Sample records for large arf1 guanine

  1. Role of protein-phospholipid interactions in the activation of ARF1 by the guanine nucleotide exchange factor Arno.


    Paris, S; Béraud-Dufour, S; Robineau, S; Bigay, J; Antonny, B; Chabre, M; Chardin, P


    Arno is a 47-kDa human protein recently identified as a guanine nucleotide exchange factor for ADP ribosylation factor 1 (ARF1) with a central Sec7 domain responsible for the exchange activity and a carboxyl-terminal pleckstrin homology (PH) domain (Chardin, P., Paris, S., Antonny, B., Robineau, S., Béraud-Dufour, S., Jackson, C. L., and Chabre, M. (1996) Nature 384, 481-484). Binding of the PH domain to phosphatidylinositol 4,5-bisphosphate (PIP2) greatly enhances Arno-mediated activation of myristoylated ARF1. We show here that in the absence of phospholipids, Arno promotes nucleotide exchange on [Delta17]ARF1, a soluble mutant of ARF1 lacking the first 17 amino acids. This reaction is unaffected by PIP2, which suggests that the PIP2-PH domain interaction does not directly regulate the catalytic activity of Arno but rather serves to recruit Arno to membranes. Arno catalyzes the release of GDP more efficiently than that of GTP from [Delta17]ARF1, and a stable complex between Arno Sec7 domain and nucleotide-free [Delta17]ARF1 can be isolated. In contrast to [Delta17]ARF1, full-length unmyristoylated ARF1 is not readily activated by Arno in solution. Its activation requires the presence of phospholipids and a reduction of ionic strength and Mg2+ concentration. PIP2 is strongly stimulatory, indicating that binding of Arno to phospholipids is involved, but in addition, electrostatic interactions between phospholipids and the amino-terminal portion of unmyristoylated ARF1GDP seem to be important. We conclude that efficient activation of full-length ARF1 by Arno requires a membrane surface and two distinct protein-phospholipid interactions: one between the PH domain of Arno and PIP2, and the other between amino-terminal cationic residues of ARF1 and anionic phospholipids. The latter interaction is normally induced by insertion of the amino-terminal myristate into the bilayer but can also be artificially facilitated by decreasing Mg2+ and salt concentrations.

  2. A glutamic finger in the guanine nucleotide exchange factor ARNO displaces Mg2+ and the beta-phosphate to destabilize GDP on ARF1.

    PubMed Central

    Béraud-Dufour, S; Robineau, S; Chardin, P; Paris, S; Chabre, M; Cherfils, J; Antonny, B


    The Sec7 domain of the guanine nucleotide exchange factor ARNO (ARNO-Sec7) is responsible for the exchange activity on the small GTP-binding protein ARF1. ARNO-Sec7 forms a stable complex with the nucleotide-free form of [Delta17]ARF1, a soluble truncated form of ARF1. The crystal structure of ARNO-Sec7 has been solved recently, and a site-directed mutagenesis approach identified a hydrophobic groove and an adjacent hydrophilic loop as the ARF1-binding site. We show that Glu156 in the hydrophilic loop of ARNO-Sec7 is involved in the destabilization of Mg2+ and GDP from ARF1. The conservative mutation E156D and the charge reversal mutation E156K reduce the exchange activity of ARNO-Sec7 by several orders of magnitude. Moreover, [E156K]ARNO-Sec7 forms a complex with the Mg2+-free form of [Delta17]ARF1-GDP without inducing the release of GDP. Other mutations in ARNO-Sec7 and in [Delta17]ARF1 suggest that prominent hydrophobic residues of the switch I region of ARF1 insert into the groove of the Sec7 domain, and that Lys73 of the switch II region of ARF1 forms an ion pair with Asp183 of ARNO-Sec7. PMID:9649435

  3. Kinetics of Interaction between ADP-ribosylation Factor-1 (Arf1) and the Sec7 Domain of Arno Guanine Nucleotide Exchange Factor, Modulation by Allosteric Factors, and the Uncompetitive Inhibitor Brefeldin A

    PubMed Central

    Rouhana, Jad; Padilla, André; Estaran, Sébastien; Bakari, Sana; Delbecq, Stephan; Boublik, Yvan; Chopineau, Joel; Pugnière, Martine; Chavanieu, Alain


    The GDP/GTP nucleotide exchange of Arf1 is catalyzed by nucleotide exchange factors (GEF), such as Arno, which act through their catalytic Sec7 domain. This exchange is a complex mechanism that undergoes conformational changes and intermediate complex species involving several allosteric partners such as nucleotides, Mg2+, and Sec7 domains. Using a surface plasmon resonance approach, we characterized the kinetic binding parameters for various intermediate complexes. We first confirmed that both GDP and GTP counteract equivalently to the free-nucleotide binary Arf1-Arno complex stability and revealed that Mg2+ potentiates by a factor of 2 the allosteric effect of GDP. Then we explored the uncompetitive inhibitory mechanism of brefeldin A (BFA) that conducts to an abortive pentameric Arf1-Mg2+-GDP-BFA-Sec7 complex. With BFA, the association rate of the abortive complex is drastically reduced by a factor of 42, and by contrast, the 15-fold decrease of the dissociation rate concurs to stabilize the pentameric complex. These specific kinetic signatures have allowed distinguishing the level and nature as well as the fate in real time of formed complexes according to experimental conditions. Thus, we showed that in the presence of GDP, the BFA-resistant Sec7 domain of Arno can also associate to form a pentameric complex, which suggests that the uncompetitive inhibition by BFA and the nucleotide allosteric effect combine to stabilize such abortive complex. PMID:23255605

  4. Structure and Membrane Interaction of Myristoylated ARF1

    PubMed Central

    Liu, Yizhou; Kahn, Richard A.; Prestegard, James H.


    Summary ADP-ribosylation factors (ARFs) are small (21 kDa), monomeric GTPases that are important regulators of membrane traffic. When membrane bound, they recruit soluble adaptors to membranes and trigger the assembly of coating complexes involved in cargo selection and vesicular budding. N-myristoylation is a conserved feature of all ARF proteins that is required for its biological functions, though the mechanism(s) by which the myristate acts in ARF functions is not fully understood. Here, we present the first structure of a myristoylated ARF1 protein, determined by solution NMR methods, and an assessment of the influence of myristoylation on association of ARF1·GDP and ARF1·GTP with lipid bilayers. A model in which myristoylation contributes to both the regulation of guanine nucleotide exchange and stable membrane association is supported. PMID:19141284

  5. ARF1 recruits RAC1 to leading edge in neutrophil chemotaxis.


    Mazaki, Yuichi; Onodera, Yasuhito; Higashi, Tsunehito; Horinouchi, Takahiro; Oikawa, Tsukasa; Sabe, Hisataka


    The small GTPase ARF1 mediates membrane trafficking mostly from the Golgi, and is essential for the G protein-coupled receptor (GPCR)-mediated chemotaxis of neutrophils. In this process, ARF1 is activated by the guanine nucleotide exchanger GBF1, and is inactivated by the GTPase-activating protein GIT2. Neutrophils generate the Gβγ-PAK1-αPIX-GIT2 linear complex during GPCR-induced chemotaxis, in which αPIX activates RAC1/CDC42, which then employs PAK1. However, it has remained unclear as to why GIT2 is included in this complex. We investigated the association between ARF1 and RAC1/CDC42 during the fMLP-stimulated chemotaxis of HL60 cells. We found that the silencing of GBF1 significantly impaired the recruitment of RAC1 to the leading edges, but not PAK1, αPIX, RAC2, or CDC42. A significant population of RAC1 colocalized with ARF1 at the leading edges in stimulated cells, whereas fMLP activated both ARF1 and ARF5. Consistently, the silencing of ARF1, but not ARF5, impaired the recruitment of RAC1, whereas the silencing of RAC1 did not affect the recruitment of ARF1 to the leading edges. Our results indicated that the activation of ARF1 triggers the plasma membrane recruitment of RAC1 in GPCR-mediated chemotaxis, which is essential for cortical actin remodeling. Thus, membrane remodeling at the leading edges appears to precede actin remodeling in chemotaxis. Together with the fact that GIT2, which inactivates ARF1, is an integral component of the machinery activating RAC1, we proposed a model in which the ARF1-RAC1 linkage enables the regulation of ARF1 by repetitive on/off cycles during GPCR-mediated neutrophil chemotaxis.

  6. The Sec7 N-terminal regulatory domains facilitate membrane-proximal activation of the Arf1 GTPase

    PubMed Central

    Richardson, Brian C; Halaby, Steve L; Gustafson, Margaret A; Fromme, J Christopher


    The Golgi complex is the central sorting compartment of eukaryotic cells. Arf guanine nucleotide exchange factors (Arf-GEFs) regulate virtually all traffic through the Golgi by activating Arf GTPase trafficking pathways. The Golgi Arf-GEFs contain multiple autoregulatory domains, but the precise mechanisms underlying their function remain largely undefined. We report a crystal structure revealing that the N-terminal DCB and HUS regulatory domains of the Arf-GEF Sec7 form a single structural unit. We demonstrate that the established role of the N-terminal region in dimerization is not conserved; instead, a C-terminal autoinhibitory domain is responsible for dimerization of Sec7. We find that the DCB/HUS domain amplifies the ability of Sec7 to activate Arf1 on the membrane surface by facilitating membrane insertion of the Arf1 amphipathic helix. This enhancing function of the Sec7 N-terminal domains is consistent with the high rate of Arf1-dependent trafficking to the plasma membrane necessary for maximal cell growth. DOI: PMID:26765562

  7. The Arf GAP Asap promotes Arf1 function at the Golgi for cleavage furrow biosynthesis in Drosophila

    PubMed Central

    Rodrigues, Francisco F.; Shao, Wei; Harris, Tony J. C.


    Biosynthetic traffic from the Golgi drives plasma membrane growth. For Drosophila embryo cleavage, this growth is rapid but regulated for cycles of furrow ingression and regression. The highly conserved small G protein Arf1 organizes Golgi trafficking. Arf1 is activated by guanine nucleotide exchange factors, but essential roles for Arf1 GTPase-activating proteins (GAPs) are less clear. We report that the conserved Arf GAP Asap is required for cleavage furrow ingression in the early embryo. Because Asap can affect multiple subcellular processes, we used genetic approaches to dissect its primary effect. Our data argue against cytoskeletal or endocytic involvement and reveal a common role for Asap and Arf1 in Golgi organization. Although Asap lacked Golgi enrichment, it was necessary and sufficient for Arf1 accumulation at the Golgi, and a conserved Arf1-Asap binding site was required for Golgi organization and output. Of note, Asap relocalized to the nuclear region at metaphase, a shift that coincided with subtle Golgi reorganization preceding cleavage furrow regression. We conclude that Asap is essential for Arf1 to function at the Golgi for cleavage furrow biosynthesis. Asap may recycle Arf1 to the Golgi from post-Golgi membranes, providing optimal Golgi output for specific stages of the cell cycle. PMID:27535433

  8. ARF1 and SAR1 GTPases in endomembrane trafficking in plants.


    Cevher-Keskin, Birsen


    Small GTPases largely control membrane traffic, which is essential for the survival of all eukaryotes. Among the small GTP-binding proteins, ARF1 (ADP-ribosylation factor 1) and SAR1 (Secretion-Associated RAS super family 1) are commonly conserved among all eukaryotes with respect to both their functional and sequential characteristics. The ARF1 and SAR1 GTP-binding proteins are involved in the formation and budding of vesicles throughout plant endomembrane systems. ARF1 has been shown to play a critical role in COPI (Coat Protein Complex I)-mediated retrograde trafficking in eukaryotic systems, whereas SAR1 GTPases are involved in intracellular COPII-mediated protein trafficking from the ER to the Golgi apparatus. This review offers a summary of vesicular trafficking with an emphasis on the ARF1 and SAR1 expression patterns at early growth stages and in the de-etiolation process.

  9. Arf1 and Arf6 Promote Ventral Actin Structures formed by acute Activation of Protein Kinase C and Src

    PubMed Central

    Caviston, Juliane P.; Cohen, Lee Ann; Donaldson, Julie G.


    Arf proteins regulate membrane traffic and organelle structure. Although Arf6 is known to initiate actin-based changes in cell surface architecture, Arf1 may also function at the plasma membrane. Here we show that acute activation of protein kinase C (PKC) induced by the phorbol ester PMA led to the formation of motile actin structures on the ventral surface of Beas-2b cells, a lung bronchial epithelial cell line. Ventral actin structures also formed in PMA-treated HeLa cells that had elevated levels of Arf activation. For both cell types, formation of the ventral actin structures was enhanced by expression of active forms of either Arf1 or Arf6, and by the expression of guanine nucleotide exchange factors that activate these Arfs. By contrast, formation of these structures was blocked by inhibitors of PKC and Src, and required phosphatidylinositol 4, 5-bisphosphate, Rac, Arf6 and Arf1. Furthermore, expression of ASAP1, an Arf1 GTPase activating protein (GAP) was more effective at inhibiting the ventral actin structures than was ACAP1, an Arf6 GAP. This study adds to the expanding role for Arf1 in the periphery and identifies a requirement for Arf1, a “Golgi Arf”, in the reorganization of the cortical actin cytoskeleton on ventral surfaces, against the substratum. PMID:24916416

  10. A novel physiological role for ARF1 in the formation of bidirectional tubules from the Golgi

    PubMed Central

    Bottanelli, Francesca; Kilian, Nicole; Ernst, Andreas M.; Rivera-Molina, Felix; Schroeder, Lena K.; Kromann, Emil B.; Lessard, Mark D.; Erdmann, Roman S.; Schepartz, Alanna; Baddeley, David; Bewersdorf, Joerg; Toomre, Derek; Rothman, James E.


    Capitalizing on CRISPR/Cas9 gene-editing techniques and super-resolution nanoscopy, we explore the role of the small GTPase ARF1 in mediating transport steps at the Golgi. Besides its well-established role in generating COPI vesicles, we find that ARF1 is also involved in the formation of long (∼3 µm), thin (∼110 nm diameter) tubular carriers. The anterograde and retrograde tubular carriers are both largely free of the classical Golgi coat proteins coatomer (COPI) and clathrin. Instead, they contain ARF1 along their entire length at a density estimated to be in the range of close packing. Experiments using a mutant form of ARF1 affecting GTP hydrolysis suggest that ARF1[GTP] is functionally required for the tubules to form. Dynamic confocal and stimulated emission depletion imaging shows that ARF1-rich tubular compartments fall into two distinct classes containing 1) anterograde cargoes and clathrin clusters or 2) retrograde cargoes and coatomer clusters. PMID:28428254

  11. Mouse Hepatitis Coronavirus RNA Replication Depends on GBF1-Mediated ARF1 Activation

    PubMed Central

    Verheije, Monique H.; Raaben, Matthijs; Mari, Muriel; te Lintelo, Eddie G.; Reggiori, Fulvio; van Kuppeveld, Frank J. M.; Rottier, Peter J. M.; de Haan, Cornelis A. M.


    Coronaviruses induce in infected cells the formation of double membrane vesicles, which are the sites of RNA replication. Not much is known about the formation of these vesicles, although recent observations indicate an important role for the endoplasmic reticulum in the formation of the mouse hepatitis coronavirus (MHV) replication complexes (RCs). We now show that MHV replication is sensitive to brefeldin A (BFA). Consistently, expression of a dominant-negative mutant of ARF1, known to mimic the action of the drug, inhibited MHV infection profoundly. Immunofluorescence analysis and quantitative electron microscopy demonstrated that BFA did not block the formation of RCs per se, but rather reduced their number. MHV RNA replication was not sensitive to BFA in MDCK cells, which are known to express the BFA-resistant guanine nucleotide exchange factor GBF1. Accordingly, individual knockdown of the Golgi-resident targets of BFA by transfection of small interfering RNAs (siRNAs) showed that GBF1, but not BIG1 or BIG2, was critically involved in MHV RNA replication. ARF1, the cellular effector of GBF1, also appeared to be involved in MHV replication, as siRNAs targeting this small GTPase inhibited MHV infection significantly. Collectively, our results demonstrate that GBF1-mediated ARF1 activation is required for efficient MHV RNA replication and reveal that the early secretory pathway and MHV replication complex formation are closely connected. PMID:18551169

  12. The small GTPase Arf1 modulates mitochondrial morphology and function.


    Ackema, Karin B; Hench, Jürgen; Böckler, Stefan; Wang, Shyi Chyi; Sauder, Ursula; Mergentaler, Heidi; Westermann, Benedikt; Bard, Frédéric; Frank, Stephan; Spang, Anne


    The small GTPase Arf1 plays critical roles in membrane traffic by initiating the recruitment of coat proteins and by modulating the activity of lipid-modifying enzymes. Here, we report an unexpected but evolutionarily conserved role for Arf1 and the ArfGEF GBF1 at mitochondria. Loss of function of ARF-1 or GBF-1 impaired mitochondrial morphology and activity in Caenorhabditis elegans. Similarly, mitochondrial defects were observed in mammalian and yeast cells. In Saccharomyces cerevisiae, aberrant clusters of the mitofusin Fzo1 accumulated in arf1-11 mutants and were resolved by overexpression of Cdc48, an AAA-ATPase involved in ER and mitochondria-associated degradation processes. Yeast Arf1 co-fractionated with ER and mitochondrial membranes and interacted genetically with the contact site component Gem1. Furthermore, similar mitochondrial abnormalities resulted from knockdown of either GBF-1 or contact site components in worms, suggesting that the role of Arf1 in mitochondrial functioning is linked to ER-mitochondrial contacts. Thus, Arf1 is involved in mitochondrial homeostasis and dynamics, independent of its role in vesicular traffic.

  13. Myristoylation-facilitated binding of the G protein ARF1GDP to membrane phospholipids is required for its activation by a soluble nucleotide exchange factor.


    Franco, M; Chardin, P; Chabre, M; Paris, S


    We have investigated the role of N-myristoylation in the activation of bovine ADP-ribosylation factor 1 (ARF1). We previously showed that myristoylation allows some spontaneous GDP-to-GTP exchange to occur on ARF1 at physiological Mg2+ levels in the presence of phospholipid vesicles (Franco, M., Chardin, P., Chabre, M., and Paris, S. (1995) J. Biol. Chem. 270, 1337-1341). Here, we report that this basal nucleotide exchange can be accelerated (by up to 5-fold) by addition of a soluble fraction obtained from bovine retinas. This acceleration is totally abolished by brefeldin A (IC50 = 2 microM) and by trypsin treatment of the retinal extract, as expected for an ARF-specific guanine nucleotide exchange factor. To accelerate GDP release from ARF1, this soluble exchange factor absolutely requires myristoylation of ARF1 and the presence of phospholipid vesicles. The retinal extract also stimulates guanosine 5'-3-O-(thio)-triphosphate (GTP gamma S) release from ARF1 in the presence of phospholipids, but in this case myristoylation of ARF is not required. These observations, together with our previous findings that both myristoylated and non-myristoylated forms of ARF GTP-gamma S but only the myristoylated form of ARFGDP bind to membrane phospholipids, suggest that (i) the retinal exchange factor acts only on membrane-bound ARF, (ii) the myristate is not involved in the protein-protein interaction between ARF1 and the exchange factor, and (iii) N-myristoylation facilitates both spontaneous and catalyzed GDP-to-GTP exchange on ARF1 simply by facilitating the binding of ARFGDP to membrane phospholipids.

  14. EFA6 controls Arf1 and Arf6 activation through a negative feedback loop.


    Padovani, Dominique; Folly-Klan, Marcia; Labarde, Audrey; Boulakirba, Sonia; Campanacci, Valérie; Franco, Michel; Zeghouf, Mahel; Cherfils, Jacqueline


    Guanine nucleotide exchange factors (GEFs) of the exchange factor for Arf6 (EFA6), brefeldin A-resistant Arf guanine nucleotide exchange factor (BRAG), and cytohesin subfamilies activate small GTPases of the Arf family in endocytic events. These ArfGEFs carry a pleckstrin homology (PH) domain in tandem with their catalytic Sec7 domain, which is autoinhibitory and supports a positive feedback loop in cytohesins but not in BRAGs, and has an as-yet unknown role in EFA6 regulation. In this study, we analyzed how EFA6A is regulated by its PH and C terminus (Ct) domains by reconstituting its GDP/GTP exchange activity on membranes. We found that EFA6 has a previously unappreciated high efficiency toward Arf1 on membranes and that, similar to BRAGs, its PH domain is not autoinhibitory and strongly potentiates nucleotide exchange on anionic liposomes. However, in striking contrast to both cytohesins and BRAGs, EFA6 is regulated by a negative feedback loop, which is mediated by an allosteric interaction of Arf6-GTP with the PH-Ct domain of EFA6 and monitors the activation of Arf1 and Arf6 differentially. These observations reveal that EFA6, BRAG, and cytohesins have unanticipated commonalities associated with divergent regulatory regimes. An important implication is that EFA6 and cytohesins may combine in a mixed negative-positive feedback loop. By allowing EFA6 to sustain a pool of dormant Arf6-GTP, such a circuit would fulfill the absolute requirement of cytohesins for activation by Arf-GTP before amplification of their GEF activity by their positive feedback loop.

  15. EFA6 controls Arf1 and Arf6 activation through a negative feedback loop

    PubMed Central

    Padovani, Dominique; Folly-Klan, Marcia; Labarde, Audrey; Boulakirba, Sonia; Campanacci, Valérie; Franco, Michel; Zeghouf, Mahel; Cherfils, Jacqueline


    Guanine nucleotide exchange factors (GEFs) of the exchange factor for Arf6 (EFA6), brefeldin A-resistant Arf guanine nucleotide exchange factor (BRAG), and cytohesin subfamilies activate small GTPases of the Arf family in endocytic events. These ArfGEFs carry a pleckstrin homology (PH) domain in tandem with their catalytic Sec7 domain, which is autoinhibitory and supports a positive feedback loop in cytohesins but not in BRAGs, and has an as-yet unknown role in EFA6 regulation. In this study, we analyzed how EFA6A is regulated by its PH and C terminus (Ct) domains by reconstituting its GDP/GTP exchange activity on membranes. We found that EFA6 has a previously unappreciated high efficiency toward Arf1 on membranes and that, similar to BRAGs, its PH domain is not autoinhibitory and strongly potentiates nucleotide exchange on anionic liposomes. However, in striking contrast to both cytohesins and BRAGs, EFA6 is regulated by a negative feedback loop, which is mediated by an allosteric interaction of Arf6-GTP with the PH-Ct domain of EFA6 and monitors the activation of Arf1 and Arf6 differentially. These observations reveal that EFA6, BRAG, and cytohesins have unanticipated commonalities associated with divergent regulatory regimes. An important implication is that EFA6 and cytohesins may combine in a mixed negative-positive feedback loop. By allowing EFA6 to sustain a pool of dormant Arf6-GTP, such a circuit would fulfill the absolute requirement of cytohesins for activation by Arf-GTP before amplification of their GEF activity by their positive feedback loop. PMID:25114232

  16. Effect of myristoylated N-terminus of Arf1 on the bending rigidity of phospholipid membranes

    NASA Astrophysics Data System (ADS)

    Burrola Gabilondo, Beatriz; Zhou, Hernan; Randazzo, Paul A.; Losert, Wolfgang


    The protein Arf1 is part of the COPI vesicle transport process from the Golgi to the ER. It binds to membranes via a myristoylated N-terminus and it has been shown to tubulate Large Unilamellar Vesicles. The effect of the N-terminus of Arf1 on physical properties of membranes has not been studied, with the exception of curvature. We previously found that the myristoylated N-terminus increases the packing of the lipid molecules, but has no effect on the lateral mobility. We tested the hypothesis that myristoylated peptides affect the bending rigidity of phospholipid Giant Unilamellar Vesicles (GUV). We use optical tweezers to pull tethers from GUV and measure the force of pulling the tether, as well as the retraction speed of the tether once it is released. We also used flicker spectroscopy to estimate the values of the mechanical properties of GUV. We will present results of the force and tether retraction measurements, as well as mechanical properties estimates from flicker, for GUV in the presence of varying concentrations of myristoylated and non-myristoylated N-terminus of Arf1, and compare these with measurements for GUV in the absence of peptide.

  17. The Drosophila Arf1 homologue Arf79F is essential for lamellipodium formation.


    Humphreys, Daniel; Liu, Tao; Davidson, Anthony C; Hume, Peter J; Koronakis, Vassilis


    The WAVE regulatory complex (WRC) drives the polymerisation of actin filaments located beneath the plasma membrane to generate lamellipodia that are pivotal to cell architecture and movement. By reconstituting WRC-dependent actin assembly at the membrane, we recently discovered that several classes of Arf family GTPases directly recruit and activate WRC in cell extracts, and that Arf cooperates with Rac1 to trigger actin polymerisation. Here, we demonstrate that the Class 1 Arf1 homologue Arf79F colocalises with the WRC at dynamic lamellipodia. We report that Arf79F is required for lamellipodium formation in Drosophila S2R+ cells, which only express one Arf isoform for each class. Impeding Arf function either by dominant-negative Arf expression or by Arf double-stranded RNA interference (dsRNAi)-mediated knockdown uncovered that Arf-dependent lamellipodium formation was specific to Arf79F, establishing that Class 1 Arfs, but not Class 2 or Class 3 Arfs, are crucial for lamellipodia. Lamellipodium formation in Arf79F-silenced cells was restored by expressing mammalian Arf1, but not by constitutively active Rac1, showing that Arf79F does not act via Rac1. Abolition of lamellipodium formation in Arf79F-silenced cells was not due to Golgi disruption. Blocking Arf79F activation with guanine nucleotide exchange factor inhibitors impaired WRC localisation to the plasma membrane and concomitant generation of lamellipodia. Our data indicate that the Class I Arf GTPase is a central component in WRC-driven lamellipodium formation.

  18. The Drosophila Arf1 homologue Arf79F is essential for lamellipodium formation

    PubMed Central

    Humphreys, Daniel; Liu, Tao; Davidson, Anthony C.; Hume, Peter J.; Koronakis, Vassilis


    Summary The WAVE regulatory complex (WRC) drives the polymerisation of actin filaments located beneath the plasma membrane to generate lamellipodia that are pivotal to cell architecture and movement. By reconstituting WRC-dependent actin assembly at the membrane, we recently discovered that several classes of Arf family GTPases directly recruit and activate WRC in cell extracts, and that Arf cooperates with Rac1 to trigger actin polymerisation. Here, we demonstrate that the Class 1 Arf1 homologue Arf79F colocalises with the WRC at dynamic lamellipodia. We report that Arf79F is required for lamellipodium formation in Drosophila S2R+ cells, which only express one Arf isoform for each class. Impeding Arf function either by dominant-negative Arf expression or by Arf double-stranded RNA interference (dsRNAi)-mediated knockdown uncovered that Arf-dependent lamellipodium formation was specific to Arf79F, establishing that Class 1 Arfs, but not Class 2 or Class 3 Arfs, are crucial for lamellipodia. Lamellipodium formation in Arf79F-silenced cells was restored by expressing mammalian Arf1, but not by constitutively active Rac1, showing that Arf79F does not act via Rac1. Abolition of lamellipodium formation in Arf79F-silenced cells was not due to Golgi disruption. Blocking Arf79F activation with guanine nucleotide exchange factor inhibitors impaired WRC localisation to the plasma membrane and concomitant generation of lamellipodia. Our data indicate that the Class I Arf GTPase is a central component in WRC-driven lamellipodium formation. PMID:22992458

  19. BEX1/ARF1A1C is required for BFA-sensitive recycling of PIN auxin transporters and auxin-mediated development in Arabidopsis.


    Tanaka, Hirokazu; Nodzyłski, Tomasz; Kitakura, Saeko; Feraru, Mugurel I; Sasabe, Michiko; Ishikawa, Tomomi; Kleine-Vehn, Jürgen; Kakimoto, Tatsuo; Friml, Jiři


    Correct positioning of membrane proteins is an essential process in eukaryotic organisms. The plant hormone auxin is distributed through intercellular transport and triggers various cellular responses. Auxin transporters of the PIN-FORMED (PIN) family localize asymmetrically at the plasma membrane (PM) and mediate the directional transport of auxin between cells. A fungal toxin, brefeldin A (BFA), inhibits a subset of guanine nucleotide exchange factors for ADP-ribosylation factor small GTPases (ARF GEFs) including GNOM, which plays a major role in localization of PIN1 predominantly to the basal side of the PM. The Arabidopsis genome encodes 19 ARF-related putative GTPases. However, ARF components involved in PIN1 localization have been genetically poorly defined. Using a fluorescence imaging-based forward genetic approach, we identified an Arabidopsis mutant, bfa-visualized exocytic trafficking defective1 (bex1), in which PM localization of PIN1-green fluorescent protein (GFP) as well as development is hypersensitive to BFA. We found that in bex1 a member of the ARF1 gene family, ARF1A1C, was mutated. ARF1A1C localizes to the trans-Golgi network/early endosome and Golgi apparatus, acts synergistically to BEN1/MIN7 ARF GEF and is important for PIN recycling to the PM. Consistent with the developmental importance of PIN proteins, functional interference with ARF1 resulted in an impaired auxin response gradient and various developmental defects including embryonic patterning defects and growth arrest. Our results show that ARF1A1C is essential for recycling of PIN auxin transporters and for various auxin-dependent developmental processes.

  20. ARF1(2-17) does not specifically interact with ARF1-dependent pathways. Inhibition by peptide of phospholipases C beta, D and exocytosis in HL60 cells.


    Fensome, A; Cunningham, E; Troung, O; Cockcroft, S


    The small GTP-binding protein ARF has been shown recently to regulate phospholipase D (PLD). In order to investigate the role of ARF proteins in regulated exocytosis, we have used the N-terminal peptide ARF1(2-17) of the ARF1 protein. ARF1 reconstituted PLD activity in cytosol-depleted HL60 cells was inhibited by ARF1(2-17). In the presence of endogenous cytosol, ARF1(2-17) also inhibited GTP-gamma-S-stimulated PLD activity and exocytosis. Mastoparan Politses jadwagae and mastoparan Vespula lewisii which exhibit similar structural properties to ARF1(2-17) also inhibited GTP-gamma-S-stimulated PLD and exocytosis. GTP-gamma-S-stimulated phospholipase C-beta (PLC-beta) was also inhibited by ARF(2-17) and mastoparan. In cytosol-depleted HL60 cells, the ARF(2-17) inhibited the reconstitution of GTP-gamma-S-stimulated PLC-beta activity with exogenously-added PLC-beta 1 and phosphatidylinositol transfer protein. We conclude that the widely-used ARF1(2-17) peptide inhibits both ARF-independent (i.e. PLC-beta) and ARF-dependent pathways (i.e. PLD) and therefore cannot be regarded as a specific inhibitor of ARF function.

  1. IGF-1 drives chromogranin A secretion via activation of Arf1 in human neuroendocrine tumour cells

    PubMed Central

    Münzberg, Christin; Höhn, Katharina; Krndija, Denis; Maaß, Ulrike; Bartsch, Detlef K; Slater, Emily P; Oswald, Franz; Walther, Paul; Seufferlein, Thomas; von Wichert, Götz


    Hypersecretion is the major symptom of functional neuroendocrine tumours. The mechanisms that contribute to this excessive secretion of hormones are still elusive. A key event in secretion is the exit of secretory products from the Golgi apparatus. ADP-ribosylation factor (Arf) GTPases are known to control vesicle budding and trafficking, and have a leading function in the regulation of formation of secretory granula at the Golgi. Here, we show that Arf1 is the predominant Arf protein family member expressed in the neuroendocrine pancreatic tumour cell lines BON and QGP-1. In BON cells Arf1 colocalizes with Golgi markers as well as chromogranin A, and shows significant basal activity. The inhibition of Arf1 activity or expression significantly impaired secretion of chromogranin A. Furthermore, we show that the insulin-like growth factor 1 (IGF-1), a major regulator of growth and secretion in BON cells, induces Arf1 activity. We found that activation of Arf1 upon IGF-1 receptor stimulation is mediated by MEK/ERK signalling pathway in BON and QGP-1 cells. Moreover, the activity of Arf1 in BON cells is mediated by autocrinely secreted IGF-1, and concomitantly, autocrine IGF1 secretion is maintained by Arf1 activity. In summary, our data indicate an important regulatory role for Arf1 at the Golgi in hypersecretion in neuroendocrine cancer cells. PMID:25754106

  2. IGF-1 drives chromogranin A secretion via activation of Arf1 in human neuroendocrine tumour cells.


    Münzberg, Christin; Höhn, Katharina; Krndija, Denis; Maaß, Ulrike; Bartsch, Detlef K; Slater, Emily P; Oswald, Franz; Walther, Paul; Seufferlein, Thomas; von Wichert, Götz


    Hypersecretion is the major symptom of functional neuroendocrine tumours. The mechanisms that contribute to this excessive secretion of hormones are still elusive. A key event in secretion is the exit of secretory products from the Golgi apparatus. ADP-ribosylation factor (Arf) GTPases are known to control vesicle budding and trafficking, and have a leading function in the regulation of formation of secretory granula at the Golgi. Here, we show that Arf1 is the predominant Arf protein family member expressed in the neuroendocrine pancreatic tumour cell lines BON and QGP-1. In BON cells Arf1 colocalizes with Golgi markers as well as chromogranin A, and shows significant basal activity. The inhibition of Arf1 activity or expression significantly impaired secretion of chromogranin A. Furthermore, we show that the insulin-like growth factor 1 (IGF-1), a major regulator of growth and secretion in BON cells, induces Arf1 activity. We found that activation of Arf1 upon IGF-1 receptor stimulation is mediated by MEK/ERK signalling pathway in BON and QGP-1 cells. Moreover, the activity of Arf1 in BON cells is mediated by autocrinely secreted IGF-1, and concomitantly, autocrine IGF1 secretion is maintained by Arf1 activity. In summary, our data indicate an important regulatory role for Arf1 at the Golgi in hypersecretion in neuroendocrine cancer cells.

  3. Structural basis for recruitment and activation of the AP-1 clathrin adaptor complex by Arf1.


    Ren, Xuefeng; Farías, Ginny G; Canagarajah, Bertram J; Bonifacino, Juan S; Hurley, James H


    AP-1 is a clathrin adaptor complex that sorts cargo between the trans-Golgi network and endosomes. AP-1 recruitment to these compartments requires Arf1-GTP. The crystal structure of the tetrameric core of AP-1 in complex with Arf1-GTP, together with biochemical analyses, shows that Arf1 activates cargo binding by unlocking AP-1. Unlocking is driven by two molecules of Arf1 that bridge two copies of AP-1 at two interaction sites. The GTP-dependent switch I and II regions of Arf1 bind to the N terminus of the β1 subunit of one AP-1 complex, while the back side of Arf1 binds to the central part of the γ subunit trunk of a second AP-1 complex. A third Arf1 interaction site near the N terminus of the γ subunit is important for recruitment, but not activation. These observations lead to a model for the recruitment and activation of AP-1 by Arf1.

  4. Expression of a dominant allele of human ARF1 inhibits membrane traffic in vivo

    PubMed Central


    ADP-ribosylation factor (ARF) proteins and inhibitory peptides derived from ARFs have demonstrated activities in a number of in vitro assays that measure ER-to-Golgi and intra-Golgi transport and endosome fusion. To better understand the roles of ARF proteins in vivo, stable cell lines were obtained from normal rat kidney (NRK) cells transfected with either wild-type or a dominant activating allele ([Q71L]) of the human ARF1 gene under the control of the interferon-inducible mouse Mx1 promoter. Upon addition of interferon, expression of ARF1 proteins increased with a half-time of 7-8 h, as determined by immunoblot analysis. Induction of mutant ARF1, but not wild-type ARF1, led to an inhibition of protein secretion with kinetics similar to that observed for induction of protein expression. Examination of the Golgi apparatus and the ER by indirect immunofluorescence or transmission electron microscopy revealed that expression of low levels of mutant ARF1 protein correlated with a dramatic increase in vesiculation of the Golgi apparatus and expansion of the ER lumen, while expression of substantially higher levels of wild-type ARF1 had no discernible effect. Endocytosis was also inhibited by expression of mutant ARF1, but not by the wild-type protein. Finally, the expression of [Q71L]ARF1, but not wild-type ARF1, antagonized the actions of brefeldin A, as determined by the delayed loss of ARF and beta-COP from Golgi membranes and disruption of the Golgi apparatus. General models for the actions of ARF1 in membrane traffic events are discussed. PMID:8294513

  5. Active ADP-ribosylation Factor-1 (ARF1) Is Required for Mitotic Golgi Fragmentation*S

    PubMed Central

    Xiang, Yi; Seemann, Joachim; Bisel, Blaine; Punthambaker, Sukanya; Wang, Yanzhuang


    In mammalian cells the Golgi apparatus undergoes an extensive disassembly process at the onset of mitosis that is believed to facilitate equal partitioning of this organelle into the two daughter cells. However, the underlying mechanisms for this fragmentation process are so far unclear. Here we have investigated the role of the ADP-ribosylation factor-1 (ARF1) in this process to determine whether Golgi fragmentation in mitosis is mediated by vesicle budding. ARF1 is a small GTPase that is required for COPI vesicle formation from the Golgi membranes. Treatment of Golgi membranes with mitotic cytosol or with purified coatomer together with wild type ARF1 or its constitutive active form, but not the inactive mutant, converted the Golgi membranes into COPI vesicles. ARF1-depleted mitotic cytosol failed to fragment Golgi membranes. ARF1 is associated with Golgi vesicles generated in vitro and with vesicles in mitotic cells. In addition, microinjection of constitutive active ARF1 did not affect mitotic Golgi fragmentation or cell progression through mitosis. Our results show that ARF1 is active during mitosis and that this activity is required for mitotic Golgi fragmentation. PMID:17562717

  6. Active ADP-ribosylation factor-1 (ARF1) is required for mitotic Golgi fragmentation.


    Xiang, Yi; Seemann, Joachim; Bisel, Blaine; Punthambaker, Sukanya; Wang, Yanzhuang


    In mammalian cells the Golgi apparatus undergoes an extensive disassembly process at the onset of mitosis that is believed to facilitate equal partitioning of this organelle into the two daughter cells. However, the underlying mechanisms for this fragmentation process are so far unclear. Here we have investigated the role of the ADP-ribosylation factor-1 (ARF1) in this process to determine whether Golgi fragmentation in mitosis is mediated by vesicle budding. ARF1 is a small GTPase that is required for COPI vesicle formation from the Golgi membranes. Treatment of Golgi membranes with mitotic cytosol or with purified coatomer together with wild type ARF1 or its constitutive active form, but not the inactive mutant, converted the Golgi membranes into COPI vesicles. ARF1-depleted mitotic cytosol failed to fragment Golgi membranes. ARF1 is associated with Golgi vesicles generated in vitro and with vesicles in mitotic cells. In addition, microinjection of constitutive active ARF1 did not affect mitotic Golgi fragmentation or cell progression through mitosis. Our results show that ARF1 is active during mitosis and that this activity is required for mitotic Golgi fragmentation.

  7. Molecular cloning, characterization, and expression of human ADP-ribosylation factors: Two guanine nucleotide-dependent activators of cholera toxin

    SciTech Connect

    Bobak, D.A.; Nightingale, M.S.; Murtagh, J.J.; Price, S.R.; Moss, J.; Vaughan, M. )


    ADP-ribosylation factors (ARFs) are small guanine nucleotide-binding proteins that enhance the enzymatic activities of cholera toxin. Two ARF cDNAs, ARF1 and ARF3, were cloned from a human cerebellum library. Based on deduced amino acid sequences and patterns of hybridization of cDNA and oligonucleotide probes with mammalian brain poly(A){sup +} RNA, human ARF1 is the homologue of bovine ARF1. Human ARF3, which differs from bovine ARF1 and bovine ARF2, appears to represent a newly identified third type of ARF. Hybridization patterns of human ARF cDNA and clone-specific oligonucleotides with poly(A){sup +} RNA are consistent with the presence of at least two, and perhaps four, separate ARF messages in human brain. In vitro translation of ARF1, ARF2, and ARF3 produced proteins that behaved, by SDS/PAGE, similar to a purified soluble brain ARF. Deduced amino acid sequences of human ARF1 and ARF3 contain regions, similar to those in other G proteins, that are believed to be involved in GTP binding and hydrolysis. ARFS also exhibit a modest degree of homology with a bovine phospholipase C. The observations reported here support the conclusion that the ARFs are members of a multigene family of small guanine nucleotide-binding proteins. Definition of the regulation of ARF mRNAs and of function(s) of recombinant ARF proteins will aid in the elucidation of the physiologic role(s) of ARFs.

  8. The leukemia-associated Rho guanine nucleotide exchange factor LARG is required for efficient replication stress signaling

    PubMed Central

    Beveridge, Ryan D; Staples, Christopher J; Patil, Abhijit A; Myers, Katie N; Maslen, Sarah; Skehel, J Mark; Boulton, Simon J; Collis, Spencer J


    We previously identified and characterized TELO2 as a human protein that facilitates efficient DNA damage response (DDR) signaling. A subsequent yeast 2-hybrid screen identified LARG; Leukemia-Associated Rho Guanine Nucleotide Exchange Factor (also known as Arhgef12), as a potential novel TELO2 interactor. LARG was previously shown to interact with Pericentrin (PCNT), which, like TELO2, is required for efficient replication stress signaling. Here we confirm interactions between LARG, TELO2 and PCNT and show that a sub-set of LARG co-localizes with PCNT at the centrosome. LARG-deficient cells exhibit replication stress signaling defects as evidenced by; supernumerary centrosomes, reduced replication stress-induced γH2AX and RPA nuclear foci formation, and reduced activation of the replication stress signaling effector kinase Chk1 in response to hydroxyurea. As such, LARG-deficient cells are sensitive to replication stress-inducing agents such as hydroxyurea and mitomycin C. Conversely we also show that depletion of TELO2 and the replication stress signaling kinase ATR leads to RhoA signaling defects. These data therefore reveal a level of crosstalk between the RhoA and DDR signaling pathways. Given that mutations in both ATR and PCNT can give rise to the related primordial dwarfism disorders of Seckel Syndrome and Microcephalic osteodysplastic primordial dwarfism type II (MOPDII) respectively, which both exhibit defects in ATR-dependent checkpoint signaling, these data also raise the possibility that mutations in LARG or disruption to RhoA signaling may be contributory factors to the etiology of a sub-set of primordial dwarfism disorders. PMID:25485589

  9. The leukemia-associated Rho guanine nucleotide exchange factor LARG is required for efficient replication stress signaling.


    Beveridge, Ryan D; Staples, Christopher J; Patil, Abhijit A; Myers, Katie N; Maslen, Sarah; Skehel, J Mark; Boulton, Simon J; Collis, Spencer J


    We previously identified and characterized TELO2 as a human protein that facilitates efficient DNA damage response (DDR) signaling. A subsequent yeast 2-hybrid screen identified LARG; Leukemia-Associated Rho Guanine Nucleotide Exchange Factor (also known as Arhgef12), as a potential novel TELO2 interactor. LARG was previously shown to interact with Pericentrin (PCNT), which, like TELO2, is required for efficient replication stress signaling. Here we confirm interactions between LARG, TELO2 and PCNT and show that a sub-set of LARG co-localizes with PCNT at the centrosome. LARG-deficient cells exhibit replication stress signaling defects as evidenced by; supernumerary centrosomes, reduced replication stress-induced γH2AX and RPA nuclear foci formation, and reduced activation of the replication stress signaling effector kinase Chk1 in response to hydroxyurea. As such, LARG-deficient cells are sensitive to replication stress-inducing agents such as hydroxyurea and mitomycin C. Conversely we also show that depletion of TELO2 and the replication stress signaling kinase ATR leads to RhoA signaling defects. These data therefore reveal a level of crosstalk between the RhoA and DDR signaling pathways. Given that mutations in both ATR and PCNT can give rise to the related primordial dwarfism disorders of Seckel Syndrome and Microcephalic osteodysplastic primordial dwarfism type II (MOPDII) respectively, which both exhibit defects in ATR-dependent checkpoint signaling, these data also raise the possibility that mutations in LARG or disruption to RhoA signaling may be contributory factors to the etiology of a sub-set of primordial dwarfism disorders.

  10. Molecular analysis of ARF1 expression profiles during development of physic nut (Jatropha curcas L.).


    Qin, Xiaobo; Lin, Fanrong; Lii, Yifan; Gou, Chunbao; Chen, Fang


    A cDNA clone designated arf1 was isolated from a physic nut (Jatropha curcas L.) endosperm cDNA library which encodes a small GTP-binding protein and has significant homology to ADP-ribosylation factors (ARF) in plants, animals and microbes. The cDNA contains an open reading frame that encodes a polypeptide of 181 amino acids with a calculated molecular mass of 20.7 kDa. The deduced amino acid sequence showed high homology to known ARFs from other organisms. The products of the arf1 obtained by overexpression in E. coli revealed the specific binding activity toward GTP. The expression of arf1 was observed in flowers, roots, stems and leaves as analyzed by RT-PCR, and its transcriptional level was highest in flowers. In particular, the accumulation of arf1 transcripts was different under various environmental stresses in seedlings. The results suggest that arf1 plays distinct physiological roles in Jatropha curcas cells.

  11. The domain architecture of large guanine nucleotide exchange factors for the small GTP-binding protein Arf.


    Mouratou, Barbara; Biou, Valerie; Joubert, Alexandra; Cohen, Jean; Shields, David J; Geldner, Niko; Jürgens, Gerd; Melançon, Paul; Cherfils, Jacqueline


    Small G proteins, which are essential regulators of multiple cellular functions, are activated by guanine nucleotide exchange factors (GEFs) that stimulate the exchange of the tightly bound GDP nucleotide by GTP. The catalytic domain responsible for nucleotide exchange is in general associated with non-catalytic domains that define the spatio-temporal conditions of activation. In the case of small G proteins of the Arf subfamily, which are major regulators of membrane trafficking, GEFs form a heterogeneous family whose only common characteristic is the well-characterized Sec7 catalytic domain. In contrast, the function of non-catalytic domains and how they regulate/cooperate with the catalytic domain is essentially unknown. Based on Sec7-containing sequences from fully-annotated eukaryotic genomes, including our annotation of these sequences from Paramecium, we have investigated the domain architecture of large ArfGEFs of the BIG and GBF subfamilies, which are involved in Golgi traffic. Multiple sequence alignments combined with the analysis of predicted secondary structures, non-structured regions and splicing patterns, identifies five novel non-catalytic structural domains which are common to both subfamilies, revealing that they share a conserved modular organization. We also report a novel ArfGEF subfamily with a domain organization so far unique to alveolates, which we name TBS (TBC-Sec7). Our analysis unifies the BIG and GBF subfamilies into a higher order subfamily, which, together with their being the only subfamilies common to all eukaryotes, suggests that they descend from a common ancestor from which species-specific ArfGEFs have subsequently evolved. Our identification of a conserved modular architecture provides a background for future functional investigation of non-catalytic domains.

  12. The clathrin adaptor AP-1 complex and Arf1 regulate planar cell polarity in vivo

    PubMed Central

    Mendoza, Meg; Dussert, Aurore; Collu, Giovanna; Roman, Angel-Carlos; Weber, Ursula; Ciruna, Brian; Mlodzik, Marek


    A key step in generating planar cell polarity (PCP) is the formation of restricted junctional domains containing Frizzled/Dishevelled/Diego (Fz/Dsh/Dgo) or Van Gogh/Prickle (Vang/Pk) complexes within the same cell, stabilized via Flamingo (Fmi) across cell membranes. Although models have been proposed for how these complexes acquire and maintain their polarized localization, the machinery involved in moving core PCP proteins around cells remains unknown. We describe the AP-1 adaptor complex and Arf1 as major regulators of PCP protein trafficking in vivo. AP-1 and Arf1 disruption affects the accumulation of Fz/Fmi and Vang/Fmi complexes in the proximo–distal axis, producing severe PCP phenotypes. Using novel tools, we demonstrate a direct and specific Arf1 involvement in Fz trafficking in vivo. Moreover, we uncover a conserved Arf1 PCP function in vertebrates. Our data support a model whereby the trafficking machinery plays an important part during PCP establishment, promoting formation of polarized PCP-core complexes in vivo. PMID:25849195

  13. The clathrin adaptor AP-1 complex and Arf1 regulate planar cell polarity in vivo.


    Carvajal-Gonzalez, Jose Maria; Balmer, Sophie; Mendoza, Meg; Dussert, Aurore; Collu, Giovanna; Roman, Angel-Carlos; Weber, Ursula; Ciruna, Brian; Mlodzik, Marek


    A key step in generating planar cell polarity (PCP) is the formation of restricted junctional domains containing Frizzled/Dishevelled/Diego (Fz/Dsh/Dgo) or Van Gogh/Prickle (Vang/Pk) complexes within the same cell, stabilized via Flamingo (Fmi) across cell membranes. Although models have been proposed for how these complexes acquire and maintain their polarized localization, the machinery involved in moving core PCP proteins around cells remains unknown. We describe the AP-1 adaptor complex and Arf1 as major regulators of PCP protein trafficking in vivo. AP-1 and Arf1 disruption affects the accumulation of Fz/Fmi and Vang/Fmi complexes in the proximo-distal axis, producing severe PCP phenotypes. Using novel tools, we demonstrate a direct and specific Arf1 involvement in Fz trafficking in vivo. Moreover, we uncover a conserved Arf1 PCP function in vertebrates. Our data support a model whereby the trafficking machinery plays an important part during PCP establishment, promoting formation of polarized PCP-core complexes in vivo.

  14. HIV-1 Nef hijacks clathrin coats by stabilizing AP-1:Arf1 polygons.


    Shen, Qing-Tao; Ren, Xuefeng; Zhang, Rui; Lee, Il-Hyung; Hurley, James H


    The lentiviruses HIV and simian immunodeficiency virus (SIV) subvert intracellular membrane traffic as part of their replication cycle. The lentiviral Nef protein helps viruses evade innate and adaptive immune defenses by hijacking the adaptor protein 1 (AP-1) and AP-2 clathrin adaptors. We found that HIV-1 Nef and the guanosine triphosphatase Arf1 induced trimerization and activation of AP-1. Here we report the cryo-electron microscopy structures of the Nef- and Arf1-bound AP-1 trimer in the active and inactive states. A central nucleus of three Arf1 molecules organizes the trimers. We combined the open trimer with a known dimer structure and thus predicted a hexagonal assembly with inner and outer faces that bind the membranes and clathrin, respectively. Hexagons were directly visualized and the model validated by reconstituting clathrin cage assembly. Arf1 and Nef thus play interconnected roles in allosteric activation, cargo recruitment, and coat assembly, revealing an unexpectedly intricate organization of the inner AP-1 layer of the clathrin coat.

  15. Structural dynamics and cation interactions of DNA quadruplex molecules containing mixed guanine/cytosine quartets revealed by large-scale MD simulations.


    Spacková, N; Berger, I; Sponer, J


    Large-scale molecular dynamics (MD) simulations have been utilized to study G-DNA quadruplex molecules containing mixed GCGC and all-guanine GGGG quartet layers. Incorporation of mixed GCGC quartets into G-DNA stems substantially enhances their sequence variability. The mixed quadruplexes form rigid assemblies that require integral monovalent cations for their stabilization. The interaction of cations with the all-guanine quartets is the leading contribution for the stability of the four-stranded assemblies, while the mixed quartets are rather tolerated within the structure. The simulations predict that two cations are preferred to stabilize a four-layer quadruplex stem composed of two GCGC and two all-guanine quartets. The distribution of cations in the structure is influenced by the position of the GCGC quartets within the quadruplex, the presence and arrangement of thymidine loops connecting the guanine/cytosine stretches forming the stems, and the cation type present (Na(+) or K(+)). The simulations identify multiple nanosecond-scale stable arrangements of the thymidine loops present in the molecules investigated. In these thymidine loops, several structured pockets are identified capable of temporarily coordinating cations. However, no stable association of cations to a loop has been observed. The simulations reveal several paths through the thymidine loop regions that can be followed by the cations when exchanging between the central ion channel in the quadruplex stem and the surrounding solvent. We have carried out 20 independent simulations while the length of simulations reaches a total of 90 ns, rendering this study one of the most extensive MD investigations carried out on nucleic acids so far. The trajectories provide a largely converged characterization of the structural dynamics of these four-stranded G-DNA molecules.

  16. ARF1 controls Rac1 signaling to regulate migration of MDA-MB-231 invasive breast cancer cells.


    Lewis-Saravalli, Sebastian; Campbell, Shirley; Claing, Audrey


    ADP-ribosylation factors (ARFs) are monomeric G proteins that regulate many cellular processes such as reorganization of the actin cytoskeleton. We have previously shown that ARF1 is overexpressed in highly invasive breast cancer cells and contribute to their enhanced migration. In this study, we propose to define the molecular mechanism by which ARF1 regulates this complex cellular response by investigating the role of this ARF GTPase on the activation process of Rac1, a Rho GTPase, associated with lamellipodia formation during cell migration. Here, we first show that inhibition of ARF1 or Rac1 expression markedly impacts the ability of MDA-MB-231 cells to migrate upon EGF stimulation. However, the effect of ARF1 depletion can be reversed by overexpression of the Rac1 active mutant, Rac1 Q(61)L. Depletion of ARF1 also impairs the ability of EGF stimulation to promote GTP-loading of Rac1. To further investigate the possible cross-talk between ARF1 and Rac1, we next examined whether they could form a complex. We observed that the two GTPases could directly interact independently of the nature of the nucleotide bound to them. EGF treatment however resulted in the association of Rac1 with its effector IRSp53, which was completely abrogated in ARF1 depleted cells. We present evidences that this ARF isoform is responsible for the plasma membrane targeting of both Rac1 and IRSp53, a step essential for lamellipodia formation. In conclusion, this study provides a new mechanism by which ARF1 regulates cell migration and identifies this GTPase as a promising pharmacological target to reduce metastasis formation in breast cancer patients.

  17. The Qb-SNARE Memb11 interacts specifically with Arf1 in the Golgi apparatus of Arabidopsis thaliana.


    Marais, Claireline; Wattelet-Boyer, Valérie; Bouyssou, Guillaume; Hocquellet, Agnès; Dupuy, Jean-William; Batailler, Brigitte; Brocard, Lysiane; Boutté, Yohann; Maneta-Peyret, Lilly; Moreau, Patrick


    The SNARE (soluble N-ethylmaleimide-sensitive factor attachment protein receptor) proteins are critical for the function of the secretory pathway. The SNARE Memb11 is involved in membrane trafficking at the ER-Golgi interface. The aim of the work was to decipher molecular mechanisms acting in Memb11-mediated ER-Golgi traffic. In mammalian cells, the orthologue of Memb11 (membrin) is potentially involved in the recruitment of the GTPase Arf1 at the Golgi membrane. However molecular mechanisms associated to Memb11 remain unknown in plants. Memb11 was detected mainly at the cis-Golgi and co-immunoprecipitated with Arf1, suggesting that Arf1 may interact with Memb11. This interaction of Memb11 with Arf1 at the Golgi was confirmed by in vivo BiFC (Bimolecular Fluorescence Complementation) experiments. This interaction was found to be specific to Memb11 as compared to either Memb12 or Sec22. Using a structural bioinformatic approach, several sequences in the N-ter part of Memb11 were hypothesized to be critical for this interaction and were tested by BiFC on corresponding mutants. Finally, by using both in vitro and in vivo approaches, we determined that only the GDP-bound form of Arf1 interacts with Memb11. Together, our results indicate that Memb11 interacts with the GDP-bound form of Arf1 in the Golgi apparatus.

  18. [The structural characteristics, alternative splicing and genetic experession analysis of ADP-ribosylation-factor 1 (arf1) in cotton].


    Ren, Mao-Zhi; Chen, Quan-Jia; Zhang, Rui; Guo, San-Dui


    The full-length cDNA,DNA and promoter of ADP-ribosylation-factor 1 (arf1) was isolated from Gossypium hirsutum Y18 by means of isocaudarner inverse PCR (II-PCR) and rapid isolating cDNA 5' unknown sequence and promoter (RICUP) established in our lab. Results indicated that the gene is 4 360 bp in size, including seven exons and six introns. Interestingly, alterative splicing occurs at intron I. Differential processing of intron 1 yields three different transcripts with 1 026 bp, 1103 bp and 1 544 bp in sizes, respectively. Arf1 encodes 181 amino acids. Sequence analysis indicated that sequence upstream transcription initiation site of arf1 includes typical initiator, TATA box, CCAAT box, GC box and several forward and reverse repeat sequences. And typical promoter structures, such as AT-rich sequence and palindrome structure have been detected in the sequence downstream transcription initiation site. Southern blot analysis indicated that the gene has two copies in the genome of cotton. Northern blot confirmed the predominate expression of arf1 in reproductive organs of cotton, including bud, flower, fiber and boll. Also, the feature and character of arf1 and its promoter have been studied. This study will lay foundation for the other research on function of arf1 in the development of reproductive organs in cotton.

  19. ARAP1 regulates the ring size of circular dorsal ruffles through Arf1 and Arf5

    PubMed Central

    Hasegawa, Junya; Tsujita, Kazuya; Takenawa, Tadaomi; Itoh, Toshiki


    Small guanosine triphosphatase (GTPase) ADP-ribosylation factors (Arfs) regulate membrane traffic and actin reorganization under the strict control of GTPase-activating proteins (GAPs). ARAP1 (Arf GAP with Rho GAP domain, ankyrin repeat, and PH domain 1) is an Arf GAP molecule with multiple PH domains that recognize phosphatidylinositol 3,4,5-trisphosphate. We found that growth factor stimulation induced localization of ARAP1 to an area of the plasma membrane inside the ring structure of circular dorsal ruffles (CDRs). Moreover, expression of ARAP1 increased the size of the CDR filamentous-actin ring in an Arf GAP activity–dependent manner, whereas smaller CDRs were formed by ARAP1 knockdown. In addition, expression of a dominant-negative mutant of Arf1 and Arf5, the substrates of ARAP1, expanded the size of CDRs, suggesting that the two Arf isoforms regulate ring structure downstream of ARAP1. Therefore our results reveal a novel molecular mechanism of CDR ring size control through the ARAP1–Arf1/5 pathway. PMID:22573888

  20. Interaction of FAPP1 with ARF1 and PI4P at a membrane surface: an example of coincidence detection

    PubMed Central

    Liu, Yizhou; Kahn, Richard A.; Prestegard, James H.


    SUMMARY Interactions among ADP-ribosylation factors (ARFs), various adaptor proteins, and membrane lipids are essential for intracellular vesicle transport of a variety of cellular materials. Here we present NMR-based information on the nature of the interaction of yeast ARF1 (yARF1) and the pleckstrin homology (PH) domain of four-phosphate-adaptor protein 1 (FAPP1) as it occurs at a model membrane surface. Interactions favor a model in which FAPP1 is partially embedded in the membrane and interacts with a membrane-associated ARF1 molecule primarily through contacts between residues in switch I of ARF1 and regions near and under the solution exposed C-terminal extension of the PH domain. The ARF1 binding site on FAPP1-PH is distinct from a positively charged phosphatidylinositol-4-phosphate (PI4P) binding site. A structural model is constructed that supports coincidence detection of both activated ARF and PI4P as a mechanism facilitating FAPP1 recruitment to membranes. PMID:24462251

  1. ARF1 and ARF4 regulate recycling endosomal morphology and retrograde transport from endosomes to the Golgi apparatus.


    Nakai, Waka; Kondo, Yumika; Saitoh, Akina; Naito, Tomoki; Nakayama, Kazuhisa; Shin, Hye-Won


    Small GTPases of the ADP-ribosylation factor (ARF) family, except for ARF6, mainly localize to the Golgi apparatus, where they trigger formation of coated carrier vesicles. We recently showed that class I ARFs (ARF1 and ARF3) localize to recycling endosomes, as well as to the Golgi, and are redundantly required for recycling of endocytosed transferrin. On the other hand, the roles of class II ARFs (ARF4 and ARF5) are not yet fully understood, and the complementary or overlapping functions of class I and class II ARFs have been poorly characterized. In this study, we find that simultaneous depletion of ARF1 and ARF4 induces extensive tubulation of recycling endosomes. Moreover, the depletion of ARF1 and ARF4 inhibits retrograde transport of TGN38 and mannose-6-phosphate receptor from early/recycling endosomes to the trans-Golgi network (TGN) but does not affect the endocytic/recycling pathway of transferrin receptor or inhibit retrograde transport of CD4-furin from late endosomes to the TGN. These observations indicate that the ARF1+ARF4 and ARF1+ARF3 pairs are both required for integrity of recycling endosomes but are involved in distinct transport pathways: the former pair regulates retrograde transport from endosomes to the TGN, whereas the latter is required for the transferrin recycling pathway from endosomes to the plasma membrane.

  2. Analysis of Arf1 GTPase-dependent membrane binding and remodeling using the exomer secretory vesicle cargo adaptor

    PubMed Central

    Paczkowski, Jon E.; Fromme, J. Christopher


    Summary Protein-protein and protein-membrane interactions play a critical role in shaping biological membranes through direct physical contact with the membrane surface. This is particularly evident in many steps of membrane trafficking, in which proteins deform the membrane and induce fission to form transport carriers. The small GTPase Arf1 and related proteins have the ability to remodel membranes by insertion of an amphipathic helix into the membrane. Arf1 and the exomer cargo adaptor coordinate cargo sorting into subset of secretory vesicle carriers in the model organism Saccharomyces cerevisiae. Here, we detail the assays we used to explore the cooperative action of Arf1 and exomer to bind and remodel membranes. We expect these methods are broadly applicable to other small GTPase/effector systems where investigation of membrane binding and remodeling is of interest. PMID:27632000

  3. The RhoA guanine nucleotide exchange factor, LARG, mediates ICAM-1-dependent mechanotransduction in endothelial cells to stimulate transendothelial migration.


    Lessey-Morillon, Elizabeth C; Osborne, Lukas D; Monaghan-Benson, Elizabeth; Guilluy, Christophe; O'Brien, E Timothy; Superfine, Richard; Burridge, Keith


    RhoA-mediated cytoskeletal rearrangements in endothelial cells (ECs) play an active role in leukocyte transendothelial cell migration (TEM), a normal physiological process in which leukocytes cross the endothelium to enter the underlying tissue. Although much has been learned about RhoA signaling pathways downstream from ICAM-1 in ECs, little is known about the consequences of the tractional forces that leukocytes generate on ECs as they migrate over the surface before TEM. We have found that after applying mechanical forces to ICAM-1 clusters, there is an increase in cellular stiffening and enhanced RhoA signaling compared with ICAM-1 clustering alone. We have identified that leukemia-associated Rho guanine nucleotide exchange factor (LARG), also known as Rho GEF 12 (ARHGEF12) acts downstream of clustered ICAM-1 to increase RhoA activity, and that this pathway is further enhanced by mechanical force on ICAM-1. Depletion of LARG decreases leukocyte crawling and inhibits TEM. To our knowledge, this is the first report of endothelial LARG regulating leukocyte behavior and EC stiffening in response to tractional forces generated by leukocytes.

  4. Molecular Basis of Phosphatidylinositol 4-Phosphate and ARF1 GTPase Recognition by the FAPP1 Pleckstrin Homology (PH) Domain

    SciTech Connect

    He, J.; Heroux, A.; Scott, J. L.; Roy, S.; Lenoir, M.; Overduin, M.; Stahelin, R. V.; Kutateladze, T. G.


    Four-phosphate-adaptor protein 1 (FAPP1) regulates secretory transport from the trans-Golgi network (TGN) to the plasma membrane. FAPP1 is recruited to the Golgi through binding of its pleckstrin homology (PH) domain to phosphatidylinositol 4-phosphate (PtdIns(4)P) and a small GTPase ADP-ribosylation factor 1 (ARF1). Despite the critical role of FAPP1 in membrane trafficking, the molecular basis of its dual function remains unclear. Here, we report a 1.9 {angstrom} resolution crystal structure of the FAPP1 PH domain and detail the molecular mechanisms of the PtdIns(4)P and ARF1 recognition. The FAPP1 PH domain folds into a seven-stranded {beta}-barrel capped by an {alpha}-helix at one edge, whereas the opposite edge is flanked by three loops and the {beta}4 and {beta}7 strands that form a lipid-binding pocket within the {beta}-barrel. The ARF1-binding site is located on the outer side of the {beta}-barrel as determined by NMR resonance perturbation analysis, mutagenesis, and measurements of binding affinities. The two binding sites have little overlap, allowing FAPP1 PH to associate with both ligands simultaneously and independently. Binding to PtdIns(4)P is enhanced in an acidic environment and is required for membrane penetration and tubulation activity of FAPP1, whereas the GTP-bound conformation of the GTPase is necessary for the interaction with ARF1. Together, these findings provide structural and biochemical insight into the multivalent membrane anchoring by the PH domain that may augment affinity and selectivity of FAPP1 toward the TGN membranes enriched in both PtdIns(4)P and GTP-bound ARF1.

  5. Molecular basis of phosphatidylinositol 4-phosphate and ARF1 GTPase recognition by the FAPP1 pleckstrin homology (PH) domain.


    He, Ju; Scott, Jordan L; Heroux, Annie; Roy, Siddhartha; Lenoir, Marc; Overduin, Michael; Stahelin, Robert V; Kutateladze, Tatiana G


    Four-phosphate-adaptor protein 1 (FAPP1) regulates secretory transport from the trans-Golgi network (TGN) to the plasma membrane. FAPP1 is recruited to the Golgi through binding of its pleckstrin homology (PH) domain to phosphatidylinositol 4-phosphate (PtdIns(4)P) and a small GTPase ADP-ribosylation factor 1 (ARF1). Despite the critical role of FAPP1 in membrane trafficking, the molecular basis of its dual function remains unclear. Here, we report a 1.9 Å resolution crystal structure of the FAPP1 PH domain and detail the molecular mechanisms of the PtdIns(4)P and ARF1 recognition. The FAPP1 PH domain folds into a seven-stranded β-barrel capped by an α-helix at one edge, whereas the opposite edge is flanked by three loops and the β4 and β7 strands that form a lipid-binding pocket within the β-barrel. The ARF1-binding site is located on the outer side of the β-barrel as determined by NMR resonance perturbation analysis, mutagenesis, and measurements of binding affinities. The two binding sites have little overlap, allowing FAPP1 PH to associate with both ligands simultaneously and independently. Binding to PtdIns(4)P is enhanced in an acidic environment and is required for membrane penetration and tubulation activity of FAPP1, whereas the GTP-bound conformation of the GTPase is necessary for the interaction with ARF1. Together, these findings provide structural and biochemical insight into the multivalent membrane anchoring by the PH domain that may augment affinity and selectivity of FAPP1 toward the TGN membranes enriched in both PtdIns(4)P and GTP-bound ARF1.

  6. Recruitment of Arf1-GDP to Golgi by Glo3p-type ArfGAPs is crucial for golgi maintenance and plant growth.


    Min, Myung Ki; Jang, Mihue; Lee, Myounghui; Lee, Junho; Song, Kyungyoung; Lee, Yongjik; Choi, Kwan Yong; Robinson, David G; Hwang, Inhwan


    ADP-ribosylation factor1 (Arf1), a member of the small GTP-binding proteins, plays a pivotal role in protein trafficking to multiple organelles. In its GDP-bound form, Arf1 is recruited from the cytosol to organelle membranes, where it functions in vesicle-mediated protein trafficking. However, the mechanism of Arf1-GDP recruitment remains unknown. Here, we provide evidence that two Glo3p-type Arf GTPase-activating proteins (ArfGAPs), ArfGAP domain8 (AGD8) and AGD9, are involved in the recruitment of Arf1-GDP to the Golgi apparatus in Arabidopsis (Arabidopsis thaliana). RNA interference plants expressing low levels of AGD8 and AGD9 exhibited abnormal Golgi morphology, inhibition of protein trafficking, and arrest of plant growth and development. In RNA interference plants, Arf1 was poorly recruited to the Golgi apparatus. Conversely, high levels of AGD8 and AGD9 induced Arf1 accumulation at the Golgi and suppressed Golgi disruption and inhibition of vacuolar trafficking that was caused by overexpression of AGD7. Based on these results, we propose that the Glo3p-type ArfGAPs AGD8 and AGD9 recruit Arf1-GDP from the cytosol to the Golgi for Arf1-mediated protein trafficking, which is essential for plant development and growth.

  7. Recruitment of Arf1-GDP to Golgi by Glo3p-Type ArfGAPs Is Crucial for Golgi Maintenance and Plant Growth1[W][OA

    PubMed Central

    Min, Myung Ki; Jang, Mihue; Lee, Myounghui; Lee, Junho; Song, Kyungyoung; Lee, Yongjik; Choi, Kwan Yong; Robinson, David G.; Hwang, Inhwan


    ADP-ribosylation factor1 (Arf1), a member of the small GTP-binding proteins, plays a pivotal role in protein trafficking to multiple organelles. In its GDP-bound form, Arf1 is recruited from the cytosol to organelle membranes, where it functions in vesicle-mediated protein trafficking. However, the mechanism of Arf1-GDP recruitment remains unknown. Here, we provide evidence that two Glo3p-type Arf GTPase-activating proteins (ArfGAPs), ArfGAP domain8 (AGD8) and AGD9, are involved in the recruitment of Arf1-GDP to the Golgi apparatus in Arabidopsis (Arabidopsis thaliana). RNA interference plants expressing low levels of AGD8 and AGD9 exhibited abnormal Golgi morphology, inhibition of protein trafficking, and arrest of plant growth and development. In RNA interference plants, Arf1 was poorly recruited to the Golgi apparatus. Conversely, high levels of AGD8 and AGD9 induced Arf1 accumulation at the Golgi and suppressed Golgi disruption and inhibition of vacuolar trafficking that was caused by overexpression of AGD7. Based on these results, we propose that the Glo3p-type ArfGAPs AGD8 and AGD9 recruit Arf1-GDP from the cytosol to the Golgi for Arf1-mediated protein trafficking, which is essential for plant development and growth. PMID:23266962

  8. 9Å structure of the COPI coat reveals that the Arf1 GTPase occupies two contrasting molecular environments

    PubMed Central

    Dodonova, Svetlana O; Aderhold, Patrick; Kopp, Juergen; Ganeva, Iva; Röhling, Simone; Hagen, Wim J H; Sinning, Irmgard; Wieland, Felix; Briggs, John A G


    COPI coated vesicles mediate trafficking within the Golgi apparatus and between the Golgi and the endoplasmic reticulum. Assembly of a COPI coated vesicle is initiated by the small GTPase Arf1 that recruits the coatomer complex to the membrane, triggering polymerization and budding. The vesicle uncoats before fusion with a target membrane. Coat components are structurally conserved between COPI and clathrin/adaptor proteins. Using cryo-electron tomography and subtomogram averaging, we determined the structure of the COPI coat assembled on membranes in vitro at 9 Å resolution. We also obtained a 2.57 Å resolution crystal structure of βδ-COP. By combining these structures we built a molecular model of the coat. We additionally determined the coat structure in the presence of ArfGAP proteins that regulate coat dissociation. We found that Arf1 occupies contrasting molecular environments within the coat, leading us to hypothesize that some Arf1 molecules may regulate vesicle assembly while others regulate coat disassembly. DOI: PMID:28621666

  9. 9Å structure of the COPI coat reveals that the Arf1 GTPase occupies two contrasting molecular environments.


    Dodonova, Svetlana O; Aderhold, Patrick; Kopp, Juergen; Ganeva, Iva; Röhling, Simone; Hagen, Wim J H; Sinning, Irmgard; Wieland, Felix; Briggs, John A G


    COPI coated vesicles mediate trafficking within the Golgi apparatus and between the Golgi and the endoplasmic reticulum. Assembly of a COPI coated vesicle is initiated by the small GTPase Arf1 that recruits the coatomer complex to the membrane, triggering polymerization and budding. The vesicle uncoats before fusion with a target membrane. Coat components are structurally conserved between COPI and clathrin/adaptor proteins. Using cryo-electron tomography and subtomogram averaging, we determined the structure of the COPI coat assembled on membranes in vitro at 9 Å resolution. We also obtained a 2.57 Å resolution crystal structure of βδ-COP. By combining these structures we built a molecular model of the coat. We additionally determined the coat structure in the presence of ArfGAP proteins that regulate coat dissociation. We found that Arf1 occupies contrasting molecular environments within the coat, leading us to hypothesize that some Arf1 molecules may regulate vesicle assembly while others regulate coat disassembly.

  10. Ribose 2'-O methylation of the vesicular stomatitis virus mRNA cap precedes and facilitates subsequent guanine-N-7 methylation by the large polymerase protein.


    Rahmeh, Amal A; Li, Jianrong; Kranzusch, Philip J; Whelan, Sean P J


    During conventional mRNA cap formation, two separate methyltransferases sequentially modify the cap structure, first at the guanine-N-7 (G-N-7) position and subsequently at the ribose 2'-O position. For vesicular stomatitis virus (VSV), a prototype of the nonsegmented negative-strand RNA viruses, the two methylase activities share a binding site for the methyl donor S-adenosyl-l-methionine and are inhibited by individual amino acid substitutions within the C-terminal domain of the large (L) polymerase protein. This led to the suggestion that a single methylase domain functions for both 2'-O and G-N-7 methylations. Here we report a trans-methylation assay that recapitulates both ribose 2'-O and G-N-7 modifications by using purified recombinant L and in vitro-synthesized RNA. Using this assay, we demonstrate that VSV L typically modifies the 2'-O position of the cap prior to the G-N-7 position and that G-N-7 methylation is diminished by pre-2'-O methylation of the substrate RNA. Amino acid substitutions in the C terminus of L that prevent all cap methylation in recombinant VSV (rVSV) partially retain the ability to G-N-7 methylate a pre-2'-O-methylated RNA, therefore uncoupling the effect of substitutions in the C terminus of the L protein on the two methylations. In addition, we show that the 2'-O and G-N-7 methylase activities act specifically on RNA substrates that contain the conserved elements of a VSV mRNA start at the 5' terminus. This study provides new mechanistic insights into the mRNA cap methylase activities of VSV L, demonstrates that 2'-O methylation precedes and facilitates subsequent G-N-7 methylation, and reveals an RNA sequence and length requirement for the two methylase activities. We propose a model of regulation of the activity of the C terminus of L protein in 2'-O and G-N-7 methylation of the cap structure.

  11. Interaction of ARF-1.1 and neuronal calcium sensor-1 in the control of the temperature-dependency of locomotion in Caenorhabditis elegans

    PubMed Central

    Todd, Paul A. C.; McCue, Hannah V.; Haynes, Lee P.; Barclay, Jeff W.; Burgoyne, Robert D.


    Neuronal calcium sensor-1 (NCS-1) mediates changes in cellular function by regulating various target proteins. Many potential targets have been identified but the physiological significance of only a few has been established. Upon temperature elevation, Caenorhabditis elegans exhibits reversible paralysis. In the absence of NCS-1, worms show delayed onset and a shorter duration of paralysis. This phenotype can be rescued by re-expression of ncs-1 in AIY neurons. Mutants with defects in four potential NCS-1 targets (arf-1.1, pifk-1, trp-1 and trp-2) showed qualitatively similar phenotypes to ncs-1 null worms, although the effect of pifk-1 mutation on time to paralysis was considerably delayed. Inhibition of pifk-1 also resulted in a locomotion phenotype. Analysis of double mutants showed no additive effects between mutations in ncs-1 and trp-1 or trp-2. In contrast, double mutants of arf-1.1 and ncs-1 had an intermediate phenotype, consistent with NCS-1 and ARF-1.1 acting in the same pathway. Over-expression of arf-1.1 in the AIY neurons was sufficient to rescue partially the phenotype of both the arf-1.1 and the ncs-1 null worms. These findings suggest that ARF-1.1 interacts with NCS-1 in AIY neurons and potentially pifk-1 in the Ca2+ signaling pathway that leads to inhibited locomotion at an elevated temperature. PMID:27435667

  12. Mon2, a relative of large Arf exchange factors, recruits Dop1 to the Golgi apparatus.


    Gillingham, Alison K; Whyte, James R C; Panic, Bojana; Munro, Sean


    The protein Mon2 is distantly related to the guanine nucleotide exchange factors (GEFs) that activate Arf1 on Golgi membranes. However, unlike these "large" Arf GEFs, Mon2 lacks the Sec7 domain that catalyzes nucleotide exchange on Arf1. Here we report that yeast Mon2 shares extensive homology with the noncatalytic parts of both the BIG and Golgi brefeldin A resistance factor subfamilies of Arf GEFs and is located to the trans-Golgi. Moreover, we find that Mon2 forms a complex with Dop1, a large cytoplasmic protein conserved in evolution from humans to protozoa. Deletion of Mon2 results in mislocalization of Dop1 from the Golgi and defects in cycling between endosomes and the Golgi. However, unlike Mon2, Dop1 is essential for yeast viability. A conditional allele of Dop1 shows that loss of Dop1 activity not only affects endosome to Golgi transport but also causes a severe perturbation of the organization of the endoplasmic reticulum. Thus, it appears that Dop1 plays a widespread role in membrane organization, and Mon2 acts as a scaffold to recruit the Golgi-localized pool of Dop1.

  13. Structure of an ADP-ribosylation factor, ARF1, from Entamoeba histolytica bound to Mg(2+)-GDP.


    Serbzhinskiy, Dmitry A; Clifton, Matthew C; Sankaran, Banumathi; Staker, Bart L; Edwards, Thomas E; Myler, Peter J


    Entamoeba histolytica is the etiological agent of amebiasis, a diarrheal disease which causes amoebic liver abscesses and amoebic colitis. Approximately 50 million people are infected worldwide with E. histolytica. With only 10% of infected people developing symptomatic amebiasis, there are still an estimated 100,000 deaths each year. Because of the emergence of resistant strains of the parasite, it is necessary to find a treatment which would be a proper response to this challenge. ADP-ribosylation factor (ARF) is a member of the ARF family of GTP-binding proteins. These proteins are ubiquitous in eukaryotic cells; they generally associate with cell membranes and regulate vesicular traffic and intracellular signalling. The crystal structure of ARF1 from E. histolytica has been determined bound to magnesium and GDP at 1.8 Å resolution. Comparison with other structures of eukaryotic ARF proteins shows a highly conserved structure and supports the interswitch toggle mechanism of communicating the conformational state to partner proteins.

  14. Conserved guanine-guanine stacking in tetraplex and duplex DNA.


    Kypr, J; Fialová, M; Chládková, J; Tůmová, M; Vorlícková, M


    Using a series of suitably chosen oligonucleotides, we demonstrate that the DNA duplex of d(CCCCGGGG) provides an almost identical CD spectrum as the parallel-stranded tetraplex of d(GGGG). The CD spectra are very sensitive to base stacking in DNA so that the above observation indicates that guanine-guanine stacking is essentially the same within the duplex of d(CCCCGGGG) and the tetraplex of d(GGGG). A very similar CD spectrum is also provided by the A-form of d(CCCCGGGG) induced by trifluoroethanol. These results reveal that guanine-guanine stacking is a structural invariant conserved in various nucleic acid conformers. The structural invariance is likely to cohere with evolution of the genetic molecules and be important for fundamental functions, e.g. initiation of transcription.

  15. Structure of an ADP-ribosylation factor, ARF1, from Entamoeba histolytica bound to Mg2+–GDP

    PubMed Central

    Serbzhinskiy, Dmitry A.; Clifton, Matthew C.; Sankaran, Banumathi; Staker, Bart L.; Edwards, Thomas E.; Myler, Peter J.


    Entamoeba histolytica is the etiological agent of amebiasis, a diarrheal disease which causes amoebic liver abscesses and amoebic colitis. Approximately 50 million people are infected worldwide with E. histolytica. With only 10% of infected people developing symptomatic amebiasis, there are still an estimated 100 000 deaths each year. Because of the emergence of resistant strains of the parasite, it is necessary to find a treatment which would be a proper response to this challenge. ADP-ribosylation factor (ARF) is a member of the ARF family of GTP-binding proteins. These proteins are ubiquitous in eukaryotic cells; they generally associate with cell membranes and regulate vesicular traffic and intracellular signalling. The crystal structure of ARF1 from E. histolytica has been determined bound to magnesium and GDP at 1.8 Å resolution. Comparison with other structures of eukaryotic ARF proteins shows a highly conserved structure and supports the interswitch toggle mechanism of communicating the conformational state to partner proteins. PMID:25945714

  16. Leukaemia-associated Rho guanine nucleotide exchange factor (LARG) plays an agonist specific role in platelet function through RhoA activation.


