrioD1) domain of Trio, which can activate Rac1 and RhoG, interact with ICAM-1 and are recruited to leukocyte adhesion sites. Moreover, upon clustering of ICAM-1, the Rho-guanine nucleotide exchange factor Trio activates Rac1, prior to activating RhoG, in a filamin-dependent manner. We further show that docking structure formation is initiated by ICAM-1 clustering into ring-like structures, which is followed by apical membrane protrusion. Interestingly, we find that Rac1 is required for ICAM-1 clustering, whereas RhoG controls membrane protrusion formation. Finally, silencing endothelial Trio expression or reducing TrioD1 activity without affecting SGEF impairs both docking structure formation and leukocyte transmigration. We conclude that Trio promotes leukocyte transendothelial migration by inducing endothelial docking structure formation in a filamin-dependent manner through the activation of Rac1 and RhoG.

  16. Myosin II directly binds and inhibits Dbl family guanine nucleotide exchange factors: a possible link to Rho family GTPases

    PubMed Central

    Lee, Chan-Soo; Choi, Chang-Ki; Schwartz, Martin Alexander


    Cell migration requires the coordinated spatiotemporal regulation of actomyosin contraction and cell protrusion/adhesion. Nonmuscle myosin II (MII) controls Rac1 and Cdc42 activation, and cell protrusion and focal complex formation in migrating cells. However, these mechanisms are poorly understood. Here, we show that MII interacts specifically with multiple Dbl family guanine nucleotide exchange factors (GEFs). Binding is mediated by the conserved tandem Dbl homology–pleckstrin homology module, the catalytic site of these GEFs, with dissociation constants of ∼0.3 µM. Binding to the GEFs required assembly of the MII into filaments and actin-stimulated ATPase activity. Binding of MII suppressed GEF activity. Accordingly, inhibition of MII ATPase activity caused release of GEFs and activation of Rho GTPases. Depletion of βPIX GEF in migrating NIH3T3 fibroblasts suppressed lamellipodial protrusions and focal complex formation induced by MII inhibition. The results elucidate a functional link between MII and Rac1/Cdc42 GTPases, which may regulate protrusion/adhesion dynamics in migrating cells. PMID:20713598

  17. Critical function of RA-GEF-2/Rapgef6, a guanine nucleotide exchange factor for Rap1, in mouse spermatogenesis.


    Okada, Keisuke; Miyake, Hideaki; Yamaguchi, Kohei; Chiba, Koji; Maeta, Kazuhiro; Bilasy, Shymaa E; Edamatsu, Hironori; Kataoka, Tohru; Fujisawa, Masato


    Small GTPase Rap1 has been implicated in the proper differentiation of testicular germ cells. In the present study, we investigated the functional significance of RA-GEF-2/Rapgef6, a guanine nucleotide exchange factor for Rap1, in testicular differentiation using mice lacking RA-GEF-2. RA-GEF-2 was expressed predominantly on the luminal side of the seminiferous tubules in wild-type mice. No significant differences were observed in the body weights or hormonal parameters of RA-GEF-2(-)(/)(-) and wild-type mice. However, the testes of RA-GEF-2(-)(/)(-) male mice were significantly smaller than those of wild-type mice and were markedly atrophied as well as hypospermatogenic. The concentration and motility of epididymal sperm were also markedly reduced and frequently had an abnormal shape. The pregnancy rate and number of fetuses were markedly lower in wild-type females after they mated with RA-GEF-2(-)(/)(-) males than with wild-type males, which demonstrated the male infertility phenotype of RA-GEF-2(-)(/)(-) mice. Furthermore, a significant reduction and alteration were observed in the expression level and cell junctional localization of N-cadherin, respectively, in RA-GEF-2(-)(/)(-) testes, which may, at least in part, account for the defects in testicular differentiation and spermatogenesis in these mice.

  18. Electronic transition moments of 6-methyl isoxanthopterin--a fluorescent analogue of the nucleic acid base guanine.


    Widom, Julia R; Rappoport, Dmitrij; Perdomo-Ortiz, Alejandro; Thomsen, Hanna; Johnson, Neil P; von Hippel, Peter H; Aspuru-Guzik, Alán; Marcus, Andrew H


    Fluorescent nucleic acid base analogues are important spectroscopic tools for understanding local structure and dynamics of DNA and RNA. We studied the orientations and magnitudes of the electric dipole transition moments (EDTMs) of 6-methyl isoxanthopterin (6-MI), a fluorescent analogue of guanine that has been particularly useful in biological studies. Using a combination of absorption spectroscopy, linear dichroism (LD) and quantum chemical calculations, we identified six electronic transitions that occur within the 25,000-50,000 cm(-1) spectral range. Our results indicate that the two experimentally observed lowest-energy transitions, which occur at 29,687 cm(-1) (337 nm) and 34,596 cm(-1) (289 nm), are each polarized within the plane of the 6-MI base. A third in-plane polarized transition is experimentally observed at 47,547 cm(-1) (210 nm). The theoretically predicted orientation of the lowest-energy transition moment agrees well with experiment. Based on these results, we constructed an exciton model to describe the absorption spectra of a 6-MI dinucleotide-substituted double-stranded DNA construct. This model is in good agreement with the experimental data. The orientations and intensities of the low-energy electronic transitions of 6-MI reported here should be useful for studying local conformations of DNA and RNA in biologically important complexes.

  19. Electron transfer from aromatic amino acids to guanine and adenine radical cations in pi stacked and T-shaped complexes.


    Butchosa, Cristina; Simon, Sílvia; Voityuk, Alexander A


    Similar redox properties of the natural nucleobases and aromatic amino acids make it possible for electron transfer (ET) to occur between these sites in protein-nucleic acid complexes. Using DFT calculations, we estimate the ET rate from aromatic amino acid X (X = Phe, His, Tyr and Trp) to radical cations of guanine (G) and adenine (A) in dimers G-X and A-X with different arrangement of the subunits. We show that irrespective of the mutual orientation of the aromatic rings, the electronic interaction in the systems is strong enough to ensure effective ET from X to G(+) or A(+). Surprisingly, relatively high ET rates are found in T-shaped dimers. This suggests that pi stacking of nucleobases and aromatic amino acids is not required for feasible ET. In most complexes [G-X](+) and [A-X](+), we find the excess charge to be confined to a single site, either the nucleobase or amino acid X. Then, conformational changes may initiate migration of the radical cation state from the nucleobase to X and back. The ET process from Trp and Tyr to G(+) is found to be faster than deprotonation of G(+). Because the last reaction may lead to the formation of highly mutagenic species, the efficient repair of G(+) may play an important role in the protection of genomic DNA from oxidative damage.

  20. [The clinical effects of a new antiviral 9-(2-hydroxyethoxymethyl) guanine (aciclovir) against herpes virus infections].


    Masaoka, T; Shibata, H; Amaki, I; Takeo, H; Sakurai, K; Ise, T; Ohhira, M; Tanaka, M; Shimoyama, M; Ishihara, K; Shibata, A; Moriyama, Y; Arimori, S; Nagao, T; Yamada, K; Ohno, R; Kodera, Y; Yamada, H; Hirota, Y; Fujiwara, Y; Nakaide, Y; Yoshikawa, S; Yoshikawa, H; Akao, Y; Hattori, K; Funada, H; Yoshida, T; Tsujino, G; Sako, M; Nagai, K; Kanamaru, A; Fujita, S; Tasaka, E; Hamada, T; Takahashi, M


    The clinical effects of a new anti-viral 9-(2-hydroxymethoxymethyl) guanine (Aciclovir) against Herpes virus infections have been investigated. The patients had malignant tumours or auto-immune disease complicated by shingles and chicken pox due to Vaicella zoster virus (VZV) (43 cases), Herpes simplex virus (HSV) (10 cases) and 9 cases which were clinically diagnosed as Herpes, though the virus was not confirmed as the causative agent. As a general principle the dosage of Aciclovir was 5 mg/kg, t. i. d. for 5 days by slow intravenous infusion. The clinically effective rate against VZV was 93%, being excellent in 42% and against HSV it was 80%, being excellent in 40% and when the results of the cases of unknown origin were included it was excellent in 40% and the cumulative effective rate was 88%. Concerning the efficacy in reduction of pain, swelling, disappearance of vesicles and new scab formation, the effect was most noticeable after the third day of treatment. Treatment given early in the disease is likely to provide better results. Concerning side effects, one of 62 patients had proteinuria and the other had a drug rash and an abnormal liver function test. It is likely that the combination of treatment and the primary disease had some influence, but the cause/effect relationship to Aciclovir treatment is not clear.

  1. DNA-directed aniline mustards with high selectivity for adenine or guanine bases: mutagenesis in a variety of Salmonella typhimurium strains differing in DNA-repair capability.


    Ferguson, L R; Denny, W A; Boritzki, T J


    Two closely-related aniline monomustards (1 and 2), linked to a DNA-targeting acridine chromophore by a linker chain of different length, show high selectivity for alkylation of polymer DNA. The shorter-chain derivative (2) alkylates mainly at guanine N7 sites, while the longer-chain analogue (1) reacts almost exclusively at adenine N1. The biological effects of these compounds have been studied in standard Ames Salmonella typhimurium strains in order to determine the mutagenic consequences of such well-defined DNA lesions, and the effect of DNA-repair systems on them. Both compounds caused detectable mutations in strains TA1537, TA98 or TA100 and some related strains. Mutation rates were greatly enhanced in strains carrying either a uvrB deletion or the plasmid pKM101. Frameshift mutagenesis by both compounds was completely eliminated by recA deletion, in both the presence or absence of the plasmid. The adenine-selective compound (1) appeared more sensitive to the DNA-repair defects than the guanine-selective derivative (2). Additionally, only the adenine-selective compound (1) caused statistically significant levels of detectable mutation in the repair-proficient strains TA102, TA4001 or TA4006. The bacterial mutagenesis evidence suggests that a bulky, major groove-residing adenine lesion may be more readily recognised by DNA-repair systems, and more likely to lead to a wider range of mutagenic events, than a similar guanine lesion.

  2. Toward electrochemical resolution of two genes on one electrode: using 7-deaza analogues of guanine and adenine to prepare PCR products with differential redox activity.


    Yang, Ivana V; Ropp, Patricia A; Thorp, H Holden


    The 7-deaza analogues of guanine and adenine were incorporated into polymerase chain reaction (PCR) products by substitution of the appropriate nucleotide triphosphates into the reaction. These PCR products can be immobilized on ITO electrodes and detected by catalytic cyclic voltammetry with ruthenium polypyridyl complexes. Immobilization on indium tin oxide (ITO) electrodes of 330- and 1200-base pair (bp) PCR amplicons from the E. coli dacA gene containing one or both of the 7-deazapurines was effected by precipitation from a 9:1 DMF/acetate solution. Amplicons containing the 7-deazaguanine base were detected by observing current enhancement in the cyclic voltammogram of Ru(dmb)3(3)+/2+ (dmb = 4,4'-dimethyl-2,2'-bipyridine) due to the selective oxidation of the modified base by this mediator. Oxidation of incorporated 7-deazaadenine bases in addition to native guanines gives rise to a higher current enhancement in the cyclic voltammogram of Ru(bpy)3(3)+/2+ (bpy = 2,2'-bipyridine) compared to the enhancement observed in the presence of guanine only. This strategy was employed to simultaneously detect the 330-bp sequence containing 7-deazaadenine and the 1200-bp sequence containing 7-deazaguanine on the same ITO electrode. Such a strategy may provide a means for detecting multiple genes on a single microlocation and may thereby lead to more highly multiplexed gene assays.

  3. Mammalian Mon2/Ysl2 regulates endosome-to-Golgi trafficking but possesses no guanine nucleotide exchange activity toward Arl1 GTPase

    NASA Astrophysics Data System (ADS)

    Mahajan, Divyanshu; Boh, Boon Kim; Zhou, Yan; Chen, Li; Cornvik, Tobias Carl; Hong, Wanjin; Lu, Lei


    Arl1 is a member of Arf family small GTPases that is essential for the organization and function of Golgi complex. Mon2/Ysl2, which shares significant homology with Sec7 family Arf guanine nucleotide exchange factors, was poorly characterized in mammalian cells. Here, we report the first in depth characterization of mammalian Mon2. We found that Mon2 localized to trans-Golgi network which was dependent on both its N and C termini. The depletion of Mon2 did not affect the Golgi localized or cellular active form of Arl1. Furthermore, our in vitro assay demonstrated that recombinant Mon2 did not promote guanine nucleotide exchange of Arl1. Therefore, our results suggest that Mon2 could be neither necessary nor sufficient for the guanine nucleotide exchange of Arl1. We demonstrated that Mon2 was involved in endosome-to-Golgi trafficking as its depletion accelerated the delivery of furin and CI-M6PR to Golgi after endocytosis.

  4. Oxidative generation of guanine radicals by carbonate radicals and their reactions with nitrogen dioxide to form site specific 5-guanidino-4-nitroimidazole lesions in oligodeoxynucleotides.


    Joffe, Avrum; Mock, Steven; Yun, Byeong Hwa; Kolbanovskiy, Alexander; Geacintov, Nicholas E; Shafirovich, Vladimir


    A simple photochemical approach is described for synthesizing site specific, stable 5-guanidino-4-nitroimidazole (NIm) adducts in single- and double-stranded oligodeoxynucleotides containing single and multiple guanine residues. The DNA sequences employed, 5'-d(ACC CG(1)C G(2)TC CG(3)C G(4)CC) and 5'-d(ACC CG(1)C G(2)TC C), were a portion of exon 5 of the p53 tumor suppressor gene, including the codons 157 (G(2)) and 158 (G(3)) mutation hot spots in the former sequence with four Gs and the codon 157 (G(2)) mutation hot spot in the latter sequence with two Gs. The nitration of oligodeoxynucleotides was initiated by the selective photodissociation of persulfate anions to sulfate radicals induced by UV laser pulses (308 nm). In aqueous solutions, of bicarbonate and nitrite anions, the sulfate radicals generate carbonate anion radicals and nitrogen dioxide radicals by one electron oxidation of the respective anions. The guanine residue in the oligodeoxynucleotide is oxidized by the carbonate anion radical to form the neutral guanine radical. While the nitrogen dioxide radicals do not react with any of the intact DNA bases, they readily combine with the guanine radicals at either the C8 or the C5 positions. The C8 addition generates the well-known 8-nitroguanine (8-nitro-G) lesions, whereas the C5 attack produces unstable adducts, which rapidly decompose to NIm lesions. The maximum yields of the nitro products (NIm + 8-nitro-G) were typically in the range of 20-40%, depending on the number of guanine residues in the sequence. The ratio of the NIm to 8-nitro-G lesions gradually decreases from 3.4 in the model compound, 2',3',5'-tri-O-acetylguanosine, to 2.1-2.6 in the single-stranded oligodeoxynucleotides and to 0.8-1.1 in the duplexes. The adduct of the 5'-d(ACC CG(1)C G(2)TC C) oligodeoxynucleotide containing the NIm lesion in codon 157 (G(2)) was isolated in HPLC-pure form. The integrity of this adduct was established by a detailed analysis of exonuclease digestion

  5. Interaction of a tricationic meso-substituted porphyrin with guanine-containing polyribonucleotides of various structures

    NASA Astrophysics Data System (ADS)

    Ryazanova, Olga; Zozulya, Victor; Voloshin, Igor; Glamazda, Alexander; Dubey, Igor; Dubey, Larysa; Karachevtsev, Victor


    The interaction of a tricationic water-soluble meso-(N-methylpyridinium)-substituted porphyrin, TMPyP3+, derived from classic TMPyP4, with double-stranded poly(G)  ṡ  poly(C) and four-stranded poly(G) polyribonucleotides has been studied in aqueous buffered solutions, pH 6.9, of low and near-physiological ionic strengths in a wide range of molar phosphate-to-dye ratios (P/D). To clarify the binding modes of TMPyP3+ to biopolymers various spectroscopic techniques, including absorption and polarized fluorescence spectroscopy, Raman spectroscopy, and resonance light scattering, were used. As a result, two competitive binding modes were revealed. In solution of low ionic strength outside binding of the porphyrin to the polynucleotide backbone with self-stacking prevailed at low P/D ratios (P/D  <  3.5). It manifested itself by the substantial quenching of porphyrin fluorescence. Also the formation of large-scale porphyrin aggregates was observed near the stoichiometric binding ratio. The spectral changes observed at P/D  >  30 including emission enhancement were supposed to be caused by the embedding of partially stacked porphyrin J-dimers into the polymer groove. TMPyP3+ binding to poly(G) induced a fluorescence increase 2.5 times as large as that observed for poly(G)  ṡ  poly(C). In solution of near-physiological ionic strength the efficiency of external porphyrin binding was reduced substantially due to the competitive binding of Na+ ions with the polymer backbone. The spectroscopic characteristics of porphyrin bound to polynucleotides at different conditions were compared with those for free porphyrin.

  6. Suppression of breast cancer metastasis through the inactivation of ADP-ribosylation factor 1

    PubMed Central

    Xie, Xiayang; Tang, Shou-Ching; Cai, Yafei; Pi, Wenhu; Deng, Libin; Wu, Guangyu; Chavanieu, Alain; Teng, Yong


    Metastasis is the major cause of cancer-related death in breast cancer patients, which is controlled by specific sets of genes. Targeting these genes may provide a means to delay cancer progression and allow local treatment to be more effective. We report for the first time that ADP-ribosylation factor 1 (ARF1) is the most amplified gene in ARF gene family in breast cancer, and high-level amplification of ARF1 is associated with increased mRNA expression and poor outcomes of patients with breast cancer. Knockdown of ARF1 leads to significant suppression of migration and invasion in breast cancer cells. Using the orthotopic xenograft model in NSG mice, we demonstrate that loss of ARF1 expression in breast cancer cells inhibits pulmonary metastasis. The zebrafish-metastasis model confirms that the ARF1 gene depletion suppresses breast cancer cells to metastatic disseminate throughout fish body, indicating that ARF1 is a very compelling target to limit metastasis. ARF1 function largely dependents on its activation and LM11, a cell-active inhibitor that specifically inhibits ARF1 activation through targeting the ARF1-GDP/ARNO complex at the Golgi, significantly impairs metastatic capability of breast cancer cell in zebrafish. These findings underline the importance of ARF1 in promoting metastasis and suggest that LM11 that inhibits ARF1 activation may represent a potential therapeutic approach to prevent or treat breast cancer metastasis. PMID:27517156

  7. Correlation between vibrational frequencies and hydrogen bonding states of the guanine ring studied by UV resonance Raman spectroscopy of 2'-deoxy-3',5'-bis(triisopropylsilyl)guanosine dissolved in various solvents

    NASA Astrophysics Data System (ADS)

    Toyama, Akira; Hamuara, Mutsuo; Takeuchi, Hideo


    Ultraviolet resonance Raman spectra of 2'-deoxy-3',5'-bis(triisopropylsilyl)guanosine (TPS-dGuo) were recorded in non-hydrogen bonding, proton acceptor, and proton donor/acceptor solvents. Raman spectral changes observed on going from inert to proton acceptor solvents were ascribed to the hydrogen bonding at the proton donor sites of the guanine ring (N1H and C2NH 2), and the spectral changes associated with the solvent change from proton acceptor to donor/acceptor were ascribed to the hydrogen bonding at the proton acceptor sites (N3, C6O, and N7). A Raman band appearing at 1624 cm -1 in inert solvents is assigned mainly to the NH 2 scissors mode and its frequency changes to ≈ 1640 cm -1 in acceptor solvents, reflecting the hydrogen bonding at C2NH 2. Another band at 1581 cm -1, arising largely from the N1H bend, shows an upshift of ≈ 10 cm -1 upon hydrogen bonding at either N1H or acceptor sites. Hydrogen bonding at the acceptor sites also produces frequency shifts of other Raman bands (at 1710, 1565, 1528, 1481, and 1154 cm -1 in 1,2-dichloroethane solution). Among the Raman bands listed above, the 1710 cm -1 band due to the C6O stretch decreases in frequency, whereas the others increase. The downshift of the C6O stretching frequency is correlated with the strength of hydrogen bonding at C6O. The frequency of the 1481 cm -1 band increases with a decrease of the C6O stretching frequency, indicating that the 1481 cm -1 band is also a marker of hydrogen bonding at C6O. This finding is in sharp contrast to the previously proposed correlation with the hydrogen bonding at N7. The 1565 cm -1 band is assigned to a vibration mainly involving the N1C2N3 linkage, and its frequency increases with increasing strength of the hydrogen bond at N3. Three bands around 1315, 1180, and 1030 cm -1, which are known to be sensitive to the ribose ring puckering and glycosidic bond orientation, also show small frequency changes upon hydrogen

  8. Guanine nucleotide binding proteins in zucchini seedlings: Characterization and interactions with the NPA receptor

    SciTech Connect

    Lindeberg, M.; Jacobs, M. )


    A microsomal membrane preparation from hypocotyls of dark-grown Cucurbita pepo L. seedlings contains specific high-affinity binding sites for the non-hydrolyzable GTP analog guanosine 5{prime}-({gamma}-thio) triphosphate (GTP-{gamma}-S). Both the binding affinity and the pattern of binding specificity for GTP and GTP analogs are similar to animal G-proteins, and two zucchini membrane proteins are recognized in western blots by antiserum specific for the {sigma} subunit of platelet G{sub s} protein. GTP-{gamma}-S can increase specific naphthylphthalamic acid (NPA) binding in zucchini microsomal membrane preparations, with its stimulation increasing with large tissue age. Al{sup +3} and F{sup {minus}} agents known to activate G-proteins - decreased NPA specific binding by ca. 15%. In tests of in vitro auxin transport employing zucchini plasma membrane vesicles, AlF{sup {minus}}{sub 4} strongly inhibited {sup 3}H-indoleacetic acid nor accumulation; GTP-{gamma}-S effects on this system will be discussed.

  9. Photoinduced Electron Transfer in DNA: Charge Shift Dynamics Between 8-Oxo-Guanine Anion and Adenine.


    Zhang, Yuyuan; Dood, Jordan; Beckstead, Ashley A; Li, Xi-Bo; Nguyen, Khiem V; Burrows, Cynthia J; Improta, Roberto; Kohler, Bern


    Femtosecond time-resolved IR spectroscopy is used to investigate the excited-state dynamics of a dinucleotide containing an 8-oxoguanine anion at the 5'-end and neutral adenine at the 3'-end. UV excitation of the dinucleotide transfers an electron from deprotonated 8-oxoguanine to its π-stacked neighbor adenine in less than 1 ps, generating a neutral 8-oxoguanine radical and an adenine radical anion. These species are identified by the excellent agreement between the experimental and calculated IR difference spectra. The quantum efficiency of this ultrafast charge shift reaction approaches unity. Back electron transfer from the adenine radical anion to the 8-oxguanine neutral radical occurs in 9 ps, or approximately 6 times faster than between the adenine radical anion and the 8-oxoguanine radical cation (Zhang, Y. et al. Proc. Natl. Acad. Sci. U.S.A. 2014, 111, 11612-11617). The large asymmetry in forward and back electron transfer rates is fully rationalized by semiclassical nonadiabatic electron transfer theory. Forward electron transfer is ultrafast because the driving force is nearly equal to the reorganization energy, which is estimated to lie between 1 and 2 eV. Back electron transfer is highly exergonic and takes place much more slowly in the Marcus inverted region.

  10. Thermodynamic Consequences of the Hyperoxidized Guanine Lesion Guanidinohydantoin in Duplex DNA

    PubMed Central

    Yennie, Craig J.; Delaney, Sarah


    Guanidinohydantoin (Gh) is a hyperoxidized DNA lesion produced by oxidation of 8-oxo-7,8-dihydroguanine (8-oxoG). Previous work has shown that Gh is potently mutagenic both in vitro and in vivo coding for G → T and G → C transversion mutations. In this work, analysis by circular dichroism shows that the Gh lesion does not significantly alter the global structure of a 15-mer duplex, and that the DNA remains in the B-form. However, we find that Gh causes a large decrease in the thermal stability, decreasing the duplex melting temperature by ~ 17 °C relative to an unmodified duplex control. Using optical melting analysis and differential scanning calorimetry the thermodynamic parameters describing duplex melting were also determined. We find that the Gh lesion causes a dramatic decrease in the enthalpic stability of the duplex. This enthalpic destabilization is somewhat tempered by entropic stabilization yet Gh results in an overall decrease in thermodynamic stability of the duplex relative to a control which lacks DNA damage, with a ΔΔG° of −7 kcal/mol. These results contribute to our understanding of the consequences of hyperoxidation of G and provide insight into how the thermal and thermodynamic destabilization caused by Gh may influence replication and/or repair of the lesion. PMID:22780843

  11. Biochemical, Biophysical and Cellular Techniques to Study the Guanine Nucleotide Exchange Factor, GIV/Girdin.


    Ghosh, Pradipta; Aznar, Nicolas; Swanson, Lee; Lo, I-Chung; Lopez-Sanchez, Inmaculada; Ear, Jason; Rohena, Cristina; Kalogriopoulos, Nicholas; Joosen, Linda; Dunkel, Ying; Sun, Nina; Nguyen, Peter; Bhandari, Deepali


    Canonical signal transduction via heterotrimeric G proteins is spatiotemporally restricted, i.e., triggered exclusively at the plasma membrane, only by agonist activation of G protein-coupled receptors via a finite process that is terminated within a few hundred milliseconds. Recently, a rapidly emerging paradigm has revealed a noncanonical pathway for activation of heterotrimeric G proteins via the nonreceptor guanidine-nucleotide exchange factor, GIV/Girdin. Biochemical, biophysical, and functional studies evaluating this pathway have unraveled its unique properties and distinctive spatiotemporal features. As in the case of any new pathway/paradigm, these studies first required an in-depth optimization of tools/techniques and protocols, governed by rationale and fundamentals unique to the pathway, and more specifically to the large multimodular GIV protein. Here we provide the most up-to-date overview of protocols that have generated most of what we know today about noncanonical G protein activation by GIV and its relevance in health and disease. © 2016 by John Wiley & Sons, Inc.

  12. Overexpression of GEFT, a Rho family guanine nucleotide exchange factor, predicts poor prognosis in patients with rhabdomyosarcoma.


