Sample records for large subunit cdna

  1. Molecular cloning and characterization of ADP-glucose pyrophosphorylase cDNA clones isolated from pea cotyledons.

    PubMed

    Burgess, D; Penton, A; Dunsmuir, P; Dooner, H

    1997-02-01

    Three ADP-glucose pyrophosphorylase (ADPG-PPase) cDNA clones have been isolated and characterized from a pea cotyledon cDNA library. Two of these clones (Psagps1 and Psagps2) encode the small subunit of ADPG-PPase. The deduced amino acid sequences for these two clones are 95% identical. Expression of these two genes differs in that the Psagps2 gene shows comparatively higher expression in seeds relative to its expression in other tissues. Psagps2 expression also peaks midway through seed development at a time in which Psagps1 transcripts are still accumulating. The third cDNA isolated (Psagp11) encodes the large subunit of ADPG-PPase. It shows greater selectivity in expression than either of the small subunit clones. It is highly expressed in sink organs (seed, pod, and seed coat) and undetectable in leaves.

  2. Geranyl diphosphate synthase large subunit, and methods of use

    DOEpatents

    Croteau, Rodney B.; Burke, Charles C.; Wildung, Mark R.

    2001-10-16

    A cDNA encoding geranyl diphosphate synthase large subunit from peppermint has been isolated and sequenced, and the corresponding amino acid sequence has been determined. Replicable recombinant cloning vehicles are provided which code for geranyl diphosphate synthase large subunit). In another aspect, modified host cells are provided that have been transformed, transfected, infected and/or injected with a recombinant cloning vehicle and/or DNA sequence encoding geranyl diphosphate synthase large subunit. In yet another aspect, the present invention provides isolated, recombinant geranyl diphosphate synthase protein comprising an isolated, recombinant geranyl diphosphate synthase large subunit protein and an isolated, recombinant geranyl diphosphate synthase small subunit protein. Thus, systems and methods are provided for the recombinant expression of geranyl diphosphate synthase.

  3. Isolation and characterization of a cDNA clone for the complete protein coding region of the delta subunit of the mouse acetylcholine receptor.

    PubMed Central

    LaPolla, R J; Mayne, K M; Davidson, N

    1984-01-01

    A mouse cDNA clone has been isolated that contains the complete coding region of a protein highly homologous to the delta subunit of the Torpedo acetylcholine receptor (AcChoR). The cDNA library was constructed in the vector lambda 10 from membrane-associated poly(A)+ RNA from BC3H-1 mouse cells. Surprisingly, the delta clone was selected by hybridization with cDNA encoding the gamma subunit of the Torpedo AcChoR. The nucleotide sequence of the mouse cDNA clone contains an open reading frame of 520 amino acids. This amino acid sequence exhibits 59% and 50% sequence homology to the Torpedo AcChoR delta and gamma subunits, respectively. However, the mouse nucleotide sequence has several stretches of high homology with the Torpedo gamma subunit cDNA, but not with delta. The mouse protein has the same general structural features as do the Torpedo subunits. It is encoded by a 3.3-kilobase mRNA. There is probably only one, but at most two, chromosomal genes coding for this or closely related sequences. Images PMID:6096870

  4. PCR amplification and sequences of cDNA clones for the small and large subunits of ADP-glucose pyrophosphorylase from barley tissues.

    PubMed

    Villand, P; Aalen, R; Olsen, O A; Lüthi, E; Lönneborg, A; Kleczkowski, L A

    1992-06-01

    Several cDNAs encoding the small and large subunit of ADP-glucose pyrophosphorylase (AGP) were isolated from total RNA of the starchy endosperm, roots and leaves of barley by polymerase chain reaction (PCR). Sets of degenerate oligonucleotide primers, based on previously published conserved amino acid sequences of plant AGP, were used for synthesis and amplification of the cDNAs. For either the endosperm, roots and leaves, the restriction analysis of PCR products (ca. 550 nucleotides each) has revealed heterogeneity, suggesting presence of three transcripts for AGP in the endosperm and roots, and up to two AGP transcripts in the leaf tissue. Based on the derived amino acid sequences, two clones from the endosperm, beps and bepl, were identified as coding for the small and large subunit of AGP, respectively, while a leaf transcript (blpl) encoded the putative large subunit of AGP. There was about 50% identity between the endosperm clones, and both of them were about 60% identical to the leaf cDNA. Northern blot analysis has indicated that beps and bepl are expressed in both the endosperm and roots, while blpl is detectable only in leaves. Application of the PCR technique in studies on gene structure and gene expression of plant AGP is discussed.

  5. Isolated spinach ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit .sup..epsilon. N-methyltransferase and method of inactivating ribulose-1,5-bisphosphatase carboxylase/oxygenase large subunit .sup..epsilon. N-methyltransferase activity

    DOEpatents

    Houtz, Robert L.

    1999-01-01

    The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) .sup..epsilon. N-methyltransferase (protein methylase III or Rubisco LSMT) from a plant which has a des(methyl) lysyl residue in the LS is disclosed. In addition, the full-length cDNA clones for Rubisco LSMT are disclosed. Transgenic plants and methods of producing same which have the Rubisco LSMT gene inserted into the DNA are also provided. Further, methods of inactivating the enzymatic activity of Rubisco LSMT are also disclosed.

  6. Cloning and developmental expression of pea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit N-methyltransferase

    DOEpatents

    Houtz, Robert L.

    1998-01-01

    The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) .epsilon.N-methyltransferase (protein methylase III or Rubisco LSMT) is disclosed. This enzyme catalyzes methylation of the .epsilon.-amine of lysine-14 in the large subunit of Rubisco. In addition, a full-length cDNA clone for Rubisco LSMT is disclosed. Transgenic plants and methods of producing same which (1) have the Rubisco LSMT gene inserted into the DNA, and (2) have the Rubisco LSMT gene product or the action of the gene product deleted from the DNA are also provided. Further, methods of using the gene to selectively deliver desired agents to a plant are also disclosed.

  7. Cloning and developmental expression of pea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit epsilon N-methyltransferase

    DOEpatents

    Houtz, Robert L.

    1999-01-01

    The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) .sup..epsilon. N-methyltransferase (protein methylase III or Rubisco LSMT) is disclosed. This enzyme catalyzes methylation of the .epsilon.-amine of lysine-14 in the large subunit of Rubisco. In addition, a full-length cDNA clone for Rubisco LSMT is disclosed. Transgenic plants and methods of producing same which (1) have the Rubisco LSMT gene inserted into the DNA, and (2) have the Rubisco LSMT gene product or the action of the gene product deleted from the DNA are also provided. Further, methods of using the gene to selectively deliver desired agents to a plant are also disclosed.

  8. Cloning and developmental expression of pea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit N-methyltransferase

    DOEpatents

    Houtz, R.L.

    1998-03-03

    The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) {epsilon}N-methyltransferase (protein methylase III or Rubisco LSMT) is disclosed. This enzyme catalyzes methylation of the {epsilon}-amine of lysine-14 in the large subunit of Rubisco. In addition, a full-length cDNA clone for Rubisco LSMT is disclosed. Transgenic plants and methods of producing same which (1) have the Rubisco LSMT gene inserted into the DNA, and (2) have the Rubisco LSMT gene product or the action of the gene product deleted from the DNA are also provided. Further, methods of using the gene to selectively deliver desired agents to a plant are also disclosed. 5 figs.

  9. Cloning and developmental expression of pea ribulose-1,5-bisphosphate carboxylase/oxygenase large subunit epsilon N-methyltransferase

    DOEpatents

    Houtz, R.L.

    1999-02-02

    The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS){sup {epsilon}}N-methyltransferase (protein methylase III or Rubisco LSMT) is disclosed. This enzyme catalyzes methylation of the {epsilon}-amine of lysine-14 in the large subunit of Rubisco. In addition, a full-length cDNA clone for Rubisco LSMT is disclosed. Transgenic plants and methods of producing same which (1) have the Rubisco LSMT gene inserted into the DNA, and (2) have the Rubisco LSMT gene product or the action of the gene product deleted from the DNA are also provided. Further, methods of using the gene to selectively deliver desired agents to a plant are also disclosed. 8 figs.

  10. [Cloning of cDNA for RNA polymerase subunit from the fission yeast Schizosaccharomyces pombe by heterospecific complementation in Saccharomyces cerevisiae].

    PubMed

    Shpakovskiĭ, G V; Lebedenko, E N; Thuriaux, P

    1997-02-01

    The rpb10 cDNA of the fission yeast Schizosaccharomyces pombe, encoding one of the five small subunits common to all three nuclear DNA-dependent RNA polymerases, was isolated from an expression cDNA library by two independent approaches: PCR-based screening and direct suppression by means of heterospecific complementation of a temperature-sensitive mutant defective in the corresponding gene of Saccharomyces cerevisiae. The cloned Sz. pombe cDNA encodes a protein Rpb10 of 71 amino acids with an M of 8,275 Da, sharing 51 amino acids (71% identity) with the subunit ABC10 beta of RNA polymerases I-III from S. cerevisiae. All eukaryotic members of this protein family have the same general organization featuring two highly conserved motifs (RCFT/SCGK and RYCCRRM) around an atypical zinc finger and an additional invariant HVDLIEK motif toward the C-terminal end. The last motif is only characteristics for homologs from eukaryotes. In keeping with this remarkable structural conservation, the Sz. pombe cDNA also fully complemented a S. cerevisiae deletion mutant lacking subunit ABC10 beta (null allele rpb10-delta 1::HIS3).

  11. Isolated spinach ribulose-1,5-bisphosphate carboxylase/oxgenase large subunit .epsilon. n-methyltransferase and method of inactivating ribulose-1,5-bishosphatase .epsilon. n-methyltransferase activity

    DOEpatents

    Houtz, Robert L.

    2001-01-01

    The gene sequence for ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) large subunit (LS) .sup..epsilon. N-methyltansferase (protein methylase III or Rubisco LSMT) from a plant which has a des(methyl) lysyl residue in the LS is disclosed. In addition, the full-length cDNA clones for Rubisco LSMT are disclosed. Transgenic plants and methods of producing same which have the Rubisco LSMT gene inserted into the DNA are also provided. Further, methods of inactivating the enzymatic activity of Rubisco LSMT are also disclosed.

  12. [Three regions of Rpb10 mini-subunit of nuclear RNA polymerases are strictly conserved in all eukaryotes].

    PubMed

    Shpakovskiĭ, G V; Lebedenko, E N

    1996-12-01

    The rpb10+ cDNA from the fission yeast Schizosaccharomyces pombe was cloned using two independent approaches (PCR and genetic suppression). The cloned cDNA encoded the Rpb10 subunit common for all three RNA polymerases. Comparison of the deduced amino acid sequence of the Sz. pombe Rbp10 subunit (71 amino acid residues) with those of the homologous subunits of RNA polymerases I, II, and III from Saccharomyces cerevisiae and Home sapiens revealed that heptapeptides RCFT/SCGK (residues 6-12), RYCCRRM (residues 43-49), and HVDLIEK (residues 53-59) were evolutionarily the most conserved structural motifs of these subunits. It is shown that the Rbp10 subunit from Sz. pombe can substitute its homolog (ABC10 beta) in the baker's yeast S. cerevisiae.

  13. Four subunits that are shared by the three classes of RNA polymerase are functionally interchangeable between Homo sapiens and Saccharomyces cerevisiae.

    PubMed Central

    Shpakovski, G V; Acker, J; Wintzerith, M; Lacroix, J F; Thuriaux, P; Vigneron, M

    1995-01-01

    Four cDNAs encoding human polypeptides hRPB7.0, hRPB7.6, hRPB17, and hRPB14.4 (referred to as Hs10 alpha, Hs10 beta, Hs8, and Hs6, respectively), homologous to the ABC10 alpha, ABC10 beta, ABC14.5, and ABC23 RNA polymerase subunits (referred to as Sc10 alpha, Sc10 beta, Sc8, and Sc6, respectively) of Saccharomyces cerevisiae, were cloned and characterized for their ability to complement defective yeast mutants. Hs10 alpha and the corresponding Sp10 alpha of Schizosaccharomyces pombe can complement an S. cerevisiae mutant (rpc10-delta::HIS3) defective in Sc10 alpha. The peptide sequences are highly conserved in their carboxy-terminal halves, with an invariant motif CX2CX12RCX2CGXR corresponding to a canonical zinc-binding domain. Hs10 beta, Sc10 beta, and the N subunit of archaeal RNA polymerase are homologous. An invariant CX2CGXnCCR motif presumably forms an atypical zinc-binding domain. Hs10 beta, but not the archaeal subunit, complemented an S. cerevisiae mutant (rpb10-delta 1::HIS3) lacking Sc10 beta. Hs8 complemented a yeast mutant (rpb8-delta 1::LYS2) defective in the corresponding Sc8 subunit, although with a strong thermosensitive phenotype. Interspecific complementation also occurred with Hs6 and with the corresponding Dm6 cDNA of Drosophila melanogaster. Hs6 cDNA and the Sp6 cDNA of S. pombe are dosage-dependent suppressors of rpo21-4, a mutation generating a slowly growing yeast defective in the largest subunit of RNA polymerase II. Finally, a doubly chimeric S. cerevisiae strain bearing the Sp6 cDNA and the human Hs10 beta cDNA was also viable. No interspecific complementation was observed for the human hRPB25 (Hs5) homolog of the yeast ABC27 (Sc5) subunit. PMID:7651387

  14. Cloning and sequence analysis of a cDNA encoding the alpha-subunit of mouse beta-N-acetylhexosaminidase and comparison with the human enzyme.

    PubMed Central

    Beccari, T; Hoade, J; Orlacchio, A; Stirling, J L

    1992-01-01

    cDNAs encoding the mouse beta-N-acetylhexosaminidase alpha-subunit were isolated from a mouse testis library. The longest of these (1.7 kb) was sequenced and showed 83% similarity with the human alpha-subunit cDNA sequence. The 5' end of the coding sequence was obtained from a genomic DNA clone. Alignment of the human and mouse sequences showed that all three putative N-glycosylation sites are conserved, but that the mouse alpha-subunit has an additional site towards the C-terminus. All eight cysteines in the human sequence are conserved in the mouse. There are an additional two cysteines in the mouse alpha-subunit signal peptide. All amino acids affected in Tay-Sachs-disease mutations are conserved in the mouse. Images Fig. 1. PMID:1379046

  15. [Molecular cloning and characterization of cDNA of the rpc10+ gene encoding the smallest subunit of nuclear RNA polymerases of Schizosaccharomyces pombe].

    PubMed

    Shpakovskiĭ, G V; Lebedenko, E N

    1997-05-01

    The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.

  16. The delta-subunit of murine guanine nucleotide exchange factor eIF-2B. Characterization of cDNAs predicts isoforms differing at the amino-terminal end.

    PubMed

    Henderson, R A; Krissansen, G W; Yong, R Y; Leung, E; Watson, J D; Dholakia, J N

    1994-12-02

    Protein synthesis in mammalian cells is regulated at the level of the guanine nucleotide exchange factor, eIF-2B, which catalyzes the exchange of eukaryotic initiation factor 2-bound GDP for GTP. We have isolated and sequenced cDNA clones encoding the delta-subunit of murine eIF-2B. The cDNA sequence encodes a polypeptide of 544 amino acids with molecular mass of 60 kDa. Antibodies against a synthetic polypeptide of 30 amino acids deduced from the cDNA sequence specifically react with the delta-subunit of mammalian eIF-2B. The cDNA-derived amino acid sequence shows significant homology with the yeast translational regulator Gcd2, supporting the hypothesis that Gcd2 may be the yeast homolog of the delta-subunit of mammalian eIF-2B. Primer extension studies and anchor polymerase chain reaction analysis were performed to determine the 5'-end of the transcript for the delta-subunit of eIF-2B. Results of these experiments demonstrate two different mRNAs for the delta-subunit of eIF-2B in murine cells. The isolation and characterization of two different full-length cDNAs also predicts the presence of two alternate forms of the delta-subunit of eIF-2B in murine cells. These differ at their amino-terminal end but have identical nucleotide sequences coding for amino acids 31-544.

  17. Identification of a GTP-binding protein. cap alpha. subunit that lacks an apparent ADP-ribosylation site for pertussis toxin

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Fong, H.K.W.; Yoshimoto, K.K.; Eversole-Cire, P.

    1988-05-01

    Recent molecular cloning of cDNA for the ..cap alpha.. subunit of bovine transducin (a guanine nucleotide-binding regulatory protein, or G protein) has revealed the presence of two retinal-specific transducins, called T/sub r/ and T/sub c/, which are expressed in rod or cone photoreceptor cells. In a further study of G-protein diversity and signal transduction in the retina, the authors have identified a G-protein ..cap alpha.. subunit, which they refer to as G/sub z/..cap alpha.., by isolating a human retinal cDNA clone that cross-hybridizes at reduced stringency with bovine T/sub r/ ..cap alpha..-subunit cDNA. The deduced amino acid sequence of G/submore » z/..cap alpha.. is 41-67% identical with those of other known G-protein ..cap alpha.. subunits. However, the 355-residue G/sub z/..cap alpha.. lacks a consensus site for ADP-ribosylation by pertussis toxin, and its amino acid sequence varies within a number of regions that are strongly conserved among all of the other G-protein ..cap alpha.. subunits. They suggest that G/sub z/..cap alpha.., which appears to be highly expressed in neural tissues, represents a member of a subfamily of G proteins that mediate signal transduction in pertussis toxin-insensitive systems.« less

  18. A tolerance gene for prenylated flavonoid encodes a 26S proteasome regulatory subunit in Sophora flavescens.

    PubMed

    Shitan, Nobukazu; Kamimoto, Yoshihisa; Minami, Shota; Kubo, Mizuki; Ito, Kozue; Moriyasu, Masataka; Yazaki, Kazufumi

    2011-01-01

    Yeast functional screening with a Sophora flavescens cDNA library was performed to identify the genes involved in the tolerant mechanism to the self-producing prenylated flavonoid sophoraflavanone G (SFG). One cDNA, which conferred SFG tolerance, encoded a regulatory particle triple-A ATPase 2 (SfRPT2), a member of the 26S proteasome subunit. The yeast transformant of SfRPT2 showed reduced SFG accumulation in the cells.

  19. Guanine nucleotide-binding regulatory proteins in retinal pigment epithelial cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jiang, Meisheng; Tran, V.T.; Fong, H.K.W.

    1991-05-01

    The expression of GTP-binding regulatory proteins (G proteins) in retinal pigment epithelial (RPE) cells was analyzed by RNA blot hybridization and cDNA amplification. Both adult and fetal human RPE cells contain mRNA for multiple G protein {alpha} subunits (G{alpha}) including G{sub s}{alpha}, G{sub i-1}{alpha}, G{sub i-2}{alpha}, G{sub i-3}{alpha}, and G{sub z}{alpha} (or G{sub x}{alpha}), where G{sub s} and G{sub i} are proteins that stimulate or inhibit adenylyl cyclase, respectively, and G{sub z} is a protein that may mediate pertussis toxin-insensitive events. Other G{alpha}-related mRNA transcripts were detected in fetal RPE cells by low-stringency hybridization to G{sub i-2}{alpha} and G{sub s}{alpha}more » protein-coding cDNA probes. The diversity of G proteins in RPE cells was further studied by cDNA amplification with reverse transcriptase and the polymerase chain reaction. This approach revealed that, besides the above mentioned members of the G{alpha} gene family, at least two other G{alpha} subunits are expressed in RPE cells. Human retinal cDNA clones that encode one of the additional G{alpha} subunits were isolated and characterized. The results indicate that this G{alpha} subunit belongs to a separate subfamily of G proteins that may be insensitive to inhibition by pertussis toxin.« less

  20. Cloning and functional expression of the small subunit of acetolactate synthase from Nicotiana plumbaginifolia.

    PubMed

    Hershey, H P; Schwartz, L J; Gale, J P; Abell, L M

    1999-07-01

    Acetolactate synthase (ALS) is the first committed step of branched-chain amino acid biosynthesis in plants and bacteria. The bacterial holoenzyme has been well characterized and is a tetramer of two identical large subunits (LSUs) of 60 kDa and two identical small subunits (SSUs) ranging in molecular mass from 9 to 17 kDa depending on the isozyme. The enzyme from plants is much less well characterized. Attempts to purify the protein have yielded an enzyme which appears to be an oligomer of LSUs, with the potential existence of a SSU for the plant enzyme remaining a matter of considerable speculation. We report here the discovery of a cDNA clone that encodes a SSU of plant ALS based upon the homology of the encoded peptide with various bacterial ALS SSUs. The plant ALS SSU is more than twice as large as any of its prokaryotic homologues and contains two domains that each encode a full-length copy of the prokaryotic SSU polypeptide. The cDNA clone was used to express Nicotiana plumbaginifolia SSU in Escherichia coli. Mixing a partially purified preparation of this SSU with the LSU of ALS from either N. plumbaginifolia or Arabidopsis thaliana results in both increased specific activity and increased stability of the enzymic activity. These results are consistent with those observed for the bacterial enzyme in similar experiments and represent the first functional demonstration of the existence of a SSU for plant ALS.

  1. Vacuolar H[sup +]-ATPase 69-kilodalton catalytic subunit cDNA from developing cotton (Gossypium hirsutum) ovules

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wilkins, T.A.

    1993-06-01

    This study investigates the molecular events of vacuole ontogeny in rapidly elongated cotton plant cells. Within the DNA coding region, the cotton and carrot cDNA clones exhibit 82.2% nucleotide sequence homology; at the amino acid level cotton and carrot catalytic subunits exhibited 95.7% identity and 2.1% amino acid similarity. When aligned with the analogous sequences from yeast, the cotton protein shared only 60.5% amino acid identity and 12.7% similarity. 10 refs., 1 tab.

  2. Cloning and characterization of two novel zebrafish P2X receptor subunits.

    PubMed

    Diaz-Hernandez, Miguel; Cox, Jane A; Migita, Keisuke; Haines, William; Egan, Terrance M; Voigt, Mark M

    2002-07-26

    In this report we describe the cloning and characterization of two P2X receptor subunits cloned from the zebrafish (Danio rerio). Primary sequence analysis suggests that one cDNA encodes an ortholog of the mammalian P2X(4) subunit and the second cDNA encodes the ortholog of the mammalian P2X(5) subunit. The zP2X(4) subunit forms a homo-oligomeric receptor that displays a low affinity for ATP (EC(50)=274+/-48 microM) and very low affinity (EC(50)>500 microM) for other purinergic ligands such as alphabetameATP, suramin, and PPADS. As seen with the mammalian orthologs, the zP2X(5) subunit forms a homo-oligomeric receptor that yields very small whole-cell currents (<20pA), making determination of an EC(50) problematic. Both subunit genes were physically mapped onto the zebrafish genome using radiation hybrid analysis of the T51 panel, with the zp2x4 localized to LG21 and zp2x5 to LG5.

  3. NADH:ubiquinone oxidoreductase from bovine heart mitochondria. cDNA sequences of the import precursors of the nuclear-encoded 39 kDa and 42 kDa subunits.

    PubMed Central

    Fearnley, I M; Finel, M; Skehel, J M; Walker, J E

    1991-01-01

    The 39 kDa and 42 kDa subunits of NADH:ubiquinone oxidoreductase from bovine heart mitochondria are nuclear-coded components of the hydrophobic protein fraction of the enzyme. Their amino acid sequences have been deduced from the sequences of overlapping cDNA clones. These clones were amplified from total bovine heart cDNA by means of the polymerase chain reaction, with the use of complex mixtures of oligonucleotide primers based upon fragments of protein sequence determined at the N-terminals of the proteins and at internal sites. The protein sequences of the 39 kDa and 42 kDa subunits are 345 and 320 amino acid residues long respectively, and their calculated molecular masses are 39,115 Da and 36,693 Da. Both proteins are predominantly hydrophilic, but each contains one or two hydrophobic segments that could possibly be folded into transmembrane alpha-helices. The bovine 39 kDa protein sequence is related to that of a 40 kDa subunit from complex I from Neurospora crassa mitochondria; otherwise, it is not related significantly to any known sequence, including redox proteins and two polypeptides involved in import of proteins into mitochondria, known as the mitochondrial processing peptidase and the processing-enhancing protein. Therefore the functions of the 39 kDa and 42 kDa subunits of complex I are unknown. The mitochondrial gene product, ND4, a hydrophobic component of complex I with an apparent molecular mass of about 39 kDa, has been identified in preparations of the enzyme. This subunit stains faintly with Coomassie Blue dye, and in many gel systems it is not resolved from the nuclearcoded 36 kDa subunit. Images Fig. 1. PMID:1832859

  4. Na+/K+-ATPase α-subunit in swimming crab Portunus trituberculatus: molecular cloning, characterization, and expression under low salinity stress

    NASA Astrophysics Data System (ADS)

    Han, Xiaolin; Liu, Ping; Gao, Baoquan; Wang, Haofeng; Duan, Yafei; Xu, Wenfei; Chen, Ping

    2015-07-01

    Na+/K+-ATPases are membrane-associated enzymes responsible for the active transport of Na+ and K+ ions across cell membranes, generating chemical and electrical gradients. These enzymes' α-subunit provides catalytic function, binding and hydrolyzing ATP, and itself becoming phosphorylated during the transport cycle. In this study, Na+/K+-ATPase α-subunit cDNA was cloned from gill tissue of the swimming crab Portunus trituberculatus by reverse-transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end methods. Analysis of the nucleotide sequence revealed that the cDNA had a full-length of 3 833 base pairs (bp), with an open reading frame of 3 120 bp, 5' untranslated region (UTR) of 317 bp, and 3' UTR of 396 bp. The sequence encoded a 1 039 amino acid protein with a predicted molecular weight of 115.57 kDa and with estimated pI of 5.21. It was predicted here to possess all expected features of Na+/K+-ATPase members, including eight transmembrane domains, putative ATP-binding site, and phosphorylation site. Comparison of amino acid sequences showed that the P. trituberculatus α-subunit possessed an overall identity of 75%-99% to that of other organisms. Phylogenetic analysis revealed that this α-subunit was in the same category as those of crustaceans. Quantitative real-time RT-PCR analysis indicated that this α-subunit's transcript were most highly expressed in gill and lowest in muscle. RT-PCR analysis also revealed that α-subunit expression in crab gill decreased after 2 and 6 h, but increased after 12, 24, 48, and 72 h. In addition, α-subunit expression in hepatopancreas of crab decreased after 2-72 h. These facts indicated that the crab's Na+/K+-ATPase α-subunit was potentially involved in the observed acute response to low salinity stress.

  5. Amino acid sequence of the human fibronectin receptor

    PubMed Central

    1987-01-01

    The amino acid sequence deduced from cDNA of the human placental fibronectin receptor is reported. The receptor is composed of two subunits: an alpha subunit of 1,008 amino acids which is processed into two polypeptides disulfide bonded to one another, and a beta subunit of 778 amino acids. Each subunit has near its COOH terminus a hydrophobic segment. This and other sequence features suggest a structure for the receptor in which the hydrophobic segments serve as transmembrane domains anchoring each subunit to the membrane and dividing each into a large ectodomain and a short cytoplasmic domain. The alpha subunit ectodomain has five sequence elements homologous to consensus Ca2+- binding sites of several calcium-binding proteins, and the beta subunit contains a fourfold repeat strikingly rich in cysteine. The alpha subunit sequence is 46% homologous to the alpha subunit of the vitronectin receptor. The beta subunit is 44% homologous to the human platelet adhesion receptor subunit IIIa and 47% homologous to a leukocyte adhesion receptor beta subunit. The high degree of homology (85%) of the beta subunit with one of the polypeptides of a chicken adhesion receptor complex referred to as integrin complex strongly suggests that the latter polypeptide is the chicken homologue of the fibronectin receptor beta subunit. These receptor subunit homologies define a superfamily of adhesion receptors. The availability of the entire protein sequence for the fibronectin receptor will facilitate studies on the functions of these receptors. PMID:2958481

  6. Cytochrome b in human complex II (succinate-ubiquinone oxidoreductase): cDNA cloning of the components in liver mitochondria and chromosome assignment of the genes for the large (SDHC) and small (SDHD) subunits to 1q21 and 11q23.

    PubMed

    Hirawake, H; Taniwaki, M; Tamura, A; Kojima, S; Kita, K

    1997-01-01

    Complex II (succinate-ubiquinone oxidoreductase) is an important enzyme complex in both the tricarboxylic acid cycle and the aerobic respiratory chains of mitochondria in eukaryotic cells and prokaryotic organisms. In this study, the amino acid sequences of the large (cybL) and small (cybS) subunits of cytochrome b in human liver complex II were deduced from cDNAs isolated by homology probing with mixed primers for the polymerase chain reaction. The mature cybL and cybS contain 140 and 103 amino acids, respectively, and show little similarity to the amino acid sequences of the subunits from other species in contrast to the highly conserved features of the flavoprotein (Fp) subunit and iron-sulfur protein (Ip) subunit. From hydrophobicity analysis, both cybL and cybS appear to have three transmembrane segments, indicating their role as membrane-anchors for the enzyme complex. Histidine residues, which are possible heme axial ligands in cytochrome b of complex II, were found in the second transmembrane segment of each subunit. The genes for cybL (SDHC) and cybS (SDHD) were mapped to chromosome 1q21 and 11q23, respectively by fluorescent in situ hybridization (FISH).

  7. Proteolytic processing of endogenous and recombinant beta 4 integrin subunit

    PubMed Central

    1992-01-01

    The alpha 6 beta 4 integrin is a receptor involved in the interaction of epithelial cells with basement membranes. This integrin is unique among the known integrins in that its beta 4 subunit has a large cytoplasmic domain. The function of this cytoplasmic domain is not known. In this paper we show that the beta 4 subunit undergoes proteolytic processing in cultured cells and provide evidence that this also happens in tissues. Immunoprecipitation experiments indicated that the cytoplasmic domain of beta 4 is susceptible to a calcium-dependent protease present in cellular extracts. In vitro assays with purified calpain showed that this enzyme can cleave beta 4 at two distinct sites in the cytoplasmic domain, generating truncated molecules of 165 and 130 kD. Immunoblotting experiments performed on cultured epithelial cells using an antibody to a peptide modeled after the COOH-terminus of the beta 4 subunit showed 70-kD fragments and several fragments of molecular masses between 185 and 115 kD. Similar fragments were detected in CHO cells transfected with the full-length beta 4 cDNA, but not in control transfected cells or in cells transfected with a mutant cDNA lacking the epitope of the cytoplasmic peptide antibody. The sizes of the fragments indicated that both the intracellular and extracellular domains of beta 4 are proteolytically processed. To examine the processing of the beta 4 subunit in epithelial tissues in vivo, human skin frozen sections were stained with antibodies to the ectodomain or the cytoplasmic domain of beta 4. The distinct staining patterns obtained with the two types of antibodies provided evidence that beta 4 is proteolytically processed in vivo in skin. Analogous experiments performed on sections of the cornea suggested that beta 4 is not proteolytically processed at a detectable level in this tissue. Thus, cleavage of the beta 4 subunit occurs in a tissue-specific fashion. These results suggest a potential mechanism of modulating the activities of the alpha 6 beta 4 integrin. PMID:1500432

  8. Functional Analysis of a Wheat AGPase Plastidial Small Subunit with a Truncated Transit Peptide.

    PubMed

    Yang, Yang; Gao, Tian; Xu, Mengjun; Dong, Jie; Li, Hanxiao; Wang, Pengfei; Li, Gezi; Guo, Tiancai; Kang, Guozhang; Wang, Yonghua

    2017-03-01

    ADP-glucose pyrophosphorylase (AGPase), the key enzyme in starch synthesis, consists of two small subunits and two large subunits with cytosolic and plastidial isoforms. In our previous study, a cDNA sequence encoding the plastidial small subunit (TaAGPS1b) of AGPase in grains of bread wheat ( Triticum aestivum L.) was isolated and the protein subunit encoded by this gene was characterized as a truncated transit peptide (about 50% shorter than those of other plant AGPS1bs). In the present study, TaAGPS1b was fused with green fluorescent protein (GFP) in rice protoplast cells, and confocal fluorescence microscopy observations revealed that like other AGPS1b containing the normal transit peptide, TaAGPS1b-GFP was localized in chloroplasts. TaAGPS1b was further overexpressed in a Chinese bread wheat cultivar, and the transgenic wheat lines exhibited a significant increase in endosperm AGPase activities, starch contents, and grain weights. These suggested that TaAGPS1b subunit was targeted into plastids by its truncated transit peptide and it could play an important role in starch synthesis in bread wheat grains.

  9. The chorionic gonadotropin alpha-subunit gene is on human chromosome 18 in JEG cells.

    PubMed Central

    Hardin, J W; Riser, M E; Trent, J M; Kohler, P O

    1983-01-01

    The gene for the alpha subunit of human chorionic gonadotropin (hCG) has been tentatively assigned to human chromosome 18. This localization was accomplished through the use of Southern blot analysis. A full-length cDNA probe for the hCG alpha subunit and DNA isolated from a series of somatic hybrids between mouse and human cells were utilized to make this assignment. In addition, in situ hybridization with normal human peripheral blood lymphocytes as a source of human chromosomes and with the same cDNA probe confirmed this result. The presence of human chromosome 18 was required for the detection of DNA fragments characteristic of the alpha-hCG gene. These results are consistent with our previous observation that human chromosomes 10 and 18 are required for the production of hCG in cultured cells. Images PMID:6578509

  10. Molecular cloning and characterization of RGA1 encoding a G protein alpha subunit from rice (Oryza sativa L. IR-36).

    PubMed

    Seo, H S; Kim, H Y; Jeong, J Y; Lee, S Y; Cho, M J; Bahk, J D

    1995-03-01

    A cDNA clone, RGA1, was isolated by using a GPA1 cDNA clone of Arabidopsis thaliana G protein alpha subunit as a probe from a rice (Oryza sativa L. IR-36) seedling cDNA library from roots and leaves. Sequence analysis of genomic clone reveals that the RGA1 gene has 14 exons and 13 introns, and encodes a polypeptide of 380 amino acid residues with a calculated molecular weight of 44.5 kDa. The encoded protein exhibits a considerable degree of amino acid sequence similarity to all the other known G protein alpha subunits. A putative TATA sequence (ATATGA), a potential CAAT box sequence (AGCAATAC), and a cis-acting element, CCACGTGG (ABRE), known to be involved in ABA induction are found in the promoter region. The RGA1 protein contains all the consensus regions of G protein alpha subunits except the cysteine residue near the C-terminus for ADP-ribosylation by pertussis toxin. The RGA1 polypeptide expressed in Escherichia coli was, however, ADP-ribosylated by 10 microM [adenylate-32P] NAD and activated cholera toxin. Southern analysis indicates that there are no other genes similar to the RGA1 gene in the rice genome. Northern analysis reveals that the RGA1 mRNA is 1.85 kb long and expressed in vegetative tissues, including leaves and roots, and that its expression is regulated by light.

  11. cap alpha. /sub i/-3 cDNA encodes the. cap alpha. subunit of G/sub k/, the stimulatory G protein of receptor-regulated K/sup +/ channels

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Codina, J.; Olate, J.; Abramowitz, J.

    1988-05-15

    cDNA cloning has identified the presence in the human genome of three genes encoding ..cap alpha.. subunits of pertussis toxin substrates, generically called G/sub i/. They are named ..cap alpha../sub i/-1, ..cap alpha../sub i/-2 and ..cap alpha../sub i/-3. However, none of these genes has been functionally identified with any of the ..cap alpha.. subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A/sub 2/, G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K/sup +/ channels. The authors now report the nucleotide sequence and the complete predicted aminomore » acid sequence of human liver ..cap alpha../sub i/-3 and the partial amino acid sequence of proteolytic fragments of the ..cap alpha.. subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of ..cap alpha../sub i/-3, thus identifying it as ..cap alpha../sub k/. The probable identity of ..cap alpha../sub i/-1 with ..cap alpha../sub p/ and possible roles for ..cap alpha../sub i/-2, as well as additional roles for ..cap alpha../sub i/-1 and ..cap alpha../sub i/-3 (..cap alpha../sub k/) are discussed.« less

  12. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Antonacci, R.; Colombo, I.; Volta, M.

    The electron-transfer flavoprotein (ETF), located in the mitochondrial matrix, is a nuclear-encoded enzyme delivering to the respiratory chain electrons by straight-chain acyl-CoA dehydrogenases and other dehydrogenases. ETF is composed of a 35-kDa [alpha]-subunit that is cleaved to a 32-kDa protein during mitochondrial import (ETFA) and a [beta]-subunit that reaches the mitochondrion unmodified (ETFB). The cDNA encoding both these subunits has been cloned and sequenced. 14 refs., 1 fig.

  13. Human alpha 7 acetylcholine receptor: cloning of the alpha 7 subunit from the SH-SY5Y cell line and determination of pharmacological properties of native receptors and functional alpha 7 homomers expressed in Xenopus oocytes.

    PubMed

    Peng, X; Katz, M; Gerzanich, V; Anand, R; Lindstrom, J

    1994-03-01

    The alpha-bungarotoxin-binding acetylcholine receptors from the human neuroblastoma cell line SH-SY5Y were found to cross-react with some monoclonal antibodies to alpha 7 subunits of nicotinic acetylcholine receptors from chicken brain. The human alpha 7 subunit cDNA from SH-SY5Y was cloned, revealing 94% amino acid sequence identity to rat alpha 7 subunits and 92% identity to chicken alpha 7 subunits. Native human alpha 7 receptors showed affinities for some ligands similar to those previously observed with native chicken alpha 7 receptors, but for other ligands there were large species-specific differences in binding affinity. These results paralleled properties of alpha 7 homomers expressed in Xenopus oocytes. Human alpha 7 homomers exhibited rapidly desensitizing, inwardly rectifying, agonist-induced, cation currents that triggered Ca(2+)-sensitive Cl- channels in the oocytes. A change in efficacy from partial agonist for chicken alpha 7 homomers to full agonist for human alpha 7 homomers was exhibited by 1,1-dimethyl-4-phenylpiperazinium. This result reveals a large species-specific pharmacological difference, despite small differences in alpha 7 sequences. This is important for understanding the effects of these drugs in humans and for identifying amino acids that may contribute to the acetylcholine binding site, for analysis by in vitro mutagenesis. These results also characterize properties of native alpha 7 receptors and alpha 7 homomers that will provide criteria for functional properties expected of structural subunits, when these can be identified, cloned, and coexpressed with alpha 7 subunits.

  14. Multi site polyadenylation and transcriptional response to stress of a vacuolar type H+-ATPase subunit A gene in Arabidopsis thaliana

    PubMed Central

    Magnotta, Scot M; Gogarten, Johann Peter

    2002-01-01

    Background Vacuolar type H+-ATPases play a critical role in the maintenance of vacuolar homeostasis in plant cells. V-ATPases are also involved in plants' defense against environmental stress. This research examined the expression and regulation of the catalytic subunit of the vacuolar type H+-ATPase in Arabidopsis thaliana and the effect of environmental stress on multiple transcripts generated by this gene. Results Evidence suggests that subunit A of the vacuolar type H+-ATPase is encoded by a single gene in Arabidopsis thaliana. Genome blot analysis showed no indication of a second subunit A gene being present. The single gene identified was shown by whole RNA blot analysis to be transcribed in all organs of the plant. Subunit A was shown by sequencing the 3' end of multiple cDNA clones to exhibit multi site polyadenylation. Four different poly (A) tail attachment sites were revealed. Experiments were performed to determine the response of transcript levels for subunit A to environmental stress. A PCR based strategy was devised to amplify the four different transcripts from the subunit A gene. Conclusions Amplification of cDNA generated from seedlings exposed to cold, salt stress, and etiolation showed that transcript levels for subunit A of the vacuolar type H+-ATPase in Arabidopsis were responsive to stress conditions. Cold and salt stress resulted in a 2–4 fold increase in all four subunit A transcripts evaluated. Etiolation resulted in a slight increase in transcript levels. All four transcripts appeared to behave identically with respect to stress conditions tested with no significant differential regulation. PMID:11985780

  15. Identification and cloning of a gamma 3 subunit splice variant of the human GABA(A) receptor.

    PubMed

    Poulsen, C F; Christjansen, K N; Hastrup, S; Hartvig, L

    2000-05-31

    cDNA sequences encoding two forms of the GABA(A) gamma 3 receptor subunit were cloned from human hippocampus. The nucleotide sequences differ by the absence (gamma 3S) or presence (gamma 3L) of 18 bp located in the presumed intracellular loop between transmembrane region (TM) III and IV. The extra 18 bp in the gamma 3L subunit generates a consensus site for phosphorylation by protein kinase C (PKC). Analysis of human genomic DNA encoding the gamma 3 subunit reveals that the 18 bp insert is contiguous with the upstream proximal exon.

  16. Molecular characterization of cDNAs encoding G protein alpha and beta subunits and study of their temporal and spatial expression patterns in Nicotiana plumbaginifolia Viv.

    PubMed

    Kaydamov, C; Tewes, A; Adler, K; Manteuffel, R

    2000-04-25

    We have isolated cDNA sequences encoding alpha and beta subunits of potential G proteins from a cDNA library prepared from somatic embryos of Nicotiana plumbaginifolia Viv. at early developmental stages. The predicted NPGPA1 and NPGPB1 gene products are 75-98% identical to the known respective plant alpha and beta subunits. Southern hybridizations indicate that NPGPA1 is probably a single-copy gene, whereas at least two copies of NPGPB1 exist in the N. plumbaginifolia genome. Northern analyses reveal that both NPGPA1 and NPGPB1 mRNA are expressed in all embryogenic stages and plant tissues examined and their expression is obviously regulated by the plant hormone auxin. Immunohistological localization of NPGPalpha1 and NPGPbeta1 preferentially on plasma and endoplasmic reticulum membranes and their immunochemical detection exclusively in microsomal cell fractions implicate membrane association of both proteins. The temporal and spatial expression patterns of NPGPA1 and NPGPB1 show conformity as well as differences. This could account for not only cooperative, but also individual activities of both subunits during embryogenesis and plant development.

  17. Some properties and cDNA cloning of proteinaceous toxins from two species of lionfish (Pterois antennata and Pterois volitans).

    PubMed

    Kiriake, Aya; Shiomi, Kazuo

    2011-11-01

    Lionfish, members of the genera Pterois, Parapterois and Dendrochirus, are well known to be venomous, having venomous glandular tissues in dorsal, pelvic and anal spines. The lionfish toxins have been shown to cross-react with the stonefish toxins by neutralization tests using the commercial stonefish antivenom, although their chemical properties including structures have been little characterized. In this study, an antiserum against neoverrucotoxin, the stonefish Synanceia verrucosa toxin, was first raised in a guinea pig and used in immunoblotting and inhibition immunoblotting to confirm that two species of Pterois lionfish (P. antennata and P. volitans) contain a 75kDa protein (corresponding to the toxin subunit) cross-reacting with neoverrucotoxin. Then, the amino acid sequences of the P. antennata and P. volitans toxins were successfully determined by cDNA cloning using primers designed from the highly conserved sequences of the stonefish toxins. Notably, either α-subunits (699 amino acid residues) or β-subunits (698 amino acid residues) of the P. antennata and P. volitans toxins share as high as 99% sequence identity with each other. Furthermore, both α- and β-subunits of the lionfish toxins exhibit high sequence identity (70-80% identity) with each other and also with the β-subunits of the stonefish toxins. As reported for the stonefish toxins, the lionfish toxins also contain a B30.2/SPRY domain (comprising nearly 200 amino acid residues) in the C-terminal region of each subunit. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Transduction of beta3 integrin subunit cDNA confers on human keratinocytes the ability to adhere to gelatin.

    PubMed

    Kubo, Miyoko; Clark, Richard A F; Katz, Anne B; Taichman, Lorne B; Jin, Zaishun; Zhao, Ying; Moriguchi, Takahiko

    2007-04-01

    alphavbeta3 is a multiligand integrin receptor that interacts with fibrinogen (FG), fibrin (FB), fibronectin (FN), vitronectin (VN), and denatured collagen. We previously reported that cultured normal human keratinocytes, like in vivo keratinocytes, do not express alphavbeta3 on the cell surface, and do not adhere to and migrate on FG and FB. Furthermore, we reported that human keratinocytes transduced with beta3 integrin subunit cDNA by a retrovirus-mediated transduction method express alphavbeta3 on the cell surface and adhere to FG, FB, FN, and VN significantly compared with beta-galactosidase (beta-gal) cDNA-transduced keratinocytes (control). In this study, we determined whether these beta3 integrin subunit cDNA-transduced keratinocytes or normal human keratinocytes adhere to denatured collagen (gelatin) using a 1 h cell adhesion assay. beta3 cDNA-transduced keratinocytes adhered to gelatin, whereas no significant adhesion was observed with the control cells (beta-gal cDNA-transduced keratinocytes and normal human keratinocytes). The adhesion to gelatin was inhibited by LM609, a monoclonal antibody to alphavbeta3, and RGD peptides but not by normal mouse IgG1 nor RGE peptides. Thus, transduction of beta3 integrin subunit cDNA confers on human keratinocytes the ability to adhere to denatured collagen (gelatin) as well as to FG, FB, VN, and FN. Otherwise, normal human keratinocytes do not adhere to gelatin. These data support the idea that beta3 cDNA-transduced human keratinocytes can be a good material for cultured epithelium to achieve better take rate with acute or chronic wounds, in which FG, FB, and denatured collagen are abundantly present.

  19. Human molybdopterin synthase gene: identification of a bicistronic transcript with overlapping reading frames.

    PubMed Central

    Stallmeyer, B; Drugeon, G; Reiss, J; Haenni, A L; Mendel, R R

    1999-01-01

    A universal molybdenum-containing cofactor (MoCo) is essential for the activity of all human molybdoenzymes, including sulphite oxidase. The free cofactor is highly unstable, and all organisms share a similar biosynthetic pathway. The involved enzymes exhibit homologies, even between bacteria and humans. We have exploited these homologies to isolate a cDNA for the heterodimeric molybdopterin (MPT)-synthase. This enzyme is necessary for the conversion of an unstable precursor into molybdopterin, the organic moiety of MoCo. The corresponding transcript shows a bicistronic structure, encoding the small and large subunits of the MPT-synthase in two different open reading frames (ORFs) that overlap by 77 nucleotides. In various human tissues, only one size of mRNA coinciding with the bicistronic transcript was detected. In vitro translation and mutagenesis experiments demonstrated that each ORF is translated independently, leading to the synthesis of a 10-kDa protein and a 21-kDa protein for the small and large subunits, respectively, and indicated that the 3'-proximal ORF of the bicistronic transcript is translated by leaky scanning. PMID:10053003

  20. Role of mp 17O Seprase in Breast Cancer.

    DTIC Science & Technology

    1998-07-01

    identical subunits of MT 97 kDa. Recent evidence indicated that the Seprase subunit is identical to Fibroblast Activation Protein a ( FAPa ). To characterize...and define the role of this molecule in cancer, human Seprase/ FAPa cDNA was cloned and stable transfected in two human epithelial carcinoma cell lines...SW-13 and MCF-7. Unexpectedly, overexpression of Seprase/ FAPa has no apparent effect on the proliferation, matrix adhesion and matrigel invasion of

  1. Cloning and sequence analysis of a full-length cDNA of SmPP1cb encoding turbot protein phosphatase 1 beta catalytic subunit

    NASA Astrophysics Data System (ADS)

    Qi, Fei; Guo, Huarong; Wang, Jian

    2008-02-01

    Reversible protein phosphorylation, catalyzed by protein kinases and phosphatases, is an important and versatile mechanism by which eukaryotic cells regulate almost all the signaling processes. Protein phosphatase 1 (PP1) is the first and well-characterized member of the protein serine/threonine phosphatase family. In the present study, a full-length cDNA encoding the beta isoform of the catalytic subunit of protein phosphatase 1(PP1cb), was for the first time isolated and sequenced from the skin tissue of flatfish turbot Scophthalmus maximus, designated SmPP1cb, by the rapid amplification of cDNA ends (RACE) technique. The cDNA sequence of SmPP1cb we obtained contains a 984 bp open reading frame (ORF), flanked by a complete 39 bp 5' untranslated region and 462 bp 3' untranslated region. The ORF encodes a putative 327 amino acid protein, and the N-terminal section of this protein is highly acidic, Met-Ala-Glu-Gly-Glu-Leu-Asp-Val-Asp, a common feature for PP1 catalytic subunit but absent in protein phosphatase 2B (PP2B). And its calculated molecular mass is 37 193 Da and pI 5.8. Sequence analysis indicated that, SmPP1cb is extremely conserved in both amino acid and nucleotide acid levels compared with the PP1cb of other vertebrates and invertebrates, and its Kozak motif contained in the 5'UTR around ATG start codon is GXXAXXGXX ATGG, which is different from mammalian in two positions A-6 and G-3, indicating the possibility of different initiation of translation in turbot, and also the 3'UTR of SmPP1cb is highly diverse in the sequence similarity and length compared with other animals, especially zebrafish. The cloning and sequencing of SmPP1cb gene lays a good foundation for the future work on the biological functions of PP1 in the flatfish turbot.

  2. Escaping introns in COI through cDNA barcoding of mushrooms: Pleurotus as a test case.

    PubMed

    Avin, Farhat A; Subha, Bhassu; Tan, Yee-Shin; Braukmann, Thomas W A; Vikineswary, Sabaratnam; Hebert, Paul D N

    2017-09-01

    DNA barcoding involves the use of one or more short, standardized DNA fragments for the rapid identification of species. A 648-bp segment near the 5' terminus of the mitochondrial cytochrome c oxidase subunit I (COI) gene has been adopted as the universal DNA barcode for members of the animal kingdom, but its utility in mushrooms is complicated by the frequent occurrence of large introns. As a consequence, ITS has been adopted as the standard DNA barcode marker for mushrooms despite several shortcomings. This study employed newly designed primers coupled with cDNA analysis to examine COI sequence diversity in six species of Pleurotus and compared these results with those for ITS. The ability of the COI gene to discriminate six species of Pleurotus , the commonly cultivated oyster mushroom, was examined by analysis of cDNA. The amplification success, sequence variation within and among species, and the ability to design effective primers was tested. We compared ITS sequences to their COI cDNA counterparts for all isolates. ITS discriminated between all six species, but some sequence results were uninterpretable, because of length variation among ITS copies. By comparison, a complete COI sequences were recovered from all but three individuals of Pleurotus giganteus where only the 5' region was obtained. The COI sequences permitted the resolution of all species when partial data was excluded for P. giganteus . Our results suggest that COI can be a useful barcode marker for mushrooms when cDNA analysis is adopted, permitting identifications in cases where ITS cannot be recovered or where it offers higher resolution when fresh tissue is. The suitability of this approach remains to be confirmed for other mushrooms.

  3. Expression of the leukemia-associated CBF{beta}/SMMHC chimeric gene causes transformation of 3T3 cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Hajra, A.; Liu, P.; Collins, E.S.

    1994-09-01

    A pericentric inversion of chromosome 16 (inv(16)(p13;q22)) is consistently seen in acute myeloid leukemia of the M4Eo subtype. This inversion fuses almost the entire coding region of the gene encoding of the {beta} subunit of the heterodimeric transcription factor CBF/PEBP2 to the region of the MYH11 gene encoding the rod domain for the smooth muscle myosin heavy chain (SMMHC). To investigate the biological properties of the CBF{beta}/SMMHC fusion protein, we have generated 3T3 cell lines that stably express the CBF{beta}/SMMHC chimeric cDNA or the normal, nonchimeric CBF{beta} and SMMHC cDNAs. 3T3 cells expressing CBF{beta}/SMMHC acquire a transformed phenotype, as indicatedmore » by altered cell morphology, formation of foci, and growth in soft agar. Cells constitutively overexpressing the normal CBF{beta} cDNA or the rod region of SMMHC remain nontransformed. Western blot analysis using antibodies to CBF{beta} and the SMMHC rod demonstrates that stably transfected cells express the appropriate chimeric or normal protein. Electrophoretic mobility shift assays reveal that cells transformed by the chimeric cDNA do not have a CBF-DNA complex of the expected mobility, but instead contain a large complex with CBF DNA-binding activity that fails to migrate out of the gel wells. In order to define the regions of CBF{beta}/SMMHC necessary for 3T3 transformation, we have stably transfected cells with mutant CBF{beta}/SMMHC cDNAs containing various deletions of the coding region. Analysis of these cell lines indicates that the transformation property of CBF{beta}/SMMHC requires regions of CBF{beta} known to be necessary for association with the DNA-binding CBF{alpha} subunit, and also requires an intact SMMHC carboxyl terminus, which is necessary for formation of the coiled coil domain of the myosin rod.« less

  4. Stress and transcriptional regulation of tick ferritin HC.

    PubMed

    Mulenga, A; Simser, J A; Macaluso, K R; Azad, A F

    2004-08-01

    We previously identified a partial Dermacentor variabilis cDNA encoding ferritin HC (HC) subunit homolog (DVFER) that was differentially upregulated in Rickettsia montanensis infected ticks (Mulenga et al., 2003a). We have used rapid amplification of cDNA ends to clone full-length DVFER cDNA and its apparent ortholog from the wood tick, D. andersoni (DAFER), both of which show high sequence similarity to vertebrate than insect ferritin. Both DVFER and DAFER contain the stem-loop structure of a putative iron responsive element in the 5' untranslated region (nucleotide positions, 16-42) and the feroxidase centre loop typical for vertebrate ferritin HC subunits. Quantitative Western and Northern blotting analyses of protein and RNA from unfed and partially fed whole tick as well as dissected tick tissues demonstrated that DVFER is constitutively and ubiquitously expressed. Based on densitometric analysis of detected protein and mRNA bands, DVFER is predominantly expressed in the midgut, and to a lesser extent in the salivary glands, ovary and fatbody. Sham treatment (mechanical injury) and Escherichia coli challenge of D. variabilis ticks stimulated statistically significant (approximately 1.5- and approximately 3.0-fold, respectively) increases in DVFER mRNA abundance over time point matched naive control ticks. These data suggest that DVFER mRNA is nonspecifically up regulated in response to mechanical injury or bacterial infection induced stress.

  5. The cytochrome oxidase subunit I and subunit III genes in Oenothera mitochondria are transcribed from identical promoter sequences

    PubMed Central

    Hiesel, Rudolf; Schobel, Werner; Schuster, Wolfgang; Brennicke, Axel

    1987-01-01

    Two loci encoding subunit III of the cytochrome oxidase (COX) in Oenothera mitochondria have been identified from a cDNA library of mitochondrial transcripts. A 657-bp sequence block upstream from the open reading frame is also present in the two copies of the COX subunit I gene and is presumably involved in homologous sequence rearrangement. The proximal points of sequence rearrangements are located 3 bp upstream from the COX I and 1139 bp upstream from the COX III initiation codons. The 5'-termini of both COX I and COX III mRNAs have been mapped in this common sequence confining the promoter region for the Oenothera mitochondrial COX I and COX III genes to the homologous sequence block. ImagesFig. 5. PMID:15981332

  6. [Tonoplast transport and salt tolerance in plants

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Taiz, L.

    1993-01-01

    We have showed that the tonoplast V-ATPase could be specifically inhibited by antisense DNA to the catalytic (A) subunit; that cell expansion was inhibited in carrot transformants deficient in the enzyme and have provided evidence for at least two different isoforms of the A subunit which are Golgi- and tonoplast-specific. These findings prompted a search for sequences of the isoforms of the A subunit in carrot. We have cloned and sequenced 1.0--1.5 kb fragments of three different genes for the catalytic subunit, the fragments differ greatly in their introns, but have nearly identical exons. We are using PCR to amplifymore » and subclone carrot seedling cDNA. Thus far two bands have been amplified and are currently being subcloned for sequencing.« less

  7. [Tonoplast transport and salt tolerance in plants]. Progress report

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Taiz, L.

    1993-04-01

    We have showed that the tonoplast V-ATPase could be specifically inhibited by antisense DNA to the catalytic (A) subunit; that cell expansion was inhibited in carrot transformants deficient in the enzyme and have provided evidence for at least two different isoforms of the A subunit which are Golgi- and tonoplast-specific. These findings prompted a search for sequences of the isoforms of the A subunit in carrot. We have cloned and sequenced 1.0--1.5 kb fragments of three different genes for the catalytic subunit, the fragments differ greatly in their introns, but have nearly identical exons. We are using PCR to amplifymore » and subclone carrot seedling cDNA. Thus far two bands have been amplified and are currently being subcloned for sequencing.« less

  8. The diversity and evolution of chelicerate hemocyanins

    PubMed Central

    2012-01-01

    Background Oxygen transport in the hemolymph of many arthropod species is facilitated by large copper-proteins referred to as hemocyanins. Arthropod hemocyanins are hexamers or oligomers of hexamers, which are characterized by a high O2 transport capacity and a high cooperativity, thereby enhancing O2 supply. Hemocyanin subunit sequences had been available from horseshoe crabs (Xiphosura) and various spiders (Araneae), but not from any other chelicerate taxon. To trace the evolution of hemocyanins and the emergence of the large hemocyanin oligomers, hemocyanin cDNA sequences were obtained from representatives of selected chelicerate classes. Results Hemocyanin subunits from a sea spider, a scorpion, a whip scorpion and a whip spider were sequenced. Hemocyanin has been lost in Opiliones, Pseudoscorpiones, Solifugae and Acari, which may be explained by the evolution of trachea (i.e., taxon Apulmonata). Bayesian phylogenetic analysis was used to reconstruct the evolution of hemocyanin subunits and a relaxed molecular clock approach was applied to date the major events. While the sea spider has a simple hexameric hemocyanin, four distinct subunit types evolved before Xiphosura and Arachnida diverged around 470 Ma ago, suggesting the existence of a 4 × 6mer at that time. Subsequently, independent gene duplication events gave rise to the other distinct subunits in each of the 8 × 6mer hemocyanin of Xiphosura and the 4 × 6mer of Arachnida. The hemocyanin sequences were used to infer the evolutionary history of chelicerates. The phylogenetic trees support a basal position of Pycnogonida, a sister group relationship of Xiphosura and Arachnida, and a sister group relationship of the whip scorpions and the whip spiders. Conclusion Formation of a complex hemocyanin oligomer commenced early in the evolution of euchelicerates. A 4 × 6mer hemocyanin consisting of seven subunit types is conserved in most arachnids since more than 400 Ma, although some entelegyne spiders display selective subunit loss and independent oligomerization. Hemocyanins also turned out to be a good marker to trace chelicerate evolution, which is, however, limited by the loss of hemocyanin in some taxa. The molecular clock calculations were in excellent agreement with the fossil record, also demonstrating the applicability of hemocyanins for such approach. PMID:22333134

  9. Expression of glutathione peroxidase I gene in selenium-deficient rats.

    PubMed Central

    Reddy, A P; Hsu, B L; Reddy, P S; Li, N Q; Thyagaraju, K; Reddy, C C; Tam, M F; Tu, C P

    1988-01-01

    We have characterized a cDNA pGPX1211 encoding rat glutathione peroxidase I. The selenocysteine in the protein corresponded to a TGA codon in the coding region of the cDNA, similar to earlier findings in mouse and human genes, and a gene encoding the formate dehydrogenase from E. coli, another selenoenzyme. The rat GSH peroxidase I has a calculated subunit molecular weight of 22,155 daltons and shares 95% and 86% sequence homology with the mouse and human subunits, respectively. The 3'-noncoding sequence (greater than 930 bp) in pGPX1211 is much longer than that of the human sequences. We found that glutathione peroxidase I mRNA, but not the polypeptide, was expressed under nutritional stress of selenium deficiency where no glutathione peroxidase I activity can be detected. The failure of detecting any apoprotein for the glutathione peroxidase I under selenium deficiency and results published from other laboratories supports the proposal that selenium may be incorporated into the glutathione peroxidase I co-translationally. Images PMID:2838821

  10. Molecular cloning and developmental expression of the catalytic and 65-kDa regulatory subunits of protein phosphatase 2A in Drosophila.

    PubMed Central

    Mayer-Jaekel, R E; Baumgartner, S; Bilbe, G; Ohkura, H; Glover, D M; Hemmings, B A

    1992-01-01

    cDNA clones encoding the catalytic subunit and the 65-kDa regulatory subunit of protein phosphatase 2A (PR65) from Drosophila melanogaster have been isolated by homology screening with the corresponding human cDNAs. The Drosophila clones were used to analyze the spatial and temporal expression of the transcripts encoding these two proteins. The Drosophila PR65 cDNA clones contained an open reading frame of 1773 nucleotides encoding a protein of 65.5 kDa. The predicted amino acid sequence showed 75 and 71% identity to the human PR65 alpha and beta isoforms, respectively. As previously reported for the mammalian PR65 isoforms, Drosophila PR65 is composed of 15 imperfect repeating units of approximately 39 amino acids. The residues contributing to this repeat structure show also the highest sequence conservation between species, indicating a functional importance for these repeats. The gene encoding Drosophila PR65 was located at 29B1,2 on the second chromosome. A major transcript of 2.8 kilobase (kb) encoding the PR65 subunit and two transcripts of 1.6 and 2.5 kb encoding the catalytic subunit could be detected throughout Drosophila development. All of these mRNAs were most abundant during early embryogenesis and were expressed at lower levels in larvae and adult flies. In situ hybridization of different developmental stages showed a colocalization of the PR65 and catalytic subunit transcripts. The mRNA expression is high in the nurse cells and oocytes, consistent with a high equally distributed expression in early embryos. In later embryonal development, the expression remains high in the nervous system and the gonads but the overall transcript levels decrease. In third instar larvae, high levels of mRNA could be observed in brain, imaginal discs, and in salivary glands. These results indicate that protein phosphatase 2A transcript levels change during development in a tissue and in a time-specific manner. Images PMID:1320961

  11. Expression of the 68-kilodalton neurofilament gene in aluminum intoxication

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Muma, N.A.; Troncoso, J.C.; Hoffman, P.N.

    1986-03-01

    Intrathecal administration of aluminum salts induces accumulation of neurofilaments (NFs) in cell bodies and proximal axons of rabbit spinal motor neurons. Mechanisms leading to this pathological change are not well understood. Although impairments of NF transport have been demonstrated in this model, the hypothesis that NF accumulations are the result of an increase in NF synthesis needs to be explored. In rabbits, a large percentage of neurons develop accumulations of NFs following injections of aluminum lactate directly into the cisterna magna or into a reservoir placed in the lateral ventricle. To study levels of mRNA encoding cytoskeletal proteins, spinal cordmore » RNA was extracted, separated on a denaturing agarose gel, transferred to nitrocellulose paper, and hybridized to (/sup 32/P)-labeled cDNA clones encoding the mouse 68-kilodalton (kd) NF subunit and tubulin. Examining a constant amount of RNA, the radioactivity of labeled mRNA bands for the 68-kd NF subunit and for tubulin was decreased in spinal cords of aluminum-treated rabbits. These preliminary results will be followed up by in situ hybridization to determine levels of mRNA for tubulin and 68-kd NF subunit in affected and in normal spinal neurons. In conclusion, administration of aluminum decreased mRNA for the 608-kd NF protein in spinal neurons.« less

  12. Characterization of two forms of mouse salivary androgen-binding protein (ABP): implications for evolutionary relationships and ligand-binding function.

    PubMed

    Karn, Robert C; Laukaitis, Christina M

    2003-06-17

    Mouse salivary androgen-binding protein (ABP) is a member of the secretoglobin family produced in the submaxillary glands of house mice (Mus musculus). We report the cDNA sequences and amino acid sequences of the beta and gamma subunits of ABP from a mouse cDNA library, identifying the two subunits by their pIs and molecular weights. An anomalously high molecular weight of the alpha subunit is likely due to glycosylation at a single site. A phylogenetic comparison of the three subunits of ABP with the chains of other mammalian secretoglobins shows that ABP is most closely related to mouse lachrymal protein and to the major cat allergen Fel dI. An evaluation of the most conserved residues in ABP and the other secretoglobins, in light of structural data reported by others [Callebaut, I., Poupon, A., Bally, R., Demaret, J.-P., Housset, D., Delettre, J., Hossenlopp, P., and Mornon, J.-P. (2000) Ann. N.Y. Acad. Sci. 923, 90-112; Pattabiraman, N., Matthews, J., Ward, K., Mantile-Selvaggi, G., Miele, L., and Mukherjee, A. (2000) Ann. N.Y. Acad. Sci. 923, 113-127], allows us to draw conclusions about the critical residues important in ligand binding by the two different ABP dimers and to assess the importance of ligand binding in the function of the molecule. In addition to the cDNAs, which represent those of the musculus subspecies of Mus musculus, we also report the coding regions of the beta and gamma subunit cDNAs from two other mouse inbred strains which represent the other two subspecies: M. musculus domesticus and M. musculus castaneus. The high nonsynonymous/synonymous substitution rate ratios (K(a)/K(s)) for both the beta and gamma subunits suggest that these two proteins are evolving under strong directional selection, as has been reported for the alpha subunit [Hwang, J., Hofstetter, J., Bonhomme, F., and Karn, R. (1997) J. Hered. 88, 93-97; Karn, R., and Clements, M. (1999) Biochem. Genet. 37, 187-199].

  13. Cloning and characterization of Sdga gene encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex in Scoparia dulcis.

    PubMed

    Shite, Masato; Yamamura, Yoshimi; Hayashi, Toshimitsu; Kurosaki, Fumiya

    2008-11-01

    A homology-based cloning strategy yielded Sdga, a cDNA clone presumably encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex, from leaf tissues of Scoparia dulcis. Phylogenetic tree analysis of G-protein alpha-subunits from various biological sources suggested that, unlike in animal cells, classification of Galpha-proteins into specific subfamilies could not be applicable to the proteins from higher plants. Restriction digests of genomic DNA of S. dulcis showed a single hybridized signal in Southern blot analysis, suggesting that Sdga is a sole gene encoding Galpha-subunit in this plant. The expression level of Sdga appeared to be maintained at almost constant level after exposure of the leaves to methyl jasmonate as analyzed by reverse-transcription polymerase chain reaction. These results suggest that Sdga plays roles in methyl jasmonate-induced responses of S. dulcis without a notable change in the transcriptional level.

  14. Suppression of the heterotrimeric G protein causes abnormal morphology, including dwarfism, in rice

    PubMed Central

    Fujisawa, Yukiko; Kato, Teruhisa; Ohki, Shizuka; Ishikawa, Atsushi; Kitano, Hidemi; Sasaki, Takuji; Asahi, Tadashi; Iwasaki, Yukimoto

    1999-01-01

    Transgenic rice containing an antisense cDNA for the α subunit of rice heterotrimeric G protein produced little or no mRNA for the subunit and exhibited abnormal morphology, including dwarf traits and the setting of small seeds. In normal rice, the mRNA for the α subunit was abundant in the internodes and florets, the tissues closely related to abnormality in the dwarf transformants. The position of the α-subunit gene was mapped on rice chromosome 5 by mapping with the restriction fragment length polymorphism. The position was closely linked to the locus of a rice dwarf mutant, Daikoku dwarf (d-1), which is known to exhibit abnormal phenotypes similar to those of the transformants that suppressed the endogenous mRNA for the α subunit by antisense technology. Analysis of the cDNAs for the α subunits of five alleles of Daikoku dwarf (d-1), ID-1, DK22, DKT-1, DKT-2, and CM1361–1, showed that these dwarf mutants had mutated in the coding region of the α-subunit gene. These results show that the G protein functions in the formation of normal internodes and seeds in rice. PMID:10377457

  15. The Aged Microenvironment Influences Prostate Carcinogenesis

    DTIC Science & Technology

    2009-12-01

    Pcdhb4 protocadherin beta 4 NM_053129 -2.3 BC068157 cDNA sequence BC068157 NM_207203 -2.3 Bub1 budding uninhibited by benzimidazoles 1 NM_009772...protein phosphatase 2, regulatory subunit B NM_028392 -2.1 Bub3 budding uninhibited by benzimidazoles 3 AK083742 -2.1 Kif4 kinesin family member 4

  16. Identification and characterization of the DNA replication origin recognition complex gene family in the silkworm Bombyx mori.

    PubMed

    Yang, Hui-Peng; Luo, Su-Juan; Li, Yi-Nü; Zhang, Yao-Zhou; Zhang, Zhi-Fang

    2011-10-01

    The ORC (origin recognition complex) binds to the DNA replication origin and recruits other replication factors to form the pre-replication complex. The cDNA and genomic sequences of all six subunits of ORC in Bombyx mori (BmORC1-6) were determined by RACE (rapid amplification of cDNA ends) and bioinformatic analysis. The conserved domains were identified in BmOrc1p-6p and the C-terminal of BmOrc6p features a short sequence that may be specific for Lepidoptera. As in other organisms, each of the six BmORC subunits had evolved individually from ancestral genes in early eukaryotes. During embryo development, the six genes were co-regulated, but different ratios of the abundance of mRNAs were observed in 13 tissues of the fifth instar day-6 larvae. Infection by BmNPV (B. mori nucleopolyhedrovirus) initially decreased and then increased the abundance of BmORC. We suggest that some of the BmOrc proteins may have additional functions and that BmOrc proteins participate in the replication of BmNPV.

  17. Isolation and characterization of cDNA clones for human erythrocyte beta-spectrin.

    PubMed Central

    Prchal, J T; Morley, B J; Yoon, S H; Coetzer, T L; Palek, J; Conboy, J G; Kan, Y W

    1987-01-01

    Spectrin is an important structural component of the membrane skeleton that underlies and supports the erythrocyte plasma membrane. It is composed of nonidentical alpha (Mr 240,000) and beta (Mr 220,000) subunits, each of which contains multiple homologous 106-amino acid segments. We report here the isolation and characterization of a human erythroid-specific beta-spectrin cDNA clone that encodes parts of the beta-9 through beta-12 repeat segments. This cDNA was used as a hybridization probe to assign the beta-spectrin gene to human chromosome 14 and to begin molecular analysis of the gene and its mRNA transcripts. RNA transfer blot analysis showed that the reticulocyte beta-spectrin mRNA is 7.8 kilobases in length. Southern blot analysis of genomic DNA revealed the presence of restriction fragment length polymorphisms (RFLPs) within the beta-spectrin gene locus. The isolation of human spectrin cDNA probes and the identification of closely linked RFLPs will facilitate analysis of mutant spectrin genes causing congenital hemolytic anemias associated with quantitative and qualitative spectrin abnormalities. Images PMID:3478706

  18. Polysome Immunoselection Combined with cDNA Cloning to Obtain Specific Genes from Chlamydomonas reinhardtii

    DTIC Science & Technology

    1989-02-05

    speclficlty of an avallable antitody (IgG) aginst the ribulose bisphosphate carboxylase sma"Ll subunit ( RUBISCO SSU). First, polysomal poly A+) RNA was...Lnlunopreclpitated by the antibody is the same size as the precursor of the RUBISCO S&U ,Fig. ,. When intact polysones were added to the wheat germ

  19. cDNA cloning of rat and human medium chain acyl-CoA dehydrogenase (MCAD)

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Matsubara, Y.; Kraus, J.P.; Rosenberg, L.E.

    MCAD is one of three mitochondrial flavoenzymes which catalyze the first step in the ..beta..-oxidation of straight chain fatty acids. It is a tetramer with a subunit Mr of 45 kDa. MCAD is synthesized in the cytosol as a 49 kDa precursor polypeptide (pMCAD), imported into mitochondria, and cleaved to the mature form. Genetic deficiency of MCAD causes recurrent episodes of hypoglycemic coma accompanied by medium chain dicarboxylic aciduria. Employing a novel approach, the authors now report isolation of partial rat and human cDNA clones encoding pMCAD. mRNA encoding pMCAD was purified to near homogeneity by polysome immunoadsorption using polyclonalmore » monospecific antibody. Single-stranded (/sup 32/P)labeled cDNA probe was synthesized using the enriched mRNA as template, and was used to screen directly 16,000 colonies from a total rat liver cDNA library constructed in pBR322. One clone (600 bp) was detected by in situ hybridization. Hybrid-selected translation with this cDNA yielded a 49 kDa polypeptide indistinguishable in size from rat pMCAD and immunoprecipitable with anti-MCAD antibody. Using the rat cDNA as probe, 43,000 colonies from a human liver cDNA library were screened. Four identical positive clones (400 bp) were isolated and positively identified by hybrid-selected translation and immunoprecipitation. The sizes of rat and human mRNAs encoding pMCAD were 2.2 kb and 2.4 kb, respectively, as determined by Northern blotting.« less

  20. The over-expression of the β2 catalytic subunit of the proteasome decreases homologous recombination and impairs DNA double-strand break repair in human cells.

    PubMed

    Collavoli, Anita; Comelli, Laura; Cervelli, Tiziana; Galli, Alvaro

    2011-01-01

    By a human cDNA library screening, we have previously identified two sequences coding two different catalytic subunits of the proteasome which increase homologous recombination (HR) when overexpressed in the yeast Saccharomyces cerevisiae. Here, we investigated the effect of proteasome on spontaneous HR and DNA repair in human cells. To determine if the proteasome has a role in the occurrence of spontaneous HR in human cells, we overexpressed the β2 subunit of the proteasome in HeLa cells and determined the effect on intrachromosomal HR. Results showed that the overexpression of β2 subunit decreased HR in human cells without altering the cell proteasome activity and the Rad51p level. Moreover, exposure to MG132 that inhibits the proteasome activity reduced HR in human cells. We also found that the expression of the β2 subunit increases the sensitivity to the camptothecin that induces DNA double-strand break (DSB). This suggests that the β2 subunit has an active role in HR and DSB repair but does not alter the intracellular level of the Rad51p.

  1. The Over-expression of the β2 Catalytic Subunit of the Proteasome Decreases Homologous Recombination and Impairs DNA Double-Strand Break Repair in Human Cells

    PubMed Central

    Collavoli, Anita; Comelli, Laura; Cervelli, Tiziana; Galli, Alvaro

    2011-01-01

    By a human cDNA library screening, we have previously identified two sequences coding two different catalytic subunits of the proteasome which increase homologous recombination (HR) when overexpressed in the yeast Saccharomyces cerevisiae. Here, we investigated the effect of proteasome on spontaneous HR and DNA repair in human cells. To determine if the proteasome has a role in the occurrence of spontaneous HR in human cells, we overexpressed the β2 subunit of the proteasome in HeLa cells and determined the effect on intrachromosomal HR. Results showed that the overexpression of β2 subunit decreased HR in human cells without altering the cell proteasome activity and the Rad51p level. Moreover, exposure to MG132 that inhibits the proteasome activity reduced HR in human cells. We also found that the expression of the β2 subunit increases the sensitivity to the camptothecin that induces DNA double-strand break (DSB). This suggests that the β2 subunit has an active role in HR and DSB repair but does not alter the intracellular level of the Rad51p. PMID:21660142

  2. The general mitochondrial processing peptidase from potato is an integral part of cytochrome c reductase of the respiratory chain.

    PubMed Central

    Braun, H P; Emmermann, M; Kruft, V; Schmitz, U K

    1992-01-01

    The major mitochondrial processing activity removing presequences from nuclear encoded precursor proteins is present in the soluble fraction of fungal and mammalian mitochondria. We found that in potato, this activity resides in the inner mitochondrial membrane. Surprisingly, the proteolytic activity co-purifies with cytochrome c reductase, a protein complex of the respiratory chain. The purified complex is bifunctional, as it has the ability to transfer electrons from ubiquinol to cytochrome c and to cleave off the presequences of mitochondrial precursor proteins. In contrast to the nine subunit fungal complex, cytochrome c reductase from potato comprises 10 polypeptides. Protein sequencing of peptides from individual subunits and analysis of corresponding cDNA clones reveals that subunit III of cytochrome c reductase (51 kDa) represents the general mitochondrial processing peptidase. Images PMID:1324169

  3. 3' rapid amplification of cDNA ends (RACE) walking for rapid structural analysis of large transcripts.

    PubMed

    Ozawa, Tatsuhiko; Kondo, Masato; Isobe, Masaharu

    2004-01-01

    The 3' rapid amplification of cDNA ends (3' RACE) is widely used to isolate the cDNA of unknown 3' flanking sequences. However, the conventional 3' RACE often fails to amplify cDNA from a large transcript if there is a long distance between the 5' gene-specific primer and poly(A) stretch, since the conventional 3' RACE utilizes 3' oligo-dT-containing primer complementary to the poly(A) tail of mRNA at the first strand cDNA synthesis. To overcome this problem, we have developed an improved 3' RACE method suitable for the isolation of cDNA derived from very large transcripts. By using the oligonucleotide-containing random 9mer together with the GC-rich sequence for the suppression PCR technology at the first strand of cDNA synthesis, we have been able to amplify the cDNA from a very large transcript, such as the microtubule-actin crosslinking factor 1 (MACF1) gene, which codes a transcript of 20 kb in size. When there is no splicing variant, our highly specific amplification allows us to perform the direct sequencing of 3' RACE products without requiring cloning in bacterial hosts. Thus, this stepwise 3' RACE walking will help rapid characterization of the 3' structure of a gene, even when it encodes a very large transcript.

  4. Identification and transcription profiling of NDUFS8 in Aedes taeniorhynchus (Diptera:Culididae): developmental regulation and environmental response

    USDA-ARS?s Scientific Manuscript database

    The cDNA of a NADH dehydrogenase -ubiquinone Fe-S protein 8 subunit (NDUFS8) gene from Aedes (Ochlerotatus) taeniorhynchus Wiedemann has been cloned and sequenced. The full-length mRNA sequence (824 bp) of AetNDUFS8 encodes an open reading region of 651 bp (i.e., 217 amino acids). To detect whether ...

  5. The Kv7.2/Kv7.3 heterotetramer assembles with a random subunit arrangement.

    PubMed

    Stewart, Andrew P; Gómez-Posada, Juan Camilo; McGeorge, Jessica; Rouhani, Maral J; Villarroel, Alvaro; Murrell-Lagnado, Ruth D; Edwardson, J Michael

    2012-04-06

    Voltage-gated K(+) channels composed of Kv7.2 and Kv7.3 are the predominant contributors to the M-current, which plays a key role in controlling neuronal activity. Various lines of evidence have indicated that Kv7.2 and Kv7.3 form a heteromeric channel. However, the subunit stoichiometry and arrangement within this putative heteromer are so far unknown. Here, we have addressed this question using atomic force microscopy imaging of complexes between isolated Kv7.2/Kv7.3 channels and antibodies to epitope tags on the two subunits, Myc on Kv7.2 and HA on Kv7.3. Initially, tsA 201 cells were transiently transfected with equal amounts of cDNA for the two subunits. The heteromer was isolated through binding of either tag to immunoaffinity beads and then decorated with antibodies to the other tag. In both cases, the distribution of angles between pairs of bound antibodies had two peaks, at around 90° and around 180°, and in both cases the 90° peak was about double the size of the 180° peak. These results indicate that the Kv7.2/Kv7.3 heteromer generated by cells expressing approximately equal amounts of the two subunits assembles as a tetramer with a predominantly 2:2 subunit stoichiometry and with a random subunit arrangement. When the DNA ratio for the two subunits was varied, copurification experiments indicated that the subunit stoichiometry was variable and not fixed at 2:2. Hence, there are no constraints on either the subunit stoichiometry or the subunit arrangement.

  6. Structure and characterization of a cDNA clone for phenylalanine ammonia-lyase from cut-injured roots of sweet potato

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tanaka, Yoshiyuki; Matsuoka, Makoto; Yamanoto, Naoki

    A cDNA clone for phenylalanine ammonia-lyase (PAL) induced in wounded sweet potato (Ipomoea batatas Lam.) root was obtained by immunoscreening a cDNA library. The protein produced in Escherichia coli cells containing the plasmid pPAL02 was indistinguishable from sweet potato PAL as judged by Ouchterlony double diffusion assays. The M{sub r} of its subunit was 77,000. The cells converted ({sup 14}C)-L-phenylalanine into ({sup 14}C)-t-cinnamic acid and PAL activity was detected in the homogenate of the cells. The activity was dependent on the presence of the pPAL02 plasmid DNA. The nucleotide sequence of the cDNA contained a 2,121-base pair (bp) open-reading framemore » capable of coding for a polypeptide with 707 amino acids (M{sub r} 77,137), a 22-bp 5{prime}-noncoding region and a 207-bp 3{prime}-noncoding region. The results suggest that the insert DNA fully encoded the amino acid sequence for sweet potato PAL that is induced by wounding. Comparison of the deduced amino acid sequence with that of a PAL cDNA fragment from Phaseolus vulgaris revealed 78.9% homology. The sequence from amino acid residues 258 to 494 was highly conserved, showing 90.7% homology.« less

  7. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Greene, T.W.; Chantler, S.E.; Kahn, M.L.

    ADPglucose pyrophosphorylase (glucose-1-phosphate adenylytransferase; AD P:{alpha}-D-glucose-1-phosphate adenylyltransferase, EC 2.7.7.27) catalyzes a key regulatory step in {alpha}-glucan synthesis in bacteria and higher plants. We have previously shown that the expression of the cDNA sequences of the potato tuber large (LS) and small (SS) subunits yielded a functional heterotetrameric enzyme capable of complementing a mutation in the single AGP (glgC) structural gene of Escherichia coli. This heterologous complementation provides a powerful genetic approach to obtain biochemical information on the specific roles of LS and SS in enzyme function. By mutagenizing the LS cDNA with hydroxylamine and then coexpressing with wild-type SS inmore » an E. coli glgC{sup {minus}} strain, >350 mutant colonies were identified that were impaired in glycogen production. One mutant exhibited enzymatic and antigen levels comparable to the wild-type recombinant enzyme but required 45-fold greater levels of the activator 3-phosphoglycerate for maximum activity. Sequence analysis identified a single nucleotide change that resulted in the change of Pro-52 to Leu. This heterologous genetic system provides and efficient means to identify residues important for catalysis and allosteric functioning and should lead to novel approaches to increase plant productivity. 31 refs., 4 figs., 1 tab.« less

  8. The gene for the alpha 1 subunit of the skeletal muscle dihydropyridine-sensitive calcium channel (Cchl1a3) maps to mouse chromosome 1.

    PubMed

    Chin, H; Krall, M; Kim, H L; Kozak, C A; Mock, B

    1992-12-01

    Cchl1a3 encodes the dihydropyridine-sensitive calcium channel alpha 1 subunit isoform predominantly expressed in skeletal muscle. mdg (muscular dysgenesis) has previously been implicated as a mutant allele of this gene. Hybridization of a rat brain cDNA probe for Cchl1a3 to Southern blots of DNAs from a panel of Chinese hamster x mouse somatic cell hybrids suggested that this gene maps to mouse Chromosome 1. Analysis of the progeny of an inbred strain cross-positioned Cchl1a3 1.3 cM proximal to the Pep-3 locus on Chr 1.

  9. Linkage of genes for laminin B1 and B2 subunits on chromosome 1 in mouse.

    PubMed

    Elliott, R W; Barlow, D; Hogan, B L

    1985-08-01

    We have used cDNA clones for the B1 and B2 subunits of laminin to find restriction fragment length DNA polymorphisms for the genes encoding these polypeptides in the mouse. Three alleles were found for LamB2 and two for LamB1 among the inbred mouse strains. The segregation of these polymorphisms among recombinant inbred strains showed that these genes are tightly linked in the central region of mouse Chromosome 1 between Sas-1 and Ly-m22, 7.4 +/- 3.2 cM distal to the Pep-3 locus. There is no evidence in the mouse for pseudogenes for these proteins.

  10. Expression of functional receptors by the human γ-aminobutyric acid A γ2 subunit

    PubMed Central

    Martínez-Torres, Ataúlfo; Miledi, Ricardo

    2004-01-01

    γ-Aminobutyric acid A (GABAA) receptors are heteromeric membrane proteins formed mainly by various combinations of α, β, and γ subunits; and it is commonly thought that the γ2 subunit alone does not form functional receptors. In contrast, we found that cDNA encoding the γ2L subunit of the human GABAA receptor, injected alone into Xenopus oocytes, expressed functional GABA receptors whose properties were investigated by using the two-microelectrode voltage-clamp technique. GABA elicited desensitizing membrane currents that recovered after a few minutes' wash. Repetitive applications of GABA induced a “run-up” of GABA currents that nearly doubled the amplitude of the first response. The GABA currents inverted direction at about -30 mV, indicating that they are carried mainly by Cl- ions. The homomeric γ2L receptors were also activated by β-alanine > taurine > glycine, and, like some types of heteromeric GABAA receptors, the γ2L receptors were blocked by bicuculline and were potentiated by pentobarbital and flunitrazepam. These results indicate that the human γ2L subunit is capable of forming fully functional GABA receptors by itself in Xenopus oocytes and suggest that the roles proposed for the various subunits that make up the heteromeric GABAA receptors in situ require further clarification. PMID:14981251

  11. The Mediator co-activator complex regulates Ty1 retromobility by controlling the balance between Ty1i and Ty1 promoters.