    Zou, Siying; Teixeira, Alexandra M; Yin, Mingzhu; Xiang, Yaozu; Xavier-Ferrucio, Juliana; Zhang, Ping-Xia; Hwa, John; Min, Wang; Krause, Diane S


    Leukemia-Associated RhoGEF (LARG) is highly expressed in platelets, which are essential for maintaining normal haemostasis. We studied the function of LARG in murine and human megakaryocytes and platelets with Larg knockout (KO), shRNA-mediated knockdown and small molecule-mediated inhibition. We found that LARG is important for human, but not murine, megakaryocyte maturation. Larg KO mice exhibit macrothrombocytopenia, internal bleeding in the ovaries and prolonged bleeding times. KO platelets have impaired aggregation, α-granule release and integrin α2bβ3 activation in response to thrombin and thromboxane, but not to ADP. The same agonist-specific reductions in platelet aggregation occur in human platelets treated with a LARG inhibitor. Larg KO platelets have reduced RhoA activation and myosin light chain phosphorylation, suggesting that Larg plays an agonist-specific role in platelet signal transduction. Using two different in vivo assays, Larg KO mice are protected from in vivo thrombus formation. Together, these results establish that LARG regulates human megakaryocyte maturation, and is critical for platelet function in both humans and mice.

  17. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2012 CFR


    ... eye, in amounts consistent with good manufacturing practice. (d) Labeling. The color additive and any... ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine is... derived. (2) Color additive mixtures for drug use made with guanine may contain only those diluents listed...

  18. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2013 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The color additive guanine shall conform in identity and specifications to the requirements of § 73.1329 (a)(1) and (b). (2) Color additive mixtures of guanine may contain the following diluents: (i) For...

  19. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2014 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The color additive guanine shall conform in identity and specifications to the requirements of § 73.1329 (a)(1) and (b). (2) Color additive mixtures of guanine may contain the following diluents: (i) For...

  20. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2012 CFR


    ... ADDITIVES EXEMPT FROM CERTIFICATION Cosmetics § 73.2329 Guanine. (a) Identity and specifications. (1) The color additive guanine shall conform in identity and specifications to the requirements of § 73.1329 (a)(1) and (b). (2) Color additive mixtures of guanine may contain the following diluents: (i) For...

  1. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2013 CFR


    ... eye, in amounts consistent with good manufacturing practice. (d) Labeling. The color additive and any... ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine is... derived. (2) Color additive mixtures for drug use made with guanine may contain only those diluents listed...

  2. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2010 CFR


    ... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR... color additive guanine shall conform in identity and specifications to the requirements of § 73.1329 (a)(1) and (b). (2) Color additive mixtures of guanine may contain the following diluents: (i) For...

  3. 21 CFR 73.2329 - Guanine.

    Code of Federal Regulations, 2011 CFR


    ... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR... color additive guanine shall conform in identity and specifications to the requirements of § 73.1329 (a)(1) and (b). (2) Color additive mixtures of guanine may contain the following diluents: (i) For...

  4. 21 CFR 73.1329 - Guanine.

    Code of Federal Regulations, 2011 CFR


    ... eye, in amounts consistent with good manufacturing practice. (d) Labeling. The color additive and any... FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL LISTING OF COLOR ADDITIVES EXEMPT FROM CERTIFICATION Drugs § 73.1329 Guanine. (a) Identity. (1) The color additive guanine is...

  5. Bacterial Ammeline Metabolism via Guanine Deaminase ▿

    PubMed Central

    Seffernick, Jennifer L.; Dodge, Anthony G.; Sadowsky, Michael J.; Bumpus, John A.; Wackett, Lawrence P.


    Melamine toxicity in mammals has been attributed to the blockage of kidney tubules by insoluble complexes of melamine with cyanuric acid or uric acid. Bacteria metabolize melamine via three consecutive deamination reactions to generate cyanuric acid. The second deamination reaction, in which ammeline is the substrate, is common to many bacteria, but the genes and enzymes responsible have not been previously identified. Here, we combined bioinformatics and experimental data to identify guanine deaminase as the enzyme responsible for this biotransformation. The ammeline degradation phenotype was demonstrated in wild-type Escherichia coli and Pseudomonas strains, including E. coli K12 and Pseudomonas putida KT2440. Bioinformatics analysis of these and other genomes led to the hypothesis that the ammeline deaminating enzyme was guanine deaminase. An E. coli guanine deaminase deletion mutant was deficient in ammeline deaminase activity, supporting the role of guanine deaminase in this reaction. Two guanine deaminases from disparate sources (Bradyrhizobium japonicum USDA 110 and Homo sapiens) that had available X-ray structures were purified to homogeneity and shown to catalyze ammeline deamination at rates sufficient to support bacterial growth on ammeline as a sole nitrogen source. In silico models of guanine deaminase active sites showed that ammeline could bind to guanine deaminase in a similar orientation to guanine, with a favorable docking score. Other members of the amidohydrolase superfamily that are not guanine deaminases were assayed in vitro, and none had substantial ammeline deaminase activity. The present study indicated that widespread guanine deaminases have a promiscuous activity allowing them to catalyze a key reaction in the bacterial transformation of melamine to cyanuric acid and potentially contribute to the toxicity of melamine. PMID:20023034

  6. AlFx affects the formation of focal complexes by stabilizing the Arf-GAP ASAP1 in a complex with Arf1.


    Klein, Stéphanie; Franco, Michel; Chardin, Pierre; Luton, Frédéric


    Aluminum fluoride (AlFx) is known to activate directly the alpha subunit of G-proteins but not the homologous small GTP-binding proteins. However, AlFx can stabilize complexes formed between Ras, RhoA or Cdc42 and their corresponding GTPase-activating proteins (GAPs). Here, we demonstrate that Arf1GDP can be converted into an active conformation by AlFx to form a complex with the Arf-GAP ASAP1 in vitro and in vivo. Within this complex ASAP1, which GAP activity is inoperative, can still alter the recruitment of paxillin to the focal complexes, thus indicating that ASAP1 interferes with focal complexes independently of its GAP activity.

  7. ESR study of the guanine cation

    NASA Astrophysics Data System (ADS)

    Close, David M.; Sagstuen, Einar; Nelson, William H.


    It has been proposed that the primary direct radiation damage products in DNA are guanine cations and thymine anions. Experiments reported here characterize a guanine cation observed in a single crystal of guanine:HCl:H2O. ESR experiments were performed by x-irradiating and observing the crystals at 15 K. Spectral parameters for the cation include N3 and N10 hyperfine couplings, a C8-Hα hyperfine coupling, and two small exchangeable couplings presumably from the N10 protons. The computed spin densities of ρ(N3)=0.283, ρ(N10)=0.168, and ρ(C8)=0.182 agree nicely with those observed for the guanine cation in DNA. In the single crystal the native molecule is protonated at N7. It is proposed that once the native molecule is oxidized it rapidly deprotonates at N7 to form the cation observed.

  8. The brefeldin A-inhibited guanine nucleotide-exchange protein, BIG2, regulates the constitutive release of TNFR1 exosome-like vesicles.


    Islam, Aminul; Shen, Xiaoyan; Hiroi, Toyoko; Moss, Joel; Vaughan, Martha; Levine, Stewart J


    The type I, 55-kDa tumor necrosis factor receptor (TNFR1) is released from cells to the extracellular space where it can bind and modulate TNF bioactivity. Extracellular TNFR1 release occurs by two distinct pathways: the inducible proteolytic cleavage of TNFR1 ectodomains and the constitutive release of full-length TNFR1 in exosome-like vesicles. Regulation of both TNFR1 release pathways appears to involve the trafficking of cytoplasmic TNFR1 vesicles. Vesicular trafficking is controlled by ADP-ribosylation factors (ARFs), which are active in the GTP-bound state and inactive when bound to GDP. ARF activation is enhanced by guanine nucleotide-exchange factors that catalyze replacement of GDP by GTP. We investigated whether the brefeldin A (BFA)-inhibited guanine nucleotide-exchange proteins, BIG1 and/or BIG2, are required for TNFR1 release from human umbilical vein endothelial cells. Effects of specific RNA interference (RNAi) showed that BIG2, but not BIG1, regulated the release of TNFR1 exosome-like vesicles, whereas neither BIG2 nor BIG1 was required for the IL-1beta-induced proteolytic cleavage of TNFR1 ectodomains. BIG2 co-localized with TNFR1 in diffusely distributed cytoplasmic vesicles, and the association between BIG2 and TNFR1 was disrupted by BFA. Consistent with the preferential activation of class I ARFs by BIG2, ARF1 and ARF3 participated in the extracellular release of TNFR1 exosome-like vesicles in a nonredundant and additive fashion. We conclude that the association between BIG2 and TNFR1 selectively regulates the extracellular release of TNFR1 exosome-like vesicles from human vascular endothelial cells via an ARF1- and ARF3-dependent mechanism.

  9. Guanine base stacking in G-quadruplex nucleic acids

    PubMed Central

    Lech, Christopher Jacques; Heddi, Brahim; Phan, Anh Tuân


    G-quadruplexes constitute a class of nucleic acid structures defined by stacked guanine tetrads (or G-tetrads) with guanine bases from neighboring tetrads stacking with one another within the G-tetrad core. Individual G-quadruplexes can also stack with one another at their G-tetrad interface leading to higher-order structures as observed in telomeric repeat-containing DNA and RNA. In this study, we investigate how guanine base stacking influences the stability of G-quadruplexes and their stacked higher-order structures. A structural survey of the Protein Data Bank is conducted to characterize experimentally observed guanine base stacking geometries within the core of G-quadruplexes and at the interface between stacked G-quadruplex structures. We couple this survey with a systematic computational examination of stacked G-tetrad energy landscapes using quantum mechanical computations. Energy calculations of stacked G-tetrads reveal large energy differences of up to 12 kcal/mol between experimentally observed geometries at the interface of stacked G-quadruplexes. Energy landscapes are also computed using an AMBER molecular mechanics description of stacking energy and are shown to agree quite well with quantum mechanical calculated landscapes. Molecular dynamics simulations provide a structural explanation for the experimentally observed preference of parallel G-quadruplexes to stack in a 5′–5′ manner based on different accessible tetrad stacking modes at the stacking interfaces of 5′–5′ and 3′–3′ stacked G-quadruplexes. PMID:23268444

  10. [Molecular forms of guanine aminohydrolase (author's transl)].


    Martínez-Farnós, L; Gubert, S; Bozal, J


    Guanine aminohydrolase (E.C. has been purified 11-fold from the supernatant fraction of guinea-pig liver homogenates in 0.25 M sucrose (centrifuged at 50,000 X g) through thermic denaturation at 60 degrees C and ammonium sulphate fractionation (30--60% saturation). The enzyme in the homogenates and purified preparations exhibited two Km values. In both preparations four enzymatic electrophoretic bands have been detected. Purified guanine aminohydrolase is chromatographically resolved on DEAE-sephadex in three components whose active forms appeared separately on their pherograms. The enzymatic form eluted at lower ionic strength has the least anodic mobility, is inhibited by guanine (4 X 10(-5) M) and presents only one Km value (1.5 X 10(-5) M). The enzymatic form eluted at greater ionic strength exhibits the highest anodic mobility, is also inhibited by guanine (7 X 10(-5) M) and its Km value seems to be 6.3 X 10(-6) M. Molecular weight of enzymatics forms determined by Sephadex G-200 chromatography, is 120,000 +/- 5,000. The preceding results, correlated with the chromatographic homogeneity of guanine aminohydrolase, purified in Sephadex G-100, suggests that the four molecular forms of the native enzyme may be considered as isozymes.

  11. ARF1 and ARF6 regulate recycling of GRASP/Tamalin and the Rac1-GEF Dock180 during HGF-induced Rac1 activation.


    Koubek, Emily J; Santy, Lorraine C


    Hepatocyte growth factor (HGF) is a potent signaling factor that acts on epithelial cells, causing them to dissociate and scatter. This migration is coordinated by a number of small GTPases, such as ARF6 and Rac1. Active ARF6 is required for HGF-stimulated migration and intracellular levels of ARF6-GTP and Rac1-GTP increase following HGF treatment. During migration, cross talk between ARF6 and Rac1 occurs through formation of a multi-protein complex containing the ARF-GEF cytohesin-2, the scaffolding protein GRASP/Tamalin, and the Rac1-GEF Dock180. Previously, the role of ARF6 in this process was unclear. We have now found that ARF6 and ARF1 regulate trafficking of GRASP and Dock180 to the plasma membrane following HGF treatment. Trafficking of GRASP and Dock180 is impaired by blocking ARF6-mediated recycling pathways and is required for HGF-stimulated Rac1 activation. Finally, HGF treatment stimulates association of GRASP and Dock180. Inhibition of ARF6 trafficking pathways traps GRASP and Dock180 as a complex in the cell.

  12. ARF-GEP100, a guanine nucleotide-exchange protein for ADP-ribosylation factor 6

    PubMed Central

    Someya, Akimasa; Sata, Makoto; Takeda, Kazuyo; Pacheco-Rodriguez, Gustavo; Ferrans, Victor J.; Moss, Joel; Vaughan, Martha


    A human cDNA encoding an 841-aa guanine nucleotide-exchange protein (GEP) for ADP-ribosylation factors (ARFs), named ARF-GEP100, which contains a Sec7 domain, a pleckstrin homology (PH)-like domain, and an incomplete IQ-motif, was identified. On Northern blot analysis of human tissues, a ≈8-kb mRNA that hybridized with an ARF-GEP100 cDNA was abundant in peripheral blood leukocytes, brain, and spleen. ARF-GEP100 accelerated [35S]GTPγS binding to ARF1 (class I) and ARF5 (class II) 2- to 3-fold, and to ARF6 (class III) ca. 12-fold. The ARF-GEP100 Sec7 domain contains Asp543 and Met555, corresponding to residues associated with sensitivity to the inhibitory effect of the fungal metabolite brefeldin A (BFA) in yeast Sec7, but also Phe535 and Ala536, associated with BFA-insensitivity. The PH-like domain differs greatly from those of other ARF GEPs in regions involved in phospholipid binding. Consistent with its structure, ARF-GEP100 activity was not affected by BFA or phospholipids. After subcellular fractionation of cultured T98G human glioblastoma cells, ARF6 was almost entirely in the crude membrane fraction, whereas ARF-GEP100, a 100-kDa protein detected with antipeptide antibodies, was cytosolic. On immunofluorescence microscopy, both proteins had a punctate pattern of distribution throughout the cells, with apparent colocalization only in peripheral areas. The coarse punctate distribution of EEA-1 in regions nearer the nucleus appeared to coincide with that of ARF-GEP100 in those areas. No similar coincidence of ARF-GEP100 with AP-1, AP-2, catenin, LAMP-1, or 58K was observed. The new human BFA-insensitive GEP may function with ARF6 in specific endocytic processes. PMID:11226253

  13. Electronic properties of guanine traps in DNA

    NASA Astrophysics Data System (ADS)

    Apalkov, Vadim; Chakraborty, Tapash


    We report on our study of the electronic properties of guanine traps in the DNA surrounded by adenines. We have shown that for a typical range of DNA parameters, formation of the bound state of two holes at the same guanine trap is possible for the GGG and GGGG traps if the hole-hole interaction is weak, which can be achieved for the DNA in solutions. The origin of the two-hole bound state is the competition between the Coulomb repulsion and the phonon mediated attraction between the holes. For the hole-phonon coupling constant ≈1 two holes will be at the same trap if the on-site hole-hole repulsion energy is ≲0.9eV .

  14. Guanine tracts enhance sequence directed DNA bends.

    PubMed Central

    Milton, D L; Casper, M L; Wills, N M; Gesteland, R F


    Synthetic DNA fragments were constructed to determine the effect of G tracts, in conjunction with periodically spaced A tracts, on DNA bends. Relative length measurements showed that the G tracts spaced at the half helical turn enhanced the DNA bend. When the G tract was interrupted with a thymine or shortened to one or two guanines, the relative lengths decreased. If the G tract was replaced with either an A tract or a T tract, the bend was cancelled. Replacement with a C tract decreased the relative length to that of a thymine interruption suggesting that bend enhancement due to G tracts requires A tracts on the same strand. PMID:2315040

  15. Calculation of the stabilization energies of oxidatively damaged guanine base pairs with guanine.


    Suzuki, Masayo; Kino, Katsuhito; Morikawa, Masayuki; Kobayashi, Takanobu; Komori, Rie; Miyazawa, Hiroshi


    DNA is constantly exposed to endogenous and exogenous oxidative stresses. Damaged DNA can cause mutations, which may increase the risk of developing cancer and other diseases. G:C-C:G transversions are caused by various oxidative stresses. 2,2,4-Triamino-5(2H)-oxazolone (Oz), guanidinohydantoin (Gh)/iminoallantoin (Ia) and spiro-imino-dihydantoin (Sp) are known products of oxidative guanine damage. These damaged bases can base pair with guanine and cause G:C-C:G transversions. In this study, the stabilization energies of these bases paired with guanine were calculated in vacuo and in water. The calculated stabilization energies of the Ia:G base pairs were similar to that of the native C:G base pair, and both bases pairs have three hydrogen bonds. By contrast, the calculated stabilization energies of Gh:G, which form two hydrogen bonds, were lower than the Ia:G base pairs, suggesting that the stabilization energy depends on the number of hydrogen bonds. In addition, the Sp:G base pairs were less stable than the Ia:G base pairs. Furthermore, calculations showed that the Oz:G base pairs were less stable than the Ia:G, Gh:G and Sp:G base pairs, even though experimental results showed that incorporation of guanine opposite Oz is more efficient than that opposite Gh/Ia and Sp.

  16. The post-SCF quantum chemistry characteristics of the guanine-guanine stacking B-DNA.


    Cysewski, Piotr; Czyznikowska, Zaneta; Zaleśny, Robert; Czeleń, Przemysław


    The stacking interactions of two guanine molecules were analyzed detail at the DF-MP2/aug-cc-pVDZ level of theory for conformations appearing B-DNA. The dependence of intermolecular interaction energies on the pairs of step parameters (shift, slide, rise, tilt, roll and twist) was determined. The values of these parameters were chosen to cover the whole range of variability appearing crystallographic data. The scanning procedure was performed by subsequent changes of two variables with fixed values of the remaining base-pair and base-step BDNA parameters. Additionally, the hybrid variational-perturbational scheme was applied for the decomposition of the interaction energy into physically meaningful contributions at the MP2 level of theory. The significant impact of the mutual orientations of guanine bases was observed not only on the total intermolecular energy but also on its components. The second-order dispersion interaction is the most significant contribution to stabilization energy and is about eight times larger compared to the first-order electrostatic term with relaxation effects, which is also of stabilizing character. The dispersion interactions may vary up to 9.6 kcal mol(-1) between different guanine-guanine conformations. The parameters defining the mutual orientation of stacked guanine molecules have a different impact on the stabilization of the investigated complex. The following base-step parameters have only a minor impact on the stabilization energies: shift-slide, shift-roll, shift-twist, slide-twist and roll-twist. On the other hand, parameters such as rise and tilt significantly influence intermolecular interactions, i.e. strong attraction occurs only for a limited range of their values.

  17. Chlorophyll fluorescence control in microalgae by biogenic guanine crystals

    NASA Astrophysics Data System (ADS)

    Miyashita, Yuito; Iwasaka, Masakazu; Endo, Hirotoshi


    Magnetic fields were applied to water suspensions of guanine crystals to induce changes in light scattering as a possible way to control photosynthesis in microalgae. The effect of guanine microcrystals with and without an applied magnetic field on the photosynthesis of a unicellular microalgae (plant), Pleurochrysis. carterae (P. carterae), was investigated by examining chlorophyll fluorescence. The fluorescence intensity at 600-700 nm of the photosynthetic cells increased remarkably when the concentration ratio of guanine microcrystals was 10 times larger than that of the cells. This increase in fluorescence occurred reproducibly and was proportional to the amount of guanine microcrystals added. It is speculated that the guanine microcrystals enhance the intensity of the excitation light on the cells by concentrating the excitation light or prolonging the time of light exposure to the cells. Moreover, applying a 500-mT magnetic field allowed modulation of the fluorescence intensity, depending on the direction of the fluorescence light.

  18. Identification, expression, and characterization of Escherichia coli guanine deaminase.


    Maynes, J T; Yuan, R G; Snyder, F F


    Using the human cDNA sequence corresponding to guanine deaminase, the Escherichia coli genome was scanned using the Basic Local Alignment Search Tool (BLAST), and a corresponding 439-residue open reading frame of unknown function was identified as having 36% identity to the human protein. The putative gene was amplified, subcloned into the pMAL-c2 vector, expressed, purified, and characterized enzymatically. The 50.2-kDa protein catalyzed the conversion of guanine to xanthine, having a K(m) of 15 microM with guanine and a k(cat) of 3.2 s(-1). The bacterial enzyme shares a nine-residue heavy metal binding site with human guanine deaminase, PG[FL]VDTHIH, and was found to contain approximately 1 mol of zinc per mol of subunit of protein. The E. coli guanine deaminase locus is 3' from an open reading frame which shows homology to a bacterial purine base permease.

  19. Identification, Expression, and Characterization of Escherichia coli Guanine Deaminase

    PubMed Central

    Maynes, Jason T.; Yuan, Richard G.; Snyder, Floyd F.


    Using the human cDNA sequence corresponding to guanine deaminase, the Escherichia coli genome was scanned using the Basic Local Alignment Search Tool (BLAST), and a corresponding 439-residue open reading frame of unknown function was identified as having 36% identity to the human protein. The putative gene was amplified, subcloned into the pMAL-c2 vector, expressed, purified, and characterized enzymatically. The 50.2-kDa protein catalyzed the conversion of guanine to xanthine, having a Km of 15 μM with guanine and a kcat of 3.2 s−1. The bacterial enzyme shares a nine-residue heavy metal binding site with human guanine deaminase, PG[FL]VDTHIH, and was found to contain approximately 1 mol of zinc per mol of subunit of protein. The E. coli guanine deaminase locus is 3′ from an open reading frame which shows homology to a bacterial purine base permease. PMID:10913105

  20. Experimental observation of guanine tautomers with VUV photoionization

    SciTech Connect

    Zhou, Jia; Kostko, Oleg; Nicolas, Christophe; Tang, Xiaonan; Belau, Leonid; de Vries, Mattanjah S.; Ahmed, Musahid


    Two methods of preparing guanine in the gas phase, thermal vaporization and laser desorption, have been investigated. The guanine generated by each method is entrained in a molecular beam, single photon ionized with tunable VUV synchrotron radiation, and analyzed using reflectron mass spectrometry. The recorded photoionization efficiency (PIE) curves show a dramatic difference for experiments performed via thermal vaporization compared to laser desorption. The calculated vertical and adiabatic ionization energies for the eight lowest lying tautomers of guanine suggest the experimental observations arise from different tautomers being populated in the two different experimental methods.

  1. Guanine oxidation: one- and two-electron reactions.


    Pratviel, Geneviève; Meunier, Bernard


    Guanine bases in DNA are the most sensitive to oxidation. A lot of effort has been devoted to the understanding of the chemical modifications of guanine under different oxidizing conditions, the final goal being to know which lesions in DNA can be expected in vivo and their biological consequences. This article analyses the mechanisms underlying guanine oxidation by the comparison between one- and two-electron transfer processes. The different oxidants used in vitro give complementary answers. This overview presents a choice of some key intermediates and the predictive description of G-oxidation products that can be generated from these intermediates depending on the reaction conditions.

  2. Guanine- Formation During the Thermal Polymerization of Amino Acids

    NASA Technical Reports Server (NTRS)

    Mc Caw, B. K.; Munoz, E. F.; Ponnamperuma, C.; Young, R. S.


    The action of heat on a mixture of amino acids was studied as a possible abiological pathway for the synthesis of purines and pyrimidines. Guanine was detected. This result is significant in the context of chemical evolution.

  3. Unapparent hypoxanthine-guanine phosphoribosyltransferase deficiency.


    Torres, R J; Puente, S; Menendez, A; Fernandez-Garcia, N


    Complete deficiency of hypoxanthine-guanine phosphoribosyltransferase (HPRT) activity causes Lesch Nyhan disease (LND), characterized by hyperuricemia, severe action dystonia, choreoathetosis, ballismus, cognitive and attention deficit and self-injurious behavior. Partial HPRT deficiency is present in patients with Lesch-Nyhan variant (LNV), who present with HPRT-related gout and a variable degree of neurological involvement. The diagnosis of HPRT deficiency relies on clinical, biochemical, enzymatic and molecular data. Patients with HPRT deficiency present low or undetectable HPRT activity in hemolysates, with increased adenine phosphoribosyltransferase (APRT) activity. We present a 9-year-old boy who experienced an episode of macroscopic hematuria with dysuria and left flank pain. He presented hyperuricemia and hyperuricosuria. HPRT and APRT activities were both normal in hemolysate; however, HPRT activity assayed in intact erythrocytes was 50% of control levels. A new missense point mutation c.424 A>G (T142A) was found in the HPRT1 gene. The apparent Michaelis constant (Km) for 5-phosphoribosyl-pyrophosphate assayed in patient hemolysate was 20-fold of control levels. In conclusion, we report a patient with HPRT deficiency who presented with both normal HPRT and APRT activity in hemolysate, in which the enzyme activity determined in intact erythrocytes was of diagnostic utility. Copyright © 2017 Elsevier B.V. All rights reserved.

  4. The Formation and Biological Significance of N7-Guanine Adducts

    PubMed Central

    Boysen, Gunnar; Pachkowski, Brian F.; Nakamura, Jun; Swenberg, James A


    DNA alkylation or adduct formation occurs at nucleophilic sites in DNA, mainly the N7-position of guanine. Ever since identification of the first N7-guanine adduct, several hundred studies on DNA adducts have been reported. Major issues addressed include the relationships between N7-guanine adducts and exposure, mutagenesis, and other biological endpoints. It became quickly apparent that N7-guanine adducts are frequently formed, but may have minimal biological relevance, since they are chemically unstable and do not participate in Watson Crick base pairing. However, N7-guanine adducts have been shown to be excellent biomarkers for internal exposure to direct acting and metabolically activated carcinogens. Questions arise, however, regarding the biological significance for N7-guanine adducts that are readily formed, do not persist, and are not likely to be mutagenic. Thus, we set out to review the current literature to evaluate their formation and the mechanistic evidence for the involvement of N7-guanine adducts in mutagenesis or other biological processes. It was concluded that there is insufficient evidence that N7-guanine adducts can be used beyond confirmation of exposure to the target tissue and demonstration of the molecular dose. There is little to no evidence that N7-guanine adducts or their depurination product, apurinic sites, are the cause of mutations in cells and tissues, since increases in AP sites have not been shown unless toxicity is extant. However, more research is needed to define the extent of chemical depurination versus removal by DNA repair proteins. Interestingly, N7-guanine adducts are clearly present as endogenous background adducts and the endogenous background amounts appear to increase with age. Furthermore, the N7-guanine adducts have been shown to convert to ring opened lesions (FAPy), which are much more persistent and have higher mutagenic potency. Studies in humans are limited in sample size and differences between controls and

  5. [Triplet expansion cytosine-guanine-guanine: Three cases of OMIM syndrome in the same family].


    González-Pérez, Jesús; Izquierdo-Álvarez, Silvia; Fuertes-Rodrigo, Cristina; Monge-Galindo, Lorena; Peña-Segura, José Luis; López-Pisón, Francisco Javier


    The dynamic increase in the number of triplet repeats of cytosine-guanine-guanine (CGG) in the FMR1 gene mutation is responsible for three OMIM syndromes with a distinct clinical phenotype: Fragile X syndrome (FXS) and two pathologies in adult carriers of the premutation (55-200 CGG repeats): Primary ovarian insufficiency (FXPOI) and tremor-ataxia syndrome (FXTAS) associated with FXS. CGG mutation dynamics of the FMR1 gene were studied in DNA samples from peripheral blood from the index case and other relatives of first, second and third degree by TP-PCR, and the percentage methylation. Diagnosis of FXS was confirmed in three patients (21.4%), eight patients (57.1%) were confirmed in the premutation range transmitters, one male patient with full mutation/permutation mosaicism (7.1%) and two patients (14.3%) with normal study. Of the eight permutated patients, three had FXPOI and one male patient had FXTAS. Our study suggests the importance of making an early diagnosis of SXF in order to carry out a family study and genetic counselling, which allow the identification of new cases or premutated patients with FMR1 gene- associated syndromes (FXTAS, FXPOI). Copyright © 2015 Elsevier España, S.L.U. All rights reserved.

  6. Studies on guanine deaminase and its inhibitors in rat tissue

    PubMed Central

    Kumar, S.; Josan, V.; Sanger, K. C. S.; Tewari, K. K.; Krishnan, P. S.


    1. In kidney, but not in rat whole brain and liver, guanine-deaminase activity was localized almost exclusively in the 15000g supernatant fraction of iso-osmotic sucrose homogenates. However, as in brain and liver, the enzymic activity recovered in the supernatant was higher than that in the whole homogenate. The particulate fractions of kidney, especially the heavy mitochondria, brought about powerful inhibition of the supernatant guanine-deaminase activity. 2. In spleen, as in kidney, guanine-deaminase activity was localized in the 15000g supernatant fraction of iso-osmotic sucrose homogenates. However, the particulate fractions did not inhibit the activity of the supernatant. 3. Guanine-deaminase activity in rat brain was absent from the cerebellum and present only in the cerebral hemispheres. The inhibitor of guanine deaminase was located exclusively in the cerebellum, where it was associated with the particles sedimenting at 5000g from sucrose homogenates. 4. Homogenates of cerebral hemispheres, the separated cortex or the remaining portion of the hemispheres had significantly higher guanine-deaminase activity than homogenates of whole brain. The enzymic activity of the subcellular particulate fractions was nearly the same. 5. Guanine deaminase was purified from the 15000g supernatant of sucrose homogenates of whole brain. The enzyme separated as two distinct fractions, A and B, on DEAE-cellulose columns. 6. The guanine-deaminase activity of the light-mitochondrial fraction of whole brain was fully exposed and solubilized by treatment with Triton X-100, and partially purified. 7. Tested in the form of crude preparations, the inhibitor from kidney did not act on the brain and liver supernatant enzymes and the inhibitor from cerebellum did not act on kidney enzyme, but the inhibitor from liver acted on both brain and kidney enzyme. 8. The inhibitor of guanine deaminase was purified from the heavy mitochondria of whole brain and liver and the 5000g residue of

  7. Characterization of Oxidative Guanine Damage and Repair in Mammalian Telomeres

    PubMed Central

    Wang, Zhilong; Rhee, David B.; Lu, Jian; Bohr, Christina T.; Zhou, Fang; Vallabhaneni, Haritha; de Souza-Pinto, Nadja C.; Liu, Yie


    8-oxo-7,8-dihydroguanine (8-oxoG) and 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapyG) are among the most common oxidative DNA lesions and are substrates for 8-oxoguanine DNA glycosylase (OGG1)–initiated DNA base excision repair (BER). Mammalian telomeres consist of triple guanine repeats and are subject to oxidative guanine damage. Here, we investigated the impact of oxidative guanine damage and its repair by OGG1 on telomere integrity in mice. The mouse cells were analyzed for telomere integrity by telomere quantitative fluorescence in situ hybridization (telomere–FISH), by chromosome orientation–FISH (CO–FISH), and by indirect immunofluorescence in combination with telomere–FISH and for oxidative base lesions by Fpg-incision/Southern blot assay. In comparison to the wild type, telomere lengthening was observed in Ogg1 null (Ogg1−/−) mouse tissues and primary embryonic fibroblasts (MEFs) cultivated in hypoxia condition (3% oxygen), whereas telomere shortening was detected in Ogg1−/− mouse hematopoietic cells and primary MEFs cultivated in normoxia condition (20% oxygen) or in the presence of an oxidant. In addition, telomere length abnormalities were accompanied by altered telomere sister chromatid exchanges, increased telomere single- and double-strand breaks, and preferential telomere lagging- or G-strand losses in Ogg1−/− mouse cells. Oxidative guanine lesions were increased in telomeres in Ogg1−/− mice with aging and primary MEFs cultivated in 20% oxygen. Furthermore, oxidative guanine lesions persisted at high level in Ogg1−/− MEFs after acute exposure to hydrogen peroxide, while they rapidly returned to basal level in wild-type MEFs. These findings indicate that oxidative guanine damage can arise in telomeres where it affects length homeostasis, recombination, DNA replication, and DNA breakage repair. Our studies demonstrate that BER pathway is required in repairing oxidative guanine damage in telomeres and maintaining

  8. ESI-MS Characterization of a Novel Pyrrole-Inosine Nucleoside that Interacts with Guanine Bases

    PubMed Central

    Pierce, Sarah E.; Sherman, Courtney L.; Jayawickramarajah, Janarthanan; Lawrence, Candace M.; Sessler, Jonathan L.; Brodbelt, Jennifer S.


    Based on binding studies undertaken by electrospray ionization-mass spectrometry, a synthetic pyrrole-inosine nucleoside, 1, capable of forming an extended three-point Hoogsteen-type hydrogen-bonding interaction with guanine, is shown to form specific complexes with two different quadruplex DNA structures [dTG4T]4 and d(T2G4)4 as well as guanine rich duplex DNA. The binding interactions of two other analogs were evaluated in order to unravel the structural features that contribute to specific DNA recognition. The importance of the Hoogsteen interactions was confirmed through the absence of specific binding when the pyrrole NH hydrogen-bonding site was blocked or removed. While 2, with a large blocking group, was not found to interact with virtually any form of DNA, 3, with the pyrrole functionality missing, was found to interact non-specifically with several types of DNA. The specific binding of 1 to guanine rich DNA emphasizes the necessity of careful ligand design for specific sequence recognition. PMID:18790136

  9. Highly sensitive and synergistic detection of guanine and adenine based on poly(xanthurenic acid)-reduced graphene oxide interface.


    Yang, Tao; Kong, Qianqian; Li, Qianhe; Wang, Xinxing; Chen, Lihua; Jiao, Kui


    In order to achieve the large direct electrochemical signals of guanine and adenine, an urgent request to explore novel electrode materials and interfaces has been put forward. In this paper, a poly(xanthurenic acid, Xa)-reduced graphene oxide (PXa-ERGNO) interface, which has rich negatively charged active sites and accelerated electron transfer ability, was fabricated for monitoring the positively charged guanine and adenine. Scanning electron microscopy, Fourier transform infrared spectroscopy, Raman spectra, X-ray photoelectron spectroscopy, cyclic voltammetry, electrochemical impedance spectroscopy, and differential pulse voltammetry were adopted to characterize the morphology and prove the electrochemical properties of the prepared interface. The PXa-ERGNO interface with rich negative charge and large electrode surface area was an excellent sensing platform to prompt the adsorption of the positively charged guanine and adenine via strong π-π* interaction or electrostatic adsorption. The PXa-ERGNO interface exhibited prominent synergistic effect and good electrocatalytic activity for sensitive determination of guanine and adenine compared with sole PXa or ERGNO modified electrode. The sensing platform we built could be further applied in the adsorption and detection of other positively charged biomolecules or aromatic molecules.

  10. A 2-iminohydantoin from the oxidation of guanine.


    Ye, Wenjie; Sangaiah, R; Degen, Diana E; Gold, Avram; Jayaraj, K; Koshlap, Karl M; Boysen, Gunnar; Williams, Jason; Tomer, Kenneth B; Ball, Louise M


    The nucleobase guanine was oxidized with dimethyldioxirane (DMDO) to explore the role of epoxidizing agents in oxidative DNA damage. Treatment of guanine with 10% molar excess DMDO in aqueous solution at 0 degrees C and pH 7.5 followed by workup under mild conditions gave 5-carboxamido-5-formamido-2-iminohydantoin (1) as the sole isolable product in 71% yield. The structure of 1 was established on the basis of mass spectrometry and NMR studies on 1 and its isotopomers generated by the oxidation of [4-(13)C] and [7-(15)N]guanine, which yield [5-(13)C]1 and [7-(15)N]1. The distribution of 13C and 15N labels in the isotopomeric products supports initial epoxidation of the C4-C5 bond of guanine followed by a 1,2-acyl migration of guanine C6. Compound 1 is suggested as a possible primary DNA lesion from putative epoxidizing agents, including hydroperoxides present during biological processes such as lipid peroxidation.

  11. N-Sulfomethylation of guanine, adenine and cytosine with formaldehyde-bisulfite. A selective modification of guanine in DNA.


    Hayatsu, H; Yamashita, Y; Yui, S; Yamagata, Y; Tomita, K; Negishi, K


    When guanine-, adenine- and cytosine-nucleosides and nucleotides were treated with formaldehyde and then with bisulfite, stable N-sulfomethyl compounds were formed. N2-Sulfomethylguanine, N6-sulfomethyladenine, N4-sulfomthylcytosine and N6-sulfomethyl-9-beta-D-arabinofuranosyladenine were isolated as crystals and characterized. A guanine-specific sulfomethylation was brought about by treatment and denatured single-stranded DNA with formaldehyde and then with bisulfite at pH 7 and 4 degrees C. Since native double-stranded DNA was not modified by this treatment, this new method of modification is expected to be useful as a conformational probe for polynucleotides.

  12. N-Sulfomethylation of guanine, adenine and cytosine with formaldehyde-bisulfite. A selective modification of guanine in DNA.

    PubMed Central

    Hayatsu, H; Yamashita, Y; Yui, S; Yamagata, Y; Tomita, K; Negishi, K


    When guanine-, adenine- and cytosine-nucleosides and nucleotides were treated with formaldehyde and then with bisulfite, stable N-sulfomethyl compounds were formed. N2-Sulfomethylguanine, N6-sulfomethyladenine, N4-sulfomthylcytosine and N6-sulfomethyl-9-beta-D-arabinofuranosyladenine were isolated as crystals and characterized. A guanine-specific sulfomethylation was brought about by treatment and denatured single-stranded DNA with formaldehyde and then with bisulfite at pH 7 and 4 degrees C. Since native double-stranded DNA was not modified by this treatment, this new method of modification is expected to be useful as a conformational probe for polynucleotides. PMID:7177848

  13. Global deformation facilitates flipping of damaged 8-oxo-guanine and guanine in DNA

    PubMed Central

    La Rosa, Giuseppe; Zacharias, Martin


    Oxidation of guanine (Gua) to form 7,8-dihydro-8-oxoguanine (8oxoG) is a frequent mutagenic DNA lesion. DNA repair glycosylases such as the bacterial MutM can effciently recognize and eliminate the 8oxoG damage by base excision. The base excision requires a 8oxoG looping out (flipping) from an intrahelical base paired to an extrahelical state where the damaged base is in the enzyme active site. It is still unclear how the damage is identified and flipped from an energetically stable stacked and paired state without any external energy source. Free energy simulations have been employed to study the flipping process for globally deformed DNA conformational states. DNA deformations were generated by systematically untwisting the DNA to mimic its conformation in repair enzyme encounter complex. The simulations indicate that global DNA untwisting deformation toward the enzyme bound form alone (without protein) significantly reduces the penalty for damage flipping to about half of the penalty observed in regular DNA. The finding offers a mechanistic explanation how binding free energy that is transformed to binding induced DNA deformation facilitates flipping and helps to rapidly detect a damaged base. It is likely of general relevance since repair enzyme binding frequently results in significant deformation of the target DNA. PMID:27651459

  14. Camptothecins guanine interactions: mechanism of charge transfer reaction upon photoactivation

    NASA Astrophysics Data System (ADS)

    Steenkeste, K.; Guiot, E.; Tfibel, F.; Pernot, P.; Mérola, F.; Georges, P.; Fontaine-Aupart, M. P.


    The potent activity exhibited by the antitumoral camptothecin (CPT) and its analog irinotecan (CPT-11) is known to be related to a close contact between the drug and the nucleic acid base guanine. This specificity of interaction between these two chromophores was examined by following changes in the photophysical properties of the drug using steady-state as well as time-resolved absorption and fluorescence methods. The observed effects on absorption, fluorescence emission and singlet excited state lifetimes give evidence for the occurrence of a stacking complex formation restricted to the quinoline part of CPT or CPT-11 and the guanine base but also with the adenine base. The triplet excited state properties of the drugs have been also characterized in absence and in presence of guanosine monophosphate and reveal the occurrence of an electron transfer from the guanine base to the drug. Support for this conclusion was obtained from the studies of a set of biological targets of various oxido-reduction potentials, adenosine monophosphate, cytidine, cytosine, tryptophan, tyrosine and phenylalanine. This finding gives an interpretation of the CPT-induced guanine photolesions previously reported in the literature. These data taken together are discussed in connection with the drug activity. The stacking complex CPT/guanine is necessary but not sufficient to explain the role of the chirality and of the lactone structure in the function of the drug. A stereospecific interaction with the enzyme topoisomerase I seems necessary to stabilize the stacking complex. The first experiments using time-resolved fluorescence by two-photon excitation confirms that CPT does not bind to the isolated enzyme.

  15. Formation of Two Novel Estrogen Guanine Adducts and HPLC/MS Detection of 4-Hydroxyestradiol-N7-Guanine in Human Urine

    PubMed Central

    Bransfield, Leslie A.; Rennie, Alissa; Visvanathan, Kala; Odwin, Shelly-Ann; Kensler, Thomas W.; Yager, James D.; Friesen, Marlin D.; Groopman, John D.


    Estrogen-DNA adducts are potential biomarkers for assessing the risk of developing of a number of hormonally-modified cancers, including breast cancer. Formation of the 4-hydroxyestradiol-N7-guanine (4-OHE2-N7-guanine) adduct from reaction of estradiol-3,4-quinone with DNA and its detection in vivo has been established. With the ultimate goal of exploring estrogen-DNA adducts as biomarkers in experimental and human investigations, the 4-OHE2-N7-guanine was synthesized and preliminary studies demonstrated that this adduct was detectable in all ten female human urine samples examined. Therefore, more extensive investigations were conducted to study this compound’s chemical-physical properties and to examine the stability of 4-OHE2-N7-guanine under a range of pH conditions that might influence biomarker measurement. Under neutral to alkaline conditions 4-OHE2-N7-guanine could completely oxidize to an 8-oxo-guanine derivative. This derivative was isolated by HPLC and mass spectrometry confirmed the oxidized compound by demonstrating the formation of an m/z 168 fragment, generated by oxygen addition to guanine. Further, investigation of the 4-OHE2-N7-2’-deoxyguanosine nucleoside adduct showed that under alkaline conditions a formamidopyrimidine analogue was produced. The formamidopyrimidine derivative forms from ring opening of the guanine imidazole ring following C-8 oxidation in the N7,N9 disubstituted guanine Formation of both of these oxidized estrogen-guanine DNA adducts has precedent with other chemical agents that covalently bind to the N7 position in guanine. Therefore, the development and application of methods to measure estrogen-guanine adducts will need to also consider these new adducts and the biological implications of these compounds will need to be explored to determine their contribution to estrogen toxicology. PMID:18582124

  16. Family-wide Analysis of the Inhibition of Arf Guanine Nucleotide Exchange Factors with Small Molecules: Evidence of Unique Inhibitory Profiles.


    Benabdi, Sarah; Peurois, François; Nawrotek, Agata; Chikireddy, Jahnavi; Cañeque, Tatiana; Yamori, Takao; Shiina, Isamu; Ohashi, Yoshimi; Dan, Shingo; Rodriguez, Raphaël; Cherfils, Jacqueline; Zeghouf, Mahel


    Arf GTPases and their guanine nucleotide exchange factors (ArfGEFs) are major regulators of membrane traffic and organelle structure in cells. They are associated with a variety of diseases and are thus attractive therapeutic targets for inhibition by small molecules. Several inhibitors of unrelated chemical structures have been discovered, which have shown their potential in dissecting molecular pathways and blocking disease-related functions. However, their specificity across the ArfGEF family has remained elusive. Importantly, inhibitory responses in the context of membranes, which are critical determinants of Arf and ArfGEF cellular functions, have not been investigated. Here, we compare the efficiency and specificity of four structurally distinct ArfGEF inhibitors, Brefeldin A, SecinH3, M-COPA, and NAV-2729, toward six ArfGEFs (human ARNO, EFA6, BIG1, and BRAG2 and Legionella and Rickettsia RalF). Inhibition was assessed by fluorescence kinetics using pure proteins, and its modulation by membranes was determined with lipidated GTPases in the presence of liposomes. Our analysis shows that despite the intra-ArfGEF family resemblance, each inhibitor has a specific inhibitory profile. Notably, M-COPA is a potent pan-ArfGEF inhibitor, and NAV-2729 inhibits all GEFs, the strongest effects being against BRAG2 and Arf1. Furthermore, the presence of the membrane-binding domain in Legionella RalF reveals a strong inhibitory effect of BFA that is not measured on its GEF domain alone. This study demonstrates the value of family-wide assays with incorporation of membranes, and it should enable accurate dissection of Arf pathways by these inhibitors to best guide their use and development as therapeutic agents.

  17. The guanine nucleotide exchange factor Tiam1: a Janus-faced molecule in cellular signaling.


    Boissier, P; Huynh-Do, U


    The Rho family of GTPases consists of several small proteins that have been described as molecular switches, playing important roles in a wide variety of fundamental cellular processes and in human diseases such as cancer. These proteins, active in the GTP conformation and inactive in the GDP form, are in turn regulated by guanine nucleotide exchange factors (GEFs), guanine nucleotide activating proteins (GAPs) and guanine dissociation inhibitors (GDIs). Two decades ago, Tiam1 (T-lymphoma invasion and metastasis) was identified as a GEF specific for Rac1 activation, but also for Cdc42 and in a lesser extent RhoA. Acting principally upstream of Rac1, Tiam1 is mainly involved in the regulation of Rac1 mediated signaling pathways including cytoskeletal activities, cell polarity, endocytosis and membrane trafficking, cell migration, adhesion and invasion, cell growth and survival, metastasis and carcinogenesis. However, given the large number of protein interaction domains found in its structure, it is possible that Tiam1 affects cellular processes in another way than through its GEF activity by interactions with other signaling proteins. Due to its functional diversity, Tiam1 is involved in multiple steps of tumorigenesis. As its name suggests, Tiam1 has been shown to increase T-cell lymphoma invasion and metastasis. It also promotes migration of fibroblasts, neuronal and cancer cells. On the contrary, Tiam1-induced cell adhesion has also been described, as opposed to cell migration. Moreover, studies indicate that Tiam1 is involved in both anti-apoptotic and pro-apoptotic mechanisms. While increasing evidence has demonstrated Tiam1's contribution to tumorigenesis and metastasis, others suggest that Tiam1 could have anti-cancer properties. In the present review, we discuss the current knowledge about the controversial roles of Tiam1 in cellular signaling. In particular, we will focus on Tiam1's regulation, its biological functions and implication in cancer. Copyright

  18. Cloning and expression of the hypoxanthine-guanine phosphoribosyltransferase gene from Trypanosoma brucei.

    PubMed Central

    Allen, T E; Ullman, B


    The hypoxanthine-guanine phosphoribosyltransferase (HGPRT) enzyme of Trypanosoma brucei and related parasites provides a rational target for the treatment of African sleeping sickness and several other parasitic diseases. To characterize the T. brucei HGPRT enzyme in detail, the T. brucei hgprt was isolated within a 4.2 kb SalI-KpnI genomic insert and sequenced. Nucleotide sequence analysis revealed an open reading frame of 630 bp that encoded a protein of 210 amino acids with a M(r) = 23.4 kd. After gap alignment, the T. brucei HGPRT exhibited 21-23% amino acid sequence identity, mostly in three clustered regions, with the HGPRTs from human, S. mansoni, and P falciparum, indicating that the trypanosome enzyme was the most divergent of the group. Surprisingly, the T. brucei HGPRT was more homologous to the hypoxanthine phosphoribosyltransferase (HPRT) from the prokaryote V. harveyi than to the eukaryotic HGPRTs. Northern blot analysis revealed two trypanosome transcripts of 1.4 and 1.9 kb, each expressed to equivalent degrees in insect vector and mammalian forms of the parasite. The T. brucei hgprt was inserted into an expression plasmid and transformed into S phi 606 E. coli that are deficient in both HPRT and xanthine-guanine phosphoribosyltransferase activities. Soluble, enzymatically active recombinant T. brucei HGPRT was expressed to high levels and purified to homogeneity by GTP-agarose affinity chromatography. The purified recombinant enzyme recognized hypoxanthine, guanine, and allopurinol, but not xanthine or adenine, as substrates and was inhibited by a variety of nucleotide effectors. The availability of a molecular clone encoding the T. brucei hgprt and large quantities of homogeneous recombinant HGPRT enzyme provides an experimentally manipulable molecular and biochemical system for the rational design of novel therapeutic agents for the treatment of African sleeping sickness and other diseases of parasitic origin. Images PMID:8265360

  19. Effect O6-guanine alkylation on DNA flexibility studied by comparative molecular dynamics simulations.


    Kara, Mahmut; Drsata, Tomas; Lankas, Filip; Zacharias, Martin


    Alkylation of guanine at the O6 atom is a highly mutagenic DNA lesion because it alters the coding specificity of the base causing G:C to A:T transversion mutations. Specific DNA repair enzymes, e.g. O(6)-alkylguanin-DNA-Transferases (AGT), recognize and repair such damage after looping out the damaged base to transfer it into the enzyme active site. The exact mechanism how the repair enzyme identifies a damaged site within a large surplus of undamaged DNA is not fully understood. The O(6)-alkylation of guanine may change the deformability of DNA which may facilitate the initial binding of a repair enzyme at the damaged site. In order to characterize the effect of O(6)-methyl-guanine (O(6)-MeG) containing base pairs on the DNA deformability extensive comparative molecular dynamics (MD) simulations on duplex DNA with central G:C, O(6)-MeG:C or O(6)-MeG:T base pairs were performed. The simulations indicate significant differences in the helical deformability due to the presence of O(6)-MeG compared to regular undamaged DNA. This includes enhanced base pair opening, shear and stagger motions and alterations in the backbone fine structure caused in part by transient rupture of the base pairing at the damaged site and transient insertion of water molecules. It is likely that the increased opening motions of O(6)-MeG:C or O(6)-MeG:T base pairs play a decisive role for the induced fit recognition or for the looping out of the damaged base by repair enzymes.

  20. Guanine is a growth factor for Legionella species.

    PubMed Central

    Pine, L; Franzus, M J; Malcolm, G B


    Evaluation of previously described chemically defined media for the growth of Legionella pneumophila showed that these media supported poor growth of several strains of L. pneumophila and did not support growth of certain of the Legionella species described later. Growth was stimulated by the dialysate from yeast extract but not by the nondialyzable fraction. Further investigations indicated that the active factors from the yeast extract dialysate were purine or pyrimidine derivatives, and certain known purines and pyrimidines were found to stimulate growth. Of these, guanine universally stimulated growth of all Legionella strains and was a growth requirement for several of the species tested. A balanced, N-(2-acetamido)-2-aminoethanesulfonic acid-buffered, chemically defined medium having guanine or a purine-pyrimidine mix is presented for the general growth of Legionella species. PMID:3700600

  1. Impedimetric investigation of gold nanoparticles - guanine modified electrode

    SciTech Connect

    Vulcu, A.; Pruneanu, S.; Berghian-Grosan, C.; Olenic, L.; Muresan, L. M.; Barbu-Tudoran, L.


    In this paper we report the preparation of a modified electrode with gold nanoparticles and guanine. The colloidal suspension of gold nanoparticles was obtained by Turkevich method and was next analyzed by UV-Vis spectroscopy and Transmission Electron Microscopy (TEM). The gold electrode was modified by self-assembling the gold nanoparticles with guanine, the organic molecule playing also the role of linker. The electrochemical characteristics of the bare and modified electrode were investigated by Electrochemical Impedance Spectroscopy (EIS). A theoretical model was developed based on an electrical equivalent circuit which contain solution resistance (R{sub s}), charge transfer resistance (R{sub ct}), Warburg impedance (Z{sub W}) and double layer capacitance (C{sub dl})

  2. Quantitative Analysis of Guanine Nucleotide Exchange Factors (GEFs) as Enzymes

    PubMed Central

    Randazzo, Paul A; Jian, Xiaoying; Chen, Pei-Wen; Zhai, Peng; Soubias, Olivier; Northup, John K


    The proteins that possess guanine nucleotide exchange factor (GEF) activity, which include about ~800 G protein coupled receptors (GPCRs),1 15 Arf GEFs,2 81 Rho GEFs,3 8 Ras GEFs,4 and others for other families of GTPases,5 catalyze the exchange of GTP for GDP on all regulatory guanine nucleotide binding proteins. Despite their importance as catalysts, relatively few exchange factors (we are aware of only eight for ras superfamily members) have been rigorously characterized kinetically.5–13 In some cases, kinetic analysis has been simplistic leading to erroneous conclusions about mechanism (as discussed in a recent review14). In this paper, we compare two approaches for determining the kinetic properties of exchange factors: (i) examining individual equilibria, and; (ii) analyzing the exchange factors as enzymes. Each approach, when thoughtfully used,14,15 provides important mechanistic information about the exchange factors. The analysis as enzymes is described in further detail. With the focus on the production of the biologically relevant guanine nucleotide binding protein complexed with GTP (G•GTP), we believe it is conceptually simpler to connect the kinetic properties to cellular effects. Further, the experiments are often more tractable than those used to analyze the equilibrium system and, therefore, more widely accessible to scientists interested in the function of exchange factors. PMID:25332840

  3. `Guanigma': the revised structure of biogenic anhydrous guanine

    NASA Astrophysics Data System (ADS)

    Hirsch, Anna; Gur, Dvir; Polishchuk, Iryna; Levy, Davide; Pokroy, Boaz; Cruz-Cabeza, Aurora J.; Addadi, Lia; Kronik, Leeor; Leiserowitz, Leslie

    Living organisms display a spectrum of colors, produced by pigmentation, structural coloration, or both. A relatively well-studied system, which produces colors via an array of alternating anhydrous guanine crystals and cytoplasm, is responsible for the metallic luster of many fish. The structure of biogenic anhydrous guanine was believed to be the same as that of the synthetic one - a monoclinic polymorph. Here we re-examine the structure of biogenic guanine, using experimental X-ray and electron diffraction (ED) data exposing troublesome inconsistencies - namely, a 'guanigma'. To address this, we sought alternative candidate polymorphs using symmetry and packing considerations, then used first principles calculations to determine whether the selected candidates could be energetically stable. We identified theoretically a different monoclinic polymorph, were able to synthesize it, and to confirm using X-ray diffraction that it is this polymorph that occurs in biogenic samples. However, the ED data were still not consistent with this polymorph, but rather with a theoretically generated orthorhombic polymorph. This apparent inconsistency was resolved by showing how the ED pattern could be affected by crystal structural faults composed of offset molecular layers.

  4. Fragmentation mechanisms of cytosine, adenine and guanine ionized bases.


    Sadr-Arani, Leila; Mignon, Pierre; Chermette, Henry; Abdoul-Carime, Hassan; Farizon, Bernadette; Farizon, Michel


    The different fragmentation channels of cytosine, adenine and guanine have been studied through DFT calculations. The electronic structure of bases, their cations, and the fragments obtained by breaking bonds provides a good understanding of the fragmentation process that can complete the experimental approach. The calculations allow assigning various fragments to the given peaks. The comparison between the energy required for the formation of fragments and the peak intensity in the mass spectrum is used. For cytosine and guanine the elimination of the HNCO molecule is a major route of dissociation, while for adenine multiple loss of HCN or HNC can be followed up to small fragments. For cytosine, this corresponds to the initial bond cleavage of N3-C4/N1-C2, which represents the main dissociation route. For guanine the release of HNCO is obtained through the N1-C2/C5-C6 bond cleavage (reverse order also possible) leading to the largest peak of the spectrum. The corresponding energies of 3.5 and 3.9 eV are typically in the range available in the experiments. The loss of NH3 or HCN is also possible but requires more energy. For adenine, fragmentation consists of multiple loss of the HCN molecule and the main route corresponding to HC8N9 loss is followed by the release of HC2N1.

  5. A three-state model for the photophysics of guanine.


    Serrano-Andrés, Luis; Merchán, Manuela; Borin, Antonio Carlos


    The nonadiabatic photochemistry of the guanine molecule (2-amino-6-oxopurine) and some of its tautomers has been studied by means of the high-level theoretical ab initio quantum chemistry methods CASSCF and CASPT2. Accurate computations, based by the first time on minimum energy reaction paths, states minima, transition states, reaction barriers, and conical intersections on the potential energy hypersurfaces of the molecules lead to interpret the photochemistry of guanine and derivatives within a three-state model. As in the other purine DNA nucleobase, adenine, the ultrafast subpicosecond fluorescence decay measured in guanine is attributed to the barrierless character of the path leading from the initially populated 1(pi pi* L(a)) spectroscopic state of the molecule toward the low-lying methanamine-like conical intersection (gs/pi pi* L(a))CI. On the contrary, other tautomers are shown to have a reaction energy barrier along the main relaxation profile. A second, slower decay is attributed to a path involving switches toward two other states, 1(pi pi* L(b)) and, in particular, 1(n(O) pi*), ultimately leading to conical intersections with the ground state. A common framework for the ultrafast relaxation of the natural nucleobases is obtained in which the predominant role of a pi pi*-type state is confirmed.

  6. Ball with hair: modular functionalization of highly stable G-quadruplex DNA nano-scaffolds through N2-guanine modification.


    Lech, Christopher Jacques; Phan, Anh Tuân


    Functionalized nanoparticles have seen valuable applications, particularly in the delivery of therapeutic and diagnostic agents in biological systems. However, the manufacturing of such nano-scale systems with the consistency required for biological application can be challenging, as variation in size and shape have large influences in nanoparticle behavior in vivo. We report on the development of a versatile nano-scaffold based on the modular functionalization of a DNA G-quadruplex. DNA sequences are functionalized in a modular fashion using well-established phosphoramidite chemical synthesis with nucleotides containing modification of the amino (N2) position of the guanine base. In physiological conditions, these sequences fold into well-defined G-quadruplex structures. The resulting DNA nano-scaffolds are thermally stable, consistent in size, and functionalized in a manner that allows for control over the density and relative orientation of functional chemistries on the nano-scaffold surface. Various chemistries including small modifications (N2-methyl-guanine), bulky aromatic modifications (N2-benzyl-guanine), and long chain-like modifications (N2-6-amino-hexyl-guanine) are tested and are found to be generally compatible with G-quadruplex formation. Furthermore, these modifications stabilize the G-quadruplex scaffold by 2.0-13.3 °C per modification in the melting temperature, with concurrent modifications producing extremely stable nano-scaffolds. We demonstrate the potential of this approach by functionalizing nano-scaffolds for use within the biotin-avidin conjugation approach. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  7. Guanine oxidation by electron transfer: one- versus two-electron oxidation mechanism.


    Kupan, Adam; Saulière, Aude; Broussy, Sylvain; Seguy, Christel; Pratviel, Geneviève; Meunier, Bernard


    The degeneracy of the guanine radical cation, which is formed in DNA by oxidation of guanine by electron transfer, was studied by a detailed analysis of the oxidation products of guanine on oligonucleotide duplexes and by labeling experiments. It was shown that imidazolone, the major product of guanine oxidation, is formed through a one-electron oxidation process and incorporates one oxygen atom from O2. The formation of 8-oxo-7,8-dihydroguanine by a two-electron oxidation process was a minor pathway. The two-electron oxidation mechanism was also evidenced by the formation of a tris(hydroxymethyl)aminomethane adduct.

  8. Structure-Based Design of Trna-Guanine Transglycosylase Inhibitors

    NASA Astrophysics Data System (ADS)

    Klebe, Gerhard

    Taking the development of inhibitors for the tRNA-modifying enzyme tRNA-guanine transglycosylase (TGT) as an example, the scope of a structure-based drug development project will be demonstrated, performed via several cycles of iterative design. The described example is based on studies, performed at ETH-Zurich and University of Marburg in joint collaboration. As these studies have been executed in an academic environment, different tools of structure-based design have been applied and several issues of more fundamental interest to the methodological background of the project could be addressed.

  9. Production of guanine from NH(4)CN polymerizations

    NASA Technical Reports Server (NTRS)

    Levy, M.; Miller, S. L.; Oro, J.


    The synthesis of adenine from the polymerization of concentrated ammonium cyanide solutions is well known. We show here that guanine is also produced by this reaction but at yields ranging from 10 to 40 times less than that of adenine. This synthesis is effective at both +80 and -20 degrees C. Since high concentrations of NH(4)CN are obtainable only by freezing, this prebiotic synthesis would be applicable to frozen regions of the primitive Earth, the Jovian satellite Europa and other icy satellites, and the parent body of the Murchison meteorite.

  10. Guanine binding to gold nanoparticles through nonbonding interactions.


    Zhang, Xi; Sun, Chang Q; Hirao, Hajime


    Gold nanoparticles have been widely used as nanocarriers in gene delivery. However, the binding mechanism between gold nanoparticles and DNA bases remains a puzzle. We performed density functional theory calculations with and without dispersion correction on Au(N)( (N = 13, 55, or 147) nanoparticles in high-symmetry cuboctahedral structures to understand the mechanism of their binding with guanine at the under-coordinated sites. Our study verified that: (i) negative charges transfer from the inner area to the surface of a nanoparticle as a result of the surface quantum trapping effect; and (ii) the valence states shift up toward the Fermi level, and thereby participate more actively in the binding to guanine. These effects are more prominent in a smaller nanoparticle, which has a larger surface-to-volume ratio. Additional fragment orbital analysis revealed that: (i) electron donation from the lone-pair orbital of N to the unoccupied orbital of the Au cluster occurs in all complexes; (ii) π back-donation occurs from the polarized Au d(yz) orbital to the N p(y)-π* orbital when there is no Au···H-N hydrogen bond, and, (iii) depending on the configuration, Au···H-N hydrogen bonding can also exist, to which the Au occupied orbital and the H-N unoccupied orbital contribute.

  11. Molecular dynamics simulations reveal the balance of forces governing the formation of a guanine tetrad—a common structural unit of G-quadruplex DNA

    PubMed Central

    Kogut, Mateusz; Kleist, Cyprian; Czub, Jacek


    G-quadruplexes (G4) are nucleic acid conformations of guanine-rich sequences, in which guanines are arranged in the square-planar G-tetrads, stacked on one another. G4 motifs form in vivo and are implicated in regulation of such processes as gene expression and chromosome maintenance. The structure and stability of various G4 topologies were determined experimentally; however, the driving forces for their formation are not fully understood at the molecular level. Here, we used all-atom molecular dynamics to probe the microscopic origin of the G4 motif stability. By computing the free energy profiles governing the dissociation of the 3′-terminal G-tetrad in the telomeric parallel-stranded G4, we examined the thermodynamic and kinetic stability of a single G-tetrad, as a common structural unit of G4 DNA. Our results indicate that the energetics of guanine association alone does not explain the overall stability of the G-tetrad and that interactions involving sugar–phosphate backbone, in particular, the constrained minimization of the phosphate–phosphate repulsion energy, are crucial in providing the observed enthalpic stabilization. This enthalpic gain is largely compensated by the unfavorable entropy change due to guanine association and optimization of the backbone topology. PMID:26980278

  12. Determination of the base composition of deoxyribonucleic acid by measurement of the adenine/guanine ratio

    PubMed Central

    Kirk, J. T. O.


    A method is described for determination of the base composition (as guanine+cytosine or adenine+thymine content) of DNA by accurate measurement of the adenine/guanine ratio. The DNA is hydrolysed with 0·03n-hydrochloric acid for 40min. to release the purines. The hydrolysate is subjected to ion-exchange chromatography on Zeo-Karb 225. Apurinic acids are eluted with 0·03n-hydrochloric acid and then guanine and adenine are eluted separately with 2n-hydrochloric acid. Guanine and adenine are each collected as a single fraction, and the amount of base in each case is determined by measuring the volume and the extinction at suitable wavelengths. For use in the calculations, millimolar extinction coefficients in 2n-hydrochloric acid of 12·09 for adenine at 262mμ, and 10·77 for guanine at 248mμ, were determined with authentic samples of bases. The method gives extremely reproducible results: from 12 determinations with calf thymus DNA the adenine/guanine molar ratio had a standard deviation of 0·011; this corresponds to a standard deviation in guanine+cytosine content of 0·2% guanine+cytosine. PMID:5626094

  13. Translesion synthesis by human DNA polymerase eta across oxidative products of guanine.


    Kino, Katuhito; Ito, Nobutoshi; Sugasawa, Kaoru; Sugiyama, Hiroshi; Hanaoka, Fumio


    Guanine is the most oxidizable base among natural bases. 8-Oxoguanine (8-oxoG) is the typical oxidative product, but the amount of 8-oxoG does not directly reflect the strength of oxidative stress. Imidazolone, oxazolone and guanidinohydantoin are oxidative products of guanine and 8-oxoG. Here, we investigated enzymatic reactions with human DNA polymerase eta on these lesions.

  14. Mobility enhancement of organic field-effect transistor based on guanine trap-neutralizing layer

    NASA Astrophysics Data System (ADS)

    Shi, Wei; Zheng, Yifan; Yu, Junsheng; Taylor, André D.; Katz, Howard E.


    We introduced a nucleic acid component guanine as a trap-neutralizing layer between silicon dioxide gate dielectric and a pentacene semiconducting layer to obtain increased field-effect mobility in organic field-effect transistors (OFETs). A tripling of the field-effect mobility, from 0.13 to 0.42 cm2/V s, was achieved by introducing a 2 nm guanine layer. By characterizing the surface morphology of pentacene films grown on guanine, we found that the effect of guanine layer on the topography of pentacene film was not responsible for the mobility enhancement of the OFETs. The increased field-effect mobility was mainly attributed to the hydrogen bonding capacity of otherwise unassociated guanine molecules, which enabled them to neutralize trapping sites on the silicon dioxide surface.

  15. The synergism of nucleoside antibiotics combined with guanine 7-N-oxide against a rhabdovirus, infectious hematopoietic necrosis virus (IHNV).


    Hasobe, M; Saneyoshi, M; Isono, K


    Guanine 7-N-oxide was shown to have synergistic activity in combination with neplanocin A against a rhabdovirus, infectious hematopoietic necrosis virus (IHNV), as reported previously. We examined further the antiviral activity of guanine 7-N-oxide in combination with other nucleoside antibiotics against IHNV. Synergism was seen between guanine 7-N-oxide and D-eritadenine or cordycepin. It is considered that compounds inhibiting RNA methylation show synergism with guanine 7-N-oxide.

  16. Guanine- 5-carboxylcytosine base pairs mimic mismatches during DNA replication.


    Shibutani, Toshihiro; Ito, Shinsuke; Toda, Mariko; Kanao, Rie; Collins, Leonard B; Shibata, Marika; Urabe, Miho; Koseki, Haruhiko; Masuda, Yuji; Swenberg, James A; Masutani, Chikahide; Hanaoka, Fumio; Iwai, Shigenori; Kuraoka, Isao


    The genetic information encoded in genomes must be faithfully replicated and transmitted to daughter cells. The recent discovery of consecutive DNA conversions by TET family proteins of 5-methylcytosine into 5-hydroxymethylcytosine, 5-formylcytosine, and 5-carboxylcytosine (5caC) suggests these modified cytosines act as DNA lesions, which could threaten genome integrity. Here, we have shown that although 5caC pairs with guanine during DNA replication in vitro, G·5caC pairs stimulated DNA polymerase exonuclease activity and were recognized by the mismatch repair (MMR) proteins. Knockdown of thymine DNA glycosylase increased 5caC in genome, affected cell proliferation via MMR, indicating MMR is a novel reader for 5caC. These results suggest the epigenetic modification products of 5caC behave as DNA lesions.

  17. Unusual energy transfer and structures in guanine oligodeoxynucleotides

    NASA Astrophysics Data System (ADS)

    Davis, Steven Paul; Truss, Tiffany; Nordlund, Thomas M.


    2-Aminopurine (2AP), a fluorescent analog of adenine, was alternately substituted into each of the five positions in guanine (G) pentadeoxynucleotides. Temperature dependent absorption and fluorescence excitation spectra of these and of samples plus complements showed that 2AP placed in the terminal 3' position exhibited higher energy transfer from G to 2AP than samples with 2AP in other positions: 102-3thymine-containing, but four times less than in adenine oligomers. The unusual position dependence in G oligomers may arise from intrastrand H bonding between 2AP-NH2 and G-O6. Additionally, the temperature dependence of the 2AP excitation band in G oligomers is unique. In GGGG[2AP] the spectral change is a shift to the red with increasing temperature; in the other G oligomers, the spectral shape changes and shifts to the blue. Spectral changes for oligomers of other bases are generally shifts to the blue.

  18. Unusual energy transfer and structures in guanine oligodeoxynucleotides

    NASA Astrophysics Data System (ADS)

    Davis, Steven Paul; Truss, Tiffany; Nordlund, Thomas M.


    2-Aminopurine (2AP), a fluorescent analog of adenine, was alternately substituted into each of the five positions in guanine (G) pentadeoxynucleotides. Temperature dependent absorption and fluorescence excitation spectra of these and of samples plus complements showed that 2AP placed in the terminal 3' position exhibited higher energy transfer from G to 2AP than samples with 2AP in other positions: 102-3thymine-containing, but four times less than in adenine oligomers. The unusual position dependence in G oligomers may arise from intrastrand H bonding between 2AP-NH2 and G-O6. Additionally, the temperature dependence of the 2AP excitation band in G oligomers is unique. In GGGG[2AP] the spectral change is a shift to the red with increasing temperature; in the other G oligomers, the spectral shape changes and shifts to the blue. Spectral changes for oligomers of other bases are generally shifts to the blue.

  19. In vivo methylation of guanine by the organophosphorus insecticide tetrachlorvinphos.


    Zayed, S M; Mostafa, I Y; Adam, Y; Hegazi, B


    The in vivo methylating capability of the organophosphorus insecticide tetrachlorvinphos, assayed by the formation of 7-methyl-guanine in mouse liver, was investigated. Following intraperitoneal injection of male mice with different doses of the 14C-insecticide, labelled at the OCH3 groups, the total and specific radioactivity of nucleic acids and protein were determined. The 14C-labelling in the isolated macromolecules reached its maximum 24 hours following administration of the insecticide. Analysis of the acid hydrolysate of DNA and of RNA on Dowex-50 WX-12 revealed the presence of (7-14C) methylguanine. At maximum 14C-labelling, the amount of radioactive 7-MeGu, calculated as fraction of total dose, was around 9 X 10(-5) and 39 X 10(-5) for DNA and RNA, respectively.

  20. Mechanistic Aspects of Hydration of Guanine Radical Cations in DNA

    PubMed Central


    The mechanistic aspects of hydration of guanine radical cations, G•+ in double- and single-stranded oligonucleotides were investigated by direct time-resolved spectroscopic monitoring methods. The G•+ radical one-electron oxidation products were generated by SO4•– radical anions derived from the photolysis of S2O82– anions by 308 nm laser pulses. In neutral aqueous solutions (pH 7.0), after the complete decay of SO4•– radicals (∼5 μs after the actinic laser flash) the transient absorbance of neutral guanine radicals, G(-H)• with maximum at 312 nm, is dominant. The kinetics of decay of G(-H)• radicals depend strongly on the DNA secondary structure. In double-stranded DNA, the G(-H)• decay is biphasic with one component decaying with a lifetime of ∼2.2 ms and the other with a lifetime of ∼0.18 s. By contrast, in single-stranded DNA the G(-H)• radicals decay monophasically with a ∼ 0.28 s lifetime. The ms decay component in double-stranded DNA is correlated with the enhancement of 8-oxo-7,8-dihydroguanine (8-oxoG) yields which are ∼7 greater than in single-stranded DNA. In double-stranded DNA, it is proposed that the G(-H)• radicals retain radical cation character by sharing the N1-proton with the N3-site of C in the [G•+:C] base pair. This [G(-H)•:H+C ⇆ G•+:C] equilibrium allows for the hydration of G•+ followed by formation of 8-oxoG. By contrast, in single-stranded DNA, deprotonation of G•+ and the irreversible escape of the proton into the aqueous phase competes more effectively with the hydration mechanism, thus diminishing the yield of 8-oxoG, as observed experimentally. PMID:24689701

  1. Lifetimes and reaction pathways of guanine radical cations and neutral guanine radicals in an oligonucleotide in aqueous solutions.


    Rokhlenko, Yekaterina; Geacintov, Nicholas E; Shafirovich, Vladimir


    The exposure of guanine in the oligonucleotide 5'-d(TCGCT) to one-electron oxidants leads initially to the formation of the guanine radical cation G(•+), its deptotonation product G(-H)(•), and, ultimately, various two- and four-electron oxidation products via pathways that depend on the oxidants and reaction conditions. We utilized single or successive multiple laser pulses (308 nm, 1 Hz rate) to generate the oxidants CO(3)(•-) and SO(4)(•-) (via the photolysis of S(2)O(8)(2-) in aqueous solutions in the presence and absence of bicarbonate, respectively) at concentrations/pulse that were ∼20-fold lower than the concentration of 5'-d(TCGCT). Time-resolved absorption spectroscopy measurements following single-pulse excitation show that the G(•+) radical (pK(a) = 3.9) can be observed only at low pH and is hydrated within 3 ms at pH 2.5, thus forming the two-electron oxidation product 8-oxo-7,8-dihydroguanosine (8-oxoG). At neutral pH, and single pulse excitation, the principal reactive intermediate is G(-H)(•), which, at best, reacts only slowly with H(2)O and lives for ∼70 ms in the absence of oxidants/other radicals to form base sequence-dependent intrastrand cross-links via the nucleophilic addition of N3-thymidine to C8-guanine (5'-G*CT* and 5'-T*CG*). Alternatively, G(-H)(•) can be oxidized further by reaction with CO(3)(•-), generating the two-electron oxidation products 8-oxoG (C8 addition) and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih, by C5 addition). The four-electron oxidation products, guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp), appear only after a second (or more) laser pulse. The levels of all products, except 8-oxoG, which remains at a low constant value, increase with the number of laser pulses.

  2. Guanine and 7,8-dihydro-8-oxo-guanine-specific oxidation in DNA by chromium(V).


    Sugden, Kent D; Martin, Brooke D


    The hexavalent oxidation state of chromium [Cr(VI)] is a well-established human carcinogen, although the mechanism of cancer induction is currently unknown. Intracellular reduction of Cr(VI) forms Cr(V), which is thought to play a fundamental role in the mechanism of DNA damage by this carcinogen. Two separate pathways of DNA damage, an oxidative pathway and a metal-binding pathway, have been proposed to account for the lesions observed in cell systems. We have used a model Cr(V) complex, N,N-ethylenebis(salicylidene-animato)oxochromium(V) [Cr(V)-Salen], to investigate the oxidative pathway of DNA damage and to elucidate the lesions generated from this oxidation process. Reaction of Cr(V)-Salen with synthetic oligonucleotides produced guanine-specific lesions that were not 8-oxo-2'-deoxyguanosine, based on the inability of iridium(IV) to further oxidize these sites. Oxidation products were identified using a 7,8-dihydro-8-oxo-2'-deoxyguanosine (8-oxo-G) containing oligonucleotide to increase the yields of product for identification by electrospray ionization mass spectrometry. The guanine-based lesions observed by mass spectrometry corresponded to the lesions guanidinohydantoin and spiroiminodihydantoin. The effects of these Cr(V)-Salen-induced lesions on DNA replication fidelity was assayed using a polymerase-based misincorporation assay. These lesions produced G --> T transversion mutations and polymerase stops at levels greater than those observed for 8-oxo-G. These data suggest a model by which chromate can cause DNA damage leading to mutations and cancer.

  3. Theoretical study of hydrated copper(II) interactions with guanine: a computational density functional theory study.


    Pavelka, Matej; Shukla, Manoj K; Leszczynski, Jerzy; Burda, Jaroslav V


    Optimization of the hydrated Cu(II)(N7-guanine) structures revealed a number of minima on the potential energy surface. For selected structures, energy decompositions together with the determination of electronic properties (partial charges and electron spin densities) were performed. In the complexes of guanine with the bare copper cation and that with the monoaqua ligated cation, an electron transfer from guanine to Cu(II) was observed, resulting in a Cu(I)-guanine(+) type of complex. Conformers with two aqua ligands are borderline systems characterized by a Cu partial charge of +0.7e and a similar value of the spin density (0.6e) localized on guanine. When tetracoordination of copper was achieved, only then the prevailing electron spin density is unambiguously localized on copper. The energetic preference of diaqua-Cu-(N7,O6-guanine) over triaqua-Cu-(N7-guanine) was found for the four-coordinate structures. However, the energy difference between these two conformations decreases with the number of water molecules present in the systems, and in complexes with five water molecules this preference is preserved only at DeltaG level where thermal and entropy terms are included.

  4. Guanine Oxidation in Double-stranded DNA by MnTMPyP/KHSO(5): At Least Three Independent Reaction Pathways.


    Lapi, A; Pratviel, G; Meunier, B


    In order to better define the mechanism and the products of guanine oxidation within DNA, we investigated the details of the mechanism of guanine oxidation by a metalloporphyrin, Mn-TMPyP, associated to KHSO(5) on oligonucleotides. We found that the three major products of guanine oxidation are formed by independent reaction routes. The oxidized guanidinohydantoin (1) and the proposed spiro compound 3 derivatives are not precursors of imidazolone lesion (Iz). These guanine lesions as well as their degradation products, may account for non-detected guanine oxidation products on oxidatively damaged DNA.

  5. Density Functional Study of the Influence of C5 Cytosine Substitution in Base Pairs with Guanine

    PubMed Central

    Moser, Adam; Guza, Rebecca; Tretyakova, Natalia; York, Darrin M.


    The present study employs density-functional electronic structure methods to investigate the effect of chemical modification at the C5 position of cytosine. A series of experimentally motivated chemical modifications are considered, including alkyl, halogen, aromatic, fused ring, and strong σ and π withdrawing functional groups. The effect of these modifications on cytosine geometry, electronic structure, proton affinities, gas phase basicities, cytosine-guanine base-pair hydrogen bond network and corresponding nucleophilicity at guanine are examined. Ultimately, these results play a part in dissecting the effect of endogenous cytosine methylation on the reactivity of neighboring guanine toward carcinogens and DNA alkylating agents. PMID:19890472

  6. Mechanistic aspects of hydration of guanine radical cations in DNA.


    Rokhlenko, Yekaterina; Cadet, Jean; Geacintov, Nicholas E; Shafirovich, Vladimir


    The mechanistic aspects of hydration of guanine radical cations, G(•+) in double- and single-stranded oligonucleotides were investigated by direct time-resolved spectroscopic monitoring methods. The G(•+) radical one-electron oxidation products were generated by SO4(•-) radical anions derived from the photolysis of S2O8(2-) anions by 308 nm laser pulses. In neutral aqueous solutions (pH 7.0), after the complete decay of SO4(•-) radicals (∼5 μs after the actinic laser flash) the transient absorbance of neutral guanine radicals, G(-H)(•) with maximum at 312 nm, is dominant. The kinetics of decay of G(-H)(•) radicals depend strongly on the DNA secondary structure. In double-stranded DNA, the G(-H)(•) decay is biphasic with one component decaying with a lifetime of ∼2.2 ms and the other with a lifetime of ∼0.18 s. By contrast, in single-stranded DNA the G(-H)(•) radicals decay monophasically with a ∼ 0.28 s lifetime. The ms decay component in double-stranded DNA is correlated with the enhancement of 8-oxo-7,8-dihydroguanine (8-oxoG) yields which are ∼7 greater than in single-stranded DNA. In double-stranded DNA, it is proposed that the G(-H)(•) radicals retain radical cation character by sharing the N1-proton with the N3-site of C in the [G(•+):C] base pair. This [G(-H)(•):H(+)C ⇆ G(•+):C] equilibrium allows for the hydration of G(•+) followed by formation of 8-oxoG. By contrast, in single-stranded DNA, deprotonation of G(•+) and the irreversible escape of the proton into the aqueous phase competes more effectively with the hydration mechanism, thus diminishing the yield of 8-oxoG, as observed experimentally.

  7. Analysis of guanine oxidation products in double-stranded DNA and proposed guanine oxidation pathways in single-stranded, double-stranded or quadruplex DNA.


    Morikawa, Masayuki; Kino, Katsuhito; Oyoshi, Takanori; Suzuki, Masayo; Kobayashi, Takanobu; Miyazawa, Hiroshi


    Guanine is the most easily oxidized among the four DNA bases, and some guanine-rich sequences can form quadruplex structures. In a previous study using 6-mer DNA d(TGGGGT), which is the shortest oligomer capable of forming quadruplex structures, we demonstrated that guanine oxidation products of quadruplex DNA differ from those of single-stranded DNA. Therefore, the hotooxidation products of double-stranded DNA (dsDNA) may also differ from that of quadruplex or single-stranded DNA, with the difference likely explaining the influence of DNA structures on guanine oxidation pathways. In this study, the guanine oxidation products of the dsDNA d(TGGGGT)/d(ACCCCA) were analyzed using HPLC and electrospray ionization-mass spectrometry (ESI-MS). As a result, the oxidation products in this dsDNA were identified as 2,5-diamino-4H-imidazol-4-one (Iz), 8-oxo-7,8-dihydroguanine (8oxoG), dehydroguanidinohydantoin (Ghox), and guanidinohydantoin (Gh). The major oxidation products in dsDNA were consistent with a combination of each major oxidation product observed in single-stranded and quadruplex DNA. We previously reported that the kinds of the oxidation products in single-stranded or quadruplex DNA depend on the ease of deprotonation of the guanine radical cation (G•+) at the N1 proton. Similarly, this mechanism was also involved in dsDNA. Deprotonation in dsDNA is easier than in quadruplex DNA and more difficult in single-stranded DNA, which can explain the formation of the four oxidation products in dsDNA.