    Sun, Chao; Liu, Chunxia; Li, Shugang; Li, Hongan; Wang, Yuanyuan; Xie, Yuwen; Li, Bingcheng; Cui, Xiaobin; Chen, Yunzhao; Zhang, Wenjie; Li, Feng


    Rhabdomyosarcoma (RMS) is one of the most common soft-tissue sarcomas in children and adolescents with poor prognosis. Yet, there is lack of effective prognostic biomarkers for RMS. The present study, therefore, aimed to explore potential biomarkers for RMS based on our previous findings using array comparative genomic hybridization. We investigated guanine nucleotide exchange factor, GEFT, at expression level in 45 RMS patients and 36 normal striated muscle controls using immunohistochemistry using tissue microarrays. The expression rate of GEFT in RMS samples (42/45, 93.33%) was significantly higher (P<0.05) than that in normal controls (5/36, 13.89%). Moreover, the overexpression rate of GEFT in RMS (31/45, 68.89%) was also significantly higher (P<0.05) than that in normal controls (0/36, 0.00%). Increased expression of GEFT correlated significantly with advanced disease stages (stages III/IV) (P=0.001), lymph node metastasis (P=0.019), and distant metastasis (P=0.004), respectively, in RMS patients. In addition, RMS patients having overexpressed GEFT experienced worse overall survival (OS) than those having low levels of GEFT (P=0.001). GEFT overexpression was determined to be an independent prognostic factor for poor OS in RMS patients (hazard ratio: 3.491, 95% confidence interval: 1.121-10.871, P=0.004). In conclusion, these observations provide the first evidence of GEFT overexpression in RMS and its correlations with disease aggressiveness and metastasis. These findings suggest that GEFT may serve as a promising biomarker predicting poor prognosis in RMS patients, thus implying its potential as a therapeutic target.

  13. The ect2 rho Guanine nucleotide exchange factor is essential for early mouse development and normal cell cytokinesis and migration.


    Cook, Danielle R; Solski, Patricia A; Bultman, Scott J; Kauselmann, Gunther; Schoor, Michael; Kuehn, Ralf; Friedman, Lori S; Cowley, Dale O; Van Dyke, Terry; Yeh, Jen Jen; Johnson, Leisa; Der, Channing J


    Ect2 is a member of the human Dbl family of guanine nucleotide exchange factors (RhoGEFs) that serve as activators of Rho family small GTPases. Although Ect2 is one of at least 25 RhoGEFs that can activate the RhoA small GTPase, cell culture studies using established cell lines determined that Ect2 is essential for mammalian cell cytokinesis and proliferation. To address the function of Ect2 in normal mammalian development, we performed gene targeting to generate Ect2 knockout mice. The heterozygous Ect2(+/-) mice showed normal development and life span, indicating that Ect2 haplodeficiency was not deleterious for development or growth. In contrast, Ect2(-/-) embryos were not found at birth or postimplantation stages. Ect2(-/-) blastocysts were recovered at embryonic day 3.5 but did not give rise to viable outgrowths in culture, indicating that Ect2 is required for peri-implantation development. To further assess the importance of Ect2 in normal cell physiology, we isolated primary fibroblasts from Ect2(fl/fl) embryos (MEFs) and ablated Ect2 using adenoviral delivery of Cre recombinase. We observed a significant increase in multinucleated cells and accumulation of cells in G2/M phase, consistent with a role for Ect2 in cytokinesis. Ect2 deficiency also caused enlargement of the cytoplasm and impaired cell migration. Finally, although Ect2-dependent activation of RhoA has been implicated in cytokinesis, Ect2 can also activate Rac1 and Cdc42 to cause growth transformation. Surprisingly, ectopic expression of constitutively activated RhoA, Rac1, or Cdc42, known substrates of Ect2, failed to phenocopy Ect2 and did not rescue the defect in cytokinesis caused by loss of Ect2. In summary, our results establish the unique role of Ect2 in development and normal cell proliferation.

  14. In vivo bypass efficiencies and mutational signatures of the guanine oxidation products 2-aminoimidazolone and 5-guanidino-4-nitroimidazole.


    Neeley, William L; Delaney, James C; Henderson, Paul T; Essigmann, John M


    The in vivo mutagenic properties of 2-aminoimidazolone and 5-guanidino-4-nitroimidazole, two products of peroxynitrite oxidation of guanine, are reported. Two oligodeoxynucleotides of identical sequence, but containing either 2-aminoimidazolone or 5-guanidino-4-nitroimidazole at a specific site, were ligated into single-stranded M13mp7L2 bacteriophage genomes. Wild-type AB1157 Escherichia coli cells were transformed with the site-specific 2-aminoimidazolone- and 5-guanidino-4-nitroimidazole-containing genomes, and analysis of the resulting progeny phage allowed determination of the in vivo bypass efficiencies and mutational signatures of the DNA lesions. 2-Aminoimidazolone was efficiently bypassed and 91% mutagenic, producing almost exclusively G to C transversion mutations. In contrast, 5-guanidino-4-nitroimidazole was a strong block to replication and 50% mutagenic, generating G to A, G to T, and to a lesser extent, G to C mutations. The G to A mutation elicited by 5-guanidino-4-nitroimidazole implicates this lesion as a novel source of peroxynitrite-induced transition mutations in vivo. For comparison, the error-prone bypass DNA polymerases were overexpressed in the cells by irradiation with UV light (SOS induction) prior to transformation. SOS induction caused little change in the efficiency of DNA polymerase bypass of 2-aminoimidazolone; however, bypass of 5-guanidino-4-nitroimidazole increased nearly 10-fold. Importantly, the mutation frequencies of both lesions decreased during replication in SOS-induced cells. These data suggest that 2-aminoimidazolone and 5-guanidino-4-nitroimidazole in DNA are substrates for one or more of the SOS-induced Y-family DNA polymerases and demonstrate that 2-aminoimidazolone and 5-guanidino-4-nitroimidazole are potent sources of mutations in vivo.

  15. Theoretical study of the protonation of the one-electron-reduced guanine-cytosine base pair by water.


    Hsu, Sodio C N; Wang, Tzu-Pin; Kao, Chai-Lin; Chen, Hui-Fen; Yang, Po-Yu; Chen, Hsing-Yin


    Prototropic equilibria in ionized DNA play an important role in charge transport and radiation damage of DNA and, therefore, continue to attract considerable attention. Although it is well-established that electron attachment will induce an interbase proton transfer from N1 of guanine (G) to N3 of cytosine (C), the question of whether the surrounding water in the major and minor grooves can protonate the one-electron-reduced G:C base pair still remains open. In this work, density functional theory (DFT) calculations were employed to investigate the energetics and mechanism for the protonation of the one-electron-reduced G:C base pair by water. Through the calculations of thermochemical cycles, the protonation free energies were estimated to be in the range of 11.6-14.2 kcal/mol. The calculations for the models of C(•-)(H(2)O)(8) and G(-H1)(-)(H(2)O)(16), which were used to simulate the detailed processes of protonation by water before and after the interbase proton transfer, respectively, revealed that the protonation proceeds through a concerted double proton transfer involving the water molecules in the first and second hydration shells. Comparing the present results with the rates of interbase proton transfer and charge transfer along DNA suggests that protonation on the C(•-) moiety is not competitive with interbase proton transfer, but the possibility of protonation on the G(-H1)(-) moiety after interbase proton transfer cannot be excluded. Electronic-excited-state calculations were also carried out by the time-dependent DFT approach. This information is valuable for experimental identification in the future.

  16. Association of genetic variants in the Rho guanine nucleotide exchange factor AKAP13 with familial breast cancer.


    Wirtenberger, Michael; Tchatchou, Sandrine; Hemminki, Kari; Klaes, Rüdiger; Schmutzler, Rita K; Bermejo, Justo L; Chen, Bowang; Wappenschmidt, Barbara; Meindl, Alfons; Bartram, Claus R; Burwinkel, Barbara


    The A-kinase anchor protein 13 (AKAP13, alias BRX and lbc) tethers cAMP-dependent protein kinase to its subcellular environment and catalyses Rho GTPases activity as a guanine nucleotide exchange factor. The crucial role of members of the Rho family of GTPases in carcinogenesis is well established and targeting Rho proteins with antineoplastic compounds has become a major effort in the fight against cancer. Thus, genetic alterations within the candidate cancer susceptibility gene AKAP13 would be expected to provoke a constitutive Rho signalling, thereby facilitating the development of cancer. Here, we analysed the potential impact of four polymorphic non-conservative amino acid exchanges (Arg494Trp, Lys526Gln, Asn1086Asp and Gly2461Ser) in AKAP13 on familial breast cancer. We performed a case-control study using genomic DNA of BRCA1/2 mutation-negative German female index patients from 601 unrelated families, among a subset of 356 high-risk families, and 1053 German female unrelated controls. The newfound Lys526Gln polymorphism revealed a significant association with familial breast cancer (OR = 1.58, 95% CI = 1.07-2.35) and an even stronger association with high-risk familial breast cancer (OR = 1.85, 95% CI = 1.19-2.88). Haplotype analyses were in line with genotype results displaying a similar significance as analyses of individual polymorphisms. Due to the pivotal role of AKAP13 in the Rho GTPases signalling network, this variant might affect the susceptibility to other cancers as well.

  17. Extent of the Acidification by N7-Coordinated cis-Diammine-Platinum(II) on the Acidic Sites of Guanine Derivatives

    PubMed Central

    Song, Bin; Oswald, Gerda; Bastian, Matthias


    Coordination of two monoprotonated 2'-deoxyguanosine 5'-monophosphate species, H(dGMP)−, via N7 to cis-(NH2)2Pt2+ gives the complex cis-(NH2)2Pt(H·dGMP)2 which is a four-protonic acid. The corresponding acidity constants were measured by potentiometric pH titrations (25℃; I = 0.1 M, NaNO3). The first two protons are released from the two -P(O)2(OH)− groups (PKa/1= 5.57; PKa/2 = 6.29) and the next two protons are from the H(N1) sites of the guanine residues (PKa/3 = 8.73; PKa/4 = 9.48). The micro acidity constants of the various sites are also evaluated. Comparison of these data with those determined for the three-protonic H2(dGMP)± (PKa/1 = 2.69 for the H+(N7) site; PKa/2 = 6.29 for -P(O)2(OH)− ;PKa/3 = 9.56 for H(N1)) shows that on average the N-7-coordinated Pt2+ acidifies the phosphate protons by Δ pKa = 0.36 and the H(N1) sites by Δ pKa = 0.46. These results are further compared with those obtained previously for cis-(NH2)2Pt(L)2, where L = 9-ethylguanine or monoprotonated 2'-deoxycytidine 5'-monophosphate. Conclusions regarding platinated DNA are also presented. PMID:18472808

  18. Mutation analysis of inhibitory guanine nucleotide binding protein alpha (GNAI) loci in young and familial pituitary adenomas.


    Demir, Hande; Donner, Iikki; Kivipelto, Leena; Kuismin, Outi; Schalin-Jäntti, Camilla; De Menis, Ernesto; Karhu, Auli


    Pituitary adenomas are neoplasms of the anterior pituitary lobe and account for 15-20% of all intracranial tumors. Although most pituitary tumors are benign they can cause severe symptoms related to tumor size as well as hypopituitarism and/or hypersecretion of one or more pituitary hormones. Most pituitary adenomas are sporadic, but it has been estimated that 5% of patients have a familial background. Germline mutations of the tumor suppressor gene aryl hydrocarbon receptor-interacting protein (AIP) predispose to hereditary pituitary neoplasia. Recently, it has been demonstrated that AIP mutations predispose to pituitary tumorigenesis through defective inhibitory GTP binding protein (Gαi) signaling. This finding prompted us to examine whether germline loss-of-function mutations in inhibitory guanine nucleotide (GTP) binding protein alpha (GNAI) loci are involved in genetic predisposition of pituitary tumors. To our knowledge, this is the first time GNAI genes are sequenced in order to examine the occurrence of inactivating germline mutations. Thus far, only somatic gain-of-function hot-spot mutations have been studied in these loci. Here, we have analyzed the coding regions of GNAI1, GNAI2, and GNAI3 in a set of young sporadic somatotropinoma patients (n = 32; mean age of diagnosis 32 years) and familial index cases (n = 14), thus in patients with a disease phenotype similar to that observed in AIP mutation carriers. In addition, expression of Gαi proteins was studied in human growth hormone (GH), prolactin (PRL), adrenocorticotropic hormone (ACTH)-secreting and non-functional pituitary tumors. No pathogenic germline mutations affecting the Gαi proteins were detected. The result suggests that loss-of-function mutations of GNAI loci are rare or nonexistent in familial pituitary adenomas.

  19. Formation of 8-hydroxy(deoxy)guanosine and generation of strand breaks at guanine residues in DNA by singlet oxygen

    SciTech Connect

    Devasagayam, T.P.A.; Obendorf, M.S.W.; Schulz, W.A.; Sies, H. ); Steenken, S. )


    Singlet molecular oxygen ({sup 1}O{sub 2}) was generated in aqueous solution (H{sub 2}O or D{sub 2}O) at 37 C by the thermal dissociation of the endoperoxide of 3,3'-(1,4-naphthylidene) dipropionate (NDPO{sub 2}). Guanosine and deoxyguanosine quench {sup 1}O{sub 2} with overall quenching rate constants of 6.2 {times} 10{sup 6} M{sup {minus}1} s{sup {minus}1} and 5.2 {times} 10{sup 6} M{sup {minus}1} s{sup {minus}1}, respectively. Reaction with {sup 1}O{sub 2} results in the formation of 8-hydroxyguanosine (8-OH-Guo) and 8-hydroxydeoxyguanosine (8-OH-dGuo), respectively, with a yield of 1.5% at 1 mM substrate with an NDPO{sub 2} concentration of 40 mM; a corresponding 8-hydroxy derivative is not formed from deoxyadenosine. in D{sub 2}O the yield of 8-OH-Guo is 1.5-fold that in H{sub 2}O. Sodium azide suppresses 8-OH-Guo and 8-OH-dGuo production. in contrast, the hydroxyl radical scavengers, tert-butanol, 2-propanol, or sodium formate, do not decrease the production of the 8-OH derivatives. The formation of 8-OH derivatives is significantly increased (2-5-fold) by thiols such as dithiothreitol, glutathione, cysteine, and cysteamine. With use of a plasmid containing a fragment of the mouse metallothionein 1 promoter (pMTP3') and a novel end-labeling technique, the position of {sup 1}O{sub 2}-induced single-strand breaks in DNA was examined. Strand breaks occur selectively at dGuo; no major differences (hot spots) were observed between individual guanines.

  20. Calcium- and guanine-nucleotide-dependent exocytosis in permeabilized rat mast cells. Modulation by protein kinase C.

    PubMed Central

    Koopmann, W R; Jackson, R C


    We have used a digitonin-permeabilized cell system to study the signal transduction pathways responsible for stimulus-secretion coupling in the rat peritoneal mast cell. Conditions were established for permeabilizing the mast cell plasma membrane without disrupting secretory vesicles. Exocytotic release of histamine from digitonin-permeabilized cells required a combination of micromolar concentrations of Ca2+ and the stable guanine nucleotide analogue guanosine 5'-[gamma-thio]triphosphate (GTP[S]), but was independent of exogenous ATP. In the presence of 40 microM-GTP[S], exocytosis was half-maximal at 1.3 microM-Ca2+ and maximal at 10 microM-Ca2+; GTP[S] alone (100 microM) had no effect on histamine release in the absence of added Ca2+. In the presence of 10 microM free Ca2+, 5 microM-GTP[S] was required for half-maximal exocytosis. To examine the possible role of protein kinase C (PKC) in exocytosis, we utilized 12-O-tetradecanoylphorbol 13-acetate (TPA) to activate PKC and studied its effect on histamine release from permeabilized mast cells. Cells that had been incubated with TPA (25 nM for 5 min) exhibited increased sensitivity to both GTP[S] and Ca2+. The PKC inhibitor staurosporine blocked the effect of TPA without inhibiting normal exocytosis in response to the combination of GTP[S] and Ca2+. In addition, down-regulation of mast-cell PKC by long-term TPA treatment (25 nM for 20 h) blocked the ability of the cells to respond to TPA and inhibited exocytosis in response to Ca2+ and GTP[S] by 40-50%. These results suggest that the sensitivity of the exocytotic machinery of the mast cell can be altered by PKC-catalysed phosphorylation events, but that activation of PKC is not required for exocytosis to occur. Images Fig. 7. PMID:1689146

  1. Calcium channel currents and their inhibition by (-)-baclofen in rat sensory neurones: modulation by guanine nucleotides.

    PubMed Central

    Dolphin, A C; Scott, R H


    1. The effect of intracellular application of the hydrolysis-resistant GTP and GDP analogues, guanosine 5'-O-3-thiotriphosphate (GTP-gamma-S), and guanosine 5'-O-2-thiodiphosphate (GDP-beta-S) has been examined on voltage-activated calcium-channel currents and the ability of the gamma-aminobutyric acid B agonist baclofen to inhibit them, in cultured rat dorsal root ganglion (d.r.g.) neurones. 2. Under control conditions, the calcium-channel current, recorded using the whole-cell patch technique with Ba2+ rather than Ca2+ as the permeant divalent cation, consists of an inactivating and a sustained current. In the presence of 500 microM-GTP-gamma-S included in the patch pipette, the calcium-channel current was activated more slowly and was largely non-inactivating during the 100 ms depolarization voltage step. The effects of GTP-gamma-S were abolished by pre-treatment of cells with pertussis toxin. 3. The calcium-channel current recorded in the presence of 500 microM-GDP-beta-S had a more marked transient component than the control calcium-channel current. The proportion of transient calcium-channel current in the presence of GDP-beta-S was not reduced in Na+-free medium. 4. No statistically significant effects of GTP-gamma-S and GDP-beta-S were observed on the calcium-activated potassium current IK(Ca), the transient outward potassium current activated in Ca2+-free medium, or on the inwardly rectifying current (Ih) activated by hyperpolarization. 5. GTP-gamma-S increased the ability of baclofen to inhibit calcium-channel currents, whereas this was decreased by GDP-beta-S and by pre-treatment of cells with pertussis toxin. The half-maximal effective dose (EC50) for baclofen was 2 microM in the presence of GTP-gamma-S, 15 microM for control and 50 microM in the presence of GDP-beta-S. Comparable results were obtained using a single concentration of the adenosine agonist 2-chloroadenosine (2-CA, 0.05 microM) to inhibit calcium-channel currents; its effect was

  2. Specific labeling of O6-alkylguanine-DNA alkyltransferase by reaction with O6-(p-hydroxy[3H]methylbenzyl)guanine.


    Ciocco, G M; Moschel, R C; Chae, M Y; McLaughlin, P J; Zagon, I S; Pegg, A E


    O6-Alkylguanine-DNA alkyltransferase (AGT) is an important DNA repair protein that removes adducts from the O6 position of guanine by transferring them to a cysteine residue within its amino acid sequence. Mammalian AGTs are readily inactivated by incubation with O6-benzyl-guanine (BG), which is an alternative substrate for the protein. To examine this inactivation in more detail and to develop a procedure for the specific labeling of human AGT, we synthesized a BG derivative, O6-(p-hydroxy[3H]methylbenzyl_guanine ([3H]HMBG) and examined its interaction with AGT in HT29 cell extracts and in HT29 cells. Incubation of human AGT with [3H]HMBG led to the incorporation of radioactivity in the protein in a time- and temperature-dependent manner. This reaction was specific, since neither AGT that was first inactivated by reaction with BG nor proteins other than AGT were labeled. Digestion of the labeled AGT with trypsin showed that a single peptide contained the label. Sequencing of this peptide indicated that the label was bound to cysteine-145. These results demonstrate that AGT accepts HMBG as a substrate and becomes inactivated by transfer of a p-hydroxymethylbenzyl residue to the cysteine-145 acceptor site. When [3H]HMBG was added to cultures of HT29 cells which are Mer+ and express active AGT, radioactivity was incorporated in a macromolecule and could be detected by autoradiography. No such labeling occurred with BE or CHO cells, which are Mer- and lack AGT. Examination of the interaction of [3H]HMBG with mutant AGT proteins that differ greatly in their abilities to react with BG showed that there was a strong correlation between the reaction with BG and the labeling with [3H]HMBG. These results indicate that [3H]HMBG is a potentially useful reagent for the detection and localization of AGT activity and for the investigation of its mechanism of action.

  3. Regulation of formyl peptide receptor binding to rabbit neutrophil plasma membranes. Use of monovalent cations, guanine nucleotides, and bacterial toxins to discriminate among different states of the receptor

    SciTech Connect

    Feltner, D.E.; Marasco, W.A.


    The regulation by monovalent cations, guanine nucleotides, and bacterial toxins of (3H)FMLP binding to rabbit neutrophil plasma membranes was studied by using dissociation techniques to identify regulatory effects on separate receptor states. Under conditions of low receptor occupancy (1 nM (3H)FMLP) and in both Na+ and K+ buffers, dissociation is heterogenous, displaying two distinct, statistically significant off rates. (3H)FMLP binding was enhanced by substituting other monovalent cations for Na+. In particular, enhanced binding in the presence of K+ relative to Na+ was caused by additional binding to both rapidly and slowly dissociating receptors. Three receptor dissociation rates, two of which appear to correspond to the two affinity states detected in equilibrium binding studies, were defined by specific GTP and pertussis toxin (PT) treatments. Neither GTP, nor PT or cholera toxins (CT) had an effect on the rate of dissociation of (3H)FMLP from the rapidly dissociating form of the receptor. Both 100 microM GTP and PT treatments increased the percentage of rapidly dissociating receptors, correspondingly decreasing the percentage of slowly dissociating receptors. The observed changes in the rapidly and slowly dissociating receptors after GTP, PT, and CT treatments were caused by an absolute decrease in the amount of binding to the slowly dissociating receptors. However, complete inhibition of slowly dissociating receptor binding by GTP, PT, or both was never observed. Both GTP and PT treatments, but not CT treatment, increased by two-fold the rate of dissociation of 1 nM (3H)FMLP from the slowly dissociating form of the receptor, resulting in a third dissociation rate. Thus, slowly dissociating receptors comprise two different receptor states, a G protein-associated guanine nucleotide and PT-sensitive state and a guanine nucleotide-insensitive state.

  4. How protonation and deprotonation of 9-methylguanine alter its singlet O2 addition path: about the initial stage of guanine nucleoside oxidation.


    Lu, Wenchao; Teng, Huayu; Liu, Jianbo


    Mutagenicity of singlet O2 is due to its oxidatively generated damage to the guanine nucleobases of DNA. Oxidation of neutral guanosine has been assumed to be initiated by the formation of a transient 4,8-endoperoxide via a Diels-Alder cycloaddition of singlet O2. Protonation and deprotonation of guanosine represent another factor related to DNA damage and repair. Herein, 9-methylguanine was utilized as a model substrate to mimic the correlation between singlet O2 oxidation of the nucleoside and its ionization states, both in the absence and in the presence of water ligands. We used guided-ion-beam scattering tandem mass spectrometry to detect and quantify transient intermediates at room temperature. To provide a reliable description of reaction potential surfaces, different levels of theory including restricted and unrestricted density functional theory, CCSD(T), MP2, and multi-reference CASSCF and CASMP2 were applied. By means of molecular potential, kinetic and direct dynamics simulations, two reaction pathways were identified and neither follows the mechanism for neutral guanosine. Singlet O2 oxidation of protonated 9-methylguanine begins by a concerted cycloaddition; but it is mediated by a 5,8-endoperoxide. By contrast, a concerted cycloaddition does not occur for deprotonated 9-methylguanine. The latter involves a stepwise addition starting with the formation of an 8-peroxide, which subsequently evolves to a 4,8-endoperoxide. This dichotomy implies that acidic and basic media may lead to different chemistries for guanosine oxidation in aqueous solutions, starting from initial stage. The comparison with oxidation of protonated/deprotonated guanine illustrates the different mechanisms and products and particularly the suppressed oxidizability of 9-methylguanine vs. free guanine.

  5. Mechanism of Repair of Acrolein- and Malondialdehyde-Derived Exocyclic Guanine Adducts by the α-Ketoglutarate/Fe(II) Dioxygenase AlkB

    PubMed Central


    The structurally related exocyclic guanine adducts α-hydroxypropano-dG (α-OH-PdG), γ-hydroxypropano-dG (γ-OH-PdG), and M1dG are formed when DNA is exposed to the reactive aldehydes acrolein and malondialdehyde (MDA). These lesions are believed to form the basis for the observed cytotoxicity and mutagenicity of acrolein and MDA. In an effort to understand the enzymatic pathways and chemical mechanisms that are involved in the repair of acrolein- and MDA-induced DNA damage, we investigated the ability of the DNA repair enzyme AlkB, an α-ketoglutarate/Fe(II) dependent dioxygenase, to process α-OH-PdG, γ-OH-PdG, and M1dG in both single- and double-stranded DNA contexts. By monitoring the repair reactions using quadrupole time-of-flight (Q-TOF) mass spectrometry, it was established that AlkB can oxidatively dealkylate γ-OH-PdG most efficiently, followed by M1dG and α-OH-PdG. The AlkB repair mechanism involved multiple intermediates and complex, overlapping repair pathways. For example, the three exocyclic guanine adducts were shown to be in equilibrium with open-ring aldehydic forms, which were trapped using (pentafluorobenzyl)hydroxylamine (PFBHA) or NaBH4. AlkB repaired the trapped open-ring form of γ-OH-PdG but not the trapped open-ring of α-OH-PdG. Taken together, this study provides a detailed mechanism by which three-carbon bridge exocyclic guanine adducts can be processed by AlkB and suggests an important role for the AlkB family of dioxygenases in protecting against the deleterious biological consequences of acrolein and MDA. PMID:25157679

  6. Studies by Near Edge X-ray Absorption Spectroscopies of Bonding Dynamics at the Graphene/Guanine Interface - A Proposal for High Mobility, Organic Graphene Field Effect Transistors

    DTIC Science & Technology


    deposition .  However,  the  question... deposition .     Emissions  at  ~287  and  288  eV  are  typically  assinged  to    σ*  C-­‐H  and  π*  C=O...spectral  signatures  upon  10  nm   deposited  PMMA  and  7  nm   deposited  guanine   on  C  and

  7. Refinement of DNA structures through near-edge X-ray absorption fine structure analysis: applications on guanine and cytosine nucleobases, nucleosides, and nucleotides.


    Hua, Weijie; Gao, Bin; Li, Shuhua; Agren, Hans; Luo, Yi


    In this work we highlight the potential of NEXAFS—near-edge X-ray absorption fine structure—analysis to perform refinements of hydrogen-bond structure in DNA. For this purpose we have carried out first-principle calculations of the N1s NEXAFS spectra of the guanine and cytosine nucleobases and their tautomers, nucleosides, and nucleotides in the gas phase, as well as for five crystal structures of guanine, cytosine, or guanosine. The spectra all clearly show imine (π1*) and amine (π2*) nitrogen absorption bands with a characteristic energy difference (Δ). Among all of the intramolecule covalent connections, the tautomerism of hydrogens makes the largest influence, around ±0.4−0.5 eV change of Δ, to the spectra due to a switch of single−double bonds. Deoxyribose and ribose sugars can cause at most 0.2 eV narrowing of Δ, while the phosphate groups have nearly negligible effects on the spectra. Two kinds of intermolecule interactions are analyzed, the hydrogen bonds and the stacking effect, by comparing “compressed” and “expanded” models or by comparing models including or excluding the nearest stacking molecules. The shortening of hydrogen-bond length by 0.2−0.3 Å can result in the reduction of Δ by 0.2−0.8 eV. This is because the hydrogen bonds make the electrons more delocalized, and the amine and imine nitrogens become less distinguishable. Moreover, the hydrogen bond has a different ability to influence the spectra of different crystals, with guanine crystals as the largest (change by 0.8 eV) and the guanosine crystal as the smallest (change by 0.2 eV). The stacking has negligible effects on the spectra in all studied systems. A comparison of guanosine to guanine crystals shows that the sugars in the crystal could create “blocks” in the π-and hydrogen bonds network of bases and thus makes the imine and amine nitrogens more distinguishable with a larger Δ. Our theoretical calculations offer a good match with experimental findings

  8. Structure of Low-Lying Excited States of Guanine in DNA and Solution: Combined Molecular Mechanics and High-Level Coupled Cluster Studies


    Kowalski, Karol; Valiev, Marat


    High-level ab-initio equation-of-motion coupled-cluster methods with singles, doubles, and noniterative triples are used, in conjunction with the combined quantum mechanical molecular mechanics approach, to investigate the structure of low-lying excited states of the guanine base in DNA and solvated environments. Our results indicate that while the excitation energy of the first excited state is barely changed compared to its gas-phase counterpart, the excitation energy of the second excited state is blue-shifted by 0.24 eV.