    PubMed

    Salinero, Alicia C; Knoll, Elisabeth R; Zhu, Z Iris; Landsman, David; Curcio, M Joan; Morse, Randall H

    2018-02-01

    The Ty1 retrotransposons present in the genome of Saccharomyces cerevisiae belong to the large class of mobile genetic elements that replicate via an RNA intermediary and constitute a significant portion of most eukaryotic genomes. The retromobility of Ty1 is regulated by numerous host factors, including several subunits of the Mediator transcriptional co-activator complex. In spite of its known function in the nucleus, previous studies have implicated Mediator in the regulation of post-translational steps in Ty1 retromobility. To resolve this paradox, we systematically examined the effects of deleting non-essential Mediator subunits on the frequency of Ty1 retromobility and levels of retromobility intermediates. Our findings reveal that loss of distinct Mediator subunits alters Ty1 retromobility positively or negatively over a >10,000-fold range by regulating the ratio of an internal transcript, Ty1i, to the genomic Ty1 transcript. Ty1i RNA encodes a dominant negative inhibitor of Ty1 retromobility that blocks virus-like particle maturation and cDNA synthesis. These results resolve the conundrum of Mediator exerting sweeping control of Ty1 retromobility with only minor effects on the levels of Ty1 genomic RNA and the capsid protein, Gag. Since the majority of characterized intrinsic and extrinsic regulators of Ty1 retromobility do not appear to effect genomic Ty1 RNA levels, Mediator could play a central role in integrating signals that influence Ty1i expression to modulate retromobility.

  12. Human endomembrane H+ pump strongly resembles the ATP-synthetase of Archaebacteria.

    PubMed Central

    Südhof, T C; Fried, V A; Stone, D K; Johnston, P A; Xie, X S

    1989-01-01

    Preparations of mammalian H+ pumps that acidify intracellular vesicles contain eight or nine polypeptides, ranging in size from 116 to 17 kDa. Biochemical analysis indicates that the 70- and 58-kDa polypeptides are subunits critical for ATP hydrolysis. The amino acid sequences of the major catalytic subunits (58 and 70 kDa) of the endomembrane H+ pump are unknown from animal cells. We report here the complete sequence of the 58-kDa subunit derived from a human kidney cDNA clone and partial sequences of the 70- and 58-kDa subunits purified from clathrin-coated vesicles of bovine brain. The amino acid sequences of both proteins strongly resemble the sequences of the corresponding subunits of the vacuolar H+ pumps of Archaebacteria, plants, and fungi. The archaebacterial enzyme is believed to use a H+ gradient to synthesize ATP. Thus, a common ancestral protein has given rise to a H+ pump that synthesizes ATP in one organism and hydrolyzes it in another and is highly conserved from prokaryotes to humans. The same pump appears to mediate the acidification of intracellular organelles, including coated vesicles, lysosomes, and secretory granules, as well as extracellular fluids such as urine. PMID:2527371

  13. Purification of an eight subunit RNA polymerase I complex in Trypanosoma brucei.

    PubMed

    Nguyen, Tu N; Schimanski, Bernd; Zahn, André; Klumpp, Birgit; Günzl, Arthur

    2006-09-01

    Trypanosoma brucei harbors a unique multifunctional RNA polymerase (pol) I which transcribes, in addition to ribosomal RNA genes, the gene units encoding the major cell surface antigens variant surface glycoprotein and procyclin. In consequence, this RNA pol I is recruited to three structurally different types of promoters and sequestered to two distinct nuclear locations, namely the nucleolus and the expression site body. This versatility may require parasite-specific protein-protein interactions, subunits or subunit domains. Thus far, data mining of trypanosomatid genomes have revealed 13 potential RNA pol I subunits which include two paralogous sets of RPB5, RPB6, and RPB10. Here, we analyzed a cDNA library prepared from procyclic insect form T. brucei and found that all 13 candidate subunits are co-expressed. Moreover, we PTP-tagged the largest subunit TbRPA1, tandem affinity-purified the enzyme complex to homogeneity, and determined its subunit composition. In addition to the already known subunits RPA1, RPA2, RPC40, 1RPB5, and RPA12, the complex contained RPC19, RPB8, and 1RPB10. Finally, to evaluate the absence of RPB6 in our purifications, we used a combination of epitope-tagging and reciprocal coimmunoprecipitation to demonstrate that 1RPB6 but not 2RPB6 binds to RNA pol I albeit in an unstable manner. Collectively, our data strongly suggest that T. brucei RNA pol I binds a distinct set of the RPB5, RPB6, and RPB10 paralogs.

  14. The α6 nicotinic acetylcholine receptor subunit of Frankliniella occidentalis is not involved in resistance to spinosad.

    PubMed

    Hou, Wenjie; Liu, Qiulei; Tian, Lixia; Wu, Qingjun; Zhang, Youjun; Xie, Wen; Wang, Shaoli; Miguel, Keri San; Funderburk, Joe; Scott, Jeffrey G

    2014-05-01

    Insects evolve resistance which constrains the sustainable use of insecticides. Spinosyns, a class of environmentally-friendly macrolide insecticides, is not an exception. The mode of inheritance and the mechanisms of resistance to spinosad (the most common spinosyn insecticide) in Frankliniella occidentalis (Western flower thrips, WFT) were investigated in this study. Resistance (170,000-fold) was autosomal and completely recessive. Recent studies showed that deletion of the nicotinic acetylcholine receptor α6 subunit gene resulted in strains of Drosophila melanogaster, Plutella xylostella and Bactrocera dorsalis that are resistant to spinosad, indicating that nAChRα6 subunit maybe important for the toxic action of this insecticide. Conversely, a G275E mutation of this subunit in F. occidentalis was recently proposed as the mechanism of resistance to spinosad. We cloned and characterized nAChRα6 from three susceptible and two spinosad resistant strains from China and the USA. The Foα6 cDNA is 1873bp and the open reading frame is 1458bp which encodes 485 amino acid residues with a predicted molecular weight of 53.5-kDa, the 5' and 3' UTRs are 121 and 294bp, respectively. There was no difference in the cDNA sequence between the resistant and susceptible thrips, suggesting the G275E mutation does not confer resistance in these populations. Ten isoforms of Foα6, arising from alternative splicing, were isolated and did not differ between the spinosad-susceptible and resistant strains. Quantitative real time PCR analysis showed Foα6 was highly expressed in the first instar larva, pupa and adult, and the expression levels were 3.67, 2.47, 1.38 times that of the second instar larva. The expression level was not significantly different between the susceptible and resistant strains. These results indicate that Foα6 is not involved in resistance to spinosad in F. occidentalis from China and the USA. Copyright © 2014 Elsevier Inc. All rights reserved.

  15. Integrins beta 5, beta 3 and alpha v are apically distributed in endometrial epithelium.

    PubMed

    Aplin, J D; Spanswick, C; Behzad, F; Kimber, S J; Vićovac, L

    1996-07-01

    Several adhesion molecules have been shown to occur at the surface of endometrial cells. One of these is the integrin alpha v subunit which associates with various beta chains including beta 5. We demonstrate the presence of integrin beta 5 polypeptide in human endometrial epithelial cells throughout the menstrual cycle using immunocytochemistry with monospecific antibodies, and at the mRNA level by thermal amplification from endometrial cDNA. Integrin beta 5 is also found in a population of bone marrow-derived cells. A notable feature of the distribution of the beta 5 subunit in the glandular and luminal epithelium is its apical localization, which may suggest an involvement in implantation. However, no evidence was found for regulated expression of epithelial beta 5. In mouse, the beta 5 subunit is found at both the apical and basal surface of epithelial cells and expression is essentially oestrous cycle-independent. Comparisons are made in both species with the distribution of the alpha v and beta 3 subunits which also localize to the apical epithelium.

  16. Complex alternative splicing of acetylcholinesterase transcripts in Torpedo electric organ; primary structure of the precursor of the glycolipid-anchored dimeric form.

    PubMed Central

    Sikorav, J L; Duval, N; Anselmet, A; Bon, S; Krejci, E; Legay, C; Osterlund, M; Reimund, B; Massoulié, J

    1988-01-01

    In this paper, we show the existence of alternative splicing in the 3' region of the coding sequence of Torpedo acetylcholinesterase (AChE). We describe two cDNA structures which both diverge from the previously described coding sequence of the catalytic subunit of asymmetric (A) forms (Schumacher et al., 1986; Sikorav et al., 1987). They both contain a coding sequence followed by a non-coding sequence and a poly(A) stretch. Both of these structures were shown to exist in poly(A)+ RNAs, by S1 mapping experiments. The divergent region encoded by the first sequence corresponds to the precursor of the globular dimeric form (G2a), since it contains the expected C-terminal amino acids, Ala-Cys. These amino acids are followed by a 29 amino acid extension which contains a hydrophobic segment and must be replaced by a glycolipid in the mature protein. Analyses of intact G2a AChE showed that the common domain of the protein contains intersubunit disulphide bonds. The divergent region of the second type of cDNA consists of an adjacent genomic sequence, which is removed as an intron in A and Ga mRNAs, but may encode a distinct, less abundant catalytic subunit. The structures of the cDNA clones indicate that they are derived from minor mRNAs, shorter than the three major transcripts which have been described previously (14.5, 10.5 and 5.5 kb). Oligonucleotide probes specific for the asymmetric and globular terminal regions hybridize with the three major transcripts, indicating that their size is determined by 3'-untranslated regions which are not related to the differential splicing leading to A and Ga forms. Images PMID:3181125

  17. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed Central

    Muldoon, L. L.; Neuwelt, E. A.; Pagel, M. A.; Weiss, D. L.

    1994-01-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy. Images Figure 1 Figure 3 Figure 4 Figure 5 PMID:8178934

  18. Characterization of the molecular defect in a feline model for type II GM2-gangliosidosis (Sandhoff disease).

    PubMed

    Muldoon, L L; Neuwelt, E A; Pagel, M A; Weiss, D L

    1994-05-01

    The Korat cat provides an animal model for type II GM2-gangliosidosis (Sandhoff disease) that may be suitable for tests of gene replacement therapy with the HEXB gene encoding the beta subunit of the beta-hexosaminidases. In the present report, we examined the brain and liver pathology of a typical Sandhoff-affected cat. We characterized the feline HEXB complementary DNA (cDNA) and determined the molecular defect in this feline model. cDNA libraries were produced from one normal and one affected animal, and cDNA clones homologous to human HEXB were sequenced. In the affected cDNA clone, the deletion of a cytosine residue at position +39 of the putative coding region results in a frame shift and a stop codon at base +191. This disease-related deletion was consistently detected by sequencing of cloned polymerase chain reaction amplified reverse transcribed messenger RNA from one more normal Korat and two additional affected animals. The defect was further demonstrated using single-strand conformational polymorphism analysis of the polymerase chain reaction products. In addition, alternative splicing of both normal and affected messenger RNAs was demonstrated. These results should facilitate the use of this animal model to assess gene therapy.

  19. Molecular cloning of a cDNA encoding the glycoprotein of hen oviduct microsomal signal peptidase.

    PubMed Central

    Newsome, A L; McLean, J W; Lively, M O

    1992-01-01

    Detergent-solubilized hen oviduct signal peptidase has been characterized previously as an apparent complex of a 19 kDa protein and a 23 kDa glycoprotein (GP23) [Baker & Lively (1987) Biochemistry 26, 8561-8567]. A cDNA clone encoding GP23 from a chicken oviduct lambda gt11 cDNA library has now been characterized. The cDNA encodes a protein of 180 amino acid residues with a single site for asparagine-linked glycosylation that has been directly identified by amino acid sequence analysis of a tryptic-digest peptide containing the glycosylated site. Immunoblot analysis reveals cross-reactivity with a dog pancreas protein. Comparison of the deduced amino acid sequence of GP23 with the 22/23 kDa glycoprotein of dog microsomal signal peptidase [Shelness, Kanwar & Blobel (1988) J. Biol. Chem. 263, 17063-17070], one of five proteins associated with this enzyme, reveals that the amino acid sequences are 90% identical. Thus the signal peptidase glycoprotein is as highly conserved as the sequences of cytochromes c and b from these same species and is likely to be found in a similar form in many, if not all, vertebrate species. The data also show conclusively that the dog and avian signal peptidases have at least one protein subunit in common. Images Fig. 1. PMID:1546959

  20. Isolation and Characterization of the PKAr Gene From a Plant Pathogen, Curvularia lunata.

    PubMed

    Liu, T; Ma, B C; Hou, J M; Zuo, Y H

    2014-09-01

    By using EST database from a full-length cDNA library of Curvularia lunata, we have isolated a 2.9 kb cDNA, termed PKAr. An ORF of 1,383 bp encoding a polypeptide of 460 amino acids with molecular weight 50.1 kDa, (GeneBank Acc. No. KF675744) was cloned. The deduced amino acid sequence of the PKAr shows 90 and 88 % identity with cAMP-dependent protein kinase A regulatory subunit from Alternaria alternate and Pyrenophora tritici-repentis Pt-1C-BFP, respectively. Database analysis revealed that the deduced amino acid sequence of PKAr shares considerable similarity with that of PKA regulatory subunits in other organisms, particularly in the conserved regions. No introns were identified within the 1,383 bp of ORF compared with PKAr genomic DNA sequence. Southern blot indicated that PKAr existed as a single copy per genome. The mRNA expression level of PKAr in different development stages were demonstrated using real-time quantitative PCR. The results showed that the level of PKAr expression was highest in vegetative growth mycelium, which indicated it might play an important role in the vegetative growth of C. lunata. These results provided a fundamental supporting research on the function of PKAr in plant pathogen, C. lunata.

  1. Intron loss from the NADH dehydrogenase subunit 4 gene of lettuce mitochondrial DNA: evidence for homologous recombination of a cDNA intermediate.

    PubMed

    Geiss, K T; Abbas, G M; Makaroff, C A

    1994-04-01

    The mitochondrial gene coding for subunit 4 of the NADH dehydrogenase complex I (nad4) has been isolated and characterized from lettuce, Lactuca sativa. Analysis of nad4 genes in a number of plants by Southern hybridization had previously suggested that the intron content varied between species. Characterization of the lettuce gene confirms this observation. Lettuce nad4 contains two exons and one group IIA intron, whereas previously sequenced nad4 genes from turnip and wheat contain three group IIA introns. Northern analysis identified a transcript of 1600 nucleotides, which represents the mature nad4 mRNA and a primary transcript of 3200 nucleotides. Sequence analysis of lettuce and turnip nad4 cDNAs was used to confirm the intron/exon border sequences and to examine RNA editing patterns. Editing is observed at the 5' and 3' ends of the lettuce transcript, but is absent from sequences that correspond to exons two, three and the 5' end of exon four in turnip and wheat. In contrast, turnip transcripts are highly edited in this region, suggesting that homologous recombination of an edited and spliced cDNA intermediate was involved in the loss of introns two and three from an ancestral lettuce nad4 gene.

  2. Genome-Wide Identification and Testing of Superior Reference Genes for Transcript Normalization in Arabidopsis1[w

    PubMed Central

    Czechowski, Tomasz; Stitt, Mark; Altmann, Thomas; Udvardi, Michael K.; Scheible, Wolf-Rüdiger

    2005-01-01

    Gene transcripts with invariant abundance during development and in the face of environmental stimuli are essential reference points for accurate gene expression analyses, such as RNA gel-blot analysis or quantitative reverse transcription-polymerase chain reaction (PCR). An exceptionally large set of data from Affymetrix ATH1 whole-genome GeneChip studies provided the means to identify a new generation of reference genes with very stable expression levels in the model plant species Arabidopsis (Arabidopsis thaliana). Hundreds of Arabidopsis genes were found that outperform traditional reference genes in terms of expression stability throughout development and under a range of environmental conditions. Most of these were expressed at much lower levels than traditional reference genes, making them very suitable for normalization of gene expression over a wide range of transcript levels. Specific and efficient primers were developed for 22 genes and tested on a diverse set of 20 cDNA samples. Quantitative reverse transcription-PCR confirmed superior expression stability and lower absolute expression levels for many of these genes, including genes encoding a protein phosphatase 2A subunit, a coatomer subunit, and an ubiquitin-conjugating enzyme. The developed PCR primers or hybridization probes for the novel reference genes will enable better normalization and quantification of transcript levels in Arabidopsis in the future. PMID:16166256

  3. Isolation of a candidate human telomerase catalytic subunit gene, which reveals complex splicing patterns in different cell types.

    PubMed

    Kilian, A; Bowtell, D D; Abud, H E; Hime, G R; Venter, D J; Keese, P K; Duncan, E L; Reddel, R R; Jefferson, R A

    1997-11-01

    Telomerase is a multicomponent reverse transcriptase enzyme that adds DNA repeats to the ends of chromosomes using its RNA component as a template for synthesis. Telomerase activity is detected in the germline as well as the majority of tumors and immortal cell lines, and at low levels in several types of normal cells. We have cloned a human gene homologous to a protein from Saccharomyces cerevisiae and Euplotes aediculatus that has reverse transcriptase motifs and is thought to be the catalytic subunit of telomerase in those species. This gene is present in the human genome as a single copy sequence with a dominant transcript of approximately 4 kb in a human colon cancer cell line, LIM1215. The cDNA sequence was determined using clones from a LIM1215 cDNA library and by RT-PCR, cRACE and 3'RACE on mRNA from the same source. We show that the gene is expressed in several normal tissues, telomerase-positive post-crisis (immortal) cell lines and various tumors but is not expressed in the majority of normal tissues analyzed, pre-crisis (non-immortal) cells and telomerase-negative immortal (ALT) cell lines. Multiple products were identified by RT-PCR using primers within the reverse transcriptase domain. Sequencing of these products suggests that they arise by alternative splicing. Strikingly, various tumors, cell lines and even normal tissues (colonic crypt and testis) showed considerable differences in the splicing patterns. Alternative splicing of the telomerase catalytic subunit transcript may be important for the regulation of telomerase activity and may give rise to proteins with different biochemical functions.

  4. Concholepas concholepas Ferritin H-like subunit (CcFer): Molecular characterization and single nucleotide polymorphism associated to innate immune response.

    PubMed

    Chávez-Mardones, Jacqueline; Valenzuela-Muñoz, Valentina; Núñez-Acuña, Gustavo; Maldonado-Aguayo, Waleska; Gallardo-Escárate, Cristian

    2013-09-01

    Ferritin has been identified as the principal protein of iron storage and iron detoxification, playing a pivotal role for the cellular homeostasis in living organisms. However, recent studies in marine invertebrates have suggested its association with innate immune system. In the present study, one Ferritin subunit was identified from the gastropod Concholepas concholepas (CcFer), which was fully characterized by Rapid Amplification of cDNA Ends technique. Simultaneously, a challenge test was performed to evaluate the immune response against Vibrio anguillarum. The full length of cDNA Ccfer was 1030 bp, containing 513 bp of open reading frame that encodes to 170 amino acid peptide, which was similar to the Ferritin H subunit described in vertebrates. Untranslated Regions (UTRs) were identified with a 5'UTR of 244 bp that contains iron responsive element (IRE), and a 3'UTR of 273 bp. The predicted molecular mass of deduced amino acid of CcFer was 19.66 kDa and isoelectric point of 4.92. Gene transcription analysis revealed that CcFer increases against infections with V. anguillarum, showing a peak expression at 6 h post-infection. Moreover, a single nucleotide polymorphism was detected at -64 downstream 5'UTR sequence (SNP-64). Quantitative real time analysis showed that homozygous mutant allele (TT) was significantly associated with higher expression levels of the challenged group compared to wild (CC) and heterozygous (CT) variants. Our findings suggest that CcFer is associated to innate immune response in C. concholepas and that the presence of SNPs may involve differential transcriptional expression of CcFer. Copyright © 2013 Elsevier Ltd. All rights reserved.

  5. Molecular characterization of two ferritins of the scallop Argopecten purpuratus and gene expressions in association with early development, immune response and growth rate.

    PubMed

    Coba de la Peña, Teodoro; Cárcamo, Claudia B; Díaz, María I; Brokordt, Katherina B; Winkler, Federico M

    2016-08-01

    Ferritin is involved in several iron homoeostasis processes in molluscs. We characterized two ferritin homologues and their expression patterns in association with early development, growth rate and immune response in the scallop Argopecten purpuratus, a species of economic importance for Chile and Peru. Two ferritin subunits (Apfer1 and Apfer2) were cloned. Apfer1 cDNA is a 792bp clone containing a 516bp open reading frame (ORF) that corresponds to a novel ferritin subunit in A. purpuratus. Apfer2 cDNA is a 681bp clone containing a 522bp ORF that corresponds to a previously sequenced EST. A putative iron responsive element (IRE) was identified in the 5'-untranslated region of both genes. The deduced protein sequences of both cDNAs possessed the motifs and domains characteristic of functional ferritin subunits. Both genes showed differential expression patterns at tissue-specific and early development stage levels. Apfer1 expression level increased 40-fold along larval developmental stages, decreasing markedly after larval settlement. Apfer1 expression in mantle tissue was 2.8-fold higher in fast-growing than in slow-growing scallops. Apfer1 increased 8-fold in haemocytes 24h post-challenge with the bacterium Vibrio splendidus. Apfer2 expression did not differ between fast- and slow-growing scallops or in response to bacterial challenge. These results suggest that Apfer1 and Apfer2 may be involved in iron storage, larval development and shell formation. Apfer1 expression may additionally be involved in immune response against bacterial infections and also in growth; and thus would be a potential marker for immune capacity and for fast growth in A. purpuratus. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Self-assembly of proglycinin and hybrid proglycinin synthesized in vitro from cDNA

    PubMed Central

    Dickinson, Craig D.; Floener, Liliane A.; Lilley, Glenn G.; Nielsen, Niels C.

    1987-01-01

    An in vitro system was developed that results in the self-assembly of subunit precursors into complexes that resemble those found naturally in the endoplasmic reticulum. Subunits of glycinin, the predominant seed protein of soybeans, were synthesized from modified cDNAs using a combination of the SP6 transcription and the rabbit reticulocyte translation systems. Subunits produced from plasmid constructions that encoded either Gy4 or Gy5 gene products, but modified such that their signal sequences were absent, self-assembled into trimers equivalent in size to those precursors found in the endoplasmic reticulum. In contrast, proteins synthesized in vitro from Gy4 constructs failed to self-assemble when the signal sequence was left intact (e.g., preproglycinin) or when the coding sequence was modified to remove 27 amino acids from an internal hydrophobic region, which is highly conserved among the glycinin subunits. Various hybrid subunits were also produced by trading portions of Gy4 and Gy5 cDNAs and all self-assembled in our system. The in vitro assembly system provides an opportunity to study the self-assembly of precursors and to probe for regions important for assembly. It will also be helpful in attempts to engineer beneficial nutritional changes into this important food protein. Images PMID:16593868

  7. Evolutionary relationships of lactate dehydrogenases (LDHs) from mammals, birds, an amphibian, fish, barley, and bacteria: LDH cDNA sequences from Xenopus, pig, and rat.

    PubMed Central

    Tsuji, S; Qureshi, M A; Hou, E W; Fitch, W M; Li, S S

    1994-01-01

    The nucleotide sequences of the cDNAs encoding LDH (EC 1.1.1.27) subunits LDH-A (muscle), LDH-B (liver), and LDH-C (oocyte) from Xenopus laevis, LDH-A (muscle) and LDH-B (heart) from pig, and LDH-B (heart) and LDH-C (testis) from rat were determined. These seven newly deduced amino acid sequences and 22 other published LDH sequences, and three unpublished fish LDH-A sequences kindly provided by G. N. Somero and D. A. Powers, were used to construct the most parsimonious phylogenetic tree of these 32 LDH subunits from mammals, birds, an amphibian, fish, barley, and bacteria. There have been at least six LDH gene duplications among the vertebrates. The Xenopus LDH-A, LDH-B, and LDH-C subunits are most closely related to each other and then are more closely related to vertebrate LDH-B than LDH-A. Three fish LDH-As, as well as a single LDH of lamprey, also seem to be more related to vertebrate LDH-B than to land vertebrate LDH-A. The mammalian LDH-C (testis) subunit appears to have diverged very early, prior to the divergence of vertebrate LDH-A and LDH-B subunits, as reported previously. Images PMID:7937776

  8. The Mediator co-activator complex regulates Ty1 retromobility by controlling the balance between Ty1i and Ty1 promoters

    PubMed Central

    Salinero, Alicia C.; Knoll, Elisabeth R.; Zhu, Z. Iris

    2018-01-01

    The Ty1 retrotransposons present in the genome of Saccharomyces cerevisiae belong to the large class of mobile genetic elements that replicate via an RNA intermediary and constitute a significant portion of most eukaryotic genomes. The retromobility of Ty1 is regulated by numerous host factors, including several subunits of the Mediator transcriptional co-activator complex. In spite of its known function in the nucleus, previous studies have implicated Mediator in the regulation of post-translational steps in Ty1 retromobility. To resolve this paradox, we systematically examined the effects of deleting non-essential Mediator subunits on the frequency of Ty1 retromobility and levels of retromobility intermediates. Our findings reveal that loss of distinct Mediator subunits alters Ty1 retromobility positively or negatively over a >10,000-fold range by regulating the ratio of an internal transcript, Ty1i, to the genomic Ty1 transcript. Ty1i RNA encodes a dominant negative inhibitor of Ty1 retromobility that blocks virus-like particle maturation and cDNA synthesis. These results resolve the conundrum of Mediator exerting sweeping control of Ty1 retromobility with only minor effects on the levels of Ty1 genomic RNA and the capsid protein, Gag. Since the majority of characterized intrinsic and extrinsic regulators of Ty1 retromobility do not appear to effect genomic Ty1 RNA levels, Mediator could play a central role in integrating signals that influence Ty1i expression to modulate retromobility. PMID:29462141

  9. Short communication: molecular characterization of dog and cat p65 subunits of NF-kappaB.

    PubMed

    Ishikawa, Shingo; Takemitsu, Hiroshi; Li, Gebin; Mori, Nobuko; Yamamoto, Ichiro; Arai, Toshiro

    2015-04-01

    Nuclear factor kappa B (NF-κB) plays an important role in the immune system. The p65 subunit is an important part of NF-κB unit, and studies of dog and cat p65 subunits of NF-κB (dp65 and cp65) are important in understanding their immune function. In this study, we described the molecular characterization of dp65 and cp65. The dp65 and cp65 complementary DNA encoded 542 and 555 amino acids, respectively, showing a high sequence homology with the mammalian p65 subunit (>87.5%). Quantitative polymerase chain reaction revealed that the p65 messenger RNA is highly expressed in the dog stomach and cat heart and adipose tissue. Functional NF-κB promoter-luciferase reporter vectors revealed that our isolated dp65 and cp65 cDNA encodes a functionally active protein. Transiently expressed dp65 and cp65 up-regulated pro-inflammatory cytokine expression levels in dog and cat, respectively. These findings suggest that dp65 and cp65 play important roles in regulating immune function. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Molecular structure of P2X receptors.

    PubMed

    Egan, Terrance M; Cox, Jane A; Voigt, Mark M

    2004-01-01

    P2X receptors are ligand-gated ion channels that transduce many of the physiological effects of extracellular ATP. There has been a dramatic increase in awareness of these receptors over the past 5 or so years, in great part due to their molecular cloning and characterization. The availability of cDNA clones for the various subunits has led to rapid progress in identifying their tissue-specific expression, resulting in new ideas concerning the functional roles these receptors might play in physiological and pathophysiological processes. In addition, molecular approaches have yielded much information regarding the structure and function of the receptor proteins themselves. In this review we seek to review recent findings concerning the molecular determinants of receptor-channel function, with particular focus on ligand binding and gating, ion selectivity, and subunit assembly.

  11. The gene for human U2 snRNP auxiliary factor small 35-kDa subunit (U2AF1) maps to the progressive myoclonus epilepsy (EPM1) critical region on chromosome 21q22.3

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Lalioti, M.D.; Rossier, C.; Antonarakis, S.E.

    1996-04-15

    We used targeted exon trapping to clone portions of genes from human chromosome 21q22.3. One trapped sequence showed complete homology with the cDNA of human U2AF{sup 35} (M96982; HGM-approved nomenclature U2AF1), which encodes for the small 35-kDa subunit of the U2 snRNP auxiliary factor. Using the U2AF1 cDNA as a probe, we mapped this gene to cosmid Q15D2, a P1, and YAC 350F7 of the Chumakov et al. contig, close to the cystathionine-{beta}-synthase gene (CBS) on 21q22.3. This localization was confirmed by PCR using oligonucleotides from the 3{prime} UTR and by FISH. As U2AF1 associated with a number of differentmore » factors during mRNA splicing, overexpression in trisomy 21 individuals could contribute to some Down syndrome phenotypes by interfering with the splicing process. Furthermore, because this gene maps in the critical region for the progressive myoclonus epilepsy I locus (EPM1), mutation analysis will be carried out in patients to evaluate the potential role of U2AF1 as a candidate for EPM1. 24 refs., 1 fig.« less

  12. Proteinaceous toxins from three species of scorpaeniform fish (lionfish Pterois lunulata, devil stinger Inimicus japonicus and waspfish Hypodytes rubripinnis): close similarity in properties and primary structures to stonefish toxins.

    PubMed

    Kiriake, Aya; Suzuki, Yasuko; Nagashima, Yuji; Shiomi, Kazuo

    2013-08-01

    The crude toxins from three species of venomous fish (lionfish Pterois lunulata, devil stinger Inimicus japonicus and waspfish Hypodytes rubripinnis) belonging to the order Scorpaeniformes exhibited mouse-lethal, hemolytic, edema-forming and nociceptive activities. In view of the antigenic cross-reactivity with the stonefish toxins, the primary structures of the stonefish toxin-like toxins from the three scorpaeniform fish were determined by cDNA cloning using primers designed from the highly conserved sequences of the stonefish toxins. Based on the data obtained in gel filtration, immunoblotting and cDNA cloning, each toxin was judged to be a 160 kDa heterodimer composed of 80 kDa α- and β-subunits. The three scorpaeniform fish toxins contain a B30.2/SPRY domain (∼200 amino acid residues) in the C-terminal region of each subunit, as reported for the toxins from two species of lionfish and two species of stonefish. With respect to the amino acid sequence similarity, the scorpaeniform fish toxins are divided into the following two groups: toxins from three species of lionfish and those from devil stinger, two species of stonefish and waspfish. The phylogenetic tree generated also clearly supports the classification of the toxins. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. The bark of Robinia pseudoacacia contains a complex mixture of lectins.Characterization of the proteins and the cDNA clones.

    PubMed Central

    Van Damme, E J; Barre, A; Smeets, K; Torrekens, S; Van Leuven, F; Rougé, P; Peumans, W J

    1995-01-01

    Two lectins were isolated from the inner bark of Robinia pseudoacacia (black locust). The first (and major) lectin (called RPbAI) is composed of five isolectins that originate from the association of 31.5- and 29-kD polypeptides into tetramers. In contrast, the second (minor) lectin (called RPbAII) is a hometetramer composed of 26-kD subunits. The cDNA clones encoding the polypeptides of RPbAI and RPbAII were isolated and their sequences determined. Apparently all three polypeptides are translated from mRNAs of approximately 1.2 kb. Alignment of the deduced amino acid sequences of the different clones indicates that the 31.5- and 29-kD RPbAI polypeptides show approximately 80% sequence identity and are homologous to the previously reported legume seed lectins, whereas the 26-kD RPbAII polypeptide shows only 33% sequence identity to the previously described legume lectins. Modeling the 31.5-kD subunit of RPbAI predicts that its three-dimensional structure is strongly related to the three-dimensional models that have been determined thus far for a few legume lectins. Southern blot analysis of genomic DNA isolated from Robinia has revealed that the Robinia bark lectins are the result of the expression of a small family of lectin genes. PMID:7716244

  14. Arabidopsis cop8 and fus4 mutations define the same gene that encodes subunit 4 of the COP9 signalosome.

    PubMed Central

    Serino, G; Tsuge, T; Kwok, S; Matsui, M; Wei, N; Deng, X W

    1999-01-01

    The pleiotropic constitutive photomorphogenic/deetiolated/fusca (cop/det/fus) mutants of Arabidopsis exhibit features of light-grown seedlings when grown in the dark. Cloning and biochemical analysis of COP9 have revealed that it is a component of a multiprotein complex, the COP9 signalosome (previously known as the COP9 complex). Here, we compare the immunoaffinity and the biochemical purification of the COP9 signalosome from cauliflower and confirm its eight-subunit composition. Molecular cloning of subunit 4 of the complex revealed that it is a proteasome-COP9 complex-eIF3 domain protein encoded by a gene that maps to chromosome 5, near the chromosomal location of the cop8 and fus4 mutations. Genetic complementation tests showed that the cop8 and fus4 mutations define the same locus, now designated as COP8. Molecular analysis of the subunit 4-encoding gene in both cop8 and fus4 mutants identified specific molecular lesions, and overexpression of the subunit 4 cDNA in a cop8 mutant background resulted in complete rescue of the mutant phenotype. Thus, we conclude that COP8 encodes subunit 4 of the COP9 signalosome. Examination of possible molecular interactions by using the yeast two-hybrid assay indicated that COP8 is capable of strong self-association as well as interaction with COP9, FUS6/COP11, FUS5, and Arabidopsis JAB1 homolog 1, the latter four proteins being previously defined subunits of the Arabidopsis COP9 signalosome. A comparative sequence analysis indicated that COP8 is highly conserved among multicellular eukaryotes and is also similar to a subunit of the 19S regulatory particle of the 26S proteasome. PMID:10521526

  15. The primary structure of L37--a rat ribosomal protein with a zinc finger-like motif.

    PubMed

    Chan, Y L; Paz, V; Olvera, J; Wool, I G

    1993-04-30

    The amino acid sequence of the rat 60S ribosomal subunit protein L37 was deduced from the sequence of nucleotides in a recombinant cDNA. Ribosomal protein L37 has 96 amino acids, the NH2-terminal methionine is removed after translation of the mRNA, and has a molecular weight of 10,939. Ribosomal protein L37 has a single zinc finger-like motif of the C2-C2 type. Hybridization of the cDNA to digests of nuclear DNA suggests that there are 13 or 14 copies of the L37 gene. The mRNA for the protein is about 500 nucleotides in length. Rat L37 is related to Saccharomyces cerevisiae ribosomal protein YL35 and to Caenorhabditis elegans L37. We have identified in the data base a DNA sequence that encodes the chicken homolog of rat L37.

  16. Memory in aged mice is rescued by enhanced expression of the GluN2B subunit of the NMDA receptor

    PubMed Central

    Brim, B. L.; Haskell, R.; Awedikian, R.; Ellinwood, N.M.; Jin, L.; Kumar, A.; Foster, T.C.; Magnusson, K.

    2012-01-01

    The GluN2B subunit of the N-methyl-D-aspartate (NMDA) receptor shows age-related declines in expression across the frontal cortex and hippocampus. This decline is strongly correlated to age-related memory declines. This study was designed to determine if increasing GluN2B subunit expression in the frontal lobe or hippocampus would improve memory in aged mice. Mice were injected bilaterally with either the GluN2B vector, containing cDNA specific for the GluN2B subunit and enhanced Green Fluorescent Protein (eGFP); a control vector or vehicle. Spatial memory, cognitive flexibility, and associative memory were assessed using the Morris water maze. Aged mice, with increased GluN2B subunit expression, exhibited improved long-term spatial memory, comparable to young mice. However, memory was rescued on different days in the Morris water maze; early for hippocampal GluN2B subunit enrichment and later for the frontal lobe. A higher concentration of the GluN2B antagonist, Ro 25-6981, was required to impair long-term spatial memory in aged mice with enhanced GluN2B expression, as compared to aged controls, suggesting there was an increase in the number of GluN2B-containing NMDA receptors. In addition, hippocampal slices from aged mice with increased GluN2B subunit expression exhibited enhanced NMDA receptor-mediated excitatory post-synaptic potentials (EPSP). Treatment with Ro 25-6981 showed that a greater proportion of the NMDA receptor-mediated EPSP was due to the GluN2B subunit in these animals, as compared to aged controls. These results suggest that increasing the production of the GluN2B subunit in aged animals enhances memory and synaptic transmission. Therapies that enhance GluN2B subunit expression within the aged brain may be useful for ameliorating age-related memory declines. PMID:23103326

  17. Molecular cloning and characterization of an acetylcholinesterase cDNA in the brown planthopper, Nilaparvata lugens.

    PubMed

    Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

    2010-01-01

    A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain.

  18. Cloning and characterization of p52, the fifth subunit of the core of the transcription/DNA repair factor TFIIH.

    PubMed Central

    Marinoni, J C; Roy, R; Vermeulen, W; Miniou, P; Lutz, Y; Weeda, G; Seroz, T; Gomez, D M; Hoeijmakers, J H; Egly, J M

    1997-01-01

    TFIIH is a multiprotein factor involved in transcription and DNA repair and is implicated in DNA repair/transcription deficiency disorders such as xeroderma pigmentosum, Cockayne syndrome and trichothiodystrophy. Eight out of the nine genes encoding the subunits forming TFIIH have already been cloned. We report here the identification, cDNA cloning and gene structure of the 52 kDa polypeptide and its homology with the yeast counterpart TFB2. This protein, along with p89/XPB, p62, p44 and p34, forms the core of TFIIH. Moreover, using in vitro reconstituted transcription and nucleotide excision repair (NER) assays and microinjection experiments, we demonstrate that p52 is directly involved in both transcription and DNA repair mechanisms in vitro and in vivo. PMID:9118947

  19. Molecular characterization of a gene POLR2H encoded an essential subunit for RNA polymerase II from the Giant Panda (Ailuropoda Melanoleuca).

    PubMed

    Du, Yu-Jie; Hou, Yi-Ling; Hou, Wan-Ru

    2013-02-01

    The Giant Panda is an endangered and valuable gene pool in genetic, its important functional gene POLR2H encodes an essential shared peptide H of RNA polymerases. The genomic DNA and cDNA sequences were cloned successfully for the first time from the Giant Panda (Ailuropoda melanoleuca) adopting touchdown-PCR and reverse transcription polymerase chain reaction (RT-PCR), respectively. The length of the genomic sequence of the Giant Panda is 3,285 bp, including five exons and four introns. The cDNA fragment cloned is 509 bp in length, containing an open reading frame of 453 bp encoding 150 amino acids. Alignment analysis indicated that both the cDNA and its deduced amino acid sequence were highly conserved. Protein structure prediction showed that there was one protein kinase C phosphorylation site, four casein kinase II phosphorylation sites and one amidation site in the POLR2H protein, further shaping advanced protein structure. The cDNA cloned was expressed in Escherichia coli, which indicated that POLR2H fusion with the N-terminally His-tagged form brought about the accumulation of an expected 20.5 kDa polypeptide in line with the predicted protein. On the basis of what has already been achieved in this study, further deep-in research will be conducted, which has great value in theory and practical significance.

  20. The identification of cellular targets of 17β estradiol using a lytic (T7) cDNA phage display approach.

    PubMed

    Van Dorst, Bieke; Mehta, Jaytry; Rouah-Martin, Elsa; De Coen, Wim; Blust, Ronny; Robbens, Johan

    2011-02-01

    To unravel the mechanism of action of chemical compounds, it is crucial to know their cellular targets. A novel in vitro tool that can be used as a fast, simple and cost effective alternative is cDNA phage display. This tool is used in our study to select cellular targets of 17β estradiol (E2). It was possible to select two potential cellular targets of E2 out of the T7 Select™ Human Breast cDNA phage library. The selected cellular targets, autophagy/beclin-1 regulator 1 (beclin 1) and ATP synthase F(0) subunit 6 (ATP6) have so far been unknown as binding proteins of E2. To confirm the E2 binding properties of these selected proteins, surface plasmon resonance (SPR) was used. With SPR the K(d) values were determined to be 0.178±0.031 and 0.401±0.142 nM for the ATP6 phage and beclin 1 phage, respectively. These K(d) values in the low nM range verify that the selected cellular proteins are indeed binding proteins for E2. The selection and identification of these two potential cellular targets of E2, can enhance our current understanding of its mechanism of action. This illustrates the potential of lytic (T7) cDNA phage display in toxicology, to provide important information about cellular targets of chemical compounds. Copyright © 2010 Elsevier Ltd. All rights reserved.

  1. Antagonism of ligand-gated ion channel receptors: two domains of the glycine receptor alpha subunit form the strychnine-binding site.

    PubMed Central

    Vandenberg, R J; French, C R; Barry, P H; Shine, J; Schofield, P R

    1992-01-01

    The inhibitory glycine receptor (GlyR) is a member of the ligand-gated ion channel receptor superfamily. Glycine activation of the receptor is antagonized by the convulsant alkaloid strychnine. Using in vitro mutagenesis and functional analysis of the cDNA encoding the alpha 1 subunit of the human GlyR, we have identified several amino acid residues that form the strychnine-binding site. These residues were identified by transient expression of mutated cDNAs in mammalian (293) cells and examination of resultant [3H]strychnine binding, glycine displacement of [3H]strychnine, and electrophysiological responses to the application of glycine and strychnine. This mutational analysis revealed that residues from two separate domains within the alpha 1 subunit form the binding site for the antagonist strychnine. The first domain includes the amino acid residues Gly-160 and Tyr-161, and the second domain includes the residues Lys-200 and Tyr-202. These results, combined with analyses of other ligand-gated ion channel receptors, suggest a conserved tertiary structure and a common mechanism for antagonism in this receptor superfamily. PMID:1311851

  2. Isolation and characterization of a presynaptic neurotoxin, P-elapitoxin-Bf1a from Malaysian Bungarus fasciatus venom.

    PubMed

    Rusmili, Muhamad Rusdi Ahmad; Yee, Tee Ting; Mustafa, Mohd Rais; Hodgson, Wayne C; Othman, Iekhsan

    2014-10-01

    Presynaptic neurotoxins are one of the major components in Bungarus venom. Unlike other Bungarus species that have been studied, β-bungarotoxin has never been isolated from Bungarus fasciatus venom. It was hypothesized that the absence of β-bungarotoxin in this species was due to divergence during evolution prior to evolution of β-bungarotoxin. In this study, we have isolated a β-bungarotoxin isoform we named P-elapitoxin-Bf1a by using gel filtration, cation-exchange and reverse-phase chromatography from Malaysian B. fasciatus venom. The toxin consists of two heterogeneous subunits, subunit A and subunit B. LCMS/MS data showed that subunit A was homologous to acidic phospholipase A2 subunit A3 from Bungarus candidus and B. multicinctus venoms, whereas subunit B was homologous with subunit B1 from B. fasciatus venom that was previously detected by cDNA cloning. The toxin showed concentration- and time-dependent reduction of indirect-twitches without affecting contractile responses to ACh, CCh or KCl at the end of experiment in the chick biventer preparation. Toxin modification with 4-BPB inhibited the neurotoxic effect suggesting the importance of His-48. Tissue pre-incubation with monovalent B. fasciatus (BFAV) or neuro-polyvalent antivenom (NPV), at the recommended titer, was unable to inhibit the twitch reduction induced by the toxin. This study indicates that Malaysian B. fasciatus venom has a unique β-bungarotoxin isoform which was not neutralized by antivenoms. This suggests that there might be other presynaptic neurotoxins present in the venom and there is a variation in the enzymatic neurotoxin composition in venoms from different localities. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Expression Profile of the Integrin Receptor Subunits in the Guinea Pig Sclera.

    PubMed

    Wang, Kevin K; Metlapally, Ravikanth; Wildsoet, Christine F

    2017-06-01

    The ocular dimensional changes in myopia reflect increased scleral remodeling, and in high myopia, loss of scleral integrity leads to biomechanical weakening and continued scleral creep. As integrins, a type of cell surface receptors, have been linked to scleral remodeling, they represent potential targets for myopia therapies. As a first step, this study aimed to characterize the integrin subunits at the messenger RNA level in the sclera of the guinea pig, a more recently added but increasingly used animal model for myopia research. Primers for α and β integrin subunits were designed using NCBI/UCSC Genome Browser and Primer3 software tools. Total RNA was extracted from normal scleral tissue and isolated cultured scleral fibroblasts, as well as liver and lung, as reference tissues, all from guinea pig. cDNA was produced by reverse transcription, PCR was used to amplify products of predetermined sizes, and products were sequenced using standard methods. Guinea pig scleral tissue expressed all known integrin alpha subunits except αD and αE. The latter integrin subunits were also not expressed by cultured guinea pig scleral fibroblasts; however, their expression was confirmed in guinea pig liver. In addition, isolated cultured fibroblasts did not express integrin subunits αL, αM, and αX. This difference between results for cultured cells and intact sclera presumably reflects the presence in the latter of additional cell types. Both guinea pig scleral tissue and isolated scleral fibroblasts expressed all known integrin beta subunits. All results were verified through sequencing. The possible contributions of integrins to scleral remodeling make them plausible targets for myopia prevention. Data from this study will help guide future ex vivo and in vitro studies directed at understanding the relationship between scleral integrins and ocular growth regulation in the guinea pig model for myopia.

  4. Subunit association of gamma-glutamyltranspeptidase of Escherichia coli K-12.

    PubMed

    Hashimoto, W; Suzuki, H; Nohara, S; Tachi, H; Yamamoto, K; Kumagai, H

    1995-12-01

    gamma-Glutamyltranspeptidase [EC 2.3.2.2] of Escherichia coli K-12 consists of one large subunit and one small subunit, which can be separated from each other by high-performance liquid chromatography. Using ion spray mass spectrometry, the masses of the large and the small subunit were determined to be 39,207 and 20,015, respectively. The large subunit exhibited no gamma-glutamyltranspeptidase activity and the small subunit had little enzymatic activity, but a mixture of the two subunits showed partial recovery of the enzymatic activity. The results of native-polyacrylamide gel electrophoresis suggested that they could partially recombine, and that the recombined dimer exhibited enzymatic activity. The gene of gamma-glutamyltranspeptidase encoded a signal peptide, and the large and small subunits in a single open reading frame in that order. Two kinds of plasmid were constructed encoding the signal peptide and either the large or the small subunit. A gamma-glutamyltranspeptidase-less mutant of E. coli K-12 was transformed with each plasmid or with both of them. The strain harboring the plasmid encoding each subunit produced a small amount of the corresponding subunit protein in the periplasmic space but exhibited no enzymatic activity. The strain transformed with both plasmids together exhibited the enzymatic activity, but its specific activity was approximately 3% of that of a strain harboring a plasmid encoding the intact structural gene. These results indicate that a portion of the separated large and small subunits can be reconstituted in vitro and exhibit the enzymatic activity, and that the expressed large and small subunits independently are able to associate in vivo and be folded into an active structure, though the specific activity of the associated subunits was much lower than that of native enzyme. This suggests that the synthesis of gamma-glutamyltranspeptidase in a single precursor polypeptide and subsequent processing are more effective to construct the intact structure of gamma-glutamyltranspeptidase than the association of the separated large and small subunits.

  5. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jack Preiss

    Conversion of the Potato tuber ADP-glucose Pyrophopshorylase Regulatory Subunit into a Catalytic Subunit. ADP-glucose synthesis, a rate-limiting reaction in starch synthesis, is catalyzed by ADP-glucose pyrophosphorylase (ADPGlc PPase). The enzyme in plants is allosterically activated by 3-phosphoglycerate (3PGA) and inhibited by inorganic phosphate (Pi) and is composed of two subunits as a heterotetramer, a2b2. Subunit a is the catalytic subunit and subunit b is designated as the regulatory subunit.The b subunit increases the affinty of the activator for the catalytic subunit. Recent results have shown that the subunits are derived from the same ancestor subunit as the regulatory subunit canmore » be converted to a catalytically subunit via mutation of just two amino acids. Lys44 and Thr54 in the large subunit from potato tuber were converted to the homologous catalytic subunit residues, Arg33 and Lys43. The activity of the large subunit mutants cannot be readily tested with a co-expressed wild-type small (catalytic) subunit because of the intrinsic activity of the latter. We co-expressed the regulatory-subunit mutants with SmallD145N, an inactive S subunit in which the catalytic Asp145 was mutated. The activity of the small (catalytic) subunit was reduced more than three orders of magnitude. Coexpression of the L subunit double mutant LargeK44R/T54K with SmallD145N generated an enzyme with considerable activity, 10% and 18% of the wildtype enzyme, in the ADP-glucose synthetic and pyrophosphorolytic direction, respectively. Replacement of those two residues in the small subunit by the homologous amino acids in the L subunits (mutations R33K and K43T) decreased the activity one and two orders of magnitude. The wild-type enzyme and SmallD145NLargeK44R/T54K had very similar kinetic properties indicating that the substrate site has been conserved. The fact that only two mutations in the L subunit restored enzyme activity is very strong evidence that the large subunit is derived from the catalytic ancestor. Previous results showed that Asp145 in the small subunit of the wild-type is essential for catalysis, whereas the homologous Asp160 in the Large WT subunit is not. However, in this study, mutation D160N or D160E in the LK44R/T54K subunit abolished the activity, which shows the ancestral essential role of this residue and confirms that the catalysis of SmallD145NLarge K44R/T54K occurs in the L(b) subunit. A phylogenetic tree of the ADP-Glc PPases present in photosynthetic eukaryotes also sheds information about the origin of the subunits. The tree showed that plant Small and Large subunits can be divided into two and four distinct groups, respectively. The two main groups of S subunits are from dicot and monocot plants, whereas Large subunit groups correlate better with their documented tissue expression. The first Large-subunit group is generally expressed in photosynthetic tissues and comprises Large subunits from dicots and monocots. Group II displays a broader expression pattern, whereas groups III and IV are expressed in storage organs (roots, stems, tubers, seeds). Subunits from group III are only from dicot plants, whereas group IV are seed-specific subunits from monocots. These last two groups stem from the same branch of the phylogenetic tree and split before monocot and dicot separation. Thus few as two mutations turned the L subunit from Solanum tuberosum catalytic, showing that L and S subunits share a common catalytic ancestor, rather than a non-catalytic one. The L subunit evolved to have a regulatory role, lost catalytic residues more than 130 million years ago before monocots and dicots diverged, and preserved, possibly as a byproduct, the active site domain.« less

  6. Molecular study of electron transfer flavoprotein alpha-subunit deficiency in two Japanese children with different phenotypes of glutaric acidemia type II.

    PubMed

    Purevjav, E; Kimura, M; Takusa, Y; Ohura, T; Tsuchiya, M; Hara, N; Fukao, T; Yamaguchi, S

    2002-09-01

    Electron transfer flavoprotein is a mitochondrial matrix protein composed of alpha- and beta-subunits (ETF alpha and ETF beta, respectively). This protein transfers electrons between several mitochondrial dehydrogenases and the main respiratory chain via ETF dehydrogenase (ETF-DH). Defects in ETF or ETF-DH cause glutaric acidemias type II (GAII). We investigated the molecular basis of ETF alpha deficiency in two Japanese children with different clinical phenotypes using expression study. Patient 1 had the severe form of GAII, a compound heterozygote of two mutations: 799G to A (alpha G267R) and nonsense 7C to T (alpha R3X). Patient 2 had the mild form and carried two heterozygous mutations: 764G to T (alpha G255V) and 478delG (frameshift). Both patients had one each of missense mutations in one allele; the others were either nonsense or truncated. Restriction enzyme digestion assay using genomic DNAs from 100 healthy Japanese revealed that these mutations were all novel. No signal for ETF alpha was detected by immunoblotting in cases of missense mutants, while wild-type cDNA resulted in expression of ETF alpha protein. Transfection with wild-type ETF alpha cDNA into cultured cells from both patients elevated incorporation of radioisotope-labelled fatty acids. These four mutations were pathogenic for GAII and missense mutations, alpha G255V and alpha G267R were considered anecdotal for mild and severe forms, respectively.

  7. Cloning of the cDNA for a hematopoietic cell-specific protein related to CD20 and the {beta} subunit of the high-affinity IgE receptor: Evidence for a family of proteins with four membrane-spanning regions

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Adra, C.N.; Morrison, P.; Lim, B.

    1994-10-11

    The authors report the cloning of the cDNA for a human gene whose mRNA is expressed specifically in hematopoietic cells. A long open reading frame in the 1.7-kb mRNA encodes a 214-aa protein of 25 kDa with four hydrophobic regions consistent with a protein that traverses the membrane four times. To reflect the structure and expression of this gene in diverse hematopoietic lineages of lymphoid and myeloid origin, the authors named the gene HTm{sub 4}. The protein is about 20% homologous to two other {open_quotes}four-transmembrane{close_quotes} proteins; the B-cell-specific antigen CD20 and the {beta} subunit of the high-affinity receptor for IgE,more » Fc{sub {epsilon}}RI{beta}. The highest homologies among the three proteins are found in the transmembrane domains, but conserved residues are also recognized in the inter-transmembrane domains and in the N and C termini. Using fluorescence in situ hybridization, they localized HTm{sub 4} to human chromosome 11q12-13.1, where the CD20 and Fc{sub {epsilon}}RI{beta} genes are also located. Both the murine homologue for CD20, Ly-44, and the murine Fc{sub {epsilon}}RI{beta} gene map to the same region in murine chromosome 19. The authors propose that the HTm{sub 4}, CD20, and Fc{sub {epsilon}}RI{beta} genes evolved from the same ancestral gene to form a family of four-transmembrane proteins. It is possible that other related members exist. Similar to CD20 and Fc{sub {epsilon}}RI{beta}, it is likely that Htm{sub 4} has a role in signal transduction and, like Fc{sub {epsilon}}RI{beta}, might be a subunit associated with receptor complexes.« less

  8. Molecular cloning, phylogenetic analysis, and expression profiling of endoplasmic reticulum molecular chaperone BiP genes from bread wheat (Triticum aestivum L.).

    PubMed

    Zhu, Jiantang; Hao, Pengchao; Chen, Guanxing; Han, Caixia; Li, Xiaohui; Zeller, Friedrich J; Hsam, Sai L K; Hu, Yingkao; Yan, Yueming

    2014-10-01

    The endoplasmic reticulum chaperone binding protein (BiP) is an important functional protein, which is involved in protein synthesis, folding assembly, and secretion. In order to study the role of BiP in the process of wheat seed development, we cloned three BiP homologous cDNA sequences in bread wheat (Triticum aestivum), completed by rapid amplification of cDNA ends (RACE), and examined the expression of wheat BiP in wheat tissues, particularly the relationship between BiP expression and the subunit types of HMW-GS using near-isogenic lines (NILs) of HMW-GS silencing, and under abiotic stress. Sequence analysis demonstrated that all BiPs contained three highly conserved domains present in plants, animals, and microorganisms, indicating their evolutionary conservation among different biological species. Quantitative reverse transcription-polymerase chain reaction (qRT-PCR) revealed that TaBiP (Triticum aestivum BiP) expression was not organ-specific, but was predominantly localized to seed endosperm. Furthermore, immunolocalization confirmed that TaBiP was primarily located within the protein bodies (PBs) in wheat endosperm. Three TaBiP genes exhibited significantly down-regulated expression following high molecular weight-glutenin subunit (HMW-GS) silencing. Drought stress induced significantly up-regulated expression of TaBiPs in wheat roots, leaves, and developing grains. The high conservation of BiP sequences suggests that BiP plays the same role, or has common mechanisms, in the folding and assembly of nascent polypeptides and protein synthesis across species. The expression of TaBiPs in different wheat tissue and under abiotic stress indicated that TaBiP is most abundant in tissues with high secretory activity and with high proportions of cells undergoing division, and that the expression level of BiP is associated with the subunit types of HMW-GS and synthesis. The expression of TaBiPs is developmentally regulated during seed development and early seedling growth, and under various abiotic stresses.

  9. A linear concatenation strategy to construct 5'-enriched amplified cDNA libraries using multiple displacement amplification.

    PubMed

    Gadkar, Vijay J; Filion, Martin

    2013-06-01

    In various experimental systems, limiting available amounts of RNA may prevent a researcher from performing large-scale analyses of gene transcripts. One way to circumvent this is to 'pre-amplify' the starting RNA/cDNA, so that sufficient amounts are available for any downstream analysis. In the present study, we report the development of a novel protocol for constructing amplified cDNA libraries using the Phi29 DNA polymerase based multiple displacement amplification (MDA) system. Using as little as 200 ng of total RNA, we developed a linear concatenation strategy to make the single-stranded cDNA template amenable for MDA. The concatenation, made possible by the template switching property of the reverse transcriptase enzyme, resulted in the amplified cDNA library with intact 5' ends. MDA generated micrograms of template, allowing large-scale polymerase chain reaction analyses or other large-scale downstream applications. As the amplified cDNA library contains intact 5' ends, it is also compatible with 5' RACE analyses of specific gene transcripts. Empirical validation of this protocol is demonstrated on a highly characterized (tomato) and an uncharacterized (corn gromwell) experimental system.

  10. A Polymerase Chain Reaction-Based Method for Isolating Clones from a Complimentary DNA Library in Sheep

    PubMed Central

    Friis, Thor Einar; Stephenson, Sally; Xiao, Yin; Whitehead, Jon

    2014-01-01

    The sheep (Ovis aries) is favored by many musculoskeletal tissue engineering groups as a large animal model because of its docile temperament and ease of husbandry. The size and weight of sheep are comparable to humans, which allows for the use of implants and fixation devices used in human clinical practice. The construction of a complimentary DNA (cDNA) library can capture the expression of genes in both a tissue- and time-specific manner. cDNA libraries have been a consistent source of gene discovery ever since the technology became commonplace more than three decades ago. Here, we describe the construction of a cDNA library using cells derived from sheep bones based on the pBluescript cDNA kit. Thirty clones were picked at random and sequenced. This led to the identification of a novel gene, C12orf29, which our initial experiments indicate is involved in skeletal biology. We also describe a polymerase chain reaction-based cDNA clone isolation method that allows the isolation of genes of interest from a cDNA library pool. The techniques outlined here can be applied in-house by smaller tissue engineering groups to generate tools for biomolecular research for large preclinical animal studies and highlights the power of standard cDNA library protocols to uncover novel genes. PMID:24447069

  11. Isolation and characterization of the stage-specific cytochrome b small subunit (CybS) of Ascaris suum complex II from the aerobic respiratory chain of larval mitochondria.

    PubMed

    Amino, Hisako; Osanai, Arihiro; Miyadera, Hiroko; Shinjyo, Noriko; Tomitsuka, Eriko; Taka, Hikari; Mineki, Reiko; Murayama, Kimie; Takamiya, Shinzaburo; Aoki, Takashi; Miyoshi, Hideto; Sakamoto, Kimitoshi; Kojima, Somei; Kita, Kiyoshi

    2003-05-01

    We recently reported that Ascaris suum mitochondria express stage-specific isoforms of complex II: the flavoprotein subunit and the small subunit of cytochrome b (CybS) of the larval complex II differ from those of adult enzyme, while two complex IIs share a common iron-sulfur cluster subunit (Ip). In the present study, A. suum larval complex II was highly purified to characterize the larval cytochrome b subunits in more detail. Peptide mass fingerprinting and N-terminal amino acid sequencing showed that the larval and adult cytochrome b (CybL) proteins are identical. In contrast, cDNA sequences revealed that the small subunit of larval cytochrome b (CybS(L)) is distinct from the adult CybS (CybS(A)). Furthermore, Northern analysis and immunoblotting showed stage-specific expression of CybS(L) and CybS(A) in larval and adult mitochondria, respectively. Enzymatic assays revealed that the ratio of rhodoquinol-fumarate reductase (RQFR) to succinate-ubiquinone reductase (SQR) activities and the K(m) values for quinones are almost identical for the adult and larval complex IIs, but that the fumarate reductase (FRD) activity is higher for the adult form than for the larval form. These results indicate that the adult and larval A. suum complex IIs have different properties than the complex II of the mammalian host and that the larval complex II is able to function as a RQFR. Such RQFR activity of the larval complex II would be essential for rapid adaptation to the dramatic change of oxygen availability during infection of the host.

  12. Expression of the nuclear gene TaF(A)d is under mitochondrial retrograde regulation in anthers of male sterile wheat plants with timopheevii cytoplasm.

    PubMed

    Xu, Pei; Yang, Yuwen; Zhang, Zhengzhi; Chen, Weihua; Zhang, Caiqin; Zhang, Lixia; Zou, Sixiang; Ma, Zhengqiang

    2008-01-01

    Alterations of mitochondrial-encoded subunits of the F(o)F(1)-ATP synthase are frequently associated with cytoplasmic male sterility (CMS) in plants; however, little is known about the relationship of the nuclear encoded subunits of this enzyme with CMS. In the present study, the full cDNA of the gene TaF(A)d that encodes the putative F(A)d subunit of the F(o)F(1)-ATP synthase was isolated from the wheat (Triticum aestivum) fertility restorer '2114' for timopheevii cytoplasm-based CMS. The deduced 238 amino acid polypeptide is highly similar to its counterparts in dicots and other monocots but has low homology to its mammalian equivalents. TaF(A)d is a single copy gene in wheat and maps to the short arm of the group 6 chromosomes. Transient expression of the TaF(A)d-GFP fusion in onion epidermal cells demonstrated TaF(A)d's mitochondrial location. TaF(A)d was expressed abundantly in stem, leaf, anther, and ovary tissues of 2114. Nevertheless, its expression was repressed in anthers of CMS plants with timopheevii cytoplasm. Genic male sterility did not affect its expression in anthers. The expression of the nuclear gene encoding the 20 kDa subunit of F(o) was down-regulated in a manner similar to TaF(A)d in the T-CMS anthers while that of genes encoding the 6 kDa subunit of F(o) and the gamma subunit of F(1) was unaffected. These observations implied that TaF(A)d is under mitochondrial retrograde regulation in the anthers of CMS plants with timopheevii cytoplasm.

  13. Molecular characterization and expression profiles of nicotinic acetylcholine receptors in the rice striped stem borer, Chilo suppressalis (Lepidoptera: Crambidae).

    PubMed

    Xu, Gang; Wu, Shun-Fan; Teng, Zi-Wen; Yao, Hong-Wei; Fang, Qi; Huang, Jia; Ye, Gong-Yin

    2017-06-01

    Nicotinic acetylcholine receptors (nAChRs) are members of the cys-loop ligand-gated ion channel (cysLGIC) superfamily, mediating fast synaptic cholinergic transmission in the central nervous system in insects. Insect nAChRs are the molecular targets of economically important insecticides, such as neonicotinoids and spinosad. Identification and characterization of the nAChR gene family in the rice striped stem borer, Chilo suppressalis, could provide beneficial information about this important receptor gene family and contribute to the investigation of the molecular modes of insecticide action and resistance for current and future chemical control strategies. We searched our C. suppressalis transcriptome database using Bombyx mori nAChR sequences in local BLAST searches and obtained the putative nAChR subunit complementary DNAs (cDNAs) via reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends methods. Similar to B. mori, C. suppressalis possesses 12 nAChR subunits, including nine α-type and three β-type subunits. Quantitative RT-PCR analysis revealed the expression profiles of the nAChR subunits in various tissues, including the brain, subesophageal ganglion, thoracic ganglion, abdominal ganglion, hemocytes, fat body, foregut, midgut, hindgut and Malpighian tubules. Developmental expression analyses showed clear differential expression of nAChR subunits throughout the C. suppressalis life cycle. The identification of nAChR subunits in this study will provide a foundation for investigating the diverse roles played by nAChRs in C. suppressalis and for exploring specific target sites for chemicals that control agricultural pests while sparing beneficial species. ©2016 The Authors Insect Science published by John Wiley & Sons Australia, Ltd on behalf of Institute of Zoology, Chinese Academy of Sciences.

  14. Generation and characterization of anti-MUC4 monoclonal antibodies reactive with normal and cancer cells in humans.

    PubMed

    Moniaux, Nicolas; Varshney, Grish Chandra; Chauhan, Subhash Chand; Copin, Marie Christine; Jain, Maneesh; Wittel, Uwe A; Andrianifahanana, Mahefatiana; Aubert, Jean-Pierre; Batra, Surinder Kumar

    2004-02-01

    We have previously cloned the full-length cDNA (approximately 28 Kb) and established the complete genomic organization (25 exons/introns over 100 kb) of the human MUC4 mucin. This large molecule is predicted to protrude over 2 microm above the cell surface, in which MUC4alpha is an extracellular mucin-type glycoprotein subunit and MUC4beta is the transmembrane subunit. Over two thirds of the encoded protein sequence consists of 16-amino-acid tandem repeats (TR), which are flanked by unique sequences. In this study we generated and characterized monoclonal antibodies (MAbs) directed against the TR region of MUC4. Mice were immunized with a KLH-conjugated MUC4 TR peptide, STGDTTPLPVTDTSSV. Several clones were purified by three rounds of limited dilutions and stable clones presenting a sustained antibody production were selected for subsequent characterization. Antibodies were tested for their reactivity and specificity to recognize the MUC4 peptide and further screened by enzyme-linked immunosorbent assay (ELISA) and Western blotting analyses. One of the MAbs (8G7) was strongly reactive against the MUC4 peptide and with native MUC4 from human tissues or pancreatic cancer cells in Western blotting, immunohistochemistry, and confocal analysis. Anti-MUC4 MAb may represent a powerful tool for the study of MUC4 function under normal and pathological conditions and for diagnosis of solid tumors including those in the breast, pancreas, lungs, and ovaries.

  15. Effect of metal ions on the activity of casein kinase II from Xenopus laevis.

    PubMed

    Gatica, M; Hinrichs, M V; Jedlicki, A; Allende, C C; Allende, J E

    1993-01-04

    Casein kinase II purified from the nuclei of Xenopus laevis oocytes as well as the recombinant alpha and beta subunits of the X. laevis CKII, produced in E. coli from the cloned cDNA genes, were tested with different divalent metal ions. The enzyme from both sources was active with either Mg2+, Mn2+, or Co2+. Optimal concentrations were 7-10 mM for Mg2+, 0.5-0.7 mM for Mn2+ and 1-2 mM for Co2+. In the presence of Mn2+ or Co2+ the enzyme used GTP more efficiently than ATP as a phosphate donor while the reverse was true in the presence of Mg2+. The apparent Km values for both nucleotide triphosphates were greatly decreased in the presence of Mn2+ as compared with Mg2+. Addition of Zn2+ (above 150 microM) to an assay containing the optimal Mg2+ ion concentration caused strong inhibition of both holoenzyme and alpha subunit. Inhibition of the holoenzyme by 400 microM Ni2+ could be reversed by high concentrations of Mg2+ but no reversal of this inhibition was observed with the alpha subunit.

  16. Functional Expression of Two Neuronal Nicotinic Acetylcholine Receptors from cDNA Clones Identifies a Gene Family

    NASA Astrophysics Data System (ADS)

    Boulter, Jim; Connolly, John; Deneris, Evan; Goldman, Dan; Heinemann, Steven; Patrick, Jim

    1987-11-01

    A family of genes coding for proteins homologous to the α subunit of the muscle nicotinic acetylcholine receptor has been identified in the rat genome. These genes are transcribed in the central and peripheral nervous systems in areas known to contain functional nicotinic receptors. In this paper, we demonstrate that three of these genes, which we call alpha3, alpha4, and beta2, encode proteins that form functional nicotinic acetylcholine receptors when expressed in Xenopus oocytes. Oocytes expressing either alpha3 or alpha4 protein in combination with the beta2 protein produced a strong response to acetylcholine. Oocytes expressing only the alpha4 protein gave a weak response to acetylcholine. These receptors are activated by acetylcholine and nicotine and are blocked by Bungarus toxin 3.1. They are not blocked by α -bungarotoxin, which blocks the muscle nicotinic acetylcholine receptor. Thus, the receptors formed by the alpha3, alpha4, and beta2 subunits are pharmacologically similar to the ganglionic-type neuronal nicotinic acetylcholine receptor. These results indicate that the alpha3, alpha4, and beta2 genes encode functional nicotinic acetylcholine receptor subunits that are expressed in the brain and peripheral nervous system.

  17. Molecular Cloning and Characterization of an Acetylcholinesterase cDNA in the Brown Planthopper, Nilaparvata lugens

    PubMed Central

    Yang, Zhifan; Chen, Jun; Chen, Yongqin; Jiang, Sijing

    2010-01-01

    A full cDNA encoding an acetylcholinesterase (AChE, EC 3.1.1.7) was cloned and characterized from the brown planthopper, Nilaparvata lugens Stål (Hemiptera: Delphacidae). The complete cDNA (2467 bp) contains a 1938-bp open reading frame encoding 646 amino acid residues. The amino acid sequence of the AChE deduced from the cDNA consists of 30 residues for a putative signal peptide and 616 residues for the mature protein with a predicted molecular weight of 69,418. The three residues (Ser242, Glu371, and His485) that putatively form the catalytic triad and the six Cys that form intra-subunit disulfide bonds are completely conserved, and 10 out of the 14 aromatic residues lining the active site gorge of the AChE are also conserved. Northern blot analysis of poly(A)+ RNA showed an approximately 2.6-kb transcript, and Southern blot analysis revealed there likely was just a single copy of this gene in N. lugens. The deduced protein sequence is most similar to AChE of Nephotettix cincticeps with 83% amino acid identity. Phylogenetic analysis constructed with 45 AChEs from 30 species showed that the deduced N. lugens AChE formed a cluster with the other 8 insect AChE2s. Additionally, the hypervariable region and amino acids specific to insect AChE2 also existed in the AChE of N. lugens. The results revealed that the AChE cDNA cloned in this work belongs to insect AChE2 subgroup, which is orthologous to Drosophila AChE. Comparison of the AChEs between the susceptible and resistant strains revealed a point mutation, Gly185Ser, is likely responsible for the insensitivity of the AChE to methamidopho in the resistant strain. PMID:20874389

  18. Assignment of the human glutamate receptor gene GLUR5 to 21q22 by screening a chromosome 21 YAC library

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Potier, M.C.; Dutriaux, A.; Lambolez, B.

    1993-03-01

    Ionotropic L-glutamate receptors form transmembrane channels permeant to cations which are involved in synaptic transmission. Nine different subunits coding for non-NMDA (N-methyl-D-aspartate) receptors have been cloned and sequenced in rat. One of them, the GluR5 subunit, has a high affinity binding site for kainate and is expressed in neurons of the developing and adult nervous system. The permeability of the GluR5 receptor channel is modulated by edition of the transcripts. In human, GluR1 and GluR2 cDNAs have been sequenced and mapped to chromosomes 5 and 4, respectively. Also, GluR3 and GluR4 genes have been mapped to chromosome X and 11,more » respectively. Screening of the YAC chromosome 21 library was performed by colony hybridization on nylon Hybond-N filters at high stringency, as previously described, with the pore located in the center of the rat cDNA. Two positive colonies were obtained and analyzed for their YAC content by PFGE and Southern blotting. Only one (HY128) contained a 450-kb YAC hybridizing to the central rat cDNA probe as well as to the 5[prime] and 3[prime] end probes. Since GluR5 and GluR6 are highly homologous in rat, a probe in the 3[prime] untranslated region of GluR6, showing low homology to GluR5, was synthetized by PCR. Sequences and positions of the PCR primers on the rat sequence (9) are from 5[prime] to 3[prime]: CGACAGAAGGTTGCCAGGT (sense, position 2690-2708)/GATGTTCTGCCTTCAGTTCCAC (antisense, 3314-3335). HY128 YAC did not hybridize to the GluR6 probe (data not shown). Southern blot of human genomic DNA and yeast DNA from HY128 clone cut with EcoRI and HindIII showed the same bands of more than 10 and 6.6 kb, respectively, when hybridized to the 3[prime] end rat cDNA probe (data not shown). This last result confirms the presence of human GluR5 gene in HY128.« less

  19. Molecular cloning and expression of heteromeric ACCase subunit genes from Jatropha curcas.

    PubMed

    Gu, Keyu; Chiam, Huihui; Tian, Dongsheng; Yin, Zhongchao

    2011-04-01

    Acetyl-CoA carboxylase (ACCase) catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA, which is the essential first step in the biosynthesis of long-chain fatty acids. ACCase exists as a multi-subunit enzyme in most prokaryotes and the chloroplasts of most plants and algae, while it is present as a multi-domain enzyme in the endoplasmic reticulum of most eukaryotes. The heteromeric ACCase of higher plants consists of four subunits: an α-subunit of carboxyltransferase (α-CT, encoded by accA gene), a biotin carboxyl carrier protein (BCCP, encoded by accB gene), a biotin carboxylase (BC, encoded by accC gene) and a β-subunit of carboxyltransferase (β-CT, encoded by accD gene). In this study, we cloned and characterized the genes accA, accB1, accC and accD that encode the subunits of heteromeric ACCase in Jatropha (Jatropha curcas), a potential biofuel plant. The full-length cDNAs of the four subunit genes were isolated from a Jatropha cDNA library and by using 5' RACE, whereas the genomic clones were obtained from a Jatropha BAC library. They encode a 771 amino acid (aa) α-CT, a 286-aa BCCP1, a 537-aa BC and a 494-aa β-CT, respectively. The single-copy accA, accB1 and accC genes are nuclear genes, while the accD gene is located in chloroplast genome. Jatropha α-CT, BCCP1, BC and β-CT show high identity to their homologues in other higher plants at amino acid level and contain all conserved domains for ACCase activity. The accA, accB1, accC and accD genes are temporally and spatially expressed in the leaves and endosperm of Jatropha plants, which are regulated by plant development and environmental factors. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.

  20. Cloning, Purification, and Characterization of a Heterodimeric β-Galactosidase from Lactobacillus kefiranofaciens ZW3.

    PubMed

    He, Xi; Han, Ning; Wang, Yan-Ping

    2016-01-01

    Lactobacillus kefiranofaciens ZW3 was obtained from kefir grains, which have high lactose hydrolytic activity. In this study, a heterodimeric LacLM-type β-galactosidase gene (lacLM) from ZW3 was isolated, which was composed of two overlapping genes, lacL (1,884 bp) and lacM (960 bp) encoding large and small subunits with calculated molecular masses of 73,620 and 35,682 Da, respectively. LacLM, LacL, and LacM were expressed in Escherichia coli BL21(DE3) and these recombinant proteins were purified and characterized. The results showed that, compared with the recombinant holoenzyme, the recombinant large subunit exhibits obviously lower thermostability and hydrolytic activity. Moreover, the optimal temperature and pH of the holoenzyme and large subunit are 60°C and 7.0, and 50°C and 8.0, respectively. However, the recombinant small subunit alone has no activity. Interestingly, the activity and thermostability of the large subunit were greatly improved after mixing it with the recombinant small subunit. Therefore, the results suggest that the small subunit might play an important role in maintaining the stability of the structure of the catalytic center located in the large subunit.

  1. Vertical structure of the phytoplankton community associated with a coastal plume in the Gulf of Mexico

    USGS Publications Warehouse

    Wawrik, B.; Paul, J.H.; Campbell, L.; Griffin, D.; Houchin, L.; Fuentes-Ortega, A.; Muller-Karger, F.

    2003-01-01

    Low salinity plumes of coastal origin are occasionally found far offshore, where they display a distinct color signature detectable by satellites. The impact of such plumes on carbon fixation and phytoplankton community structure in vertical profiles and on basin wide scales is poorly understood. On a research cruise in June 1999, ocean-color satellite-images (Sea-viewing Wide Field-of-view Sensor, SeaWiFS) were used in locating a Mississippi River plume in the eastern Gulf of Mexico. Profiles sampled within and outside of the plume were analyzed using flow cytometry, HPLC pigment analysis and primary production using 14C incorporation. Additionally, RubisCO large subunit (rbcL) gene expression was measured by hybridization of extracted RNA using 3 full-length RNA gene probes specific for individual phytoplankton clades. We also used a combination of RT-PCR/PCR and TA cloning in order to generate cDNA and DNA rbcL clone libraries from samples taken in the plume. Primary productivity was greatest in the low salinity surface layer of the plume. The plume was also associated with high Synechococcus counts and a strong peak in Form IA rbcL expression. Form IB rbcL (green algal) mRNA was abundant at the subsurface chlorophyll maximum (SCM), whereas Form ID rbcL (chromophytic) expression showed little vertical structure. Phylogenetic analysis of cDNA libraries demonstrated the presence of Form IA rbcL Synechococcus phylotypes in the plume. Below the plume, 2 spatially separated and genetically distinct rbcL clades of Prochlorococcus were observed. This indicated the presence of the high- and low-light adapted clades of Prochlorococcus. A large and very diverse clade of Prymnesiophytes was distributed throughout the water column, whereas a clade of closely related prasinophytes may have dominated at the SCM. These data indicate that the Mississippi river plume may dramatically alter the surface picoplankton composition of the Gulf of Mexico, with Synechococcus displacing Prochlorococcus in the surface waters.

  2. Palmitoylation of the β4-Subunit Regulates Surface Expression of Large Conductance Calcium-activated Potassium Channel Splice Variants*

    PubMed Central

    Chen, Lie; Bi, Danlei; Tian, Lijun; McClafferty, Heather; Steeb, Franziska; Ruth, Peter; Knaus, Hans Guenther; Shipston, Michael J.

    2013-01-01

    Regulatory β-subunits of large conductance calcium- and voltage-activated potassium (BK) channels play an important role in generating functional diversity and control of cell surface expression of the pore forming α-subunits. However, in contrast to α-subunits, the role of reversible post-translational modification of intracellular residues on β-subunit function is largely unknown. Here we demonstrate that the human β4-subunit is S-acylated (palmitoylated) on a juxtamembrane cysteine residue (Cys-193) in the intracellular C terminus of the regulatory β-subunit. β4-Subunit palmitoylation is important for cell surface expression and endoplasmic reticulum (ER) exit of the β4-subunit alone. Importantly, palmitoylated β4-subunits promote the ER exit and surface expression of the pore-forming α-subunit, whereas β4-subunits that cannot be palmitoylated do not increase ER exit or surface expression of α-subunits. Strikingly, however, this palmitoylation- and β4-dependent enhancement of α-subunit surface expression was only observed in α-subunits that contain a putative trafficking motif (… REVEDEC) at the very C terminus of the α-subunit. Engineering this trafficking motif to other C-terminal α-subunit splice variants results in α-subunits with reduced surface expression that can be rescued by palmitoylated, but not depalmitoylated, β4-subunits. Our data reveal a novel mechanism by which palmitoylated β4-subunit controls surface expression of BK channels through masking of a trafficking motif in the C terminus of the α-subunit. As palmitoylation is dynamic, this mechanism would allow precise control of specific splice variants to the cell surface. Our data provide new insights into how complex interplay between the repertoire of post-transcriptional and post-translational mechanisms controls cell surface expression of BK channels. PMID:23504458

  3. Contribution of oligosaccharides to protection of the H,K-ATPase beta-subunit against trypsinolysis.

    PubMed

    Crothers, James M; Asano, Shinji; Kimura, Tohru; Yoshida, Ayumi; Wong, Aline; Kang, Jung Wook; Forte, John G

    2004-08-01

    The proton-pumping H+,K+-adenosinetriphosphatase (H,K-ATPase), responsible for acid secretion by the gastric parietal cell, faces a harshly acidic environment, with some pepsin from neighboring chief cells, at its luminal surface. Its large catalytic alpha-subunit is mostly oriented cytoplasmically. The smaller beta-subunit (HKbeta), is mainly extracellular, with one transmembrane domain and a small cytoplasmic domain. Seven N-linked oligosaccharides in the extracellular domain of HKbeta are thought to contribute to protection of the H,K-ATPase, since previous work has shown that their complete removal, by peptide N-glycosidase F (PNGase F), greatly increased susceptibility of HKbeta to proteolysis. The possibility of graded protection by different numbers of oligosaccharides was investigated here with the use of mutant HKbeta cDNA, having various N-glycosylation sites mutated (Asn to Gln), transfected into HEK-293 cells. Membrane preparations, two days after transfection, were solubilized in 1% Triton X-100 and subjected to trypsinolysis (pH 8, 37 degrees C, trypsin:protein 1:10-1:25). Relative amounts of HKbeta remaining after 20 min trypsin were determined, after sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and probing of Western blots with an antibody to the HKbeta extracellular domain, by chemiluminescent development of blots and densitometry of resulting films. Maturely glycosylated HKbeta was made significantly more susceptible to trypsin than wild type when at least five oligosaccharides were deleted, while the high-mannose form (pre-beta), from the endoplasmic reticulum, became significantly more susceptible than wild-type pre-beta with removal of only two or more oligosaccharides. For each mutant, and wild type, pre-beta was consistently more susceptible than the mature form. While the number, and kind, of oligosaccharides seem to affect protection for HKbeta against trypsinolysis, other aspects of protein maturation, including proper folding of peptide domains and possible subtle alterations of conformation during Golgi processing, are also likely to contribute to this protection. Copyright 2004 Wiley-VCH Verlag GmbH and Co.

  4. Rapid and efficient cDNA library screening by self-ligation of inverse PCR products (SLIP).

    PubMed

    Hoskins, Roger A; Stapleton, Mark; George, Reed A; Yu, Charles; Wan, Kenneth H; Carlson, Joseph W; Celniker, Susan E

    2005-12-02

    cDNA cloning is a central technology in molecular biology. cDNA sequences are used to determine mRNA transcript structures, including splice junctions, open reading frames (ORFs) and 5'- and 3'-untranslated regions (UTRs). cDNA clones are valuable reagents for functional studies of genes and proteins. Expressed Sequence Tag (EST) sequencing is the method of choice for recovering cDNAs representing many of the transcripts encoded in a eukaryotic genome. However, EST sequencing samples a cDNA library at random, and it recovers transcripts with low expression levels inefficiently. We describe a PCR-based method for directed screening of plasmid cDNA libraries. We demonstrate its utility in a screen of libraries used in our Drosophila EST projects for 153 transcription factor genes that were not represented by full-length cDNA clones in our Drosophila Gene Collection. We recovered high-quality, full-length cDNAs for 72 genes and variously compromised clones for an additional 32 genes. The method can be used at any scale, from the isolation of cDNA clones for a particular gene of interest, to the improvement of large gene collections in model organisms and the human. Finally, we discuss the relative merits of directed cDNA library screening and RT-PCR approaches.

  5. A rapid and cost-effective method for sequencing pooled cDNA clones by using a combination of transposon insertion and Gateway technology.

    PubMed

    Morozumi, Takeya; Toki, Daisuke; Eguchi-Ogawa, Tomoko; Uenishi, Hirohide

    2011-09-01

    Large-scale cDNA-sequencing projects require an efficient strategy for mass sequencing. Here we describe a method for sequencing pooled cDNA clones using a combination of transposon insertion and Gateway technology. Our method reduces the number of shotgun clones that are unsuitable for reconstruction of cDNA sequences, and has the advantage of reducing the total costs of the sequencing project.

  6. Major groove binding track residues of the connection subdomain of human immunodeficiency virus type 1 reverse transcriptase enhance cDNA synthesis at high temperatures.

    PubMed

    Matamoros, Tania; Barrioluengo, Verónica; Abia, David; Menéndez-Arias, Luis

    2013-12-23

    At high temperatures, RNA denaturation can improve the efficiency and specificity of reverse transcription. Refined structures and molecular models of HIV-1 reverse transcriptases (RTs) from phylogenetically distant clades (i.e., group M subtype B and group O) revealed a major interaction between the template-primer and the Arg³⁵⁸-Gly³⁵⁹-Ala³⁶⁰ triad in the large subunit of HIV-1M/B RT. However, fewer contacts were predicted for the equivalent Lys³⁵⁸-Ala³⁵⁹-Ser³⁶⁰ triad of HIV-1O RT and the nucleic acid. An engineered HIV-1O K358R/A359G/S360A RT showed increased cDNA synthesis efficiency above 68 °C, as determined by qualitative and quantitative reverse transcription polymerase chain reactions. In comparison with wild-type HIV-1O RT, the mutant enzyme showed higher thermal stability but retained wild-type RNase H activity. Mutations that increased the accuracy of HIV-1M/B RTs were tested in combination with the K358R/A359G/S360A triple mutation. Some of them (e.g., F61A, K65R, K65R/V75I, and V148I) had a negative effect on reverse transcription efficiency above 65 °C. RTs with improved DNA binding affinities also showed higher cDNA synthesis efficiencies at elevated temperatures. Two of the most thermostable RTs (i.e., mutants T69SSG/K358R/A359G/S360A and K358R/A359G/S360A/E478Q) showed moderately increased fidelity in forward mutation assays. Our results demonstrate that the triad of Arg³⁵⁸, Gly³⁵⁹, and Ala³⁶⁰ in the major groove binding track of HIV-1 RT is a major target for RT stabilization, and most relevant for improving reverse transcription efficiency at high temperatures.

  7. The nicotinic acetylcholine receptor gene family of the silkworm, Bombyx mori

    PubMed Central

    Shao, Ya-Ming; Dong, Ke; Zhang, Chuan-Xi

    2007-01-01

    Background Nicotinic acetylcholine receptors (nAChRs) mediate fast synaptic cholinergic transmission in the insect central nervous system. The insect nAChR is the molecular target of a class of insecticides, neonicotinoids. Like mammalian nAChRs, insect nAChRs are considered to be made up of five subunits, coded by homologous genes belonging to the same family. The nAChR subunit genes of Drosophila melanogaster, Apis mellifera and Anopheles gambiae have been cloned previously based on their genome sequences. The silkworm Bombyx mori is a model insect of Lepidoptera, among which are many agricultural pests. Identification and characterization of B. mori nAChR genes could provide valuable basic information for this important family of receptor genes and for the study of the molecular mechanisms of neonicotinoid action and resistance. Results We searched the genome sequence database of B. mori with the fruit fly and honeybee nAChRs by tBlastn and cloned all putative silkworm nAChR cDNAs by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) methods. B. mori appears to have the largest known insect nAChR gene family to date, including nine α-type subunits and three β-type subunits. The silkworm possesses three genes having low identity with others, including one α and two β subunits, α9, β2 and β3. Like the fruit fly and honeybee counterparts, silkworm nAChR gene α6 has RNA-editing sites, and α4, α6 and α8 undergo alternative splicing. In particular, alternative exon 7 of Bmα8 may have arisen from a recent duplication event. Truncated transcripts were found for Bmα4 and Bmα5. Conclusion B. mori possesses a largest known insect nAChR gene family characterized to date, including nine α-type subunits and three β-type subunits. RNA-editing, alternative splicing and truncated transcripts were found in several subunit genes, which might enhance the diversity of the gene family. PMID:17868469

  8. Identification of a subunit of NADH-dehydrogenase as a p49/STRAP-binding protein.

    PubMed

    Zhang, Xiaomin; Azhar, Gohar; Helms, Scott; Zhong, Ying; Wei, Jeanne Y

    2008-01-29

    The p49/STRAP (or SRFBP1) protein was recently identified in our laboratory as a cofactor of serum response factor that contributes to the regulation of SRF target genes in the heart. In the present study, we report that NDUFAB1, a nuclear encoded subunit of NADH dehydrogenase, represented the majority of the cDNA clones that interacted with p49/STRAP in multiple screenings using the yeast two-hybrid system. The p49/STRAP and NDUFAB1 proteins interacted and co-localized with each other in the cell. The p49/STRAP protein contains four classic nuclear localization sequence motifs, and it was observed to be present predominantly in the nucleus. Overexpression of p49/STRAP altered the intracellular level of NAD, and reduced the NAD/NADH ratio. Overexpression of p49/STRAP also induced the deacetylation of serum response factor. These data suggest that p49/STRAP plays a role in the regulation of intracellular processes such as cardiac cellular metabolism, gene expression, and possibly aging.