  8. G-quartet type self-assembly of guanine functionalized single-walled carbon nanotubes

    NASA Astrophysics Data System (ADS)

    Singh, Prabhpreet; Venkatesh, V.; Nagapradeep, N.; Verma, Sandeep; Bianco, Alberto


    The simple strategy of linking guanine to single-walled carbon nanotubes (CNTs) through covalent functionalization permitted generation of the alignment of the nanotubes into lozenges reminiscent of guanine quartets (G-quartets) in the presence of potassium ions as observed by atomic force microscopy.The simple strategy of linking guanine to single-walled carbon nanotubes (CNTs) through covalent functionalization permitted generation of the alignment of the nanotubes into lozenges reminiscent of guanine quartets (G-quartets) in the presence of potassium ions as observed by atomic force microscopy. Electronic supplementary information (ESI) available: Experimental procedures for the synthesis and characterization of the precursors and MWCNT conjugates. See DOI: 10.1039/c2nr11849a

  9. The intrinsic stabilities and structures of alkali metal cationized guanine quadruplexes.


    Azargun, M; Jami-Alahmadi, Y; Fridgen, T D


    The structures and stabilities of self-assembled guanine quadruplexes, M(9eG)8(+) (M = Na, K, Rb, Cs; 9eG = 9-ethylguanine), have been studied in the gas phase by blackbody infrared radiative dissociation to determine the difference in the stabilizing effect of the alkali metal cations. The order of stabilities to decomposition was determined to be K(+) > Rb(+) > Cs(+) ≫ Na(+), which is consistent with the observation of K(+) being the ion of choice in guanine quadruplexes in nucleic acids. In the gas phase, the sodiated quadruplex was found to lose one 9eG at a time, whereas the quadruplexes of the heavier cations lost a neutral guanine tetrad. Vibrational spectroscopy on the gas-phase quadruplex ions was consistent with the structures in which the metal cations were sandwiched between two guanine tetrads. Electronic structure calculations are also used to compare with the observed stabilities and vibrational spectra.

  10. Fluorescence enhancement of DNA-silver nanoclusters from guanine proximity

    SciTech Connect

    Yeh, Hsin-chih; Sharma, Jaswinder; Yoo, Hyojong; Martinez, Jennifer S


    Oligonucleotide-templated, silver nanoclusters (DNA/Ag NCs) are a versatile set of fluorophores and have already been used for live cell imaging, detection of specific metal ions, and single-nucleotide variation identification. Compared to commonly used organic dyes, these fluorescent nanoclusters have much better photostability and are often a few times brighter. Owing to their small size, simple preparation, and biocompatibility (i.e. made of nontoxic metals), DNA/Ag NCs should find more applications in biological imaging and chemical detection in the years to come. While clearly promising as new fluorophores, DNA/Ag NCs possess a unique and poorly understood dynamic process not shared by organic dyes or photoluminescent nanocrystals - the conversion among different NC species due to silver oxidation/reduction or NC regrouping. While this environmental sensitivity can be viewed as a drawback, in the appropriate context, it can be used as a sensor or reporter. Often reversible, conversions among different NC species have been found to depend upon a number of factors, including time, temperature, oxygen and salt content. In this communication, we report significant fluorescence enhancement of DNA/Ag NCs via interactions with guanine-rich DNA sequences. Moreover, we demonstrated this property can be used for sensitive detection of specific target DNA from a human oncogene (i.e. Braf gene).

  11. Chlamydial entry involves TARP binding of guanine nucleotide exchange factors.


    Lane, B Josh; Mutchler, Charla; Al Khodor, Souhaila; Grieshaber, Scott S; Carabeo, Rey A


    Chlamydia trachomatis attachment to cells induces the secretion of the elementary body-associated protein TARP (Translocated Actin Recruiting Protein). TARP crosses the plasma membrane where it is immediately phosphorylated at tyrosine residues by unknown host kinases. The Rac GTPase is also activated, resulting in WAVE2 and Arp2/3-dependent recruitment of actin to the sites of chlamydia attachment. We show that TARP participates directly in chlamydial invasion activating the Rac-dependent signaling cascade to recruit actin. TARP functions by binding two distinct Rac guanine nucleotide exchange factors (GEFs), Sos1 and Vav2, in a phosphotyrosine-dependent manner. The tyrosine phosphorylation profile of the sequence YEPISTENIYESI within TARP, as well as the transient activation of the phosphatidylinositol 3-kinase (PI3-K), appears to determine which GEF is utilized to activate Rac. The first and second tyrosine residues, when phosphorylated, are utilized by the Sos1/Abi1/Eps8 and Vav2, respectively, with the latter requiring the lipid phosphatidylinositol 3,4,5-triphosphate. Depletion of these critical signaling molecules by siRNA resulted in inhibition of chlamydial invasion to varying degrees, owing to a possible functional redundancy of the two pathways. Collectively, these data implicate TARP in signaling to the actin cytoskeleton remodeling machinery, demonstrating a mechanism by which C.trachomatis invades non-phagocytic cells.

  12. Guanine nucleotides stimulate hydrolysis of phosphatidyl inositol bis phosphate in human myelin membranes

    SciTech Connect

    Boulias, C.; Moscarello, M.A. )


    Phosphodiesterase activity was stimulated in myelin membranes in the presence of guanine nucleotide analogues. This activity was reduced in myelin membranes which had been adenosine diphosphate ribosylated in the presence of cholera toxin which ADP-ribosylated three proteins of Mr 46,000, 43,000 and 18,500. Aluminum fluoride treatment of myelin had the same stimulatory effects on phosphodiesterase activity as did the guanine nucleotides.

  13. Guanine-06 methylation reduces the reactivity of d(GpG) towards platinum complexes.


    Struik, A F; Zuiderwijk, C T; van Boom, J H; Elding, L I; Reedijk, J


    6-methylated guanine dinucleotides were used to study the influence of hydrogen bonding on the specific binding of the antitumor drug cDDP, cis-PtCl2(NH3)2, to DNA. In this interaction, the guanine-06 site appears to be important in explaining the preference for a pGpG-N7(1),N7(2) chelate, which results from H-bridge formation with the ammine ligand of cDDP. Guanine-06 methylated dinucleotides and the nonmodified dinucleotides were reacted with [Pt(dien)Cl]+, cis-PtCl2(NH3)2, and cis-[Pt(NH3)2(H2O)2]2+ and the reaction products were characterized by 1H NMR using pH titrations. Methylation at guanine-06 clearly reduces the preference for the guanine. In competition experiments monitored by NMR and experiments using UV spectrophotometry a decreasing reactivity towards [Pt(dien)(H2O)]2+ and cis-[Pt(NH3)2(H2O)2]2+ was found, in the order of d(GpG) greater than d(GomepG) greater than d(GpGome) greater than d(GomepGome). The difference in reactivity between 5' guanine methylation and 3' guanine methylation is ascribed to differences in the H-bond formation with the backbone phosphate. The resulting reduced stacking of the bases in both modified dinucleotides, compared to the bases in d(GpG), results in a preference for the 3' guanine over 5'.

  14. Theoretical investigation of hydrogen transfer mechanism in the guanine cytosine base pair

    NASA Astrophysics Data System (ADS)

    Villani, Giovanni


    We have studied the quantum-dynamics of the hydrogen bonds in the guanine-cytosine base pair. Due to the position of hydrogen atoms, different tautomers are possible: the stable Watson-Crick G-C, the imino-enol G*-C*, the imino-enol-imino-enol G #-C # and some zwitterionic structures. The common idea in the literature is that only the G-C and the G*-C* tautomers are stable with an estimate of G-C → G*-C* transition probability of 10 -6-10 -9 by the help of Boltzmann statistics. Here we show a detailed quantum theoretical study that suggests the following conclusion: G-C is the stablest tautomer, some partially charged systems (due to the movement of only one hydrogen atom) are important and a large amount of the imino-enol G*-C* (and less of the imino-enol-imino-enol G #-C # structure) tautomer is present at any time. The corresponding transition probabilities from different tautomers are not due to thermal passage, but they are a pure quantum phenomenon. These large probabilities definitively disprove the idea of these tautomers as mutation points. The mechanisms of passage from the G-C tautomer to the others have also been investigated.

  15. In vitro guanine nucleotide exchange activity of DHR-2/DOCKER/CZH2 domains.


    Côté, Jean-François; Vuori, Kristiina


    Rho family GTPases regulate a large variety of biological processes, including the reorganization of the actin cytoskeleton. Like other members of the Ras superfamily of small GTP-binding proteins, Rho GTPases cycle between a GDP-bound (inactive) and a GTP-bound (active) state, and, when active, the GTPases relay extracellular signals to a large number of downstream effectors. Guanine nucleotide exchange factors (GEFs) promote the exchange of GDP for GTP on Rho GTPases, thereby activating them. Most Rho-GEFs mediate their effects through their signature domain known as the Dbl Homology-Pleckstrin Homology (DH-PH) module. Recently, we and others identified a family of evolutionarily conserved, DOCK180-related proteins that also display GEF activity toward Rho GTPases. The DOCK180-family of proteins lacks the canonical DH-PH module. Instead, they rely on a novel domain, termed DHR-2, DOCKER, or CZH2, to exchange GDP for GTP on Rho targets. In this chapter, the experimental approach that we used to uncover the exchange activity of the DHR-2 domain of DOCK180-related proteins will be described.

  16. Photoirradiation products of flavin derivatives, and the effects of photooxidation on guanine.


    Kino, Katsuhito; Kobayashi, Teruhiko; Arima, Eiji; Komori, Rie; Kobayashi, Takanobu; Miyazawa, Hiroshi


    Photoirradiation in the presence of riboflavin led to guanine oxidation and the formation of imidazolone. Meanwhile, riboflavin itself was degraded by ultraviolet light A (UV-A) and visible light (VIS) radiation, and the end product was lumichrome. VIS radiation in the presence of riboflavin oxidized guanine similarly to UV-A radiation. Although UV-A radiation with lumichrome oxidized guanine, VIS radiation with lumichrome did not. Thus, UV-A radiation with riboflavin can oxidize guanine even if riboflavin is degraded to lumichrome. In contrast, following VIS radiation degradation of riboflavin to lumichrome, VIS radiation with riboflavin is hardly capable of oxidizing guanine. The consequences of riboflavin degradation and guanine photooxidation can be extended to flavin mononucleotide and flavin adenine dinucleotide. In addition, we report advanced synthesis; carboxymethylflavin was obtained by oxidation of formylmethylflavin with chlorite and hydrogen peroxide; lumichrome was obtained by heating of formylmethylflavin in 50% AcOH; lumiflavin was obtained by incubation of formylmethylflavin in 2 M NaOH, followed by isolation by step-by-step concentration.

  17. Mechanisms involved in the antinociception induced by spinal administration of inosine or guanine in mice.


    de Oliveira, Enderson D; Schallenberger, Cristhine; Böhmer, Ana Elisa; Hansel, Gisele; Fagundes, Aécio C; Milman, Michael; Silva, Marcos D P; Oses, Jean P; Porciúncula, Lisiane O; Portela, Luís V; Elisabetsky, Elaine; Souza, Diogo O; Schmidt, André P


    It is well known that adenine-based purines exert multiple effects on pain transmission. Recently, we have demonstrated that guanine-based purines may produce some antinociceptive effects against chemical and thermal pain in mice. The present study was designed to investigate the antinociceptive effects of intrathecal (i.t.) administration of inosine or guanine in mice. Additionally, investigation into the mechanisms of action of these purines, their general toxicity and measurements of CSF purine levels were performed. Animals received an i.t. injection of vehicle (30mN NaOH), inosine or guanine (up to 600nmol) and submitted to several pain models and behavioural paradigms. Guanine and inosine produced dose-dependent antinociceptive effects in the tail-flick, hot-plate, intraplantar ( glutamate, capsaicin and acetic acid pain models. Additionally, i.t. inosine inhibited the biting behaviour induced by spinal injection of capsaicin and i.t. guanine reduced the biting behaviour induced by spinal injection of glutamate or AMPA. Intrathecal administration of inosine (200nmol) induced an approximately 115-fold increase on CSF inosine levels. This study provides new evidence on the mechanism of action of extracellular guanine and inosine presenting antinociceptive effects following spinal administration. These effects seem to be related, at least partially, to the modulation of A1 adenosine receptors.

  18. Novel regulatory mechanisms for the Dbl family guanine nucleotide exchange factor Cool-2/alpha-Pix.


    Feng, Qiyu; Baird, Daniel; Cerione, Richard A


    The Cool-2 (cloned-out of library-2) protein (identical to alpha-Pix for Pak-interactive exchange factor) has been implicated in various biological responses including chemoattractant signaling and in certain forms of mental retardation. We show that when Cool-2 exists as a dimer, it functions as a Rac-specific guanine nucleotide exchange factor (GEF). Dimerization of Cool-2 enables its Dbl (diffuse B-cell lymphoma) and pleckstrin homology domains to work together (in trans) to bind specifically to Rac-GDP. Dissociation of dimeric Cool-2 into its monomeric form allows it to act as a GEF for Cdc42 as well as for Rac. The binding of either PAK (p21-activated kinase) or Cbl (Casitas B-lymphoma) to the SH3 domain of monomeric Cool-2 is necessary for the functional interactions between GDP-bound Cdc42 or Rac and the Cool-2 monomer. The betagamma subunit complex of large GTP-binding proteins, by interacting with PAK, stimulates the dissociation of the Cool-2 dimer and activates its GEF activity for Cdc42. Overall, these findings highlight novel mechanisms by which extracellular signals can direct the specific activation of Rac versus Cdc42 by Cool-2/alpha-Pix.

  19. Diverse roles of guanine nucleotide exchange factors in regulating collective cell migration.


    Zaritsky, Assaf; Tseng, Yun-Yu; Rabadán, M Angeles; Krishna, Shefali; Overholtzer, Michael; Danuser, Gaudenz; Hall, Alan


    Efficient collective migration depends on a balance between contractility and cytoskeletal rearrangements, adhesion, and mechanical cell-cell communication, all controlled by GTPases of the RHO family. By comprehensive screening of guanine nucleotide exchange factors (GEFs) in human bronchial epithelial cell monolayers, we identified GEFs that are required for collective migration at large, such as SOS1 and β-PIX, and RHOA GEFs that are implicated in intercellular communication. Down-regulation of the latter GEFs differentially enhanced front-to-back propagation of guidance cues through the monolayer and was mirrored by down-regulation of RHOA expression and myosin II activity. Phenotype-based clustering of knockdown behaviors identified RHOA-ARHGEF18 and ARHGEF3-ARHGEF28-ARHGEF11 clusters, indicating that the latter may signal through other RHO-family GTPases. Indeed, knockdown of RHOC produced an intermediate between the two phenotypes. We conclude that for effective collective migration, the RHOA-GEFs → RHOA/C → actomyosin pathways must be optimally tuned to compromise between generation of motility forces and restriction of intercellular communication. © 2017 Zaritsky et al.

  20. Computational Study of Oxidation of Guanine by Singlet Oxygen ((1) Δg ) and Formation of Guanine:Lysine Cross-Links.


    Thapa, Bishnu; Munk, Barbara H; Burrows, Cynthia J; Schlegel, H Bernhard


    Oxidation of guanine in the presence of lysine can lead to guanine-lysine cross-links. The ratio of the C4, C5 and C8 crosslinks depends on the manner of oxidation. Type II photosensitizers such as Rose Bengal and methylene blue can generate singlet oxygen, which leads to a different ratio of products than oxidation by type I photosensitizers or by one electron oxidants. Modeling reactions of singlet oxygen can be quite challenging. Reactions have been explored using CASSCF, NEVPT2, DFT, CCSD(T), and BD(T) calculations with SMD implicit solvation. The spin contamination in open-shell calculations were corrected by Yamaguchi's approximate spin projection method. The addition of singlet oxygen to guanine to form guanine endo- peroxide proceeds step-wise via a zwitterionic peroxyl intermediate. The subsequent barrier for ring closure is smaller than the initial barrier for singlet oxygen addition. Ring opening of the endoperoxide by protonation at C4-O is followed by loss of a proton from C8 and dehydration to produce 8-oxoG(ox) . The addition of lysine (modelled by methylamine) or water across the C5=N7 double bond of 8-oxoG(ox) is followed by acyl migration to form the final spiro products. The barrier for methylamine addition is significantly lower than for water addition and should be the dominant reaction channel. These results are in good agreement with the experimental results for the formation of guanine-lysine cross-links by oxidation by type II photosensitizers.

  1. Effect of ionic strength and cationic DNA affinity binders on the DNA sequence selective alkylation of guanine N7-positions by nitrogen mustards

    SciTech Connect

    Hartley, J.A.; Forrow, S.M.; Souhami, R.L. )


    Large variations in alkylation intensities exist among guanines in a DNA sequence following treatment with chemotherapeutic alkylating agents such as nitrogen mustards, and the substituent attached to the reactive group can impose a distinct sequence preference for reaction. In order to understand further the structural and electrostatic factors which determine the sequence selectivity of alkylation reactions, the effect of increase ionic strength, the intercalator ethidium bromide, AT-specific minor groove binders distamycin A and netropsin, and the polyamine spermine on guanine N7-alkylation by L-phenylalanine mustard (L-Pam), uracil mustard (UM), and quinacrine mustard (QM) was investigated with a modification of the guanine-specific chemical cleavage technique for DNA sequencing. The result differed with both the nitrogen mustard and the cationic agent used. The effect, which resulted in both enhancement and suppression of alkylation sites, was most striking in the case of netropsin and distamycin A, which differed from each other. DNA footprinting indicated that selective binding to AT sequences in the minor groove of DNA can have long-range effects on the alkylation pattern of DNA in the major groove.

  2. Identification of N2-(1-carboxyethyl)guanine (CEG) as a guanine advanced glycosylation end product.


    Papoulis, A; al-Abed, Y; Bucala, R


    Reducing sugars such as glucose react nonenzymatically with protein amino groups to initiate a posttranslational modification process known as advanced glycosylation. Nucleotide bases also participate in advanced glycosylation reactions, producing DNA-linked advanced glycosylation endproducts (AGEs) that cause mutations and DNA transposition. Although several protein-derived AGEs have been isolated and structurally characterized, AGE-modified nucleotides have not yet been reported. We systematically examined the reactivities of the model nucleotide bases 9-methylguanine (9-mG), 9-methyladenine (9-mA), and 1-methylcytosine (1-mC) toward glucose and several glucose-derived reactants. In "fast" reactions performed at refluxing temperature and physiological pH, 1 equiv of nucleotide base was reacted with 10 equiv of D-glucose, D-glucose 6-phosphate (G-6-P), D-glucose 6-phosphate/lysine (G-6-P/Lys), the Schiff base 1-n-propylamino-N-D-glucoside (SB), or the Amadori product 1-n-propylamino-N-D-fructose (AP). In every reaction involving 9-mG, N2-(1-carboxyethyl)-9-methylguanine (CEmG) was a major product which was produced. N2-(1-carboxyethyl)-9-methylguanine also formed from 9-mG and AP in long-term incubations performed at 37 degrees C. Direct treatment of 9-mG with methylglyoxal (MG), a Maillard reaction propagator that forms from the decomposition of AP, also produced CEmG in high yield. N2-(1-Carboxyethyl)-9-methylguanine appears to result from the nucleophilic addition of the primary amino group of guanine to the ketone group of MG followed by an intramolecular rearrangement. Methylglyoxal is a known prokaryotic mutagen and was shown additionally to be mutagenic in a eukaryotic shuttle vector assay system.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. Design and synthesis of novel adenine fluorescence probe based on Eu(III) complexes with dtpa-bis(guanine) ligand

    NASA Astrophysics Data System (ADS)

    Tian, Fengyun; Jiang, Xiaoqing; Dou, Xuekai; Wu, Qiong; Wang, Jun; Song, Youtao


    A novel adenine (Ad) fluorescence probe (EuIII-dtpa-bis(guanine)) was designed and synthesized by improving experimental method based on the Eu(III) complex and dtpa-bis(guanine) ligand. The dtpa-bis(guanine) ligand was first synthesized by the acylation action between dtpaa and guanine (Gu), and the corresponding Eu(III) complex was successfully prepared through heat-refluxing method with dtpa-bis(guanine) ligand. As a novel fluorescence probe, the EuIII-dtpa-bis(guanine) complex can detect adenine (Ad) with characteristics of strong targeting, high specificity and high recognition ability. The detection mechanism of the adenine (Ad) using this probe in buffer solution was studied by ultraviolet-visible (UV-vis) and fluorescence spectroscopy. When the EuIII-dtpa-bis(guanine) was introduced to the adenine (Ad) solution, the fluorescence emission intensity was significantly enhanced. However, adding other bases such as guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) with similar composition and structure to that of adenine (Ad) to the EuIII-dtpa-bis(guanine) solution, the fluorescence emission intensities are nearly invariable. Meanwhile, the interference of guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) on the detection of the adenine using EuIII-dtpa-bis(guanine) probe was also studied. It was found that presence of these bases does not affect the detection of adenine (Ad). A linear response of fluorescence emission intensities of EuIII-dtpa-bis(guanine) at 570 nm as a function of adenine (Ad) concentration in the range of 0.00-5.00 × 10- 5 mol L- 1 was observed. The detection limit is about 4.70 × 10- 7 mol L- 1.

  4. Design and synthesis of novel adenine fluorescence probe based on Eu(III) complexes with dtpa-bis(guanine) ligand.


    Tian, Fengyun; Jiang, Xiaoqing; Dou, Xuekai; Wu, Qiong; Wang, Jun; Song, Youtao


    A novel adenine (Ad) fluorescence probe (Eu(III)-dtpa-bis(guanine)) was designed and synthesized by improving experimental method based on the Eu(III) complex and dtpa-bis(guanine) ligand. The dtpa-bis(guanine) ligand was first synthesized by the acylation action between dtpaa and guanine (Gu), and the corresponding Eu(III) complex was successfully prepared through heat-refluxing method with dtpa-bis(guanine) ligand. As a novel fluorescence probe, the Eu(III)-dtpa-bis(guanine) complex can detect adenine (Ad) with characteristics of strong targeting, high specificity and high recognition ability. The detection mechanism of the adenine (Ad) using this probe in buffer solution was studied by ultraviolet-visible (UV-vis) and fluorescence spectroscopy. When the Eu(III)-dtpa-bis(guanine) was introduced to the adenine (Ad) solution, the fluorescence emission intensity was significantly enhanced. However, adding other bases such as guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) with similar composition and structure to that of adenine (Ad) to the Eu(III)-dtpa-bis(guanine) solution, the fluorescence emission intensities are nearly invariable. Meanwhile, the interference of guanine (Gu), xanthine (Xa), hypoxanthine (Hy) and uric acid (Ur) on the detection of the adenine using Eu(III)-dtpa-bis(guanine) probe was also studied. It was found that presence of these bases does not affect the detection of adenine (Ad). A linear response of fluorescence emission intensities of Eu(III)-dtpa-bis(guanine) at 570nm as a function of adenine (Ad) concentration in the range of 0.00-5.00×10(-5)molL(-1) was observed. The detection limit is about 4.70×10(-7)molL(-1).

  5. Hypoxanthine-guanine phosophoribosyltransferase (HPRT) deficiency: Lesch-Nyhan syndrome

    PubMed Central

    Torres, Rosa J; Puig, Juan G


    Deficiency of hypoxanthine-guanine phosphoribosyltransferase (HPRT) activity is an inborn error of purine metabolism associated with uric acid overproduction and a continuum spectrum of neurological manifestations depending on the degree of the enzymatic deficiency. The prevalence is estimated at 1/380,000 live births in Canada, and 1/235,000 live births in Spain. Uric acid overproduction is present inall HPRT-deficient patients and is associated with lithiasis and gout. Neurological manifestations include severe action dystonia, choreoathetosis, ballismus, cognitive and attention deficit, and self-injurious behaviour. The most severe forms are known as Lesch-Nyhan syndrome (patients are normal at birth and diagnosis can be accomplished when psychomotor delay becomes apparent). Partial HPRT-deficient patients present these symptoms with a different intensity, and in the least severe forms symptoms may be unapparent. Megaloblastic anaemia is also associated with the disease. Inheritance of HPRT deficiency is X-linked recessive, thus males are generally affected and heterozygous female are carriers (usually asymptomatic). Human HPRT is encoded by a single structural gene on the long arm of the X chromosome at Xq26. To date, more than 300 disease-associated mutations in the HPRT1 gene have been identified. The diagnosis is based on clinical and biochemical findings (hyperuricemia and hyperuricosuria associated with psychomotor delay), and enzymatic (HPRT activity determination in haemolysate, intact erythrocytes or fibroblasts) and molecular tests. Molecular diagnosis allows faster and more accurate carrier and prenatal diagnosis. Prenatal diagnosis can be performed with amniotic cells obtained by amniocentesis at about 15–18 weeks' gestation, or chorionic villus cells obtained at about 10–12 weeks' gestation. Uric acid overproduction can be managed by allopurinol treatment. Doses must be carefully adjusted to avoid xanthine lithiasis. The lack of precise

  6. Hypoxanthine-guanine phosophoribosyltransferase (HPRT) deficiency: Lesch-Nyhan syndrome.


    Torres, Rosa J; Puig, Juan G


    Deficiency of hypoxanthine-guanine phosphoribosyltransferase (HPRT) activity is an inborn error of purine metabolism associated with uric acid overproduction and a continuum spectrum of neurological manifestations depending on the degree of the enzymatic deficiency. The prevalence is estimated at 1/380,000 live births in Canada, and 1/235,000 live births in Spain. Uric acid overproduction is present inall HPRT-deficient patients and is associated with lithiasis and gout. Neurological manifestations include severe action dystonia, choreoathetosis, ballismus, cognitive and attention deficit, and self-injurious behaviour. The most severe forms are known as Lesch-Nyhan syndrome (patients are normal at birth and diagnosis can be accomplished when psychomotor delay becomes apparent). Partial HPRT-deficient patients present these symptoms with a different intensity, and in the least severe forms symptoms may be unapparent. Megaloblastic anaemia is also associated with the disease. Inheritance of HPRT deficiency is X-linked recessive, thus males are generally affected and heterozygous female are carriers (usually asymptomatic). Human HPRT is encoded by a single structural gene on the long arm of the X chromosome at Xq26. To date, more than 300 disease-associated mutations in the HPRT1 gene have been identified. The diagnosis is based on clinical and biochemical findings (hyperuricemia and hyperuricosuria associated with psychomotor delay), and enzymatic (HPRT activity determination in haemolysate, intact erythrocytes or fibroblasts) and molecular tests. Molecular diagnosis allows faster and more accurate carrier and prenatal diagnosis. Prenatal diagnosis can be performed with amniotic cells obtained by amniocentesis at about 15-18 weeks' gestation, or chorionic villus cells obtained at about 10-12 weeks' gestation. Uric acid overproduction can be managed by allopurinol treatment. Doses must be carefully adjusted to avoid xanthine lithiasis. The lack of precise

  7. Guanine-based structural coloration as an indicator of oxidative stress in a cichlid fish.


    Cahn, Matthew D; Brown, Alexandria C; Clotfelter, Ethan D


    Vertebrate pigmentation is known to be influenced by oxidative stress, but few studies have tested the hypothesis that structural coloration can be similarly affected. We tested whether fish iridophores, which produce structural color using guanine stacks, might be affected by the prooxidant-antioxidant balance of the animal. Specifically, we hypothesized that convict cichlids (Amatitlania nigrofasciata) metabolize guanine present in iridophores to uric acid, an antioxidant, in response to oxidative damage. We used Hunter's contrast gloss and high performance liquid chromatography to determine whether dietary guanine supplementation allows fish to maintain their structural coloration despite oxidative stress induced via ultraviolet-B (UV-B) radiation. We found that dietary guanine was associated with greater skin gloss, and that exposure to UV-B light reduced glossiness. UV-B exposure did not increase oxidative damage (acrolein) or total antioxidant capacity in the skin or liver. Our experiment did not detect effects of dietary guanine or UV-B light on uric acid, but uric acid was positively related to antioxidant capacity. Our results support the hypothesis that structural color in fish may be altered by environmental stressors such as exposure to UV light, and highlight the need for future studies to consider the role of iridophores in condition-dependent visual signaling.

  8. Theoretical Study of the Photophysics of 8-Vinylguanine, an Isomorphic Fluorescent Analogue of Guanine.


    Kochman, Michał A; Pola, Martina; Miller, R J Dwayne


    Paving the way for the application of the algebraic-diagrammatic construction scheme of second-order (ADC(2)) to systems based on the guanine chromophore, we demonstrate the this excited-state electronic structure method provides a realistic description of the photochemistry of 9H-guanine, in close agreement with the benchmark provided by the CASPT2 method. We then proceed to apply the ADC(2) method to the photochemistry of 8-vinylguanine (8vG), a minimally modified analogue of guanine which, unlike the naturally occurring nucleobase, displays intense fluorescence, indicative of a much longer-lived excited electronic state. The emissive electronic state of 8vG is identified as an ππ*-type intramolecular charge transfer (ICT) state, in which a charge of roughly -0.2 e is transferred from the guanine moiety onto the vinyl substituent. The main radiationless deactivation pathway competing with fluorescence is predicted to involve the molecule leaving the minimum on the ICT ππ* state, and reaching a region of the S1 adiabatic state where it resembles the La ππ* state of unmodified 9H-guanine. The topology of the La ππ* region of the S1 state favors subsequent internal conversion at a crossing seam with the ground electronic state. The sensitivity of this process to environment polarity may explain the experimentally observed fluorescence quenching of 8vG upon incorporation in single- and double-stranded DNA.

  9. Control of self-assembled 2D nanostructures by methylation of guanine.


    Bald, Ilko; Wang, Yao-guang; Dong, Mingdong; Rosen, Christian B; Ravnsbaek, Jens B; Zhuang, Gui-lin; Gothelf, Kurt V; Wang, Jian-guo; Besenbacher, Flemming


    Methylation of DNA nucleobases is an important control mechanism in biology applied, for example, in the regulation of gene expression. The effect of methylation on the intermolecular interactions between guanine molecules is studied through an interplay between scanning tunneling microscopy (STM) and density functional theory with empirical dispersion correction (DFT-D). The present STM and DFT-D results show that methylation of guanine can have subtle effects on the hydrogen-bond strength with a strong dependence on the position of methylation. It is demonstrated that the methylation of DNA nucleobases is a precise means to tune intermolecular interactions and consequently enables very specific recognition of DNA methylation by enzymes. This scheme is used to generate four different types of artificial 2D nanostructures from methylated guanine. For instance, a 2D guanine windmill motif that is stabilized by cooperative hydrogen bonding is revealed. It forms by self-assembly on a graphite surface under ambient conditions at the liquid-solid interface when the hydrogen-bonding donor at the N1 site of guanine is blocked by a methyl group.

  10. Do clinical features of Lesch-Nyhan disease correlate more closely with hypoxanthine or guanine recycling?


    Schretlen, David J; Callon, Wynne; Ward, Rebecca E; Fu, Rong; Ho, Tiffany; Gordon, Barry; Harris, James C; Jinnah, H A


    Lesch-Nyhan disease (LND) is a rare, X-linked recessive neurodevelopmental disorder caused by deficiency of hypoxanthine-guanine phosphoribosyltransferase (HGprt), an enzyme in the purine salvage pathway. HGprt has two functions; it recycles hypoxanthine and guanine. Which of these two functions is more relevant for pathogenesis is unclear because some evidence points to hypoxanthine recycling, but other evidence points to guanine recycling. In this study, we selectively assayed hypoxanthine (Hprt) and guanine (Gprt) recycling in skin fibroblasts from 17 persons with LND, 11 with an attenuated variant of the disease (LNV), and 19 age-, sex-, and race-matched healthy controls (HC). Activity levels of both enzymes differed across groups (p < 0.0001), but only Gprt distinguished patients with LND from those with LNV (p < 0.05). Gprt also showed slightly stronger correlations than Hprt with 13 of 14 measures of the clinical phenotype, including the severity of dystonia, cognitive impairment, and behavioral abnormalities. These findings suggest that loss of guanine recycling might be more closely linked to the LND/LNV phenotype than loss of hypoxanthine recycling.

  11. Electrochemical studies on the oxidation of guanine and adenine at cyclodextrin modified electrodes.


    Abbaspour, Abdolkarim; Noori, Abolhassan


    An electrochemical sensor for guanine and adenine using cyclodextrin-modified poly(N-acetylaniline) (PNAANI) on a carbon paste electrode has been developed. The oxidation mechanism of guanine and adenine on the surface of the electrode was investigated by cyclic voltammetry. It was found that the electrode processes are irreversible, pH dependent, and involve several reaction products. The electron transfer process occurs in consecutive steps with the formation of a strongly adsorbed intermediate on the electrode surface. Also, a new method for estimating the apparent formation constants of guanine and adenine with the immobilized cyclodextrins, through the change of surface coverage of studied analytes has been reported. Both guanine and adenine showed linear concentrations in the range of 0.1-10 microM by using differential pulse voltammetry, with an experimental limit of detection down to 0.05 microM. Linear concentration ranges of 2-150 microM for guanine and 6-104 microM for adenine have been found when cyclic voltammetry was used for determination of both analytes.

  12. Label-free detection of telomerase activity using guanine electrochemical oxidation signal.


    Eskiocak, Ugur; Ozkan-Ariksoysal, Dilsat; Ozsoz, Mehmet; Oktem, Huseyin Avni


    Telomerase is an important biomarker for cancer cells and its activation in 85% of all cancer types confers a clinical diagnostic value. A label-free electrochemical assay based on guanine oxidation signal to measure telomerase activity is described. This developed technology combined with a disposable sensor, carbon graphite electrode (CGE), and differential pulse voltammetry (DPV) was performed by using PCR amplicons with/without telomeric repeats as the guanine oxidation signal observed at +1.0 V measured after the immobilization of PCR products. Guanine oxidation signal was chosen as a measure of telomerase activity because a substantial increase in the number of guanines was introduced by the action of telomerase which adds hexameric repeats (TTAGGG)n that contain 50% guanine. The developed assay was shown to specifically measure telomerase activity from cell extracts, and elongation rates increased linearly in a concentration dependent manner. Telomerase activity could be detected in cell extracts containing as low as 100 ng/microL of protein. All of the electrochemical measurements were also confirmed with the conventional TRAP-silver staining assay. Rapidity, simplicity, and the label-free nature of the developed assay make it suitable for practical use in quantitative determination of telomerase activity from clinical samples for diagnosis of cancer.

  13. Reduction of electron deficient guanine radical species in plasmid DNA by tyrosine derivatives.


    Tsoi, Mandi; Do, Trinh T; Tang, Vicky J; Aguilera, Joseph A; Milligan, Jamie R


    Guanine bases are the most easily oxidized sites in DNA and therefore electron deficient guanine radical species are major intermediates in the direct effect of ionizing radiation (ionization of the DNA itself) on DNA as a consequence of hole migration to guanine. As a model for this process we have used gamma-irradiation in the presence of thiocyanate ions to generate single electron oxidized guanine radicals in a plasmid target in aqueous solution. The stable species formed from these radicals can be detected and quantified by the formation of strand breaks in the plasmid after a post-irradiation incubation using a suitable enzyme. If a tyrosine derivative is also present during irradiation, the production of guanine oxidation products is decreased by electron transfer from tyrosine to the intermediate guanyl radical species. By using cationic tyrosine containing ligands we are able to observe this process when the tyrosine is electrostatically bound to the plasmid. The driving force dependence of this reaction was determined by comparing the reactivity of tyrosine with its 3-nitro analog. The results imply that the electron transfer reaction is coupled to a proton transfer. The experimental conditions used in this model system provide a reasonable approximation to those involved in the radioprotection of DNA by tightly bound proteins in chromatin.

  14. Regulation of IMP dehydrogenase gene expression by its end products, guanine nucleotides.

    PubMed Central

    Glesne, D A; Collart, F R; Huberman, E


    To study the regulation of IMP dehydrogenase (IMPDH), the rate-limiting enzyme of guanine nucleotide biosynthesis, we examined the effects of nucleosides, nucleotides, nucleotide analogs, or the IMPDH inhibitor mycophenolic acid (MPA) on the steady-state levels of IMPDH mRNA. The results indicated that IMPDH gene expression is regulated inversely by the intracellular level of guanine ribonucleotides. We have shown that treatment with guanosine increased the level of cellular guanine ribonucleotides and subsequently reduced IMPDH steady-state mRNA levels in a time- and dose-dependent manner. Conversely, MPA treatment diminished the level of guanine ribonucleotides and increased IMPDH mRNA levels. Both of these effects on the steady-state level of IMPDH mRNA could be negated by cotreatment with guanosine and MPA. The down regulation of IMPDH gene expression by guanosine or its up regulation by MPA was not due to major changes in transcriptional initiation and elongation or mRNA stability in the cytoplasm but rather was due to alterations in the levels of the IMPDH mRNA in the nucleus. These results suggest that IMPDH gene expression is regulated by a posttranscriptional, nuclear event in response to fluctuations in the intracellular level of guanine ribonucleotides. Images PMID:1717828

  15. Guanine derivatives modulate L-glutamate uptake into rat brain synaptic vesicles.


    Tasca, Carla I; Santos, Tiago G; Tavares, Rejane G; Battastini, Ana M O; Rocha, João B T; Souza, Diogo O


    Glutamate uptake into synaptic vesicles is driven by a proton electrochemical gradient generated by a vacuolar H(+)-ATPase and stimulated by physiological concentrations of chloride. This uptake plays an important role in glutamatergic transmission. We show here that vesicular glutamate uptake is selectively inhibited by guanine derivatives, in a time- and concentration-dependent manner. Guanosine, GMP, GDP, guanosine-5'-O-2-thiodiphosphate, GTP, or 5'-guanylylimidodiphosphate (GppNHp) inhibited glutamate uptake in 1.5 and 3 min incubations, however, when incubating for 10 min, only GTP or GppNHp displayed such inhibition. By increasing ATP concentrations, the inhibitory effect of GTP was no longer observed, but GppNHp still inhibited glutamate uptake. In the absence of ATP, vesicular ATPase can hydrolyze GTP in order to drive glutamate uptake. However, 5mM GppNHp inhibited ATP hydrolysis by synaptic vesicle preparations. GTP or GppNHp decreased the proton electrochemical gradient, whereas the other guanine derivatives did not. Glutamate saturation curves were assayed in order to evaluate the specificity of inhibition of the vesicular glutamate carrier by the guanine derivatives. The maximum velocity of the initial rate of glutamate uptake was decreased by all guanine derivatives. These results indicate that, although GppNHp can inhibit ATPase activity, guanine derivatives are more likely to be acting through interaction with vesicular glutamate carrier.

  16. Oxidation of the guanine nucleotide pool underlies cell death by bactericidal antibiotics.


    Foti, James J; Devadoss, Babho; Winkler, Jonathan A; Collins, James J; Walker, Graham C


    A detailed understanding of the mechanisms that underlie antibiotic killing is important for the derivation of new classes of antibiotics and clinically useful adjuvants for current antimicrobial therapies. Our efforts to understand why DinB (DNA polymerase IV) overproduction is cytotoxic to Escherichia coli led to the unexpected insight that oxidation of guanine to 8-oxo-guanine in the nucleotide pool underlies much of the cell death caused by both DinB overproduction and bactericidal antibiotics. We propose a model in which the cytotoxicity of beta-lactams and quinolones predominantly results from lethal double-strand DNA breaks caused by incomplete repair of closely spaced 8-oxo-deoxyguanosine lesions, whereas the cytotoxicity of aminoglycosides might additionally result from mistranslation due to the incorporation of 8-oxo-guanine into newly synthesized RNAs.

  17. Formation of the carboxamidine precursor of cyanuric acid from guanine oxidative lesion dehydro-guanidinohydantoin.


    Irvoas, Joris; Trzcionka, Jérôme; Pratviel, Geneviève


    DNA damage under oxidative stress leads to oxidation of guanine base. The identification of the resulting guanine lesions in cellular DNA is difficult due to the sensitivity of the primary oxidation products to hydrolysis and/or further oxidation. We isolated dehydroguanidino-hydantoin (DGh) (or oxidized guanidinohydantoin), a secondary oxidation product of guanine, and showed that this lesion reacts readily with nucleophiles such as asymmetric peroxides and transforms to 2,4,6-trioxo-1,3,5-triazinane-1-carboxamidine residue. Further hydrolysis of this intermediate leads to cyanuric acid and finally to urea residue. This work demonstrates a new possible pathway for the formation of the well-known carboxamidine precursor of cyanuric acid lesion.

  18. Effect of intense magnetic fields on the convection of biogenic guanine crystals in aqueous solution

    NASA Astrophysics Data System (ADS)

    Iwasaka, M.; Mizukawa, Y.


    In this study, the basic magneto-optic properties of biogenic microcrystals in aqueous media were investigated. Microcrystals, mica plates, silica, and microcrystals from a diatom cell and biogenic guanine crystals from goldfish showed light scattering inhibition when the crystals were observed in water under a 5 T magnetic field and dark-field illumination. In particular, in 50% ethanol/water medium, convection of the biogenic guanine particle aggregates was reversibly inhibited when the microcrystal suspension was exposed to a 5 T magnetic field. Microscopic observation comparing the biogenic guanine crystals in water with 95% ethanol or 99% acetone revealed that light flickering on the surface of the crystals was affected by the surface interaction of the crystal with the surrounding medium. By considering both the magnetic orientation of the microcrystals and the possible interactions of crystals with the surrounding medium, a magnetically controllable fluidic tracer was suggested.

  19. Guanine riboswitch variants from Mesoplasma florum selectively recognize 2′-deoxyguanosine

    PubMed Central

    Kim, Jane N.; Roth, Adam; Breaker, Ronald R.


    Several mRNA aptamers have been identified in Mesoplasma florum that have sequence and structural features resembling those of guanine and adenine riboswitches. Two features distinguish these RNAs from established purine-sensing riboswitches. All possess shortened hairpin-loop sequences expected to alter tertiary contacts known to be critical for aptamer folding. The RNAs also carry nucleotide changes in the core of each aptamer that otherwise is strictly conserved in guanine and adenine riboswitches. Some aptamers retain the ability to selectively bind guanine or adenine despite these mutations. However, one variant type exhibits selective and high-affinity binding of 2′-deoxyguanosine, which is consistent with its occurrence in the 5′ untranslated region of an operon containing ribonucleotide reductase genes. The identification of riboswitch variants that bind nucleosides and reject nucleobases reveals that natural metabolite-sensing RNA motifs can accrue mutations that expand the diversity of ligand detection in bacteria. PMID:17911257

  20. A DFT investigation on interactions between asymmetric derivatives of cisplatin and nucleobase guanine

    NASA Astrophysics Data System (ADS)

    Tai, Truong Ba; Nhat, Pham Vu


    The interactions of hydrolysis products of cisplatin and its asymmetric derivatives cis- and trans-[PtCl2(iPram)(Mepz)] with guanine were studied using DFT methods. These interactions are dominated by electrostatic effects, namely hydrogen bond contributions and there exists a charge flow from H-atoms of ligands to the O-atoms of guanine. The replacement of NH3 moieties by larger functional groups accompanies with a moderate reaction between PtII and guanine molecule, diminishing the cytotoxicity of the drug. The asymmetric and symmetric NH2 stretching modes of complexes having strong hydrogen bond interactions are red shifted importantly as compared to complexes without presence of hydrogen bond interactions.

  1. Rapid and simple G-quadruplex DNA aptasensor with guanine chemiluminescence detection.


    Cho, Sandy; Park, Lucienne; Chong, Richard; Kim, Young Teck; Lee, Ji Hoon


    Cost-effective and sensitive aptasensor with guanine chemiluminescence detection capable of simply quantifying thrombin in human serum was developed using thrombin aptamer (TBA), one of the G-quadruplex DNA aptamers, without expensive nanoparticles and complicated procedures. Guanines of G-quadruplex TBA-conjugated carboxyfluorescein (6-FAM) bound with thrombin do not react with 3,4,5-trimethoxylphenylglyoxal (TMPG) in the presence of tetra-n-propylammonium hydroxide (TPA), whereas guanines of free TBA- and TBA-conjugated 6-FAM immobilized on the surface of graphene oxide rapidly react with TMPG to emit light. Thus, guanine chemiluminescence in 5% human serum with thrombin was lower than that without thrombin when TBA-conjugated 6-FAM was added in two samples and incubated for 20 min. In other words, the brightness of guanine chemiluminescence was quenched due to the formation of G-quadruplex TBA-conjugated 6-FAM bound with thrombin in a sample. High-energy intermediate, capable of emitting dim light by itself, formed from the reaction between guanines of TBA and TMPG in the presence of TPA, transfers energy to 6-FAM to emit bright light based on the principle of chemiluminescence energy transfer (CRET). G-quadruplex TBA aptasensor devised using the rapid interaction between TBA-conjugated 6-FAM and thrombin quantified trace levels of thrombin without complicated procedures. The limit of detection (LOD = background + 3 × standard deviation) of G-quadruplex TBA aptasensor with good linear calibration curve, accuracy, precision, and recovery was as low as 12.3 nM in 5% human serum. Using the technology reported in this research, we expect that various types of G-quadruplex DNA aptasensors capable of specifically sensing a target molecule such as ATP, HIV, ochratoxin, potassium ions, and thrombin can be developed.

  2. Mechanisms of oxidation of guanine in DNA by carbonate radical anion, a decomposition product of nitrosoperoxycarbonate.


    Lee, Young Ae; Yun, Byeong Hwa; Kim, Seog K; Margolin, Yelena; Dedon, Peter C; Geacintov, Nicholas E; Shafirovich, Vladimir


    Peroxynitrite is produced during inflammation and combines rapidly with carbon dioxide to yield the unstable nitrosoperoxycarbonate, which decomposes (in part) to CO(3) (.-) and (.)NO(2) radicals. The CO(3) (.-) radicals oxidize guanine bases in DNA through a one-electron transfer reaction process that ultimately results in the formation of stable guanine oxidation products. Here we have explored these mechanisms, starting with a spectroscopic study of the kinetics of electron transfer from 20-22mer double-stranded oligonucleotides to CO(3) (.-) radicals, together with the effects of base sequence on the formation of the end-products in runs of one, two, or three contiguous guanines. The distributions of these alkali-labile lesions were determined by gel electrophoresis methods. The cascade of events was initiated through the use of 308 nm XeCl excimer laser pulses to generate CO(3) (.-) radicals by an established method based on the photodissociation of persulfate to sulfate radicals and the oxidation of bicarbonate. Although the Saito model (Saito et al., J. Am. Chem. Soc. 1995, 117, 6406-6407) predicts relative ease of one-electron oxidations in DNA, following the trend 5'-GGG > 5'-GG > 5'-G, we found that the rate constants for CO(3) (.-)-mediated oxidation of guanines in these sequence contexts (k(5)) showed only small variation within a narrow range [(1.5-3.0)x10(7) M(-1) s(-1)]. In contrast, the distributions of the end-products are dependent on the base sequence context and are higher at the 5'-G in 5'-GG sequences and at the first two 5'-guanines in the 5'-GGG sequences. These effects are attributed to a combination of initial hole distributions among the contiguous guanines and the subsequent differences in chemical reaction yields at each guanine. The lack of dependence of k(5) on sequence context indicates that the one-electron oxidation of guanine in DNA by CO(3) (.-) radicals occurs by an inner-sphere mechanism.

  3. Alkylation of urinary guanine in mice by the organophosphorus insecticide tetrachlorvinphos.


    Zayed, S M; Mostafa, I Y; Hegazi, B


    The methylating capability of tetrachlorvinphos on urinary guanine in mice has been investigated using an insecticide labeled at both O-CH3 groups. Following intraperitoneal administration of the 14C-labeled insecticide to mice, about 0.57% of the radioactivity in the O- to 24-hr samples was associated with the purine fraction. The amount of [7-14C]methylguanine in 0- to 48-hr urine samples, estimated as fraction of applied dose, was 26-31 X 10(-5). The results obtained indicate possible chemical alkylation of urinary guanine. On the other hand, a considerable portion of radioactivity is probably incorporated via the C-1 pool.

  4. Transcription profiling of guanine nucleotide binding proteins during developmental regulation, and pesticide response in Solenopsis invicta (Hymenoptera: Formicidae)

    USDA-ARS?s Scientific Manuscript database

    Guanine nucleotide binding proteins (GNBP or G-protein) are glycoproteins anchored on the cytoplasmic cell membrane, and are mediators for many cellular processes. Complete cDNA of guanine nucleotide-binding protein gene ß-subunit (SiGNBP) was cloned and sequenced from S. invicta workers. To detect ...

  5. Catching Functional Modes and Structural Communication in Dbl Family Rho Guanine Nucleotide Exchange Factors.


    Raimondi, Francesco; Felline, Angelo; Fanelli, Francesca


    Computational approaches such as Principal Component Analysis (PCA) and Elastic Network Model-Normal Mode Analysis (ENM-NMA) are proving to be of great value in investigating relevant biological problems linked to slow motions with no demand in computer power. In this study, these approaches have been coupled to the graph theory-based Protein Structure Network (PSN) analysis to dissect functional dynamics and structural communication in the Dbl family of Rho Guanine Nucleotide Exchange Factors (RhoGEFs). They are multidomain proteins whose common structural feature is a DH-PH tandem domain deputed to the GEF activity that makes them play a central role in cell and cancer biology. While their common GEF action is accomplished by the DH domain, their regulatory mechanisms are highly variegate and depend on the PH and the additional domains as well as on interacting proteins. Major evolutionary-driven deformations as inferred from PCA concern the α6 helix of DH that dictates the orientation of the PH domain. Such deformations seem to depend on the mechanisms adopted by the GEF to prevent Rho binding, i.e. functional specialization linked to autoinhibition. In line with PCA, ENM-NMA indicates α6 and the linked PH domain as the portions of the tandem domain holding almost the totality of intrinsic and functional dynamics, with the α6/β1 junction acting as a hinge point for the collective motions of PH. In contrast, the DH domain holds a static scaffolding and hub behavior, with structural communication playing a central role in the regulatory actions by other domains/proteins. Possible allosteric communication pathways involving essentially DH were indeed found in those RhoGEFs acting as effectors of small or heterotrimeric RasGTPases. The employed methodology is suitable for deciphering structure/dynamics relationships in large sets of homologous or analogous proteins.

  6. Evolution of complete proteomes: guanine-cytosine pressure, phylogeny and environmental influences blend the proteomic architecture

    PubMed Central


    Background Guanine-cytosine (GC) composition is an important feature of genomes. Likewise, amino acid composition is a distinct, but less valued, feature of proteomes. A major concern is that it is not clear what valuable information can be acquired from amino acid composition data. To address this concern, in-depth analyses of the amino acid composition of the complete proteomes from 63 archaea, 270 bacteria, and 128 eukaryotes were performed. Results Principal component analysis of the amino acid matrices showed that the main contributors to proteomic architecture were genomic GC variation, phylogeny, and environmental influences. GC pressure drove positive selection on Ala, Arg, Gly, Pro, Trp, and Val, and adverse selection on Asn, Lys, Ile, Phe, and Tyr. The physico-chemical framework of the complete proteomes withstood GC pressure by frequency complementation of GC-dependent amino acid pairs with similar physico-chemical properties. Gln, His, Ser, and Val were responsible for phylogeny and their constituted components could differentiate archaea, bacteria, and eukaryotes. Environmental niche was also a significant factor in determining proteomic architecture, especially for archaea for which the main amino acids were Cys, Leu, and Thr. In archaea, hyperthermophiles, acidophiles, mesophiles, psychrophiles, and halophiles gathered successively along the environment-based principal component. Concordance between proteomic architecture and the genetic code was also related closely to genomic GC content, phylogeny, and lifestyles. Conclusions Large-scale analyses of the complete proteomes of a wide range of organisms suggested that amino acid composition retained the trace of GC variation, phylogeny, and environmental influences during evolution. The findings from this study will help in the development of a global understanding of proteome evolution, and even biological evolution. PMID:24088322

  7. Human Sos1: A guanine nucleotide exchange factor for ras that binds to GRB2

    SciTech Connect

    Chardin, P. ); Camonis, J.; Gale, N.W.; Aelst, L. Van; Wigler, M.H.; Bar-Sagi, D. ); Schlessinger, J. )


    A human complementary DNA was isolated that encodes a widely expressed protein, hSos1, that is closely related to Sos, the product of the Drosophila son of sevenless gene. The hSos1 protein contains a region of significant sequence similarity to CDC25, a guanine nucleotide exchange factor for Ras from yeast. A fragment of hSos1 encoding the CDC25-related domain complemented loss of CDC25 function in yeast. This hSos1 domain specifically stimulated guanine nucleotide exchange on mammalian Ras proteins in vitro. Mammalian cells overexpressing full-length hSos1 had increased guanine nucleotide exchange activity. Thus hSos1 is a guanine nucleotide exchange factor for Ras. The hSos1 interacted with growth factor receptor-bound protein 2 (GRB2) in vivo and in vitro. This interaction was mediated by the carboxyl-terminal domain of hSos1 and the Src homology 3 (SH3) domains of GRB2. These results suggest that the coupling of receptor tyrosine kinases to Ras signaling is mediated by a molecular complex consisting of GRB2 and hSos1. 42 refs., 5 figs.

  8. Vibrational investigations of guanine, thioguanine and their singly charged cations and anions

    NASA Astrophysics Data System (ADS)

    Singh, R.; Yadav, R. A.


    The complete vibrational studies have been done with help of quantum mechanics for the neutral Guanine (Gua) and Thioguanine (TGua) molecules and their singly charged cations and anions employing the B3LYP/6-311++G** method. Neutral Thioguanine and cations of Guanine and Thioguanine show planar structures and belong to Cs point group symmetry while the neutral Guanine and anions of Guanine and Thioguanine possess non-planar structure with C1 point group symmetry. Vibrational studies of ionic radicals of Gua and its thio- derivative are not available in literatures. Such extensive studies have been attempted for the first time. The normal modes of all the species have been assigned on the basis using potential energy distributions (PEDs) using GAR2PED software. The PEDs have also been calculated to make a conspicuous assignment as animation available in GaussView is not a guarantee for correct normal mode assignment. Charge transfer occurs in the molecule have been shown by the calculated highest occupied molecular orbital—lowest unoccupied molecular orbital (HOMO-LUMO) energies. The mapping of electron density iso-surface with electrostatic potential, has been carried out to get the information about the size, shape, charge density distribution and site of chemical reactivity of the molecule. The electronic properties HOMO and LUMO energies have been measured. The energy gap from HOMO to LUMO of the Gua is 5.0547 eV and TGua 4.0743 eV.

  9. Extracellular conversion of guanine-based purines to guanosine specifically enhances astrocyte glutamate uptake.


    Frizzo, Marcos Emílio dos Santos; Antunes Soares, Félix Alexandre; Dall'Onder, Leonara Patrícia; Lara, Diogo Rizzato; Swanson, Raymond A; Souza, Diogo Onofre


    Guanosine (GUO) has been shown to stimulate glutamate uptake in primary astrocyte cultures. The purpose of this study was to determine the effect and specificity of guanine- or adenine-based purines on glutamate and GABA uptake in cultured astrocytes. Stimulatory effect on glutamate uptake was observed with GUO, GMP or GTP. Simultaneous exposure with these guanine-based purines did not show an additive effect. We also investigated a possible interconversion of guanine-based purines during incubation time. Action by GTP was excluded since the hydrolysis resistant GTP analog, GMP-PNP did not stimulate glutamate uptake. Addition of an ecto-5'-nucleotidase inhibitor abolished GMP-stimulatory effect on glutamate uptake, without affecting GUO action. Taken together, these results suggest that GUO is the guanine-based purines responsible for glutamate uptake activation. In addition, the stimulatory effect on glutamate uptake was not observed with adenine-based purines. Moreover, GABA uptake was not activated by GUO. These results point to specificity in the interaction between GUO and the astrocyte glutamate uptake system.

  10. Human Sos1: a guanine nucleotide exchange factor for Ras that binds to GRB2.


    Chardin, P; Camonis, J H; Gale, N W; van Aelst, L; Schlessinger, J; Wigler, M H; Bar-Sagi, D


    A human complementary DNA was isolated that encodes a widely expressed protein, hSos1, that is closely related to Sos, the product of the Drosophila son of sevenless gene. The hSos1 protein contains a region of significant sequence similarity to CDC25, a guanine nucleotide exchange factor for Ras from yeast. A fragment of hSos1 encoding the CDC25-related domain complemented loss of CDC25 function in yeast. This hSos1 domain specifically stimulated guanine nucleotide exchange on mammalian Ras proteins in vitro. Mammalian cells overexpressing full-length hSos1 had increased guanine nucleotide exchange activity. Thus hSos1 is a guanine nucleotide exchange factor for Ras. The hSos1 interacted with growth factor receptor-bound protein 2 (GRB2) in vivo and in vitro. This interaction was mediated by the carboxyl-terminal domain of hSos1 and the Src homology 3 (SH3) domains of GRB2. These results suggest that the coupling of receptor tyrosine kinases to Ras signaling is mediated by a molecular complex consisting of GRB2 and hSos1.

  11. Successive attachment of electrons to protonated Guanine: (G+H)* radicals and (G+H)- anions.


    Zhang, Jun D; Xie, Yaoming; Schaefer, Henry F


    The structures, energetics, and vibrational frequencies of nine hydrogenated 9H-keto-guanine radicals (G+H)(*) and closed-shell anions (G+H)(-) are predicted using the carefully calibrated (Chem. Rev. 2002, 102, 231) B3LYP density functional method in conjunction with a DZP++ basis set. These radical and anionic species come from consecutive electron attachment to the corresponding protonated (G+H)(+) cations in low pH environments. The (G+H)(+) cations are studied using the same level of theory. The proton affinity (PA) of guanine computed in this research (228.1 kcal/mol) is within 0.7 kcal/mol of the latest experiment value. The radicals range over 41 kcal/mol in relative energy, with radical r1, in which H is attached at the C8 site of guanine, having the lowest energy. The lowest energy anion is a2, derived by hydride ion attachment at the C2 site of guanine. No stable N2-site hydride should exist in the gas phase. Structure a9 was predicted to be dissociative in this research. The theoretical adiabatic electron affinities (AEA), vertical electron affinities, and vertical detachment energies were computed, with AEAs ranging from 0.07 to 3.12 eV for the nine radicals.

  12. Exploring the Use of a Guanine-Rich Catalytic DNA for Sulfoxide Preparation.


    Dellafiore, María A; Montserrat, Javier M; Iribarren, Adolfo M


    A guanine-rich DNA oligonucleotide complexed with hemin was used to catalyze controlled oxygen transfer reactions to different sulfides for sulfoxide preparation in the presence of H2O2. Comparable activities were obtained when using fully modified L-DNA. In addition, oligonucleotide immobilization led to an active catalyst which could be successfully recovered and reused without loss of activity.

  13. Magnetic control of the inclination of biogenic guanine crystals fixed on a substrate

    NASA Astrophysics Data System (ADS)

    Mizukawa, Yuri; Iwasaka, Masakazu


    In the present study, we describe the fabrication and manipulation of a micro-mirror system similar to the iridophores of neon tetra that allow microstructural light control. Biogenic guanine crystals as micro-mirrors were adhered to a glass substrate with flexible DNA joints under a vertical magnetic field of 480 mT. We then observed the movement of the micro-mirrors under sub-Tesla horizontal magnetic fields. Under ambient fields, the orientation of the guanine micro-mirrors did not change. Appling a horizontal magnetic field of approximately 400 mT generated by an electromagnet induced motion and width changes of the guanine micro-mirrors, which were observed by an optical microscope. However, the inclination of the micro-mirrors recovered upon removal of the magnetic field. The developed guanine micro-mirrors on a glass substrate demonstrate the remote control of microstructural diamagnetic materials, and may show promise for use as an underwater microactuator for microfluidic systems.

  14. Preparation of DNA and RNA Fragments Containing Guanine N2-Thioalkyl Tethers

    PubMed Central

    Hou, Xiaorong; Wang, Gang; Gaffney, Barbara L.; Jones, Roger A.


    This unit describes procedures for preparation of deoxyguanosine and guanosine derivatives in which the guanine N2 contains a thiopropyl tether, protected as a tert-butyl disulfide. After incorporation into a DNA or RNA fragment, this tether allows site-specific crosslinking to a thiol of a protein or another nucleic acid. PMID:20517990

  15. Coupling of guanine nucleotide inhibitory protein to somatostatin receptors on pancreatic acinar membranes

    SciTech Connect

    Sakamoto, C.; Matozaki, T.; Nagao, M.; Baba, S.


    Guanine nucleotides and pertussis toxin were used to investigate whether somatostatin receptors interact with the guanine nucleotide inhibitory protein (NI) on pancreatic acinar membranes in the rat. Guanine nucleotides reduced /sup 125/I-(Tyr/sup 1/)somatostatin binding to acinar membranes up to 80%, with rank order of potency being 5'-guanylyl imidodiphosphate (Gpp(NH)p)>GTP>TDP>GMP. Scatchard analysis revealed that the decrease in somatostatin binding caused by Gpp(NH)p was due to the decrease in the maximum binding capacity without a significant change in the binding affinity. The inhibitory effect of Gpp(NH)p was partially abolished in the absence of Mg/sup 2 +/. When pancreatic acini were treated with 1 pertussis toxin for 4 h, subsequent /sup 125/I-(Tyr/sup 1/)somatostatin binding to acinar membranes was reduced. Pertussis toxin treatment also abolished the inhibitory effect of somatostatin on vasoactive intestinal peptide-stimulated increase in cellular content of adenosine 3',5'-cyclic monophosphate (cAMP) in the acini. The present results suggest that 1) somatostatin probably functions in the pancreas to regulate adenylate cyclase enzyme system via Ni, 2) the extent of modification of Ni is correlated with the ability of somatostatin to inhibit cAMP accumulation in acini, and 3) guanine nucleotides also inhibit somatostatin binding to its receptor.

  16. Improved bioactivity of G-rich triplex-forming oligonucleotides containing modified guanine bases

    PubMed Central

    Rogers, Faye A; Lloyd, Janice A; Tiwari, Meetu Kaushik


    Triplex structures generated by sequence-specific triplex-forming oligonucleotides (TFOs) have proven to be promising tools for gene targeting strategies. In addition, triplex technology has been highly utilized to study the molecular mechanisms of DNA repair, recombination and mutagenesis. However, triplex formation utilizing guanine-rich oligonucleotides as third strands can be inhibited by potassium-induced self-association resulting in G-quadruplex formation. We report here that guanine-rich TFOs partially substituted with 8-aza-7-deaza-guanine (PPG) have improved target site binding in potassium compared with TFOs containing the natural guanine base. We designed PPG-substituted TFOs to bind to a polypurine sequence in the supFG1 reporter gene. The binding efficiency of PPG-substituted TFOs to the target sequence was analyzed using electrophoresis mobility gel shift assays. We have determined that in the presence of potassium, the non-substituted TFO, AG30 did not bind to its target sequence, however binding was observed with the PPG-substituted AG30 under conditions with up to 140 mM KCl. The PPG-TFOs were able to maintain their ability to induce genomic modifications as measured by an assay for gene-targeted mutagenesis. In addition, these compounds were capable of triplex-induced DNA double strand breaks, which resulted in activation of apoptosis. PMID:25483840

  17. An RNA aptamer to the xanthine/guanine base with a distinctive mode of purine recognition.

    PubMed Central

    Kiga, D; Futamura, Y; Sakamoto, K; Yokoyama, S


    RNAs that bind to xanthine (2,6-dioxypurine) were isolated from a population of 10(12) random sequences by in vitro selection. These xanthine-binding RNAs were found to have a 10 nt consensus sequence at an internal loop in the most probable secondary structure. By trimming one of the xanthine-binding RNAs, a representative xanthine-binding RNA (designated as XBA) of 32 nt residues was prepared. The dissociation constant of this RNA for xanthine was determined to be 3.3 microM by equilibrium filtration experiments. The XBA RNA can bind to guanine as well, whereas it hardly accommodates adenine, cytosine or uracil. The K d values for various xanthine/guanine analogues were determined, and revealed that the N1H, N7 and O6 moieties of the ligand are involved in the binding with the XBA RNA. The ribonuclease sensitivities of some internal-loop residues changed upon the addition of xanthine, suggesting that the internal loop of the XBA RNA is involved in the ligand binding. Interestingly, the consensus sequence of the xanthine/guanine-binding RNAs is the same as a sequence in one of the internal loops of the hairpin ribozyme, except for a substitution that is neutral with respect to xanthine/guanine binding. PMID:9512549

  18. Arxula adeninivorans recombinant guanine deaminase and its application in the production of food with low purine content.


    Trautwein-Schult, Anke; Jankowska, Dagmara; Cordes, Arno; Hoferichter, Petra; Klein, Christina; Matros, Andrea; Mock, Hans-Peter; Baronian, Keith; Bode, Rüdiger; Kunze, Gotthard


    Purines of exogenous and endogenous sources are degraded to uric acid in human beings. Concentrations >6.8 mg uric acid/dl serum cause hyperuricemia and its symptoms. Pharmaceuticals and the reduction of the intake of purine-rich food are used to control uric acid levels. A novel approach to the latter proposition is the enzymatic reduction of the purine content of food by purine-degrading enzymes. Here we describe the production of recombinant guanine deaminase by the yeast Arxula adeninivorans LS3 and its application in food. In media supplemented with nitrogen sources hypoxanthine or adenine, guanine deaminase (AGDA) gene expression is induced and intracellular accumulation of guanine deaminase (Agdap) protein occurs. The characteristics of the guanine deaminase isolated from wild-type strain LS3 and a transgenic strain expressing the AGDA gene under control of the strong constitutive TEF1 promoter were determined and compared. Both enzymes were dimeric and had temperature optima of 55°C with high substrate specificity for guanine and localisation in both the cytoplasm and vacuole of yeast. The enzyme was demonstrated to reduce levels of guanine in food. A mixture of guanine deaminase and other purine degradation enzymes will allow the reduction of purines in purine-rich foods. © 2014 S. Karger AG, Basel.

  19. Hypoxanthine-guanine phosphoribosyltransferase: characteristics of the mutant enzyme in erythrocytes from patients with the Lesch-Nyhan syndrome.


    Arnold, W J; Meade, J C; Kelley, W N


    The Lesch-Nyhan syndrome is characterized clinically by choreoathetosis, spasticity, selfmutilation, and mental and growth retardation. Biochemically, there is a striking reduction of hypoxanthine-guanine phosphoribosyltransferase (HGPRT) activity in affected individuals. We have examined erythrocytes from 14 patients with the Lesch-Nyhan syndrome for the presence of hypoxanthine-guanine phosphoribosyltransferase activity and enzyme protein. In contrast to the usual finding of no detectable hypoxanthine-guanine phosphoribosyltransferase activity, we have found low levels (0.002-0.79 nmoles/mg protein per hr) of hypoxanthine-guanine phosphoribosyltransferase activity in erythrocyte lysates from five of these patients. In three of the five patients, hypoxanthine-guanine phosphoribosyltransferase activity appeared to be substantially more labile in vivo than normal using erythrocytes which had been separated according to their density (age). Immunochemical studies using a monospecific antiserum prepared from a homogeneous preparation of normal human erythrocyte hypoxanthine-guanine phosphoribosyltransferase revealed immunoreactive protein (CRM) in hemolysate from all 14 patients with the Lesch-Nyhan syndrome. The immunoreactive protein from each patient gave a reaction of complete identity with normal erythrocyte hypoxanthine-guanine phosphoribosyltransferase and was present in quantities equal to those observed in normal erythrocytes. In addition, a constant amount of CRM was found in erythrocytes of increasing density (age) from patients with the Lesch-Nyhan syndrome despite the decreasing hypoxanthine-guanine phosphoribosyltransferase activity. These studies confirm previous data which indicate that the mutations leading to the Lesch-Nyhan syndrome are usually, if not always on the structural gene coding for hypoxanthine-guanine phosphoribosyltransferase. In addition, although the mutant proteins appear to be present in normal amounts, they are often very labile in

  20. Defective Guanine Nucleotide Exchange in the Elongation Factor-like 1 (EFL1) GTPase by Mutations in the Shwachman-Diamond Syndrome Protein*

    PubMed Central

    García-Márquez, Adrián; Gijsbers, Abril; de la Mora, Eugenio; Sánchez-Puig, Nuria


    Ribosome biogenesis is orchestrated by the action of several accessory factors that provide time and directionality to the process. One such accessory factor is the GTPase EFL1 involved in the cytoplasmic maturation of the ribosomal 60S subunit. EFL1 and SBDS, the protein mutated in the Shwachman-Diamond syndrome (SBDS), release the anti-association factor eIF6 from the surface of the ribosomal subunit 60S. Here we report a kinetic analysis of fluorescent guanine nucleotides binding to EFL1 alone and in the presence of SBDS using fluorescence stopped-flow spectroscopy. Binding kinetics of EFL1 to both GDP and GTP suggests a two-step mechanism with an initial binding event followed by a conformational change of the complex. Furthermore, the same behavior was observed in the presence of the SBDS protein irrespective of the guanine nucleotide evaluated. The affinity of EFL1 for GTP is 10-fold lower than that calculated for GDP. Association of EFL1 to SBDS did not modify the affinity for GTP but dramatically decreased that for GDP by increasing the dissociation rate of the nucleotide. Thus, SBDS acts as a guanine nucleotide exchange factor (GEF) for EFL1 promoting its activation by the release of GDP. Finally, fluorescence anisotropy measurements showed that the S143L mutation present in the Shwachman-Diamond syndrome altered a surface epitope for EFL1 and largely decreased the affinity for it. These results suggest that loss of interaction between these proteins due to mutations in the disease consequently prevents the nucleotide exchange regulation the SBDS exerts on EFL1. PMID:25991726

  1. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    PubMed Central

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.


    Inosine-5′-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches. PMID:26558346

  2. Guanine-based amphiphiles: synthesis, ion transport properties and biological activity.


    Musumeci, Domenica; Irace, Carlo; Santamaria, Rita; Milano, Domenico; Tecilla, Paolo; Montesarchio, Daniela


    Novel amphiphilic guanine derivatives, here named Gua1 and Gua2, have been prepared through few, simple and efficient synthetic steps. In ion transport experiments through phospholipid bilayers, carried out to evaluate their ability to mediate H(+) transport, Gua2 showed high activity. When this compound was investigated for ion-selective transport activities, no major differences were observed in the behaviour with cations while, in the case of anions, selective activity was observed in the series I(-)>Br(-)>Cl(-)>F(-). The bioactivity of these guanine analogues has been evaluated on a panel of human tumour and non-tumour cell lines in preliminary in vitro cytotoxicity assays, showing a relevant antiproliferative profile for Gua2. Copyright © 2014 Elsevier Ltd. All rights reserved.

  3. Absence of hypoxanthine:guanine phosphoribosyltransferase activity in murine Dunn osteosarcoma

    SciTech Connect

    Abelson, H.T.; Gorka, C.


    The transplantable murine Dunn osteosarcoma has no detectable hypoxanthine:guanine phosphoribosyltransferase (EC activity. This was established from the tumors directly and from tissue culture cell lines derived from the tumor using a variety of assays: e.g., no (3H)hypoxanthine uptake into tumor or tissue culture cells, no conversion of (3H)hypoxanthine to (3H)IMP by cell extracts from tumors or tissue culture cells, no growth of tissue culture cells in hypoxanthine:aminopterin:thymidine medium, and normal growth of these cells in 10 microM 6-mercaptopurine. Ten human osteosarcomas have been assayed, and two have no apparent hypoxanthine:guanine phosphoribosyltransferase enzyme activity. After high-dose methotrexate treatment in vivo, murine tumors could be selectively killed and normal tissues could be spared by using a rescue regimen of hypoxanthine-thymidine-allopurinol.

  4. Guanine nucleotide binding to the Bateman domain mediates the allosteric inhibition of eukaryotic IMP dehydrogenases

    NASA Astrophysics Data System (ADS)

    Buey, Rubén M.; Ledesma-Amaro, Rodrigo; Velázquez-Campoy, Adrián; Balsera, Mónica; Chagoyen, Mónica; de Pereda, José M.; Revuelta, José L.


    Inosine-5'-monophosphate dehydrogenase (IMPDH) plays key roles in purine nucleotide metabolism and cell proliferation. Although IMPDH is a widely studied therapeutic target, there is limited information about its physiological regulation. Using Ashbya gossypii as a model, we describe the molecular mechanism and the structural basis for the allosteric regulation of IMPDH by guanine nucleotides. We report that GTP and GDP bind to the regulatory Bateman domain, inducing octamers with compromised catalytic activity. Our data suggest that eukaryotic and prokaryotic IMPDHs might have developed different regulatory mechanisms, with GTP/GDP inhibiting only eukaryotic IMPDHs. Interestingly, mutations associated with human retinopathies map into the guanine nucleotide-binding sites including a previously undescribed non-canonical site and disrupt allosteric inhibition. Together, our results shed light on the mechanisms of the allosteric regulation of enzymes mediated by Bateman domains and provide a molecular basis for certain retinopathies, opening the door to new therapeutic approaches.

  5. Finding Adiabatically Bound Anions of Guanine through a Combinatorial Computational Approach

    SciTech Connect

    Haranczyk, Maciej; Gutowski, Maciej S.


    In summary, guanine supports many adiabatically bound valence anions, which result from enamine-imine transformations of the most stable neutral tautomers. These stable anionic tautomers have been found using combinatorial-computational prescreening at the B3LYP level of theory followed by CCSD(T)/aug-cc-pVDZ calculations. The new anionic tautomers contradict a common opinion that guanine has the lowest electron affinity among nucleobases. The new anionic tautomers might be formed in the course of dissociative electron attachment followed by a hydrogen atom attachment to a carbon atom. They might affect the structure and properties of DNA and RNA exposed to low-energy electrons. Chemical transformations of DNA triggered by the new anionic tautomers will be explored in our future studies.

  6. Structure-wise discrimination of adenine and guanine by proteins on the basis of their nonbonded interactions.


    Usha, S; Selvaraj, S


    We have analyzed the nonbonded interactions of the structurally similar moieties, adenine and guanine forming complexes with proteins. The results comprise (a) the amino acid-ligand atom preferences, (b) solvent accessibility of ligand atoms before and after complex formation with proteins, and (c) preferred amino acid residue atoms involved in the interactions. We have observed that the amino acid preferences involved in the hydrogen bonding interactions vary for adenine and guanine. The structural variation between the purine atoms is clearly reflected by their burial tendency in the solvent environment. Correlation of the mean amino acid preference values show the variation that exists between adenine and guanine preferences of all the amino acid residues. All our observations provide evidence for the discriminating nature of the proteins in recognizing adenine and guanine.

  7. A Rab1 mutant affecting guanine nucleotide exchange promotes disassembly of the Golgi apparatus

    PubMed Central


    The Golgi apparatus is a dynamic organelle whose structure is sensitive to vesicular traffic and to cell cycle control. We have examined the potential role for rab1a, a GTPase previously associated with ER to Golgi and intra-Golgi transport, in the formation and maintenance of Golgi structure. Bacterially expressed, recombinant rab1a protein was microinjected into rat embryonic fibroblasts, followed by analysis of Golgi morphology by fluorescence and electron microscopy. Three recombinant proteins were tested: wild-type rab, mutant rab1a(S25N), a constitutively GDP-bound form (Nuoffer, C., H. W. Davidson, J. Matteson, J. Meinkoth, and W. E. Balch, 1994. J. Cell Biol. 125: 225- 237), and mutant rab1a(N124I) defective in guanine nucleotide binding. Microinjection of wild-type rab1a protein or a variety of negative controls (injection buffer alone or activated ras protein) did not affect the appearance of the Golgi, as visualized by immunofluorescence of alpha-mannosidase II (Man II), used as a Golgi marker. In contrast, microinjection of the mutant forms promoted the disassembly of the Golgi stacks into dispersed vesicular structures visualized by immunofluorescence. When S25N-injected cells were analyzed by EM after immunoperoxidase labeling, Man II was found in isolated ministacks and large vesicular elements that were often surrounded by numerous smaller unlabeled vesicles resembling carrier vesicles. Golgi disassembly caused by rab1a mutants differs from BFA-induced disruption, since beta- COP remains membrane associated, and Man II does not redistribute to the ER. BFA can still cause these residual Golgi elements to fuse and disperse, albeit at a slower rate. Moreover, BFA recovery is incomplete in the presence of rab1 mutants or GTP gamma S. We conclude that GTP exchange and hydrolysis by GTPases, specifically rab1a, are required to form and maintain normal Golgi stacks. The similarity of Golgi disassembly seen with rab1a mutants to that occurring during

  8. Benchmark Theoretical and Experimental Study on (15)N NMR Shifts of Oxidatively Damaged Guanine.


    Dračínský, Martin; Šála, Michal; Klepetářová, Blanka; Šebera, Jakub; Fukal, Jiří; Holečková, Veronika; Tanaka, Yoshiyuki; Nencka, Radim; Sychrovský, Vladimír


    The (15)N NMR shifts of 9-ethyl-8-oxoguanine (OG) were calculated and measured in liquid DMSO and in crystal. The OG molecule is a model for oxidatively damaged 2'-deoxyguanosine that occurs owing to oxidative stress in cell. The DNA lesion is repaired with human 8-oxoguanine glycosylase 1 (hOGG1) base-excision repair enzyme, however, the exact mechanism of excision of damaged nucleobase with hOGG1 is currently unknown. This benchmark study on (15)N NMR shifts of OG aims their accurate structural interpretation and calibration of the calculation protocol utilizable in future studies on mechanism of hOGG1 enzyme. The effects of NMR reference, DFT functional, basis set, solvent, structure, and dynamics on calculated (15)N NMR shifts were first evaluated for OG in crystal to calibrate the best performing calculation method. The effect of large-amplitude motions on (15)N NMR shifts of OG in liquid was calculated employing molecular dynamics. The B3LYP method with Iglo-III basis used for B3LYP optimized geometry with 6-311++G(d,p) basis and including effects of solvent and molecular dynamic was the calculation protocol used for calculation of (15)N NMR shifts of OG. The NMR shift of N9 nitrogen of OG was particularly studied because the atom is involved in an N-glycosidic bond that is cleaved with hOGG1. The change of N9 NMR shift owing to oxidation of 9-ethylguanine (G) measured in liquid was -27.1 ppm. The calculated N9 NMR shift of OG deviated from experiment in crystal and in liquid by 0.45 and 0.65 ppm, respectively. The calculated change of N9 NMR shift owing to notable N9-pyramidalization of OG in one previously found polymorph was 20.53 ppm. We therefore assume that the pyramidal geometry of N9 nitrogen that could occur for damaged DNA within hOGG1 catalytic site might be detectable with (15)N NMR spectroscopy. The calculation protocol can be used for accurate structural interpretation of (15)N NMR shifts of oxidatively damaged guanine DNA residue.

  9. Protein–DNA charge transport: Redox activation of a DNA repair protein by guanine radical

    PubMed Central

    Yavin, Eylon; Boal, Amie K.; Stemp, Eric D. A.; Boon, Elizabeth M.; Livingston, Alison L.; O'Shea, Valerie L.; David, Sheila S.; Barton, Jacqueline K.


    DNA charge transport (CT) chemistry provides a route to carry out oxidative DNA damage from a distance in a reaction that is sensitive to DNA mismatches and lesions. Here, DNA-mediated CT also leads to oxidation of a DNA-bound base excision repair enzyme, MutY. DNA-bound Ru(III), generated through a flash/quench technique, is found to promote oxidation of the [4Fe-4S]2+ cluster of MutY to [4Fe-4S]3+ and its decomposition product [3Fe-4S]1+. Flash/quench experiments monitored by EPR spectroscopy reveal spectra with g = 2.08, 2.06, and 2.02, characteristic of the oxidized clusters. Transient absorption spectra of poly(dGC) and [Ru(phen)2dppz]3+ (dppz = dipyridophenazine), generated in situ, show an absorption characteristic of the guanine radical that is depleted in the presence of MutY with formation instead of a long-lived species with an absorption at 405 nm; we attribute this absorption also to formation of the oxidized [4Fe-4S]3+ and [3Fe-4S]1+ clusters. In ruthenium-tethered DNA assemblies, oxidative damage to the 5′-G of a 5′-GG-3′ doublet is generated from a distance but this irreversible damage is inhibited by MutY and instead EPR experiments reveal cluster oxidation. With ruthenium-tethered assemblies containing duplex versus single-stranded regions, MutY oxidation is found to be mediated by the DNA duplex, with guanine radical as an intermediate oxidant; guanine radical formation facilitates MutY oxidation. A model is proposed for the redox activation of DNA repair proteins through DNA CT, with guanine radicals, the first product under oxidative stress, in oxidizing the DNA-bound repair proteins, providing the signal to stimulate DNA repair. PMID:15738421

  10. Solubilization and reconstitution of the formylmethionylleucylphenylalanine receptor coupled to guanine nucleotide regulatory protein

    SciTech Connect

    Williamson, K.; Dickey, B.F.; Pyun, H.Y.; Navarro, J.