  9. Formation of guanine-6-sulfonate from 6-thioguanine and singlet oxygen: a combined theoretical and experimental study.


    Zou, Xiaoran; Zhao, Hongmei; Yu, Youqing; Su, Hongmei


    As an end metabolism product of the widely used thiopurine drugs, 6-thioguanine (6-TG) absorbs UVA and produces (1)O2 by photosensitization. This unusual photochemical property triggers a variety of DNA damage, among which the oxidation of 6-TG itself by (1)O2 to the promutagenic product guanine-6-sulfonate (G(SO3)) represents one of the major forms. It has been suspected that there exists an initial intermediate, G(SO), prior to its further oxidation to G(SO2) and G(SO3), but G(SO) has never been observed. Using density functional theory, we have explored the energetics and intermediates of 6-TG and (1)O2. A new mechanism via G(SOOH) → G(SO2) → G(SO4) → G(SO3) has been discovered to be the most feasible energetically, whereas the anticipated G(SO) mechanism is found to encounter an inaccessibly high barrier and thus is prevented. The mechanism through the G(SOOH) and G(SO4) intermediates can be validated further by joint experimental measurements, where the fast rate constant of 4.9 × 10(9) M(-1) s(-1) and the reaction stoichiometry of 0.58 supports this low-barrier new mechanism. In addition to the dominant pathway of G(SOOH) → G(SO2) → G(SO4) → G(SO3), a side pathway with higher barrier, G(SOOH) → G, has also been located, providing a rationalization for the observed product distributions of G(SO2) and G(SO3) as major products and G as minor product. From mechanistic and kinetics points of view, the present findings provide new chemical insights to understand the high phototoxicity of 6-TG in DNA and point to methods of using 6-TG as a sensitive fluorescence probe for the quantitative detection of (1)O2, which holds particular promise for detecting (1)O2 in DNA-related biological surroundings.

  10. cis-[Pt(NH 3) 2] 2+ coordination to the N7 and O6 sites of a guanine-cytosine pair: disruption of the Watson-Crick H-bonding pattern

    NASA Astrophysics Data System (ADS)

    Pelmenschikov, Alexander; Zilberberg, Igor; Leszczynski, Jerzy; Famulari, Antonino; Sironi, Maurizio; Raimondi, Mario


    The coordination of cis-[Pt(NH 3) 2] 2+ to the N7 and O6 sites of guanine of the guanine-cytosine (GC) nucleic base pair is studied at the SCF, DFT and MP2 levels of theory, and by an ab initio BSSE-free optimization algorithm, concerning the possible mechanisms of the antitumor activity of cis-[Pt(NH 3) 2Cl 2]. The calculations show that the cis-[Pt(NH 3) 2] 2+ coordination results in the breakage of the (cytosine)N4-H-O6(guanine) H-bond and a substantial non-planarity of the GC moiety. From an analysis of the electrostatic potential at the O6, N1-H and N2-H sites of cis-[Pt(NH 3) 2G] 2+ we can explain the predicted changes in geometry and binding energy of the GC complex.

  11. Binding effects of Mn²⁺ and Zn²⁺ ions on the vibrational properties of guanine-cytosine base pairs in the Watson-Crick and Hoogsteen configurations.


    Morari, Cristian; Bogdan, Diana; Muntean, Cristina M


    The binding effects of Mn²⁺ and Zn²⁺ ions on the vibrational properties of guanine-cytosine base pairs have been performed using density functional theory investigations. The calculations were carried out on Watson-Crick and Hoogsteen configurations of the base pairs. We have found, that in Watson-Crick configuration, the metal is coordinated to N7 atom of guanine while, in the case of Hoogsteen configuration, the coordination is at N3 atom of guanine. We have pointed out the vibrational bands that can be used to detect the presence of metallic ions in the Watson-Crick and Hoogsteen structures. Our results show that the vibrational amplitudes of metallic atoms are strong for wavenumbers lower than 600 cm⁻¹. Also, we predict that the distinction between Watson-Crick and Hoogsteen configurations can be seen around 85, 170 and 310 cm⁻¹.

  12. Universal 1/f noise, crossovers of scaling exponents, and chromosome-specific patterns of guanine-cytosine content in DNA sequences of the human genome

    NASA Astrophysics Data System (ADS)

    Li, Wentian; Holste, Dirk


    Spatial fluctuations of guanine and cytosine base content (GC%) are studied by spectral analysis for the complete set of human genomic DNA sequences. We find that (i) 1/fα decay is universally observed in the power spectra of all 24 chromosomes, and (ii) the exponent α≈1 extends to about 107 bases, one order of magnitude longer than has previously been observed. We further find that (iii) almost all human chromosomes exhibit a crossover from α1≈1 (1/fα1) at lower frequency to α2<1 (1/fα2) at higher frequency, typically occurring at around 30 000-100 000 bases, while (iv) the crossover in this frequency range is virtually absent in human chromosome 22. In addition to the universal 1/fα noise in power spectra, we find (v) several lines of evidence for chromosome-specific correlation structures, including a 500 000 base long oscillation in human chromosome 21. The universal 1/fα spectrum in the human genome is further substantiated by a resistance to reduction in variance of guanine and cytosine content when the window size is increased.

  13. Oxidatively Generated Guanine(C8)-Thymine(N3) Intrastrand Cross-links in Double-stranded DNA Are Repaired by Base Excision Repair Pathways.


    Talhaoui, Ibtissam; Shafirovich, Vladimir; Liu, Zhi; Saint-Pierre, Christine; Akishev, Zhiger; Matkarimov, Bakhyt T; Gasparutto, Didier; Geacintov, Nicholas E; Saparbaev, Murat


    Oxidatively generated guanine radical cations in DNA can undergo various nucleophilic reactions including the formation of C8-guanine cross-links with adjacent or nearby N3-thymines in DNA in the presence of O2. The G*[C8-N3]T* lesions have been identified in the DNA of human cells exposed to oxidative stress, and are most likely genotoxic if not removed by cellular defense mechanisms. It has been shown that the G*[C8-N3]T* lesions are substrates of nucleotide excision repair in human cell extracts. Cleavage at the sites of the lesions was also observed but not further investigated (Ding et al. (2012) Nucleic Acids Res. 40, 2506-2517). Using a panel of eukaryotic and prokaryotic bifunctional DNA glycosylases/lyases (NEIL1, Nei, Fpg, Nth, and NTH1) and apurinic/apyrimidinic (AP) endonucleases (Apn1, APE1, and Nfo), the analysis of cleavage fragments by PAGE and MALDI-TOF/MS show that the G*[C8-N3]T* lesions in 17-mer duplexes are incised on either side of G*, that none of the recovered cleavage fragments contain G*, and that T* is converted to a normal T in the 3'-fragment cleavage products. The abilities of the DNA glycosylases to incise the DNA strand adjacent to G*, while this base is initially cross-linked with T*, is a surprising observation and an indication of the versatility of these base excision repair proteins.

  14. Chemical reactivity as a tool to study carcinogenicity: reaction between estradiol and estrone 3,4-quinones ultimate carcinogens and guanine.


    Huetz, Ph; Kamarulzaman, E E; Wahab, H A; Mavri, J


    In this article we study the chemical reactions between guanine and two ultimate carcinogens, the 3,4-quinone forms of the estrogens estrone (E1) and estradiol (E2). DNA was truncated to guanine, i.e. no deoxyribose moiety was included. Due to a complex reaction that involves proton transfer via water molecules we applied linear free energy relationships rather than computation of the transition state and activation energies. The minima corresponding to reactants and products were obtained on the B3LYP/6-31G(d) level. The effects of hydration were considered using the solvent reaction field of Tomasi and co-workers and the Langevin dipoles model of Florian and Warshel. No significant difference in reaction free energy for the reaction involving estrone and estradiol metabolites was found, despite the fact that for the two substances different carcinogenic activities were reported. Differences in carcinogenicity may be therefore attributed to other types of interactions or reactions such as (i) specific interactions of the carbonyl or hydroxyl group with DNA giving rise to different activation free energies for the reactions, (ii) the reaction of depurination and subsequent effects on the DNA, (iii) enzymatic or nonenzymatic oxidation steps (P450, aromatase, peroxidases, O2) and detoxification reactions (catechol-O-methyl transferase, S-transferase), or (iv) binding of the hormone to its nuclear receptors.

  15. Phospholipase C-gamma1 is a guanine nucleotide exchange factor for dynamin-1 and enhances dynamin-1-dependent epidermal growth factor receptor endocytosis.


    Choi, Jang Hyun; Park, Jong Bae; Bae, Sun Sik; Yun, Sanguk; Kim, Hyeon Soo; Hong, Won-Pyo; Kim, Il-Shin; Kim, Jae Ho; Han, Mi Young; Ryu, Sung Ho; Patterson, Randen L; Snyder, Solomon H; Suh, Pann-Ghill


    Phospholipase C-gamma1 (PLC-gamma1), which interacts with a variety of signaling molecules through its two Src homology (SH) 2 domains and a single SH3 domain has been implicated in the regulation of many cellular functions. We demonstrate that PLC-gamma1 acts as a guanine nucleotide exchange factor (GEF) of dynamin-1, a 100 kDa GTPase protein, which is involved in clathrin-mediated endocytosis of epidermal growth factor (EGF) receptor. Overexpression of PLC-gamma1 increases endocytosis of the EGF receptor by increasing guanine nucleotide exchange activity of dynamin-1. The GEF activity of PLC-gamma1 is mediated by the direct interaction of its SH3 domain with dynamin-1. EGF-dependent activation of ERK and serum response element (SRE) are both up-regulated in PC12 cells stably overexpressing PLC-gamma1, but knockdown of PLC-gamma1 by siRNA significantly reduces ERK activation. These results establish a new role for PLC-gamma1 in the regulation of endocytosis and suggest that endocytosis of activated EGF receptors may mediate PLC-gamma1-dependent proliferation.

  16. Isolation of a gene encoding a developmentally regulated T cell-specific protein with a guanine nucleotide triphosphate-binding motif

    SciTech Connect

    Carlow, D.A.; Teh, H.S.; Marth, J.


    In this study, we describe a novel full length cDNA clone designated Tgtp that encodes a predicted 415-amino acid a T cell-specific guanine nucleotide triphosphate-binding protein (TGTP) bearing the characteristic motifs of a guanine nucleotide triphosphate (GTP) binding protein. Tgtp is expressed preferentially, if not exclusively, in T cells, and is up-regulated in both unfractionated and in purified CD4{sup +}8{sup +} thymocytes upon TCR cross-linking. In contrast, expression of Tgtp in peripheral T cells is maintained at relatively high levels and is not grossly affected by TCR cross-linking. Antiserum generated against synthetic peptides from the predicted TGTP amino acid sequence recognized a single protein with a molecular mass of {approx}50 kDa, corresponding well with the computed molecular mass of 47 kDa. The only known relative of Tgtp is MUSGTP, which is reportedly expressed in B cells and bears a GTP binding motif. Thus, the discovery of Tgtp resolves a subfamily of molecules with GTP binding motifs and apparent lymphoid lineage-restricted expression. Given the restricted expression pattern in T cells, the up-regulated expression observed in response to TCR signaling in immature thymocytes, and the presence of the motifs characteristic of GTP binding proteins, we suggest that TGTP may have an important function in T cell development and/or T cell activation. 51 refs., 6 figs.

  17. Arf6 Guanine Nucleotide Exchange Factor Cytohesin-2 Binds to CCDC120 and Is Transported Along Neurites to Mediate Neurite Growth*

    PubMed Central

    Torii, Tomohiro; Miyamoto, Yuki; Tago, Kenji; Sango, Kazunori; Nakamura, Kazuaki; Sanbe, Atsushi; Tanoue, Akito; Yamauchi, Junji


    The mechanism of neurite growth is complicated, involving continuous cytoskeletal rearrangement and vesicular trafficking. Cytohesin-2 is a guanine nucleotide exchange factor for Arf6, an Arf family molecular switch protein, controlling cell morphological changes such as neuritogenesis. Here, we show that cytohesin-2 binds to a protein with a previously unknown function, CCDC120, which contains three coiled-coil domains, and is transported along neurites in differentiating N1E-115 cells. Transfection of the small interfering RNA (siRNA) specific for CCDC120 into cells inhibits neurite growth and Arf6 activation. When neurites start to extend, vesicles containing CCDC120 and cytohesin-2 are transported in an anterograde manner rather than a retrograde one. As neurites continue extension, anterograde vesicle transport decreases. CCDC120 knockdown inhibits cytohesin-2 localization into vesicles containing CCDC120 and diffuses cytohesin-2 in cytoplasmic regions, illustrating that CCDC120 determines cytohesin-2 localization in growing neurites. Reintroduction of the wild type CCDC120 construct into cells transfected with CCDC120 siRNA reverses blunted neurite growth and Arf6 activity, whereas the cytohesin-2-binding CC1 region-deficient CCDC120 construct does not. Thus, cytohesin-2 is transported along neurites by vesicles containing CCDC120, and it mediates neurite growth. These results suggest a mechanism by which guanine nucleotide exchange factor for Arf6 is transported to mediate neurite growth. PMID:25326380

  18. Specific and nonspecific metal ion-nucleotide interactions at aqueous/solid interfaces functionalized with adenine, thymine, guanine, and cytosine oligomers.


    Holland, Joseph G; Malin, Jessica N; Jordan, David S; Morales, Esmeralda; Geiger, Franz M


    This article reports nonlinear optical measurements that quantify, for the first time directly and without labels, how many Mg(2+) cations are bound to DNA 21-mers covalently linked to fused silica/water interfaces maintained at pH 7 and 10 mM NaCl, and what the thermodynamics are of these interactions. The overall interaction of Mg(2+) with adenine, thymine, guanine, and cytosine is found to involve -10.0 ± 0.3, -11.2 ± 0.3, -14.0 ± 0.4, and -14.9 ± 0.4 kJ/mol, and nonspecific interactions with the phosphate and sugar backbone are found to contribute -21.0 ± 0.6 kJ/mol for each Mg(2+) ion bound. The specific and nonspecific contributions to the interaction energy of Mg(2+) with oligonucleotide single strands is found to be additive, which suggests that within the uncertainty of these surface-specific experiments, the Mg(2+) ions are evenly distributed over the oligomers and not isolated to the most strongly binding nucleobase. The nucleobases adenine and thymine are found to bind only three Mg(2+) ions per 21-mer oligonucleotide, while the bases cytosine and guanine are found to bind eleven Mg(2+) ions per 21-mer oligonucleotide.

  19. Oxidation of guanine in G, GG, and GGG sequence contexts by aromatic pyrenyl radical cations and carbonate radical anions: relationship between kinetics and distribution of alkali-labile lesions.


    Lee, Young Ae; Durandin, Alexander; Dedon, Peter C; Geacintov, Nicholas E; Shafirovich, Vladimir


    Oxidatively generated DNA damage induced by the aromatic radical cation of the pyrene derivative 7,8,9,10-tetrahydroxytetrahydrobenzo[a]pyrene (BPT), and by carbonate radicals anions, was monitored from the initial one-electron transfer, or hole injection step, to the formation of hot alkali-labile chemical end-products monitored by gel electrophoresis. The fractions of BPT molecules bound to double-stranded 20-35-mer oligonucleotides with noncontiguous guanines G and grouped as contiguous GG and GGG sequences were determined by a fluorescence quenching method. Utilizing intense nanosecond 355 nm Nd:YAG laser pulses, the DNA-bound BPT molecules were photoionized to BPT*+ radicals by a consecutive two-photon ionization mechanism. The BPT*+ radicals thus generated within the duplexes selectively oxidize guanine by intraduplex electron-transfer reactions, and the rate constants of these reactions follow the trend 5'-..GGG.. > 5'-..GG.. > 5'-..G... In the case of CO3*- radicals, the oxidation of guanine occurs by intermolecular collision pathways, and the bimolecular rate constants are independent of base sequence context. However, the distributions of the end-products generated by CO3*- radicals, as well as by BPT*+, are base sequence context-dependent and are greater than those in isolated guanines at the 5'-G in 5'-...GG... sequences, and the first two 5'- guanines in the 5'-..GGG sequences. These results help to clarify the conditions that lead to a similar or different base sequence dependence of the initial hole injection step and the final distribution of oxidized, alkali-labile guanine products. In the case of the intermolecular one-electron oxidant CO3*-, the rate constant of hole injection is similar for contiguous and isolated guanines, but the subsequent equilibration of holes by hopping favors trapping and product formation at contiguous guanines, and the sequence dependence of these two phenomena are not correlated. In contrast, in the case of the DNA

  20. High-yield production of short GpppA- and 7MeGpppA-capped RNAs and HPLC-monitoring of methyltransfer reactions at the guanine-N7 and adenosine-2′O positions

    PubMed Central

    Peyrane, F.; Selisko, B.; Decroly, E.; Vasseur, J. J.; Benarroch, D.; Canard, B.; Alvarez, K.


    Many eukaryotic and viral mRNAs, in which the first transcribed nucleotide is an adenosine, are decorated with a cap-1 structure, 7MeG5′-ppp5′-A2′OMe. The positive-sense RNA genomes of flaviviruses (Dengue, West Nile virus) for example show strict conservation of the adenosine. We set out to produce GpppA- and 7MeGpppA-capped RNA oligonucleotides for non-radioactive mRNA cap methyltransferase assays and, in perspective, for studies of enzyme specificity in relation to substrate length as well as for co-crystallization studies. This study reports the use of a bacteriophage T7 DNA primase fragment to synthesize GpppACn and 7MeGpppACn (1 ≤ n ≤ 9) in a one-step enzymatic reaction, followed by direct on-line cleaning HPLC purification. Optimization studies show that yields could be modulated by DNA template, enzyme and substrate concentration adjustments and longer reaction times. Large-scale synthesis rendered pure (in average 99%) products (1 ≤ n ≤ 7) in quantities of up to 100 nmol starting from 200 nmol cap analog. The capped RNA oligonucleotides were efficient substrates of Dengue virus (nucleoside-2′-O-)-methyltransferase, and human (guanine-N7)-methyltransferase. Methyltransfer reactions were monitored by a non-radioactive, quantitative HPLC assay. Additionally, the produced capped RNAs may serve in biochemical, inhibition and structural studies involving a variety of eukaryotic and viral methyltransferases and guanylyltransferases. PMID:17259217

  1. Identification of the Structural Features of Guanine Derivatives as MGMT Inhibitors Using 3D-QSAR Modeling Combined with Molecular Docking.


    Sun, Guohui; Fan, Tengjiao; Zhang, Na; Ren, Ting; Zhao, Lijiao; Zhong, Rugang


    DNA repair enzyme O⁶-methylguanine-DNA methyltransferase (MGMT), which plays an important role in inducing drug resistance against alkylating agents that modify the O⁶ position of guanine in DNA, is an attractive target for anti-tumor chemotherapy. A series of MGMT inhibitors have been synthesized over the past decades to improve the chemotherapeutic effects of O⁶-alkylating agents. In the present study, we performed a three-dimensional quantitative structure activity relationship (3D-QSAR) study on 97 guanine derivatives as MGMT inhibitors using comparative molecular field analysis (CoMFA) and comparative molecular similarity indices analysis (CoMSIA) methods. Three different alignment methods (ligand-based, DFT optimization-based and docking-based alignment) were employed to develop reliable 3D-QSAR models. Statistical parameters derived from the models using the above three alignment methods showed that the ligand-based CoMFA (Qcv² = 0.672 and Rncv² = 0.997) and CoMSIA (Qcv² = 0.703 and Rncv² = 0.946) models were better than the other two alignment methods-based CoMFA and CoMSIA models. The two ligand-based models were further confirmed by an external test-set validation and a Y-randomization examination. The ligand-based CoMFA model (Qext² = 0.691, Rpred² = 0.738 and slope k = 0.91) was observed with acceptable external test-set validation values rather than the CoMSIA model (Qext² = 0.307, Rpred² = 0.4 and slope k = 0.719). Docking studies were carried out to predict the binding modes of the inhibitors with MGMT. The results indicated that the obtained binding interactions were consistent with the 3D contour maps. Overall, the combined results of the 3D-QSAR and the docking obtained in this study provide an insight into the understanding of the interactions between guanine derivatives and MGMT protein, which will assist in designing novel MGMT inhibitors with desired activity.

  2. Direct oxidation of guanine and 7,8-dihydro-8-oxoguanine in DNA by a high-valent chromium complex: a possible mechanism for chromate genotoxicity.


    Sugden, K D; Campo, C K; Martin, B D


    Intracellular reductive activation of the human carcinogen chromate, Cr(VI), is a necessary step in the formation of DNA lesions that lead to cancer. Reductive activation forms the transient metastable high-valent oxidation state of Cr(V) as a precursor to the final intracellularly stable oxidation state, Cr(III). In this study, we have used a model high-valent Cr(V) complex, N,N'-ethylenebis(salicylideneanimato)oxochromium(V), Cr(V)-Salen, to probe the mechanism of interaction between this oxidation state of chromium and DNA. This interaction was found to be specific toward the oxidation of the nucleic acid base guanine in unmodified single- and double-stranded oligonucleotides as measured by an increased level of DNA strand cleavage at these sites following piperidine treatment. Replacement of a single guanine residue in DNA with a more readily oxidized 7,8-dihydro-8-oxoguanine (8-oxo-G) base allowed for site-specific oxidation at this modified site within the DNA strand by the Cr(V)-Salen complex. HPLC and ESI-mass spectrometry were used to identify the modified guanine base lesions formed in the reaction of this high-valent chromium complex with the 8-oxo-G-containing DNA substrate. Two of these modified base lesions, identified as guanidinohydantoin and spiroiminodihydantoin, were found in the reaction of the Cr(V)-Salen complex with 8-oxo-G-modified DNA, while only one, spiroiminodihydantoin, was formed from oxidation of the 8-oxo-G nucleoside. A primer extension assay using the exo(-) Klenow fragment demonstrated polymerase arrest at the site of these base modifications as well as a high degree of misincorporation of adenine opposite the site of modification. These results suggest that mutations arising from G --> T transversions would predominate with these lesions. The mechanism of damage and base oxidation products for the interaction between high-valent chromium and DNA described herein may be relevant to the in vivo formation of DNA damage leading to

  3. The effects of acute exposure to ethanol on neurotensin and guanine nucleotide-stimulation of phospholipase C activity in intact NIE-115 neuroblastoma cells

    SciTech Connect

    Smith, T.L. )


    Both ethanol and neurotensin produce sedation and hypothermia. When administered in combination the behavioral effects of these two substances are potentiated. In order to better understand the biochemical nature of this interaction, the direct effects of ethanol on neurotensin receptors and an associated signal transduction process were determined in NIE-115 neuroblastoma cells. Ethanol in physiologically relevant concentrations significantly reduced neurotensin stimulated ({sup 3}H)inositol phosphate production while having no effect on the specific binding of ({sup 3}H)neurotensin. In addition, ethanol up to 200 mM had no effect on GTPYS mediated ({sup 3}H)inositol phosphate production. The results indicate that acute exposure ethanol partially disrupts the normal coupling of activated neurotensin receptors to the guanine nucleotide binding protein associated with phospholipase C.

  4. Studies on the energy metabolism of opossum (Didelphis virginiana) erythrocytes: V. Utilization of hypoxanthine for the synthesis of adenine and guanine nucleotides in vitro

    SciTech Connect

    Bethlenfalvay, N.C.; White, J.C.; Chadwick, E.; Lima, J.E. )


    High pressure liquid radiochromatography was used to test the ability of opossum erythrocytes to incorporate tracer amounts of (G-{sup 3}H) hypoxanthine (Hy) into ({sup 3}H) labelled triphosphates of adenine and guanine. In the presence of supraphysiologic (30 mM) phosphate which is optimal for PRPP synthesis, both ATP and GTP are extensively labelled. When physiologic (1 mM) medium phosphate is used, red cells incubated under an atmosphere of nitrogen accumulate ({sup 3}H) ATP in a linear fashion suggesting ongoing PRPP synthesis in red cells whose hemoglobin is deoxygenated. In contrast, a lesser increase of labelled ATP is observed in cells incubated under oxygen, suggesting that conditions for purine nucleotide formation from ambient Hy are more favorable in the venous circulation.

  5. Measurement of one and two bond N-C couplings in large proteins by TROSY-based J-modulation experiments.


    Liu, Yizhou; Prestegard, James H


    Residual dipolar couplings (RDCs) between NC' and NC(alpha) atoms in polypeptide backbones of proteins contain information on the orientation of bond vectors that is complementary to that contained in NH RDCs. The (1)J(NC)(alpha) and (2)J(NC)(alpha) scalar couplings between these atoms also display a Karplus relation with the backbone torsion angles and report on secondary structure. However, these N-C couplings tend to be small and they are frequently unresolvable in frequency domain spectra having the broad lines characteristic of large proteins. Here a TROSY-based J-modulated approach for the measurement of small (15)N-(13)C couplings in large proteins is described. The cross-correlation interference effects inherent in TROSY methods improve resolution and signal to noise ratios for large proteins, and the use of J-modulation to encode couplings eliminates the need to remove frequency distortions from overlapping peaks during data analysis. The utility of the method is demonstrated by measurement of (1)J(NC'), (1)J(NC)(alpha) , and (2)J(NC)(alpha) scalar couplings and (1)D(NC') and D(NC)(alpha) residual dipolar couplings for the myristoylated yeast ARF1.GTPgammas protein bound to small lipid bicelles, a system with an effective molecule weight of approximately 70kDa.

  6. The auto-inhibitory state of Rho guanine nucleotide exchange factor ARHGEF5/TIM can be relieved by targeting its SH3 domain with rationally designed peptide aptamers.