  9. Phenol emulsion-enhanced DNA-driven subtractive cDNA cloning: isolation of low-abundance monkey cortex-specific mRNAs.

    PubMed Central

    Travis, G H; Sutcliffe, J G

    1988-01-01

    To isolate cDNA clones of low-abundance mRNAs expressed in monkey cerebral cortex but absent from cerebellum, we developed an improved subtractive cDNA cloning procedure that requires only modest quantities of mRNA. Plasmid DNA from a monkey cerebellum cDNA library was hybridized in large excess to radiolabeled monkey cortex cDNA in a phenol emulsion-enhanced reaction. The unhybridized cortex cDNA was isolated by chromatography on hydroxyapatite and used to probe colonies from a monkey cortex cDNA library. Of 60,000 colonies screened, 163 clones were isolated and confirmed by colony hybridization or RNA blotting to represent mRNAs, ranging from 0.001% to 0.1% abundance, specific to or highly enriched in cerebral cortex relative to cerebellum. Clones of one medium-abundance mRNA were recovered almost quantitatively. Two of the lower-abundance mRNAs were expressed at levels reduced by a factor of 10 in Alzheimer disease relative to normal human cortex. One of these was identified as the monkey preprosomatostatin I mRNA. Images PMID:2894033

  10. LEDGF/p75 Deficiency Increases Deletions at the HIV-1 cDNA Ends.

    PubMed

    Bueno, Murilo T D; Reyes, Daniel; Llano, Manuel

    2017-09-15

    Processing of unintegrated linear HIV-1 cDNA by the host DNA repair system results in its degradation and/or circularization. As a consequence, deficient viral cDNA integration generally leads to an increase in the levels of HIV-1 cDNA circles containing one or two long terminal repeats (LTRs). Intriguingly, impaired HIV-1 integration in LEDGF/p75-deficient cells does not result in a correspondent increase in viral cDNA circles. We postulate that increased degradation of unintegrated linear viral cDNA in cells lacking the lens epithelium-derived growth factor (LEDGF/p75) account for this inconsistency. To evaluate this hypothesis, we characterized the nucleotide sequence spanning 2-LTR junctions isolated from LEDGF/p75-deficient and control cells. LEDGF/p75 deficiency resulted in a significant increase in the frequency of 2-LTRs harboring large deletions. Of note, these deletions were dependent on the 3' processing activity of integrase and were not originated by aberrant reverse transcription. Our findings suggest a novel role of LEDGF/p75 in protecting the unintegrated 3' processed linear HIV-1 cDNA from exonucleolytic degradation.

  11. Deregulation of DNA-dependent protein kinase catalytic subunit contributes to human hepatocarcinogenesis development and has a putative prognostic value.

    PubMed

    Evert, M; Frau, M; Tomasi, M L; Latte, G; Simile, M M; Seddaiu, M A; Zimmermann, A; Ladu, S; Staniscia, T; Brozzetti, S; Solinas, G; Dombrowski, F; Feo, F; Pascale, R M; Calvisi, D F

    2013-11-12

    The DNA-repair gene DNA-dependent kinase catalytic subunit (DNA-PKcs) favours or inhibits carcinogenesis, depending on the cancer type. Its role in human hepatocellular carcinoma (HCC) is unknown. DNA-dependent protein kinase catalytic subunit, H2A histone family member X (H2AFX) and heat shock transcription factor-1 (HSF1) levels were assessed by immunohistochemistry and/or immunoblotting and qRT-PCR in a collection of human HCC. Rates of proliferation, apoptosis, microvessel density and genomic instability were also determined. Heat shock factor-1 cDNA or DNA-PKcs-specific siRNA were used to explore the role of both genes in HCC. Activator protein 1 (AP-1) binding to DNA-PKcs promoter was evaluated by chromatin immunoprecipitation. Kaplan-Meier curves and multivariate Cox model were used to study the impact on clinical outcome. Total and phosphorylated DNA-PKcs and H2AFX were upregulated in HCC. Activated DNA-PKcs positively correlated with HCC proliferation, genomic instability and microvessel density, and negatively with apoptosis and patient's survival. Proliferation decline and massive apoptosis followed DNA-PKcs silencing in HCC cell lines. Total and phosphorylated HSF1 protein, mRNA and activity were upregulated in HCC. Mechanistically, we demonstrated that HSF1 induces DNA-PKcs upregulation through the activation of the MAPK/JNK/AP-1 axis. DNA-dependent protein kinase catalytic subunit transduces HSF1 effects in HCC cells, and might represent a novel target and prognostic factor in human HCC.

  12. A yeast-based genetic screening to identify human proteins that increase homologous recombination.

    PubMed

    Collavoli, Anita; Comelli, Laura; Rainaldi, Giuseppe; Galli, Alvaro

    2008-05-01

    To identify new human proteins implicated in homologous recombination (HR), we set up 'a papillae assay' to screen a human cDNA library using the RS112 strain of Saccharomyces cerevisiae containing an intrachromosomal recombination substrate. We isolated 23 cDNAs, 11 coding for complete proteins and 12 for partially deleted proteins that increased HR when overexpressed in yeast. We characterized the effect induced by the overexpression of the complete human proteasome subunit beta 2, the partially deleted proteasome subunits alpha 3 and beta 8, the ribosomal protein L12, the brain abundant membrane signal protein (BASP1) and the human homologue to v-Ha-RAS (HRAS), which elevated HR by 2-6.5-fold over the control. We found that deletion of the RAD52 gene, which has a key role in most HR events, abolished the increase of HR induced by the proteasome subunits and HRAS; by contrast, the RAD52 deletion did not affect the high level of HR due to BASP1 and RPL12. This suggests that the proteins stimulated yeast HR via different mechanisms. Overexpression of the complete beta 2 human proteasome subunit or the partially deleted alpha 3 and beta 8 subunits increased methyl methanesulphonate (MMS) resistance much more in the rad52 Delta mutant than in the wild-type. Overexpression of RPL12 and BASP1 did not affect MMS resistance in both the wild-type and the rad52 Delta mutant, whereas HRAS decreased MMS resistance in the rad52 Delta mutant. The results indicate that these proteins may interfere with the pathway(s) involved in the repair of MMS-induced DNA damage. Finally, we provide further evidence that yeast is a helpful tool to identify human proteins that may have a regulatory role in HR.

  13. White shrimp Litopenaeus vannamei recombinant lactate dehydrogenase: Biochemical and kinetic characterization.

    PubMed

    Fregoso-Peñuñuri, Ambar A; Valenzuela-Soto, Elisa M; Figueroa-Soto, Ciria G; Peregrino-Uriarte, Alma B; Ochoa-Valdez, Manuel; Leyva-Carrillo, Lilia; Yepiz-Plascencia, Gloria

    2017-09-01

    Shrimp lactate dehydrogenase (LDH) is induced in response to environmental hypoxia. Two protein subunits deduced from different transcripts of the LDH gene from the shrimp Litopenaeus vannamei (LDHvan-1 and LDHvan-2) were identified. These subunits are expressed by alternative splicing. Since both subunits are expressed in most tissues, the purification of the enzyme from the shrimp will likely produce hetero LDH containing both subunits. Therefore, the aim of this study was to overexpress, purify and characterize only one subunit as a recombinant protein, the LDHvan-2. For this, the cDNA from muscle was cloned and overexpressed in E. coli as a fusion protein containing an intein and a chitin binding protein domain (CBD). The recombinant protein was purified by chitin affinity chromatography column that retained the CBD and released solely the full and active LDH. The active protein appears to be a tetramer with molecular mass of approximately 140 kDa and can use pyruvate or lactate as substrates, but has higher specific activity with pyruvate. The enzyme is stable between pH 7.0 to 8.5, and between 20 and 50 °C with an optimal temperature of 50 °C. Two pK a of 9.3 and 6.6, and activation energy of 44.8 kJ/mol°K were found. The kinetic constants K m for NADH was 23.4 ± 1.8 μM, and for pyruvate was 203 ± 25 μM, while V max was 7.45 μmol/min/mg protein. The shrimp LDH that is mainly expressed in shrimp muscle preferentially converts pyruvate to lactate and is an important enzyme for the response to hypoxia. Copyright © 2017 Elsevier Inc. All rights reserved.

  14. Disease-associated mutations in CNGB3 promote cytotoxicity in photoreceptor-derived cells

    PubMed Central

    Liu, Chunming; Sherpa, Tshering

    2013-01-01

    Purpose To determine if achromatopsia associated F525N and T383fsX mutations in the CNGB3 subunit of cone photoreceptor cyclic nucleotide-gated (CNG) channels increases susceptibility to cell death in photoreceptor-derived cells. Methods Photoreceptor-derived 661W cells were transfected with cDNA encoding wild-type (WT) CNGA3 subunits plus WT or mutant CNGB3 subunits, and incubated with the membrane-permeable CNG channel activators 8-(4-chlorophenylthio) guanosine 3′,5′-cyclic monophosphate (CPT-cGMP) or CPT-adenosine 3′,5′-cyclic monophosphate (CPT-cAMP). Cell viability under these conditions was determined by measuring lactate dehydrogenase release. Channel ligand sensitivity was calibrated by patch-clamp recording after expression of WT or mutant channels in Xenopus oocytes. Results Coexpression of CNGA3 with CNGB3 subunits containing F525N or T383fsX mutations produced channels exhibiting increased apparent affinity for CPT-cGMP compared to WT channels. Consistent with these effects, cytotoxicity in the presence of 0.1 μM CPT-cGMP was enhanced relative to WT channels, and the increase in cell death was more pronounced for the mutation with the largest gain-of-function effect on channel gating, F525N. Increased susceptibility to cell death was prevented by application of the CNG channel blocker L-cis-diltiazem. Increased cytotoxicity was also found to be dependent on the presence of extracellular calcium. Conclusions These results indicate a connection between disease-associated mutations in cone CNG channel subunits, altered CNG channel-activation properties, and photoreceptor cytotoxicity. The rescue of cell viability via CNG channel block or removal of extracellular calcium suggests that cytotoxicity in this model depends on calcium entry through hyperactive CNG channels. PMID:23805033

  15. Analysis of expressed sequence tags from the Ulva prolifera (Chlorophyta)

    NASA Astrophysics Data System (ADS)

    Niu, Jianfeng; Hu, Haiyan; Hu, Songnian; Wang, Guangce; Peng, Guang; Sun, Song

    2010-01-01

    In 2008, a green tide broke out before the sailing competition of the 29th Olympic Games in Qingdao. The causative species was determined to be Enteromorpha prolifera ( Ulva prolifera O. F. Müller), a familiar green macroalga along the coastline of China. Rapid accumulation of a large biomass of floating U. prolifera prompted research on different aspects of this species. In this study, we constructed a nonnormalized cDNA library from the thalli of U. prolifera and acquired 10 072 high-quality expressed sequence tags (ESTs). These ESTs were assembled into 3 519 nonredundant gene groups, including 1 446 clusters and 2 073 singletons. After annotation with the nr database, a large number of genes were found to be related with chloroplast and ribosomal protein, GO functional classification showed 1 418 ESTs participated in photosynthesis and 1 359 ESTs were responsible for the generation of precursor metabolites and energy. In addition, rather comprehensive carbon fixation pathways were found in U. prolifera using KEGG. Some stress-related and signal transduction-related genes were also found in this study. All the evidences displayed that U. prolifera had substance and energy foundation for the intense photosynthesis and the rapid proliferation. Phylogenetic analysis of cytochrome c oxidase subunit I revealed that this green-tide causative species is most closely affiliated to Pseudendoclonium akinetum (Ulvophyceae).

  16. Cloning and characterization of the rat HIF-1 alpha prolyl-4-hydroxylase-1 gene.

    PubMed

    Cobb, Ronald R; McClary, John; Manzana, Warren; Finster, Silke; Larsen, Brent; Blasko, Eric; Pearson, Jennifer; Biancalana, Sara; Kauser, Katalin; Bringmann, Peter; Light, David R; Schirm, Sabine

    2005-08-01

    Prolyl-4-hydroxylase domain-containing enzymes (PHDs) mediate the oxygen-dependent regulation of the heterodimeric transcription factor hypoxia-inducible factor-1 (HIF-1). Under normoxic conditions, one of the subunits of HIF-1, HIF-1alpha, is hydroxylated on specific proline residues to target HIF-1alpha for degradation by the ubiquitin-proteasome pathway. Under hypoxic conditions, the hydroxylation by the PHDs is attenuated by lack of the oxygen substrate, allowing HIF-1 to accumulate, translocate to the nucleus, and mediate HIF-mediated gene transcription. In several mammalian species including humans, three PHDs have been identified. We report here the cloning of a full-length rat cDNA that is highly homologous to the human and murine PHD-1 enzymes and encodes a protein that is 416 amino acids long. Both cDNA and protein are widely expressed in rat tissues and cell types. We demonstrate that purified and crude baculovirus-expressed rat PHD-1 exhibits HIF-1alpha specific prolyl hydroxylase activity with similar substrate affinities and is comparable to human PHD-1 protein.

  17. Inhibitory effect of protopine on K(ATP) channel subunits expressed in HEK-293 cells.

    PubMed

    Jiang, Bo; Cao, Kun; Wang, Rui

    2004-12-15

    Protopine is an isoquinoline alkaloid purified from Corydalis tubers and other families of medicinal plants. The purpose of the present study was to investigate the effects of protopine on K(ATP) channels and big conductance (BKCa) channels. Protopine concentration-dependently inhibited K(ATP) channel currents in human embryonic kidney cells (HEK-293) which were cotransfected with Kir6.1 and sulfonylurea receptor 1 (SUR1) subunits, but not that with Kir6.1 cDNA transfection alone. At 25 muM, protopine reversibly decreased Kir6.1/SUR1 currents densities from -17.4+/-3 to -13.2+/-2.4 pA/pF at -60 mV (n=5, P<0.05). The heterologously expressed mSlo-encoded BK(Ca) channel currents in HEK-293 cells were not affected by protopine (25 muM), although iberiotoxin (100 nM) significantly inhibited the expressed BK(Ca) currents (n=5, P<0.05). In summary, protopine selectively inhibited K(ATP) channels by targeting on SUR1 subunit. This discovery may help design specific agents to selectively modulate the function of Kir6.1/SUR1 channel complex and facilitate the understanding of the structure-function relationship of specific subtype of K(ATP) channels.

  18. Cloning and molecular characterization of the betaine aldehyde dehydrogenase involved in the biosynthesis of glycine betaine in white shrimp (Litopenaeus vannamei).

    PubMed

    Delgado-Gaytán, María F; Rosas-Rodríguez, Jesús A; Yepiz-Plascencia, Gloria; Figueroa-Soto, Ciria G; Valenzuela-Soto, Elisa M

    2017-10-01

    The enzyme betaine aldehyde dehydrogenase (BADH) catalyzes the irreversible oxidation of betaine aldehyde to glycine betaine (GB), a very efficient osmolyte accumulated during osmotic stress. In this study, we determined the nucleotide sequence of the cDNA for the BADH from the white shrimp Litopenaeus vannamei (LvBADH). The cDNA was 1882 bp long, with a complete open reading frame of 1524 bp, encoding 507 amino acids with a predicted molecular mass of 54.15 kDa and a pI of 5.4. The predicted LvBADH amino acid sequence shares a high degree of identity with marine invertebrate BADHs. Catalytic residues (C-298, E-264 and N-167) and the decapeptide VTLELGGKSP involved in nucleotide binding and highly conserved in BADHs were identified in the amino acid sequence. Phylogenetic analyses classified LvBADH in a clade that includes ALDH9 sequences from marine invertebrates. Molecular modeling of LvBADH revealed that the protein has amino acid residues and sequence motifs essential for the function of the ALDH9 family of enzymes. LvBADH modeling showed three potential monovalent cation binding sites, one site is located in an intra-subunit cavity; other in an inter-subunit cavity and a third in a central-cavity of the protein. The results show that LvBADH shares a high degree of identity with BADH sequences from marine invertebrates and enzymes that belong to the ALDH9 family. Our findings suggest that the LvBADH has molecular mechanisms of regulation similar to those of other BADHs belonging to the ALDH9 family, and that BADH might be playing a role in the osmoregulation capacity of L. vannamei. Copyright © 2017 Elsevier B.V. All rights reserved.

  19. Molecular cloning of the alpha subunit of complement component C8 (CpC8α) of whitespotted bamboo shark (Chiloscyllium plagiosum).

    PubMed

    Wang, Ying; Zhang, Mengmeng; Wang, Conghui; Ye, Boping; Hua, Zichun

    2013-12-01

    Complement-mediated cytolysis is the important effect of immune response, which results from the assembly of terminal complement components (C5b-9). Among them, α subunit of C8 (C8α) is the first protein that traverses the lipid bilayer, and then initiates the recruitment of C9 molecules to form pore on target membranes. In this article, a full-length cDNA of C8α (CpC8α) is identified from the whitespotted bamboo shark (Chiloscyllium plagiosum) by RACE. The CpC8α cDNA is 2183 bp in length, encoding a protein of 591 amino acids. The deduced CpC8α exhibits 89%, 49% and 44% identity with nurse shark, frog and human orthologs, respectively. Sequence alignment indicates that the C8α is well conserved during the evolution process from sharks to mammals, with the same modular architecture as well as the identical cysteine composition in the mature protein. Phylogenetic analysis places CpC8α and nurse shark C8α in cartilaginous fish clade, in parallel with the teleost taxa, to form the C8α cluster with higher vertebrates. Hydrophobicity analysis also indicates a similar hydrophobicity of CpC8α to mammals. Finally, expression analysis revealed CpC8α transcripts were constitutively highly expressed in shark liver, with much less expression in other tissues. The well conserved structure and properties suggests an analogous function of CpC8α to mammalian C8α, though it remains to be confirmed by further study. Copyright © 2013 Elsevier Ltd. All rights reserved.

  20. Subtraction of cap-trapped full-length cDNA libraries to select rare transcripts.

    PubMed

    Hirozane-Kishikawa, Tomoko; Shiraki, Toshiyuki; Waki, Kazunori; Nakamura, Mari; Arakawa, Takahiro; Kawai, Jun; Fagiolini, Michela; Hensch, Takao K; Hayashizaki, Yoshihide; Carninci, Piero

    2003-09-01

    The normalization and subtraction of highly expressed cDNAs from relatively large tissues before cloning dramatically enhanced the gene discovery by sequencing for the mouse full-length cDNA encyclopedia, but these methods have not been suitable for limited RNA materials. To normalize and subtract full-length cDNA libraries derived from limited quantities of total RNA, here we report a method to subtract plasmid libraries excised from size-unbiased amplified lambda phage cDNA libraries that avoids heavily biasing steps such as PCR and plasmid library amplification. The proportion of full-length cDNAs and the gene discovery rate are high, and library diversity can be validated by in silico randomization.

  1. Molecular characterization of cDNA encoding oxygen evolving enhancer protein 1 increased by salt treatment in the mangrove Bruguiera gymnorrhiza.

    PubMed

    Sugihara, K; Hanagata, N; Dubinsky, Z; Baba, S; Karube, I

    2000-11-01

    Young plants of the common Okinawa mangrove species Bruguiera gymnorrhiza were transferred from freshwater to a medium with seawater salt level (500 mM NaCl). Two-dimensional gel electrophoresis revealed in the leaf extract of the plant a 33 kDa protein with pI 5.2, whose quantity increased as a result of NaCl treatment. The N-terminal amino acids sequence of this protein had a significant homology with mature region of oxygen evolving enhancer protein 1 (OEE1) precursor. The cloning of OEE1 precursor cDNA fragment was carried out by means of reverse transcription-PCR (RT-PCR) using degenerated primers. Both 3'- and 5'-regions were isolated by rapid amplification of cDNA ends (RACE) method. The deduced amino acid sequence consisted of 322 amino acids and was 87% identical to that of Nicotiana tabacum. In B. gymnorrhiza, the predicted amino acid sequence of the mature protein starts at the residue number 85 of the open reading frame. The first 84-amino acid residues correspond to a typical transit sequence for the signal directing OEE1 to its appropriate compartment of chloroplast. The expression of OEE1 was analyzed together with other OEE subunits and D1 protein of photosystem II. The transcript levels of all the three OEEs were enhanced by NaCl treatment, but the significant increase of D1 protein was not observed.

  2. Delivery of Iron-Sulfur Clusters to the Hydrogen-Oxidizing [NiFe]-Hydrogenases in Escherichia coli Requires the A-Type Carrier Proteins ErpA and IscA

    PubMed Central

    Pinske, Constanze; Sawers, R. Gary

    2012-01-01

    During anaerobic growth Escherichia coli synthesizes two membrane-associated hydrogen-oxidizing [NiFe]-hydrogenases, termed hydrogenase 1 and hydrogenase 2. Each enzyme comprises a catalytic subunit containing the [NiFe] cofactor, an electron-transferring small subunit with a particular complement of [Fe-S] (iron-sulfur) clusters and a membrane-anchor subunit. How the [Fe-S] clusters are delivered to the small subunit of these enzymes is unclear. A-type carrier (ATC) proteins of the Isc (iron-sulfur-cluster) and Suf (sulfur mobilization) [Fe-S] cluster biogenesis pathways are proposed to traffic pre-formed [Fe-S] clusters to apoprotein targets. Mutants that could not synthesize SufA had active hydrogenase 1 and hydrogenase 2 enzymes, thus demonstrating that the Suf machinery is not required for hydrogenase maturation. In contrast, mutants devoid of the IscA, ErpA or IscU proteins of the Isc machinery had no detectable hydrogenase 1 or 2 activities. Lack of activity of both enzymes correlated with the absence of the respective [Fe-S]-cluster-containing small subunit, which was apparently rapidly degraded. During biosynthesis the hydrogenase large subunits receive their [NiFe] cofactor from the Hyp maturation machinery. Subsequent to cofactor insertion a specific C-terminal processing step occurs before association of the large subunit with the small subunit. This processing step is independent of small subunit maturation. Using western blotting experiments it could be shown that although the amount of each hydrogenase large subunit was strongly reduced in the iscA and erpA mutants, some maturation of the large subunit still occurred. Moreover, in contrast to the situation in Isc-proficient strains, these processed large subunits were not membrane-associated. Taken together, our findings demonstrate that both IscA and ErpA are required for [Fe-S] cluster delivery to the small subunits of the hydrogen-oxidizing hydrogenases; however, delivery of the Fe atom to the active site might have different requirements. PMID:22363723

  3. Subunit Conformations and Assembly States of a DNA Translocating Motor: The Terminase of Bacteriophage P22

    PubMed Central

    Němeček, Daniel; Gilcrease, Eddie B.; Kang, Sebyung; Prevelige, Peter E.; Casjens, Sherwood; Thomas, George J.

    2007-01-01

    Bacteriophage P22, a podovirus infecting strains of Salmonella typhimurium, packages a 42 kbp genome using a headful mechanism. DNA translocation is accomplished by the phage terminase, a powerful molecular motor consisting of large and small subunits. Although many of the structural proteins of the P22 virion have been well characterized, little is known about the terminase subunits and their molecular mechanism of DNA translocation. We report here structural and assembly properties of ectopically expressed and highly purified terminase large and small subunits. The large subunit (gp2), which contains the nuclease and ATPase activities of terminase, exists as a stable monomer with an α/β fold. The small subunit (gp3), which recognizes DNA for packaging and may regulate gp2 activity, exhibits a highly α-helical secondary structure and self-associates to form a stable oligomeric ring in solution. For wildtype gp3, the ring contains nine subunits, as demonstrated by hydrodynamic measurements, electron microscopy and native mass spectrometry. We have also characterized a gp3 mutant (Ala 112 → Thr) that forms a ten subunit ring, despite a subunit fold indistinguishable from wildtype. Both the nonameric and decameric gp3 rings exhibit nonspecific DNA binding activity, and gp2 is able to bind strongly to the DNA/gp3 complex but not to DNA alone. We propose a scheme for the roles of P22 terminase large and small subunits in the recruitment and packaging of viral DNA and discuss the model in relation to proposals for terminase-driven DNA translocation in other phages. PMID:17945256

  4. A double mutation in exon 6 of the [beta]-hexosaminidase [alpha] subunit in a patient with the B1 variant of Tay-Sachs disease

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ainsworth, P.J.; Coulter-Mackie, M.B.

    1992-10-01

    The B1 variant form of Tay-Sachs disease is enzymologically unique in that the causative mutation(s) appear to affect the active site in the [alpha] subunit of [beta]-hexosaminidase A without altering its ability to associate with the [beta] subunit. Most previously reported B1 variant mutations were found in exon 5 within codon 178. The coding sequence of the [alpha] subunit gene of a patient with the B1 variant form was examined with a combination of reverse transcription of mRNA to cDNA, PCR, and dideoxy sequencing. A double mutation in exon 6 has been identified: a G[sub 574][yields]C transversion causing a val[submore » 192][yields]leu change and a G[sub 598][yields] A transition resulting in a val[sub 200][yields]met alteration. The amplified cDNAs were otherwise normal throughout their sequence. The 574 and 598 alterations have been confirmed by amplification directly from genomic DNA from the patient and her mother. Transient-expression studies of the two exon 6 mutations (singly or together) in COS-1 cells show that the G[sub 574][yields]C change is sufficient to cause the loss of enzyme activity. The biochemical phenotype of the 574 alteration in transfection studies is consistent with that expected for a B1 variant mutation. As such, this mutation differs from previously reported B1 variant mutations, all of which occur in exon 5. 31 refs., 2 figs., 2 tabs.« less

  5. Isolation of CYP3A5P cDNA from human liver: a reflection of a novel cytochrome P-450 pseudogene.

    PubMed

    Schuetz, J D; Guzelian, P S

    1995-03-14

    We have isolated, from a human liver cDNA library, a 1627 bp CYP3A5 cDNA variant (CYP3A5P) that contains several large insertions, deletions, and in-frame termination codons. By comparison with the genomic structure of other CYP3A genes, the major insertions in CYP3A5P cDNA demarcate the inferred sites of several CYP3A5 exons. The segments inserted in CYP3A5P have no homology with splice donor acceptor sites. It is unlikely that CYP3A5P cDNA represents an artifact of the cloning procedures since Southern blot analysis of human genomic DNA disclosed that CYP3A5P cDNA hybridized with a DNA fragment distinct from fragments that hybridized with either CYP3A5, CYP3A3 or CYP3A4. Moreover, analysis of adult human liver RNA on Northern blots hybridized with a CYP3A5P cDNA fragment revealed the presence of an mRNA with the predicted size of CYP3A5P. We conclude that CYP3A5P cDNA was derived from a separate gene, CYP3A5P, most likely a pseudogene evolved from CYP3A5.

  6. Proteopedia Entry: The Large Ribosomal Subunit of "Haloarcula Marismortui"

    ERIC Educational Resources Information Center

    Decatur, Wayne A.

    2010-01-01

    This article presents a "Proteopedia" page that shows the refined version of the structure of the "Haloarcula" large ribosomal subunit as solved by the laboratories of Thomas Steitz and Peter Moore. The landmark structure is of great impact as it is the first atomic-resolution structure of the highly conserved ribosomal subunit which harbors…

  7. Combining suppressive subtractive hybridization and cDNA microarrays to identify dietary phosphorus-responsive genes of the rainbow trout (Oncorhynchus mykiss) kidney.

    PubMed

    Lake, Jennifer; Gravel, Catherine; Koko, Gabriel Koffi D; Robert, Claude; Vandenberg, Grant W

    2010-03-01

    Phosphorus (P)-responsive genes and how they regulate renal adaptation to phosphorous-deficient diets in animals, including fish, are not well understood. RNA abundance profiling using cDNA microarrays is an efficient approach to study nutrient-gene interactions and identify these dietary P-responsive genes. To test the hypothesis that dietary P-responsive genes are differentially expressed in fish fed varying P levels, rainbow trout were fed a practical high-P diet (R20: 0.96% P) or a low-P diet (R0: 0.38% P) for 7 weeks. The differentially-expressed genes between dietary groups were identified and compared from the kidney by combining suppressive subtractive hybridization (SSH) with cDNA microarray analysis. A number of genes were confirmed by real-time PCR, and correlated with plasma and bone P concentrations. Approximately 54 genes were identified as potential dietary P-responsive after 7 weeks on a diet deficient in P according to cDNA microarray analysis. Of 18 selected genes, 13 genes were confirmed to be P-responsive at 7 weeks by real-time PCR analysis, including: iNOS, cytochrome b, cytochrome c oxidase subunit II , alpha-globin I, beta-globin, ATP synthase, hyperosmotic protein 21, COL1A3, Nkef, NDPK, glucose phosphate isomerase 1, Na+/H+ exchange protein and GDP dissociation inhibitor 2. Many of these dietary P-responsive genes responded in a moderate way (R0/R20 ratio: <2-3 or >0.5) and in a transient manner to dietary P limitation. In summary, renal adaptation to dietary P deficiency in trout involves changes in the expression of several genes, suggesting a profile of metabolic stress, since many of these differentially-expressed candidates are associated with the cellular adaptative responses. Crown Copyright 2009. Published by Elsevier Inc. All rights reserved.

  8. Structural analysis, plastid localization, and expression of the biotin carboxylase subunit of acetyl-coenzyme A carboxylase from tobacco.

    PubMed

    Shorrosh, B S; Roesler, K R; Shintani, D; van de Loo, F J; Ohlrogge, J B

    1995-06-01

    Acetyl-coenzyme A carboxylase (ACCase, EC 6.4.1.2) catalyzes the synthesis of malonyl-coenzyme A, which is utilized in the plastid for de novo fatty acid synthesis and outside the plastid for a variety of reactions, including the synthesis of very long chain fatty acids and flavonoids. Recent evidence for both multifunctional and multisubunit ACCase isozymes in dicot plants has been obtained. We describe here the isolation of a tobacco (Nicotiana tabacum L. cv bright yellow 2 [NT1]) cDNA clone (E3) that encodes a 58.4-kD protein that shares 80% sequence similarity and 65% identity with the Anabaena biotin carboxylase subunit of ACCase. Similar to other biotin carboxylase subunits of acetyl-CoA carboxylase, the E3-encoded protein contains a putative ATP-binding motif but lacks a biotin-binding site (methionine-lysine-methionine or methionine-lysine-leucine). The deduced protein sequence contains a putative transit peptide whose function was confirmed by its ability to direct in vitro chloroplast uptake. The subcellular localization of this biotin carboxylase has also been confirmed to be plastidial by western blot analysis of pea (Pisum sativum), alfalfa (Medicago sativa L.), and castor (Ricinus communis L.) plastid preparations. Northern blot analysis indicates that the plastid biotin carboxylase transcripts are expressed at severalfold higher levels in castor seeds than in leaves.

  9. Structural analysis, plastid localization, and expression of the biotin carboxylase subunit of acetyl-coenzyme A carboxylase from tobacco.

    PubMed Central

    Shorrosh, B S; Roesler, K R; Shintani, D; van de Loo, F J; Ohlrogge, J B

    1995-01-01

    Acetyl-coenzyme A carboxylase (ACCase, EC 6.4.1.2) catalyzes the synthesis of malonyl-coenzyme A, which is utilized in the plastid for de novo fatty acid synthesis and outside the plastid for a variety of reactions, including the synthesis of very long chain fatty acids and flavonoids. Recent evidence for both multifunctional and multisubunit ACCase isozymes in dicot plants has been obtained. We describe here the isolation of a tobacco (Nicotiana tabacum L. cv bright yellow 2 [NT1]) cDNA clone (E3) that encodes a 58.4-kD protein that shares 80% sequence similarity and 65% identity with the Anabaena biotin carboxylase subunit of ACCase. Similar to other biotin carboxylase subunits of acetyl-CoA carboxylase, the E3-encoded protein contains a putative ATP-binding motif but lacks a biotin-binding site (methionine-lysine-methionine or methionine-lysine-leucine). The deduced protein sequence contains a putative transit peptide whose function was confirmed by its ability to direct in vitro chloroplast uptake. The subcellular localization of this biotin carboxylase has also been confirmed to be plastidial by western blot analysis of pea (Pisum sativum), alfalfa (Medicago sativa L.), and castor (Ricinus communis L.) plastid preparations. Northern blot analysis indicates that the plastid biotin carboxylase transcripts are expressed at severalfold higher levels in castor seeds than in leaves. PMID:7610168

  10. The alpha subunit of Go interacts with promyelocytic leukemia zinc finger protein and modulates its functions.

    PubMed

    Won, Jung Hee; Park, Jung Sik; Ju, Hyun Hee; Kim, Soyeon; Suh-Kim, Haeyoung; Ghil, Sung Ho

    2008-05-01

    Heterotrimeric GTP-binding proteins (G proteins) mediate signal transduction generated by neurotransmitters and hormones. Go, a member of the Go/Gi family, is the most abundant heterotrimeric G protein in the brain. Most mechanistic analyses on Go activation demonstrate that its action is mediated by the Gbetagamma dimer; downstream effectors for its alpha subunit (Goalpha) have not been clearly defined. Here, we employ the yeast two-hybrid system to screen for Goalpha-interacting partners in a cDNA library from human fetal brain. The transcription factor promyelocytic leukemia zinc finger protein (PLZF) specifically bound to Goalpha. Interactions between PLZF and Goalpha were confirmed using in vitro and in vivo affinity binding assays. Activated Goalpha interacted directly with PLZF, and enhanced its function as a transcriptional and cell growth suppressor. Notably, PLZF activity was additionally promoted by the Go/ialpha-coupled cannabinoid receptor (CB) in HL60 cells endogenously expressing CB and PLZF. These results collectively suggest that Goalpha modulates the function of PLZF via direct interactions. Our novel findings provide insights into the diverse cellular roles of Goalpha and its coupled receptor.

  11. Identification of a subunit of NADH-dehydrogenase as a p49/STRAP-binding protein

    PubMed Central

    Zhang, Xiaomin; Azhar, Gohar; Helms, Scott; Zhong, Ying; Wei, Jeanne Y

    2008-01-01

    Background The p49/STRAP (or SRFBP1) protein was recently identified in our laboratory as a cofactor of serum response factor that contributes to the regulation of SRF target genes in the heart. Results In the present study, we report that NDUFAB1, a nuclear encoded subunit of NADH dehydrogenase, represented the majority of the cDNA clones that interacted with p49/STRAP in multiple screenings using the yeast two-hybrid system. The p49/STRAP and NDUFAB1 proteins interacted and co-localized with each other in the cell. The p49/STRAP protein contains four classic nuclear localization sequence motifs, and it was observed to be present predominantly in the nucleus. Overexpression of p49/STRAP altered the intracellular level of NAD, and reduced the NAD/NADH ratio. Overexpression of p49/STRAP also induced the deacetylation of serum response factor. Conclusion These data suggest that p49/STRAP plays a role in the regulation of intracellular processes such as cardiac cellular metabolism, gene expression, and possibly aging. PMID:18230186

  12. Cloning of the chaperonin t-complex polypeptide 1 gene from Schistosoma mansoni and studies of its expression levels under heat shock and oxidative stress.

    PubMed

    Campos, E G; Hamdan, F F

    2000-03-01

    The protein TCP-1 (t-complex polypeptide 1) is a subunit of the hetero-oligomeric complex CCT (chaperonin containing TCP- 1) present in the eukaryotic cytosol. Chaperone function may be critical for the development and survival of the different life stages of Schistosoma mansoni, a parasite that is exposed to drastic environmental changes during its development. We isolated a full-length S. mansoni TCP-1 cDNA (SmTCP-1A) encoding a protein highly homologous with TCP-1. The deduced SmTCP-1A amino-acid sequence shows up to 65% identity with other eukaryotic CCT family members. Semiquantitative reverse transcriptase-polymerase chain reaction (RT-PCR) analysis revealed that the mRNA expression levels of SmTCP-1A in adult S. mansoni were down-regulated in worms subjected to heat shock and oxidative stress conditions. This down-regulation of SmTCP-1A mRNA may reflect a switch in CCT subunits as an adaptive response to heat shock and oxidative stress conditions.

  13. Linkage and homology analysis divides the eight genes for the small subunit of petunia ribulose 1,5-bisphosphate carboxylase into three gene families

    PubMed Central

    Dean, Caroline; van den Elzen, Peter; Tamaki, Stanley; Dunsmuir, Pamela; Bedbrook, John

    1985-01-01

    Twenty-six λ phage clones with homology to coding sequences of the small subunit (SSU) of ribulose 1,5-bisphosphate carboxylase have been isolated from an EMBL3 λ phage bank of Petunia (Mitchell) DNA. Restriction mapping of the phage inserts shows that the clones were obtained from five nonoverlapping regions of petunia DNA that carry seven SSU genes. Comparison of the HindIII genomic fragments of petunia DNA with the HindIII restriction fragments of the isolated phage indicates that petunia nuclear DNA encodes eight SSU genes, seven of which are present in the phage clones. Two incomplete genes, which contain only the 3′ end of an SSU gene, were also found in the phage clones. We demonstrate that the eight SSU genes of petunia can be divided into three gene families based on homology to three petunia cDNA clones. Two gene families contain single SSU genes and the third contains six genes, four of which are closely linked within petunia nuclear DNA. Images PMID:16593584

  14. Toxin gene determination and evolution in scorpaenoid fish.

    PubMed

    Chuang, Po-Shun; Shiao, Jen-Chieh

    2014-09-01

    In this study, we determine the toxin genes from both cDNA and genomic DNA of four scorpaenoid fish and reconstruct their evolutionary relationship. The deduced protein sequences of the two toxin subunits in Sebastapistes strongia, Scorpaenopsis oxycephala, and Sebastiscus marmoratus are about 700 amino acid, similar to the sizes of the stonefish (Synanceia horrida, and Synanceia verrucosa) and lionfish (Pterois antennata and Pterois volitans) toxins previously published. The intron positions are highly conserved among these species, which indicate the applicability of gene finding by using genomic DNA template. The phylogenetic analysis shows that the two toxin subunits were duplicated prior to the speciation of Scorpaenoidei. The precedence of the gene duplication over speciation indicates that the toxin genes may be common to the whole family of Scorpaeniform. Furthermore, one additional toxin gene has been determined in the genomic DNA of Dendrochirus zebra. The phylogenetic analysis suggests that an additional gene duplication occurred before the speciation of the lionfish (Pteroinae) and a pseudogene may be generally present in the lineage of lionfish. Copyright © 2014 Elsevier Ltd. All rights reserved.

  15. Evaluation of nearest-neighbor methods for detection of chimeric small-subunit rRNA sequences

    NASA Technical Reports Server (NTRS)

    Robison-Cox, J. F.; Bateson, M. M.; Ward, D. M.

    1995-01-01

    Detection of chimeric artifacts formed when PCR is used to retrieve naturally occurring small-subunit (SSU) rRNA sequences may rely on demonstrating that different sequence domains have different phylogenetic affiliations. We evaluated the CHECK_CHIMERA method of the Ribosomal Database Project and another method which we developed, both based on determining nearest neighbors of different sequence domains, for their ability to discern artificially generated SSU rRNA chimeras from authentic Ribosomal Database Project sequences. The reliability of both methods decreases when the parental sequences which contribute to chimera formation are more than 82 to 84% similar. Detection is also complicated by the occurrence of authentic SSU rRNA sequences that behave like chimeras. We developed a naive statistical test based on CHECK_CHIMERA output and used it to evaluate previously reported SSU rRNA chimeras. Application of this test also suggests that chimeras might be formed by retrieving SSU rRNAs as cDNA. The amount of uncertainty associated with nearest-neighbor analyses indicates that such tests alone are insufficient and that better methods are needed.

  16. Epitopes of human testis-specific lactate dehydrogenase deduced from a cDNA sequence

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Millan, J.L.; Driscoll, C.E.; LeVan, K.M.

    The sequence and structure of human testis-specific L-lactate dehydrogenase (LDHC/sub 4/, LDHX; (L)-lactate:NAD/sup +/ oxidoreductase, EC 1.1.1.27) has been derived from analysis of a complementary DNA (cDNA) clone comprising the complete protein coding region of the enzyme. From the deduced amino acid sequence, human LDHC/sub 4/ is as different from rodent LDHC/sub 4/ (73% homology) as it is from human LDHA/sub 4/ (76% homology) and porcine LDHB/sub 4/ (68% homology). Subunit homologies are consistent with the conclusion that the LDHC gene arose by at least two independent duplication events. Furthermore, the lower degree of homology between mouse and human LDHC/submore » 4/ and the appearance of this isozyme late in evolution suggests a higher rate of mutation in the mammalian LDHC genes than in the LDHA and -B genes. Comparison of exposed amino acid residues of discrete anti-genic determinants of mouse and human LDHC/sub 4/ reveals significant differences. Knowledge of the human LDHC/sub 4/ sequence will help design human-specific peptides useful in the development of a contraceptive vaccine.« less

  17. Mannan-binding lectin of the sea urchin Strongylocentrotus nudus.

    PubMed

    Bulgakov, Aleksandr A; Eliseikina, Marina G; Kovalchuk, Svetlana N; Petrova, Irina Yu; Likhatskaya, Galina N; Shamshurina, Ekaterina V; Rasskazov, Valery A

    2013-02-01

    A novel lectin specific to low-branched mannans (MBL-SN) was isolated from coelomic plasma of the sea urchin Strongylocentrotus nudus by combining anion-exchange liquid chromatography on DEAE Toyopearl 650 M, affinity chromatography on mannan-Sepharose and gel filtration on the Sephacryl S-200. The molecular mass of MBL-SN was estimated by sodium dodecyl sulphate polyacrylamide gel electrophoresis under non-reducing conditions to be about 34 kDa. MBL-SN was shown to be a dimer with two identical subunits of about 17 kDa. The native MBL-SN exists as a tetramer. The physico-chemical properties of MBL-SN indicate that it belongs to C-type mannan-binding lectins. The cDNA encoding MBL-SN was cloned from the total cDNA of S. nudus coelomocytes and encodes a 17-kDa protein of 144 amino acid residues that contains a single carbohydrate-recognition domain of C-type lectins. Prediction of the MBL-SN tertiary structure using comparative modelling revealed that MBL-SN is an α/β-protein with eight β-strands and two α-helices. Comparison of the MBL-SN model with available three-dimensional structures of C-type lectins revealed that they share a common fold pattern.

  18. Highly conserved small subunit residues influence rubisco large subunit catalysis.

    PubMed

    Genkov, Todor; Spreitzer, Robert J

    2009-10-30

    The chloroplast enzyme ribulose 1,5-bisphosphate carboxylase/oxygenase (Rubisco) catalyzes the rate-limiting step of photosynthetic CO(2) fixation. With a deeper understanding of its structure-function relationships and competitive inhibition by O(2), it may be possible to engineer an increase in agricultural productivity and renewable energy. The chloroplast-encoded large subunits form the active site, but the nuclear-encoded small subunits can also influence catalytic efficiency and CO(2)/O(2) specificity. To further define the role of the small subunit in Rubisco function, the 10 most conserved residues in all small subunits were substituted with alanine by transformation of a Chlamydomonas reinhardtii mutant that lacks the small subunit gene family. All the mutant strains were able to grow photosynthetically, indicating that none of the residues is essential for function. Three of the substitutions have little or no effect (S16A, P19A, and E92A), one primarily affects holoenzyme stability (L18A), and the remainder affect catalysis with or without some level of associated structural instability (Y32A, E43A, W73A, L78A, P79A, and F81A). Y32A and E43A cause decreases in CO(2)/O(2) specificity. Based on the x-ray crystal structure of Chlamydomonas Rubisco, all but one (Glu-92) of the conserved residues are in contact with large subunits and cluster near the amino- or carboxyl-terminal ends of large subunit alpha-helix 8, which is a structural element of the alpha/beta-barrel active site. Small subunit residues Glu-43 and Trp-73 identify a possible structural connection between active site alpha-helix 8 and the highly variable small subunit loop between beta-strands A and B, which can also influence Rubisco CO(2)/O(2) specificity.

  19. Phosducin-like protein: an ethanol-responsive potential modulator of guanine nucleotide-binding protein function.

    PubMed

    Miles, M F; Barhite, S; Sganga, M; Elliott, M

    1993-11-15

    Acute and chronic exposure to ethanol produces specific changes in several signal transduction cascades. Such alterations in signaling are thought to be a crucial aspect of the central nervous system's adaptive response, which occurs with chronic exposure to ethanol. We have recently identified and isolated several genes whose expression is specifically induced by ethanol in neural cell cultures. The product of one of these genes has extensive sequence homology to phosducin, a phosphoprotein expressed in retina and pineal gland that modulates trimeric guanine nucleotide-binding protein (G protein) function by binding to G-protein beta gamma subunits. We identified from a rat brain cDNA library an isolate encoding the phosducin-like protein (PhLP), which has 41% identity and 65% amino acid homology to phosducin. PhLP cDNA is expressed in all tissues screened by RNA blot-hybridization analysis and shows marked evolutionary conservation on Southern hybridization. We have identified four forms of PhLP cDNA varying only in their 5' ends, probably due to alternative splicing. This 5'-end variation generates two predicted forms of PhLP protein that differ by 79 aa at the NH2 terminus. Treatment of NG108-15 cells for 24 hr with concentrations of ethanol seen in actively drinking alcoholics (25-100 mM) causes up to a 3-fold increase in PhLP mRNA levels. Induction of PhLP by ethanol could account for at least some of the widespread alterations in signal transduction and G-protein function that are known to occur with chronic exposure to ethanol.

  20. Intra-isolate genome variation in arbuscular mycorrhizal fungi persists in the transcriptome.

    PubMed

    Boon, E; Zimmerman, E; Lang, B F; Hijri, M

    2010-07-01

    Arbuscular mycorrhizal fungi (AMF) are heterokaryotes with an unusual genetic makeup. Substantial genetic variation occurs among nuclei within a single mycelium or isolate. AMF reproduce through spores that contain varying fractions of this heterogeneous population of nuclei. It is not clear whether this genetic variation on the genome level actually contributes to the AMF phenotype. To investigate the extent to which polymorphisms in nuclear genes are transcribed, we analysed the intra-isolate genomic and cDNA sequence variation of two genes, the large subunit ribosomal RNA (LSU rDNA) of Glomus sp. DAOM-197198 (previously known as G. intraradices) and the POL1-like sequence (PLS) of Glomus etunicatum. For both genes, we find high sequence variation at the genome and transcriptome level. Reconstruction of LSU rDNA secondary structure shows that all variants are functional. Patterns of PLS sequence polymorphism indicate that there is one functional gene copy, PLS2, which is preferentially transcribed, and one gene copy, PLS1, which is a pseudogene. This is the first study that investigates AMF intra-isolate variation at the transcriptome level. In conclusion, it is possible that, in AMF, multiple nuclear genomes contribute to a single phenotype.

  1. Qualitative and Quantitative Assays of Transposition and Homologous Recombination of the Retrotransposon Tf1 in Schizosaccharomyces pombe.

    PubMed

    Sangesland, Maya; Atwood-Moore, Angela; Rai, Sudhir K; Levin, Henry L

    2016-01-01

    Transposition and homologous recombination assays are valuable genetic tools to measure the production and integration of cDNA from the long terminal repeat (LTR) retrotransposon Tf1 in the fission yeast (Schizosaccharomyces pombe). Here we describe two genetic assays, one that measures the transposition activity of Tf1 by monitoring the mobility of a drug resistance marked Tf1 element expressed from a multi-copy plasmid and another assay that measures homologous recombination between Tf1 cDNA and the expression plasmid. While the transposition assay measures insertion of full-length Tf1 cDNA mediated by the transposon integrase, the homologous recombination assay measures levels of cDNA present in the nucleus and is independent of integrase activity. Combined, these assays can be used to systematically screen large collections of strains to identify mutations that specifically inhibit the integration step in the retroelement life cycle. Such mutations can be identified because they reduce transposition activity but nevertheless have wild-type frequencies of homologous recombination. Qualitative assays of yeast patches on agar plates detect large defects in integration and recombination, while the quantitative approach provides a precise method of determining integration and recombination frequencies.

  2. Expression, purification, and evaluation for anticancer activity of ribosomal protein L31 gene (RPL31) from the giant panda (Ailuropoda melanoleuca).

    PubMed

    Su, Xiu-Lan; Hou, Yi-Ling; Yan, Xiang-Hui; Ding, Xiang; Hou, Wan-Ru; Sun, Bing; Zhang, Si-Nan

    2012-09-01

    Ribosomal protein L31 gene is a component of the 60S large ribosomal subunit encoded by RPL31 gene, while ribosomal protein L31 (RPL31) is an important constituent of peptidyltransferase center. In our research, the cDNA and the genomic sequence of RPL31 were cloned successfully from the giant panda (Ailuropoda melanoleuca) using RT-PCR technology respectively, following sequencing and analyzing preliminarily. We constructed a recombinant expression vector contained RPL31 cDNA and over-expressed it in Escherichia coli using pET28a plasmids. The expression product was purified to obtain recombinant protein of RPL31 from the giant panda. Recombinant protein of RPL31 obtained from the experiment acted on human laryngeal carcinoma Hep-2 and human hepatoma HepG-2 cells for study of its anti-cancer activity by MTT [3-(4, 5-dimehyl-2-thiazolyl)-2, 5-diphenyl-2H-tetrazolium bromide] method. Then observe these cells growth depressive effect. The result indicated that the cDNA fragment of the RPL31 cloned from the giant panda is 419 bp in size, containing an open reading frame of 378 bp, and deduced protein was composed of 125 amino acids with an estimated molecular weight of 14.46-kDa and PI of 11.21. The length of the genomic sequence is 8,091 bp, which was found to possess four exons and three introns. The RPL31 gene can be readily expressed in E.coli, expecting 18-kDa polypeptide that formed inclusion bodies. Recombinant protein RPL31 from the giant panda consists of 157 amino acids with an estimated molecular weight of 17.86 kDa and PI of 10.77. The outcomes showed that the cell growth inhibition rate in a time- and dose-dependent on recombinant protein RPL31. And also indicated that the effect at low concentrations was better than high concentrations on Hep-2 cells, and the concentration of 0.33 μg/mL had the best rate of growth inhibition, 44 %. Consequently, our study aimed at revealing the recombinant protein RPL31 anti-cancer function from the giant panda, providing scientific basis and resources for the research and development of cancer protein drugs anti-cancer mechanism research. Further studies of the mechanism and the signal transduction pathways are in progress.

  3. Mutations in the PCCA gene encoding the {alpha} subunit of propionyl-CoA carboxylase in patients with propionic acidemia

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Campeau, E.; Leon-Del-Rio, A.; Gravel, R.A.

    Propionic acidemia is a rare autosomal recessive disorder characterized by a deficiency of the mitochondrial biotin-dependent enzyme, propionyl-CoA carboxylase (PCC). PCC has the structure {alpha}{sub 4}{beta}{sub 4}, with the {alpha} subunit containing the biotin prosthetic group. This study is concerned with defining the spectrum of mutations occurring in the PCCA gene encoding the {alpha} subunit. Mutations were initially assigned to this gene through complementation experiments done after somatic fusion of patient fibroblasts. The analyses were performed on PCR-amplified reverse transcripts of fibroblast RNA. The mutations were identified by single strand conformational polymorphism analysis and direct sequencing of PCR products. Threemore » candidate disease-causing mutations and one DNA polymorphism were identified in the {alpha} subunit sequence in different patients: (1) a 3 bp deletion {triangle}CTG{sub 2058-2060}, which eliminates Cys687 near the biotin binding site (Lys669); (2) T{sub 611}{r_arrow}A which converts Met204 to Lys in a highly conserved region matching that of an ATP binding site; (3) An {approximately}50 bp deletion near the 3{prime} end of the cDNA which likely corresponds to the loss of an exon due to a splicing defect; and (4) a 3 bp insertion, +CAG{sub 2203}, located downstream of the stop codon, which is likely a DNA polymorphism. In order to determine the effect of the Cys687 deletion on the biotinylation of PCC, we expressed the mutation in a 67 amino acid C-terminal fragment of the PCC {alpha} subunit in E. coli in which biotinylation is directed by the bacterial biotin ligase. While the mutant peptide was expressed at about half-normal levels, the biotinylation of the peptide that was present was reduced to only {approximately}20% normal. We suggest, therefore, that the absence of PCC activity due to {triangle}Cys687 results at least in part from defective biotinylation of an unstable protein.« less

  4. First comparative characterization of three distinct ferritin subunits from a teleost: Evidence for immune-responsive mRNA expression and iron depriving activity of seahorse (Hippocampus abdominalis) ferritins.

    PubMed

    Oh, Minyoung; Umasuthan, Navaneethaiyer; Elvitigala, Don Anushka Sandaruwan; Wan, Qiang; Jo, Eunyoung; Ko, Jiyeon; Noh, Gyeong Eon; Shin, Sangok; Rho, Sum; Lee, Jehee

    2016-02-01

    Ferritins play an indispensable role in iron homeostasis through their iron-withholding function in living beings. In the current study, cDNA sequences of three distinct ferritin subunits, including a ferritin H, a ferritin M, and a ferritin L, were identified from big belly seahorse, Hippocampus abdominalis, and molecularly characterized. Complete coding sequences (CDS) of seahorse ferritin H (HaFerH), ferritin M (HaFerM), and ferritin L (HaFerL) subunits were comprised of 531, 528, and 522 base pairs (bp), respectively, which encode polypeptides of 177, 176, and 174 amino acids, respectively, with molecular masses of ∼20-21 kDa. Our in silico analyses demonstrate that these three ferritin subunits exhibit the typical characteristics of ferritin superfamily members including iron regulatory elements, domain signatures, and reactive centers. The coding sequences of HaFerH, M, and L were cloned and the corresponding proteins were overexpressed in a bacterial system. Recombinantly expressed HaFer proteins demonstrated detectable in vivo iron sequestrating (ferroxidase) activity, consistent with their putative iron binding capability. Quantification of the basal expression of these three HaFer sequences in selected tissues demonstrated a gene-specific ubiquitous spatial distribution pattern, with abundance of mRNA in HaFerM in the liver and predominant expression of HaFerH and HaFerL in blood. Interestingly, the basal expression of all three ferritin genes was found to be significantly modulated against pathogenic stress mounted by lipopolysaccharides (LPS), poly I:C, Streptococcus iniae, and Edwardsiella tarda. Collectively, our findings suggest that the three HaFer subunits may be involved in iron (II) homeostasis in big belly seahorse and that they are important in its host defense mechanisms. Copyright © 2016 Elsevier Ltd. All rights reserved.

  5. Plasma proteins of rainbow trout (Oncorhynchus mykiss) isolated by binding to lipopolysaccharide from Aeromonas salmonicida.

    PubMed

    Hoover, G J; el-Mowafi, A; Simko, E; Kocal, T E; Ferguson, H W; Hayes, M A

    1998-07-01

    In an attempt to find plasma proteins that might be involved in the constitutive resistance of rainbow trout to furunculosis, a disease caused by Aeromonas salmonicida (AS), we purified serum and plasma proteins based on their calcium- and carbohydrate-dependent affinity for A. salmonicida lipopolysaccharide (LPS) coupled to an epoxy-activated synthetic matrix (Toyopearl AF Epoxy 650M). A multimeric family of high molecular weight (96 to 200-kDa) LPS-binding proteins exhibiting both calcium and mannose dependent binding was isolated. Upon reduction the multimers collapsed to subunits of approximately 16-kDa as estimated by 1D-PAGE and exhibited pI values of 5.30 and 5.75 as estimated from 2D-PAGE. Their N-terminal sequences were related to rainbow trout ladderlectin (RT-LL), a Sepharose-binding protein. Polyclonal antibodies to the LPS-purified 16-kDa subunits recognized both the reduced 16-kDa subunits and the non-reduced multimeric forms. A calcium- and N-acetylglucosamine (GlcNAc)-dependent LPS-binding multimeric protein (approximately 207-kDa) composed of 34.5-kDa subunits was purified and found to be identical to trout serum amyloid P (SAP) by N-terminal sequence (DLQDLSGKVFV). A protein of 24-kDa, in reduced and non-reduced conditions, was isolated and had N-terminal sequence identity with a known C-reactive protein (CRP) homologue, C-polysaccharide-binding protein 2 (TCBP2) of rainbow trout. A novel calcium-dependent LPS-binding protein was purified and termed rainbow trout lectin 37 (RT-L37). This protein, composed of dimers, tetramers and pentamers of 37 kDa subunits (pI 5.50-6.10) with N-terminal sequence (IQE(D/N)GHAEAPGATTVLNEILR) showed no close homology to proteins known or predicted from cDNA sequences. These findings demonstrate that rainbow trout have several blood proteins with lectin properties for the LPS of A. salmonicida; the biological functions of these proteins in resistance to furunculosis are still unknown.

  6. Structural basis for translational surveillance by the large ribosomal subunit-associated protein quality control complex

    PubMed Central

    Lyumkis, Dmitry; Oliveira dos Passos, Dario; Tahara, Erich B.; Webb, Kristofor; Bennett, Eric J.; Vinterbo, Staal; Potter, Clinton S.; Carragher, Bridget; Joazeiro, Claudio A. P.

    2014-01-01

    All organisms have evolved mechanisms to manage the stalling of ribosomes upon translation of aberrant mRNA. In eukaryotes, the large ribosomal subunit-associated quality control complex (RQC), composed of the listerin/Ltn1 E3 ubiquitin ligase and cofactors, mediates the ubiquitylation and extraction of ribosome-stalled nascent polypeptide chains for proteasomal degradation. How RQC recognizes stalled ribosomes and performs its functions has not been understood. Using single-particle cryoelectron microscopy, we have determined the structure of the RQC complex bound to stalled 60S ribosomal subunits. The structure establishes how Ltn1 associates with the large ribosomal subunit and properly positions its E3-catalytic RING domain to mediate nascent chain ubiquitylation. The structure also reveals that a distinguishing feature of stalled 60S particles is an exposed, nascent chain-conjugated tRNA, and that the Tae2 subunit of RQC, which facilitates Ltn1 binding, is responsible for selective recognition of stalled 60S subunits. RQC components are engaged in interactions across a large span of the 60S subunit surface, connecting the tRNA in the peptidyl transferase center to the distally located nascent chain tunnel exit. This work provides insights into a mechanism linking translation and protein degradation that targets defective proteins immediately after synthesis, while ignoring nascent chains in normally translating ribosomes. PMID:25349383

  7. Non-biased and efficient global amplification of a single-cell cDNA library

    PubMed Central

    Huang, Huan; Goto, Mari; Tsunoda, Hiroyuki; Sun, Lizhou; Taniguchi, Kiyomi; Matsunaga, Hiroko; Kambara, Hideki

    2014-01-01

    Analysis of single-cell gene expression promises a more precise understanding of molecular mechanisms of a living system. Most techniques only allow studies of the expressions for limited numbers of gene species. When amplification of cDNA was carried out for analysing more genes, amplification biases were frequently reported. A non-biased and efficient global-amplification method, which uses a single-cell cDNA library immobilized on beads, was developed for analysing entire gene expressions for single cells. Every step in this analysis from reverse transcription to cDNA amplification was optimized. By removing degrading excess primers, the bias due to the digestion of cDNA was prevented. Since the residual reagents, which affect the efficiency of each subsequent reaction, could be removed by washing beads, the conditions for uniform and maximized amplification of cDNAs were achieved. The differences in the amplification rates for randomly selected eight genes were within 1.5-folds, which could be negligible for most of the applications of single-cell analysis. The global amplification gives a large amount of amplified cDNA (>100 μg) from a single cell (2-pg mRNA), and that amount is enough for downstream analysis. The proposed global-amplification method was used to analyse transcript ratios of multiple cDNA targets (from several copies to several thousand copies) quantitatively. PMID:24141095

  8. In cellulo examination of a beta-alpha hybrid construct of beta-hexosaminidase A subunits, reported to interact with the GM2 activator protein and hydrolyze GM2 ganglioside.

    PubMed

    Sinici, Incilay; Yonekawa, Sayuri; Tkachyova, Ilona; Gray, Steven J; Samulski, R Jude; Wakarchuk, Warren; Mark, Brian L; Mahuran, Don J

    2013-01-01

    The hydrolysis in lysosomes of GM2 ganglioside to GM3 ganglioside requires the correct synthesis, intracellular assembly and transport of three separate gene products; i.e., the alpha and beta subunits of heterodimeric beta-hexosaminidase A, E.C. # 3.2.1.52 (encoded by the HEXA and HEXB genes, respectively), and the GM2-activator protein (GM2AP, encoded by the GM2A gene). Mutations in any one of these genes can result in one of three neurodegenerative diseases collectively known as GM2 gangliosidosis (HEXA, Tay-Sachs disease, MIM # 272800; HEXB, Sandhoff disease, MIM # 268800; and GM2A, AB-variant form, MIM # 272750). Elements of both of the hexosaminidase A subunits are needed to productively interact with the GM2 ganglioside-GM2AP complex in the lysosome. Some of these elements have been predicted from the crystal structures of hexosaminidase and the activator. Recently a hybrid of the two subunits has been constructed and reported to be capable of forming homodimers that can perform this reaction in vivo, which could greatly simplify vector-mediated gene transfer approaches for Tay-Sachs or Sandhoff diseases. A cDNA encoding a hybrid hexosaminidase subunit capable of dimerizing and hydrolyzing GM2 ganglioside could be incorporated into a single vector, whereas packaging both subunits of hexosaminidase A into vectors, such as adeno-associated virus, would be impractical due to size constraints. In this report we examine the previously published hybrid construct (H1) and a new more extensive hybrid (H2), with our documented in cellulo (live cell- based) assay utilizing a fluorescent GM2 ganglioside derivative. Unfortunately when Tay-Sachs cells were transfected with either the H1 or H2 hybrid construct and then were fed the GM2 derivative, no significant increase in its turnover was detected. In vitro assays with the isolated H1 or H2 homodimers confirmed that neither was capable of human GM2AP-dependent hydrolysis of GM2 ganglioside.

  9. In Cellulo Examination of a Beta-Alpha Hybrid Construct of Beta-Hexosaminidase A Subunits, Reported to Interact with the GM2 Activator Protein and Hydrolyze GM2 Ganglioside

    PubMed Central

    Sinici, Incilay; Yonekawa, Sayuri; Tkachyova, Ilona; Gray, Steven J.; Samulski, R. Jude; Wakarchuk, Warren; Mark, Brian L.; Mahuran, Don J.

    2013-01-01

    The hydrolysis in lysosomes of GM2 ganglioside to GM3 ganglioside requires the correct synthesis, intracellular assembly and transport of three separate gene products; i.e., the alpha and beta subunits of heterodimeric beta-hexosaminidase A, E.C. # 3.2.1.52 (encoded by the HEXA and HEXB genes, respectively), and the GM2-activator protein (GM2AP, encoded by the GM2A gene). Mutations in any one of these genes can result in one of three neurodegenerative diseases collectively known as GM2 gangliosidosis (HEXA, Tay-Sachs disease, MIM # 272800; HEXB, Sandhoff disease, MIM # 268800; and GM2A, AB-variant form, MIM # 272750). Elements of both of the hexosaminidase A subunits are needed to productively interact with the GM2 ganglioside-GM2AP complex in the lysosome. Some of these elements have been predicted from the crystal structures of hexosaminidase and the activator. Recently a hybrid of the two subunits has been constructed and reported to be capable of forming homodimers that can perform this reaction in vivo, which could greatly simplify vector-mediated gene transfer approaches for Tay-Sachs or Sandhoff diseases. A cDNA encoding a hybrid hexosaminidase subunit capable of dimerizing and hydrolyzing GM2 ganglioside could be incorporated into a single vector, whereas packaging both subunits of hexosaminidase A into vectors, such as adeno-associated virus, would be impractical due to size constraints. In this report we examine the previously published hybrid construct (H1) and a new more extensive hybrid (H2), with our documented in cellulo (live cell- based) assay utilizing a fluorescent GM2 ganglioside derivative. Unfortunately when Tay-Sachs cells were transfected with either the H1 or H2 hybrid construct and then were fed the GM2 derivative, no significant increase in its turnover was detected. In vitro assays with the isolated H1 or H2 homodimers confirmed that neither was capable of human GM2AP-dependent hydrolysis of GM2 ganglioside. PMID:23483939

  10. Distinct cellular distributions of Kv4 pore-forming and auxiliary subunits in rat dorsal root ganglion neurons.

    PubMed

    Matsuyoshi, Hiroko; Takimoto, Koichi; Yunoki, Takakazu; Erickson, Vickie L; Tyagi, Pradeep; Hirao, Yoshihiko; Wanaka, Akio; Yoshimura, Naoki

    2012-09-17

    Dorsal root ganglia contain heterogeneous populations of primary afferent neurons that transmit various sensory stimuli. This functional diversity may be correlated with differential expression of voltage-gated K(+) (Kv) channels. Here, we examine cellular distributions of Kv4 pore-forming and ancillary subunits that are responsible for fast-inactivating A-type K(+) current. Expression pattern of Kv α-subunit, β-subunit and auxiliary subunit was investigated using immunohistochemistry, in situ hybridization and RT-PCR technique. The two pore-forming subunits Kv4.1 and Kv4.3 show distinct cellular distributions: Kv4.3 is predominantly in small-sized C-fiber neurons, whereas Kv4.1 is seen in DRG neurons in various sizes. Furthermore, the two classes of Kv4 channel auxiliary subunits are also distributed in different-sized cells. KChIP3 is the only significantly expressed Ca(2+)-binding cytosolic ancillary subunit in DRGs and present in medium to large-sized neurons. The membrane-spanning auxiliary subunit DPP6 is seen in a large number of DRG neurons in various sizes, whereas DPP10 is restricted in small-sized neurons. Distinct combinations of Kv4 pore-forming and auxiliary subunits may constitute A-type channels in DRG neurons with different physiological roles. Kv4.1 subunit, in combination with KChIP3 and/or DPP6, form A-type K(+) channels in medium to large-sized A-fiber DRG neurons. In contrast, Kv4.3 and DPP10 may contribute to A-type K(+) current in non-peptidergic, C-fiber somatic afferent neurons. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. The expression of full length Gp91-phox protein is associated with reduced amphotropic retroviral production.

    PubMed

    Bellantuono, I; Lashford, L S; Rafferty, J A; Fairbairn, L J

    2000-05-01

    As a single gene defect in mature bone marrow cells, chronic granulomatous disease (X-CGD) represents a disorder which may be amenable to gene therapy by the transfer of the missing subunit into hemopoietic stem cells. In the majority of cases lack of Gp91-phox causes the disease. So far, studies involving transfer of Gp91-phox cDNA, including a phase I clinical trial, have yielded disappointing results. Most often, low titers of virus have been reported. In the present study we investigated the possible reasons for low titer amphotropic viral production. To investigate the effect of Gp91 cDNA on the efficiency of retroviral production from the packaging cell line, GP+envAm12, we constructed vectors containing either the native cDNA, truncated versions of the cDNA or a mutated form (LATG) in which the natural translational start codon was changed to a stop codon. Following derivation of clonal packaging cell lines, these were assessed for viral titer by RNA slot blot and analyzed by non-parametrical statistical analysis (Whitney-Mann U-test). An improvement in viral titer of just over two-fold was found in packaging cells containing the start-codon mutant of Gp91 and no evidence of truncated viral RNA was seen in these cells. Further analysis revealed the presence of rearranged forms of the provirus in Gp91-expressing cells, and the production of truncated, unpackaged viral RNA. Protein analysis revealed that LATG-transduced cells did not express full-length Gp91-phox, whereas those containing the wild-type cDNA did. However, a truncated protein was seen in ATG-transduced cells which was also present in wild type cells. No evidence for the presence of a negative transcriptional regulatory element was found from studies with the deletion mutants. A statistically significant effect of protein production on the production of virus from Gp91-expressing cells was found. Our data point to a need to restrict expression of the Gp91-phox protein and its derivatives in order to enhance retroviral production and suggest that improvements in current vectors for CGD gene therapy may need to include controlled, directed expression only in mature neutrophils.

  12. Differential mitochondrial DNA and gene expression in inherited retinal dysplasia in miniature Schnauzer dogs.

    PubMed

    Appleyard, Greg D; Forsyth, George W; Kiehlbauch, Laura M; Sigfrid, Kristen N; Hanik, Heather L J; Quon, Anita; Loewen, Matthew E; Grahn, Bruce H

    2006-05-01

    To investigate the molecular basis of inherited retinal dysplasia in miniature Schnauzers. Retina and retinal pigment epithelial tissues were collected from canine subjects at the age of 3 weeks. Total RNA isolated from these tissues was reverse transcribed to make representative cDNA pools that were compared for differences in gene expression by using a subtractive hybridization technique referred to as representational difference analysis (RDA). Expression differences identified by RDA were confirmed and quantified by real-time reverse-transcription PCR. Mitochondrial morphology from leukocytes and skeletal muscle of normal and affected miniature Schnauzers was examined by transmission electron microscopy. RDA screening of retinal pigment epithelial cDNA identified differences in mRNA transcript coding for two mitochondrial (mt) proteins--cytochrome oxidase subunit 1 and NADH dehydrogenase subunit 6--in affected dogs. Contrary to expectations, these identified sequences did not contain mutations. Based on the implication of mt-DNA-encoded proteins by the RDA experiments we used real-time PCR to compare the relative amounts of mt-DNA template in white blood cells from normal and affected dogs. White blood cells of affected dogs contained less than 30% of the normal amount of two specific mtDNA sequences, compared with the content of the nuclear-encoded glyceraldehyde-3-phosphate dehydrogenase (GA-3-PDH) reference gene. Retina and RPE tissue from affected dogs had reduced mRNA transcript levels for the two mitochondrial genes detected in the RDA experiment. Transcript levels for another mtDNA-encoded gene as well as the nuclear-encoded mitochondrial Tfam transcription factor were reduced in these tissues in affected dogs. Mitochondria from affected dogs were reduced in number and size and were unusually electron dense. Reduced levels of nuclear and mitochondrial transcripts in the retina and RPE of miniature Schnauzers affected with retinal dysplasia suggest that the pathogenesis of the disorder may arise from a lowered energy supply to the retina and RPE.

  13. Molecular characterization of variant alpha-subunit of electron transfer flavoprotein in three patients with glutaric acidemia type II--and identification of glycine substitution for valine-157 in the sequence of the precursor, producing an unstable mature protein in a patient.

    PubMed Central

    Indo, Y; Glassberg, R; Yokota, I; Tanaka, K

    1991-01-01

    In our previous study of eight glutaric acidemia type II (GAII) fibroblast lines by using [35S]methionine labeling and immunoprecipitation, three of them had a defect in the synthesis of the alpha-subunit of electron transfer flavoprotein (alpha-ETF) (Ikeda et al. 1986). In one of them (YH1313) the labeling of the mature alpha-ETF was barely detectable, while that of the precursor (p) was stronger. In another (YH605) no synthesis of immunoreactive p alpha-ETF was detectable. In the third cell line (YH1391) the rate of variant p alpha-ETF synthesis was comparable to normal, but its electrophoretic mobility was slightly faster than normal. In the present study, the northern blot analysis revealed that all three mutant cell lines contained p alpha-ETF mRNA and that their size and amount were comparable to normal. In immunoblot analysis, both alpha- and beta-ETF bands were barely detectable in YH1313 and YH605 but were detectable in YH1391 in amounts comparable to normal. Sequencing of YH1313 p alpha-ETF cDNA via PCR identified a transversion of T-470 to G. We then devised a simple PCR method for the 119-bp section (T-443/G-561) for detecting this mutation. In the upstream primer, A-466 was artificially replaced with C, to introduce a BstNI site into the amplified copies in the presence of G-470 from the variant sequence. The genomic DNA analysis using this method demonstrated that YH1313 was homozygous for T----G-470 transversion. It was not detected either in two other alpha-ETF-deficient GAII or in seven control cell lines. The alpha-ETF cDNA sequence in YH605 was identical to normal. Images Figure 1 Figure 2 Figure 3 Figure 5 PMID:1882842

  14. Production and characterization of murine models of classic and intermediate maple syrup urine disease

    PubMed Central

    Homanics, Gregg E; Skvorak, Kristen; Ferguson, Carolyn; Watkins, Simon; Paul, Harbhajan S

    2006-01-01

    Background Maple Syrup Urine Disease (MSUD) is an inborn error of metabolism caused by a deficiency of branched-chain keto acid dehydrogenase. MSUD has several clinical phenotypes depending on the degree of enzyme deficiency. Current treatments are not satisfactory and require new approaches to combat this disease. A major hurdle in developing new treatments has been the lack of a suitable animal model. Methods To create a murine model of classic MSUD, we used gene targeting and embryonic stem cell technologies to create a mouse line that lacked a functional E2 subunit gene of branched-chain keto acid dehydrogenase. To create a murine model of intermediate MSUD, we used transgenic technology to express a human E2 cDNA on the knockout background. Mice of both models were characterized at the molecular, biochemical, and whole animal levels. Results By disrupting the E2 subunit gene of branched-chain keto acid dehydrogenase, we created a gene knockout mouse model of classic MSUD. The homozygous knockout mice lacked branched-chain keto acid dehydrogenase activity, E2 immunoreactivity, and had a 3-fold increase in circulating branched-chain amino acids. These metabolic derangements resulted in neonatal lethality. Transgenic expression of a human E2 cDNA in the liver of the E2 knockout animals produced a model of intermediate MSUD. Branched-chain keto acid dehydrogenase activity was 5–6% of normal and was sufficient to allow survival, but was insufficient to normalize circulating branched-chain amino acids levels, which were intermediate between wildtype and the classic MSUD mouse model. Conclusion These mice represent important animal models that closely approximate the phenotype of humans with the classic and intermediate forms of MSUD. These animals provide useful models to further characterize the pathogenesis of MSUD, as well as models to test novel therapeutic strategies, such as gene and cellular therapies, to treat this devastating metabolic disease. PMID:16579849

  15. Bm-muted, orthologous to mouse muted and encoding a subunit of the BLOC-1 complex, is responsible for the otm translucent mutation of the silkworm Bombyx mori.

    PubMed

    Zhang, Haokun; Kiuchi, Takashi; Wang, Lingyan; Kawamoto, Munetaka; Suzuki, Yutaka; Sugano, Sumio; Banno, Yutaka; Katsuma, Susumu; Shimada, Toru

    2017-09-20

    "Tanaka's mottled translucent" (otm) is a mutation of the silkworm Bombyx mori that exhibits translucent skin during larval stages. We performed positional cloning of the gene responsible for otm and mapped it to a 364-kb region on chromosome 5 that contains 22 hypothetical protein-coding genes. We performed RNA-seq analysis of the epidermis and fat body of otm larvae and determined that the gene BGIBMGA002619 may be responsible for the otm mutation. BGIBMGA002619 encodes the biosynthesis of lysosome-related organelles complex 1 (BLOC-1) subunit 5, whose ortholog is responsible for the Muted mutant in mouse. Accordingly, we named this gene Bm-muted. We discovered that the expression of Bm-muted in the epidermis and fat body of otm mutants was dramatically suppressed compared with the wild type. We determined the nucleotide sequences of the full-length cDNA and genomic region corresponding to Bm-muted and found that a 538-bp long DNA sequence similar to B. mori transposon Organdy was inserted into the 3' end of the first intron of Bm-muted in two otm strains. The Bm-muted cDNA of otm mutants lacked exon 2, and accordingly generated a premature stop codon in exon 3. In addition, short interfering RNA (siRNA)-mediated knockdown of this gene caused localized partial translucency of larval skin. These data indicate that the mutation in Bm-muted caused the otm-mutant phenotype. We propose that the insertion of Organdy caused a splicing disorder in Bm-muted in the otm mutant, resulting in a null mutation of Bm-muted. This mutation is likely to cause deficiencies in urate granule formation in epidermal cells that result in translucent larval skin. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. Functional analysis of a frame-shift mutant of the dihydropyridine receptor pore subunit (α1S) expressing two complementary protein fragments

    PubMed Central

    Ahern, Chris A; Vallejo, Paola; Mortenson, Lindsay; Coronado, Roberto

    2001-01-01

    Background The L-type Ca2+ channel formed by the dihydropyridine receptor (DHPR) of skeletal muscle senses the membrane voltage and opens the ryanodine receptor (RyR1). This channel-to-channel coupling is essential for Ca2+ signaling but poorly understood. We characterized a single-base frame-shift mutant of α1S, the pore subunit of the DHPR, that has the unusual ability to function voltage sensor for excitation-contraction (EC) coupling by virtue of expressing two complementary hemi-Ca2+ channel fragments. Results Functional analysis of cDNA transfected dysgenic myotubes lacking α1S were carried out using voltage-clamp, confocal Ca2+ indicator fluoresence, epitope immunofluorescence and immunoblots of expressed proteins. The frame-shift mutant (fs-α1S) expressed the N-terminal half of α1S (M1 to L670) and the C-terminal half starting at M701 separately. The C-terminal fragment was generated by an unexpected restart of translation of the fs-α1S message at M701 and was eliminated by a M701I mutation. Protein-protein complementation between the two fragments produced recovery of skeletal-type EC coupling but not L-type Ca2+ current. Discussion A premature stop codon in the II-III loop may not necessarily cause a loss of DHPR function due to a restart of translation within the II-III loop, presumably by a mechanism involving leaky ribosomal scanning. In these cases, function is recovered by expression of complementary protein fragments from the same cDNA. DHPR-RyR1 interactions can be achieved via protein-protein complementation between hemi-Ca2+ channel proteins, hence an intact II-III loop is not essential for coupling the DHPR voltage sensor to the opening of RyR1 channel. PMID:11806762

  17. Construction of a cDNA microarray derived from the ascidian Ciona intestinalis.

    PubMed

    Azumi, Kaoru; Takahashi, Hiroki; Miki, Yasufumi; Fujie, Manabu; Usami, Takeshi; Ishikawa, Hisayoshi; Kitayama, Atsusi; Satou, Yutaka; Ueno, Naoto; Satoh, Nori

    2003-10-01

    A cDNA microarray was constructed from a basal chordate, the ascidian Ciona intestinalis. The draft genome of Ciona has been read and inferred to contain approximately 16,000 protein-coding genes, and cDNAs for transcripts of 13,464 genes have been characterized and compiled as the "Ciona intestinalis Gene Collection Release I". In the present study, we constructed a cDNA microarray of these 13,464 Ciona genes. A preliminary experiment with Cy3- and Cy5-labeled probes showed extensive differential gene expression between fertilized eggs and larvae. In addition, there was a good correlation between results obtained by the present microarray analysis and those from previous EST analyses. This first microarray of a large collection of Ciona intestinalis cDNA clones should facilitate the analysis of global gene expression and gene networks during the embryogenesis of basal chordates.

  18. Protection Conferred by recombinant Yersinia pestis Antigens Produced by a Rapid and Highly Scalable Plant Expression System

    DTIC Science & Technology

    2006-01-24

    translational fusions with dsRED (lanes 8), and cytosol-targeted GFP (lanes 9). RbcL, large subunit of Rubisco . 862 ! www.pnas.org"cgi"doi൒.1073...analysis of F1-V expression with SDS"PAGE-Coomassie staining was difficult because the chimeric protein comigrates with the large subunit of Rubisco , a...contaminated by the Rubisco large subunit, which is very similar in size to F1-V. Analysis of Purified Plant-Produced Antigens. Western blots were

  19. APPLICATION OF CDNA MICROARRAY TECHNOLOGY TO IN VITRO TOXICOLOGY AND THE SELECTION OF GENES FOR A REAL TIME RT-PCR-BASED SCREEN FOR OXIDATIVE STRESS IN HEP-G2 CELLS

    EPA Science Inventory

    Large-scale analysis of gene expression using cDNA microarrays promises the
    rapid detection of the mode of toxicity for drugs and other chemicals. cDNA
    microarrays were used to examine chemically-induced alterations of gene
    expression in HepG2 cells exposed to oxidative ...

  20. Mechanism of the modulation of BK potassium channel complexes with different auxiliary subunit compositions by the omega-3 fatty acid DHA.

    PubMed

    Hoshi, Toshinori; Tian, Yutao; Xu, Rong; Heinemann, Stefan H; Hou, Shangwei

    2013-03-19

    Large-conductance Ca(2+)- and voltage-activated K(+) (BK) channels are well known for their functional versatility, which is bestowed in part by their rich modulatory repertoire. We recently showed that long-chain omega-3 polyunsaturated fatty acids such as docosahexaenoic acid (DHA) found in oily fish lower blood pressure by activating vascular BK channels made of Slo1+β1 subunits. Here we examined the action of DHA on BK channels with different auxiliary subunit compositions. Neuronal Slo1+β4 channels were just as well activated by DHA as vascular Slo1+β1 channels. In contrast, the stimulatory effect of DHA was much smaller in Slo1+β2, Slo1+LRRC26 (γ1), and Slo1 channels without auxiliary subunits. Mutagenesis of β1, β2, and β4 showed that the large effect of DHA in Slo1+β1 and Slo1+β4 is conferred by the presence of two residues, one in the N terminus and the other in the first transmembrane segment of the β1 and β4 subunits. Transfer of this amino acid pair from β1 or β4 to β2 introduces a large response to DHA in Slo1+β2. The presence of a pair of oppositely charged residues at the aforementioned positions in β subunits is associated with a large response to DHA. The Slo1 auxiliary subunits are expressed in a highly tissue-dependent fashion. Thus, the subunit composition-dependent stimulation by DHA demonstrates that BK channels are effectors of omega-3 fatty acids with marked tissue specificity.

  1. γ-Aminobutyric Acid Type A α4, β2, and δ Subunits Assemble to Produce More Than One Functionally Distinct Receptor Type

    PubMed Central

    Eaton, Megan M.; Bracamontes, John; Shu, Hong-Jin; Li, Ping; Mennerick, Steven; Steinbach, Joe Henry

    2014-01-01

    Native γ-aminobutyric acid (GABA)A receptors consisting of α4, β1–3, and δ subunits mediate responses to the low, tonic concentration of GABA present in the extracellular milieu. Previous studies on heterologously expressed α4βδ receptors have shown a large degree of variability in functional properties, including sensitivity to the transmitter. We studied properties of α4β2δ receptors employing free subunits and concatemeric constructs, expressed in Xenopus oocytes, HEK 293 cells, and cultured hippocampal neurons. The expression system had a strong effect on the properties of receptors containing free subunits. The midpoint of GABA activation curve was 10 nM for receptors in oocytes versus 2300 nM in HEK cells. Receptors activated by the steroid alfaxalone had an estimated maximal open probability of 0.6 in oocytes and 0.01 in HEK cells. Irrespective of the expression system, receptors resulting from combining the tandem construct β2-δ and a free α4 subunit exhibited large steroid responses. We propose that free α4, β2, and δ subunits assemble in different configurations with distinct properties in oocytes and HEK cells, and that subunit linkage can overcome the expression system-dependent preferential assembly of free subunits. Hippocampal neurons transfected with α4 and the picrotoxin-resistant δ(T269Y) subunit showed large responses to alfaxalone in the presence of picrotoxin, suggesting that α4βδ receptors may assemble in a similar configuration in neurons and oocytes. PMID:25238745

  2. The morphological and chemical characteristics of striatal neurons immunoreactive for the alpha1-subunit of the GABA(A) receptor in the rat.