    The authors describe the solubilization, resolution, and reconstitution of the formylmethionylleucylphenylalanine (fMet-Leu-Phe) receptor and guanine nucleotide regulatory proteins (G-proteins). The receptor was solubilized with 3-((3-cholamidopropyl)dimethylammonio)-1-propanesulfonate. Guanine nucleotides decreased the number of high-affinity binding sites and accelerated the rate of dissociation of the receptor-ligand complex, suggesting that the solubilized receptor remained coupled to endogenous G-proteins. The solubilized receptor was resolved from endogenous G-proteins by fractionation on a wheat germ agglutinin (WGA)-Sepharose 4B column. High-affinity (/sup 3/H)fMet-Leu-Phe binding to the WGA-purified receptor was diminished and exhibited reduced guanine nucleotide sensitivity. High-affinity (/sup 3/H)fMET-Leu-Phe binding and guanine nucleotide sensitivity were reconstituted upon the addition of purified brain G-proteins. Similar results were obtained when the receptor was reconstituted with brain G-proteins into phospholipid vesicles by gel filtration chromatography. In addition, they also demonstrated fMET-Leu-Phe-dependent GTP hydrolysis in the reconstituted vesicles. The results of this work indicate that coupling of the fMet-Leu-Phe receptor to G-proteins converts the receptor to a high-affinity binding state and that agonist produces activation of G-proteins. The resolution and functional reconstitution of this receptor should provide an important step toward the elucidation of the molecular mechanism of the fMet-Leu-Phe transduction system in neutrophils.

  11. Mutations in the guanine nucleotide exchange factor gene IQSEC2 cause nonsyndromic intellectual disability

    PubMed Central

    Shoubridge, Cheryl; Tarpey, Patrick S; Abidi, Fatima; Ramsden, Sarah L; Rujirabanjerd, Sinitdhorn; Murphy, Jessica A; Boyle, Jackie; Shaw, Marie; Gardner, Alison; Proos, Anne; Puusepp, Helen; Raymond, F Lucy; Schwartz, Charles E; Stevenson, Roger E; Turner, Gill; Field, Michael; Walikonis, Randall S; Harvey, Robert J; Hackett, Anna; Futreal, P Andrew; Stratton, Michael R; Gécz, Jozef


    The first family identified as having a nonsyndromic intellectual disability was mapped in 1988. Here we show that a mutation of IQSEC2, encoding a guanine nucleotide exchange factor for the ADP-ribosylation factor family of small GTPases, caused this disorder. In addition to MRX1, IQSEC2 mutations were identified in three other families with X-linked intellectual disability. This discovery was made possible by systematic and unbiased X chromosome exome resequencing. PMID:20473311

  12. Stimulation of phospholipase C by guanine-nucleotide-binding protein beta gamma subunits.


    Camps, M; Hou, C; Sidiropoulos, D; Stock, J B; Jakobs, K H; Gierschik, P


    We have previously shown that soluble fractions obtained from human HL-60 granulocytes contain a phospholipase C which is markedly stimulated by the stable GTP analogue guanosine 5'-[3-O-thio]triphosphate (Camps, M., Hou, C., Jakobs, K. H. and Gierschik, P. (1990) Biochem. J. 271, 743-748]. To investigate whether this stimulation was due to a soluble alpha subunit of a heterotrimeric guanine-nucleotide-binding protein or a soluble low-molecular-mass GTP-binding protein, we have examined the effect of purified guanine-nucleotide-binding protein beta gamma dimers on the phospholipase-C-mediated formation of inositol phosphates by HL-60 cytosol. We found that beta gamma subunits, purified from bovine retinal transducin (beta gamma t), markedly stimulated the hydrolysis of phosphatidylinositol 4,5-bisphosphate by this phospholipase C preparation. The stimulation of phospholipase C by beta gamma t was not secondary to a phospholipase-A2-mediated generation of arachidonic acid, was prevented by the GDP-liganded transducin alpha subunit and was additive to activation of phospholipase C by guanosine 5'-[3-O-thio]triphosphate. Beta gamma t also stimulated soluble phospholipase C from human and bovine peripheral neutrophils, as well as membrane-bound, detergent-solubilized phospholipase C from HL-60 cells. Stimulation of soluble HL-60 phospholipase C was not restricted to beta gamma t, but was also observed with highly purified beta gamma subunits from bovine brain. Fractionation of HL-60 cytosol by anion-exchange chromatography revealed the existence of at least two distinct forms of phospholipase C in HL-60 granulocytes. Only one of these forms was sensitive to stimulation by beta gamma t, demonstrating that stimulation of phospholipase C by beta gamma subunits is isozyme specific. Taken together, our results suggest that guanine-nucleotide-binding protein beta gamma subunits may play an important and active role in mediating the stimulation of phospholipase C by

  13. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte

    PubMed Central

    Dutta, Dipak; Nagapradeep, N.; Zhu, Haijin; Forsyth, Maria; Verma, Sandeep; Bhattacharyya, Aninda J.


    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it’s in-built supply of Li+-ions, exhibited remarkably high lithium-ion transference number (= 0.75) and tunable room temperature ionic conductivity spanning three decades (≈10−7 to 10−3 Ω−1 cm−1) as a function of moisture content. The ionic conductivity show a distinct reversible transition around 80–100 °C, from a dual Li+ and H+ (<100 °C) to a pure Li+ conductor (>100 °C). Systematic studies reveal a transition from water-assisted Li-ion transport to Li hopping-like mechanism involving guanine-Li coordination. While as-synthesized G7Li has potential in humidity sensors, the anhydrous G7Li is attractive for rechargeable batteries. PMID:27091631

  14. Oxidative modification of guanine bases initiated by oxyl radicals derived from photolysis of azo compounds.


    Shao, Jie; Geacintov, Nicholas E; Shafirovich, Vladimir


    Oxidative damage to guanine bases initiated by photolysis of the water-soluble radical generator 2,2'-azobis(2-amidinopropane) dihydrochloride (AAPH) has been investigated by laser kinetic spectroscopy. In the neutral oxygenated aqueous solutions, 355 nm laser flash photolysis of AAPH generates a whole spectrum of free radicals including 2-amidinoprop-2-peroxyl (ROO(*)), 2-amidinoprop-2-oxyl (RO(*)), and superoxide (O(2)(*-)) radicals. These oxyl radicals with negligible absorption in a near UV-visible range were monitored in the reactions leading to the products with characteristic absorption spectra. This approach reveals that RO(*) radicals induce fast one-electron oxidation of 2'-deoxyguanosine (dG) to form guanine neutral radicals, dG(-H)(*). In contrast, ROO(*) radicals do not react at observable rates with dG. The O(2)(*-) radicals were detected using a classical test reaction with tetranitromethane to form nitroform. The major pathway for formation of the end-products of guanine oxidation is the combination of the G(-H)(*) and O(2)(*-) radicals to form 2,5-diamino-4H-imidazolone (Iz). This mechanism was confirmed by analysis of the end-products produced by oxidation of two substrates: (1) the guanosine derivative 2',3',5'-tri-O-acetylguanosine (tri-O-Ac-G) and (2) the 5'-d(CCATCGCTACC) sequence. The major products isolated by HPLC and identified by mass spectrometry methods were the tri-O-Ac-Iz and 5'-d(CCATC[Iz]CTACC products.

  15. Guanine-aspartic acid interactions probed with IR-UV resonance spectroscopy.


    Crews, Bridgit O; Abo-Riziq, Ali; Pluhácková, Kristýna; Thompson, Patrina; Hill, Glake; Hobza, Pavel; de Vries, Mattanjah S


    Double resonance spectroscopy of clusters of guanine with aspartic acid reveals geometries similar to patterns exhibited in DNA base pairs. In the spectral region of 32,800 cm(-1) to 35,500 cm(-1) we observe five isomers of guanine-aspartic acid clusters and assign their structures based on IR-UV hole-burning spectra and wave function theory calculations at the MP2/cc-pVDZ and MP2/cc-pVTZ levels. The calculations employed both harmonic and one-dimensional scan anharmonic approximations. Three of the isomers are similar, assigned to structures containing three hydrogen bonds and 9-enolguanine. We assign the fourth isomer to a structure containing a 9-keto tautomer of guanine and forming a triply bonded structure similar to a base pairing interaction. The fifth isomer dissociates with proton transfer upon excitation or ionization. This is the first set of experiments and high-level ab initio calculations of the isolated, microscopic interactions of an amino acid and a nucleobase, the building blocks of nucleic acids and proteins.

  16. Activation of G Proteins by Guanine Nucleotide Exchange Factors Relies on GTPase Activity

    PubMed Central

    Stanley, Rob J.; Thomas, Geraint M. H.


    G proteins are an important family of signalling molecules controlled by guanine nucleotide exchange and GTPase activity in what is commonly called an ‘activation/inactivation cycle’. The molecular mechanism by which guanine nucleotide exchange factors (GEFs) catalyse the activation of monomeric G proteins is well-established, however the complete reversibility of this mechanism is often overlooked. Here, we use a theoretical approach to prove that GEFs are unable to positively control G protein systems at steady-state in the absence of GTPase activity. Instead, positive regulation of G proteins must be seen as a product of the competition between guanine nucleotide exchange and GTPase activity—emphasising a central role for GTPase activity beyond merely signal termination. We conclude that a more accurate description of the regulation of G proteins via these processes is as a ‘balance/imbalance’ mechanism. This result has implications for the understanding of intracellular signalling processes, and for experimental strategies that rely on modulating G protein systems. PMID:26986850

  17. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte

    NASA Astrophysics Data System (ADS)

    Dutta, Dipak; Nagapradeep, N.; Zhu, Haijin; Forsyth, Maria; Verma, Sandeep; Bhattacharyya, Aninda J.


    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it’s in-built supply of Li+-ions, exhibited remarkably high lithium-ion transference number (= 0.75) and tunable room temperature ionic conductivity spanning three decades (≈10‑7 to 10‑3 Ω‑1 cm‑1) as a function of moisture content. The ionic conductivity show a distinct reversible transition around 80–100 °C, from a dual Li+ and H+ (<100 °C) to a pure Li+ conductor (>100 °C). Systematic studies reveal a transition from water-assisted Li-ion transport to Li hopping-like mechanism involving guanine-Li coordination. While as-synthesized G7Li has potential in humidity sensors, the anhydrous G7Li is attractive for rechargeable batteries.

  18. Magnetic Control of the Light Reflection Anisotropy in a Biogenic Guanine Microcrystal Platelet.


    Iwasaka, Masakazu; Mizukawa, Yuri; Roberts, Nicholas W


    Bioinspired but static optical devices such as lenses, retarders, and reflectors have had a significant impact on the designs of many man-made optical technologies. However, while numerous adaptive and flexible optical mechanisms are found throughout the animal kingdom, highly desirable biomimetic copies of these remarkable smart systems remain, in many cases, a distant dream. Many aquatic animals have evolved highly efficient reflectors based on multilayer stacks of the crystallized nucleic acid base guanine. With exceptional levels of spectral and intensity control, these reflectors represent an interesting design pathway towards controllable micromirror structures. Here we show that individual guanine crystals, with dimensions of 5 μm × 20 μm × 70 nm, can be magnetically controlled to act as individual micromirrors. By applying magnetic fields of 500 mT, the reflectivity of these crystals can be switched off and on for the change in reflectivity. Overall, the use of guanine represents a novel design scheme for a highly efficient and controllable synthetic organic micromirror array.

  19. Guanine nucleotide-induced polymerization of actin in electropermeabilized human neutrophils

    PubMed Central


    The effects of exogenous guanine nucleotides on the polymerization of actin in human neutrophils were tested in an electropermeabilized cell preparation. Close to 40% permeabilization was achieved with a single electric discharge as measured by nucleic acid staining with ethidium bromide or propidium iodide with minimal (less than 2%) release of the cytoplasmic marker lactate dehydrogenase. In addition, electropermeabilized neutrophils retained their capacity to produce superoxide anions and to sustain a polymerization of actin in response to surface-receptor dependent stimuli such as chemotactic factors. Electropermeabilization produced a rapid and transient permeabilization that allowed the entry of guanine nucleotides into the cells. GTP and, to a larger extent, its nonhydrolyzable analog guanosine 5'-O-2- thiotriphosphate (GTP[S]), induced a time- and concentration-dependent polymerization of actin, as determined by increased staining with 7- nitrobenz-2-oxa-1,3-diazolylphallacidin. The effects of the aforementioned guanine nucleotides were antagonized by GDP[S], but were insensitive to pertussis toxin. Cholera toxin potentiated to a small degree the amount of actin polymerization induced by GTP[S]. These results provided direct evidence for the involvement of GTP-binding proteins in the regulation of the organization of the cytoskeleton of neutrophils, an event that is of crucial importance to the performance of the defense-oriented functions of these cells. PMID:2768336

  20. Non-covalent functionalization of hexagonal boron nitride nanosheets with guanine.


    Anota, E Chigo; Tlapale, Y; Villanueva, M Salazar; Márquez, J A Rivera


    Density functional theory (DFT) calculations were performed to analyze changes in the structural and electronic properties generated by the interaction of a single nucleobase group (guanine) with the surface of boron nitride nanosheets with hexagonal symmetry (hBNNs). Nanosheets in two contexts were tested: pristine sheets and with point defects (doped with carbon atoms). The criterion of energy minimum was used to find the ground state of the nine possible isomers generated by the hBNNs-guanine interaction. The phenomenon of physisorption is known to occur at values less than 1.0 eV; the adsorption energy results revealed that the preferential geometry was a parallel arrangement between the two partners, with van der Waals-type bonds generated for the hBNNs doped with two carbon atoms. This was the only energetically stable configuration, thus revealing a vibrational mode rather than imaginaries. Furthermore, the hBNNs/C-guanine system has a low value for work function, and therefore could be used in health applications such drug transport and delivery. The increased polarity values suggest that these nanosheets could be solubilized in common solvents used in experimental processes.

  1. Singlet Oxygen Attack on Guanine: Reactivity and Structural Signature within the B-DNA Helix.


    Dumont, Elise; Grüber, Raymond; Bignon, Emmanuelle; Morell, Christophe; Aranda, Juan; Ravanat, Jean-Luc; Tuñón, Iñaki


    Oxidatively generated DNA lesions are numerous and versatile, and have been the subject of intensive research since the discovery of 8-oxoguanine in 1984. Even for this prototypical lesion, the precise mechanism of formation remains elusive due to the inherent difficulties in characterizing high-energy intermediates. We have probed the stability of the guanine endoperoxide in B-DNA as a key intermediate and determined a unique activation free energy of around 6 kcal mol(-1) for the formation of the first C-O covalent bond upon the attack of singlet molecular oxygen ((1) O2 ) on the central guanine of a solvated 13 base-pair poly(dG-dC), described by means of quantum mechanics/molecular mechanics (QM/MM) simulations. The B-helix remains stable upon oxidation in spite of the bulky character of the guanine endoperoxide. Our modeling study has revealed the nature of the versatile (1) O2 attack in terms of free energy and shows a sensitivity to electrostatics and solvation as it involves a charge-separated intermediate. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Covalent Bonding of Pyrrolobenzodiazepines (PBDs) to Terminal Guanine Residues within Duplex and Hairpin DNA Fragments

    PubMed Central

    Mantaj, Julia; Jackson, Paul J. M.; Karu, Kersti; Rahman, Khondaker M.; Thurston, David E.


    Pyrrolobenzodiazepines (PBDs) are covalent-binding DNA-interactive agents with growing importance as payloads in Antibody Drug Conjugates (ADCs). Until now, PBDs were thought to covalently bond to C2-NH2 groups of guanines in the DNA-minor groove across a three-base-pair recognition sequence. Using HPLC/MS methodology with designed hairpin and duplex oligonucleotides, we have now demonstrated that the PBD Dimer SJG-136 and the C8-conjugated PBD Monomer GWL-78 can covalently bond to a terminal guanine of DNA, with the PBD skeleton spanning only two base pairs. Control experiments with the non-C8-conjugated anthramycin along with molecular dynamics simulations suggest that the C8-substituent of a PBD Monomer, or one-half of a PBD Dimer, may provide stability for the adduct. This observation highlights the importance of PBD C8-substituents, and also suggests that PBDs may bind to terminal guanines within stretches of DNA in cells, thus representing a potentially novel mechanism of action at the end of DNA strand breaks. PMID:27055050

  3. Formation of ring-opened and rearranged products of guanine: mechanisms and biological significance.


    Jena, N R; Mishra, P C


    DNA damage by endogenous and exogenous agents is a serious concern, as the damaged products can affect genome integrity severely. Damage to DNA may arise from various factors such as DNA base modifications, strand break, inter- and intrastrand crosslinks, and DNA-protein crosslinks. Among these factors, DNA base modification is a common and important form of DNA damage that has been implicated in mutagenesis, carcinogenesis, and many other pathological conditions. Among the four DNA bases, guanine (G) has the smallest oxidation potential, because of which it is frequently modified by reactive species, giving rise to a plethora of lethal lesions. Similarly, 8-oxo-7,8-dihydroguanine (8-oxoG), an oxidatively damaged guanine lesion, also undergoes various degradation reactions giving rise to several mutagenic species. The various products formed from reactions of G or 8-oxoG with different reactive species are mainly 2,6-diamino-4-oxo-5-formamidopyrimidine, 2,5-diamino-4H-imidazolone, 2,2,4-triamino-5-(2H)-oxazolone, 5-guanidino-4-nitroimidazole, guanidinohydantoin, spiroiminodihydantoin, cyanuric acid, parabanic acid, oxaluric acid, and urea, among others. These products are formed from either ring opening or ring opening and subsequent rearrangement. The main aim of this review is to provide a comprehensive overview of various possible reactions and the mechanisms involved, after which these ring-opened and rearranged products of guanine would be formed in DNA. The biological significance of oxidatively damaged products of G is also discussed.

  4. Rates of chemical cleavage of DNA and RNA oligomers containing guanine oxidation products.


    Fleming, Aaron M; Alshykhly, Omar; Zhu, Judy; Muller, James G; Burrows, Cynthia J


    The nucleobase guanine in DNA (dG) and RNA (rG) has the lowest standard reduction potential of the bases, rendering it a major site of oxidative damage in these polymers. Mapping the sites at which oxidation occurs in an oligomer via chemical reagents utilizes hot piperidine for cleaving oxidized DNA and aniline (pH 4.5) for cleaving oxidized RNA. In the present studies, a series of time-dependent cleavages of DNA and RNA strands containing various guanine lesions were examined to determine the strand scission rate constants. The guanine base lesions 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), 5-guanidinohydantoin (Gh), 2,2,4-triamino-2H-oxazol-5-one (Z), and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih) were evaluated in piperidine-treated DNA and aniline-treated RNA. These data identified wide variability in the chemical lability of the lesions studied in both DNA and RNA. Further, the rate constants for cleaving lesions in RNA were generally found to be significantly smaller than for lesions in DNA. The OG nucleotides were poorly cleaved in DNA and RNA; Sp nucleotides were slowly cleaved in DNA and did not cleave significantly in RNA; Gh and Z nucleotides cleaved in both DNA and RNA at intermediate rates; and 2Ih oligonucleotides cleaved relatively quickly in both DNA and RNA. The data are compared and contrasted with respect to future experimental design.

  5. DNA polymerase V allows bypass of toxic guanine oxidation products in vivo.


    Neeley, William L; Delaney, Sarah; Alekseyev, Yuriy O; Jarosz, Daniel F; Delaney, James C; Walker, Graham C; Essigmann, John M


    Reactive oxygen and nitrogen radicals produced during metabolic processes, such as respiration and inflammation, combine with DNA to form many lesions primarily at guanine sites. Understanding the roles of the polymerases responsible for the processing of these products to mutations could illuminate molecular mechanisms that correlate oxidative stress with cancer. Using M13 viral genomes engineered to contain single DNA lesions and Escherichia coli strains with specific polymerase (pol) knockouts, we show that pol V is required for efficient bypass of structurally diverse, highly mutagenic guanine oxidation products in vivo. We also find that pol IV participates in the bypass of two spiroiminodihydantoin lesions. Furthermore, we report that one lesion, 5-guanidino-4-nitroimidazole, is a substrate for multiple SOS polymerases, whereby pol II is necessary for error-free replication and pol V for error-prone replication past this lesion. The results spotlight a major role for pol V and minor roles for pol II and pol IV in the mechanism of guanine oxidation mutagenesis.

  6. Geometrical Characterization of Adenine And Guanine on Cu(110) By NEXAFS, XPS, And DFT Calculation

    SciTech Connect

    Furukawa, M.; Yamada, T.; Katano, S.; Kawai, M.; Ogasawara, H.; Nilsson, A.; /SLAC, SSRL /Stockholm U.


    Adsorption of purine DNA bases (guanine and adenine) on Cu(1 1 0) was studied by X-ray photoelectron spectroscopy (XPS), near-edge X-ray absorption fine-structure spectroscopy (NEXAFS), and density-functional theory (DFT) calculation. At coverages near 0.2 monolayers, Angular-resolved NEXAFS analysis revealed that adenine adsorbates lie almost flat and that guanine adsorbates are tilted up on the surface with the purine ring parallel to the atom rows of Cu(1 1 0). Referring to the previous studies on pyrimidine DNA bases [M. Furukawa, H. Fujisawa, S. Katano, H. Ogasawara, Y. Kim, T. Komeda, A. Nilsson, M. Kawai, Surf. Sci. 532-535 (2003) 261], the isomerization of DNA bases on Cu(1 1 0) was found to play an important role in the adsorption geometry. Guanine, thymine and cytosine adsorption have an amine-type nitrogen next to a carbonyl group, which is dehydrogenated into imine nitrogen on Cu(1 1 0). These bases are bonded by the inherent portion of - NH-CO - altered by conversion into enolic form and dehydrogenation. Adenine contains no CO group and is bonded to Cu(1 1 0) by participation of the inherent amine parts, resulting in nearly flatly-lying position.

  7. Rates of Chemical Cleavage of DNA and RNA Oligomers Containing Guanine Oxidation Products

    PubMed Central


    The nucleobase guanine in DNA (dG) and RNA (rG) has the lowest standard reduction potential of the bases, rendering it a major site of oxidative damage in these polymers. Mapping the sites at which oxidation occurs in an oligomer via chemical reagents utilizes hot piperidine for cleaving oxidized DNA and aniline (pH 4.5) for cleaving oxidized RNA. In the present studies, a series of time-dependent cleavages of DNA and RNA strands containing various guanine lesions were examined to determine the strand scission rate constants. The guanine base lesions 8-oxo-7,8-dihydroguanine (OG), spiroiminodihydantoin (Sp), 5-guanidinohydantoin (Gh), 2,2,4-triamino-2H-oxazol-5-one (Z), and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih) were evaluated in piperidine-treated DNA and aniline-treated RNA. These data identified wide variability in the chemical lability of the lesions studied in both DNA and RNA. Further, the rate constants for cleaving lesions in RNA were generally found to be significantly smaller than for lesions in DNA. The OG nucleotides were poorly cleaved in DNA and RNA; Sp nucleotides were slowly cleaved in DNA and did not cleave significantly in RNA; Gh and Z nucleotides cleaved in both DNA and RNA at intermediate rates; and 2Ih oligonucleotides cleaved relatively quickly in both DNA and RNA. The data are compared and contrasted with respect to future experimental design. PMID:25853314

  8. N7-(carboxymethyl)guanine-Lithium Crystalline Complex: A Bioinspired Solid Electrolyte.


    Dutta, Dipak; Nagapradeep, N; Zhu, Haijin; Forsyth, Maria; Verma, Sandeep; Bhattacharyya, Aninda J


    Electrochemical device with components having direct significance to biological life processes is a potent futuristic strategy for the realization of all-round green and sustainable development. We present here synthesis design, structural analysis and ion transport of a novel solid organic electrolyte (G7Li), a compound reminiscent of ion channels, derived from regioisomeric N7-guanine-carboxylate conjugate and Li-ions. G7Li, with it's in-built supply of Li(+)-ions, exhibited remarkably high lithium-ion transference number (= 0.75) and tunable room temperature ionic conductivity spanning three decades (≈10(-7) to 10(-3) Ω(-1) cm(-1)) as a function of moisture content. The ionic conductivity show a distinct reversible transition around 80-100 °C, from a dual Li(+) and H(+) (<100 °C) to a pure Li(+) conductor (>100 °C). Systematic studies reveal a transition from water-assisted Li-ion transport to Li hopping-like mechanism involving guanine-Li coordination. While as-synthesized G7Li has potential in humidity sensors, the anhydrous G7Li is attractive for rechargeable batteries.

  9. Thiol-modifying phenylarsine oxide inhibits guanine nucleotide binding of Rho but not of Rac GTPases.


    Gerhard, Ralf; John, Harald; Aktories, Klaus; Just, Ingo


    Phenylarsine oxide (PAO) is a phosphotyrosine phosphatase inhibitor that cross-links vicinal thiol groups, thereby inactivating phosphatases possessing XCysXXCysX motifs. The RhoA-GTPase, but not the Rac1-GTPase, also possesses vicinal cysteines within the guanine nucleotide-binding region (aa 13-20) and the phosphohydrolase activity site. Treatment of Caco-2 cells with PAO showed a dose-dependent reorganization of the actin cytoskeleton, indicating involvement of Rho GTPases. As tested by pull-down experiments, RhoA, but not Rac1, from cell lysates was inactivated by PAO in a concentration-dependent manner. Modification of RhoA by PAO resulted in altered mobility on SDS-polyacrylamide gel electrophoresis, and PAO-modified RhoA was no longer substrate for C3-catalyzed ADP-ribosylation. Furthermore, RhoA treated with PAO, but not Rac1 treated with PAO, lost its property to bind to guanine nucleotides. Matrix-assisted laser desorption ionization-mass analysis of PAO-modified RhoA showed a mass shift according to an adduction of a single PAO molecule per molecule RhoA. Further analysis of Glu-C-generated RhoA peptides confirmed binding of PAO to a peptide harboring the guanine nucleotide binding region. Thus, PAO does not exclusively inhibit phosphotyrosine phosphatases but also inactivates RhoA by alteration of nucleotide binding.

  10. Electron microscopic visualization of complementary labeled DNA with platinum-containing guanine derivative.


    Loukanov, Alexandre; Filipov, Chavdar; Mladenova, Polina; Toshev, Svetlin; Emin, Saim


    The object of the present report is to provide a method for a visualization of DNA in TEM by complementary labeling of cytosine with guanine derivative, which contains platinum as contrast-enhanced heavy element. The stretched single-chain DNA was obtained by modifying double-stranded DNA. The labeling method comprises the following steps: (i) stretching and adsorption of DNA on the support film of an electron microscope grid (the hydrophobic carbon film holding negative charged DNA); (ii) complementary labeling of the cytosine bases from the stretched single-stranded DNA pieces on the support film with platinum containing guanine derivative to form base-specific hydrogen bond; and (iii) producing a magnified image of the base-specific labeled DNA. Stretched single-stranded DNA on a support film is obtained by a rapid elongation of DNA pieces on the surface between air and aqueous buffer solution. The attached platinum-containing guanine derivative serves as a high-dense marker and it can be discriminated from the surrounding background of support carbon film and visualized by use of conventional TEM observation at 100 kV accelerated voltage. This method allows examination of specific nucleic macromolecules through atom-by-atom analysis and it is promising way toward future DNA-sequencing or molecular diagnostics of nucleic acids by electron microscopic observation. © 2016 Wiley Periodicals, Inc.

  11. Aquifex aeolicus tRNA (N2,N2-guanine)-dimethyltransferase (Trm1) catalyzes transfer of methyl groups not only to guanine 26 but also to guanine 27 in tRNA.


    Awai, Takako; Kimura, Satoshi; Tomikawa, Chie; Ochi, Anna; Ihsanawati; Bessho, Yoshitaka; Yokoyama, Shigeyuki; Ohno, Satoshi; Nishikawa, Kazuya; Yokogawa, Takashi; Suzuki, Tsutomu; Hori, Hiroyuki


    Transfer RNA (N2,N2-guanine)-dimethyltransferase (Trm1) catalyzes N2,N2-dimethylguanine formation at position 26 (m(2)(2)G26) in tRNA. In the reaction, N2-guanine at position 26 (m(2)G26) is generated as an intermediate. The trm1 genes are found only in archaea and eukaryotes, although it has been reported that Aquifex aeolicus, a hyper-thermophilic eubacterium, has a putative trm1 gene. To confirm whether A. aeolicus Trm1 has tRNA methyltransferase activity, we purified recombinant Trm1 protein. In vitro methyl transfer assay revealed that the protein has a strong tRNA methyltransferase activity. We confirmed that this gene product is expressed in living A. aeolicus cells and that the enzymatic activity exists in cell extract. By preparing 22 tRNA transcripts and testing their methyl group acceptance activities, it was demonstrated that this Trm1 protein has a novel tRNA specificity. Mass spectrometry analysis revealed that it catalyzes methyl transfers not only to G26 but also to G27 in substrate tRNA. Furthermore, it was confirmed that native tRNA(Cys) has an m(2)(2)G26m(2)G27 or m(2)(2)G26m(2)(2)G27 sequence, demonstrating that these modifications occur in living cells. Kinetic studies reveal that the m2G26 formation is faster than the m(2)G27 formation and that disruption of the G27-C43 base pair accelerates velocity of the G27 modification. Moreover, we prepared an additional 22 mutant tRNA transcripts and clarified that the recognition sites exist in the T-arm structure. This long distance recognition results in multisite recognition by the enzyme.

  12. Crosslinking reactions of 4-amino-6-oxo-2-vinylpyrimidine with guanine derivatives and structural analysis of the adducts

    PubMed Central

    Kusano, Shuhei; Ishiyama, Shogo; Lam, Sik Lok; Mashima, Tsukasa; Katahira, Masato; Miyamoto, Kengo; Aida, Misako; Nagatsugi, Fumi


    DNA interstrand crosslinks (ICLs) are the primary mechanism for the cytotoxic activity of many clinical anticancer drugs, and numerous strategies for forming ICLs have been developed. One such method is using crosslink-forming oligonucleotides (CFOs). In this study, we designed a 4-amino-6-oxo-2-vinylpyrimidine (AOVP) derivative with an acyclic spacer to react selectively with guanine. The AOVP CFO exhibited selective crosslinking reactivity with guanine and thymine in DNA, and with guanine in RNA. These crosslinking reactions with guanine were accelerated in the presence of CoCl2, NiCl2, ZnCl2 and MnCl2. In addition, we demonstrated that the AOVP CFO was reactive toward 8-oxoguanine opposite AOVP in the duplex DNA. The structural analysis of each guanine and 8-oxoguanine adduct in the duplex DNA was investigated by high-resolution NMR. The results suggested that AOVP reacts at the N2 amine in guanine and at the N1 or N2 amines in 8-oxoguanine in the duplex DNA. This study demonstrated the first direct determination of the adduct structure in duplex DNA without enzyme digestion. PMID:26245348

  13. Lead(II)-catalyzed oxidation of guanine in solution studied with electrospray ionization mass spectrometry.


    Banu, Laura; Blagojevic, Voislav; Bohme, Diethard K


    The oxidation of guanine was investigated in water/methanol solution both in the absence and in the presence of Pb(II) with a variable temperature reactor coupled to a tandem mass spectrometer that allowed signature ions of solution reagents and products to be monitored by electrospray ionization (ESI). Two different oxidizing agents were employed, one strong (peroxymonosulfuric acid) and one weaker (hydrogen peroxide). Peroxymonosulfuric acid was observed to oxidize guanine rapidly at room temperature, k(app) > 10(-2) s(-1), whether in the absence or in the presence of Pb(II), to produce spiroiminohydantoin. Guanine did not show measurable oxidation by hydrogen peroxide in the absence of Pb(II) at concentrations of H(2)O(2) up to 1 M at temperatures up to 333 K (k(app) < 3 × 10(-8) s(-1) at 298 K), but in the presence of Pb(II), it was observed to produce both 5-carboxamido-5-formamido-2-iminohydantoin (2-Ih) and imidazolone (Iz) in a ratio of 2.3 ± 0.1 with a total rate enhancement of more than 4 × 10(3). The activation energy was measured to be 82 ± 11 kJ mol(-1) and is more than 120 kJ mol(-1) lower than that for the uncatalyzed oxidation with hydrogen peroxide measured to be at least 208 ± 26 kJ mol(-1). An activation energy of 113 ± 9 kJ mol(-1) has been reported by Bruskov et al. (Nucleic Acids Res.2002, 30, 1354) for the heat-induced oxidation by hydrogen peroxide of guanine embedded as guanosine in DNA which leads to the production of 8-oxo-7,8-dihydro-guanine (8-oxo-Gua). The atomic lead dication lowers the activation energy by activating the hydrogen peroxide oxidant, possibly by O-O bond activation, and by directing the oxidation, possibly through coordination to the functional groups adjacent to the carbon C5: the C6 carbonyl group and the N7 nitrogen. The coupling of tandem mass spectrometry (MS(2)) with a simple variable temperature reactor by ESI proved to be very effective for measuring reaction kinetics and activation energies in solution

  14. Detection of Benzo[a]pyrene-Guanine Adducts in Single-Stranded DNA using the α-Hemolysin Nanopore

    PubMed Central

    Perera, Rukshan T.; Fleming, Aaron M.; Johnson, Robert P.; Burrows, Cynthia J.; White, Henry S.


    The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2′-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5′ or 3′ directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples. PMID:25629967

  15. Detection of benzo[a]pyrene-guanine adducts in single-stranded DNA using the α-hemolysin nanopore.


    Perera, Rukshan T; Fleming, Aaron M; Johnson, Robert P; Burrows, Cynthia J; White, Henry S


    The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2'-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5' or 3' directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples.

  16. The Garz Sec7 domain guanine nucleotide exchange factor for Arf regulates salivary gland development in Drosophila

    PubMed Central

    Szul, Tomasz; Burgess, Jason; Jeon, Mili; Zinn, Kai; Marques, Guillermo; Brill, Julie A


    Surface delivery of proteins involved in cell-cell and cell-matrix interactions in cultured mammalian cells requires the GBF1 guanine nucleotide exchange factor. However, the role of GBF1 in delivery of adhesion proteins during organogenesis in intact animals has not been characterized. Here, we report the function of the fly GBF1 homolog, Gartenzwerg (Garz) in the development of the salivary gland in Drosophila melanogaster. We used the GAL4/UAS system to selectively deplete Garz from salivary gland cells. We show that depletion of Garz disrupts the secretory pathway as evidenced by the collapse of Golgi-localized Lava lamp (Lva) and the TGN-localized γ subunit of the clathrin-adaptor protein complex (AP-1). Additionally, Garz depletion inhibits trafficking of cell-cell adhesion proteins cadherin (DE-cad) and Flamingo to the cell surface. Disregulation of trafficking correlates with mistargeting of the tumor suppressor protein Discs large involved in epithelial polarity determination. Garz-depleted salivary cells are smaller and lack well-defined plasma membrane domains. Garz depletion also inhibits normal elongation and positioning of epithelial cells, resulting in a disorganized salivary gland that lacks a well defined luminal duct. Our findings suggest that Garz is essential for establishment of epithelial structures and demonstrate an absolute requirement for Garz during Drosophila development. PMID:21686256

  17. The Garz Sec7 domain guanine nucleotide exchange factor for Arf regulates salivary gland development in Drosophila.


    Szul, Tomasz; Burgess, Jason; Jeon, Mili; Zinn, Kai; Marques, Guillermo; Brill, Julie A; Sztul, Elizabeth


    Surface delivery of proteins involved in cell-cell and cell-matrix interactions in cultured mammalian cells requires the GBF1 guanine nucleotide exchange factor. However, the role of GBF1 in delivery of adhesion proteins during organogenesis in intact animals has not been characterized. Here, we report the function of the fly GBF1 homolog, Gartenzwerg (Garz) in the development of the salivary gland in Drosophila melanogaster. We used the GAL4/UAS system to selectively deplete Garz from salivary gland cells. We show that depletion of Garz disrupts the secretory pathway as evidenced by the collapse of Golgi-localized Lava lamp (Lva) and the TGN-localized γ subunit of the clathrin-adaptor protein complex (AP-1). Additionally, Garz depletion inhibits trafficking of cell-cell adhesion proteins cadherin (DE-cad) and Flamingo to the cell surface. Disregulation of trafficking correlates with mistargeting of the tumor suppressor protein Discs large involved in epithelial polarity determination. Garz-depleted salivary cells are smaller and lack well-defined plasma membrane domains. Garz depletion also inhibits normal elongation and positioning of epithelial cells, resulting in a disorganized salivary gland that lacks a well defined luminal duct. Our findings suggest that Garz is essential for establishment of epithelial structures and demonstrate an absolute requirement for Garz during Drosophila development.

  18. Detection of benzo[a]pyrene-guanine adducts in single-stranded DNA using the α-hemolysin nanopore

    NASA Astrophysics Data System (ADS)

    Perera, Rukshan T.; Fleming, Aaron M.; Johnson, Robert P.; Burrows, Cynthia J.; White, Henry S.


    The carcinogenic precursor benzo[a]pyrene (BP), a polycyclic aromatic hydrocarbon, is released into the environment through the incomplete combustion of hydrocarbons. Metabolism of BP in the human body yields a potent alkylating agent (benzo[a]pyrene diol epoxide, BPDE) that reacts with guanine (G) in DNA to form an adduct implicated in cancer initiation. We report that the α-hemolysin (αHL) nanopore platform can be used to detect a BPDE adduct to G in synthetic oligodeoxynucleotides. Translocation of a 41-mer poly-2‧-deoxycytidine strand with a centrally located BPDE adduct to G through αHL in 1 M KCl produces a unique multi-level current signature allowing the adduct to be detected. This readily distinguishable current modulation was observed when the BPDE-adducted DNA strand translocated from either the 5‧ or 3‧ directions. This study suggests that BPDE adducts and other large aromatic biomarkers can be detected with αHL, presenting opportunities for the monitoring, quantification, and sequencing of mutagenic compounds from cellular DNA samples.

  19. Enforced Presentation of an Extrahelical Guanine to the Lesion Recognition Pocket of Human 8-Oxoguanine Glycosylase, hOGG1

    SciTech Connect

    Crenshaw, Charisse M.; Nam, Kwangho; Oo, Kimberly; Kutchukian, Peter S.; Bowman, Brian R.; Karplus, Martin; Verdine, Gregory L.


    A poorly understood aspect of DNA repair proteins is their ability to identify exceedingly rare sites of damage embedded in a large excess of nearly identical undamaged DNA, while catalyzing repair only at the damaged sites. Progress toward understanding this problem has been made by comparing the structures and biochemical behavior of these enzymes when they are presented with either a target lesion or a corresponding undamaged nucleobase. Trapping and analyzing such DNA-protein complexes is particularly difficult in the case of base extrusion DNA repair proteins because of the complexity of the repair reaction, which involves extrusion of the target base from DNA followed by its insertion into the active site where glycosidic bond cleavage is catalyzed. Here we report the structure of a human 8-oxoguanine (oxoG) DNA glycosylase, hOGG1, in which a normal guanine from DNA has been forcibly inserted into the enzyme active site. Although the interactions of the nucleobase with the active site are only subtly different for G versus oxoG, hOGG1 fails to catalyze excision of the normal nucleobase. This study demonstrates that even if hOGG1 mistakenly inserts a normal base into its active site, the enzyme can still reject it on the basis of catalytic incompatibility.

  20. Increased mobility and on/off ratio in organic field-effect transistors using low-cost guanine-pentacene multilayers

    NASA Astrophysics Data System (ADS)

    Shi, Wei; Zheng, Yifan; Taylor, André D.; Yu, Junsheng; Katz, Howard E.


    Layer-by-layer deposited guanine and pentacene in organic field-effect transistors (OFETs) is introduced. Through adjusting the layer thickness ratio of guanine and pentacene, the tradeoff of two electronic parameters in OFETs, charge carrier mobility and current on/off ratio, was controlled. The charge mobility was enhanced by depositing pentacene over and between guanine layers and by increasing the proportion of pentacene in the layer-by-layer system, while the current on/off ratio was increased via the decreased off current induced by the guanine layers. The tunable device performance was mainly ascribed to the trap and dopant neutralizing properties of the guanine layers, which would decrease the density of free hydroxyl groups in the OFETs. Furthermore, the cost of the devices could be reduced remarkably via the adoption of low-cost guanine.

  1. Effect of 10-T magnetic fields on structural colors in guanine crystals of fish scales

    NASA Astrophysics Data System (ADS)

    Iwasaka, M.; Miyashita, Y.; Kudo, M.; Kurita, S.; Owada, N.


    This work reports the magnetically modulated structural colors in the chromatophore of goldfish scales under static magnetic fields up to 10 T. A fiber optic system for spectroscopy measurements and a CCD microscope were set in the horizontal bore of a 10-T superconducting magnet. One leaf of a fish scale was set in a glass chamber, exposed to visible light from its side direction, and then static magnetic fields were applied perpendicular to the surface of the scale. In addition, an optical fiber for spectroscopy was directed perpendicular to the surface. During the magnetic field sweep-up, the aggregate of guanine thin plates partially showed a rapid light quenching under 0.26 to 2 T; however, most of the thin plates continued to scatter the side-light and showed changing iridescence, which was displayed individually by each guanine plate. For example, an aggregate in the chromatophore exhibited a dynamic change in structural color from white-green to dark blue when the magnetic fields changed from 2 to 10 T. The spectrum profile, which was obtained by the fiber optic system, confirmed the image color changes under magnetic field exposure. Also, a linearly polarized light transmission was measured on fish scales by utilizing an optical polarizer and analyzer. The transmitted polarized light intensities increased in the range of 500-550 nm compared to the intensity at 700 nm during the magnetic field sweep-up. These results indicate that the multi-lamella structure of nano-mirror plates in guanine hexagonal micro-plates exhibit diamagnetically modulated structure changes, and its light interference is affected by strong magnetic fields.

  2. Oxidative Modification of Guanine Bases Initiated by Oxyl Radicals Derived From Photolysis of Azo Compounds

    PubMed Central

    Shao, Jie; Geacintov, Nicholas E.; Shafirovich, Vladimir


    Oxidative damage to guanine bases initiated by photolysis of the water-soluble radical generator 2,2′-azobis(2-amidinopropane) dihydrochloride (AAPH) has been investigated by laser kinetic spectroscopy. In the neutral oxygenated aqueous solutions, 355 nm laser flash photolysis of AAPH generates a whole spectrum of free radicals including 2-amidinoprop-2-peroxyl (ROO•), 2-amidinoprop-2-oxyl (RO•), and superoxide (O2•−) radicals. These oxyl radicals with negligible absorption in a near UV – visible range were monitored in the reactions leading to the products with characteristic absorption spectra. This approach reveals that RO• radicals induce fast one-electron oxidation of 2′-deoxyguanosine (dG) to form guanine neutral radicals, dG(-H)•. In contrast, ROO• radicals do not react with observable rates with dG. The O2•− radicals were detected using a classical test reaction with tetranitromethane to form nitroform. The major pathway for formation of the end products of guanine oxidation is combination of the G(-H)• and O2•− radicals to form 2,5-diamino-4H-imidazolone (Iz). This mechanism was confirmed by analysis of the end products produced by oxidation of two substrates: (1) guanosine derivative 2′,3′,5′-tri-O-acetylguanosine (tri-O-Ac-G), and (2) the 5′-d(CCATCGCTACC) sequence. The major products isolated by HPLC and identified by mass spectrometry methods were the tri-O-Ac-Iz and 5′-d(CCATC[Iz]CTACC products. PMID:20415485

  3. Interactions of. beta. -adrenergic receptors with guanine nucleotide-binding proteins

    SciTech Connect

    Abramson, S.N.


    The properties of ..beta..-adrenergic receptors were investigated with radioligand binding assays using the agonists (/sup 3/H)hydroxybenzyl-isoproterenol (/sup 3/H-HBI) and (/sup 3/H)epinephrine (/sup 3/H-EPI), and the antagonist (/sup 125/I)iodopindolol (/sup 125/I-IPIN). Membranes prepared from L6 myoblasts bound (/sup 3/H)HBI, (/sup 3/H)EPI, and (/sup 125/I)IPIN with high affinity and Scatchard plots revealed densities of 222 +/- 23, 111 +/- 7, and 325 +/- 37 fmol/mg of protein, respectively. Binding of (/sup 3/H)HBI and (/sup 3/H)EPI was inhibited allosterically by guanine nucleotides. Membranes prepared from wild-type S49 lymphoma cells bound (/sup 3/H)HBI and (/sup 125/I)IPIN with high affinity and Scatchard plots revealed densities of 48.9 +/- 7.1 and 196 +/- 29 fmol/mg of protein, respectively. Binding of (/sup 3/H)HBI was inhibited allosterically by GTP. Similar results were obtained with membranes prepared from the adenylate cyclase deficient variant of S49 lymphoma cells (cyc-), which does not contain a functional stimulatory guanine nucleotide-binding protein (N/sub s/), but does contain a functional inhibitory guanine nucleotide-binding protein (N/sub i/). Binding of (/sup 3/H)HBI to membranes prepared from cyc- S49 cells was inhibited by pretreatment of cells with pertussis toxin. These results suggest that ..beta..-adrenergic receptors on membranes prepared from cyc- S49 cells interact with N/sub i/ to form a ternary complex composed of agonist, receptor, and N/sub i/.

  4. Fragmentation of the adenine and guanine molecules induced by electron collisions

    SciTech Connect

    Minaev, B. F. E-mail:; Shafranyosh, M. I.; Svida, Yu. Yu; Sukhoviya, M. I.; Shafranyosh, I. I.; Baryshnikov, G. V.; Minaeva, V. A.


    Secondary electron emission is the most important stage in the mechanism of radiation damage to DNA biopolymers induced by primary ionizing radiation. These secondary electrons ejected by the primary electron impacts can produce further ionizations, initiating an avalanche effect, leading to genome damage through the energy transfer from the primary objects to sensitive biomolecular targets, such as nitrogenous bases, saccharides, and other DNA and peptide components. In this work, the formation of positive and negative ions of purine bases of nucleic acids (adenine and guanine molecules) under the impact of slow electrons (from 0.1 till 200 eV) is studied by the crossed electron and molecular beams technique. The method used makes it possible to measure the molecular beam intensity and determine the total cross-sections for the formation of positive and negative ions of the studied molecules, their energy dependences, and absolute values. It is found that the maximum cross section for formation of the adenine and guanine positive ions is reached at about 90 eV energy of the electron beam and their absolute values are equal to 2.8 × 10{sup −15} and 3.2 × 10{sup −15} cm{sup 2}, respectively. The total cross section for formation of the negative ions is 6.1 × 10{sup −18} and 7.6 × 10{sup −18} cm{sup 2} at the energy of 1.1 eV for adenine and guanine, respectively. The absolute cross-section values for the molecular ions are measured and the cross-sections of dissociative ionization are determined. Quantum chemical calculations are performed for the studied molecules, ions and fragments for interpretation of the crossed beams experiments.

  5. Adenine and guanine nucleotide metabolism during platelet storage at 22 degree C

    SciTech Connect

    Edenbrandt, C.M.; Murphy, S. )


    Adenine and guanine nucleotide metabolism of platelet concentrates (PCs) was studied during storage for transfusion at 22 +/- 2 degrees C over a 7-day period using high-pressure liquid chromatography. There was a steady decrease in platelet adenosine triphosphate (ATP) and adenosine diphosphate (ADP), which was balanced quantitatively by an increase in plasma hypoxanthine. As expected, ammonia accumulated along with hypoxanthine but at a far greater rate. A fall in platelet guanosine triphosphate (GTP) and guanosine diphosphate (GDP) paralleled the fall in ATP + ADP. When adenine was present in the primary anticoagulant, it was carried over into the PC and metabolized. ATP, GTP, total adenine nucleotides, and total guanine nucleotides declined more slowly in the presence of adenine than in its absence. With adenine, the increase in hypoxanthine concentration was more rapid and quantitatively balanced the decrease in adenine and platelet ATP + ADP. Plasma xanthine rose during storage but at a rate that exceeded the decline in GTP + GDP. When platelet ATP + ADP was labeled with 14C-adenine at the initiation of storage, half of the radioactivity was transferred to hypoxanthine (45%) and GTP + GDP + xanthine (5%) by the time storage was completed. The isotopic data were consistent with the presence of a radioactive (metabolic) and a nonradioactive (storage) pool of ATP + ADP at the initiation of storage with each pool contributing approximately equally to the decline in ATP + ADP during storage. The results suggested a continuing synthesis of GTP + GDP from ATP + ADP, explaining the slower rate of fall of GTP + GDP relative to the rate of rise of plasma xanthine. Throughout storage, platelets were able to incorporate 14C-hypoxanthine into both adenine and guanine nucleotides but at a rate that was only one fourth the rate of hypoxanthine accumulation.

  6. Guanine nucleotide exchange factor Dock7 mediates HGF-induced glioblastoma cell invasion via Rac activation

    PubMed Central

    Murray, D W; Didier, S; Chan, A; Paulino, V; Van Aelst, L; Ruggieri, R; Tran, N L; Byrne, A T; Symons, M


    Background: Glioblastoma multiforme (GBM), a highly invasive primary brain tumour, remains an incurable disease. Rho GTPases and their activators, guanine nucleotide exchange factors (GEFs), have central roles in GBM invasion. Anti-angiogenic therapies may stimulate GBM invasion via HGF/c-Met signalling. We aim to identify mediators of HGF-induced GBM invasion that may represent targets in a combination anti-angiogenic/anti-invasion therapeutic paradigm. Methods: Guanine nucleotide exchange factor expression was measured by microarray analysis and western blotting. Specific depletion of proteins was accomplished using siRNA. Cell invasion was determined using matrigel and brain slice assays. Cell proliferation and survival were monitored using sulforhodamine B and colony formation assays. Guanine nucleotide exchange factor and GTPase activities were determined using specific affinity precipitation assays. Results: We found that expression of Dock7, a GEF, is elevated in human GBM tissue in comparison with non-neoplastic brain. We showed that Dock7 mediates serum- and HGF-induced glioblastoma cell invasion. We also showed that Dock7 co-immunoprecipitates with c-Met and that this interaction is enhanced upon HGF stimulation in a manner that is dependent on the adaptor protein Gab1. Dock7 and Gab1 also co-immunoprecipitate in an HGF-dependent manner. Furthermore, Gab1 is required for HGF-induced Dock7 and Rac1 activation and glioblastoma cell invasion. Conclusions: Dock7 mediates HGF-induced GBM invasion. Targeting Dock7 in GBM may inhibit c-MET-mediated invasion in tumours treated with anti-angiogenic regimens. PMID:24518591

  7. Solvent effect on the anharmonic vibrational frequencies in guanine-cytosine base pair

    NASA Astrophysics Data System (ADS)

    Bende, A.; Muntean, C. M.


    We present an ab initio study of the vibrational properties of cytosine and guanine in the Watson-Crick and Hoogsteen base pair configurations. The results are obtained by considering the DFT method together with the Polarizable Continuum Model (PCM) using PBE and B3PW91 exchange-correlation functionals and triple-ζ valence basis set. We investigate the importance of anharmonic corrections for the vibrational modes taking into account the solvent effect of the water environment. In particular, the unusual anharmonic effect of the H+ vibration in the case of the Hoogsteen base pair configuration is discussed.

  8. Purine salvage pathways of Bacillus subtilis and effect of guanine on growth of GMP reductase mutants.

    PubMed Central

    Endo, T; Uratani, B; Freese, E


    We have isolated numerous mutants containing mutations in the salvage pathways of purine synthesis. The mutations cause deficiencies in adenine phosphoribosyltransferase (adeF), in hypoxanthine-guanine phosphoribosyltransferase (guaF), in adenine deaminase (adeC), in inosine-guanosine phosphorylase, (guaP), and in GMP reductase (guaC). The physiological properties of mutants containing one or more of these mutations and corresponding enzyme measurements have been used to derive a metabolic chart of the purine salvage pathway of Bacillus subtilis. PMID:6408059

  9. Research Update: Density functional theory investigation of the interactions of silver nanoclusters with guanine

    NASA Astrophysics Data System (ADS)

    Dale, Brandon B.; Senanayake, Ravithree D.; Aikens, Christine M.


    Bare and guanine-complexed silver clusters Ag n z (n = 2-6; z = 0-2) are examined using density functional theory to elucidate the geometries and binding motifs that are present experimentally. Whereas the neutral systems remain planar in this size range, a 2D-3D transition occurs at Ag 5 + for the cationic system and at Ag 4 2 + for the dicationic system. Neutral silver clusters can bind with nitrogen 3 or with the pi system of the base. However, positively charged clusters interact with nitrogen 7 and the neighboring carbonyl group. Thus, the cationic silver-DNA clusters present experimentally may preferentially interact at these sites.

  10. First-Principles Vibrational Electron Energy Loss Spectroscopy of β -Guanine

    NASA Astrophysics Data System (ADS)

    Radtke, G.; Taverna, D.; Lazzeri, M.; Balan, E.


    A general approach to model vibrational electron energy loss spectra obtained using an electron beam positioned away from the specimen is presented. The energy-loss probability of the fast electron is evaluated using first-principles quantum mechanical calculations (density functional theory) of the dielectric response of the specimen. The validity of the method is assessed using recently measured anhydrous β -guanine, an important molecular solid used by animals to produce structural colors. The good agreement between theory and experiments lays the basis for a quantitative interpretation of this spectroscopy in complex systems.

  11. Generation of Guanine – Thymidine Cross-links in DNA by Peroxynitrite/Carbon Dioxide

    PubMed Central

    Yun, Byeong Hwa; Geacintov, Nicholas E.; Shafirovich, Vladimir


    Nitrosoperoxycarbonate derived from the combination of carbon dioxide and peroxynitrite, is an important chemical mediator of inflammation. In aqueous solutions, it rapidly decomposes to the reactive species CO3•− and •NO2 radicals that are known to initiate the selective oxidation and nitration of guanine in DNA. We have previously demonstrated that the reactions of carbonate radical anions with guanine in 2′-deoxyoligoribonucleotides generate a previously unknown intrastrand cross-linked guanine-thymine product G*-T* with a covalent bond between the C8 (G*) and thymine N3 (T*) atoms (Crean et al., Nucleic Acids Res., 2008, 36, 742–755). In this work we demonstrate that G*-T* cross-linked products are also formed when peroxynitrite (0.1 mM) reacts with native DNA in aqueous solutions (pH 7.5–7.7) containing 25 mM carbon dioxide/bicarbonate, in addition to the well known nitration/oxidation products of guanine such as 8-nitroguanine (8-nitroG), 5-guanidino-4-nitroimidazole (NIm), 8-oxo-7,8-dehydroguanine (8-oxoG) and spiroiminodihydantoin (Sp). The yields of these products, after enzymatic digestion with P1 nuclease and alkaline phosphatase to the nucleotide level, and reversed phase HPLC separation, were compared with those obtained with the uniformly, isotopically labeled 15N,13C-labeled 2′-deoxy oligoribonucleotides 5′-dGpT and 5′-dGpCpT. The d(G*pT*) and d(G*-T*) cross-linked products derived from the di- and tri-oligonucleotides, respectively, were used as standards for identifying the analogous lesions in calf thymus DNA by isotope dilution LC-MS/MS methods in the selected reaction-monitoring mode. The Nim and 8nitroG are the major products formed (~ 0.05% each), and lesser amounts of 8-oxoG (~ 0.02%), and d(G*pT*) and d(G*-T*) enzymatic digestion products (~ 0.002% each) were found. It is shown that the formation of d(G*pT*) enzyme digestion product can arise only from intrastrand cross-links, whereas d(G*-T*) can arise from both

  12. Generation of guanine-thymidine cross-links in DNA by peroxynitrite/carbon dioxide.


    Yun, Byeong Hwa; Geacintov, Nicholas E; Shafirovich, Vladimir


    Nitrosoperoxycarbonate derived from the combination of carbon dioxide and peroxynitrite is an important chemical mediator of inflammation. In aqueous solutions, it rapidly decomposes to the reactive species CO(3)(•-) and (•)NO(2) radicals that are known to initiate the selective oxidation and nitration of guanine in DNA. We have previously demonstrated that the reactions of carbonate radical anions with guanine in 2'-deoxyoligoribonucleotides generate a previously unknown intrastrand cross-linked guanine-thymine product G*-T* with a covalent bond between the C8 (G*) and the thymine N3 (T*) atoms (Crean Nucleic Acids Res. 2008, 36, 742-755). In this work, we demonstrate that G*-T* cross-linked products are also formed when peroxynitrite (0.1 mM) reacts with native DNA in aqueous solutions (pH 7.5-7.7) containing 25 mM carbon dioxide/bicarbonate, in addition to the well-known nitration/oxidation products of guanine such as 8-nitroguanine (8-nitro-G), 5-guanidino-4-nitroimidazole (NIm), 8-oxo-7,8-dehydroguanine (8-oxo-G), and spiroiminodihydantoin (Sp). The yields of these products, after enzymatic digestion with P1 nuclease and alkaline phosphatase to the nucleotide level and reversed phase HPLC separation, were compared with those obtained with the uniformly, isotopically labeled (15)N,(13)C-labeled 2'-deoxy oligoribonucleotides 5'-dGpT and 5'-dGpCpT. The d(G*pT*) and d(G*-T*) cross-linked products derived from the di- and trioligonucleotides, respectively, were used as standards for identifying the analogous lesions in calf thymus DNA by isotope dilution LC-MS/MS methods in the selected reaction monitoring mode. The NIm and 8-nitro-G are the major products formed (∼0.05% each), and lesser amounts of 8-oxo-G (∼0.02%) and d(G*pT*) and d(G*-T*) enzymatic digestion products (∼0.002% each) were found. It is shown that the formation of d(G*pT*) enzyme digestion product can arise only from intrastrand cross-links, whereas d(G*-T*) can arise from both interstrand

  13. Fluorescent Sensing of Guanine and Guanosine Monophosphate with Conjugated Receptors Incorporating Aniline and Naphthyridine Moieties.


    Lu, Shao-Hung; Phang, Riping; Fang, Jim-Min


    Ethyne-linked naphthyridine-aniline conjugated molecules are selective sensors of decylguanine in dichloromethane and guanosine monophosphate in water (Kass = 16,000 M(-1)). The 2-acetamido-1,8-naphthyridine moiety binds with guanine in a DAA-ADD triply hydrogen-bonded motif. The aniline moiety enhances an electron-donating effect, and the substituent is tuned to attain extra hydrogen bonds, π-π stacking, and electrostatic interactions. The proposed binding modes are supported by a Job plot, ESI-MS, (1)H NMR, UV-vis, and fluorescence spectral analyses.

  14. Experimental treatment of Staphylococcus aureus bovine intramammary infection using a guanine riboswitch ligand analog.


    Ster, C; Allard, M; Boulanger, S; Lamontagne Boulet, M; Mulhbacher, J; Lafontaine, D A; Marsault, E; Lacasse, P; Malouin, F


    Staphylococcus aureus is a leading cause of intramammary infections (IMI). We recently demonstrated that Staph. aureus strains express the gene guaA during bovine IMI. This gene codes for a guanosine monophosphate synthetase and its expression is regulated by a guanine riboswitch. The guanine analog 2,5,6-triaminopyrimidine-4-one (PC1) is a ligand of the guanine riboswitch. Interactions between PC1 and its target result in inhibition of guanosine monophosphate synthesis and subsequent death of the bacterium. The present study describes the investigational use of PC1 for therapy of Staph. aureus IMI in lactating cows. The in vitro minimal inhibitory concentration of PC1 ranged from 0.5 to 4 μg/mL for a variety of Staph. aureus and Staphylococcus epidermidis strains and required a reducing agent for stability and full potency. A safety assessment study was performed, whereby the healthy quarters of 4 cows were infused with increasing doses of PC1 (0, 150, 250, and 500 mg). Over the 44 h following infusions, no obvious adverse effect was observed. Ten Holstein multiparous cows in mid lactation were then experimentally infused into 3 of the quarters with approximately 50 cfu of Staph. aureus strain SHY97-3906 and infection was allowed to progress for 2 wk before starting PC1 treatment. Bacterial counts reached then about 10(3) to 10(4) cfu/mL of milk. Infected quarters were treated with 1 of 3 doses of PC1 (0, 250, or 500 mg) after each morning and evening milking for 7d (i.e., 14 intramammary infusions of PC1). During the treatment period, milk from PC1-treated quarters showed a significant reduction in bacterial concentrations. However, this reduction of Staph. aureus count in milk was not maintained during the 4 wk following the end of the treatment and only 15% of the PC1-treated quarters underwent bacteriological cure. The somatic cell count and the quarter milk production were not affected by treatments. Although bacterial clearance was not achieved following

  15. Electron and hole transfer from DNA base radicals to oxidized products of guanine in DNA.


    Cai, Zhongli; Sevilla, Michael D


    An investigation of electron and hole transfer to oxidized guanine bases in DNA is reported. Guanine in DNA was preferentially oxidized by Br(2)(*-) at 298 K to 8-oxo-7,8-dihydro-guanine (8-oxo-G) and higher oxidation products. HPLC-EC analysis of irradiated DNA shows that the formation of 8-oxo-G could not be increased above the ratio of one 8-oxo-G to 127 +/- 6 bp regardless of dose. 8-oxo-G can be produced only at low levels because it is further oxidized to other species. These oxidation products of guanine have been extensively investigated and identified by others. Our electron spin resonance studies suggest that at 77 K 8-oxo-G is a trap for radiation-produced holes, but certain further oxidation products of 8-oxo-G (G(ox)) are found to be efficient electron traps. Gamma irradiation of oxidized DNA samples in frozen (D(2)O) aqueous ices and glassy 7 M LiBr solutions resulted in radicals formed by electron attachment to the G(ox) sites that were monitored by electron spin resonance spectroscopy (ESR) at 77 K. These ESR spectra suggest that those oxidation products of 8-oxo-G containing alpha-diketo groups account for the electron traps (G(ox)) in oxidized DNA with oxaluric acid a likely major trap. Electron transfer from DNA anion radicals to G(ox) was followed by monitoring of their ESR signals with time at 77 K. Using typical values for the tunneling constant beta estimates of the relative amount of G(ox) to base pairs were obtained. Radicals formed by UV photolysis of oxidized DNA in 8 M NaClO(4) glassy aqueous solutions were also investigated. The 8-oxo-G cation accounts for less than 10% of all the radicals observed after either gamma irradiation of oxidized DNA in frozen (D(2)O) aqueous solution or UV photolysis of oxidized DNA in 8 M NaClO(4) glassy aqueous solutions. We estimate hole transfer distances of about 7 +/- 1 bp at 1 min from G(*+) to 8-oxo-G.

  16. Expression systems for industrial Gram-positive bacteria with low guanine and cytosine content.


    de Vos, W M; Kleerebezem, M; Kuipers, O P


    Recent years have seen an increase in the development of gene expression systems for industrial Gram-positive bacteria with low guanine and cytosine content that belong to the genera Bacillus, Clostridium, Lactococcus, Lactobacillus, Staphylococcus and Streptococcus. In particular, considerable advances have been made in the construction of inducible gene expression systems based on the capacity of these bacteria to utilize specific sugars or to secrete autoinducing peptides that are involved in quorum sensing. These controlled expression systems allow for present and future exploitation of these bacteria as cell factories in medical, agricultural, and food biotechnology.

  17. Insights into the biological functions of Dock family guanine nucleotide exchange factors.


    Laurin, Mélanie; Côté, Jean-François


    Rho GTPases play key regulatory roles in many aspects of embryonic development, regulating processes such as differentiation, proliferation, morphogenesis, and migration. Two families of guanine nucleotide exchange factors (GEFs) found in metazoans, Dbl and Dock, are responsible for the spatiotemporal activation of Rac and Cdc42 proteins and their downstream signaling pathways. This review focuses on the emerging roles of the mammalian DOCK family in development and disease. We also discuss, when possible, how recent discoveries concerning the biological functions of these GEFs might be exploited for the development of novel therapeutic strategies.

  18. Insights into the biological functions of Dock family guanine nucleotide exchange factors

    PubMed Central

    Laurin, Mélanie; Côté, Jean-François


    Rho GTPases play key regulatory roles in many aspects of embryonic development, regulating processes such as differentiation, proliferation, morphogenesis, and migration. Two families of guanine nucleotide exchange factors (GEFs) found in metazoans, Dbl and Dock, are responsible for the spatiotemporal activation of Rac and Cdc42 proteins and their downstream signaling pathways. This review focuses on the emerging roles of the mammalian DOCK family in development and disease. We also discuss, when possible, how recent discoveries concerning the biological functions of these GEFs might be exploited for the development of novel therapeutic strategies. PMID:24637113

  19. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    NASA Astrophysics Data System (ADS)

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.


    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  20. Silver (I) as DNA glue: Ag(+)-mediated guanine pairing revealed by removing Watson-Crick constraints.


    Swasey, Steven M; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G


    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag(+) is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg(2+). In contrast to prior studies of Ag(+) incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag(+)-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag(+) bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag(+)-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science.

  1. Direct experimental observation of the low ionization potentials of guanine in free oligonucleotides by using photoelectron spectroscopy

    PubMed Central

    Yang, Xin; Wang, Xue-Bin; Vorpagel, Erich R.; Wang, Lai-Sheng


    Photodetachment photoelectron spectroscopy is used to probe the electronic structure of mono-, di-, and trinucleotide anions in the gas phase. A weak and well defined threshold band was observed in the photoelectron spectrum of 2′-deoxyguanosine 5′-monophosphate at a much lower ionization energy than the other three mononucleotides. Density function theory calculations revealed that this unique spectral feature is caused by electron-detachment from a π orbital of the guanine base on 2′-deoxyguanosine 5′-monophosphate, whereas the lowest ionization channel for the other three mononucleotides takes place from the phosphate group. This low-energy feature was shown to be a “fingerprint” in all the spectra of dinucleotides and trinucleotides that contain the guanine base. The current experiment provides direct spectroscopic evidence that the guanine base is the site with the lowest ionization potential in oligonucleotides and DNA and is consistent with the fact that guanine is most susceptible to oxidation to give the guanine cation in DNA damage. PMID:15591345

  2. Simultaneous Determination of Adenine and Guanine Using Cadmium Selenide Quantum Dots-Graphene Oxide Nanocomposite Modified Electrode.


    Kalaivani, Arumugam; Narayanan, Sangilimuthu Sriman


    A novel electrochemical sensor was fabricated by immobilizing Cadmium Selenide Quantum Dots (CdSe QDs)-Graphene Oxide (GO) nanocomposite on a paraffin wax impregnated graphite electrode (PIGE) and was used for the simultaneous determination of adenine and guanine. The CdSe QDs-GO nanocomposite was prepared by ultrasonication and was characterized with spectroscopic and microscopic techniques. The nanocomposite modified electrode was characterized by cyclic voltammetry (CV). The modified electrode showed excellent electrocatalytic activity towards the oxidative determination of adenine and guanine with a good peak separation of 0.31 V. This may be due to the high surface area and fast electron transfer kinetics of the nanocomposite. The modified electrode exhibited wide linear ranges from 0.167 μM to 245 μM for Guanine and 0.083 μM to 291 μM for Adenine with detection limits of 0.055 μM Guanine and 0.028 μM of Adenine (S/N = 3) respectively. Further, the modified electrode was used for the quantitative determination of adenine and guanine in herring sperm DNA with satisfactory results. The modified electrode showed acceptable selectivity, reproducibility and stability under optimal conditions.

  3. Effect of hydration on the lowest singlet PiPi* excited-state geometry of guanine: a theoretical study.


    Shukla, M K; Leszczynski, Jerzy


    An ab-initio computational study was performed to investigate the effect of explicit hydration on the ground and lowest singlet PiPi* excited-state geometry and on the selected stretching vibrational frequencies corresponding to the different NH sites of the guanine acting as hydrogen-bond donors. The studied systems consisted of guanine interacting with one, three, five, six, and seven water molecules. Ground-state geometries were optimized at the HF level, while excited-state geometries were optimized at the CIS level. The 6-311G(d,p) basis set was used in all calculations. The nature of potential energy surfaces was ascertained via the harmonic vibrational frequency analysis; all structures were found minima at the respective potential energy surfaces. The changes in the geometry and the stretching vibrational frequencies of hydrogen-bond-donating sites of the guanine in the ground and excited state consequent to the hydration are discussed. It was found that the first solvation shell of the guanine can accommodate up to six water molecules. The addition of the another water molecule distorts the hydrogen-bonding network by displacing other neighboring water molecules away from the guanine plane.

  4. Silver (I) as DNA glue: Ag+-mediated guanine pairing revealed by removing Watson-Crick constraints

    PubMed Central

    Swasey, Steven M.; Leal, Leonardo Espinosa; Lopez-Acevedo, Olga; Pavlovich, James; Gwinn, Elisabeth G.


    Metal ion interactions with DNA have far-reaching implications in biochemistry and DNA nanotechnology. Ag+ is uniquely interesting because it binds exclusively to the bases rather than the backbone of DNA, without the toxicity of Hg2+. In contrast to prior studies of Ag+ incorporation into double-stranded DNA, we remove the constraints of Watson-Crick pairing by focusing on homo-base DNA oligomers of the canonical bases. High resolution electro-spray ionization mass spectrometry reveals an unanticipated Ag+-mediated pairing of guanine homo-base strands, with higher stability than canonical guanine-cytosine pairing. By exploring unrestricted binding geometries, quantum chemical calculations find that Ag+ bridges between non-canonical sites on guanine bases. Circular dichroism spectroscopy shows that the Ag+-mediated structuring of guanine homobase strands persists to at least 90 °C under conditions for which canonical guanine-cytosine duplexes melt below 20 °C. These findings are promising for DNA nanotechnology and metal-ion based biomedical science. PMID:25973536

  5. Electrocatalytic activity of molybdenum disulfide nanosheets enhanced by self-doped polyaniline for highly sensitive and synergistic determination of adenine and guanine.


    Yang, Tao; Yang, Ruirui; Chen, Huaiyin; Nan, Fuxin; Ge, Tong; Jiao, Kui


    Recently, easy, green, and low-cost liquild exfoliation of bulk materials to obtain thin-layered nanostructure significantly emerged. In this work, thin-layered molybdenum disulfide (MoS2) nanosheets were fabricated through intercalation of self-doped polyaniline (SPAN) to layer space of bulk MoS2 by ultrasonic exfoliating method to effectively prevent reaggregation of MoS2 nanosheets. The obtained hybrid showed specific surface area, a large number of electroactive species, and open accessible space, accompanied by rich negative charged and special conjugated structure, which was applied to adopt positively charged guanine and adenine, based on their strong π-π* interactions and electrostatic adsorption. Also, the SPAN-MoS2 interface exhibited the synergistic effect and good electrocatalytic activity compared with the sole SPAN or MoS2 modified electrode.

  6. Severe Gouty Arthritis and Mild Neurologic Symptoms Due to F199C, a Newly Identified Variant of the Hypoxanthine Guanine Phosphoribosyltransferase

    PubMed Central

    Ea, Hang-Korng; Bardin, Thomas; Jinnah, H. A.; Aral, Bernard; Lioté, Frédéric; Ceballos-Picot, Irène


    A deficiency in hypoxanthine guanine phosphoribosyltransferase (HPRT) activity leads to overproduction of uric acid. According to the degree of enzymatic deficiency, a large spectrum of neurologic features can also be observed, ranging from mild or no neurologic involvement to complete Lesch-Nyhan disease. Herein, we describe a patient with hyperuricemia, juvenile-onset gouty arthritis, nephrolithiasis, and mild neurologic symptoms, attributed to a newly identified variant of the hprt gene, c.596T>G, resulting in the amino acid change p.F199C. Residual HPRT activity (8%) protected against severe neurologic involvement in this patient. Modeling of the mutated protein was used to predict the mechanisms that led to partial enzymatic activity. Careful neurologic examination is warranted in juvenile and middle-aged patients with gout, in order to detect mild symptoms that may lead to a diagnosis of HPRT deficiency. PMID:19565499

  7. Identification and characterization of a novel Rho-specific guanine nucleotide exchange factor.

    PubMed Central

    Blomquist, A; Schwörer, G; Schablowski, H; Psoma, A; Lehnen, M; Jakobs, K H; Rümenapp, U


    Rho GTPases are implicated in a multitude of cellular processes regulated by membrane receptors, such as cytoskeletal rearrangements, gene transcription and cell growth and motility. Activation of these GTPases is under the direct control of guanine nucleotide exchange factors (GEFs), the Dbl family proteins. By searching protein databases we have identified a novel Rho-GEF, termed p114-Rho-GEF, which similarly to other Rho-GEFs contains a Dbl homology domain followed by a pleckstrin homology domain. p114-Rho-GEF interacted specifically with RhoA, in its nucleotide-free and guanosine 5'-[gamma-thio]triphosphate-bound states, but not with Rac1 and Cdc42, and efficiently catalysed guanine nucleotide exchange of RhoA. Consistent with these results in vitro was our finding that the overexpression of p114-Rho-GEF in J82 and HEK-293 cells induced the formation of actin stress fibres and stimulated serum-response-factor-mediated gene transcription in a Rho-dependent manner. Rho-mediated transcriptional activation induced by M(3) muscarinic acetylcholine and lysophosphatidic acid receptors was enhanced by p114-Rho-GEF, suggesting that the activity of this novel Rho-GEF, which is widely expressed in human tissues, can be controlled by G-protein-coupled receptors. PMID:11085924

  8. Cytosolic Na+ controls and epithelial Na+ channel via the Go guanine nucleotide-binding regulatory protein.

    PubMed Central

    Komwatana, P; Dinudom, A; Young, J A; Cook, D I


    In tight Na+-absorbing epithelial cells, the fate of Na+ entry through amiloride-sensitive apical membrane Na+ channels is matched to basolateral Na+ extrusion so that cell Na+ concentration and volume remain steady. Control of this process by regulation of apical Na+ channels has been attributed to changes in cytosolic Ca2+ concentration or pH, secondary to changes in cytosolic Na+ concentration, although cytosolic Cl- seems also to be involved. Using mouse mandibular gland duct cells, we now demonstrate that increasing cytosolic Na+ concentration inhibits apical Na+ channels independent of changes in cytosolic Ca2+, pH, or Cl-, and the effect is blocked by GDP-beta-S, pertussis toxin, and antibodies against the alpha-subunits of guanine nucleotide-binding regulatory proteins (Go). In contrast, the inhibitory effect of cytosolic anions is blocked by antibodies to inhibitory guanine nucleotide-binding regulatory proteins (Gi1/Gi2. It thus appears that apical Na+ channels are regulated by Go and Gi proteins, the activities of which are controlled, respectively, by cytosolic Na+ and Cl-. Images Fig. 4 PMID:8755611

  9. Chromosomal localization of genes encoding guanine nucleotide-binding protein subunits in mouse and human

    SciTech Connect

    Blatt, C.; Eversole-Cire, P.; Cohn, V.H.; Zollman, S.; Fournier, R.E.K.; Mohandas, L.T.; Nesbitt, M.; Lugo, T.; Jones, D.T.; Reed, R.R.; Weiner, L.P.; Sparkes, R.S.; Simon, M.I. )


    A variety of genes have been identified that specify the synthesis of the components of guanine nucleotide-binding proteins (G proteins). Eight different guanine nucleotide-binding {alpha}-subunit proteins, two different {beta} subunits, and one {gamma} subunit have been described. Hybridization of cDNA clones with DNA from human-mouse somatic cell hybrids was used to assign many of these genes to human chromosomes. The retinal-specific transducin subunit genes GNAT1 and GNAT2 were on chromosomes 3 and 1; GNAI1, GNAI2, and GNAI3 were assigned to chromosomes 7, 3, and 1, respectively; GNAZ and GNAS were found on chromosomes 22 and 20. The {beta} subunits were also assigned-GNB1 to chromosome 1 and GNB2 to chromosome 7. Restriction fragment length polymorphisms were used to map the homologues of some of these genes in the mouse. GNAT1 and GNAI2 were found to map adjacent to each other on mouse chromosome 9 and GNAT2 was mapped on chromosome 17. The mouse GNB1 gene was assigned to chromosome 19. These mapping assignments will be useful in defining the extend of the G{alpha} gene family and may help in attempts to correlate specific genetic diseases and with genes corresponding to G proteins.

  10. Cytosolic Na+ Controls an Epithelial Na+ Channel Via the Go Guanine Nucleotide-Binding Regulatory Protein

    NASA Astrophysics Data System (ADS)

    Komwatana, P.; Dinudom, A.; Young, J. A.; Cook, D. I.


    In tight Na+-absorbing epithelial cells, the rate of Na+ entry through amiloride-sensitive apical membrane Na+ channels is matched to basolateral Na+ extrusion so that cell Na+ concentration and volume remain steady. Control of this process by regulation of apical Na+ channels has been attributed to changes in cytosolic Ca2+ concentration or pH, secondary to changes in cytosolic Na+ concentration, although cytosolic Cl- seems also to be involved. Using mouse mandibular gland duct cells, we now demonstrate that increasing cytosolic Na+ concentration inhibits apical Na+ channels independent of changes in cytosolic Ca2+, pH, or Cl-, and the effect is blocked by GDP-β -S, pertussis toxin, and antibodies against the α -subunits of guanine nucleotide-binding regulatory proteins (Go). In contrast, the inhibitory effect of cytosolic anions is blocked by antibodies to inhibitory guanine nucleotide-binding regulatory proteins (Gi1/Gi2. It thus appears that apical Na+ channels are regulated by Go and Gi proteins, the activities of which are controlled, respectively, by cytosolic Na+ and Cl-.

  11. The NEIL glycosylases remove oxidized guanine lesions from telomeric and promoter quadruplex DNA structures

    PubMed Central

    Zhou, Jia; Fleming, Aaron M.; Averill, April M.; Burrows, Cynthia J.; Wallace, Susan S.


    G-quadruplex is a four-stranded G-rich DNA structure that is highly susceptible to oxidation. Despite the important roles that G-quadruplexes play in telomere biology and gene transcription, neither the impact of guanine lesions on the stability of quadruplexes nor their repair are well understood. Here, we show that the oxidized guanine lesions 8-oxo-7,8-dihydroguanine (8-oxoG), guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp) reduce the thermostability and alter the folding of telomeric quadruplexes in a location-dependent manner. Also, the NEIL1 and NEIL3 DNA glycosylases can remove hydantoin lesions but none of the glycosylases, including OGG1, are able to remove 8-oxoG from telomeric quadruplexes. Interestingly, a hydantoin lesion at the site most prone to oxidation in quadruplex DNA is not efficiently removed by NEIL1 or NEIL3. However, NEIL1, NEIL2 and NEIL3 remove hydantoins from telomeric quadruplexes formed by five TTAGGG repeats much more rapidly than the commonly studied four-repeat quadruplex structures. We also show that APE1 cleaves furan in selected positions in Na+-coordinated telomeric quadruplexes. In promoter G-quadruplex DNA, the NEIL glycosylases primarily remove Gh from Na+-coordinated antiparallel quadruplexes but not K+-coordinated parallel quadruplexes containing VEGF or c-MYC promoter sequences. Thus, the NEIL DNA glycosylases may be involved in both telomere maintenance and in gene regulation. PMID:25813041

  12. Base and Nucleotide Excision Repair of Oxidatively Generated Guanine Lesions in DNA.


    Shafirovich, Vladimir; Kropachev, Konstantin; Anderson, Thomas; Liu, Zhi; Kolbanovskiy, Marina; Martin, Brooke D; Sugden, Kent; Shim, Yoonjung; Chen, Xuejing; Min, Jung-Hyun; Geacintov, Nicholas E


    The well known biomarker of oxidative stress, 8-oxo-7,8-dihydroguanine, is more susceptible to further oxidation than the parent guanine base and can be oxidatively transformed to the genotoxic spiroiminodihydantoin (Sp) and 5-guanidinohydantoin (Gh) lesions. Incubation of 135-mer duplexes with single Sp or Gh lesions in human cell extracts yields a characteristic nucleotide excision repair (NER)-induced ladder of short dual incision oligonucleotide fragments in addition to base excision repair (BER) incision products. The ladders were not observed when NER was inhibited either by mouse monoclonal antibody (5F12) to human XPA or in XPC(-/-) fibroblast cell extracts. However, normal NER activity appeared when the XPC(-/-) cell extracts were complemented with XPC-RAD23B proteins. The Sp and Gh lesions are excellent substrates of both BER and NER. In contrast, 5-guanidino-4-nitroimidazole, a product of the oxidation of guanine in DNA by peroxynitrite, is an excellent substrate of BER only. In the case of mouse embryonic fibroblasts, BER of the Sp lesion is strongly reduced in NEIL1(-/-) relative to NEIL1(+/+) extracts. In summary, in human cell extracts, BER and NER activities co-exist and excise Gh and Sp DNA lesions, suggesting that the relative NER/BER product ratios may depend on competitive BER and NER protein binding to these lesions.