    He, Ping; Tan, De-Li; Liu, Hong-Xiang; Lv, Feng-Lin; Wu, Wei


    The short isoform of Rho guanine nucleotide exchange factor ARHGEF5 is known as TIM, which plays diverse roles in, for example, tumorigenesis, neuronal development and Src-induced podosome formation through the activation of its substrates, the Rho family of GTPases. The activation is auto-inhibited by a putative helix N-terminal to the DH domain of TIM, which is stabilized by the intramolecular interaction of C-terminal SH3 domain with a poly-proline sequence between the putative helix and the DH domain. In this study, we systematically investigated the structural basis, energetic landscape and biological implication underlying TIM auto-inhibition by using atomistic molecular dynamics simulations and binding free energy analysis. The computational study revealed that the binding of SH3 domain to poly-proline sequence is the prerequisite for the stabilization of TIM auto-inhibition. Thus, it is suggested that targeting SH3 domain with competitors of the poly-proline sequence would be a promising strategy to relieve the auto-inhibitory state of TIM. In this consideration, we rationally designed a number of peptide aptamers for competitively inhibiting the SH3 domain based on modeled TIM structure and computationally generated data. Peptide binding test and guanine nucleotide exchange analysis solidified that these designed peptides can both bind to the SH3 domain potently and activate TIM-catalyzed RhoA exchange reaction effectively. Interestingly, a positive correlation between the peptide affinity and induced exchange activity was observed. In addition, separate mutation of three conserved residues Pro49, Pro52 and Lys54 - they are required for peptide recognition by SH3 domain -- in a designed peptide to Ala would completely abolish the capability of this peptide activating TIM. All these come together to suggest an intrinsic relationship between peptide binding to SH3 domain and the activation of TIM.

  7. Guanine nucleotide-dependent, pertussis toxin-insensitive, stimulation of inositol phosphate formation by carbachol in a membrane preparation from astrocytoma cells

    SciTech Connect

    Hepler, J.R.; Harden, T.K.


    Formation of the inositol phosphates (InsP), InsP/sub 3/, InsP/sub 2/, and InsP/sub 1/ was increased in a concentration dependent manner (K/sub 0.5/ approx. 5 by GTP..sigma..S in washed membranes prepared from /sup 3/H-inositol-prelabelled 1321N1 human astrocytoma cells. Both GTP..gamma..S and GppNHp stimulated InsP formation by 2-3 fold over control; GTP and GDP were much less efficacious and GMP had no effect. Although the muscarinic cholinergic receptor agonist carbachol had no effect in the absence of guanine nucleotide, in the presence of 10 GTP..gamma..S, carbachol stimulated (K/sub 0.5/ approx. 10 M) the formation of InsP above the level achieved with GTP..gamma..S alone. The effect of carbachol was completely blocked by atropine. The order of potency for a series of nucleotides for stimulation of InsP formation in the presence of 500 carbachol was GTP..gamma..S > GppNHp > GTP = GDP. Pertussis toxin, at concentrations that fully ADP-ribosylate and functionally inactivate G/sub i/, had no effect on InsP formation in the presence of GTP..gamma..S or GTP..gamma..S plus carbachol. Histamine and bradykinin also stimulated InsP formation in the presence of GTP..gamma..S in washed membranes from 1321N1 cells. These data are consistent with the idea that a guanine nucleotide regulatory protein that is not G/sub i/ is involved in receptor-mediated stimulation of InsP formation in 1321N1 human astrocytoma cells.

  8. The mechanism of guanine specific photooxidation in the presence of berberine and palmatine: activation of photosensitized singlet oxygen generation through DNA-binding interaction.


    Hirakawa, Kazutaka; Kawanishi, Shosuke; Hirano, Toru


    The mechanism of DNA damage by photoexcited alkaloids, berberine and palmatine, was examined using 32P-labeled DNA fragments obtained from human genes. Berberine and palmatine easily bind to DNA, leading to the formation of strong fluorescent complexes. The binding constants of berberine and palmatine to DNA, estimated from an analysis of their fluorescence enhancements, indicate the formation of stable complexes. Photoexcited berberine and palmatine caused DNA cleavage, specifically at almost all guanine residues, under the aerobic condition after Escherichia coli formamidopyrimidine-DNA glycosylase or piperidine treatment, suggesting the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodGuo), an oxidized product of 2'-deoxyguanosine, and further oxidized products. The formation of 8-oxodGuo was confirmed by HPLC measurement. The quantum yield of 8-oxodGuo formation by berberine was almost the same as that induced by palmatine. Berberine and palmatine did not cause DNA photodamage under anaerobic conditions. Scavengers of singlet oxygen (1O2), such as sodium azide and methional, inhibited DNA damage. These findings suggest that photoexcited berberine and palmatine give rise to 8-oxodGuo through 1O2 generation. The photosensitized 1O2 generation from these alkaloids was examined using near-infrared luminescence measurements. Emission at ca. 1270 nm was observed during photoexcitation of the DNA-alkaloid complexes. This emission was quenched by sodium azide, a scavenger of 1O2. In the absence of DNA, berberine and palmatine could not show the emission. This spectroscopic study has shown that photoexcited alkaloids can generate 1O2 only when the DNA-alkaloid complexes are formed. In conclusion, berberine and palmatine easily bind to DNA and induce guanine specific photooxidation via 1O2 formation. The present study suggests that berberine and palmatine can act as functional photosensitizers enabling a switch in phototoxicity via 1O2 formation by the interaction

  9. Combination of nitrogen dioxide radicals with 8-oxo-7,8-dihydroguanine and guanine radicals in DNA: oxidation and nitration end-products.


    Misiaszek, Richard; Crean, Conor; Geacintov, Nicholas E; Shafirovich, Vladimir


    The oxidation and nitration reactions in DNA associated with the combination of nitrogen dioxide radicals with 8-oxo-7,8-dihydroguanine (8-oxoGua) and guanine radicals were explored by kinetic laser spectroscopy and mass spectrometry methods. The oxidation/nitration processes were triggered by photoexcitation of 2-aminopurine (2AP) residues site-specifically positioned in the 2'-deoxyribooligonucleotide 5'-d(CC[2AP]TC[X]CTACC) sequences (X = 8-oxoGua or G), by intense 308 nm excimer laser pulses. The photoionization products, 2AP radicals, rapidly oxidize either 8-oxoGua or G residues positioned within the same oligonucleotide but separated by a TC dinucleotide step on the 3'-side of 2AP. The two-photon ionization of the 2AP residue also generates hydrated electrons that are trapped by nitrate anions thus forming nitrogen dioxide radicals. The combination of nitrogen dioxide radicals with the 8-oxoGua and G radicals occurs with similar rate constants (approximately 4.3 x 10(8) M(-1) s(-1)) in both single- and double-stranded DNA. In the case of 8-oxoGua, the major end-products of this bimolecular radical-radical addition are spiroiminodihydantoin lesions, the products of 8-oxoGua oxidation. Oxygen-18 isotope labeling experiments reveal that the O-atom in the spiroiminodihydantoin lesion originates from water molecules, not from nitrogen dioxide radicals. In contrast, combination of nitrogen dioxide and guanine neutral radicals generated under the same conditions results in the formation of the nitro products, 5-guanidino-4-nitroimidazole and 8-nitroguanine adducts. The mechanistic aspects of the oxidation/nitration processes and their biological implications are discussed.

  10. A Computational Study of a Recreated G Protein-GEF Reaction Intermediate Competent for Nucleotide Exchange: Fate of the Mg Ion

    PubMed Central

    Ben Hamida-Rebaï, Mériam; Robert, Charles H.


    Small G-proteins of the superfamily Ras function as molecular switches, interacting with different cellular partners according to their activation state. G-protein activation involves the dissociation of bound GDP and its replacement by GTP, in an exchange reaction that is accelerated and regulated in the cell by guanine-nucleotide exchange factors (GEFs). Large conformational changes accompany the exchange reaction, and our understanding of the mechanism is correspondingly incomplete. However, much knowledge has been derived from structural studies of blocked or inactive mutant GEFs, which presumably closely represent intermediates in the exchange reaction and yet which are by design incompetent for carrying out the nucleotide exchange reaction. In this study we have used comparative modelling to recreate an exchange-competent form of a late, pre-GDP-ejection intermediate species in Arf1, a well-characterized small G-protein. We extensively characterized three distinct models of this intermediate using molecular dynamics simulations, allowing us to address ambiguities related to the mutant structural studies. We observed in particular the unfavorable nature of Mg associated forms of the complex and the establishment of closer Arf1-GEF contacts in its absence. The results of this study shed light on GEF-mediated activation of this small G protein and on predicting the fate of the Mg ion at a critical point in the exchange reaction. The structural models themselves furnish additional targets for interfacial inhibitor design, a promising direction for exploring potentially druggable targets with high biological specificity. PMID:20174625

  11. Analysis of peroxynitrite reactions with guanine, xanthine, and adenine nucleosides by high-pressure liquid chromatography with electrochemical detection: C8-nitration and -oxidation.


    Sodum, R S; Fiala, E S


    Peroxynitrite, the reaction product of nitric oxide and superoxide anion, and a powerful oxidant, was found to nitrate as well as oxidize adenine, guanine, and xanthine nucleosides. A highly sensitive reverse-phase HPLC method with a dual-mode electrochemical detector, which reduces the nitro product at the first electrode and detects the reduced product by oxidation at the second electrode, was applied to detect femtomole levels of 8-nitroguanine and 8-nitroxanthine. This method was used to separate and identify the products of nitration and oxidation from the reactions of nucleosides with peroxynitrite. Peroxynitrite nitrates deoxyguanosine at neutral pH to give the very unstable 8-nitrodeoxyguanosine, in addition to 8-nitroguanine. 8-Nitrodeoxyguanosine, with a half-life of approximately 10 min at room temperature and guanine nucleosides, adenine nucleosides undergo peroxynitrite-mediated C8 oxidation even at neutral pH to give the corresponding 8-oxoadenine nucleosides in approximately 0.3% yield. Adenine nitration, though minor compared to C8-oxidation, appears to occur at both C2 and C8 positions of the adenine ring. Lowering the

  12. Neisseria gonorrhoeae MutS Affects Pilin Antigenic Variation through Mismatch Correction and Not by pilE Guanine Quartet Binding

    PubMed Central

    Rotman, Ella


    ABSTRACT Many pathogens use homologous recombination to vary surface antigens to avoid immune surveillance. Neisseria gonorrhoeae achieves this in part by changing the properties of its surface pili in a process called pilin antigenic variation (AV). Pilin AV occurs by high-frequency gene conversion reactions that transfer silent pilS sequences into the expressed pilE locus and requires the formation of an upstream guanine quartet (G4) DNA structure to initiate this process. The MutS and MutL proteins of the mismatch correction (MMC) system act to correct mismatches after replication and prevent homeologous (i.e., partially homologous) recombination, but MutS orthologs can also bind to G4 structures. A previous study showed that mutation of MutS resulted in a 3-fold increase in pilin AV, which could be due to the loss of MutS antirecombination properties or loss of G4 binding. We tested two site-directed separation-of-function MutS mutants that are both predicted to bind to G4s but are not able to perform MMC. Pilus phase variation assays and DNA sequence analysis of pilE variants produced in these mutants showed that all three mutS mutants and a mutL mutant had similar increased frequencies of pilin AV. Moreover, the mutS mutants all showed similar increased levels of pilin AV-dependent synthetic lethality. These results show that antirecombination by MMC is the reason for the effect that MutS has on pilin AV and is not due to pilE G4 binding by MutS. IMPORTANCE Neisseria gonorrhoeae continually changes its outer surface proteins to avoid recognition by the immune system. N. gonorrhoeae alters the antigenicity of the pilus by directed recombination between partially homologous pilin copies in a process that requires a guanine quartet (G4) structure. The MutS protein of the mismatch correction (MMC) system prevents recombination between partially homologous sequences and can also bind to G4s. We confirmed that loss of MMC increases the frequency of pilin antigenic

  13. Photooxidative damage of guanine in DG and DNA by the radicals derived from the alpha cleavage of the electronically excited carbonyl products generated in the thermolysis of alkoxymethyl-substituted dioxetanes and the photolysis of alkoxyacetones.


    Adam, W; Arnold, M A; Saha-Möller, C R


    On thermolysis of the methoxy (MeO-TMD), tert-butoxy (tBuO-TMD), and hydroxy (HO-TMD) derivatives of 3,3,4,4-tetramethyl-1,2-dioxetane (TMD) in the presence of dG and calf-thymus DNA, the guanine is oxidized considerably more efficiently than the parent TMD. The same trend in the oxidative reactivity is observed for the photolysis of the corresponding oxy-substituted ketones versus acetone. The oxidative reactivity order in the dioxetane thermolysis, as well as in the ketone photolysis, parallels the ability of the excited ketones to release radicals (determined by spin trapping with DMPO and EPR spectroscopy) upon alpha cleavage (Norrish-type-I reaction). In the presence of molecular oxygen, the carbon-centered radicals are scavenged to produce peroxyl radicals, which are proposed as the reactive species in the oxidation of the guanine in dG and calf-thymus DNA.

  14. Computational Study of the Radical Mediated Mechanism of the Formation of C8, C5, and C4 Guanine:Lysine Adducts in the Presence of the Benzophenone Photosensitizer.


    Thapa, Bishnu; Munk, Barbara H; Burrows, Cynthia J; Schlegel, H Bernhard


    The oxidation of guanine by triplet benzophenone in the presence of lysine has been shown to produce mono- and dilysine-substituted spiroiminodihydantion products, 8-Lys-Sp and 5,8-diLys-Sp. The potential energy surfaces for C8, C5, and C4 nucleophilic addition have been mapped out using the B3LYP/aug-cc-pVTZ//B3LYP/6-31+G(d,p) level of density functional theory with the SMD solvation model and employing methylamine as a model for the side chain of lysine. Enthalpies, barrier heights, pKa's, and reduction potentials were calculated for intermediates to find the lowest energy paths. For neutral methylamine plus guanine radical and neutral methylamine radical plus guanine, the barrier for addition at C8 is ca. 10 kcal/mol lower than that for addition at C5 and C4. The barriers for water addition at C8, C5, and C4 of guanine radical are 13-20 kcal/mol higher than that for methylamine addition at C8. Further oxidation and loss of a proton leads to 8-methylaminoguanine, the methylamino analogue of 8-oxo-7,8-dihydroguanine (8-oxoG). The barrier for the addition of a second methylamine at C5 of 8-methylaminoguanine is 4.5 kcal/mol lower than that for the corresponding addition of water. Nevertheless, if the concentration of methylamine (or lysine) is very low, water addition could be competitive with methylamine addition. This would lead to comparable fractions of 8-monosubstituted-Sp and 5-8-disubstituted-Sp, in agreement with the experimental observations.

  15. The use of primary rat hepatocytes to achieve metabolic activation of promutagens in the Chinese hamster ovary/hypoxantine-guanine phosphoribosyl transferase mutational assay

    SciTech Connect

    Bermudez, E.; Couch, D.B.; Tillery, D.


    A method is described in which primary rat hepatocytes have been cocultured with chinese hamster ovary (CHO) cells to provide metabolic activation of promutgens in the Chinese hamster ovary/hypoxanthine-guanine phosphoribosyl transferase (CHO/HGPRT) mutational assay. Single cell hepatocyte suspensions were prepared from male Fisher-344 rats using the in situ collagenase perfusion technique. Hepatocytes were allowed to attach for 1.5 hours in tissue culture dishes containing an approximately equal number of CHO cells in log growth. The cocultures were exposed to promutagens for up to 20 hours in serum-free medium. The survival and 6-thioguanine-resistant fraction of treated CHO cells were then determined as in the standard CHO/HGPRT assay. Aflatoxin B/sub 1/ (AFB/sub 1/) 7,12-dimethylbenz(a)anthracene (DMBA) and benzo(a)pyrene (B(a)P) were found to produce increases in the mutant fractions of treated CHO cells as a function of concentration. The time required for optimum expression of the mutant phenotype following exposure to DMBA and AFB/sub 1/ was approximately 8 days. Primary cell-mediated mutagenesis may be useful in elucidating methobolic pathways important in the production and detoxification of genotoxic products in vivo.

  16. Hydrophilic-interaction liquid chromatography-tandem mass spectrometric determination of erythrocyte 5-phosphoribosyl 1-pyrophosphate in patients with hypoxanthine-guanine phosphoribosyltransferase deficiency.


    Hasegawa, Hiroshi; Shinohara, Yoshihiko; Nozaki, Sayako; Nakamura, Makiko; Oh, Koei; Namiki, Osamu; Suzuki, Kiyotaka; Nakahara, Akihiko; Miyazawa, Mari; Ishikawa, Ken; Himeno, Takahiro; Yoshida, Sayaka; Ueda, Takanori; Yamada, Yasukazu; Ichida, Kimiyoshi


    Mutations in the gene encoding hypoxanthine-guanine phosphoribosyltransferase (HPRT) cause Lesch-Nyhan disease (LND) and its variants (LNV). Due to the technical problems for measuring the HPRT activity in vitro, discordances between the residual HPRT activity and the clinical severity were found. 5-Phosphoribosyl 1-pyrophosphate (PRPP) is a substrate for HPRT. Since increased PRPP concentrations were observed in erythrocytes from patients with LND and LNV, we have turned our attention to erythrocyte PRPP as a biomarker for the phenotype classification. In the present work, a method for determination of PRPP concentration in erythrocyte was developed using liquid chromatography-tandem mass spectrometry (LC-MS/MS) with multiple reaction monitoring (MRM). Packed erythrocyte samples were deproteinized by heating and the supernatants were injected into the LC-MS/MS system. All measurement results showed good precision with RSD <6%. PRPP concentrations of nine normal male subjects, four male patents with LND and six male patients with LNV were compared. The PRPP concentrations in erythrocyte from patients with LND were markedly increased compared with those from normal subjects, and those from patients with LNV were also increased but the degree was smaller than those with LND. The increase pattern of PRPP concentration in erythrocyte from patients with HPRT deficiency was consistent with the respective phenotypes and was correlated with the disease severity. PRPP concentration was suggested to give us supportive information for the diagnosis and the phenotype classification of LND and LNV.

  17. Guanine nucleotide dissociation inhibitor is essential for Rab1 function in budding from the endoplasmic reticulum and transport through the Golgi stack

    PubMed Central


    The small GTPase Rab1 is required for vesicular traffic from the ER to the cis-Golgi compartment, and for transport between the cis and medial compartments of the Golgi stack. In the present study, we examine the role of guanine nucleotide dissociation inhibitor (GDI) in regulating the function of Rab1 in the transport of vesicular stomatitis virus glycoprotein (VSV-G) in vitro. Incubation in the presence of excess GDI rapidly (t1/2 < 30 s) extracted Rab1 from membranes, inhibiting vesicle budding from the ER and sequential transport between the cis-, medial-, and trans-Golgi cisternae. These results demonstrate a direct role for GDI in the recycling of Rab proteins. Analysis of rat liver cytosol by gel filtration revealed that a major pool of Rab1 fractionates with a molecular mass of approximately 80 kD in the form of a GDI-Rab1 complex. When the GDI-Rab1 complex was depleted from cytosol by use of a Rab1-specific antibody, VSV-G failed to exit the ER. However, supplementation of depleted cytosol with a GDI-Rab1 complex prepared in vitro from recombinant forms of Rab1 and GDI efficiently restored export from the ER, and transport through the Golgi stack. These results provide evidence that a cytosolic GDI-Rab1 complex is required for the formation of non-clathrin-coated vesicles mediating transport through the secretory pathway. PMID:8089173

  18. Drosophila RhoGEF4 encodes a novel RhoA-specific guanine exchange factor that is highly expressed in the embryonic central nervous system.


    Nahm, Minyeop; Lee, Mihye; Baek, Seung-Hak; Yoon, Jin-Ho; Kim, Hong-Hee; Lee, Zang Hee; Lee, Seungbok


    Rho family small GTPases act as molecular switches that regulate neuronal morphogenesis, including axon growth and guidance, dendritic spine formation, and synapse formation. These proteins are positively regulated by guanine nucleotide exchange factors (GEFs) of the Dbl family. This study describes the identification and characterization of Drosophila RhoGEF4 (DRhoGEF4), a novel Dbl family protein that is specifically expressed in the central nervous system during Drosophila embryogenesis. The predicted amino acid sequence of DRhoGEF4 contains a Dbl homology (DH) domain and an adjacent C-terminal pleckstrin homology (PH) domain, which are most closely related to those of mammalian frabins. In this study, the DH-PH motif is shown to enhance the dissociation of GDP from either RhoA or Rac1 but not from Cdc42 in vitro. In addition, p21-binding domain pull-down assays demonstrate that DRhoGEF4 activates RhoA, but neither Rac1 nor Cdc42 in HEK293 cells. Finally, overexpression of DRhoGEF4 is able to induce assembly of stress fibers in cultured NIH3T3 cells. Taken together, these findings suggest that DRhoGEF4 may participate in cytoskeleton-related cellular events by specifically activating RhoA in neuronal morphogenesis.

  19. Role of the guanine nucleotide exchange factor in Akt2-mediated plasma membrane translocation of GLUT4 in insulin-stimulated skeletal muscle.


    Takenaka, Nobuyuki; Yasuda, Naoto; Nihata, Yuma; Hosooka, Tetsuya; Noguchi, Tetsuya; Aiba, Atsu; Satoh, Takaya


    The small GTPase Rac1 plays a key role in insulin-promoted glucose uptake mediated by the GLUT4 glucose transporter in skeletal muscle. Our recent studies have demonstrated that the serine/threonine protein kinase Akt2 is critically involved in insulin-dependent Rac1 activation. The purpose of this study is to clarify the role of the guanine nucleotide exchange factor FLJ00068 in Akt2-mediated Rac1 activation and GLUT4 translocation in mouse skeletal muscle and cultured myocytes. Constitutively activated FLJ00068 induced GLUT4 translocation in a Rac1-dependent and Akt2-independent manner in L6 myocytes. On the other hand, knockdown of FLJ00068 significantly reduced constitutively activated Akt2-triggered GLUT4 translocation. Furthermore, Rac1 activation and GLUT4 translocation induced by constitutively activated phosphoinositide 3-kinase were inhibited by knockdown of FLJ00068. In mouse gastrocnemius muscle, constitutively activated FLJ00068 actually induced GLUT4 translocation to the sarcolemma. GLUT4 translocation by constitutively activated FLJ00068 was totally abolished in rac1 knockout mouse gastrocnemius muscle. Additionally, we were successful in detecting the activation of Rac1 following the expression of constitutively activated FLJ00068 in gastrocnemius muscle by immunofluorescence microscopy using an activation-specific probe. Collectively, these results strongly support the notion that FLJ00068 regulates Rac1 downstream of Akt2, leading to the stimulation of glucose uptake in skeletal muscle.

  20. RhoA Phosphorylation Induces Rac1 Release from Guanine Dissociation Inhibitor α and Stimulation of Vascular Smooth Muscle Cell Migration▿

    PubMed Central

    Rolli-Derkinderen, Malvyne; Toumaniantz, Gilles; Pacaud, Pierre; Loirand, Gervaise


    Although overactivation of RhoA is recognized as a common component of vascular disorders, the molecular mechanisms regulating RhoA activity in vascular smooth muscle cells (VSMC) are still unclear. We have previously shown that in VSMC, RhoA is phosphorylated on Ser188 by nitric oxide (NO)-stimulated cGMP-dependent kinase (PKG), which leads to RhoA-Rho kinase pathway inhibition. In this study, we showed that expression of phosphoresistant RhoA mutants prevented the stimulation of VSMC migration and adhesion induced by NO-PKG pathway activation. In contrast, under basal conditions, phosphomimetic RhoA mutants stimulated VSMC adhesion and migration through a signaling pathway requiring Rac1 and the Rho exchange factor Vav3. RhoA phosphorylation or phosphomimetic RhoA mutants induced Rac1 activation but did not activate Vav3. Indeed, phosphorylated RhoA or phosphomimetic mutants trapped guanine dissociation inhibitor α (GDIα), leading to the release of Rac1 and its translocation to the membrane, where it was then activated by the basal Vav3 nucleotide exchange activity. In vivo, RhoA phosphorylation induced by PKG activation in the aortas of rats treated with sildenafil induced dissociation of Rac1 from GDIα and activation of the Rac1 signaling pathway. These results suggest that the phosphorylation of RhoA represents a novel potent and physiological GDIα displacement factor that leads to Rac1 activation and regulation of Rac1-dependent VSMC functions. PMID:20696841

  1. Fine-Tuning of the Actin Cytoskeleton and Cell Adhesion During Drosophila Development by the Unconventional Guanine Nucleotide Exchange Factors Myoblast City and Sponge

    PubMed Central

    Biersmith, Bridget; Wang, Zong-Heng; Geisbrecht, Erika R.


    The evolutionarily conserved Dock proteins function as unconventional guanine nucleotide exchange factors (GEFs). Upon binding to engulfment and cell motility (ELMO) proteins, Dock–ELMO complexes activate the Rho family of small GTPases to mediate a diverse array of biological processes, including cell motility, apoptotic cell clearance, and axon guidance. Overlapping expression patterns and functional redundancy among the 11 vertebrate Dock family members, which are subdivided into four families (Dock A, B, C, and D), complicate genetic analysis. In both vertebrate and invertebrate systems, the actin dynamics regulator, Rac, is the target GTPase of the Dock-A subfamily. However, it remains unclear whether Rac or Rap1 are the in vivo downstream GTPases of the Dock-B subfamily. Drosophila melanogaster is an excellent genetic model organism for understanding Dock protein function as its genome encodes one ortholog per subfamily: Myoblast city (Mbc; Dock A) and Sponge (Spg; Dock B). Here we show that the roles of Spg and Mbc are not redundant in the Drosophila somatic muscle or the dorsal vessel. Moreover, we confirm the in vivo role of Mbc upstream of Rac and provide evidence that Spg functions in concert with Rap1, possibly to regulate aspects of cell adhesion. Together these data show that Mbc and Spg can have different downstream GTPase targets. Our findings predict that the ability to regulate downstream GTPases is dependent on cellular context and allows for the fine-tuning of actin cytoskeletal or cell adhesion events in biological processes that undergo cell morphogenesis. PMID:25908317

  2. Determination of guanine and adenine by high-performance liquid chromatography with a self-fabricated wall-jet/thin-layer electrochemical detector at a glassy carbon electrode.


    Zhou, Yaping; Yan, Hongling; Xie, Qingji; Yao, Shouzhuo


    A sensitive wall-jet/thin-layer amperometric electrochemical detector (ECD) coupled to high-performance liquid chromatography (HPLC) was developed for simultaneous determination of guanine (G) and adenine (A). The analytes were detected at a glassy carbon electrode (GCE) and the HPLC-ECD calibration curves showed good linearity (R(2)>0.997) under optimized conditions. Limits of detection for G and A are 0.6 nM and 1.4 nM (S/N=3), respectively, which are lower than those obtained with an UV-vis detector and a commercial electrochemical detector. We have successfully applied this HPLC-ECD to assess the contents of G and A in hydrochloric acid-digested calf thymus double-stranded DNA. In addition, we compared in detail the analysis of G and A by cyclic voltammetry (CV) and by the HPLC-ECD system on both bare GCE and electroreduced graphene oxide (ERGO) modified GCE. We found that the adsorption of G and A on the electrode surfaces can vary their anodic CV peaks and the competitive adsorption of G and A on the limited sites of the electrode surfaces can cause crosstalk effects on their anodic CV peak signals, but the HPLC-ECD system is insensitive to such electrode-adsorption and can give more reliable analytical results.