    PubMed

    Waldvogel, H J; Kubota, Y; Trevallyan, S C; Kawaguchi, Y; Fritschy, J M; Mohler, H; Faull, R L

    1997-10-01

    The distribution, morphology and chemical characteristics of neurons immunoreactive for the alpha1-subunit of the GABA(A) receptor in the striatum of the basal ganglia in the rat brain were investigated at the light, confocal and electron microscope levels using single, double and triple immunohistochemical labelling techniques. The results showed that alpha1-subunit immunoreactive neurons were sparsely distributed throughout the rat striatum. Double and triple labelling results showed that all the alpha1-subunit-immunoreactive neurons were positive for glutamate decarboxylase and immunoreactive for the beta2,3 and gamma2 subunits of the GABA(A) receptor. Three types of alpha1-subunit-immunoreactive neurons were identified in the striatum on the basis of cellular morphology and chemical characteristics. The most numerous alpha1-subunit-immunoreactive neurons were medium-sized, aspiny neurons with a widely branching dendritic tree. They were parvalbumin-negative and were located mainly in the dorsolateral regions of the striatum. Electron microscopy showed that these neurons had an indented nuclear membrane, typical of striatal interneurons, and were surrounded by small numbers of axon terminals which established alpha1-subunit-immunoreactive synaptic contacts with the soma and dendrites. These cells were classified as type 1 alpha1-subunit-immunoreactive neurons and comprised 75% of the total population of alpha1-subunit-immunoreactive neurons in the striatum. The remaining alpha1-subunit-immunoreactive neurons comprised of a heterogeneous population of large-sized neurons localized in the ventral and medial regions of the striatum. The most numerous large-sized cells were parvalbumin-negative, had two to three relatively short branching dendrites and were designated type 2 alpha1-subunit-immunoreactive neurons. Electron microscopy showed that the type 2 neurons were characterized by a highly convoluted nuclear membrane and were sparsely covered with small axon terminals. The type 2 neurons comprised 20% of the total population of alpha1-subunit-immunoreactive neurons. The remaining large-sized alpha1-immunoreactive cells were designated type 3 cells; they were positive for parvalbumin and were distinguished by long branching dendrites extending dorsally for 600-800 microm into the striatum. These neurons comprised 5% of the total population of alpha1-subunit-immunoreactive neurons and were surrounded by enkephalin-immunoreactive terminals. Electron microscopy showed that the alpha1-subunit type 3 neurons had an indented nuclear membrane and were densely covered with small axon terminals which established alpha1-subunit-immunoreactive symmetrical synaptic contacts with the soma and dendrites. These results provide a detailed characterization of the distribution, morphology and chemical characteristics of the alpha1-subunit-immunoreactive neurons in the rat striatum and suggest that the type 1 and type 2 neurons comprise of separate populations of striatal interneurons while the type 3 neurons may represent the large striatonigral projection neurons described by Bolam et al. [Bolam J. P., Somogyi P., Totterdell S. and Smith A. D. (1981) Neuroscience 6, 2141-2157.].

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Spreitzer, Robert Joseph

    Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) catalyzes the rate-limiting step of CO 2 fixation in photosynthesis. However, it is a slow enzyme, and O 2 competes with CO 2 at the active site. Oxygenation initiates the photorespiratory pathway, which also results in the loss of CO 2. If carboxylation could be increased or oxygenation decreased, an increase in net CO 2 fixation would be realized. Because Rubisco provides the primary means by which carbon enters all life on earth, there is much interest in engineering Rubisco to increase the production of food and renewable energy. Rubisco is located in the chloroplasts of plants,more » and it is comprised of two subunits. Much is known about the chloroplast-gene-encoded large subunit (rbcL gene), which contains the active site, but much less is known about the role of the nuclear-gene-encoded small subunit in Rubisco function (rbcS gene). Both subunits are coded by multiple genes in plants, which makes genetic engineering difficult. In the eukaryotic, green alga Chlamydomonas reinhardtii, it has been possible to eliminate all the Rubisco genes. These Rubisco-less mutants can be maintained by providing acetate as an alternative carbon source. In this project, focus has been placed on determining whether the small subunit might be a better genetic-engineering target for improving Rubisco. Analysis of a variable-loop structure (βA-βB loop) of the small subunit by genetic selection, directed mutagenesis, and construction of chimeras has shown that the small subunit can influence CO 2/O 2 specificity. X-ray crystal structures of engineered chimeric-loop enzymes have indicated that additional residues and regions of the small subunit may also contribute to Rubisco function. Structural dynamics of the small-subunit carboxyl terminus was also investigated. Alanine-scanning mutagenesis of the most-conserved small-subunit residues has identified a possible structural pathway between the small-subunit βA-βB loop and alpha-helix 8 of the large-subunit α/β-barrel active site. Hybrid enzymes were also created comprised of plant small subunits and Chlamydomonas large subunits, and these enzymes have increases in CO 2/O 2 specificity, further indicating that small subunits may be the key for ultimately engineering an improved Rubisco enzyme.« less

  4. Molecular cloning and evolutionary analysis of the calcium-modulated contractile protein, centrin, in green algae and land plants.

    PubMed

    Bhattacharya, D; Steinkötter, J; Melkonian, M

    1993-12-01

    Centrin (= caltractin) is a ubiquitous, cytoskeletal protein which is a member of the EF-hand superfamily of calcium-binding proteins. A centrin-coding cDNA was isolated and characterized from the prasinophyte green alga Scherffelia dubia. Centrin PCR amplification primers were used to isolate partial, homologous cDNA sequences from the green algae Tetraselmis striata and Spermatozopsis similis. Annealing analyses suggested that centrin is a single-copy-coding region in T. striata and S. similis and other green algae studied. Centrin-coding regions from S. dubia, S. similis and T. striata encode four colinear EF-hand domains which putatively bind calcium. Phylogenetic analyses, including homologous sequences from Chlamydomonas reinhardtii and the land plant Atriplex nummularia, demonstrate that the domains of centrins are congruent and arose from the two-fold duplication of an ancestral EF hand with Domains 1+3 and Domains 2+4 clustering. The domains of centrins are also congruent with those of calmodulins demonstrating that, like calmodulin, centrin is an ancient protein which arose within the ancestor of all eukaryotes via gene duplication. Phylogenetic relationships inferred from centrin-coding region comparisons mirror results of small subunit ribosomal RNA sequence analyses suggesting that centrin-coding regions are useful evolutionary markers within the green algae.

  5. Examining the Interactome of Huperzine A by Magnetic Biopanning

    PubMed Central

    Guo, Wei; Liu, Shupeng; Peng, Jinliang; Wei, Xiaohui; Sun, Ye; Qiu, Yangsheng; Gao, Guangwei; Wang, Peng; Xu, Yuhong

    2012-01-01

    Huperzine A is a bioactive compound derived from traditional Chinese medicine plant Qian Ceng Ta (Huperzia serrata), and was found to have multiple neuroprotective effects. In addition to being a potent acetylcholinesterase inhibitor, it was thought to act through other mechanisms such as antioxidation, antiapoptosis, etc. However, the molecular targets involved with these mechanisms were not identified. In this study, we attempted to exam the interactome of Huperzine A using a cDNA phage display library and also mammalian brain tissue extracts. The drugs were chemically linked on the surface of magnetic particles and the interactive phages or proteins were collected and analyzed. Among the various cDNA expressing phages selected, one was identified to encode the mitochondria NADH dehydrogenase subunit 1. Specific bindings between the drug and the target phages and target proteins were confirmed. Another enriched phage clone was identified as mitochondria ATP synthase, which was also panned out from the proteome of mouse brain tissue lysate. These data indicated the possible involvement of mitochondrial respiratory chain matrix enzymes in Huperzine A's pharmacological effects. Such involvement had been suggested by previous studies based on enzyme activity changes. Our data supported the new mechanism. Overall we demonstrated the feasibility of using magnetic biopanning as a simple and viable method for investigating the complex molecular mechanisms of bioactive molecules. PMID:22615909

  6. [Development of specific and degenerated primers to CesA genes encoding flax (Linum usitatissimum L.) cellulose synthase].

    PubMed

    Grushetskaia, Z E; Lemesh, V A; Khotyleva, L V

    2010-01-01

    Cellulose synthase catalytic subunit genes, CesA, have been discovered in several higher plant species, and it has been shown that the CesA gene family has multiple members. HVR2 fragment of these genes determine the class specificity of the CESA protein and its participation in the primary or secondary cell wall synthesis. The aim of this study was development of specific and degenerated primers to flax CesA gene fragments leading to obtaining the class specific HVR2 region of the gene. Two pairs of specific primers to the certain fragments of CesA-1 and CesA-6 genes and one pair of degenerated primers to HVR2 region of all flax CesA genes were developed basing on comparison of six CesA EST sequences of flax and full cDNA sequences of Arabidopsis, poplar, maize and cotton plants, obtained from GenBank. After amplification of flax cDNA, the bands of expected size were detected (201 and 300 b.p. for the CesA-1 and CesA-6, and 600 b.p. for the HVR2 region of CesA respectively). The developed markers can be used for cloning and sequencing of flax CesA genes, identifying their number in flax genome, tissue and stage specificity.

  7. Understanding large multiprotein complexes: applying a multiple allosteric networks model to explain the function of the Mediator transcription complex.

    PubMed

    Lewis, Brian A

    2010-01-15

    The regulation of transcription and of many other cellular processes involves large multi-subunit protein complexes. In the context of transcription, it is known that these complexes serve as regulatory platforms that connect activator DNA-binding proteins to a target promoter. However, there is still a lack of understanding regarding the function of these complexes. Why do multi-subunit complexes exist? What is the molecular basis of the function of their constituent subunits, and how are these subunits organized within a complex? What is the reason for physical connections between certain subunits and not others? In this article, I address these issues through a model of network allostery and its application to the eukaryotic RNA polymerase II Mediator transcription complex. The multiple allosteric networks model (MANM) suggests that protein complexes such as Mediator exist not only as physical but also as functional networks of interconnected proteins through which information is transferred from subunit to subunit by the propagation of an allosteric state known as conformational spread. Additionally, there are multiple distinct sub-networks within the Mediator complex that can be defined by their connections to different subunits; these sub-networks have discrete functions that are activated when specific subunits interact with other activator proteins.

  8. Engineering of chimeric eukaryotic/bacterial Rubisco large subunits in Escherichia coli.

    PubMed

    Koay, Teng Wei; Wong, Hann Ling; Lim, Boon Hoe

    2016-11-26

    Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) is a rate-limiting photosynthetic enzyme that catalyzes carbon fixation in the Calvin cycle. Much interest has been devoted to engineering this ubiquitous enzyme with the goal of increasing plant growth. However, experiments that have successfully produced improved Rubisco variants, via directed evolution in Escherichia coli, are limited to bacterial Rubisco because the eukaryotic holoenzyme cannot be produced in E. coli. The present study attempts to determine the specific differences between bacterial and eukaryotic Rubisco large subunit primary structure that are responsible for preventing heterologous eukaryotic holoenzyme formation in E. coli. A series of chimeric Synechococcus Rubiscos were created in which different sections of the large subunit were swapped with those of the homologous Chlamydomonas Rubisco. Chimeric holoenzymes that can form in vivo would indicate that differences within the swapped sections do not disrupt holoenzyme formation. Large subunit residues 1-97, 198-247 and 448-472 were successfully swapped without inhibiting holoenzyme formation. In all ten chimeras, protein expression was observed for the separate subunits at a detectable level. As a first approximation, the regions that can tolerate swapping may be targets for future engineering.

  9. Lipid transfer particle from the silkworm, Bombyx mori, is a novel member of the apoB/large lipid transfer protein family[S

    PubMed Central

    Yokoyama, Hiroshi; Yokoyama, Takeru; Yuasa, Masashi; Fujimoto, Hirofumi; Sakudoh, Takashi; Honda, Naoko; Fugo, Hajime; Tsuchida, Kozo

    2013-01-01

    Lipid transfer particle (LTP) is a high-molecular-weight, very high-density lipoprotein known to catalyze the transfer of lipids between a variety of lipoproteins, including both insects and vertebrates. Studying the biosynthesis and regulation pathways of LTP in detail has not been possible due to a lack of information regarding the apoproteins. Here, we sequenced the cDNA and deduced amino acid sequences for three apoproteins of LTP from the silkworm (Bombyx mori). The three subunit proteins of the LTP are coded by two genes, apoLTP-II/I and apoLTP-III. ApoLTP-I and apoLTP-II are predicted to be generated by posttranslational cleavage of the precursor protein, apoLTP-II/I. Clusters of amphipathic secondary structure within apoLTP-II/I are similar to Homo sapiens apolipoprotein B (apoB) and insect lipophorins. The apoLTP-II/I gene is a novel member of the apoB/large lipid transfer protein gene family. ApoLTP-III has a putative conserved juvenile hormone-binding protein superfamily domain. Expression of apoLTP-II/I and apoLTP-III genes was synchronized and both genes were primarily expressed in the fat body at the stage corresponding to increased lipid transport needs. We are now in a position to study in detail the physiological role of LTP and its biosynthesis and assembly. PMID:23812557

  10. The Status, Quality, and Expansion of the NIH Full-Length cDNA Project: The Mammalian Gene Collection (MGC)

    PubMed Central

    2004-01-01

    The National Institutes of Health's Mammalian Gene Collection (MGC) project was designed to generate and sequence a publicly accessible cDNA resource containing a complete open reading frame (ORF) for every human and mouse gene. The project initially used a random strategy to select clones from a large number of cDNA libraries from diverse tissues. Candidate clones were chosen based on 5′-EST sequences, and then fully sequenced to high accuracy and analyzed by algorithms developed for this project. Currently, more than 11,000 human and 10,000 mouse genes are represented in MGC by at least one clone with a full ORF. The random selection approach is now reaching a saturation point, and a transition to protocols targeted at the missing transcripts is now required to complete the mouse and human collections. Comparison of the sequence of the MGC clones to reference genome sequences reveals that most cDNA clones are of very high sequence quality, although it is likely that some cDNAs may carry missense variants as a consequence of experimental artifact, such as PCR, cloning, or reverse transcriptase errors. Recently, a rat cDNA component was added to the project, and ongoing frog (Xenopus) and zebrafish (Danio) cDNA projects were expanded to take advantage of the high-throughput MGC pipeline. PMID:15489334

  11. HUNT: launch of a full-length cDNA database from the Helix Research Institute.

    PubMed

    Yudate, H T; Suwa, M; Irie, R; Matsui, H; Nishikawa, T; Nakamura, Y; Yamaguchi, D; Peng, Z Z; Yamamoto, T; Nagai, K; Hayashi, K; Otsuki, T; Sugiyama, T; Ota, T; Suzuki, Y; Sugano, S; Isogai, T; Masuho, Y

    2001-01-01

    The Helix Research Institute (HRI) in Japan is releasing 4356 HUman Novel Transcripts and related information in the newly established HUNT database. The institute is a joint research project principally funded by the Japanese Ministry of International Trade and Industry, and the clones were sequenced in the governmental New Energy and Industrial Technology Development Organization (NEDO) Human cDNA Sequencing Project. The HUNT database contains an extensive amount of annotation from advanced analysis and represents an essential bioinformatics contribution towards understanding of the gene function. The HRI human cDNA clones were obtained from full-length enriched cDNA libraries constructed with the oligo-capping method and have resulted in novel full-length cDNA sequences. A large fraction has little similarity to any proteins of known function and to obtain clues about possible function we have developed original analysis procedures. Any putative function deduced here can be validated or refuted by complementary analysis results. The user can also extract information from specific categories like PROSITE patterns, PFAM domains, PSORT localization, transmembrane helices and clones with GENIUS structure assignments. The HUNT database can be accessed at http://www.hri.co.jp/HUNT.

  12. MUC1 and MUC4: Switching the Emphasis from Large to Small

    PubMed Central

    Carraway, Kermit L.

    2011-01-01

    Summation The MUC1 and MUC4 membrane mucins are each composed of a large alpha (α) and a small beta (β) subunit. The α subunits are fully exposed at the cell surface and contain variable numbers of repeated amino acid sequences that are heavily glycosylated. In contrast, the β subunits are much smaller and are anchored within the cell membrane, with their amino-terminal portions exposed at the cell surface and their carboxy-terminal tails facing the cytosol. Studies over the last several years are challenging the long-held belief that α subunits play the predominant role in cancer by conferring cellular properties that allow tumor cells to evade immune recognition and destruction. Indeed, the β subunits of MUC1 and MUC4 have emerged as oncogenes, as they engage signaling pathways responsible for tumor initiation and progression. Thus, a switch in the emphasis from the large α to the small β subunits offers attractive possibilities for successful clinical application. Such a focus shift is further supported by the absence of allelic polymorphism and variable glycosylation in the β subunit as well as by the presence of the β subunit in most MUC1 and MUC4 isoforms expressed by tumors. MUC1α, also known as CA15.3, is a Food and Drug Administration-approved serum biomarker for breast cancer, but its use is no longer recommended by the American Society of Clinical Oncology. However, comparison of β subunit expression in normal and malignant breast tissues may offer a novel approach to the exploitation of membrane mucins as biomarkers, as MUC1β-induced gene signatures with prognostic and predictive values in breast cancer have been reported. Preclinical studies with peptides that interfere with MUC1β oncogenic functions also look promising. PMID:21728842

  13. Bacterial diversity in the active stage of a bioremediation system for mineral oil hydrocarbon-contaminated soils.

    PubMed

    Popp, Nicole; Schlömann, Michael; Mau, Margit

    2006-11-01

    Soils contaminated with mineral oil hydrocarbons are often cleaned in off-site bioremediation systems. In order to find out which bacteria are active during the degradation phase in such systems, the diversity of the active microflora in a degrading soil remediation system was investigated by small-subunit (SSU) rRNA analysis. Two sequential RNA extracts from one soil sample were generated by a procedure incorporating bead beating. Both extracts were analysed separately by generating individual SSU rDNA clone libraries from cDNA of the two extracts. The sequencing results showed moderate diversity. The two clone libraries were dominated by Gammaproteobacteria, especially Pseudomonas spp. Alphaproteobacteria and Betaproteobacteria were two other large groups in the clone libraries. Actinobacteria, Firmicutes, Bacteroidetes and Epsilonproteobacteria were detected in lower numbers. The obtained sequences were predominantly related to genera for which cultivated representatives have been described, but were often clustered together in the phylogenetic tree, and the sequences that were most similar were originally obtained from soils and not from pure cultures. Most of the dominant genera in the clone libraries, e.g. Pseudomonas, Acinetobacter, Sphingomonas, Acidovorax and Thiobacillus, had already been detected in (mineral oil hydrocarbon) contaminated environmental samples. The occurrence of the genera Zymomonas and Rhodoferax was novel in mineral oil hydrocarbon-contaminated soil.

  14. Nmd3p Is a Crm1p-Dependent Adapter Protein for Nuclear Export of the Large Ribosomal Subunit

    PubMed Central

    Ho, Jennifer Hei-Ngam; Kallstrom, George; Johnson, Arlen W.

    2000-01-01

    In eukaryotic cells, nuclear export of nascent ribosomal subunits through the nuclear pore complex depends on the small GTPase Ran. However, neither the nuclear export signals (NESs) for the ribosomal subunits nor the receptor proteins, which recognize the NESs and mediate export of the subunits, have been identified. We showed previously that Nmd3p is an essential protein from yeast that is required for a late step in biogenesis of the large (60S) ribosomal subunit. Here, we show that Nmd3p shuttles and that deletion of the NES from Nmd3p leads to nuclear accumulation of the mutant protein, inhibition of the 60S subunit biogenesis, and inhibition of the nuclear export of 60S subunits. Moreover, the 60S subunits that accumulate in the nucleus can be coimmunoprecipitated with the NES-deficient Nmd3p. 60S subunit biogenesis and export of truncated Nmd3p were restored by the addition of an exogenous NES. To identify the export receptor for Nmd3p we show that Nmd3p shuttling and 60S export is blocked by the Crm1p-specific inhibitor leptomycin B. These results identify Crm1p as the receptor for Nmd3p export. Thus, export of the 60S subunit is mediated by the adapter protein Nmd3p in a Crm1p-dependent pathway. PMID:11086007

  15. The role of TcdB and TccC subunits in secretion of the Photorhabdus Tcd toxin complex.

    PubMed

    Yang, Guowei; Waterfield, Nicholas R

    2013-01-01

    The Toxin Complex (TC) is a large multi-subunit toxin encoded by a range of bacterial pathogens. The best-characterized examples are from the insect pathogens Photorhabdus, Xenorhabdus and Yersinia. They consist of three large protein subunits, designated A, B and C that assemble in a 5∶1∶1 stoichiometry. Oral toxicity to a range of insects means that some have the potential to be developed as pest control technology. The three subunit proteins do not encode any recognisable export sequences and as such little progress has been made in understanding their secretion. We have developed heterologous TC production and secretion models in E. coli and used them to ascribe functions to different domains of the crucial B+C sub-complex. We have determined that the B and C subunits use a secretion mechanism that is either encoded by the proteins themselves or employ an as yet undefined system common to laboratory strains of E. coli. We demonstrate that both the N-terminal domains of the B and C subunits are required for secretion of the whole complex. We propose a model whereby the N-terminus of the C-subunit toxin exports the B+C sub-complex across the inner membrane while that of the B-subunit allows passage across the outer membrane. We also demonstrate that even in the absence of the B-subunit, that the C-subunit can also facilitate secretion of the larger A-subunit. The recognition of this novel export system is likely to be of importance to future protein secretion studies. Finally, the identification of homologues of B and C subunits in diverse bacterial pathogens, including Burkholderia and Pseudomonas, suggests that these toxins are likely to be important in a range of different hosts, including man.

  16. The plastid ribosomal proteins. Identification of all the proteins in the 30 S subunit of an organelle ribosome (chloroplast).

    PubMed

    Yamaguchi, K; von Knoblauch, K; Subramanian, A R

    2000-09-15

    Identification of all the protein components of a plastid (chloroplast) ribosomal 30 S subunit has been achieved, using two-dimensional gel electropholesis, high performance liquid chromatography purification, N-terminal sequencing, polymerase chain reaction-based screening of cDNA library, nucleotide sequencing, and mass spectrometry (electrospray ionization, matrix-assisted laser desorption/ionization time-of-flight, and reversed-phase HPLC coupled with electrospray ionization mass spectrometry). 25 proteins were identified, of which 21 are orthologues of all Escherichia coli 30 S ribosomal proteins (S1-S21), and 4 are plastid-specific ribosomal proteins (PSRPs) that have no homologues in the mitochondrial, archaebacterial, or cytosolic ribosomal protein sequences in data bases. 12 of the 25 plastid 30 S ribosomal proteins (PRPs) are encoded in the plastid genome, whereas the remaining 13 are encoded by the nuclear genome. Post-translational transit peptide cleavage sites for the maturation of the 13 cytosolically synthesized PRPs, and post-translational N-terminal processing in the maturation of the 12 plastid synthesized PRPs are described. Post-translational modifications in several PRPs were observed: alpha-N-acetylation of S9, N-terminal processings leading to five mature forms of S6 and two mature forms of S10, C-terminal and/or internal modifications in S1, S14, S18, and S19, leading to two distinct forms differing in mass and/or charge (the corresponding modifications are not observed in E. coli). The four PSRPs in spinach plastid 30 S ribosomal subunit (PSRP-1, 26.8 kDa, pI 6.2; PSRP-2, 21.7 kDa, pI 5.0; PSRP-3, 13.8 kDa, pI 4.9; PSRP-4, 5.2 kDa, pI 11.8) comprise 16% (67.6 kDa) of the total protein mass of the 30 S subunit (429.3 kDa). PSRP-1 and PSRP-3 show sequence similarities with hypothetical photosynthetic bacterial proteins, indicating their possible origins in photosynthetic bacteria. We propose the hypothesis that PSRPs form a "plastid translational regulatory module" on the 30 S ribosomal subunit structure for the possible mediation of nuclear factors on plastid translation.

  17. Sequence and functional characterization of hypoxia-inducible factors, HIF1α, HIF2αa, and HIF3α, from the estuarine fish, Fundulus heteroclitus

    PubMed Central

    Townley, Ian K.; Karchner, Sibel I.; Skripnikova, Elena; Wiese, Thomas E.; Hahn, Mark E.

    2017-01-01

    The hypoxia-inducible factor (HIF) family of transcription factors plays central roles in the development, physiology, pathology, and environmental adaptation of animals. Because many aquatic habitats are characterized by episodes of low dissolved oxygen, fish represent ideal models to study the roles of HIF in the response to aquatic hypoxia. The estuarine fish Fundulus heteroclitus is found in habitats prone to hypoxia. It responds to low oxygen via behavioral, physiological, and molecular changes, and one member of the HIF family, HIF2α, has been previously described. Herein, cDNA sequencing, phylogenetic analyses, and genomic approaches were used to determine other members of the HIFα family from F. heteroclitus and their relationships to HIFα subunits from other vertebrates. In vitro and cellular approaches demonstrated that full-length forms of HIF1α, HIF2α, and HIF3α independently formed complexes with the β-subunit, aryl hydrocarbon receptor nuclear translocator, to bind to hypoxia response elements and activate reporter gene expression. Quantitative PCR showed that HIFα mRNA abundance varied among organs of normoxic fish in an isoform-specific fashion. Analysis of the F. heteroclitus genome revealed a locus encoding a second HIF2α—HIF2αb—a predicted protein lacking oxygen sensing and transactivation domains. Finally, sequence analyses demonstrated polymorphism in the coding sequence of each F. heteroclitus HIFα subunit, suggesting that genetic variation in these transcription factors may play a role in the variation in hypoxia responses among individuals or populations. PMID:28039194

  18. Sequence and functional characterization of hypoxia-inducible factors, HIF1α, HIF2αa, and HIF3α, from the estuarine fish, Fundulus heteroclitus.

    PubMed

    Townley, Ian K; Karchner, Sibel I; Skripnikova, Elena; Wiese, Thomas E; Hahn, Mark E; Rees, Bernard B

    2017-03-01

    The hypoxia-inducible factor (HIF) family of transcription factors plays central roles in the development, physiology, pathology, and environmental adaptation of animals. Because many aquatic habitats are characterized by episodes of low dissolved oxygen, fish represent ideal models to study the roles of HIF in the response to aquatic hypoxia. The estuarine fish Fundulus heteroclitus is found in habitats prone to hypoxia. It responds to low oxygen via behavioral, physiological, and molecular changes, and one member of the HIF family, HIF2α, has been previously described. Herein, cDNA sequencing, phylogenetic analyses, and genomic approaches were used to determine other members of the HIFα family from F. heteroclitus and their relationships to HIFα subunits from other vertebrates. In vitro and cellular approaches demonstrated that full-length forms of HIF1α, HIF2α, and HIF3α independently formed complexes with the β-subunit, aryl hydrocarbon receptor nuclear translocator, to bind to hypoxia response elements and activate reporter gene expression. Quantitative PCR showed that HIFα mRNA abundance varied among organs of normoxic fish in an isoform-specific fashion. Analysis of the F. heteroclitus genome revealed a locus encoding a second HIF2α-HIF2αb-a predicted protein lacking oxygen sensing and transactivation domains. Finally, sequence analyses demonstrated polymorphism in the coding sequence of each F. heteroclitus HIFα subunit, suggesting that genetic variation in these transcription factors may play a role in the variation in hypoxia responses among individuals or populations. Copyright © 2017 the American Physiological Society.

  19. Tetracapsuloides bryosalmonae infection affects the expression of genes involved in cellular signal transduction and iron metabolism in the kidney of the brown trout Salmo trutta.

    PubMed

    Kumar, Gokhlesh; Sarker, Subhodeep; Menanteau-Ledouble, Simon; El-Matbouli, Mansour

    2015-06-01

    Tetracapsuloides bryosalmonae is an enigmatic endoparasite which causes proliferative kidney disease in various species of salmonids in Europe and North America. The life cycle of the European strain of T. bryosalmonae generally completes in an invertebrate host freshwater bryozoan and vertebrate host brown trout (Salmo trutta) Linnaeus, 1758. Little is known about the gene expression in the kidney of brown trout during the developmental stages of T. bryosalmonae. In the present study, quantitative real-time PCR was applied to quantify the target genes of interest in the kidney of brown trout at different time points of T. bryosalmonae development. PCR primers specific for target genes were designed and optimized, and their gene expression levels were quantified in the cDNA kidney samples using SYBR Green Supermix. Expression of Rab GDP dissociation inhibitor beta, integral membrane protein 2B, NADH dehydrogenase 1 beta subcomplex subunit 6, and 26S protease regulatory subunit S10B were upregulated significantly in infected brown trout, while the expression of the ferritin M middle subunit was downregulated significantly. These results suggest that host genes involved in cellular signal transduction, proteasomal activities, including membrane transporters and cellular iron storage, are differentially upregulated or downregulated in the kidney of brown trout during parasite development. The gene expression pattern of infected renal tissue may support the development of intraluminal sporogonic stages of T. bryosalmonae in the renal tubular lumen of brown trout which may facilitate the release of viable parasite spores to transmit to the invertebrate host bryozoan.

  20. Amino-acid sequence and predicted three-dimensional structure of pea seed (Pisum sativum) ferritin.

    PubMed Central

    Lobreaux, S; Yewdall, S J; Briat, J F; Harrison, P M

    1992-01-01

    The iron storage protein, ferritin, is widely distributed in the living kingdom. Here the complete cDNA and derived amino-acid sequence of pea seed ferritin are described, together with its predicted secondary structure, namely a four-helix-bundle fold similar to those of mammalian ferritins, with a fifth short helix at the C-terminus. An N-terminal extension of 71 residues contains a transit peptide (first 47 residues) responsible for plastid targetting as in other plant ferritins, and this is cleaved before assembly. The second part of the extension (24 residues) belongs to the mature subunit; it is cleaved during germination. The amino-acid sequence of pea seed ferritin is aligned with those of other ferritins (49% amino-acid identity with H-chains and 40% with L-chains of human liver ferritin in the aligned region). A three-dimensional model has been constructed by fitting the aligned sequence to the coordinates of human H-chains, with appropriate modifications. A folded conformation with an 11-residue helix is predicted for the N-terminal extension. As in mammalian ferritins, 24 subunits assemble into a hollow shell. In pea seed ferritin, its N-terminal extension is exposed on the outside surface of the shell. Within each pea subunit is a ferroxidase centre resembling those of human ferritin H-chains except for a replacement of Glu-62 by His. The channel at the 4-fold-symmetry axes defined by E-helices, is predicted to be hydrophilic in plant ferritins, whereas it is hydrophobic in mammalian ferritins. Images Fig. 3. Fig. 5. Fig. 6. PMID:1472006

  1. Missense mutations in SURF1 associated with deficient cytochrome c oxidase assembly in Leigh syndrome patients.

    PubMed

    Poyau, A; Buchet, K; Bouzidi, M F; Zabot, M T; Echenne, B; Yao, J; Shoubridge, E A; Godinot, C

    2000-02-01

    We have studied the fibroblasts of three patients suffering from Leigh syndrome associated with cytochrome c oxidase deficiency (LS-COX-). Their mitochondrial DNA was functional and all nuclear COX subunits had a normal sequence. The expression of transcripts encoding mitochondrial and nuclear COX subunits was normal or slightly increased. Similarly, the OXA1 transcript coding for a protein involved in COX assembly was increased. However, several COX-protein subunits were severely depressed, indicating deficient COX assembly. Surf1, a factor involved in COX biogenesis, was recently reported as mutated in LS-COX- patients, all mutations predicting a truncated protein. Sequence analysis of SURF1 gene in our three patients revealed seven heterozygous mutations, six of which were new : an insertion, a nonsense mutation, a splicing mutation of intron 7 in addition to three missense mutations. The mutation G385 A (Gly124-->Glu) changes a Gly that is strictly conserved in Surfl homologs of 12 species. The substitution G618 C (Asp202-->His), changing an Asp that is conserved only in mammals, appears to be a polymorphism. The mutation T751 C changes Ile246 to Thr, a position at which a hydrophobic amino acid is conserved in all eukaryotic and some bacterial species. Replacing Ile246 by Thr disrupts a predicted beta sheet structure present in all higher eukaryotes. COX activity could be restored in fibroblasts of the three patients by complementation with a retroviral vector containing normal SURF1 cDNA. These mutations identify domains essential to Surf1 protein structure and/or function.

  2. Gamma-aminobutyric acid (GABA) stimulates pancreatic cancer growth through overexpressing GABAA receptor pi subunit.

    PubMed

    Takehara, Akio; Hosokawa, Masayo; Eguchi, Hidetoshi; Ohigashi, Hiroaki; Ishikawa, Osamu; Nakamura, Yusuke; Nakagawa, Hidewaki

    2007-10-15

    Gamma-aminobutyric acid (GABA) functions primarily as an inhibitory neurotransmitter in the mature central nervous system, and GABA/GABA receptors are also present in nonneural tissues, including cancer, but their precise function in nonneuronal or cancerous cells has thus far been poorly defined. Through the genome-wide cDNA microarray analysis of pancreatic ductal adenocarcinoma (PDAC) cells as well as subsequent reverse transcription-PCR and Northern blot analyses, we identified the overexpression of GABA receptor pi subunit (GABRP) in PDAC cells. We also found the expression of this peripheral type GABAA receptor subunit in few adult human organs. Knockdown of endogenous GABRP expression in PDAC cells by small interfering RNA attenuated PDAC cell growth, suggesting its essential role in PDAC cell viability. Notably, the addition of GABA into the cell culture medium promoted the proliferation of GABRP-expressing PDAC cells, but not GABRP-negative cells, and GABAA receptor antagonists inhibited this growth-promoting effect by GABA. The HEK293 cells constitutively expressing exogenous GABRP revealed the growth-promoting effect of GABA treatment. Furthermore, GABA treatment in GABRP-positive cells increased intracellular Ca2+ levels and activated the mitogen-activated protein kinase/extracellular signal-regulated kinase (MAPK/Erk) cascade. Clinical PDAC tissues contained a higher level of GABA than normal pancreas tissues due to the up-regulation of glutamate decarboxylase 1 expression, suggesting their autocrine/paracrine growth-promoting effect in PDACs. These findings imply that GABA and GABRP could play important roles in PDAC development and progression, and that this pathway can be a promising molecular target for the development of new therapeutic strategies for PDAC.

  3. Assignment of Etfdh, Etfb, and Etfa to chromosomes 3, 7, and 13: The mouse homologs of genes respondible for glutaric acidemia type II in human

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    White, R.A.; Dowler, L.L.; Angeloni, S.V.

    Electron transfer flavoprotein (composed of {alpha} and {beta} subunits) is an obligatory electron acceptor for several dehydrogenases and is located in the mitochondrial matrix. Electrons accepted by electron transfer flavo-protein (ETF) are transferred to the main mitochondrial respiratory chain by the way of ETF dehydrogenase (ETFDH). In humans, deficiency of ETF or ETFDH leads to glutaric acidemia type II, an inherited metabolic disorder that can be fatal in its neonatal form and is characterized by severe hypoketotic hypoglycemia and acidosis. We used cDNA probes for the Etfdh, Etfb, and Etfa genes to determine localization of these mouse genes to chromosomesmore » 3, 7, and 13. 18 refs., 3 figs.« less

  4. Crotoxin: Structural Studies, Mechanism of Action and Cloning of its Gene

    DTIC Science & Technology

    1988-03-01

    thirteen amino acids being acidic . Sequencing of the three peptides present in the acidic subunit, two of which are blocked by pyroglutamate ...the sequence determination of both the basic and acidic subunits of crotoxin- The acidic * subunit peptides were d!Tfficult, .sfi~n~e two of-ftflý...fluorescence spectroscopy. Results indicate a large conformational change occurs upon) ccmplex formation between the acidic and basic subunits of all four

  5. Molecular Cloning, Characterization, and Expression Analysis of a Prolyl 4-Hydroxylase from the Marine Sponge Chondrosia reniformis.

    PubMed

    Pozzolini, Marina; Scarfì, Sonia; Mussino, Francesca; Ferrando, Sara; Gallus, Lorenzo; Giovine, Marco

    2015-08-01

    Prolyl 4-hydroxylase (P4H) catalyzes the hydroxylation of proline residues in collagen. P4H has two functional subunits, α and β. Here, we report the cDNA cloning, characterization, and expression analysis of the α and β subunits of the P4H derived from the marine sponge Chondrosia reniformis. The amino acid sequence of the α subunit is 533 residues long with an M r of 59.14 kDa, while the β subunit counts 526 residues with an M r of 58.75 kDa. Phylogenetic analyses showed that αP4H and βP4H are more related to the mammalian sequences than to known invertebrate P4Hs. Western blot analysis of sponge lysate protein cross-linking revealed a band of 240 kDa corresponding to an α2β2 tetramer structure. This result suggests that P4H from marine sponges shares the same quaternary structure with vertebrate homologous enzymes. Gene expression analyses showed that αP4H transcript is higher in the choanosome than in the ectosome, while the study of factors affecting its expression in sponge fragmorphs revealed that soluble silicates had no effect on the αP4H levels, whereas ascorbic acid strongly upregulated the αP4H mRNA. Finally, treatment with two different tumor necrosis factor (TNF)-alpha inhibitors determined a significant downregulation of αP4H gene expression in fragmorphs demonstrating, for the first time in Porifera, a positive involvement of TNF in sponge matrix biosynthesis. The molecular characterization of P4H genes involved in collagen hydroxylation, including the mechanisms that regulate their expression, is a key step for future recombinant sponge collagen production and may be pivotal to understand pathological mechanisms related to extracellular matrix deposition in higher organisms.

  6. Alterations of the PPP2R1B gene located at 11q23 in human colorectal cancers

    PubMed Central

    Takagi, Y; Futamura, M; Yamaguchi, K; Aoki, S; Takahashi, T; Saji, S

    2000-01-01

    BACKGROUND/AIMS—In 1998 the PPP2R1B gene encoding the A subunit of the serine/threonine protein phosphatase was identified as a putative tumour suppressor gene in lung and colon cancer in the chromosome region 11q22-24. The aim of the present study was to determine the type of alterations in primary rectal cancers as well as colon cancers and the correlation between these alterations and clinicopathological data.
METHODS—Mutation analyses of the PPP2R1B gene sequence encoding the binding sites of the catalytic C subunit (Huntington elongation A subunit TOR (HEAT) repeats 11-15) and partial binding sites of the regulatory B subunit were carried out on cDNA samples from 30 primary colorectal cancer specimens and corresponding normal tissues using a combination of the polymerase chain reaction and subsequent direct DNA sequencing.
RESULTS—Five missense mutations producing amino acid substitutions were detected in the four colon cancer cases (13.3%; four of 30 colorectal cancers): 15glycine (GGT) to alanine (GCT) and 499leucine (TTA) to isoleucine (ATA) in the same case, and 498valine (GTG) to glutamic acid (GAG), 500valine (GTA) to glycine (GGA), and 365serine (TCT) to proline (CCT). Of these five mutations, three (60%) were located in HEAT repeat 13 and four (80%) showed T to other nucleotide substitutions. In addition, a normal polymorphism, 478leucine, was found. No correlation was found between these mutations and clinicopathological data.
CONCLUSION—Our results suggest that the PPP2R1B gene is one of the true targets at 11q23, and its inactivation is involved in the development of all types of colorectal cancers.


Keywords: PPP2R1B gene; colorectal cancer; tumour suppressor gene; protein phosphatase PMID:10896920

  7. Topography of the Duchenne muscular dystrophy (DMD) gene: FIGE and cDNA analysis of 194 cases reveals 115 deletions and 13 duplications.

    PubMed Central

    Den Dunnen, J T; Grootscholten, P M; Bakker, E; Blonden, L A; Ginjaar, H B; Wapenaar, M C; van Paassen, H M; van Broeckhoven, C; Pearson, P L; van Ommen, G J

    1989-01-01

    We have studied 34 Becker and 160 Duchenne muscular dystrophy (DMD) patients with the dystrophin cDNA, using conventional blots and FIGE analysis. One hundred twenty-eight mutations (65%) were found, 115 deletions and 13 duplications, of which 106 deletions and 11 duplications could be precisely mapped in relation to both the mRNA and the major and minor mutation hot spots. Junction fragments, ideal markers for carrier detection, were found in 23 (17%) of the 128 cases. We identified eight new cDNA RFLPs within the DMD gene. With the use of cDNA probes we have completed the long-range map of the DMD gene, by the identification of a 680-kb SfiI fragment containing the gene's 3' end. The size of the DMD gene is now determined to be about 2.3 million basepairs. The combination of cDNA hybridizations with long-range analysis of deletion and duplication patients yields a global picture of the exon spacing within the dystrophin gene. The gene shows a large variability of intron size, ranging from only a few kilobases to 160-180 kb for the P20 intron. Images Figure 1 Figure 4 PMID:2573997

  8. Large-Scale Concatenation cDNA Sequencing

    PubMed Central

    Yu, Wei; Andersson, Björn; Worley, Kim C.; Muzny, Donna M.; Ding, Yan; Liu, Wen; Ricafrente, Jennifer Y.; Wentland, Meredith A.; Lennon, Greg; Gibbs, Richard A.

    1997-01-01

    A total of 100 kb of DNA derived from 69 individual human brain cDNA clones of 0.7–2.0 kb were sequenced by concatenated cDNA sequencing (CCS), whereby multiple individual DNA fragments are sequenced simultaneously in a single shotgun library. The method yielded accurate sequences and a similar efficiency compared with other shotgun libraries constructed from single DNA fragments (>20 kb). Computer analyses were carried out on 65 cDNA clone sequences and their corresponding end sequences to examine both nucleic acid and amino acid sequence similarities in the databases. Thirty-seven clones revealed no DNA database matches, 12 clones generated exact matches (≥98% identity), and 16 clones generated nonexact matches (57%–97% identity) to either known human or other species genes. Of those 28 matched clones, 8 had corresponding end sequences that failed to identify similarities. In a protein similarity search, 27 clone sequences displayed significant matches, whereas only 20 of the end sequences had matches to known protein sequences. Our data indicate that full-length cDNA insert sequences provide significantly more nucleic acid and protein sequence similarity matches than expressed sequence tags (ESTs) for database searching. [All 65 cDNA clone sequences described in this paper have been submitted to the GenBank data library under accession nos. U79240–U79304.] PMID:9110174

  9. A puzzle assembly strategy for fabrication of large engineered cartilage tissue constructs.

    PubMed

    Nover, Adam B; Jones, Brian K; Yu, William T; Donovan, Daniel S; Podolnick, Jeremy D; Cook, James L; Ateshian, Gerard A; Hung, Clark T

    2016-03-21

    Engineering of large articular cartilage tissue constructs remains a challenge as tissue growth is limited by nutrient diffusion. Here, a novel strategy is investigated, generating large constructs through the assembly of individually cultured, interlocking, smaller puzzle-shaped subunits. These constructs can be engineered consistently with more desirable mechanical and biochemical properties than larger constructs (~4-fold greater Young׳s modulus). A failure testing technique was developed to evaluate the physiologic functionality of constructs, which were cultured as individual subunits for 28 days, then assembled and cultured for an additional 21-35 days. Assembled puzzle constructs withstood large deformations (40-50% compressive strain) prior to failure. Their ability to withstand physiologic loads may be enhanced by increases in subunit strength and assembled culture time. A nude mouse model was utilized to show biocompatibility and fusion of assembled puzzle pieces in vivo. Overall, the technique offers a novel, effective approach to scaling up engineered tissues and may be combined with other techniques and/or applied to the engineering of other tissues. Future studies will aim to optimize this system in an effort to engineer and integrate robust subunits to fill large defects. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. A Puzzle Assembly Strategy for Fabrication of Large Engineered Cartilage Tissue Constructs

    PubMed Central

    Nover, Adam B.; Jones, Brian K.; Yu, William T.; Donovan, Daniel S.; Podolnick, Jeremy D.; Cook, James L.; Ateshian, Gerard A.; Hung, Clark T.

    2016-01-01

    Engineering of large articular cartilage tissue constructs remains a challenge as tissue growth is limited by nutrient diffusion. Here, a novel strategy is investigated, generating large constructs through the assembly of individually cultured, interlocking, smaller puzzle-shaped subunits. These constructs can be engineered consistently with more desirable mechanical and biochemical properties than larger constructs (~4-fold greater Young's modulus). A failure testing technique was developed to evaluate the physiologic functionality of constructs, which were cultured as individual subunits for 28 days, then assembled and cultured for an additional 21-35 days. Assembled puzzle constructs withstood large deformations (40-50% compressive strain) prior to failure. Their ability to withstand physiologic loads may be enhanced by increases in subunit strength and assembled culture time. A nude mouse model was utilized to show biocompatibility and fusion of assembled puzzle pieces in vivo. Overall, the technique offers a novel, effective approach to scaling up engineered tissues and may be combined with other techniques and/or applied to the engineering of other tissues. Future studies will aim to optimize this system in an effort to engineer and integrate robust subunits to fill large defects. PMID:26895780

  11. Effects of transgene-encoded high-molecular weight glutenin proteins in wheat flour blends and sponge and dough baking

    USDA-ARS?s Scientific Manuscript database

    HMW glutenin subunits are the most important determinants of wheat (Triticum aestivum L.) bread-making quality, and subunit composition explains a large percentage of the variability observed between genotypes. Experiments were designed to elevate expression of a key native HMW glutenin subunit (1D...

  12. Large conductance Ca(2+)-activated K(+) channel (BKCa) activating properties of a series of novel N-arylbenzamides: Channel subunit dependent effects.

    PubMed

    Kirby, R W; Martelli, A; Calderone, V; McKay, N G; Lawson, K

    2013-07-15

    Large conductance calcium activated potassium channels (BKCa) are fundamental in the control of cellular excitability. Thus, compounds that activate BKCa channels could provide potential therapies in the treatment of pathologies of the cardiovascular and central nervous system. A series of novel N-arylbenzamide compounds, and the reference compound NS1619, were evaluated for BKCa channel opener properties in Human Embryonic Kidney (HEK293) cells expressing the human BKCa channel α-subunit alone or α+β1-subunit complex. Channel activity was determined using a non-radioactive Rb(+) efflux assay to construct concentration effect curves for each compound. All N-arylbenzamide compounds and NS1619 evoked significant (p <0.05) concentration related increases in Rb(+) efflux both in cells expressing α-subunit alone or α+β1-subunits. Co-expression of the β1-subunit modified the Rb(+) efflux responses, relative to that obtained in cells expressing the α-subunit alone, for most of the N-arylbenzamide compounds, in contrast to NS1619. The EC40 values of NS1619, BKMe1 and BKOEt1 were not significantly affected by the co-expression of the BKCa channel α+β1-subunits. In contrast, 5 other N-arylbenzamides (BKPr2, BKPr3, BKPr4, BKH1 and BKVV) showed a significant (p <0.05) 2- to 10-fold increase in EC40 values when tested on the BKCa α+β1-subunit expressing cells compared to BKCa α-subunit expressing cells. Further, the Emax values for BKPr4, BKVV and BKH1 were lower in the BKCa channel α+β1-subunit expressing cells. In conclusion, the N-arylbenzamides studied, like NS1619, were able to activate BKCa channels formed of the α-subunit only. The co-expression of the β1-subunit, however, modified the ability of certain compounds to active the channel leading to differentiated pharmacodynamic profiles. Copyright © 2013 Elsevier Ltd. All rights reserved.

  13. Improved purification of brine-shrimp (Artemia saline) (Na+ + K+)-activated adenosine triphosphatase and amino-acid and carbohydrate analyses of the isolated subunits.

    PubMed Central

    Peterson, G L; Hokin, L E

    1980-01-01

    Purification of the (Na+ + K+)-activated ATPase has been improved 2-fold the respect to both purity and yield over the previous method [Peterson, Ewing, Hootman & Conte (1978) J. Biol. Chem. 253, 4762-4770] by using Lubrol WX and non-denaturing concentrations of sodium dodecyl sulphate (SDS). The enzyme was purified 200-fold over the homogenate. The preparation had a specific activity of about 600 mumol of Pi/h per mg of protein, and was about 60% pure according to quantification of Coomassie Blue-stained SDS/polyacrylamide gels. The yield of purified enzyme was about 10 mg of protein per 100g of dry brine-shrimp (Artemia salina) cysts. The method is highly suitable for purification either on a small scale (10-25g of dry cysts) or on a large scale (900g of dry cysts) and methods are described for both. The large (Na+ + K+)-activated ATPase subunit (alpha-subunit) was isolated in pure form by SDS-gel filtration on Bio-Gel A 1.5m. The small subunit (beta-subunit) was eluted with other contaminating proteins on the Bio-Gel column, but was isolated in pure form by extraction from SDS/polyacrylamide gels. The amino acid and carbohydrate compositions of both subunits are reported. The alpha-subunit contained 5.2% carbohydrate by weight, and the beta-subunit 9.2%. Sialic acid was absent from both subunits. Images Fig. 3. Fig. 4. PMID:6272692

  14. Structural Variation of Type I-F CRISPR RNA Guided DNA Surveillance.

    PubMed

    Pausch, Patrick; Müller-Esparza, Hanna; Gleditzsch, Daniel; Altegoer, Florian; Randau, Lennart; Bange, Gert

    2017-08-17

    CRISPR-Cas systems are prokaryotic immune systems against invading nucleic acids. Type I CRISPR-Cas systems employ highly diverse, multi-subunit surveillance Cascade complexes that facilitate duplex formation between crRNA and complementary target DNA for R-loop formation, retention, and DNA degradation by the subsequently recruited nuclease Cas3. Typically, the large subunit recognizes bona fide targets through the PAM (protospacer adjacent motif), and the small subunit guides the non-target DNA strand. Here, we present the Apo- and target-DNA-bound structures of the I-Fv (type I-F variant) Cascade lacking the small and large subunits. Large and small subunits are functionally replaced by the 5' terminal crRNA cap Cas5fv and the backbone protein Cas7fv, respectively. Cas5fv facilitates PAM recognition from the DNA major groove site, in contrast to all other described type I systems. Comparison of the type I-Fv Cascade with an anti-CRISPR protein-bound I-F Cascade reveals that the type I-Fv structure differs substantially at known anti-CRISPR protein target sites and might therefore be resistant to viral Cascade interception. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Evidence of accelerated evolution and ectodermal-specific expression of presumptive BDS toxin cDNAs from Anemonia viridis.

    PubMed

    Nicosia, Aldo; Maggio, Teresa; Mazzola, Salvatore; Cuttitta, Angela

    2013-10-30

    Anemonia viridis is a widespread and extensively studied Mediterranean species of sea anemone from which a large number of polypeptide toxins, such as blood depressing substances (BDS) peptides, have been isolated. The first members of this class, BDS-1 and BDS-2, are polypeptides belonging to the β-defensin fold family and were initially described for their antihypertensive and antiviral activities. BDS-1 and BDS-2 are 43 amino acid peptides characterised by three disulfide bonds that act as neurotoxins affecting Kv3.1, Kv3.2 and Kv3.4 channel gating kinetics. In addition, BDS-1 inactivates the Nav1.7 and Nav1.3 channels. The development of a large dataset of A. viridis expressed sequence tags (ESTs) and the identification of 13 putative BDS-like cDNA sequences has attracted interest, especially as scientific and diagnostic tools. A comparison of BDS cDNA sequences showed that the untranslated regions are more conserved than the protein-coding regions. Moreover, the KA/KS ratios calculated for all pairwise comparisons showed values greater than 1, suggesting mechanisms of accelerated evolution. The structures of the BDS homologs were predicted by molecular modelling. All toxins possess similar 3D structures that consist of a triple-stranded antiparallel β-sheet and an additional small antiparallel β-sheet located downstream of the cleavage/maturation site; however, the orientation of the triple-stranded β-sheet appears to differ among the toxins. To characterise the spatial expression profile of the putative BDS cDNA sequences, tissue-specific cDNA libraries, enriched for BDS transcripts, were constructed. In addition, the proper amplification of ectodermal or endodermal markers ensured the tissue specificity of each library. Sequencing randomly selected clones from each library revealed ectodermal-specific expression of ten BDS transcripts, while transcripts of BDS-8, BDS-13, BDS-14 and BDS-15 failed to be retrieved, likely due to under-representation in our cDNA libraries. The calculation of the relative abundance of BDS transcripts in the cDNA libraries revealed that BDS-1, BDS-3, BDS-4, BDS-5 and BDS-6 are the most represented transcripts.

  16. A large-scale full-length cDNA analysis to explore the budding yeast transcriptome

    PubMed Central

    Miura, Fumihito; Kawaguchi, Noriko; Sese, Jun; Toyoda, Atsushi; Hattori, Masahira; Morishita, Shinichi; Ito, Takashi

    2006-01-01

    We performed a large-scale cDNA analysis to explore the transcriptome of the budding yeast Saccharomyces cerevisiae. We sequenced two cDNA libraries, one from the cells exponentially growing in a minimal medium and the other from meiotic cells. Both libraries were generated by using a vector-capping method that allows the accurate mapping of transcription start sites (TSSs). Consequently, we identified 11,575 TSSs associated with 3,638 annotated genomic features, including 3,599 ORFs, to suggest that most yeast genes have two or more TSSs. In addition, we identified 45 previously undescribed introns, including those affecting current ORF annotations and those spliced alternatively. Furthermore, the analysis revealed 667 transcription units in the intergenic regions and transcripts derived from antisense strands of 367 known features. We also found that 348 ORFs carry TSSs in their 3′-halves to generate sense transcripts starting from inside the ORFs. These results indicate that the budding yeast transcriptome is considerably more complex than previously thought, and it shares many recently revealed characteristics with the transcriptomes of mammals and other higher eukaryotes. Thus, the genome-wide active transcription that generates novel classes of transcripts appears to be an intrinsic feature of the eukaryotic cells. The budding yeast will serve as a versatile model for the studies on these aspects of transcriptome, and the full-length cDNA clones can function as an invaluable resource in such studies. PMID:17101987

  17. How the structure of the large subunit controls function in an oxygen-tolerant [NiFe]-hydrogenase

    PubMed Central

    Bowman, Lisa; Flanagan, Lindsey; Fyfe, Paul K.; Parkin, Alison; Hunter, William N.; Sargent, Frank

    2014-01-01

    Salmonella enterica is an opportunistic pathogen that produces a [NiFe]-hydrogenase under aerobic conditions. In the present study, genetic engineering approaches were used to facilitate isolation of this enzyme, termed Hyd-5. The crystal structure was determined to a resolution of 3.2 Å and the hydro-genase was observed to comprise associated large and small subunits. The structure indicated that His229 from the large subunit was close to the proximal [4Fe–3S] cluster in the small subunit. In addition, His229 was observed to lie close to a buried glutamic acid (Glu73), which is conserved in oxygen-tolerant hydrogenases. His229 and Glu73 of the Hyd-5 large subunit were found to be important in both hydrogen oxidation activity and the oxygen-tolerance mechanism. Substitution of His229 or Glu73 with alanine led to a loss in the ability of Hyd-5 to oxidize hydrogen in air. Furthermore, the H229A variant was found to have lost the overpotential requirement for activity that is always observed with oxygen-tolerant [NiFe]-hydrogenases. It is possible that His229 has a role in stabilizing the super-oxidized form of the proximal cluster in the presence of oxygen, and it is proposed that Glu73could play a supporting role in fine-tuning the chemistry of His229 to enable this function. PMID:24428762

  18. Brain distribution and molecular cloning of the bovine GABA rho1 receptor.

    PubMed

    Rosas-Arellano, Abraham; Ochoa-de la Paz, Lenin David; Miledi, Ricardo; Martínez-Torres, Ataúlfo

    2007-03-01

    GABA(C) receptors were originally found in the mammalian retina and recent evidence shows that they are also expressed in several areas of the brain, including caudate nucleus, brain stem, pons and corpus callosum. In this study, plasma membranes from the caudate nucleus were microinjected into X. laevis oocytes. This led the oocyte plasma membrane to incorporate functional bicuculline-resistant, Cl(-) conducting bovine GABA receptors, similar to those of the retina. Immunolocalization of the GABA rho1 subunit revealed its expression in bovine neurons in the head of the caudate as well as in the olive, cuneiform and reticular nuclei of the brain stem. The same antibodies failed to show expression in the callosum and pons, where the GABA rho1 mRNA was previously detected. The cloned GABA rho1 sequence predicts a protein with 473 amino acids and 74-93% similarity to other GABA rho1 subunits. Oocytes injected with the cDNA express a non-desensitizing, homomeric receptor with a GABA EC(50)=6.0 microM and a Hill coefficient of 1.8. The results confirm the presence of GABA(C) receptor mRNAs in several areas of the mammalian brain and show that some of these areas express functional GABA rho1 receptors that have the classic GABA(C) receptor characteristics.

  19. A mutation in protein phosphatase 2A regulatory subunit A affects auxin transport in Arabidopsis

    NASA Technical Reports Server (NTRS)

    Garbers, C.; DeLong, A.; Deruere, J.; Bernasconi, P.; Soll, D.; Evans, M. L. (Principal Investigator)

    1996-01-01

    The phytohormone auxin controls processes such as cell elongation, root hair development and root branching. Tropisms, growth curvatures triggered by gravity, light and touch, are also auxin-mediated responses. Auxin is synthesized in the shoot apex and transported through the stem, but the molecular mechanism of auxin transport is not well understood. Naphthylphthalamic acid (NPA) and other inhibitors of auxin transport block tropic curvature responses and inhibit root and shoot elongation. We have isolated a novel Arabidopsis thaliana mutant designated roots curl in NPA (rcn1). Mutant seedlings exhibit altered responses to NPA in root curling and hypocotyl elongation. Auxin efflux in mutant seedlings displays increased sensitivity to NPA. The rcn1 mutation was transferred-DNA (T-DNA) tagged and sequences flanking the T-DNA insert were cloned. Analysis of the RCN1 cDNA reveals that the T-DNA insertion disrupts a gene for the regulatory A subunit of protein phosphatase 2A (PP2A-A). The RCN1 gene rescues the rcn1 mutant phenotype and also complements the temperature-sensitive phenotype of the Saccharomyces cerevisiae PP2A-A mutation, tpd3-1. These data implicate protein phosphatase 2A in the regulation of auxin transport in Arabidopsis.

  20. Cloning and characterization of GETS-1, a goldfish Ets family member that functions as a transcriptional repressor in muscle.

    PubMed

    Goldman, D; Sapru, M K; Stewart, S; Plotkin, J; Libermann, T A; Wasylyk, B; Guan, K

    1998-10-15

    An Ets transcription factor family member, GETS-1, was cloned from a goldfish retina cDNA library. GETS-1 contains a conserved Ets DNA-binding domain at its N-terminus and is most similar to ternary complex factor (TCF) serum-response-factor protein-1a (SAP-1a). GETS-1 is expressed in many tissues, but is enriched in retina and brain. As with the TCFs SAP-1a and ets-related protein (ERP), overexpression of the GETS-1 promoter suppresses nicotinic acetylcholine receptor epsilon-subunit gene expression in cultured muscle cells. A consensus Ets binding site sequence in the promoter of the epsilon-subunit gene is required for GETS-1-mediated repression. GETS-1 repressor activity is abrogated by overexpression of an activated Ras/mitogen-activated protein kinase (MAP kinase) or by mutation of Ser-405, a MAP kinase phosphorylation site in GETS-1. Fusion proteins created between GETS-1 and the Gal4 DNA-binding domain show that, like other TCFs, GETS-1 contains a C-terminal activation domain that is activated by a Ras/MAP kinase signalling cascade. Interestingly, mutation of Ser-405 located within this activation domain abrogated transcriptional activation of the fusion protein.

  1. Transcripts of the NADH-dehydrogenase subunit 3 gene are differentially edited in Oenothera mitochondria.

    PubMed Central

    Schuster, W; Wissinger, B; Unseld, M; Brennicke, A

    1990-01-01

    A number of cytosines are altered to be recognized as uridines in transcripts of the nad3 locus in mitochondria of the higher plant Oenothera. Such nucleotide modifications can be found at 16 different sites within the nad3 coding region. Most of these alterations in the mRNA sequence change codon identities to specify amino acids better conserved in evolution. Individual cDNA clones differ in their degree of editing at five nucleotide positions, three of which are silent, while two lead to codon alterations specifying different amino acids. None of the cDNA clones analysed is maximally edited at all possible sites, suggesting slow processing or lowered stringency of editing at these nucleotides. Differentially edited transcripts could be editing intermediates or could code for differing polypeptides. Two edited nucleotides in an open reading frame located upstream of nad3 change two amino acids in the deduced polypeptide. Part of the well-conserved ribosomal protein gene rps12 also encoded downstream of nad3 in other plants, is lost in Oenothera mitochondria by recombination events. The functional rps12 protein must be imported from the cytoplasm since the deleted sequences of this gene are not found in the Oenothera mitochondrial genome. The pseudogene sequence is not edited at any nucleotide position. Images Fig. 3. Fig. 4. Fig. 7. PMID:1688531

  2. A wheat (Triticum aestivum) protein phosphatase 2A catalytic subunit gene provides enhanced drought tolerance in tobacco.

    PubMed

    Xu, Chongyi; Jing, Ruilian; Mao, Xinguo; Jia, Xiaoyun; Chang, Xiaoping

    2007-03-01

    Multiple copies of genes encoding the catalytic subunit (c) of protein phosphatase 2A (PP2A) are commonly found in plants. For some of these genes, expression is up-regulated under water stress. The aim of this study was to investigate expression and characterization of TaPP2Ac-1 from Triticum aestivum, and to evaluate the effects of TaPP2Ac-1 on Nicotiana benthamiana in response to water stress. TaPP2Ac-1 cDNA was isolated from wheat by in silico identification and RT-PCR amplification. Transcript levels of TaPP2Ac-1 were examined in wheat responding to water deficit. Copy numbers of TaPP2Ac-1 in wheat genomes and subcellular localization in onion epidermal cells were studied. Enzyme properties of the recombinant TaPP2Ac-1 protein were determined. In addition, studies were carried out in tobacco plants with pCAPE2-TaPP2Ac-1 under water-deficit conditions. TaPP2Ac-1 cDNA was cloned from wheat. Transcript levels of TaPP2Ac-1 in wheat seedlings were up-regulated under drought condition. One copy for this TaPP2Ac-1 was present in each of the three wheat genomes. TaPP2Ac-1 fused with GFP was located in the nucleus and cytoplasm of onion epidermis cells. The recombinant TaPP2Ac-1 gene was over-expressed in Escherichia coli and encoded a functional serine/threonine phosphatase. Transgenic tobacco plants over-expressing TaPP2Ac-1 exhibited stronger drought tolerance than non-transgenic tobacco plants. Tobacco plants with pCAPE2-TaPP2Ac-1 appeared to be resistant to water deficit, as shown by their higher capacity to maintain leaf relative water content, leaf cell-membrane stability index, water-retention ability and water use efficiency under water stress. The results suggest that the physiological role of TaPP2Ac-1 is related to drought stress response, possibly through its involvement in drought-responding signal transduction pathways.

  3. Identification of a Kinase in Wheat Germ that Phosphorylates the Large Subunit of Initiation Factor 4F 1

    PubMed Central

    Humphreys, Jean; Browning, Karen S.; Ravel, Joanne M.

    1988-01-01

    A kinase has been isolated from wheat (Triticum aestivum) germ that phosphorylates the 220 kilodaltons (kD) subunit of wheat germ initiation factor (eIF) 4F, the 80 kD subunit of eIF-4B (an isozyme form of eIF-4F) and eIF-4G (the functional equivalent to mammalian eIF-4B). The kinase elutes from Sephacryl S-200 slightly in front of ovalbumin. The kinase phosphorylates casein and histone IIA to a small extent, but does not phosphorylate phosvitin. Of the wheat germ initiation factors, elongation factors, and small and large ribosomal subunits, only eIF-4F, eIF-4B, and eIF-4G are phosphorylated to a significant extent. The kinase phosphorylates eIF-4F to the extent of two phosphates per mole of the 220 kD subunit and phosphorylates eIF-4B to the extent of one phosphate per mole of the 80 kD subunit. The 26 kD subunit of eIF-4F and the 28 kD subunit of eIF-4B are not phosphorylated by the kinase. The kinase phosphorylates the 59 kD component of eIF-4G to the extent of 0.25 phosphate per mole of eIF-4G. Phosphorylation of eIF-4F and eIF-4B does not affect their ability to support the binding of mRNA to small ribosomal subunits in vitro. Images Fig. 2 Fig. 3 PMID:16666331

  4. Multiple effects of S13 in modulating the strength of intersubunit interactions in the ribosome during translation.

    PubMed

    Cukras, Anthony R; Green, Rachel

    2005-05-27

    The ribosomal protein S13 is found in the head region of the small subunit, where it interacts with the central protuberance of the large ribosomal subunit and with the P site-bound tRNA through its extended C terminus. The bridging interactions between the large and small subunits are dynamic, and are thought to be critical in orchestrating the molecular motions of the translation cycle. S13 provides a direct link between the tRNA-binding site and the movements in the head of the small subunit seen during translocation, thereby providing a possible pathway of signal transduction. We have created and characterized an rpsM(S13)-deficient strain of Escherichia coli and have found significant defects in subunit association, initiation and translocation through in vitro assays of S13-deficient ribosomes. Targeted mutagenesis of specific bridge and tRNA contact elements in S13 provides evidence that these two interaction domains play critical roles in maintaining the fidelity of translation. This ribosomal protein thus appears to play a non-essential, yet important role by modulating subunit interactions in multiple steps of the translation cycle.

  5. Isolation of human hexosaminidase. cap alpha. cDNA and expression of. cap alpha. chains in E. coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wiktorowicz, J.E.; Whitman, J.M.

    1986-05-01

    Pooled antisera against homogeneous, glutaraldehyde cross-linked hexosaminidase (hex) A was adsorbed with E. coli lysate insolubilized on Sepharose 4B. Aliquots of a human liver lambdagtll cDNA library (50,000-100,000 pfu) were plated on E. coli Y1090. Expression of cloned cDNA, after sufficient plaque growth at 42/sup 0/, was accomplished by induction with isopropylthiogalactoside soaked nitrocellulose filters. Identification of hex cDNA clones was performed by incubation of the filters with purified antisera. Protein A labelled with I-125 was used to develop the reactive plaques. Positive plaques, identified by autoradiography, were picked, replated at a lower density, and rescreened. This was repeated severalmore » more times until all plaques yielded positive signals. Identification of the clones as containing ..cap alpha.. or ..beta.. cDNA was accomplished by replating the purified phage and rescreening the plaques with anti-hex B antiserum preadsorbed with E. coli lysate. According to this protocol several hex ..cap alpha.. clones have been identified. While these clones generate ..beta..-galactosidase: hex ..cap alpha.. fusion proteins, these findings suggest that in the future it may be possible to obtain large quantities of unmodified hex ..cap alpha.. and ..beta.. polypeptides from E. coli for the study of the structural and enzymatic properties of these polypeptides and for diagnostic purposes in the GM2 gangliosidoses.« less

  6. Deletion of Marek’s disease virus large subunit of ribonucleotide reductase (RR) impairs virus growth in vitro and in vivo

    USDA-ARS?s Scientific Manuscript database

    Marek’s disease virus (MDV), a highly cell-associated lymphotropic alphaherpesvirus, is the causative agent of a neoplastic disease in domestic chickens, called Marek’s disease (MD). In the unique long region of the MDV genome, open reading frames UL39 and UL40 encode the large and small subunits o...

  7. Marek’s Disease Virus Encoded Ribonucleotide Reductase Large Subunit is not Essential for In Vitro Replication

    USDA-ARS?s Scientific Manuscript database

    Marek’s disease virus (MDV) infected cells express a viral ribonucleotide reductase (RR) that is distinguishable from that present in uninfected cells by monoclonal antibody T81. Open reading frames UL39 and UL40 of the MDV genome encode the large (RR1) and small (RR2) subunits of RR enzyme, respe...

  8. In vivo effects on intron retention and exon skipping by the U2AF large subunit and SF1/BBP in the nematode Caenorhabditis elegans

    PubMed Central

    Ma, Long; Tan, Zhiping; Teng, Yanling; Hoersch, Sebastian; Horvitz, H. Robert

    2011-01-01

    The in vivo analysis of the roles of splicing factors in regulating alternative splicing in animals remains a challenge. Using a microarray-based screen, we identified a Caenorhabditis elegans gene, tos-1, that exhibited three of the four major types of alternative splicing: intron retention, exon skipping, and, in the presence of U2AF large subunit mutations, the use of alternative 3′ splice sites. Mutations in the splicing factors U2AF large subunit and SF1/BBP altered the splicing of tos-1. 3′ splice sites of the retained intron or before the skipped exon regulate the splicing pattern of tos-1. Our study provides in vivo evidence that intron retention and exon skipping can be regulated largely by the identities of 3′ splice sites. PMID:22033331

  9. Identification and characterization of the adipokinetic hormone/corazonin-related peptide signaling system in Rhodnius prolixus.

    PubMed

    Zandawala, Meet; Haddad, Amir S; Hamoudi, Zina; Orchard, Ian

    2015-09-01

    The mammalian gonadotropin-releasing hormone is evolutionarily related to the arthropod adipokinetic hormone and the recently discovered adipokinetic hormone/corazonin-related peptide (ACP). The function of the ACP signaling system in arthropods is currently unknown. In the present study, we identify and characterize the ACP signaling system in the kissing bug Rhodnius prolixus. We isolated the complete cDNA sequence encoding R. prolixus ACP (Rhopr-ACP) and examined its expression pattern. Rhopr-ACP is predominantly expressed in the central nervous system. In particular, it is found in both the brain and corpus cardiacum (CC)/corpora allata (CA) complex. To gain an insight into its role in R. prolixus, we also isolated and functionally characterized cDNA sequences of three splice variants (Rhopr-ACPR-A, B and C) encoding R. prolixus ACP G protein-coupled receptor (Rhopr-ACPR). Rhopr-ACPR-A has only five transmembrane domains, whereas Rhopr-ACPR-B and C have all seven domains. Interestingly, Rhopr-ACPR-A, B and C were all activated by Rhopr-ACP, albeit at different sensitivities, when expressed in Chinese hamster ovary cells stably expressing the human G-protein G16 (CHO/G16). To our knowledge, this is the first study to isolate a truncated receptor cDNA in invertebrates that is functional in a heterologous expression system. Moreover, Rhopr-ACPR-B and C but not Rhopr-ACPR-A can be coupled with Gq α subunits. Expression profiling indicates that Rhopr-ACPR is highly expressed in the central nervous system, as well as the CC/CA complex, suggesting that it may control the release of other hormones found in the CC in a manner analogous to gonadotropin-releasing hormone. Temporal expression profiling shows that both Rhopr-ACP and Rhopr-ACPR are upregulated after ecdysis, suggesting that this neuropeptide may be involved in processes associated with post-ecdysis. © 2015 FEBS.

  10. Community Composition and Transcriptional Activity of Ammonia-Oxidizing Prokaryotes of Seagrass Thalassia hemprichii in Coral Reef Ecosystems.

    PubMed

    Ling, Juan; Lin, Xiancheng; Zhang, Yanying; Zhou, Weiguo; Yang, Qingsong; Lin, Liyun; Zeng, Siquan; Zhang, Ying; Wang, Cong; Ahmad, Manzoor; Long, Lijuan; Dong, Junde

    2018-01-01

    Seagrasses in coral reef ecosystems play important ecological roles by enhancing coral reef resilience under ocean acidification. However, seagrass primary productivity is typically constrained by limited nitrogen availability. Ammonia oxidation is an important process conducted by ammonia-oxidizing archaea (AOA) and bacteria (AOB), yet little information is available concerning the community structure and potential activity of seagrass AOA and AOB. Therefore, this study investigated the variations in the abundance, diversity and transcriptional activity of AOA and AOB at the DNA and transcript level from four sample types: the leaf, root, rhizosphere sediment and bulk sediment of seagrass Thalassia hemprichii in three coral reef ecosystems. DNA and complementary DNA (cDNA) were used to prepare clone libraries and DNA and cDNA quantitative PCR ( q PCR) assays, targeting the ammonia monooxygenase-subunit ( amo A) genes as biomarkers. Our results indicated that the closest relatives of the obtained archaeal and bacterial amo A gene sequences recovered from DNA and cDNA libraries mainly originated from the marine environment. Moreover, all the obtained AOB sequences belong to the Nitrosomonadales cluster. Nearly all the AOA communities exhibited higher diversity than the AOB communities at the DNA level, but the q PCR data demonstrated that the abundances of AOB communities were higher than that of AOA communities based on both DNA and RNA transcripts. Collectively, most of the samples shared greater community composition similarity with samples from the same location rather than sample type. Furthermore, the abundance of archaeal amo A gene in rhizosphere sediments showed significant relationships with the ammonium concentration of sediments and the nitrogen content of plant tissue (leaf and root) at the DNA level ( P < 0.05). Conversely, no such relationships were found for the AOB communities. This work provides new insight into the nitrogen cycle, particularly nitrification of seagrass meadows in coral reef ecosystems.

  11. JunB is required for endothelial cell morphogenesis by regulating core-binding factor β

    PubMed Central

    Licht, Alexander H.; Pein, Oliver T.; Florin, Lore; Hartenstein, Bettina; Reuter, Hendrik; Arnold, Bernd; Lichter, Peter; Angel, Peter; Schorpp-Kistner, Marina

    2006-01-01

    The molecular mechanism triggering the organization of endothelial cells (ECs) in multicellular tubules is mechanistically still poorly understood. We demonstrate that cell-autonomous endothelial functions of the AP-1 subunit JunB are required for proper endothelial morphogenesis both in vivo in mouse embryos with endothelial-specific ablation of JunB and in in vitro angiogenesis models. By cDNA microarray analysis, we identified core-binding factor β (CBFβ), which together with the Runx proteins forms the heterodimeric core-binding transcription complex CBF, as a novel JunB target gene. In line with our findings, expression of the CBF target MMP-13 was impaired in JunB-deficient ECs. Reintroduction of CBFβ into JunB-deficient ECs rescued the tube formation defect and MMP-13 expression, indicating an important role for CBFβ in EC morphogenesis. PMID:17158955

  12. Reengineering ribosome export.

    PubMed

    Lo, Kai-Yin; Johnson, Arlen W

    2009-03-01

    Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages.

  13. Reengineering Ribosome Export

    PubMed Central

    Lo, Kai-Yin

    2009-01-01

    Large cargoes require multiple receptors for efficient transport through the nuclear pore complex. The 60S ribosomal subunit is one of the bulkiest transport cargoes, and in yeast three different receptors, Crm1, Mex67/Mtr2, and Arx1, collaborate in its export. However, only Crm1, recruited by the adapter Nmd3, appears to be conserved for 60S export in higher eukaryotes. We asked if export of the large subunit requires specific receptors. We made protein fusions between mutant Nmd3 and various export receptors. Surprisingly, fusions of Mex67, the tRNA exportin Los1, Mtr2, Cse1, or Msn5 to Nmd3, lacking its Crm1-dependent nuclear export signal (NES), all functioned in export. Furthermore, these chimeric proteins supported 60S export even in the presence of the Crm1 inhibitor leptomycin B, indicating that export was now independent of Crm1. These results suggest that there is not a requirement for a specific export receptor for the large subunit, as recruitment of any receptor will suffice. Finally we show that the addition of an NES directly to the 60S ribosomal subunit protein Rpl3 promotes export. These results imply remarkable flexibility in the export pathway for the 60S subunit and help explain how different export receptors could have evolved in different eukaryotic lineages. PMID:19144820

  14. Cloning, promoter analysis and expression in response to bacterial exposure of sea bass (Dicentrarchus labrax L.) interleukin-12 p40 and p35 subunits.

    PubMed

    Nascimento, Diana S; do Vale, Ana; Tomás, Ana M; Zou, Jun; Secombes, Christopher J; dos Santos, Nuno M S

    2007-03-01

    Interleukin-12 (IL-12) is a heterodimeric cytokine pivotal in resistance to microbial and viral infections. In the search for immunoregulatory genes in sea bass the genes for the two IL-12 subunits p40 and p35 were cloned and sequenced. Molecular characterization of these two genes was performed at both the cDNA and genomic levels. Sea bass IL-12 p40 and p35 conserve most cysteines involved in the intra-chain disulfide bonds of human IL-12 subunits as well as the important structural residues for human IL-12 heterodimerization. The gene organization of sea bass IL-12 p40 is similar to the human orthologue, whilst the sea bass IL-12 p35 gene structure, as reported for pufferfish, differs from the human one in containing an additional exon and lacking a second copy of a duplicated exon present in the mammalian genes. The promoter analysis of both sea bass and pufferfish IL-12 genes showed the presence of the main cis-acting elements involved in the transcriptional regulation of human and mouse orthologues. The involvement of IL-12 in sea bass anti-bacterial immune responses was demonstrated by investigating the expression profiles of IL-1beta, IL-12 p40 and p35 in the head-kidney and spleen following intraperitoneal injection of UV-killed and live Photobacterium damselae ssp. piscicida (Phdp). Finally, the importance of nuclear factor (NF)-kappaB on UV-killed Phdp-induced IL-12 p40 and p35 gene transcription was shown by the use of pyrrolidine dithiocarbamate (PDTC).

  15. The alpha subunit of the epithelial sodium channel in the mouse: developmental regulation of its expression.

    PubMed

    Dagenais, A; Kothary, R; Berthiaume, Y

    1997-09-01

    Sodium reabsorption by the amiloride-sensitive sodium channel of epithelial cells plays a crucial role in the management of ionic composition and fluid volume in the body. In the respiratory system, sodium transport is involved in the clearance of pulmonary edema and of liquid secreted during fetal life at birth. We have cloned a partial cDNA of the alpha subunit of the mouse amiloride-sensitive sodium channel (alpha mENaC). In the region of comparison, the mouse alpha subunit shows 92% identity at the DNA level and 95% identity at the amino acid level with the rat sequence. The kidneys, lungs, and distal colon are major sites of expression of a 3.5-kb alpha mENaC mRNA. During mouse development, alpha mENaC transcripts appear late during gestation (d 17.5) and are expressed continuously thereafter. In the distal colon, a short 1.2-kb mRNA deleted of the 5' part of the transcript is detected during gestation and is replaced gradually by the mature 3.5-kb transcript after birth. Alpha mENaC and alpha1 Na+-K+-ATPase mRNAs have an expression profile that is modulated similarly during development for a given tissue. The expression of alpha mENaC transcripts increases transiently in the lungs at birth (2.5-fold), as for alpha1 Na+-K+-ATPase mRNAs (1.5-fold), suggesting that the expression of several components of the sodium transport system is modulated in the lungs at that time. In the kidney, there is no significant increase of alpha mENaC and alpha1 Na+-K+-ATPase mRNAs in newborns.

  16. Beta3 subunits promote expression and nicotine-induced up-regulation of human nicotinic alpha6* nicotinic acetylcholine receptors expressed in transfected cell lines.

    PubMed

    Tumkosit, Prem; Kuryatov, Alexander; Luo, Jie; Lindstrom, Jon

    2006-10-01

    Nicotinic acetylcholine receptors (AChRs) containing alpha6 subunits are typically found at aminergic nerve endings where they play important roles in nicotine addiction and Parkinson's disease. alpha6* AChRs usually contain beta3 subunits. beta3 subunits are presumed to assemble only in the accessory subunit position within AChRs where they do not participate in forming acetylcholine binding sites. Assembly of subunits in the accessory position may be a critical final step in assembly of mature AChRs. Human alpha6 AChRs subtypes were permanently transfected into human tsA201 human embryonic kidney (HEK) cell lines. alpha6beta2beta3 and alpha6beta4beta3 cell lines were found to express much larger amounts of AChRs and were more sensitive to nicotine-induced increase in the amount of AChRs than were alpha6beta2 or alpha6beta4 cell lines. The increased sensitivity to nicotine-induced up-regulation was due not to a beta3-induced increase in affinity for nicotine but probably to a direct effect on assembly of AChR subunits. HEK cells express only a small amount of mature alpha6beta2 AChRs, but many of these subunits are on the cell surface. This contrasts with Xenopus laevis oocytes, which express a large amount of incorrectly assembled alpha6beta2 subunits that bind cholinergic ligands but form large amorphous intracellular aggregates. Monoclonal antibodies (mAbs) were made to the alpha6 and beta3 subunits to aid in the characterization of these AChRs. The alpha6 mAbs bind to epitopes C-terminal of the extracellular domain. These data demonstrate that both cell type and the accessory subunit beta3 can play important roles in alpha6* AChR expression, stability, and up-regulation by nicotine.

  17. Analysis by mutagenesis of the ATP binding site of the gamma subunit of skeletal muscle phosphorylase kinase expressed using a baculovirus system.

    PubMed

    Lee, J H; Maeda, S; Angelos, K L; Kamita, S G; Ramachandran, C; Walsh, D A

    1992-11-03

    Active gamma subunit of skeletal muscle phosphorylase kinase has been obtained by expression of the rat soleus cDNA in a baculovirus system. The protein exhibited the expected pH 6.8/8.2 activity ratio of 0.6, and its activity was insensitive to Ca2+ addition, indicating that it was free gamma subunit and not a gamma subunit-calmodulin complex. It was stimulated approximately 2-fold by Ca(2+)-calmodulin addition, demonstrating that it had retained high-affinity calmodulin binding. By site-directed mutagenesis, we have examined the role of six of the amino acids that constitute the consensus ATP binding site of the protein kinase, which in the gamma subunit is represented by the sequence 26Gly.Arg.Gly.Val.Ser.Ser.Val.Val33. Changes were evaluated by the kinetic determination of the dissociation constants of gamma-ATP, gamma-ADP, gamma-AMP.PCP, and gamma-phosphorylase and the maximum catalytic activity. The mutants Ser26-gamma, Ser29-gamma, Phe30-gamma, and Gly31-gamma each exhibited an essentially identical dissociation constant for gamma subunit phosphorylase, indicating that these mutations had not caused a global alteration in the protein structure but were limited to changes in the nucleotide binding site domain. Substitution of either Val33 (by Gly) or Gly28 (by Ser), two of the most conserved residues in all protein kinases, resulted in enzyme with marginally detectable activity. In noted contrast, the Ser26 mutant, which substituted the first glycine of the consensus glycine trio motif, and which is also very highly conserved, retained at least 25% of the enzymatic activity. The Gly31 substitution, which restored a glycine to a position characteristic for most protein kinases, had little overall effect upon the maximum rate of catalysis. Restoration of Ser30 to the more typical phenylalanine, which is present in most protein kinases, had minimal effect on catalysis. These data provide the first direct evaluation of the roles that different residues play within this consensus glycine trio/valine motif of the protein kinases, which up to now have only been surmised to be of importance because of their conservation. Two unexpected findings are that for one residue that is very conserved (Gly26) there is some flexibility of substitution not apparent from the evolutionary conservation and that a second quite conserved residue in protein kinases (equivalent to Gly at position 31) does not produce a protein optimized for nucleotide binding.

  18. Revisiting the phylogeny of Ocellularieae, the second largest tribe within Graphidaceae (lichenized Ascomycota: Ostropales)

    Treesearch

    Ekaphan Kraichak; Sittiporn Parnmen; Robert Lücking; Eimy Rivas Plata; Andre Aptroot; Marcela E.S. Caceres; Damien Ertz; Armin Mangold; Joel A. Mercado-Diaz; Khwanruan Papong; Dries Van der Broeck; Gothamie Weerakoon; H. Thorsten Lumbsch; NO-VALUE

    2014-01-01

    We present an updated 3-locus molecular phylogeny of tribe Ocellularieae, the second largest tribe within subfamily Graphidoideae in the Graphidaceae. Adding 165 newly generated sequences from the mitochondrial small subunit rDNA (mtSSU), the nuclear large subunit rDNA (nuLSU), and the second largest subunit of the DNA-directed RNA polymerase II (RPB2), we currently...

  19. Marek’s disease virus encoded ribonucleotide reductase large subunit is essential for in vivo replication and plays a critical role in viral pathogenesis.

    USDA-ARS?s Scientific Manuscript database

    Marek’s disease virus encodes a ribonucleotide reductase (RR) that consists of two subunits namely RR1 and RR2, both of which associate to form an active holoenzyme and both subunits are necessary for enzyme activity. It is an essential enzyme for the conversion of ribonucleotides to deoxyribonucleo...

  20. Dendritic mRNA targeting and translation.

    PubMed

    Kindler, Stefan; Kreienkamp, Hans-Jürgen

    2012-01-01

    Selective targeting of specific mRNAs into neuronal dendrites and their locally regulated translation at particular cell contact sites contribute to input-specific synaptic plasticity. Thus, individual synapses become decision-making units, which control gene expression in a spatially restricted and nucleus-independent manner. Dendritic targeting of mRNAs is achieved by active, microtubule-dependent transport. For this purpose, mRNAs are packaged into large ribonucleoprotein (RNP) particles containing an array of trans-acting RNA-binding proteins. These are attached to molecular motors, which move their RNP cargo into dendrites. A variety of proteins may be synthesized in dendrites, including signalling and scaffold proteins of the synapse and neurotransmitter receptors. In some cases, such as the alpha subunit of the calcium/calmodulin-dependent protein kinase II (αCaMKII) and the activity-regulated gene of 3.1 kb (Arg3.1, also referred to as activity-regulated cDNA, Arc), their local synthesis at synapses can modulate long-term changes in synaptic efficiency. Local dendritic translation is regulated by several signalling cascades including Akt/mTOR and Erk/MAP kinase pathways, which are triggered by synaptic activity. More recent findings show that miRNAs also play an important role in protein synthesis at synapses. Disruption of local translation control at synapses, as observed in the fragile X syndrome (FXS) and its mouse models and possibly also in autism spectrum disorders, interferes with cognitive abilities in mice and men.