  13. Reactions of the OOH radical with guanine: Mechanisms of formation of 8-oxoguanine and other products

    NASA Astrophysics Data System (ADS)

    Kumar, Nagendra; Shukla, P. K.; Mishra, P. C.


    The mutagenic product 8-oxoguanine (8-oxoGua) is formed due to intermediacy of peroxyl (OOR) radicals in lipid peroxidation and protein oxidation-induced DNA damage. The mechanisms of these reactions are not yet understood properly. Therefore, in the present study, the mechanisms of formation of 8-oxoGua and other related products due to the reaction of the guanine base of DNA with the hydroperoxyl radical (OOH) were investigated theoretically employing the B3LYP and BHandHLYP hybrid functionals of density functional theory and the polarizable continuum model for solvation. It is found that the reaction of the OOH radical with guanine can occur following seven different mechanisms leading to the formation of various products including 8-oxoGua, its radicals, 5-hydroxy-8-oxoguanine and CO 2. The mechanism that yields 8-oxoGua as an intermediate and 5-hydroxy-8-oxoGua as the final product was found to be energetically most favorable.

  14. Human Rho Guanine Nucleotide Exchange Factor 11 (ARHGEF11) Regulates Dendritic Morphogenesis

    PubMed Central

    Mizuki, Yutaka; Takaki, Manabu; Sakamoto, Shinji; Okamoto, Sojiro; Kishimoto, Makiko; Okahisa, Yuko; Itoh, Masahiko; Yamada, Norihito


    Disturbances of synaptic connectivity during perinatal and adolescent periods have been hypothesized to be related to the pathophysiology of schizophrenia. Rho guanine nucleotide exchange factor 11 (ARHGEF11) is a specific guanine nucleotide exchange factors (GEF) for RhoA, which is a critical regulator of actin cytoskeleton dynamics and organization of dendritic spines and inhibitor of spine maintenance. ARHGEF11 variants are reported to be associated with a higher risk for the onset of schizophrenia in a Japanese population; however, how ARHGEF11 contributes to the pathogenesis of schizophrenia in dendritic spines is unknown. Therefore, we first studied the distribution, binding, and function of ARHGEF11 in the dendritic spines of the rat cerebral cortex. After subcellular fractionation of the rat cerebral cortex, ARHGEF11 was detected with synaptophysin and post-synaptic density protein 95 (PSD-95) in the P2 fractions including synaptosomal fractions containing presynaptic and postsynaptic density proteins. Endogenous ARHGEF11 was coimmunoprecipitated with synaptophysin or PSD-95. In cortical primary neurons at 28 days in vitro, immunostaining revealed that ARHGEF11 located in the dendrites and dendritic spines and colocalized with PSD-95 and synaptophysin. Overexpression of exogenous ARHGEF11 significantly decreased the number of spines (p = 0.008). These results indicate that ARHGEF11 is likely to be associated with synaptic membranes and regulation of spine. PMID:28036092

  15. Guanine nucleotide exchange factors for RhoGTPases: good therapeutic targets for cancer therapy?


    Lazer, Galit; Katzav, Shulamit


    Rho guanosine triphosphatases (GTPases) are a family of small proteins which function as molecular switches in a variety of signaling pathways following stimulation of cell surface receptors. RhoGTPases regulate numerous cellular processes including cytoskeleton organization, gene transcription, cell proliferation, migration, growth and cell survival. Because of their central role in regulating processes that are dysregulated in cancer, it seems reasonable that defects in the RhoGTPase pathway may be involved in the development of cancer. RhoGTPase activity is regulated by a number of protein families: guanine nucleotide exchange factors (GEFs), GTPase activating proteins (GAPs) and guanine nucleotide-dissociation inhibitors (GDIs). This review discusses the participation of RhoGTPases and their regulators, especially GEFs in human cancers. In particular, we focus on the involvement of the RhoGTPase GEF, Vav1, a hematopoietic specific signal transducer which is involved in human neuroblastoma, pancreatic ductal carcinoma and lung cancer. Finally, we summarize recent advances in the design and application of a number of molecules that specifically target individual RhoGTPases or their regulators or effectors, and discuss their potential for cancer therapy.

  16. Monitoring one-electron photo-oxidation of guanine in DNA crystals using ultrafast infrared spectroscopy

    NASA Astrophysics Data System (ADS)

    Hall, James P.; Poynton, Fergus E.; Keane, Páraic M.; Gurung, Sarah P.; Brazier, John A.; Cardin, David J.; Winter, Graeme; Gunnlaugsson, Thorfinnur; Sazanovich, Igor V.; Towrie, Michael; Cardin, Christine J.; Kelly, John M.; Quinn, Susan J.


    To understand the molecular origins of diseases caused by ultraviolet and visible light, and also to develop photodynamic therapy, it is important to resolve the mechanism of photoinduced DNA damage. Damage to DNA bound to a photosensitizer molecule frequently proceeds by one-electron photo-oxidation of guanine, but the precise dynamics of this process are sensitive to the location and the orientation of the photosensitizer, which are very difficult to define in solution. To overcome this, ultrafast time-resolved infrared (TRIR) spectroscopy was performed on photoexcited ruthenium polypyridyl-DNA crystals, the atomic structure of which was determined by X-ray crystallography. By combining the X-ray and TRIR data we are able to define both the geometry of the reaction site and the rates of individual steps in a reversible photoinduced electron-transfer process. This allows us to propose an individual guanine as the reaction site and, intriguingly, reveals that the dynamics in the crystal state are quite similar to those observed in the solvent medium.

  17. New investigations of the guanine trichloro cuprate(II) complex crystal

    NASA Astrophysics Data System (ADS)

    Fabijanić, Ivana; Matković-Čalogović, Dubravka; Pilepić, Viktor; Ivanišević, Irena; Mohaček-Grošev, Vlasta; Sanković, Krešimir


    Crystals of the guanine trichloro cuprate(II) complex, (HGua)2[Cu2Cl6]·2H2O (HGua = protonated guanine), were prepared and analysed by spectroscopic (IR, Raman) and computational methods. A new single-crystal X-ray diffraction analysis was conducted to obtain data with lower standard uncertainties than those in the previously published structure. Raman and IR spectroscopy and quantum-mechanical analysis gave us new insight into the vibrational states of the (HGua)2[Cu2Cl6]·2H2O crystal. The vibrational spectra of the crystal were assigned by performing a normal coordinate analysis for a free dimer with a centre of inversion as the only symmetry element. The stretching vibration observed at 279 cm-1 in the infrared spectrum corresponds to the N-Cu bond. The noncovalent interaction (NCI) plots and quantum theory of atoms in molecules (QTAIM) analysis of the electron density obtained from periodic DFT calculations elucidated the interactions that exist within the crystal structure. Closed-shell ionic attractions, as well as weak and medium strength hydrogen bonds, prevailed in the crystal packing.

  18. Polymerase recognition of 2-thio-iso-guanine·5-methyl-4-pyrimidinone (iGs·P)--A new DD/AA base pair.


    Lee, Dong-Kye; Switzer, Christopher


    Polymerase specificity is reported for a previously unknown base pair with a non-standard DD/AA hydrogen bonding pattern: 2-thio-iso-guanine·5-methyl-4-pyrimidinone. Our findings suggest that atomic substitution may provide a solution for low fidelity previously associated with enzymatic copying of iso-guanine. Copyright © 2016 Elsevier Ltd. All rights reserved.

  19. Adenine and guanine 8CH exchange in nucleic acids: resolution and measurement by Raman optical multichannel analysis.


    Lamba, O P; Becka, R; Thomas, G J

    Deuterium exchange of 8C protons of adenine and guanine in nucleic acids is conveniently monitored by laser Raman spectrophotometry, and the average exchange rate so determined [kA + kG] can be exploited as a dynamic probe of the secondary structure of DNA or RNA [J. M. Benevides and G. J. Thomas, Jr. (1985) Biopolymers 24, 667-682]. The present work describes a rapid Raman procedure, based upon optical multichannel analysis, which permits discrimination of the different 8CH exchange rates, kA of adenine and kG of guanine, in a single experimental protocol. For this procedure, simultaneous measurements are made of the intensity decay or frequency shift in separately resolved Raman bands of adenine and guanine, each of which is sensitive only to 8C deuteration of its respective purine. Resolution of the rates kA and kG is demonstrated for the mononucleotide mixtures, 5'-rAMP + 5'-rGMP and 5'-dAMP + 5'-dGMP, for the polynucleotides poly(dA-dT).poly(dA-dT) and poly(dG-dC).poly(dG-dC), for calf thymus DNA, and for the 17 base-pair operator OR3. We show that the different exchange rates of adenine and guanine, in nucleotide mixtures and in DNA, may also be calculated independently from intensity decay of the composite 1481-cm-1 band, comprising overlapped adenine and guanine components, over a time domain that encompasses two distinct regimes: (1) a relatively more rapid exchange of guanine, and (2) a concurrent slower exchange of adenine. Both methods developed here yield consistent results. We find, first, that exchange of guanine is approximately twofold more rapid than that of adenine when both purines are present in the same structure and solvent environment, presumably a consequence of the greater basicity of the 7N site of guanine. Second, we find that adenine suffers greater retardation of exchange than guanine when both purines are incorporated into a "classical" B-DNA secondary structure, such as that of calf thymus DNA. This finding suggests different

  20. Pathways of arachidonic acid peroxyl radical reactions and product formation with guanine radicals.


    Crean, Conor; Geacintov, Nicholas E; Shafirovich, Vladimir


    Peroxyl radicals were derived from the one-electron oxidation of polyunsaturated fatty acids by sulfate radicals that were generated by the photodissociation of peroxodisulfate anions in air-equilibrated aqueous solutions. Reactions of these peroxyl and neutral guanine radicals, also generated by oxidation with sulfate radicals, were investigated by laser kinetic spectroscopy, and the guanine oxidation products were identified by HPLC and mass spectrometry methods. Sulfate radicals rapidly oxidize arachidonic (ArAc), linoleic (LnAc), and palmitoleic (PmAc) acids with similar rate constants, (2-4) x 10 (9) M (-1) s (-1). The C-centered radicals derived from the oxidation of ArAc and LnAc include nonconjugated Rn(.) ( approximately 80%) and conjugated bis-allylic Rba(.) ( approximately 20%) radicals. The latter were detectable in the absence of oxygen by their prominent, narrow absorption band at 280 nm. The Rn(.) radicals of ArAc (containing three bis-allylic sites) transform to the Rba(.) radicals via an intramolecular H-atom abstraction [rate constant (7.5 +/- 0.7) x 10 (4) s (-1)]. In contrast, the Rn(.) radicals of LnAc that contain only one bis-allylic site do not transform intramolecularly to the Rba(.) radicals. In the case of PmAc, which contains only one double bond, the Rba(.) radicals are not observed. The Rn(.) radicals of PmAc rapidly combine with oxygen with a rate constant of (3.8 +/- 0.4) x 10(9) M(-1) s(-1). The Rba(.) radicals of ArAc are less reactive and react with oxygen with a rate constant of (2.2 +/- 0.2) x 10 (8) M (-1) s (-1). The ArAc peroxyl radicals formed spontaneously eliminate superoxide radical anions [rate constant = (3.4 +/- 0.3) x 10 (4) M (-1) s (-1)]. The stable oxidative lesions derived from the 2',3',5'-tri- O-acetylguanosine or 2',3',5'-tri- O-acetyl-8-oxo-7,8-dihydroguanosine radicals and their subsequent reactions with ArAc peroxyl radicals were also investigated. The major products found were the 2,5-diamino-4 H

  1. Biologically relevant oxidants cause bound proteins to readily oxidatively cross-link at Guanine.


    Solivio, Morwena J; Nemera, Dessalegn B; Sallans, Larry; Merino, Edward J


    Oxidative DNA-protein cross-links have received less attention than other types of DNA damage and remain as one of the least understood types of oxidative lesion. A model system using ribonuclease A and a 27-nucleotide DNA was used to determine the propensity of oxidative cross-linking to occur in the presence of oxidants. Cross-link formation was examined using four different oxidation systems that generate singlet oxygen, superoxide, and metal-based Fenton reactions. It is shown that oxidative cross-linking occurs in yields ranging from 14% to a maximal yield of 61% in all oxidative systems when equivalent concentrations of DNA and protein are present. Because singlet oxygen is the most efficient oxidation system in generating DNA-protein cross-links, it was chosen for further analyses. Cross-linking occurred with single-stranded DNA binding protein and not with bovine serum albumin. Addition of salt lowered nonspecific binding affinity and lowered cross-link yield by up to 59%. The yield of cross-linking increased with increased ratios of protein compared with DNA. Cross-linking was highly dependent on the number of guanines in a DNA sequence. Loss of guanine content on the 27-nucleotide DNA led to nearly complete loss in cross-linking, while primer extension studies showed cross-links to predominantly occur at guanine base on a 100-nucleotide DNA. The chemical species generated were examined using two peptides derived from the ribonuclease A sequence, N-acetyl-AAAKF and N-acetyl-AYKTT, which were cross-linked to 2'-deoxyguanosine. The cross-link products were spiroiminodihydantoin, guanidinohydantoin, and tyrosyl-based adducts. Formation of tyrosine-based adducts may be competitive with the more well-studied lysine-based cross-links. We conclude that oxidative cross-links may be present at high levels in cells since the propensity to oxidatively cross-link is high and so much of the genomic DNA is coated with protein.

  2. Hydroxyl Radical (OH•) Reaction with Guanine in an Aqueous Environment: A DFT Study

    PubMed Central

    Kumar, Anil; Pottiboyina, Venkata; Sevilla, Michael D.


    The reaction of hydroxyl radical (OH•) with DNA accounts for about half of radiation-induced DNA damage in living systems. Previous literature reports point out that the reaction of OH• with DNA proceeds mainly through the addition of OH• to the C=C bond of the DNA bases. However, recently it has been reported that the principal reaction of OH• with dGuo (deoxyguanosine) is the direct hydrogen atom abstraction from its exocyclic amine group rather than addition of OH• to the C=C bond. In the present work, these two reaction pathways of OH• attack on guanine (G) in the presence of water molecules (aqueous environment) are investigated using the density functional theory (DFT) B3LYP method with 6-31G* and 6-31++G** basis sets. The calculations show that the initial addition of the OH• at C4=C5 double bond of guanine is barrier free and the adduct radical (G-OH•) has only a small activation barrier of ca. 1 – 6 kcal/mol leading to the formation of a metastable ion-pair intermediate (G•+---OH−). The formation of ion-pair is a result of the highly oxidizing nature of the OH• in aqueous media. The resulting ion-pair (G•+---OH−) deprotonates to form H2O and neutral G radicals favoring G(N1-H)• with an activation barrier of ca. 5 kcal/mol. The overall process from the G(C4)-OH• (adduct) to G(N1-H)• and water is found to be exothermic in nature by more than 13 kcal/mol. (G-OH•), (G•+---OH−), and G(N1-H)• were further characterized by the CAM-B3LYP calculations of their UV-visible spectra and good agreement between theory and experiment is achieved. Our calculations for the direct hydrogen abstraction pathway from N1 and N2 sites of guanine by the OH• show that this is also a competitive route to produce G(N2-H)•, G(N1-H)• and H2O. PMID:22050033

  3. Solution structures of oligonucleotides containing either a guanine or a cytosine in front of a gap of one nucleotide

    NASA Astrophysics Data System (ADS)

    Boulard, Y.; Faibis, V.; Fazakerley, G. V.


    We report NMR and molecular modelling studies on two DNA duplexes containing a gap of one nucleotides. The difference between the two oligonucleotides lies in the central base face to the gap, a guanine or a cytosine. For the gapG, we observed in solution a B-form conformation where the guanine stacks in the helix. For the gapC, we reveal the existence of two species, one majority where the cytosine is inside the helix and a second for which the cytosine is extrahelical. Nous présentons une étude par RMN et modélisation moléculaire sur deux duplexes d'ADN contenant une lacune de un nucléotide. La différence entre les deux oligonucléotides réside dans la base centrale en face de la lacune, une guanine ou une cytosine. Pour le duplex appelé gapG, nous observons en solution une hélice de type B dans laquelle la guanine est empilée à l'intérieur de l'hélice. Dans le cas du duplex gapC, nous montrons l'existence de deux formes, l'une où la cytosine est à l'intérieur de l'hélice; la seconde où la cytosine est extra hélicale.

  4. Examination of the effect of the annealing cation on higher order structures containing guanine or isoguanine repeats

    PubMed Central

    Pierce, Sarah E.; Wang, Junmei; Jayawickramarajah, Janarthanan; Hamilton, Andrew D.; Brodbelt, Jennifer S.


    Isoguanine (2-oxo-6-amino-guanine), a natural but non-standard base, exhibits unique self-association properties compared to its isomer, guanine, and results in formation of different higher order DNA structures. In this work, the higher order structures formed by oligonucleotides containing guanine repeats or isoguanine repeats after annealing in solutions containing various cations are evaluated by electrospray ionization mass spectrometry (ESI-MS) and circular dichroism (CD) spectroscopy. The guanine-containing strand (G9) consistently formed quadruplexes upon annealing, whereas the isoguanine strand (Ig9) formed both pentaplexes and quadruplexes depending on the annealing cation. Quadruplex formation with G9 showed some dependence on the identity of the cation present during annealing with high relative quadruplex formation detected with six of ten cations. Analogous annealing experiments with Ig9 resulted in complex formation with all ten cations, and the majority of the resulting complexes were pentaplexes. CD results indicated most of the original complexes survived the desalting process necessary for ESI-MS analysis. In addition, several complexes, especially the pentaplexes, were found to be capable of cation exchange with ammonium ions. Ab initio calculations were conducted for isoguanine tetrads and pentads coordinated with all ten cations to predict the most energetically stable structures of the complexes in the gas phase. The observed preference of forming quadruplexes versus pentaplexes as a function of the coordinated cation can be interpreted by the calculated reaction energies of both the tetrads and pentads in combination with the distortion energies of tetrads. PMID:19746468

  5. UVA-visible photo-excitation of guanine radical cations produces sugar radicals in DNA and model structures

    PubMed Central

    Adhikary, Amitava; Malkhasian, Aramice Y. S.; Collins, Sean; Koppen, Jessica; Becker, David; Sevilla, Michael D.


    This work presents evidence that photo-excitation of guanine radical cations results in high yields of deoxyribose sugar radicals in DNA, guanine deoxyribonucleosides and deoxyribonucleotides. In dsDNA at low temperatures, formation of C1′• is observed from photo-excitation of G•+ in the 310–480 nm range with no C1′• formation observed ≥520 nm. Illumination of guanine radical cations in 2′dG, 3′-dGMP and 5′-dGMP in aqueous LiCl glasses at 143 K is found to result in remarkably high yields (∼85–95%) of sugar radicals, namely C1′•, C3′• and C5′•. The amount of each of the sugar radicals formed varies dramatically with compound structure and temperature of illumination. Radical assignments were confirmed using selective deuteration at C5′ or C3′ in 2′-dG and at C8 in all the guanine nucleosides/tides. Studies of the effect of temperature, pH, and wavelength of excitation provide important information about the mechanism of formation of these sugar radicals. Time-dependent density functional theory calculations verify that specific excited states in G•+ show considerable hole delocalization into the sugar structure, in accord with our proposed mechanism of action, namely deprotonation from the sugar moiety of the excited molecular radical cation. PMID:16204456

  6. Semiclassical dynamics of electron attachment to guanine-cytosine base pair

    NASA Astrophysics Data System (ADS)

    Honda, Tomohiro; Minoshima, Yusuke; Yokoi, Yuki; Takayanagi, Toshiyuki; Shiga, Motoyuki


    Electron attachment dynamics to the guanine-cytosine (G-C) base pair in the gas phase is studied using DFT and molecular dynamics. The potential energy surface of the G-C anion is constructed with the empirical-valence-bond method using force-field information obtained from long-range corrected DFT calculations. Ring-polymer molecular dynamics simulations predict that the initial dipole-bound anion readily converts into the valence-bound anion within 0.1 ps and proton-transfer occurs subsequently within 10 ps. The same process was found in classical simulations, but on a much slower time scale. This result suggests that nuclear quantum effects are important in understanding DNA damage by low-energy electrons.

  7. Targeting of Polycomb Repressive Complex 2 to RNA by Short Repeats of Consecutive Guanines.


    Wang, Xueyin; Goodrich, Karen J; Gooding, Anne R; Naeem, Haroon; Archer, Stuart; Paucek, Richard D; Youmans, Daniel T; Cech, Thomas R; Davidovich, Chen


    Polycomb repressive complex 2 (PRC2) is a histone methyltransferase that trimethylates H3K27, a mark of repressed chromatin. Mammalian PRC2 binds RNA promiscuously, with thousands of target transcripts in vivo. But what does PRC2 recognize in these RNAs? Here we show that purified human PRC2 recognizes G > C,U ≫ A in single-stranded RNA and has a high affinity for folded guanine quadruplex (G4) structures but little binding to duplex RNAs. Importantly, G-tract motifs are significantly enriched among PRC2-binding transcripts in vivo. DNA sequences coding for PRC2-binding RNA motifs are enriched at PRC2-binding sites on chromatin and H3K27me3-modified nucleosomes. Collectively, the abundance of PRC2-binding RNA motifs rationalizes the promiscuous RNA binding of PRC2, and their enrichment at Polycomb target genes provides a means for RNA-mediated regulation.

  8. Guanine Can Direct Binding Specificity of Ru-dipyridophenazine (dppz) Complexes to DNA through Steric Effects.


    Hall, James P; Gurung, Sarah P; Henle, Jessica; Poidl, Patrick; Andersson, Johanna; Lincoln, Per; Winter, Graeme; Sorensen, Thomas; Cardin, David J; Brazier, John A; Cardin, Christine J


    X-ray crystal structures of three Λ-[Ru(L)2 dppz](2+) complexes (dppz=dipyridophenazine; L=1,10-phenanthroline (phen), 2,2'-bipyridine (bpy)) bound to d((5BrC)GGC/GCCG) showed the compounds intercalated at a 5'-CG-3' step. The compounds bind through canted intercalation, with the binding angle determined by the guanine NH2 group, in contrast to symmetrical intercalation previously observed at 5'-TA-3' sites. This result suggests that canted intercalation is preferred at 5'-CG-3' sites even though the site itself is symmetrical, and we hypothesise that symmetrical intercalation in a 5'-CG-3' step could give rise to a longer luminescence lifetime than canted intercalation. © 2017 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA.

  9. Herpes simplex virus-mediated human hypoxanthine-guanine phosphoribosyltransferase gene transfer into neuronal cells.


    Palella, T D; Silverman, L J; Schroll, C T; Homa, F L; Levine, M; Kelley, W N


    The virtually complete deficiency of the purine salvage enzyme hypoxanthine-guanine phosphoribosyltransferase (HPRT) results in a devastating neurological disease, Lesch-Nyhan syndrome. Transfer of the HPRT gene into fibroblasts and lymphoblasts in vitro and into hematopoietic cells in vivo has been accomplished by other groups with retroviral-derived vectors. It appears to be necessary, however, to transfer the HPRT gene into neuronal cells to correct the neurological dysfunction of this disorder. The neurotropic virus herpes simplex virus type 1 has features that make it suitable for use as a vector to transfer the HPRT gene into neuronal tissue. This report describes the isolation of an HPRT-deficient rat neuroma cell line, designated B103-4C, and the construction of a recombinant herpes simplex virus type 1 that contained human HPRT cDNA. These recombinant viruses were used to infect B103-4C cells. Infected cells expressed HPRT activity which was human in origin.

  10. Surface-Enhanced Hyper-Raman Spectra of Adenine, Guanine, Cytosine, Thymine, and Uracil

    PubMed Central


    Using picosecond excitation at 1064 nm, surface-enhanced hyper-Raman scattering (SEHRS) spectra of the nucleobases adenine, guanine, cytosine, thymine, and uracil with two different types of silver nanoparticles were obtained. Comparing the SEHRS spectra with SERS data from the identical samples excited at 532 nm and with known infrared spectra, the major bands in the spectra are assigned. Due to the different selection rules for the one- and two-photon excited Raman scattering, we observe strong variation in relative signal strengths of many molecular vibrations obtained in SEHRS and SERS spectra. The two-photon excited spectra of the nucleobases are found to be very sensitive with respect to molecule–nanoparticle interactions. Using both the SEHRS and SERS data, a comprehensive vibrational characterization of the interaction of nucleobases with silver nanostructures can be achieved. PMID:28077982

  11. Simultaneous determination of adenine and guanine in ruminant bacterial pellets by ion-pair HPLC.


    García del Moral, Pilar; Arín, María Jesús; Resines, José Antonio; Díez, María Teresa


    An ion-pair reversed-phase high-performance liquid chromatography with gradient elution and UV detection was used to measure adenine (A) and guanine (G) in lyophilized bacterial pellets from ruminants using allopurinol as internal standard. The separation was performed on a Symmetry C18 column and the detection was monitored at 280 nm. Calibration curves were found to be linear in the concentration range from 5 to 50 mg/l with correlation coefficients (r2)>0.999. Mean recoveries of A and G standards added to bacterial samples were 102.2 and 98.2, respectively. The method proposed yielded sharp, well-resolved peaks within 25 min and was successfully applied for the determination of A and G in bacterial pellets.

  12. Particular behavior of the adenine and guanine ring-breathing modes upon the DNA conformational transitions.


    Ghomi, M; Letellier, R; Taillandier, E


    Harmonic dynamics calculations performed on the deoxyguanosine (dG) and deoxyadenosine (dA) residues, based on a reliable force field, show that the breathing motions of both guanine and adenine residues are involved in two different vibration modes (750-500 cm-1 spectral region). The calculated results reveal a strong coupling of these modes with the sugar pucker motions. This effect has been verified for the dG residue by the Raman spectra of polyd(G-C). As far as the dA residue is concerned, the particular behavior of the adenine residue breathing mode predicted by these calculations, has been confirmed by Raman spectra of polyd(A-T) undergoing a B----Z conformational transition.

  13. Zizimin and Dock guanine nucleotide exchange factors in cell function and disease

    PubMed Central

    Pakes, Nicholl K.; Veltman, Douwe M.; Williams, Robin S.B.


    Zizimin proteins belong to the Dock (Dedicator of Cytokinesis) superfamily of Guanine nucleotide Exchange Factor (GEF) proteins. This family of proteins plays a role in the regulation of Rho family small GTPases. Together the Rho family of small GTPases and the Dock/Zizimin proteins play a vital role in a number of cell processes including cell migration, apoptosis, cell division and cell adhesion. Our recent studies of Zizimin proteins, using a simple biomedical model, the eukaryotic social amoeba Dictyostelium discoideum, have helped to elucidate the cellular role of these proteins. In this article, we discuss the domain structure of Zizimin proteins from an evolutionary viewpoint. We also compare what is currently known about the mammalian Zizimin proteins to that of related Dock proteins. Understanding the cellular functions of these proteins will provide a better insight into their role in cell signaling, and may help in treating disease pathology associated with mutations in Dock/Zizimin proteins. PMID:23247359

  14. Novel designed enediynes: molecular design, chemical synthesis, mode of cycloaromatization and guanine-specific DNA cleavage.


    Toshima, K; Ohta, K; Kano, T; Nakamura, T; Nakata, M; Kinoshita, M; Matsumura, S


    The molecular design and chemical synthesis of novel enediyne molecules related to the neocarzinostatin chromophore (1), and their chemical and DNA cleaving properties are described. The 10-membered enediyne triols 16-18 were effectively synthesized from xylitol (10) in a short step, and found to be quite stable when handled at room temperature. The representative and acylated enediyne 16 was cycloaromatized by 1,8-diazabicyclo[5.4.0]undec-7-ene (DBU) in cyclohexa-1,4-diene-benzene to give the benzenoid product 21 through a radical pathway. On the other hand, the enediyne 16 was cycloaromatized by diethylamine in dimethyl sulfoxide-Tris-HCl, pH 8.5 buffer to afford another benzenoid product 22 as a diethylamine adduct through a polar pathway. Furthermore, the enediynes 16-18 were found to exhibit guanine-specific DNA cleavage under weakly basic conditions with no additive.

  15. Zizimin and Dock guanine nucleotide exchange factors in cell function and disease.


    Pakes, Nicholl K; Veltman, Douwe M; Williams, Robin S B


    Zizimin proteins belong to the Dock (Dedicator of Cytokinesis) superfamily of Guanine nucleotide Exchange Factor (GEF) proteins. This family of proteins plays a role in the regulation of Rho family small GTPases. Together the Rho family of small GTPases and the Dock/Zizimin proteins play a vital role in a number of cell processes including cell migration, apoptosis, cell division and cell adhesion. Our recent studies of Zizimin proteins, using a simple biomedical model, the eukaryotic social amoeba Dictyostelium discoideum, have helped to elucidate the cellular role of these proteins. In this article, we discuss the domain structure of Zizimin proteins from an evolutionary viewpoint. We also compare what is currently known about the mammalian Zizimin proteins to that of related Dock proteins. Understanding the cellular functions of these proteins will provide a better insight into their role in cell signaling, and may help in treating disease pathology associated with mutations in Dock/Zizimin proteins.

  16. Identification of 17 independent mutations responsible for human hypoxanthine-guanine phosphoribosyltransferase (HPRT) deficiency.

    PubMed Central

    Davidson, B L; Tarlé, S A; Van Antwerp, M; Gibbs, D A; Watts, R W; Kelley, W N; Palella, T D


    Complete hypoxanthine-guanine phosphoribosyltransferase (HPRT) deficiency causes the Lesch-Nyhan syndrome, an X-linked, purine metabolism disorder manifested by hyperuricemia, hyperuricaciduria, and neurologic dysfunction. Partial HPRT deficiency causes hyperuricemia and gout. One requirement for understanding the molecular basis of HPRT deficiency is the determination of which amino acids in this salvage enzyme are necessary for structural or catalytic competence. In this study we have used the PCR coupled with direct sequencing to determine the nucleotide and subsequent amino acid changes in 22 subjects representing 17 unrelated kindreds from the United Kingdom. These mutations were confirmed by using either RNase mapping or Southern analyses. In addition, experiments were done to determine enzyme activity and electrophoretic mobility, and predictive paradigms were used to study the impact of these amino acid substitutions on secondary structure. Images Figure 2 Figure 3 Figure 4 PMID:2018042

  17. A direct-dynamics study of proton transfer through water bridges in guanine and 7-azaindole

    NASA Astrophysics Data System (ADS)

    Smedarchina, Zorka; Siebrand, Willem; Fernández-Ramos, Antonio; Gorb, Leonid; Leszczynski, Jerzy


    To evaluate the efficiency of bridges of water molecules as proton conduits, multidimensional ab initio proton transfer rate constants are reported for complexes of guanine and 7-azaindole with one and two water molecules. These water molecules form hydrogen-bonded bridges between functional groups involved in tautomerization via proton transfer and catalyze this transfer. Structures and energies of the relevant stationary configurations are optimized at the second-order Møller-Plesset level and vibrational force fields are evaluated at the Hartree-Fock level. The proton transfer rate constants, calculated with the instanton method, show the effect of the structure and strength of the hydrogen bonds, reflected in couplings between the tunneling mode and the other vibrations of the complexes. The results indicate that strongly hydrogen-bonded, strain-free water bridges can serve as very efficient proton conduits.

  18. Structural and thermodynamic studies on the adenine.guanine mismatch in B-DNA.

    PubMed Central

    Leonard, G A; Booth, E D; Brown, T


    The structure of the synthetic dodecamer d(CGCAAATTGGCG) has been shown by single crystal X-ray diffraction methods to be that of a B-DNA helix containing two A(anti).G(syn) base pairs. The refinement, based on data to a resolution of 2.25 A shows that the mismatch base pairs are held together by two hydrogen bonds. The syn-conformation of the guanine base of the mismatch is stabilised by hydrogen bonding to a network of solvent molecules in both the major and minor grooves. A pH-dependent ultraviolet melting study indicates that the duplex is stabilised by protonation, suggesting that the bases of the A.G mispair are present in their most common tautomeric forms and that the N(1)-atom of adenine is protonated. The structure refinement shows that there is some disorder in the sugar-phosphate backbone. PMID:2216754

  19. Molecular evolution of the Rab-escort-protein/guanine-nucleotide-dissociation-inhibitor superfamily.


    Alory, Christelle; Balch, William E


    Prenylation of Rab GTPases regulating vesicle traffic by Rab geranylgeranyltransferase (RabGGTase) requires a complex formed by the association of newly synthesized Rab proteins with Rab-escort-protein (REP), the choroideremia-gene-product that is mutated in disease, leading to loss of vision. After delivery to the membrane by the REP-Rab complex, subsequent recycling to the cytosol requires the REP-related guanine-nucleotide-dissociation-inhibitor (GDI). Although REP and GDI share common Rab-binding properties, GDI cannot assist in Rab prenylation and REP cannot retrieve Rab proteins from the membranes. We have now isolated REP mutant proteins that are able to partially function as both REP and GDI. These results provide molecular insight into the functional and evolutionary organization of the REP/GDI superfamily.

  20. Molecular Evolution of the Rab-Escort-Protein/Guanine-Nucleotide-Dissociation-Inhibitor Superfamily

    PubMed Central

    Alory, Christelle; Balch, William E.


    Prenylation of Rab GTPases regulating vesicle traffic by Rab geranylgeranyltransferase (RabGGTase) requires a complex formed by the association of newly synthesized Rab proteins with Rab-escort-protein (REP), the choroideremia-gene-product that is mutated in disease, leading to loss of vision. After delivery to the membrane by the REP–Rab complex, subsequent recycling to the cytosol requires the REP-related guanine-nucleotide-dissociation-inhibitor (GDI). Although REP and GDI share common Rab-binding properties, GDI cannot assist in Rab prenylation and REP cannot retrieve Rab proteins from the membranes. We have now isolated REP mutant proteins that are able to partially function as both REP and GDI. These results provide molecular insight into the functional and evolutionary organization of the REP/GDI superfamily. PMID:12972569

  1. Synaptic functions of the IQSEC family of ADP-ribosylation factor guanine nucleotide exchange factors.


    Um, Ji Won


    Postsynaptic scaffolding proteins interact with numerous synaptic proteins to ensure the organization and specialization of functional excitatory and inhibitory synapses. IQSECs (IQ motif and SEC7 domain-containing proteins) are a class of ADP ribosylation factor-guanine nucleotide exchange factors (ARF-GEFs), whose functions are beginning to be understood as both scaffolding and signaling proteins. Specifically, IQSEC1 binds to PSD-95, and IQSEC2 functions as a regulator of AMPA receptor trafficking at excitatory synapses, whereas IQSEC3 interacts with gephyrin to promote inhibitory synapse development. Here, I review the currently known findings on IQSECs and discuss the possible relations between dysfunctions of IQSECs and the pathophysiology of brain disorders. Copyright © 2016 Elsevier Ireland Ltd and Japan Neuroscience Society. All rights reserved.

  2. Acyclic Immucillin Phosphonates. Second-Generation Inhibitors of Plasmodium falciparum Hypoxanthine- Guanine-Xanthine Phosphoribosyltransferase

    SciTech Connect

    Hazelton, Keith Z.; Ho, Meng-Chaio; Cassera, Maria B.; Clinch, Keith; Crump, Douglas R.; Rosario Jr., Irving; Merino, Emilio F.; Almo, Steve C.; Tyler, Peter C.; Schramm, Vern L.


    We found that Plasmodium falciparum is the primary cause of deaths from malaria. It is a purine auxotroph and relies on hypoxanthine salvage from the host purine pool. Purine starvation as an antimalarial target has been validated by inhibition of purine nucleoside phosphorylase. Hypoxanthine depletion kills Plasmodium falciparum in cell culture and in Aotus monkey infections. Hypoxanthine-guanine-xanthine phosphoribosyltransferase (HGXPRT) from P. falciparum is required for hypoxanthine salvage by forming inosine 5'-monophosphate, a branchpoint for all purine nucleotide synthesis in the parasite. We present a class of HGXPRT inhibitors, the acyclic immucillin phosphonates (AIPs), and cell permeable AIP prodrugs. The AIPs are simple, potent, selective, and biologically stable inhibitors. The AIP prodrugs block proliferation of cultured parasites by inhibiting the incorporation of hypoxanthine into the parasite nucleotide pool and validates HGXPRT as a target in malaria.

  3. Herpes simplex virus-mediated human hypoxanthine-guanine phosphoribosyltransferase gene transfer into neuronal cells

    SciTech Connect

    Palella, T.D.; Silverman, L.J.; Schroll, C.T.; Homa, F.L.; Levine, M.; Kelley, W.N.


    The virtually complete deficiency of the purine salvage enzyme hypoxanthine-guanine phosphoribosyltransferase (HPRT) results in a devastating neurological disease, Lesch-Nyhan syndrome. Transfer of the HPRT gene into fibroblasts and lymphoblasts in vitro and into hematopoietic cells in vivo has been accomplished by other groups with retroviral-derived vectors. It appears to be necessary, however, to transfer the HPRT gene into neuronal cells to correct the neurological dysfunction of this disorder. The neurotropic virus herpes simplex virus type 1 has features that make it suitable for use as a vector to transfer the HPRT gene into neuronal tissue. This report describes the isolation of an HPRT-deficient rat neuroma cell line, designated B103-4C, and the construction of a recombinant herpes simplex virus type 1 that contained human HPRT cDNA. These recombinant viruses were used to infect B103-4C cells. Infected cells expressed HPRT activity which was human in origin.

  4. QUAD, a protein from hepatocyte chromatin that binds selectively to guanine-rich quadruplex DNA.


    Weisman-Shomer, P; Fry, M


    The single-stranded oligomer Q, whose nucleotide sequence 5'-d(TACAGGGGAGCTGGGGTAGA)-3' corresponds to the IgG switch region, forms in concentrated solutions and in the presence of alkali metal cation parallel four-stranded complexes termed G4 DNA (Sen, D., and Gilbert, W. (1988) Nature 334, 364-366). We show that G4 DNA was also formed during storage of dried oligomer Q. This quadruplex complex migrated more slowly than mono-strand oligomer Q during nondenaturing gel electrophoresis, the rate of its formation depended on the mass of stored oligomer Q, and N7 positions of guanine residues were involved in its stabilization. Here we report the purification of a protein designated QUAD that binds specifically to the G4 form of oligomer Q, from non-histone protein extracts of rabbit hepatocytes. QUAD was 80-90% purified by sequential steps of column chromatography on Sepharose 6B, DEAE-cellulose, phosphocellulose, and phenyl-Sepharose. Purified QUAD migrated on SDS-polyacrylamide gel electrophoresis as a 58 +/- 2.6-kDa polypeptide and had a native molecular mass of 57 +/- 2.5 kDa as determined by Sepharose 6B gel filtration. The dissociation constant of G4 DNA binding to QUAD was in the range of 2.5 to 7.0 x 10(-9) M/liter. Excess unlabeled monostranded oligomer Q did not compete with 5'-32P-labeled G4 DNA on its binding to QUAD. Further, that QUAD recognized the G4 DNA structure rather than a DNA sequence was also demonstrated by the inefficient competition on the binding of 5'-[32P]G4 DNA to QUAD by excess unlabeled single- or double-stranded DNA molecules that contained guanine clusters of different length or various other nucleotide sequences.

  5. Guanine-specific DNA damage induced by γ-irradiated histone

    PubMed Central


    In γ-irradiation, •OH is directly generated from water and causes DNA damage leading to carcinogenesis. Exposure of proteins to γ-irradiation, in the presence of oxygen, gives high yields of hydroperoxides. To clarify whether these hydroperoxides, particularly those formed on DNA-binding histone proteins, participate in γ-irradiation-induced carcinogenesis, experiments using 32P-labelled DNA fragments obtained from human cancer-related genes were undertaken. Histone protein-hydroperoxides induced significant DNA damage in the presence of Cu(I). Histone H1- and H3-hydroperoxides showed stronger DNA damage compared with histone H2A- and H4-hydroperoxides at 0.7 μM. Histone H1-hydroperoxides caused Cu(I)-dependent DNA damage predominantly at guanine residues, especially at 5′-GGC-3′, 5′-GGA-3′, 5′-GGT-3′ and single G bases. In contrast, histone H3-hydroperoxides/Cu(I) induced DNA damage at 5′-G in GG sequences; this sequence specificity is identical with that generated by 2,2′-azobis (2-amidinopropane) dihydrochloride, which is known to produce peroxyl radicals (RO2•). The difference in site specificity of DNA damage induced by histone H1- and H3-hydroperoxides may arise from their amino acid composition or their mode of binding to DNA. The histone H1-hydroperoxides/Cu(I) system also induced 8-oxo-7,8-dihydro-2′-deoxyguanosine formation in calf thymus DNA. It is concluded that histone protein-hydroperoxides can induce guanine-specific DNA damage, which may contribute to γ-irradiation-induced carcinogenesis. PMID:15698381

  6. Guanine nucleotide regulatory protein co-purifies with the D/sub 2/-dopamine receptor

    SciTech Connect

    Senogles, S.E.; Caron, M.G.


    The D/sub 2/-dopamine receptor from bovine anterior pituitary was purified approx.1000 fold by affinity chromatography on CMOS-Sepharose. Reconstitution of the affinity-purified receptor into phospholipid vesicles revealed the presence of high and low affinity agonist sites as detected by N-n-propylnorapomorphine (NPA) competition experiments with /sup 3/H-spiperone. High affinity agonist binding could be converted to the low affinity form by guanine nucleotides, indicating the presence of an endogenous guanine nucleotide binding protein (N protein) in the affinity-purified D/sub 2/ receptor preparations. Furthermore, this preparation contained an agonist-sensitive GTPase activity which was stimulated 2-3 fold over basal by 10 NPA. /sup 35/S-GTP..gamma..S binding to these preparations revealed a stoichiometry of 0.4-0.7 mole N protein/mole receptor, suggesting the N protein may be specifically coupled with the purified D/sub 2/-dopamine receptor and not present as a contaminant. Pertussis toxin treatment of the affinity purified receptor preparations prevented high affinity agonist binding, as well as agonist stimulation of the GTPase activity, presumably by inactivating the associated N protein. Pertussis toxin lead to the ADP-ribosylation of a protein of 39-40K on SDS-PAGE. These findings indicate that an endogenous N protein, N/sub i/ or N/sub o/, co-purifies with the D/sub 2/-dopamine receptor which may reflect a precoupling of this receptor with an N protein within the membranes.

  7. Recognition and activation of Rho GTPases by Vav1 and Vav2 guanine nucleotide exchange factors.


    Heo, Jongyun; Thapar, Roopa; Campbell, Sharon L


    Vav proteins are Rho GTPase-specific guanine nucleotide exchange factors (GEFs) that are distinguished by the tandem arrangement of Dbl homology (DH), Pleckstrin homology (PH), and cysteine rich domains (CRD). Whereas the tandem DH-PH arrangement is conserved among Rho GEFs, the presence of the CRD is unique to Vav family members and is required for efficient nucleotide exchange. We provide evidence that Vav2-mediated nucleotide exchange of Rho GTPases follows the Theorell-Chance mechanism in which the Vav2.Rho GTPase complex is the major species during the exchange process and the Vav2.GDP-Mg(2+).Rho GTPase ternary complex is present only transiently. The GTPase specificity for the DH-PH-CRD Vav2 in vitro follows this order: Rac1 > Cdc42 > RhoA. Results obtained from fluorescence anisotropy and NMR chemical shift mapping experiments indicate that the isolated Vav1 CRD is capable of directly associating with Rac1, and residues K116 and S83 that are in the proximity of the P-loop and the guanine base either are part of this binding interface or undergo a conformational change in response to CRD binding. The NMR studies are supported by kinetic measurements on Rac1 mutants S83A, K116A, and K116Q and Vav2 CRD mutant K533A in that these mutants affect both the initial binding event of Vav2 with Rac1 (k(on)) and the rate-limiting dissociation of Vav2 from the Vav2.Rac1 binary complex (thereby influencing the enzyme turnover number, k(cat)). The results suggest that the CRD domain in Vav proteins plays an active role, affecting both the k(on) and the k(cat) for Vav-mediated nucleotide exchange on Rho GTPases.

  8. Circular dichroism anisotrophy of DNA with different modifications at N7 of guanine.


    Zavriev, S K; Minchenkova, L E; Vorlícková, M; Kolchinsky, A M; Volkenstein, M V; Ivanov, V I


    The complexex DNA-Ag1+, DNA-Cu1+, protonated DNA and DNA methylated at N7 of guanine were oriented by pumping the solutions through a multicapillary cell in the direction of a light beam. The CD components along the DNA axis, delta epsilon parallel, and normal to it, 2 delta epsilon perpendicular, were calculated from the CD spectra of the oriented samples by the method of Chung and Holzwarth, (1975) J. Mol. Biol. 92, 449--466. It was shown that in most cases, except that of the protonated DNA, the degree of orientation was only slightly less than that for pure DNA. This demonstrated the absence of aggregation and of appreciable denaturation. In all cases the modifications of DNA give rise to a negative component 2 delta epsilon perpendicular, whose magnitude increased as the extent of modification increased. From both the CD spectra of non-oriented samples and the absorption spectra, an inference is drawn that Ag1+ and Cu1+ are attached to the same site as CH3 groups i.e., to the N7 atom of guanine. Proton transfer along the H-bond from the N1 atom of G to the N3 atom of the complementary cytosine is suggested to be a result of the modifications, although the case of H+-DNA may differ from the others. Based on the CD spectra for the anisotropic components, delta epsilon parallel and 2 delta epsilon perpendicular, it is proposed that ligand binding is accompanied by winding of the DNA helix.

  9. Electrochemical oxidation of guanine: electrode reaction mechanism and tailoring carbon electrode surfaces to switch between adsorptive and diffusional responses.


    Li, Qian; Batchelor-McAuley, Christopher; Compton, Richard G


    The electrochemical oxidation of guanine is studied in aqueous media at various carbon electrodes. Specifically edge plane pyrolytic graphite (EPPG), basal plane pyrolytic graphite (BPPG), and highly ordered pyrolytic graphite (HOPG) were used, and the voltammetry was found to vary significantly. In all cases, signals characteristic of adsorbed guanine were seen and the total charge passed varied from surface to surface in the order roughened BPPG > EPPG > BPPG > HOPG. It is of note that the peak height for the EPPG electrode is less than that found for roughened BPPG; furthermore, across the series of electrodes, there is a significant decrease in peak potential with increasing density of edge plane sites present at the electrode surface. This leads us to conclude that there are two dominating and controlling factors present: (i) the density of basal plane sites on which guanine can adsorb and (ii) the density of edge plane sites necessary for the electro-oxidation of the analyte. This conclusion is corroborated through further experiments with multi- and single-walled carbon nanotubes. Adsorption was seen to be enhanced by modification of the EPPG surface with alumina particles, and as such, increased peak signals were observed in their presence. It is further reported that via the pre-adsorption of acetone onto the graphite surface that the adsorption of guanine may be blocked, resulting in a diffusional voltammetric signal. This diffusional response has been successfully modeled and gives insight into the complex -4e(-), -4H(+) oxidation mechanism; specifically, it enables explanation of the observed change in rate-determining step with scan rate. The oxidation of guanine first proceeds via a two-electron oxidation followed by a chemical step to form 8-oxoguanine, then 8-oxoguanine is then further oxidized to form nonelectroactive products. The change is mechanism is attributed to the variation in potential of the first and second electron transfer with scan

  10. Investigation of base pairs containing oxidized guanine using ab initio method and ABEEMσπ polarizable force field.


    Liu, Cui; Wang, Yang; Zhao, Dongxia; Gong, Lidong; Yang, Zhongzhi


    The integrity of the genetic information is constantly threatened by oxidizing agents. Oxidized guanines have all been linked to different types of cancers. Theoretical approaches supplement the assorted experimental techniques, and bring new sight and opportunities to investigate the underlying microscopic mechanics. Unfortunately, there is no specific force field to DNA system including oxidized guanines. Taking high level ab initio calculations as benchmark, we developed the ABEEMσπ fluctuating charge force field, which uses multiple fluctuating charges per atom. And it was applied to study the energies, structures and mutations of base pairs containing oxidized guanines. The geometries were obtained in reference to other studies or using B3LYP/6-31+G* level optimization, which is more rational and timesaving among 24 quantum mechanical methods selected and tested by this work. The energies were determined at MP2/aug-cc-pVDZ level with BSSE corrections. Results show that the constructed potential function can accurately simulate the change of H-bond and the buckled angle formed by two base planes induced by oxidized guanine, and it provides reliable information of hydrogen bonding, stacking interaction and the mutation processes. The performance of ABEEMσπ polarizable force field in predicting the bond lengths, bond angles, dipole moments etc. is generally better than those of the common force fields. And the accuracy of ABEEMσπ PFF is close to that of the MP2 method. This shows that ABEEMσπ model is a reliable choice for further research of dynamics behavior of DNA fragment including oxidized guanine.

  11. Influence of carrier ligand NH hydrogen bonding to the O6 and phosphate group of guanine nucleotides in platinum complexes with a single guanine ligand.


    Carlone, M; Fanizzi, F P; Intini, F P; Margiotta, N; Marzilli, L G; Natile, G


    Coordinated N,N',N"-trimethyldiethylenetriamine (Me3dien) has several possible configurations: two have mirror symmetry (R,S configurations at the terminal nitrogens) and the terminal N-Me's anti or syn with respect to the central N-Me (anti-(R,S) and syn-(R,S) isomers, respectively), and two are nonsymmetrical (R,R and S,S configurations at terminal nitrogens, rac denotes a 1:1 mixture of the two isomers). For each configuration, two Me3dienPtG atropisomers can be formed (anti or syn orientation of central N-Me and G 06, G = guanine derivative), and these can be observed since the terminal N-Me's decrease the rate of G rotation about the Pt-N7 bond. In symmetrical syn-(R,S)-Me3dienPtG derivatives with G = 9-EtG and 3'-GMP, the anti rotamer, which can form O6-NH H-bonds, was slightly favored over the syn rotamer but never more than 2:1. This anti rotamer is also favored by lower steric repulsion between the terminal N-Me's and G O6; thus, the contribution of O6-NH H-bonding to the stability of the anti rotamer could be rather small. With G = 5'-GMP, an O6-NH H-bond in the anti rotamer and a phosphate-NH H-bond in the syn rotamer can form. Only the syn rotamer was detected in solution, indicating that NH H-bonds to 5'-phosphate are far more important than to O6, particularly since steric factors favor the anti rotamer. Interconversion between rotamers was faster for syn-(R,S)- than for rac-Me3dien derivatives. This appears to be determined by a smaller steric impediment to G rotation of two "quasi equatorial" N-Me's, both on one side of the platinum coordination plane (syn-(R,S) isomer), than one "quasi equatorial" and one "quasi axial" N-Me on either side of the coordination plane (rac isomer).

  12. Molecular mechanism of the effects of guanine nucleotide and sulfhydryl reagent on muscarinic receptors in smooth muscles studied by radiation inactivation

    SciTech Connect

    Uchida, S.; Matsumoto, K.; Takeyasu, K.; Higuchi, H.; Yoshida, H.


    The molecular sizes of the units concerned in 3-quinuclidinyl benzilate (QNB) binding and in the effects of guanine nucleotide and sulfhydryl reagent on the inhibition of QNB binding by carbachol in smooth muscle of guinea pig ileum were determined to be 76,000, 179,000 and 107,000, respectively by the radiation inactivation method. One or more subunits (GTP subunit) other than the receptor subunit in a muscarinic receptor appeared to be involved in the effect of guanine nucleotide. When guanine nucleotide was present, the receptor subunit seemed to be dissociated from the GTP subunit.

  13. Trichomonas vaginalis NTPDase and ecto-5'-nucleotidase hydrolyze guanine nucleotides and increase extracellular guanosine levels under serum restriction.


    Menezes, Camila Braz; Durgante, Juliano; de Oliveira, Rafael Rodrigues; Dos Santos, Victor Hugo Jacks Mendes; Rodrigues, Luiz Frederico; Garcia, Solange Cristina; Dos Santos, Odelta; Tasca, Tiana


    Trichomonas vaginalis is the aethiologic agent of trichomoniasis, the most common non-viral sexually transmitted disease in the world. The purinergic signaling pathway is mediated by extracellular nucleotides and nucleosides that are involved in many biological effects as neurotransmission, immunomodulation and inflammation. Extracellular nucleotides can be hydrolyzed by a family of enzymes known as ectonucleotidases including the ecto-nucleoside triphosphate diphosphohydrolases (E-NTPDases) family which hydrolyses nucleosides triphosphate and diphosphate as preferential substrates and ecto-5'-nucleotidase which catalyzes the conversion of monophosphates into nucleosides. In T. vaginalis the E-NTPDase and ecto-5'-nucleotidase activities upon adenine nucleotides have already been characterized in intact trophozoites but little is known concerning guanine nucleotides and nucleoside. These enzymes may exert a crucial role on nucleoside generation, providing the purine sources for the synthesis de novo of these essential nutrients, sustaining parasite growth and survival. In this study, we investigated the hydrolysis profile of guanine-related nucleotides and nucleoside in intact trophozoites from long-term-grown and fresh clinical isolates of T. vaginalis. Knowing that guanine nucleotides are also substrates for T. vaginalis ectoenzymes, we evaluated the profile of nucleotides consumption and guanosine uptake in trophozoites submitted to a serum limitation condition. Results show that guanine nucleotides (GTP, GDP, GMP) were substrates for T. vaginalis ectonucleotidases, with expected kinetic parameters for this enzyme family. Different T. vaginalis isolates (two from the ATCC and nine fresh clinical isolates) presented a heterogeneous hydrolysis profile. The serum culture condition increased E-NTPDase and ecto-5'-nucleotidase activities with high consumption of extracellular GTP generating enhanced GDP, GMP and guanosine levels as demonstrated by HPLC, with final

  14. DNA lesions derived from the site selective oxidation of Guanine by carbonate radical anions.


    Joffe, Avrum; Geacintov, Nicholas E; Shafirovich, Vladimir


    Carbonate radical anions are potentially important oxidants of nucleic acids in physiological environments. However, the mechanisms of action are poorly understood, and the end products of oxidation of DNA by carbonate radicals have not been characterized. These oxidation pathways were explored in this work, starting from the laser pulse-induced generation of the primary radical species to the identification of the stable oxidative modifications (lesions). The cascade of events was initiated by utilizing 308 nm XeCl excimer laser pulses to generate carbonate radical anions on submicrosecond time scales. This laser flash photolysis method involved the photodissociation of persulfate to sulfate radical anions and the one electron oxidation of bicarbonate anions by the sulfate radicals to yield the carbonate radical anions. The latter were monitored by their characteristic transient absorption band at 600 nm. The rate constants of reactions of carbonate radicals with oligonucleotides increase in the ascending order: 5'-d(CCATCCTACC) [(5.7 +/- 0.6) x 10(6) M(-)(1) s(-)(1)] < 5'-d(TATAACGTTATA), self-complementary duplex [(1.4 +/- 0.2) x 10(7) M(-)(1) s(-)(1)] < 5'-d(CCATCGCTACC [(2.4 +/- 0.3) x 10(7) M(-)(1) s(-)(1)] < 5'-d(CCATC[8-oxo-G]CTACC) [(3.2 +/- 0.4) x 10(8) M(-)(1) s(-)(1)], where 8-oxo-G is 8-oxo-7,8-dihydroguanine, the product of a two electron oxidation of guanine. This remarkable enhancement of the rate constants is correlated with the presence of either G or 8-oxo-G bases in the oligonucleotides. The rate constant for the oxidation of G in a single-stranded oligonuclotide is faster by a factor of approximately 2 than in the double-stranded form. The site selective oxidation of G and 8-oxo-G residues by carbonate radicals results in the formation of unique end products, the diastereomeric spiroiminodihydantoin (Sp) lesions, the products of a four electron oxidation of guanine. These lesions, formed in high yields (40-60%), were isolated by reversed phase

  15. Photoinduced cleavage by a rhodium complex at G.U mismatches and exposed guanines in large and small RNAs.


    Chow, Christine S; Cunningham, Philip R; Lee, KangSeok; Meroueh, May; SantaLucia, John; Varma, Shikha


    Photoinduced cleavage reactions by the rhodium complex tris(4,7-diphenyl-1,10-phenanthroline)rhodium(III) [Rh(DIP)(3)(3+)] with three RNA hairpins, r(GGGGU UCGCUC CACCA) (16 nucleotide, tetraloop(Ala2)), r(GGGGCUAUAGCUCUAGCUC CACCA) (24 nucleotide, microhelix(Ala)), and r(GGCGGUUAGAUAUCGCC) (17 nucleotide, 790 loop), and full-length (1542 nucleotide) 16S rRNA from Escherichia coli were investigated. The cleavage reactions were monitored by gel electrophoresis and the sites of cleavage by Rh(DIP)(3)(3+) were determined by comparisons with chemical or enzymatic sequencing reactions. In general, RNA backbone scission by the metal complex was induced at G.U mismatches and at exposed G residues. The cleavage activity was observed on the three small RNA hairpins as well as on the isolated 1542-nucleotide ribosomal RNA.

  16. Highly Sensitive Bacteria Quantification Using Immunomagnetic Separation and Electrochemical Detection of Guanine-Labeled Secondary Beads

    PubMed Central

    Jayamohan, Harikrishnan; Gale, Bruce K.; Minson, Bj; Lambert, Christopher J.; Gordon, Neil; Sant, Himanshu J.


    In this paper, we report the ultra-sensitive indirect electrochemical detection of E. coli O157:H7 using antibody functionalized primary (magnetic) beads for capture and polyguanine (polyG) oligonucleotide functionalized secondary (polystyrene) beads as an electrochemical tag. Vacuum filtration in combination with E. coli O157:H7 specific antibody modified magnetic beads were used for extraction of E. coli O157:H7 from 100 mL samples. The magnetic bead conjugated E. coli O157:H7 cells were then attached to polyG functionalized secondary beads to form a sandwich complex (magnetic bead/E. coli/ secondary bead). While the use of magnetic beads for immuno-based capture is well characterized, the use of oligonucleotide functionalized secondary beads helps combine amplification and potential multiplexing into the system. The antibody functionalized secondary beads can be easily modified with a different antibody to detect other pathogens from the same sample and enable potential multiplexing. The polyGs on the secondary beads enable signal amplification up to 108 guanine tags per secondary bead (7.5 × 106 biotin-FITC per secondary bead, 20 guanines per oligonucleotide) bound to the target (E. coli). A single-stranded DNA probe functionalized reduced graphene oxide modified glassy carbon electrode was used to bind the polyGs on the secondary beads. Fluorescent imaging was performed to confirm the hybridization of the complex to the electrode surface. Differential pulse voltammetry (DPV) was used to quantify the amount of polyG involved in the hybridization event with tris(2,2′-bipyridine)ruthenium(II) ( Ru(bpy)32+) as the mediator. The amount of polyG signal can be correlated to the amount of E. coli O157:H7 in the sample. The method was able to detect concentrations of E. coli O157:H7 down to 3 CFU/100 mL, which is 67 times lower than the most sensitive technique reported in literature. The signal to noise ratio for this work was 3. We also demonstrate the use of the

  17. Highly sensitive bacteria quantification using immunomagnetic separation and electrochemical detection of guanine-labeled secondary beads.


    Jayamohan, Harikrishnan; Gale, Bruce K; Minson, Bj; Lambert, Christopher J; Gordon, Neil; Sant, Himanshu J


    In this paper, we report the ultra-sensitive indirect electrochemical detection of E. coli O157:H7 using antibody functionalized primary (magnetic) beads for capture and polyguanine (polyG) oligonucleotide functionalized secondary (polystyrene) beads as an electrochemical tag. Vacuum filtration in combination with E. coli O157:H7 specific antibody modified magnetic beads were used for extraction of E. coli O157:H7 from 100 mL samples. The magnetic bead conjugated E. coli O157:H7 cells were then attached to polyG functionalized secondary beads to form a sandwich complex (magnetic bead/E. coli secondary bead). While the use of magnetic beads for immuno-based capture is well characterized, the use of oligonucleotide functionalized secondary beads helps combine amplification and potential multiplexing into the system. The antibody functionalized secondary beads can be easily modified with a different antibody to detect other pathogens from the same sample and enable potential multiplexing. The polyGs on the secondary beads enable signal amplification up to 10⁸ guanine tags per secondary bead (7.5 x 10⁶ biotin-FITC per secondary bead, 20 guanines per oligonucleotide) bound to the target (E. coli). A single-stranded DNA probe functionalized reduced graphene oxide modified glassy carbon electrode was used to bind the polyGs on the secondary beads. Fluorescent imaging was performed to confirm the hybridization of the complex to the electrode surface. Differential pulse voltammetry (DPV) was used to quantify the amount of polyG involved in the hybridization event with tris(2,2'-bipyridine)ruthenium(II) (Ru(bpy)3(2+)) as the mediator. The amount of polyG signal can be correlated to the amount of E. coli O157:H7 in the sample. The method was able to detect concentrations of E. coli O157:H7 down to 3 CFU/100 mL, which is 67 times lower than the most sensitive technique reported in literature. The signal to noise ratio for this work was 3. We also demonstrate the use of the

  18. Oxidation of guanine by carbonate radicals derived from photolysis of carbonatotetramminecobalt(III) complexes and the pH dependence of intrastrand DNA cross-links mediated by guanine radical reactions.


    Crean, Conor; Lee, Young Ae; Yun, Byeong Hwa; Geacintov, Nicholas E; Shafirovich, Vladimir


    The carbonate radical anion CO(3)(*-) is a decomposition product of nitrosoperoxycarbonate derived from the combination of carbon dioxide and peroxynitrite, an important biological byproduct of the inflammatory response. The selective oxidation of guanine in DNA by CO(3)(*-) radicals is known to yield spiroiminodihydantoin (Sp) and guanidinohydantoin (Gh) products, and also a novel intrastrand cross-linked product: 5'-d(CCATCG*CT*ACC), featuring a linkage between guanine C8 (G*) and thymine N3 (T*) atoms in the oligonucleotide (Crean et al., Nucleic Acids Res. 2008, 36, 742-755). Involvement of the T-N3 (pK(a) of N3-H is 9.67) suggests that the formation of 5'-d(CCATCG*CT*ACC) might be pH-dependent. This hypothesis was tested by generating CO(3)(*-) radicals through the photodissociation of carbonatotetramminecobalt(III) complexes by steady-state UV irradiation, which allowed for studies of product yields in the pH 5.0-10.0 range. The yield of 5'-d(CCATCG*CT*ACC) at pH 10.0 is approximately 45 times greater than at pH 5.0; this is consistent with the proposed mechanism, which requires N3(H) thymine proton dissociation followed by nucleophilic addition to the C8 guanine radical.

  19. A human exchange factor for ARF contains Sec7- and pleckstrin-homology domains.


    Chardin, P; Paris, S; Antonny, B; Robineau, S; Béraud-Dufour, S; Jackson, C L; Chabre, M


    The small G protein ARF1 is involved in the coating of vesicles that bud from the Golgi compartments. Its activation is controlled by as-yet unidentified guanine-nucleotide exchange factors. Gea1, the first ARF exchange factor to be discovered in yeast, is a large protein containing a domain of homology with Sec7, another yeast protein that is also involved in secretion. Here we characterized a smaller human protein (relative molecular mass 47K) named ARNO, which contains a central Sec7 domain that promotes guanine-nucleotide exchange on ARF1. ARNO also contains an amino-terminal coiled-coil motif and a carboxy-terminal pleckstrin-homology (PH) domain. The PH domain mediates an enhancement of ARNO exchange activity by negatively charged phospholipid vesicles supplemented with phosphatidylinositol bisphosphate. The exchange activity of ARNO is not inhibited by brefeldin A, an agent known to block vesicular transport and inhibit the exchange activity on ARF1 in cell extracts. This suggests that a regulatory component which is sensitive to brefeldin A associates with ARNO in vivo, possibly through the amino-terminal coiled-coil. We propose that other proteins with a Sec7 domain regulate different members of the ARF family.

  20. Synthesis of adenine, guanine, cytosine, and other nitrogen organic compounds by a Fischer-Tropsch-like process.

    NASA Technical Reports Server (NTRS)

    Yang, C. C.; Oro, J.


    Study of the formation of purines, pyrimidines, and other bases from CO, H2, and NH3 under conditions similar to those used in the Fischer-Tropsch process. It is found that industrial nickel/iron alloy catalyzes the synthesis of adenine, guanine, cytosine, and other nitrogenous compounds from mixtures of CO, H2, and NH3 at temperatures of about 600 C. Sufficient sample was accumulated to isolate as solid products adenine, guanine, and cytosine, which were identified by infrared spectrophotometry. In the absence of nickel/iron catalyst, at 650 C, or in the presence of this catalyst, at 450 C, no purines or pyrimidines were synthesized. These results confirm and extend some of the work reported by Kayatsu et al. (1968).

  1. Direct demonstration of guanine nucleotide sensitive receptors for vasoactive intestinal peptide in the anterior lobe of the rat pituitary gland

    SciTech Connect

    Agui, T.; Matsumoto, K. )


    The vasoactive intestinal peptide (VIP) receptors were identified on the membranes from the rat anterior pituitary gland with ({sup 125}I)VIP. The dissociation constant (Kd) and the maximal binding capacity (Bmax) values were estimated from the competitive inhibition data. The Kd and Bmax values were 1.05 +/- 0.75 nM and 103 +/- 11 fmol/mg protein, respectively. The order of molar potency of related peptides to inhibit ({sup 125}I)VIP binding was VIP greater than peptide histidine isoleucine (PHI) greater than secretin greater than glucagon. Glucagon was not effective to inhibit the binding. ({sup 125}I)VIP binding was effectively inhibited by the addition of guanine nucleotides. The order of molar potency to inhibit the binding was Gpp(NH)p greater than GTP greater than GDP greater than GMP greater than ATP. These results directly suggest the coupling of VIP receptors with guanine nucleotide binding proteins in the anterior pituitary gland.

  2. Ruthenation of Non‐stacked Guanines in DNA G‐Quadruplex Structures: Enhancement of c‐MYC Expression

    PubMed Central

    Rodríguez, Jéssica; Mosquera, Jesús; Couceiro, José R.


    Abstract Guanine quadruplexes (GQs) are compact four‐stranded DNA structures that play a key role in the control of a variety of biological processes, including gene transcription. Bulky ruthenium complexes featuring a bipyridine, a terpyridine, and one exchangeable ligand ([Ru(terpy)(bpy)X]n+) are able to metalate exposed guanines present in the GQ of the c‐MYC promoter region that are not involved in quadruplex base pairing. qRT‐PCR and western‐blot experiments indicated that the complexes promote a remarkable increase in the expression of this oncogene. We also show that exchangeable thioether ligands (X=RSR′, Met) allow regulation of the metalating activity of the complex with visible light. PMID:27860057

  3. Guanine versus deoxyribose damage in DNA oxidation mediated by vanadium(IV) and vanadium(V) complexes.


    Stemmler, A J; Burrows, C J


    Vanadyl sulfate reacts with the peroxy acid oxidant KHSO5 to produce guanine-selective oxidation of a 167-bp restriction fragment of DNA. The oxidized lesions result in strand scission after hot piperidine treatment. Although several reactive intermediates are possible, quenching studies with ethanol and tert-butyl alcohol suggest that a monoperoxysulfate radical or a caged sulfate radical are the likely species responsible for oxidation of guanine. Several oxidants and various vanadium complexes (including insulin mimetic compounds) were studied with DNA for comparison. None of the other vanadium complexes showed modification of the double-stranded 167-bp fragment of DNA in the presence of KHSO5. The reactivity of VOSO4 may be due to its irreversible oxidation potential of 0.77 V (vs. Ag+/AgCl, pH 7.0, 10 mM phosphate), making it an appropriate catalyst for decomposition of monoperoxysulfate.

  4. Lpg0393 of Legionella pneumophila is a guanine-nucleotide exchange factor for Rab5, Rab21 and Rab22.


    Sohn, Young-Sik; Shin, Ho-Chul; Park, Wei Sun; Ge, Jianning; Kim, Chan-Hee; Lee, Bok Luel; Heo, Won Do; Jung, Jae U; Rigden, Daniel John; Oh, Byung-Ha


    Legionella pneumophila, a human intracellular pathogen, encodes about 290 effector proteins that are translocated into host cells through a secretion machinery. Some of these proteins have been shown to manipulate or subvert cellular processes during infection, but functional roles of a majority of them remain unknown. Lpg0393 is a newly identified Legionella effector classified as a hypothetical protein. Through X-ray crystallographic analysis, we show that Lpg0393 contains a Vps9-like domain, which is structurally most similar to the catalytic core of human Rabex-5 that activates the endosomal Rab proteins Rab5, Rab21 and Rab22. Consistently, Lpg0393 exhibited a guanine-nucleotide exchange factor activity toward the endosomal Rabs. This work identifies the first example of a bacterial guanine-nucleotide exchange factor that is active towards the Rab5 sub-cluster members, implying that the activation of these Rab proteins might be advantageous for the intracellular survival of Legionella.

  5. Automated quantum chemistry based molecular dynamics simulations of electron ionization induced fragmentations of the nucleobases Uracil, Thymine, Cytosine, and Guanine.


    Grimme, Stefan; Bauer, Christopher Alexander


    The gas-phase decomposition pathways of electron ionization (EI)-induced radical cations of the nucleobases uracil, thymine, cytosine, and guanine are investigated by means of mixed quantum-classical molecular dynamics. No preconceived fragmentation channels are used in the calculations. The results compare well to a plethora of experimental and theoretical data for these important biomolecules. With our combined stochastic and dynamic approach, one can access in an unbiased way the energetically available decomposition mechanisms. Additionally, we are able to separate the EI mass spectra of different tautomers of cytosine and guanine. Our method (previously termed quantum chemistry electron ionization mass spectra) reproduces free nucleobase experimental mass spectra well and provides detailed mechanistic in-sight into high-energy unimolecular decomposition processes.

  6. A Cu(II) complex of an imidazolium-based ionic liquid: synthesis, X-ray structure and application in the selective electrochemical sensing of guanine.


    Singh, Amanpreet; Singh, Ajnesh; Singh, Narinder


    An imidazolium-based ionic liquid containing a carboxylic acid group was synthesized and complexed with Cu(II). The resulting complex R1 was fully characterized using various techniques, including IR spectroscopy and X-ray crystallography. Binding studies of the complex R1 were performed with anions and biomolecules using cyclic voltammetry, which showed no change in its voltammogram upon the addition of various anions and most biomolecules. However, a shift in the reduction peak from +0.20 to -0.15 was observed upon the addition of guanine. This selective determination of guanine by R1 was extended by using R1 as an electrochemical sensor for guanine in various voltammetric techniques, including cyclic voltammetry, LSV and DPV. The proposed sensor showed excellent reproducibility and high selectivity and sensitivity towards guanine, with a linear range of 0-20 μM and a detection limit of 45 nM.

  7. Structure of Radicals from X-irradiated Guanine Derivatives: An Experimental and Computational Study of Sodium Guanosine Dihydrate Single Crystals

    PubMed Central

    Jayatilaka, Nayana; Nelson, William H.


    In sodium guanosine dihydrate single crystals, the guanine moiety is deprotonated at N1 due to growth from high-pH (>12) solutions. EPR and ENDOR study of crystals x-irradiated at 10 K detected evidence for three radical forms. Radical R1,characterized by two proton and two nitrogen hyperfine interactions, was identified as the product of net hydrogenation at N7 of the N1-deprotonated guanine unit. R1 exhibited an unusually distorted structure leading to net positive isotropic components of the hydrogen couplings. Radical R2, characterized by one proton and one nitrogen hyperfine coupling was identified as the primary electron loss product. This product is equivalent to that of deprotonation at N1 by the guanine cation and represents the first ENDOR characterization of that product. Radical R3, characterized by a single hydrogen hyperfine coupling, was identified as the product of net dehydrogenation at C1 of the ribose moiety. The identification of radicals R1-R3 was supported by DFT calculations on several possible structures using the B3LYP/6-311G(2df,p)//6-31G(d,p) approach. Radical R4, detected after warming the crystals to room temperature, was identified as the well-known product of net hydrogenation of C8 of the (N1-deprotonated) guanine component. Radical R1, evidently formed by protonation of the primary electron addition product, was present as roughly 60% of the total radicals detected at 10 K. Radical R2 was present as roughly 27% of the total yield, and the concentration of R3 contributed the remaining 13%. R3 is evidently the product of oneelectron oxidation followed by deprotonation; thus, the balance of oxidation and reduction products is approximately equal within experimental uncertainty. PMID:17249824

  8. Cap analog substrates reveal three clades of cap guanine-N2 methyltransferases with distinct methyl acceptor specificities.


    Benarroch, Delphine; Jankowska-Anyszka, Marzena; Stepinski, Janusz; Darzynkiewicz, Edward; Shuman, Stewart


    The Tgs proteins are structurally homologous AdoMet-dependent eukaryal enzymes that methylate the N2 atom of 7-methyl guanosine nucleotides. They have an imputed role in the synthesis of the 2,2,7-trimethylguanosine (TMG) RNA cap. Here we exploit a collection of cap-like substrates to probe the repertoire of three exemplary Tgs enzymes, from mammalian, protozoan, and viral sources, respectively. We find that human Tgs (hTgs1) is a bona fide TMG synthase adept at two separable transmethylation steps: (1) conversion of m(7)G to m(2,7)G, and (2) conversion of m(2,7)G to m(2,2,7)G. hTgs1 is unable to methylate G or m(2)G, signifying that both steps require an m(7)G cap. hTgs1 utilizes a broad range of m(7)G nucleotides, including mono-, di-, tri-, and tetraphosphate derivatives as well as cap dinucleotides with triphosphate or tetraphosphate bridges. In contrast, Giardia lamblia Tgs (GlaTgs2) exemplifies a different clade of guanine-N2 methyltransferase that synthesizes only a dimethylguanosine (DMG) cap structure and cannot per se convert DMG to TMG under any conditions tested. Methylation of benzyl(7)G and ethyl(7)G nucleotides by hTgs1 and GlaTgs2 underscored the importance of guanine N7 alkylation in providing a key pi-cation interaction in the methyl acceptor site. Mimivirus Tgs (MimiTgs) shares with the Giardia homolog the ability to catalyze only a single round of methyl addition at guanine-N2, but is distinguished by its capacity for guanine-N2 methylation in the absence of prior N7 methylation. The relaxed cap specificity of MimiTgs is revealed at alkaline pH. Our findings highlight both stark and subtle differences in acceptor specificity and reaction outcomes among Tgs family members.

  9. Rational design of hetero-ring-expanded guanine analogs with enhanced properties for modified DNA building blocks.


    Zhang, Jinmei; Cukier, Robert I; Bu, Yuxiang


    The properties and modes of recognition of physiological DNAs associated with the four natural nucleobases might be extended, in principle, by the design of non-natural nucleobase derivatives. The goal is an expansion of the genetic alphabet, with the possible outcome of producing new DNAs with improved physical or biological properties. In this work, a new series of hetero-ring-expanded guanine analogs are proposed, and their relevant structural characteristics and electronic properties are determined by density functional theory. The stabilities of the decamer DNA duplexes (dn.dC)10 (where n represents the corresponding expanded guanine analog designed here) are also examined, using molecular dynamics. The simulations show that the designed motifs can form stable DNA-like structures. We determined the pairing energies for the Watson-Crick (WC) hydrogen-bonded dimers between the expanded G-analogs and the natural C, and found that the pairing energies are close to those of the natural GC pair. The calculated adiabatic ionization potentials (IPs) of the size-expanded guanine analogs and their base pairs, and the corresponding vertical ionization potentials, show that some are distinctly smaller than the corresponding natural versions. The HOMO-LUMO energy gaps for most of the size-expanded guanine analogs and their WC base pairs are considerably lower than those of the corresponding natural base and base pairs. Thus, the expanded G bases may be considered as DNA genetic motifs, and they may serve as building blocks for potential biological applications and the development of molecular electronic devices.

  10. Quantum-chemical study of interactions of trans-resveratrol with guanine-thymine dinucleotide and DNA-nucleobases.


    Mikulski, Damian; Szeląg, Małgorzata; Molski, Marcin


    Trans-resveratrol, a natural phytoalexin present in red wine and grapes, has gained considerable attention because of its antiproliferative, chemopreventive and proapoptotic activity against human cancer cells. The accurate quantum-chemical computations based on the density functional theory (DFT) and ab initio second-order Møller-Plesset perturbation method (MP2) have been performed for the first time to study interactions of trans-resveratrol with guanine-thymine dinucleotide and DNA-derived nitrogenous bases: adenine, guanine, cytosine and thymine in vacuum and water medium. This compound is found to show high affinity to nitrogenous bases and guanine-thymine dinucleotide. The electrostatic interactions from intermolecular hydrogen bonding increase the stability of complexes studied. In particular, significantly strong hydrogen bonds between 4'-H atom of trans-resveratrol and imidazole nitrogen as well as carbonyl oxygen atoms of nucleobases studied stabilize these systems. The stabilization energies computed reveal that the negatively charged trans-resveratrol-dinucleotide complex is more energetically stable in water medium than in vacuum. MP2 method gives more reliable and significantly high values of stabilization energy of trans-resveratrol-dinucleotide, trans-resveratrol-guanine and trans-resveratrol-thymine complexes than B3LYP exchange-correlation functional because it takes into account London dispersion energy. According to the results, in the presence of trans-resveratrol the 3'-5' phosphodiester bond in dinucleotide can be cleaved and the proton from 4'-OH group of trans-resveratrol migrates to the 3'-O atom of dinucleotide. It is concluded that trans-resveratrol is able to break the DNA strand. Hence, the findings obtained help understand antiproliferative and anticancer properties of this polyphenol.

  11. Structure of radicals from X-irradiated guanine derivatives: an experimental and computational study of sodium guanosine dihydrate single crystals.


    Jayatilaka, Nayana; Nelson, William H


    In sodium guanosine dihydrate single crystals, the guanine moiety is deprotonated at N1 due to growth from high-pH (>12) solutions. Electron paramagnetic resonance (EPR) and electron-nuclear double resonance (ENDOR) studies of crystals X-irradiated at 10 K detected evidence for three radical forms. Radical R1, characterized by two proton and two nitrogen hyperfine interactions, was identified as the product of net hydrogenation at N7 of the N1-deprotonated guanine unit. R1 exhibited an unusually distorted structure leading to net positive isotropic components of the hydrogen alpha-couplings. Radical R2, characterized by one proton and one nitrogen hyperfine coupling, was identified as the primary electron-loss product. This product is equivalent to that of deprotonation at N1 by the guanine cation and represents the first ENDOR characterization of that product. Radical R3, characterized by a single hydrogen hyperfine coupling, was identified as the product of net dehydrogenation at C1' of the ribose moiety. The identification of radicals R1-R3 was supported by density functional theory (DFT) calculations on several possible structures using the B3LYP/6-311G(2df,p)//6-31G(d,p) approach. Radical R4, detected after warming the crystals to room temperature, was identified as the well-known product of net hydrogenation of C8 of the (N1-deprotonated) guanine component. Radical R1, evidently formed by protonation of the primary electron addition product, was present as roughly 60% of the total radicals detected at 10 K. Radical R2 was present as roughly 27% of the total yield, and the concentration of R3 contributed the remaining 13%. R3 is evidently the product of one-electron oxidation followed by deprotonation; thus, the balance of oxidation and reduction products is approximately equal within experimental uncertainty.

  12. Computational prediction of one-electron reduction potentials and acid dissociation constants for guanine oxidation intermediates and products.


    Psciuk, Brian T; Schlegel, H Bernhard


    Reduction potentials and pK(a) values were calculated for intermediates and products along three major pathways for guanine oxidation using the B3LYP and CBS-QB3 levels of theory with the SMD implicit solvation model. N-methylated nucleobases were used as models for nucleoside species. Ensemble averaged reduction potentials at pH 7 (E7) were obtained by combining calculated standard reduction potentials with calculated pKa values in addition to accounting for tautomerization energies. Calculated pK(a) values are reasonable based on experimental estimates and chemical intuition. Pathway A leads to guanidinohydantoin (Gh) and spiroiminodihydantoin (Sp). The first step is the oxidation of 8-oxoguanine which proceeds by the loss of an electron followed by the loss of two protons and loss of another electron, yielding 8-oxopurine. The calculated E7 values for the remaining intermediates and products are at least 0.3 V higher than that of guanine, indicating that further oxidation of these species is unlikely. Pathway B leads to two formamidopyrimidine isomers (FAPyG and 2,5FAPyG). Species along this pathway have calculated reduction potentials that are much lower than the oxidation potential for guanine and would likely be very short-lived in an oxidatively stressed environment. Pathway C leads to reduced spiroiminodihydantoin and 5-carboxamido-5-formamido-2-iminohydantoin (2Ih). Similar to pathway A, the calculated reduction potentials for species along this pathway are at least 0.4 V higher than that of guanine.