  3. Inositol phospholipids regulate the guanine-nucleotide-exchange factor Tiam1 by facilitating its binding to the plasma membrane and regulating GDP/GTP exchange on Rac1

    PubMed Central


    Binding of the Rac1-specific guanine-nucleotide-exchange factor, Tiam1, to the plasma membrane requires the N-terminal pleckstrin homology domain. In the present study, we show that membrane-association is mediated by binding of PtdIns(4,5)P2 to the pleckstrin homology domain. Moreover, in 1321N1 astrocytoma cells, translocation of Tiam1 to the cytosol, following receptor-mediated stimulation of PtdIns(4,5)P2 breakdown, correlates with decreased Rac1-GTP levels, indicating that membrane-association is required for GDP/GTP exchange on Rac1. In addition, we show that platelet-derived growth factor activates Rac1 in vivo by increasing PtdIns(3,4,5)P3 concentrations, rather than the closely related lipid, PtdIns(3,4)P2. Finally, the data demonstrate that PtdIns(4,5)P2 and PtdIns(3,4,5)P3 bind to the same pleckstrin homology domain in Tiam1 and that soluble inositol phosphates appear to compete with lipids for this binding. Together, these novel observations provide strong evidence that distinct phosphoinositides regulate different functions of this enzyme, indicating that local concentrations of signalling lipids and the levels of cytosolic inositol phosphates will play crucial roles in determining its activity in vivo. PMID:15242348

  4. Guanine oxidation product 5-carboxamido-5-formamido-2-iminohydantoin induces mutations when bypassed by DNA polymerases and is a substrate for base excision repair.


    Alshykhly, Omar R; Fleming, Aaron M; Burrows, Cynthia J


    Guanine (G) is a target for oxidation by reactive oxygen species in DNA, RNA, and the nucleotide pool. Damage to DNA yields products with alternative properties toward DNA processing enzymes compared to those of the parent nucleotide. A new lesion, 5-carboxamido-5-formamido-2-iminohydantoin (2Ih), bearing a stereocenter in the base was recently identified from the oxidation of G. DNA polymerase and base excision repair processing of this new lesion has now been evaluated. Single nucleotide insertion opposite (S)-2Ih and (R)-2Ih in the template strand catalyzed by the DNA polymerases Klenow fragment exo(-), DPO4, and Hemo KlenTaq demonstrates these lesions to cause point mutations. Specifically, they promote 3-fold more G·C → C·G transversion mutations than G·C → T·A, and (S)-2Ih was 2-fold more blocking for polymerase bypass than (R)-2Ih. Both diastereomer lesions were found to be substrates for the DNA glycosylases NEIL1 and Fpg, and poorly excised by endonuclease III (Nth). The activity was independent of the base pair partner. Thermal melting, CD spectroscopy, and density functional theory geometric optimization calculations were conducted to provide insight into these polymerase and DNA glycosylase studies. These results identify that formation of the 2Ih lesions in a cell would be mutagenic in the event that they were not properly repaired.

  5. Calculation of pKa values of nucleobases and the guanine oxidation products guanidinohydantoin and spiroiminodihydantoin using density functional theory and a polarizable continuum model.


    Verdolino, Vincenzo; Cammi, Roberto; Munk, Barbara H; Schlegel, H Bernhard


    An efficient computational method has been identified that uses B3LYP density functional theory, IEF-PCM solvation modeling with a modified UFF cavity, and Boltzmann weighting of tautomers to predict the site-specific and global pKa of DNA nucleobases and their oxidation products. The method has been used to evaluate the acidity of guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp), two highly mutagenic guanine oxidation products. The trend observed for the pKa values of Gh (9.64 and 8.15) is consistent with the experimentally observed values for guanidine cation (13.7) and hydantoin (9.16). The pKa1(calc) value for deprotonation of Sp cation (Sp+ --> Sp) is very close to the experimentally observed pKa1 for 8-oxoG and is consistent with the similarity in their structures. The data suggest that the imide (N7) proton in Sp is considerably more acidic than that in Gh, possibly due to the presence of the through-space electronic effects of the carbonyl group located at C6. This difference in the acidity of Gh and Sp may be an indication of their potential toxicity and mutagenicity in vivo and remains a fertile area for experimental study.

  6. Inositol phospholipids regulate the guanine-nucleotide-exchange factor Tiam1 by facilitating its binding to the plasma membrane and regulating GDP/GTP exchange on Rac1.


    Fleming, Ian N; Batty, Ian H; Prescott, Alan R; Gray, Alex; Kular, Gursant S; Stewart, Hazel; Downes, C Peter


    Binding of the Rac1-specific guanine-nucleotide-exchange factor, Tiam1, to the plasma membrane requires the N-terminal pleckstrin homology domain. In the present study, we show that membrane-association is mediated by binding of PtdIns(4,5)P(2) to the pleckstrin homology domain. Moreover, in 1321N1 astrocytoma cells, translocation of Tiam1 to the cytosol, following receptor-mediated stimulation of PtdIns(4,5)P(2) breakdown, correlates with decreased Rac1-GTP levels, indicating that membrane-association is required for GDP/GTP exchange on Rac1. In addition, we show that platelet-derived growth factor activates Rac1 in vivo by increasing PtdIns(3,4,5)P(3) concentrations, rather than the closely related lipid, PtdIns(3,4)P(2). Finally, the data demonstrate that PtdIns(4,5)P(2) and PtdIns(3,4,5)P(3) bind to the same pleckstrin homology domain in Tiam1 and that soluble inositol phosphates appear to compete with lipids for this binding. Together, these novel observations provide strong evidence that distinct phosphoinositides regulate different functions of this enzyme, indicating that local concentrations of signalling lipids and the levels of cytosolic inositol phosphates will play crucial roles in determining its activity in vivo.

  7. Fine-Tuning of the Actin Cytoskeleton and Cell Adhesion During Drosophila Development by the Unconventional Guanine Nucleotide Exchange Factors Myoblast City and Sponge.


    Biersmith, Bridget; Wang, Zong-Heng; Geisbrecht, Erika R


    The evolutionarily conserved Dock proteins function as unconventional guanine nucleotide exchange factors (GEFs). Upon binding to engulfment and cell motility (ELMO) proteins, Dock-ELMO complexes activate the Rho family of small GTPases to mediate a diverse array of biological processes, including cell motility, apoptotic cell clearance, and axon guidance. Overlapping expression patterns and functional redundancy among the 11 vertebrate Dock family members, which are subdivided into four families (Dock A, B, C, and D), complicate genetic analysis. In both vertebrate and invertebrate systems, the actin dynamics regulator, Rac, is the target GTPase of the Dock-A subfamily. However, it remains unclear whether Rac or Rap1 are the in vivo downstream GTPases of the Dock-B subfamily. Drosophila melanogaster is an excellent genetic model organism for understanding Dock protein function as its genome encodes one ortholog per subfamily: Myoblast city (Mbc; Dock A) and Sponge (Spg; Dock B). Here we show that the roles of Spg and Mbc are not redundant in the Drosophila somatic muscle or the dorsal vessel. Moreover, we confirm the in vivo role of Mbc upstream of Rac and provide evidence that Spg functions in concert with Rap1, possibly to regulate aspects of cell adhesion. Together these data show that Mbc and Spg can have different downstream GTPase targets. Our findings predict that the ability to regulate downstream GTPases is dependent on cellular context and allows for the fine-tuning of actin cytoskeletal or cell adhesion events in biological processes that undergo cell morphogenesis.

  8. The Rho Guanine Nucleotide Exchange Factor DRhoGEF2 Is a Genetic Modifier of the PI3K Pathway in Drosophila.


    Chang, Ying-Ju; Zhou, Lily; Binari, Richard; Manoukian, Armen; Mak, Tak; McNeill, Helen; Stambolic, Vuk


    The insulin/IGF-1 signaling pathway mediates various physiological processes associated with human health. Components of this pathway are highly conserved throughout eukaryotic evolution. In Drosophila, the PTEN ortholog and its mammalian counterpart downregulate insulin/IGF signaling by antagonizing the PI3-kinase function. From a dominant loss-of-function genetic screen, we discovered that mutations of a Dbl-family member, the guanine nucleotide exchange factor DRhoGEF2 (DRhoGEF22(l)04291), suppressed the PTEN-overexpression eye phenotype. dAkt/dPKB phosphorylation, a measure of PI3K signaling pathway activation, increased in the eye discs from the heterozygous DRhoGEF2 wandering third instar larvae. Overexpression of DRhoGEF2, and it's functional mammalian ortholog PDZ-RhoGEF (ArhGEF11), at various stages of eye development, resulted in both dPKB/Akt-dependent and -independent phenotypes, reflecting the complexity in the crosstalk between PI3K and Rho signaling in Drosophila.

  9. BIG1, a brefeldin A-inhibited guanine nucleotide-exchange factor, is required for GABA-gated Cl⁻ influx through regulation of GABAA receptor trafficking.


    Li, Cuixian; Chen, Shaorui; Yu, Yang; Zhou, Chun; Wang, Ying; Le, Kang; Li, Dong; Shao, Weiwei; Lu, Liang; You, Yan; Peng, Jin; Huang, Heqing; Liu, Peiqing; Shen, Xiaoyan


    GABAA receptors (GABAARs) mediate the majority of fast synaptic inhibition. Trafficking regulation and protein-protein interactions that maintain the appropriate number of GABAARs at the cell surface are considered to be important mechanisms for controlling the strength of synaptic inhibition. Here, we report that BIG1, a brefeldin A (BFA)-inhibited guanine nucleotide-exchange factor (GEF) which has a known role in vesicle trafficking, is a new binding partner of GABAARs. Treatment of neurons with BFA, an uncompetitive inhibitor of BIG1 GEF activity, or depletion of BIG1 by small RNA interference (siRNA) significantly decreased GABAARs at the neuronal surface and suppressed GABA-gated influx of chloride ions. Over-expression of HA-tagged BIG1-E793K, a dominant-negative mutant, also significantly decreased GABAARs at the neuronal surface, but had no effect on the total amount of GABAARs. Inhibition of GABAAR endocytosis by muscimol increased both GABAARs and BIG1 at the neuronal surface in a time-dependent fashion, and this increase could be abolished by bicuculline. Finally, depletion of BIG1 by siRNA inhibited the muscimol-stimulated increase of GABAARs. Those data suggest an important function of BIG1 in trafficking of GABAARs to the cell surface through its GEF activity. Thus, we identify an important role of BIG1 in modulating GABA-gated Cl(-) influx through the regulation of cell surface expression of GABAARs.

  10. The Rho Guanine Nucleotide Exchange Factor DRhoGEF2 Is a Genetic Modifier of the PI3K Pathway in Drosophila

    PubMed Central

    Chang, Ying-Ju; Zhou, Lily; Binari, Richard; Manoukian, Armen; Mak, Tak; McNeill, Helen; Stambolic, Vuk


    The insulin/IGF-1 signaling pathway mediates various physiological processes associated with human health. Components of this pathway are highly conserved throughout eukaryotic evolution. In Drosophila, the PTEN ortholog and its mammalian counterpart downregulate insulin/IGF signaling by antagonizing the PI3-kinase function. From a dominant loss-of-function genetic screen, we discovered that mutations of a Dbl-family member, the guanine nucleotide exchange factor DRhoGEF2 (DRhoGEF22(l)04291), suppressed the PTEN-overexpression eye phenotype. dAkt/dPKB phosphorylation, a measure of PI3K signaling pathway activation, increased in the eye discs from the heterozygous DRhoGEF2 wandering third instar larvae. Overexpression of DRhoGEF2, and it’s functional mammalian ortholog PDZ-RhoGEF (ArhGEF11), at various stages of eye development, resulted in both dPKB/Akt-dependent and -independent phenotypes, reflecting the complexity in the crosstalk between PI3K and Rho signaling in Drosophila. PMID:27015411

  11. MS-CASPT2 study of hole transfer in guanine-indole complexes using the generalized Mulliken-Hush method: effective two-state treatment.


    Butchosa, C; Simon, S; Blancafort, L; Voityuk, A


    Because hole transfer from nucleobases to amino acid residues in DNA-protein complexes can prevent oxidative damage of DNA in living cells, computational modeling of the process is of high interest. We performed MS-CASPT2 calculations of several model structures of π-stacked guanine and indole and derived electron-transfer (ET) parameters for these systems using the generalized Mulliken-Hush (GMH) method. We show that the two-state model commonly applied to treat thermal ET between adjacent donor and acceptor is of limited use for the considered systems because of the small gap between the ground and first excited states in the indole radical cation. The ET parameters obtained within the two-state GMH scheme can deviate significantly from the corresponding matrix elements of the two-state effective Hamiltonian based on the GMH treatment of three adiabatic states. The computed values of diabatic energies and electronic couplings provide benchmarks to assess the performance of less sophisticated computational methods.

  12. Purine salvage in the apicomplexan Sarcocystis neurona, and generation of hypoxanthine-xanthine-guanine phosphoribosyltransferase-deficient clones for positive-negative selection of transgenic parasites.


    Dangoudoubiyam, Sriveny; Zhang, Zijing; Howe, Daniel K


    Sarcocystis neurona is an apicomplexan parasite that causes severe neurological disease in horses and marine mammals. The Apicomplexa are all obligate intracellular parasites that lack purine biosynthesis pathways and rely on the host cell for their purine requirements. Hypoxanthine-xanthine-guanine phosphoribosyltransferase (HXGPRT) and adenosine kinase (AK) are key enzymes that function in two complementary purine salvage pathways in apicomplexans. Bioinformatic searches of the S. neurona genome revealed genes encoding HXGPRT, AK and all of the major purine salvage enzymes except purine nucleoside phosphorylase. Wild-type S. neurona were able to grow in the presence of mycophenolic acid (MPA) but were inhibited by 6-thioxanthine (6-TX), suggesting that the pathways involving either HXGPRT or AK are functional in this parasite. Prior work with Toxoplasma gondii demonstrated the utility of HXGPRT as a positive-negative selection marker. To enable the use of HXGPRT in S. neurona, the SnHXGPRT gene sequence was determined and a gene-targeting plasmid was transfected into S. neurona. SnHXGPRT-deficient mutants were selected with 6-TX, and single-cell clones were obtained. These Sn∆HXG parasites were susceptible to MPA and could be complemented using the heterologous T. gondii HXGPRT gene. In summary, S. neurona possesses both purine salvage pathways described in apicomplexans, thus allowing the use of HXGPRT as a positive-negative drug selection marker in this parasite.

  13. Intersectin 1L Guanine Nucleotide Exchange Activity Is Regulated by Adjacent src Homology 3 Domains That Are Also Involved in Endocytosis

    PubMed Central

    Zamanian, Jennifer L.; Kelly, Regis B.


    Intersectin 1L is a scaffolding protein involved in endocytosis that also has guanine nucleotide exchange activity for Cdc42. In the context of the full-length protein, the catalytic exchange activity of the DH domain is repressed. Here we use biochemical methods to dissect the mechanism for this inhibition. We demonstrate that the intersectin 1L SH3 domains, which bind endocytic proteins, directly inhibit the activity of the DH domain in assays for both binding and exchange of Cdc42. This inhibitory mechanism seems to act through steric hindrance of Cdc42 binding by an intramolecular interaction between the intersectin 1L SH3 domain region and the adjacent DH domain. Surprisingly, the mode of SH3 domain binding is other than through the proline peptide binding pocket. The dual role of the SH3 domains in endocytosis and repression of exchange activity suggests that the intersectin 1L exchange activity is regulated by endocytosis. We show that the endocytic protein, dynamin, competes for binding to the SH3 domains with the neural Wiskott-Aldrich Syndrome protein, an actin filament nucleation protein that is a substrate for activated Cdc42. Swapping of SH3 domain binding partners might act as a switch controlling the actin nucleation activity of intersectin 1L. PMID:12686614

  14. Architecture and mechanism of the late endosomal Rab7-like Ypt7 guanine nucleotide exchange factor complex Mon1–Ccz1

    PubMed Central

    Kiontke, Stephan; Langemeyer, Lars; Kuhlee, Anne; Schuback, Saskia; Raunser, Stefan; Ungermann, Christian; Kümmel, Daniel


    The Mon1–Ccz1 complex (MC1) is the guanine nucleotide exchange factor (GEF) for the Rab GTPase Ypt7/Rab7 and is required for endosomal maturation and fusion at the vacuole/lysosome. Here we present the overall architecture of MC1 from Chaetomium thermophilum, and in combining biochemical studies and mutational analysis in yeast, we identify the domains required for catalytic activity, complex assembly and localization of MC1. The crystal structure of a catalytic MC1 core complex bound to Ypt7 provides mechanistic insight into its function. We pinpoint the determinants that allow for a discrimination of the Rab7-like Ypt7 over the Rab5-like Vps21, which are both located on the same membrane. MC1 shares structural similarities with the TRAPP complex, but employs a novel mechanism to promote nucleotide exchange that utilizes a conserved lysine residue of Ypt7, which is inserted upon MC1 binding into the nucleotide-binding pocket of Ypt7 and contributes to specificity. PMID:28051187

  15. Activation of guanine-{beta}-D-arabinofuranoside and deoxyguanosine to triphosphates by a common pathway blocks T lymphoblasts at different checkpoints

    SciTech Connect

    Leanza, Luigi; Miazzi, Cristina; Ferraro, Paola; Reichard, Peter; Bianchi, Vera


    The deoxyguanosine (GdR) analog guanine-ss-D-arabinofuranoside (araG) has a specific toxicity for T lymphocytes. Also GdR is toxic for T lymphocytes, provided its degradation by purine nucleoside phosphorylase (PNP) is prevented, by genetic loss of PNP or by enzyme inhibitors. The toxicity of both nucleosides requires their phosphorylation to triphosphates, indicating involvement of DNA replication. In cultured cells we found by isotope-flow experiments with labeled araG a rapid accumulation and turnover of araG phosphates regulated by cytosolic and mitochondrial kinases and deoxynucleotidases. At equilibrium their partition between cytosol and mitochondria depended on the substrate saturation kinetics and cellular abundance of the kinases leading to higher araGTP concentrations in mitochondria. dGTP interfered with the allosteric regulation of ribonucleotide reduction, led to highly imbalanced dNTP pools with gradual inhibition of DNA synthesis and cell-cycle arrest at the G1-S boundary. AraGTP had no effect on ribonucleotide reduction. AraG was in minute amounts incorporated into nuclear DNA and stopped DNA synthesis arresting cells in S-phase. Both nucleosides eventually induced caspases and led to apoptosis. We used high, clinically relevant concentrations of araG, toxic for nuclear DNA synthesis. Our experiments do not exclude an effect on mitochondrial DNA at low araG concentrations when phosphorylation occurs mainly in mitochondria.

  16. Stimulation of Toll-like receptor 9 by chronic intraventricular unmethylated cytosine-guanine DNA infusion causes neuroinflammation and impaired spatial memory.


    Tauber, Simone C; Ebert, Sandra; Weishaupt, Jochen H; Reich, Arno; Nau, Roland; Gerber, Joachim


    Bacterial DNA contains a high frequency of unmethylated cytosine-guanine (CpG) motifs that have strong immunostimulatory properties; they are recognized by mammalian Toll-like receptor 9 (TLR9). Because accumulating data suggest that chronic inflammatory processes are involved in the pathogenesis of neurodegenerative diseases, we hypothesized that inflammatory responses stimulated by CpG DNA might contribute to neurodegeneration and brain dysfunction. To assess the effects of continuous CpG DNA exposure in the brain, C57BL/6 (n = 21) and TLR9-deficient mice (n = 15) were given intracerebroventricular infusions of CpG DNA or saline for 28 days. Spatial memory assessed weekly by Morris water maze demonstrated impairment in CpG-treated wild-type mice but not in TLR9-deficient or control-treated mice. Motor function was not affected. Immunohistochemical analysis revealed marked microglial activation and acute axonal damage surrounding the ventricles, ependymal disruption, and reactive astrogliosis within the hippocampal formation in the CpG-treated wild-type but not TLR9-deficient mice or saline-infused controls. These results suggest that the unfavorable effects of CpG DNA are dependent on TLR9 signaling and that exposure to bacterial DNA may contribute to impaired neural function, neuroinflammation, and subsequent neurodegeneration.

  17. In vivo expression of the Arf6 Guanine-nucleotide exchange factor cytohesin-1 in mice exhibits enhanced myelin thickness in nerves.


    Torii, Tomohiro; Miyamoto, Yuki; Onami, Naoko; Tsumura, Hideki; Nemoto, Noriko; Kawahara, Katsumasa; Kato, Minoru; Kotera, Jun; Nakamura, Kazuaki; Tanoue, Akito; Yamauchi, Junji


    The myelin sheath consists of a unique multiple layer structure that acts as an insulator between neuronal axons to enhance the propagation of the action potential. In neuropathies such as demyelinating or dismyelinating diseases, chronic demyelination and defective remyelination occur repeatedly, leading to more severe neuropathy. As yet, little is known about the possibility of drug target-specific medicine for such diseases. In the developing peripheral nervous system (PNS), myelin sheaths form as Schwann cells wrap individual axons. It is thought that the development of a drug promoting myelination by Schwann cells would provide effective therapy against peripheral nerve disorders: to test such treatment, genetically modified mice overexpressing the drug target molecules are needed. We previously identified an Arf6 activator, the guanine-nucleotide exchange factor cytohesin-1, as the signaling molecule controlling myelination of peripheral axons by Schwann cells; yet, the important issue of whether cytohesin-1 itself promotes myelin thickness in vivo has remained unclear. Herein, we show that, in mouse PNS nerves, Schwann cell-specific expression of wild-type cytohesin-1 exhibits enhanced myelin thickness. Downstream activation of Arf6 is also seen in these transgenic mice, revealing the involvement of the cytohesin-1 and Arf6 signaling unit in promoting myelination. These results suggest that cytohesin-1 may be a candidate for the basis of a therapy for peripheral neuropathies through its enhancement of myelin thickness.

  18. The influence of anharmonic and solvent effects on the theoretical vibrational spectra of the guanine-cytosine base pairs in Watson-Crick and Hoogsteen configurations.


    Bende, Attila; Muntean, Cristina M


    The theoretical IR and Raman spectra of the guanine-cytosine DNA base pairs in Watson-Crick and Hoogsteen configurations were computed using DFT method with M06-2X meta-hybrid GGA exchange-correlation functional, including the anharmonic corrections and solvent effects. The results for harmonic frequencies and their anharmonic corrections were compared with our previously calculated values obtained with the B3PW91 hybrid GGA functional. Significant differences were obtained for the anharmonic corrections calculated with the two different DFT functionals, especially for the stretching modes, while the corresponding harmonic frequencies did not differ considerable. For the Hoogtseen case the H⁺ vibration between the G-C base pair can be characterized as an asymmetric Duffing oscillator and therefore unrealistic anharmonic corrections for normal modes where this proton vibration is involved have been obtained. The spectral modification due to the anharmonic corrections, solvent effects and the influence of sugar-phosphate group for the Watson-Crick and Hoogsteen base pair configurations, respectively, were also discussed. For the Watson-Crick case also the influence of the stacking interaction on the theoretical IR and Raman spectra was analyzed. Including the anharmonic correction in our normal mode analysis is essential if one wants to obtain correct assignments of the theoretical frequency values as compared with the experimental spectra.

  19. Isolation of a second yeast Saccharomyces cerevisiae gene (GPA2) coding for guanine nucleotide-binding regulatory protein: studies on its structure and possible functions.

    PubMed Central

    Nakafuku, M; Obara, T; Kaibuchi, K; Miyajima, I; Miyajima, A; Itoh, H; Nakamura, S; Arai, K; Matsumoto, K; Kaziro, Y


    In a previous paper, we demonstrated that a gene coding for a protein homologous to the alpha subunit of mammalian guanine nucleotide-binding regulatory (G) proteins occurs in Saccharomyces cerevisiae. The gene, designated GPA1, encodes a protein (GP1 alpha) of 472 amino acids with a calculated Mr of 54,075. Here we report the isolation of another G-protein-homologous gene, GPA2, which encodes an amino acid sequence of 449 amino acid residues with a Mr of 50,516. The predicted primary structure of the GPA2-encoded protein (GP2 alpha) is homologous to mammalian G proteins [inhibitory and stimulatory G proteins (Gi and Gs, respectively), a G protein of unknown function (Go), and transducins (Gt)] as well as yeast GP1 alpha. When aligned with the alpha subunit of Gi (Gi alpha) to obtain maximal homology, GP2 alpha was found to contain a stretch of 83 additional amino acid residues near the NH2 terminus. The gene was mapped in chromosome V, close to the centromere. Haploid cells carrying a disrupted GPA2 gene are viable. Cells carrying a high copy number of plasmid GPA2 (YEpGPA2) had markedly elevated levels of cAMP and could suppress a temperature-sensitive mutation of RAS2. These results suggest that GPA2 may be involved in the regulation of cAMP levels in S. cerevisiae. Images PMID:2830616

  20. Essential role for vav Guanine nucleotide exchange factors in brain-derived neurotrophic factor-induced dendritic spine growth and synapse plasticity.


    Hale, Carly F; Dietz, Karen C; Varela, Juan A; Wood, Cody B; Zirlin, Benjamin C; Leverich, Leah S; Greene, Robert W; Cowan, Christopher W


    Brain-derived neurotrophic factor (BDNF) and its cognate receptor, TrkB, regulate a wide range of cellular processes, including dendritic spine formation and functional synapse plasticity. However, the signaling mechanisms that link BDNF-activated TrkB to F-actin remodeling enzymes and dendritic spine morphological plasticity remain poorly understood. We report here that BDNF/TrkB signaling in neurons activates the Vav family of Rac/RhoA guanine nucleotide exchange factors through a novel TrkB-dependent mechanism. We find that Vav is required for BDNF-stimulated Rac-GTP production in cortical and hippocampal neurons. Vav is partially enriched at excitatory synapses in the postnatal hippocampus but does not appear to be required for normal dendritic spine density. Rather, we observe significant reductions in both BDNF-induced, rapid, dendritic spine head growth and in CA3-CA1 theta burst-stimulated long-term potentiation in Vav-deficient mouse hippocampal slices, suggesting that Vav-dependent regulation of dendritic spine morphological plasticity facilitates normal functional synapse plasticity.

  1. Purine metabolite and energy charge analysis of Trypanosoma brucei cells in different growth phases using an optimized ion-pair RP-HPLC/UV for the quantification of adenine and guanine pools.