  1. Evidence for a Posttranscriptional Role of a TFIIICα-like Protein in Chironomus tentans

    PubMed Central

    Sabri, Nafiseh; Farrants, Ann-Kristin Östlund; Hellman, Ulf; Visa, Neus

    2002-01-01

    We have cloned and sequenced a cDNA that encodes for a nuclear protein of 238 kDa in the dipteran Chironomus tentans. This protein, that we call p2D10, is structurally similar to the α subunit of the general transcription factor TFIIIC. Using immunoelectron microscopy we have shown that a fraction of p2D10 is located at sites of transcription, which is consistent with a possible role of this protein in transcription initiation. We have also found that a large fraction of p2D10 is located in the nucleoplasm and in the nuclear pore complexes. Using gel filtration chromatography and coimmunoprecipitation methods, we have identified and characterized two p2D10-containing complexes that differ in molecular mass and composition. The heavy p2D10-containing complex contains at least one other component of the TFIIIC complex, TFIIIC-ε. Based on its molecular mass and composition, the heavy p2D10-containing complex may be the Pol III holoenzyme. The light p2D10-containing complex contains RNA together with at least two proteins that are thought to be involved in mRNA trafficking, RAE1 and hrp65. The observations reported here suggest that this new TFIIIC-α-like protein is involved in posttranscriptional steps of premRNA metabolism in Chironomus tentans. PMID:12006668

  2. Biology of Symbioses between Marine Invertebrates and Intracellular Bacteria

    DTIC Science & Technology

    1990-01-30

    bisphosphate carboxylase We designed from published sequence information oligonucleotide primers which are complementary to conserved regions on RubisCO ...large and small subunit genes. These primers were used successfully to amplify using polymerase chain reaction (PCR) specific regions of RubisCO ...for the large subunit of ribulose bisphosphate carboxylase/oxygenase ( RubisCO ) to symbiont DNA shows that the symbionts from both deep-sea and shallow

  3. Pharmacological consequences of the coexpression of BK channel α and auxiliary β subunits

    PubMed Central

    Torres, Yolima P.; Granados, Sara T.; Latorre, Ramón

    2014-01-01

    Coded by a single gene (Slo1, KCM) and activated by depolarizing potentials and by a rise in intracellular Ca2+ concentration, the large conductance voltage- and Ca2+-activated K+ channel (BK) is unique among the superfamily of K+ channels. BK channels are tetramers characterized by a pore-forming α subunit containing seven transmembrane segments (instead of the six found in voltage-dependent K+ channels) and a large C terminus composed of two regulators of K+ conductance domains (RCK domains), where the Ca2+-binding sites reside. BK channels can be associated with accessory β subunits and, although different BK modulatory mechanisms have been described, greater interest has recently been placed on the role that the β subunits may play in the modulation of BK channel gating due to its physiological importance. Four β subunits have currently been identified (i.e., β1, β2, β3, and β4) and despite the fact that they all share the same topology, it has been shown that every β subunit has a specific tissue distribution and that they modify channel kinetics as well as their pharmacological properties and the apparent Ca2+ sensitivity of the α subunit in different ways. Additionally, different studies have shown that natural, endogenous, and synthetic compounds can modulate BK channels through β subunits. Considering the importance of these channels in different pathological conditions, such as hypertension and neurological disorders, this review focuses on the mechanisms by which these compounds modulate the biophysical properties of BK channels through the regulation of β subunits, as well as their potential therapeutic uses for diseases such as those mentioned above. PMID:25346693

  4. Pharmacological consequences of the coexpression of BK channel α and auxiliary β subunits.

    PubMed

    Torres, Yolima P; Granados, Sara T; Latorre, Ramón

    2014-01-01

    Coded by a single gene (Slo1, KCM) and activated by depolarizing potentials and by a rise in intracellular Ca(2+) concentration, the large conductance voltage- and Ca(2+)-activated K(+) channel (BK) is unique among the superfamily of K(+) channels. BK channels are tetramers characterized by a pore-forming α subunit containing seven transmembrane segments (instead of the six found in voltage-dependent K(+) channels) and a large C terminus composed of two regulators of K(+) conductance domains (RCK domains), where the Ca(2+)-binding sites reside. BK channels can be associated with accessory β subunits and, although different BK modulatory mechanisms have been described, greater interest has recently been placed on the role that the β subunits may play in the modulation of BK channel gating due to its physiological importance. Four β subunits have currently been identified (i.e., β1, β2, β3, and β4) and despite the fact that they all share the same topology, it has been shown that every β subunit has a specific tissue distribution and that they modify channel kinetics as well as their pharmacological properties and the apparent Ca(2+) sensitivity of the α subunit in different ways. Additionally, different studies have shown that natural, endogenous, and synthetic compounds can modulate BK channels through β subunits. Considering the importance of these channels in different pathological conditions, such as hypertension and neurological disorders, this review focuses on the mechanisms by which these compounds modulate the biophysical properties of BK channels through the regulation of β subunits, as well as their potential therapeutic uses for diseases such as those mentioned above.

  5. An infectious full-length cDNA clone of duck Tembusu virus, a newly emerging flavivirus causing duck egg drop syndrome in China.

    PubMed

    Li, Shuang; Zhang, Lijiao; Wang, Yongyue; Wang, Shuxia; Sun, Haigang; Su, Wenliang; He, Weiyong; Han, Bo; Su, Jingliang

    2013-01-01

    Duck Tembusu virus (TMUV) is a recently identified pathogenic flavivirus that causes severe egg drop and encephalitis in Chinese ducks and geese. It has been found to be most closely related to the mosquito-origin Tembusu virus and chicken Sitiawan virus reported in Malaysia. However, the ecological characteristics and the pathogenesis of duck TMUV are largely unknown. We report the construction of full-length cDNA clone of duck TMUV strain JXSP. The virus genome was reverse transcribed, amplified as seven overlapping fragments and successively ligated into the low copy number vector pWSK29 under the control of a T7 promoter. Transfection of BHK-21 cells with the transcribed RNA from the full-length cDNA clone resulted in production of highly infectious progeny virus. In vitro growth characteristics in BHK-21 cells and virulence in ducklings and BALB/c mice were similar for the rescued and parental viruses. This stable infectious cDNA clone will be a valuable tool for studying the genetic determinants of duck TMUV. Copyright © 2012 Elsevier B.V. All rights reserved.

  6. African swine fever virus encodes two genes which share significant homology with the two largest subunits of DNA-dependent RNA polymerases.

    PubMed Central

    Yáñez, R J; Boursnell, M; Nogal, M L; Yuste, L; Viñuela, E

    1993-01-01

    A random sequencing strategy applied to two large SalI restriction fragments (SB and SD) of the African swine fever virus (ASFV) genome revealed that they might encode proteins similar to the two largest RNA polymerase subunits of eukaryotes, poxviruses and Escherichia coli. After further mapping by dot-blot hybridization, two large open reading frames (ORFs) were completely sequenced. The first ORF (NP1450L) encodes a protein of 1450 amino acids with extensive similarity to the largest subunit of RNA polymerases. The second one (EP1242L) codes for a protein of 1242 amino acids similar to the second largest RNA polymerase subunit. Proteins NP1450L and EP1242L are more similar to the corresponding subunits of eukaryotic RNA polymerase II than to those of vaccinia virus, the prototype poxvirus, which shares many functional characteristics with ASFV. ORFs NP1450L and EP1242L are mainly expressed late in ASFV infection, after the onset of DNA replication. Images PMID:8506138

  7. Cloning and characterization of a cDNA encoding a novel extracellular peroxidase from Trametes versicolor.

    PubMed

    Collins, P J; O'Brien, M M; Dobson, A D

    1999-03-01

    The white rot basidiomycete Trametes versicolor secretes a large number of peroxidases which are believed to be involved in the degradation of polymeric lignin. These peroxidases have been classified previously as lignin peroxidases or manganese peroxidases (MnP). We have isolated a novel extracellular peroxidase-encoding cDNA sequence from T. versicolor CU1, the transcript levels of which are repressed by low concentrations of Mn2+ and induced by nitrogen and carbon but not induced in response to a range of stresses which have been reported to induce MnP expression.

  8. Cloning and Characterization of a cDNA Encoding a Novel Extracellular Peroxidase from Trametes versicolor

    PubMed Central

    Collins, Patrick J.; O’Brien, Margaret M.; Dobson, Alan D. W.

    1999-01-01

    The white rot basidiomycete Trametes versicolor secretes a large number of peroxidases which are believed to be involved in the degradation of polymeric lignin. These peroxidases have been classified previously as lignin peroxidases or manganese peroxidases (MnP). We have isolated a novel extracellular peroxidase-encoding cDNA sequence from T. versicolor CU1, the transcript levels of which are repressed by low concentrations of Mn2+ and induced by nitrogen and carbon but not induced in response to a range of stresses which have been reported to induce MnP expression. PMID:10049906

  9. Decreased surface expression of the δ subunit of the GABAA receptor contributes to reduced tonic inhibition in dentate granule cells in a mouse model of fragile X syndrome.

    PubMed

    Zhang, Nianhui; Peng, Zechun; Tong, Xiaoping; Lindemeyer, A Kerstin; Cetina, Yliana; Huang, Christine S; Olsen, Richard W; Otis, Thomas S; Houser, Carolyn R

    2017-11-01

    While numerous changes in the GABA system have been identified in models of Fragile X Syndrome (FXS), alterations in subunits of the GABA A receptors (GABA A Rs) that mediate tonic inhibition are particularly intriguing. Considering the key role of tonic inhibition in controlling neuronal excitability, reduced tonic inhibition could contribute to FXS-associated disorders such as hyperactivity, hypersensitivity, and increased seizure susceptibility. The current study has focused on the expression and function of the δ subunit of the GABA A R, a major subunit involved in tonic inhibition, in granule cells of the dentate gyrus in the Fmr1 knockout (KO) mouse model of FXS. Electrophysiological studies of dentate granule cells revealed a marked, nearly four-fold, decrease in tonic inhibition in the Fmr1 KO mice, as well as reduced effects of two δ subunit-preferring pharmacological agents, THIP and DS2, supporting the suggestion that δ subunit-containing GABA A Rs are compromised in the Fmr1 KO mice. Immunohistochemistry demonstrated a small but statistically significant decrease in δ subunit labeling in the molecular layer of the dentate gyrus in Fmr1 KO mice compared to wildtype (WT) littermates. The discrepancy between the large deficits in GABA-mediated tonic inhibition in granule cells in the Fmr1 KO mice and only modest reductions in immunolabeling of the δ subunit led to studies of surface expression of the δ subunit. Cross-linking experiments followed by Western blot analysis demonstrated a small, non-significant decrease in total δ subunit protein in the hippocampus of Fmr1 KO mice, but a four-fold decrease in surface expression of the δ subunit in these mice. No significant changes were observed in total or surface expression of the α4 subunit protein, a major partner of the δ subunit in the forebrain. Postembedding immunogold labeling for the δ subunit demonstrated a large, three-fold, decrease in the number of symmetric synapses with immunolabeling at perisynaptic locations in Fmr1 KO mice. While α4 immunogold particles were also reduced at perisynaptic locations in the Fmr1 KO mice, the labeling was increased at synaptic sites. Together these findings suggest that, in the dentate gyrus, altered surface expression of the δ subunit, rather than a decrease in δ subunit expression alone, could be limiting δ subunit-mediated tonic inhibition in this model of FXS. Finding ways to increase surface expression of the δ subunit of the GABA A R could be a novel approach to treatment of hyperexcitability-related alterations in FXS. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Ribulose-1,5-bis-phosphate carboxylase/oxygenase accumulation factor1 is required for holoenzyme assembly in maize.

    PubMed

    Feiz, Leila; Williams-Carrier, Rosalind; Wostrikoff, Katia; Belcher, Susan; Barkan, Alice; Stern, David B

    2012-08-01

    Most life is ultimately sustained by photosynthesis and its rate-limiting carbon fixing enzyme, ribulose-1,5-bis-phosphate carboxylase/oxygenase (Rubisco). Although the structurally comparable cyanobacterial Rubisco is amenable to in vitro assembly, the higher plant enzyme has been refractory to such manipulation due to poor understanding of its assembly pathway. Here, we report the identification of a chloroplast protein required for Rubisco accumulation in maize (Zea mays), RUBISCO ACCUMULATION FACTOR1 (RAF1), which lacks any characterized functional domains. Maize lines lacking RAF1 due to Mutator transposon insertions are Rubisco deficient and seedling lethal. Analysis of transcripts and proteins showed that Rubisco large subunit synthesis in raf1 plants is not compromised; however, newly synthesized Rubisco large subunit appears in a high molecular weight form whose accumulation requires a specific chaperonin 60 isoform. Gel filtration analysis and blue native gels showed that endogenous and recombinant RAF1 are trimeric; however, following in vivo cross-linking, RAF1 copurifies with Rubisco large subunit, suggesting that they interact weakly or transiently. RAF1 is predominantly expressed in bundle sheath chloroplasts, consistent with a Rubisco accumulation function. Our results support the hypothesis that RAF1 acts during Rubisco assembly by releasing and/or sequestering the large subunit from chaperonins early in the assembly process.

  11. Analyses of the Large Subunit Histidine-Rich Motif Expose an Alternative Proton Transfer Pathway in [NiFe] Hydrogenases

    PubMed Central

    Szőri-Dorogházi, Emma; Maróti, Gergely; Szőri, Milán; Nyilasi, Andrea; Rákhely, Gábor; Kovács, Kornél L.

    2012-01-01

    A highly conserved histidine-rich region with unknown function was recognized in the large subunit of [NiFe] hydrogenases. The HxHxxHxxHxH sequence occurs in most membrane-bound hydrogenases, but only two of these histidines are present in the cytoplasmic ones. Site-directed mutagenesis of the His-rich region of the T. roseopersicina membrane-attached Hyn hydrogenase disclosed that the enzyme activity was significantly affected only by the replacement of the His104 residue. Computational analysis of the hydrogen bond network in the large subunits indicated that the second histidine of this motif might be a component of a proton transfer pathway including Arg487, Asp103, His104 and Glu436. Substitutions of the conserved amino acids of the presumed transfer route impaired the activity of the Hyn hydrogenase. Western hybridization was applied to demonstrate that the cellular level of the mutant hydrogenases was similar to that of the wild type. Mostly based on theoretical modeling, few proton transfer pathways have already been suggested for [NiFe] hydrogenases. Our results propose an alternative route for proton transfer between the [NiFe] active center and the surface of the protein. A novel feature of this model is that this proton pathway is located on the opposite side of the large subunit relative to the position of the small subunit. This is the first study presenting a systematic analysis of an in silico predicted proton translocation pathway in [NiFe] hydrogenases by site-directed mutagenesis. PMID:22511957

  12. Molecular cloning of human protein 4.2: a major component of the erythrocyte membrane.

    PubMed Central

    Sung, L A; Chien, S; Chang, L S; Lambert, K; Bliss, S A; Bouhassira, E E; Nagel, R L; Schwartz, R S; Rybicki, A C

    1990-01-01

    Protein 4.2 (P4.2) comprises approximately 5% of the protein mass of human erythrocyte (RBC) membranes. Anemia occurs in patients with RBCs deficient in P4.2, suggesting a role for this protein in maintaining RBC stability and integrity. We now report the molecular cloning and characterization of human RBC P4.2 cDNAs. By immunoscreening a human reticulocyte cDNA library and by using the polymerase chain reaction, two cDNA sequences of 2.4 and 2.5 kilobases (kb) were obtained. These cDNAs differ only by a 90-base-pair insert in the longer isoform located three codons downstream from the putative initiation site. The 2.4- and 2.5-kb cDNAs predict proteins of approximately 77 and approximately 80 kDa, respectively, and the authenticity was confirmed by sequence identity with 46 amino acids of three cyanogen bromide-cleaved peptides of P4.2. Northern blot analysis detected a major 2.4-kb RNA species in reticulocytes. Isolation of two P4.2 cDNAs implies existence of specific regulation of P4.2 expression in human RBCs. Human RBC P4.2 has significant homology with human factor XIII subunit a and guinea pig liver transglutaminase. Sequence alignment of P4.2 with these two transglutaminases, however, revealed that P4.2 lacks the critical cysteine residue required for the enzymatic crosslinking of substrates. Images PMID:1689063

  13. Characterization and expression analysis of a complement component gene in sea cucumber ( Apostichopus japonicus)

    NASA Astrophysics Data System (ADS)

    Chen, Zhong; Zhou, Zunchun; Yang, Aifu; Dong, Ying; Guan, Xiaoyan; Jiang, Bei; Wang, Bai

    2015-12-01

    The complement system plays a crucial role in the innate immune system of animals. It can be activated by distinct yet overlapping classical, alternative and lectin pathways. In the alternative pathway, complement factor B (Bf) serves as the catalytic subunit of complement component 3 (C3) convertase, which plays the central role among three activation pathways. In this study, the Bf gene in sea cucumber ( Apostichopus japonicus), termed AjBf, was obtained by rapid amplification of cDNA ends (RACE). The full-length cDNA of AjBf was 3231 bp in length barring the poly (A) tail. It contained an open reading frame (ORF) of 2742 bp encoding 913 amino acids, a 105 bp 5'-UTR (5'-terminal untranslated region) and a 384 bp 3'-UTR. AjBf was a mosaic protein with six CCP (complement control protein) domains, a VWA (von Willebrand factor A) domain, and a serine protease domain. The deduced molecular weight of AjBf protein was 101 kDa. Quantitative real time PCR (qRT-PCR) analysis indicated that the expression level of AjBf in A. japonicus was obviously higher at larval stage than that at embryonic stage. Expression detection in different tissues showed that AjBf expressed higher in coelomocytes than in other four tissues. In addation, AjBf expression in different tissues was induced significantly after LPS or PolyI:C challenge. These results indicated that AjBf plays an important role in immune responses to pathogen infection.

  14. Expression of bitter taste receptors of the T2R family in the gastrointestinal tract and enteroendocrine STC-1 cells.

    PubMed

    Wu, S Vincent; Rozengurt, Nora; Yang, Moon; Young, Steven H; Sinnett-Smith, James; Rozengurt, Enrique

    2002-02-19

    Although a role for the gastric and intestinal mucosa in molecular sensing has been known for decades, the initial molecular recognition events that sense the chemical composition of the luminal contents has remained elusive. Here we identified putative taste receptor gene transcripts in the gastrointestinal tract. Our results, using reverse transcriptase-PCR, demonstrate the presence of transcripts corresponding to multiple members of the T2R family of bitter taste receptors in the antral and fundic gastric mucosa as well as in the lining of the duodenum. In addition, cDNA clones of T2R receptors were detected in a rat gastric endocrine cell cDNA library, suggesting that these receptors are expressed, at least partly, in enteroendocrine cells. Accordingly, expression of multiple T2R receptors also was found in STC-1 cells, an enteroendocrine cell line. The expression of alpha subunits of G proteins implicated in intracellular taste signal transduction, namely Galpha(gust), and Galpha(t)-(2), also was demonstrated in the gastrointestinal mucosa as well as in STC-1 cells, as revealed by reverse transcriptase-PCR and DNA sequencing, immunohistochemistry, and Western blotting. Furthermore, addition of compounds widely used in bitter taste signaling (e.g., denatonium, phenylthiocarbamide, 6-n-propil-2-thiouracil, and cycloheximide) to STC-1 cells promoted a rapid increase in intracellular Ca(2+) concentration. These results demonstrate the expression of bitter taste receptors of the T2R family in the mouse and rat gastrointestinal tract.

  15. The Helicoverpa zea (Boddie) (Lepidoptera: Noctuidae) voltage-gated sodium channel and mutations associated with pyrethroid resistance in field-collected adult males.

    PubMed

    Hopkins, B W; Pietrantonio, P V

    2010-05-01

    Helicoverpa zea is one of the most costly insect pests of food and fiber crops throughout the Americas. Pyrethroid insecticides are widely applied for its control as they are effective and relatively inexpensive; however, resistance to pyrethroids threatens agricultural systems sustainability because alternative insecticides are often more expensive or less effective. Although pyrethroid resistance has been identified in this pest since 1990, the mechanisms of resistance have not yet been elucidated at the molecular level. Pyrethroids exert their toxicity by prolonging the open state of the voltage-gated sodium channel. Here we report the cDNA sequence of the H. zea sodium channel alpha-subunit homologous to the para gene from Drosophila melanogaster. In field-collected males which were resistant to cypermethrin as determined by the adult vial test, we identify known resistance-conferring mutations L1029H and V421M, along with two novel mutations at the V421 residue, V421A and V421G. An additional mutation, I951V, may be the first example of a pyrethroid resistance mutation caused by RNA editing. Identification of the sodium channel cDNA sequence will allow for testing hypotheses on target-site resistance for insecticides acting on this channel through modeling and expression studies. Understanding the mechanisms responsible for resistance will greatly improve our ability to identify and predict resistance, as well as preserve susceptibility to pyrethroid insecticides. Copyright 2010 Elsevier Ltd. All rights reserved.

  16. The potential role of ribosomal protein S5 on cell cycle arrest and initiation of murine erythroleukemia cell differentiation.

    PubMed

    Matragkou, Christina N; Papachristou, Eleni T; Tezias, Sotirios S; Tsiftsoglou, Asterios S; Choli-Papadopoulou, Theodora; Vizirianakis, Ioannis S

    2008-07-01

    Evidence now exists to indicate that some ribosomal proteins besides being structural components of the ribosomal subunits are involved in the regulation of cell differentiation and apoptosis. As we have shown earlier, initiation of erythroid differentiation of murine erythroleukemia (MEL) cells is associated with transcriptional inactivation of genes encoding ribosomal RNAs and ribosomal proteins S5 (RPS5) and L35a. In this study, we extended these observations and investigated whether transfection of MEL cells with RPS5 cDNA affects the onset of initiation of erythroid maturation and their entrance in cell cycle arrest. Stably transfected MEL cloned cells (MEL-C14 and MEL-C56) were established and assessed for their capacity to produce RPS5 RNA transcript and its translated product. The impact of RPS5 cDNA transfection on the RPS5 gene expression patterns and the accumulation of RPS5 protein in inducible transfected MEL cells were correlated with their ability to: (a) initiate differentiation, (b) enter cell cycle arrest at G(1)/G(0) phase, and (c) modulate the level of cyclin-dependent kinases CDK2, CDK4, and CDK6. The data presented indicate that deregulation of RPS5 gene expression (constitutive expression) affects RPS5 protein level and delays both the onset of initiation of erythroid maturation and entrance in cell cycle arrest in inducer-treated MEL cells. 2008 Wiley-Liss, Inc.

  17. Molecular cloning, characterization and functional analysis of QRFP in orange-spotted grouper (Epinephelus coioides).

    PubMed

    Shu, Hu; Chen, Huapu; Liu, Yun; Yang, Lidong; Yang, Yuqing; Zhang, Haifa

    2014-10-01

    The peptide QRFP plays an important role in the regulation of vertebrate feeding behavior. In this study, we cloned the full length cDNA of a QRFP precursor in a teleost fish, the orange-spotted grouper (Epinephelus coioides). Sequence analysis has shown that the functional regions of QRFP in other vertebrates (QRFP-25 and QRFP-7) are conserved in orange-spotted grouper. RT-PCR demonstrated that the pre-processed mRNA of QRFP is widely expressed in orange-spotted grouper. Three days of food deprivation did not change the hypothalamic pre-processed QRFP expression. However, QRFP expression significantly increased when the fish were reefed after three days of fasting. Intraperitoneal injection of QRFP-25 peptide to orange-spotted grouper suppressed expression of orexin, but elevated expression of pro-opiomelanocortin (POMC) in the hypothalamus. We also investigated the effects of QRFP-25 on the expression of reproductive genes. The peptide suppressed the expression of seabream-type gonadotropin-releasing hormones (sbGnRH), luteinizing hormone beta subunit (LHβ) and follicle-stimulating hormone beta subunit (FSHβ) in vivo, as well as inhibited the expression of LHβ and FSHβ in pituitary cells in primary culture. Our results indicate that QRFP may play an inhibitory role in the regulation of feeding behavior and reproduction in orange-spotted grouper. Copyright © 2014 Elsevier Inc. All rights reserved.

  18. Purification and characterization of glutamate N-acetyltransferase involved in citrulline accumulation in wild watermelon.

    PubMed

    Takahara, Kentaro; Akashi, Kinya; Yokota, Akiho

    2005-10-01

    Citrulline is an efficient hydroxyl radical scavenger that can accumulate at concentrations of up to 30 mm in the leaves of wild watermelon during drought in the presence of strong light; however, the mechanism of this accumulation remains unclear. In this study, we characterized wild watermelon glutamate N-acetyltransferase (CLGAT) that catalyses the transacetylation reaction between acetylornithine and glutamate to form acetylglutamate and ornithine, thereby functioning in the first and fifth steps in citrulline biosynthesis. CLGAT enzyme purified 7000-fold from leaves was composed of two subunits with different N-terminal amino acid sequences. Analysis of the corresponding cDNA revealed that these two subunits have molecular masses of 21.3 and 23.5 kDa and are derived from a single precursor polypeptide, suggesting that the CLGAT precursor is cleaved autocatalytically at the conserved ATML motif, as in other glutamate N-acetyltransferases of microorganisms. A green fluorescence protein assay revealed that the first 26-amino acid sequence at the N-terminus of the precursor functions as a chloroplast transit peptide. The CLGAT exhibited thermostability up to 70 degrees C, suggesting an increase in enzyme activity under high leaf temperature conditions during drought/strong-light stresses. Moreover, CLGAT was not inhibited by citrulline or arginine at physiologically relevant high concentrations. These findings suggest that CLGAT can effectively participate in the biosynthesis of citrulline in wild watermelon leaves during drought/strong-light stress.

  19. Putative subunits of the rat mesangial KATP: a type 2B sulfonylurea receptor and an inwardly rectifying K+ channel.

    PubMed

    Szamosfalvi, Balázs; Cortes, Pedro; Alviani, Rebecca; Asano, Kenichiro; Riser, Bruce L; Zasuwa, Gary; Yee, Jerry

    2002-05-01

    Sulfonylurea agents exert their physiological effects in many cell types via binding to specific sulfonylurea receptors (SUR). SUR couple to inwardly-rectifying K+ channel (Kir6.x) to form tetradimeric ATP-sensitive K+ channels (KATP). The SUR subunits confer ATP-sensitivity on KATP and also provide the binding sites for sulfonylureas and other pharmacological agents. Our previous work demonstrated that the exposure of mesangial cells (MC) to sulfonylureas generated profound effects on MC glucose uptake and matrix metabolism and induced heightened cell contractility in association with Ca2+ transients. Because these responses likely resulted from the binding of sulfonylurea to a mesangial SUR2, we subsequently documented [3H]-glibenclamide binding to MC and the gene expression of several mesangial SUR2 transcripts. From these data, we inferred that MC expressed the components of a mesangial KATP and sought to establish their presence in primary MC. To obtain mesangial SUR2 cDNA sequences, rapid amplification of cDNA ends (RACE) was utilized. DNA sequences were established by the fluorescent dye termination method. Gene expression of mesangial SUR2 and Kir6.1/2 was examined by reverse transcription polymerase chain reaction (RT-PCR) and Northern analysis. SUR2 proteins were identified by immunoblotting of mesangial proteins from membrane-enriched fractions with polyclonal antiserum directed against SUR2. RACE cloning yielded two mesangial SUR2 cDNAs of 4.8 and 6.7 kbp whose open reading frames translated proteins of 964 and 1535 aa, respectively. Using probes specific to each cDNA, the presence of a unique, 5.5 kbp serum-regulated mesangial SUR2 splice variant was established. The sequence of this mesangial SUR2 (mcSUR2B) shares identity with the recently cloned rat SUR2B (rSUR2B), but, in comparison to rSUR2B, is truncated by 12 exons at the N-terminus where it contains a unique insert of 16 aa. Immunoblotting studies with anti-SUR2 antiserum demonstrated SUR2 proteins of 108 and 170 kD in membrane-enriched fractions of MC protein extracts. Complementary studies showed abundant gene expression of Kir6.1, thereby establishing gene expression of both components of KATP. Based upon analogy to vascular smooth muscle cells (VSMC), there are at least two putative mesangial KATP that most likely represent hetero-octamers, comprised of either rSUR2B or mcSUR2 in complex with Kir6.1. Our results define the mesangial SUR2B as the possible first link in a chain of cellular events that culminates in MC contraction and altered extracellular matrix metabolism following exposure to sulfonylureas. In addition, our results serve as the basis for the future elucidation of the electrophysiologic characteristics of the mesangial KATP and the study of endogenous regulators of mesangial cell contractility.

  20. Role of ART-27, a Novel Androgen Receptor Coactivator, in Normal Prostate and Prostate Cancer

    DTIC Science & Technology

    2005-04-01

    associates with pro- teins that include RBP5, a subunit shared by RNA polymerases I, II , and Ill, an RBP5 binding protein called unconventional prefoldin ...of a large multiprotein complex that contains RNA polymerase II subunit 5, a subunit shared by all three RNA polymerases; unconventional prefoldin ...dithiothreitol; GRIP, glucocorticoid re- ceptor Interacting p rotein; HA, hemagglutinin; MMTV, mouse mamm ary tumor virus ; PAIS, partial AIS; SDS

  1. Gene expression profiling in respond to TBT exposure in small abalone Haliotis diversicolor.

    PubMed

    Jia, Xiwei; Zou, Zhihua; Wang, Guodong; Wang, Shuhong; Wang, Yilei; Zhang, Ziping

    2011-10-01

    In this study, we investigated the gene expression profiling of small abalone, Haliotis diversicolor by tributyltin (TBT) exposure using a cDNA microarray containing 2473 unique transcripts. Totally, 107 up-regulated genes and 41 down-regulated genes were found. For further investigation of candidate genes from microarray data and EST analysis, quantitative real-time PCR was performed at 6 h, 24 h, 48 h, 96 h and 192 h TBT exposure. 26 genes were found to be significantly differentially expressed in different time course, 3 of them were unknown. Some gene homologues like cellulose, endo-beta-1,4-glucanase, ferritin subunit 1 and thiolester containing protein II CG7052-PB might be the good biomarker candidate for TBT monitor. The identification of stress response genes and their expression profiles will permit detailed investigation of the defense responses of small abalone genes. Published by Elsevier Ltd.

  2. Immunohistochemical analyses of alpha1 and alpha3 Na+/K+-ATPase subunit expression in medulloblastomas.

    PubMed

    Suñol, Mariona; Cusi, Victoria; Cruz, Ofelia; Kiss, Robert; Lefranc, Florence

    2011-03-01

    The levels of expression of the α1 and α3 subunits of the Na(+)/K(+)-ATPase (the NaK sodium pump) in medulloblastomas are unclear. This study investigated the expression of the NaK subunits using immunohistochemical methods in 29 medulloblastomas including 23 classic, three large-cell/anaplastic and three nodular/desmoplastic medulloblastomas, as well as in three atypical teratoid/rhabdoid tumors (AT/RTs). There was overexpression of the α1 or α3 NaK subunits in more than half of the medulloblastomas and atypical AT/RTs, with about one-third of these tumours displaying overexpression of both subunits. These preliminary data suggest that targeting these subunits in AT/RTs and medulloblastomas that overexpress these proteins may lead to therapeutic benefit. These findings warrant confirmation in larger numbers of patients than those used in this study. Moreover, it should be determined whether inhibition of the α1/α3 NaK subunits can be integrated into the risk stratification schemes already in use for medulloblastoma patients.

  3. DiBAC4(3) hits a “sweet spot” for the activation of arterial large-conductance Ca2+-activated potassium channels independently of the β1-subunit

    PubMed Central

    Scornik, Fabiana S.; Bucciero, Ronald S.; Wu, Yuesheng; Selga, Elisabet; Bosch Calero, Cristina; Brugada, Ramon

    2013-01-01

    The voltage-sensitive dye bis-(1,3-dibutylbarbituric acid)trimethine oxonol [DiBAC4(3)] has been reported as a novel large-conductance Ca2+-activated K+ (BK) channel activator with selectivity for its β1- or β4-subunits. In arterial smooth muscle, BK channels are formed by a pore-forming α-subunit and a smooth muscle-abundant regulatory β1-subunit. This tissue specificity has driven extensive pharmacological research aimed at regulating arterial tone. Using animals with a disruption of the gene for the β1-subunit, we explored the effects of DiBAC4(3) in native channels from arterial smooth muscle. We tested the hypothesis that, in native BK channels, activation by DiBAC4(3) relies mostly on its α-subunit. We studied BK channels from wild-type and transgenic β1-knockout mice in excised patches. BK channels from brain arteries, with or without the β1-subunit, were similarly activated by DiBAC4(3). In addition, we found that saturating concentrations of DiBAC4(3) (∼30 μM) promote an unprecedented persistent activation of the channel that negatively shifts its voltage dependence by as much as −300 mV. This “sweet spot” for persistent activation is independent of Ca2+ and/or the β1–4-subunits and is fully achieved when DiBAC4(3) is applied to the intracellular side of the channel. Arterial BK channel response to DiBAC4(3) varies across species and/or vascular beds. DiBAC4(3) unique effects can reveal details of BK channel gating mechanisms and help in the rational design of BK channel activators. PMID:23542916

  4. Inter-subunit electrostatic interactions in ferritin molecule: comparison with inter-molecular interactions in crystals

    NASA Astrophysics Data System (ADS)

    Takahashi, Takuya; Hogyoku, Michiru; Nagayama, Kuniaki

    1996-10-01

    We evaluated the contribution of electrostatic interactions to the stability of macromolecular assembly in a horse L ferritin molecule composed of 24 subunits and the three-dimensional crystal of the ferritin molecules with numerical calculation of Poisson-Boltzmann equation based on dielectric model. The calculation showed that the electrostatic energy both favors the assembly of the 24 subunits and the crystalline assembly of the ferritin molecules (i.e., 24-mers). Short-range interactions less than 5 Å such as salt bridges and hydrogen bonds were important for both the subunit assembly and the crystalline assembly. To elucidate the strong stabilization by electrostatic interactions in both the ferritin 24-mer and its crystal, we analyzed the contribution of individual atoms. It revealed that the stabilization was arising from buried salt bridges or hydrogen bonds, which yielded more than 5 kcal/mol in some interactions. These large electrostatic stabilization and also the unexpected small ionic strength dependence was different from those of bovine pancreatic trypsin inhibitor (BPTI) orthorhombic and pig-insulin cubic crystals previously calculated. We also evaluated changes of the accessible surface area (ASA) and hydration free energy in accordance with the process of the subunit assembly. The change of hydration free energy, which was very large (i.e. ˜ + 100 kcal/mol/subunit) and unfavorable for the assembly, was proportional to the electrostatic hydration energy (i.e. Born energy change in hydration process). Hydrophobic groups were likely to appear more frequently than hydrophilic groups at the subunit interfaces. These results suggest that the molecular structure of the ferritin 24-mer and the crystal structure of the 24-mers were both stabilized by local electrostatic interactions, in particular. We view protein crystals as an extension of the protein oligomer to an infinite number of subunits association.

  5. Subunit mass fingerprinting of mitochondrial complex I.

    PubMed

    Morgner, Nina; Zickermann, Volker; Kerscher, Stefan; Wittig, Ilka; Abdrakhmanova, Albina; Barth, Hans-Dieter; Brutschy, Bernhard; Brandt, Ulrich

    2008-10-01

    We have employed laser induced liquid bead ion desorption (LILBID) mass spectrometry to determine the total mass and to study the subunit composition of respiratory chain complex I from Yarrowia lipolytica. Using 5-10 pmol of purified complex I, we could assign all 40 known subunits of this membrane bound multiprotein complex to peaks in LILBID subunit fingerprint spectra by comparing predicted protein masses to observed ion masses. Notably, even the highly hydrophobic subunits encoded by the mitochondrial genome were easily detectable. Moreover, the LILBID approach allowed us to spot and correct several errors in the genome-derived protein sequences of complex I subunits. Typically, the masses of the individual subunits as determined by LILBID mass spectrometry were within 100 Da of the predicted values. For the first time, we demonstrate that LILBID spectrometry can be successfully applied to a complex I band eluted from a blue-native polyacrylamide gel, making small amounts of large multiprotein complexes accessible for subunit mass fingerprint analysis even if they are membrane bound. Thus, the LILBID subunit mass fingerprint method will be of great value for efficient proteomic analysis of complex I and its assembly intermediates, as well as of other water soluble and membrane bound multiprotein complexes.

  6. Increasing the starch content and grain weight of common wheat by overexpression of the cytosolic AGPase large subunit gene.

    PubMed

    Kang, Guozhang; Liu, Guoqin; Peng, Xiaoqi; Wei, Liting; Wang, Chenyang; Zhu, YunJi; Ma, Ying; Jiang, Yumei; Guo, Tiancai

    2013-12-01

    ADP-glucose pyrophosphorylase (AGPase) catalyzes the first committed step of starch synthesis. AGPase is a heterotetramer composed of two large subunits and two small subunits, has cytosolic and plastidial isoforms, and is detected mainly in the cytosol of endosperm in cereal crops. To investigate the effects of AGPase cytosolic large subunit gene (LSU I) on starch biosynthesis in higher plant, in this study, a TaLSU I gene from wheat was overexpressed under the control of an endosperm-specific promoter in a wheat cultivar (Yumai 34). PCR, Southern blot, and real-time RT-PCR analyses indicated that the transgene was integrated into the genome of transgenic plants and was overexpressed in their progeny. The overexpression of the TaLSU I gene remarkably enhanced AGPase activity, endosperm starch weight, grain number per spike, and single grain weight. Therefore, we conclude that overexpression of the TaLSU I gene enhances the starch biosynthesis in endosperm of wheat grains, having potential applications in wheat breeding to develop a high-yield wheat cultivar with high starch weight and kernel weight. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  7. Topography of succinate dehydrogenase in the mitochondrial inner membrane. A study using limited proteolysis and immunoblotting.

    PubMed Central

    Clarkson, G H; Neagle, J; Lindsay, J G

    1991-01-01

    The arrangement of the large (70,000-Mr) and small (30,000-Mr) subunits of succinate dehydrogenase in the mitochondrial inner membrane was investigated by immunoblot analysis of bovine heart mitochondria (right-side-out, outer membrane disrupted) or submitochondrial particles (inside-out) that had been subjected to surface-specific proteolysis. Both subunits were resistant to proteinase treatment provided that the integrity of the inner membrane was preserved, suggesting that neither subunit is exposed at the cytoplasmic surface of the membrane. The bulk of the small subunit appears to protrude into the matrix compartment, since the 30,000-Mr polypeptide is degraded extensively during limited proteolysis of submitochondrial particles without the appearance of an immunologically reactive membrane-associated fragment: moreover, a soluble 27,000-Mr peptide derived from this subunit is observed transiently on incubation with trypsin. Similar data obtained from the large subunit suggest that this polypeptide interacts with the matrix side of the inner membrane via two distinct domains; these are detected as stable membrane-associated fragments of 32,000 Mr and 27,000 Mr after treatment of submitochondrial particles with papain or proteinase K, although the 27,000-Mr fragment can be degraded further to low-Mr peptides with trypsin or alpha-chymotrypsin. A stable 32,000-34,000-Mr fragment is generated by a variety of specific and non-specific proteinases, indicating that it may be embedded largely within the lipid bilayer, or is inaccessible to proteolytic attack owing to its proximity to the surface of the intact membrane, possibly interacting with the hydrophobic membrane anchoring polypeptides of the succinate: ubiquinone reductase complex. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. PMID:1996968

  8. Improved methodology to obtain large quantities of correctly folded recombinant N-terminal extracellular domain of the human muscle acetylcholine receptor for inducing experimental autoimmune myasthenia gravis in rats

    PubMed Central

    Sun, Chenjing; Zhang, Hongliang; Xu, Jiang; Gao, Jie

    2013-01-01

    Introduction Human myasthenia gravis (MG) is an autoimmune disorder of the neuromuscular system. Experimental autoimmune myasthenia gravis (EAMG) is a well-established animal model for MG that can be induced by active immunization with the Torpedo californica-derived acetylcholine receptor (AChR). Due to the expensive cost of purifying AChR from Torpedo californica, the development of an easier and more economical way of inducing EAMG remains critically needed. Material and methods Full-length cDNA of the human skeletal muscle AChR α1 subunit was obtained from TE671 cells. The DNA fragment encoding the extracellular domain (ECD) was then amplified by polymerase chain reaction (PCR) and inserted into pET-16b. The reconstructed plasmid was transformed into the host strain BL21(DE3)pLysS, which was derived from Escherichia coli. Isopropyl-β-D-thiogalactopyranoside (IPTG) was used to induce the expression of the N-terminal ECD. The produced protein was purified with immobilized Ni2+ affinity chromatography and refolded by dialysis. Results The recombinant protein was efficiently refolded to soluble active protein, which was verified by ELISA. After immunization with the recombinant ECD, all rats acquired clinical signs of EAMG. The titer of AChR antibodies in the serum was significantly higher in the EAMG group than in the control group, indicating successful induction of EAMG. Conclusions We describe an improved procedure for refolding recombinant ECD of human muscle AChR. This improvement allows for the generation of large quantities of correctly folded recombinant ECD of human muscle AChR, which provides for an easier and more economical way of inducing the animal model of MG. PMID:24904677

  9. Conformational Sampling and Nucleotide-Dependent Transitions of the GroEL Subunit Probed by Unbiased Molecular Dynamics Simulations

    PubMed Central

    Skjaerven, Lars; Grant, Barry; Muga, Arturo; Teigen, Knut; McCammon, J. Andrew; Reuter, Nathalie; Martinez, Aurora

    2011-01-01

    GroEL is an ATP dependent molecular chaperone that promotes the folding of a large number of substrate proteins in E. coli. Large-scale conformational transitions occurring during the reaction cycle have been characterized from extensive crystallographic studies. However, the link between the observed conformations and the mechanisms involved in the allosteric response to ATP and the nucleotide-driven reaction cycle are not completely established. Here we describe extensive (in total long) unbiased molecular dynamics (MD) simulations that probe the response of GroEL subunits to ATP binding. We observe nucleotide dependent conformational transitions, and show with multiple 100 ns long simulations that the ligand-induced shift in the conformational populations are intrinsically coded in the structure-dynamics relationship of the protein subunit. Thus, these simulations reveal a stabilization of the equatorial domain upon nucleotide binding and a concomitant “opening” of the subunit, which reaches a conformation close to that observed in the crystal structure of the subunits within the ADP-bound oligomer. Moreover, we identify changes in a set of unique intrasubunit interactions potentially important for the conformational transition. PMID:21423709

  10. Subunit interface dynamics in hexadecameric rubisco.

    PubMed

    van Lun, Michiel; van der Spoel, David; Andersson, Inger

    2011-09-02

    Ribulose-1,5-bisphosphate (RuBP) carboxylase/oxygenase (Rubisco) plays an important role in the global carbon cycle as a hub for biomass. Rubisco catalyzes not only the carboxylation of RuBP with carbon dioxide but also a competing oxygenation reaction of RuBP with a negative impact on photosynthetic yield. The functional active site is built from two large (L) subunits that form a dimer. The octameric core of four L(2) dimers is held at each end by a cluster of four small (S) subunits, forming a hexadecamer. Each large subunit contacts more than one S subunit. These interactions exploit the dynamic flexibility of Rubisco, which we address in this study. Here, we describe seven different types of interfaces of hexadecameric Rubisco. We have analyzed these interfaces with respect to the size of the interface area and the number of polar interactions, including salt bridges and hydrogen bonds in a variety of Rubisco enzymes from different organisms and different kingdoms of life, including the Rubisco-like proteins. We have also performed molecular dynamics simulations of Rubisco from Chlamydomonas reinhardtii and mutants thereof. From our computational analyses, we propose structural checkpoints of the S subunit to ensure the functionality and/or assembly of the Rubisco holoenzyme. These checkpoints appear to fine-tune the dynamics of the enzyme in a way that could influence enzyme performance. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Quantitative Analysis of HIV-1 Preintegration Complexes

    PubMed Central

    Engelman, Alan; Oztop, Ilker; Vandegraaff, Nick; Raghavendra, Nidhanapati K.

    2009-01-01

    Retroviral replication proceeds through the formation of a provirus, an integrated DNA copy of the viral RNA genome. The linear cDNA product of reverse transcription is the integration substrate and two different integrase activities, 3′ processing and DNA strand transfer, are required for provirus formation. Integrase nicks the cDNA ends adjacent to phylogenetically-conserved CA dinucleotides during 3′ processing. After nuclear entry and locating a suitable chromatin acceptor site, integrase joins the recessed 3′-OHs to the 5′-phosphates of a double-stranded staggered cut in the DNA target. Integrase functions in the context of a large nucleoprotein complex, called the preintegration complex (PIC), and PICs are analyzed to determine levels of integrase 3′ processing and DNA strand transfer activities that occur during acute virus infection. Denatured cDNA end regions are monitored by indirect end-labeling to measure the extent of 3′ processing. Native PICs can efficiently integrate their viral cDNA into exogenously added target DNA in vitro, and Southern blotting or nested PCR assays are used to quantify the resultant DNA strand transfer activity. This study details HIV-1 infection, PIC extraction, partial purification, and quantitative analyses of integrase 3′ processing and DNA strand transfer activities. PMID:19233280

  12. Cloning and expression of cDNA for a human low-K sub m , rolipram-sensitive cyclic AMP phosphodiesterase

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Livi, G.P.; McHale, M.J.; Sathe, G.M.

    1990-06-01

    The authors have isolated cDNA clones representing cyclic AMP (cAMP)-specific phosphodiesterases (PDEases) from a human monocyte cDNA library. One cDNA clone (hPDE-1) defines a large open reading frame of ca. 2.1 kilobases, predicting a 686-amino-acid, ca. 77-kilodalton protein which contains significant homology to both rat brain and {ital Drosophila} cAMP PDEases, especially within an internal conserved domain of ca. 270 residues. Amino acid sequence divergence exists at the NH{sub 2} terminus and also within a 40- to 100-residue domain near the COOH-terminal end. hPDE-1 hybridizes to a major 4.8-kilobase mRNA transcript from both human monocytes and placenta. The coding regionmore » of hPDE-1 was engineered for expression in COS-1 cells, resulting in the overproduction of cAMP PDEase activity. The hPDE-1 recombinant gene product was identified as a low-{ital K{sub m}} cAMP phosphodiesterase on the basis of several biochemical properties including selective inhibition by the antidepressant drug rolipram. Known inhibitors of other PDEases (cGMP-specific PDEase, cGMP-inhibited PDEase) had little or no effect on the hPDE-1 recombinant gene product.« less

  13. cDNA cloning and heterologous expression of a wheat proteinase inhibitor of subtilisin and chymotrypsin (WSCI) that interferes with digestive enzymes of insect pests.

    PubMed

    Di Gennaro, Simone; Ficca, Anna G; Panichi, Daniela; Poerio, Elia

    2005-04-01

    A cDNA encoding the proteinase inhibitor WSCI (wheat subtilisin/chymotrypsin inhibitor) was isolated by RT-PCR. Degenerate oligonucleotide primers were designed based on the amino acid sequence of WSCI and on the nucleotide sequence of the two homologous inhibitors (CI-2A and CI-2B) isolated from barley. For large-scale production, wsci cDNA was cloned into the E. coli vector pGEX-2T. The fusion protein GST-WSCI was efficiently produced in the bacterial expression system and, as the native inhibitor, was capable of inhibiting bacterial subtilisin, mammalian chymotrypsins and chymotrypsin-like activities present in crude extracts of a number of insect larvae ( Helicoverpa armigera , Plodia interpunctella and Tenebrio molitor ). The recombinant protein produced was also able to interfere with chymotrypsin-like activity isolated from immature wheat caryopses. These findings support a physiological role for this inhibitor during grain maturation.

  14. A protein with an inactive pterin-4a-carbinolamine dehydratase domain is required for Rubisco biogenesis in plants.

    PubMed

    Feiz, Leila; Williams-Carrier, Rosalind; Belcher, Susan; Montano, Monica; Barkan, Alice; Stern, David B

    2014-12-01

    Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) plays a critical role in sustaining life by catalysis of carbon fixation in the Calvin-Benson pathway. Incomplete knowledge of the assembly pathway of chloroplast Rubisco has hampered efforts to fully delineate the enzyme's properties, or seek improved catalytic characteristics via directed evolution. Here we report that a Mu transposon insertion in the Zea mays (maize) gene encoding a chloroplast dimerization co-factor of hepatocyte nuclear factor 1 (DCoH)/pterin-4α-carbinolamine dehydratases (PCD)-like protein is the causative mutation in a seedling-lethal, Rubisco-deficient mutant named Rubisco accumulation factor 2 (raf2-1). In raf2 mutants newly synthesized Rubisco large subunit accumulates in a high-molecular weight complex, the formation of which requires a specific chaperonin 60-kDa isoform. Analogous observations had been made previously with maize mutants lacking the Rubisco biogenesis proteins RAF1 and BSD2. Chemical cross-linking of maize leaves followed by immunoprecipitation with antibodies to RAF2, RAF1 or BSD2 demonstrated co-immunoprecipitation of each with Rubisco small subunit, and to a lesser extent, co-immunoprecipitation with Rubisco large subunit. We propose that RAF2, RAF1 and BSD2 form transient complexes with the Rubisco small subunit, which in turn assembles with the large subunit as it is released from chaperonins. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  15. D1/D2 domain of large-subunit ribosomal DNA for differentiation of Orpinomyces spp.

    PubMed

    Dagar, Sumit S; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K

    2011-09-01

    This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation.

  16. Photoinduced reduction of the medial FeS center in the hydrogenase small subunit HupS from Nostoc punctiforme.

    PubMed

    Raleiras, Patrícia; Hammarström, Leif; Lindblad, Peter; Styring, Stenbjörn; Magnuson, Ann

    2015-07-01

    The small subunit from the NiFe uptake hydrogenase, HupSL, in the cyanobacterium Nostoc punctiforme ATCC 29133, has been isolated in the absence of the large subunit (P. Raleiras, P. Kellers, P. Lindblad, S. Styring, A. Magnuson, J. Biol. Chem. 288 (2013) 18,345-18,352). Here, we have used flash photolysis to reduce the iron-sulfur clusters in the isolated small subunit, HupS. We used ascorbate as electron donor to the photogenerated excited state of Ru(II)-trisbipyridine (Ru(bpy)3), to generate Ru(I)(bpy)3 as reducing agent. Our results show that the isolated small subunit can be reduced by the Ru(I)(bpy)3 generated through flash photolysis. Copyright © 2015 Elsevier Inc. All rights reserved.

  17. Ribulose-1,5-Bis-Phosphate Carboxylase/Oxygenase Accumulation Factor1 Is Required for Holoenzyme Assembly in Maize[C][W

    PubMed Central

    Feiz, Leila; Williams-Carrier, Rosalind; Wostrikoff, Katia; Belcher, Susan; Barkan, Alice; Stern, David B.

    2012-01-01

    Most life is ultimately sustained by photosynthesis and its rate-limiting carbon fixing enzyme, ribulose-1,5-bis-phosphate carboxylase/oxygenase (Rubisco). Although the structurally comparable cyanobacterial Rubisco is amenable to in vitro assembly, the higher plant enzyme has been refractory to such manipulation due to poor understanding of its assembly pathway. Here, we report the identification of a chloroplast protein required for Rubisco accumulation in maize (Zea mays), RUBISCO ACCUMULATION FACTOR1 (RAF1), which lacks any characterized functional domains. Maize lines lacking RAF1 due to Mutator transposon insertions are Rubisco deficient and seedling lethal. Analysis of transcripts and proteins showed that Rubisco large subunit synthesis in raf1 plants is not compromised; however, newly synthesized Rubisco large subunit appears in a high molecular weight form whose accumulation requires a specific chaperonin 60 isoform. Gel filtration analysis and blue native gels showed that endogenous and recombinant RAF1 are trimeric; however, following in vivo cross-linking, RAF1 copurifies with Rubisco large subunit, suggesting that they interact weakly or transiently. RAF1 is predominantly expressed in bundle sheath chloroplasts, consistent with a Rubisco accumulation function. Our results support the hypothesis that RAF1 acts during Rubisco assembly by releasing and/or sequestering the large subunit from chaperonins early in the assembly process. PMID:22942379

  18. Characterization of a Novel Rieske-Type Alkane Monooxygenase System in Pusillimonas sp. Strain T7-7

    PubMed Central

    Li, Ping; Wang, Lei

    2013-01-01

    The cold-tolerant bacterium Pusillimonas sp. strain T7-7 is able to utilize diesel oils (C5 to C30 alkanes) as a sole carbon and energy source. In the present study, bioinformatics, proteomics, and real-time reverse transcriptase PCR approaches were used to identify the alkane hydroxylation system present in this bacterium. This system is composed of a Rieske-type monooxygenase, a ferredoxin, and an NADH-dependent reductase. The function of the monooxygenase, which consists of one large (46.711 kDa) and one small (15.355 kDa) subunit, was further studied using in vitro biochemical analysis and in vivo heterologous functional complementation tests. The purified large subunit of the monooxygenase was able to oxidize alkanes ranging from pentane (C5) to tetracosane (C24) using NADH as a cofactor, with greatest activity on the C15 substrate. The large subunit also showed activity on several alkane derivatives, including nitromethane and methane sulfonic acid, but it did not act on any aromatic hydrocarbons. The optimal reaction condition of the large subunit is pH 7.5 at 30°C. Fe2+ can enhance the activity of the enzyme evidently. This is the first time that an alkane monooxygenase system belonging to the Rieske non-heme iron oxygenase family has been identified in a bacterium. PMID:23417490

  19. Sinophysis and Pseudophalacroma are distantly related to typical Dinophysoid dinoflagellates (Dinophysales, Dinophyceae).

    PubMed

    Gómez, Fernando; Moreira, David; López-García, Purificación

    2012-01-01

    Dinophysoid dinoflagellates are usually considered a large monophyletic group. Large subunit and small subunit (SSU) rDNA phylogenies suggest a basal position for Amphisoleniaceae (Amphisolenia,Triposolenia) with respect to two sister groups, one containing most Phalacroma species plus Oxyphysis and the other Dinophysis,Ornithocercus, Dinophysoid dinoflagellates are usually considered a large monophyletic group. Large subunit and small subunit (SSU) rDNA phylogenies suggest a basal position for Amphisoleniaceae (Amphisolenia,Triposolenia) with respect to two sister groups, one containing most Phalacroma species plus Oxyphysis and the other Dinophysis,Ornithocercus, Histioneis,Citharistes and some Phalacroma species. We provide here new SSU rDNA sequences of Pseudophalacroma (pelagic) and Sinophysis (the only benthic dinophysoid genus). Molecular phylogenies support that they are very divergent with respect to the main clade of Dinophysales. Additional molecular markers of these two key genera are needed to elucidate the evolutionary relations among the dinophysoid dinoflagellates. Histioneis,Citharistes and some Phalacroma species. We provide here new SSU rDNA sequences of Pseudophalacroma (pelagic) and Sinophysis (the only benthic dinophysoid genus). Molecular phylogenies support that they are very divergent with respect to the main clade of Dinophysales. Additional molecular markers of these two key genera are needed to elucidate the evolutionary relations among the dinophysoid dinoflagellates. © 2011 The Author(s) Journal of Eukaryotic Microbiology © 2011 International Society of Protistologists.

  20. Structural changes of homodimers in the PDB.

    PubMed

    Koike, Ryotaro; Amemiya, Takayuki; Horii, Tatsuya; Ota, Motonori

    2018-04-01

    Protein complexes are involved in various biological phenomena. These complexes are intrinsically flexible, and structural changes are essential to their functions. To perform a large-scale automated analysis of the structural changes of complexes, we combined two original methods. An application, SCPC, compares two structures of protein complexes and decides the match of binding mode. Another application, Motion Tree, identifies rigid-body motions in various sizes and magnitude from the two structural complexes with the same binding mode. This approach was applied to all available homodimers in the Protein Data Bank (PDB). We defined two complex-specific motions: interface motion and subunit-spanning motion. In the former, each subunit of a complex constitutes a rigid body, and the relative movement between subunits occurs at the interface. In the latter, structural parts from distinct subunits constitute a rigid body, providing the relative movement spanning subunits. All structural changes were classified and examined. It was revealed that the complex-specific motions were common in the homodimers, detected in around 40% of families. The dimeric interfaces were likely to be small and flat for interface motion, while large and rugged for subunit-spanning motion. Interface motion was accompanied by a drastic change in contacts at the interface, while the change in the subunit-spanning motion was moderate. These results indicate that the interface properties of homodimers correlated with the type of complex-specific motion. The study demonstrates that the pipeline of SCPC and Motion Tree is useful for the massive analysis of structural change of protein complexes. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. [cDNA library construction from panicle meristem of finger millet].

    PubMed

    Radchuk, V; Pirko, Ia V; Isaenkov, S V; Emets, A I; Blium, Ia B

    2014-01-01

    The protocol for production of full-size cDNA using SuperScript Full-Length cDNA Library Construction Kit II (Invitrogen) was tested and high quality cDNA library from meristematic tissue of finger millet panicle (Eleusine coracana (L.) Gaertn) was created. The titer of obtained cDNA library comprised 3.01 x 10(5) CFU/ml in avarage. In average the length of cDNA insertion consisted about 1070 base pairs, the effectivity of cDNA fragment insertions--99.5%. The selective sequencing of cDNA clones from created library was performed. The sequences of cDNA clones were identified with usage of BLAST-search. The results of cDNA library analysis and selective sequencing represents prove good functionality and full length character of inserted cDNA clones. Obtained cDNA library from meristematic tissue of finger millet panicle represents good and valuable source for isolation and identification of key genes regulating metabolism and meristematic development and for mining of new molecular markers to conduct out high quality genetic investigations and molecular breeding as well.

  2. cDNA, genomic sequence cloning and overexpression of ribosomal protein S25 gene (RPS25) from the Giant Panda.

    PubMed

    Hao, Yan-Zhe; Hou, Wan-Ru; Hou, Yi-Ling; Du, Yu-Jie; Zhang, Tian; Peng, Zheng-Song

    2009-11-01

    RPS25 is a component of the 40S small ribosomal subunit encoded by RPS25 gene, which is specific to eukaryotes. Studies in reference to RPS25 gene from animals were handful. The Giant Panda (Ailuropoda melanoleuca), known as a "living fossil", are increasingly concerned by the world community. Studies on RPS25 of the Giant Panda could provide scientific data for inquiring into the hereditary traits of the gene and formulating the protective strategy for the Giant Panda. The cDNA of the RPS25 cloned from Giant Panda is 436 bp in size, containing an open reading frame of 378 bp encoding 125 amino acids. The length of the genomic sequence is 1,992 bp, which was found to possess four exons and three introns. Alignment analysis indicated that the nucleotide sequence of the coding sequence shows a high homology to those of Homo sapiens, Bos taurus, Mus musculus and Rattus norvegicus as determined by Blast analysis, 92.6, 94.4, 89.2 and 91.5%, respectively. Primary structure analysis revealed that the molecular weight of the putative RPS25 protein is 13.7421 kDa with a theoretical pI 10.12. Topology prediction showed there is one N-glycosylation site, one cAMP and cGMP-dependent protein kinase phosphorylation site, two Protein kinase C phosphorylation sites and one Tyrosine kinase phosphorylation site in the RPS25 protein of the Giant Panda. The RPS25 gene was overexpressed in E. coli BL21 and Western Blotting of the RPS25 protein was also done. The results indicated that the RPS25 gene can be really expressed in E. coli and the RPS25 protein fusioned with the N-terminally his-tagged form gave rise to the accumulation of an expected 17.4 kDa polypeptide. The cDNA and the genomic sequence of RPS25 were cloned successfully for the first time from the Giant Panda using RT-PCR technology and Touchdown-PCR, respectively, which were both sequenced and analyzed preliminarily; then the cDNA of the RPS25 gene was overexpressed in E. coli BL21 and immunoblotted, which is the first report on the RPS25 gene from the Giant Panda. The data will enrich and supplement the information about RPS25, which will contribute to the protection for gene resources and the discussion of the genetic polymorphism.

  3. Construction of a cDNA library for miniature pig mandibular deciduous molars

    PubMed Central

    2014-01-01

    Background The miniature pig provides an excellent experimental model for tooth morphogenesis because its diphyodont and heterodont dentition resembles that of humans. However, little information is available on the process of tooth development or the exact molecular mechanisms controlling tooth development in miniature pigs or humans. Thus, the analysis of gene expression related to each stage of tooth development is very important. Results In our study, after serial sections were made, the development of the crown of the miniature pigs’ mandibular deciduous molar could be divided into five main phases: dental lamina stage (E33-E35), bud stage (E35-E40), cap stage (E40-E50), early bell stage (E50-E60), and late bell stage (E60-E65). Total RNA was isolated from the tooth germ of miniature pig embryos at E35, E45, E50, and E60, and a cDNA library was constructed. Then, we identified cDNA sequences on a large scale screen for cDNA profiles in the developing mandibular deciduous molars (E35, E45, E50, and E60) of miniature pigs using Illumina Solexa deep sequencing. Microarray assay was used to detect the expression of genes. Lastly, through Unigene sequence analysis and cDNA expression pattern analysis at E45 and E60, we found that 12 up-regulated and 15 down-regulated genes during the four periods are highly conserved genes homologous with known Homo sapiens genes. Furthermore, there were 6 down-regulated and 2 up-regulated genes in the miniature pig that were highly homologous to Homo sapiens genes compared with those in the mouse. Conclusion Our results not only identify the specific transcriptome and cDNA profile in developing mandibular deciduous molars of the miniature pig, but also provide useful information for investigating the molecular mechanism of tooth development in the miniature pig. PMID:24750690

  4. Diverse Roles for Auxiliary Subunits in Phosphorylation-Dependent Regulation of Mammalian Brain Voltage-Gated Potassium Channels

    PubMed Central

    Vacher, Helene; Trimmer, James S.

    2012-01-01

    Voltage-gated ion channels are a diverse family of signaling proteins that mediate rapid electrical signaling events. Among these, voltage-gated potassium or Kv channels are the most diverse, in part due to the large number of principal (or α) subunits and auxiliary subunits that can assemble in different combinations to generate Kv channel complexes with distinct structures and functions. The diversity of Kv channels underlies much of the variability in the active properties between different mammalian central neurons, and the dynamic changes that lead to experience-dependent plasticity in intrinsic excitability. Recent studies have revealed that Kv channel α subunits and auxiliary subunits are extensively phosphorylated, contributing to additional structural and functional diversity. Here we highlight recent studies that show that auxiliary subunits exert some of their profound effects on dendritic Kv4 and axonal Kv1 channels through phosphorylation-dependent mechanisms, either due to phosphorylation on the auxiliary subunit itself, or by influencing the extent and/or impact of α subunit phosphorylation. The complex effects of auxiliary subunits and phosphorylation provide a potent mechanism to generate additional diversity in the structure and function of Kv4 and Kv1 channels, as well as allowing for dynamic reversible regulation of these important ion channels. PMID:21822597

  5. L-Arginine Modulates Intestinal Inflammation in Rats Submitted to Mesenteric Ischemia-Reperfusion Injury.

    PubMed

    Taha, M O; de Oliveira, J V; Dias Borges, M; de Lucca Melo, F; Gualtieri, F G; E Silva Aidar, A L; Pacheco, R L; de Melo Alexandre E Silva, T; Klajner, R K; Iuamoto, L R; Munhoz Torres, L; Morais Mendes de Paula, B J; de Campos, K; Oliveira-Junior, I S; Fagundes, D J

    2016-03-01

    The goal of this study was to investigate whether exogenous offer of L-arginine (LARG) modulates the gene expression of intestinal dysfunction caused by ischemia and reperfusion. Eighteen Wistar-EPM1 male rats (250-300 g) were anesthetized and subjected to laparotomy. The superior mesenteric vessels were exposed, and the rats were randomized into 3 groups (n = 6): the control group (CG), with no superior mesenteric artery interruption; the ischemia/reperfusion group (IRG), with 60 minutes of ischemia and 120 minutes of reperfusion and saline injections; and the L-arginine group (IRG + LARG), with L-arginine injected in the femoral vein 5 minutes before ischemia, 5 minutes after reperfusion, and after 55 minutes of reperfusion. The total RNA was extracted and purified from samples of the small intestine. The concentration of each total RNA sample was determined by using spectrophotometry. The first-strand complementary DNA (cDNA) was synthesized in equal amounts of cDNA and the Master Mix SYBR Green qPCR Mastermix (SABiosciences, a Qiagen Company, Frederick, Md). Amounts of cDNA and Master Mix SYBR Green qPCR Mastermix were distributed to each well of the polymerase chain reaction microarray plate containing the predispensed gene-specific primer sets for Bax and Bcl2. Each sample was evaluated in triplicate, and the Student t test was applied to validate the homogeneity of each gene expression reaction (P < .05). The gene expression of Bax in IRG (+1.48) was significantly higher than in IRG-LARG (+9.69); the expression of Bcl2L1 in IRG (+1.01) was significantly higher than IRG-LARG (+22.89). The apoptotic cell pathway of 2 protagonists showed that LARG improves the gene expression of anti-apoptotic Bcl2l1 (Bcl2-like 1) more than the pro-apoptotic Bax (Bcl2-associated X protein). Copyright © 2016. Published by Elsevier Inc.

  6. Immunoreactivity of polyclonal antibodies generated against the carboxy terminus of the predicted amino acid sequence of the Huntington disease gene

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Alkatib, G.; Graham, R.; Pelmear-Telenius, A.

    1994-09-01

    A cDNA fragment spanning the 3{prime}-end of the Huntington disease gene (from 8052 to 9252) was cloned into a prokaryotic expression vector containing the E. Coli lac promoter and a portion of the coding sequence for {beta}-galactosidase. The truncated {beta}-galactosidase gene was cleaved with BamHl and fused in frame to the BamHl fragment of the Huntington disease gene 3{prime}-end. Expression analysis of proteins made in E. Coli revealed that 20-30% of the total cellular proteins was represented by the {beta}-galactosidase-huntingtin fusion protein. The identity of the Huntington disease protein amino acid sequences was confirmed by protein sequence analysis. Affinity chromatographymore » was used to purify large quantities of the fusion protein from bacterial cell lysates. Affinity-purified proteins were used to immunize New Zealand white rabbits for antibody production. The generated polyclonal antibodies were used to immunoprecipitate the Huntington disease gene product expressed in a neuroblastoma cell line. In this cell line the antibodies precipitated two protein bands of apparent gel migrations of 200 and 150 kd which together, correspond to the calculated molecular weight of the Huntington disease gene product (350 kd). Immunoblotting experiments revealed the presence of a large precursor protein in the range of 350-750 kd which is in agreement with the predicted molecular weight of the protein without post-translational modifications. These results indicate that the huntingtin protein is cleaved into two subunits in this neuroblastoma cell line and implicate that cleavage of a large precursor protein may contribute to its biological activity. Experiments are ongoing to determine the precursor-product relationship and to examine the synthesis of the huntingtin protein in freshly isolated rat brains, and to determine cellular and subcellular distribution of the gene product.« less

  7. Molecular phylogeny of Laetiporus and other brown rot polypore genera in North America

    Treesearch

    Daniel L. Lindner; Mark T. Banik

    2008-01-01

    Phylogenetic relationships were investigated among North American species of Laetiporus, Leptoporus, Phaeolus, Pycnoporellus, and Wolfiporia using ITS, nuclear large subunit and mitochondrial small subunit rDNA sequences. Members of these genera have poroid hymenophores, simple septate hyphae and cause brown rots in a variety of...

  8. D1/D2 Domain of Large-Subunit Ribosomal DNA for Differentiation of Orpinomyces spp.▿

    PubMed Central

    Dagar, Sumit S.; Kumar, Sanjay; Mudgil, Priti; Singh, Rameshwar; Puniya, Anil K.

    2011-01-01

    This study presents the suitability of D1/D2 domain of large-subunit (LSU) ribosomal DNA (rDNA) for differentiation of Orpinomyces joyonii and Orpinomyces intercalaris based on PCR-restriction fragment length polymorphism (RFLP). A variation of G/T in O. intercalaris created an additional restriction site for AluI, which was used as an RFLP marker. The results demonstrate adequate heterogeneity in the LSU rDNA for species-level differentiation. PMID:21784906

  9. Sequence data for two large-subunit rRNA genes from an Asian strain of Alexandrium catenella.

    PubMed Central

    Yeung, P K; Kong, K F; Wong, F T; Wong, J T

    1996-01-01

    PCR generated two distinct products from a toxic isolate of Alexandrium catenella, which had been taken from Dai Ya Bay (southern China), by using primers for large-subunit rRNA. This pattern is distinct from published data for North American Alexandrium species. Sequences of the two products suggest that the smaller was generated by a deletion event. Single-cell PCR generated the same pattern, confirming that the two products were not the results from different individuals. PMID:8900010

  10. LEGO-NMR spectroscopy: a method to visualize individual subunits in large heteromeric complexes.

    PubMed

    Mund, Markus; Overbeck, Jan H; Ullmann, Janina; Sprangers, Remco

    2013-10-18

    Seeing the big picture: Asymmetric macromolecular complexes that are NMR active in only a subset of their subunits can be prepared, thus decreasing NMR spectral complexity. For the hetero heptameric LSm1-7 and LSm2-8 rings NMR spectra of the individual subunits of the complete complex are obtained, showing a conserved RNA binding site. This LEGO-NMR technique makes large asymmetric complexes accessible to detailed NMR spectroscopic studies. © 2013 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA. This is an open access article under the terms of Creative Commons the Attribution Non-Commercial NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non-commercial and no modifications or adaptations are made.

  11. Stopped-flow studies of changes in fluorescence of 8-anilino-1-naphthalene sulfonic acid caused by magnesium and salt binding to yeast enolase.

    PubMed

    Brewer, J M

    1976-12-11

    Stopped-flow studies of magnesium and salt (potassium chloride and acetate) effects on yeast enolase were carried out by following 8-anilino-1-naphthalenesulfonic acid fluorescence changes. The fluorescence changes appear to be largely caused by subunit association and dissociation, though there is evidence in some reactions for large changes in fluorescence occurring within the dead time of the stopped-flow measurements. These data are combined with measurements of initial enzyme activity after incubation in various solvents with or without magnesium to obtain subunit association and dissociation rates. From these, it is concluded that magnesium and the salts act by directly changing the affinities of the subunits for each other, apparently by producing a rapid change in protein conformation.

  12. GABAA receptors: Various stoichiometrics of subunit arrangement in α1β3 and α1β3ε receptors.

    PubMed

    Has, Ahmad Tarmizi Che; Chebib, Mary

    2018-05-15

    GABAA receptors (GABAARs) are members of the Cys-loop ligand-gated ion channel (LGIC) superfamily, which includes nicotinic acetylcholine, glycine, and serotonin (5HT3) receptors [1,2,3,4]. LGICs typically mediate fast synaptic transmission via the movement of ions through channels gated by neurotransmitters, such as acetylcholine for nicotinic receptors and GABA for GABAARs [5]. The term Cys-loop receptors originates from the presence of a conserved disulphide bond (or bridge) which holds together two cysteine amino acids of the loop that forms from the structure of polypeptides in the extracellular domain of the receptor's subunit [6]. GABAARs are pentameric transmembrane protein complexes consisting of five subunits from a variety of polypeptide subunits [7,8]. All of these subunits are pseudo-symmetrically organized in the plane of the membrane, with a Cl--selective channel in the middle of the complex. To date, nineteen GABAAR subunits have been identified and categorized into eight classes, α1-6, β1-3, γ1-3, δ, ε, θ, π and ρ1-3, but their variety is further broadened by the existence of several splice forms for certain subunits (e.g., α6, β2 and γ2) [9,10,11,12]. The subunits within each class have an amino acid sequence homology of 70% or more, whereas those with a sequence homology of 30% or less are grouped into different classes [13,14]. A subunit consists of four transmembrane domains (TM1-TM4), each forming an α-helix; a large extracellular N-terminal domain that incorporates part of the orthosteric agonist/antagonist binding site; a large intracellular loop between the TM3 and TM4; a small intracellular loop between TM1 and TM2; a small extracellular loop between TM2 and TM3; and a C-terminal extracellular domain [15,16]. Each subunit is arranged in such a way as to create principal and complementary interfaces with the other subunits, and in a position such that the TM2 of each subunit forms the wall of the channel pore [17,18,19]. The major subunit combination found in the brain comprises α1, β2 and γ2 subunits with the stoichiometry 2α1:2β2:1γ2 [18,20]. For the GABAA α1β2γ2 receptors, the subunits form a specific arrangement in which α1 and β2 subunits alternate with each other and are connected by a γ2 subunit (Figure A) [16,20,21]. For minor subtypes, different α and β subunits have been detected to co-exist as proven by the existence of GABAARs containing α1α2, α1α3, α1α5, α2α3, α3α5, α4α1, α4α2 and α4α3 in the central nervous system [22,23]. Meanwhile, the same pattern has been detected with β and γ subunits, at least the co-occurrence of β in the same GABAAR as well as γ2 with γ3, indicating that these subunits have the capacity to co-exist with each other [24,25,26]. Since different subunits can actually occur in one receptor, GABAARs are considered to exist in a multi-subunit arrangement, leading to ambiguity in the determination of a receptor's stoichiometry. In this review, we first briefly discuss the different subunit arrangements of α1 and β3 subunits in the binary α1β3 receptors. Then we review the GABAA ε-containing receptors predominantly in terms of the ability of ε subunit to present in different position in the ternary α1β3ε receptors, which introduce distinct populations of receptor. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  13. Use of Trypanosoma equiperdum infected rabbits as a source of splenic mRNA; construction of cDNA clones and identification of a rabbit mu heavy chain clone.

    PubMed

    Bernstein, K E; Pavirani, A; Alexander, C; Jacobsen, F; Fitzmaurice, L; Mage, R

    1983-01-01

    Rabbits were infected by Trypanosoma equiperdum and the splenic mRNA was isolated. In vitro translation of this RNA and immunoprecipitation with anti-light chain, anti-heavy chain, anti-mu and anti-VH antibodies demonstrated that T. equiperdum infection elicits large quantities of splenic mRNA encoding mu and kappa chains. The mu and gamma heavy chains and the kappa light chains synthesized in the cell-free translation system were specifically immunoprecipitated by antisera to heavy chain VHa and light chain kappa b allotypes. In vitro labeling of spleen cells from trypanosome-infected animals demonstrated that the biosynthetically labeled IgM has a mu chain of higher molecular weight than the mu chain synthesized by in vitro translation, a difference that is largely abolished when cellular glycosylation is blocked with the antibiotic tunicamycin. Enrichment for heavy chain or light chain mRNA was achieved by fractionating mRNA from trypanosome-infected animals on a sucrose gradient. cDNA clones carrying mu heavy chain sequences were produced using a 'one tube' protocol and identified by cross species hybridization and hybridization selection. Infection of rabbits with T. equiperdum followed by sucrose gradient enrichment of splenic mRNA has provided sufficient quantities of mRNA encoding mu heavy chain suitable for cDNA cloning.

  14. H and T subunits of acetylcholinesterase from Torpedo, expressed in COS cells, generate all types of globular forms

    PubMed Central

    1992-01-01

    We analyzed the production of Torpedo marmorata acetylcholinesterase (AChE) in transfected COS cells. We report that the presence of an aspartic acid at position 397, homologous to that observed in other cholinesterases and related enzymes (Krejci, E., N. Duval, A. Chatonnet, P. Vincens, and J. Massoulie. 1991. Proc. Natl. Acad. Sci. USA. 88:6647-6651), is necessary for catalytic activity. The presence of an asparagine in the previously reported cDNA sequence (Sikorav, J.L., E. Krejci, and J. Massoulie. 1987. EMBO (Eur. Mol. Biol. Organ.) J. 6:1865-1873) was most likely due to a cloning error (codon AAC instead of GAC). We expressed the T and H subunits of Torpedo AChE, which differ in their COOH-terminal region and correspond respectively to the collagen-tailed asymmetric forms and to glycophosphatidylinositol-anchored dimers of Torpedo electric organs, as well as a truncated T subunit (T delta), lacking most of the COOH- terminal peptide. The transfected cells synthesized similar amounts of AChE immunoreactive protein at 37 degrees and 27 degrees C. However AChE activity was only produced at 27 degrees C and, even at this temperature, only a small proportion of the protein was active. We analyzed the molecular forms of active AChE produced at 27 degrees C. The H polypeptides generated glycophosphatidylinositol-anchored dimers, resembling the corresponding natural AChE form. The cells also released non-amphiphilic dimers G2na. The T polypeptides generated a series of active forms which are not produced in Torpedo electric organs: G1a, G2a, G4a, and G4na cellular forms and G2a and G4na secreted forms. The amphiphilic forms appeared to correspond to type II forms (Bon, S., J. P. Toutant, K. Meflah, and J. Massoulie. 1988. J. Neurochem. 51:776- 785; Bon, S., J. P. Toutant, K. Meflah, and J. Massoulie. 1988. J. Neurochem. 51:786-794), which are abundant in the nervous tissue and muscles of higher vertebrates (Bon, S., T. L. Rosenberry, and J. Massoulie. 1991. Cell. Mol. Neurobiol. 11:157-172). The H and T catalytic subunits are thus sufficient to account for all types of known AChE forms. The truncated T delta subunit yielded only non- amphiphilic monomers, demonstrating the importance of the T COOH- terminal peptide in the formation of oligomers, and in the hydrophobic character of type II forms. PMID:1639848

  15. Implications of High Molecular Divergence of Nuclear rRNA and Phylogenetic Structure for the Dinoflagellate Prorocentrum (Dinophyceae, Prorocentrales).

    PubMed

    Boopathi, Thangavelu; Faria, Daphne Georgina; Cheon, Ju-Yong; Youn, Seok Hyun; Ki, Jang-Seu

    2015-01-01

    The small and large nuclear subunit molecular phylogeny of the genus Prorocentrum demonstrated that the species are dichotomized into two clades. These two clades were significantly different (one-factor ANOVA, p < 0.01) with patterns compatible for both small and large subunit Bayesian phylogenetic trees, and for a larger taxon sampled dinoflagellate phylogeny. Evaluation of the molecular divergence levels showed that intraspecies genetic variations were significantly low (t-test, p < 0.05), than those for interspecies variations (> 2.9% and > 26.8% dissimilarity in the small and large subunit [D1/D2], respectively). Based on the calculated molecular divergence, the genus comprises two genetically distinct groups that should be considered as two separate genera, thereby setting the pace for major systematic changes for the genus Prorocentrum sensu Dodge. Moreover, the information presented in this study would be useful for improving species identification, detection of novel clades from environmental samples. © 2015 The Author(s) Journal of Eukaryotic Microbiology © 2015 International Society of Protistologists.

  16. The Purification of the Chlamydomonas reinhardtii chloroplast ClpP complex: additional subunits and structural features

    PubMed Central

    Derrien, Benoît; Majeran, Wojciech; Effantin, Grégory; Ebenezer, Joseph; Friso, Giulia; van Wijk, Klaas J.; Steven, Alasdair C.; Maurizi, Michael R.; Vallon, Olivier

    2012-01-01

    The ClpP peptidase is a major constituent of the proteolytic machinery of bacteria and organelles. The chloroplast ClpP complex is unusual, in that it associates a large number of subunits, one of which (ClpP1) is encoded in the chloroplast, the others in the nucleus. The complexity of these large hetero-oligomeric complexes has been a major difficulty in their overproduction and biochemical characterization. In this paper, we describe the purification of native chloroplast ClpP complex from the green alga Chlamydomonas reinhardtii, using a strain that carries the Strep-tag II at the C-terminus of the ClpP1 subunit. Similar to land plants, the algal complex comprises active and inactive subunits (3 ClpP and 5 ClpR, respectively). Evidence is presented that a sub-complex can be produced by dissociation, comprising ClpP1 and ClpR1, 2, 3 and 4, similar to the ClpR-ring described in land plants. Our Chlamydomonas ClpP preparation also contains two ClpT subunits, ClpT3 and ClpT4, which like the land plant ClpT1 and ClpT2 show 2 Clp-N domains. ClpTs are believed to function in substrate binding and/or assembly of the two heptameric rings. Phylogenetic analysis indicates that ClpT subunits have appeared independently in Chlorophycean algae, in land plants and in dispersed cyanobacterial genomes. Negative staining electron microscopy shows that the Chlamydomonas complex retains the barrel-like shape of homo-oligomeric ClpPs, with 4 additional peripheral masses that we speculate represent either the additional IS1 domain of ClpP1 (a feature unique to algae) or ClpTs or extensions of ClpR subunits PMID:22772861

  17. The Relative Abundance and Transcriptional Activity of Marine Sponge-Associated Microorganisms Emphasizing Groups Involved in Sulfur Cycle.

    PubMed

    Jensen, Sigmund; Fortunato, Sofia A V; Hoffmann, Friederike; Hoem, Solveig; Rapp, Hans Tore; Øvreås, Lise; Torsvik, Vigdis L

    2017-04-01

    During the last decades, our knowledge about the activity of sponge-associated microorganisms and their contribution to biogeochemical cycling has gradually increased. Functional groups involved in carbon and nitrogen metabolism are well documented, whereas knowledge about microorganisms involved in the sulfur cycle is still limited. Both sulfate reduction and sulfide oxidation has been detected in the cold water sponge Geodia barretti from Korsfjord in Norway, and with specimens from this site, the present study aims to identify extant versus active sponge-associated microbiota with focus on sulfur metabolism. Comparative analysis of small subunit ribosomal RNA (16S rRNA) gene (DNA) and transcript (complementary DNA (cDNA)) libraries revealed profound differences. The transcript library was predominated by Chloroflexi despite their low abundance in the gene library. An opposite result was found for Acidobacteria. Proteobacteria were detected in both libraries with representatives of the Alpha- and Gammaproteobacteria related to clades with presumably thiotrophic bacteria from sponges and other marine invertebrates. Sequences that clustered with sponge-associated Deltaproteobacteria were remotely related to cultivated sulfate-reducing bacteria. The microbes involved in sulfur cycling were identified by the functional gene aprA (adenosine-5'-phosphosulfate reductase) and its transcript. Of the aprA sequences (DNA and cDNA), 87 % affiliated with sulfur-oxidizing bacteria. They clustered with Alphaproteobacteria and with clades of deep-branching Gammaproteobacteria. The remaining sequences clustered with sulfate-reducing Archaea of the phylum Euryarchaeota. These results indicate an active role of yet uncharacterized Bacteria and Archaea in the sponge's sulfur cycle.

  18. Troponin T3 regulates nuclear localization of the calcium channel Ca{sub v}β{sub 1a} subunit in skeletal muscle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Zhang, Tan; Taylor, Jackson; Jiang, Yang

    The voltage-gated calcium channel (Ca{sub v}) β{sub 1a} subunit (Ca{sub v}β{sub 1a}) plays an important role in excitation–contraction coupling (ECC), a process in the myoplasm that leads to muscle-force generation. Recently, we discovered that the Ca{sub v}β{sub 1a} subunit travels to the nucleus of skeletal muscle cells where it helps to regulate gene transcription. To determine how it travels to the nucleus, we performed a yeast two-hybrid screening of the mouse fast skeletal muscle cDNA library and identified an interaction with troponin T3 (TnT3), which we subsequently confirmed by co-immunoprecipitation and co-localization assays in mouse skeletal muscle in vivo andmore » in cultured C2C12 muscle cells. Interacting domains were mapped to the leucine zipper domain in TnT3 COOH-terminus (160–244 aa) and Ca{sub v}β{sub 1a} NH{sub 2}-terminus (1–99 aa), respectively. The double fluorescence assay in C2C12 cells co-expressing TnT3/DsRed and Ca{sub v}β{sub 1a}/YFP shows that TnT3 facilitates Ca{sub v}β{sub 1a} nuclear recruitment, suggesting that the two proteins play a heretofore unknown role during early muscle differentiation in addition to their classical role in ECC regulation. - Highlights: • Previously, we demonstrated that Ca{sub v}β{sub 1a} is a gene transcription regulator. • Here, we show that TnT3 interacts with Ca{sub v}β{sub 1a}. • We mapped TnT3 and Ca{sub v}β{sub 1a} interaction domain. • TnT3 facilitates Ca{sub v}β{sub 1a} nuclear enrichment. • The two proteins play a heretofore unknown role during early muscle differentiation.« less

  19. Biochemical and molecular characterization of the calcineurin in Echinococcus granulosus larval stages.

    PubMed

    Nicolao, María Celeste; Cumino, Andrea C

    2015-06-01

    Calcineurin (CaN) is a Ca(2+)-calmodulin activated serine-threonine protein phosphatase that couples the local or global calcium signals, thus controlling important cellular functions in physiological and developmental processes. The aim of this study was to characterize CaN in Echinococcus granulosus (Eg-CaN), a human cestode parasite of clinical importance, both functionally and molecularly. We found that the catalytic subunit isoforms have predicted sequences of 613 and 557 amino acids and are substantially similar to those of the human counterpart, except for the C-terminal end. We also found that the regulatory subunit consists of 169 amino acids which are 87% identical to the human ortholog. We cloned a cDNA encoding for one of the two catalytic subunit isoforms of CaN (Eg-can-A1) as well as the only copy of the Eg-can-B gene, both constitutively transcribed in all Echinococcus larval stages and responsible for generating a functionally active heterodimer. Eg-CaN native enzyme has phosphatase activity, which is enhanced by Ca(2+)/Ni(2+) and reduced by cyclosporine A and Ca(2+) chelators. Participation of Eg-CaN in exocytosis was demonstrated using the FM4-64 probe and Eg-CaN-A was immunolocalized in the cytoplasm of tegumental cells, suckers and excretory bladder of protoscoleces. We also showed that the Eg-can-B transcripts were down-regulated in response to low Ca(2+) intracellular level, in agreement with decreased enzyme activity. Confocal microscopy revealed a striking pattern of Eg-CaN-A in discrete fluorescent spots in the protoscolex posterior bladder and vesicularized protoscoleces beginning the vesicular differentiation. In contrast, Eg-CaN-A was undetectable during the pre-microcyst closing stage while a high DDX-like RNA helicase expression was evidenced. Finally, we identified and analyzed the expression of CaN-related endogenous regulators. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Mutations in COA3 cause isolated complex IV deficiency associated with neuropathy, exercise intolerance, obesity, and short stature.