  13. Crystal structures and inhibition of Trypanosoma brucei hypoxanthine-guanine phosphoribosyltransferase.


    Terán, David; Hocková, Dana; Česnek, Michal; Zíková, Alena; Naesens, Lieve; Keough, Dianne T; Guddat, Luke W


    Human African Trypanosomiasis (HAT) is a life-threatening infectious disease caused by the protozoan parasite, Trypanosoma brucei (Tbr). Due to the debilitating side effects of the current therapeutics and the emergence of resistance to these drugs, new medications for this disease need to be developed. One potential new drug target is 6-oxopurine phosphoribosyltransferase (PRT), an enzyme central to the purine salvage pathway and whose activity is critical for the production of the nucleotides (GMP and IMP) required for DNA/RNA synthesis within this protozoan parasite. Here, the first crystal structures of this enzyme have been determined, these in complex with GMP and IMP and with three acyclic nucleoside phosphonate (ANP) inhibitors. The Ki values for GMP and IMP are 30.5 μM and 77 μM, respectively. Two of the ANPs have Ki values considerably lower than for the nucleotides, 2.3 μM (with guanine as base) and 15.8 μM (with hypoxanthine as base). The crystal structures show that when two of the ANPs bind, they induce an unusual conformation change to the loop where the reaction product, pyrophosphate, is expected to bind. This and other structural differences between the Tbr and human enzymes suggest selective inhibitors for the Tbr enzyme can be designed.

  14. Herpes simplex virus-mediated human hypoxanthine-guanine phosphoribosyltransferase gene transfer into neuronal cells.

    PubMed Central

    Palella, T D; Silverman, L J; Schroll, C T; Homa, F L; Levine, M; Kelley, W N


    The virtually complete deficiency of the purine salvage enzyme hypoxanthine-guanine phosphoribosyltransferase (HPRT) results in a devastating neurological disease, Lesch-Nyhan syndrome. Transfer of the HPRT gene into fibroblasts and lymphoblasts in vitro and into hematopoietic cells in vivo has been accomplished by other groups with retroviral-derived vectors. It appears to be necessary, however, to transfer the HPRT gene into neuronal cells to correct the neurological dysfunction of this disorder. The neurotropic virus herpes simplex virus type 1 has features that make it suitable for use as a vector to transfer the HPRT gene into neuronal tissue. This report describes the isolation of an HPRT-deficient rat neuroma cell line, designated B103-4C, and the construction of a recombinant herpes simplex virus type 1 that contained human HPRT cDNA. These recombinant viruses were used to infect B103-4C cells. Infected cells expressed HPRT activity which was human in origin. Images PMID:2827006

  15. The Guanine-Nucleotide Exchange Factor SGEF Plays a Crucial Role in the Formation of Atherosclerosis

    PubMed Central

    Kroon, Jeffrey; Welch, Christopher; Bakker, Erik N.; Matlung, Hanke L.; van den Berg, Timo K.; Sharek, Lisa; Doerschuk, Claire; Hahn, Klaus; Burridge, Keith


    The passage of leukocytes across the endothelium and into arterial walls is a critical step in the development of atherosclerosis. Previously, we showed in vitro that the RhoG guanine nucleotide exchange factor SGEF (Arhgef26) contributes to the formation of ICAM-1-induced endothelial docking structures that facilitate leukocyte transendothelial migration. To further explore the in vivo role of this protein during inflammation, we generated SGEF-deficient mice. When crossed with ApoE null mice and fed a Western diet, mice lacking SGEF showed a significant decrease in the formation of atherosclerosis in multiple aortic areas. A fluorescent biosensor revealed local activation of RhoG around bead-clustered ICAM-1 in mouse aortic endothelial cells. Notably, this activation was decreased in cells from SGEF-deficient aortas compared to wild type. In addition, scanning electron microscopy of intimal surfaces of SGEF−/− mouse aortas revealed reduced docking structures around beads that were coated with ICAM-1 antibody. Similarly, under conditions of flow, these beads adhered less stably to the luminal surface of carotid arteries from SGEF−/− mice. Taken together, these results show for the first time that a Rho-GEF, namely SGEF, contributes to the formation of atherosclerosis by promoting endothelial docking structures and thereby retention of leukocytes at athero-prone sites of inflammation experiencing high shear flow. SGEF may therefore provide a novel therapeutic target for inhibiting the development of atherosclerosis. PMID:23372835

  16. Electron correlation effects and density analysis of the first-order hyperpolarizability of neutral guanine tautomers.


    Alparone, Andrea


    Dipole moments (μ), charge distributions, and static electronic first-order hyperpolarizabilities (β(μ)) of the two lowest-energy keto tautomers of guanine (7H and 9H) were determined in the gas phase using Hartree-Fock, Møller-Plesset perturbation theory (MP2 and MP4), and DFT (PBE1PBE, B97-1, B3LYP, CAM-B3LYP) methods with Dunning's correlation-consistent aug-cc-pVDZ and d-aug-cc-pVDZ basis sets. The most stable isomer 7H exhibits a μ value smaller than that of the 9H form by a factor of ca. 3.5. The β μ value of the 9H tautomer is strongly dependent on the computational method employed, as it dramatically influences the β(μ) (9H)/β(μ) (7H) ratio, which at the highest correlated MP4/aug-cc-pVDZ level is predicted to be ca. 5. The Coulomb-attenuating hybrid exchange-correlation CAM-B3LYP method is superior to the conventional PBE1PBE, B3LYP, and B97-1 functionals in predicting the β(μ) values. Differences between the largest diagonal hyperpolarizability components were clarified through hyperpolarizability density analyses. Dipole moment and first-order hyperpolarizability are molecular properties that are potentially useful for distinguishing the 7H from the 9H tautomer.

  17. Molecular basis of RNA guanine-7 methyltransferase (RNMT) activation by RAM

    PubMed Central

    Varshney, Dhaval; Petit, Alain-Pierre; Bueren-Calabuig, Juan A.; Jansen, Chimed; Fletcher, Dan A.; Peggie, Mark; Weidlich, Simone; Scullion, Paul; Pisliakov, Andrei V.; Cowling, Victoria H.


    Maturation and translation of mRNA in eukaryotes requires the addition of the 7-methylguanosine cap. In vertebrates, the cap methyltransferase, RNA guanine-7 methyltransferase (RNMT), has an activating subunit, RNMT-Activating Miniprotein (RAM). Here we report the first crystal structure of the human RNMT in complex with the activation domain of RAM. A relatively unstructured and negatively charged RAM binds to a positively charged surface groove on RNMT, distal to the active site. This results in stabilisation of a RNMT lobe structure which co-evolved with RAM and is required for RAM binding. Structure-guided mutagenesis and molecular dynamics simulations reveal that RAM stabilises the structure and positioning of the RNMT lobe and the adjacent α-helix hinge, resulting in optimal positioning of helix A which contacts substrates in the active site. Using biophysical and biochemical approaches, we observe that RAM increases the recruitment of the methyl donor, AdoMet (S-adenosyl methionine), to RNMT. Thus we report the mechanism by which RAM allosterically activates RNMT, allowing it to function as a molecular rheostat for mRNA cap methylation. PMID:27422871

  18. Self-catalyzed site-specific depurination of guanine residues within gene sequences.


    Amosova, Olga; Coulter, Richard; Fresco, Jacques R


    A self-catalyzed, site-specific guanine-depurination activity has been found to occur in short gene sequences with a potential to form a stem-loop structure. The critical features of that catalytic intermediate are a 5'-G-T-G-G-3' loop and an adjacent 5'-T.A-3' base pair of a short duplex stem stable enough to fix the loop structure required for depurination of its 5'-G residue. That residue is uniquely depurinated with a rate some 5 orders of magnitude faster than that of random "spontaneous" depurination. In contrast, all other purine residues in the sequence depurinate at the spontaneous background rate. The reaction requires no divalent cations or other cofactors and occurs under essentially physiological conditions. Such stem-loops can form in duplex DNA under superhelical stress, and their critical sequence features have been found at numerous sites in the human genome. Self-catalyzed stem-loop-mediated depurination leading to flexible apurinic sites may therefore serve some important biological role, e.g., in nucleosome positioning, genetic recombination, or chromosome superfolding.

  19. Mutation at a distance caused by homopolymeric guanine repeats in Saccharomyces cerevisiae.


    McDonald, Michael J; Yu, Yen-Hsin; Guo, Jheng-Fen; Chong, Shin Yen; Kao, Cheng-Fu; Leu, Jun-Yi


    Mutation provides the raw material from which natural selection shapes adaptations. The rate at which new mutations arise is therefore a key factor that determines the tempo and mode of evolution. However, an accurate assessment of the mutation rate of a given organism is difficult because mutation rate varies on a fine scale within a genome. A central challenge of evolutionary genetics is to determine the underlying causes of this variation. In earlier work, we had shown that repeat sequences not only are prone to a high rate of expansion and contraction but also can cause an increase in mutation rate (on the order of kilobases) of the sequence surrounding the repeat. We perform experiments that show that simple guanine repeats 13 bp (base pairs) in length or longer (G 13+ ) increase the substitution rate 4- to 18-fold in the downstream DNA sequence, and this correlates with DNA replication timing (R = 0.89). We show that G 13+ mutagenicity results from the interplay of both error-prone translesion synthesis and homologous recombination repair pathways. The mutagenic repeats that we study have the potential to be exploited for the artificial elevation of mutation rate in systems biology and synthetic biology applications.

  20. Molecular basis of RNA guanine-7 methyltransferase (RNMT) activation by RAM.


    Varshney, Dhaval; Petit, Alain-Pierre; Bueren-Calabuig, Juan A; Jansen, Chimed; Fletcher, Dan A; Peggie, Mark; Weidlich, Simone; Scullion, Paul; Pisliakov, Andrei V; Cowling, Victoria H


    Maturation and translation of mRNA in eukaryotes requires the addition of the 7-methylguanosine cap. In vertebrates, the cap methyltransferase, RNA guanine-7 methyltransferase (RNMT), has an activating subunit, RNMT-Activating Miniprotein (RAM). Here we report the first crystal structure of the human RNMT in complex with the activation domain of RAM. A relatively unstructured and negatively charged RAM binds to a positively charged surface groove on RNMT, distal to the active site. This results in stabilisation of a RNMT lobe structure which co-evolved with RAM and is required for RAM binding. Structure-guided mutagenesis and molecular dynamics simulations reveal that RAM stabilises the structure and positioning of the RNMT lobe and the adjacent α-helix hinge, resulting in optimal positioning of helix A which contacts substrates in the active site. Using biophysical and biochemical approaches, we observe that RAM increases the recruitment of the methyl donor, AdoMet (S-adenosyl methionine), to RNMT. Thus we report the mechanism by which RAM allosterically activates RNMT, allowing it to function as a molecular rheostat for mRNA cap methylation. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.

  1. Rho guanine exchange factors in blood vessels: fine-tuners of angiogenesis and vascular function.


    Kather, Jakob Nikolas; Kroll, Jens


    The angiogenic cascade is a multi-step process essential for embryogenesis and other physiological and pathological processes. Rho family GTPases are binary molecular switches and serve as master regulators of various basic cellular processes. Rho GTPases are known to exert important functions in angiogenesis and vascular physiology. These functions demand a tight and context-specific control of cellular processes requiring superordinate control by a multitude of guanine nucleotide exchange factors (GEFs). GEFs display various features enabling them to fine-tune the actions of Rho GTPases in the vasculature: (1) GEFs regulate specific steps of the angiogenic cascade; (2) GEFs show a spatio-temporally specific expression pattern; (3) GEFs differentially regulate endothelial function depending on their subcellular location; (4) GEFs mediate crosstalk between complex signaling cascades and (5) GEFs themselves are regulated by another layer of interacting proteins. The aim of this review is to provide an overview about the role of GEFs in regulating angiogenesis and vascular function and to point out current limitations as well as clinical perspectives. Copyright © 2012 Elsevier Inc. All rights reserved.

  2. EspM2 is a RhoA guanine nucleotide exchange factor

    PubMed Central

    Arbeloa, Ana; Garnett, James; Lillington, James; Bulgin, Richard R; Berger, Cedric N; Lea, Susan M; Matthews, Steve; Frankel, Gad


    We investigated how the type III secretion system WxxxE effectors EspM2 of enterohaemorrhagic Escherichia coli, which triggers stress fibre formation, and SifA of Salmonella enterica serovar Typhimurium, which is involved in intracellular survival, modulate Rho GTPases. We identified a direct interaction between EspM2 or SifA and nucleotide-free RhoA. Nuclear Magnetic Resonance Spectroscopy revealed that EspM2 has a similar fold to SifA and the guanine nucleotide exchange factor (GEF) effector SopE. EspM2 induced nucleotide exchange in RhoA but not in Rac1 or H-Ras, while SifA induced nucleotide exchange in none of them. Mutating W70 of the WxxxE motif or L118 and I127 residues, which surround the catalytic loop, affected the stability of EspM2. Substitution of Q124, located within the catalytic loop of EspM2, with alanine, greatly attenuated the RhoA GEF activity in vitro and the ability of EspM2 to induce stress fibres upon ectopic expression. These results suggest that binding of SifA to RhoA does not trigger nucleotide exchange while EspM2 is a unique Rho GTPase GEF. PMID:20039879

  3. Identification of guanine exchange factor key residues involved in exchange activity and Ras interaction.


    Camus, C; Hermann-Le Denmat, S; Jacquet, M


    We have carried out a functional analysis of the human HGRF55 exchange factor in the yeast Saccharomyces cerevisiae. Twelve residues conserved among most of all known guanine exchange factors (GEFs) have been independently changed to alanine. Taking advantage of the ability of Hgrf55p to replace the yeast Cdc25p exchange factor, and using the two-hybrid system with RAS2ala22 allele, we have identified key residues for the interaction with Ras and/or its activation. Substitution of arginine 392 to alanine leads to a complete loss of interaction with Ras, though the protein remains stable. Substitution of Asp266 or Arg359 to alanine results in inactive proteins at 39 degrees C, still able however to interact with Ras. The other charged-to-alanine substitutions led to no detectable phenotype when present alone but most of them dramatically increased the temperature sensitive phenotype observed with [Asp266Ala] substitution. Surprisingly, the cysteine to alanine substitution in the highly conserved PCVPF/Y motif proved to be without effect, suggesting that the sulfhydryl group is not essential for stability or interaction with Ras.

  4. Activation of Variants of Hypoxanthine-Guanine Phosphoribosyl Transferase by the Normal Enzyme

    PubMed Central

    Bakay, Bohdan; Nyhan, William L.


    Deficient hypoxanthine-guanine phosphoribosyl transferase (HGPRT; EC enzymes from erythrocytes of patients with hyperuricemia and with the Lesch-Nyhan syndrome migrate 15% faster in polyacrylamide gel disc electrophoresis than the normal enzyme. A half-sister of two males with partial deficiency, who had 34% of normal HGPRT activity in her erythrocytes, yielded profiles containing two distinct zones of activity; one corresponded to the enzyme found in normal individuals and one to the variant of her half-brothers. However, in her profile her variant enzyme showed notably greater activity than that observed in her half-brothers. This increase was due to an activation of the variant by normal enzyme. Electrophoresis of mixtures of normal enzyme with partially deficient enzymes from patients with hyperuricemia and with the Lesch-Nyhan syndrome also led to activation of deficient HGPRT variants by normal enzymes. Deficient variants were also activated by normal enzyme on filtration through Sephadex G-25. Experiments in which deficient variant enzymes were activated with purified normal enzyme labeled with 125I indicated that deficient enzymes incorporate components of the normal enzyme. No such activation of deficient enzymes was ever obtained when mixtures of deficient and normal enzymes were put together in a test tube. Images PMID:4341698

  5. How not to do kinetics: examples involving GTPases and guanine nucleotide exchange factors.


    Goody, Roger S


    Guanine nucleotide exchange factors (GEFs) are crucial regulators of the action of GTPases in signal transduction and cellular regulation. Although their basic mechanism of action has been apparent for almost 20 years, there are still misconceptions concerning their properties, and these are confounded by superficial or incorrect interpretation of experimental results in individual cases. Here, an example is described in which an incorrect mechanism was derived because of an inadequate analysis of kinetic results. In a second example, a case is discussed where certain GTP analogs were erroneously described as being able to function as low molecular mass GEFs. In both cases, a lack of distinction between rates, rate constants, and apparent rate constants, together with a disregard of relative signal amplitudes, led to the misinterpretations. In a final example, it is shown how the lack of an appropriate kinetic investigation led to the false conclusion that a secreted protein from Legionella pneumophila can act not only as a GEF towards eukaryotic Rab1 but also as a factor that is able to actively dissociate the stable complex between Rab1 and GDP dissociation inhibitor.

  6. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization.


    Dhapola, Parashar; Chowdhury, Shantanu


    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 ( presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way.

  7. Crystal structures and inhibition of Trypanosoma brucei hypoxanthine–guanine phosphoribosyltransferase

    PubMed Central

    Terán, David; Hocková, Dana; Česnek, Michal; Zíková, Alena; Naesens, Lieve; Keough, Dianne T.; Guddat, Luke W.


    Human African Trypanosomiasis (HAT) is a life-threatening infectious disease caused by the protozoan parasite, Trypanosoma brucei (Tbr). Due to the debilitating side effects of the current therapeutics and the emergence of resistance to these drugs, new medications for this disease need to be developed. One potential new drug target is 6-oxopurine phosphoribosyltransferase (PRT), an enzyme central to the purine salvage pathway and whose activity is critical for the production of the nucleotides (GMP and IMP) required for DNA/RNA synthesis within this protozoan parasite. Here, the first crystal structures of this enzyme have been determined, these in complex with GMP and IMP and with three acyclic nucleoside phosphonate (ANP) inhibitors. The Ki values for GMP and IMP are 30.5 μM and 77 μM, respectively. Two of the ANPs have Ki values considerably lower than for the nucleotides, 2.3 μM (with guanine as base) and 15.8 μM (with hypoxanthine as base). The crystal structures show that when two of the ANPs bind, they induce an unusual conformation change to the loop where the reaction product, pyrophosphate, is expected to bind. This and other structural differences between the Tbr and human enzymes suggest selective inhibitors for the Tbr enzyme can be designed. PMID:27786284

  8. bis-Molybdopterin Guanine Dinucleotide Is Required for Persistence of Mycobacterium tuberculosis in Guinea Pigs

    PubMed Central

    Williams, Monique J.; Shanley, Crystal A.; Zilavy, Andrew; Peixoto, Blas; Manca, Claudia; Kaplan, Gilla; Orme, Ian M.; Mizrahi, Valerie


    Mycobacterium tuberculosis is able to synthesize molybdopterin cofactor (MoCo), which is utilized by numerous enzymes that catalyze redox reactions in carbon, nitrogen, and sulfur metabolism. In bacteria, MoCo is further modified through the activity of a guanylyltransferase, MobA, which converts MoCo to bis-molybdopterin guanine dinucleotide (bis-MGD), a form of the cofactor that is required by the dimethylsulfoxide (DMSO) reductase family of enzymes, which includes the nitrate reductase NarGHI. In this study, the functionality of the mobA homolog in M. tuberculosis was confirmed by demonstrating the loss of assimilatory and respiratory nitrate reductase activity in a mobA deletion mutant. This mutant displayed no survival defects in human monocytes or mouse lungs but failed to persist in the lungs of guinea pigs. These results implicate one or more bis-MGD-dependent enzymes in the persistence of M. tuberculosis in guinea pig lungs and underscore the applicability of this animal model for assessing the role of molybdoenzymes in this pathogen. PMID:25404027

  9. The Guanine-Based Purinergic System: The Tale of An Orphan Neuromodulation

    PubMed Central

    Garozzo, Roberta; Frinchi, Monica; Fernandez-Dueñas, Víctor; Di Iorio, Patrizia; Ciccarelli, Renata; Caciagli, Francesco; Condorelli, Daniele F.; Ciruela, Francisco; Belluardo, Natale


    Guanine-based purines (GBPs) have been recently proposed to be not only metabolic agents but also extracellular signaling molecules that regulate important functions in the central nervous system. In such way, GBPs-mediated neuroprotection, behavioral responses and neuronal plasticity have been broadly described in the literature. However, while a number of these functions (i.e., GBPs neurothophic effects) have been well-established, the molecular mechanisms behind these GBPs-dependent effects are still unknown. Furthermore, no plasma membrane receptors for GBPs have been described so far, thus GBPs are still considered orphan neuromodulators. Interestingly, an intricate and controversial functional interplay between GBPs effects and adenosine receptors activity has been recently described, thus triggering the hypothesis that GBPs mechanism of action might somehow involve adenosine receptors. Here, we review recent data describing the GBPs role in the brain. We focus on the involvement of GBPs regulating neuronal plasticity, and on the new hypothesis based on putative GBPs receptors. Overall, we expect to shed some light on the GBPs world since although these molecules might represent excellent candidates for certain neurological diseases management, the lack of putative GBPs receptors precludes any high throughput screening intent for the search of effective GBPs-based drugs. PMID:27378923

  10. Crystal Structure of a Replicative DNA Polymerase Bound to the Oxidized Guanine Lesion Guanidinohydantoin

    SciTech Connect

    Aller, Pierre; Ye, Yu; Wallace, Susan S.; Burrows, Cynthia J.; Doubli, Sylvie


    The oxidation of guanine generates one of the most common DNA lesions, 8-oxo-7,8-dihydroguanine (8-oxoG). The further oxidation of 8-oxoG can produce either guanidinohydantoin (Gh) in duplex DNA or spiroiminodihydantoin (Sp) in nucleosides and ssDNA. Although Gh can be a strong block for replicative DNA polymerases such as RB69 DNA polymerase, this lesion is also mutagenic: DNA polymerases bypass Gh by preferentially incorporating a purine with a slight preference for adenine, which results in G {center_dot} C {yields} T {center_dot} A or G {center_dot} C {yields} C {center_dot} G transversions. The 2.15 {angstrom} crystal structure of the replicative RB69 DNA polymerase in complex with DNA containing Gh reveals that Gh is extrahelical and rotated toward the major groove. In this conformation Gh is no longer in position to serve as a templating base for the incorporation of an incoming nucleotide. This work also constitutes the first crystallographic structure of Gh, which is stabilized in the R configuration in the two polymerase/DNA complexes present in the crystal asymmetric unit. In contrast to 8-oxoG, Gh is found in a high syn conformation in the DNA duplex and therefore presents the same hydrogen bond donor and acceptor pattern as thymine, which explains the propensity of DNA polymerases to incorporate a purine opposite Gh when bypass occurs.

  11. Guanine nucleotide exchange factor RABGEF1 regulates keratinocyte-intrinsic signaling to maintain skin homeostasis

    PubMed Central

    Marichal, Thomas; El Abbas, Sophie; Sibilano, Riccardo; Zurek, Oliwia; Reber, Laurent L.; Pirottin, Dimitri; Kim, Jinah; Chambon, Pierre; Roers, Axel; Antoine, Nadine; Kawakami, Yuko; Bureau, Fabrice; Tam, See-Ying; Tsai, Mindy


    Epidermal keratinocytes form a structural and immune barrier that is essential for skin homeostasis. However, the mechanisms that regulate epidermal barrier function are incompletely understood. Here we have found that keratinocyte-specific deletion of the gene encoding RAB guanine nucleotide exchange factor 1 (RABGEF1, also known as RABEX-5) severely impairs epidermal barrier function in mice and induces an allergic cutaneous and systemic phenotype. RABGEF1-deficient keratinocytes exhibited aberrant activation of the intrinsic IL-1R/MYD88/NF-κB signaling pathway and MYD88-dependent abnormalities in expression of structural proteins that contribute to skin barrier function. Moreover, ablation of MYD88 signaling in RABGEF1-deficient keratinocytes or deletion of Il1r1 restored skin homeostasis and prevented development of skin inflammation. We further demonstrated that epidermal RABGEF1 expression is reduced in skin lesions of humans diagnosed with either atopic dermatitis or allergic contact dermatitis as well as in an inducible mouse model of allergic dermatitis. Our findings reveal a key role for RABGEF1 in dampening keratinocyte-intrinsic MYD88 signaling and sustaining epidermal barrier function in mice, and suggest that dysregulation of RABGEF1 expression may contribute to epidermal barrier dysfunction in allergic skin disorders in mice and humans. Thus, RABGEF1-mediated regulation of IL-1R/MYD88 signaling might represent a potential therapeutic target. PMID:27820702

  12. QuadBase2: web server for multiplexed guanine quadruplex mining and visualization

    PubMed Central

    Dhapola, Parashar; Chowdhury, Shantanu


    DNA guanine quadruplexes or G4s are non-canonical DNA secondary structures which affect genomic processes like replication, transcription and recombination. G4s are computationally identified by specific nucleotide motifs which are also called putative G4 (PG4) motifs. Despite the general relevance of these structures, there is currently no tool available that can allow batch queries and genome-wide analysis of these motifs in a user-friendly interface. QuadBase2 ( presents a completely reinvented web server version of previously published QuadBase database. QuadBase2 enables users to mine PG4 motifs in up to 178 eukaryotes through the EuQuad module. This module interfaces with Ensembl Compara database, to allow users mine PG4 motifs in the orthologues of genes of interest across eukaryotes. PG4 motifs can be mined across genes and their promoter sequences in 1719 prokaryotes through ProQuad module. This module includes a feature that allows genome-wide mining of PG4 motifs and their visualization as circular histograms. TetraplexFinder, the module for mining PG4 motifs in user-provided sequences is now capable of handling up to 20 MB of data. QuadBase2 is a comprehensive PG4 motif mining tool that further expands the configurations and algorithms for mining PG4 motifs in a user-friendly way. PMID:27185890

  13. Guanine and inosine nucleotides, nucleosides and oxypurines in snail muscles as potential biomarkers of fluoride toxicity.


    Rać, Monika E; Safranow, Krzysztof; Dołegowska, Barbara; Machoy, Zygmunt


    The aim of the present study was to determine the toxicity of fluorides on energy metabolism in muscles of the Helix aspersa maxima snail. Qualitative and quantitative analysis of purine compounds was performed in slices of foot from mature snails with high-performance liquid chromatography. Fluoride concentrations were measured using an ion-selective electrode and gas chromatography. The results show that exposure to fluoride pollution was accompanied by a statistically significant increase in fluoride concentrations in soft tissues. This effect was already noticeable with the smallest fluoride dose. Accumulation was greatest in the shell. There is a significant and positive correlation between fluoride concentrations in foot muscles and guanine and inosine nucleotides or uridine content. The content of low-energy guanylate, inosylate and oxypurine in foot muscles significantly increased with rising dose of fluoride. The difference as compared with controls was significant only for the highest dose of fluoride. Interestingly, uric acid, the final product of purine catabolism, dominated quantitatively in the foot muscles of snails. In conclusion, increased low-energy guanylate and inosylate as well as decreased xanthine concentrations in snail muscle can be indicators of the toxic influence of fluoride on the organism. The measuring of fluoride accumulation in the shell is the most suitable bioindicator of fluoride pollution in the environment.

  14. Guanine nucleotide binding protein-like 3 is a potential prognosis indicator of gastric cancer.


    Chen, Jing; Dong, Shuang; Hu, Jiangfeng; Duan, Bensong; Yao, Jian; Zhang, Ruiyun; Zhou, Hongmei; Sheng, Haihui; Gao, Hengjun; Li, Shunlong; Zhang, Xianwen


    Guanine nucleotide binding protein-like 3 (GNL3) is a GIP-binding nuclear protein that has been reported to be involved in various biological processes, including cell proliferation, cellular senescence and tumorigenesis. This study aimed to investigate the expression level of GNL3 in gastric cancer and to evaluate the relationship between its expression and clinical variables and overall survival of gastric cancer patients. The expression level of GNL3 was examined in 89 human gastric cancer samples using immunohistochemistry (IHC) staining. GNL3 in gastric cancer tissues was significantly upregulated compared with paracancerous tissues. GNL3 expression in adjacent non-cancerous tissues was associated with sex and tumor size. Survival analyses showed that GNL3 expression in both gastric cancer and adjacent non-cancerous tissues were not related to overall survival. However, in the subgroup of patients with larger tumor size (≥ 6 cm), a close association was found between GNL3 expression in gastric cancer tissues and overall survival. GNL3-positive patients had a shorter survival than GNL3-negative patients. Our study suggests that GNL3 might play an important role in the progression of gastric cancer and serve as a biomarker for poor prognosis in gastric cancer patients.

  15. Fluorescence detection of cytosine/guanine transversion based on a hydrogen bond forming ligand.


    Nishizawa, Seiichi; Yoshimoto, Keitaro; Seino, Takehiro; Xu, Chun-Yan; Minagawa, Masakazu; Satake, Hiroyuki; Tong, Aijun; Teramae, Norio


    In combination with abasic site (AP site)-containing oligodeoxynucleotides (ODNs), we demonstrate potential use of a hydrogen bond forming ligand, 2-amino-7-methyl-1,8-naphthyridine (AMND), for the fluorescence detection of the cytosine (C)/guanine (G) mutation sequence of the cancer repression gene p53. Our method is based on construction of the AP site in ODN duplexes, which allows small synthetic ligands to bind to target nucleobases accompanied by fluorescence signaling: an AP site-containing ODN is hybridized with a target ODN so as to place the AP site toward a target nucleobase, by which hydrophobic microenvironments are provided for ligands to recognize target nucleobases through hydrogen-bonding. In 10mM sodium cacodylate buffer solutions (pH, 7.0) containing 100mM NaCl and 1.0mM EDTA, AMND is found to strongly bind to C (K(d)=1.5x10(-6)M) in the target ODN while the binding affinity for G is relatively moderate (K(d)=50x10(-6)M). Significant fluorescence quenching of AMND is observed only when binding to C, making it possible to judge the C/G transversion with the naked eye.

  16. Guanine nucleotide exchange factor H1 can be a new biomarker of melanoma

    PubMed Central

    Shi, Jie; Guo, Bingyu; Zhang, Yu; Hui, Qiang; Chang, Peng; Tao, Kai


    Guanine nucleotide exchange factor H1 (GEF-H1), which couples microtubule dynamics to RhoA activation, is a microtubule-regulated exchange factor. Studies have shown that GEF-H1 can be involved in various cancer pathways; however, the clinical significance of GEF-H1 expression and functions in melanoma has not been established. In this study, we investigated the relationship between clinical outcomes and GEF-H1 functions in melanoma. A total of 60 cases of different grades of melanoma samples were used to detect the expression of GEF-H1. Results showed that both messenger RNA and protein levels of GEF-H1 were significantly higher in high-grade melanomas. Furthermore, patients with high GEF-H1 expression had a shorter overall survival (22 months) than patients with low level of GEF-H1 expression (33.38 months). We also found that GEF-H1 can promote the proliferation and metastasis of melanoma cells. In summary, these results suggested that GEF-H1 may be a valuable biomarker for assessing the degree and prognosis of melanoma following surgery. PMID:27462139

  17. Covalency in resonance-assisted halogen bonds demonstrated with cooperativity in N-halo-guanine quartets.


    Wolters, Lando P; Smits, Nicole W G; Guerra, Célia Fonseca


    Halogen bonds are shown to possess the same characteristics as hydrogen bonds: charge transfer, resonance assistance and cooperativity. This follows from the computational analyses of the structure and bonding in N-halo-base pairs and quartets. The objective was to achieve an understanding of the nature of resonance-assisted halogen bonds (RAXB): how they resemble or differ from the better understood resonance-assisted hydrogen bonds (RAHB) in DNA. We present an accurate physical model of the RAXB based on the molecular orbital theory, which is derived from the corresponding energy decomposition analyses and study of the charge distribution. We show that the RAXB arise from classical electrostatic interaction and also receive strengthening from donor-acceptor interactions within the σ-electron system. Similar to RAHB, there is also a small stabilization by π-electron delocalization. This resemblance leads to prove cooperativity in N-halo-guanine quartets, which originates from the charge separation that occurs with donor-acceptor orbital interactions in the σ-electron system.

  18. How Does Guanine-Cytosine Base Pair Affect Excess-Electron Transfer in DNA?


    Lin, Shih-Hsun; Fujitsuka, Mamoru; Majima, Tetsuro


    Charge transfer and proton transfer in DNA have attracted wide attention due to their relevance in biological processes and so on. Especially, excess-electron transfer (EET) in DNA has strong relation to DNA repair. However, our understanding on EET in DNA still remains limited. Herein, by using a strongly electron-donating photosensitizer, trimer of 3,4-ethylenedioxythiophene (3E), and an electron acceptor, diphenylacetylene (DPA), two series of functionalized DNA oligomers were synthesized for investigation of EET dynamics in DNA. The transient absorption measurements during femtosecond laser flash photolysis showed that guanine:cytosine (G:C) base pair affects EET dynamics in DNA by two possible mechanisms: the excess-electron quenching by proton transfer with the complementary G after formation of C(•-) and the EET hindrance by inserting a G:C base pair as a potential barrier in consecutive thymines (T's). In the present paper, we provided useful information based on the direct kinetic measurements, which allowed us to discuss EET through oligonucleotides for the investigation of DNA damage/repair.

  19. Influence of gamma subunit prenylation on association of guanine nucleotide-binding regulatory proteins with membranes.

    PubMed Central

    Muntz, K H; Sternweis, P C; Gilman, A G; Mumby, S M


    Two approaches were taken to address the possible role of gamma-subunit prenylation in dictating the cellular distribution of guanine nucleotide-binding regulatory proteins. Prenylation of gamma subunits was prevented by site-directed mutagenesis or by inhibiting the synthesis of mevalonate, the precursor of cellular isoprenoids. When beta or gamma subunits were transiently expressed in COS-M6 simian kidney cells (COS) cells, the proteins were found in the membrane fraction by immunoblotting. Immunofluorescence experiments indicated that the proteins were distributed to intracellular structures in addition to plasma membranes. Replacement of Cys68 of gamma with Ser prevented prenylation of the mutant protein and association of the protein with the membrane fraction of COS cells. Immunoblotting results demonstrated that some of the beta subunits were found in the cytoplasm when coexpressed with the nonprenylated mutant gamma subunit. When Neuro 2A cells were treated with compactin to inhibit protein prenylation, a fraction of endogenous beta and gamma was distributed in the cytoplasm. It is concluded that prenylation facilitates association of gamma subunits with membranes, that the cellular location of gamma influences the distribution of beta, and that prenylation is not an absolute requirement for interaction of beta and gamma. Images PMID:1550955

  20. Multisite-specific archaeosine tRNA-guanine transglycosylase (ArcTGT) from Thermoplasma acidophilum, a thermo-acidophilic archaeon

    PubMed Central

    Kawamura, Takuya; Hirata, Akira; Ohno, Satoshi; Nomura, Yuichiro; Nagano, Tomoko; Nameki, Nobukazu; Yokogawa, Takashi; Hori, Hiroyuki


    Archaeosine (G+), which is found only at position 15 in many archaeal tRNA, is formed by two steps, the replacement of the guanine base with preQ0 by archaeosine tRNA-guanine transglycosylase (ArcTGT) and the subsequent modification of preQ0 to G+ by archaeosine synthase. However, tRNALeu from Thermoplasma acidophilum, a thermo-acidophilic archaeon, exceptionally has two G+13 and G+15 modifications. In this study, we focused on the biosynthesis mechanism of G+13 and G+15 modifications in this tRNALeu. Purified ArcTGT from Pyrococcus horikoshii, for which the tRNA recognition mechanism and structure were previously characterized, exchanged only the G15 base in a tRNALeu transcript with 14C-guanine. In contrast, T. acidophilum cell extract exchanged both G13 and G15 bases. Because T. acidophilum ArcTGT could not be expressed as a soluble protein in Escherichia coli, we employed an expression system using another thermophilic archaeon, Thermococcus kodakarensis. The arcTGT gene in T. kodakarensis was disrupted, complemented with the T. acidophilum arcTGT gene, and tRNALeu variants were expressed. Mass spectrometry analysis of purified tRNALeu variants revealed the modifications of G+13 and G+15 in the wild-type tRNALeu. Thus, T. acidophilum ArcTGT has a multisite specificity and is responsible for the formation of both G+13 and G+15 modifications. PMID:26721388

  1. Mapping structurally defined guanine oxidation products along DNA duplexes: influence of local sequence context and endogenous cytosine methylation.


    Ming, Xun; Matter, Brock; Song, Matthew; Veliath, Elizabeth; Shanley, Ryan; Jones, Roger; Tretyakova, Natalia


    DNA oxidation by reactive oxygen species is nonrandom, potentially leading to accumulation of nucleobase damage and mutations at specific sites within the genome. We now present the first quantitative data for sequence-dependent formation of structurally defined oxidative nucleobase adducts along p53 gene-derived DNA duplexes using a novel isotope labeling-based approach. Our results reveal that local nucleobase sequence context differentially alters the yields of 2,2,4-triamino-2H-oxal-5-one (Z) and 8-oxo-7,8-dihydro-2'-deoxyguanosine (OG) in double stranded DNA. While both lesions are overproduced within endogenously methylated (Me)CG dinucleotides and at 5' Gs in runs of several guanines, the formation of Z (but not OG) is strongly preferred at solvent-exposed guanine nucleobases at duplex ends. Targeted oxidation of (Me)CG sequences may be caused by a lowered ionization potential of guanine bases paired with (Me)C and the preferential intercalation of riboflavin photosensitizer adjacent to (Me)C:G base pairs. Importantly, some of the most frequently oxidized positions coincide with the known p53 lung cancer mutational "hotspots" at codons 245 (GGC), 248 (CGG), and 158 (CGC) respectively, supporting a possible role of oxidative degradation of DNA in the initiation of lung cancer.

  2. DNA oxidation in anionic reverse micelles: ruthenium-mediated damage at Guanine in single- and double-stranded DNA.


    Evans, Sarah E; Mon, Soe; Singh, Robinder; Ryzhkov, Lev R; Szalai, Veronika A


    One-electron guanine oxidation in DNA has been investigated in anionic reverse micelles (RMs). A photochemical method for generating Ru3+ from the ruthenium polypyridyl complex tris(2-2'-bipyridine)ruthenium(II) chloride ([Ru(bpy)3]Cl2) is combined with high-resolution polyacrylamide gel electrophoresis (PAGE) to quantify piperidine-labile guanine oxidation products. As characterized by emission spectroscopy of Ru(bpy)3(2+), the addition of DNA to RMs containing Ru(bpy)3(2+) does not perturb the environment of Ru(bpy)3(2+). The steady-state quenching efficiency of Ru(bpy)3(2+) with K3[Fe(CN)6] in buffer solution is approximately 2-fold higher than that observed in RMs. Consistent with the difference in quenching efficiency in the two media, a 1.5-fold higher yield of piperidine-labile damage products as monitored by PAGE is observed for duplex oligonucleotide in buffer vs RMs. In contrast, a 13-fold difference in the yield of PAGE-detected G oxidation products is observed when single-stranded DNA is the substrate. Circular dichroism spectra showed that single-stranded DNA undergoes a structural change in anionic RMs. This structural change is potentially due to cation-mediated adsorption of the DNA phosphates on the anionic headgroups of the RMs, leading to protection of the guanine from oxidatively generated damage.

  3. Electrochemical biosensor based on silver nanoparticles-polydopamine-graphene nanocomposite for sensitive determination of adenine and guanine.


    Huang, Ke-Jing; Wang, Lan; Wang, Hai-Bo; Gan, Tian; Wu, Ying-Ying; Li, Jing; Liu, Yan-Ming


    A multifunctional Ag nanoparticles (AgNPs)-polydopamine (Pdop)@graphene (Gr) composite was prepared by a simple and mild procedure. Gr was easily coated with Pdop at room temperature and then AgNPs was deposited by mildly stirring. The nanocomposite was characterized by scanning electron microscope (SEM) and transmission electron microscope (TEM). Guanine and adenine as model moleculars were employed to study their electrochemical responses at the Ag-Pdop@Gr composite modified electrode, which showed more favorable electron transfer kinetics than Gr modified glassy carbon and AgNPs modified glassy carbon electrodes. The Ag-Pdop@Gr modified electrode exhibited linear ranges of 0.04-50 μM and 0.02-40 μM with detection limits of 4.0 nM and 2.0 nM for guanine and adenine, respectively. The developed method was applied for simultaneous determination of trace-level adenine and guanine in fish sperm. The results demonstrated that the AgNPs-Pdop@Gr nanocomposite was a promising substrate for the development of high-performance electrocatalysts for biosensing.

  4. Energy flow and long-range correlations in guanine-binding riboswitch: a nonequilibrium molecular dynamics study.


    Nguyen, Phuong H; Derreumaux, Philippe; Stock, Gerhard


    A nonequilibrium molecular dynamics (MD) study of the temperature-induced energy flow in a RNA-ligand complex is presented, which employs extensive all-atom explicit solvent MD simulations of the aptamer domain of the guanine-sensing riboswitch (GRA). Since the few existing MD investigations of biomolecular energy flow have used quite different computational approaches, the applicability and performance of the various methods are compared first. In particular, a nonequilibrium correlation function C(ij)(tau) is introduced that describes the cumulative response of residue j at delay time tau to the energy source at residue i. Employing this analysis, the anisotropic energy flow and long-range correlations in GRA are studied, which can be monitored over distances up to approximately 4 nm. To test whether these long-range correlations are relevant for molecular function, the unbinding-induced conformational changes of GRA are calculated using the linear-response theory, assuming that the unbinding of the guanine ligand represents the first step responsible for the function of GRA. Interestingly, it is found that the same residues that are of functional importance are also prominently involved in the energy transfer. In particular, significant correlations between the guanine ligand and the distant "kissing" loops of GRA are found. This finding is in line with recent experiments which indicate that these long-range interactions may be important for the induced-fit binding of the ligand.

  5. Structural outline of the detailed mechanism for elongation factor Ts-mediated guanine nucleotide exchange on elongation factor Tu.


    Thirup, Søren S; Van, Lan Bich; Nielsen, Tine K; Knudsen, Charlotte R


    Translation elongation factor EF-Tu belongs to the superfamily of guanine-nucleotide binding proteins, which play key cellular roles as regulatory switches. All G-proteins require activation via exchange of GDP for GTP to carry out their respective tasks. Often, guanine-nucleotide exchange factors are essential to this process. During translation, EF-Tu:GTP transports aminoacylated tRNA to the ribosome. GTP is hydrolyzed during this process, and subsequent reactivation of EF-Tu is catalyzed by EF-Ts. The reaction path of guanine-nucleotide exchange is structurally poorly defined for EF-Tu and EF-Ts. We have determined the crystal structures of the following reaction intermediates: two structures of EF-Tu:GDP:EF-Ts (2.2 and 1.8Å resolution), EF-Tu:PO4:EF-Ts (1.9Å resolution), EF-Tu:GDPNP:EF-Ts (2.2Å resolution) and EF-Tu:GDPNP:pulvomycin:Mg(2+):EF-Ts (3.5Å resolution). These structures provide snapshots throughout the entire exchange reaction and suggest a mechanism for the release of EF-Tu in its GTP conformation. An inferred sequence of events during the exchange reaction is presented.

  6. Overoxidized polypyrrole/graphene nanocomposite with good electrochemical performance as novel electrode material for the detection of adenine and guanine.


    Gao, Yan-Sha; Xu, Jing-Kun; Lu, Li-Min; Wu, Li-Ping; Zhang, Kai-Xin; Nie, Tao; Zhu, Xiao-Fei; Wu, Yao


    Most conducting polymer/graphene composites have excellent electrical conductivity. However, the background currents of these composites modified electrodes are much larger. In order to improve the sensitivities of these methods, it is necessary to decrease the background signal. In this paper, porous structure films of overoxidized polypyrrole/graphene (PPyox/GR) have been electrochemically coated onto glassy carbon electrode (GCE) and successfully utilized as an efficient electrode material for the quantitive detection of adenine and guanine, two of the most important components of DNA and RNA. The permselective polymer coatings with low background current could improve the selectivity and sensitivity of microelectrodes for the electropositive purine bases. The GRs into these polymers would further improve sensitivity by increasing the electroactive surface area. The electrochemical sensor can be applied to the quantification of adenine and guanine with a linear range covering 0.06-100 µM and 0.04-100 µM, and a low detection limit of 0.02 μM and 0.01 μM, respectively. More importantly, the proposed method was applied to quantify adenine and guanine in calf thymus DNA with satisfactory results. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Studies by Near Edge X-ray Absorption Spectroscopies of Bonding Dynamics at the Graphene/Guanine Interface - A Proposal for High Mobility, Organic Graphene Field Effect Transistors

    DTIC Science & Technology


    AFRL-AFOSR-UK-TR-2015-0034 Studies by Near Edge X-ray Absorption Spectroscopies of Bonding Dynamics at the Graphene/Guanine...April 2015 4. TITLE AND SUBTITLE Studies by Near Edge X-ray Absorption Spectroscopies of Bonding Dynamics at the Graphene/Guanine Interface - A...native graphene on SiC when used with the Si- terminated surface. Structural and chemical analysis suggest healthy dielectric epilayers, suggesting

  8. Identification of aflatoxin M1-N7-guanine in liver and urine of tree shrews and rats following administration of aflatoxin B1.


    Egner, Patricia A; Yu, Xiang; Johnson, Jesse K; Nathasingh, Christopher K; Groopman, John D; Kensler, Thomas W; Roebuck, Bill D


    Epidemiological studies have shown that exposure to aflatoxin B(1) (AFB(1)) and concurrent infection with hepatitis B lead to a multiplicative risk of developing liver cancer. This chemical-viral interaction can be recapitulated in the tree shrew (Tupia belangeri chinensis). As an initial characterization of this model, the metabolism of AFB(1) in tree shrews has been examined and compared to a sensitive bioassay species, the rat. Utilizing LC/MS/MS, an unreported product, aflatoxin M(1)-N(7)-guanine (AFM(1)-N(7)-guanine), was detected in urine and hepatic DNA samples 24 h after administration of 400 microg/kg AFB(1). In hepatic DNA isolated from tree shrews, AFM(1)-N(7)-guanine was the predominant adduct, 0.74 +/- 0.14 pmol/mg DNA, as compared to 0.37 +/- 0.07 pmol/mg DNA of AFB(1)-N(7)-guanine. Conversely, in rat liver, 6.56 +/- 2.41 pmol/mg DNA of AFB(1)-N(7)-guanine and 0.42 +/- 0.13 pmol/mg DNA of AFM(1)-N(7)-guanine were detected. Rats excreted 1.00 +/- 0.21 pmol AFB(1)-N(7)-guanine/mg creatinine and 0.29 +/- 0.10 pmol AFM(1)-N(7)-guanine/mg creatinine as compared to 0.60 +/- 0.12 pmol AFB(1)-N(7)-guanine/mg creatinine and 0.69 +/- 0.16 pmol AFM(1)-N(7)-guanine/mg creatinine excreted by the tree shrew. Furthermore, tree shrew urine contained 40 times more of the hydroxylated metabolite, AFM(1), than was excreted by rats. In vitro experiments confirmed this difference in oxidative metabolism. Hepatic microsomes isolated from tree shrews failed to produce aflatoxin Q(1) or aflatoxin P(1) but formed a significantly greater amount of AFM(1) than rat microsomes. Bioassays indicated that the tree shrew was considerably more resistant than the rat to AFB(1) hepatocarcinogenesis, which may reflect the significant differences in metabolic profiles of the two species.

  9. De Novo Guanine Biosynthesis but Not the Riboswitch-Regulated Purine Salvage Pathway Is Required for Staphylococcus aureus Infection In Vivo

    PubMed Central

    Yan, Donghong; Katakam, Anand K.; Reichelt, Mike; Lin, Baiwei; Kim, Janice; Park, Summer; Date, Shailesh V.; Monk, Ian R.; Xu, Min; Austin, Cary D.; Maurer, Till


    ABSTRACT De novo guanine biosynthesis is an evolutionarily conserved pathway that creates sufficient nucleotides to support DNA replication, transcription, and translation. Bacteria can also salvage nutrients from the environment to supplement the de novo pathway, but the relative importance of either pathway during Staphylococcus aureus infection is not known. In S. aureus, genes important for both de novo and salvage pathways are regulated by a guanine riboswitch. Bacterial riboswitches have attracted attention as a novel class of antibacterial drug targets because they have high affinity for small molecules, are absent in humans, and regulate the expression of multiple genes, including those essential for cell viability. Genetic and biophysical methods confirm the existence of a bona fide guanine riboswitch upstream of an operon encoding xanthine phosphoribosyltransferase (xpt), xanthine permease (pbuX), inosine-5′-monophosphate dehydrogenase (guaB), and GMP synthetase (guaA) that represses the expression of these genes in response to guanine. We found that S. aureus guaB and guaA are also transcribed independently of riboswitch control by alternative promoter elements. Deletion of xpt-pbuX-guaB-guaA genes resulted in guanine auxotrophy, failure to grow in human serum, profound abnormalities in cell morphology, and avirulence in mouse infection models, whereas deletion of the purine salvage genes xpt-pbuX had none of these effects. Disruption of guaB or guaA recapitulates the xpt-pbuX-guaB-guaA deletion in vivo. In total, the data demonstrate that targeting the guanine riboswitch alone is insufficient to treat S. aureus infections but that inhibition of guaA or guaB could have therapeutic utility. IMPORTANCE De novo guanine biosynthesis and purine salvage genes were reported to be regulated by a guanine riboswitch in Staphylococcus aureus. We demonstrate here that this is not true, because alternative promoter elements that uncouple the de novo pathway from

  10. Guanine nucleotide-binding protein regulation of melatonin receptors in lizard brain

    SciTech Connect

    Rivkees, S.A.; Carlson, L.L.; Reppert, S.M. )


    Melatonin receptors were identified and characterized in crude membrane preparations from lizard brain by using {sup 125}I-labeled melatonin ({sup 125}I-Mel), a potent melatonin agonist. {sup 125}I-Mel binding sites were saturable; Scatchard analysis revealed high-affinity and lower affinity binding sites, with apparent K{sub d} of 2.3 {plus minus} 1.0 {times} 10{sup {minus}11} M and 2.06 {plus minus} 0.43 {times} 10{sup {minus}10} M, respectively. Binding was reversible and inhibited by melatonin and closely related analogs but not by serotonin or norepinephrine. Treatment of crude membranes with the nonhydrolyzable GTP analog guanosine 5{prime}-({gamma}-thio)triphosphate (GTP({gamma}S)), significantly reduced the number of high-affinity receptors and increased the dissociation rate of {sup 125}I-Mel from its receptor. Furthermore, GTP({gamma}S) treatment of ligand-receptor complexes solubilized by Triton X-100 also led to a rapid dissociation of {sup 125}I-Mel from solubilized ligand-receptor complexes. Gel filtration chromatography of solubilized ligand-receptor complexes revealed two major peaks of radioactivity corresponding to M{sub r} > 400,000 and M{sub r} ca. 110,000. This elution profile was markedly altered by pretreatment with GTP({gamma}S) before solubilization; only the M{sub r} 110,000 peak was present in GTP({gamma}S)-pretreated membranes. The results strongly suggest that {sup 125}I-mel binding sites in lizard brain are melatonin receptors, with agonist-promoted guanine nucleotide-binding protein (G protein) coupling and that the apparent molecular size of receptors uncoupled from G proteins is about 110,000.

  11. The atypical Guanine-nucleotide exchange factor, dock7, negatively regulates schwann cell differentiation and myelination.


    Yamauchi, Junji; Miyamoto, Yuki; Hamasaki, Hajime; Sanbe, Atsushi; Kusakawa, Shinji; Nakamura, Akane; Tsumura, Hideki; Maeda, Masahiro; Nemoto, Noriko; Kawahara, Katsumasa; Torii, Tomohiro; Tanoue, Akito


    In development of the peripheral nervous system, Schwann cells proliferate, migrate, and ultimately differentiate to form myelin sheath. In all of the myelination stages, Schwann cells continuously undergo morphological changes; however, little is known about their underlying molecular mechanisms. We previously cloned the dock7 gene encoding the atypical Rho family guanine-nucleotide exchange factor (GEF) and reported the positive role of Dock7, the target Rho GTPases Rac/Cdc42, and the downstream c-Jun N-terminal kinase in Schwann cell migration (Yamauchi et al., 2008). We investigated the role of Dock7 in Schwann cell differentiation and myelination. Knockdown of Dock7 by the specific small interfering (si)RNA in primary Schwann cells promotes dibutyryl cAMP-induced morphological differentiation, indicating the negative role of Dock7 in Schwann cell differentiation. It also results in a shorter duration of activation of Rac/Cdc42 and JNK, which is the negative regulator of myelination, and the earlier activation of Rho and Rho-kinase, which is the positive regulator of myelination. To obtain the in vivo evidence, we generated Dock7 short hairpin (sh)RNA transgenic mice. They exhibited a decreased expression of Dock7 in the sciatic nerves and enhanced myelin thickness, consistent with in vitro observation. The effects of the in vivo knockdown on the signals to Rho GTPases are similar to those of the in vitro knockdown. Collectively, the signaling through Dock7 negatively regulates Schwann cell differentiation and the onset of myelination, demonstrating the unexpected role of Dock7 in the interplay between Schwann cell migration and myelination.

  12. Guanine-centric self-assembly of nucleotides in water: an important consideration in prebiotic chemistry.


    Cassidy, Lauren M; Burcar, Bradley T; Stevens, Wyatt; Moriarty, Elizabeth M; McGown, Linda B


    Investigations of plausible prebiotic chemistry on early Earth must consider not only chemical reactions to form more complex products such as proto-biopolymers but also reversible, molecular self-assembly that would influence the availability, organization, and sequestration of reactant molecules. The self-assembly of guanosine compounds into higher-order structures and lyotropic liquid crystalline "gel" phases through formation of hydrogen-bonded guanine tetrads (G-tetrads) is one such consideration that is particularly relevant to an RNA-world scenario. G-tetrad-based gelation has been well studied for individual guanosine compounds and was recently observed in mixtures of guanosine with 5'-guanosine monophosphate (GMP) as well. The present work investigates the self-assembly of GMP in the presence of the other RNA nucleotides. Effects of the total concentration and relative proportion of the nucleotides in the mixtures, the form (disodium salt vs. free acid) of the nucleotides, temperature, pH, and salt concentration were determined by visual observations and circular dichroism (CD) spectroscopy. The results show that formation of cholesteric G-tetrad phases is influenced by interactions with other nucleotides, likely through association (e.g., intercalation) of the nucleotides with the G-tetrad structures. These interactions affect the structure and stability of the G-tetrad gel phase, as well as the formation of alternate self-assembled GMP structures such as a continuous, hydrogen-bonded GMP helix or dimers and aggregates of GMP. These interactions and multiple equilibria are influenced by the presence of cations, especially in the presence of K(+). This work could have important implications for the emergence of an RNA or proto-RNA world, which would require mixtures of nucleotides at sufficiently high, local concentrations for abiotic polymerization to occur.

  13. Guanine nucleotide induced conformational change of Cdc42 revealed by hydrogen/deuterium exchange mass spectrometry.


    Yang, Sheng-Wei; Ting, Hsiu-Chi; Lo, Yi-Ting; Wu, Ting-Yuan; Huang, Hung-Wei; Yang, Chia-Jung; Chan, Jui-Fen Riva; Chuang, Min-Chieh; Hsu, Yuan-Hao Howard


    Cdc42 regulates pathways related to cell division. Dysregulation of Cdc42 can lead to cancer, cardiovascular diseases and neurodegenerative diseases. GTP induced activation mechanism plays an important role in the activity and biological functions of Cdc42. P-loop, Switch I and Switch II are critical regions modulating the enzymatic activity of Cdc42. We applied amide hydrogen/deuterium exchange coupled with liquid chromatography mass spectrometry (HDXMS) to investigate the dynamic changes of apo-Cdc42 after GDP, GTP and GMP-PCP binding. The natural substrate GTP induced significant decreases of deuteration in P-loop and Switch II, moderate changes of deuteration in Switch I and significant changes of deuteration in the α7 helix, a region far away from the active site. GTP binding induced similar effects on H/D exchange to its non-hydrolysable analog, GMP-PCP. HDXMS results indicate that GTP binding blocked the solvent accessibility in the active site leading to the decrease of H/D exchange rate surrounding the active site, and further triggered a conformational change resulting in the drastic decrease of H/D exchange rate at the remote α7 helix. Comparing the deuteration levels in three activation states of apo-Cdc42, Cdc42-GDP and Cdc42-GMP-PCP, the apo-Cdc42 has the most flexible structure, which can be stabilized by guanine nucleotide binding. The rates of H/D exchange of Cdc42-GDP are between the GMP-PCP-bound and the apo form, but more closely to the GMP-PCP-bound form. Our results show that the activation of Cdc42 is a process of conformational changes involved with P-loop, Switch II and α7 helix for structural stabilization.

  14. Deciphering the photochemical mechanisms describing the UV-induced processes occurring in solvated guanine monophosphate

    PubMed Central

    Altavilla, Salvatore F.; Segarra-Martí, Javier; Nenov, Artur; Conti, Irene; Rivalta, Ivan; Garavelli, Marco


    The photophysics and photochemistry of water-solvated guanine monophosphate (GMP) are here characterized by means of a multireference quantum-chemical/molecular mechanics theoretical approach (CASPT2//CASSCF/AMBER) in order to elucidate the main photo-processes occurring upon UV-light irradiation. The effect of the solvent and of the phosphate group on the energetics and structural features of this system are evaluated for the first time employing high-level ab initio methods and thoroughly compared to those in vacuo previously reported in the literature and to the experimental evidence to assess to which extent they influence the photoinduced mechanisms. Solvated electronic excitation energies of solvated GMP at the Franck-Condon (FC) region show a red shift for the ππ* La and Lb states, whereas the energy of the oxygen lone-pair nπ* state is blue-shifted. The main photoinduced decay route is promoted through a ring-puckering motion along the bright lowest-lying La state toward a conical intersection (CI) with the ground state, involving a very shallow stationary point along the minimum energy pathway in contrast to the barrierless profile found in gas-phase, the point being placed at the end of the minimum energy path (MEP) thus endorsing its ultrafast deactivation in accordance with time-resolved transient and photoelectron spectroscopy experiments. The role of the nπ* state in the solvated system is severely diminished as the crossings with the initially populated La state and also with the Lb state are placed too high energetically to partake prominently in the deactivation photo-process. The proposed mechanism present in solvated and in vacuo DNA/RNA chromophores validates the intrinsic photostability mechanism through CI-mediated non-radiative processes accompanying the bright excited-state population toward the ground state and subsequent relaxation back to the FC region. PMID:25941671

  15. Activation of Ras in vitro and in intact fibroblasts by the Vav guanine nucleotide exchange protein.

    PubMed Central

    Gulbins, E; Coggeshall, K M; Langlet, C; Baier, G; Bonnefoy-Berard, N; Burn, P; Wittinghofer, A; Katzav, S; Altman, A


    We recently identified Vav, the product of the vav proto-oncogene, as a guanine nucleotide exchange factor (GEF) for Ras. Vav is enzymatically activated by lymphocyte antigen receptor-coupled protein tyrosine kinases or independently by diglycerides. To further evaluate the physiological role of Vav, we assessed its GDP-GTP exchange activity against several Ras-related proteins in vitro and determined whether Vav activation in transfected NIH 3T3 fibroblasts correlates with the activity status of Ras and mitogen-activated protein (MAP) kinases. In vitro translated purified Vav activated by phorbol myristate acetate (PMA) or phosphorylation with recombinant p56lck displayed GEF activity against Ras but not against recombinant RacI, RacII, Ral, or RhoA proteins. Expression of vav or proto-vav in stably transfected NIH 3T3 cells led to a approximately 10-fold increase in basal or PMA-stimulated Ras exchange activity, respectively, in total-cell lysates and Vav immunoprecipitates. Elevated GEF activity was paralleled in each case by a significant increase in the proportion of active, GTP-bound Ras. PMA had a minimal effect on the low Ras. GTP level in untransfected control fibroblasts but increased it from 20 to 37% in proto-vav-transfected cells. vav-transfected cells displayed a constitutively elevated Ras. GTP level (35%), which was not increased further by PMA treatment. MAP kinases, known downstream intermediates in Ras-dependent signaling pathways, similarly exhibited increased basal or PMA-stimulated activity in Vav-expressing cells by comparison with normal NIH 3T3 cells. These results demonstrate a physiologic interaction between Vav and its target, Ras, leading to MAP kinase activation. Images PMID:8289830

  16. The use of photosensitizers to selectively generate radiation-induced guanine decomposition products

    SciTech Connect

    Buchko, G.W.; Weinfeld, M.; Berger, M.; Cadet, J.; Raoul, S.


    Free radicals generated in vivo through biological processes, including photosensitization, may lead to oxidative damage to cellular DNA. Such photosensitizer-mediated damage to DNA occurs through two principal competitive mechanisms, labeled type 1 and type 2, depending on the process by which an excited photosensitizer decays from its triplet state back to the ground state. Type 1 mechanisms involve initial electron or hydrogen transfer by the excited photosensitizer to, or from, the substrate (DNA) to generate free radicals. Type 2 mechanisms involve the initial generation of singlet oxygen by the excited photosensitizer which subsequently reacts with the substrate to generate unstable peroxidic intermediates. Although in both cases the primary target in DNA is the guanine base, the two mechanisms generate a different set of photoproducts. The lesions 2-amino-5-[(3,5-di-O-acetyl-2-deoxy-{beta}-D-erythro-pentofuran-osyl)-amino]-4H-imidazol-4-one and its major decomposition product, 2,2-diamino-4-[(3,5-di-O-acetyl-2-deoxy-{beta}-D-erythro-pentofuranosyl)amino]-5(2H)-oxazolone, have previously been identified and characterized following the exposure of 3{prime},5{prime}-di-O-acetyl-2{prime}-deoxyguanosine to OH radicals in aerated aqueous solution. In this report the authors more fully characterize 2-amino-5-[(2-deoxy-{beta}-D-erythropentofuranosyl)amino]-4H-imidazol-4-one (dIZ) and its major decomposition product, 2,2-diamino-4-[(2-deoxy-{beta}-D-erythro-pentofuranosyl)amino]-5(2H)-oxazolone (dZ), obtained from the {gamma}-radiolysis of the non-acetyled nucleoside, 2{prime}-deoxyguanosine (dG), in aerated aqueous solution.

  17. Giardia lamblia RNA cap guanine-N2 methyltransferase (Tgs2).


    Hausmann, Stéphane; Shuman, Stewart


    Tgs1 is the enzyme responsible for converting 7-methylguanosine RNA caps to the 2,2,7-trimethylguanosine cap structures of small nuclear and small nucleolar RNAs. Whereas budding yeast Saccharomyces cerevisiae and fission yeast Schizosaccharomyces pombe encode a single Tgs1 protein, the primitive eukaryote Giardia lamblia encodes two paralogs, Tgs1 and Tgs2. Here we show that purified Tgs2 is a monomeric enzyme that catalyzes methyl transfer from AdoMet (K(m) of 6 microm) to m(7)GDP (K(m) of 65 microm; k(cat) of 14 min(-1)) to form m(2,7)GDP. Tgs2 also methylates m(7)GTP (K(m) of 30 microm; k(cat) of 13 min(-1)) and m(7)GpppA (K(m) of 7 microm; k(cat)) of 14 min(-1) but is unreactive with GDP, GTP, GpppA, ATP, CTP, or UTP. We find that the conserved residues Asp-68, Glu-91, and Trp-143 are essential for Tgs2 methyltransferase activity in vitro. The m(2,7)GDP product formed by Tgs2 can be converted to m(2,2,7)GDP by S. pombe Tgs1 in the presence of excess AdoMet. However, Giardia Tgs2 itself is apparently unable to add a second methyl group at guanine-N2. This result implies that 2,2,7-trimethylguanosine caps in Giardia are either synthesized by Tgs1 alone or by the sequential action of Tgs2 and Tgs1. The specificity of Tgs2 raises the prospect that some Giardia mRNAs might contain dimethylguanosine caps.

  18. A Minimal Rac Activation Domain in the Unconventional Guanine Nucleotide Exchange Factor Dock180†

    PubMed Central

    Wu, Xin; Ramachandran, Sekar; Cerione, Richard A.; Erickson, Jon W.


    Guanine nucleotide exchange factors (GEFs) activate Rho GTPases by catalyzing the exchange of bound GDP for GTP, thereby resulting in downstream effector recognition. Two metazoan families of GEFs have been described: Dbl-GEF family members that share conserved Dbl homology (DH) and Pleckstrin homology (PH) domains and the more recently described Dock180 family members that share little sequence homology with the Dbl family and are characterized by conserved Dock homology regions 1 and 2 (DHR-1 and -2). While extensive characterization of the Dbl family has been performed, less is known about how Dock180 family members act as GEFs, with only a single x-ray structure having recently been reported for the Dock9-Cdc42 complex. In order to learn more about the mechanisms used by the founding member of the family, Dock180, to act as a Rac-specific GEF, we set out to identify and characterize its limit functional GEF domain. A C-terminal portion of the DHR-2 domain, composed of approximately 300 residues (designated as Dock180DHR-2c), is shown to be necessary and sufficient for robust Rac-specific GEF activity both in vitro and in vivo. We further show that Dock180DHR-2c binds to Rac in a manner distinct from Rac-GEFs of the Dbl family. Specifically, Ala27 and Trp56 of Rac appear to provide a bipartite binding site for the specific recognition of Dock180DHR-2c, whereas, for Dbl family Rac-GEFs, Trp56 of Rac is the sole primary determinant of GEF specificity. Based on our findings, we are able to define the core of Dock180 responsible for its Rac-GEF activity as well as highlight key recognition sites that distinguish different Dock180 family members and determine their corresponding GTPase specificities. PMID:21033699

  19. Guanine nucleotide binding properties of the mammalian RalA protein produced in Escherichia coli.


    Frech, M; Schlichting, I; Wittinghofer, A; Chardin, P


    The simian ralA cDNA was inserted in a ptac expression vector, and high amounts of soluble ral protein were expressed in Escherichia coli. The purified p24ral contains 1 mol of bound nucleotide/mol of protein that can be exchanged against external nucleotide. The ral protein exchanges GDP with a t 1/2 of 90 min at 37 degrees C in the presence of Mg2+, and has a low GTPase activity (0.07 min-1 at 37 degrees C). We have also studied its affinity for various guanine nucleotides and analogs. NMR measurements show that the three-dimensional environment around the nucleotide is similar in p21ras and p24ral. In addition to these studies on the wild-type ral protein, we used in vitro mutagenesis to introduce substitutions corresponding to the Val12, Val12 + Thr59, and Leu61 substitutions of p21ras. These mutant ral proteins display altered nucleotide exchange kinetics and GTPase activities, however, the effects of the substitutions are less pronounced than in the ras proteins. p24ralVal12 + Thr59 autophosphorylates on the substituted Thr, as a side reaction of the GTP hydrolysis, but the rate is much lower than those of the Thr59 mutants of p21ras. These results show that ras and ral proteins have similar structures and biochemical properties. Significant differences are found, however, in the contribution of the Mg2+ ion to GDP binding, in the rate of the GTPase reaction and in the sensitivity of these two proteins to substitutions around the phosphate-binding site, suggesting that the various "small G-proteins" of the ras family perform different functions.

  20. Guanine-specific DNA damage photosensitized by the dihydroxo(tetraphenylporphyrinato)antimony(V) complex.


    Hirakawa, Kazutaka; Kawanishi, Shosuke; Matsumoto, Jin; Shiragami, Tsutomu; Yasuda, Masahide


    The dihydroxo(tetraphenylporphyrinato)antimony(V) complex (SbTPP) demonstrates bactericidal activity under visible-light irradiation. This phototoxic effect could be caused by photodamage to biomolecules, but the mechanism has not been well understood. In this study, to clarify the mechanism of phototoxicity by SbTPP, DNA damage photosensitized by SbTPP was examined using [(32)P]-5'-end-labeled DNA fragments. SbTPP induced markedly severe photodamage to single-stranded rather than to double-stranded DNA. Photo-irradiated SbTPP frequently caused DNA cleavage at the guanine residue of single-stranded DNA after Escherichia coli formamidopyrimidine-DNA glycosylase or piperidine treatment. HPLC measurement confirmed the formation of 8-oxo-7,8-dihydro-2'-deoxyguanosine (8-oxodG), an oxidation product of 2'-deoxyguanosine, and showed that the content of 8-oxodG in single-stranded DNA is larger than that in double-stranded DNA. The effects of scavengers of reactive oxygen species on DNA damage suggested the involvement of singlet oxygen. These results have shown that the mechanism via singlet oxygen formation mainly contributes to the phototoxicity of SbTPP. On the other hand, SbTPP induced DNA damage specifically at the underlined G of 5'-GG, 5'-GGG, and 5'-GGGG in double-stranded DNA. The sequence-specificity of DNA damage is quite similar to that induced by the type I photosensitizers, suggesting that photo-induced electron transfer slightly participates in the phototoxicity of SbTPP. In conclusion, SbTPP induces DNA photodamage via singlet oxygen formation and photo-induced electron transfer. A similar mechanism can damage other biomacromolecules, such as protein and the phospholipid membrane. The damage to biomacromolecules via these mechanisms may participate in the phototoxicity of SbTPP.

  1. Elimination and utilization of oxidized guanine nucleotides in the synthesis of RNA and its precursors.


    Sekiguchi, Takeshi; Ito, Riyoko; Hayakawa, Hiroshi; Sekiguchi, Mutsuo


    Reactive oxygen species are produced as side products of oxygen utilization and can lead to the oxidation of nucleic acids and their precursor nucleotides. Among the various oxidized bases, 8-oxo-7,8-dihydroguanine seems to be the most critical during the transfer of genetic information because it can pair with both cytosine and adenine. During the de novo synthesis of guanine nucleotides, GMP is formed first, and it is converted to GDP by guanylate kinase. This enzyme hardly acts on an oxidized form of GMP (8-oxo-GMP) formed by the oxidation of GMP or by the cleavage of 8-oxo-GDP and 8-oxo-GTP by MutT protein. Although the formation of 8-oxo-GDP from 8-oxo-GMP is thus prevented, 8-oxo-GDP itself may be produced by the oxidation of GDP by reactive oxygen species. The 8-oxo-GDP thus formed can be converted to 8-oxo-GTP because nucleoside-diphosphate kinase and adenylate kinase, both of which catalyze the conversion of GDP to GTP, do not discriminate 8-oxo-GDP from normal GDP. The 8-oxo-GTP produced in this way and by the oxidation of GTP can be used for RNA synthesis. This misincorporation is prevented by MutT protein, which has the potential to cleave 8-oxo-GTP as well as 8-oxo-GDP to 8-oxo-GMP. When (14)C-labeled 8-oxo-GTP was applied to CaCl2-permeabilized cells of a mutT(-) mutant strain, it could be incorporated into RNA at 4% of the rate for GTP. Escherichia coli cells appear to possess mechanisms to prevent misincorporation of 8-oxo-7,8-dihydroguanine into RNA.

  2. Spiroiminodihydantoin lesions derived from guanine oxidation: structures, energetics, and functional implications.


    Jia, Lei; Shafirovich, Vladimir; Shapiro, Robert; Geacintov, Nicholas E; Broyde, Suse


    Reactive oxygen species present in the cell generate DNA damage. One of the major oxidation products of guanine in DNA, 8-oxo-7,8-dihydroguanine, formed by loss of two electrons, is among the most extensively studied base lesions. The further removal of two electrons from this product can yield spiroiminodihydantoin (Sp) R and S stereoisomers. Both in vitro and in vivo experiments have shown that the Sp stereoisomers are highly mutagenic, causing G --> T and G --> C transversions. Hence, they are of interest as examples of endogenous DNA damage that may initiate cancer. To interpret the mutagenic properties of the Sp lesions, an understanding of their structural properties is needed. To elucidate these structural effects, we have carried out computational investigations at the level of the Sp-modified base and nucleoside. At the base level, quantum mechanical geometry optimization studies have revealed exact mirror image symmetry of the R and S stereoisomers, with a near-perpendicular geometry of the two rings. At the nucleoside level, an extensive survey of the potential energy surface by molecular mechanics calculations using AMBER has provided three-dimensional potential energy maps. These maps reveal that the range and flexibility of the glycosidic torsion angles are significantly more restricted in both stereoisomeric adducts than in unmodified 2'-deoxyguanosine. The structural and energetic results suggest that the unusual geometric, steric, and hydrogen bonding properties of these lesions underlie their mutagenicity. In addition, stereoisomer-specific differences indicate the possibility that their processing by cellular replication and repair enzymes may be differentially affected by their absolute configuration.

  3. Stability of low concentrations of guanine-based antivirals in sucrose or maltitol solutions.


    Desai, D; Rao, V; Guo, H; Li, D; Bolgar, M


    Three guanine-based antiviral drugs, entecavir, lobucavir, and acyclovir showed degradation in presence of sucrose in ready-to-use solutions held at 50 degrees C, with more degradation at pH 4 than at pH 6 or 7. LC/MS analysis of the solutions showed isomeric adducts of the drugs and reducing sugars. Sucrose, a disaccharide and a non-reducing sugar, was the source of monosaccharides, the reducing sugars. Sucrose showed pH-dependent hydrolysis at 50 degrees C into two monosaccharides, fructose and glucose, with more sucrose hydrolyzing at pH 4 than pH 6 or 7. Additionally, the three drugs showed pH-dependent degradation at 50 degrees C in fructose and glucose solutions with the following rank order: pH 7>pH 6>pH 4. This indicated that the increased degradation of the drugs in sucrose solutions at pH 4 was mainly due to more hydrolysis of sucrose into fructose and glucose compared to pH 6 or 7, and subsequent reactions of the fructose and glucose with the drugs. Based on structures of the major degradants, it is proposed that the main cause of the degradation was nucleophilic addition of the primary amine group of the drugs to the carbonyl group of the fructose and glucose. This reaction was facilitated as the solution pH increased from 4 to 7. All the drugs showed satisfactory stability regardless of the storage temperature or solution pH in maltitol, an alternate sweetener. The free aldehyde or ketone group in maltitol precursors is reduced to a hydroxyl group after the hydrogenation process making maltitol less susceptible to nucleophilic addition.

  4. Vacuum-Ultraviolet photoionization studies of the microhydrationof DNA bases (Guanine, Cytosine, Adenine and Thymine)

    SciTech Connect

    Belau, L.; Wilson, K.R.; Leone, S.R.; Musahid, Ahmed


    In this work, we report on a photoionization study of the microhydration of the four DNA bases. Gas-phase clusters of water with DNA bases [guanine (G), cytosine (C), adenine (A), and thymine (T)] are generated via thermal vaporization of the bases and expansion of the resultant vapor in a continuous supersonic jet expansion of water seeded in Ar. The resulting clusters are investigated by single-photon ionization with tunable vacuum-ultraviolet synchrotron radiation and mass analyzed using reflectron mass spectrometry. Photoionization efficiency (PIE) curves are recorded for the DNA bases and the following water (W) clusters: G, GW{sub n} (n = 1-3); C, CW{sub n} (n = 1-3); A, AW{sub n} (n = 1,2); and T, TW{sub n} (n = 1-3). Appearance energies (AE) are derived from the onset of these PIE curves (all energies in eV): G (8.1 {+-} 0.1), GW (8.0 {+-} 0.1), GW{sub 2} (8.0 {+-} 0.1), and GW{sub 3} (8.0); C (8.65 {+-} 0.05), CW (8.45 {+-} 0.05), CW{sub 2} (8.4 {+-} 0.1), and CW{sub 3} (8.3 {+-} 0.1); A (8.30 {+-} 0.05), AW (8.20 {+-} 0.05), and AW{sub 2} (8.1 {+-} 0.1); T (8.90 {+-} 0.05); and TW (8.75 {+-} 0.05), TW{sub 2} (8.6 {+-} 0.1), and TW{sub 3} (8.6 {+-} 0.1). The AEs of the DNA bases decrease slightly with the addition of water molecules (up to three) but do not converge to values found for photoinduced electron removal from DNA bases in solution.

  5. Double proton transfer in the isolated and DNA-embedded guanine-cytosine base pair

    NASA Astrophysics Data System (ADS)

    Zoete, Vincent; Meuwly, Markus


    The energetics and dynamics of double proton transfer (DPT) is investigated theoretically for the Watson-Crick conformation of the guanine-cytosine (GC) base pair. Using semiempirical density functional theory the isolated and DNA-embedded GC pair is considered. Differences in the energetics and dynamics of DPT thus addresses the question of how relevant studies of isolated base pairs are for the understanding of processes occurring in DNA. Two-dimensional potential energy surfaces involving the transferring hydrogen atoms and the proton donors and acceptors are presented for both systems. The DPT reaction is accompanied by a contraction of the distance between the two bases with virtually identical energetic barriers being 18.8 and 18.7 kcal/mol for the isolated and DNA-embedded system, respectively. However, the transition state for DPT in the DNA-embedded GC pair is offset by 0.1 Å to larger N-H separation compared to the isolated GC pair. Using activated ab initio molecular dynamics, DPT is readily observed for the isolated base pair with a minimal amount of 21.4 kcal/mol of initial average kinetic energy along the DPT normal mode vector. On a time scale of ≈100 fs DPT has occurred and the excess energy is redistributed. For the DNA-embedded GC pair considerably more kinetic energy is required (30.0 kcal/mol) for DPT and the process is completed within one hydrogen vibration. The relevance of studies of isolated base pairs and base pair analogs in regard of reactions or properties involving DNA is discussed.

  6. A Homogenous Bioluminescent System for Measuring GTPase, GTPase Activating Protein, and Guanine Nucleotide Exchange Factor Activities

    PubMed Central

    Mondal, Subhanjan; Hsiao, Kevin


    Abstract GTPases play a major role in various cellular functions such as cell signaling, cell proliferation, cell differentiation, cytoskeleton modulation, and cell motility. Deregulation or mutation of these proteins has considerable consequences resulting in multiple pathological conditions. Targeting GTPases and its regulators has been challenging due to paucity of convenient assays. In this study, we describe a homogenous bioluminescent assay for monitoring the activities of GTPase and its immediate regulators: GTPase activating proteins (GAPs) and guanine nucleotide exchange factors (GEFs). Since Mg2+ plays a critical role in influencing the affinity of GTPases with guanosine triphosphate/guanosine diphosphate (GTP/GDP) and the process of nucleotide exchange, manipulating Mg2+ concentrations in the GTPase reaction buffer allows continuous progression of the GTPase cycle and faster hydrolysis of GTP. The assay relies on enzymatic conversion of GTP that remains after the GTPase reaction to ATP and detection of the generated ATP using the luciferin/luciferase combination. The GTPase/GAP/GEF-Glo assay system enables monitoring of GTPase, GAP-stimulated GTPase, GAP, and GEF activities. The system can also be used to analyze these proteins when expressed in cells as fusion proteins by performing the assay in a pulldown format. The assays showed minimal false hits upon testing for compound interference using the library of pharmacologically active compounds and its robustness was demonstrated by a high Z′-factor of 0.93 and CV of 2.2%. The assay system has a high dynamic range, formatted in a convenient add–mix–read, and applicable to high-throughput screening. PMID:26167953

  7. Pre-thymic somatic mutation leads to high mutant frequency at hypoxanthine-guanine phosphoribosyltransferase gene

    SciTech Connect

    Jett, J.


    While characterizing the background mutation spectrum of the Hypoxathine-guanine phosphoribosyltransferase (HPRT) gene in a healthy population, an outlier with a high mutant frequency of thioguanine resistant lymphocytes was found. When studied at the age of 46, this individual had been smoking 60 cigarettes per day for 38 years. His mutant frequency was calculated at 3.6 and 4.2x10{sup {minus}4} for two sampling periods eight months apart. Sequencing analysis of the HPRT gene in his mutant thioguanine resistant T lymphocytes was done to find whether the cells had a high rate of mutation, or if the mutation was due to a single occurrence of mutation and, if so, when in the T lymphocyte development the mutation occurred. By T-cell receptor analysis it has been found that out of 35 thioguanine resistant clones there was no dominant gamma T cell receptor gene rearrangement. During my appointment in the Science & Engineering Research Semester, I found that 34 of those clones have the same base substitution of G{yields}T at cDNA position 197. Due to the consistent mutant frequency from both sampling periods and the varying T cell receptors, the high mutant frequency cannot be due to recent proliferation of a mature mutant T lymphocyte. From the TCR and DNA sequence analysis we conclude that the G{yields}T mutation must have occurred in a T lymphocyte precursor before thymic differentiation so that the thioguanine resistant clones share the same base substitution but not the same gamma T cell receptor gene.