    Graven, Patricia; Tambalo, Margherita; Scapozza, Leonardo; Perozzo, Remo


    Human African Trypanosomiasis (HAT) is caused by the protozoan parasite Trypanosoma brucei. Although trypanosomes are well-studied model organisms, only little is known about their adenine and guanine nucleotide pools. Besides being building blocks of RNA and DNA, these nucleotides are also important modulators of diverse biochemical cellular processes. Adenine nucleotides also play an important role in the regulation of metabolic energy. The energetic state of cells is evaluated by the energy charge which gives information about how much energy is available in form of high energy phosphate bonds of adenine nucleotides. A sensitive and reproducible ion-pair RP-HPLC/UV method was developed and optimized, allowing the quantification of guanine and adenine nucleosides/nucleotides in T. brucei. With this method, the purine levels and their respective ratios were investigated in trypanosomes during logarithmic, stationary and senescent growth phases. Results of this study showed that all adenine and guanine purines under investigation were in the low mM range. The energy charge was found to decrease from logarithmic to static and to senescent phase whereas AMP/ATP, ADP/ATP and GDP/GTP ratios increased in the same order. In addition, the AMP/ATP ratio varied as the square of the ADP/ATP ratio, indicating AMP to be the key energy sensor molecule in trypanosomes.

  2. Role of a guanine nucleotide-binding protein in. cap alpha. /sub 1/-adrenergic receptor-mediated Ca/sup 2 +/ mobilization in DDT/sub 1/ MF-2 cells

    SciTech Connect

    Cornett, L.E.; Norris, J.S.


    In this study the mechanisms involved in ..cap alpha../sub 1/-adrenergic receptor-mediated Ca/sup 2 +/ mobilization at the level of the plasma membrane were investigated. Stimulation of /sup 45/Ca/sup 2 +/ efflux from saponin-permeabilized DDT/sub 1/ MF-2 cells was observed with the addition of either the ..cap alpha../sub 1/-adrenergic agonist phenylephrine and guanosine-5'-triphosphate or the nonhydrolyzable guanine nucleotide guanylyl-imidodiphosphate. In the presence of (/sup 32/P) NAD, pertussis toxin was found to catalyze ADP-ribosylation of a M/sub r/ = 40,500 (n = 8) peptide in membranes prepared from DDT/sub 1/, MF-2 cells, possibly the ..cap alpha..-subunit of N/sub i/. However, stimulation of unidirectional /sup 45/Ca/sup 2 +/ efflux by phenylephrine was not affected by previous treatment of cells with 100 ng/ml pertussis toxin. These data suggest that the putative guanine nucleotide-binding protein which couples the ..cap alpha../sub 1/-adrenergic receptor to Ca/sup 2 +/ mobilization in DDT/sub 1/ MF-2 cells is not a pertussis toxin substrate and may possibly be an additional member of guanine nucleotide binding protein family.

  3. Large N

    NASA Astrophysics Data System (ADS)

    't Hooft, Gerard


    In the first part of this lecture, the 1/N expansion technique is illustrated for the case of the large-N sigma model. In large-N gauge theories, the 1/N expansion is tantamount to sorting the Feynman diagrams according to their degree of planarity, that is, the minimal genus of the plane onto which the diagram can be mapped without any crossings. This holds both for the usual perturbative expansion with respect to powers of ˜ {g}2 = g2N, as well as for the expansion of lattice theories in positive powers of 1/˜ {g}2. If there were no renormalization effects, the ˜ {g} expansion would have a finite radius of convergence. The zero-dimensional theory can be used for counting planar diagrams. It can be solved explicitly, so that the generating function for the number of diagrams with given 3-vertices and 4-vertices, can be derived exactly. This can be done for various kinds of Feynman diagrams. We end with some remarks about planar renormalization.

  4. Regulated Localization Is Sufficient for Hormonal Control of Regulator of G Protein Signaling Homology Rho Guanine Nucleotide Exchange Factors (RH-RhoGEFs)*

    PubMed Central

    Carter, Angela M.; Gutowski, Stephen; Sternweis, Paul C.


    The regulator of G protein signaling homology (RH) Rho guanine nucleotide exchange factors (RhoGEFs) (p115RhoGEF, leukemia-associated RhoGEF, and PDZ-RhoGEF) contain an RH domain and are specific GEFs for the monomeric GTPase RhoA. The RH domains interact specifically with the α subunits of G12 heterotrimeric GTPases. Activated Gα13 modestly stimulates the exchange activity of both p115RhoGEF and leukemia-associated RhoGEF but not PDZ-RhoGEF. Because all three RH-RhoGEFs can localize to the plasma membrane upon expression of activated Gα13, cellular localization of these RhoGEFs has been proposed as a mechanism for controlling their activity. We use a small molecule-regulated heterodimerization system to rapidly control the localization of RH-RhoGEFs. Acute localization of the proteins to the plasma membrane activates RhoA within minutes and to levels that are comparable with activation of RhoA by hormonal stimulation of G protein-coupled receptors. The catalytic activity of membrane-localized RhoGEFs is not dependent on activated Gα13. We further show that the conserved RH domains can rewire two different RacGEFs to activate Rac1 in response to a traditional activator of RhoA. Thus, RH domains act as independent detectors for activated Gα13 and are sufficient to modulate the activity of RhoGEFs by hormones via mediating their localization to substrate, membrane-associated RhoA. PMID:24855647

  5. Chemical structure and properties of interstrand cross-links formed by reaction of guanine residues with abasic sites in duplex DNA.


    Catalano, Michael J; Liu, Shuo; Andersen, Nisana; Yang, Zhiyu; Johnson, Kevin M; Price, Nathan E; Wang, Yinsheng; Gates, Kent S


    A new type of interstrand cross-link resulting from the reaction of a DNA abasic site with a guanine residue on the opposing strand of the double helix was recently identified, but the chemical connectivity of the cross-link was not rigorously established. The work described here was designed to characterize the chemical structure and properties of dG-AP cross-links generated in duplex DNA. The approach involved characterization of the nucleoside cross-link "remnant" released by enzymatic digestion of DNA duplexes containing the dG-AP cross-link. We first carried out a chemical synthesis and complete spectroscopic structure determination of the putative cross-link remnant 9b composed of a 2-deoxyribose adduct attached to the exocyclic N(2)-amino group of dG. A reduced analogue of the cross-link remnant was also prepared (11b). Liquid chromatography-tandem mass spectrometric (LC-MS/MS) analysis revealed that the retention times and mass spectral properties of synthetic standards 9b and 11b matched those of the authentic cross-link remnants released by enzymatic digestion of duplexes containing the native and reduced dG-AP cross-link, respectively. These results establish the chemical connectivity of the dG-AP cross-link released from duplex DNA and provide a foundation for detection of this lesion in biological samples. The dG-AP cross-link in duplex DNA was remarkably stable, decomposing with a half-life of 22 days at pH 7 and 23 °C. The intrinsic chemical stability of the dG-AP cross-link suggests that this lesion in duplex DNA may have the power to block DNA-processing enzymes involved in transcription and replication.

  6. Identification of function and mechanistic insights of guanine deaminase from Nitrosomonas europaea: role of the C-terminal loop in catalysis.


    Bitra, Aruna; Hussain, Bhukya; Tanwar, Ajay Singh; Anand, Ruchi


    NE0047 from Nitrosomonas europaea has been annotated as a zinc-dependent deaminase; however, the substrate specificity is unknown because of the low level of structural similarity and sequence identity compared to other family members. In this study, the function of NE0047 was established as a guanine deaminase (catalytic efficiency of 1.2 × 10(5) M(-1) s(-1)), exhibiting secondary activity towards ammeline. The structure of NE0047 in the presence of the substrate analogue 8-azaguanine was also determined to a resolution of 1.9 Å. NE0047 crystallized as a homodimer in an asymmetric unit. It was found that the extreme nine-amino acid C-terminal loop forms an active site flap; in one monomer, the flap is in the closed conformation and in the other in the open conformation with this loop region exposed to the solvent. Calorimetric data obtained using the full-length version of the enzyme fit to a sequential binding model, thus supporting a cooperative mode of ligand occupancy. In contrast, the mutant form of the enzyme (ΔC) with the deletion of the extreme nine amino acids follows an independent model of ligand occupancy. In addition, the ΔC mutant also does not exhibit any enzyme activity. Therefore, we propose that the progress of the reaction is communicated via changes in the conformation of the C-terminal flap and the closed form of the enzyme is the catalytically active form, while the open form allows for product release. The catalytic mechanism of deamination was also investigated, and we found that the mutagenesis of the highly conserved active site residues Glu79 and Glu143 resulted in a complete loss of activity and concluded that they facilitate the reaction by serving as proton shuttles.

  7. Concordance and interaction of guanine nucleotide dissociation inhibitor (RhoGDI) with RhoA in oogenesis and early development of the sea urchin

    PubMed Central

    Zazueta-Novoa, Vanesa; Martínez-Cadena, Guadalupe; Wessel, Gary M.; Zazueta-Sandoval, Roberto; Castellano, Laura; García-Soto, Jesús


    Rho GTPases are Ras-related GTPases that regulate a variety of cellular processes. In the sea urchin Strongylocentrotus purpuratus, RhoA in the oocyte associates with the membrane of the cortical granules and directs their movement from the cytoplasm to the cell cortex during maturation to an egg. RhoA also plays an important role regulating the Na+-H+ exchanger activity which determines the internal pH of the cell during the first minutes of embryogenesis. We investigated how this activity may be regulated by a Guanine-nucleotide Dissociation Inhibitor (RhoGDI). The sequence of this RhoA regulatory protein was identified in the genome on the basis of its similarity to other RhoGDI species, especially for key segments in the formation of the isoprenyl-binding pocket and in interactions with the Rho GTPase. We examined the expression and the subcellular localization of RhoGDI during oogenesis and in different developmental stages. We found that RhoGDI mRNA levels were high in eggs and during cleavage divisions until blastula, when it disappeared, only to reappear in gastrula stage. RhoGDI localization overlaps the presence of RhoA during oogenesis and in embryonic development, reinforcing the regulatory premise of the interaction. By use of recombinant protein interactions in vitro, we also find that these two proteins selectively interact. These results support the hypothesis of a functional relationship in vivo and now enable mechanistic insight for the cellular and organellar rearrangements that occur during oogenesis and embryonic development. PMID:21492154

  8. Neisseria gonorrhoeae RecQ helicase HRDC domains are essential for efficient binding and unwinding of the pilE guanine quartet structure required for pilin antigenic variation.


    Cahoon, Laty A; Manthei, Kelly A; Rotman, Ella; Keck, James L; Seifert, H Steven


    The strict human pathogen Neisseria gonorrhoeae utilizes homologous recombination to antigenically vary the pilus, thus evading the host immune response. High-frequency gene conversion reactions between many silent pilin loci and the expressed pilin locus (pilE) allow for numerous pilus variants per strain to be produced from a single strain. For pilin antigenic variation (Av) to occur, a guanine quartet (G4) structure must form upstream of pilE. The RecQ helicase is one of several recombination or repair enzymes required for efficient levels of pilin Av, and RecQ family members have been shown to bind to and unwind G4 structures. Additionally, the vast majority of RecQ helicase family members encode one "helicase and RNase D C-terminal" (HRDC) domain, whereas the N. gonorrhoeae RecQ helicase gene encodes three HRDC domains, which are critical for pilin Av. Here, we confirm that deletion of RecQ HRDC domains 2 and 3 causes a decrease in the frequency of pilin Av comparable to that obtained with a functional knockout. We demonstrate that the N. gonorrhoeae RecQ helicase can bind and unwind the pilE G4 structure. Deletion of the RecQ HRDC domains 2 and 3 resulted in a decrease in G4 structure binding and unwinding. These data suggest that the decrease in pilin Av observed in the RecQ HRDC domain 2 and 3 deletion mutant is a result of the enzyme's inability to efficiently bind and unwind the pilE G4 structure.

  9. Photoinduced electron detachment and proton transfer: the proposal for alternative path of formation of triplet states of guanine (G) and cytosine (C) pair.


    Gu, Jiande; Wang, Jing; Leszczynski, Jerzy


    A viable pathway is proposed for the formation of the triplet state of the GC Watson-Crick base pair. It includes the following steps: (a) a low-energy electron is captured by cytosine in the GC pair, forming the cytosine base-centered radical anion GC(-•); and (b) photoradiation with energy around 5 eV initiates the electron detachment from either cytosine (in the gas phase) or guanine (in aqueous solutions). This triggers interbase proton transfer from G to C, creating the triplet state of the GC pair. Double proton transfer involving the triplet state of GC pair leads to the formation of less stable tautomer G(N2-H)(•)C(O2H)(•). Tautomerization is accomplished through a double proton transfer process in which one proton at the N3 of C(H)(•) migrates to the N1 of G(-H)(•); meanwhile, the proton at the N2 of G transfers to the O2 of C. This process is energetically viable; the corresponding activation energy is around 12-13 kcal/mol. The base-pairing energy of the triplet is found to be ∼3-5 kcal/mol smaller than that of the singlet state. Thus, the formation of the triplet state GC pair in DNA double strand only slightly weakens its stability. The obtained highly reactive radicals are expected to cause serious damage in the DNA involved in biochemical processes, such as DNA replication where radicals are exposed in the single strands.

  10. Hypoxanthine-guanine phosphoribosyltransferase and inosine 5'-monophosphate dehydrogenase activities in three mammalian species: aquatic (Mirounga angustirostris), semi-aquatic (Lontra longicaudis annectens) and terrestrial (Sus scrofa).


    Barjau Pérez-Milicua, Myrna; Zenteno-Savín, Tania; Crocker, Daniel E; Gallo-Reynoso, Juan P


    Aquatic and semiaquatic mammals have the capacity of breath hold (apnea) diving. Northern elephant seals (Mirounga angustirostris) have the ability to perform deep and long duration dives; during a routine dive, adults can hold their breath for 25 min. Neotropical river otters (Lontra longicaudis annectens) can hold their breath for about 30 s. Such periods of apnea may result in reduced oxygen concentration (hypoxia) and reduced blood supply (ischemia) to tissues. Production of adenosine 5'-triphosphate (ATP) requires oxygen, and most mammalian species, like the domestic pig (Sus scrofa), are not adapted to tolerate hypoxia and ischemia, conditions that result in ATP degradation. The objective of this study was to explore the differences in purine synthesis and recycling in erythrocytes and plasma of three mammalian species adapted to different environments: aquatic (northern elephant seal) (n = 11), semiaquatic (neotropical river otter) (n = 4), and terrestrial (domestic pig) (n = 11). Enzymatic activity of hypoxanthine-guanine phosphoribosyltransferase (HGPRT) was determined by spectrophotometry, and activity of inosine 5'-monophosphate dehydrogenase (IMPDH) and the concentration of hypoxanthine (HX), inosine 5'-monophosphate (IMP), adenosine 5'-monophosphate (AMP), adenosine 5'-diphosphate (ADP), ATP, guanosine 5'-diphosphate (GDP), guanosine 5'-triphosphate (GTP), and xanthosine 5'-monophosphate (XMP) were determined by high-performance liquid chromatography (HPLC). The activities of HGPRT and IMPDH and the concentration of HX, IMP, AMP, ADP, ATP, GTP, and XMP in erythrocytes of domestic pigs were higher than in erythrocytes of northern elephant seals and river otters. These results suggest that under basal conditions (no diving, sleep apnea or exercise), aquatic, and semiaquatic mammals have less purine mobilization than their terrestrial counterparts.

  11. Oxidation of guanine in double-stranded DNA by [Ru(bpy)2dppz]Cl2 in cationic reverse micelles.


    Evans, Sarah E; Grigoryan, Armine; Szalai, Veronika A


    DNA oxidation has been investigated in the medium of cationic reverse micelles (RMs). The oxidative chemistry is photochemically initiated using the DNA intercalator bis(bipyridine)dipyridophenazine ruthenium(II) chloride ([Ru(bpy)2dppz]Cl2) bound to duplex DNA in the RMs. High-resolution polyacrylamide gel electrophoresis (PAGE) is used to reveal and quantify guanine (G) oxidation products, including 8-oxo-7,8-dihydroguanine (8OG). In buffer solution, the addition of the oxidative quenchers potassium ferricyanide or pentaamminechlorocobalt(III) dichloride leads to an increase in the amount of piperidine-labile G oxidation products generated via one-electron oxidation. In RMs, however, the yield of oxidatively generated damage is attenuated. With or without ferricyanide quencher in the RMs, the yield of oxidatively generated products is approximately the same. Inclusion of the cationic quencher [CoCl(NH3)5]2+ in the RMs increases the amount of oxidation products generated but not to the extent that it does in buffer solution. Under anaerobic conditions, all of the samples in RMs, with or without added oxidative quenchers, show decreased levels of piperidine-labile oxidation products, suggesting that the primary oxidant in RMs is singlet oxygen. G oxidation is enhanced in D2O and deuterated heptane and is diminished in the presence of sodium azide in RMs, also supporting 1O2 as the main G oxidant in RMs. Isotopic labeling experiments show that the oxygen atom in 8OG produced in RMs is not from water. The observed change in the G oxidation mechanism from a one-electron process in buffer to mostly 1O2 in RMs illustrates the importance of both DNA structure and DNA environment on the chemistry of G oxidation.

  12. Serotonin-induced muscle contraction in rat stomach fundus is mediated by a G alpha z-like guanine nucleotide binding protein.


    Wang, H Y; Eberle-Wang, K; Simansky, K J; Friedman, E


    Serotonin (5-HT) potently contracts the fundus of the rat stomach; however, the associated transduction pathway has not been described fully. Experiments were performed in an attempt to gain insight into the coupling mechanism associated with this fundal 5-HT receptor. 5-HT-stimulated [35S]GTP gamma S binding to a protein which was recognized by anti-G alpha Z antiserum in a Mg(++)-dependent fashion. 5-HT increased [35S]GTP gamma S binding in the fundus, but not in the corpus of the rat stomach. 5-HT also enhanced the binding of [alpha-32P]GTP to the fundal protein and increased the hydrolysis of GTP to GDP in fundal membranes. The fundal protein which binds GTP is 25 to 29 kDa in size whereas the brain G alpha Z protein which is recognized by the anti-G alpha Z antibody is a 41 kDa protein. Mixing experiments revealed that the fundal guanine nucleotide binding protein does not appear to be a proteolytic product of the 41 kDa G alpha Z protein. Activating protein kinase C with phorbol-12-myristate, 13-acetate induced a concentration-dependent, noncompetitive inhibition of [35S]GTP gamma S binding to the fundal protein, and of 5-HT-induced contraction of fundal strips. Phorbol-12-myristate, 13-acetate did not alter carbachol- or KCl-mediated fundus contraction. Furthermore, the activation of [35S]GTP gamma S binding by serotonergic agonists and its inhibition by pharmacological antagonists corresponded to the known actions of these agents on contraction of fundal muscle. The results provide evidence that the 5-HT receptor in the rat stomach fundus is coupled directly or indirectly to a G alpha z-like protein which may mediate 5-HT-induced contraction in this tissue.

  13. Role of the Active Site Guanine in the glmS Ribozyme Self-Cleavage Mechanism: Quantum Mechanical/Molecular Mechanical Free Energy Simulations

    PubMed Central


    The glmS ribozyme catalyzes a self-cleavage reaction at the phosphodiester bond between residues A-1 and G1. This reaction is thought to occur by an acid–base mechanism involving the glucosamine-6-phosphate cofactor and G40 residue. Herein quantum mechanical/molecular mechanical free energy simulations and pKa calculations, as well as experimental measurements of the rate constant for self-cleavage, are utilized to elucidate the mechanism, particularly the role of G40. Our calculations suggest that an external base deprotonates either G40(N1) or possibly A-1(O2′), which would be followed by proton transfer from G40(N1) to A-1(O2′). After this initial deprotonation, A-1(O2′) starts attacking the phosphate as a hydroxyl group, which is hydrogen-bonded to deprotonated G40, concurrent with G40(N1) moving closer to the hydroxyl group and directing the in-line attack. Proton transfer from A-1(O2′) to G40 is concomitant with attack of the scissile phosphate, followed by the remainder of the cleavage reaction. A mechanism in which an external base does not participate, but rather the proton transfers from A-1(O2′) to a nonbridging oxygen during nucleophilic attack, was also considered but deemed to be less likely due to its higher effective free energy barrier. The calculated rate constant for the favored mechanism is in agreement with the experimental rate constant measured at biological Mg2+ ion concentration. According to these calculations, catalysis is optimal when G40 has an elevated pKa rather than a pKa shifted toward neutrality, although a balance among the pKa’s of A-1, G40, and the nonbridging oxygen is essential. These results have general implications, as the hammerhead, hairpin, and twister ribozymes have guanines at a similar position as G40. PMID:25526516

  14. Measurement of thyroid stimulating immunoglobulins using a novel thyroid stimulating hormone receptor-guanine nucleotide-binding protein, (GNAS) fusion bioassay.


    Pierce, M; Sandrock, R; Gillespie, G; Meikle, A W


    Hyperthyroidism, defined by overproduction of thyroid hormones, has a 2-3% prevalence in the population. The most common form of hyperthyroidism is Graves' disease. A diagnostic biomarker for Graves' disease is the presence of immunoglobulins which bind to, and stimulate, the thyroid stimulating hormone receptor (TSHR), a G-protein coupled receptor (GPCR). We hypothesized that the ectopically expressed TSHR gene in a thyroid stimulating immunoglobulin (TSI) assay could be engineered to increase the accumulation of the GPCR pathway second messenger, cyclic AMP (cAMP), the molecule measured in the assay as a marker for pathway activation. An ectopically expressing TSHR-mutant guanine nucleotide-binding protein, (GNAS) Chinese hamster ovary (CHO) cell clone was constructed using standard molecular biology techniques. After incubation of the new clone with sera containing various levels of TSI, GPCR pathway activation was then quantified by measuring cAMP accumulation in the clone. The clone, together with a NaCl-free cell assay buffer containing 5% polyethylene glycol (PEG)6000, was tested against 56 Graves' patients, 27 toxic thyroid nodule patients and 119 normal patients. Using receiver operating characteristic analysis, when comparing normal with Graves' sera, the assay yielded a sensitivity of 93%, a specificity of 99% and an efficiency of 98%. Total complex precision (within-run, across runs and across days), presented as a percentage coefficient of variation, was found to be 7·8, 8·7 and 7·6% for low, medium and high TSI responding serum, respectively. We conclude that the performance of the new TSI assay provides sensitive detection of TSI, allowing for accurate, early detection of Graves' disease.

  15. Replication Past the γ-Radiation-Induced Guanine-Thymine Cross-Link G[8,5-Me]T by Human and Yeast DNA Polymerase η

    PubMed Central

    Raychaudhury, Paromita; Basu, Ashis K.


    γ-Radiation-induced intrastrand guanine-thymine cross-link, G[8,5-Me]T, hinders replication in vitro and is mutagenic in mammalian cells. Herein we report in vitro translesion synthesis of G[8,5-Me]T by human and yeast DNA polymerase η (hPol η and yPol η). dAMP misincorporation opposite the cross-linked G by yPol η was preferred over correct incorporation of dCMP, but further extension was 100-fold less efficient for G∗:A compared to G∗:C. For hPol η, both incorporation and extension were more efficient with the correct nucleotides. To evaluate translesion synthesis in the presence of all four dNTPs, we have developed a plasmid-based DNA sequencing assay, which showed that yPol η was more error-prone. Mutational frequencies of yPol η and hPol η were 36% and 14%, respectively. Targeted G → T was the dominant mutation by both DNA polymerases. But yPol η induced targeted G → T in 23% frequency relative to 4% by hPol η. For yPol η, targeted G → T and G → C constituted 83% of the mutations. By contrast, with hPol η, semi-targeted mutations (7.2%), that is, mutations at bases near the lesion, occurred at equal frequency as the targeted mutations (6.9%). The kind of mutations detected with hPol η showed significant similarities with the mutational spectrum of G[8,5-Me]T in human embryonic kidney cells. PMID:20936176

  16. Architecture of the eIF2B regulatory subcomplex and its implications for the regulation of guanine nucleotide exchange on eIF2

    PubMed Central

    Kuhle, Bernhard; Eulig, Nora K.; Ficner, Ralf


    Eukaryal translation initiation factor 2B (eIF2B) acts as guanine nucleotide exchange factor (GEF) for eIF2 and forms a central target for pathways regulating global protein synthesis. eIF2B consists of five non-identical subunits (α–ϵ), which assemble into a catalytic subcomplex (γ, ϵ) responsible for the GEF activity, and a regulatory subcomplex (α, β, δ) which regulates the GEF activity under stress conditions. Here, we provide new structural and functional insight into the regulatory subcomplex of eIF2B (eIF2BRSC). We report the crystal structures of eIF2Bβ and eIF2Bδ from Chaetomium thermophilum as well as the crystal structure of their tetrameric eIF2B(βδ)2 complex. Combined with mutational and biochemical data, we show that eIF2BRSC exists as a hexamer in solution, consisting of two eIF2Bβδ heterodimers and one eIF2Bα2 homodimer, which is homologous to homohexameric ribose 1,5-bisphosphate isomerases. This homology is further substantiated by the finding that eIF2Bα specifically binds AMP and GMP as ligands. Based on our data, we propose a model for eIF2BRSC and its interactions with eIF2 that is consistent with previous biochemical and genetic data and provides a framework to better understand eIF2B function, the molecular basis for Gcn−, Gcd− and VWM/CACH mutations and the evolutionary history of the eIF2B complex. PMID:26384431

  17. Coordinated regulation by two VPS9 domain-containing guanine nucleotide exchange factors in small GTPase Rab5 signaling pathways in fission yeast

    SciTech Connect

    Tsukamoto, Yuta; Kagiwada, Satoshi; Shimazu, Sayuri; Takegawa, Kaoru; Noguchi, Tetsuko; Miyamoto, Masaaki


    The small GTPase Rab5 is reported to regulate various cellular functions, such as vesicular transport and endocytosis. VPS9 domain-containing proteins are thought to activate Rab5(s) by their guanine-nucleotide exchange activities. Numerous VPS9 proteins have been identified and are structurally conserved from yeast to mammalian cells. However, the functional relationships among VPS9 proteins in cells remain unclear. Only one Rab5 and two VPS9 proteins were identified in the Schizosaccharomyces pombe genome. Here, we examined the cellular function of two VPS9 proteins and the relationship between these proteins in cellular functions. Vps901-GFP and Vps902-GFP exhibited dotted signals in vegetative and differentiated cells. vps901 deletion mutant (Δvps901) cells exhibited a phenotype deficient in the mating process and responses to high concentrations of ions, such as calcium and metals, and Δvps901Δvps902 double mutant cells exhibited round cell shapes similar to ypt5-909 (Rab5 mutant allele) cells. Deletion of both vps901 and vps902 genes completely abolished the mating process and responses to various stresses. A lack of vacuole formation and aberrant inner cell membrane structures were also observed in Δvps901Δvps902 cells by electron microscopy. These data strongly suggest that Vps901 and Vps902 are cooperatively involved in the regulation of cellular functions, such as cell morphology, sexual development, response to ion stresses, and vacuole formation, via Rab5 signaling pathways in fission yeast cells. - Highlights: • Roles of Rab5 activator VPS9 proteins in cellular functions. • Cooperation between VPS9 proteins in Rab5 signaling pathway. • Roles of each VPS9 protein in Rab5 signaling pathway are discussed.

  18. Concordance and interaction of guanine nucleotide dissociation inhibitor (RhoGDI) with RhoA in oogenesis and early development of the sea urchin.