    PubMed

    Ostergaard, Elsebet; Weraarpachai, Woranontee; Ravn, Kirstine; Born, Alfred Peter; Jønson, Lars; Duno, Morten; Wibrand, Flemming; Shoubridge, Eric A; Vissing, John

    2015-03-01

    We investigated a subject with an isolated cytochrome c oxidase (COX) deficiency presenting with an unusual phenotype characterised by neuropathy, exercise intolerance, obesity, and short stature. Blue-native polyacrylamide gel electrophoresis (BN-PAGE) analysis showed an almost complete lack of COX assembly in subject fibroblasts, consistent with the very low enzymatic activity, and pulse-labelling mitochondrial translation experiments showed a specific decrease in synthesis of the COX1 subunit, the core catalytic subunit that nucleates assembly of the holoenzyme. Whole exome sequencing identified compound heterozygous mutations (c.199dupC, c.215A>G) in COA3, a small inner membrane COX assembly factor, resulting in a pronounced decrease in the steady-state levels of COA3 protein. Retroviral expression of a wild-type COA3 cDNA completely rescued the COX assembly and mitochondrial translation defects, confirming the pathogenicity of the mutations, and resulted in increased steady-state levels of COX1 in control cells, demonstrating a role for COA3 in the stabilisation of this subunit. COA3 exists in an early COX assembly complex that contains COX1 and other COX assembly factors including COX14 (C12orf62), another single pass transmembrane protein that also plays a role in coupling COX1 synthesis with holoenzyme assembly. Immunoblot analysis showed that COX14 was undetectable in COA3 subject fibroblasts, and that COA3 was undetectable in fibroblasts from a COX14 subject, demonstrating the interdependence of these two COX assembly factors. The mild clinical course in this patient contrasts with nearly all other cases of severe COX assembly defects that are usually fatal early in life, and underscores the marked tissue-specific involvement in mitochondrial diseases. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  1. ScMED7, a sugarcane mediator subunit gene, acts as a regulator of plant immunity and is responsive to diverse stress and hormone treatments.

    PubMed

    Zhang, Xu; Yang, Yuting; Zou, Jiake; Chen, Yun; Wu, Qibin; Guo, Jinlong; Que, Youxiong; Xu, Liping

    2017-12-01

    The Mediator complex, is an essential component of the RNA polymerase II general transcriptional machinery in eukaryotes. Mediator subunit 7 (MED7), a key subunit in the central module of this complex, plays an important role in gene transcriptional regulation. The present study isolated the full-length cDNA of the MED7 gene of sugarcane, hereby designated as ScMED7, which was characterized to harbor a 525-bp open reading frame that is predicted to encode a 174-amino acid protein with a molecular mass of 19.9 kDa and was localized to the nucleus and cytoplasm. ScMED7 contains one typical conserved domain of MED7 proteins and shares 98% homology with that from Sorghum bicolor (XP_002447862.1). ScMED7 was constitutively expressed, yet significantly higher in bud tissues. ScMED7 transcription was obviously induced by heavy metal (CdCl 2 ), low temperature (4 °C), and hormone (SA and MeJA) treatments, while inhibited by osmotic stresses of NaCl and PEG. The role of ScMED7 in plant immunity was demonstrated by transient overexpression in tobacco, which in turn induces the expression of six out of nine defense-related marker genes, including all the three hypersensitive response genes. The responses of defense-related marker genes in the mock and in the ScMED7 transiently overexpressed leaves challenged by pathogenic Pseudomonas solanacearum and Fusarium solani var. coeruleum suggest that ScMED7 acts as a negative regulator during pathogen infections, whereas only fungal infection was clearly phenotypically expressed. In sum, ScMED7 plays an important role in modulating sugarcane responses to biotic and abiotic stresses, and may have dual roles in hypersensitive responses and basal defense against pathogens.

  2. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Petroulakis, E.; Cao, Z.; Salo, T.

    Mutations in the HEXA gene that encodes the {alpha}-subunit of the heterodimeric lysosomal enzyme {beta}-hexosaminidase A, or Hex A ({alpha}{beta}), cause G{sub M2} gangliosidosis, type 1. The infantile form (Tay-Sachs disease) results when there is no residual Hex A activity, while less severe and more variable clinical phenotypes result when residual Hex A activity is present. A non-Jewish male who presented with an acute psychotic episode at age 16 was diagnosed with a subacute encephalopathic form of G{sub M2} gangliosidosis. At age 19, chronic psychosis with intermittent acute exacerbations remains the most disabling symptom in this patient and his affectedmore » brother although both exhibit some ataxia and moderately severe dysarthria. We have found a 4 bp insertion (+TATC 1278) associated with infantile Tay-Sachs disease on one allele; no previously identified mutation was found on the second allele. SSCP analysis detected a shift in exon 13 and sequencing revealed a G1422C mutation in the second allele that results in a Trp474Cys substitution. The presence of the mutation was confirmed by the loss of HaeIII and ScrFI sites in exon 13 PCR products from the subjects and their father. The mutation was introduced into the {alpha}-subunit cDNA and Hex S ({alpha}{alpha}) and Hex A ({alpha}{beta}) were transiently expressed in monkey COS-7 cells. The Trp474Cys mutant protein had approximately 5% and 12% of wild-type Hex S and Hex A activity, respectively. Western blot analysis revealed a small amount of residual mature {alpha}-subunit and a normal level of precursor protein. We conclude that the Trp474Cys mutation is the cause of the Hex A deficiency associated with a subacute (juvenile-onset) phenotype in this patient. Like other mutations in exon 13 of HEXA, it appears to affect intracellular processing. Studies of the defect in intracellular processing are in progress.« less

  3. Did Androgen-Binding Protein Paralogs Undergo Neo- and/or Subfunctionalization as the Abp Gene Region Expanded in the Mouse Genome?

    PubMed Central

    Karn, Robert C.; Chung, Amanda G.; Laukaitis, Christina M.

    2014-01-01

    The Androgen-binding protein (Abp) region of the mouse genome contains 30 Abpa genes encoding alpha subunits and 34 Abpbg genes encoding betagamma subunits, their products forming dimers composed of an alpha and a betagamma subunit. We endeavored to determine how many Abp genes are expressed as proteins in tears and saliva, and as transcripts in the exocrine glands producing them. Using standard PCR, we amplified Abp transcripts from cDNA libraries of C57BL/6 mice and found fifteen Abp gene transcripts in the lacrimal gland and five in the submandibular gland. Proteomic analyses identified proteins corresponding to eleven of the lacrimal gland transcripts, all of them different from the three salivary ABPs reported previously. Our qPCR results showed that five of the six transcripts that lacked corresponding proteins are expressed at very low levels compared to those transcripts with proteins. We found 1) no overlap in the repertoires of expressed Abp paralogs in lacrimal gland/tears and salivary glands/saliva; 2) substantial sex-limited expression of lacrimal gland/tear expressed-paralogs in males but no sex-limited expression in females; and 3) that the lacrimal gland/tear expressed-paralogs are found exclusively in ancestral clades 1, 2 and 3 of the five clades described previously while the salivary glands/saliva expressed-paralogs are found only in clade 5. The number of instances of extremely low levels of transcription without corresponding protein production in paralogs specific to tears and saliva suggested the role of subfunctionalization, a derived condition wherein genes that may have been expressed highly in both glands ancestrally were down-regulated subsequent to duplication. Thus, evidence for subfunctionalization can be seen in our data and we argue that the partitioning of paralog expression between lacrimal and salivary glands that we report here occurred as the result of adaptive evolution. PMID:25531410

  4. Did androgen-binding protein paralogs undergo neo- and/or Subfunctionalization as the Abp gene region expanded in the mouse genome?

    PubMed

    Karn, Robert C; Chung, Amanda G; Laukaitis, Christina M

    2014-01-01

    The Androgen-binding protein (Abp) region of the mouse genome contains 30 Abpa genes encoding alpha subunits and 34 Abpbg genes encoding betagamma subunits, their products forming dimers composed of an alpha and a betagamma subunit. We endeavored to determine how many Abp genes are expressed as proteins in tears and saliva, and as transcripts in the exocrine glands producing them. Using standard PCR, we amplified Abp transcripts from cDNA libraries of C57BL/6 mice and found fifteen Abp gene transcripts in the lacrimal gland and five in the submandibular gland. Proteomic analyses identified proteins corresponding to eleven of the lacrimal gland transcripts, all of them different from the three salivary ABPs reported previously. Our qPCR results showed that five of the six transcripts that lacked corresponding proteins are expressed at very low levels compared to those transcripts with proteins. We found 1) no overlap in the repertoires of expressed Abp paralogs in lacrimal gland/tears and salivary glands/saliva; 2) substantial sex-limited expression of lacrimal gland/tear expressed-paralogs in males but no sex-limited expression in females; and 3) that the lacrimal gland/tear expressed-paralogs are found exclusively in ancestral clades 1, 2 and 3 of the five clades described previously while the salivary glands/saliva expressed-paralogs are found only in clade 5. The number of instances of extremely low levels of transcription without corresponding protein production in paralogs specific to tears and saliva suggested the role of subfunctionalization, a derived condition wherein genes that may have been expressed highly in both glands ancestrally were down-regulated subsequent to duplication. Thus, evidence for subfunctionalization can be seen in our data and we argue that the partitioning of paralog expression between lacrimal and salivary glands that we report here occurred as the result of adaptive evolution.

  5. Characterization and Expression Pattern Analysis of the T-Complex Protein-1 Zeta Subunit in Musca domestica L (Diptera).

    PubMed

    Zhao, Xuejun; Xiu, Jiangfan; Li, Yan; Ma, Huiling; Wu, Jianwei; Wang, Bo; Guo, Guo

    2017-07-01

    Chaperonins, belonging to the T-complex protein-1 (TCP-1) family, assist in the correct folding of nascent and misfolded proteins. It is well-known that in mammals, the zeta subunit of the TCP-1 complex (TCP-1ζ) plays a vital role in the folding and assembly of cytoskeleta proteins. This study reported for the first time the cloning, characterization and expression pattern analysis of the TCP-1ζ from Musca domestica, which was named as MdTCP-1ζ. The MdTCP-1ζ cDNA is 1,803 bp long with a 1,596 bp open reading frame that encodes a protein with 531 bp amino acids. The analysis of the transcriptional profile of MdTCP-1ζ using qRT-PCR revealed relatively high expression in the salivary glands and trachea at the tissues while among the developmental stages. The highest expression was observed only in the eggs suggesting that the MdTCP-1ζ may play a role in embryonic development. The expression of MdTCP-1ζ was also significantly induced after exposure to short-term heat shock and infection by Escherichia coli, Staphylococcus aureus, or Candida albicans. This suggested that MdTCP-1ζ may take part in the immune responses of housefly and perhaps contribute to the protection against cellular injury. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  6. Overexpression of StNF-YB3.1 reduces photosynthetic capacity and tuber production, and promotes ABA-mediated stomatal closure in potato (Solanum tuberosum L.).

    PubMed

    Xuanyuan, Guochao; Lu, Congming; Zhang, Ruofang; Jiang, Jiming

    2017-08-01

    Nuclear factor Y (NF-Y) is one of the most ubiquitous transcription factors (TFs), comprising NF-YA, NF-YB and NF-YC subunits, and has been identified and reported in various aspects of development for plants and animals. In this work, StNF-YB3.1, a putative potato NF-YB subunit encoding gene, was isolated from Solanum tuberosum by rapid amplification of cDNA ends (RACE). Overexpression of StNF-YB3.1 in potato (cv. Atlantic) resulted in accelerated onset of flowering, and significant increase in leaf chlorophyll content in field trials. However, transgenic potato plants overexpressing StNF-YB3.1 (OEYB3.1) showed significant decreases in photosynthetic rate and stomatal conductance both at tuber initiation and bulking stages. OEYB3.1 lines were associated with significantly fewer tuber numbers and yield reduction. Guard cell size and stomatal density were not changed in OEYB3.1 plants, whereas ABA-mediated stomatal closure was accelerated compared to that of wild type plants because of the up-regulation of genes for ABA signaling, such as StCPK10-like, StSnRK2.6/OST1-like, StSnRK2.7-like and StSLAC1-like. We speculate that the acceleration of stomatal closure was a possible reason for the significantly decreased stomatal conductance and photosynthetic rate. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Synthesis of prolyl 4-hydroxylase alpha subunit and type IV collagen in hemocytic granular cells of silkworm, Bombyx mori: Involvement of type IV collagen in self-defense reaction and metamorphosis.

    PubMed

    Adachi, Takahiro; Tomita, Masahiro; Yoshizato, Katsutoshi

    2005-04-01

    The present study shows that hemocytic granular cells synthesize and secrete type IV collagen (ColIV) in the silkworm Bombyx mori (B. mori) and suggests that these cells play roles in the formation of basement membrane, the encapsulation of foreign bodies, and the metamorphic remodeling of the gut. The full- and partial-length cDNA of B. mori prolyl 4-hydroxylase alpha subunit (BmP4Halpha) and B. mori ColIV (BmColIV) were cloned, respectively. In situ hybridization and immunocytochemistry on larval tissues and cells identified hemocytic granular cells as the cells that express mRNAs and proteins of both BmP4Halpha and BmColIV. Immunohistochemistry and immunocytochemistry demonstrated that BmColIV was present in the basement membrane and in the secretory granules of granular cells, respectively. Granular cells in culture secreted BmColIV without accompanying the degranulation and discharged it from the granules when the cells were degranulated. Nylon threads were inserted into the hemocoel of larvae. Granular cells concentrated around the nylon threads and encapsulated them as a self-defense reaction. BmColIV was found to be a component of the capsules. Furthermore, the present study showed that actively BmColIV-expressing granular cells accumulated around the midgut epithelium and formed BmColIV-rich thick basal lamina-like structures there in larval to pupal metamorphosis.

  8. Vacuolar H+-ATPase Is Expressed in Response to Gibberellin during Tomato Seed Germination1

    PubMed Central

    Cooley, Michael B.; Yang, Hong; Dahal, Peetambar; Mella, R. Alejandra; Downie, A. Bruce; Haigh, Anthony M.; Bradford, Kent J.

    1999-01-01

    Completion of germination (radicle emergence) by gibberellin (GA)-deficient (gib-1) mutant tomato (Lycopersicon esculentum Mill.) seeds is dependent upon exogenous GA, because weakening of the endosperm tissue enclosing the radicle tip requires GA. To investigate genes that may be involved in endosperm weakening or embryo growth, differential cDNA display was used to identify mRNAs differentially expressed in gib-1 seeds imbibed in the presence or absence of GA4+7. Among these was a GA-responsive mRNA encoding the 16-kD hydrophobic subunit c of the V0 membrane sector of vacuolar H+-translocating ATPases (V-ATPase), which we termed LVA-P1. LVA-P1 mRNA expression in gib-1 seeds was dependent on GA and was particularly abundant in the micropylar region prior to radicle emergence. Both GA dependence and tissue localization of LVA-P1 mRNA expression were confirmed directly in individual gib-1 seeds using tissue printing. LVA-P1 mRNA was also expressed in wild-type seeds during development and germination, independent of exogenous GA. Specific antisera detected protein subunits A and B of the cytoplasmic V1 sector of the V-ATPase holoenzyme complex in gib-1 seeds only in the presence of GA, and expression was localized to the micropylar region. The results suggest that V-ATPase plays a role in GA-regulated germination of tomato seeds. PMID:10594121

  9. Patterns of gene expression in atrophying skeletal muscles: response to food deprivation

    NASA Technical Reports Server (NTRS)

    Jagoe, R. Thomas; Lecker, Stewart H.; Gomes, Marcelo; Goldberg, Alfred L.

    2002-01-01

    During fasting and many systemic diseases, muscle undergoes rapid loss of protein and functional capacity. To define the transcriptional changes triggering muscle atrophy and energy conservation in fasting, we used cDNA microarrays to compare mRNAs from muscles of control and food-deprived mice. Expression of >94% of genes did not change, but interesting patterns emerged among genes that were differentially expressed: 1) mRNAs encoding polyubiquitin, ubiquitin extension proteins, and many (but not all) proteasome subunits increased, which presumably contributes to accelerated protein breakdown; 2) a dramatic increase in mRNA for the ubiquitin ligase, atrogin-1, but not most E3s; 3) a significant suppression of mRNA for myosin binding protein H (but not other myofibrillar proteins) and IGF binding protein 5, which may favor cell protein loss; 4) decreases in mRNAs for several glycolytic enzymes and phosphorylase kinase subunits, and dramatic increases in mRNAs for pyruvate dehydrogenase kinase 4 and glutamine synthase, which should promote glucose sparing and gluconeogenesis. During fasting, metallothionein mRNA increased dramatically, mRNAs for extracellular matrix components fell, and mRNAs that may favor cap-independent mRNA translation rose. Significant changes occurred in mRNAs for many growth-related proteins and transcriptional regulators. These transcriptional changes indicate a complex adaptive program that should favor protein degradation and suppress glucose oxidation in muscle. Similar analysis of muscles atrophying for other causes is allowing us to identify a set of atrophy-specific changes in gene expression.

  10. Cloning and Immunocytochemical Localization of a Cyclic Nucleotide–Gated Channel α-Subunit to All Cone Photoreceptors in the Mouse Retina

    PubMed Central

    HIRANO, ARLENE A.; HACK, IRIS; WÄSSLE, HEINZ; DUVOISIN, ROBERT M.

    2010-01-01

    Cyclic nucleotide–gated channels (CNGC) are ligand-gated ion channels that open and close in response to changes in the intracellular concentration of the second messengers, 3′,5′-cyclic adenosine monophosphate and 3′,5′-cyclic guanosine monophosphate. Most notably, they transduce the chemical signal produced by the absorption of light in photoreceptors into a membrane potential change, which is then transmitted to the ascending visual pathway. CNGCs have also been implicated in the signal transduction of other neurons downstream of the photoreceptors, in particular the ON-bipolar cells, as well as in other areas of the central nervous system. We therefore undertook a search for additional cyclic nucleotide–gated channels expressed in the retina. Following a degenerate reverse transcription polymerase chain reaction approach to amplify low-copy number messages, a cDNA encoding a new splice variant of CNGC α-subunit was isolated from mouse retina and classified as mCNG3. An antiserum raised against the carboxy-terminal sequence identified the retinal cell type expressing mCNG3 as cone photoreceptors. Preembedding immunoelectron microscopy demonstrated its membrane localization in the outer segments, consistent with its role in phototransduction. Double-labeling experiments with cone-specific markers indicated that all cone photoreceptors in the murid retina use the same or a highly conserved cyclic nucleotide–gated channel. Therefore, defects in this channel would be predicted to severely impair photopic vision. PMID:10813773

  11. Complementary DNA libraries: an overview.

    PubMed

    Ying, Shao-Yao

    2004-07-01

    The generation of complete and full-length cDNA libraries for potential functional assays of specific gene sequences is essential for most molecules in biotechnology and biomedical research. The field of cDNA library generation has changed rapidly in the past 10 yr. This review presents an overview of the method available for the basic information of generating cDNA libraries, including the definition of the cDNA library, different kinds of cDNA libraries, difference between methods for cDNA library generation using conventional approaches and a novel strategy, and the quality of cDNA libraries. It is anticipated that the high-quality cDNA libraries so generated would facilitate studies involving genechips and the microarray, differential display, subtractive hybridization, gene cloning, and peptide library generation.

  12. Preparation of fluorescent-dye-labeled cDNA from RNA for microarray hybridization.

    PubMed

    Ares, Manuel

    2014-01-01

    This protocol describes how to prepare fluorescently labeled cDNA for hybridization to microarrays. It consists of two steps: first, a mixture of anchored oligo(dT) and random hexamers is used to prime amine-modified cDNA synthesis by reverse transcriptase using a modified deoxynucleotide with a reactive amine group (aminoallyl-dUTP) and an RNA sample as a template. Second, the cDNA is purified and exchanged into bicarbonate buffer so that the amine groups in the cDNA react with the dye N-hydroxysuccinimide (NHS) esters, covalently joining the dye to the cDNA. The dye-coupled cDNA is purified again, and the amount of dye incorporated per microgram of cDNA is determined.

  13. Conopeptide Vt3.1 preferentially inhibits BK potassium channels containing β4 subunits via electrostatic interactions.

    PubMed

    Li, Min; Chang, Shan; Yang, Longjin; Shi, Jingyi; McFarland, Kelli; Yang, Xiao; Moller, Alyssa; Wang, Chunguang; Zou, Xiaoqin; Chi, Chengwu; Cui, Jianmin

    2014-02-21

    BK channel β subunits (β1-β4) modulate the function of channels formed by slo1 subunits to produce tissue-specific phenotypes. The molecular mechanism of how the homologous β subunits differentially alter BK channel functions and the role of different BK channel functions in various physiologic processes remain unclear. By studying channels expressed in Xenopus laevis oocytes, we show a novel disulfide-cross-linked dimer conopeptide, Vt3.1 that preferentially inhibits BK channels containing the β4 subunit, which is most abundantly expressed in brain and important for neuronal functions. Vt3.1 inhibits the currents by a maximum of 71%, shifts the G-V relation by 45 mV approximately half-saturation concentrations, and alters both open and closed time of single channel activities, indicating that the toxin alters voltage dependence of the channel. Vt3.1 contains basic residues and inhibits voltage-dependent activation by electrostatic interactions with acidic residues in the extracellular loops of the slo1 and β4 subunits. These results suggest a large interaction surface between the slo1 subunit of BK channels and the β4 subunit, providing structural insight into the molecular interactions between slo1 and β4 subunits. The results also suggest that Vt3.1 is an excellent tool for studying β subunit modulation of BK channels and for understanding the physiological roles of BK channels in neurophysiology.

  14. Subunit architecture and functional modular rearrangements of the transcriptional Mediator complex

    PubMed Central

    Tsai, Kuang-Lei; Tomomori-Sato, Chieri; Sato, Shigeo; Conaway, Ronald C.; Conaway, Joan W.; Asturias, Francisco J.

    2014-01-01

    SUMMARY The multisubunit Mediator comprising ~30 distinct proteins, plays an essential role in gene expression regulation by acting as a bridge between DNA binding transcription factors and the RNA polymerase II (RNAPII) transcription machinery. Efforts to uncover the Mediator mechanism have been hindered by a poor understanding of its structure, subunit organization, and conformational rearrangements. By overcoming biochemical and image analysis hurdles, we obtained accurate EM structures of yeast and human Mediators. Subunit localization experiments, docking of partial X-ray structures, and biochemical analyses resulted in comprehensive mapping of yeast Mediator subunits and a complete reinterpretation of our previous Mediator organization model. Large-scale Mediator rearrangements depend on changes at the interfaces between previously described Mediator modules, which appear to be facilitated by factors conducive to transcription initiation. Conservation across eukaryotes of Mediator structure, subunit organization, and RNA polymerase II interaction suggest conservation of fundamental aspects of the Mediator mechanism. PMID:24882805

  15. Intramolecular electron transport in quinoprotein alcohol dehydrogenase of Acetobacter methanolicus: a redox-titration study

    PubMed

    Frébortova; Matsushita; Arata; Adachi

    1998-01-27

    Quinohemoprotein-cytochrome c complex alcohol dehydrogenase (ADH) of acetic acid bacteria consists of three subunits, of which subunit I contains pyrroloquinoline quinone (PQQ) and heme c, and subunit II contains three heme c components. The PQQ and heme c components are believed to be involved in the intramolecular electron transfer from ethanol to ubiquinone. To study the intramolecular electron transfer in ADH of Acetobacter methanolicus, the redox potentials of heme c components were determined with ADH complex and the isolated subunits I and II of A. methanolicus, as well as hybrid ADH consisting of the subunit I/III complex of Gluconobacter suboxydans ADH and subunit II of A. methanolicus ADH. The redox potentials of hemes c in ADH complex were -130, 49, 188, and 188 mV at pH 7.0 and 24, 187, 190, and 255 mV at pH 4.5. In hybrid ADH, one of these heme c components was largely changed in the redox potential. Reduced ADH was fully oxidized with potassium ferricyanide, while ubiquinone oxidized the enzyme partially. The results indicate that electrons extracted from ethanol at PQQ site are transferred to ubiquinone via heme c in subunit I and two of the three hemes c in subunit II. Copyright 1998 Elsevier Science B.V.

  16. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, Marcelo Bento; Bonaldo, Maria de Fatima

    1998-01-01

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

  17. Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

    DOEpatents

    Soares, M.B.; Fatima Bonaldo, M. de

    1998-12-08

    This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

  18. Comparison of cloned Kir2 channels with native inward rectifier K+ channels from guinea-pig cardiomyocytes

    PubMed Central

    Xin Liu, Gong; Derst, Christian; Schlichthörl, Günter; Heinen, Steffen; Seebohm, Guiscard; Brüggemann, Andrea; Kummer, Wolfgang; Veh, Rüdiger W; Daut, Jürgen; Preisig-Müller, Regina

    2001-01-01

    The aim of the study was to compare the properties of cloned Kir2 channels with the properties of native rectifier channels in guinea-pig (gp) cardiac muscle. The cDNAs of gpKir2.1, gpKir2.2, gpKir2.3 and gpKir2.4 were obtained by screening a cDNA library from guinea-pig cardiac ventricle. A partial genomic structure of all gpKir2 genes was deduced by comparison of the cDNAs with the nucleotide sequences derived from a guinea-pig genomic library. The cell-specific expression of Kir2 channel subunits was studied in isolated cardiomyocytes using a multi-cell RT-PCR approach. It was found that gpKir2.1, gpKir2.2 and gpKir2.3, but not gpKir2.4, are expressed in cardiomyocytes. Immunocytochemical analysis with polyclonal antibodies showed that expression of Kir2.4 is restricted to neuronal cells in the heart. After transfection in human embryonic kidney cells (HEK293) the mean single-channel conductance with symmetrical K+ was found to be 30.6 pS for gpKir2.1, 40.0 pS for gpKir2.2 and 14.2 pS for Kir2.3. Cell-attached measurements in isolated guinea-pig cardiomyocytes (n = 351) revealed three populations of inwardly rectifying K+ channels with mean conductances of 34.0, 23.8 and 10.7 pS. Expression of the gpKir2 subunits in Xenopus oocytes showed inwardly rectifying currents. The Ba2+ concentrations required for half-maximum block at -100 mV were 3.24 μm for gpKir2.1, 0.51 μm for gpKir2.2, 10.26 μm for gpKir2.3 and 235 μm for gpKir2.4. Ba2+ block of inward rectifier channels of cardiomyocytes was studied in cell-attached recordings. The concentration and voltage dependence of Ba2+ block of the large-conductance inward rectifier channels was virtually identical to that of gpKir2.2 expressed in Xenopus oocytes. Our results suggest that the large-conductance inward rectifier channels found in guinea-pig cardiomyocytes (34.0 pS) correspond to gpKir2.2. The intermediate-conductance (23.8 pS) and low-conductance (10.7 pS) channels described here may correspond to gpKir2.1 and gpKir2.3, respectively. PMID:11283229

  19. Cloning and characterization of a basic phospholipase A2 homologue from Micrurus corallinus (coral snake) venom gland.

    PubMed

    de Oliveira, Ursula Castro; Assui, Alessandra; da Silva, Alvaro Rossan de Brandão Prieto; de Oliveira, Jane Silveira; Ho, Paulo Lee

    2003-09-01

    During the cloning of abundant cDNAs expressed in the Micrurus corallinus coral snake venom gland, several putative toxins, including a phospholipase A2 homologue cDNA (clone V2), were identified. The V2 cDNA clone codes for a potential coral snake toxin with a signal peptide of 27 amino acid residues plus a predicted mature protein with 119 amino acid residues. The deduced protein is highly similar to known phospholipases A2, with seven deduced S-S bridges at the same conserved positions. This protein was expressed in Escherichia coli as a His-tagged protein that allowed the rapid purification of the recombinant protein. This protein was used to generate antibodies, which recognized the recombinant protein in Western blot. This antiserum was used to screen a large number of venoms, showing a ubiquitous distribution of immunorelated proteins in all elapidic venoms but not in the viperidic Bothrops jararaca venom. This is the first description of a complete primary structure of a phospholipase A2 homologue deduced by cDNA cloning from a coral snake.

  20. Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes

    PubMed Central

    Shiroguchi, Katsuyuki; Jia, Tony Z.; Sims, Peter A.; Xie, X. Sunney

    2012-01-01

    RNA sequencing (RNA-Seq) is a powerful tool for transcriptome profiling, but is hampered by sequence-dependent bias and inaccuracy at low copy numbers intrinsic to exponential PCR amplification. We developed a simple strategy for mitigating these complications, allowing truly digital RNA-Seq. Following reverse transcription, a large set of barcode sequences is added in excess, and nearly every cDNA molecule is uniquely labeled by random attachment of barcode sequences to both ends. After PCR, we applied paired-end deep sequencing to read the two barcodes and cDNA sequences. Rather than counting the number of reads, RNA abundance is measured based on the number of unique barcode sequences observed for a given cDNA sequence. We optimized the barcodes to be unambiguously identifiable, even in the presence of multiple sequencing errors. This method allows counting with single-copy resolution despite sequence-dependent bias and PCR-amplification noise, and is analogous to digital PCR but amendable to quantifying a whole transcriptome. We demonstrated transcriptome profiling of Escherichia coli with more accurate and reproducible quantification than conventional RNA-Seq. PMID:22232676

  1. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Schlagnhaufer, C.D.; Arteca, R.N.; Pell, E.J.

    When potato plants (Solanum tuberosum L. cv Norland) are subjected to oxone stress ethylene is emitted. Increases in ethylene production are often the result of increased expression of the enzyme ACC synthase. We used the polymerase chain reaction (PCR) to clone a cDNA encoding an ozone-induced ACC synthase. After treating potato plants with 300 ppb ozone for 4 h, RNA was extracted using a guanidinium isothiocyanate method. Using degenerate oligonucleotides corresponding to several conserved regions of ACC synthase sequences reported from different plant tissues as primers, we were able to reverse transcribe the RNA and amplify a cDNA for ACCmore » synthase. The clone is 1098 bp in length encoding for 386 amino acids comprising [approximately]80% of the protein. Computer analysis of the deduced amino acid sequence showed that our clone is 50-70% homologous with ACC synthase genes cloned from other plant tissues. Using the cDNA as a probe in northern analysis we found that there is little or no expression in control tissue: however there is a large increase in the expression of the ACC synthase message in response to ozone treatment.« less

  2. Characterization of full-length sequenced cDNA inserts (FLIcs) from Atlantic salmon (Salmo salar)

    PubMed Central

    Andreassen, Rune; Lunner, Sigbjørn; Høyheim, Bjørn

    2009-01-01

    Background Sequencing of the Atlantic salmon genome is now being planned by an international research consortium. Full-length sequenced inserts from cDNAs (FLIcs) are an important tool for correct annotation and clustering of the genomic sequence in any species. The large amount of highly similar duplicate sequences caused by the relatively recent genome duplication in the salmonid ancestor represents a particular challenge for the genome project. FLIcs will therefore be an extremely useful resource for the Atlantic salmon sequencing project. In addition to be helpful in order to distinguish between duplicate genome regions and in determining correct gene structures, FLIcs are an important resource for functional genomic studies and for investigation of regulatory elements controlling gene expression. In contrast to the large number of ESTs available, including the ESTs from 23 developmental and tissue specific cDNA libraries contributed by the Salmon Genome Project (SGP), the number of sequences where the full-length of the cDNA insert has been determined has been small. Results High quality full-length insert sequences from 560 pre-smolt white muscle tissue specific cDNAs were generated, accession numbers [GenBank: BT043497 - BT044056]. Five hundred and ten (91%) of the transcripts were annotated using Gene Ontology (GO) terms and 440 of the FLIcs are likely to contain a complete coding sequence (cCDS). The sequence information was used to identify putative paralogs, characterize salmon Kozak motifs, polyadenylation signal variation and to identify motifs likely to be involved in the regulation of particular genes. Finally, conserved 7-mers in the 3'UTRs were identified, of which some were identical to miRNA target sequences. Conclusion This paper describes the first Atlantic salmon FLIcs from a tissue and developmental stage specific cDNA library. We have demonstrated that many FLIcs contained a complete coding sequence (cCDS). This suggests that the remaining cDNA libraries generated by SGP represent a valuable cCDS FLIc source. The conservation of 7-mers in 3'UTRs indicates that these motifs are functionally important. Identity between some of these 7-mers and miRNA target sequences suggests that they are miRNA targets in Salmo salar transcripts as well. PMID:19878547

  3. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi

    PubMed Central

    Schoch, Conrad L.; Seifert, Keith A.; Huhndorf, Sabine; Robert, Vincent; Spouge, John L.; Levesque, C. André; Chen, Wen; Bolchacova, Elena; Voigt, Kerstin; Crous, Pedro W.; Miller, Andrew N.; Wingfield, Michael J.; Aime, M. Catherine; An, Kwang-Deuk; Bai, Feng-Yan; Barreto, Robert W.; Begerow, Dominik; Bergeron, Marie-Josée; Blackwell, Meredith; Boekhout, Teun; Bogale, Mesfin; Boonyuen, Nattawut; Burgaz, Ana R.; Buyck, Bart; Cai, Lei; Cai, Qing; Cardinali, G.; Chaverri, Priscila; Coppins, Brian J.; Crespo, Ana; Cubas, Paloma; Cummings, Craig; Damm, Ulrike; de Beer, Z. Wilhelm; de Hoog, G. Sybren; Del-Prado, Ruth; Dentinger, Bryn; Diéguez-Uribeondo, Javier; Divakar, Pradeep K.; Douglas, Brian; Dueñas, Margarita; Duong, Tuan A.; Eberhardt, Ursula; Edwards, Joan E.; Elshahed, Mostafa S.; Fliegerova, Katerina; Furtado, Manohar; García, Miguel A.; Ge, Zai-Wei; Griffith, Gareth W.; Griffiths, K.; Groenewald, Johannes Z.; Groenewald, Marizeth; Grube, Martin; Gryzenhout, Marieka; Guo, Liang-Dong; Hagen, Ferry; Hambleton, Sarah; Hamelin, Richard C.; Hansen, Karen; Harrold, Paul; Heller, Gregory; Herrera, Cesar; Hirayama, Kazuyuki; Hirooka, Yuuri; Ho, Hsiao-Man; Hoffmann, Kerstin; Hofstetter, Valérie; Högnabba, Filip; Hollingsworth, Peter M.; Hong, Seung-Beom; Hosaka, Kentaro; Houbraken, Jos; Hughes, Karen; Huhtinen, Seppo; Hyde, Kevin D.; James, Timothy; Johnson, Eric M.; Johnson, Joan E.; Johnston, Peter R.; Jones, E.B. Gareth; Kelly, Laura J.; Kirk, Paul M.; Knapp, Dániel G.; Kõljalg, Urmas; Kovács, Gábor M.; Kurtzman, Cletus P.; Landvik, Sara; Leavitt, Steven D.; Liggenstoffer, Audra S.; Liimatainen, Kare; Lombard, Lorenzo; Luangsa-ard, J. Jennifer; Lumbsch, H. Thorsten; Maganti, Harinad; Maharachchikumbura, Sajeewa S. N.; Martin, María P.; May, Tom W.; McTaggart, Alistair R.; Methven, Andrew S.; Meyer, Wieland; Moncalvo, Jean-Marc; Mongkolsamrit, Suchada; Nagy, László G.; Nilsson, R. Henrik; Niskanen, Tuula; Nyilasi, Ildikó; Okada, Gen; Okane, Izumi; Olariaga, Ibai; Otte, Jürgen; Papp, Tamás; Park, Duckchul; Petkovits, Tamás; Pino-Bodas, Raquel; Quaedvlieg, William; Raja, Huzefa A.; Redecker, Dirk; Rintoul, Tara L.; Ruibal, Constantino; Sarmiento-Ramírez, Jullie M.; Schmitt, Imke; Schüßler, Arthur; Shearer, Carol; Sotome, Kozue; Stefani, Franck O.P.; Stenroos, Soili; Stielow, Benjamin; Stockinger, Herbert; Suetrong, Satinee; Suh, Sung-Oui; Sung, Gi-Ho; Suzuki, Motofumi; Tanaka, Kazuaki; Tedersoo, Leho; Telleria, M. Teresa; Tretter, Eric; Untereiner, Wendy A.; Urbina, Hector; Vágvölgyi, Csaba; Vialle, Agathe; Vu, Thuy Duong; Walther, Grit; Wang, Qi-Ming; Wang, Yan; Weir, Bevan S.; Weiß, Michael; White, Merlin M.; Xu, Jianping; Yahr, Rebecca; Yang, Zhu L.; Yurkov, Andrey; Zamora, Juan-Carlos; Zhang, Ning; Zhuang, Wen-Ying; Schindel, David

    2012-01-01

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups. PMID:22454494

  4. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for Fungi.

    PubMed

    Schoch, Conrad L; Seifert, Keith A; Huhndorf, Sabine; Robert, Vincent; Spouge, John L; Levesque, C André; Chen, Wen

    2012-04-17

    Six DNA regions were evaluated as potential DNA barcodes for Fungi, the second largest kingdom of eukaryotic life, by a multinational, multilaboratory consortium. The region of the mitochondrial cytochrome c oxidase subunit 1 used as the animal barcode was excluded as a potential marker, because it is difficult to amplify in fungi, often includes large introns, and can be insufficiently variable. Three subunits from the nuclear ribosomal RNA cistron were compared together with regions of three representative protein-coding genes (largest subunit of RNA polymerase II, second largest subunit of RNA polymerase II, and minichromosome maintenance protein). Although the protein-coding gene regions often had a higher percent of correct identification compared with ribosomal markers, low PCR amplification and sequencing success eliminated them as candidates for a universal fungal barcode. Among the regions of the ribosomal cistron, the internal transcribed spacer (ITS) region has the highest probability of successful identification for the broadest range of fungi, with the most clearly defined barcode gap between inter- and intraspecific variation. The nuclear ribosomal large subunit, a popular phylogenetic marker in certain groups, had superior species resolution in some taxonomic groups, such as the early diverging lineages and the ascomycete yeasts, but was otherwise slightly inferior to the ITS. The nuclear ribosomal small subunit has poor species-level resolution in fungi. ITS will be formally proposed for adoption as the primary fungal barcode marker to the Consortium for the Barcode of Life, with the possibility that supplementary barcodes may be developed for particular narrowly circumscribed taxonomic groups.

  5. Three new anascosporic genera of the Saccharomycotina: Danielozyma gen. nov., Deakozyma gen. nov. and Middelhovenomyces gen. nov.

    USDA-ARS?s Scientific Manuscript database

    Three new non-ascosporic, ascomycetous yeast genera are proposed based on their isolation from currently described species and genera. Phylogenetic placement of the genera was determined from analysis of nuclear gene sequences for D1/D2 large subunit rRNA, small subunit rRNA, translation elongation...

  6. Cryo-EM structure of the large subunit of the spinach chloroplast ribosome

    PubMed Central

    Ahmed, Tofayel; Yin, Zhan; Bhushan, Shashi

    2016-01-01

    Protein synthesis in the chloroplast is mediated by the chloroplast ribosome (chloro-ribosome). Overall architecture of the chloro-ribosome is considerably similar to the Escherichia coli (E. coli) ribosome but certain differences are evident. The chloro-ribosome proteins are generally larger because of the presence of chloroplast-specific extensions in their N- and C-termini. The chloro-ribosome harbours six plastid-specific ribosomal proteins (PSRPs); four in the small subunit and two in the large subunit. Deletions and insertions occur throughout the rRNA sequence of the chloro-ribosome (except for the conserved peptidyl transferase center region) but the overall length of the rRNAs do not change significantly, compared to the E. coli. Although, recent advancements in cryo-electron microscopy (cryo-EM) have provided detailed high-resolution structures of ribosomes from many different sources, a high-resolution structure of the chloro-ribosome is still lacking. Here, we present a cryo-EM structure of the large subunit of the chloro-ribosome from spinach (Spinacia oleracea) at an average resolution of 3.5 Å. High-resolution map enabled us to localize and model chloro-ribosome proteins, chloroplast-specific protein extensions, two PSRPs (PSRP5 and 6) and three rRNA molecules present in the chloro-ribosome. Although comparable to E. coli, the polypeptide tunnel and the tunnel exit site show chloroplast-specific features. PMID:27762343

  7. Mutant botrocetin-2 inhibits von Willebrand factor-induced platelet agglutination.

    PubMed

    Matsui, T; Hori, A; Hamako, J; Matsushita, F; Ozeki, Y; Sakurai, Y; Hayakawa, M; Matsumoto, M; Fujimura, Y

    2017-03-01

    Essentials Botrocetin-2 (Bot2) binds to von Willebrand factor (VWF) and induces platelet agglutination. We identified Bot2 residues that are required for binding to VWF and glycoprotein (GP) Ib. We produced a mutant Bot2 that binds to VWF but inhibits platelet agglutination. Mutant Bot2 could be used as a potential anti-thrombotic reagent to block VWF-GPIb interaction. Background Botrocetin-2 (Bot2) is a botrocetin-like protein composed of α and β subunits that have been cloned from the snake Bothrops jararaca. Bot2 binds specifically to von Willebrand factor (VWF), and the complex induces glycoprotein (GP) Ib-dependent platelet agglutination. Objectives To exploit Bot2's VWF-binding capacity in order to attempt to create a mutant Bot2 that binds to VWF but inhibits platelet agglutination. Methods and Results Several point mutations were introduced into Bot2 cDNA, and the recombinant protein (recombinant Bot2 [rBot2]) was purified on an anti-botrocetin column. The mutant rBot2 with either Ala at Asp70 in the β subunit (Aspβ70Ala), or Argβ115Ala and Lysβ117Ala, showed reduced platelet agglutination-inducing activity. rBot2 with Aspβ70Ala showed little binding activity towards immobilized VWF on an ELISA plate, whereas rBot2 with Argβ115Ala/Lysβ117Ala showed reduced binding activity towards GPIb (glycocalicin) after forming a complex with VWF. rBot2 point-mutated to oppositely charged Glu at both Argβ115 and Lysβ117 showed normal binding activity towards VWF but no platelet-agglutinating activity. Furthermore, this doubly mutated protein inhibited ristocetin-induced or high shear stress-induced platelet aggregation, and restrained thrombus formation under flow conditions. Conclusions Asp70 in the β subunit of botrocetin is important for VWF binding, and Arg115 and Lys117 in the β subunit are essential for interaction with GPIb. Doubly mutated rBot2, with Argβ115Glu and Lysβ117Glu, repels GPIb and might have potential as an antithrombotic reagent that specifically blocks VWF function. This is the first report on an artificial botrocetin that can inhibit the VWF-GPIb interaction. © 2017 International Society on Thrombosis and Haemostasis.

  8. Kinetic pathway of 40S ribosomal subunit recruitment to hepatitis C virus internal ribosome entry site.

    PubMed

    Fuchs, Gabriele; Petrov, Alexey N; Marceau, Caleb D; Popov, Lauren M; Chen, Jin; O'Leary, Seán E; Wang, Richard; Carette, Jan E; Sarnow, Peter; Puglisi, Joseph D

    2015-01-13

    Translation initiation can occur by multiple pathways. To delineate these pathways by single-molecule methods, fluorescently labeled ribosomal subunits are required. Here, we labeled human 40S ribosomal subunits with a fluorescent SNAP-tag at ribosomal protein eS25 (RPS25). The resulting ribosomal subunits could be specifically labeled in living cells and in vitro. Using single-molecule Förster resonance energy transfer (FRET) between RPS25 and domain II of the hepatitis C virus (HCV) internal ribosome entry site (IRES), we measured the rates of 40S subunit arrival to the HCV IRES. Our data support a single-step model of HCV IRES recruitment to 40S subunits, irreversible on the initiation time scale. We furthermore demonstrated that after binding, the 40S:HCV IRES complex is conformationally dynamic, undergoing slow large-scale rearrangements. Addition of translation extracts suppresses these fluctuations, funneling the complex into a single conformation on the 80S assembly pathway. These findings show that 40S:HCV IRES complex formation is accompanied by dynamic conformational rearrangements that may be modulated by initiation factors.

  9. Protein Flexibility Facilitates Quaternary Structure Assembly and Evolution

    PubMed Central

    Marsh, Joseph A.; Teichmann, Sarah A.

    2014-01-01

    The intrinsic flexibility of proteins allows them to undergo large conformational fluctuations in solution or upon interaction with other molecules. Proteins also commonly assemble into complexes with diverse quaternary structure arrangements. Here we investigate how the flexibility of individual protein chains influences the assembly and evolution of protein complexes. We find that flexibility appears to be particularly conducive to the formation of heterologous (i.e., asymmetric) intersubunit interfaces. This leads to a strong association between subunit flexibility and homomeric complexes with cyclic and asymmetric quaternary structure topologies. Similarly, we also observe that the more nonhomologous subunits that assemble together within a complex, the more flexible those subunits tend to be. Importantly, these findings suggest that subunit flexibility should be closely related to the evolutionary history of a complex. We confirm this by showing that evolutionarily more recent subunits are generally more flexible than evolutionarily older subunits. Finally, we investigate the very different explorations of quaternary structure space that have occurred in different evolutionary lineages. In particular, the increased flexibility of eukaryotic proteins appears to enable the assembly of heteromeric complexes with more unique components. PMID:24866000

  10. Conditional poliovirus mutants made by random deletion mutagenesis of infectious cDNA.

    PubMed Central

    Kirkegaard, K; Nelsen, B

    1990-01-01

    Small deletions were introduced into DNA plasmids bearing cDNA copies of Mahoney type 1 poliovirus RNA. The procedure used was similar to that of P. Hearing and T. Shenk (J. Mol. Biol. 167:809-822, 1983), with modifications designed to introduce only one lesion randomly into each DNA molecule. Methods to map small deletions in either large DNA or RNA molecules were employed. Two poliovirus mutants, VP1-101 and VP1-102, were selected from mutagenized populations on the basis of their host range phenotype, showing a large reduction in the relative numbers of plaques on CV1 and HeLa cells compared with wild-type virus. The deletions borne by the mutant genomes were mapped to the region encoding the amino terminus of VP1. That these lesions were responsible for the mutant phenotypes was substantiated by reintroduction of the sequenced lesions into a wild-type poliovirus cDNA by deoxyoligonucleotide-directed mutagenesis. The deletion of nucleotides encoding amino acids 8 and 9 of VP1 was responsible for the VP1-101 phenotype; the VP1-102 defect was caused by the deletion of the sequences encoding the first four amino acids of VP1. The peptide sequence at the VP1-VP3 proteolytic cleavage site was altered from glutamine-glycine to glutamine-methionine in VP1-102; this apparently did not alter the proteolytic cleavage pattern. The biochemical defects resulting from these mutations are discussed in the accompanying report. Images PMID:2152811

  11. Structure and Location of the Regulatory β Subunits in the (αβγδ)4 Phosphorylase Kinase Complex* ♦

    PubMed Central

    Nadeau, Owen W.; Lane, Laura A.; Xu, Dong; Sage, Jessica; Priddy, Timothy S.; Artigues, Antonio; Villar, Maria T.; Yang, Qing; Robinson, Carol V.; Zhang, Yang; Carlson, Gerald M.

    2012-01-01

    Phosphorylase kinase (PhK) is a hexadecameric (αβγδ)4 complex that regulates glycogenolysis in skeletal muscle. Activity of the catalytic γ subunit is regulated by allosteric activators targeting the regulatory α, β, and δ subunits. Three-dimensional EM reconstructions of PhK show it to be two large (αβγδ)2 lobes joined with D2 symmetry through interconnecting bridges. The subunit composition of these bridges was unknown, although indirect evidence suggested the β subunits may be involved in their formation. We have used biochemical, biophysical, and computational approaches to not only address the quaternary structure of the β subunits within the PhK complex, i.e. whether they compose the bridges, but also their secondary and tertiary structures. The secondary structure of β was determined to be predominantly helical by comparing the CD spectrum of an αγδ subcomplex with that of the native (αβγδ)4 complex. An atomic model displaying tertiary structure for the entire β subunit was constructed using chemical cross-linking, MS, threading, and ab initio approaches. Nearly all this model is covered by two templates corresponding to glycosyl hydrolase 15 family members and the A subunit of protein phosphatase 2A. Regarding the quaternary structure of the β subunits, they were directly determined to compose the four interconnecting bridges in the (αβγδ)4 kinase core, because a β4 subcomplex was observed through both chemical cross-linking and top-down MS of PhK. The predicted model of the β subunit was docked within the bridges of a cryoelectron microscopic density envelope of PhK utilizing known surface features of the subunit. PMID:22969083

  12. The Barley Magnesium Chelatase 150-kD Subunit Is Not an Abscisic Acid Receptor1[OA

    PubMed Central

    Müller, André H.; Hansson, Mats

    2009-01-01

    Magnesium chelatase is the first unique enzyme of the chlorophyll biosynthetic pathway. It is composed of three gene products of which the largest is 150 kD. This protein was recently identified as an abscisic acid receptor in Arabidopsis (Arabidopsis thaliana). We have evaluated whether the barley (Hordeum vulgare) magnesium chelatase large subunit, XanF, could be a receptor for the phytohormone. The study involved analysis of recombinant magnesium chelatase protein as well as several induced chlorophyll-deficient magnesium chelatase mutants with defects identified at the gene and protein levels. Abscisic acid had no effect on magnesium chelatase activity and binding to the barley 150-kD protein could not be shown. Magnesium chelatase mutants showed a wild-type response in respect to postgermination growth and stomatal aperture. Our results question the function of the large magnesium chelatase subunit as an abscisic acid receptor. PMID:19176716

  13. Gene-targeted mice lacking the Trex1 (DNase III) 3'-->5' DNA exonuclease develop inflammatory myocarditis.

    PubMed

    Morita, Masashi; Stamp, Gordon; Robins, Peter; Dulic, Anna; Rosewell, Ian; Hrivnak, Geza; Daly, Graham; Lindahl, Tomas; Barnes, Deborah E

    2004-08-01

    TREX1, originally designated DNase III, was isolated as a major nuclear DNA-specific 3'-->5' exonuclease that is widely distributed in both proliferating and nonproliferating mammalian tissues. The cognate cDNA shows homology to the editing subunit of the Escherichia coli replicative DNA polymerase III holoenzyme and encodes an exonuclease which was able to serve a DNA-editing function in vitro, promoting rejoining of a 3' mismatched residue in a reconstituted DNA base excision repair system. Here we report the generation of gene-targeted Trex1(-/-) mice. The null mice are viable and do not show the increase in spontaneous mutation frequency or cancer incidence that would be predicted if Trex1 served an obligatory role of editing mismatched 3' termini generated during DNA repair or DNA replication in vivo. Unexpectedly, Trex1(-/-) mice exhibit a dramatically reduced survival and develop inflammatory myocarditis leading to progressive, often dilated, cardiomyopathy and circulatory failure.

  14. Archaeal amoA and ureC genes and their transcriptional activity in the Arctic Ocean

    NASA Astrophysics Data System (ADS)

    Pedneault, Estelle; Galand, Pierre E.; Potvin, Marianne; Tremblay, Jean-Éric; Lovejoy, Connie

    2014-04-01

    Thaumarchaeota and the gene encoding for a subunit of ammonia monooxygenase (amoA) are ubiquitous in Polar Seas, and some Thaumarchaeota also have a gene coding for ureC, diagnostic for urease. Using quantitative PCR we investigated the occurrence of genes and transcripts of ureC and amoA in Arctic samples from winter, spring and summer. AmoA genes, ureC genes and amoA transcripts were always present, but ureC transcripts were rarely detected. Over a 48 h light manipulation experiment amoA transcripts persisted under light and dark conditions, but not ureC transcripts. In addition, maxima for amoA transcript were nearer the surface compared to amoA genes. Clone libraries using DNA template recovered shallow and deep amoA clades but only the shallow clade was recovered from cDNA (from RNA). These results imply environmental control of amoA expression with direct or indirect light effects, and rare ureC expression despite its widespread occurrence in the Arctic Ocean.

  15. Recombinant VP1 protein of duck hepatitis virus 1 expressed in Pichia pastoris and its immunogenicity in ducks.

    PubMed

    Wang, C; Li, X K; Wu, T C; Wang, Y; Zhang, C J; Cheng, X C; Chen, P Y

    2014-01-01

    The VP1 gene of duck hepatitis virus type 1 (DHV-1) strain VJ09 was amplified by reverse transcription PCR from the liver of a duckling with clinical symptoms of viral hepatitis. The resulting VP1 cDNA was 720 bp in length and encoded a 240-amino-acid protein. In VP1 gene-based phylogenetic analysis, the VJ09 strain grouped with DHV-1 genotype C. The VP1 gene was inserted into the expression vector pPICZαA and expressed in Pichia pastoris. The expressed VP1 protein was purified and identified by western blot analysis. To evaluate the recombinant VP1's immunogenic potential in ducklings, the antibodies raised in the immunized ducklings were titrated by ELISA, and lymphocyte proliferation and virus neutralization assays were performed. The results show that the recombinant VP1 protein induced a significant immune response in ducklings and this could be a candidate for the development of a subunit vaccine against DHV-1 genotype C.

  16. Antisense and sense poly(A)-RNAs from the Xenopus laevis pyruvate dehydrogenase gene loci are regulated with message production during embryogenesis.

    PubMed

    Islam, N; Poitras, L; Gagnon, F; Moss, T

    1996-10-17

    The structure and temporal expression of two Xenopus cDNAs encoding the beta subunit of pyruvate dehydrogenase (XPdhE1 beta) have been determined. XPdhE1 beta was 88% homologous to mature human PdhE1 beta, but the putative N-terminal mitochondrial signal peptide was poorly conserved. Zygotic expression of XPdhE1 beta mRNA was detected at neural tube closure and increased until stage 40. RT-PCR cloning identified a short homology to a protein kinase open reading frame within the 3' non-coding sequence of the XPdhE1 beta cDNAs. This homology, which occurred on the antisense cDNA strand, was shown by strand specific RT-PCR to be transcribed in vivo as part of an antisense RNA. Northern analysis showed that this RNA formed part of an abundant and heterogeneous population of antisense and sense poly(A)-RNAs transcribed from the XPdhE1 beta loci and coordinately regulated with message production.

  17. Development and use of domain-specific antibodies in a characterization of the large subunits of soybean photosystem 1

    NASA Technical Reports Server (NTRS)

    Henry, R. L.; Takemoto, L. J.; Murphy, J.; Gallegos, G. L.; Guikema, J. A.; Spooner, B. S. (Principal Investigator)

    1992-01-01

    The molecular architecture of the soybean photosystem 1 reaction center complex was examined using a combination of surface labeling and immunological methodology on isolated thylakoid membranes. Synthetic peptides (12 to 14 amino acids in length) were prepared which correspond to the N-terminal regions of the 83 and 82.4 kDa subunits of photosystem 1 (the PsaA and PsaB proteins, respectively). Similarly, a synthetic peptide was prepared corresponding to the C-terminal region of the PsaB subunit. These peptides were conjugated to a carrier protein, and were used for the production of polyclonal antibodies in rabbits. The resulting sera could distinguish between the PsaA and PsaB photosystem 1 subunits by Western blot analysis, and could identify appropriate size classes of cyanogen bromide cleavage fragments as predicted from the primary sequences of these two subunits. When soybean thylakoid membranes were surface-labeled with N-hydroxysuccinimidobiotin, several subunits of the complete photosystem 1 lipid/protein complex incorporated label. These included the light harvesting chlorophyll proteins of photosystem 1, and peptides thought to aid in the docking of ferredoxin to the complex during photosynthetic electron transport. However, the PsaA and PsaB subunits showed very little biotinylation. When these subunits were examined for the domains to which biotin did attach, most of the observed label was associated with the N-terminal domain of the PsaA subunit, as identified using a domain-specific polyclonal antisera.

  18. cDNA Cloning, expression and characterization of an allergenic 60s ribosomal protein of almond (prunus dulcis).

    PubMed

    Abolhassani, Mohsen; Roux, Kenneth H

    2009-06-01

    Tree nuts, including almond (prunus dulcis) are a source of food allergens often associated with life-threatening allergic reactions in susceptible individuals. Although the proteins in almonds have been biochemically characterized, relatively little has been reported regarding the identity of the allergens involved in almond sensitivity. The present study was undertaken to identify the allergens of the almond by cDNA library approach. cDNA library of almond seeds was constructed in Uni-Zap XR lamda vector and expressed in E. coli XL-1 blue. Plaques were immunoscreened with pooled sera of allergic patients. The cDNA clone reacting significantly with specific IgE antibodies was selected and subcloned and subsequently expressed in E. coli. The amino acids deducted from PCR product of clone showed homology to 60s acidic ribosomal protein of almond. The expressed protein was 11,450 Dalton without leader sequence. Immunoreactivity of the recombinant 60s ribosomal protein (r60sRP) was evaluated with dot blot analysis using pooled and individual sera of allergic patients. The data showed that r60sRP and almond extract (as positive control) possess the ability to bind the IgE antibodies. The results showed that expressed protein is an almond allergen.Whether this r60sRP represents a major allergen of almond needs to be further studied which requires a large number of sera from the almond atopic patients and also need to determine the IgE-reactive frequencies of each individual allergen.

  19. Polymerase ε1 mutation in a human syndrome with facial dysmorphism, immunodeficiency, livedo, and short stature (“FILS syndrome”)

    PubMed Central

    Pachlopnik Schmid, Jana; Lemoine, Roxane; Nehme, Nadine; Cormier-Daire, Valéry; Revy, Patrick; Debeurme, Franck; Debré, Marianne; Nitschke, Patrick; Bole-Feysot, Christine; Legeai-Mallet, Laurence; Lim, Annick; de Villartay, Jean-Pierre; Picard, Capucine; Durandy, Anne; Fischer, Alain

    2012-01-01

    DNA polymerase ε (Polε) is a large, four-subunit polymerase that is conserved throughout the eukaryotes. Its primary function is to synthesize DNA at the leading strand during replication. It is also involved in a wide variety of fundamental cellular processes, including cell cycle progression and DNA repair/recombination. Here, we report that a homozygous single base pair substitution in POLE1 (polymerase ε 1), encoding the catalytic subunit of Polε, caused facial dysmorphism, immunodeficiency, livedo, and short stature (“FILS syndrome”) in a large, consanguineous family. The mutation resulted in alternative splicing in the conserved region of intron 34, which strongly decreased protein expression of Polε1 and also to a lesser extent the Polε2 subunit. We observed impairment in proliferation and G1- to S-phase progression in patients’ T lymphocytes. Polε1 depletion also impaired G1- to S-phase progression in B lymphocytes, chondrocytes, and osteoblasts. Our results evidence the developmental impact of a Polε catalytic subunit deficiency in humans and its causal relationship with a newly recognized, inherited disorder. PMID:23230001

  20. Multiple forms of ADP-glucose pyrophosphorylase from tomato fruit

    NASA Technical Reports Server (NTRS)

    Chen, B. Y.; Janes, H. W.

    1997-01-01

    ADP-glucose pyrophosphorylase (AGP) was purified from tomato (Lycopersicon esculentum Mill.) fruit to apparent homogeneity. By sodium dodecyl sulfate-polyacrylamide gel electrophoresis the enzyme migrated as two close bands with molecular weights of 50,000 and 51,000. Two-dimensional polyacrylamide gel electrophoresis analysis of the purified enzyme, however, revealed at least five major protein spots that could be distinguished by their slight differences in net charge and molecular weight. Whereas all of the spots were recognized by the antiserum raised against tomato fruit AGP holoenzyme, only three of them reacted strongly with antiserum raised against the potato tuber AGP large subunit, and the other two spots (with lower molecular weights) reacted specifically with antisera raised against spinach leaf AGP holoenzyme and the potato tuber AGP small subunit. The results suggest the existence of at least three isoforms of the AGP large subunit and two isoforms of the small subunit in tomato fruit in vivo. The native molecular mass of the enzyme determined by gel filtration was 220 +/- 10 kD, indicating a tetrameric structure for AGP from tomato fruit. The purified enzyme is very sensitive to 3-phosphoglycerate/inorganic phosphate regulation.

  1. Copper coordination in the Glycine receptor by electron spin resonance

    NASA Astrophysics Data System (ADS)

    Ruthstein, Sharon; Stone, Katherine; Cascio, Michael; Saxena, Sunil

    2009-03-01

    We describe the use of Electron Spin Resonance (ESR) to identify the coordination environment of copper in the extracellular domain of the protein, as well as the number of copper atoms that bind to Glycine receptor (GlyR). The GlyR channel mediates inhibitory neurotransmission in the central nervous system. It belongs to the superfamily of nicotincoid receptors. These receptors are formed by pentameric arrangement of subunits, each sharing a common topology having a large extracellular domain (ECD) and a transmembrane (TM) domain comprised of four membrane-spanning segments (TM1-TM4). For GlyR, four subunits (1-4) and one subunit have been identified to date, although the homomeric expression of just the α1 subunit of GlyR is sufficient to reconstitute native-like activity. The results are expected to shed light on the role of metals ion in modulating ion permeation in such receptor. In addition, an identification of copper binding sites will allow the measurement of large range distance constraints in the receptor by pulsed ESR. Such structural information on the GlyR in various allosteric states is essential in order to shed light on the gating mechanism of this protein membrane.

  2. Expression of the ribulose-1,5-bisphosphate carboxylase large subunit gene and three small subunit genes in two cell types of maize leaves

    PubMed Central

    Sheen, Jenq-Yunn; Bogorad, Lawrence

    1986-01-01

    Transcripts of three distinct ribulose-1,5-bisphosphate carboxylase (RuBPC) small subunit (SS) genes account for ∼90% of the mRNA for this protein in maize leaves. Transcripts of two of them constitute >80% of the SS mRNA in 24-h greening maize leaves. The third gene contribute ∼10%. Transcripts of all three nuclear-encoded SS genes are detectable in bundle sheath (BSC) and mesophyll cells (MC) of etiolated maize leaves. The level of mRNA for each gene is different in etioplasts of MC but all drop during photoregulated development of chloroplasts in MC and follow a pattern of transitory rise and fall in BSC. The amounts of LS and SS proteins continue to increase steadily well after the mRNA levels reach their peaks in BSC. The molar ratio of mRNA for chloroplast-encoded RuBPC large subunit (LS) to the nuclear genome encoded SS is about 10:1 although LS and SS proteins are present in about equimolar amounts. ImagesFig. 1.Fig. 2.Fig. 3.Fig. 4.Fig. 5.Fig. 6. PMID:16453739

  3. MACF1 Overexpression by Transfecting the 21 kbp Large Plasmid PEGFP-C1A-ACF7 Promotes Osteoblast Differentiation and Bone Formation.

    PubMed

    Zhang, Yan; Yin, Chong; Hu, Lifang; Chen, Zhihao; Zhao, Fan; Li, Dijie; Ma, Jianhua; Ma, Xiaoli; Su, Peihong; Qiu, Wuxia; Yang, Chaofei; Wang, Pai; Li, Siyu; Zhang, Ge; Wang, Liping; Qian, Airong; Xian, Cory J

    2018-02-01

    Microtubule actin crosslinking factor 1 (MACF1) is a large spectraplakin protein known to have crucial roles in regulating cytoskeletal dynamics, cell migration, growth, and differentiation. However, its role and action mechanism in bone remain unclear. The present study investigated optimal conditions for effective transfection of the large plasmid PEGFP-C1A-ACF7 (∼21 kbp) containing full-length human MACF1 cDNA, as well as the potential role of MACF1 in bone formation. To enhance MACF1 expression, the plasmid was transfected into osteogenic cells by electroporation in vitro and into mouse calvaria with nanoparticles. Then, transfection efficiency, osteogenic marker expression, calvarial thickness, and bone formation were analyzed. Notably, MACF1 overexpression triggered a drastic increase in osteogenic gene expression, alkaline phosphatase activity, and matrix mineralization in vitro. Mouse calvarial thickness, mineral apposition rate, and osteogenic marker protein expression were significantly enhanced by local transfection. In addition, MACF1 overexpression promoted β-catenin expression and signaling. In conclusion, MACF1 overexpression by transfecting the large plasmid containing full-length MACF1 cDNA promotes osteoblast differentiation and bone formation via β-catenin signaling. Current data will provide useful experimental parameters for the transfection of large plasmids and a novel strategy based on promoting bone formation for prevention and therapy of bone disorders.

  4. Development of two bacterial artificial chromosome shuttle vectors for a recombination-based cloning and regulated expression of large genes in mammalian cells.

    PubMed

    Hong, Y K; Kim, D H; Beletskii, A; Lee, C; Memili, E; Strauss, W M

    2001-04-01

    Most conditional expression vectors designed for mammalian cells have been valuable systems for studying genes of interest by regulating their expressions. The available vectors, however, are reliable for the short-length cDNA clones and not optimal for relatively long fragments of genomic DNA or long cDNAs. Here, we report the construction of two bacterial artificial chromosome (BAC) vectors, capable of harboring large inserts and shuttling among Escherichia coli, yeast, and mammalian cells. These two vectors, pEYMT and pEYMI, contain conditional expression systems which are designed to be regulated by tetracycline and mouse interferons, respectively. To test the properties of the vectors, we cloned in both vectors the green fluorescence protein (GFP) through an in vitro ligation reaction and the 17.8-kb-long X-inactive-specific transcript (Xist) cDNA through homologous recombination in yeast. Subsequently, we characterized their regulated expression properties using real-time quantitative RT-PCR (TaqMan) and RNA-fluorescent in situ hybridization (FISH). We demonstrate that these two BAC vectors are good systems for recombination-based cloning and regulated expression of large genes in mammalian cells. Copyright 2001 Academic Press.

  5. Radon in ground water of the Lower Susqehanna and Potomac River basins

    USGS Publications Warehouse

    Lindsey, Bruce D.; Ator, Scott W.

    1996-01-01

    Ground-water samples collected from 267 wells were analyzed for radon as part of a water-quality reconnaissance of subunits of the Lower Susquehanna and Potomac River Basins conducted by the United States Geological Survey (USGS) as part of the National Water-Quality Assessment (NAWQA) program. Radon is a product of the radioactive decay of uranium. Airborne radon has been cited by the Surgeon General of the United States as the second-leading cause of lung cancer and the United States Environmental Protection Agency (USEPA) has identified ground-water supplies as possible contributing sources of indoor radon. Eighty percent of ground-water samples collected for this study were found to contain radon at activities greater than 300 pCi/L (picocuries per liter), the USEPA's proposed Maximum Contaminant Level for radon in drinking water, and 31 percent of samples contained radon at activities greater than 1,000 pCi/L. The 10 subunits where samples were collected were grouped into three classes - median ground-water radon activity less than 300 pCi/L, between 300 pCi/L and 1,000 pCi/L, and greater than 1,000 pCi/L. Subunits underlain by igneous and metamorphic rocks of the Piedmont Physiographic Province typically have the highest median ground-water radon activities (greater than 1,000 pCi/L); although there is a large variation in radon activities within most of the subunits. Lower median radon activities (between 300 pCi/L and 1,000 pCi/L) were found in ground water in subunits underlain by limestone and dolomite. Of three subunits underlain by sandstone and shale, one fell into each of the three radon-activity classes. The large variability within these subunits may be attributed to the fact that the uranium content of sandstone and shale is related to the uranium content of the sediments from which they formed.

  6. Evidence for an unusual transmembrane configuration of AGG3, a class C Gγ subunit of Arabidopsis

    DOE PAGES

    Wolfenstetter, Susanne; Chakravorty, David; Kula, Ryan; ...

    2014-12-22

    Heterotrimeric G proteins are crucial for the perception of external signals and subsequent signal transduction in animal and plant cells. In both model systems, the complex is comprised of one Gα, one Gβ and one Gγ subunit. However, in addition to the canonical Gγ subunits (Class A), plants also possess two unusual, plant-specific classes of Gγ subunits (Classes B and C) not yet found in animals. These include Gγ subunits lacking the C-terminal CaaX motif (Class B) which is important for membrane anchoring of the protein, and thus give rise to a flexible subpopulation of Gβ/γ heterodimers that is notmore » necessarily restricted to the plasma membrane. Even more interesting, plants also contain Class C Gγ subunits which are twice the size of canonical Gγs, with a predicted transmembrane domain, and a large cysteine-rich, extracellular C-terminus. However, neither the presence of the transmembrane domain nor the membrane topology has been unequivocally demonstrated. Finally, we provide compelling evidence that AGG3, a Class C Ggamma subunit of Arabidopsis, contains a functional transmembrane domain, which is sufficient but not essential for plasma membrane localization, and that the cysteine-rich C-terminus is extracellular.« less

  7. Subunit architecture and functional modular rearrangements of the transcriptional mediator complex.

    PubMed

    Tsai, Kuang-Lei; Tomomori-Sato, Chieri; Sato, Shigeo; Conaway, Ronald C; Conaway, Joan W; Asturias, Francisco J

    2014-06-05

    The multisubunit Mediator, comprising ∼30 distinct proteins, plays an essential role in gene expression regulation by acting as a bridge between DNA-binding transcription factors and the RNA polymerase II (RNAPII) transcription machinery. Efforts to uncover the Mediator mechanism have been hindered by a poor understanding of its structure, subunit organization, and conformational rearrangements. By overcoming biochemical and image analysis hurdles, we obtained accurate EM structures of yeast and human Mediators. Subunit localization experiments, docking of partial X-ray structures, and biochemical analyses resulted in comprehensive mapping of yeast Mediator subunits and a complete reinterpretation of our previous Mediator organization model. Large-scale Mediator rearrangements depend on changes at the interfaces between previously described Mediator modules, which appear to be facilitated by factors conducive to transcription initiation. Conservation across eukaryotes of Mediator structure, subunit organization, and RNA polymerase II interaction suggest conservation of fundamental aspects of the Mediator mechanism. Copyright © 2014 Elsevier Inc. All rights reserved.

  8. Highly acidic C-terminal domain of pp32 is required for the interaction with histone chaperone, TAF-Ibeta.

    PubMed

    Lee, In-Seon; Oh, Sang-Min; Kim, Sung-Mi; Lee, Dong-Seok; Seo, Sang-Beom

    2006-12-01

    We have previously reported that INHAT (inhibitor of acetyltransferases) complex subunits, TAF (template activating factor)-Ialpha, TAF-Ibeta and pp32 can inhibit histone acetylation and HAT (histone acetyltransferase)-dependent transcription by binding to histones. Evidences are accumulating that INHAT complex subunits have important regulatory roles in various cellular activities such as replication, transcription, and apoptosis etc. However, how these subunits interact each other remains largely unknown. Using immunoprecipitation (IP) and protein-protein interaction assays with TAF-Ibeta and pp32 deletion mutant proteins, we identify INHAT complex subunits, TAF-Ibeta and pp32 interaction requires highly acidic C-terminal domain of pp32. We also show that the interaction between the INHAT complex subunits is stronger in the presence of histones. In this study, we report that the synergistic inhibition of HAT-mediated transcription by TAF-Ibeta and pp32 is dependent on the highly acidic C-terminal domain of pp32.

  9. Chemically related 4,5-linked aminoglycoside antibiotics drive subunit rotation in opposite directions

    PubMed Central

    Wasserman, Michael R.; Pulk, Arto; Zhou, Zhou; Altman, Roger B.; Zinder, John C.; Green, Keith D.; Garneau-Tsodikova, Sylvie; Doudna Cate, Jamie H.; Blanchard, Scott C.

    2015-01-01

    Dynamic remodelling of intersubunit bridge B2, a conserved RNA domain of the bacterial ribosome connecting helices 44 (h44) and 69 (H69) of the small and large subunit, respectively, impacts translation by controlling intersubunit rotation. Here we show that aminoglycosides chemically related to neomycin—paromomycin, ribostamycin and neamine—each bind to sites within h44 and H69 to perturb bridge B2 and affect subunit rotation. Neomycin and paromomycin, which only differ by their ring-I 6′-polar group, drive subunit rotation in opposite directions. This suggests that their distinct actions hinge on the 6′-substituent and the drug's net positive charge. By solving the crystal structure of the paromomycin–ribosome complex, we observe specific contacts between the apical tip of H69 and the 6′-hydroxyl on paromomycin from within the drug's canonical h44-binding site. These results indicate that aminoglycoside actions must be framed in the context of bridge B2 and their regulation of subunit rotation. PMID:26224058

  10. Recovery of Infectious Pariacoto Virus from cDNA Clones and Identification of Susceptible Cell Lines

    PubMed Central

    Johnson, Karyn N.; Ball, L. Andrew

    2001-01-01

    Pariacoto virus (PaV) is a nodavirus that was recently isolated in Peru from the Southern armyworm, Spodoptera eridania. Virus particles are non enveloped and about 30 nm in diameter and have T=3 icosahedral symmetry. The 3.0-Å crystal structure shows that about 35% of the genomic RNA is icosahedrally ordered, with the RNA forming a dodecahedral cage of 25-nucleotide (nt) duplexes that underlie the inner surface of the capsid. The PaV genome comprises two single-stranded, positive-sense RNAs: RNA1 (3,011 nt), which encodes the 108-kDa catalytic subunit of the RNA-dependent RNA polymerase, and RNA2 (1,311 nt), which encodes the 43-kDa capsid protein precursor α. In order to apply molecular genetics to the structure and assembly of PaV, we identified susceptible cell lines and developed a reverse genetic system for this virus. Cell lines that were susceptible to infection by PaV included those from Spodoptera exigua, Helicoverpa zea and Aedes albopictus, whereas cells from Drosophila melanogaster and Spodoptera frugiperda were refractory to infection. To recover virus from molecular clones, full-length cDNAs of PaV RNAs 1 and 2 were cotranscribed by T7 RNA polymerase in baby hamster kidney cells that expressed T7 RNA polymerase. Lysates of these cells were infectious both for cultured cells from Helicoverpa zea (corn earworm) and for larvae of Galleria mellonella (greater wax moth). The combination of infectious cDNA clones, cell culture infectivity, and the ability to produce milligram amounts of virus allows the application of DNA-based genetic methods to the study of PaV structure and assembly. PMID:11711613

  11. Methyl-coenzyme M reductase A as an indicator to estimate methane production from dairy cows.

    PubMed

    Aguinaga Casañas, M A; Rangkasenee, N; Krattenmacher, N; Thaller, G; Metges, C C; Kuhla, B

    2015-06-01

    The evaluation of greenhouse gas mitigation strategies requires the quantitative assessment of individual methane production. Because methane measurement in respiration chambers is highly accurate, but also comprises various disadvantages such as limited capacity and high costs, the establishment of an indicator for estimating methane production of individual ruminants would provide an alternative to direct methane measurement. Methyl-coenzyme M reductase is involved in methanogenesis and the subunit α of methyl-coenzyme M reductase is encoded by the mcrA gene of rumen archaea. We therefore examined the relationship between methane emissions of Holstein dairy cows measured in respiration chambers with 2 different diets (high- and medium-concentrate diet) and the mcrA DNA and mcrA cDNA abundance determined from corresponding rumen fluid samples. Whole-body methane production per kilogram of dry matter intake and mcrA DNA normalized to the abundance of the rrs gene coding for 16S rRNA correlated significantly when using qmcrA primers. Use of qmcrA primers also revealed linear correlation between mcrA DNA copy number and methane yield. Regression analyses based on normalized mcrA cDNA abundances revealed no significant linear correlation with methane production per kilogram of dry matter intake. Furthermore, the correlations between normalized mcrA DNA abundance and the rumen fluid concentration of acetic and isobutyric acid were positive, whereas the correlations with propionic and lactic acid were negative. These data suggest that the mcrA DNA approach based on qmcrA primers could potentially be a molecular proxy for methane yield after further refinement. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  12. Alpha-tryptophan synthase of Isatis tinctoria: gene cloning and expression.

    PubMed

    Salvini, M; Boccardi, T M; Sani, E; Bernardi, R; Tozzi, S; Pugliesi, C; Durante, M

    2008-07-01

    Indole producing reaction is a crux in the regulation of metabolite flow through the pathways and the coordination of primary and secondary product biosynthesis in plants. Indole is yielded transiently from indole-3-glycerol phosphate and immediately condensed with serine to give tryptophan, by the enzyme tryptophan synthase (TS). There is evidence that plant TS, like the bacterial complex, functions as an alpha beta heteromer. In few species, e.g. maize, are known enzymes, related with the TS alpha-subunit (TSA), able to catalyse reaction producing indole, which is free to enter the secondary metabolite pathways. In this contest, we searched for TSA and TSA related genes in Isatis tinctoria, a species producing the natural blue dye indigo. The It-TSA cDNA and the full-length exons/introns genomic region were isolated. The phylogenetic analysis indicates that It-TSA is more closely related to Arabidopsis thaliana At-T14E10.210 TSA (95.7% identity at the amino acid level) with respect to A. thaliana At-T10P11.11 TSA1-like (63%), Zea mays indole-3-glycerol phosphate lyase (54%), Z. mays TSA (53%), and Z. mays indole synthase (50%). The It-TSA cDNA was also able to complement an Escherichia coli trpA mutant. To examine the involvement of It-TSA in the biosynthesis of secondary metabolism compounds, It-TSA expression was tested in seedling grown under different light conditions. Semi-quantitative RT-PCR showed an increase in the steady-state level of It-TSA mRNA, paralleled by an increase of indigo and its precursor isatan B. Our results appear to indicate an involvement for It-TSA in indigo precursor synthesis and/or tryptophan biosynthesis.

  13. [Change of chart genes expression in small intestines of mouse induced by electromagnetic pulse irradiation].

    PubMed

    Ren, Dongqing; Jin, Juan; Li, Xiaojuan; Zeng, Guiying

    2008-01-01

    To explore the bio-effects of electromagnetic pulse(EMP) on mouse small intestines induced by means of gene chip. Twelve BALB/c mice were randomly assigned to the normal control group and the EMP group with 6 in each group. The EMP group was irradiated with 200 kV/m, 200 pulses EMP. 18 hours after the irradiation, the mice were sacrificed and their jejunum of small intestines were eviscerated. The fluorescent cDNA probes labeled with Cy3 and Cy5 were prepared from RNA extracted from the intestines of the two groups. Probes of the two groups were then hybridized against cDNA gene chip, the fluorescent signals were scanned with a scanner and the results were analyzed by computer. Compared with the control, 56 genes in gene expression profile were altered. The expression levels of 37 genes were up-regulated distinctly while 19 genes were down-regulated significantly. Among the 56 genes, 19 were reported with known or inferred functions, 12 up-regulated genes were catenin alpha 1 (alpha-catenin), ly-6 alloantigen(Ly-6E), fructose-6-phosphate transaminase (GF6P), ribosomal protein S17 (rpS17), small proline-rich protein 2A (Sprr2a), glandular kallikrein27 (GK27), lipoxygenase-3, aldo-keto reductase (Akr1c12), GSG1, amylase 2 (Amy2),elastase 2, p6-5 gene and 7 down-regulated genes were junctional adhesion molecule (Jam), protein arginine methyltransferase (Carm1),NNP-1, 2-5 A synthetase L2,Mlark gene, ATP synthase alpha subunit, uncoupling protein-2 (Ucp2) gene; the other 37 were reported with unknown functions. EMP irradiation could induce specific expressions of some genes in mouse small intestines and most of these genes were up-regulated ones.

  14. Recovery of infectious pariacoto virus from cDNA clones and identification of susceptible cell lines.

    PubMed

    Johnson, K N; Ball, L A

    2001-12-01

    Pariacoto virus (PaV) is a nodavirus that was recently isolated in Peru from the Southern armyworm, Spodoptera eridania. Virus particles are non enveloped and about 30 nm in diameter and have T=3 icosahedral symmetry. The 3.0-A crystal structure shows that about 35% of the genomic RNA is icosahedrally ordered, with the RNA forming a dodecahedral cage of 25-nucleotide (nt) duplexes that underlie the inner surface of the capsid. The PaV genome comprises two single-stranded, positive-sense RNAs: RNA1 (3,011 nt), which encodes the 108-kDa catalytic subunit of the RNA-dependent RNA polymerase, and RNA2 (1,311 nt), which encodes the 43-kDa capsid protein precursor alpha. In order to apply molecular genetics to the structure and assembly of PaV, we identified susceptible cell lines and developed a reverse genetic system for this virus. Cell lines that were susceptible to infection by PaV included those from Spodoptera exigua, Helicoverpa zea and Aedes albopictus, whereas cells from Drosophila melanogaster and Spodoptera frugiperda were refractory to infection. To recover virus from molecular clones, full-length cDNAs of PaV RNAs 1 and 2 were cotranscribed by T7 RNA polymerase in baby hamster kidney cells that expressed T7 RNA polymerase. Lysates of these cells were infectious both for cultured cells from Helicoverpa zea (corn earworm) and for larvae of Galleria mellonella (greater wax moth). The combination of infectious cDNA clones, cell culture infectivity, and the ability to produce milligram amounts of virus allows the application of DNA-based genetic methods to the study of PaV structure and assembly.

  15. orf260cra, a novel mitochondrial gene, is associated with the homeotic transformation of stamens into pistil-like structures (pistillody) in alloplasmic wheat.

    PubMed

    Zhu, Ye; Saraike, Tatsunori; Yamamoto, Yuko; Hagita, Hiroko; Takumi, Shigeo; Murai, Koji

    2008-11-01

    Homeotic transformation of stamens into pistil-like structures (pistillody) can occur in cytoplasmic substitution (alloplasmic) lines of bread wheat (Triticum aestivum) that have the cytoplasm of the related species, Aegilops crassa. Previously we showed that pistillody results from altered patterns of expression of class B MADS-box genes mediated by mitochondrial gene(s) in the Ae. crassa cytoplasm. The wheat cultivar Chinese Spring does not show pistillody when Ae. crassa cytoplasm is introduced. The absence of an effect is due to a single dominant gene (designated Rfd1) located on the long arm of chromosome 7B. To identify the mitochondrial gene involved in pistillody induction, we performed a subtraction analysis using cDNAs derived from young spikes of a pistillody line and a normal line. We found that mitochondrial cDNA clone R04 was abundant in the young spikes of the pistillody line but was down-regulated in the normal line that carried nuclear Rfd1. Sequencing of the full-length cDNA corresponding to clone R04 showed that two genes were present, cox I (cytochrome c oxidase subunit I) and orf260(cra). orf260(cra) shows high sequence similarity to orf256, the T. timopheevii mitochondrial gene responsible for cytoplasmic male sterility (CMS). orf260(cra) was also present in the cytoplasms of Ae. juvenalis and Ae. vavilovii, which induce pistillody, but not in the cytoplasms of other species not associated with pistillody. Furthermore, Western blot analysis revealed that the ORF260cra protein was more abundant in the pistillody line than in the normal line. We suggest therefore that orf260(cra) is associated with pistillody induction.

  16. Characterization and simulation of cDNA microarray spots using a novel mathematical model

    PubMed Central

    Kim, Hye Young; Lee, Seo Eun; Kim, Min Jung; Han, Jin Il; Kim, Bo Kyung; Lee, Yong Sung; Lee, Young Seek; Kim, Jin Hyuk

    2007-01-01

    Background The quality of cDNA microarray data is crucial for expanding its application to other research areas, such as the study of gene regulatory networks. Despite the fact that a number of algorithms have been suggested to increase the accuracy of microarray gene expression data, it is necessary to obtain reliable microarray images by improving wet-lab experiments. As the first step of a cDNA microarray experiment, spotting cDNA probes is critical to determining the quality of spot images. Results We developed a governing equation of cDNA deposition during evaporation of a drop in the microarray spotting process. The governing equation included four parameters: the surface site density on the support, the extrapolated equilibrium constant for the binding of cDNA molecules with surface sites on glass slides, the macromolecular interaction factor, and the volume constant of a drop of cDNA solution. We simulated cDNA deposition from the single model equation by varying the value of the parameters. The morphology of the resulting cDNA deposit can be classified into three types: a doughnut shape, a peak shape, and a volcano shape. The spot morphology can be changed into a flat shape by varying the experimental conditions while considering the parameters of the governing equation of cDNA deposition. The four parameters were estimated by fitting the governing equation to the real microarray images. With the results of the simulation and the parameter estimation, the phenomenon of the formation of cDNA deposits in each type was investigated. Conclusion This study explains how various spot shapes can exist and suggests which parameters are to be adjusted for obtaining a good spot. This system is able to explore the cDNA microarray spotting process in a predictable, manageable and descriptive manner. We hope it can provide a way to predict the incidents that can occur during a real cDNA microarray experiment, and produce useful data for several research applications involving cDNA microarrays. PMID:18096047

  17. Structure-function of proteins interacting with the α1 pore-forming subunit of high-voltage-activated calcium channels

    PubMed Central

    Neely, Alan; Hidalgo, Patricia

    2014-01-01

    Openings of high-voltage-activated (HVA) calcium channels lead to a transient increase in calcium concentration that in turn activate a plethora of cellular functions, including muscle contraction, secretion and gene transcription. To coordinate all these responses calcium channels form supramolecular assemblies containing effectors and regulatory proteins that couple calcium influx to the downstream signal cascades and to feedback elements. According to the original biochemical characterization of skeletal muscle Dihydropyridine receptors, HVA calcium channels are multi-subunit protein complexes consisting of a pore-forming subunit (α1) associated with four additional polypeptide chains β, α2, δ, and γ, often referred to as accessory subunits. Twenty-five years after the first purification of a high-voltage calcium channel, the concept of a flexible stoichiometry to expand the repertoire of mechanisms that regulate calcium channel influx has emerged. Several other proteins have been identified that associate directly with the α1-subunit, including calmodulin and multiple members of the small and large GTPase family. Some of these proteins only interact with a subset of α1-subunits and during specific stages of biogenesis. More strikingly, most of the α1-subunit interacting proteins, such as the β-subunit and small GTPases, regulate both gating and trafficking through a variety of mechanisms. Modulation of channel activity covers almost all biophysical properties of the channel. Likewise, regulation of the number of channels in the plasma membrane is performed by altering the release of the α1-subunit from the endoplasmic reticulum, by reducing its degradation or enhancing its recycling back to the cell surface. In this review, we discuss the structural basis, interplay and functional role of selected proteins that interact with the central pore-forming subunit of HVA calcium channels. PMID:24917826

  18. Virtual interface substructure synthesis method for normal mode analysis of super-large molecular complexes at atomic resolution.