  8. Amyloid Precursor Protein Translation Is Regulated by a 3'UTR Guanine Quadruplex.


    Crenshaw, Ezekiel; Leung, Brian P; Kwok, Chun Kit; Sharoni, Michal; Olson, Kalee; Sebastian, Neeraj P; Ansaloni, Sara; Schweitzer-Stenner, Reinhard; Akins, Michael R; Bevilacqua, Philip C; Saunders, Aleister J


    A central event in Alzheimer's disease is the accumulation of amyloid β (Aβ) peptides generated by the proteolytic cleavage of the amyloid precursor protein (APP). APP overexpression leads to increased Aβ generation and Alzheimer's disease in humans and altered neuronal migration and increased long term depression in mice. Conversely, reduction of APP expression results in decreased Aβ levels in mice as well as impaired learning and memory and decreased numbers of dendritic spines. Together these findings indicate that therapeutic interventions that aim to restore APP and Aβ levels must do so within an ideal range. To better understand the effects of modulating APP levels, we explored the mechanisms regulating APP expression focusing on post-transcriptional regulation. Such regulation can be mediated by RNA regulatory elements such as guanine quadruplexes (G-quadruplexes), non-canonical structured RNA motifs that affect RNA stability and translation. Via a bioinformatics approach, we identified a candidate G-quadruplex within the APP mRNA in its 3'UTR (untranslated region) at residues 3008-3027 (NM_201414.2). This sequence exhibited characteristics of a parallel G-quadruplex structure as revealed by circular dichroism spectrophotometry. Further, as with other G-quadruplexes, the formation of this structure was dependent on the presence of potassium ions. This G-quadruplex has no apparent role in regulating transcription or mRNA stability as wild type and mutant constructs exhibited equivalent mRNA levels as determined by real time PCR. Instead, we demonstrate that this G-quadruplex negatively regulates APP protein expression using dual luciferase reporter and Western blot analysis. Taken together, our studies reveal post-transcriptional regulation by a 3'UTR G-quadruplex as a novel mechanism regulating APP expression.

  9. Activator of G protein signaling 3 is a guanine dissociation inhibitor for Gαi subunits

    PubMed Central

    De Vries, Luc; Fischer, Thierry; Tronchère, Hélène; Brothers, Greg M.; Strockbine, Bentley; Siderovski, David P.; Farquhar, Marilyn Gist


    Activator of G protein signaling 3 (AGS3) is a newly identified protein shown to act at the level of the G protein itself. AGS3 belongs to the GoLoco family of proteins, sharing the 19-aa GoLoco motif that is a Gαi/o binding motif. AGS3 interacts only with members of the Gαi/o subfamily. By surface plasmon resonance, we found that AGS3 binds exclusively to the GDP-bound form of Gαi3. In GTPγS binding assays, AGS3 behaves as a guanine dissociation inhibitor (GDI), inhibiting the rate of exchange of GDP for GTP by Gαi3. AGS3 interacts with both Gαi3 and Gαo subunits, but has GDI activity only on Gαi3, not on Gαo. The fourth GoLoco motif of AGS3 is a major contributor to this activity. AGS3 stabilizes Gαi3 in its GDP-bound form, as it inhibits the increase in tryptophan fluorescence of the Gαi3-GDP subunit stimulated by AlF4−. AGS3 is widely expressed as it is detected by immunoblotting in brain, testis, liver, kidney, heart, pancreas, and in PC-12 cells. Several different sizes of the protein are detected. By Northern blotting, AGS3 shows 2.3-kb and 3.5-kb mRNAs in heart and brain, respectively, suggesting tissue-specific alternative splicing. Taken together, our results demonstrate that AGS3 is a GDI. To the best of our knowledge, no other GDI has been described for heterotrimeric G proteins. Inhibition of the Gα subunit and stimulation of heterotrimeric G protein signaling, presumably by stimulating Gβγ, extend the possibilities for modulating signal transduction through heterotrimeric G proteins. PMID:11121039

  10. Activation of JNK by Epac is independent of its activity as a Rap guanine nucleotide exchanger.


    Hochbaum, Daniel; Tanos, Tamara; Ribeiro-Neto, Fernando; Altschuler, Daniel; Coso, Omar A


    Guanine nucleotide exchange factors (GEFs) and their associated GTP-binding proteins (G-proteins) are key regulatory elements in the signal transduction machinery that relays information from the extracellular environment into specific intracellular responses. Among them, the MAPK cascades represent ubiquitous downstream effector pathways. We have previously described that, analogous to the Ras-dependent activation of the Erk-1/2 pathway, members of the Rho family of small G-proteins activate the JNK cascade when GTP is loaded by their corresponding GEFs. Searching for novel regulators of JNK activity we have identified Epac (exchange protein activated by cAMP) as a strong activator of JNK-1. Epac is a member of a growing family of GEFs that specifically display exchange activity on the Rap subfamily of Ras small G-proteins. We report here that while Epac activates the JNK severalfold, a constitutively active (G12V) mutant of Rap1b does not, suggesting that Rap-GTP is not sufficient to transduce Epac-dependent JNK activation. Moreover, Epac signaling to the JNKs was not blocked by inactivation of endogenous Rap, suggesting that Rap activation is not necessary for this response. Consistent with these observations, domain deletion mutant analysis shows that the catalytic GEF domain is dispensable for Epac-mediated activation of JNK. These studies identified a region overlapping the Ras exchange motif domain as critical for JNK activation. Consistent with this, an isolated Ras exchange motif domain from Epac is sufficient to activate JNK. We conclude that Epac signals to the JNK cascade through a new mechanism that does not involve its canonical catalytic action, i.e. Rap-specific GDP/GTP exchange. This represents not only a novel way to activate the JNKs but also a yet undescribed mechanism of downstream signaling by Epac.

  11. Deciphering the photochemical mechanisms describing the UV-induced processes occurring in solvated guanine monophosphate

    NASA Astrophysics Data System (ADS)

    Altavilla, Salvatore; Segarra-Martí, Javier; Nenov, Artur; Conti, Irene; Rivalta, Ivan; Garavelli, Marco


    The photophysics and photochemistry of water-solvated guanine monophosphate (GMP) are here characterized by means of a multireference quantum-chemical/molecular mechanics theoretical approach (CASPT2//CASSCF/AMBER) in order to elucidate the main photo-processes occurring upon UV-light irradiation. The effect of the solvent and of the phosphate group on the energetics and structural features of this system are evaluated for the first time employing high-level ab initio methods and thoroughly compared to those in vacuo previously reported in the literature and to the experimental evidence to assess to which extent they influence the photoinduced mechanisms. Solvated electronic excitation energies of solvated GMP at the Franck-Condon (FC) region show a red shift for the ππ* La and Lb states, whereas the energy of the oxygen lone-pair nπ* state is blue-shifted. The main photoinduced decay route is promoted through a ring-puckering motion along the bright lowest-lying La state towards a conical intersection (CI) with the ground state, involving a very shallow stationary point along the minimum energy pathway in contrast to the barrierless profile found in gas-phase, the point being placed at the end of the minimum energy path (MEP) thus endorsing its ultrafast deactivation in accordance with time-resolved transient and photoelectron spectroscopy experiments. The role of the nπ* state in the solvated system is severely diminished as the crossings with the initially populated La state and also with the Lb state are placed too high energetically to partake prominently in the deactivation photo-process. The proposed mechanism present in solvated and in vacuo DNA/RNA chromophores validates the intrinsic photostability mechanism through CI-mediated non-radiative processes accompanying the bright excited-state population towards the ground state and subsequent relaxation back to the FC region.

  12. The GIT/PIX complex: an oligomeric assembly of GIT family ARF GTPase-activating proteins and PIX family Rac1/Cdc42 guanine nucleotide exchange factors.


    Premont, Richard T; Perry, Stephen J; Schmalzigaug, Robert; Roseman, J Tyler; Xing, Yanghui; Claing, Audrey


    GIT proteins are GTPase-activating proteins (GAPs) for ADP-ribosylation factor (ARF) small GTP-binding proteins, and interact with the PIX family of Rac1/Cdc42 guanine nucleotide exchange factors. GIT and PIX transiently localize p21-activated protein kinases (PAKs) to remodeling focal adhesions through binding to paxillin. To understand the role of these interactions, the association of GIT and PIX proteins was examined in detail. Two separable binding interactions link GIT and PIX proteins, GIT and PIX proteins each dimerize and a beta-PIX fragment containing the GIT-binding region failed to inhibit the association of the GIT and PIX proteins. Endogenous GIT and PIX co-fractionate at a very high molecular size. Purified 6xHis-tagged beta-PIX from Sf9 cells co-expressing untagged GIT1 yields recombinant GIT1/beta-PIX complexes that have equal amounts of beta-PIX and GIT1 and co-fractionate at the same large size as native GIT/PIX complexes. Thus, GIT and PIX proteins are tightly associated as a multimeric nexus capable of linking together important signaling molecules, including PAKs.

  13. Assessment of roles for the Rho-specific guanine nucleotide dissociation inhibitor Ly-GDI in platelet function: a spatial systems approach.


    Ngo, Anh T P; Thierheimer, Marisa L D; Babur, Özgün; Rocheleau, Anne D; Huang, Tao; Pang, Jiaqing; Rigg, Rachel A; Mitrugno, Annachiara; Theodorescu, Dan; Burchard, Julja; Nan, Xiaolin; Demir, Emek; McCarty, Owen J T; Aslan, Joseph E


    On activation at sites of vascular injury, platelets undergo morphological alterations essential to hemostasis via cytoskeletal reorganizations driven by the Rho GTPases Rac1, Cdc42, and RhoA. Here we investigate roles for Rho-specific guanine nucleotide dissociation inhibitor proteins (RhoGDIs) in platelet function. We find that platelets express two RhoGDI family members, RhoGDI and Ly-GDI. Whereas RhoGDI localizes throughout platelets in a granule-like manner, Ly-GDI shows an asymmetric, polarized localization that largely overlaps with Rac1 and Cdc42 as well as microtubules and protein kinase C (PKC) in platelets adherent to fibrinogen. Antibody interference and platelet spreading experiments suggest a specific role for Ly-GDI in platelet function. Intracellular signaling studies based on interactome and pathways analyses also support a regulatory role for Ly-GDI, which is phosphorylated at PKC substrate motifs in a PKC-dependent manner in response to the platelet collagen receptor glycoprotein (GP) VI-specific agonist collagen-related peptide. Additionally, PKC inhibition diffuses the polarized organization of Ly-GDI in spread platelets relative to its colocalization with Rac1 and Cdc42. Together, our results suggest a role for Ly-GDI in the localized regulation of Rho GTPases in platelets and hypothesize a link between the PKC and Rho GTPase signaling systems in platelet function. Copyright © 2017 the American Physiological Society.

  14. Mechanisms of the Formation of Adenine, Guanine, and Their Analogues in UV-Irradiated Mixed NH3:H2O Molecular Ices Containing Purine

    NASA Astrophysics Data System (ADS)

    Bera, Partha P.; Stein, Tamar; Head-Gordon, Martin; Lee, Timothy J.


    We investigated the formation mechanisms of the nucleobases adenine and guanine and the nucleobase analogues hypoxanthine, xanthine, isoguanine, and 2,6-diaminopurine in a UV-irradiated mixed 10:1 H2O:NH3 ice seeded with precursor purine by using ab initio and density functional theory computations. Our quantum chemical investigations suggest that a multistep reaction mechanism involving purine cation, hydroxyl and amino radicals, together with water and ammonia, explains the experimentally obtained products in an independent study. The relative abundances of these products appear to largely follow from relative thermodynamic stabilities. The key role of the purine cation is likely to be the reason why purine is not functionalized in pure ammonia ice, where cations are promptly neutralized by free electrons from NH3 ionization. Amine group addition to purine is slightly favored over hydroxyl group attachment based on energetics, but hydroxyl is much more abundant due to higher abundance of H2O. The amino group is preferentially attached to the 6 position, giving 6-aminopurine, that is, adenine, while the hydroxyl group is preferentially attached to the 2 position, leading to 2-hydroxypurine. A second substitution by hydroxyl or amino group occurs at either the 6 or the 2 position depending on the first substitution. Given that H2O is far more abundant than NH3 in the experimentally studied ices (as well as based on interstellar abundances), xanthine and isoguanine are expected to be the most abundant bi-substituted photoproducts.

  15. Quantification of 8-oxo-guanine and guanine as the nucleobase, nucleoside and deoxynucleoside forms in human urine by high-performance liquid chromatography-electrospray tandem mass spectrometry.


    Weimann, Allan; Belling, Dorthe; Poulsen, Henrik E


    Oxidative DNA damage, linked pathogenically to a variety of diseases such as cancer and ageing, can be investigated by measuring specific DNA repair products in urine. Within the last decade, since it was established that such products were excreted into urine, progress in their analysis in urine has been limited. Guanine is the DNA base most prone to oxidation. We present a method for determination of the urinary 8-hydroxylated species of guanine, based on direct injection of urine onto a high-performance liquid chromatography (HPLC)-tandem mass spectrometry system. The analysis covers the 8-hydroxylated base, ribonucleoside and deoxynucleoside, and the corresponding non-oxidised species. Without pre-treatment of urine the detection limits for the nucleobases are approximately 2 nM (50 fmol injected) and for the nucleosides approximately 0.5 nM (12.5 fmol injected). Previously, liquid chromatography of the nucleobases has been problematic but is made possible by low-temperature reverse-phase C18 chromatography, a method that increases retention on the column. In the case of the nucleosides, retention was almost total and provides a means for on-column concentration of larger urine samples and controlled high peak gradient elution. The total excretion of 8-hydroxylated guanine species was 212 nmol/24 h. The oxidised base accounted for 64%, the ribonucleoside for 23% and the deoxynucleoside for 13%, indicating substantial oxidation of RNA in humans. In rat urine, excretion of the oxidised base was more dominant, the percentages of the oxidised base, ribonucleoside and deoxynucleosides being 89, 8 and 3%. This finding is at odds with previous reports using immunoaffinity pre-purification and HPLC-electrochemical detection analysis. The developed method now makes it possible to measure oxidative nucleic acid stress to both RNA and DNA in epidemiological and intervention settings, and our findings indicate a substantial RNA oxidation in addition to DNA oxidation. The

  16. Electron attachment to the guanine-cytosine nucleic acid base pair and the effects of monohydration and proton transfer.


    Gupta, Ashutosh; Jaeger, Heather M; Compaan, Katherine R; Schaefer, Henry F


    The guanine-cytosine (GC) radical anion and its interaction with a single water molecule is studied using ab initio and density functional methods. Z-averaged second-order perturbation theory (ZAPT2) was applied to GC radical anion for the first time. Predicted spin densities show that the radical character is localized on cytosine. The Watson-Crick monohydrated GC anion is compared to neutral GC·H2O, as well as to the proton-transferred analogue on the basis of structural and energetic properties. In all three systems, local minima are identified that correspond to water positioned in the major and minor grooves of macromolecular DNA. On the anionic surface, two novel structures have water positioned above or below the GC plane. On the neutral and anionic surfaces, the global minimum can be described as water interacting with the minor groove. These structures are predicted to have hydration energies of 9.7 and 11.8 kcal mol(-1), respectively. Upon interbase proton-transfer (PT), the anionic global minimum has water positioned in the major groove, and the hydration energy increases to 13.4 kcal mol(-1). PT GC·H2O(•-) has distonic character; the radical character resides on cytosine, while the negative charge is localized on guanine. The effects of proton transfer are further investigated through the computed adiabatic electron affinities (AEA) of GC and monohydrated GC, and the vertical detachment energies (VDE) of the corresponding anions. Monohydration increases the AEAs and VDEs by only 0.1 eV, while proton-transfer increases the VDEs substantially (0.8 eV). The molecular charge distribution of monohydrated guanine-cytosine radical anion depends heavily on interbase proton transfer.

  17. Electronic g-factor measurement from ENDOR-induced EPR patterns: malonic acid and guanine hydrochloride dihydrate.


    Kang, Junseog; Tokdemir, Sibel; Shao, Jun; Nelson, William H


    Measurement of electronic g-factors (g) from radicals in irradiated organic crystals is generally difficult because the overall EPR pattern is usually the composite of several components, e.g., from multiple radicals and from multiple magnetic sites. However, when an ENDOR line is fully resolved, the method of ENDOR-induced EPR (EI-EPR, or EIE) in principle permits identification of the EPR pattern from the individual component yielding the line. To examine this method as an approach useful for measuring g, we used it to measure those of known radicals in two different crystal systems. First, to verify correspondence of the EIE and EPR sufficient for using EIE patterns to extract g, we used both EIE and EPR to measure g of (*CH(COOH)(2) from irradiated crystals of malonic acid. Then, to illustrate the procedure applied to a system giving a more complex EPR pattern, we used EIE to measure g of the O6-protonated anion radical of guanine in irradiated guanine.HCl.2H(2)O crystals. EPR results from the malonic acid radical are g(max)=2.00374(2), g(mid)=2.00331(2), and g(min)=2.00234(3); EIE results from the same radical are g(max)=2.00375(2), g(mid)=2.00334(2), and g(min)=2.00238(2), where numbers in parentheses indicate statistical uncertainties in the respective least significant digits. In addition, eigenvectors from the two sets of measurements agree to approximately 1 degrees. Results from the guanine radical are g(max)=2.00490(2), g(mid)=2.00318(4), and g(min)=2.00218(4). (The uncertainties should reliably indicate relative accuracy, while absolute accuracy is within +/-0.0002 as indicated by simultaneous measurement of Cr(3+) in MgO.)

  18. Combined Monte Carlo and quantum mechanics study of the hydration of the guanine-cytosine base pair.


    Coutinho, Kaline; Ludwig, Valdemir; Canuto, Sylvio


    We present a computer simulation study of the hydration of the guanine-cytosine (GC) hydrogen-bonded complex. Using first principles density-functional theory, with gradient-corrected exchange-correlation and Monte Carlo simulation, we include thermal contribution, structural effects, solvent polarization, and the water-water and water-GC hydrogen bond interaction to show that the GC interaction in an aqueous environment is weakened to about 70% of the value obtained for an isolated complex. We also analyze in detail the preferred hydration sites of the GC pair and show that on the average it makes around five hydrogen bonds with water.

  19. Peripheral Nerve Demyelination Caused by a Mutant Rho GTPase Guanine Nucleotide Exchange Factor, Frabin/FGD4

    PubMed Central

    Stendel, Claudia ; Roos, Andreas ; Deconinck, Tine ; Pereira, Jorge ; Castagner, François ; Niemann, Axel ; Kirschner, Janbernd ; Korinthenberg, Rudolf ; Ketelsen, Uwe-Peter ; Battaloglu, Esra ; Parman, Yesim ; Nicholson, Garth ; Ouvrier, Robert ; Seeger, Jürgen ; Jonghe, Peter De ; Weis, Joachim ; Krüttgen, Alexander ; Rudnik-Schöneborn, Sabine ; Bergmann, Carsten ; Suter, Ueli ; Zerres, Klaus ; Timmerman, Vincent ; Relvas, João B. ; Senderek, Jan 


    GTPases of the Rho subfamily are widely involved in the myelination of the vertebrate nervous system. Rho GTPase activity is temporally and spatially regulated by a set of specific guanine nucleotide exchange factors (GEFs). Here, we report that disruption of frabin/FGD4, a GEF for the Rho GTPase cell-division cycle 42 (Cdc42), causes peripheral nerve demyelination in patients with autosomal recessive Charcot-Marie-Tooth (CMT) neuropathy. These data, together with the ability of frabin to induce Cdc42-mediated cell-shape changes in transfected Schwann cells, suggest that Rho GTPase signaling is essential for proper myelination of the peripheral nervous system. PMID:17564972

  20. Peripheral nerve demyelination caused by a mutant Rho GTPase guanine nucleotide exchange factor, frabin/FGD4.


    Stendel, Claudia; Roos, Andreas; Deconinck, Tine; Pereira, Jorge; Castagner, Francois; Niemann, Axel; Kirschner, Janbernd; Korinthenberg, Rudolf; Ketelsen, Uwe-Peter; Battaloglu, Esra; Parman, Yesim; Nicholson, Garth; Ouvrier, Robert; Seeger, Jürgen; De Jonghe, Peter; Weis, Joachim; Krüttgen, Alexander; Rudnik-Schöneborn, Sabine; Bergmann, Carsten; Suter, Ueli; Zerres, Klaus; Timmerman, Vincent; Relvas, João B; Senderek, Jan


    GTPases of the Rho subfamily are widely involved in the myelination of the vertebrate nervous system. Rho GTPase activity is temporally and spatially regulated by a set of specific guanine nucleotide exchange factors (GEFs). Here, we report that disruption of frabin/FGD4, a GEF for the Rho GTPase cell-division cycle 42 (Cdc42), causes peripheral nerve demyelination in patients with autosomal recessive Charcot-Marie-Tooth (CMT) neuropathy. These data, together with the ability of frabin to induce Cdc42-mediated cell-shape changes in transfected Schwann cells, suggest that Rho GTPase signaling is essential for proper myelination of the peripheral nervous system.

  1. The electrochemical reduction of the purines guanine and adenine at platinum electrodes in several room temperature ionic liquids.


    Zanoni, Maria Valnice Boldrin; Rogers, Emma I; Hardacre, Christopher; Compton, Richard G


    The reduction of guanine was studied by microelectrode voltammetry in the room temperature ionic liquids (RTILs) N-hexyltriethylammonium bis (trifluoromethanesulfonyl) imide [N(6,2,2,2)][N(Tf)(2)], 1-butyl-3-methylimidazolium hexafluorosphosphate [C(4)mim][PF(6)], N-butyl-N-methyl-pyrrolidinium bis(trifluoromethanesulfonyl)imide [C(4)mpyrr][N(Tf)(2)], 1-butyl-3-methylimidazolium bis(trifluoromethanesulfonyl)imide [C(4)mim][N(Tf)(2)], N-butyl-N-methyl-pyrrolidinium dicyanamide [C(4)mpyrr][N(NC)(2)] and tris(P-hexyl)-tetradecylphosphonium trifluorotris(pentafluoroethyl)phosphate [P(14,6,6,6)][FAP] on a platinum microelectrode. In [N(6,2,2,2)][NTf(2)] and [P(14,6,6,6)][FAP], but not in the other ionic liquids studied, guanine reduction involves a one-electron, diffusion-controlled process at very negative potential to produce an unstable radical anion, which is thought to undergo a dimerization reaction, probably after proton abstraction from the cation of the ionic liquid. The rate of this subsequent reaction depends on the nature of the ionic liquid, and it is faster in the ionic liquid [P(14,6,6,6)][FAP], in which the formation of the resulting dimer can be voltammetrically monitored at less negative potentials than required for the reduction of the parent molecule. Adenine showed similar behaviour to guanine but the pyrimidines thymine and cytosine did not; thymine was not reduced at potentials less negative than required for solvent (RTIL) decomposition while only a poorly defined wave was seen for cytosine. The possibility for proton abstraction from the cation in [N(6,2,2,2)][NTf(2)] and [P(14,6,6,6)][FAP] is noted and this is thought to aid the electrochemical dimerization process. The resulting rapid reaction is thought to shift the reduction potentials for guanine and adenine to lower values than observed in RTILs where the scope for proton abstraction is not present. Such shifts are characteristic of so-called EC processes where reversible electron transfer

  2. Effect of x irradiation on the capacity of transfer RNA to act as substrate for guanine-tRNA transferase

    SciTech Connect

    Walden, T.; Farkas, W.R.


    Observation on the guanine-accepting ability of x-irradiated wheat germ tRNA shows 50% inactivation at 57,000 rad with an unusual sawtooth pattern at low doses. The sawtooth has peaks at 1330 and 3300 rad and can be modified by bovine serum albumin. RPC-5 profiles of guanylated irradiated and unirradiated tRNA are identical, indicating that irradiation does not result in abnormal tRNA species, that ordinarily are not substrates for this enzyme, becoming substrates.

  3. The Rho guanine nucleotide exchange factor ARHGEF5 promotes tumor malignancy via epithelial–mesenchymal transition

    PubMed Central

    Komiya, Y; Onodera, Y; Kuroiwa, M; Nomimura, S; Kubo, Y; Nam, J-M; Kajiwara, K; Nada, S; Oneyama, C; Sabe, H; Okada, M


    Epithelial tumor cells often acquire malignant properties, such as invasion/metastasis and uncontrolled cell growth, by undergoing epithelial–mesenchymal transition (EMT). However, the mechanisms by which EMT contributes to malignant progression remain elusive. Here we show that the Rho guanine nucleotide exchange factor (GEF) ARHGEF5 promotes tumor malignancy in a manner dependent on EMT status. We previously identified ARHGEF5, a member of the Dbl family of GEFs, as a multifunctional mediator of Src-induced cell invasion and tumor growth. In the present study, ARHGEF5 was upregulated during tumor growth factor-β-induced EMT in human epithelial MCF10A cells, and promoted cell migration by activating the Rho-ROCK pathway. ARHGEF5 was necessary for the invasive and in vivo metastatic activity of human colorectal cancer HCT116 cells. These findings underscore the crucial role of ARHGEF5 in cell migration and invasion/metastasis. An in vivo tumorigenesis assay revealed that ARHGEF5 had the potential to promote tumor growth via the phosphatidylinositol 3-kinase (PI3K) pathway. However, ARHGEF5 was not required for tumor growth in epithelial-like human colorectal cancer HCT116 and HT29 cells, whereas the growth of mesenchymal-like SW480 and SW620 cells depended on ARHGEF5. Induction of EMT by tumor necrosis factor-α or Slug in HCT116 cells resulted in the dependence of tumor growth on ARHGEF5. In these mesenchymal-like cells, Akt was activated via ARHGEF5 and its activity was required for tumor growth. Analysis of a transcriptome data set revealed that the combination of ARHGEF5 upregulation and E-cadherin downregulation or Snail upregulation was significantly correlated with poor prognosis in patients with colorectal cancers. Taken together, our findings suggest that EMT-induced ARHGEF5 activation contributes to the progression of tumor malignancy. ARHGEF5 may serve as a potential therapeutic target in a subset of malignant tumors that have undergone EMT. PMID

  4. Genetic interactions in yeast between Ypt GTPases and Arf guanine nucleotide exchangers.

    PubMed Central

    Jones, S; Jedd, G; Kahn, R A; Franzusoff, A; Bartolini, F; Segev, N


    Two families of GTPases, Arfs and Ypt/rabs, are key regulators of vesicular transport. While Arf proteins are implicated in vesicle budding from the donor compartment, Ypt/rab proteins are involved in the targeting of vesicles to the acceptor compartment. Recently, we have shown a role for Ypt31/32p in exit from the yeast trans-Golgi, suggesting a possible function for Ypt/rab proteins in vesicle budding as well. Here we report the identification of a new member of the Sec7-domain family, SYT1, as a high-copy suppressor of a ypt31/32 mutation. Several proteins that belong to the Sec7-domain family, including the yeast Gea1p, have recently been shown to stimulate nucleotide exchange by Arf GTPases. Nucleotide exchange by Arf GTPases, the switch from the GDP- to the GTP-bound form, is thought to be crucial for their function. Sec7p itself has an important role in the yeast secretory pathway. However, its mechanism of action is not yet understood. We show that all members of the Sec7-domain family exhibit distinct genetic interactions with the YPT genes. Biochemical assays demonstrate that, although the homology between the members of the Sec7-domain family is relatively low (20-35%) and limited to a small domain, they all can act as guanine nucleotide exchange factors (GEFs) for Arf proteins, but not for Ypt GTPases. The Sec7-domain of Sec7p is sufficient for this activity. Interestingly, the Sec7 domain activity is inhibited by brefeldin A (BFA), a fungal metabolite that inhibits some of the Arf-GEFs, indicating that this domain is a target for BFA. These results demonstrate that the ability to act as Arf-GEFs is a general property of all Sec7-domain proteins in yeast. The genetic interactions observed between Arf GEFs and Ypt GTPases suggest the existence of a Ypt-Arf GTPase cascade in the secretory pathway. PMID:10430582

  5. Proton transfer in guanine-cytosine radical anion embedded in B-form DNA.


    Chen, Hsing-Yin; Kao, Chai-Lin; Hsu, Sodio C N


    The electron-attachment-induced proton transfer in the guanine-cytosine (G:C) base pair is thought to be relevant to the issues of charge transport and radiation damage in DNA. However, our understanding on the reaction mainly comes from the data of isolated bases and base pairs, and the behavior of the reaction in the DNA duplex is not clear. In the present study, the proton-transfer reaction in reduced G:C stacks is investigated by quantum mechanical calculations with the aim to clarify how each environmental factor affects the proton transfer in G:C(*-). The calculations show that while the proton transfer in isolated G:C(*-) is exothermic with a small energetic barrier, it becomes endothermic with a considerably enhanced energetic barrier in G:C stacks. The substantial effect of G:C stacking is proved to originate from the electrostatic interactions between the dipole moments of outer G:C base pairs and the middle G:C(*-) base-pair radical anion; the extent of charge delocalization is very small and plays little role in affecting the proton transfer in G:C(*-). On the basis of the electrostatic model, the sequence dependence of the proton transfer in the ionized G:C base pair is predicted. In addition, the water molecules in the first hydration shell around G:C(*-) display a pronounced effect that facilitates the proton-transfer reaction; further consideration of bulk hydration only slightly lowers the energetic barrier and reaction energy. We also notice that the water arrangement around an embedded G:C(*-) is different from that around an isolated G:C(*-), which could result in a very different solvent effect on the energetics of the proton transfer. In contrast to the important influences of base stacking and hydration, the effects of sugar-phosphate backbone and counterions are found to be minor. Our calculations also reveal that a G:C base pair embedded in DNA is capable of accommodating two excess electrons only in bulk hydration; the resultant G(N1-H

  6. Influence of simulated microgravity on the activation of the small GTPase Rho involved in cytoskeletal formation – molecular cloning and sequencing of bovine leukemia-associated guanine nucleotide exchange factor

    PubMed Central

    Higashibata, Akira; Imamizo-Sato, Mari; Seki, Masaya; Yamazaki, Takashi; Ishioka, Noriaki


    Background The irregular formation of cytoskeletal fibers in spaceflown experimental cells has been observed, but the disorganization process of fibers is still poorly understood. It is well known that the activation of the small GTPase Rho leads to actin stress fibers assembly. This study was performed to evaluate the effect of simulated microgravity on the activation of Rho that is involved in actin fiber remodeling in cells. Results Clinorotation influences actin fiber remodeling and its related signaling pathways that involve the small GTPase Rho. Actin stress fiber remodeling was significantly inhibited to a greater extent in cells cultured under clinorotation than in static cultured cells. From the gene and protein expression analyses, we found that the expression level of leukemia-associated Rho guanine nucleotide exchange factor (LARG), which activates Rho, was downregulated under clinorotation. Moreover, we identified the full-length LARG cDNA. The amount of GTP-bound RhoA, that is, the active form of RhoA, decreased under this condition. Conclusion The activation of the small GTPase Rho was influenced by simulated microgravity generated by a three-dimensional (3D) clinostat. Furthermore, the full-length cDNA of bovine LARG, a member of the Rho guanine nucleotide exchange factor (GEF) family, was identified, and its gene expression was observed to be downregulated under clinorotation. This downregulation subsequently resulted in the repression of RhoA activation. These results indicated that the disorganization of the actin fibers was caused by the inhibition of Rho activation by 3D clinorotation. PMID:16803636

  7. The role of topoisomerase I in suppressing genome instability associated with a highly transcribed guanine-rich sequence is not restricted to preventing RNA:DNA hybrid accumulation.


    Yadav, Puja; Owiti, Norah; Kim, Nayun


    Highly transcribed guanine-run containing sequences, in Saccharomyces cerevisiae, become unstable when topoisomerase I (Top1) is disrupted. Topological changes, such as the formation of extended RNA:DNA hybrids or R-loops or non-canonical DNA structures including G-quadruplexes has been proposed as the major underlying cause of the transcription-linked genome instability. Here, we report that R-loop accumulation at a guanine-rich sequence, which is capable of assembling into the four-stranded G4 DNA structure, is dependent on the level and the orientation of transcription. In the absence of Top1 or RNase Hs, R-loops accumulated to substantially higher extent when guanine-runs were located on the non-transcribed strand. This coincides with the orientation where higher genome instability was observed. However, we further report that there are significant differences between the disruption of RNase Hs and Top1 in regards to the orientation-specific elevation in genome instability at the guanine-rich sequence. Additionally, genome instability in Top1-deficient yeasts is not completely suppressed by removal of negative supercoils and further aggravated by expression of mutant Top1. Together, our data provide a strong support for a function of Top1 in suppressing genome instability at the guanine-run containing sequence that goes beyond preventing the transcription-associated RNA:DNA hybrid formation.

  8. Induction of unique structural changes in guanine-rich DNA regions by the triazoloacridone C-1305, a topoisomerase II inhibitor with antitumor activities

    PubMed Central

    Lemke, Krzysztof; Wojciechowski, Marcin; Laine, William; Bailly, Christian; Colson, Pierre; Baginski, Maciej; Larsen, Annette K.; Skladanowski, Andrzej


    We recently reported that the antitumor triazoloacridone, compound C-1305, is a topoisomerase II poison with unusual properties. In this study we characterize the DNA interactions of C-1305 in vitro, in comparison with other topoisomerase II inhibitors. Our results show that C-1305 binds to DNA by intercalation and possesses higher affinity for GC- than AT-DNA as revealed by surface plasmon resonance studies. Chemical probing with DEPC indicated that C-1305 induces structural perturbations in DNA regions with three adjacent guanine residues. Importantly, this effect was highly specific for C-1305 since none of the other 22 DNA interacting drugs tested was able to induce similar structural changes in DNA. Compound C-1305 induced stronger structural changes in guanine triplets at higher pH which suggested that protonation/deprotonation of the drug is important for this drug-specific effect. Molecular modeling analysis predicts that the zwitterionic form of C-1305 intercalates within the guanine triplet, resulting in widening of both DNA grooves and aligning of the triazole ring with the N7 atoms of guanines. Our results show that C-1305 binds to DNA and induces very specific and unusual structural changes in guanine triplets which likely plays an important role in the cytotoxic and antitumor activity of this unique compound. PMID:16254080

  9. Guanine-decorated graphene nanostructures for sensitive monitoring of neuron-specific enolase based on an enzyme-free electrocatalytic reaction.


    Li, Guang-Zhou; Tian, Feng


    A new and enzyme-free electrochemical immunoassay protocol was developed for the sensitive electronic monitoring of neuron-specific enolase (NSE) on a monoclonal mouse anti-human NSE antibody (mAb)-modified glassy carbon electrode, using guanine-decorated graphene nanostructures (GGN) as nanotags. To construct such an enzyme-free immunoassay format, guanine and polyclonal rabbit anti-human NSE antibody (pAb) were co-immobilized on the graphene nanostructures through the carbodiimide coupling. Based on a sandwich-type immunoassay mode, the assay was carried out in 0.1 M pH 7.4 PBS containing 5 μM Ru(bpy)3(2+) through the catalytic oxidation of Ru(bpy)3(2+) toward the guanine on the GGN. The presence of graphene nanostructures increased the immobilized amount of guanine, thus amplifying a detectable electronic signal. The covalent conjugation of guanine and pAb on the GGN resulted in a good repeatability and intermediate reproducibility down to 9.5%. Under optimal conditions, the dynamic concentration range of the developed immunoassay spanned from 0.005 to 80 ng mL(-1) NSE with a detection limit of 1.0 pg mL(-1) at the 3S(blank) level. In addition, the methodology was evaluated by assaying the spiking serum samples, and the relative standard deviation (RSD) between the electrochemical immunoassay and a commercialized enzyme-linked immunosorbent assay (ELISA) were 2.8-7.0%.

  10. Simultaneous protection of organic p- and n-channels in complementary inverter from aging and bias-stress by DNA-base guanine/Al2O3 double layer.


    Lee, Junyeong; Hwang, Hyuncheol; Min, Sung-Wook; Shin, Jae Min; Kim, Jin Sung; Jeon, Pyo Jin; Lee, Hee Sung; Im, Seongil


    Although organic field-effect transistors (OFETs) have various advantages of lightweight, low-cost, mechanical flexibility, and nowadays even higher mobility than amorphous Si-based FET, stability issue under bias and ambient condition critically hinder its practical application. One of the most detrimental effects on organic layer comes from penetrated atmospheric species such as oxygen and water. To solve such degradation problems, several molecular engineering tactics are introduced: forming a kinetic barrier, lowering the level of molecule orbitals, and increasing the band gap. However, direct passivation of organic channels, the most promising strategy, has not been reported as often as other methods. Here, we resolved the ambient stability issues of p-type (heptazole)/or n-type (PTCDI-C13) OFETs and their bias-stability issues at once, using DNA-base small molecule guanine (C5H5N5O)/Al2O3 bilayer. The guanine protects the organic channels as buffer/and H getter layer between the channels and capping Al2O3, whereas the oxide capping resists ambient molecules. As a result, both p-type and n-type OFETs are simultaneously protected from gate-bias stress and 30 days-long ambient aging, finally demonstrating a highly stable, high-gain complementary-type logic inverter.

  11. Selective amplification of an mRNA and related pseudogene for a human ADP-ribosylation factor, a guanine nucleotide-dependent protein activator of cholera toxin

    SciTech Connect

    Monaco, L.; Murtagh, J.J.; Newman, K.B.; Tsai, Su-Chen; Moss, J.; Vaughan, M. )


    ADP-ribosylation factors (ARFs) are {approx}20-kDa proteins that act as GTP-dependent allosteric activators of cholera toxin. With deoxyinosine-containing degenerate oligonucleotide primers corresponding to conserved GTP-binding domains in ARFs, the polymerase chain reaction (PCR) was used to amplify simultaneously from human DNA portions of three ARF genes that include codons for 102 amino acids, with intervening sequences. Amplification products that differed in size because of differences in intron sizes were separated by agarose gel electrophoresis. One amplified DNA contained no introns and had a sequence different from those of known AFRs. Based on this sequence, selective oligonucleotide probes were prepared and used to isolate clone {Psi}ARF 4, a putative ARF pseudogene, from a human genomic library in {lambda} phage EMBL3. Reverse transcription-PCR was then used to clone from human poly(A){sup +} RNA the cDNA corresponding to the expressed homolog of {Psi}ARF 4, referred to as human ARF 4. It appears that {Psi}ARF 4 arose during human evolution by integration of processed ARF 4 mRNA into the genome. Human ARF 4 differs from previously identified mammalian ARFs 1, 2, and 3. Hybridization of ARF 4-specific oligonucleotide probes with human, bovine, and rat RNA revealed a single 1.8-kilobase mRNA, which was clearly distinguished from the 1.9-kilobase mRNA for ARF 1 in these tissues. The PCR provides a powerful tool for investigating diversity in this and other multigene families, especially with primers targeted at domains believed to have functional significance.

  12. Synthesis of 5′ cap-0 and cap-1 RNAs using solid-phase chemistry coupled with enzymatic methylation by human (guanine-N7)-methyl transferase

    PubMed Central

    Thillier, Yann; Decroly, Etienne; Morvan, François; Canard, Bruno; Vasseur, Jean-Jacques; Debart, Françoise


    The 5′ end of eukaryotic mRNA carries a N7-methylguanosine residue linked by a 5′-5′ triphosphate bond. This cap moiety (7mGpppN) is an essential RNA structural modification allowing its efficient translation, limiting its degradation by cellular 5′ exonucleases and avoiding its recognition as “nonself” by the innate immunity machinery. In vitro synthesis of capped RNA is an important bottleneck for many biological studies. Moreover, the lack of methods allowing the synthesis of large amounts of RNA starting with a specific 5′-end sequence have hampered biological and structural studies of proteins recognizing the cap structure or involved in the capping pathway. Due to the chemical nature of N7-methylguanosine, the synthesis of RNAs possessing a cap structure at the 5′ end is still a significant challenge. In the present work, we combined a chemical synthesis method and an enzymatic methylation assay in order to produce large amounts of RNA oligonucleotides carrying a cap-0 or cap-1. Short RNAs were synthesized on solid support by the phosphoramidite 2′-O-pivaloyloxymethyl chemistry. The cap structure was then coupled by the addition of GDP after phosphorylation of the terminal 5′-OH and activation by imidazole. After deprotection and release from the support, GpppN-RNAs or GpppN2′-Om-RNAs were purified before the N7-methyl group was added by enzymatic means using the human (guanine-N7)-methyl transferase to yield 7mGpppN-RNAs (cap-0) or 7mGpppN2′-Om-RNAs (cap-1). The RNAs carrying different cap structures (cap, cap-0 or, cap-1) act as bona fide substrates mimicking cellular capped RNAs and can be used for biochemical and structural studies. PMID:22334760

  13. Synthesis of 5' cap-0 and cap-1 RNAs using solid-phase chemistry coupled with enzymatic methylation by human (guanine-N⁷)-methyl transferase.


    Thillier, Yann; Decroly, Etienne; Morvan, François; Canard, Bruno; Vasseur, Jean-Jacques; Debart, Françoise


    The 5' end of eukaryotic mRNA carries a N(7)-methylguanosine residue linked by a 5'-5' triphosphate bond. This cap moiety ((7m)GpppN) is an essential RNA structural modification allowing its efficient translation, limiting its degradation by cellular 5' exonucleases and avoiding its recognition as "nonself" by the innate immunity machinery. In vitro synthesis of capped RNA is an important bottleneck for many biological studies. Moreover, the lack of methods allowing the synthesis of large amounts of RNA starting with a specific 5'-end sequence have hampered biological and structural studies of proteins recognizing the cap structure or involved in the capping pathway. Due to the chemical nature of N(7)-methylguanosine, the synthesis of RNAs possessing a cap structure at the 5' end is still a significant challenge. In the present work, we combined a chemical synthesis method and an enzymatic methylation assay in order to produce large amounts of RNA oligonucleotides carrying a cap-0 or cap-1. Short RNAs were synthesized on solid support by the phosphoramidite 2'-O-pivaloyloxymethyl chemistry. The cap structure was then coupled by the addition of GDP after phosphorylation of the terminal 5'-OH and activation by imidazole. After deprotection and release from the support, GpppN-RNAs or GpppN(2'-Om)-RNAs were purified before the N(7)-methyl group was added by enzymatic means using the human (guanine-N(7))-methyl transferase to yield (7m)GpppN-RNAs (cap-0) or (7m)GpppN(2'-Om)-RNAs (cap-1). The RNAs carrying different cap structures (cap, cap-0 or, cap-1) act as bona fide substrates mimicking cellular capped RNAs and can be used for biochemical and structural studies.

  14. ERK1/2 phosphorylate GEF-H1 to enhance its guanine nucleotide exchange activity toward RhoA

    SciTech Connect

    Fujishiro, Shuh-hei; Tanimura, Susumu; Mure, Shogo; Kashimoto, Yuji; Watanabe, Kazushi; Kohno, Michiaki


    Rho GTPases play an essential role in the regulation of many cellular processes. Although various guanine nucleotide exchange factors (GEFs) are involved in the activation of Rho GTPases, the precise mechanism regulating such activity remains unclear. We have examined whether ERK1/2 are involved in the phosphorylation of GEF-H1, a GEF toward RhoA, to modulate its activity. Expression of GEF-H1 in HT1080 cells with constitutive ERK1/2 activation induced its phosphorylation at Thr{sup 678}, which was totally abolished by treating the cells with PD184352, an ERK pathway inhibitor. Stimulation of HeLa S3 cells with 12-O-tetradecanoyl-phorbol-13-acetate induced the phosphorylation of GEF-H1 in an ERK-dependent manner. ERK1/2-mediated Thr{sup 678}-phosphorylation enhanced the guanine nucleotide exchange activity of GEF-H1 toward RhoA. These results suggest that the ERK pathway, by enhancing the GEF-H1 activity, contributes to the activation of RhoA to regulate the actin assembly, a necessary event for the induction of cellular responses including proliferation and motility.

  15. ARHGEF7 (Beta-PIX) acts as guanine nucleotide exchange factor for leucine-rich repeat kinase 2.


    Haebig, Karina; Gloeckner, Christian Johannes; Miralles, Marta Garcia; Gillardon, Frank; Schulte, Claudia; Riess, Olaf; Ueffing, Marius; Biskup, Saskia; Bonin, Michael


    Mutations within the leucine-rich repeat kinase 2 (LRRK2) gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i) a feedback control mechanism for LRRK2 activity as well as (ii) an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis.

  16. The guanine nucleotide exchange factor Vav3 regulates differentiation of progenitor cells in the developing mouse retina.


    Luft, Veronika; Reinhard, Jacqueline; Shibuya, Masabumi; Fischer, Klaus D; Faissner, Andreas


    The seven main cell types in the mammalian retina arise from multipotent retinal progenitor cells, a process that is tightly regulated by intrinsic and extrinsic signals. However, the molecular mechanisms that control proliferation, differentiation and cell-fate decisions of retinal progenitor cells are not fully understood yet. Here, we report that the guanine nucleotide exchange factor Vav3, a regulator of Rho-GTPases, is involved in retinal development. We demonstrate that Vav3 is expressed in the mouse retina during the embryonic period. In order to study the role of Vav3 in the developing retina, we generate Vav3-deficient mice. The loss of Vav3 results in an accelerated differentiation of retinal ganglion cells and cone photoreceptors during early and late embryonic development. We provide evidence that more retinal progenitor cells express the late progenitor marker Sox9 in Vav3-deficient mice than in wild-types. This premature differentiation is compensated during the postnatal period and late-born cell types such as bipolar cells and Müller glia display normal numbers. Taken together, our data imply that Vav3 is a regulator of retinal progenitor cell differentiation, thus highlighting a novel role for guanine nucleotide exchange factors in retinogenesis.

  17. Quadruplexes of human telomere dG{sub 3}(TTAG{sub 3}){sub 3} sequences containing guanine abasic sites

    SciTech Connect

    Skolakova, Petra; Bednarova, Klara; Vorlickova, Michaela; Sagi, Janos


    Research highlights: {yields} Loss of a guanine base does not hinder the formation of G-quadruplex of human telomere sequence. {yields} Each depurination strongly destabilizes the quadruplex of dG{sub 3}(TTAG{sub 3}){sub 3} in NaCl and KCl. {yields} Conformational change of the abasic analogs of dG{sub 3}(TTAG{sub 3}){sub 3} is inhibited in KCl. {yields} The effects abasic sites may affect telomere-end structures in vivo. -- Abstract: This study was performed to evaluate how the loss of a guanine base affects the structure and stability of the three-tetrad G-quadruplex of 5'-dG{sub 3}(TTAG{sub 3}){sub 3}, the basic quadruplex-forming unit of the human telomere DNA. None of the 12 possible abasic sites hindered the formation of quadruplexes, but all reduced the thermodynamic stability of the parent quadruplex in both NaCl and KCl. The base loss did not change the Na{sup +}-stabilized intramolecular antiparallel architecture, based on CD spectra, but held up the conformational change induced in dG{sub 3}(TTAG{sub 3}){sub 3} in physiological concentration of KCl. The reduced stability and the inhibited conformational transitions observed here in vitro for the first time may predict that unrepaired abasic sites in G-quadruplexes could lead to changes in the chromosome's terminal protection in vivo.

  18. Rotation of Guanine Amino Groups in G-Quadruplexes: A Probe for Local Structure and Ligand Binding.


    Adrian, Michael; Winnerdy, Fernaldo Richtia; Heddi, Brahim; Phan, Anh Tuân


    Nucleic acids are dynamic molecules whose functions may depend on their conformational fluctuations and local motions. In particular, amino groups are dynamic components of nucleic acids that participate in the formation of various secondary structures such as G-quadruplexes. Here, we present a cost-efficient NMR method to quantify the rotational dynamics of guanine amino groups in G-quadruplex nucleic acids. An isolated spectrum of amino protons from a specific tetrad-bound guanine can be extracted from the nuclear Overhauser effect spectroscopy spectrum based on the close proximity between the intra-residue imino and amino protons. We apply the method in different structural contexts of G-quadruplexes and their complexes. Our results highlight the role of stacking and hydrogen-bond interactions in restraining amino-group rotation. The measurement of the rotation rate of individual amino groups could give insight into the dynamic processes occurring at specific locations within G-quadruplex nucleic acids, providing valuable probes for local structure, dynamics, and ligand binding. Copyright © 2017 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  19. Effect of guanine to inosine substitution on stability of canonical DNA and RNA duplexes: molecular dynamics thermodynamics integration study.


    Krepl, Miroslav; Otyepka, Michal; Banáš, Pavel; Šponer, Jiří


    Guanine to inosine (G → I) substitution has often been used to study various properties of nucleic acids. Inosine differs from guanine only by loss of the N2 amino group, while both bases have similar electrostatic potentials. Therefore, G → I substitution appears to be optimally suited to probe structural and thermodynamics effects of single H-bonds and atomic groups. However, recent experiments have revealed substantial difference in free energy impact of G → I substitution in the context of B-DNA and A-RNA canonical helices, suggesting that the free energy changes reflect context-dependent balance of energy contributions rather than intrinsic strength of a single H-bond. In the present study, we complement the experiments by free energy computations using thermodynamics integration method based on extended explicit solvent molecular dynamics simulations. The computations successfully reproduce the basic qualitative difference in free energy impact of G → I substitution in B-DNA and A-RNA helices although the magnitude of the effect is somewhat underestimated. The computations, however, do not reproduce the salt dependence of the free energy changes. We tentatively suggest that the different effect of G → I substitution in A-RNA and B-DNA may be related to different topologies of these helices, which affect the electrostatic interactions between the base pairs and the negatively charged backbone. Limitations of the computations are briefly discussed.

  20. Higher order structural effects stabilizing the reverse Watson-Crick Guanine-Cytosine base pair in functional RNAs.


    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi


    The G:C reverse Watson-Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch.

  1. Nature of guanine oxidation in RNA via the flash-quench technique versus direct oxidation by a metal oxo complex

    PubMed Central

    Holcomb, Dana R.; Ropp, Patricia A.; Theil, Elizabeth C.; Thorp, H. Holden


    Oxidation of RNA can be effected by two different techniques: a photochemical, electron-transfer method termed “flash-quench” and direct oxidation by metal oxo complexes. The flash-quench method produces selective oxidation using a metal photosensitizer, tris(bipyridyl)ruthenium(III) trichloride (Ru(bpy)33+), and quencher, pentaamminechlorocobalt(III) chloride (Co(NH3)5Cl2+). We have optimized the flash-quench technique for the following RNAs: tRNAPhe, human ferritin iron-responsive element (IRE), and a mutated human ferritin IRE. We have also employed a chemical footprinting technique involving the oxoruthenium(IV) complex (Ru(tpy)(bpy)O2+ (tpy = 2,2′,2″-terpyridine; bpy = 2,2′-bipyridine)) to oxidize guanine. Comparison of the two methods shows that the flash-quench technique provides a visualization of nucleotide accessibility for a static conformation of RNA while the Ru(tpy)(bpy)O2+ complex selectively oxidizes labile guanines and gives a visualization of a composite of multiple conformations of the RNA structure. PMID:20038124

  2. Formation Pathways of a Guanine-Quadruplex DNA Revealed by Molecular Dynamics and Thermodynamic Analysis of the Substates

    PubMed Central

    Štefl, Richard; Cheatham, Thomas E.; Špačková, Nad'a; Fadrná, Eva; Berger, Imre; Koča, Jaroslav; Šponer, Jiří


    The formation of a cation-stabilized guanine quadruplex (G-DNA) stem is an exceptionally slow process involving complex kinetics that has not yet been characterized at atomic resolution. Here, we investigate the formation of a parallel stranded G-DNA stem consisting of four strands of d(GGGG) using molecular dynamics simulations with explicit inclusion of counterions and solvent. Due to the limitations imposed by the nanosecond timescale of the simulations, rather than watching for the spontaneous formation of G-DNA, our approach probes the stability of possible supramolecular intermediates (including two-, three-, and four-stranded assemblies with out-of-register basepairing between guanines) on the formation pathway. The simulations suggest that “cross-like” two-stranded assemblies may serve as nucleation centers in the initial formation of parallel stranded G-DNA quadruplexes, proceeding through a series of rearrangements involving trapping of cations, association of additional strands, and progressive slippage of strands toward the full stem. To supplement the analysis, approximate free energies of the models are obtained with explicit consideration of the integral cations. The approach applied here serves as a prototype for qualitatively investigating other G-DNA molecules using molecular dynamics simulation and free-energy analysis. PMID:12944293

  3. Formation pathways of a guanine-quadruplex DNA revealed by molecular dynamics and thermodynamic analysis of the substates.


    Stefl, Richard; Cheatham, Thomas E; Spacková, Nad'a; Fadrná, Eva; Berger, Imre; Koca, Jaroslav; Sponer, Jirí


    The formation of a cation-stabilized guanine quadruplex (G-DNA) stem is an exceptionally slow process involving complex kinetics that has not yet been characterized at atomic resolution. Here, we investigate the formation of a parallel stranded G-DNA stem consisting of four strands of d(GGGG) using molecular dynamics simulations with explicit inclusion of counterions and solvent. Due to the limitations imposed by the nanosecond timescale of the simulations, rather than watching for the spontaneous formation of G-DNA, our approach probes the stability of possible supramolecular intermediates (including two-, three-, and four-stranded assemblies with out-of-register base pairing between guanines) on the formation pathway. The simulations suggest that "cross-like" two-stranded assemblies may serve as nucleation centers in the initial formation of parallel stranded G-DNA quadruplexes, proceeding through a series of rearrangements involving trapping of cations, association of additional strands, and progressive slippage of strands toward the full stem. To supplement the analysis, approximate free energies of the models are obtained with explicit consideration of the integral cations. The approach applied here serves as a prototype for qualitatively investigating other G-DNA molecules using molecular dynamics simulation and free-energy analysis.

  4. Role of guanine nucleotide binding protein(s) in vasopressin-induced responses of a vascular smooth muscle cell line

    SciTech Connect

    Nambi, P.; Aiyar, N.; Whitman, M.; Stassen, F.L.; Crooke, S.T.


    Rat aortic smooth muscle cells (A-10) carry vascular V1 vasopressin receptors. In these cells, vasopressin inhibits isoproterenol-induced cAMP accumulation and stimulates phosphatidylinositol turnover and Ca/sup 2 +/ mobilization. Pretreatment of the cells with phorbol esters resulted in inhibition of the vasopressin-induced responses. The inactive phorbol ester aPDD was ineffective. These data suggested that phorbol ester might cause phosphorylation of the vasopressin receptor and/or coupling protein(s). Here, they studied the role of guanine nucleotide binding proteins by employing the novel radiolabeled vasopressin antagonist (/sup 3/H)-SKF 101926. In competition experiments with cell membranes, Gpp(NH)p shifted the vasopressin curve to the right indicating decreased agonist affinity. Phorbol ester pretreatment abolished the Gpp(NH)p effect. Pretreatment of the cells with N-ethylmaleimide (NEM) resulted in inhibition of vasopressin-induced phosphatidyinositol turnover. NEM also abolished the decrease in agonist affinity caused by Gpp(NH)p. These data showed that NEM and phorbol ester pretreatment of smooth muscle cells functionally uncoupled the vasopressin receptors and suggested that vasopressin V1 receptor responses are mediated through guanine nucleotide binding protein(s).

  5. Constructing a novel 8-hydroxy-2'-deoxyguanosine electrochemical sensor and application in evaluating the oxidative damages of DNA and guanine.


    Guo, Zhipan; Liu, Xiuhui; Liu, Yuelin; Wu, Guofan; Lu, Xiaoquan


    8-Hydroxy-2'-deoxyguanosine (8-OHdG) is commonly identified as a biomarker of oxidative DNA damage. In this work, a novel and facile 8-OHdG sensor was developed based on the multi-walled carbon nanotubes (MWCNTs) modified glassy carbon electrode (GCE). It exhibited good electrochemical responses toward the oxidation of 8-OHdG, and the linear ranges were 5.63×10(-8)-6.08×10(-6)M and 6.08×10(-6)-1.64×10(-5)M, with the detection limit of 1.88×10(-8)M (S/N=3). Moreover, the fabricated sensor was applied for the determination of 8-OHdG generated from damaged DNA and guanine, respectively, and the oxidation currents of 8-OHdG increased along with the damaged DNA and guanine within certain concentrations. These results could be used to evaluate the DNA damage, and provide useful information on diagnosing diseases caused by mutation and deficiency of the immunity system.


    PubMed Central

    Todorov, Katherine Abold; Garcia, George A.


    tRNA-guanine transglycosylase (TGT) is a key enzyme involved in the post-transcriptional modification of certain tRNAs in their anticodon wobble positions with queuine. In order to maintain the correct Watson-Crick base pairing properties of the wobble base (and hence proper translation of the genetic code), TGT must recognize its heterocyclic substrate with high specificity. The X-ray crystal structure of a eubacterial TGT bound to preQ1 (Romier et al., EMBO J. (1996) 15, 2850–2857) suggested that aspartate 143 (E. coli TGT numbering) was involved in heterocyclic substrate recognition. Subsequent mutagenic and computational modeling studies from our lab (Todorov et al., Biophys. J. (2005), 89 (3), 1965–1977) provided experimental evidence supporting this hypothesis. Herein, we report further studies probing the differential heterocyclic substrate recognition properties of the aspartate 143 mutant TGTs. Our results are consistent with one of the mutants exhibiting an inversion of substrate recognition preference (xanthine vs. guanine) relative to the wild-type, as evidenced by Km values. This confirms the key role of aspartate 143 in maintaining the anticodon identities of the queuine-containing tRNAs and suggests that TGT mutants could be developed that would alter the tRNA wobble base base-pairing properties. PMID:16401090

  7. Role of aspartate 143 in Escherichia coli tRNA-guanine transglycosylase: alteration of heterocyclic substrate specificity.


    Todorov, Katherine Abold; Garcia, George A


    tRNA-guanine transglycosylase (TGT) is a key enzyme involved in the post-transcriptional modification of certain tRNAs in their anticodon wobble positions with queuine. To maintain the correct Watson-Crick base pairing properties of the wobble base (and hence proper translation of the genetic code), TGT must recognize its heterocyclic substrate with high specificity. The X-ray crystal structure of a eubacterial TGT bound to preQ1 [Romier, C., et al. (1996) EMBO J. 15, 2850-2857] suggested that aspartate 143 (Escherichia coli TGT numbering) was involved in heterocyclic substrate recognition. Subsequent mutagenic and computational modeling studies from our lab [Todorov, K. A., et al. (2005) Biophys. J. 89 (3), 1965-1977] provided experimental evidence supporting this hypothesis. Herein, we report further studies probing the differential heterocyclic substrate recognition properties of the aspartate 143 mutant TGTs. Our results are consistent with one of the mutants exhibiting an inversion of substrate recognition preference (xanthine vs guanine) relative to that of the wild type, as evidenced by Km values. This confirms the key role of aspartate 143 in maintaining the anticodon identities of the queuine-containing tRNAs and suggests that TGT mutants could be developed that would alter the tRNA wobble base base pairing properties.

  8. The Crystal Structure of Cdc42 in Complex with Collybisin II, a Gephyrin-Interacting Guanine Nucleotide Exchange Factor

    SciTech Connect

    Xiang,S.; Kim, E.; Connelly, J.; Nassar, N.; Kirsch, J.; WinkingSchwartz, G.; Schindelin, H.


    The synaptic localization of ion channel receptors is essential for efficient synaptic transmission and the precise regulation of diverse neuronal functions. In the central nervous system, ion channel receptors reside in the postsynaptic membrane where they are juxtaposed to presynaptic terminals. For proper function, these ion channels have to be anchored to the cytoskeleton, and in the case of the inhibitory glycine and {gamma}-amino-butyric acid type A (GABA{sub A}) receptors this interaction is mediated by a gephyrin centered scaffold. Highlighting its central role in this receptor anchoring scaffold, gephyrin interacts with a number of proteins, including the neurospecific guanine nucleotide exchange factor collybistin. Collybistin belongs to the Dbl family of guanine nucleotide exchange factors, occurs in multiple splice variants, and is specific for Cdc42, a small GTPase belonging to the Rho family. The 2.3 Angstroms resolution crystal structure of the Cdc42--collybistin II complex reveals a novel conformation of the switch I region of Cdc42. It also provides the first direct observation of structural changes in the relative orientation of the Dbl-homology domain and the pleckstrin-homology domain in the same Dbl family protein. Biochemical data indicate that gephyrin negatively regulates collybistin activity.

  9. Mutagenic effects induced by the attack of NO2 radical to the guanine-cytosine base pair

    PubMed Central

    Cerón-Carrasco, José P.; Requena, Alberto; Zúñiga, José; Jacquemin, Denis


    We investigate the attack of the nitrogen dioxide radical (NO•2) to the guanine—cytosine (GC) base pair and the subsequent tautomeric reactions able to induce mutations, by means of density functional theory (DFT) calculations. The conducted simulations allow us to identify the most reactive sites of the GC base pair. Indeed, the computed relative energies demonstrate that the addition of the NO•2 radical to the C8 position of the guanine base forms to the most stable adduct. Although the initial adducts might evolve to non-canonical structures via inter-base hydrogen bonds rearrangements, the probability for the proton exchange to occur lies in the same range as that observed for undamaged DNA. As a result, tautomeric errors in NO2-attacked DNA arises at the same rate as in canonical DNA, with no macroscopic impact on the overall stability of DNA. The potential mutagenic effects of the GC–NO•2 radical adducts likely involve side reactions, e.g., the GC deprotonation to the solvent, rather than proton exchange between guanine and cytosine basis. PMID:25798437

  10. Higher order structural effects stabilizing the reverse Watson–Crick Guanine-Cytosine base pair in functional RNAs

    PubMed Central

    Chawla, Mohit; Abdel-Azeim, Safwat; Oliva, Romina; Cavallo, Luigi


    The G:C reverse Watson–Crick (W:W trans) base pair, also known as Levitt base pair in the context of tRNAs, is a structurally and functionally important base pair that contributes to tertiary interactions joining distant domains in functional RNA molecules and also participates in metabolite binding in riboswitches. We previously indicated that the isolated G:C W:W trans base pair is a rather unstable geometry, and that dicationic metal binding to the Guanine base or posttranscriptional modification of the Guanine can increase its stability. Herein, we extend our survey and report on other H-bonding interactions that can increase the stability of this base pair. To this aim, we performed a bioinformatics search of the PDB to locate all the occurencies of G:C trans base pairs. Interestingly, 66% of the G:C trans base pairs in the PDB are engaged in additional H-bonding interactions with other bases, the RNA backbone or structured water molecules. High level quantum mechanical calculations on a data set of representative crystal structures were performed to shed light on the structural stability and energetics of the various crystallographic motifs. This analysis was extended to the binding of the preQ1 metabolite to a preQ1-II riboswitch. PMID:24121683

  11. Involvement of cAMP-guanine nucleotide exchange factor II in hippocampal long-term depression and behavioral flexibility.


    Lee, Kyungmin; Kobayashi, Yuki; Seo, Hyunhyo; Kwak, Ji-Hye; Masuda, Akira; Lim, Chae-Seok; Lee, Hye-Ryeon; Kang, SukJae Joshua; Park, Pojeong; Sim, Su-Eon; Kogo, Naomi; Kawasaki, Hiroaki; Kaang, Bong-Kiun; Itohara, Shigeyoshi


    Guanine nucleotide exchange factors (GEFs) activate small GTPases that are involved in several cellular functions. cAMP-guanine nucleotide exchange factor II (cAMP-GEF II) acts as a target for cAMP independently of protein kinase A (PKA) and functions as a GEF for Rap1 and Rap2. Although cAMP-GEF II is expressed abundantly in several brain areas including the cortex, striatum, and hippocampus, its specific function and possible role in hippocampal synaptic plasticity and cognitive processes remain elusive. Here, we investigated how cAMP-GEF II affects synaptic function and animal behavior using cAMP-GEF II knockout mice. We found that deletion of cAMP-GEF II induced moderate decrease in long-term potentiation, although this decrease was not statistically significant. On the other hand, it produced a significant and clear impairment in NMDA receptor-dependent long-term depression at the Schaffer collateral-CA1 synapses of hippocampus, while microscopic morphology, basal synaptic transmission, and depotentiation were normal. Behavioral testing using the Morris water maze and automated IntelliCage system showed that cAMP-GEF II deficient mice had moderately reduced behavioral flexibility in spatial learning and memory. We concluded that cAMP-GEF II plays a key role in hippocampal functions including behavioral flexibility in reversal learning and in mechanisms underlying induction of long-term depression.

  12. ARHGEF7 (BETA-PIX) Acts as Guanine Nucleotide Exchange Factor for Leucine-Rich Repeat Kinase 2

    PubMed Central

    Haebig, Karina; Gloeckner, Christian Johannes; Miralles, Marta Garcia; Gillardon, Frank; Schulte, Claudia; Riess, Olaf; Ueffing, Marius; Biskup, Saskia; Bonin, Michael


    Background Mutations within the leucine-rich repeat kinase 2 (LRRK2) gene are a common cause of familial and sporadic Parkinson's disease. The multidomain protein LRRK2 exhibits overall low GTPase and kinase activity in vitro. Methodology/Principal Findings Here, we show that the rho guanine nucleotide exchange factor ARHGEF7 and the small GTPase CDC42 are interacting with LRRK2 in vitro and in vivo. GTPase activity of full-length LRRK2 increases in the presence of recombinant ARHGEF7. Interestingly, LRRK2 phosphorylates ARHGEF7 in vitro at previously unknown phosphorylation sites. We provide evidence that ARHGEF7 might act as a guanine nucleotide exchange factor for LRRK2 and that R1441C mutant LRRK2 with reduced GTP hydrolysis activity also shows reduced binding to ARHGEF7. Conclusions/Significance Downstream effects of phosphorylation of ARHGEF7 through LRRK2 could be (i) a feedback control mechanism for LRRK2 activity as well as (ii) an impact of LRRK2 on actin cytoskeleton regulation. A newly identified familial mutation N1437S, localized within the GTPase domain of LRRK2, further underlines the importance of the GTPase domain of LRRK2 in Parkinson's disease pathogenesis. PMID:21048939

  13. Dictyostelium Ric8 is a nonreceptor guanine exchange factor for heterotrimeric G proteins and is important for development and chemotaxis

    PubMed Central

    Kataria, Rama; Xu, Xuehua; Fusetti, Fabrizia; Keizer-Gunnink, Ineke; Jin, Tian; van Haastert, Peter J. M.; Kortholt, Arjan


    Heterotrimeric G proteins couple external signals to the activation of intracellular signal transduction pathways. Agonist-stimulated guanine nucleotide exchange activity of G-protein-coupled receptors results in the exchange of G-protein-bound GDP to GTP and the dissociation and activation of the complex into Gα-GTP and a Gβγ dimer. In Dictyostelium, a basal chemotaxis pathway consisting of heterotrimeric and monomeric G proteins is sufficient for chemotaxis. Symmetry breaking and amplification of chemoattractant sensing occurs between heterotrimeric G protein signaling and Ras activation. In a pull-down screen coupled to mass spectrometry, with Gα proteins as bait, we have identified resistant to inhibitors of cholinesterase 8 (Ric8) as a nonreceptor guanine nucleotide exchange factor for Gα-protein. Ric8 is not essential for the initial activation of heterotrimeric G proteins or Ras by uniform chemoattractant; however, it amplifies Gα signaling, which is essential for Ras-mediated symmetry breaking during chemotaxis and development. PMID:23576747

  14. Comparison of static and dynamic methods of treatment of anharmonicity for the vibrational study of isolated and aqueous forms of guanine

    NASA Astrophysics Data System (ADS)

    Thicoipe, Sandrine; Carbonniere, Philippe; Pouchan, Claude


    This theoretical study provides the anharmonic vibrational wavenumbers of isolated and aqueous guanine. They were performed at the DFT B3LYP/6-31+G(d,p) level of theory using two different ways for the treatment of anharmonicity: time-independent (VPT2) and time-dependent (molecular dynamics) approaches. The wavenumbers obtained are compared to experimental data for isolated and aqueous forms: the VPT2 approach is slightly better than MD, especially for the determination of stretching and wagging (NH) motions. Finally, the structural model of solvatation used for aqueous guanine which combines an explicit solvent model with a polarizable continuum model (PCM) was validated.

  15. The Role of Aspartic Acid 143 in E. coli tRNA-Guanine Transglycosylase: Insights from Mutagenesis Studies and Computational Modeling

    PubMed Central

    Todorov, Katherine Abold; Tan, Xiao-Jian; Nonekowski, Susanne T.; Garcia, George A.; Carlson, Heather A.


    tRNA guanine transglycosylase (TGT) is a tRNA-modifying enzyme which catalyzes the posttranscriptional exchange of guanine in position 34 of tRNAY,H,N,D with the modified base queuine in eukaryotes or its precursor, preQ1 base, in eubacteria. Thus, TGT must recognize the guanine in tRNA and the free base queuine or preQ1 to catalyze this exchange. The crystal structure of Zymomonas mobilis TGT with preQ1 bound suggests that a key aspartate is critically involved in substrate recognition. To explore this, a series of site-directed mutants of D143 in Escherichia coli TGT were made and characterized to investigate heterocyclic substrate recognition. Our data confirm that D143 has significant impact on KM of guanine; however, the trend in the KM data (D143A < D143N < D143S < D143T) is unexpected. Computational studies were used to further elucidate the interactions between guanine and the D143 mutants. A homology model of E. coli TGT was created, and the role of D143 was investigated by molecular dynamic simulations of guanine bound to the wild-type and D143-mutant TGTs. To validate the model systems against our kinetic data, free energies of binding were fit using the linear interaction energy (LIE) method. This is a unique application of the LIE method because the same ligand is bound to several mutant proteins rather than one protein binding several ligands. The atomic detail gained from the simulations provided a better understanding of the binding affinities of guanine with the mutant TGTs, revealing that water molecules enter the active site and hydrogen bond to the ligand and compensate for lost protein-ligand interactions. The trend of binding affinity for wild-type > D143A > D143N > D143S > D143T appears to be directly related to the degree of hydrogen bonding available to guanine in the binding site. PMID:15951383

  16. Escherichia coli MutY protein has a guanine-DNA glycosylase that acts on 7,8-dihydro-8-oxoguanine:guanine mispair to prevent spontaneous G:C-->C:G transversions.


    Zhang, Q M; Ishikawa, N; Nakahara, T; Yonei, S


    Low rates of spontaneous G:C-->C:G transversions would be achieved not only by the correction of base mismatches during DNA replication but also by the prevention and removal of oxidative base damage in DNA. Escherichia coli must have several pathways to repair such mismatches and DNA modifications. In this study, we attempted to identify mutator loci leading to G:C-->C:G transversions in E.coli. The strain CC103 carrying a specific mutation in lacZ was mutagenized by random miniTn 10 insertion mutagenesis. In this strain, only the G:C-->C:G change can revert the glutamic acid at codon 461, which is essential for sufficient beta-galactosidase activity to allow growth on lactose. Mutator strains were detected as colonies with significantly increased rates of papillae formation on glucose minimal plates containing P-Gal and X-Gal. We screened approximately 40 000 colonies and selected several mutator strains. The strain GC39 showed the highest mutation rate to Lac+. The gene responsible for the mutator phenotypes, mut39 , was mapped at around 67 min on the E.coli chromosome. The sequencing of the miniTn 10 -flanking DNA region revealed that the mut39 was identical to the mutY gene of E.coli. The plasmid carrying the mutY + gene reduced spontaneous G:C-->T:A and G:C-->C:G mutations in both mutY and mut39 strains. Purified MutY protein bound to the oligonucleotides containing 7,8-dihydro-8-oxo-guanine (8-oxoG):G and 8-oxoG:A. Furthermore, we found that the MutY protein had a DNA glycosylase activity which removes unmodified guanine from the 8-oxoG:G mispair. These results demonstrate that the MutY protein prevents the generation of G:C-->C:G transversions by removing guanine from the 8-oxoG:G mispair in E.coli.

  17. Quantification of 8-oxo-guanine and guanine as the nucleobase, nucleoside and deoxynucleoside forms in human urine by high-performance liquid chromatography–electrospray tandem mass spectrometry

    PubMed Central

    Weimann, Allan; Belling, Dorthe; Poulsen, Henrik E.


    Oxidative DNA damage, linked pathogenically to a variety of diseases such as cancer and ageing, can be investigated by measuring specific DNA repair products in urine. Within the last decade, since it was established that such products were excreted into urine, progress in their analysis in urine has been limited. Guanine is the DNA base most prone to oxidation. We present a method for determination of the urinary 8-hydroxylated species of guanine, based on direct injection of urine onto a high-performance liquid chromatography (HPLC)–tandem mass spectrometry system. The analysis covers the 8-hydroxylated base, ribonucleoside and deoxynucleoside, and the corresponding non-oxidised species. Without pre-treatment of urine the detection limits for the nucleobases are ∼2 nM (50 fmol injected) and for the nucleosides ∼0.5 nM (12.5 fmol injected). Previously, liquid chromatography of the nucleobases has been problematic but is made possible by low-temperature reverse-phase C18 chromatography, a method that increases retention on the column. In the case of the nucleosides, retention was almost total and provides a means for on-column concentration of larger urine samples and controlled high peak gradient elution. The total excretion of 8-hydroylated guanine species was 212 nmol/24 h. The oxidised base accounted for 64%, the ribonucleoside for 23% and the deoxynucleoside for 13%, indicating substantial oxidation of RNA in humans. In rat urine, excretion of the oxidised base was more dominant, the percentages of the oxidised base, ribonucleoside and deoxynucleosides being 89, 8 and 3%. This finding is at odds with previous reports using immunoaffinity pre-purification and HPLC–electrochemical detection analysis. The developed method now makes it possible to measure oxidative nucleic acid stress to both RNA and DNA in epidemiological and intervention settings, and our findings indicate a substantial RNA oxidation in addition to DNA oxidation. The small volume needed

  18. A highly specific and sensitive electroanalytical strategy for microRNAs based on amplified silver deposition by the synergic TiO2 photocatalysis and guanine photoreduction using charge-neutral probes.


    Li, Rui; Li, Shuying; Dong, Minmin; Zhang, Liyan; Qiao, Yuchun; Jiang, Yao; Qi, Wei; Wang, Hua


    TiO2 photocatalysis and guanine photoreduction were synergically combined for amplifying silver deposition for the electroanalysis of short-chain microRNAs with guanine bases using charge-neutral probes. It could allow for the highly specific and sensitive detection of microRNAs in the blood as well as the identification of their mutant levels.

  19. In vivo formation of N7-guanine DNA adduct by safrole 2',3'-oxide in mice.


    Shen, Li-Ching; Chiang, Su-Yin; Lin, Ming-Huan; Chung, Wen-Sheng; Wu, Kuen-Yuh


    Safrole, a naturally occurring product derived from spices and herbs, has been shown to be associated with the development of hepatocellular carcinoma in rodents. Safrole 2',3'-oxide (SFO), an electrophilic metabolite of safrole, was shown to react with DNA bases to form detectable DNA adducts in vitro, but not detected in vivo. Therefore, the objective of this study was to investigate the formation of N7-(3-benzo[1,3]dioxol-5-yl-2-hydroxypropyl)guanine (N7γ-SFO-Gua) resulting from the reaction of SFO with the most nucleophilic site of guanine in vitro and in vivo with a newly developed isotope-dilution high performance liquid chromatography electrospray ionization tandem mass spectrometry (HPLC-ESI-MS/MS) method. N7γ-SFO-Gua and [(15)N(5)]-N7-(3-benzo[1,3]dioxol-5-yl-2-hydroxypropyl)guanine ([(15)N(5)]-N7γ-SFO-Gua) were first synthesized, purified, and characterized. The HPLC-ESI-MS/MS method was developed to measure N7γ-SFO-Gua in calf thymus DNA treated with 60 μmol of SFO for 72 h and in urine samples of mice treated with a single dose of SFO (30 mg/kg body weight, intraperitoneally). In calf thymus DNA, the level of N7γ-SFO-Gua was 2670 adducts per 10(6)nucleotides. In urine of SFO-treated mice, the levels of N7γ-SFO-Gua were 1.02±0.14 ng/mg creatinine (n=4) on day 1, 0.73±0.68 ng/mg creatinine (n=4) on day 2, and below the limit of quantitation on day 3. These results suggest that SFO can cause in vivo formation of N7γ-SFO-Gua, which may then be rapidly depurinated from the DNA backbone and excreted through urine. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  20. Mechanisms of the Formation of Adenine, Guanine, and Their Analogues in UV-Irradiated Mixed NH3:H2O Molecular Ices Containing Purine.


    Bera, Partha P; Stein, Tamar; Head-Gordon, Martin; Lee, Timothy J


    We investigated the formation mechanisms of the nucleobases adenine and guanine and the nucleobase analogues hypoxanthine, xanthine, isoguanine, and 2,6-diaminopurine in a UV-irradiated mixed 10:1 H2O:NH3 ice seeded with precursor purine by using ab initio and density functional theory computations. Our quantum chemical investigations suggest that a multistep reaction mechanism involving purine cation, hydroxyl and amino radicals, together with water and ammonia, explains the experimentally obtained products in an independent study. The relative abundances of these products appear to largely follow from relative thermodynamic stabilities. The key role of the purine cation is likely to be the reason why purine is not functionalized in pure ammonia ice, where cations are promptly neutralized by free electrons from NH3 ionization. Amine group addition to purine is slightly favored over hydroxyl group attachment based on energetics, but hydroxyl is much more abundant due to higher abundance of H2O. The amino group is preferentially attached to the 6 position, giving 6-aminopurine, that is, adenine, while the hydroxyl group is preferentially attached to the 2 position, leading to 2-hydroxypurine. A second substitution by hydroxyl or amino group occurs at either the 6 or the 2 position depending on the first substitution. Given that H2O is far more abundant than NH3 in the experimentally studied ices (as well as based on interstellar abundances), xanthine and isoguanine are expected to be the most abundant bi-substituted photoproducts. Key Words: Astrophysical ice-Abiotic organic synthesis-Nucleic acids-Origin of life-RNA world. Astrobiology 17, 771-785.

  1. The product of the hypB gene, which is required for nickel incorporation into hydrogenases, is a novel guanine nucleotide-binding protein.

    PubMed Central

    Maier, T; Jacobi, A; Sauter, M; Böck, A


    The products of the hyp operon genes are essential for the formation of catalytically active hydrogenases in Escherichia coli. At least one of these auxiliary proteins, HYPB, appears to be involved in nickel liganding to the hydrogenase apoprotein, since mutations in hypB can be phenotypically suppressed by high nickel concentrations in the medium (R. Waugh and D. H. Boxer, Biochimie 68:157-166, 1986). To approach the identification of the specific function of HYPB, we overexpressed the hypB gene and purified and characterized the gene product. HYPB is a homodimer of 31.6-kDa subunits, and it binds guanine nucleotides, with a Kd for GDP of 1.2 microM. The protein displays a low level of GTPase activity, with a kcat of 0.17 min-1. The apparent Km for GTP, as measured in the GTP hydrolysis reaction, was determined to be 4 microM. A chromatography system was established to measure nickel insertion into hydrogenase 3 from E. coli and to determine the effects of lesions in hypB. Nickel appears to be associated only with the processed large subunit of hydrogenase 3 in the wild type, and hypB mutants accumulate the precursor form of this subunit, which is devoid of nickel. The results are discussed in terms of a model in which HYPB is involved in nickel donation to the hydrogenase apoprotein and in which GTP hydrolysis is thought to reverse the interaction between either HYPB or another nickel-binding protein and the hydrogenase apoprotein after the nickel has been released. Images PMID:8423137

  2. Selective acquisition and retention of genomic sequences by Pack-Mutator-like elements based on guanine-cytosine content and the breadth of expression.


    Ferguson, Ann A; Zhao, Dongyan; Jiang, Ning


    The process of gene duplication followed by sequence and functional divergence is important for the generation of new genes. Pack-MULEs, nonautonomous Mutator-like elements (MULEs) that carry genic sequence(s), are potentially involved in generating new open reading frames and regulating parental gene expression. These elements are identified in many plant genomes and are most abundant in rice (Oryza sativa). Despite the abundance of Pack-MULEs, the mechanism by which parental genes are captured by Pack-MULEs remains largely unknown. In this study, we identified all MULEs in rice and examined factors likely important for sequence acquisition. Terminal inverted repeat MULEs are the predominant MULE type and account for the majority of the Pack-MULEs. In addition to genic sequences, rice MULEs capture guanine-cytosine (GC)-rich intergenic sequences, albeit at a much lower frequency. MULEs carrying nontransposon sequences have longer terminal inverted repeats and higher GC content in terminal and subterminal regions. An overrepresentation of genes with known functions and genes with orthologs among parental genes of Pack-MULEs is observed in rice, maize (Zea mays), and Arabidopsis (Arabidopsis thaliana), suggesting preferential acquisition for bona fide genes by these elements. Pack-MULEs selectively acquire/retain parental sequences through a combined effect of GC content and breadth of expression, with GC content playing a stronger role. Increased GC content and number of tissues with detectable expression result in higher chances of a gene being acquired by Pack-MULEs. Such selective acquisition/retention provides these elements greater chances of carrying functional sequences that may provide new genetic resources for the evolution of new genes or the modification of existing genes.

  3. The Shizosaccharomyces pombe homolog (SpMYH) of the Escherichia coli MutY is required for removal of guanine from 8-oxoguanine/guanine mispairs to prevent G:C to C:G transversions.