    Zazueta-Novoa, Vanesa; Martínez-Cadena, Guadalupe; Wessel, Gary M; Zazueta-Sandoval, Roberto; Castellano, Laura; García-Soto, Jesús


    Rho GTPases are Ras-related GTPases that regulate a variety of cellular processes. In the sea urchin Strongylocentrotus purpuratus, RhoA in the oocyte associates with the membrane of the cortical granules and directs their movement from the cytoplasm to the cell cortex during maturation to an egg. RhoA also plays an important role regulating the Na(+) -H(+) exchanger activity, which determines the internal pH of the cell during the first minutes of embryogenesis. We investigated how this activity may be regulated by a guanine-nucleotide dissociation inhibitor (RhoGDI). The sequence of this RhoA regulatory protein was identified in the genome on the basis of its similarity to other RhoGDI species, especially for key segments in the formation of the isoprenyl-binding pocket and in interactions with the Rho GTPase. We examined the expression and the subcellular localization of RhoGDI during oogenesis and in different developmental stages. We found that RhoGDI mRNA levels were high in eggs and during cleavage divisions until blastula, when it disappeared, only to reappear in gastrula stage. RhoGDI localization overlaps the presence of RhoA during oogenesis and in embryonic development, reinforcing the regulatory premise of the interaction. By use of recombinant protein interactions in vitro, we also find that these two proteins selectively interact. These results support the hypothesis of a functional relationship in vivo and now enable mechanistic insight for the cellular and organelle rearrangements that occur during oogenesis and embryonic development.

  19. Cytosine-Phosphorothionate-Guanine Oligodeoxynucleotides Exacerbates Hemophagocytosis by Inducing Tumor Necrosis Factor-Alpha Production in Mice after Bone Marrow Transplantation.


    Liu, Jiajia; Guo, Yong-Mei; Onai, Nobuyuki; Ohyagi, Hideaki; Hirokawa, Makoto; Takahashi, Naoto; Tagawa, Hiroyuki; Ubukawa, Kumi; Kobayashi, Isuzu; Tezuka, Hiroyuki; Minamiya, Yoshihiro; Ohteki, Toshiaki; Sawada, Kenichi


    Hemophagocytic syndrome (HPS) is frequently associated with hematopoietic stem cell transplantation and is treated with some benefit derived from TNF-α inhibitors. However, the mechanisms of how HPS occurs and how a TNF-α inhibitor exerts some benefit to HPS management have remained unclear. We evaluated the effect of toll-like receptor (TLR) ligands, especially focusing on cytosine-phosphorothionate-guanine oligodeoxynucleotide (CpG), a TLR9 ligand, on HPS in mice that underwent transplantation with syngeneic or allogeneic bone marrow (BM) cells (Syn-BMT, Allo-BMT), or with allogeneic BM cells plus splenocytes to promote graft-versus-host disease (GVHD mice). Hemophagocytosis was a common feature early after all BMT, but it subsided in Syn-BMT and Allo-BMT mice. In GVHD mice, however, hemophagocytosis persisted and was accompanied by upregulated production of IFN-γ but not TNF-α, and it was suppressed by blockade of IFN-γ but not TNF-α. A single injection of the TLR9 ligand CpG promoted HPS in all BMT mice and was lethal in GVHD mice, accompanied by greatly upregulated production of TNF-α, IL-6, and IFN-γ. Blocking of TNF-α, but not IL-6 or IFN-γ, suppressed CpG-induced HPS in all BMT mice and rescued GVHD mice from CpG-induced mortality. Thus, TLR9 signaling mediates TNF-α-driven HPS in BMT mice and is effectively treated through TNF-α inhibition.

  20. Modeling of Toxicity-Relevant Electrophilic Reactivity for Guanine with Epoxides: Estimating the Hard and Soft Acids and Bases (HSAB) Parameter as a Predictor.


    Zhang, Jing; Wang, Chenchen; Ji, Li; Liu, Weiping


    According to the electrophilic theory in toxicology, many chemical carcinogens in the environment and/or their active metabolites are electrophiles that exert their effects by forming covalent bonds with nucleophilic DNA centers. The theory of hard and soft acids and bases (HSAB), which states that a toxic electrophile reacts preferentially with a biological macromolecule that has a similar hardness or softness, clarifies the underlying chemistry involved in this critical event. Epoxides are hard electrophiles that are produced endogenously by the enzymatic oxidation of parent chemicals (e.g., alkenes and PAHs). Epoxide ring opening proceeds through a SN2-type mechanism with hard nucleophile DNA sites as the major facilitators of toxic effects. Thus, the quantitative prediction of chemical reactivity would enable a predictive assessment of the molecular potential to exert electrophile-mediated toxicity. In this study, we calculated the activation energies for reactions between epoxides and the guanine N7 site for a diverse set of epoxides, including aliphatic epoxides, substituted styrene oxides, and PAH epoxides, using a state-of-the-art density functional theory (DFT) method. It is worth noting that these activation energies for diverse epoxides can be further predicted by quantum chemically calculated nucleophilic indices from HSAB theory, which is a less computationally demanding method than the exacting procedure for locating the transition state. More importantly, the good qualitative/quantitative correlations between the chemical reactivity of epoxides and their bioactivity suggest that the developed model based on HSAB theory may aid in the predictive hazard evaluation of epoxides, enabling the early identification of mutagenicity/carcinogenicity-relevant SN2 reactivity.

  1. A quantitative assay of mutation induction at the hypoxanthine-guanine phosphoribosyl transferase locus in Chinese hamster ovary cells (CHO/HGPRT system): development and definition of the system.


    O'Neill, J P; Brimer, P A; Machanoff, R; Hirsch, G P; Hsie, A W


    An assay is described for the measurement of mutation induction at the hypoxanthine-guanine phosphoribosyl transferase (HGPRT) locus in Chinese hamster ovary (CHO) cells utilizing resistance to 6-thioguanine (TG). Optimal selection conditions are defined for such parameters as phenotypic expression time prior to selection, and TG concentration and cell density which permits maximum mutant recovery. The nature of the TG-resistant mutants is characterized by several physiological and biochemical methods. The data demonstrate that more than 98% of the mutant clones isolated by this selection procedure contain altered HGPRTase activity. The CHO/HGPRT system thus shows the specificity necessary for a specific gene locus mutational assay.

  2. Synthesis and anti-VZV activity of 6-heteroaryl derivatives of tricyclic acyclovir and 9-{[cis-1',2'-bis(hydroxymethyl)cycloprop-1'-yl]methyl}guanine analogues.


    Ostrowski, Tomasz; Golankiewicz, Bozenna; De Clercq, Erik; Andrei, Graciela; Snoeck, Robert


    A series of tricyclic analogues of acyclovir and 9-{[cis-1',2'-bis(hydroxymethyl)cycloprop-1'-yl]methyl}guanine substituted in the 6 position with thien-2-yl, 5-bromothien-2-yl or furan-2-yl group were synthesized. The new compounds 5a-f were evaluated for their activity in vitro against varicella-zoster virus (VZV) and cytomegalovirus (CMV). The marked anti-VZV activities of 5a-f remained comparable to those of their previously described 6-phenyl-substituted counterparts.

  3. (3H)WB4101 labels the 5-HT1A serotonin receptor subtype in rat brain. Guanine nucleotide and divalent cation sensitivity

    SciTech Connect

    Norman, A.B.; Battaglia, G.; Creese, I.


    In the presence of a 30 nM prazosin mask, (/sup 3/H)-2-(2,6-dimethoxyphenoxyethyl) aminomethyl-1,4-benzodioxane ((/sup 3/H)WB4101) can selectively label 5-HT1 serotonin receptors. Serotonin exhibits high affinity (Ki = 2.5 nM) and monophasic competition for (/sup 3/H) WB4101 binding in cerebral cortex. We have found a significant correlation (r = 0.96) between the affinities of a number of serotonergic and nonserotonergic compounds at (/sup 3/H)WB4101-binding sites in the presence of 30 nM prazosin and (/sup 3/H) lysergic acid diethylamide ((/sup 3/H)LSD)-labeled 5-HT1 serotonin receptors in homogenates of rat cerebral cortex. Despite similar pharmacological profiles, distribution studies indicate that, in the presence of 5 mM MgSO4, the Bmax of (/sup 3/H)WB4101 is significantly lower than the Bmax of (/sup 3/H)LSD in various brain regions. WB4101 competition for (/sup 3/H) LSD-labeled 5-HT1 receptors fits best to a computer-derived model assuming two binding sites, with the KH for WB4101 being similar to the KD of (/sup 3/H)WB4101 binding derived from saturation experiments. This suggests that (/sup 3/H)WB4101 labels only one of the subtypes of the 5-HT1 serotonin receptors labeled by (/sup 3/H)LSD. The selective 5-HT1A serotonin receptor antagonist, spiperone, and the selective 5-HT1A agonist, 8-hydroxy-2-(di-n-propylamino) tetraline, exhibit high affinity and monophasic competition for (/sup 3/H)WB4101 but compete for multiple (/sup 3/H)LSD 5-HT1 binding sites. These data indicate that (/sup 3/H)WB4101 selectively labels the 5-HT1A serotonin receptor, whereas (/sup 3/H) LSD appears to label both the 5-HT1A and the 5-HT1B serotonin receptor subtypes. The divalent cations, Mn2+, Mg2+, and Ca2+ were found to markedly increase the affinity and Bmax of (/sup 3/H)WB4101 binding in cerebral cortex. Conversely, the guanine nucleotides guanylylimidodiphosphate and GTP, but not the adenosine nucleotide ATP, markedly reduce the Bmax of (/sup 3/H)WB4101 binding.

  4. Non-small-cell lung cancer cell lines A549 and NCI-H460 express hypoxanthine guanine phosphoribosyltransferase on the plasma membrane

    PubMed Central

    Townsend, Michelle H; Anderson, Michael D; Weagel, Evita G; Velazquez, Edwin J; Weber, K Scott; Robison, Richard A; O’Neill, Kim L


    In both males and females, lung cancer is one of the most lethal cancers worldwide and accounts for >30% of cancer-related deaths. Despite advances in biomarker analysis and tumor characterization, there remains a need to find suitable biomarker antigen targets for treatment in late-stage lung cancer. Previous research on the salvage pathway enzyme TK1 shows a unique relationship with cancer patients as serum levels are raised according to cancer grade. To expand this analysis, the other salvage pathway enzymes were evaluated for possible upregulation within lung cancer. Adenine phosphoribosyltransferase, deoxycytidine kinase, and hypoxanthine guanine phosphoribosyltransferase (HPRT) were assessed for their presentation on two non-small-cell lung cancer cell lines NCI-H460 and A549. In the present study, we show that deoxycytidine kinase and adenine phosphoribosyltransferase have no significant relationship with the membrane of NCI-H460 cells. However, we found significant localization of HPRT to the membrane of NCI-H460 and A549 cells. When treated with anti-HPRT antibodies, the average fluorescence of the cell population increased by 24.3% and 12.9% in NCI-H460 and A549 cells, respectively, in comparison with controls. To ensure that expression was not attributed to cytoplasmic HPRT, confocal microscopy was performed to visualize HPRT binding on the plasma membrane. After staining NCI-H460 cells treated with both fluorescent antibodies and a membrane-specific dye, we observed direct overlap between HPRT and the membrane of the cancer cells. Additionally, gold-conjugated antibodies were used to label and quantify the amount of HPRT on the cell surface using scanning electron microscopy and energy-dispersive analysis X-ray. Further confirming HPRT presence, the gold weight percentage of the sample increased significantly when NCI-H460 cells were exposed to HPRT antibody (P=0.012) in comparison with isotype controls. Our results show that HPRT is localized on the

  5. Expression and Function of Different Guanine-Plus-Cytosine Content 16S rRNA Genes in Haloarcula hispanica at Different Temperatures

    PubMed Central

    Sato, Yu; Fujiwara, Taketomo; Kimura, Hiroyuki


    The halophilic archaeon Haloarcula hispanica harbors three ribosomal RNA (rRNA) operons (rrnA, rrnB, and rrnC) that contain the 16S rRNA genes rrsA, rrsB, and rrsC, respectively. Although rrsB and rrsC (rrsBC) have almost identical sequences, the rrsA and rrsBC sequences differ by 5.4%, and they differ by 2.5% with respect to guanine-plus-cytosine content (PGC). The strong correlation between the typical growth temperatures of archaea and PGC of their 16S rRNA genes suggests that H. hispanica may harbor different 16S rRNA genes having different PGC to maintain rapid growth in a wide range of temperatures. We therefore performed reverse transcription-coupled quantitative PCR to assess expression levels of rrsA (PGC, 58.9%) and rrsBC (PGC, 56.4–56.5%) at various temperatures. The expression ratio of rrsA to rrsBC increased with culture temperature. Mutants with complete deletions of one or two of the three rRNA operons were constructed and their growth rates at different temperatures compared to that of the wild-type. The growth characteristics of the rRNA operon single-mutant strains were indistinguishable from the wild-type. The rRNA operon double-mutant strains maintained the same temperature range as wild-type but displayed reduced growth rates. In particular, the double-mutant strains grew much slower than wild-type at low temperature related to minimum growth temperature of the wild-type. On the other hand, at physiologically high temperatures the wild-type and the double-mutant strain which harbors only rrnA with high-PGC rrsA grew significantly faster than the double-mutant strain which harbors only rrnC with low-PGC rrsC. These findings suggest the importance of 16S rRNAs transcribed from rrsA with high-PGC in maintaining rapid growth of this halophilic archaeon at raised growth temperatures.

  6. G-quadruplex folds of the human telomere sequence alter the site reactivity and reaction pathway of guanine oxidation compared to duplex DNA.


    Fleming, Aaron M; Burrows, Cynthia J


    Telomere shortening occurs during oxidative and inflammatory stress with guanine (G) as the major site of damage. In this work, a comprehensive profile of the sites of oxidation and structures of products observed from G-quadruplex and duplex structures of the human telomere sequence was studied in the G-quadruplex folds (hybrid (K(+)), basket (Na(+)), and propeller (K(+) + 50% CH3CN)) resulting from the sequence 5'-(TAGGGT)4T-3' and in an appropriate duplex containing one telomere repeat. Oxidations with four oxidant systems consisting of riboflavin photosensitization, carbonate radical generation, singlet oxygen, and the copper Fenton-like reaction were analyzed under conditions of low product conversion to determine relative reactivity. The one-electron oxidants damaged the 5'-G in G-quadruplexes leading to spiroiminodihydantoin (Sp) and 2,2,4-triamino-2H-oxazol-5-one (Z) as major products as well as 8-oxo-7,8-dihydroguanine (OG) and 5-guanidinohydantoin (Gh) in low relative yields, while oxidation in the duplex context produced damage at the 5'- and middle-Gs of GGG sequences and resulted in Gh being the major product. Addition of the reductant N-acetylcysteine (NAC) to the reaction did not alter the riboflavin-mediated damage sites but decreased Z by 2-fold and increased OG by 5-fold, while not altering the hydantoin ratio. However, NAC completely quenched the CO3(•-) reactions. Singlet oxygen oxidations of the G-quadruplex showed reactivity at all Gs on the exterior faces of G-quartets and furnished the product Sp, while no oxidation was observed in the duplex context under these conditions, and addition of NAC had no effect. Because a long telomere sequence would have higher-order structures of G-quadruplexes, studies were also conducted with 5'-(TAGGGT)8-T-3', and it provided oxidation profiles similar to those of the single G-quadruplex. Lastly, Cu(II)/H2O2-mediated oxidations were found to be indiscriminate in the damage patterns, and 5-carboxamido-5

  7. Regulation of follitropin-sensitive adenylate cyclase by stimulatory and inhibitory forms of the guanine nucleotide regulatory protein in immature rat Sertoli cells

    SciTech Connect

    Johnson, G.P.


    Studies have been designed to examine the role of guanine nucleotides in mediating FSH-sensitive adenylate cyclase activity in Sertoli cell plasma membranes. Analysis of ({sup 3}H)GDP binding to plasma membranes suggested a single high affinity site with a K{sub d} = 0.24 uM. Competition studies indicated that GTP{sub {gamma}}S was 7-fold more potent than GDP{sub {beta}}S. Bound GDP could be released by FSH in the presence of GTP{sub {gamma}}S, but not by FSH alone. Adenylate cyclase activity was enhanced 5-fold by FSH in the presence of GTP. Addition of GDP{sub {beta}}S to the activated enzyme (FSH plus GTP) resulted in a time-dependent decay to basal activity within 20 sec. GDP{sub {beta}}S competitively inhibited GTP{sub {gamma}}S-stimulated adenylate cyclase activity with a K{sub i} = 0.18 uM. Adenylate cyclase activity was also demonstrated to be sensitive to the nucleotide bound state. In the presence of FSH, only the GTP{sub {gamma}}S-bound form persisted even if GDP{sub {beta}}S previously occupied all available binding sites. Two membrane proteins, M{sub r} = 43,000 and 48,000, were ADP{centered dot}ribosylated using cholera toxin and labeling was enhanced 2 to 4-fold by GTP{sub {gamma}}S but not by GDP{sub {beta}}S. The M{sub r} = 43,000 and 48,000 proteins represented variant forms of G{sub S}. A single protein of M{sub r} = 40,000 (G{sub i}) was ADP-ribosylated by pertussis toxin in vitro. GTP inhibited forskolin-stimulated adenylate cyclase activity with an IC{sub 50} = 0.1 uM. The adenosine analog, N{sup 6}{centered dot}phenylisopropyl adenosine enhanced GTP inhibition of forskolin-stimulated adenylate cyclase activity by an additional 15%. GTP-dependent inhibition of forskolin-sensitive adenylate cyclase activity was abolished in membranes prepared from Sertoli cells treated in culture with pertussis toxin.

  8. Does the G.G*syn DNA mismatch containing canonical and rare tautomers of the guanine tautomerise through the DPT? A QM/QTAIM microstructural study

    NASA Astrophysics Data System (ADS)

    Brovarets', Ol'ha O.; Hovorun, Dmytro M.


    We have established that the asynchronous concerted double proton transfer (DPT), moving with a time gap and without stable intermediates, is the underlying mechanism for the tautomerisation of the G.G*syn DNA base mispair (C1 symmetry), formed by the keto and enol tautomers of the guanine in the anti- and syn-configurations, into the G*.G*syn base mispair (C1), formed by the enol and imino tautomers of the G base, using quantum-mechanical calculations and Bader's quantum theory of atoms in molecules. By constructing the sweeps of the geometric, electron-topological, energetic, polar and natural bond orbital properties along the intrinsic reaction coordinate of the G.G*syn↔G*.G*syn DPT tautomerisation, the nine key points, that are critical for the atomistic understanding of the tautomerisation reaction, were set and comprehensively analysed. It was found that the G.G*syn mismatch possesses pairing scheme with the formation of the O6...HO6 (7.01) and N1H...N7 (6.77) H-bonds, whereas the G*.G*syn mismatch - of the O6H...O6 (10.68) and N1...HN7 (9.59 kcal mol-1) H-bonds. Our results highlight that these H-bonds are significantly cooperative and mutually reinforce each other in both mismatches. The deformation energy necessary to apply for the G.G*syn base mispair to acquire the Watson-Crick sizes has been calculated. We have shown that the thermodynamically stable G*.G*syn base mispair is dynamically unstable structure with a lifetime of 4.1 × 10-15 s and any of its six low-lying intermolecular vibrations can develop during this period of time. These data exclude the possibility to change the tautomeric status of the bases under the dissociation of the G.G*syn mispair into the monomers during DNA replication. Finally, it has been made an attempt to draw from the physico-chemical properties of all four incorrect purine-purine DNA base pairs a general conclusion, which claims the role of the transversions in spontaneous point mutagenesis.

  9. hSSB1 (NABP2/ OBFC2B) is required for the repair of 8-oxo-guanine by the hOGG1-mediated base excision repair pathway.


    Paquet, Nicolas; Adams, Mark N; Leong, Vincent; Ashton, Nicholas W; Touma, Christine; Gamsjaeger, Roland; Cubeddu, Liza; Beard, Sam; Burgess, Joshua T; Bolderson, Emma; O'Byrne, Ken J; Richard, Derek J


    The maintenance of genome stability is essential to prevent loss of genetic information and the development of diseases such as cancer. One of the most common forms of damage to the genetic code is the oxidation of DNA by reactive oxygen species (ROS), of which 8-oxo-7,8-dihydro-guanine (8-oxoG) is the most frequent modification. Previous studies have established that human single-stranded DNA-binding protein 1 (hSSB1) is essential for the repair of double-stranded DNA breaks by the process of homologous recombination. Here we show that hSSB1 is also required following oxidative damage. Cells lacking hSSB1 are sensitive to oxidizing agents, have deficient ATM and p53 activation and cannot effectively repair 8-oxoGs. Furthermore, we demonstrate that hSSB1 forms a complex with the human oxo-guanine glycosylase 1 (hOGG1) and is important for hOGG1 localization to the damaged chromatin. In vitro, hSSB1 binds directly to DNA containing 8-oxoguanines and enhances hOGG1 activity. These results underpin the crucial role hSSB1 plays as a guardian of the genome.

  10. pH-Modulated Watson-Crick duplex-quadruplex equilibria of guanine-rich and cytosine-rich DNA sequences 140 base pairs upstream of the c-kit transcription initiation site.


    Bucek, Pavel; Jaumot, Joaquim; Aviñó, Anna; Eritja, Ramon; Gargallo, Raimundo


    Guanine-rich regions of DNA are sequences capable of forming G-quadruplex structures. The formation of a G-quadruplex structure in a region 140 base pairs (bp) upstream of the c-kit transcription initiation site was recently proposed (Fernando et al., Biochemistry, 2006, 45, 7854). In the present study, the acid-base equilibria and the thermally induced unfolding of the structures formed by a guanine-rich region and by its complementary cytosine-rich strand in c-kit were studied by means of circular dichroism and molecular absorption spectroscopies. In addition, competition between the Watson-Crick duplex and the isolated structures was studied as a function of pH value and temperature. Multivariate data analysis methods based on both hard and soft modeling were used to allow accurate quantification of the various acid-base species present in the mixtures. Results showed that the G-quadruplex and i-motif coexist with the Watson-Crick duplex over the pH range from 3.0 to 6.5, approximately, under the experimental conditions tested in this study. At pH 7.0, the duplex is practically the only species present.

  11. Platelet cytosolic 44-kDa protein is a substrate of cholera toxin-induced ADP-ribosylation and is not recognized by antisera against the. alpha. subunit of the stimulatory guanine nucleotide-binding regulatory protein

    SciTech Connect

    Molina Y Vedia, L.M.; Reep, B.R.; Lapetina, E.G. )


    ADP-ribosylation induced by cholera toxin and pertussis toxin was studied in particulate and cytosolic fractions of human platelets. Platelets were disrupted by a cycle of freezing and thawing in the presence of a hyposmotic buffer containing protease inhibitors. In both fractions, the A subunit of cholera toxin ADP-ribosylates two proteins with molecular masses of 42 and 44 kDa, whereas pertussis toxin ADP-ribosylates a 41-kDa polypeptide. Two antisera against the {alpha} subunit of the stimulatory guanine nucleotide-binding regulatory protein recognize only the 42-kDa polypeptide. Cholera toxin-induced ADP-ribosylation of the 42- and 44-kDa proteins is reduced by pretreatment of platelets with iloprost, a prostacyclin analog. The 44-kDa protein, which is substrate of cholera toxin, could be extracted completely from the membrane and recovered in the cytosolic fraction when the cells were disrupted by Dounce homogenization and the pellet was extensively washed. A 44-kDa protein can also be labeled with 8-azidoguanosine 5{prime}-({alpha}-{sup 32}P)triphosphate in the cytosol and membranes. These finding indicate that cholera and pertussis toxins produced covalent modifications of proteins present in particulate and cytosolic platelet fractions. Moreover, the 44-kDa protein might be an {alpha} subunit of a guanine nucleotide-binding regulatory protein that is not recognized by available antisera.

  12. Guanine nucleotide exchange factor 2 for Rab5 proteins coordinated with GLUP6/GEF regulates the intracellular transport of the proglutelin from the Golgi apparatus to the protein storage vacuole in rice endosperm.


    Wen, Liuying; Fukuda, Masako; Sunada, Mariko; Ishino, Sonoko; Ishino, Yoshizumi; Okita, Thomas W; Ogawa, Masahiro; Ueda, Takashi; Kumamaru, Toshihiro


    Rice glutelin polypeptides are initially synthesized on the endoplasmic reticulum (ER) membrane as a proglutelin, which are then transported to the protein storage vacuole (PSV) via the Golgi apparatus. Rab5 and its cognate activator guanine nucleotide exchange factor (GEF) are essential for the intracellular transport of proglutelin from the Golgi apparatus to the PSV. Results from previous studies showed that the double recessive type of glup4/rab5a and glup6/gef mutant accumulated much higher amounts of proglutelin than either parent line. The present study demonstrates that the double recessive type of glup4/rab5a and glup6/gef mutant showed not only elevated proglutelin levels and much larger paramural bodies but also reduced the number and size of PSVs, indicating a synergistic mutation effect. These observations led us to the hypothesis that other isoforms of Rab5 and GEF also participate in the intracellular transport of rice glutelin. A database search identified a novel guanine nucleotide exchange factor, Rab5-GEF2. Like GLUP6/GEF, Rab5-GEF2 was capable of activating Rab5a and two other Rab5 isoforms in in vitro GTP/GDP exchange assays. GEF proteins consist of the helical bundle (HB) domain at the N-terminus, Vps9 domain, and a C-terminal region. By the deletion analysis of GEFs, the HB domain was found essential for the activation of Rab5 proteins.

  13. Synthesis of PET probe O(6)-[(3-[(11)C]methyl)benzyl]guanine by Pd(0)-mediated rapid C-[(11)C]methylation toward imaging DNA repair protein O(6)-methylguanine-DNA methyltransferase in glioblastoma.


    Koyama, Hiroko; Ikenuma, Hiroshi; Toda, Hiroshi; Kondo, Goro; Hirano, Masaki; Kato, Masaya; Abe, Junichiro; Yamada, Takashi; Wakabayashi, Toshihiko; Ito, Kengo; Natsume, Atsushi; Suzuki, Masaaki


    O(6)-Benzylguanine (O(6)-BG) is a substrate of O(6)-methylguanine-DNA methyltransferase (MGMT), which is involved in drug resistance of chemotherapy in the majority of glioblastoma multiform. For clinical diagnosis, it is hoped that the MGMT expression level could be determined by a noninvasive method to understand the detailed biological properties of MGMT-specific tumors. We synthesized (11)C-labeled O(6)-[(3-methyl)benzyl]guanine ([(11)C]mMeBG) as a positron emission tomography probe. Thus, a mixed amine-protected stannyl precursor, N(9)-(tert-butoxycarbonyl)-O(6)-[3-(tributylstannyl)benzyl]-N(2)-(trifluoroacetyl)guanine, was subjected to rapid C-[(11)C]methylation under [(11)C]CH3I/[Pd2(dba)3]/P(o-CH3C6H4)3/CuCl/K2CO3 in NMP, followed by quick deprotection with LiOH/H2O, giving [(11)C]mMeBG with total radioactivity of 1.34GBq and ≥99% radiochemical and chemical purities.