    PubMed

    Chen, Xuehui; Sun, Yunxiang; An, Xiongbo; Ming, Dengming

    2011-10-14

    Normal mode analysis of large biomolecular complexes at atomic resolution remains challenging in computational structure biology due to the requirement of large amount of memory space and central processing unit time. In this paper, we present a method called virtual interface substructure synthesis method or VISSM to calculate approximate normal modes of large biomolecular complexes at atomic resolution. VISSM introduces the subunit interfaces as independent substructures that join contacting molecules so as to keep the integrity of the system. Compared with other approximate methods, VISSM delivers atomic modes with no need of a coarse-graining-then-projection procedure. The method was examined for 54 protein-complexes with the conventional all-atom normal mode analysis using CHARMM simulation program and the overlap of the first 100 low-frequency modes is greater than 0.7 for 49 complexes, indicating its accuracy and reliability. We then applied VISSM to the satellite panicum mosaic virus (SPMV, 78,300 atoms) and to F-actin filament structures of up to 39-mer, 228,813 atoms and found that VISSM calculations capture functionally important conformational changes accessible to these structures at atomic resolution. Our results support the idea that the dynamics of a large biomolecular complex might be understood based on the motions of its component subunits and the way in which subunits bind one another. © 2011 American Institute of Physics

  19. Development of a subunit vaccine for infectious pancreatic necrosis virus using a baculovirus insect/larvae system

    USGS Publications Warehouse

    Shivappa, R.B.; McAllister, P.E.; Edwards, G.H.; Santi, N.; Evensen, O.; Vakharia, V.N.; ,

    2005-01-01

    Various attempts to develop a vaccine against infectious pancreatic necrosis virus (IPNV) have not yielded consistent results. Thus, at present, no commercial vaccine is available that can be used with confidence to immunize fry of salmon and trout. We generated a cDNA clone of the large genome segment A of an IPNV Sp strain and expressed all structural protein genes in insect cells and larvae using a baculovirus expression system. Green fluorescent protein was also co-expressed as a reporter molecule. High yields of IPNV proteins were obtained and the structural proteins self assembled to form virus-like particles (VLPs). We tested the immunogenicity of the putative VLP antigen in immersion vaccine experiments (two concentrations) in rainbow trout (Oncorhynchus mykiss) fry, and by intraperitoneal immunisation of Atlantic salmon (Salmo salar) pre-smolts using an oil adjuvant formulation. Rainbow trout were challenged by immersion using either the Sp or the VR-299 strain of IPNV two or three weeks post-vaccination, while Atlantic salmon were bath challenged with Sp strain after two months, after parr-smolt transformation. In the rainbow trout fry challenged two weeks post-immunization, cumulative mortality rates three weeks post challenge were 14 % in the fry that had received the highest dose versus 8 % in the control groups. No indication of protection was seen in repeated trials using a lower dose of antigen and challenge three weeks post-immunisation. The cumulative mortality rate of intraperitoneally immunised Atlantic salmon post-smolts four weeks post challenge was lower (56 %) than in the control fish (77 %), showing a dose-response pattern.

  20. Impact of water regimes on an experimental community of four desert arbuscular mycorrhizal fungal (AMF) species, as affected by the introduction of a non-native AMF species.

    PubMed

    Symanczik, Sarah; Courty, Pierre-Emmanuel; Boller, Thomas; Wiemken, Andres; Al-Yahya'ei, Mohamed N

    2015-11-01

    Field studies have revealed the impact of changing water regimes on the structure of arbuscular mycorrhizal fungal (AMF) communities, but it is not known what happens to the abundance of individual AMF species within the community when the water conditions in the rhizosphere change. The behavior of four AMF species isolated from the Arabian desert (Diversispora aurantia, Diversispora omaniana, Septoglomus africanum, and an undescribed Paraglomus species) was investigated when assembled in microcosms containing Sorghum bicolor as host plant, and treated with various water regimes. Furthermore, the impact of invasion of these assemblages by Rhizophagus irregularis, an AMF species widely used in commercial inocula, was studied. The abundance of each AMF species in sorghum roots was measured by determining the transcript numbers of their large ribosomal subunit (rLSU) by real-time PCR, using cDNA and species-specific primers. Plant biomass and length of AMF extraradical hyphae were also measured. The abundance of each AMF species within the sorghum roots was influenced by both the water regime and the introduction of R. irregularis. Under dry conditions, the introduction of R. irregularis reduced the total abundance of all native AMF species in roots and also led to a reduction in the amount of extraradical mycelium, as well as to a partial decrease in plant biomass. The results indicate that both water regime and the introduction of an invasive AMF species can strongly alter the structure of an AMF native assemblage with a consequent impact on the entire symbiotic mycorrhizal relationship.

  1. Multisubunit DNA-Dependent RNA Polymerases from Vaccinia Virus and Other Nucleocytoplasmic Large-DNA Viruses: Impressions from the Age of Structure.

    PubMed

    Mirzakhanyan, Yeva; Gershon, Paul D

    2017-09-01

    The past 17 years have been marked by a revolution in our understanding of cellular multisubunit DNA-dependent RNA polymerases (MSDDRPs) at the structural level. A parallel development over the past 15 years has been the emerging story of the giant viruses, which encode MSDDRPs. Here we link the two in an attempt to understand the specialization of multisubunit RNA polymerases in the domain of life encompassing the large nucleocytoplasmic DNA viruses (NCLDV), a superclade that includes the giant viruses and the biochemically well-characterized poxvirus vaccinia virus. The first half of this review surveys the recently determined structural biology of cellular RNA polymerases for a microbiology readership. The second half discusses a reannotation of MSDDRP subunits from NCLDV families and the apparent specialization of these enzymes by virus family and by subunit with regard to subunit or domain loss, subunit dissociability, endogenous control of polymerase arrest, and the elimination/customization of regulatory interactions that would confer higher-order cellular control. Some themes are apparent in linking subunit function to structure in the viral world: as with cellular RNA polymerases I and III and unlike cellular RNA polymerase II, the viral enzymes seem to opt for speed and processivity and seem to have eliminated domains associated with higher-order regulation. The adoption/loss of viral RNA polymerase proofreading functions may have played a part in matching intrinsic mutability to genome size. Copyright © 2017 American Society for Microbiology.

  2. Cloning, sequence determination, and regulation of the ribonucleotide reductase subunits from Plasmodium falciparum: a target for antimalarial therapy.

    PubMed Central

    Rubin, H; Salem, J S; Li, L S; Yang, F D; Mama, S; Wang, Z M; Fisher, A; Hamann, C S; Cooperman, B S

    1993-01-01

    Malaria remains a leading cause of morbidity and mortality worldwide, accounting for more than one million deaths annually. We have focused on the reduction of ribonucleotides to 2'-deoxyribonucleotides, catalyzed by ribonucleotide reductase, which represents the rate-determining step in DNA replication as a target for antimalarial agents. We report the full-length DNA sequence corresponding to the large (PfR1) and small (PfR2) subunits of Plasmodium falciparum ribonucleotide reductase. The small subunit (PfR2) contains the major catalytic motif consisting of a tyrosyl radical and a dinuclear Fe site. Whereas PfR2 shares 59% amino acid identity with human R2, a striking sequence divergence between human R2 and PfR2 at the C terminus may provide a selective target for inhibition of the malarial enzyme. A synthetic oligopeptide corresponding to the C-terminal 7 residues of PfR2 inhibits mammalian ribonucleotide reductase at concentrations approximately 10-fold higher than that predicted to inhibit malarial R2. The gene encoding the large subunit (PfR1) contains a single intron. The cysteines thought to be involved in the reduction mechanism are conserved. In contrast to mammalian ribonucleotide reductase, the genes for PfR1 and PfR2 are located on the same chromosome and the accumulation of mRNAs for the two subunits follow different temporal patterns during the cell cycle. Images Fig. 2 Fig. 4 Fig. 5 PMID:8415692

  3. Constitutive Gαi coupling activity of very large G protein-coupled receptor 1 (VLGR1) and its regulation by PDZD7 protein.

    PubMed

    Hu, Qiao-Xia; Dong, Jun-Hong; Du, Hai-Bo; Zhang, Dao-Lai; Ren, Hong-Ze; Ma, Ming-Liang; Cai, Yuan; Zhao, Tong-Chao; Yin, Xiao-Lei; Yu, Xiao; Xue, Tian; Xu, Zhi-Gang; Sun, Jin-Peng

    2014-08-29

    The very large G protein-coupled receptor 1 (VLGR1) is a core component in inner ear hair cell development. Mutations in the vlgr1 gene cause Usher syndrome, the symptoms of which include congenital hearing loss and progressive retinitis pigmentosa. However, the mechanism of VLGR1-regulated intracellular signaling and its role in Usher syndrome remain elusive. Here, we show that VLGR1 is processed into two fragments after autocleavage at the G protein-coupled receptor proteolytic site. The cleaved VLGR1 β-subunit constitutively inhibited adenylate cyclase (AC) activity through Gαi coupling. Co-expression of the Gαiq chimera with the VLGR1 β-subunit changed its activity to the phospholipase C/nuclear factor of activated T cells signaling pathway, which demonstrates the Gαi protein coupling specificity of this subunit. An R6002A mutation in intracellular loop 2 of VLGR1 abolished Gαi coupling, but the pathogenic VLGR1 Y6236fsx1 mutant showed increased AC inhibition. Furthermore, overexpression of another Usher syndrome protein, PDZD7, decreased the AC inhibition of the VLGR1 β-subunit but showed no effect on the VLGR1 Y6236fsx1 mutant. Taken together, we identified an independent Gαi signaling pathway of the VLGR1 β-subunit and its regulatory mechanisms that may have a role in the development of Usher syndrome. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Catalytic Subunit 1 of Protein Phosphatase 2A Is a Subunit of the STRIPAK Complex and Governs Fungal Sexual Development.

    PubMed

    Beier, Anna; Teichert, Ines; Krisp, Christoph; Wolters, Dirk A; Kück, Ulrich

    2016-06-21

    The generation of complex three-dimensional structures is a key developmental step for most eukaryotic organisms. The details of the molecular machinery controlling this step remain to be determined. An excellent model system to study this general process is the generation of three-dimensional fruiting bodies in filamentous fungi like Sordaria macrospora Fruiting body development is controlled by subunits of the highly conserved striatin-interacting phosphatase and kinase (STRIPAK) complex, which has been described in organisms ranging from yeasts to humans. The highly conserved heterotrimeric protein phosphatase PP2A is a subunit of STRIPAK. Here, catalytic subunit 1 of PP2A was functionally characterized. The Δpp2Ac1 strain is sterile, unable to undergo hyphal fusion, and devoid of ascogonial septation. Further, PP2Ac1, together with STRIPAK subunit PRO22, governs vegetative and stress-related growth. We revealed in vitro catalytic activity of wild-type PP2Ac1, and our in vivo analysis showed that inactive PP2Ac1 blocks the complementation of the sterile deletion strain. Tandem affinity purification, followed by mass spectrometry and yeast two-hybrid analysis, verified that PP2Ac1 is a subunit of STRIPAK. Further, these data indicate links between the STRIPAK complex and other developmental signaling pathways, implying the presence of a large interconnected signaling network that controls eukaryotic developmental processes. The insights gained in our study can be transferred to higher eukaryotes and will be important for understanding eukaryotic cellular development in general. The striatin-interacting phosphatase and kinase (STRIPAK) complex is highly conserved from yeasts to humans and is an important regulator of numerous eukaryotic developmental processes, such as cellular signaling and cell development. Although functional insights into the STRIPAK complex are accumulating, the detailed molecular mechanisms of single subunits are only partially understood. The first fungal STRIPAK was described in Sordaria macrospora, which is a well-established model organism used to study the formation of fungal fruiting bodies, three-dimensional organ-like structures. We analyzed STRIPAK subunit PP2Ac1, catalytic subunit 1 of protein phosphatase PP2A, to study the importance of the catalytic activity of this protein during sexual development. The results of our yeast two-hybrid analysis and tandem affinity purification, followed by mass spectrometry, indicate that PP2Ac1 activity connects STRIPAK with other signaling pathways and thus forms a large interconnected signaling network. Copyright © 2016 Beier et al.

  5. Phylogenetic relationships of the Gomphales based on nuc-25S-rDNA, mit-12S-rDNA, and mit-atp6-DNA combined sequences

    Treesearch

    Admir J. Giachini; Kentaro Hosaka; Eduardo Nouhra; Joseph Spatafora; James M. Trappe

    2010-01-01

    Phylogenetic relationships among Geastrales, Gomphales, Hysterangiales, and Phallales were estimated via combined sequences: nuclear large subunit ribosomal DNA (nuc-25S-rDNA), mitochondrial small subunit ribosomal DNA (mit-12S-rDNA), and mitochondrial atp6 DNA (mit-atp6-DNA). Eighty-one taxa comprising 19 genera and 58 species...

  6. The ribosomes of Drosophila. II. Studies on intraspecific variation.

    PubMed

    Berger, E M; Weber, L

    1974-12-01

    Electrophoretic comparisons of 40S and 55S ribosomal subunit proteins from 18 strains of Drosophila melanogaster revealed the virtual absence of allelic variation. More detailed two-dimensional studies on the large subunit proteins in 6 of the strains demonstrated additional complexity but still no interstrain variation. The significance of these results is discussed with respect to present estimates of genic heterozygosity in natural populations.

  7. Dynamic contact network between ribosomal subunits enables rapid large-scale rotation during spontaneous translocation

    PubMed Central

    Bock, Lars V.; Blau, Christian; Vaiana, Andrea C.; Grubmüller, Helmut

    2015-01-01

    During ribosomal translation, the two ribosomal subunits remain associated through intersubunit bridges, despite rapid large-scale intersubunit rotation. The absence of large barriers hindering rotation is a prerequisite for rapid rotation. Here, we investigate how such a flat free-energy landscape is achieved, in particular considering the large shifts the bridges undergo at the periphery. The dynamics and energetics of the intersubunit contact network are studied using molecular dynamics simulations of the prokaryotic ribosome in intermediate states of spontaneous translocation. Based on observed occupancies of intersubunit contacts, residues were grouped into clusters. In addition to the central contact clusters, peripheral clusters were found to maintain strong steady interactions by changing contacts in the course of rotation. The peripheral B1 bridges are stabilized by a changing contact pattern of charged residues that adapts to the rotational state. In contrast, steady strong interactions of the B4 bridge are ensured by the flexible helix H34 following the movement of protein S15. The tRNAs which span the subunits contribute to the intersubunit binding enthalpy to an almost constant degree, despite their different positions in the ribosome. These mechanisms keep the intersubunit interaction strong and steady during rotation, thereby preventing dissociation and enabling rapid rotation. PMID:26109353

  8. Polypeptide composition of fraction 1 protein of the somatic hybrid between Petunia parodii and Petunia parviflora.

    PubMed

    Kumar, A; Wilson, D; Cocking, E C

    1981-04-01

    The analysis of the subunit polypeptide composition of Fraction 1 protein provides information on the expression of both chloroplast and nuclear genomes. Fraction 1 protein, isolated from leaves of the somatic hybrid plants derived form the fusion of protoplasts of Petunia parodii and P. parviflora, was analyzed for its subunit polypeptide composition by isoelectric focusing in 8 M urea. The fraction 1 protein enzyme oligomer in the somatic hybrid plants contained small subunits resulting from the expression of both parental nuclear genomes, but probably only one of the parental large subunits, namely that of P. parodii. The relevance of such somatic hybrid material for the study of nucleocytoplasmic interrelationship is discussed, as well as the use of these fraction 1 protein isoelectric focusing patterns for the analysis of taxonomic relationships in Petunia.

  9. The "Batman flap": a novel technique to repair a large central glabellar defect.

    PubMed

    Puviani, Mario; Curci, Marco

    2018-04-01

    Given the critical position of central glabella among the frontal, nasal, and supraorbital aesthetic subunits of the face, the reconstruction of large defects in this area represents a surgical challenge. We describe a surgical technique based on a modified, curved, A-T flap to repair a large glabellar defect. Our modification is useful for large glabellar defects because it enables the distribution of the tension all over the reconstruction sides, avoiding a stressed central area and the subsequent risk of necrosis; functionally, it respects the eyebrows position and since the advancement is parallel to their major axes, it avoids the reduction of the distance between them. The "Batman flap" enables reconstructing a glabellar defect, with a good aesthetical result and the respect of the relevant aesthetical subunits. © 2017 The International Society of Dermatology.

  10. The alpha subunit of Go modulates cell proliferation and differentiation through interactions with Necdin.

    PubMed

    Ju, Hyunhee; Lee, Sujin; Kang, Sunghak; Kim, Sung-Soo; Ghil, Sungho

    2014-07-10

    Heterotrimeric GTP-binding proteins (G-proteins) play an important role in mediating signal transduction generated by neurotransmitters or hormones. Go, a member of the Gi/Go subfamily, is the most abundant G-protein found in the brain. Recently, the alpha subunit of Go (Gαo) was characterized as an inducer of neuronal differentiation. However, its underlying molecular mechanisms have remained unclear to date, since the downstream effectors of Gαo are ambiguous. A neurally differentiated embryonal carcinoma-derived protein (Necdin) was isolated as an interacting partner for Gαo from a mouse brain cDNA library using yeast two-hybrid screening. Interactions between the proteins were confirmed with several affinity binding assays, both in vitro and in vivo. Necdin interacted directly and preferentially with activated Gαo, compared to wild-type protein. Interestingly, Gαo did not interact with Gαi, despite high sequence homology between the two proteins. We subsequently analyzed whether Gαo modulates the cellular activities of Necdin. Notably, expression of Gαo significantly augmented Necdin-mediated cellular responses, such as proliferation and differentiation. Moreover, activation of type 1 cannabinoid receptor (CB1R), a Gi/oα-coupled receptor, augmented cell growth suppression, which was mediated by Gαo and Necdin in U87MG cells containing CB1R, Gαo, and Necdin as normal components. These results collectively suggest that Necdin is a candidate downstream effector for Gαo. Our findings provide novel insights into the cellular roles of Gαo and its coupled receptor.

  11. The 1-aminocyclopropane-1-carboxylate synthase of Cucurbita. Purification, properties, expression in Escherichia coli, and primary structure determination by DNA sequence analysis.

    PubMed

    Sato, T; Oeller, P W; Theologis, A

    1991-02-25

    The key regulatory enzyme in the biosynthetic pathway of the plant hormone ethylene is 1-aminocyclopropane-1-carboxylic acid (ACC) synthase (EC 4.4.1.14). We have partially purified ACC synthase 6,000-fold from Cucurbita fruit tissue treated with indoleacetic acid + benzyladenine + aminooxyacetic acid + LiCl. The enzyme has a specific activity of 35,000 nmol/h/mg protein, a pH optimum of 9.5, an isoelectric point of 5.0, a Km of 17 microM with respect to S-adenosylmethionine, and is a dimer of two identical subunits of approximately 46,000 Da each. The subunit exists in vivo as a 55,000-Da species similar in size to the primary in vitro translation product. DNA sequence analysis of the cDNA clone pACC1 revealed that the coding region of the ACC synthase mRNA spans 493 amino acids corresponding to a 55,779-Da polypeptide; and expression of the coding sequence (pACC1) in Escherichia coli as a COOH terminus hybrid of beta-galactosidase or as a nonhybrid polypeptide catalyzed the conversion of S-adenosylmethionine to ACC (Sato, T., and Theologis, A. (1989) Proc. Natl. Acad. Sci. U.S.A. 86, 6621-6625). Immunoblotting experiments herein show that the molecular mass of the beta-galactosidase hybrid polypeptide is 170,000 Da, and the size of the largest nonhybrid polypeptide is 53,000 Da. The data suggest that the enzyme is post-translationally processed during protein purification.

  12. Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene.

    PubMed

    Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen

    2016-01-01

    The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5'-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5'-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5'-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle.

  13. Agonist- and subunit-dependent potentiation of glutamate receptors by a nootropic drug aniracetam.

    PubMed

    Tsuzuki, K; Takeuchi, T; Ozawa, S

    1992-11-01

    GluR1 and GluR2 cDNAs encoding non-NMDA subtypes of glutamate receptor were isolated from a rat brain cDNA library by Boulter et al. (Science, 249 (1990) 1033-1037). Functional receptors activated by kainate, alpha-amino-3-hydroxy-5-methyl-4-isoxazole propionate (AMPA) and glutamate were expressed in Xenopus oocytes injected with GluR1, GluR2 or a mixture of GluR1 and GluR2 RNAs. In GluR1-expressed oocytes, 1 mM aniracetam potentiated AMPA-induced currents by 99 +/- 10% (mean +/- S.E.M., n = 5) and glutamate-induced currents by 140 +/- 8% (n = 4), but little affected kainate-induced currents. Aniracetam was effective from a concentration of 0.1 mM, and it exhibited more conspicuous effects with the increase of the dose. In oocytes injected with GluR1 plus GluR2 RNAs, aniracetam more markedly potentiated current responses to AMPA and glutamate than those in oocytes injected with GluR1 RNA alone. For example, 1 mM aniracetam potentiated AMPA-induced currents by 396 +/- 76% (n = 4) and glutamate-induced currents by 970 +/- 65% (n = 5) in oocytes injected with 10% GluR1 and 90% GluR2 RNAs. In these oocytes, however, the potentiation of kainate-induced currents by 1 mM aniracetam was only 8 +/- 5% (n = 4). Thus, we conclude that the potentiation of the AMPA/kainate receptor by aniracetam depends on both species of agonists and subunit composition of the receptor.

  14. Characterization of a novel organic solute transporter homologue from Clonorchis sinensis

    PubMed Central

    Dai, Fuhong; Lee, Ji-Yun; Pak, Jhang Ho; Sohn, Woon-Mok

    2018-01-01

    Clonorchis sinensis is a liver fluke that can dwell in the bile ducts of mammals. Bile acid transporters function to maintain the homeostasis of bile acids in C. sinensis, as they induce physiological changes or have harmful effects on C. sinensis survival. The organic solute transporter (OST) transports mainly bile acid and belongs to the SLC51 subfamily of solute carrier transporters. OST plays a critical role in the recirculation of bile acids in higher animals. In this study, we cloned full-length cDNA of the 480-amino acid OST from C. sinensis (CsOST). Genomic analysis revealed 11 exons and nine introns. The CsOST protein had a ‘Solute_trans_a’ domain with 67% homology to Schistosoma japonicum OST. For further analysis, the CsOST protein sequence was split into the ordered domain (CsOST-N) at the N-terminus and disordered domain (CsOST-C) at the C-terminus. The tertiary structure of each domain was built using a threading-based method and determined by manual comparison. In a phylogenetic tree, the CsOST-N domain belonged to the OSTα and CsOST-C to the OSTβ clade. These two domains were more highly conserved with the OST α- and β-subunits at the structure level than at sequence level. These findings suggested that CsOST comprised the OST α- and β-subunits. CsOST was localized in the oral and ventral suckers and in the mesenchymal tissues abundant around the intestine, vitelline glands, uterus, and testes. This study provides fundamental data for the further understanding of homologues in other flukes. PMID:29702646

  15. Cloning and characterization of an 11S legumin, Car i 4, a major allergen in pecan.

    PubMed

    Sharma, Girdhari M; Irsigler, Andre; Dhanarajan, Pushparani; Ayuso, Rosalia; Bardina, Luda; Sampson, Hugh A; Roux, Kenneth H; Sathe, Shridhar K

    2011-09-14

    Among tree nut allergens, pecan allergens remain to be identified and characterized. The objective was to demonstrate the IgE-binding ability of pecan 11S legumin and characterize its sequential IgE-binding epitopes. The 11S legumin gene was amplified from a pecan cDNA library and expressed as a fusion protein in Escherichia coli. The native 11S legumin in pecan extract was identified by mass spectrometry/mass spectrometry (MS/MS). Sequential epitopes were determined by probing the overlapping peptides with three serum pools prepared from different patients' sera. A three-dimensional model was generated using almond legumin as a template and compared with known sequential epitopes on other allergenic tree nut homologues. Of 28 patients tested by dot blot, 16 (57%) bound to 11S legumin, designated Car i 4. MS/MS sequencing of native 11S legumin identified 33 kDa acidic and 20-22 kDa basic subunits. Both pecan and walnut seed protein extracts inhibited IgE binding to recombinant Car i 4, suggesting cross-reactivity with Jug r 4. Sequential epitope mapping results of Car i 4 revealed weak, moderate, and strong reactivity of serum pools against 10, 5, and 4 peptides, respectively. Seven peptides were recognized by all three serum pools, of which two were strongly reactive. The strongly reactive peptides were located in three discrete regions of the Car i 4 acidic subunit sequence (residues 118-132, 208-219, and 238-249). Homology modeling of Car i 4 revealed significant overlapping regions shared in common with other tree nut legumins.

  16. Molecular Characterization and Transcriptional Regulation Analysis of the Bovine PDHB Gene

    PubMed Central

    Li, Anning; Zhang, Yaran; Zhao, Zhidong; Wang, Mingming; Zan, Linsen

    2016-01-01

    The pyruvate dehydrogenase beta subunit (PDHB) is a subunit of pyruvate dehydrogenase (E1), which catalyzes pyruvate into acetyl-CoA and provides a linkage between the tricarboxylic acid cycle (TCA) and the glycolysis pathway. Previous studies demonstrated PDHB to be positively related to the intramuscular fat (IMF) content. However, the transcriptional regulation of PDHB remains unclear. In our present study, the cDNA of bovine PDHB was cloned and the genomic structure was analyzed. The phylogenetic tree showed bovine PDHB to be closely related to goat and sheep, and least related to chicken. Spatial expression pattern analysis revealed the products of bovine PDHB to be widely expressed with the highest level in the fat of testis. To understand the transcriptional regulation of bovine PDHB, 1899 base pairs (bp) of the 5’-regulatory region was cloned. Sequence analysis neither found consensus TATA-box nor CCAAT-box in the 5’-flanking region of bovine PDHB. However, a CpG island was predicted from nucleotides -284 to +117. Serial deletion constructs of the 5’-flanking region, evaluated in dual-luciferase reporter assay, revealed the core promoter to be located 490bp upstream from the transcription initiation site (+1). Electrophoretic mobility shift assay (EMSA) and chromatin immunoprecipitation assay (ChIP) in combination with asite-directed mutation experiment indicated both myogenin (MYOG) and the CCAAT/enhancer-binding protein beta (C/EBPß) to be important transcription factors for bovine PDHB in skeletal muscle cells and adipocytes. Our results provide an important basis for further investigation of the bovine PDHB function and regulation in cattle. PMID:27379520

  17. Distinct functions of neuromedin u and neuromedin s in orange-spotted grouper.

    PubMed

    Li, Shuisheng; Xiao, Ling; Liu, Qiongyu; Zheng, Binbin; Chen, Huapu; Liu, Xiaochun; Zhang, Yong; Lin, Haoran

    2015-10-01

    Neuromedin U (NMU) and neuromedin S (NMS) play inhibitory roles in the regulation of food intake and energy homeostasis in mammals. However, their functions are not clearly established in teleost fish. In the present study, nmu and nms homologs were identified in several fish species. Subsequently, their cDNA sequences were cloned from the orange-spotted grouper (Epinephelus coioides). Sequence analysis showed that the orange-spotted grouper Nmu proprotein contains a 21-amino acid mature Nmu peptide (Nmu-21). The Nms proprotein lost the typical mature Nms peptide, but it retains a putative 34-amino acid peptide (Nmsrp). In situ hybridization revealed that nmu- and nms-expressing cells are mainly localized in the hypothalamic regions associated with appetite regulation. Food deprivation decreased the hypothalamic nmu mRNA levels but induced an increase of nms mRNA levels. Periprandial expression analysis showed that hypothalamic expression of nmu increased significantly at 3 h post-feeding, while nms expression was elevated at the normal feeding time. I.p. injection of synthetic Nmu-21 peptide suppressed the hypothalamic neuropeptide y (npy) expression, while Nmsrp administration significantly increased the expression of npy and orexin in orange-spotted grouper. Furthermore, the mRNA levels of LH beta subunit (lhβ) and gh in the pituitary were significantly down-regulated after Nmu-21 peptide administration, while Nmsrp was able to significantly stimulate the expression of FSH beta subunit (fshβ), prolactin (prl), and somatolaction (sl). Our results indicate that nmu and nms possess distinct neuroendocrine functions and pituitary functions in the orange spotted grouper. © 2015 Society for Endocrinology.

  18. Determination of the Stoichiometry between α- and γ1 Subunits of the BK Channel Using LRET.

    PubMed

    Carrasquel-Ursulaez, Willy; Alvarez, Osvaldo; Bezanilla, Francisco; Latorre, Ramon

    2018-06-05

    Two families of accessory proteins, β and γ, modulate BK channel gating and pharmacology. Notably, in the absence of internal Ca 2+ , the γ1 subunit promotes a large shift of the BK conductance-voltage curve to more negative potentials. However, very little is known about how α- and γ1 subunits interact. In particular, the association stoichiometry between both subunits is unknown. Here, we propose a method to answer this question using lanthanide resonance energy transfer. The method assumes that the kinetics of lanthanide resonance energy transfer-sensitized emission of the donor double-labeled α/γ1 complex is the linear combination of the kinetics of the sensitized emission in single-labeled complexes. We used a lanthanide binding tag engineered either into the α- or the γ1 subunits to bind Tb +3 as the donor. The acceptor (BODIPY) was attached to the BK pore-blocker iberiotoxin. We determined that γ1 associates with the α-subunit with a maximal 1:1 stoichiometry. This method could be applied to determine the stoichiometry of association between proteins within heteromultimeric complexes. Copyright © 2018 Biophysical Society. Published by Elsevier Inc. All rights reserved.

  19. Structure of ratcheted ribosomes with tRNAs in hybrid states

    PubMed Central

    Julián, Patricia; Konevega, Andrey L.; Scheres, Sjors H. W.; Lázaro, Melisa; Gil, David; Wintermeyer, Wolfgang; Rodnina, Marina V.; Valle, Mikel

    2008-01-01

    During protein synthesis, tRNAs and mRNA move through the ribosome between aminoacyl (A), peptidyl (P), and exit (E) sites of the ribosome in a process called translocation. Translocation is accompanied by the displacement of the tRNAs on the large ribosomal subunit toward the hybrid A/P and P/E states and by a rotational movement (ratchet) of the ribosomal subunits relative to one another. So far, the structure of the ratcheted state has been observed only when translation factors were bound to the ribosome. Using cryo-electron microscopy and classification, we show here that ribosomes can spontaneously adopt a ratcheted conformation with tRNAs in their hybrid states. The peptidyl-tRNA molecule in the A/P state, which is visualized here, is not distorted compared with the A/A state except for slight adjustments of its acceptor end, suggesting that the displacement of the A-site tRNA on the 50S subunit is passive and is induced by the 30S subunit rotation. Simultaneous subunit ratchet and formation of the tRNA hybrid states precede and may promote the subsequent rapid and coordinated tRNA translocation on the 30S subunit catalyzed by elongation factor G. PMID:18971332

  20. The gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis contains a group I intron.

    PubMed Central

    De Wachter, R; Neefs, J M; Goris, A; Van de Peer, Y

    1992-01-01

    The nucleotide sequence of the gene coding for small ribosomal subunit RNA in the basidiomycete Ustilago maydis was determined. It revealed the presence of a group I intron with a length of 411 nucleotides. This is the third occurrence of such an intron discovered in a small subunit rRNA gene encoded by a eukaryotic nuclear genome. The other two occurrences are in Pneumocystis carinii, a fungus of uncertain taxonomic status, and Ankistrodesmus stipitatus, a green alga. The nucleotides of the conserved core structure of 101 group I intron sequences present in different genes and genome types were aligned and their evolutionary relatedness was examined. This revealed a cluster including all group I introns hitherto found in eukaryotic nuclear genes coding for small and large subunit rRNAs. A secondary structure model was designed for the area of the Ustilago maydis small ribosomal subunit RNA precursor where the intron is situated. It shows that the internal guide sequence pairing with the intron boundaries fits between two helices of the small subunit rRNA, and that minimal rearrangement of base pairs suffices to achieve the definitive secondary structure of the 18S rRNA upon splicing. PMID:1561081

  1. Three-dimensional crystals of ribosomes and their subunits from eu- and archaebacteria.

    PubMed

    Glotz, C; Müssig, J; Gewitz, H S; Makowski, I; Arad, T; Yonath, A; Wittmann, H G

    1987-11-01

    Ordered three-dimensional crystals of 70S ribosomes as well as of 30S and 50S ribosomal subunits from various bacteria (E. coli, Bacillus stearothermophilus, Thermus thermophilus and Halobacterium marismortui) have been grown by vapour diffusion in hanging drops using mono- and polyalcohols. A new compact crystal form of 50S subunits has been obtained, and it is suitable for crystallographic studies at medium resolution. In addition, from one crystal form large crystals could be grown in X-ray capillaries. In all cases the crystals were obtained from functionally active ribosomal particles, and the particles from dissolved crystals retained their integrity and biological activity.

  2. Minimap2: pairwise alignment for nucleotide sequences.

    PubMed

    Li, Heng

    2018-05-10

    Recent advances in sequencing technologies promise ultra-long reads of ∼100 kilo bases (kb) in average, full-length mRNA or cDNA reads in high throughput and genomic contigs over 100 mega bases (Mb) in length. Existing alignment programs are unable or inefficient to process such data at scale, which presses for the development of new alignment algorithms. Minimap2 is a general-purpose alignment program to map DNA or long mRNA sequences against a large reference database. It works with accurate short reads of ≥ 100bp in length, ≥1kb genomic reads at error rate ∼15%, full-length noisy Direct RNA or cDNA reads, and assembly contigs or closely related full chromosomes of hundreds of megabases in length. Minimap2 does split-read alignment, employs concave gap cost for long insertions and deletions (INDELs) and introduces new heuristics to reduce spurious alignments. It is 3-4 times as fast as mainstream short-read mappers at comparable accuracy, and is ≥30 times faster than long-read genomic or cDNA mappers at higher accuracy, surpassing most aligners specialized in one type of alignment. https://github.com/lh3/minimap2. hengli@broadinstitute.org.

  3. Electrotransfer of the full-length dog dystrophin into mouse and dystrophic dog muscles.

    PubMed

    Pichavant, Christophe; Chapdelaine, Pierre; Cerri, Daniel G; Bizario, Joao C S; Tremblay, Jacques P

    2010-11-01

    Duchenne muscular dystrophy (DMD) is an X-linked genetic disease characterized by the absence of dystrophin (427 kDa). An approach to eventually restore this protein in patients with DMD is to introduce into their muscles a plasmid encoding dystrophin cDNA. Because the phenotype of the dystrophic dog is closer to the human phenotype than is the mdx mouse phenotype, we have studied the electrotransfer of a plasmid carrying the full-length dog dystrophin (FLDYS(dog)) in dystrophic dog muscle. To achieve this nonviral delivery, the FLDYS(dog) cDNA was cloned in two plasmids containing either a cytomegalovirus or a muscle creatine kinase promoter. In both cases, our results showed that the electrotransfer of these large plasmids (∼17 kb) into mouse muscle allowed FLDYS(dog) expression in the treated muscle. The electrotransfer of pCMV.FLDYS(dog) in a dystrophic dog muscle also led to the expression of dystrophin. In conclusion, introduction of the full-length dog dystrophin cDNA by electrotransfer into dystrophic dog muscle is a potential approach to restore dystrophin in patients with DMD. However, the electrotransfer procedure should be improved before applying it to humans.

  4. Analysis and Functional Annotation of an Expressed Sequence Tag Collection for Tropical Crop Sugarcane

    PubMed Central

    Vettore, André L.; da Silva, Felipe R.; Kemper, Edson L.; Souza, Glaucia M.; da Silva, Aline M.; Ferro, Maria Inês T.; Henrique-Silva, Flavio; Giglioti, Éder A.; Lemos, Manoel V.F.; Coutinho, Luiz L.; Nobrega, Marina P.; Carrer, Helaine; França, Suzelei C.; Bacci, Maurício; Goldman, Maria Helena S.; Gomes, Suely L.; Nunes, Luiz R.; Camargo, Luis E.A.; Siqueira, Walter J.; Van Sluys, Marie-Anne; Thiemann, Otavio H.; Kuramae, Eiko E.; Santelli, Roberto V.; Marino, Celso L.; Targon, Maria L.P.N.; Ferro, Jesus A.; Silveira, Henrique C.S.; Marini, Danyelle C.; Lemos, Eliana G.M.; Monteiro-Vitorello, Claudia B.; Tambor, José H.M.; Carraro, Dirce M.; Roberto, Patrícia G.; Martins, Vanderlei G.; Goldman, Gustavo H.; de Oliveira, Regina C.; Truffi, Daniela; Colombo, Carlos A.; Rossi, Magdalena; de Araujo, Paula G.; Sculaccio, Susana A.; Angella, Aline; Lima, Marleide M.A.; de Rosa, Vicente E.; Siviero, Fábio; Coscrato, Virginia E.; Machado, Marcos A.; Grivet, Laurent; Di Mauro, Sonia M.Z.; Nobrega, Francisco G.; Menck, Carlos F.M.; Braga, Marilia D.V.; Telles, Guilherme P.; Cara, Frank A.A.; Pedrosa, Guilherme; Meidanis, João; Arruda, Paulo

    2003-01-01

    To contribute to our understanding of the genome complexity of sugarcane, we undertook a large-scale expressed sequence tag (EST) program. More than 260,000 cDNA clones were partially sequenced from 26 standard cDNA libraries generated from different sugarcane tissues. After the processing of the sequences, 237,954 high-quality ESTs were identified. These ESTs were assembled into 43,141 putative transcripts. Of the assembled sequences, 35.6% presented no matches with existing sequences in public databases. A global analysis of the whole SUCEST data set indicated that 14,409 assembled sequences (33% of the total) contained at least one cDNA clone with a full-length insert. Annotation of the 43,141 assembled sequences associated almost 50% of the putative identified sugarcane genes with protein metabolism, cellular communication/signal transduction, bioenergetics, and stress responses. Inspection of the translated assembled sequences for conserved protein domains revealed 40,821 amino acid sequences with 1415 Pfam domains. Reassembling the consensus sequences of the 43,141 transcripts revealed a 22% redundancy in the first assembling. This indicated that possibly 33,620 unique genes had been identified and indicated that >90% of the sugarcane expressed genes were tagged. PMID:14613979

  5. A large scale analysis of cDNA in Arabidopsis thaliana: generation of 12,028 non-redundant expressed sequence tags from normalized and size-selected cDNA libraries.

    PubMed

    Asamizu, E; Nakamura, Y; Sato, S; Tabata, S

    2000-06-30

    For comprehensive analysis of genes expressed in the model dicotyledonous plant, Arabidopsis thaliana, expressed sequence tags (ESTs) were accumulated. Normalized and size-selected cDNA libraries were constructed from aboveground organs, flower buds, roots, green siliques and liquid-cultured seedlings, respectively, and a total of 14,026 5'-end ESTs and 39,207 3'-end ESTs were obtained. The 3'-end ESTs could be clustered into 12,028 non-redundant groups. Similarity search of the non-redundant ESTs against the public non-redundant protein database indicated that 4816 groups show similarity to genes of known function, 1864 to hypothetical genes, and the remaining 5348 are novel sequences. Gene coverage by the non-redundant ESTs was analyzed using the annotated genomic sequences of approximately 10 Mb on chromosomes 3 and 5. A total of 923 regions were hit by at least one EST, among which only 499 regions were hit by the ESTs deposited in the public database. The result indicates that the EST source generated in this project complements the EST data in the public database and facilitates new gene discovery.

  6. Structural and functional homology between the RNAPI subunits A14/A43 and the archaeal RNAP subunits E/F

    PubMed Central

    Meka, Hedije; Daoust, Gregoire; Bourke Arnvig, Kristine; Werner, Finn; Brick, Peter; Onesti, Silvia

    2003-01-01

    In the archaeal RNA polymerase and the eukaryotic RNA polymerase II, two subunits (E/F and RPB4/RPB7, respectively) form a heterodimer that reversibly associates with the core of the enzyme. Recently it has emerged that this heterodimer also has a counterpart in the other eukaryotic RNA polymerases: in particular two subunits of RNA polymerase I (A14 and A43) display genetic and biochemical characteristics that are similar to those of the RPB4 and RPB7 subunits, despite the fact that only A43 shows some sequence homology to RPB7. We demonstrate that the sequence of A14 strongly suggests the presence of a HRDC domain, a motif that is found at the C-terminus of a number of helicases and RNases. The same motif is also seen in the structure of the F subunit, suggesting a structural link between A14 and the RPB4/C17/subunit F family, even in the absence of direct sequence homology. We show that it is possible to co-express and co-purify large amounts of the recombinant A14/A43 heterodimer, indicating a tight and specific interaction between the two subunits. To shed light on the function of the heterodimer, we performed gel mobility shift assays and showed that the A14/A43 heterodimer binds single-stranded RNA in a similar way to the archaeal E/F complex. PMID:12888498

  7. Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans

    PubMed Central

    Wojtyniak, Martin; Brear, Andrea G.; O'Halloran, Damien M.; Sengupta, Piali

    2013-01-01

    Summary Primary cilia are ubiquitous sensory organelles that concentrate transmembrane signaling proteins essential for sensing environmental cues. Mislocalization of crucial ciliary signaling proteins, such as the tetrameric cyclic nucleotide-gated (CNG) channels, can lead to cellular dysfunction and disease. Although several cis- and trans-acting factors required for ciliary protein trafficking and localization have been identified, whether these mechanisms act in a protein- and cell-specific manner is largely unknown. Here, we show that CNG channel subunits can be localized to discrete ciliary compartments in individual sensory neurons in C. elegans, suggesting that channel composition is heterogeneous across the cilium. We demonstrate that ciliary localization of CNG channel subunits is interdependent on different channel subunits in specific cells, and identify sequences required for efficient ciliary targeting and localization of the TAX-2 CNGB and TAX-4 CNGA subunits. Using a candidate gene approach, we show that Inversin, transition zone proteins, intraflagellar transport motors and a MYND-domain protein are required to traffic and/or localize CNG channel subunits in both a cell- and channel subunit-specific manner. We further find that TAX-2 and TAX-4 are relatively immobile in specific sensory cilia subcompartments, suggesting that these proteins undergo minimal turnover in these domains in mature cilia. Our results uncover unexpected diversity in the mechanisms that traffic and localize CNG channel subunits to cilia both within and across cell types, highlighting the essential contribution of this process to cellular functions. PMID:23886944

  8. Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans.

    PubMed

    Wojtyniak, Martin; Brear, Andrea G; O'Halloran, Damien M; Sengupta, Piali

    2013-10-01

    Primary cilia are ubiquitous sensory organelles that concentrate transmembrane signaling proteins essential for sensing environmental cues. Mislocalization of crucial ciliary signaling proteins, such as the tetrameric cyclic nucleotide-gated (CNG) channels, can lead to cellular dysfunction and disease. Although several cis- and trans-acting factors required for ciliary protein trafficking and localization have been identified, whether these mechanisms act in a protein- and cell-specific manner is largely unknown. Here, we show that CNG channel subunits can be localized to discrete ciliary compartments in individual sensory neurons in C. elegans, suggesting that channel composition is heterogeneous across the cilium. We demonstrate that ciliary localization of CNG channel subunits is interdependent on different channel subunits in specific cells, and identify sequences required for efficient ciliary targeting and localization of the TAX-2 CNGB and TAX-4 CNGA subunits. Using a candidate gene approach, we show that Inversin, transition zone proteins, intraflagellar transport motors and a MYND-domain protein are required to traffic and/or localize CNG channel subunits in both a cell- and channel subunit-specific manner. We further find that TAX-2 and TAX-4 are relatively immobile in specific sensory cilia subcompartments, suggesting that these proteins undergo minimal turnover in these domains in mature cilia. Our results uncover unexpected diversity in the mechanisms that traffic and localize CNG channel subunits to cilia both within and across cell types, highlighting the essential contribution of this process to cellular functions.

  9. Sequence of the cDNA of a human dihydrodiol dehydrogenase isoform (AKR1C2) and tissue distribution of its mRNA.

    PubMed Central

    Shiraishi, H; Ishikura, S; Matsuura, K; Deyashiki, Y; Ninomiya, M; Sakai, S; Hara, A

    1998-01-01

    Human liver contains three isoforms (DD1, DD2 and DD4) of dihydrodiol dehydrogenase with 20alpha- or 3alpha-hydroxysteroid dehydrogenase activity; the dehydrogenases belong to the aldo-oxo reductase (AKR) superfamily. cDNA species encoding DD1 and DD4 have been identified. However, four cDNA species with more than 99% sequence identity have been cloned and are compatible with a partial amino acid sequence of DD2. In this study we have isolated a cDNA clone encoding DD2, which was confirmed by comparison of the properties of the recombinant and hepatic enzymes. This cDNA showed differences of one, two, four and five nucleotides from the previously reported four cDNA species for a dehydrogenase of human colon carcinoma HT29 cells, human prostatic 3alpha-hydroxysteroid dehydrogenase, a human liver 3alpha-hydroxysteroid dehydrogenase-like protein and chlordecone reductase-like protein respectively. Expression of mRNA species for the five similar cDNA species in 20 liver samples and 10 other different tissue samples was examined by reverse transcriptase-mediated PCR with specific primers followed by diagnostic restriction with endonucleases. All the tissues expressed only one mRNA species corresponding to the newly identified cDNA for DD2: mRNA transcripts corresponding to the other cDNA species were not detected. We suggest that the new cDNA is derived from the principal gene for DD2, which has been named AKR1C2 by a new nomenclature for the AKR superfamily. It is possible that some of the other cDNA species previously reported are rare allelic variants of this gene. PMID:9716498

  10. Phylogenetic relationship of psychoactive fungi based on rRNA gene for a large subunit and their identification using the TaqMan assay (II).

    PubMed

    Maruyama, Takuro; Kawahara, Nobuo; Yokoyama, Kazumasa; Makino, Yukiko; Fukiharu, Toshimitsu; Goda, Yukihiro

    2006-11-10

    "Magic mushroom (MM)" is the name most commonly given to psychoactive fungi containing the hallucinogenic components: psilocin (1) and psilocybin (2). We investigated the rRNA gene (internal transcribed spacer (ITS) and large subunit (LSU)) of two Panaeolus species and four Psilocybe species fungi (of these, two are non-psilocybin species). On the basis of sequence alignment, we improved the identification system developed in our previous study. In this paper, we describe the new system capable of distinguishing MMs from non-psilocybin Psilocybe species, its application data and the phylogeny of MM species.

  11. Complete primary structure of rainbow trout type I collagen consisting of alpha1(I)alpha2(I)alpha3(I) heterotrimers.

    PubMed

    Saito, M; Takenouchi, Y; Kunisaki, N; Kimura, S

    2001-05-01

    The subunit compositions of skin and muscle type I collagens from rainbow trout were found to be alpha1(I)alpha2(I)alpha3(I) and [alpha1(I)](2)alpha2(I), respectively. The occurrence of alpha3(I) has been observed only for bonyfish. The skin collagen exhibited more susceptibility to both heat denaturation and MMP-13 digestion than the muscle counterpart; the former had a lower denaturation temperature by about 0.5 degrees C than the latter. The lower stability of skin collagen, however, is not due to the low levels of imino acids because the contents of Pro and Hyp were almost constant in both collagens. On the other hand, some cDNAs coding for the N-terminal and/or a part of triple-helical domains of proalpha(I) chains were cloned from the cDNA library of rainbow trout fibroblasts. These cDNAs together with the previously cloned collagen cDNAs gave information about the complete primary structure of type I procollagen. The main triple-helical domain of each proalpha(I) chain had 338 uninterrupted Gly-X-Y triplets consisting of 1014 amino acids and was unique in its high content of Gly-Gly doublets. In particular, the bonyfish-specific alpha(I) chain, proalpha3(I) was characterized by the small number of Gly-Pro-Pro triplets, 19, and the large number of Gly-Gly doublets, 38, in the triple-helical domain, compared to 23 and 22, respectively, for proalpha1(I). The small number of Gly-Pro-Pro and the large number of Gly-Gly in proalpha3(I) was assumed to partially loosen the triple-helical structure of skin collagen, leading to the lower stability of skin collagen mentioned above. Finally, phylogenetic analyses revealed that proalpha3(I) had diverged from proalpha1(I). This study is the first report of the complete primary structure of fish type I procollagen.

  12. Functional Differentiation of SWI/SNF Remodelers in Transcription and Cell Cycle Control▿ †

    PubMed Central

    Moshkin, Yuri M.; Mohrmann, Lisette; van Ijcken, Wilfred F. J.; Verrijzer, C. Peter

    2007-01-01

    Drosophila BAP and PBAP represent two evolutionarily conserved subclasses of SWI/SNF chromatin remodelers. The two complexes share the same core subunits, including the BRM ATPase, but differ in a few signature subunits: OSA defines BAP, whereas Polybromo (PB) and BAP170 specify PBAP. Here, we present a comprehensive structure-function analysis of BAP and PBAP. An RNA interference knockdown survey revealed that the core subunits BRM and MOR are critical for the structural integrity of both complexes. Whole-genome expression profiling suggested that the SWI/SNF core complex is largely dysfunctional in cells. Regulation of the majority of target genes required the signature subunit OSA, PB, or BAP170, suggesting that SWI/SNF remodelers function mostly as holoenzymes. BAP and PBAP execute similar, independent, or antagonistic functions in transcription control and appear to direct mostly distinct biological processes. BAP, but not PBAP, is required for cell cycle progression through mitosis. Because in yeast the PBAP-homologous complex, RSC, controls cell cycle progression, our finding reveals a functional switch during evolution. BAP mediates G2/M transition through direct regulation of string/cdc25. Its signature subunit, OSA, is required for directing BAP to the string/cdc25 promoter. Our results suggest that the core subunits play architectural and enzymatic roles but that the signature subunits determine most of the functional specificity of SWI/SNF holoenzymes in general gene control. PMID:17101803

  13. HupW Protease Specifically Required for Processing of the Catalytic Subunit of the Uptake Hydrogenase in the Cyanobacterium Nostoc sp. Strain PCC 7120

    PubMed Central

    Lindberg, Pia; Devine, Ellenor; Stensjö, Karin

    2012-01-01

    The maturation process of [NiFe] hydrogenases includes a proteolytic cleavage of the large subunit. We constructed a mutant of Nostoc strain PCC 7120 in which hupW, encoding a putative hydrogenase-specific protease, is inactivated. Our results indicate that the protein product of hupW selectively cleaves the uptake hydrogenase in this cyanobacterium. PMID:22020512

  14. Large subunit of the ribonucleotide reductase gene is a virulent factor and plays a critical role in Marek's disease virus pathogenesis

    USDA-ARS?s Scientific Manuscript database

    Marek’s disease virus (MDV) encodes a ribonucleotide reductase (RR) gene consisting of two subunits UL39 (RR1) and UL40 (RR2). Both RR1 and RR2 form an active holoenzyme and are necessary for enzyme activity. This gene was indentified by monoclonal antibody T81 in a gt11 MDV expression library and f...

  15. Screening and identification of gastric adenocarcinoma metastasis-related genes by using cDNA microarray coupled to FDD-PCR.

    PubMed

    Wang, Jian-Hua; Chen, Shi-Shu

    2002-07-01

    To clone gastric adenocarcinoma metastasis related genes, RF-1 cell line (primary tumor of a gastric adenocarcinoma patient ) and RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by reverse transcription method. The two color probes were then mixed and hybridized to the cDNA chip constructed by double-dots of 4 096 human genes, and scanned at two wavelengths. The experiment was repeated for 2 times. Differential expression genes from the above two cells were analyzed using the computer. 138 in all genes (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81(2.1%) genes revealed apparent up-regulation, and 56(1.3%) genes revealed down-regulation. 45 genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including 3 novel genes. There were 7 differential expression genes that agreed with each other in two detection methods. The possible roles of some differential expressed genes, which maybe involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large scale manner, in combination with FDD-PCR for cloning unknown novel genes. In conclusion, some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis.

  16. The N-terminus of RPA large subunit and its spatial position are important for the 5'->3' resection of DNA double-strand breaks.

    PubMed

    Tammaro, Margaret; Liao, Shuren; McCane, Jill; Yan, Hong

    2015-10-15

    The first step of homology-dependent repair of DNA double-strand breaks (DSBs) is the resection of the 5' strand to generate 3' ss-DNA. Of the two major nucleases responsible for resection, EXO1 has intrinsic 5'->3' directionality, but DNA2 does not. DNA2 acts with RecQ helicases such as the Werner syndrome protein (WRN) and the heterotrimeric eukaryotic ss-DNA binding protein RPA. We have found that the N-terminus of the RPA large subunit (RPA1N) interacts with both WRN and DNA2 and is essential for stimulating WRN's 3'->5' helicase activity and DNA2's 5'->3' ss-DNA exonuclease activity. A mutant RPA complex that lacks RPA1N is unable to support resection in Xenopus egg extracts and human cells. Furthermore, relocating RPA1N to the middle subunit but not to the small subunit causes severe defects in stimulating DNA2 and WRN and in supporting resection. Together, these findings suggest that RPA1N and its spatial position are critical for restricting the directionality of the WRN-DNA2 resection pathway. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

  17. The N-terminus of RPA large subunit and its spatial position are important for the 5′->3′ resection of DNA double-strand breaks

    PubMed Central

    Tammaro, Margaret; Liao, Shuren; McCane, Jill; Yan, Hong

    2015-01-01

    The first step of homology-dependent repair of DNA double-strand breaks (DSBs) is the resection of the 5′ strand to generate 3′ ss-DNA. Of the two major nucleases responsible for resection, EXO1 has intrinsic 5′->3′ directionality, but DNA2 does not. DNA2 acts with RecQ helicases such as the Werner syndrome protein (WRN) and the heterotrimeric eukaryotic ss-DNA binding protein RPA. We have found that the N-terminus of the RPA large subunit (RPA1N) interacts with both WRN and DNA2 and is essential for stimulating WRN's 3′->5′ helicase activity and DNA2's 5′->3′ ss-DNA exonuclease activity. A mutant RPA complex that lacks RPA1N is unable to support resection in Xenopus egg extracts and human cells. Furthermore, relocating RPA1N to the middle subunit but not to the small subunit causes severe defects in stimulating DNA2 and WRN and in supporting resection. Together, these findings suggest that RPA1N and its spatial position are critical for restricting the directionality of the WRN-DNA2 resection pathway. PMID:26227969

  18. Analysis of large-scale gene expression data.

    PubMed

    Sherlock, G

    2000-04-01

    The advent of cDNA and oligonucleotide microarray technologies has led to a paradigm shift in biological investigation, such that the bottleneck in research is shifting from data generation to data analysis. Hierarchical clustering, divisive clustering, self-organizing maps and k-means clustering have all been recently used to make sense of this mass of data.

  19. Production of Human Albumin in Pigs Through CRISPR/Cas9-Mediated Knockin of Human cDNA into Swine Albumin Locus in the Zygotes.

    PubMed

    Peng, Jin; Wang, Yong; Jiang, Junyi; Zhou, Xiaoyang; Song, Lei; Wang, Lulu; Ding, Chen; Qin, Jun; Liu, Liping; Wang, Weihua; Liu, Jianqiao; Huang, Xingxu; Wei, Hong; Zhang, Pumin

    2015-11-12

    Precise genome modification in large domesticated animals is desirable under many circumstances. In the past it is only possible through lengthy and burdensome cloning procedures. Here we attempted to achieve that goal through the use of the newest genome-modifying tool CRISPR/Cas9. We set out to knockin human albumin cDNA into pig Alb locus for the production of recombinant human serum albumin (rHSA). HSA is a widely used human blood product and is in high demand. We show that homologous recombination can occur highly efficiently in swine zygotes. All 16 piglets born from the manipulated zygotes carry the expected knockin allele and we demonstrated the presence of human albumin in the blood of these piglets. Furthermore, the knockin allele was successfully transmitted through germline. This success in precision genomic engineering is expected to spur exploration of pigs and other large domesticated animals to be used as bioreactors for the production of biomedical products or creation of livestock strains with more desirable traits.

  20. Cooperative macromolecular device revealed by meta-analysis of static and time-resolved structures

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Ren, Zhong; Šrajer, Vukica; Knapp, James E.

    2013-04-08

    Here we present a meta-analysis of a large collection of static structures of a protein in the Protein Data Bank in order to extract the progression of structural events during protein function. We apply this strategy to the homodimeric hemoglobin HbI from Scapharca inaequivalvis. We derive a simple dynamic model describing how binding of the first ligand in one of the two chemically identical subunits facilitates a second binding event in the other partner subunit. The results of our ultrafast time-resolved crystallographic studies support this model. We demonstrate that HbI functions like a homodimeric mechanical device, such as pliers ormore » scissors. Ligand-induced motion originating in one subunit is transmitted to the other via conserved pivot points, where the E and F' helices from two partner subunits are 'bolted' together to form a stable dimer interface permitting slight relative rotation but preventing sliding.« less

  1. Cell-free synthesis of membrane subunits of ATP synthase in phospholipid bicelles: NMR shows subunit a fold similar to the protein in the cell membrane

    PubMed Central

    Uhlemann, Eva-Maria E; Pierson, Hannah E; Fillingame, Robert H; Dmitriev, Oleg Y

    2012-01-01

    NMR structure determination of large membrane proteins is hampered by broad spectral lines, overlap, and ambiguity of signal assignment. Chemical shift and NOE assignment can be facilitated by amino acid selective isotope labeling in cell-free protein synthesis system. However, many biological detergents are incompatible with the cell-free synthesis, and membrane proteins often have to be synthesized in an insoluble form. We report cell-free synthesis of subunits a and c of the proton channel of Escherichia coli ATP synthase in a soluble form in a mixture of phosphatidylcholine derivatives. In comparison, subunit a was purified from the cell-free system and from the bacterial cell membranes. NMR spectra of both preparations were similar, indicating that our procedure for cell-free synthesis produces protein structurally similar to that prepared from the cell membranes. PMID:22162071

  2. Molecular Characterization of the Skate Peripherin/rds Gene: Relationship to Its Orthologues and Paralogues

    PubMed Central

    Li, Chibo; Ding, Xi-Qin; O’Brien, John; Al-Ubaidi, Muayyad R.

    2010-01-01

    PURPOSE A great deal of information about functionally significant domains of a protein may be obtained by comparison of primary sequences of gene homologues over a broad phylogenetic base. This study was designed to identify evolutionarily conserved domains of the photoreceptor disc membrane protein peripherin/rds by analysis of the homologue in a primitive vertebrate, the skate. METHODS A skate retinal cDNA library was screened using a mouse peripherin/rds clone. The 5′ and 3′ untranslated regions of the skate peripherin/rds (srds) cDNA were isolated by the rapid amplification of cDNA ends (RACE) approach. The gene structure was characterized by PCR amplification and sequencing of genomic fragments. Northern and Western blot analyses were used to identify srds transcript and protein, respectively. RESULTS A new homologue of peripherin/rds was identified from the skate retinal cDNA library. SRDS is a glycoprotein with a predicted molecular mass of 40.2 kDa. The srds gene consists of two exons and one small intron and transcribes into a single 6-kb message. Phylogenetic analysis places SRDS at the base of peripherin/rds family and near the division of that group and the branch leading to rds-like and rom-1 genes. SRDS protein is 54.5% identical with peripherin/rds across species. Identity is significantly higher (73%) in the intradiscal domains. Sequence comparison revealed the conservation of all residues that have been shown, on mutation, to associate with retinitis pigmentosa and showed conservation of most residues associated with macular dystrophies. Comparison with ROM-1 and other rds-like proteins revealed the presence of a highly conserved domain in the large intradiscal loop. CONCLUSIONS Srds represents the skate orthologue of mammalian peripherin/rds genes. Conservation of most of the residues associated with human retinal diseases indicates that these residues serve important functional roles. The high degree of conservation of a short stretch within the large intradiscal loop also suggests an important function for this domain. PMID:12766040

  3. Ribosome Biogenesis in African Trypanosomes Requires Conserved and Trypanosome-Specific Factors

    PubMed Central

    Umaer, Khan; Ciganda, Martin

    2014-01-01

    Large ribosomal subunit protein L5 is responsible for the stability and trafficking of 5S rRNA to the site of eukaryotic ribosomal assembly. In Trypanosoma brucei, in addition to L5, trypanosome-specific proteins P34 and P37 also participate in this process. These two essential proteins form a novel preribosomal particle through interactions with both the ribosomal protein L5 and 5S rRNA. We have generated a procyclic L5 RNA interference cell line and found that L5 itself is a protein essential for trypanosome growth, despite the presence of other 5S rRNA binding proteins. Loss of L5 decreases the levels of all large-subunit rRNAs, 25/28S, 5.8S, and 5S rRNAs, but does not alter small-subunit 18S rRNA. Depletion of L5 specifically reduced the levels of the other large ribosomal proteins, L3 and L11, whereas the steady-state levels of the mRNA for these proteins were increased. L5-knockdown cells showed an increase in the 40S ribosomal subunit and a loss of the 60S ribosomal subunits, 80S monosomes, and polysomes. In addition, L5 was involved in the processing and maturation of precursor rRNAs. Analysis of polysomal fractions revealed that unprocessed rRNA intermediates accumulate in the ribosome when L5 is depleted. Although we previously found that the loss of P34 and P37 does not result in a change in the levels of L5, the loss of L5 resulted in an increase of P34 and P37 proteins, suggesting the presence of a compensatory feedback loop. This study demonstrates that ribosomal protein L5 has conserved functions, in addition to nonconserved trypanosome-specific features, which could be targeted for drug intervention. PMID:24706018

  4. The β subunit of the high-conductance calcium-activated potassium channel contributes to the high-affinity receptor for charybdotoxin

    PubMed Central

    Hanner, Markus; Schmalhofer, William A.; Munujos, Petraki; Knaus, Hans-Günther; Kaczorowski, Gregory J.; Garcia, Maria L.

    1997-01-01

    Transient expression of either α or α+β subunits of the high-conductance Ca2+-activated K+ (maxi-K) channel has been achieved in COS-1 cells. Expression has been studied using charybdotoxin (ChTX), a peptidyl inhibitor that binds in the pore on the α subunit. Although some properties of monoiodotyrosine-ChTX (125I-ChTX) binding to membranes derived from each type of transfected cells appear to be identical, other parameters of the binding reaction are markedly different. Under low ionic strength conditions, the affinity constant for 125I-ChTX measured under equilibrium binding conditions is increased ca. 50-fold in the presence of the β subunit. The rate constant for 125I-ChTX association is enhanced ca. 5-fold, whereas the dissociation rate constant is decreased more than 7-fold when the β subunit is present. These data indicate that functional coassembly of maxi-K channel subunits can be obtained in a transient expression system, and that the β subunit has profound effects on 125I-ChTX binding. We postulate that certain negatively charged residues in the large extracellular loop of β attract the positively charged 125I-ChTX to its binding site on α through electrostatic interactions, and account for effects observed on ligand association kinetics. Moreover, another residue(s) in the loop of β must contribute to stabilization of the toxin-bound state, either by a direct interaction with toxin, or through an allosteric effect on the α subunit. Certain regions in the extracellular loop of the β subunit may be in close proximity to the pore of the channel, and could play an important role in maxi-K channel function. PMID:9096310

  5. Alteration of GABAergic synapses and gephyrin clusters in the thalamic reticular nucleus of GABAA receptor alpha3 subunit-null mice.

    PubMed

    Studer, Remo; von Boehmer, Lotta; Haenggi, Tatjana; Schweizer, Claude; Benke, Dietmar; Rudolph, Uwe; Fritschy, Jean-Marc

    2006-09-01

    Multiple GABAA-receptor subtypes are assembled from alpha, beta and gamma subunit variants. GABAA receptors containing the alpha3 subunit represent a minor population with a restricted distribution in the CNS. In addition, they predominate in monoaminergic neurons and in the nucleus reticularis thalami (nRT), suggesting a role in the regulation of cortical function and sleep. Mice with a targeted deletion of the alpha3 subunit gene (alpha3(0/0)) are viable and exhibit a subtle behavioural phenotype possibly related to dopaminergic hyperfunction. Here, we investigated immunohistochemically the consequences of the loss of alpha3 subunit for maturation of GABAA receptors and formation of GABAergic synapses in the nRT. Throughout postnatal development, the regional distribution of the alpha1, alpha2, or alpha5 subunit was unaltered in alpha3(0/0) mice and the prominent alpha3 subunit staining of nRT neurons in wildtype mice was not replaced. Subcellularly, as seen by double immunofluorescence, the alpha3 and gamma2 subunit were clustered at postsynaptic sites in the nRT of adult wildtype mice along with the scaffolding protein gephyrin. In alpha3(0/0) mice, gamma2 subunit clustering was disrupted and gephyrin formed large aggregates localized at the cell surface, but unrelated to postsynaptic sites, indicating that nRT neurons lack postsynaptic GABAA receptors in mutant mice. Furthermore, GABAergic terminals were enlarged and reduced in number, suggesting a partial deficit of GABAergic synapses. Therefore, GABAA receptors are required for gephyrin clustering and long-term synapse maintenance. The absence of GABAA-mediated transmission in the nRT may have a significant impact on the function of the thalamo-cortical loop of alpha3(0/0) mice.

  6. Potential involvement of N-terminal acetylation in the quantitative regulation of the ε subunit of chloroplast ATP synthase under drought stress.

    PubMed

    Hoshiyasu, Saki; Kohzuma, Kaori; Yoshida, Kazuo; Fujiwara, Masayuki; Fukao, Yoichiro; Yokota, Akiho; Akashi, Kinya

    2013-01-01

    In plants, modulation of photosynthetic energy conversion in varying environments is often accompanied by adjustment of the abundance of photosynthetic components. In wild watermelon (Citrullus lanatus L.), proteome analysis revealed that the ε subunit of chloroplast ATP synthase occurs as two distinct isoforms with largely-different isoelectric points, although encoded by a single gene. Mass spectrometry (MS) analysis of the ε isoforms indicated that the structural difference between the ε isoforms lies in the presence or absence of an acetyl group at the N-terminus. The protein level of the non-acetylated ε isoform preferentially decreased in drought, whereas the abundance of the acetylated ε isoform was unchanged. Moreover, metalloprotease activity that decomposed the ε subunit was detected in a leaf extract from drought-stressed plants. Furthermore, in vitro assay suggested that the non-acetylated ε subunit was more susceptible to degradation by metalloaminopeptidase. We propose a model in which quantitative regulation of the ε subunit involves N-terminal acetylation and stress-induced proteases.

  7. Testis-specific ATP synthase peripheral stalk subunits required for tissue-specific mitochondrial morphogenesis in Drosophila.

    PubMed

    Sawyer, Eric M; Brunner, Elizabeth C; Hwang, Yihharn; Ivey, Lauren E; Brown, Olivia; Bannon, Megan; Akrobetu, Dennis; Sheaffer, Kelsey E; Morgan, Oshauna; Field, Conroy O; Suresh, Nishita; Gordon, M Grace; Gunnell, E Taylor; Regruto, Lindsay A; Wood, Cricket G; Fuller, Margaret T; Hales, Karen G

    2017-03-23

    In Drosophila early post-meiotic spermatids, mitochondria undergo dramatic shaping into the Nebenkern, a spherical body with complex internal structure that contains two interwrapped giant mitochondrial derivatives. The purpose of this study was to elucidate genetic and molecular mechanisms underlying the shaping of this structure. The knotted onions (knon) gene encodes an unconventionally large testis-specific paralog of ATP synthase subunit d and is required for internal structure of the Nebenkern as well as its subsequent disassembly and elongation. Knon localizes to spermatid mitochondria and, when exogenously expressed in flight muscle, alters the ratio of ATP synthase complex dimers to monomers. By RNAi knockdown we uncovered mitochondrial shaping roles for other testis-expressed ATP synthase subunits. We demonstrate the first known instance of a tissue-specific ATP synthase subunit affecting tissue-specific mitochondrial morphogenesis. Since ATP synthase dimerization is known to affect the degree of inner mitochondrial membrane curvature in other systems, the effect of Knon and other testis-specific paralogs of ATP synthase subunits may be to mediate differential membrane curvature within the Nebenkern.

  8. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls

    NASA Astrophysics Data System (ADS)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T. V.; Alyethodi, Rafeeque R.; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B.

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly ( P < 0.05) higher during the thermal stress. Pearson correlation coefficient analysis revealed that the expression of ATPase Β1, ATPase B2, and ATPase B3 is highly correlated ( P < 0.01) with HSP70, representing that the change in the expression pattern of these genes is positive and synergistic. These may provide a foundation for understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in cattle.

  9. cDNA cloning of Brassica napus malonyl-CoA:ACP transacylase (MCAT) (fab D) and complementation of an E. coli MCAT mutant.

    PubMed

    Simon, J W; Slabas, A R

    1998-09-18

    The GenBank database was searched using the E. coli malonyl CoA:ACP transacylase (MCAT) sequence, for plant protein/cDNA sequences corresponding to MCAT, a component of plant fatty acid synthetase (FAS), for which the plant cDNA has not been isolated. A 272-bp Zea mays EST sequence (GenBank accession number: AA030706) was identified which has strong homology to the E. coli MCAT. A PCR derived cDNA probe from Zea mays was used to screen a Brassica napus (rape) cDNA library. This resulted in the isolation of a 1200-bp cDNA clone which encodes an open reading frame corresponding to a protein of 351 amino acids. The protein shows 47% homology to the E. coli MCAT amino acid sequence in the coding region for the mature protein. Expression of a plasmid (pMCATrap2) containing the plant cDNA sequence in Fab D89, an E. coli mutant, in MCAT activity restores growth demonstrating functional complementation and direct function of the cloned cDNA. This is the first functional evidence supporting the identification of a plant cDNA for MCAT.

  10. The Glucoamylase Inhibitor Acarbose Is a Direct Activator of Phosphorylase Kinase

    PubMed Central

    Nadeau, Owen W.; Liu, Weiya; Boulatnikov, Igor G.; Sage, Jessica M.; Peters, Jennifer L.; Carlson, Gerald M.

    2011-01-01

    Phosphorylase kinase (PhK), an (αβγδ)4 complex, stimulates energy production from glycogen in the cascade activation of glycogenolysis. Its large homologous α and β subunits regulate the activity of the catalytic γ subunit and account for 81% of PhK’s mass. Both subunits are thought to be multi-domain structures, and recent predictions based on their sequences suggest the presence of potentially functional glucoamylase (GH15)-like domains near their amino-termini. We present the first experimental evidence for such a domain in PhK, by demonstrating that the glucoamylase inhibitor acarbose binds PhK, perturbs its structure, and stimulates its kinase activity. PMID:20604537

  11. Eukaryotic RNA polymerase subunit RPB8 is a new relative of the OB family.

    PubMed

    Krapp, S; Kelly, G; Reischl, J; Weinzierl, R O; Matthews, S

    1998-02-01

    RNA polymerase II subunit RPB8 is an essential subunit that is highly conserved throughout eukaryotic evolution and is present in all three types of nuclear RNA polymerases. We report the first high resolution structural insight into eukaryotic RNA polymerase architecture with the solution structure of RPB8 from Saccharomyces cerevisiae. It consists of an eight stranded, antiparallel beta-barrel, four short helical regions and a large, unstructured omega-loop. The strands are connected in classic Greek-key fashion. The overall topology is unusual and contains a striking C2 rotational symmetry. Furthermore, it is most likely a novel associate of the oligonucleotide/oligosaccharide (OB) binding protein class.

  12. B56δ-related protein phosphatase 2A dysfunction identified in patients with intellectual disability

    PubMed Central

    Houge, Gunnar; Haesen, Dorien; Vissers, Lisenka E.L.M.; Mehta, Sarju; Parker, Michael J.; Wright, Michael; Vogt, Julie; McKee, Shane; Tolmie, John L.; Cordeiro, Nuno; Kleefstra, Tjitske; Willemsen, Marjolein H.; Reijnders, Margot R.F.; Berland, Siren; Hayman, Eli; Lahat, Eli; Brilstra, Eva H.; van Gassen, Koen L.I.; Zonneveld-Huijssoon, Evelien; de Bie, Charlotte I.; Hoischen, Alexander; Eichler, Evan E.; Holdhus, Rita; Steen, Vidar M.; Døskeland, Stein Ove; Hurles, Matthew E.; FitzPatrick, David R.; Janssens, Veerle

    2015-01-01

    Here we report inherited dysregulation of protein phosphatase activity as a cause of intellectual disability (ID). De novo missense mutations in 2 subunits of serine/threonine (Ser/Thr) protein phosphatase 2A (PP2A) were identified in 16 individuals with mild to severe ID, long-lasting hypotonia, epileptic susceptibility, frontal bossing, mild hypertelorism, and downslanting palpebral fissures. PP2A comprises catalytic (C), scaffolding (A), and regulatory (B) subunits that determine subcellular anchoring, substrate specificity, and physiological function. Ten patients had mutations within a highly conserved acidic loop of the PPP2R5D-encoded B56δ regulatory subunit, with the same E198K mutation present in 6 individuals. Five patients had mutations in the PPP2R1A-encoded scaffolding Aα subunit, with the same R182W mutation in 3 individuals. Some Aα cases presented with large ventricles, causing macrocephaly and hydrocephalus suspicion, and all cases exhibited partial or complete corpus callosum agenesis. Functional evaluation revealed that mutant A and B subunits were stable and uncoupled from phosphatase activity. Mutant B56δ was A and C binding–deficient, while mutant Aα subunits bound B56δ well but were unable to bind C or bound a catalytically impaired C, suggesting a dominant-negative effect where mutant subunits hinder dephosphorylation of B56δ-anchored substrates. Moreover, mutant subunit overexpression resulted in hyperphosphorylation of GSK3β, a B56δ-regulated substrate. This effect was in line with clinical observations, supporting a correlation between the ID degree and biochemical disturbance. PMID:26168268

  13. Mouse Mammary Tumor Virus c-rel Transgenic Mice Develop Mammary Tumors

    PubMed Central

    Romieu-Mourez, Raphaëlle; Kim, Dong W.; Min Shin, Sang; Demicco, Elizabeth G.; Landesman-Bollag, Esther; Seldin, David C.; Cardiff, Robert D.; Sonenshein, Gail E.

    2003-01-01

    Amplification, overexpression, or rearrangement of the c-rel gene, encoding the c-Rel NF-κB subunit, has been reported in solid and hematopoietic malignancies. For example, many primary human breast cancer tissue samples express high levels of nuclear c-Rel. While the Rev-T oncogene v-rel causes tumors in birds, the ability of c-Rel to transform in vivo has not been demonstrated. To directly test the role of c-Rel in breast tumorigenesis, mice were generated in which overexpression of mouse c-rel cDNA was driven by the hormone-responsive mouse mammary tumor virus long terminal repeat (MMTV-LTR) promoter, and four founder lines identified. In the first cycle of pregnancy, the expression of transgenic c-rel mRNA was observed, and levels of c-Rel protein were increased in the mammary gland. Importantly, 31.6% of mice developed one or more mammary tumors at an average age of 19.9 months. Mammary tumors were of diverse histology and expressed increased levels of nuclear NF-κB. Analysis of the composition of NF-κB complexes in the tumors revealed aberrant nuclear expression of multiple subunits, including c-Rel, p50, p52, RelA, RelB, and the Bcl-3 protein, as observed previously in human primary breast cancers. Expression of the cancer-related NF-κB target genes cyclin D1, c-myc, and bcl-xl was significantly increased in grossly normal transgenic mammary glands starting the first cycle of pregnancy and increased further in mammary carcinomas compared to mammary glands from wild-type mice or virgin transgenic mice. In transient transfection analysis in untransformed breast epithelial cells, c-Rel-p52 or -p50 heterodimers either potently or modestly induced cyclin D1 promoter activity, respectively. Lastly, stable overexpression of c-Rel resulted in increased cyclin D1 and NF-κB p52 and p50 subunit protein levels. These results indicate for the first time that dysregulated expression of c-Rel, as observed in breast cancers, is capable of contributing to mammary tumorigenesis. PMID:12897145

  14. Two potential calmodulin-binding sequences in the ryanodine receptor contribute to a mobile, intra-subunit calmodulin-binding domain

    PubMed Central

    Huang, Xiaojun; Liu, Ying; Wang, Ruiwu; Zhong, Xiaowei; Liu, Yingjie; Koop, Andrea; Chen, S. R. Wayne; Wagenknecht, Terence; Liu, Zheng

    2013-01-01

    Summary Calmodulin (CaM), a 16 kDa ubiquitous calcium-sensing protein, is known to bind tightly to the calcium release channel/ryanodine receptor (RyR), and modulate RyR function. CaM binding studies using RyR fragments or synthetic peptides have revealed the presence of multiple, potential CaM-binding regions in the primary sequence of RyR. In the present study, we inserted GFP into two of these proposed CaM-binding sequences and mapped them onto the three-dimensional structure of intact cardiac RyR2 by cryo-electron microscopy. Interestingly, we found that the two potential CaM-binding regions encompassing, Arg3595 and Lys4269, respectively, are in close proximity and are adjacent to the previously mapped CaM-binding sites. To monitor the conformational dynamics of these CaM-binding regions, we generated a fluorescence resonance energy transfer (FRET) pair, a dual CFP- and YFP-labeled RyR2 (RyR2R3595-CFP/K4269-YFP) with CFP inserted after Arg3595 and YFP inserted after Lys4269. We transfected HEK293 cells with the RyR2R3595-CFP/K4269-YFP cDNA, and examined their FRET signal in live cells. We detected significant FRET signals in transfected cells that are sensitive to the channel activator caffeine, suggesting that caffeine is able to induce conformational changes in these CaM-binding regions. Importantly, no significant FRET signals were detected in cells co-transfected with cDNAs encoding the single CFP (RyR2R3595-CFP) and single YFP (RyR2K4269-YFP) insertions, indicating that the FRET signal stemmed from the interaction between R3595–CFP and K4269–YFP that are in the same RyR subunit. These observations suggest that multiple regions in the RyR2 sequence may contribute to an intra-subunit CaM-binding pocket that undergoes conformational changes during channel gating. PMID:23868982

  15. Identification of an active acidic residue in the catalytic site of beta-hexosaminidase.

    PubMed

    Tse, R; Vavougios, G; Hou, Y; Mahuran, D J

    1996-06-11

    Human beta-hexosaminidases A and B (EC 3.2.1.52) are dimeric lysosomal glycosidases composed of evolutionarily related alpha and/or beta subunits. Both isozymes hydrolyze terminal beta-linked GalNAc or GlcNAc residues from numerous artificial and natural substrates; however, in vivo GM2 ganglioside is a substrate for only the heterodimeric A isozyme. Thus, mutations in either gene encoding its alpha or beta subunits can result in GM2 ganglioside storage and Tay-Sachs or Sandhoff disease, respectively. All glycosyl hydrolases ae believed to have one or more acidic residues in their catalytic site. We demonstrate that incubation of hexosaminidase with a chemical modifier specific for carboxyl side chains produces a time-dependent loss of activity, and that this effect can be blocked by the inclusion of a strong competitive inhibitor in the reaction mix. We hypothesized that the catalytic acid residue(s) should be located in a region of overall homology and be invariant within the aligned deduced primary sequences of the human alpha and beta subunits, as well as hexosaminidases from other species, including bacteria. Such a region is encoded by exons 5-6 of the HEXA and HEXB genes. This region includes beta Arg211 (invariant in 15 sequences), which we have previously shown to be an active residue. This region also contains two invariant and one conserved acidic residues. A fourth acidic residue, Asp alpha 258, beta 290, in exon 7 was also investigated because of its association with the B1 variant of Tay-Sachs disease. Conservative substitutions were made at each candidate residue by in vitro mutagenesis of a beta cDNA, followed by cellular expression. Of these, only the beta Asp196Asn substitution decreased the kcat (350-910-fold) without any noticeable effect on the K(m). Mutagenesis of either beta Asp240 or beta Asp290 to Asn decreased kcat by 10- or 1.4-fold but also raised the K(m) of the enzyme 11- of 3-fold, respectively. The above results strongly suggest that beta Asp196 is a catalytic acid residue in beta-hexosaminidase.

  16. Human Pol ζ purified with accessory subunits is active in translesion DNA synthesis and complements Pol η in cisplatin bypass

    PubMed Central

    Lee, Young-Sam; Gregory, Mark T.; Yang, Wei

    2014-01-01

    DNA polymerase ζ (Pol ζ) is a eukaryotic B-family DNA polymerase that specializes in translesion synthesis and is essential for normal embryogenesis. At a minimum, Pol ζ consists of a catalytic subunit Rev3 and an accessory subunit Rev7. Mammalian Rev3 contains >3,000 residues and is twice as large as the yeast homolog. To date, no vertebrate Pol ζ has been purified for biochemical characterization. Here we report purification of a series of human Rev3 deletion constructs expressed in HEK293 cells and identification of a minimally catalytically active human Pol ζ variant. With a tagged form of an active Pol ζ variant, we isolated two additional accessory subunits of human Pol ζ, PolD2 and PolD3. The purified four-subunit Pol ζ4 (Rev3–Rev7–PolD2–PolD3) is much more efficient and more processive at bypassing a 1,2-intrastrand d(GpG)-cisplatin cross-link than the two-subunit Pol ζ2 (Rev3–Rev7). We show that complete bypass of cisplatin lesions requires Pol η to insert dCTP opposite the 3′ guanine and Pol ζ4 to extend the primers. PMID:24449906

  17. Human Pol ζ purified with accessory subunits is active in translesion DNA synthesis and complements Pol η in cisplatin bypass.

    PubMed

    Lee, Young-Sam; Gregory, Mark T; Yang, Wei

    2014-02-25

    DNA polymerase ζ (Pol ζ) is a eukaryotic B-family DNA polymerase that specializes in translesion synthesis and is essential for normal embryogenesis. At a minimum, Pol ζ consists of a catalytic subunit Rev3 and an accessory subunit Rev7. Mammalian Rev3 contains >3,000 residues and is twice as large as the yeast homolog. To date, no vertebrate Pol ζ has been purified for biochemical characterization. Here we report purification of a series of human Rev3 deletion constructs expressed in HEK293 cells and identification of a minimally catalytically active human Pol ζ variant. With a tagged form of an active Pol ζ variant, we isolated two additional accessory subunits of human Pol ζ, PolD2 and PolD3. The purified four-subunit Pol ζ4 (Rev3-Rev7-PolD2-PolD3) is much more efficient and more processive at bypassing a 1,2-intrastrand d(GpG)-cisplatin cross-link than the two-subunit Pol ζ2 (Rev3-Rev7). We show that complete bypass of cisplatin lesions requires Pol η to insert dCTP opposite the 3' guanine and Pol ζ4 to extend the primers.

  18. Escherichia coli gamma-glutamyltranspeptidase mutants deficient in processing to subunits.

    PubMed

    Hashimoto, W; Suzuki, H; Nohara, S; Kumagai, H

    1992-11-30

    Arginyl residues 513 and 571 of Escherichia coli K-12 gamma-glutamyl-transpeptidase (EC 2.3.2.2) were substituted with alanyl and glycyl residues, respectively, by oligonucleotide-directed in vitro mutagenesis. Both mutants were devoid of the enzymatic activity. On Western blot analysis, we found that both mutants accumulated a gamma-glutamyltranspeptidase precursor which was not processed into large and small subunits in the periplasmic space of Escherichia coli.

  19. Characterization and Evolution of Anthranilate 1,2-Dioxygenase from Acinetobacter sp. Strain ADP1

    PubMed Central

    Eby, D. Matthew; Beharry, Zanna M.; Coulter, Eric D.; Kurtz, Donald M.; Neidle, Ellen L.