    Doi, Takashi; Yonekura, Shin-Ichiro; Tano, Keizo; Yasuhira, Shinji; Yonei, Shuji; Zhang, Qiu-Mei


    The frequency of G:C-->C:G transversions significantly increases upon exposure of cells to ionizing radiation or reactive oxygen species. Transversions can be prevented by base excision repair, which removes the causative modified bases from DNA. Our previous studies revealed that MutY is responsible for removing guanine from 7,8-dihydro-8-oxoguanine/guanine mispairs (8-oxoG/G) and prevents the generation of G:C-->C:G transversions in E. coli. SpMYH, a homolog of E. coli MutY, had been identified and characterized in the fission yeast S. pombe. Purified SpMYH has adenine DNA glycosylase activity on A/8-oxoG and A/G mismatch-containing oligonucleotides. In this study, we examined whether SpMYH has a similar activity allowing it to remove G from 8-oxoG/G in DNA. The purified SpMYH tightly bound to duplex oligonucleotides containing 8-oxoG/G and removed the unmodified G from 8-oxoG/G as efficiently as A from 8-oxoG/A. The activity was absent in the cell extract prepared from an SpMYH-knockout strain of S. pombe. The expression of SpMYH markedly reduced the frequency of spontaneous G:C-->C:G transversions in the E. coli mutY mutant. These results demonstrate that SpMYH is involved in the repair of 8-oxoG/G, by which it prevents mutations induced by oxidative stress in S. pombe.

  4. Mapping the binding site of aflatoxin B/sub 1/ in DNA: systematic analysis of the reactivity of aflatoxin B/sub 1/ with guanines in different DNA sequences

    SciTech Connect

    Benasutti, M.; Ejadi, S.; Whitlow, M.D.; Loechler, E.L.


    The mutagenic and carcinogenic chemical aflatoxin B/sub 1/ (AFB/sub 1/) reacts almost exclusively at the N(7)-position of guanine following activation to its reactive form, the 8,9-epoxide (AFB/sub 1/ oxide). In general N(7)-guanine adducts yield DNA strand breaks when heated in base, a property that serves as the basis for the Maxam-Gilbert DNA sequencing reaction specific for guanine. Using DNA sequencing methods, other workers have shown that AFB/sub 1/ oxide gives strand breaks at positions of guanines; however, the guanine bands varied in intensity. This phenomenon has been used to infer that AFB/sub 1/ oxide prefers to react with guanines in some sequence contexts more than in others and has been referred to as sequence specificity of binding. Herein, data on the reaction of AFB/sub 1/ oxide with several synthetic DNA polymers with different sequences are presented, and (following hydrolysis) adduct levels are determine by high-pressure liquid chromatography. These results reveal that for AFB/sub 1/ oxide (1) the N(7)-guanine adduct is the major adduct found in all of the DNA polymers, (2) adduct levels vary in different sequences, and, thus, sequence specificity is also observed by this more direct method, and (3) the intensity of bands in DNA sequencing gels is likely to reflect adduct levels formed at the N(7)-position of guanine. Knowing this, a reinvestigation of the reactivity of guanines in different DNA sequences using DNA sequencing methods was undertaken. Methods are developed to determine the X (5'-side) base and the Y (3'-side) base are most influential in determining guanine reactivity. These rules in conjunction with molecular modeling studies were used to assess the binding sites that might be utilized by AFB/sub 1/ oxide in its reaction with DNA.

  5. Metal-organic frameworks and β-cyclodextrin-based composite electrode for simultaneous quantification of guanine and adenine in a lab-on-valve manifold.


    Wang, Yang; Chen, Huanhuan; Wu, Yichun; Ge, Huali; Ye, Guiqin; Hu, Xiaoya


    In this work, a novel chemically modified electrode is constructed based on metal-organic frameworks and β-cyclodextrin (Cu3(BTC)2/β-CD, BTC = benzene-1,3,5-tricarboxylate) composite material. The electrode was used for simultaneous determination of guanine and adenine in a sequential injection lab-on-valve format and exhibited sensitive responses to guanine and adenine oxidation due to the π-π stacking interaction of Cu3(BTC)2 and the inclusion behavior of β-CD. The analytical performance was assessed with respect to the supporting electrolyte and its pH, accumulation time and accumulation potential, and the fluid flow rates. Under optimal conditions, linear calibration ranges for both guanine and adenine were from 1.0 × 10(-7) to 1.0 × 10(-5) mol L(-1), and detection limits (S/N = 3) were found to be 5.2 × 10(-8) and 2.8 × 10(-8) mol L(-1), respectively. The proposed sensor showed advantages of high sensitivity, simple sample preparation protocol, enhanced throughput and good reproducibility. Finally, the practical application of the proposed sensor has been performed for the determination of guanine and adenine in real samples with satisfactory results.

  6. Major and minor groove conformations of DNA trimers modified on guanine or adenine by 4-aminobiphenyl: Adenine adducts favor the minor groove

    SciTech Connect

    Shapiro, R.; Ellis, S.; Hingerty, B.E.


    We have studied the conformational effects of 4-aminobiphenyl modification at C-8 of guanine or adenine on double-stranded DNA trimers. We used sequences with the modified purine at the central base pair and all 16 possible neighboring sequences at the outer pairs. Minimized potential energy calculations were carried out using the molecular mechanics program DUPLEX to survey the conformation space of these adducts, using a total of 1280 starting structures both in the modified guanine series and in the modified adenine series. Conformer families in which the bound 4-aminobiphenyl was located in the DNA major groove, and in the minor groove, were located for both adenine and guanine modification. In the modified guanine series, the major and minor groove families were roughly comparable in energy, and the sequence context determined which was more stable in a particular case. In the modified adenine series, however, the minor groove structure was more that 10 kcal/mol more stable than the major groove for all sequences. As a result, minor groove adducts provided most of the global minima in the adenine-modified series. This result may be relevant to a previous mutagenesis study [Lasko et al. (1988) J. Biol. Chem. 263, 15429-15435] in which the hot spot of most frequent occurrence was located at an adenine, in the sequence GAT. 25 refs., 9 figs., 4 tabs.

  7. The 4-nitroquinoline 1-oxide mutational spectrum in single stranded DNA is characterized by guanine to pyrimidine transversions.


    Fronza, G; Campomenosi, P; Iannone, R; Abbondandolo, A


    4-Nitroquinoline-1-oxide is a potent mutagen and carcinogen which induces two main guanine adducts at positions C8 and N2. In ds or ss damaged DNA the ratio C8/N2 adducts is 1:2 and 8-10:1, respectively. In bacteria and yeast 4NQO has been shown to be a base substitution mutagen acting at G residues inducing mainly G to A transitions. We determined the mutational spectrum induced by the 4NQO metabolite, acetoxy-4-aminoquinoline 1-oxide, in the M13lacZ'/E. coli lacZ delta M15 alpha complementation assay using ssDNA. Among 68 Ac-4HAQO induced mutants, G to Pyr transversion was the most frequent base substitution observed. By comparison with dsDNA based systems, our data suggest that dGuo-C8-AQO induces G to Pyr transversions. A mechanism to explain how this lesion may induce transversions is proposed.

  8. Frabin and other related Cdc42-specific guanine nucleotide exchange factors couple the actin cytoskeleton with the plasma membrane

    PubMed Central

    Nakanishi, Hiroyuki; Takai, Yoshimi


    Frabin, together with, at least, FGD1, FGD2, FGD3 and FGD1-related Cdc42-GEF (FRG), is a member of a family of Cdc42-specific gua-nine nucleotide exchange factors (GEFs). These proteins have multiple phosphoinositide-binding domains, including two pleckstrin homology (PH) domains and an FYVE or FERM domain. It is likely that they couple the actin cytoskeleton with the plasma membrane. Frabin associates with a specific actin structure(s) and induces the direct activation of Cdc42 in the vicinity of this structure(s), resulting in actin reorganization. Furthermore, frabin associates with a specific membrane structure(s) and induces the indirect activation of Rac in the vicinity of this structure(s), resulting in the reorganization of the actin cytoskeleton. This reorganization of the actin cytoskeleton induces cell shape changes such as the formation of filopodia and lamellipodia. PMID:18410521

  9. Differential Rac1 signalling by guanine nucleotide exchange factors implicates FLII in regulating Rac1-driven cell migration

    PubMed Central

    Marei, Hadir; Carpy, Alejandro; Woroniuk, Anna; Vennin, Claire; White, Gavin; Timpson, Paul; Macek, Boris; Malliri, Angeliki


    The small GTPase Rac1 has been implicated in the formation and dissemination of tumours. Upon activation by guanine nucleotide exchange factors (GEFs), Rac1 associates with a variety of proteins in the cell thereby regulating various functions, including cell migration. However, activation of Rac1 can lead to opposing migratory phenotypes raising the possibility of exacerbating tumour progression when targeting Rac1 in a clinical setting. This calls for the identification of factors that influence Rac1-driven cell motility. Here we show that Tiam1 and P-Rex1, two Rac GEFs, promote Rac1 anti- and pro-migratory signalling cascades, respectively, through regulating the Rac1 interactome. In particular, we demonstrate that P-Rex1 stimulates migration through enhancing the interaction between Rac1 and the actin-remodelling protein flightless-1 homologue, to modulate cell contraction in a RhoA-ROCK-independent manner. PMID:26887924

  10. "False" thymine-1H-Enol guanine base pair. low misinsertion rate by DNA polymerase explained by computational chemistry consideration.


    Seclaman, E; Kurunczi, L; Simon, Z


    Formation of correct TA and GC and "false" thymine-1H-enol guanine (TGenol) base pairs is here considered to control nucleotide insertion into DNA via low substrate concentration Michaelis-Menten controlled kinetics. Contributions of base pairing to formation of Gibbs free energies in water solution, DeltaDeltaG, are calculated for the correct and false base pairs with the semi-empiric MNDO/PM3 method for base pairing energies in vacuum and the BEM method for hydration effects. The results for DeltaDeltaG indicate equal insertion rates for correct base pairing and a 10(-3)-10(-4) error probability for false insertion controlled by the TGenol false pair.

  11. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field.


    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah


    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds' vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field.

  12. Comparison of Transition Metal-Mediated Oxidation Reactions of Guanine in Nucleoside and Single-Stranded Oligodeoxynucleotide Contexts.


    Ghude, Pranjali; Schallenberger, Mark A; Fleming, Aaron M; Muller, James G; Burrows, Cynthia J


    As the most readily oxidized of DNA's four natural bases, guanine is a prime target for attack by reactive oxygen species (ROS) and transition metal-mediated oxidants. The oxidation products of a modified guanosine nucleoside and of a single-stranded oligodeoxynucleotide, 5'-d(TTTTTTTGTTTTTTT)-3' have been studied using oxidants that include Co(II), Ni(II), and Ir(IV) compounds as well as photochemically generated oxidants such as sulphate radical, electron-transfer agents (riboflavin) and singlet oxygen. The oxidized lesions formed include spiroiminodihydantoin (Sp), guanidinohydantoin (Gh), imidazolone (Iz), oxazolone (Z) and 5-carboxamido-5-formamido-2-iminohydantion (2-Ih) nucleosides with a high degree of dependence on the exact oxidation system employed. Interestingly, a nickel(II) macrocyclic complex in conjunction with KHSO(5) leads to the recently reported 2-Ih heterocycle as the major product in both the nucleoside and oligonucleotide contexts.

  13. Evidence for a class of very small introns in the gene for hypoxanthine-guanine phosphoribosyltransferase in Schistosoma mansoni.

    PubMed Central

    Craig, S P; Muralidhar, M G; McKerrow, J H; Wang, C C


    The single copy gene for the hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) of the parasitic trematode, Schistosoma mansoni, contains seven introns, the first four of which are only 31, 33, 42, and 32 bases in length. These are the smallest introns ever discovered in a non-viral nuclear gene coding for protein. These very small introns possess the canonical GT...AG splice site sequences but lack the branching sequence, the secondary structure, and the minimum size of approximately 50 bases believed to be required for the splicing of eucaryotic mRNA precursors. Evidently, a somewhat different splicing mechanism for the transcripts of these very small introns is necessary. Their discovery within the genes of helminths raises theoretical considerations for the evolution of introns in eucaryotes. Images PMID:2701934

  14. Analysis of cDNA encoding the hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) of Schistosoma mansoni; a putative target for chemotherapy.

    PubMed Central

    Craig, S P; McKerrow, J H; Newport, G R; Wang, C C


    Because of the lack of de novo purine biosynthesis, hypoxanthine-guanine phosphoribosyltransferase (HGPRTase) is a critical enzyme in the purine metabolic pathway of the human parasite, Schistosoma mansoni. Using a cDNA clone encoding mouse HGPRTase and subsequently a synthetic oligonucleotide derived from sequencing a clone of genomic DNA, two clones were isolated from an adult schistosome cDNA library. One clone is 1.374 Kilobases (Kb) long and has an open reading frame of 693 bases. The deduced 231 amino acid sequence has 47.9% identity in a 217 amino acid overlap with human HGPRTase. Northern blot analysis indicates that the full length of mRNA for the S. mansoni HGPRTase is 1.45-1.6 Kb. Analysis of the primary structures of the putative active site for human and parasite enzymes reveal specific differences which may eventually be exploitable in the design of drugs for the treatment of schistosomiasis. Images PMID:3136439

  15. Spectroscopic (UV/VIS, Raman) and Electrophoresis Study of Cytosine-Guanine Oligonucleotide DNA Influenced by Magnetic Field

    PubMed Central

    Banihashemian, Seyedeh Maryam; Periasamy, Vengadesh; Boon Tong, Goh; Abdul Rahman, Saadah


    Studying the effect of a magnetic field on oligonucleotide DNA can provide a novel DNA manipulation technique for potential application in bioengineering and medicine. In this work, the optical and electrochemical response of a 100 bases oligonucleotides DNA, cytosine-guanine (CG100), is investigated via exposure to different magnetic fields (250, 500, 750, and 1000 mT). As a result of the optical response of CG100 to the magnetic field, the ultra-violet-visible spectrum indicated a slight variation in the band gap of CG100 of about 0.3 eV. Raman spectroscopy showed a significant deviation in hydrogen and phosphate bonds’ vibration after exposure to the magnetic field. Oligonucleotide DNA mobility was investigated in the external electric field using the gel electrophoresis technique, which revealed a small decrease in the migration of CG100 after exposure to the magnetic field. PMID:26999445

  16. Stability of guanine adsorbed in a clay mineral under gamma irradiation at temperatures (77 and 298 K): Implications for chemical evolution studies

    NASA Astrophysics Data System (ADS)

    Meléndez-López, A. L.; Ramos-Bernal, S.; Ramírez-Vázquez, M. L.


    Chemical evolution is a physical and chemical preamble prior the appearance of life. In these processes, clay minerals might have played an important role on the early Earth. The relevance of these solids in the emergence of life is due to their ancient origin, wide distribution, and especially, their physico-chemical properties. Clays, therefore, are considered the most likely inorganic materials to promote organic reactions in the primitive Earth. John D. Bernal suggested clays as concentrators of biological precursor molecules, as catalysis and clays might protect these molecules from high-energy radiation. On the other hand, nucleic acid bases and their derivatives are important compounds in biological systems. Their synthesis and stability in environmental conditions are of paramount importance in chemical evolution. The aim of this work is to extend the knowledge of the role of clays in the prebiotic epoch in relation to the behavior of guanine, a nucleic acid base, adsorbed in a clay mineral. To this end, we studied its adsorption in clays, its site of binding, and its survival under a high radiation field and at different temperatures and pH. The results showed guanine adsorption onto clays increased with the decreasing of the pH. This result could be explained by electrostatic forces between guanine positively charged at an acid pH and the negatively charged interlamellar channel of the clay. X-ray diffractograms showed that guanine is adsorbed onto the clay at the interlayer channel. To study the survival of guanine in a high radiation field, the system guanine-clay was irradiated under different irradiation doses, temperatures, and pH. The results showed that more than 90% of the guanine survives, and when the radiolysis is made without clay, the decomposition of this molecule occurs at low irradiation doses. The radiolysis performed at 77 K showed very low decomposition, which is important in cometary chemistry. These results show the protection role of

  17. Guanine-specific oxidation of double-stranded DNA by Cr(VI) and ascorbic acid forms spiroiminodihydantoin and 8-oxo-2'-deoxyguanosine.


    Slade, Peter G; Hailer, M Katie; Martin, Brooke D; Sugden, Kent D


    7,8-dihydro-8-oxoguanine (8-oxoG) is thought to be a major lesion formed in DNA by oxidative attack at the nucleobase guanine. Recent studies have shown that 8-oxoG has a lower reduction potential than the parent guanine and is a hot spot for further oxidation. Spiroiminodihydantoin (Sp) has been identified as one of these further oxidation products. Chromium(VI) is a human carcinogen that, when reduced by a cellular reductant such as ascorbate, can oxidize DNA. In this study, duplex DNA was reacted with Cr(VI) and ascorbate to identify and quantify the base lesions formed. Guanine bases were observed to be preferentially oxidized with 5' guanines within purine repeats showing enhanced oxidation. Trapping of the guanine lesions by the base excision repair enzymes hOGG1 and mNEIL2 showed nearly exclusive trapping by mNEIL2, suggesting that 8-oxoG was not the major lesion but rather a lesion recognized by mNEIL2 such as Sp. Formation of the Sp lesion in the Cr(VI)/Asc oxidation reaction with DNA was confirmed by LC-ESI-MS detection. HPLC-ECD was used to identify and quantify any 8-oxoG arising from Cr(VI)/Asc oxidation of DNA. Concentrations of Cr(VI) (3.1-50 microM) with a corresponding 1:10 ratio of Asc oxidized between 0.3% and 1.5% of all guanines within the duplex DNA strand to Sp. 8-oxoG was also identified but with the highest Cr(VI) concentration converting approximately 0.1% of all guanines to 8-oxoG. These results show that Sp was present in concentrations approximately 20 times greater than that of 8-oxoG in this system. The results indicate that 8-oxoG, while present, was not the major product of Cr(VI)/Asc oxidation of DNA and that Sp predominates under these conditions. These results further imply that Sp may be the lesion that accounts for the carcinogenicity of this metal in cellular systems.

  18. Fluorescence properties of 8-(2-pyridyl)guanine "2PyG" as compared to 2-aminopurine in DNA.


    Dumas, Anaëlle; Luedtke, Nathan W


    Because of their environment-sensitive fluorescence quantum yields, base analogues such as 2-aminopurine (2AP), 6-methylisoxanthopterin (6-MI), and 3-methylisoxanthopterin (3-MI) are widely used in nucleic-acid folding and catalysis assays. Emissions from these guanine mimics are quenched by base-stacking interactions and collisions with purine residues. Fluorescent base analogues that remain highly emissive in folded nucleic acids can provide sensitive means to differentiate DNA/RNA structures by participating in energy transfer from proximal ensembles of unmodified nucleobases. The development of new, highly emissive guanine mimics capable of proper base stacking and base-pairing interactions is an important prerequisite to this approach. Here we report a comparison of the most commonly used probe, 2-aminopurine (2AP), to 8-(2-pyridyl)-2'-deoxyguanosine (2PyG). The photophysical properties of these purine derivatives are very different. 2PyG exhibits enhanced fluorescence quantum yields upon its incorporation into folded nucleic acids--approximately 50-fold brighter fluorescence intensity than 2AP in the context of duplex DNA. Due to its bright fluorescence and compatibility with proper DNA folding, 2PyG can be used to accurately quantify energy-transfer efficiencies, whereas 2AP is much less sensitive to structure-specific trends in energy transfer. When using nucleoside monomers, Stern-Volmer plots of 2AP fluorescence revealed upward curvature of F(0) /F upon titration of guanosine monophoshate (GMP), whereas 2PyG exhibited unusual downward curvature of F(0) /F that resulted in a recovery of fluorescence at high GMP concentrations. These results are consistent with the trends observed for 2PyG- and 2AP-containing oligonucleotides, and furthermore suggest that solutions containing high concentrations of GMP can, in some ways, mimic the high local nucleobase densities of folded nucleic acids.

  19. Superoxide Inhibits Guanine Nucleotide Exchange Factor (GEF) Action on Ras, but not on Rho, through Desensitization of Ras to GEF

    PubMed Central


    Ras and Rho GTPases are molecular switches for various vital cellular signaling pathways. Overactivation of these GTPases often causes development of cancer. Guanine nucleotide exchange factors (GEFs) and oxidants function to upregulate these GTPases through facilitation of guanine nucleotide exchange (GNE) of these GTPases. However, the effect of oxidants on GEF functions, or vice versa, has not been known. We show that, via targeting Ras Cys51, an oxidant inhibits the catalytic action of Cdc25—the catalytic domain of RasGEFs—on Ras. However, the enhancement of Ras GNE by an oxidant continues regardless of the presence of Cdc25. Limiting RasGEF action by an oxidant may function to prevent the pathophysiological overactivation of Ras in the presence of both RasGEFs and oxidants. The continuous exposure of Ras to nitric oxide and its derivatives can form S-nitrosated Ras (Ras-SNO). This study also shows that an oxidant not only inhibits the catalytic action of Cdc25 on Ras-SNO but also fails to enhance Ras-SNO GNE. This lack of enhancement then populates the biologically inactive Ras-SNO in cells, which may function to prevent the continued redox signaling of the Ras pathophysiological response. Finally, this study also demonstrates that, unlike the case with RasGEFs, an oxidant does not inhibit the catalytic action of RhoGEF—Vav or Dbs—on Rho GTPases such as Rac1, RhoA, RhoC, and Cdc42. This result explains the results of the previous study in which, despite the presence of an oxidant, the catalytic action of Dbs in cells continued to enhance RhoC GNE. PMID:24422478

  20. Substrate orientation and specificity in xanthine oxidase: crystal structures of the enzyme in complex with indole-3-acetaldehyde and guanine.


    Cao, Hongnan; Hall, James; Hille, Russ


    Xanthine oxidase is a molybdenum-containing hydroxylase that catalyzes the hydroxylation of sp(2)-hybridized carbon centers in a variety of aromatic heterocycles as well as aldehydes. Crystal structures of the oxidase form of the bovine enzyme in complex with a poor substrate indole-3-acetaldehyde and the nonsubstrate guanine have been determined, both at a resolution of 1.6 Å. In each structure, a specific and unambiguous orientation of the substrate in the active site is observed in which the hydroxylatable site is oriented away from the active site molybdenum center. The orientation seen with indole-3-acetaldehyde has the substrate positioned with the indole ring rather than the exocyclic aldehyde nearest the molybdenum center, indicating that the substrate must rotate some 30° in the enzyme active site to permit hydroxylation of the aldehyde group (as observed experimentally), accounting for the reduced reactivity of the enzyme toward this substrate. The principal product of hydroxylation of indole-3-acetaldehyde by the bovine enzyme is confirmed to be indole-3-carboxylic acid based on its characteristic UV-vis spectrum, and the kinetics of enzyme reduction are reported. With guanine, the dominant orientation seen crystallographically has the C-8 position that might be hydroxylated pointed away from the active site molybdenum center, in a configuration resembling that seen previously with hypoxanthine (a substrate that is effectively hydroxylated at position 2). The ∼180° reorientation required to permit reaction is sterically prohibited, indicating that substrate (mis)orientation in the active site is a major factor precluding formation of the highly mutagenic 8-hydroxyguanine.

  1. Crystal structure of a chimera of human and Plasmodium falciparum hypoxanthine guanine phosphoribosyltransferases provides insights into oligomerization.


    Gayathri, P; Sujay Subbayya, I N; Ashok, Chethan S; Selvi, T Senthamizh; Balaram, Hemalatha; Murthy, M R N


    The crystal structure of a chimera of Plasmodium falciparum (Pf) and human hypoxanthine guanine phosphoribosyltransferases (HGPRT), which consists of the core of the protein from the human enzyme and the hood region from the Pf enzyme, has been determined as a complex with the product guanosine monophosphate (GMP). The chimera can utilize hypoxanthine, guanine, and xanthine as substrates, similar to the Pf enzyme. It exists as a monomer-dimer mixture in solution, but shifts to a tetramer on addition of phosphoribosyl pyrophosphate (PRPP). The structural studies reveal that the asymmetric unit of the crystal consists of two monomers of the chimeric HGPRT. Surprisingly, the dimer interface of the chimera is the less extensive AC interface of the parent HGPRTs. An analysis of the crystal structures of the various human HGPRTs provides an explanation for the oligomeric characteristics of the chimera. Pro93 and Tyr197 form part of crucial interactions holding together the AB interface in the unliganded or GMP-bound forms of HGPRT, while Pro93 and His26 interact at the interface after binding of PRPP. Replacement of Tyr197 of human HGPRT by Ile207 in the chimera disrupts the interaction at the AB interface in the absence of PRPP. In the presence of PRPP, the interaction between Pro93 and His26 could restore the AB interface, shifting the chimeric enzyme to a tetrameric state. The structure provides valuable insights into the differences in the AB interface between Pf and human HGPRTs, which may be useful for designing selective inhibitors against the parasite enzyme.

  2. Biochemical and genetic analysis of RNA cap guanine-N2 methyltransferases from Giardia lamblia and Schizosaccharomyces pombe.


    Hausmann, Stéphane; Ramirez, Alejandro; Schneider, Susanne; Schwer, Beate; Shuman, Stewart


    RNA cap guanine-N2 methyltransferases such as Schizosaccharomyces pombe Tgs1 and Giardia lamblia Tgs2 catalyze methylation of the exocyclic N2 amine of 7-methylguanosine. Here we performed a mutational analysis of Giardia Tgs2, entailing an alanine scan of 17 residues within the minimal active domain. Alanine substitutions at Phe18, Thr40, Asp76, Asn103 and Asp140 reduced methyltransferase specific activity to <3% of wild-type Tgs2, thereby defining these residues as essential. Alanines at Pro142, Tyr148 and Pro185 reduced activity to 7-12% of wild-type. Structure-activity relationships at Phe18, Thr40, Asp76, Asn103, Asp140 and Tyr148, and at three other essential residues defined previously (Asp68, Glu91 and Trp143) were gleaned by testing the effects of 18 conservative substitutions. Our results engender a provisional map of the Tgs2 active site, which we discuss in light of crystal structures of related methyltransferases. A genetic analysis of S. pombe Tgs1 showed that it is nonessential. An S. pombe tgs1Delta strain grows normally, notwithstanding the absence of 2,2,7-trimethylguanosine caps on its U1, U2, U4 and U5 snRNAs. However, we find that S. pombe requires cap guanine-N7 methylation catalyzed by the enzyme Pcm1. Deletion of the pcm1(+) gene was lethal, as were missense mutations in the Pcm1 active site. Thus, whereas m(7)G caps are essential in both S. pombe and S. cerevisiae, m(2,2,7)G caps are not.

  3. DNA damage by the sulfate radical anion: hydrogen abstraction from the sugar moiety versus one-electron oxidation of guanine.


    Roginskaya, Marina; Mohseni, Reza; Ampadu-Boateng, Derrick; Razskazovskiy, Yuriy


    The products of oxidative damage to double-stranded (ds) DNA initiated by photolytically generated sulfate radical anions SO4(•-) were analyzed using reverse-phase (RP) high-performance liquid chromatography (HPLC). Relative efficiencies of two major pathways were compared: production of 8-oxoguanine (8oxoG) and hydrogen abstraction from the DNA 2-deoxyribose moiety (dR) at C1,' C4,' and C5' positions. The formation of 8oxoG was found to account for 87% of all quantified lesions at low illumination doses. The concentration of 8oxoG quickly reaches a steady state at about one 8oxoG per 100 base pairs due to further oxidation of its products. It was found that another guanine oxidation product identified as 2-amino-5-(2'-alkylamino)-4H-imidazol-4-one (X) was released in significant quantities from its tentative precursor 2-amino-5-[(2'-deoxy-β-d-erythro-pentofuranosyl)amino]-4H-imidazol-4-one (dIz) upon treatment with primary amines in neutral solutions. The linear dose dependence of X release points to the formation of dIz directly from guanine and not through oxidation of 8oxoG. The damage to dR was found to account for about 13% of the total damage, with majority of lesions (33%) originating from the C4' oxidation. The contribution of C1' oxidation also turned out to be significant (17% of all dR damages) despite of the steric problems associated with the abstraction of the C1'-hydrogen. However, no evidence of base-to-sugar free valence transfer as a possible alternative to direct hydrogen abstraction at C1' was found.

  4. Guanine-nucleotide exchange on ribosome-bound elongation factor G initiates the translocation of tRNAs

    PubMed Central

    Zavialov, Andrey V; Hauryliuk, Vasili V; Ehrenberg, Måns


    Background During the translation of mRNA into polypeptide, elongation factor G (EF-G) catalyzes the translocation of peptidyl-tRNA from the A site to the P site of the ribosome. According to the 'classical' model, EF-G in the GTP-bound form promotes translocation, while hydrolysis of the bound GTP promotes dissociation of the factor from the post-translocation ribosome. According to a more recent model, EF-G operates like a 'motor protein' and drives translocation of the peptidyl-tRNA after GTP hydrolysis. In both the classical and motor protein models, GDP-to-GTP exchange is assumed to occur spontaneously on 'free' EF-G even in the absence of a guanine-nucleotide exchange factor (GEF). Results We have made a number of findings that challenge both models. First, free EF-G in the cell is likely to be in the GDP-bound form. Second, the ribosome acts as the GEF for EF-G. Third, after guanine-nucleotide exchange, EF-G in the GTP-bound form moves the tRNA2-mRNA complex to an intermediate translocation state in which the mRNA is partially translocated. Fourth, subsequent accommodation of the tRNA2-mRNA complex in the post-translocation state requires GTP hydrolysis. Conclusion These results, in conjunction with previously published cryo-electron microscopy reconstructions of the ribosome in various functional states, suggest a novel mechanism for translocation of tRNAs on the ribosome by EF-G. Our observations suggest that the ribosome is a universal guanosine-nucleotide exchange factor for EF-G as previously shown for the class-II peptide-release factor 3. PMID:15985150

  5. Protein Kinase A (PKA) Type I Interacts with P-Rex1, a Rac Guanine Nucleotide Exchange Factor

    PubMed Central

    Chávez-Vargas, Lydia; Adame-García, Sendi Rafael; Cervantes-Villagrana, Rodolfo Daniel; Castillo-Kauil, Alejandro; Bruystens, Jessica G. H.; Fukuhara, Shigetomo; Taylor, Susan S.; Mochizuki, Naoki; Reyes-Cruz, Guadalupe; Vázquez-Prado, José


    Morphology of migrating cells is regulated by Rho GTPases and fine-tuned by protein interactions and phosphorylation. PKA affects cell migration potentially through spatiotemporal interactions with regulators of Rho GTPases. Here we show that the endogenous regulatory (R) subunit of type I PKA interacts with P-Rex1, a Rac guanine nucleotide exchange factor that integrates chemotactic signals. Type I PKA holoenzyme interacts with P-Rex1 PDZ domains via the CNB B domain of RIα, which when expressed by itself facilitates endothelial cell migration. P-Rex1 activation localizes PKA to the cell periphery, whereas stimulation of PKA phosphorylates P-Rex1 and prevents its activation in cells responding to SDF-1 (stromal cell-derived factor 1). The P-Rex1 DEP1 domain is phosphorylated at Ser-436, which inhibits the DH-PH catalytic cassette by direct interaction. In addition, the P-Rex1 C terminus is indirectly targeted by PKA, promoting inhibitory interactions independently of the DEP1-PDZ2 region. A P-Rex1 S436A mutant construct shows increased RacGEF activity and prevents the inhibitory effect of forskolin on sphingosine 1-phosphate-dependent endothelial cell migration. Altogether, these results support the idea that P-Rex1 contributes to the spatiotemporal localization of type I PKA, which tightly regulates this guanine exchange factor by a multistep mechanism, initiated by interaction with the PDZ domains of P-Rex1 followed by direct phosphorylation at the first DEP domain and putatively indirect regulation of the C terminus, thus promoting inhibitory intramolecular interactions. This reciprocal regulation between PKA and P-Rex1 might represent a key node of integration by which chemotactic signaling is fine-tuned by PKA. PMID:26797121

  6. 32P-post-labelling of 7-(3-chloro-2-hydroxypropyl)guanine in white blood cells of workers occupationally exposed to epichlorohydrin.


    Plna, K; Osterman-Golkar, S; Nogradi, E; Segerbäck, D


    Epichlorohydrin (ECH) is a simple 3-carbon epoxide of industrial importance. It has been shown to be genotoxic in several systems and carcinogenic in experimental animals. The aim of the present investigation was to study DNA adducts of ECH as a biomarker of occupational exposure to this chemical. 7-(3-Chloro-2-hydroxypropyl)guanine (7-CHP-guanine) was analysed in DNA from white blood cells using an anion exchange-based adduct enrichment protocol of the (32)P-post-labelling/HPLC-based assay. Blood samples were collected from seven workers handling ECH (exposed), nine workers not handling ECH but normally present in the premises where this chemical is used (potentially exposed) and 13 office and factory workers from locations in the plant where ECH is not handled (controls). 7-CHP-guanine was detected in five of the seven workers exposed to ECH (1.6-7.1 mol/10(9) mol nucleotides) and in two of the nine workers potentially exposed to ECH (0.8-1.5 mol/10(9) mol nucleotides). This adduct was not detected in any of the 13 controls. The difference in adduct levels between exposed workers and controls was statistically significant (Mann-Whitney test, P < 0.001), as was the difference between exposed workers and potentially exposed workers (P = 0.017). The recovery of 7-CHP-guanine in the (32)P-post-labelling assay was on average 48 +/- 7%, which is considerably higher than previously reported for other 7-alkylguanines. The method used had a limit of detection of approximately 0.4 mol adduct/10(9) mol nucleotides using 20 microg DNA. This study shows for the first time ECH-induced DNA adducts in humans and suggests that 7-CHP-guanine may be used as a biomarker of occupational exposure to ECH.

  7. Intrastrand G-U cross-links generated by the oxidation of guanine in 5'-d(GCU) and 5'-r(GCU).


    Crean, Conor; Geacintov, Nicholas E; Shafirovich, Vladimir


    It has been suggested that carbonate radical anions are biologically important because they may be produced during the inflammatory response. The carbonate radicals can selectively oxidize guanine in DNA and RNA by one-electron transfer mechanisms and the guanine radicals thus formed decay by diverse competing pathways with other free radicals or nucleophiles. Using a photochemical method to generate CO(3)(-) radicals in vitro, we compare the distributions of products initiated by the one-electron oxidation of guanine in the trinucleotides 5'-r(GpCpU) and 5'-d(GpCpU) in aqueous buffer solutions (pH 7.5). Similar distributions of stable end products identified by LC-MS/MS methods were found in both cases. The guanine oxidation products include the diastereomeric pair of spiroiminodihydantoin (Sp) and 2,5-diamino-4H-imidazolone (Iz). In addition, intrastrand cross-linked products involving covalent bonds between the G and the U bases (GCU) were also found, although with different relative yields in the 2'-deoxy- and the ribotrinucleotides. The positive-ion MS/MS spectra of the 5'-r(GpCpU) and 5'-d(GpCpU) products clearly indicate the presence of covalently linked G-U products that have a mass smaller by 2 Da than the sum of the G and U bases in both types of trinucleotides. The 5'-d(GCU) cross-linked product was further characterized by 1D and 2D NMR methods that confirm its cyclic structure in which the guanine C8 atom is covalently linked to the uracil N3 atom.

  8. New Dihydro OO'Bis(Salicylidene) 2,2' Aminobenzothiazolyl Borate Complexes: Kinetic and Voltammetric Studies of Dimethyltin Copper Complex with Guanine, Adenine, and Calf Thymus DNA.


    Arjmand, Farukh; Mohani, Bhawana; Parveen, Shamima


    The newly synthesized ligand, dihydro OO'bis(salicylidene) 2,2' aminobenzothiazolyl borate (2), was derived from the reaction of Schiff base of 2-aminobenzothiazole and salicylaldehyde with KBH(4). Cu(II) (3) and Zn(II) (4) complexes of (2) were synthesized and further metallated with dimethyltindichloride to yield heterobimetallic complexes (5) and (6). All complexes have been thoroughly characterized by elemental analysis, and IR, NMR, EPR, and UV-Vis spectroscopy and conductance measurements. The spectroscopic data support square planar environment around the Cu(II) atom, while the Sn(IV) atom acquires pentacoordinate geometry. The interaction of complex (5) with guanine, adenine, and calf thymus DNA was studied by spectrophotometric, electrochemical, and kinetic methods. The absorption spectra of complex (5) exhibit a remarkable "hyperchromic effect" in the presence of guanine and calf thymus DNA. Indicative of strong binding of the complex to calf thymus DNA preferentially binds through N(7) position of guanine base, while the adenine shows binding to a lesser extent. The kinetic data were obtained from the rate constants, k(obs), values under pseudo-first-order conditions. Cyclic voltammetry was employed to study the interaction of complex (5) with guanine, adenine, and calf thymus DNA. The CV of complex (5) in the absence and in the presence of guanine and calf thymus DNA altered drastically, with a positive shift in formal peak potential E(pa) and E(pc) values and a significant increase in peak current. The positive shift in formal potentials with increase in peak current favours strong interaction of complex (5) with calf thymus DNA. The net shift in E(1/2) has been used to estimate the ratio of equilibrium constants for the binding of Cu(II) and Cu(I) complexes to calf thymus DNA.

  9. New Dihydro OO′Bis(Salicylidene) 2,2′ Aminobenzothiazolyl Borate Complexes: Kinetic and Voltammetric Studies of Dimethyltin Copper Complex with Guanine, Adenine, and Calf Thymus DNA

    PubMed Central

    Arjmand, Farukh; Mohani, Bhawana; Parveen, Shamima


    The newly synthesized ligand, dihydro OO′bis(salicylidene) 2,2′ aminobenzothiazolyl borate (2), was derived from the reaction of Schiff base of 2-aminobenzothiazole and salicylaldehyde with KBH4. CuII (3) and ZnII (4) complexes of (2) were synthesized and further metallated with dimethyltindichloride to yield heterobimetallic complexes (5) and (6). All complexes have been thoroughly characterized by elemental analysis, and IR, NMR, EPR, and UV-Vis spectroscopy and conductance measurements. The spectroscopic data support square planar environment around the CuII atom, while the SnIV atom acquires pentacoordinate geometry. The interaction of complex (5) with guanine, adenine, and calf thymus DNA was studied by spectrophotometric, electrochemical, and kinetic methods. The absorption spectra of complex (5) exhibit a remarkable “hyperchromic effect” in the presence of guanine and calf thymus DNA. Indicative of strong binding of the complex to calf thymus DNA preferentially binds through N7 position of guanine base, while the adenine shows binding to a lesser extent. The kinetic data were obtained from the rate constants, kobs, values under pseudo-first-order conditions. Cyclic voltammetry was employed to study the interaction of complex (5) with guanine, adenine, and calf thymus DNA. The CV of complex (5) in the absence and in the presence of guanine and calf thymus DNA altered drastically, with a positive shift in formal peak potential Epa and Epc values and a significant increase in peak current. The positive shift in formal potentials with increase in peak current favours strong interaction of complex (5) with calf thymus DNA. The net shift in E 1/2 has been used to estimate the ratio of equilibrium constants for the binding of Cu(II) and Cu(I) complexes to calf thymus DNA. PMID:17497007

  10. Performance characteristics of guanine incorporated PVDF-HFP/PEO polymer blend electrolytes with binary iodide salts for dye-sensitized solar cells

    NASA Astrophysics Data System (ADS)

    Senthil, R. A.; Theerthagiri, J.; Madhavan, J.; Arof, A. K.


    In this work, we have investigated the influence of guanine as an organic dopant in dye-sensitized solar cell (DSSC) based on poly(vinylidinefluoride-co-hexafluoropropylene) (PVDF-HFP)/polyethylene oxide (PEO) polymer blend electrolyte along with binary iodide salts (potassium iodide (KI) and tetrabutylammonium iodide (TBAI)) and iodine (I2). The PVDF-HFP/KI + TBAI/I2, PVDF-HFP/PEO/KI + TBAI/I2 and guanine incorporated PVDF-HFP/PEO/KI + TBAI/I2 electrolytes were prepared by solution casting technique using DMF as solvent. The PVDF-HFP/KI + TBAI/I2 electrolyte showed an ionic conductivity value of 9.99 × 10-5 Scm-1, whereas, it was found to be increased to 4.53 × 10-5 Scm-1 when PEO was blended with PVDF-HFP/KI + TBAI/I2 electrolyte. However, a maximum ionic conductivity value of 3.67 × 10-4 Scm-1 was obtained for guanine incorporated PVDF-HFP/PEO/KI + TBAI/I2 blend electrolyte. The photovoltaic properties of all these polymer electrolytes in DSSCs were characterized. As a consequence, the power conversion efficiency of the guanine incorporated PVDF-HFP/PEO/KI + TBAI/I2 electrolyte based DSSC was significantly improved to 4.98% compared with PVDF-HFP/PEO/KI + TBAI/I2 electrolyte based DSSC (2.46%). These results revealed that the guanine can be an effective organic dopant to enhance the performance of DSSCs.

  11. G-quadruplexes with (4n - 1) guanines in the G-tetrad core: formation of a G-triad·water complex and implication for small-molecule binding

    PubMed Central

    Heddi, Brahim; Martín-Pintado, Nerea; Serimbetov, Zhalgas; Kari, Teuku Mahfuzh Aufar; Phan, Anh Tuân


    G-quadruplexes are non-canonical structures of nucleic acids, in which guanine bases form planar G-tetrads (G·G·G·G) that stack on each other in the core of the structure. G-quadruplexes generally contain multiple times of four (4n) guanines in the core. Here, we study the structure of G-quadruplexes with only (4n - 1) guanines in the core. The solution structure of a DNA sequence containing 11 guanines showed the formation of a parallel G-quadruplex involving two G-tetrads and one G-triad with a vacant site. Molecular dynamics simulation established the formation of a stable G-triad·water complex, where water molecules mimic the position of the missing guanine in the vacant site. The concept of forming G-quadruplexes with missing guanines in the core broadens the current definition of G-quadruplex-forming sequences. The potential ability of such structures to bind different metabolites, including guanine, guanosine and GTP, in the vacant site, could have biological implications in regulatory functions. Formation of this unique binding pocket in the G-triad could be used as a specific target in drug design. PMID:26673723

  12. Detection of C8-(1-hydroxyethyl)guanine in liver RNA and DNA from control and ethanol-treated rats.


    Nakao, Lia S; Fonseca, Elaine; Augusto, Ohara


    Alcohol consumption is associated with an increased risk of cancer by mechanisms that remain unknown but have been suggested to involve radical metabolites. We have previously shown that the 1-hydroxyethyl radical produced from ethanol oxidation in vitro is able to alkylate nucleic acids to produce C8-(1-hydroxyethyl)guanine [C8-(1-HE)gua] among other products. To assess if this adduct is produced in vivo, we developed a sensitive HPLC-MS/MS method for its detection and analyzed hydrolysates of liver RNA and DNA from control and ethanol-treated rats. Unexpectedly, C8-(1-HE)gua was found to be present in both RNA and DNA from the liver of control Sprague-Dawley rats, and its levels increased slightly, but not significantly, after an acute ethanol dose (5 g/kg). In rat liver, C8-(1-HE)gua endogenous levels were about 10 times higher in RNA (35 +/- 5/10(7) guanine) than DNA (3.7 +/- 1.1/10(7) guanine). These levels were also found in commercial RNA (calf liver and yeast) and DNA (calf thymus), further indicating the endogenous source of the adduct. DNA basal levels of C8-(1-HE)gua were similar to those reported for other 2C guanine adducts such as N7-(2-hydroxyethyl)guanine and N2-ethyl-2'-deoxyguanosine. We speculate that all of these adducts may be generated from DNA attack by products of basal lipid peroxidation. The higher RNA levels of C8-(1-HE)gua are in agreement with the higher accessibility of RNA and nucleotides to reactive intermediates because they are not as protected or as localized as DNA. Chemical modification of RNA has been receiving increasingly attention as an important event in genotoxic mechanisms. Comparison of RNA basal levels of C8-(1-HE)gua, N7-(2-hydroxyethyl)guanine, and N2-ethyl-2'-deoxyguanosine may provide clues about their endogenous sources and biological significance. Yet, the marginal increase of DNA C8-(1-HE)gua upon ethanol administration argues against this adduct playing a major role in the carcinogenic effects of ethanol.

  13. DNA sequence context as a determinant of the quantity and chemistry of guanine oxidation produced by hydroxyl radicals and one-electron oxidants.


    Margolin, Yelena; Shafirovich, Vladimir; Geacintov, Nicholas E; DeMott, Michael S; Dedon, Peter C


    DNA sequence context has emerged as a critical determinant of the location and quantity of nucleobase damage caused by many oxidizing agents. However, the complexity of nucleobase and 2-deoxyribose damage caused by strong oxidants such as ionizing radiation and the Fenton chemistry of Fe2+-EDTA/H2O2 poses a challenge to defining the location of nucleobase damage and the effects of sequence context on damage chemistry in DNA. To address this problem, we developed a gel-based method that allows quantification of nucleobase damage in oxidized DNA by exploiting Escherichia coli exonuclease III to remove fragments containing direct strand breaks and abasic sites. The rigor of the method was verified in studies of guanine oxidation by photooxidized riboflavin and nitrosoperoxycarbonate, for which different effects of sequence context have been demonstrated by other approaches (Margolin, Y., Cloutier, J. F., Shafirovich, V., Geacintov, N. E., and Dedon, P. C. (2006) Nat. Chem. Biol. 2, 365-366). Using duplex oligodeoxynucleotides containing all possible three-nucleotide sequence contexts for guanine, the method was used to assess the role of DNA sequence context in hydroxyl radical-induced guanine oxidation associated with gamma-radiation and Fe2+-EDTA/H2O2. The results revealed both differences and similarities for G oxidation by hydroxyl radicals and by one-electron oxidation by riboflavin-mediated photooxidation, which is consistent with the predominance of oxidation pathways for hydroxyl radicals other than one-electron oxidation to form guanine radical cations. Although the relative quantities of G oxidation produced by hydroxyl radicals were more weakly correlated with sequence-specific ionization potential than G oxidation produced by riboflavin, damage produced by both hydroxyl radical generators and riboflavin within two- and three-base runs of G showed biases in location that are consistent with a role for electron transfer in defining the location of the damage

  14. Structural basis for the inhibitory effect of brefeldin A on guanine nucleotide-exchange proteins for ADP-ribosylation factors

    PubMed Central

    Sata, Makoto; Moss, Joel; Vaughan, Martha


    Protein secretion through the endoplasmic reticulum and Golgi vesicular trafficking system is initiated by the binding of ADP-ribosylation factors (ARFs) to donor membranes, leading to recruitment of coatomer, bud formation, and eventual vesicle release. ARFs are ≈20-kDa GTPases that are active with bound GTP and inactive with GDP bound. Conversion of ARF-GDP to ARF-GTP is regulated by guanine nucleotide-exchange proteins. All known ARF guanine nucleotide-exchange proteins contain a Sec7 domain of ≈200 amino acids that includes the active site and fall into two classes that differ in molecular size and susceptibility to inhibition by the fungal metabolite brefeldin A (BFA). To determine the structural basis of BFA sensitivity, chimeric molecules were constructed by using sequences from the Sec7 domains of BFA-sensitive yeast Sec7 protein (ySec7d) and the insensitive human cytohesin-1 (C-1Sec7). Based on BFA inhibition of the activities of these molecules with recombinant yeast ARF2 as substrate, the Asp965–Met975 sequence in ySec7d was shown to be responsible for BFA sensitivity. A C-1Sec7 mutant in which Ser199, Asn204, and Pro209 were replaced with the corresponding ySec7d amino acids, Asp965, Gln970, and Met975, exhibited BFA sensitivity similar to that of recombinant ySec7d (rySec7d). Single replacement in C-1Sec7 of Ser199 or Pro209 resulted in partial inhibition by BFA, whereas replacement of Gln970 in ySec7d with Asn (as found in C-1Sec7) had no effect. As predicted, the double C-1Sec7 mutant with S199D and P209M was BFA-sensitive, demonstrating that Asp965 and Met975 in ySec7d are major molecular determinants of BFA sensitivity. PMID:10077583

  15. Time-resolved probes based on guanine/thymine-rich DNA-sensitized luminescence of terbium(III).


    Zhang, Min; Le, Huynh-Nhu; Jiang, Xiao-Qin; Yin, Bin-Cheng; Ye, Bang-Ce


    In this study, we have developed a novel strategy to highly sensitize the luminescence of terbium(III) (Tb(3+)) using a designed guanine/thymine-rich DNA (5'-[G3T]5-3') as an antenna ligand, in which [G3T]5 improved the luminescence of Tb(3+) by 3 orders of magnitude due to energy transfer from nucleic acids to Tb(3+) (i.e., antenna effect). Furthermore, label-free probes for the luminescent detection of biothiols, Ag(+), and sequence-specific DNA in an inexpensive, simple, and mix-and-read format are presented based on the [G3T]5-sensitized luminescence of Tb(3+) (GTSLT). The long luminescence lifetime of the probes readily enables time-resolved luminescence (TRL) experiments. Hg(2+) can efficiently quench the luminescence of Tb(3+) sensitized by [G3T]5 (Tb(3+)/[G3T]5); however, biothiols are readily applicable to selectively grab Hg(2+) for restoration of the luminescence of Tb(3+)/[G3T]5 initially quenched by Hg(2+), which can be used for "turn on" detection of biothiols. With the use of cytosine (C)-rich oligonucleotide c[G3T]5 complementary to [G3T]5, the formed [G3T]5/c[G3T]5 duplex cannot sensitize the luminescence of Tb(3+). However, in the presence of Ag(+), Ag(+) can combine the C base of c[G3T]5 to form C-Ag(+)-C complexes, leading to the split of the [G3T]5/c[G3T]5 duplex and then release of [G3T]5. The released [G3T]5 acts as an antenna ligand for sensitizing the luminescence of Tb(3+). Therefore, the Tb(3+)/[G3T]5/c[G3T]5 probe can be applied to detect Ag(+) in a "turn on" format. Moreover, recognition of target DNA via hybridization to a molecular beacon (MB)-like probe (MB-[G3T]5) can unfold the MB-[G3T]5 to release the [G3T]5 for sensitizing the luminescence of Tb(3+), producing a detectable signal directly proportional to the amount of target DNA of interest. This allows the development of a fascinating label-free MB probe for DNA sensing based on the luminescence of Tb(3+). Results and methods reported here suggest that a guanine/thymine-rich DNA

  16. Exploring non-covalent interactions in guanine- and xanthine-based model DNA quadruplex structures: a comprehensive quantum chemical approach.


    Yurenko, Yevgen P; Novotný, Jan; Sklenář, Vladimir; Marek, Radek


    The study aimed to cast light on the structure and internal energetics of guanine- and xanthine-based model DNA quadruplexes and the physico-chemical nature of the non-covalent interactions involved. Several independent approaches were used for this purpose: DFT-D3 calculations, Quantum Theory of Atoms in Molecules, Natural Bond Orbital Analysis, Energy Decomposition Analysis, Compliance Constant Theory, and Non-Covalent Interaction Analysis. The results point to an excellent degree of structural and energetic compatibility between the two types of model quadruplexes. This fact stems from both the structural features (close values of van der Waals volumes, pore radii, geometrical parameters of the H-bonds) and the energetic characteristics (comparable values of the energies of formation). It was established that hydrogen bonding makes the greatest (∼50%) contribution to the internal stability of the DNA quadruplexes, whereas the aromatic base stacking and ion coordination terms are commensurable and account for the rest. Energy decomposition analysis performed for guanine (Gua) and xanthine (Xan) quartets B4 and higher-order structures consisting of two or three stacked quartets indicates that whereas Gua structures benefit from a high degree of H-bond cooperativity, Xan models are characterized by a more favorable and cooperative π-π stacking. The results of electron density topological analysis show that Na(+)/K(+) ion coordination deeply affects the network of non-covalent interactions in Gua models due to the change in the twist angle between the stacked tetrads. For Xan models, ion coordination makes tetrads in stacks more planar without changing the twist angle. Therefore, the presence of the ion seems to be essential for the formation of planar stacks in Xan-based DNA quadruplexes. Detailed study of the nature of ion-base coordination suggests that this interaction has a partially covalent character and cannot be considered as purely electrostatic

  17. Targeted guanine oxidation by a dinuclear copper(II) complex at single stranded/double stranded DNA junctions.


    Li, Lei; Murthy, Narasimha N; Telser, Joshua; Zakharov, Lev N; Yap, Glenn P A; Rheingold, Arnold L; Karlin, Kenneth D; Rokita, Steven E


    A dinuclear copper(II) complex [Cu(II)2(PD'O-)(H2O)2](ClO4)3 (5) with terminal Cu(II)-H(2)O moieties and a Cu...Cu distance of 4.13 A (X-ray structure) has been synthesized and characterized by EPR spectroscopy (ferromagnetic coupling observed) and cyclic voltammetry. Dizinc(II) and mononuclear copper(II) analogues [Zn(II)2(PD'O-)(H2O)2]3+ (7) and [Cu(II)(mPD'OH)(H2O)]2+ (6), respectively, have also been synthesized and structurally characterized. Reacting 5/MPA/O(2) (MPA = 3-mercaptopropionic acid) with DNA leads to a highly specific oxidation of guanine (G) at a junction between single- and double-stranded DNA. Mass spectrometric analysis of the major products indicates a gain of +18 and +34 amu relative to initial DNA strands. The most efficient reaction requires G at the first and second unpaired positions of each strand extending from the junction. Less reaction is observed for analogous targets in which the G cluster is farther from the junction or contains less than four Gs. Consistent with our previous systems, the multinuclear copper center is required for selective reaction; mononuclear complex 6 is not effective. Hydrogen peroxide as a substitute for MPA/O2 also does not lead to activity. Structural analysis of a [Cu(II)2(PD'O-)(G)]3+ complex (8) and dizinc analogue [Zn(II)(2)(PD'O-)(G)](ClO4)3 (9) (G = guanosine) reveals coordination of the G O6 and N7 atoms with the two copper (or zinc) centers and suggests that copper-G coordination likely plays a role in recognition of the DNA target. The Cu2-O2 intermediate responsible for guanine oxidation appears to be different from that responsible for direct-strand scission induced by other multinuclear copper complexes; the likely course of reaction is discussed.

  18. Competition between glutathione and guanine for a ruthenium(II) arene anticancer complex: detection of a sulfenato intermediate.


    Wang, Fuyi; Xu, Jingjing; Habtemariam, Abraha; Bella, Juraj; Sadler, Peter J


    The organometallic anticancer complex [(eta6-bip)Ru(en)Cl]+ (1; bip = biphenyl, en = ethylenediamine) selectively binds to guanine (N7) bases of DNA (Novakova, O.; Chen, H.; Vrana, O.; Rodger, A.; Sadler, P. J.; Brabec, V. Biochemistry 2003, 42, 11544-11554). In this work, competition between the tripeptide glutathione (gamma-L-Glu-L-Cys-Gly; GSH) and guanine (as guanosine 3',5'-cyclic monophosphate, cGMP) for complex 1 was investigated using HPLC, LC-MS and 1H,15N NMR spectroscopy. In unbuffered solution (pH ca. 3), the reaction of 1 with GSH gave rise to three intermediates: an S-bound thiolato adduct [(eta6-bip)Ru(en)(GS-S)] (4) and two carboxylate-bound glutathione products [(eta6-bip)Ru(en)(GSH-O)]+ (5, 6) during the early stages (<6 h), followed by en displacement and formation of a tri-GS-bridged dinuclear Ru(II) complex [((eta6-bip)Ru)2(GS-mu-S)3]2- (7). Under physiologically relevant conditions (micromolar Ru concentrations, pH 7, 22 mM NaCl, 310 K), the thiolato complex 4 was unexpectedly readily oxidized by dioxygen to the sulfenato complex [(eta6-bip)Ru(en)(GS(O)-S)] (8) instead of forming the dinuclear complex 7. Under these conditions, competitive reaction of complex 1 with GSH and cGMP gave rise to the cGMP adduct [(eta6-bip)Ru(en)(cGMP-N7)]+ (10) as the major product, accounting for ca. 62% of total Ru after 72 h, even in the presence of a 250-fold molar excess of GSH. The oxidation of coordinated glutathione in the thiolato complex 4 to the sulfenate in 8 appears to provide a facile route for displacement of S-bound glutathione by G N7. Redox reactions of cysteinyl adducts of these Ru(II) arene anticancer complexes could therefore play a significant role in their biological activity.

  19. Mutated D4-guanine diphosphate-dissociation inhibitor is found in human leukemic cells and promotes leukemic cell invasion.


    Nakata, Yuji; Kondoh, Kensuke; Fukushima, Sachiko; Hashiguchi, Akinori; Du, Wenlin; Hayashi, Mutsumi; Fujimoto, Jun-ichiroh; Hata, Jun-ichi; Yamada, Taketo


    Rho GTPase may be involved in human cancer invasion via the augmentation of cell motility and adhesion. We report on two point mutations of the D4-guanine diphosphate (GDP)-dissociation inhibitor (GDI) gene, one of the Rho-GDIs, which were found in a human leukemic cell line, Reh, and the mutated D4-GDI functions as an accelerator of leukemic cell invasion. We investigated the altered activity of GDP dissociation by mutated (mt) D4-GDI and the functions of this mt and wild-type (wt) D4-GDI in invasion. The mice inoculated with wt or mt D4-GDI vector-transfected Raji cells were observed and examined pathologically. Adhesiveness and cell motility of wt or mt D4-GDI vector-transfected Raji cells were examined. Finally, it was examined whether Rho activation was changed by mutation of D4-GDI under the condition of Rho-GDI knockdown. Two point mutations of the D4-GDI gene were found in Reh cells. The region of mutations is conserved among members of the Rho-GDI family at the amino acid level. D4-GDI with two mutations (V68L and V69A) functioned in a dominant negative manner in the inhibition of GDP dissociation from Rho. Severe combined immune-deficient mice inoculated with Raji cells developed hemiparalysis. The Raji cells were present in bone marrow and peripheral blood, and hepatic invasion was observed in 20% of the mice. Mice inoculated with wt D4-GDI vector-transfected Raji cells (wt D4) showed later paralysis and none developed hepatic invasion. Mice inoculated with mt D4-GDI-transfected Raji cells (mt D4) showed a 5-day reduction in the time to paraplegia and death. In addition, hepatic invasion was evident in 80% of mice transplanted with mt D4 cells. There were no differences in growth rates and amounts of guanine triphosphate (GTP)-bound Rho, cdc42, or Rac among all clones, however, GTP-bound Rho in mt D4 clone with short hairpin RNA (shRNA) vector for Rho-GDI knockdown was increased compared with wt D4 clone with shRNA vector for Rho-GDI knockdown. The mt D4

  20. DNA Lesions Caused by ROS and RNOS: A Review of Interactions and Reactions Involving Guanine

    NASA Astrophysics Data System (ADS)

    Shukla, P. K.; Mishra, P. C.

    DNA is constantly attacked by a large number of endogenous and exogenous reactive oxygen species (ROS), reactive nitrogen oxide species (RNOS), and alkylating agents which produce a wide variety of modifications of its constituents, particularly the bases. Some of these modifications (lesions) are hazardous to normal cell functioning, and are implicated in several lethal conditions including chronic inflammatory diseases, atherosclerosis, aging, mutation, cancer, and neurodegenerative disorders, such as the Alzheimer's and Parkinson's diseases.

  1. VUV and mid-UV photoabsorption cross sections of thin films of guanine and uracil: application on their photochemistry in the solar system.


    Saïagh, Kafila; Cottin, Hervé; Aleian, Aicha; Fray, Nicolas


    We present a photostability study of two nucleobases, guanine and uracil. For the first time, the photoabsorption cross-section spectra of these molecules in the solid phase were measured in the VUV and mid-UV domain (115≤λ≤300 nm). They show a quite similar absorption level throughout this wavelength range, highlighting the importance of considering the whole VUV and UV domain during photolysis experiments in the laboratory. Their photolysis constant (J) can be estimated from those measurements as follows: 2.2×10(-2) s(-1)±11% for guanine and 5.3×10(-2) s(-1)±14% for uracil. This work shows that (i) measuring kinetic constants from a direct and "traditional" photolysis of a thin sample in the laboratory suffers strong limitations and (ii) achieving this measurement requires comprehensive modeling of the radiative transfer that occurs in any sample not optically thin (i.e.,≤2 nm). Moreover, this work has provided other data of interest: the refractive index of solid guanine and of uracil at 650 nm are 1.52 (±0.01) and 1.39 (±0.02), respectively, and the integrated IR band strengths (A) of solid guanine between 3700 and 2120 cm(-1) (3.4×10(-16) cm·molecule(-1)±13%) and of solid uracil between 3400 and 1890 cm(-1) (2.1×10(-16) cm·molecule(-1)±21%).

  2. Expanding functions of GIT Arf GTPase-activating proteins, PIX Rho guanine nucleotide exchange factors and GIT-PIX complexes.


    Zhou, Wu; Li, Xiaobo; Premont, Richard T


    The GIT proteins, GIT1 and GIT2, are GTPase-activating proteins (inactivators) for the ADP-ribosylation factor (Arf) small GTP-binding proteins, and function to limit the activity of Arf proteins. The PIX proteins, α-PIX and β-PIX (also known as ARHGEF6 and ARHGEF7, respectively), are guanine nucleotide exchange factors (activators) for the Rho family small GTP-binding protein family members Rac1 and Cdc42. Through their multi-domain structures, GIT and PIX proteins can also function as signaling scaffolds by binding to numerous protein partners. Importantly, the constitutive association of GIT and PIX proteins into oligomeric GIT-PIX complexes allows these two proteins to function together as subunits of a larger structure that coordinates two distinct small GTP-binding protein pathways and serves as multivalent scaffold for the partners of both constituent subunits. Studies have revealed the involvement of GIT and PIX proteins, and of the GIT-PIX complex, in numerous fundamental cellular processes through a wide variety of mechanisms, pathways and signaling partners. In this Commentary, we discuss recent findings in key physiological systems that exemplify current understanding of the function of this important regulatory complex. Further, we draw attention to gaps in crucial information that remain to be filled to allow a better understanding of the many roles of the GIT-PIX complex in health and disease. © 2016. Published by The Company of Biologists Ltd.

  3. Myosin II directly binds and inhibits Dbl family guanine nucleotide exchange factors: a possible link to Rho family GTPases

    PubMed Central

    Lee, Chan-Soo; Choi, Chang-Ki; Schwartz, Martin Alexander


    Cell migration requires the coordinated spatiotemporal regulation of actomyosin contraction and cell protrusion/adhesion. Nonmuscle myosin II (MII) controls Rac1 and Cdc42 activation, and cell protrusion and focal complex formation in migrating cells. However, these mechanisms are poorly understood. Here, we show that MII interacts specifically with multiple Dbl family guanine nucleotide exchange factors (GEFs). Binding is mediated by the conserved tandem Dbl homology–pleckstrin homology module, the catalytic site of these GEFs, with dissociation constants of ∼0.3 µM. Binding to the GEFs required assembly of the MII into filaments and actin-stimulated ATPase activity. Binding of MII suppressed GEF activity. Accordingly, inhibition of MII ATPase activity caused release of GEFs and activation of Rho GTPases. Depletion of βPIX GEF in migrating NIH3T3 fibroblasts suppressed lamellipodial protrusions and focal complex formation induced by MII inhibition. The results elucidate a functional link between MII and Rac1/Cdc42 GTPases, which may regulate protrusion/adhesion dynamics in migrating cells. PMID:20713598

  4. Comparative analysis of urinary N7-(2-hydroxyethyl)guanine for ethylene oxide- and non-exposed workers.


    Huang, Chih-Chun Jean; Wu, Chia-Fang; Shih, Wei-Chung; Chen, Ming-Feng; Chen, Chang-Yuh; Chien, Yeh-Chung; Liou, Saou-Hsing; Chiang, Su-Yin; Wu, Kuen-Yuh


    Ethylene oxide (EO), a direct alkylating agent and a carcinogen, can attack the nucleophilic sites of DNA bases to form a variety of DNA adducts. The most abundant adduct, N7-(2-hydroxyethyl)guanine (N7-HEG), can be depurinated spontaneously or enzymatically from DNA backbone to form abasic sites. Molecular dosimetry of the excised N7-HEG in urine can serve as an EO exposure and potential risk-associated biomarker. This study was to analyze N7-HEG in urine collected from 89 EO-exposed and 48 nonexposed hospital workers and 20 exposed and 10 nonexposed factory workers by using our newly developed on-line solid-phase extraction isotope-dilution LC-MS/MS method. Statistical analysis of data shows that the exposed factory workers excreted significantly greater concentrations of N7-HEG than both the nonexposed factory workers and hospital workers. Multiple linear regression analysis reveals that the EO-exposed factory workers had a significantly greater post-shift urinary N7-HEG than their nonexposed coworkers and hospital workers. These results demonstrate that analysis of urinary N7-HEG can serve as a biomarker of EO exposure for future molecular epidemiology studies to better understand the role of the EO-induced DNA adduct formation in EO carcinogenicity and certainly for routine surveillance of occupational EO exposure for the study of potential health impacts on workers. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  5. Ligand-mediated and tertiary interactions cooperatively stabilize the P1 region in the guanine-sensing riboswitch

    PubMed Central

    Hanke, Christian A.


    Riboswitches are genetic regulatory elements that control gene expression depending on ligand binding. The guanine-sensing riboswitch (Gsw) binds ligands at a three-way junction formed by paired regions P1, P2, and P3. Loops L2 and L3 cap the P2 and P3 helices and form tertiary interactions. Part of P1 belongs to the switching sequence dictating the fate of the mRNA. Previous studies revealed an intricate relationship between ligand binding and presence of the tertiary interactions, and between ligand binding and influence on the P1 region. However, no information is available on the interplay among these three main regions in Gsw. Here we show that stabilization of the L2-L3 region by tertiary interactions, and the ligand binding site by ligand binding, cooperatively influences the structural stability of terminal base pairs in the P1 region in the presence of Mg2+ ions. The results are based on molecular dynamics simulations with an aggregate simulation time of ~10 μs across multiple systems of the unbound state of the Gsw aptamer and a G37A/C61U mutant, and rigidity analyses. The results could explain why the three-way junction is a central structural element also in other riboswitches and how the cooperative effect could become contextual with respect to intracellular Mg2+ concentration. The results suggest that the transmission of allosteric information to P1 can be entropy-dominated. PMID:28640851

  6. Assay of Rab17 and its guanine nucleotide exchange factor Rabex-5 in the dendrites of hippocampal neurons.


    Mori, Yasunori; Fukuda, Mitsunori


    Neurons are functionally and morphologically compartmentalized into axons and dendrites, and the localization of specific proteins within these compartments is critical to the proper formation of neuronal networks, which includes neurite morphogenesis and synapse formation. The small GTPase Rab17 is specifically localized in dendrites and is not found in axons, and it regulates the dendrite morphogenesis and postsynaptic development of mouse hippocampal neurons. However, the spatiotemporal regulation of Rab17 is poorly understood. We recently identified Rabex-5, originally described as a Rab5-guanine nucleotide exchange factor (GEF), as a physiological Rab17-GEF that promotes translocation of Rab17 from the cell body to the dendrites of developing hippocampal neurons. Knockdown of Rab17 in mouse hippocampal neurons resulted in reductions in dendrite growth, branch numbers, filopodium density, and active synapse numbers. Knockdown of Rab17-GEF Rabex-5 in hippocampal neurons resulted in decreased targeting of Rab17 to the dendrites, which led to a reduction in dendrite growth. In this chapter we describe the assay procedures for analyzing Rab17 and Rabex-5 in cultured mouse hippocampal neurons, and we particularly focus on the measurement of total dendrite (or axon) length and total dendrite (or axon) branch numbers, filopodium density, number of active synapses, and dendritic Rab17 signals.

  7. Molecular nature of spontaneous mutations at the hypoxanthine-guanine phosphoribosyltransferase (hprt) locus in Chinese hamster ovary cells.


    Xu, Z; Yu, Y; Schwartz, J L; Meltz, M L; Hsie, A W


    The hypoxanthine-guanine phosphoribosyltransferase (hprt) locus has been widely used as a selectable genetic marker for studies of mammalian cell mutagenesis. We report here the spontaneous mutation spectrum at the hprt locus in 64 independently isolated mutants of Chinese hamster ovary (CHO) cells. All nine hprt exons were simultaneously analyzed via multiplex polymerase chain reaction (PCR) for rapid detection of gene deletions or insertions. Structural point mutations were identified by direct sequence analysis of the PCR amplified cDNA. The molecular nature of RNA splicing errors and insertions was analyzed by solid-phase direct exon sequencing. Single base substitutions were found in 24 mutants (38%), of which 21 were missense and 3 were nonsense mutations. Transversions were about twice as frequent as transitions. Fifteen mutants (23%) had deletions involving either intragenic small fragments (2), single exons (9), or multiple exons (4). The majority of deletion breakpoints (71%) were located in regions surrounding exons 4, 5, and 6. RNA splicing mutations were observed in 15 mutants (23%) and affected exons 3-8; most (6/15) resulted in the loss of exon 7. Two insertion mutants, one with a 209 bp insert in exon 4 and the other with a 88 bp insert accompanied by a 24 bp deletion in exon 6, represent novel mutations reported for the first time in spontaneous mutants of the mammalian hprt gene.

  8. Emerging role of Cdc42-specific guanine nucleotide exchange factors as regulators of membrane trafficking in health and disease.


    Egorov, M V; Polishchuk, R S


    It is widely accepted that the Golgi complex operates as a main sorting station in the biosynthetic pathway. On the other hand, the Golgi complex harbors numerous signaling molecules that generate the platform for the coordination of the transduction of specific signals and of membrane transport events. A part of these processes, which require the complex integration of transport-, cytoskeleton- and polarity-associated mechanisms, is tightly regulated by molecular machineries comprising guanine nucleotide exchange factors (GEF) and their down-stream effectors, such as the small GTPase Cdc42. Dysfunction of several Cdc42-specific GEFs has been shown to cause a number of human diseases, which are associated with impaired intracellular trafficking at the level of the Golgi complex as well as in other compartments. Here we briefly overview how mutations in Cdc42-specific GEFs have an impact on the organization of intracellular trafficking fluxes and how such trafficking aberrations could be associated with a number of human disorders. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Deletion screening at the hypoxanthine-guanine phosphoribosyltransferase locus in Chinese hamster cells using the polymerase chain reaction

    SciTech Connect

    Xu, Z.D.; Yu, Y.J.; Hsie, A.W.; Caskey, C.T.; Rossiter, B.; Gibbs, R.A. )


    We have developed a rapid screening method using the polymerase chain reaction (PCR) for detecting deletion mutations at the hypoxanthine-guanine phosphoribosyltransferase (hprt) locus in Chinese hamster cells. DNA was extracted from spontaneous and ultraviolet (UV) light- and X-ray-induced hprt-deficient mutants. Two primer sets were used to amplify 276 bp and 344 bp fragments containing the entire exon 3 and exon 9 coding sequence, respectively. The PCR was performed using Taq DNA polymerase for 40 cycles, and the PCR product was directly analyzed for the presence of the respective amplified DNA using electrophoresis on agarose gels stained with ethidium bromide. With this assay, we have analyzed 39 independently derived hprt-deficient mutants. Four of ten spontaneous mutants were found to have deletions in exon 9. UV light produced mutants with predominantly wild-type amplification patterns (10/14). X-ray induced mostly deletion patterns (11/15); six of these occurred only in exon 9, and five occurred in both exons 3 and 9. These observations are consistent with the classical notion that UV light induces predominantly missense mutations and X-ray produces a high proportion of deletion mutations. Deletion mutations occurred most frequently at the 3' end of the hprt gene, suggesting the possible existence of hot spots for deletions in this region. The PCR assay for deletion detection has the advantage that it can be completed in less than 4 hr without using radioisotopes. This assay should be useful for routine deletion screening.

  10. DPT tautomerisation of the wobble guanine·thymine DNA base mispair is not mutagenic: QM and QTAIM arguments.


    Brovarets', Ol'ha O; Zhurakivsky, Roman O; Hovorun, Dmytro M


    We have shown for the first time, connecting QM methods with QTAIM analysis and using the methodology of the sweeps of the energetical, electron-topological and geometrical parameters, that the tautomerisation of the wobble guanine·thymine (wG·T) DNA base mispair into the wG(*)·T(*) base mispair induced by the double proton transfer (DPT), which undergoes a concerted asynchronous pathway, is not mutagenic. The wG·T → wG(*)·T(*) DPT tautomerisation does not result in the transition of the G base into its mutagenic tautomeric form G(*) able to mispair with the T base within the Watson-Crick base pairing scheme. This observation is explained by the so-called quantum protection of the wG·T DNA base mispair from its mutagenic tautomerisation - the dynamical non-stability of the tautomerised wG(*)·T(*) base mispair and significantly negative value of the Gibbs free energy of activation for the reverse reaction of the wG·T → wG(*)·T(*) DPT tautomerisation.

  11. A High-Throughput Assay for Rho Guanine Nucleotide Exchange Factors Based on the Transcreener GDP Assay.


    Reichman, Melvin; Schabdach, Amanda; Kumar, Meera; Zielinski, Tom; Donover, Preston S; Laury-Kleintop, Lisa D; Lowery, Robert G


    Ras homologous (Rho) family GTPases act as molecular switches controlling cell growth, movement, and gene expression by cycling between inactive guanosine diphosphate (GDP)- and active guanosine triphosphate (GTP)-bound conformations. Guanine nucleotide exchange factors (GEFs) positively regulate Rho GTPases by accelerating GDP dissociation to allow formation of the active, GTP-bound complex. Rho proteins are directly involved in cancer pathways, especially cell migration and invasion, and inhibiting GEFs holds potential as a therapeutic strategy to diminish Rho-dependent oncogenesis. Methods for measuring GEF activity suitable for high-throughput screening (HTS) are limited. We developed a simple, generic biochemical assay method for measuring GEF activity based on the fact that GDP dissociation is generally the rate-limiting step in the Rho GTPase catalytic cycle, and thus addition of a GEF causes an increase in steady-state GTPase activity. We used the Transcreener GDP Assay, which relies on selective immunodetection of GDP, to measure the GEF-dependent stimulation of steady-state GTP hydrolysis by small GTPases using Dbs (Dbl's big sister) as a GEF for Cdc42, RhoA, and RhoB. The assay is well suited for HTS, with a homogenous format and far red fluorescence polarization (FP) readout, and it should be broadly applicable to diverse Rho GEF/GTPase pairs.

  12. RIC8 is a guanine-nucleotide exchange factor for Galpha subunits that regulates growth and development in Neurospora crassa.


    Wright, Sara J; Inchausti, Regina; Eaton, Carla J; Krystofova, Svetlana; Borkovich, Katherine A


    Heterotrimeric (αβγ) G proteins are crucial components of eukaryotic signal transduction pathways. G-protein-coupled receptors (GPCRs) act as guanine nucleotide exchange factors (GEFs) for Gα subunits. Recently, facilitated GDP/GTP exchange by non-GPCR GEFs, such as RIC8, has emerged as an important mechanism for Gα regulation in animals. RIC8 is present in animals and filamentous fungi, such as the model eukaryote Neurospora crassa, but is absent from the genomes of baker's yeast and plants. In Neurospora, deletion of ric8 leads to profound defects in growth and asexual and sexual development, similar to those observed for a mutant lacking the Gα genes gna-1 and gna-3. In addition, constitutively activated alleles of gna-1 and gna-3 rescue many defects of Δric8 mutants. Similar to reports in Drosophila, Neurospora Δric8 strains have greatly reduced levels of G-protein subunits. Effects on cAMP signaling are suggested by low levels of adenylyl cyclase protein in Δric8 mutants and suppression of Δric8 by a mutation in the protein kinase A regulatory subunit. RIC8 acts as a GEF for GNA-1 and GNA-3 in vitro, with the strongest effect on GNA-3. Our results support a role for RIC8 in regulating GNA-1 and GNA-3 in Neurospora.

  13. The Rho-guanine nucleotide exchange factor Trio controls leukocyte transendothelial migration by promoting docking structure formation.


    van Rijssel, Jos; Kroon, Jeffrey; Hoogenboezem, Mark; van Alphen, Floris P J; de Jong, Renske J; Kostadinova, Elena; Geerts, Dirk; Hordijk, Peter L; van Buul, Jaap D


    Leukocyte transendothelial migration involves the active participation of the endothelium through the formation of apical membrane protrusions that embrace adherent leukocytes, termed docking structures. Using live-cell imaging, we find that prior to transmigration, endothelial docking structures form around 80% of all neutrophils. Previously we showed that endothelial RhoG and SGEF control leukocyte transmigration. In this study, our data reveal that both full-length Trio and the first DH-PH (TrioD1) domain of Trio, which can activate Rac1 and RhoG, interact with ICAM-1 and are recruited to leukocyte adhesion sites. Moreover, upon clustering of ICAM-1, the Rho-guanine nucleotide exchange factor Trio activates Rac1, prior to activating RhoG, in a filamin-dependent manner. We further show that docking structure formation is initiated by ICAM-1 clustering into ring-like structures, which is followed by apical membrane protrusion. Interestingly, we find that Rac1 is required for ICAM-1 clustering, whereas RhoG controls membrane protrusion formation. Finally, silencing endothelial Trio expression or reducing TrioD1 activity without affecting SGEF impairs both docking structure formation and leukocyte transmigration. We conclude that Trio promotes leukocyte transendothelial migration by inducing endothelial docking structure formation in a filamin-dependent manner through the activation of Rac1 and RhoG.

  14. Functional characterization of the guanine nucleotide exchange factor (GEF) motif of GIV protein reveals a threshold effect in signaling.


    Garcia-Marcos, Mikel; Kietrsunthorn, Patrick S; Pavlova, Yelena; Adia, Michelle A; Ghosh, Pradipta; Farquhar, Marilyn G


    Heterotrimeric G proteins are critical signal-transducing molecules controlled by a complex network of regulators. GIV (a.k.a. Girdin) is a unique component of this network and a nonreceptor guanine nucleotide exchange factor (GEF) that functions via a signature motif. GIV's GEF motif is involved in the regulation of critical biological processes such as phosphoinositide 3 kinase (PI3K)-Akt signaling, actin cytoskeleton remodeling, cell migration, and cancer metastasis. Here we investigated how the GEF function of GIV affects the wiring of its signaling pathway to shape different biological responses. Using a structure-guided approach, we designed a battery of GIV mutants with different Gαi-binding and -activating properties and used it to dissect the specific impact of changes in GIV's GEF activity on several cellular responses. In vivo signaling assays revealed a threshold effect of GEF activity for the activation of Akt by GIV in different cell lines and by different stimuli. Akt signaling is minimal at low GEF activity and is sharply increased to reach a maximum above a threshold of GEF activity, suggesting that GIV is a critical signal amplifier and that activation of Akt is ultrasensitive to changes in GIV's GEF activity. A similar threshold dependence was observed for other biological functions promoted by GIV such as remodeling of the actin cytoskeleton and cell migration. This functional characterization of GIV's GEF motif provides insights into the molecular interactions between nonreceptor GEFs and G proteins and the mechanisms that govern this signal transduction pathway.

  15. A new target for shigellosis: rational design and crystallographic studies of inhibitors of tRNA-guanine transglycosylase.


    Grädler, U; Gerber, H D; Goodenough-Lashua, D M; Garcia, G A; Ficner, R; Reuter, K; Stubbs, M T; Klebe, G


    Eubacterial tRNA-guanine transglycosylase (TGT) is involved in the hyper-modification of cognate tRNAs leading to the exchange of G34 at the wobble position in the anticodon loop by preQ1 (2-amino-5-(aminomethyl)pyrrolo[2,3-d]pyrimidin-4(3H)-one) as part of the biosynthesis of queuine (Q). Mutation of the tgt gene in Shigella flexneri results in a significant loss of pathogenicity of the bacterium, revealing TGT as a new target for the design of potent drugs against Shigellosis. The X-ray structure of Zymomonas mobilis TGT in complex with preQ1 was used to search for new putative inhibitors with the computer program LUDI. An initial screen of the Available Chemical Directory, a database compiled from commercially available compounds, suggested several hits. Of these, 4-aminophthalhydrazide (APH) showed an inhibition constant in the low micromolar range. The 1.95 A crystal structure of APH in complex with Z. mobilis TGT served as a starting point for further modification of this initial lead.

  16. Progression of breast tumors is accompanied by a decrease in expression of the Rho guanine exchange factor Tiam1.


    Stebel, A; Brachetti, C; Kunkel, M; Schmidt, M; Fritz, G


    In this study, we investigated the expression level of Ras-homologous (Rho) GTPases and the Rho guanine exchange factor (GEF) T-cell lymphoma invasion and metastasis 1 (Tiam1) in breast tumor specimens (n=106) by immunohistochemistry. Rho and Rho-GEF expression scores were compared to clinically established diagnostic and prognostic parameters. We found that RhoA and RhoB scores slightly increased with tumor grade, whereas the Rac1 score remained unaffected. The most significant effects were observed for the Rac1-specific GEF Tiam1. Tiam1 expression scores significantly decreased with the increase in tumor grade, tumor spreading and proliferation. Furthermore, Tiam1 expression was inversely related to the plasminogen activator inhibitor (PAI-1) and estrogen receptor (ER) expression but not the progesterone receptor (PR) and urokinase plasminogen activator (uPA). A low Tiam1 expression was associa