  14. Structure-based discovery of an inhibitor of Arf activation by Sec7 domains through targeting of protein-protein complexes.


    Viaud, Julien; Zeghouf, Mahel; Barelli, Hélène; Zeeh, Jean-Christophe; Padilla, André; Guibert, Bernard; Chardin, Pierre; Royer, Catherine A; Cherfils, Jacqueline; Chavanieu, Alain


    Small molecules that produce nonfunctional protein-protein complexes are an alternative to competitive inhibitors for the inhibition of protein functions. Here we target the activation of the small GTP-binding protein Arf1, a major regulator of membrane traffic, by the Sec7 catalytic domain of its guanine nucleotide exchange factor ARNO. The crystal structure of the Arf1-GDP/ARNO complex, which initiates the exchange reaction, was used to discover an inhibitor, LM11, using in silico screening of a flexible pocket near the Arf1/ARNO interface. Using fluorescence kinetics and anisotropy, NMR spectroscopy and mutagenesis, we show that LM11 acts following a noncompetitive mechanism in which the inhibitor targets both Arf1-GDP and the Arf1-GDP/ARNO complex and produces a nonfunctional Arf-GDP/ARNO complex whose affinity is similar to that of the native complex. In addition, LM11 recognizes features of both Arf and ARNO near the Arf/Sec7 interface, a characteristic reminiscent of the paradigm interfacial inhibitor Brefeldin A. We then show that LM11 is a cell-active inhibitor that impairs Arf-dependent trafficking structures at the Golgi. Furthermore, LM11 inhibits ARNO-dependent migration of Madin-Darby canine kidney (MDCK) cells, demonstrating that ARNO is a target of LM11 in cells. Remarkably, LM11 inhibits the activation of Arf1 but not Arf6 in vitro, pointing to a possible synergy between Arf1 and Arf6 activation by ARNO in cell migration. Our design method shows that flexible regions in protein-protein complexes provide drugable sites with the potential to develop novel tools for investigating and inhibiting signaling pathways.

  15. Design of electrochemical biosensor systems for the detection of specific DNA sequences in PCR-amplified nucleic acids related to the catechol-O-methyltransferase Val108/158Met polymorphism based on intrinsic guanine signal.


    Ozkan-Ariksoysal, Dilsat; Tezcanli, Burcin; Kosova, Buket; Ozsoz, Mehmet


    Psychiatric disorders are common and complex diseases that show polygenic and multifactorial heredity. A single nucleotide polymorphism (Val108/158Met) in the catechol-O-methyl transferase (COMT) gene is related to many psychiatric disorders such as schizophrenia, alcoholism, bipolar disorder, and obsessive-compulsive disorder. Schizophrenia is a complex disorder and a single nucleotide polymorphism (Val108/158Met) at the COMT gene is related to schizophrenia susceptibility. A novel hybridization-based disposable electrochemical DNA biosensor for the detection of a common functional polymorphism in the COMT gene from polymerase chain reaction (PCR) amplicons has been described without using an external label. This developed technology combined with a disposable carbon graphite electrode and differential pulse voltammetry was performed by using short synthetic oligonucleotides and PCR amplicons in length 203 bp to measure the change of guanine oxidation signal obtained at approximately +1.0 V after DNA hybridization between probe and target (synthetic target or denatured PCR samples). COMT-specific oligonucleotides were immobilized onto the carbon surface with a simple adsorption method in two different modes: (a) Guanine-containing targets were attached or (b) inosine-substituted probes were attached onto an electrode. By controlling the surface coverage of the target DNA, the hybridization event between the probes and their synthetic targets or specific PCR products was optimized. The wild-type or polymorphic allele-specific probes/targets were also interacted with an equal amount of noncomplementary and one-base mismatch-containing DNAs in order to measure the sensor selectivity. The decrease or appearance in the intrinsic guanine signal simplified the detection procedure and shortened the assay time because protocol eliminates the label-binding step. The nonspecific binding effects were minimized by using sodium dodecyl sulfate with different washing methods

  16. Nuclear magnetic resonance solution structure of an N(2)-guanine DNA adduct derived from the potent tumorigen dibenzo[a,l]pyrene: intercalation from the minor groove with ruptured Watson-Crick base pairing.


    Tang, Yijin; Liu, Zhi; Ding, Shuang; Lin, Chin H; Cai, Yuqin; Rodriguez, Fabian A; Sayer, Jane M; Jerina, Donald M; Amin, Shantu; Broyde, Suse; Geacintov, Nicholas E


    The most potent tumorigen identified among the polycyclic aromatic hydrocarbons (PAH) is the nonplanar fjord region dibenzo[a,l]pyrene (DB[a,l]P). It is metabolically activated in vivo through the widely studied diol epoxide (DE) pathway to form covalent adducts with DNA bases, predominantly guanine and adenine. The (+)-11S,12R,13R,14S DE enantiomer forms adducts via its C14 position with the exocyclic amino group of guanine. Here, we present the first nuclear magnetic resonance solution structure of a DB[a,l]P-derived adduct, the 14R-(+)-trans-anti-DB[a,l]P-N(2)-dG (DB[a,l]P-dG) lesion in double-stranded DNA. In contrast to the stereochemically identical benzo[a]pyrene-derived N(2)-dG adduct (B[a]P-dG) in which the B[a]P rings reside in the B-DNA minor groove on the 3'-side of the modifed deoxyguanosine, in the DB[a,l]P-derived adduct the DB[a,l]P rings intercalate into the duplex on the 3'-side of the modified base from the sterically crowded minor groove. Watson-Crick base pairing of the modified guanine with the partner cytosine is broken, but these bases retain some stacking with the bulky DB[a,l]P ring system. This new theme in PAH DE-DNA adduct conformation differs from (1) the classical intercalation motif in which Watson-Crick base pairing is intact at the lesion site and (2) the base-displaced intercalation motif in which the damaged base and its partner are extruded from the helix. The structural considerations that lead to the intercalated conformation of the DB[a,l]P-dG lesion in contrast to the minor groove alignment of the B[a]P-dG adduct, and the implications of the DB[a,l]P-dG conformational motif for the recognition of such DNA lesions by the human nucleotide excision repair apparatus, are discussed.

  17. Crystallographic studies of metal ion-DNA interactions: different binding modes of cobalt(II), copper(II) and barium(II) to N7 of guanines in Z-DNA and a drug-DNA complex.

    PubMed Central

    Gao, Y G; Sriram, M; Wang, A H


    Metal ion coordination to nucleic acids is not only required for charge neutralization, it is also essential for the biological function of nucleic acids. The structural impact of different metal ion coordinations of DNA helices is an open question. We carried out X-ray diffraction analyses of the interactions of the two transition metal ions Co(II) and Cu(II) and an alkaline earth metal ion Ba(II), with DNA of different conformations. In crystals, Co(II) ion binds exclusively at the N7 position of guanine bases by direct coordination. The coordination geometry around Co(II) is octahedral, although some sites have an incomplete hydration shell. The averaged Co-N7 bond distance is 2.3 A. The averaged Co-N7-C8 angle is 121 degrees, significantly smaller than the value of 128 degrees if the Co-N7 vector were to bisect the C5-N7-C8 bond angle. Model building of Co(II) binding to guanine N7 in B-DNA indicates that the coordinated waters in the axial positions would have a van der Waals clash with the neighboring base on the 5' side. In contrast, the major groove of A-DNA does not have enough room to accommodate the entire hydration shell. This suggests that Co(II) binding to either B-DNA or A-DNA may induce significant conformational changes. The Z-DNA structure of Cu(II)-soaked CGCGTG crystal revealed that the Cu(II) ion is bis-coordinated to N7 position of G10 and #G12 (# denotes a symmetry-related position) bases with a trigonal bipyramid geometry, suggesting a possible N7-Cu-N7 crosslinking mechanism. A similar bis-coordination to two guanines has also been seen in the interaction of Cu(II) in m5CGUAm5CG Z-DNA crystal and of Ba(II) with two other Z-DNA crystals. PMID:8371984

  18. On the Formation and Properties of Interstrand DNA-DNA Cross-links Forged by Reaction of an Abasic Site With the Opposing Guanine Residue of 5′-CAp Sequences in Duplex DNA

    PubMed Central

    Johnson, Kevin M.; Price, Nathan E.; Wang, Jin; Fekry, Mostafa I.; Dutta, Sanjay; Seiner, Derrick R.; Wang, Yinsheng; Gates, Kent S.


    We recently reported that the aldehyde residue of an abasic (Ap) site in duplex DNA can generate an interstrand cross-link via reaction with a guanine residue on the opposing strand. This finding is intriguing because the highly deleterious nature of interstrand cross-links suggests that even small amounts of Ap-derived cross-links could make a significant contribution to the biological consequences stemming from the generation of Ap sites in cellular DNA. Incubation of 21-bp duplexes containing a central 5′-CAp sequence under conditions of reductive amination (NaCNBH3, pH 5.2) generated much higher yields of cross-linked DNA than reported previously. At pH 7, in the absence of reducing agents, these Ap-containing duplexes also produced cross-linked duplexes that were readily detected on denaturing polyacrylamide gels. Cross-link formation was not highly sensitive to reaction conditions and, once formed, the cross-link was stable to a variety of work-up conditions. Results of multiple experiments including MALDI-TOF mass spectrometry, gel mobility, methoxyamine capping of the Ap aldehyde, inosine-for-guanine replacement, hydroxyl radical footprinting, and LCMS/MS were consistent with a cross-linking mechanism involving reversible reaction of the Ap aldehyde residue with the N2-amino group of the opposing guanine residue in 5′-CAp sequences to generate hemiaminal, imine, or cyclic hemiaminal cross-links (7-10) that were irreversibly converted under conditions of reductive amination (NaCNBH3/pH 5.2) to a stable amine linkage. Further support for the importance of the exocyclic N2-amino group in this reaction was provided by an experiment showing that installation of a 2-aminopurine-thymine base pair at the cross-linking site produced high yields (15-30%) of a cross-linked duplex at neutral pH, in the absence of NaCNBH3. PMID:23215239

  19. Automated NMR fragment based screening identified a novel interface blocker to the LARG/RhoA complex.


    Gao, Jia; Ma, Rongsheng; Wang, Wei; Wang, Na; Sasaki, Ryan; Snyderman, David; Wu, Jihui; Ruan, Ke


    The small GTPase cycles between the inactive GDP form and the activated GTP form, catalyzed by the upstream guanine exchange factors. The modulation of such process by small molecules has been proven to be a fruitful route for therapeutic intervention to prevent the over-activation of the small GTPase. The fragment based approach emerging in the past decade has demonstrated its paramount potential in the discovery of inhibitors targeting such novel and challenging protein-protein interactions. The details regarding the procedure of NMR fragment screening from scratch have been rarely disclosed comprehensively, thus restricts its wider applications. To achieve a consistent screening applicable to a number of targets, we developed a highly automated protocol to cover every aspect of NMR fragment screening as possible, including the construction of small but diverse libray, determination of the aqueous solubility by NMR, grouping compounds with mutual dispersity to a cocktail, and the automated processing and visualization of the ligand based screening spectra. We exemplified our streamlined screening in RhoA alone and the complex of the small GTPase RhoA and its upstream guanine exchange factor LARG. Two hits were confirmed from the primary screening in cocktail and secondary screening over individual hits for LARG/RhoA complex, while one of them was also identified from the screening for RhoA alone. HSQC titration of the two hits over RhoA and LARG alone, respectively, identified one compound binding to RhoA.GDP at a 0.11 mM affinity, and perturbed the residues at the switch II region of RhoA. This hit blocked the formation of the LARG/RhoA complex, validated by the native gel electrophoresis, and the titration of RhoA to ¹⁵N labeled LARG in the absence and presence the compound, respectively. It therefore provides us a starting point toward a more potent inhibitor to RhoA activation catalyzed by LARG.

  20. Automated NMR Fragment Based Screening Identified a Novel Interface Blocker to the LARG/RhoA Complex

    PubMed Central

    Gao, Jia; Ma, Rongsheng; Wang, Wei; Wang, Na; Sasaki, Ryan; Snyderman, David; Wu, Jihui; Ruan, Ke


    The small GTPase cycles between the inactive GDP form and the activated GTP form, catalyzed by the upstream guanine exchange factors. The modulation of such process by small molecules has been proven to be a fruitful route for therapeutic intervention to prevent the over-activation of the small GTPase. The fragment based approach emerging in the past decade has demonstrated its paramount potential in the discovery of inhibitors targeting such novel and challenging protein-protein interactions. The details regarding the procedure of NMR fragment screening from scratch have been rarely disclosed comprehensively, thus restricts its wider applications. To achieve a consistent screening applicable to a number of targets, we developed a highly automated protocol to cover every aspect of NMR fragment screening as possible, including the construction of small but diverse libray, determination of the aqueous solubility by NMR, grouping compounds with mutual dispersity to a cocktail, and the automated processing and visualization of the ligand based screening spectra. We exemplified our streamlined screening in RhoA alone and the complex of the small GTPase RhoA and its upstream guanine exchange factor LARG. Two hits were confirmed from the primary screening in cocktail and secondary screening over individual hits for LARG/RhoA complex, while one of them was also identified from the screening for RhoA alone. HSQC titration of the two hits over RhoA and LARG alone, respectively, identified one compound binding to RhoA.GDP at a 0.11 mM affinity, and perturbed the residues at the switch II region of RhoA. This hit blocked the formation of the LARG/RhoA complex, validated by the native gel electrophoresis, and the titration of RhoA to 15N labeled LARG in the absence and presence the compound, respectively. It therefore provides us a starting point toward a more potent inhibitor to RhoA activation catalyzed by LARG. PMID:24505392

  1. IPPP-CLOPPA Analysis of the Influence of the Methylation on the Potential Energy and the Molecular Polarizability of the Hydrogen Bonds in the Cytosine-Guanine Base Pair.


    Giribet, Claudia G; Ruiz de Azua, Martin C


    The IPPP-CLOPPA method is applied to investigate the influence of a methyl group on the energy of the hydrogen bonds and the potential energy curve of the bridge protons in model compounds which mimic the methylated and unmethylated cytosine guanine base pairs. On the same grounds, this influence on the polarizability of the intermolecular hydrogen bonds of these compounds is also addressed, in order to determine if this linear response property provides a significant proof of the electronic mechanisms that affect the stabilization of the hydrogen bonds. Results obtained show that the methyl electronic system delocalizes on the hydrogen bond region, and changes of these intermolecular hydrogen bonds are due to this effect of delocalization.

  2. Deficiency of the purine metabolic gene HPRT dysregulates microRNA-17 family cluster and guanine-based cellular functions: a role for EPAC in Lesch-Nyhan syndrome

    PubMed Central

    Guibinga, Ghiabe-Henri; Murray, Fiona; Barron, Nikki; Pandori, William; Hrustanovic, Gorjan


    Lesch-Nyhan syndrome (LNS) is a neurodevelopmental disorder caused by mutations in the gene encoding the purine metabolic enzyme hypoxanthine-guanine phosphoribosyltransferase (HPRT). A series of motor, cognitive and neurobehavioral anomalies characterize this disease phenotype, which is still poorly understood. The clinical manifestations of this syndrome are believed to be the consequences of deficiencies in neurodevelopmental pathways that lead to disordered brain function. We have used microRNA array and gene ontology analysis to evaluate the gene expression of differentiating HPRT-deficient human neuron-like cell lines. We set out to identify dysregulated genes implicated in purine-based cellular functions. Our approach was based on the premise that HPRT deficiency affects preeminently the expression and the function of purine-based molecular complexes, such as guanine nucleotide exchange factors (GEFs) and small GTPases. We found that several microRNAs from the miR-17 family cluster and genes encoding GEF are dysregulated in HPRT deficiency. Most notably, our data show that the expression of the exchange protein activated by cAMP (EPAC) is blunted in HPRT-deficient human neuron-like cell lines and fibroblast cells from LNS patients, and is altered in the cortex, striatum and midbrain of HPRT knockout mouse. We also show a marked impairment in the activation of small GTPase RAP1 in the HPRT-deficient cells, as well as differences in cytoskeleton dynamics that lead to increased motility for HPRT-deficient neuron-like cell lines relative to control. We propose that the alterations in EPAC/RAP1 signaling and cell migration in HPRT deficiency are crucial for neuro-developmental events that may contribute to the neurological dysfunctions in LNS. PMID:23804752

  3. Regulation of neutrophil NADPH oxidase activation in a cell-free system by guanine nucleotides and fluoride. Evidence for participation of a pertussis and cholera toxin-insensitive G protein.


    Gabig, T G; English, D; Akard, L P; Schell, M J


    Guanine nucleotide-binding regulatory proteins (G proteins) transduce a remarkably diverse group of extracellular signals to a relatively limited number of intracellular target enzymes. In the neutrophil, transduction of the signal following fMet-Leu-Phe receptor-ligand interaction is mediated by a pertussis toxin substrate (Gi) that activates inositol-specific phospholipase C. We have utilized a plasma membrane-containing fraction from unstimulated human neutrophils as the target enzyme to explore the role of G proteins in arachidonate and cytosolic cofactor-dependent activation of the NADPH-dependent O-2-generating oxidase. When certain guanine nucleotides or their nonhydrolyzable analogues were present during arachidonate and cytosolic cofactor-dependent activation, they exerted substantial dose-dependent effects. The GTP analogue, GTP gamma S, caused a 2-fold increase in NADPH oxidase activation (half-maximal stimulation, 1.1 microM). Either GDP or its nonhydrolyzable analogue, GDP beta S, inhibited up to 80% of the basal NADPH oxidase activation (Ki GDP = 0.12 mM, GDP beta S = 0.23 mM). GTP caused only slight and variable stimulation, whereas F-, an agent known to promote the active conformation of G proteins, caused a 1.6-fold stimulation of NADPH oxidase activation. NADPH oxidase activation in the cell-free system was absolutely and specifically dependent on Mg2+. Although O2- production in response to fMet-Leu-Phe was inhibited greater than 90% in neutrophils pretreated with pertussis toxin, cytosolic cofactor and target oxidase membranes from neutrophils treated with pertussis toxin showed no change in basal- or GTP gamma S-stimulated NADPH oxidase activation. Cholera toxin treatment of neutrophils also had no effect on the cell-free activation system. Our results suggest a role for a G protein that is distinct from Gs or Gi in the arachidonate and cytosolic cofactor-dependent NADPH oxidase cell-free activation system.

  4. Instantons and Large N

    NASA Astrophysics Data System (ADS)

    Mariño, Marcos


    Preface; Part I. Instantons: 1. Instantons in quantum mechanics; 2. Unstable vacua in quantum field theory; 3. Large order behavior and Borel summability; 4. Non-perturbative aspects of Yang-Mills theories; 5. Instantons and fermions; Part II. Large N: 6. Sigma models at large N; 7. The 1=N expansion in QCD; 8. Matrix models and matrix quantum mechanics at large N; 9. Large N QCD in two dimensions; 10. Instantons at large N; Appendix A. Harmonic analysis on S3; Appendix B. Heat kernel and zeta functions; Appendix C. Effective action for large N sigma models; References; Author index; Subject index.

  5. Methylation of cytosine at C5 in a CpG sequence context causes a conformational switch of a benzo[a]pyrene diol epoxide-N2-guanine adduct in DNA from a minor groove alignment to intercalation with base displacement.

    SciTech Connect

    Zhang, N.; Lin, C.; Huang, X.; Kolbanovskiy, A.; Hingerty, Brian E; Amin, S.; Broyde, S.; Geactinov, N. E.; Patel, D. J.


    It is well known that CpG dinucleotide steps in DNA, which are highly methylated at the 5-position of cytosine (meC) in human tissues, exhibit a disproportionate number of mutations within certain codons of the p53 gene. There is ample published evidence indicating that the reactivity of guanine with anti-B[a]PDE (a metabolite of the environmental carcinogen benzo[a]pyrene) at CpG mutation hot spots is enhanced by the methylation of the cytosine residue flanking the target guanine residue on the 5'-side. In this work we demonstrate that such a methylation can also dramatically affect the conformational characteristics of an adduct derived from the reaction of one of the two enantiomers of anti-B[a]PDE with the exocyclic amino group of guanine ([BP]G adduct). A detailed NMR study indicates that the 10R (-)-trans-anti-[BP]G adduct undergoes a transition from a minor groove-binding alignment of the aromatic BP ring system in the unmethylated C-[BP]G sequence context, to an intercalative BP alignment with a concomitant displacement of the modified guanine residue into the minor groove in the methylated meC-[BP]G sequence context. By contrast, a minor groove-binding alignment was observed for the stereoisomeric 10S (+)-trans-anti-[BP]G adduct in both the C-[BP]G and meC-[BP]G sequence contexts. This remarkable conformational switch resulting from the presence of a single methyl group at the 5-position of the cytosine residue flanking the lesion on the 5'-side, is attributed to the hydrophobic effect of the methyl group that can stabilize intercalated adduct conformations in an adduct stereochemistry-dependent manner. Such conformational differences in methylated and unmethylated CpG sequences may be significant because of potential alterations in the cellular processing of the [BP]G adducts by DNA transcription, replication, and repair enzymes.

  6. Leucine Zipper Down-regulated in Cancer-1 (LDOC1) interacts with Guanine nucleotide binding protein-like 3-like (GNL3L) to modulate Nuclear Factor-kappa B (NF-κB) signaling during cell proliferation.


    Thoompumkal, Indu Jose; Rehna, Krishnan; Anbarasu, Kumaraswamy; Mahalingam, Sundarasamy


    Guanine nucleotide binding protein-like 3-like (GNL3L) is an evolutionarily conserved putative nucleolar GTPase belonging to the HSR1-MMR1 family. In the present study, using protein-protein interaction assays, we show that Leucine Zipper Down-regulated in Cancer-1 (LDOC1) is a novel interacting partner of GNL3L. Furthermore, our results reveal that ectopic expression of LDOC1 destabilizes endogenous GNL3L levels and down modulates GNL3L-induced cell proliferation, in contrast, the knockdown of LDOC1 potentiates cell proliferation upon GNL3L expression. Interestingly, GNL3L upregulates NF-κB dependent transcriptional activity by modulating the expression of NF-κB subunit p65, which is reversed upon co-expression of LDOC1 with GNL3L. GNL3L also potentiates TNF-α mediated NF-κB activity. In addition, anti-apoptotic function of GNL3L is impaired upon p65 knockdown, suggesting its critical role in GNL3L mediated cell proliferation/survival. An inverse correlation of GNL3L and LDOC1 expression profiles in various tumor tissues from BioXpress database indicate their critical role in cancer. Collectively, our data provides evidence that GNL3L-LDOC1 interplay regulates cell proliferation through the modulation of NF-κB pathway during tumorigenesis.

  7. Binding of an organo-osmium(II) anticancer complex to guanine and cytosine on DNA revealed by electron-based dissociations in high resolution Top-Down FT-ICR mass spectrometry.


    Wootton, Christopher A; Sanchez-Cano, Carlos; Liu, Hong-Ke; Barrow, Mark P; Sadler, Peter J; O'Connor, Peter B


    The Os(II) arene anticancer complex [(η(6)-bip)Os(en)Cl](+) (Os1-Cl; where bip = biphenyl, and en = ethylenediamine) binds strongly to DNA. Here we investigate reactions between Os1-Cl and the self-complementary 12-mer oligonucleotide 5'-TAGTAATTACTA-3' (DNA12) using ultra high resolution Fourier Transform-Ion Cyclotron Resonance Mass Spectrometry (FT-ICR MS). Identification of the specific sites of DNA osmiation with {(η(6)-bip)Os(en)}(2+) was made possible by the use of Electron Detachment Dissociation (EDD) which produced a wide range of assignable osmiated MS/MS fragments. In contrast, the more commonly used CAD and IRMPD techniques produced fragments which lose the bound osmium. These studies reveal that not only is guanine G3 a strong binding site for {(η(6)-bip)Os(en)}(2+) but, unexpectedly, so too is cytosine C10. Interestingly, the G3/C10 di-osmiated adduct of DNA12 also formed readily but did not undergo such facile fragmentation by EDD, perhaps due to folding induced by van der Waal's interactions of the bound osmium arene species. These new insights into osmium arene DNA adducts should prove valuable for the design of new organometallic drugs and contribute to understanding the lack of cross resistance of this organometallic anticancer complex with cisplatin.

  8. Small-GTPase-Associated Signaling by the Guanine Nucleotide Exchange Factors CpDock180 and CpCdc24, the GTPase Effector CpSte20, and the Scaffold Protein CpBem1 in Claviceps purpurea

    PubMed Central

    Herrmann, Andrea; Tillmann, Britta A. M.; Schürmann, Janine; Bölker, Michael


    Monomeric GTPases of the Rho subfamily are important mediators of polar growth and NADPH (Nox) signaling in a variety of organisms. These pathways influence the ability of Claviceps purpurea to infect host plants. GTPase regulators contribute to the nucleotide loading cycle that is essential for proper functionality of the GTPases. Scaffold proteins gather GTPase complexes to facilitate proper function. The guanine nucleotide exchange factors (GEFs) CpCdc24 and CpDock180 activate GTPase signaling by triggering nucleotide exchange of the GTPases. Here we show that CpCdc24 harbors nucleotide exchange activity for both Rac and Cdc42 homologues. The GEFs partly share the cellular distribution of the GTPases and interact with the putative upstream GTPase CpRas1. Interaction studies show the formation of higher-order protein complexes, mediated by the scaffold protein CpBem1. Besides the GTPases and GEFs, these complexes also contain the GTPase effectors CpSte20 and CpCla4, as well as the regulatory protein CpNoxR. Functional characterizations suggest a role of CpCdc24 mainly in polarity, whereas CpDock180 is involved in stress tolerance mechanisms. These findings indicate the dynamic formation of small GTPase complexes and improve the model for GTPase-associated signaling in C. purpurea. PMID:24489041

  9. PKR and GCN2 kinases and guanine nucleotide exchange factor eukaryotic translation initiation factor 2B (eIF2B) recognize overlapping surfaces on eIF2alpha.


    Dey, Madhusudan; Trieselmann, Bruce; Locke, Emily G; Lu, Jingfang; Cao, Chune; Dar, Arvin C; Krishnamoorthy, Thanuja; Dong, Jinsheng; Sicheri, Frank; Dever, Thomas E


    Four stress-responsive protein kinases, including GCN2 and PKR, phosphorylate eukaryotic translation initiation factor 2alpha (eIF2alpha) on Ser51 to regulate general and gene-specific protein synthesis. Phosphorylated eIF2 is an inhibitor of its guanine nucleotide exchange factor, eIF2B. Mutations that block translational regulation were isolated throughout the N-terminal OB-fold domain in Saccharomyces cerevisiae eIF2alpha, including those at residues flanking Ser51 and around 20 A away in the conse