    2001-01-01

    The two-component anthranilate 1,2-dioxygenase of the bacterium Acinetobacter sp. strain ADP1 was expressed in Escherichia coli and purified to homogeneity. This enzyme converts anthranilate (2-aminobenzoate) to catechol with insertion of both atoms of O2 and consumption of one NADH. The terminal oxygenase component formed an α3β3 hexamer of 54- and 19-kDa subunits. Biochemical analyses demonstrated one Rieske-type [2Fe-2S] center and one mononuclear nonheme iron center in each large oxygenase subunit. The reductase component, which transfers electrons from NADH to the oxygenase component, was found to contain approximately one flavin adenine dinucleotide and one ferredoxin-type [2Fe-2S] center per 39-kDa monomer. Activities of the combined components were measured as rates and quantities of NADH oxidation, substrate disappearance, product appearance, and O2 consumption. Anthranilate conversion to catechol was stoichiometrically coupled to NADH oxidation and O2 consumption. The substrate analog benzoate was converted to a nonaromatic benzoate 1,2-diol with similarly tight coupling. This latter activity is identical to that of the related benzoate 1,2-dioxygenase. A variant anthranilate 1,2-dioxygenase, previously found to convey temperature sensitivity in vivo because of a methionine-to-lysine change in the large oxygenase subunit, was purified and characterized. The purified M43K variant, however, did not hydroxylate anthranilate or benzoate at either the permissive (23°C) or nonpermissive (39°C) growth temperatures. The wild-type anthranilate 1,2-dioxygenase did not efficiently hydroxylate methylated or halogenated benzoates, despite its sequence similarity to broad-substrate specific dioxygenases that do. Phylogenetic trees of the α and β subunits of these terminal dioxygenases that act on natural and xenobiotic substrates indicated that the subunits of each terminal oxygenase evolved from a common ancestral two-subunit component. PMID:11114907

  20. Atomic model for the membrane-embedded VO motor of a eukaryotic V-ATPase.

    PubMed

    Mazhab-Jafari, Mohammad T; Rohou, Alexis; Schmidt, Carla; Bueler, Stephanie A; Benlekbir, Samir; Robinson, Carol V; Rubinstein, John L

    2016-11-03

    Vacuolar-type ATPases (V-ATPases) are ATP-powered proton pumps involved in processes such as endocytosis, lysosomal degradation, secondary transport, TOR signalling, and osteoclast and kidney function. ATP hydrolysis in the soluble catalytic V 1 region drives proton translocation through the membrane-embedded V O region via rotation of a rotor subcomplex. Variability in the structure of the intact enzyme has prevented construction of an atomic model for the membrane-embedded motor of any rotary ATPase. We induced dissociation and auto-inhibition of the V 1 and V O regions of the V-ATPase by starving the yeast Saccharomyces cerevisiae, allowing us to obtain a ~3.9-Å resolution electron cryomicroscopy map of the V O complex and build atomic models for the majority of its subunits. The analysis reveals the structures of subunits ac 8 c'c″de and a protein that we identify and propose to be a new subunit (subunit f). A large cavity between subunit a and the c-ring creates a cytoplasmic half-channel for protons. The c-ring has an asymmetric distribution of proton-carrying Glu residues, with the Glu residue of subunit c″ interacting with Arg735 of subunit a. The structure suggests sequential protonation and deprotonation of the c-ring, with ATP-hydrolysis-driven rotation causing protonation of a Glu residue at the cytoplasmic half-channel and subsequent deprotonation of a Glu residue at a luminal half-channel.

  1. Estimating hydraulic parameters of a heterogeneous aquitard using long-term multi-extensometer and groundwater level data

    NASA Astrophysics Data System (ADS)

    Zhuang, Chao; Zhou, Zhifang; Illman, Walter A.; Guo, Qiaona; Wang, Jinguo

    2017-09-01

    The classical aquitard-drainage model COMPAC has been modified to simulate the compaction process of a heterogeneous aquitard consisting of multiple sub-units (Multi-COMPAC). By coupling Multi-COMPAC with the parameter estimation code PEST++, the vertical hydraulic conductivity ( K v) and elastic ( S ske) and inelastic ( S skp) skeletal specific-storage values of each sub-unit can be estimated using observed long-term multi-extensometer and groundwater level data. The approach was first tested through a synthetic case with known parameters. Results of the synthetic case revealed that it was possible to accurately estimate the three parameters for each sub-unit. Next, the methodology was applied to a field site located in Changzhou city, China. Based on the detailed stratigraphic information and extensometer data, the aquitard of interest was subdivided into three sub-units. Parameters K v, S ske and S skp of each sub-unit were estimated simultaneously and then were compared with laboratory results and with bulk values and geologic data from previous studies, demonstrating the reliability of parameter estimates. Estimated S skp values ranged within the magnitude of 10-4 m-1, while K v ranged over 10-10-10-8 m/s, suggesting moderately high heterogeneity of the aquitard. However, the elastic deformation of the third sub-unit, consisting of soft plastic silty clay, is masked by delayed drainage, and the inverse procedure leads to large uncertainty in the S ske estimate for this sub-unit.

  2. Isolation and characterization of cDNA clones for carrot extensin and a proline-rich 33-kDa protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Chen, J.; Varner, J.E.

    1985-07-01

    Extensins are hydroxyproline-rich glycoproteins associated with most dicotyledonous plant cell walls. To isolate cDNA clones encoding extensin, the authors started by isolating poly(A) RNA from carrot root tissue, and then translating the RNA in vitro, in the presence of tritiated leucine or proline. A 33-kDa peptide was identified in the translation products as a putative extensin precursor. From a cDNA library constructed with poly(A) RNA from wounded carrots, one cDNA clone (pDC5) was identified that specifically hybridized to poly(A) RNA encoding this 33-kDa peptide. They isolated three cDNA clones (pDC11, pDC12, and pDC16) from another cDNA library using pCD5 asmore » a probe. DNA sequence data, RNA hybridization analysis, and hybrid released in vitro translation indicate that the cDNA clones pDC11 encodes extensin and that cDNA clones pDC12 and pDC16 encode the 33-kDa peptide, which as yet has an unknown identity and function. The assumption that the 33-kDa peptide was an extensin precursor was invalid. RNA hybridization analysis showed that RNA encoded by both clone types is accumulated upon wounding.« less

  3. RICD: a rice indica cDNA database resource for rice functional genomics.

    PubMed

    Lu, Tingting; Huang, Xuehui; Zhu, Chuanrang; Huang, Tao; Zhao, Qiang; Xie, Kabing; Xiong, Lizhong; Zhang, Qifa; Han, Bin

    2008-11-26

    The Oryza sativa L. indica subspecies is the most widely cultivated rice. During the last few years, we have collected over 20,000 putative full-length cDNAs and over 40,000 ESTs isolated from various cDNA libraries of two indica varieties Guangluai 4 and Minghui 63. A database of the rice indica cDNAs was therefore built to provide a comprehensive web data source for searching and retrieving the indica cDNA clones. Rice Indica cDNA Database (RICD) is an online MySQL-PHP driven database with a user-friendly web interface. It allows investigators to query the cDNA clones by keyword, genome position, nucleotide or protein sequence, and putative function. It also provides a series of information, including sequences, protein domain annotations, similarity search results, SNPs and InDels information, and hyperlinks to gene annotation in both The Rice Annotation Project Database (RAP-DB) and The TIGR Rice Genome Annotation Resource, expression atlas in RiceGE and variation report in Gramene of each cDNA. The online rice indica cDNA database provides cDNA resource with comprehensive information to researchers for functional analysis of indica subspecies and for comparative genomics. The RICD database is available through our website http://www.ncgr.ac.cn/ricd.

  4. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1998-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries.

  5. Method for construction of normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1998-11-03

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3` noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to appropriate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. This invention also provides normalized cDNA libraries generated by the above-described method and uses of the generated libraries. 19 figs.

  6. EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries

    PubMed Central

    Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

    2008-01-01

    Background Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. Results We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. Conclusion EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects. PMID:18402700

  7. EST Express: PHP/MySQL based automated annotation of ESTs from expression libraries.

    PubMed

    Smith, Robin P; Buchser, William J; Lemmon, Marcus B; Pardinas, Jose R; Bixby, John L; Lemmon, Vance P

    2008-04-10

    Several biological techniques result in the acquisition of functional sets of cDNAs that must be sequenced and analyzed. The emergence of redundant databases such as UniGene and centralized annotation engines such as Entrez Gene has allowed the development of software that can analyze a great number of sequences in a matter of seconds. We have developed "EST Express", a suite of analytical tools that identify and annotate ESTs originating from specific mRNA populations. The software consists of a user-friendly GUI powered by PHP and MySQL that allows for online collaboration between researchers and continuity with UniGene, Entrez Gene and RefSeq. Two key features of the software include a novel, simplified Entrez Gene parser and tools to manage cDNA library sequencing projects. We have tested the software on a large data set (2,016 samples) produced by subtractive hybridization. EST Express is an open-source, cross-platform web server application that imports sequences from cDNA libraries, such as those generated through subtractive hybridization or yeast two-hybrid screens. It then provides several layers of annotation based on Entrez Gene and RefSeq to allow the user to highlight useful genes and manage cDNA library projects.

  8. Cloning of soluble alkaline phosphatase cDNA and molecular basis of the polymorphic nature in alkaline phosphatase isozymes of Bombyx mori midgut.

    PubMed

    Itoh, M; Kanamori, Y; Takao, M; Eguchi, M

    1999-02-01

    A cDNA coding for soluble type alkaline phosphatase (sALP) of Bombyx mori was isolated. Deduced amino acid sequence showed high identities to various ALPs and partial similarities to ATPase of Manduca sexta. Using this cDNA sequence as a probe, the molecular basis of electrophoretic polymorphism in sALP and membrane-bound type ALP (mALP) was studied. As for mALP, the result suggested that post-translational modification was important for the proteins to express activity and to represent their extensive polymorphic nature, whereas the magnitude of activities was mainly regulated by transcription. On the other hand, sALP zymogram showed poor polymorphism, but one exception was the null mutant, in which the sALP gene was largely lost. Interestingly, the sALP gene was shown to be transcribed into two mRNAs of different sizes, 2.0 and 2.4 Kb. In addition to the null mutant of sALP, we found a null mutant for mALP. Both of these mutants seem phenotypically silent, suggesting that the functional differentiation between these isozymes is not perfect, so that they can still work mutually and complement each other as an indispensable enzyme for B. mori.

  9. A Combination of Stable Isotope Probing, Illumina Sequencing, and Co-occurrence Network to Investigate Thermophilic Acetate- and Lactate-Utilizing Bacteria.

    PubMed

    Sun, Weimin; Krumins, Valdis; Dong, Yiran; Gao, Pin; Ma, Chunyan; Hu, Min; Li, Baoqin; Xia, Bingqing; He, Zijun; Xiong, Shangling

    2018-01-01

    Anaerobic digestion is a complicated microbiological process that involves a wide diversity of microorganisms. Acetate is one of the most important intermediates, and interactions between acetate-oxidizing bacteria and archaea could play an important role in the formation of methane in anoxic environments. Anaerobic digestion at thermophilic temperatures is known to increase methane production, but the effects on the microbial community are largely unknown. In the current study, stable isotope probing was used to characterize acetate- and lactate-oxidizing bacteria in thermophilic anaerobic digestion. In microcosms fed 13 C-acetate, bacteria related to members of Clostridium, Hydrogenophaga, Fervidobacterium, Spirochaeta, Limnohabitans, and Rhodococcus demonstrated elevated abundances of 13 C-DNA fractions, suggesting their activities in acetate oxidation. In the treatments fed 13 C-lactate, Anaeromyxobacter, Desulfobulbus, Syntrophus, Cystobacterineae, and Azospira were found to be the potential thermophilic lactate utilizers. PICRUSt predicted that enzymes related to nitrate and nitrite reduction would be enriched in 13 C-DNA fractions, suggesting that the acetate and lactate oxidation may be coupled with nitrate and/or nitrite reduction. Co-occurrence network analysis indicated bacterial taxa not enriched in 13 C-DNA fractions that may also play a critical role in thermophilic anaerobic digestion.

  10. [Construction of forward and reverse subtracted cDNA libraries between muscle tissue of Meishan and Landrace pigs].

    PubMed

    Xu, De-Quan; Zhang, Yi-Bing; Xiong, Yuan-Zhu; Gui, Jian-Fang; Jiang, Si-Wen; Su, Yu-Hong

    2003-07-01

    Using suppression subtractive hybridization (SSH) technique, forward and reverse subtracted cDNA libraries were constructed between Longissimus muscles from Meishan and Landrace pigs. A housekeeping gene, G3PDH, was used to estimate the efficiency of subtractive cDNA. In two cDNA libraries, G3PDH was subtracted very efficiently at appropriate 2(10) and 2(5) folds, respectively, indicating that some differentially expressed genes were also enriched at the same folds and the two subtractive cDNA libraries were very successful. A total of 709 and 673 positive clones were isolated from forward and reverse subtracted cDNA libraries, respectively. Analysis of PCR showed that most of all plasmids in the clones contained 150-750 bp inserts. The construction of subtractive cDNA libraries between muscle tissue from different pig breeds laid solid foundations for isolating and identifying the genes determining muscle growth and meat quality, which will be important to understand the mechanism of muscle growth, determination of meat quality and practice of molecular breeding.

  11. An alternative method for cDNA cloning from surrogate eukaryotic cells transfected with the corresponding genomic DNA.

    PubMed

    Hu, Lin-Yong; Cui, Chen-Chen; Song, Yu-Jie; Wang, Xiang-Guo; Jin, Ya-Ping; Wang, Ai-Hua; Zhang, Yong

    2012-07-01

    cDNA is widely used in gene function elucidation and/or transgenics research but often suitable tissues or cells from which to isolate mRNA for reverse transcription are unavailable. Here, an alternative method for cDNA cloning is described and tested by cloning the cDNA of human LALBA (human alpha-lactalbumin) from genomic DNA. First, genomic DNA containing all of the coding exons was cloned from human peripheral blood and inserted into a eukaryotic expression vector. Next, by delivering the plasmids into either 293T or fibroblast cells, surrogate cells were constructed. Finally, the total RNA was extracted from the surrogate cells and cDNA was obtained by RT-PCR. The human LALBA cDNA that was obtained was compared with the corresponding mRNA published in GenBank. The comparison showed that the two sequences were identical. The novel method for cDNA cloning from surrogate eukaryotic cells described here uses well-established techniques that are feasible and simple to use. We anticipate that this alternative method will have widespread applications.

  12. Purification of Single-Stranded cDNA Based on RNA Degradation Treatment and Adsorption Chromatography.

    PubMed

    Trujillo-Esquivel, Elías; Franco, Bernardo; Flores-Martínez, Alberto; Ponce-Noyola, Patricia; Mora-Montes, Héctor M

    2016-08-02

    Analysis of gene expression is a common research tool to study networks controlling gene expression, the role of genes with unknown function, and environmentally induced responses of organisms. Most of the analytical tools used to analyze gene expression rely on accurate cDNA synthesis and quantification to obtain reproducible and quantifiable results. Thus far, most commercial kits for isolation and purification of cDNA target double-stranded molecules, which do not accurately represent the abundance of transcripts. In the present report, we provide a simple and fast method to purify single-stranded cDNA, exhibiting high purity and yield. This method is based on the treatment with RNase H and RNase A after cDNA synthesis, followed by separation in silica spin-columns and ethanol precipitation. In addition, our method avoids the use of DNase I to eliminate genomic DNA from RNA preparations, which improves cDNA yield. As a case report, our method proved to be useful in the purification of single-stranded cDNA from the pathogenic fungus Sporothrix schenckii.

  13. Construction of Infectious cDNA Clone of a Chrysanthemum stunt viroid Korean Isolate

    PubMed Central

    Yoon, Ju-Yeon; Cho, In-Sook; Choi, Gug-Seoun; Choi, Seung-Kook

    2014-01-01

    Chrysanthemum stunt viroid (CSVd), a noncoding infectious RNA molecule, causes seriously economic losses of chrysanthemum for 3 or 4 years after its first infection. Monomeric cDNA clones of CSVd isolate SK1 (CSVd-SK1) were constructed in the plasmids pGEM-T easy vector and pUC19 vector. Linear positive-sense transcripts synthesized in vitro from the full-length monomeric cDNA clones of CSVd-SK1 could infect systemically tomato seedlings and chrysanthemum plants, suggesting that the linear CSVd RNA transcribed from the cDNA clones could be replicated as efficiently as circular CSVd in host species. However, direct inoculation of plasmid cDNA clones containing full-length monomeric cDNA of CSVd-SK1 failed to infect tomato and chrysanthemum and linear negative-sense transcripts from the plasmid DNAs were not infectious in the two plant species. The cDNA sequences of progeny viroid in systemically infected tomato and chrysanthemum showed a few substitutions at a specific nucleotide position, but there were no deletions and insertions in the sequences of the CSVd progeny from tomato and chrysanthemum plants. PMID:25288987

  14. Evaluation of vector-primed cDNA library production from microgram quantities of total RNA.

    PubMed

    Kuo, Jonathan; Inman, Jason; Brownstein, Michael; Usdin, Ted B

    2004-12-15

    cDNA sequences are important for defining the coding region of genes, and full-length cDNA clones have proven to be useful for investigation of the function of gene products. We produced cDNA libraries containing 3.5-5 x 10(5) primary transformants, starting with 5 mug of total RNA prepared from mouse pituitary, adrenal, thymus, and pineal tissue, using a vector-primed cDNA synthesis method. Of approximately 1000 clones sequenced, approximately 20% contained the full open reading frames (ORFs) of known transcripts, based on the presence of the initiating methionine residue codon. The libraries were complex, with 94, 91, 83 and 55% of the clones from the thymus, adrenal, pineal and pituitary libraries, respectively, represented only once. Twenty-five full-length clones, not yet represented in the Mammalian Gene Collection, were identified. Thus, we have produced useful cDNA libraries for the isolation of full-length cDNA clones that are not yet available in the public domain, and demonstrated the utility of a simple method for making high-quality libraries from small amounts of starting material.

  15. Using complementary DNA from MyoD-transduced fibroblasts to sequence large muscle genes.

    PubMed

    Waddell, Leigh B; Monnier, Nicole; Cooper, Sandra T; North, Kathryn N; Clarke, Nigel F

    2011-08-01

    Large muscle genes are often sequenced using complementary DNA (cDNA) made from muscle messenger RNA (mRNA) to reduce the cost and workload associated with sequencing from genomic DNA. Two potential barriers are the availability of a frozen muscle biopsy, and difficulties in detecting nonsense mutations due to nonsense-mediated mRNA decay (NMD). We present patient examples showing that use of MyoD-transduced fibroblasts as a source of muscle-specific mRNA overcomes these potential difficulties in sequencing large muscle-related genes. Copyright © 2011 Wiley Periodicals, Inc.

  16. Activation-induced proteolysis of cytoplasmic domain of zeta in T cell receptors and Fc receptors.

    PubMed

    Taupin, J L; Anderson, P

    1994-12-01

    The CD3-T cell receptor (TCR) complex on T cells and the Fc gamma receptor type III (Fc gamma RIII)-zeta-gamma complex on natural killer cells are functionally analogous activation receptors that associate with a family of disulfide-linked dimers composed of the related subunits zeta and gamma. Immunochemical analysis of receptor complexes separated on two-dimensional diagonal gels allowed the identification of a previously uncharacterized zeta-p14 heterodimer. zeta-p14 is a component of both CD3-TCR and Fc gamma RIII-zeta-gamma. Peptide mapping analysis shows that p14 is structurally related to zeta, suggesting that it is either: (i) derived from zeta proteolytically or (ii) the product of an alternatively spliced mRNA. The observation that COS cells transformed with a cDNA encoding zeta express zeta-p14 supports the former possibility. The expression of CD3-TCR complexes including zeta-p14 increases following activation with phorbol 12-myristate 13-acetate or concanavalin A, suggesting that proteolysis of zeta may contribute to receptor modulation or desensitization.

  17. Characterization of arrangement and expression of the beta-2 microglobulin locus in the sandbar and nurse shark.

    PubMed

    Chen, Hao; Kshirsagar, Sarika; Jensen, Ingvill; Lau, Kevin; Simonson, Caitlin; Schluter, Samuel F

    2010-02-01

    Beta 2 microglobulin (beta2m) is an essential subunit of major histocompatibility complex (MHC) type I molecules. In this report, beta2m cDNAs were identified and sequenced from sandbar shark spleen cDNA library. Sandbar shark beta2m gene encodes one amino acid less than most teleost beta2m genes, and 3 amino acids less than mammal beta2m genes. Although sandbar shark beta2m protein contains one beta sheet less than that of human in the predicted protein structure, the overall structure of beta2m proteins is conserved during evolution. Germline gene for the beta2m in sandbar and nurse shark is present as a single locus. It contains three exons and two introns. CpG sites are evenly distributed in the shark beta2m loci. Several DNA repeat elements were also identified in the shark beta2m loci. Sequence analysis suggests that the beta2m locus is not linked to the MHC I loci in the shark genome.

  18. Mutated PPP1R3B is recognized by T cells used to treat a melanoma patient who experienced a durable complete tumor regression

    PubMed Central

    Lu, Yong-Chen; Yao, Xin; Li, Yong F.; El-Gamil, Mona; Dudley, Mark E.; Yang, James C.; Almeida, Jorge R.; Douek, Daniel C.; Samuels, Yardena; Rosenberg, Steven A.; Robbins, Paul F.

    2013-01-01

    Adoptive cell therapy with tumor infiltrating lymphocytes (TILs) represents an effective treatment for patients with metastatic melanoma. However, most of the antigen targets recognized by effective melanoma reactive TILs remain elusive. In this study, patient 2369 experienced a complete response, including regressions of bulky liver tumor masses ongoing beyond seven years following adoptive TILs transfer. The screening of a cDNA library generated from the autologous melanoma cell line resulted in the isolation of a mutated PPP1R3B (protein phosphatase 1, regulatory (inhibitor) subunit 3B) gene product. The mutated PPP1R3B peptide represents the immunodominant epitope recognized by tumor reactive T cells in TIL 2369. Five years following adoptive transfer, peripheral blood T lymphocytes obtained from patient 2369 recognized the mutated PPP1R3B epitope. These results demonstrate that adoptive T cell therapy targeting a tumor-specific antigen can mediate long-term survival for a patient with metastatic melanoma. This study also provides an impetus to develop personalized immunotherapy targeting tumor-specific, mutated antigens. PMID:23690473

  19. A mutation in the insulin receptor gene that impairs transport of the receptor to the plasma membrane and causes insulin-resistant diabetes.

    PubMed Central

    Accili, D; Frapier, C; Mosthaf, L; McKeon, C; Elbein, S C; Permutt, M A; Ramos, E; Lander, E; Ullrich, A; Taylor, S I

    1989-01-01

    Insulin binds to a receptor on the cell surface, thereby triggering a biological response within the target cell. Mutations in the insulin receptor gene can render the cell resistant to the biological action of insulin. We have studied a family in which two sisters have a genetic form of insulin-resistant diabetes mellitus. The technique of homozygosity mapping has been used to demonstrate that the mutation causing diabetes in this consanguineous family is genetically linked to the insulin receptor gene. The two insulin-resistant sisters are homozygous for a mutation encoding substitution of valine for phenylalanine at position 382 in the alpha-subunit of the insulin receptor. Transfection of mutant insulin receptor cDNA into NIH3T3 cells demonstrated that the Val382 mutation impaired post-translational processing and retarded transport of the insulin receptor to the plasma membrane. Thus, the mutation causes insulin resistance by decreasing the number of insulin receptors on the surface of the patients' cells. Images PMID:2573522

  20. Identification and characterization of an SPO11 homolog in the mouse.

    PubMed

    Metzler-Guillemain, C; de Massy, B

    2000-01-01

    The SPO11/TOPVIA family includes proteins from archaebacteria and eukaryotes. The protein member from the archaebacterium Sulfulobus shibatae is the catalytic subunit of TopoVI DNA topoisomerase. In Saccharomyces cerevisiae, Schizosaccharomyces pombe, Caenorhabditis elegans and Drosophila melanogaster, SPO11 is required for meiotic recombination, suggesting a conserved mechanism for the initiation step of this process. Indeed, S. cerevisiae SPO11 has been shown to be directly involved in the formation of meiotic DNA double-strand breaks that initiate meiotic recombination. Here, we report the identification of a Mus musculus Spo11 cDNA, which encodes a protein closely related to all members of the SPO11/TOPVIA family. cDNAs resulting from alternative splicing were detected, suggesting that there are potential variants of the mouse SPO11 protein. By RNA-blotting analysis, expression of the mouse Spo11 gene was detected only in the testis, in agreement with its predicted function in the initiation of meiotic recombination. We mapped the mouse Spo11 gene to chromosome 2, band H2-H4.

  1. Screening and identification of gastric adenocarcinoma metastasis-related genes using cDNA microarray coupled to FDD-PCR.

    PubMed

    Wang, Jianhua; Chen, Shishu

    2002-10-01

    To identify certain gastric adenocarcinoma metastasis-related genes, an RF-1 cell line (primary tumor from a gastric adenocarcinoma patient) and an RF-48 cell line (its metastatic counterpart) were used as a model for studying the molecular mechanism of tumor metastasis. Two fluorescent cDNA probes, labeled with Cy3 and Cy5 dyes, were prepared from RF-1 and RF-48 mRNA samples by the reverse transcription method. The two color probes were then mixed and hybridized to a cDNA chip constructed with double-dots from 4,096 human genes, and scanned at two wavelengths. The experiment was repeated twice. Differentially expressedn genes from the above two cells were analyzed by use of computer. Of the total genes, 138 (3.4%) revealed differential expression in RF-48 cells compared with RF-1 cells: 81 (2.1%) genes revealed apparent up-regulation, and 56 (1.3%) genes revealed down-regulation. Forty-five genes involved in gastric adenocarcinoma metastasis were cloned using fluorescent differential display-PCR (FDD-PCR), including three novel genes. There were seven differentially expressed genes that presented the same behaviour under both detection methods. The possible roles of some differentially expressed genes, which may be involved in the mechanism of tumor metastasis, were discussed. cDNA chip was used to analyze gene expression in a high-throughput and large-scale manner in combination with FDD-PCR for cloning unknown novel genes. Some genes related to metastasis were preliminarily scanned, which would contribute to disclose the molecular mechanism of gastric adenocarcinoma metastasis and provide new targets for therapeutic intervention.

  2. An atypical topoisomerase II sequence from the slime mold Physarum polycephalum.

    PubMed

    Hugodot, Yannick; Dutertre, Murielle; Duguet, Michel

    2004-01-21

    We have determined the complete nucleotide sequence of the cDNA encoding DNA topoisomerase II from Physarum polycephalum. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic enzymes, a 250-bp fragment was polymerase chain reaction (PCR) amplified. This fragment was used as a probe to screen a Physarum cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. Rapid amplification of cDNA ends (RACE)-PCR was employed to isolate the remaining portion of the gene. The complete sequence of 4613 bp contains an open reading frame of 4494 bp that codes for 1498 amino acid residues with a theoretical molecular weight of 167 kDa. The predicted amino acid sequence shares similarity with those of other eukaryotes and shows the highest degree of identity with the enzyme of Dictyostelium discoideum. However, the enzyme of P. polycephalum contains an atypical amino-terminal domain very rich in serine and proline, whose function is unknown. Remarkably, both a mitochondrial targeting sequence and a nuclear localization signal were predicted respectively in the amino and carboxy-terminus of the protein, as in the case of human topoisomerase III alpha. At the Physarum genomic level, the topoisomerase II gene encompasses a region of about 16 kbp suggesting a large proportion of intronic sequences, an unusual situation for a gene of a lower eukaryote, often free of introns. Finally, expression of topoisomerase II mRNA does not appear significantly dependent on the plasmodium cycle stage, possibly due to the lack of G1 phase or (and) to a mitochondrial localization of the enzyme.

  3. Differences in cholinergic responses from outer hair cells of rat and guinea pig.

    PubMed

    Chen, C; LeBlanc, C; Bobbin, R P

    1996-09-01

    A cholinergic receptor on outer hair cells (OHC) in guinea pig cochlea induces a K+ current when it is activated by acetylcholine and suberyldicholine but not by nicotine or muscarine (Bobbin, 1995). This unusual receptor may contain an alpha 9-subunit. However, the pharmacology of the alpha 9-subunit cloned from rat and expressed in Xenopus oocytes does not completely match that obtained for the ACh receptor in guinea pig OHCs. The response to 1,1-dimethyl-4-phenylpiperazinium (DMPP) is large in guinea pig OHCs and small in oocytes containing receptors of the alpha 9-subunit. Therefore, we compared the effects of cholinergic receptor agonists in rat and guinea pig OHCs using the whole-cell variant of the patch-clamp technique. ACh caused the largest outward K+ current in OHCs from both rat and guinea pig. Carbachol- and suberyldicholine-induced responses were similar in magnitude in OHCs of rat and guinea pig. However, DMPP produced a small response in OHCs from rat and a large response in OHCs from guinea pig. At a concentration of 100 microM, muscarine, oxotremorine M, nicotine and cytisine induced little response in guinea pig OHCs and none in rat OHCs. Results suggest that the ACh receptor on rat OHCs is similar to the alpha 9-subunit-containing receptor expressed in oocytes but different from the ACh receptor on guinea pig OHCs.

  4. The helical domain of the EcoR124I motor subunit participates in ATPase activity and dsDNA translocation

    PubMed Central

    Shamayeva, Katsiaryna; Guzanova, Alena; Řeha, David; Csefalvay, Eva; Carey, Jannette; Weiserova, Marie

    2017-01-01

    Type I restriction-modification enzymes are multisubunit, multifunctional molecular machines that recognize specific DNA target sequences, and their multisubunit organization underlies their multifunctionality. EcoR124I is the archetype of Type I restriction-modification family IC and is composed of three subunit types: HsdS, HsdM, and HsdR. DNA cleavage and ATP-dependent DNA translocation activities are housed in the distinct domains of the endonuclease/motor subunit HsdR. Because the multiple functions are integrated in this large subunit of 1,038 residues, a large number of interdomain contacts might be expected. The crystal structure of EcoR124I HsdR reveals a surprisingly sparse number of contacts between helicase domain 2 and the C-terminal helical domain that is thought to be involved in assembly with HsdM. Only two potential hydrogen-bonding contacts are found in a very small contact region. In the present work, the relevance of these two potential hydrogen-bonding interactions for the multiple activities of EcoR124I is evaluated by analysing mutant enzymes using in vivo and in vitro experiments. Molecular dynamics simulations are employed to provide structural interpretation of the functional data. The results indicate that the helical C-terminal domain is involved in the DNA translocation, cleavage, and ATPase activities of HsdR, and a role in controlling those activities is suggested. PMID:28133570

  5. Fidelity of metal insertion into hydrogenases.

    PubMed

    Magalon, A; Blokesch, M; Zehelein, E; Böck, A

    2001-06-15

    The fidelity of metal incorporation into the active center of hydrogenase 3 from Escherichia coli was studied by analyzing the inhibition of the maturation pathway by zinc and other transition metals. Hydrogenase maturation of wild-type cells was significantly affected only by concentrations of zinc or cadmium higher than 200 microM, whereas a mutant with a lesion in the nickel uptake system displayed a total blockade of the proteolytic processing of the precursor form into the mature form of the large subunit after growth in the presence of 10 microM Zn(2+). The precursor could not be processed in vitro by the maturation endopeptidase even in the presence of an excess of nickel ions. Evidence is presented that zinc does not interfere with the incorporation of iron into the metal center. Precursor of the large subunit accumulated in nickel proficient cells formed a transient substrate complex with the cognate endoprotease HycI whereas that of zinc-supplemented cells did not. The results show that zinc can intrude the nickel-dependent maturation pathway only when nickel uptake is blocked. Under this condition zinc appears to be incorporated at the nickel site of the large subunit and delivers a precursor not amenable to proteolytic processing since the interaction with the endoprotease is blocked.

  6. Identification of catalytic residues of a very large NAD-glutamate dehydrogenase from Janthinobacterium lividum by site-directed mutagenesis.

    PubMed

    Kawakami, Ryushi; Sakuraba, Haruhiko; Ohshima, Toshihisa

    2014-01-01

    We previously found a very large NAD-dependent glutamate dehydrogenase with approximately 170 kDa subunit from Janthinobacterium lividum (Jl-GDH) and predicted that GDH reaction occurred in the central domain of the subunit. To gain further insights into the role of the central domain, several single point mutations were introduced. The enzyme activity was completely lost in all single mutants of R784A, K810A, K820A, D885A, and S1142A. Because, in sequence alignment analysis, these residues corresponded to the residues responsible for glutamate binding in well-known small GDH with approximately 50 kDa subunit, very large GDH and well-known small GDH may share the same catalytic mechanism. In addition, we demonstrated that C1141, one of the three cysteine residues in the central domain, was responsible for the inhibition of enzyme activity by HgCl2, and HgCl2 functioned as an activating compound for a C1141T mutant. At low concentrations, moreover, HgCl2 was found to function as an activating compound for a wild-type Jl-GDH. This suggests that the mechanism for the activation is entirely different from that for the inhibition.

  7. Vicilin and convicilin are potential major allergens from pea.

    PubMed

    Sanchez-Monge, R; Lopez-Torrejón, G; Pascual, C Y; Varela, J; Martin-Esteban, M; Salcedo, G

    2004-11-01

    Allergic reactions to pea (Pisum sativum) ingestion are frequently associated with lentil allergy in the Spanish population. Vicilin have been described as a major lentil allergen. To identify the main IgE binding components from pea seeds and to study their potential cross-reactivity with lentil vicilin. A serum pool or individual sera from 18 patients with pea allergy were used to detect IgE binding proteins from pea seeds by immunodetection and immunoblot inhibition assays. Protein preparations enriched in pea vicilin were obtained by gel filtration chromatography followed by reverse-phase high-performance liquid chromatography (HPLC). IgE binding components were identified by means of N-terminal amino acid sequencing. Complete cDNAs encoding pea vicilin were isolated by PCR, using primers based on the amino acid sequence of the reactive proteins. IgE immunodetection of crude pea extracts revealed that convicilin (63 kDa), as well as vicilin (44 kDa) and one of its proteolytic fragments (32 kDa), reacted with more than 50% of the individual sera tested. Additional proteolytic subunits of vicilin (36, 16 and 13 kDa) bound IgE from approximately 20% of the sera. The lentil vicilin allergen Len c 1 strongly inhibited the IgE binding to all components mentioned above. The characterization of cDNA clones encoding pea vicilin has allowed the deduction of its complete amino acid sequence (90% of sequence identity to Len c 1), as well as those of its reactive proteolytic processed subunits. Vicilin and convicilin are potential major allergens from pea seeds. Furthermore, proteolytic fragments from vicilin are also relevant IgE binding pea components. All these proteins cross-react with the major lentil allergen Len c 1.

  8. Interactions of the C-terminal Domain of Human Ku70 with DNA Substrate: A Molecular Dynamics Study

    NASA Technical Reports Server (NTRS)

    Hu, Shaowen; Huff, Janice; Pluth, Janice M.; Cucinotta, Francis A.

    2007-01-01

    NASA is developing a systems biology approach to improve the assessment of health risks associated with space radiation. The primary toxic and mutagenic lesion following radiation exposure is the DNA double strand break (DSB), thus a model incorporating proteins and pathways important in response and repair of this lesion is critical. One key protein heterodimer for systems models of radiation effects is the Ku(sub 70/80) complex. The Ku70/80 complex is important in the initial binding of DSB ends following DNA damage, and is a component of nonhomologous end joining repair, the primary pathway for DSB repair in mammalian cells. The C-terminal domain of Ku70 (Ku70c, residues 559-609), contains an helix-extended strand-helix motif and similar motifs have been found in other nucleic acid-binding proteins critical for DNA repair. However, the exact mechanism of damage recognition and substrate specificity for the Ku heterodimer remains unclear in part due to the absence of a high-resolution structure of the Ku70c/DNA complex. We performed a series of molecular dynamics (MD) simulations on a system with the subunit Ku70c and a 14 base pairs DNA duplex, whose starting structures are designed to be variable so as to mimic their different binding modes. By analyzing conformational changes and energetic properties of the complex during MD simulations, we found that interactions are preferred at DNA ends, and within the major groove, which is consistent with previous experimental investigations. In addition, the results indicate that cooperation of Ku70c with other subunits of Ku(sub 70/80) is necessary to explain the high affinity of binding as observed in experiments.

  9. The inner mantle of the giant clam, Tridacna squamosa, expresses a basolateral Na+/K+-ATPase α-subunit, which displays light-dependent gene and protein expression along the shell-facing epithelium.

    PubMed

    Boo, Mel V; Hiong, Kum C; Choo, Celine Y L; Cao-Pham, Anh H; Wong, Wai P; Chew, Shit F; Ip, Yuen K

    2017-01-01

    Na+/K+-ATPase (NKA) is essential for maintaining the Na+ and K+ gradients, and supporting the secondary active transport of certain ions/molecules, across the plasma membrane of animal cells. This study aimed to clone the NKA α-subunit (NKAα) from the inner mantle adjacent to the extrapallial fluid of Tridacna squamosa, to determine its subcellular localization, and to examine the effects of light exposure on its transcript level and protein abundance. The cDNA coding sequence of NKAα from T. squamosa comprised 3105 bp, encoding 1034 amino acids with an estimated molecular mass of 114 kDa. NKAα had a basolateral localization along the shell-facing epithelium of the inner mantle. Exposure to 12 h of light led to a significantly stronger basolateral NKAα-immunofluorescence at the shell-facing epithelium, indicating that NKA might play a role in light-enhanced calcification in T. squamosa. After 3 h of light exposure, the transcript level of NKAα decreased transiently in the inner mantle, but returned to the control level thereafter. In comparison, the protein abundance of NKAα remained unchanged at hour 3, but became significantly higher than the control after 12 h of light exposure. Hence, the expression of NKAα in the inner mantle of T. squamosa was light-dependent. It is probable that a higher expression level of NKA was needed in the shell-facing epithelial cells of the inner mantle to cope with a rise in Na+ influx, possibly caused by increases in activities of some Na+-dependent ion transporters/channels involved in light-enhanced calcification.

  10. A Cyclin Dependent Kinase Regulatory Subunit (CKS) Gene of Pigeonpea Imparts Abiotic Stress Tolerance and Regulates Plant Growth and Development in Arabidopsis

    PubMed Central

    Tamirisa, Srinath; Vudem, Dashavantha R.; Khareedu, Venkateswara R.

    2017-01-01

    Frequent climatic changes in conjunction with other extreme environmental factors are known to affect growth, development and productivity of diverse crop plants. Pigeonpea, a major grain legume of the semiarid tropics, endowed with an excellent deep-root system, is known as one of the important drought tolerant crop plants. Cyclin dependent kinases (CDKs) are core cell cycle regulators and play important role in different aspects of plant growth and development. The cyclin-dependent kinase regulatory subunit gene (CKS) was isolated from the cDNA library of pigeonpea plants subjected to drought stress. Pigeonpea CKS (CcCKS) gene expression was detected in both the root and leaf tissues of pigeonpea and was upregulated by polyethylene glycol (PEG), mannitol, NaCl and abscisic acid (ABA) treatments. The overexpression of CcCKS gene in Arabidopsis significantly enhanced tolerance of transgenics to drought and salt stresses as evidenced by different physiological parameters. Under stress conditions, transgenics showed higher biomass, decreased rate of water loss, decreased MDA levels, higher free proline contents, and glutathione levels. Moreover, under stress conditions transgenics exhibited lower stomatal conductance, lower transpiration, and higher photosynthetic rates. However, under normal conditions, CcCKS-transgenics displayed decreased plant growth rate, increased cell size and decreased stomatal number compared to those of wild-type plants. Real-time polymerase chain reaction revealed that CcCKS could regulate the expression of both ABA-dependent and ABA-independent genes associated with abiotic stress tolerance as well as plant growth and development. As such, the CcCKS seems promising and might serve as a potential candidate gene for enhancing the abiotic stress tolerance of crop plants. PMID:28239388

  11. A Cyclin Dependent Kinase Regulatory Subunit (CKS) Gene of Pigeonpea Imparts Abiotic Stress Tolerance and Regulates Plant Growth and Development in Arabidopsis.

    PubMed

    Tamirisa, Srinath; Vudem, Dashavantha R; Khareedu, Venkateswara R

    2017-01-01

    Frequent climatic changes in conjunction with other extreme environmental factors are known to affect growth, development and productivity of diverse crop plants. Pigeonpea, a major grain legume of the semiarid tropics, endowed with an excellent deep-root system, is known as one of the important drought tolerant crop plants. Cyclin dependent kinases (CDKs) are core cell cycle regulators and play important role in different aspects of plant growth and development. The cyclin-dependent kinase regulatory subunit gene ( CKS ) was isolated from the cDNA library of pigeonpea plants subjected to drought stress. Pigeonpea CKS ( CcCKS ) gene expression was detected in both the root and leaf tissues of pigeonpea and was upregulated by polyethylene glycol (PEG), mannitol, NaCl and abscisic acid (ABA) treatments. The overexpression of CcCKS gene in Arabidopsis significantly enhanced tolerance of transgenics to drought and salt stresses as evidenced by different physiological parameters. Under stress conditions, transgenics showed higher biomass, decreased rate of water loss, decreased MDA levels, higher free proline contents, and glutathione levels. Moreover, under stress conditions transgenics exhibited lower stomatal conductance, lower transpiration, and higher photosynthetic rates. However, under normal conditions, CcCKS -transgenics displayed decreased plant growth rate, increased cell size and decreased stomatal number compared to those of wild-type plants. Real-time polymerase chain reaction revealed that Cc CKS could regulate the expression of both ABA-dependent and ABA-independent genes associated with abiotic stress tolerance as well as plant growth and development. As such, the CcCKS seems promising and might serve as a potential candidate gene for enhancing the abiotic stress tolerance of crop plants.

  12. Cyclophilin B Interacts with Sodium-Potassium ATPase and Is Required for Pump Activity in Proximal Tubule Cells of the Kidney

    PubMed Central

    Suñé, Guillermo; Sarró, Eduard; Puigmulé, Marta; López-Hellín, Joan; Zufferey, Madeleine; Pertel, Thomas; Luban, Jeremy; Meseguer, Anna

    2010-01-01

    Cyclophilins (Cyps), the intracellular receptors for Cyclosporine A (CsA), are responsible for peptidyl-prolyl cis-trans isomerisation and for chaperoning several membrane proteins. Those functions are inhibited upon CsA binding. Albeit its great benefits as immunosuppressant, the use of CsA has been limited by undesirable nephrotoxic effects, including sodium retention, hypertension, hyperkalemia, interstial fibrosis and progressive renal failure in transplant recipients. In this report, we focused on the identification of novel CypB-interacting proteins to understand the role of CypB in kidney function and, in turn, to gain further insight into the molecular mechanisms of CsA-induced toxicity. By means of yeast two-hybrid screens with human kidney cDNA, we discovered a novel interaction between CypB and the membrane Na/K-ATPase β1 subunit protein (Na/K-β1) that was confirmed by pull-down, co-immunoprecipitation and confocal microscopy, in proximal tubule-derived HK-2 cells. The Na/K-ATPase pump, a key plasma membrane transporter, is responsible for maintenance of electrical Na+ and K+ gradients across the membrane. We showed that CypB silencing produced similar effects on Na/K-ATPase activity than CsA treatment in HK-2 cells. It was also observed an enrichment of both alpha and beta subunits in the ER, what suggested a possible failure on the maturation and routing of the pump from this compartment towards the plasma membrane. These data indicate that CypB through its interaction with Na/K-β1 might regulate maturation and trafficking of the pump through the secretory pathway, offering new insights into the relationship between cyclophilins and the nephrotoxic effects of CsA. PMID:21085665

  13. Cyclophilin B interacts with sodium-potassium ATPase and is required for pump activity in proximal tubule cells of the kidney.

    PubMed

    Suñé, Guillermo; Sarró, Eduard; Puigmulé, Marta; López-Hellín, Joan; Zufferey, Madeleine; Pertel, Thomas; Luban, Jeremy; Meseguer, Anna

    2010-11-10

    Cyclophilins (Cyps), the intracellular receptors for Cyclosporine A (CsA), are responsible for peptidyl-prolyl cis-trans isomerisation and for chaperoning several membrane proteins. Those functions are inhibited upon CsA binding. Albeit its great benefits as immunosuppressant, the use of CsA has been limited by undesirable nephrotoxic effects, including sodium retention, hypertension, hyperkalemia, interstial fibrosis and progressive renal failure in transplant recipients. In this report, we focused on the identification of novel CypB-interacting proteins to understand the role of CypB in kidney function and, in turn, to gain further insight into the molecular mechanisms of CsA-induced toxicity. By means of yeast two-hybrid screens with human kidney cDNA, we discovered a novel interaction between CypB and the membrane Na/K-ATPase β1 subunit protein (Na/K-β1) that was confirmed by pull-down, co-immunoprecipitation and confocal microscopy, in proximal tubule-derived HK-2 cells. The Na/K-ATPase pump, a key plasma membrane transporter, is responsible for maintenance of electrical Na+ and K+ gradients across the membrane. We showed that CypB silencing produced similar effects on Na/K-ATPase activity than CsA treatment in HK-2 cells. It was also observed an enrichment of both alpha and beta subunits in the ER, what suggested a possible failure on the maturation and routing of the pump from this compartment towards the plasma membrane. These data indicate that CypB through its interaction with Na/K-β1 might regulate maturation and trafficking of the pump through the secretory pathway, offering new insights into the relationship between cyclophilins and the nephrotoxic effects of CsA.

  14. Molecular characterization of hypoxia and hypoxia-inducible factor 1 alpha (HIF-1α) from Taiwan voles (Microtus kikuchii).

    PubMed

    Jiang, Yi-Fan; Chou, Chung-Hsi; Lin, En-Chung; Chiu, Chih-Hsien

    2011-02-01

    Hypoxia-inducible factor 1 (HIF-1) is a transcription factor that senses and adapts cells to hypoxic environmental conditions. HIF-1 is composed of an oxygen-regulated α subunit (HIF-1α) and a constitutively expressed β subunit (HIF-1β). Taiwan voles (Microtus kikuchii) are an endemic species in Taiwan, found only in mountainous areas greater than 2000m above sea level. In this study, the full-length HIF-1α cDNA was cloned and sequenced from liver tissues of Taiwan voles. We found that HIF-1α of Taiwan voles had high sequence similarity to HIF-1α of other species. Sequence alignment of HIF-1α functional domains indicated basic helix-loop-helix (bHLH), PER-ARNT-SIM (PAS) and C-terminal transactivation (TAD-C) domains were conserved among species, but sequence variations were found between the oxygen-dependent degradation domains (ODDD). To measure Taiwan vole HIF-1α responses to hypoxia, animals were challenged with cobalt chloride, and HIF-1α mRNA and protein expression in brain, lung, heart, liver, kidney, and muscle was assessed by quantitative RT-PCR and Western blot analysis. Upon induction of hypoxic stress with cobalt chloride, an increase in HIF-1α mRNA levels was detected in lung, heart, kidney, and muscle tissue. In contrast, protein expression levels showed greater variation between individual animals. These results suggest that the regulation of HIF-1α may be important to the Taiwan vole under cobalt chloride treatments. But more details regarding the evolutionary effect of environmental pressure on HIF-1α primary sequence, HIF-1α function and regulation in Taiwan voles remain to be identified. Copyright © 2010 Elsevier Inc. All rights reserved.

  15. Two ways of legumin-precursor processing in conifers. Characterization and evolutionary relationships of Metasequoia cDNAs representing two divergent legumin gene subfamilies.

    PubMed

    Häger, K P; Wind, C

    1997-06-15

    Subunit monomers and oligomers of crystalloid-type legumins are major components of SDS-soluble fractions from Metasequoia glyptostroboides (Dawn redwood, Taxodiaceae) seed proteins. The subunits are made up of disulfide linked alpha-polypeptides and beta-polypeptides with molecular masses of 33 kDa and 23-25 kDa, respectively. Unusually for legumins, those from Metasequoia are glycosylated and the carbohydrate moieties are residing in the C-terminal region of the respective beta-polypeptides. A Metasequoia endosperm cDNA library has been constructed and legumin-encoding transcripts representing two divergent gene subfamilies have been characterized. Intersubfamily comparisons reveal 75% identity at the amino acid level and the values range from 53-35% when the legumin precursors deduced were compared with those from angiosperms. The predicted sequences together with data from amino acid sequencing prove that post-translational processing of Metasequoia prolegumins is directed to two different processing sites, each of them specific for one of the legumin subfamilies. The sites involved differ in their relative position and in the junction to be cleaved: Metasequoia legumin precursors MgLeg18 and MgLeg26 contain the conventional post-translational Asn-Gly processing site, which is generally regarded as highly conserved. In contrast, the MgLeg4 precursor is lacking this site and post-translational cleavage is directed to an unusual Asn-Thr processing site located in its hypervariable region, causing N-terminal extension of the beta-polypeptide relative to those hitherto known. Evidence is given that the unusual variant of processing also occurs in other conifers. Phylogenetic analysis reveals the precursors concerned as representatives of a distinct legumin subfamily, originating from duplication of an ancestral gene prior to or at the beginning of Taxodiaceae diversification.

  16. DNA polymerase gamma from Xenopus laevis. I. The identification of a high molecular weight catalytic subunit by a novel DNA polymerase photolabeling procedure

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Insdorf, N.F.; Bogenhagen, D.F.

    1989-12-25

    DNA polymerase gamma has been purified over 10,000-fold from mitochondria of Xenopus laevis ovaries. We have developed a novel technique which specifically photolabels DNA polymerases. This procedure, the DNA polymerase trap, was used to identify a catalytic subunit of 140,000 Da from X. laevis DNA polymerase gamma. Additional catalytically active polypeptides of 100,000 and 55,000 Da were identified in the highly purified enzyme. These appear to be products of degradation of the 140,000-Da subunit. The DNA polymerase trap, which does not require large amounts of enzyme or renaturation from sodium dodecyl sulfate, is an alternative to the classic activity gel.

  17. Functional reconstitution of the Mycobacterium tuberculosis long-chain acyl-CoA carboxylase from multiple acyl-CoA subunits.

    PubMed

    Bazet Lyonnet, Bernardo; Diacovich, Lautaro; Gago, Gabriela; Spina, Lucie; Bardou, Fabienne; Lemassu, Anne; Quémard, Annaïk; Gramajo, Hugo

    2017-04-01

    Mycobacterium tuberculosis produces a large number of structurally diverse lipids that have been implicated in the pathogenicity, persistence and antibiotic resistance of this organism. Most building blocks involved in the biosynthesis of all these lipids are generated by acyl-CoA carboxylases whose subunit composition and physiological roles have not yet been clearly established. Inconclusive data in the literature refer to the exact protein composition and substrate specificity of the enzyme complex that produces the long-chain α-carboxy-acyl-CoAs, which are substrates involved in the last step of condensation mediated by the polyketide synthase 13 to synthesize mature mycolic acids. Here we have successfully reconstituted the long-chain acyl-CoA carboxylase (LCC) complex from its purified components, the α subunit (AccA3), the ε subunit (AccE5) and the two β subunits (AccD4 and AccD5), and demonstrated that the four subunits are essential for its activity. Furthermore, we also showed by substrate competition experiments and the use of a specific inhibitor that the AccD5 subunit's role in the carboxylation of the long acyl-CoAs, as part of the LCC complex, was structural rather than catalytic. Moreover, AccD5 was also able to carboxylate its natural substrates, acetyl-CoA and propionyl-CoA, in the context of the LCC enzyme complex. Thus, the supercomplex formed by these four subunits has the potential to generate the main substrates, malonyl-CoA, methylmalonyl-CoA and α-carboxy-C 24-26 -CoA, used as condensing units for the biosynthesis of all the lipids present in this pathogen. © 2017 Federation of European Biochemical Societies.

  18. Activation of interspecies-hybrid Rubisco enzymes to assess different models for the Rubisco-Rubisco activase interaction.

    PubMed

    Wachter, Rebekka M; Salvucci, Michael E; Carmo-Silva, A Elizabete; Barta, Csengele; Genkov, Todor; Spreitzer, Robert J

    2013-11-01

    Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) is prone to inactivation from non-productive binding of sugar-phosphates. Reactivation of Rubisco requires conformational remodeling by a specific chaperone, Rubisco activase. Rubisco activase from tobacco and other plants in the family Solanaceae is an inefficient activator of Rubisco from non-Solanaceae plants and from the green alga Chlamydomonas reinhardtii. To determine if the Rubisco small subunit plays a role in the interaction with Rubisco activase, a hybrid Rubisco (SSNT) composed of tobacco small subunits and Chlamydomonas large subunits was constructed. The SSNT hybrid, like other hybrid Rubiscos containing plant small subunits, supported photoautotrophic growth in Chlamydomonas, but growth in air was much slower than for cells containing wild-type Rubisco. The kinetic properties of the SSNT hybrid Rubisco were similar to the wild-type enzyme, indicating that the poor growth in air was probably caused by disruption of pyrenoid formation and the consequent impairment of the CO2concentrating mechanism. Recombinant Rubisco activase from Arabidopsis activated the SSNT hybrid Rubisco and hybrid Rubiscos containing spinach and Arabidopsis small subunits at rates similar to the rates with wild-type Rubisco. However, none of the hybrid Rubiscos was activated by tobacco Rubisco activase. That replacement of Chlamydomonas small subunits with plant small subunits does not affect the species-specific interaction between Rubisco and Rubisco activase suggests that the association is not dominated by the small subunits that surround the Rubisco central solvent channel. Therefore, the geometry of a side-on binding mode is more consistent with the data than a top-on or ring-stacking binding mode.

  19. Functional role of the MrpA- and MrpD-homologous protein subunits in enzyme complexes evolutionary related to respiratory chain complex I.

    PubMed

    Moparthi, Vamsi K; Kumar, Brijesh; Al-Eryani, Yusra; Sperling, Eva; Górecki, Kamil; Drakenberg, Torbjörn; Hägerhäll, Cecilia

    2014-01-01

    NADH:quinone oxidoreductase or complex I is a large membrane bound enzyme complex that has evolved from the combination of smaller functional building blocks. Intermediate size enzyme complexes exist in nature that comprise some, but not all of the protein subunits in full size 14-subunit complex I. The membrane spanning complex I subunits NuoL, NuoM and NuoN are homologous to each other and to two proteins from one particular class of Na(+)/H(+) antiporters, denoted MrpA and MrpD. In complex I, these ion transporter protein subunits are prime candidates for harboring important parts of the proton pumping machinery. Using a model system, consisting of Bacillus subtilis MrpA and MrpD deletion strains and a low copy expression plasmid, it was recently demonstrated that NuoN can rescue the strain deleted for MrpD but not that deleted for MrpA, whereas the opposite tendency was seen for NuoL. This demonstrated that the MrpA-type and MrpD-type proteins have unique functional specializations. In this work, the corresponding antiporter-like protein subunits from the smaller enzymes evolutionarily related to complex I were tested in the same model system. The subunits from 11-subunit complex I from Bacillus cereus behaved essentially as those from full size complex I, corroborating that this enzyme should be regarded as a bona fide complex I. The hydrogenase-3 and hydrogenase-4 antiporter-like proteins on the other hand, could substitute equally well for MrpA or MrpD at pH7.4, suggesting that these enzymes have intermediate forms of the antiporter-like proteins, which seemingly lack the functional specificity. © 2013. Published by Elsevier B.V. All rights reserved.

  20. Histidinoalanine, a naturally occurring cross-link derived from phosphoserine and histidine residues in mineral-binding phosphoproteins.

    PubMed

    Marsh, M E

    1986-05-06

    Native mineral-containing phosphoprotein particles were isolated from the Heterodont bivalve Macrocallista nimbosa. The native particles are discrete structures about 40 nm in diameter which migrate as a single band during electrophoresis in agarose gels. Removal of the mineral component with ethylenediaminetetraacetic acid dissociates the native protein into nonidentical subunits. The lower molecular weight subunits, representing 8% of the total protein, were obtained by differential centrifugation. The native protein is characterized by a high content of aspartic acid, phosphoserine, phosphothreonine, histidine, and the bifunctional cross-linking residue histidinoalanine. The low molecular weight subunits have the same amino acid composition except for a reduction in histidinoalanine and a corresponding increase in phosphoserine and histidine residues, demonstrating that the alanine portion of the cross-link is derived from phosphoserine residues. Ion-exchange chromatography and molecular sieve chromatography show that the low molecular weight subunits have a similar charge density but differ in molecular weight, and the relative mobilities of the subunits on agarose gels indicate that they are polymers of a single phosphoprotein molecule. The minimum molecular weight of the monomer is about 140 000 on the basis of the amino acid composition. The high molecular weight subunits are rich in histidinoalanine and too large to be resolved by either molecular sieve chromatography or gel electrophoresis. On the basis of the ultrastructural, electrophoretic, chromatographic, and compositional evidence, native phosphoprotein particles are composed of subunits ionically cross-linked via divalent cations. These subunits are variable molecular weight aggregates of a single phosphoprotein molecule covalently cross-linked via histidinoalanine residues. Evidence for a nonenzymatic cross-linking mechanism is discussed.

  1. Characterization of the Genes Encoding the Cytosolic and Plastidial Forms of ADP-Glucose Pyrophosphorylase in Wheat Endosperm1

    PubMed Central

    Burton, Rachel A.; Johnson, Philip E.; Beckles, Diane M.; Fincher, Geoffrey B.; Jenner, Helen L.; Naldrett, Mike J.; Denyer, Kay

    2002-01-01

    In most species, the synthesis of ADP-glucose (Glc) by the enzyme ADP-Glc pyrophosphorylase (AGPase) occurs entirely within the plastids in all tissues so far examined. However, in the endosperm of many, if not all grasses, a second form of AGPase synthesizes ADP-Glc outside the plastid, presumably in the cytosol. In this paper, we show that in the endosperm of wheat (Triticum aestivum), the cytosolic form accounts for most of the AGPase activity. Using a combination of molecular and biochemical approaches to identify the cytosolic and plastidial protein components of wheat endosperm AGPase we show that the large and small subunits of the cytosolic enzyme are encoded by genes previously thought to encode plastidial subunits, and that a gene, Ta.AGP.S.1, which encodes the small subunit of the cytosolic form of AGPase, also gives rise to a second transcript by the use of an alternate first exon. This second transcript encodes an AGPase small subunit with a transit peptide. However, we could not find a plastidial small subunit protein corresponding to this transcript. The protein sequence of the purified plastidial small subunit does not match precisely to that encoded by Ta.AGP.S.1 or to the predicted sequences of any other known gene from wheat or barley (Hordeum vulgare). Instead, the protein sequence is most similar to those of the plastidial small subunits from chickpea (Cicer arietinum) and maize (Zea mays) and rice (Oryza sativa) seeds. These data suggest that the gene encoding the major plastidial small subunit of AGPase in wheat endosperm has yet to be identified. PMID:12428011

  2. Genome-Wide Identification and Comprehensive Expression Profiling of Ribosomal Protein Small Subunit (RPS) Genes and their Comparative Analysis with the Large Subunit (RPL) Genes in Rice

    PubMed Central

    Saha, Anusree; Das, Shubhajit; Moin, Mazahar; Dutta, Mouboni; Bakshi, Achala; Madhav, M. S.; Kirti, P. B.

    2017-01-01

    Ribosomal proteins (RPs) are indispensable in ribosome biogenesis and protein synthesis, and play a crucial role in diverse developmental processes. Our previous studies on Ribosomal Protein Large subunit (RPL) genes provided insights into their stress responsive roles in rice. In the present study, we have explored the developmental and stress regulated expression patterns of Ribosomal Protein Small (RPS) subunit genes for their differential expression in a spatiotemporal and stress dependent manner. We have also performed an in silico analysis of gene structure, cis-elements in upstream regulatory regions, protein properties and phylogeny. Expression studies of the 34 RPS genes in 13 different tissues of rice covering major growth and developmental stages revealed that their expression was substantially elevated, mostly in shoots and leaves indicating their possible involvement in the development of vegetative organs. The majority of the RPS genes have manifested significant expression under all abiotic stress treatments with ABA, PEG, NaCl, and H2O2. Infection with important rice pathogens, Xanthomonas oryzae pv. oryzae (Xoo) and Rhizoctonia solani also induced the up-regulation of several of the RPS genes. RPS4, 13a, 18a, and 4a have shown higher transcript levels under all the abiotic stresses, whereas, RPS4 is up-regulated in both the biotic stress treatments. The information obtained from the present investigation would be useful in appreciating the possible stress-regulatory attributes of the genes coding for rice ribosomal small subunit proteins apart from their functions as house-keeping proteins. A detailed functional analysis of independent genes is required to study their roles in stress tolerance and generating stress- tolerant crops. PMID:28966624

  3. Plant RuBisCo assembly in E. coli with five chloroplast chaperones including BSD2.

    PubMed

    Aigner, H; Wilson, R H; Bracher, A; Calisse, L; Bhat, J Y; Hartl, F U; Hayer-Hartl, M

    2017-12-08

    Plant RuBisCo, a complex of eight large and eight small subunits, catalyzes the fixation of CO 2 in photosynthesis. The low catalytic efficiency of RuBisCo provides strong motivation to reengineer the enzyme with the goal of increasing crop yields. However, genetic manipulation has been hampered by the failure to express plant RuBisCo in a bacterial host. We achieved the functional expression of Arabidopsis thaliana RuBisCo in Escherichia coli by coexpressing multiple chloroplast chaperones. These include the chaperonins Cpn60/Cpn20, RuBisCo accumulation factors 1 and 2, RbcX, and bundle-sheath defective-2 (BSD2). Our structural and functional analysis revealed the role of BSD2 in stabilizing an end-state assembly intermediate of eight RuBisCo large subunits until the small subunits become available. The ability to produce plant RuBisCo recombinantly will facilitate efforts to improve the enzyme through mutagenesis. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  4. Structure of a [NiFe] hydrogenase maturation protease HycI provides insights into its substrate selectivity.

    PubMed

    Kwon, Sunghark; Nishitani, Yuichi; Hirao, Yoshinori; Kanai, Tamotsu; Atomi, Haruyuki; Miki, Kunio

    2018-04-15

    The immature large subunit of [NiFe] hydrogenases undergoes C-terminal cleavage by a specific protease in the final step of the post-translational process before assembly with other subunits. It has been reported that the [NiFe] hydrogenase maturation protease HycI from Thermococcus kodakarensis (TkHycI) has the catalytic ability to target the membrane-bound hydrogenase large subunit MbhL from T. kodakarensis. However, the detailed mechanism of its substrate recognition remains elusive. We determined the crystal structure of TkHycI at 1.59 Å resolution to clarify how TkHycI recognizes its own substrate MbhL. Although the overall structure of TkHycI is similar to that of its homologous protease TkHybD, TkHycI adopts a larger loop than TkHybD, thereby creating a broad and deep cleft. We analyzed the structural properties of the TkHycI cleft probably involved in its substrate recognition. Our findings provide novel and profound insights into the substrate selectivity of TkHycI. Copyright © 2018 Elsevier Inc. All rights reserved.

  5. The nucleotide sequence of the entire ribosomal DNA operon and the structure of the large subunit rRNA of Giardia muris.

    PubMed

    van Keulen, H; Gutell, R R; Campbell, S R; Erlandsen, S L; Jarroll, E L

    1992-10-01

    The total nucleotide sequence of the rDNA of Giardia muris, an intestinal protozoan parasite of rodents, has been determined. The repeat unit is 7668 basepairs (bp) in size and consists of a spacer of 3314 bp, a small-subunit rRNA (SSU-rRNA) gene of 1429, and a large-subunit rRNA (LSU-rRNA) gene of 2698 bp. The spacer contains long direct repeats and is heterogeneous in size. The LSU-rRNA of G. muris was compared to that of the human intestinal parasite Giardia duodenalis, to the bird parasite Giardia ardeae, and to that of Escherichia coli. The LSU-rRNA has a size comparable to the 23S rRNA of E. coli but shows structural features typical for eukaryotes. Some variable regions are typically small and account for the overall smaller size of this rRNA. The structure of the G. muris LSU-rRNA is similar to that of the other Giardia rRNA, but each rRNA has characteristic features residing in a number of variable regions.

  6. Lectin cDNA and transgenic plants derived therefrom

    DOEpatents

    Raikhel, Natasha V.

    2000-10-03

    Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

  7. Structural symmetry and protein function.

    PubMed

    Goodsell, D S; Olson, A J

    2000-01-01

    The majority of soluble and membrane-bound proteins in modern cells are symmetrical oligomeric complexes with two or more subunits. The evolutionary selection of symmetrical oligomeric complexes is driven by functional, genetic, and physicochemical needs. Large proteins are selected for specific morphological functions, such as formation of rings, containers, and filaments, and for cooperative functions, such as allosteric regulation and multivalent binding. Large proteins are also more stable against denaturation and have a reduced surface area exposed to solvent when compared with many individual, smaller proteins. Large proteins are constructed as oligomers for reasons of error control in synthesis, coding efficiency, and regulation of assembly. Symmetrical oligomers are favored because of stability and finite control of assembly. Several functions limit symmetry, such as interaction with DNA or membranes, and directional motion. Symmetry is broken or modified in many forms: quasisymmetry, in which identical subunits adopt similar but different conformations; pleomorphism, in which identical subunits form different complexes; pseudosymmetry, in which different molecules form approximately symmetrical complexes; and symmetry mismatch, in which oligomers of different symmetries interact along their respective symmetry axes. Asymmetry is also observed at several levels. Nearly all complexes show local asymmetry at the level of side chain conformation. Several complexes have reciprocating mechanisms in which the complex is asymmetric, but, over time, all subunits cycle through the same set of conformations. Global asymmetry is only rarely observed. Evolution of oligomeric complexes may favor the formation of dimers over complexes with higher cyclic symmetry, through a mechanism of prepositioned pairs of interacting residues. However, examples have been found for all of the crystallographic point groups, demonstrating that functional need can drive the evolution of any symmetry.

  8. Fragmentation of the CRISPR-Cas Type I-B signature protein Cas8b.

    PubMed

    Richter, Hagen; Rompf, Judith; Wiegel, Julia; Rau, Kristina; Randau, Lennart

    2017-11-01

    CRISPR arrays are transcribed into long precursor RNA species, which are further processed into mature CRISPR RNAs (crRNAs). Cas proteins utilize these crRNAs, which contain spacer sequences that can be derived from mobile genetic elements, to mediate immunity during a reoccurring virus infection. Type I CRISPR-Cas systems are defined by the presence of different Cascade interference complexes containing large and small subunits that play major roles during target DNA selection. Here, we produce the protein and crRNA components of the Type I-B CRISPR-Cas complex of Clostridium thermocellum and Methanococcus maripaludis. The C. thermocellum Cascade complexes were reconstituted and analyzed via size-exclusion chromatography. Activity of the heterologous M. maripaludis CRISPR-Cas system was followed using phage lambda plaques assays. The reconstituted Type-I-B Cascade complex contains Cas7, Cas5, Cas6b and the large subunit Cas8b. Cas6b can be omitted from the reconstitution protocol. The large subunit Cas8b was found to be represented by two tightly associated protein fragments and a small C-terminal Cas8b segment was identified in recombinant complexes and C. thermocellum cell lysate. Production of Cas8b generates a small C-terminal fragment, which is suggested to fulfill the role of the missing small subunit. A heterologous, synthetic M. maripaludis Type I-B system is active in E. coli against phage lambda, highlighting a potential for genome editing using endogenous Type-I-B CRISPR-Cas machineries. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.

  9. The comprehensive analysis of DEG/ENaC subunits in Hydra reveals a large variety of peptide-gated channels, potentially involved in neuromuscular transmission.

    PubMed

    Assmann, Marc; Kuhn, Anne; Dürrnagel, Stefan; Holstein, Thomas W; Gründer, Stefan

    2014-10-14

    It is generally the case that fast transmission at neural synapses is mediated by small molecule neurotransmitters. The simple nervous system of the cnidarian Hydra, however, contains a large repertoire of neuropeptides and it has been suggested that neuropeptides are the principal transmitters of Hydra. An ion channel directly gated by Hydra-RFamide neuropeptides has indeed been identified in Hydra - the Hydra Na+ channel (HyNaC) 2/3/5, which is expressed at the oral side of the tentacle base. Hydra-RFamides are more widely expressed, however, being found in neurons of the head and peduncle region. Here, we explore whether further peptide-gated HyNaCs exist, where in the animal they are expressed, and whether they are all gated by Hydra-RFamides. We report molecular cloning of seven new HyNaC subunits - HyNaC6 to HyNaC12, all of which are members of the DEG/ENaC gene family. In Xenopus oocytes, these subunits assemble together with the four already known subunits into thirteen different ion channels that are directly gated by Hydra-RFamide neuropeptides with high affinity (up to 40 nM). In situ hybridization suggests that HyNaCs are expressed in epitheliomuscular cells at the oral and the aboral side of the tentacle base and at the peduncle. Moreover, diminazene, an inhibitor of HyNaCs, delayed tentacle movement in live Hydra. Our results show that Hydra has a large variety of peptide-gated ion channels that are activated by a restricted number of related neuropeptides. The existence and expression pattern of these channels, and behavioral effects induced by channel blockers, suggests that Hydra co-opted neuropeptides for fast neuromuscular transmission.

  10. Characterization of a Polycyclic Aromatic Hydrocarbon Degradation Gene Cluster in a Phenanthrene-Degrading Acidovorax Strain▿

    PubMed Central

    Singleton, David R.; Guzmán Ramirez, Liza; Aitken, Michael D.

    2009-01-01

    Acidovorax sp. strain NA3 was isolated from polycyclic aromatic hydrocarbon (PAH)-contaminated soil that had been treated in a bioreactor and enriched with phenanthrene. The 16S rRNA gene of the isolate possessed 99.8 to 99.9% similarity to the dominant sequences recovered during a previous stable-isotope probing experiment with [U-13C]phenanthrene on the same soil (D. R. Singleton, S. N. Powell, R. Sangaiah, A. Gold, L. M. Ball, and M. D. Aitken, Appl. Environ. Microbiol. 71:1202-1209, 2005). The strain grew on phenanthrene as a sole carbon and energy source and could mineralize 14C from a number of partially labeled PAHs, including naphthalene, phenanthrene, chrysene, benz[a]anthracene, and benzo[a]pyrene, but not pyrene or fluoranthene. Southern hybridizations of a genomic fosmid library with a fragment of the large subunit of the ring-hydroxylating dioxygenase gene from a naphthalene-degrading Pseudomonas strain detected the presence of PAH degradation genes subsequently determined to be highly similar in both nucleotide sequence and gene organization to an uncharacterized Alcaligenes faecalis gene cluster. The genes were localized to the chromosome of strain NA3. To test for gene induction by selected compounds, RNA was extracted from amended cultures and reverse transcribed, and cDNA associated with the enzymes involved in the first three steps of phenanthrene degradation was quantified by quantitative real-time PCR. Expression of each of the genes was induced most strongly by phenanthene and to a lesser extent by naphthalene, but other tested PAHs and PAH metabolites had negligible effects on gene transcript levels. PMID:19270134

  11. A lectin of a non-invasive apple snail as an egg defense against predation alters the rat gut morphophysiology.

    PubMed

    Ituarte, Santiago; Brola, Tabata Romina; Fernández, Patricia Elena; Mu, Huawei; Qiu, Jian-Wen; Heras, Horacio; Dreon, Marcos Sebastián

    2018-01-01

    The eggs of the freshwater Pomacea apple snails develop above the water level, exposed to varied physical and biological stressors. Their high hatching success seems to be linked to their proteins or perivitellins, which surround the developing embryo providing nutrients, sunscreens and varied defenses. The defensive mechanism has been unveiled in P. canaliculata and P. maculata eggs, where their major perivitellins are pigmented, non-digestible and provide a warning coloration while another perivitellin acts as a toxin. In P. scalaris, a species sympatric to the former, the defense strategy seems different, since no toxin was found and the major perivitellin, PsSC, while also colored and non-digestible, is a carbohydrate-binding protein. In this study we examine the structure and function of PsSC by sequencing its subunits, characterizing its carbohydrate binding profile and evaluating its effect on gut cells. Whereas cDNA sequencing and database search showed no lectin domain, glycan array carbohydrate binding profile revealed a strong specificity for glycosphingolipids and ABO group antigens. Moreover, PsSC agglutinated bacteria in a dose-dependent manner. Inspired on the defensive properties of seed lectins we evaluated the effects of PsSC on intestinal cells both in vitro (Caco-2 and IEC-6 cells) and in the gastrointestinal tract of rats. PsSC binds to Caco-2 cell membranes without reducing its viability, while a PsSC-containing diet temporarily induces large epithelium alterations and an increased absorptive surface. Based on these results, we propose that PsSC is involved in embryo defenses by altering the gut morphophysiology of potential predators, a convergent role to plant defensive lectins.

  12. Effects of CO2 and iron availability on rbcL gene expression in Bering Sea diatoms

    NASA Astrophysics Data System (ADS)

    Endo, H.; Sugie, K.; Yoshimura, T.; Suzuki, K.

    2014-12-01

    Iron (Fe) can limit phytoplankton productivity in approximately 40% of the global ocean, including high-nutrient, low-chlorophyll (HNLC) waters. However, there is little information available on the impact of CO2-induced seawater acidification on natural phytoplankton assemblages in HNLC regions. We therefore conducted an on-deck experiment manipulating CO2 and Fe using Fe-deficient Bering Sea waters during the summer of 2009. The concentrations of CO2 in the incubation bottles were set at 380 and 600 ppm in the non-Fe-added (control) bottles and 180, 380, 600, and 1000 ppm in the Fe-added bottles. The phytoplankton assemblages were primarily composed of diatoms followed by haptophytes in all incubation bottles as estimated by pigment signatures throughout the 7 day incubation period. At the end of incubation, the relative contributions of diatoms to chlorophyll a biomass decreased significantly with increased CO2 levels in the controls, whereas minimal changes were found in the Fe-added treatments. These results indicate that, under Fe-deficient conditions, the growth of diatoms was negatively affected by the increase in CO2 availability. To confirm this, we estimated the expression and phylogeny of rbcL (which encodes the large subunit of RubisCO) mRNA in diatoms by quantitative reverse transcription PCR and clone library techniques, respectively. Interestingly, regardless of Fe availability, the expression and diversity of rbcL cDNA decreased in the high CO2 treatments (600 and 1000 ppm). The present study suggests that the projected future increase in seawater pCO2 could reduce the RubisCO activity of diatoms, resulting in a decrease in primary productivity and a shift in the food web structure of the Bering Sea.

  13. Response of Spring Diatoms to CO2 Availability in the Western North Pacific as Determined by Next-Generation Sequencing.

    PubMed

    Endo, Hisashi; Sugie, Koji; Yoshimura, Takeshi; Suzuki, Koji

    2016-01-01

    Next-generation sequencing (NGS) technologies have enabled us to determine phytoplankton community compositions at high resolution. However, few studies have adopted this approach to assess the responses of natural phytoplankton communities to environmental change. Here, we report the impact of different CO2 levels on spring diatoms in the Oyashio region of the western North Pacific as estimated by NGS of the diatom-specific rbcL gene (DNA), which encodes the large subunit of RubisCO. We also examined the abundance and composition of rbcL transcripts (cDNA) in diatoms to assess their physiological responses to changing CO2 levels. A short-term (3-day) incubation experiment was carried out on-deck using surface Oyashio waters under different pCO2 levels (180, 350, 750, and 1000 μatm) in May 2011. During the incubation, the transcript abundance of the diatom-specific rbcL gene decreased with an increase in seawater pCO2 levels. These results suggest that CO2 fixation capacity of diatoms decreased rapidly under elevated CO2 levels. In the high CO2 treatments (750 and 1000 μatm), diversity of diatom-specific rbcL gene and its transcripts decreased relative to the control treatment (350 μatm), as well as contributions of Chaetocerataceae, Thalassiosiraceae, and Fragilariaceae to the total population, but the contributions of Bacillariaceae increased. In the low CO2 treatment, contributions of Bacillariaceae also increased together with other eukaryotes. These suggest that changes in CO2 levels can alter the community composition of spring diatoms in the Oyashio region. Overall, the NGS technology provided us a deeper understanding of the response of diatoms to changes in CO2 levels in terms of their community composition, diversity, and photosynthetic physiology.

  14. A Novel Helicase-Type Protein in the Nucleolus: Protein NOH61

    PubMed Central

    Zirwes, Rudolf F.; Eilbracht, Jens; Kneissel, Sandra; Schmidt-Zachmann, Marion S.

    2000-01-01

    We report the identification, cDNA cloning, and molecular characterization of a novel, constitutive nucleolar protein. The cDNA-deduced amino acid sequence of the human protein defines a polypeptide of a calculated mass of 61.5 kDa and an isoelectric point of 9.9. Inspection of the primary sequence disclosed that the protein is a member of the family of “DEAD-box” proteins, representing a subgroup of putative ATP-dependent RNA helicases. ATPase activity of the recombinant protein is evident and stimulated by a variety of polynucleotides tested. Immunolocalization studies revealed that protein NOH61 (nucleolar helicase of 61 kDa) is highly conserved during evolution and shows a strong accumulation in nucleoli. Biochemical experiments have shown that protein NOH61 synthesized in vitro sediments with ∼11.5 S, i.e., apparently as homo-oligomeric structures. By contrast, sucrose gradient centrifugation analysis of cellular extracts obtained with buffers of elevated ionic strength (600 mM NaCl) revealed that the solubilized native protein sediments with ∼4 S, suggestive of the monomeric form. Interestingly, protein NOH61 has also been identified as a specific constituent of free nucleoplasmic 65S preribosomal particles but is absent from cytoplasmic ribosomes. Treatment of cultured cells with 1) the transcription inhibitor actinomycin D and 2) RNase A results in a complete dissociation of NOH61 from nucleolar structures. The specific intracellular localization and its striking sequence homology to other known RNA helicases lead to the hypothesis that protein NOH61 might be involved in ribosome synthesis, most likely during the assembly process of the large (60S) ribosomal subunit. PMID:10749921

  15. Ectopic Mineralization in the Middle Ear and Chronic Otitis Media with Effusion Caused by RPL38 Deficiency in the Tail-short (Ts) Mouse*

    PubMed Central

    Noben-Trauth, Konrad; Latoche, Joseph R.

    2011-01-01

    Inflammation of the middle ear cavity (otitis media) and the abnormal deposition of bone at the otic capsule are common causes of conductive hearing impairment in children and adults. Although a host of environmental factors can contribute to these conditions, a genetic predisposition has an important role as well. Here, we analyze the Tail-short (Ts) mouse, which harbors a spontaneous semi-dominant mutation that causes skeletal defects and hearing loss. By genetic means, we show that the Ts phenotypes arise from an 18-kb deletion/insertion of the Rpl38 gene, encoding a ribosomal protein of the large subunit. We show that Ts mutants exhibit significantly elevated auditory-brain stem response thresholds and reduced distortion-product otoacoustic emissions, in the presence of normal endocochlear potentials and typical inner ear histology suggestive of a conductive hearing impairment. We locate the cause of the hearing impairment to the middle ear, demonstrating over-ossification at the round window ridge, ectopic deposition of cholesterol crystals in the middle ear cavity, enlarged Eustachian tube, and chronic otitis media with effusion all beginning at around 3 weeks after birth. Using specific antisera, we demonstrate that Rpl38 is an ∼8-kDa protein that is predominantly expressed in mature erythrocytes. Finally, using an Rpl38 cDNA transgene, we rescue the Ts phenotypes. Together, these data present a previously uncharacterized combination of interrelated middle ear pathologies and suggest Rpl38 deficiency as a model to dissect the causative relationships between neo-ossification, cholesterol crystal deposition, and Eustachian tubes in the etiology of otitis media. PMID:21062742

  16. The Cac2 subunit is essential for productive histone binding and nucleosome assembly in CAF-1

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mattiroli, Francesca; Gu, Yajie; Balsbaugh, Jeremy L.

    Nucleosome assembly following DNA replication controls epigenome maintenance and genome integrity. Chromatin assembly factor 1 (CAF-1) is the histone chaperone responsible for histone (H3-H4)2 deposition following DNA synthesis. Structural and functional details for this chaperone complex and its interaction with histones are slowly emerging. Using hydrogen-deuterium exchange coupled to mass spectrometry, combined with in vitro and in vivo mutagenesis studies, we identified the regions involved in the direct interaction between the yeast CAF-1 subunits, and mapped the CAF-1 domains responsible for H3-H4 binding. The large subunit, Cac1 organizes the assembly of CAF-1. Strikingly, H3-H4 binding is mediated by a compositemore » interface, shaped by Cac1-bound Cac2 and the Cac1 acidic region. Cac2 is indispensable for productive histone binding, while deletion of Cac3 has only moderate effects on H3-H4 binding and nucleosome assembly. These results define direct structural roles for yeast CAF-1 subunits and uncover a previously unknown critical function of the middle subunit in CAF-1.« less

  17. The NMR-Rosetta capsid model of M13 bacteriophage reveals a quadrupled hydrophobic packing epitope.

    PubMed

    Morag, Omry; Sgourakis, Nikolaos G; Baker, David; Goldbourt, Amir

    2015-01-27

    Filamentous phage are elongated semiflexible ssDNA viruses that infect bacteria. The M13 phage, belonging to the family inoviridae, has a length of ∼1 μm and a diameter of ∼7 nm. Here we present a structural model for the capsid of intact M13 bacteriophage using Rosetta model building guided by structure restraints obtained from magic-angle spinning solid-state NMR experimental data. The C5 subunit symmetry observed in fiber diffraction studies was enforced during model building. The structure consists of stacked pentamers with largely alpha helical subunits containing an N-terminal type II β-turn; there is a rise of 16.6-16.7 Å and a tilt of 36.1-36.6° between consecutive pentamers. The packing of the subunits is stabilized by a repeating hydrophobic stacking pocket; each subunit participates in four pockets by contributing different hydrophobic residues, which are spread along the subunit sequence. Our study provides, to our knowledge, the first magic-angle spinning NMR structure of an intact filamentous virus capsid and further demonstrates the strength of this technique as a method of choice to study noncrystalline, high-molecular-weight molecular assemblies.

  18. The NMR–Rosetta capsid model of M13 bacteriophage reveals a quadrupled hydrophobic packing epitope

    PubMed Central

    Morag, Omry; Sgourakis, Nikolaos G.; Baker, David; Goldbourt, Amir

    2015-01-01

    Filamentous phage are elongated semiflexible ssDNA viruses that infect bacteria. The M13 phage, belonging to the family inoviridae, has a length of ∼1 μm and a diameter of ∼7 nm. Here we present a structural model for the capsid of intact M13 bacteriophage using Rosetta model building guided by structure restraints obtained from magic-angle spinning solid-state NMR experimental data. The C5 subunit symmetry observed in fiber diffraction studies was enforced during model building. The structure consists of stacked pentamers with largely alpha helical subunits containing an N-terminal type II β-turn; there is a rise of 16.6–16.7 Å and a tilt of 36.1–36.6° between consecutive pentamers. The packing of the subunits is stabilized by a repeating hydrophobic stacking pocket; each subunit participates in four pockets by contributing different hydrophobic residues, which are spread along the subunit sequence. Our study provides, to our knowledge, the first magic-angle spinning NMR structure of an intact filamentous virus capsid and further demonstrates the strength of this technique as a method of choice to study noncrystalline, high-molecular-weight molecular assemblies. PMID:25587134

  19. ICP22 and the UL13 Protein Kinase Are both Required for Herpes Simplex Virus-Induced Modification of the Large Subunit of RNA Polymerase II

    PubMed Central

    Long, Melissa C.; Leong, Vivian; Schaffer, Priscilla A.; Spencer, Charlotte A.; Rice, Stephen A.

    1999-01-01

    Herpes simplex virus type 1 (HSV-1) infection alters the phosphorylation of the large subunit of RNA polymerase II (RNAP II), resulting in the depletion of the hypophosphorylated and hyperphosphorylated forms of this polypeptide (known as IIa and IIo, respectively) and induction of a novel, alternatively phosphorylated form (designated IIi). We previously showed that the HSV-1 immediate-early protein ICP22 is involved in this phenomenon, since induction of IIi and depletion of IIa are deficient in cells infected with 22/n199, an HSV-1 ICP22 nonsense mutant (S. A. Rice, M. C. Long, V. Lam, P. A. Schaffer, and C. A. Spencer, J. Virol. 69:5550–5559, 1995). However, depletion of IIo still occurs in 22/n199-infected cells. This suggests either that another viral gene product affects the RNAP II large subunit or that the truncated ICP22 polypeptide encoded by 22/n199 retains residual activity which leads to IIo depletion. To distinguish between these possibilities, we engineered an HSV-1 ICP22 null mutant, d22-lacZ, and compared it to 22/n199. The two mutants are indistinguishable in their effects on the RNAP II large subunit, suggesting that an additional viral gene product is involved in altering RNAP II. Two candidates are UL13, a protein kinase which has been implicated in ICP22 phosphorylation, and the virion host shutoff (Vhs) factor, the expression of which is positively regulated by ICP22 and UL13. To test whether UL13 is involved, a UL13-deficient viral mutant, d13-lacZ, was engineered. This mutant was defective in IIi induction and IIa depletion, displaying a phenotype very similar to that of d22-lacZ. In contrast, a Vhs mutant had effects that were indistinguishable from wild-type HSV-1. Therefore, UL13 but not the Vhs function plays a role in modifying the RNAP II large subunit. To study the potential role of UL13 in viral transcription, we carried out nuclear run-on transcription analyses in infected human embryonic lung cells. Infections with either UL13 or ICP22 mutants led to significantly reduced amounts of viral genome transcription at late times after infection. Together, our results suggest that ICP22 and UL13 are involved in a common pathway that alters RNAP II phosphorylation and that in some cell lines this change promotes viral late transcription. PMID:10364308

  20. Construction and EST sequencing of full-length, drought stress cDNA libraries for common beans (Phaseolus vulgaris L.)

    PubMed Central

    2011-01-01

    Background Common bean is an important legume crop with only a moderate number of short expressed sequence tags (ESTs) made with traditional methods. The goal of this research was to use full-length cDNA technology to develop ESTs that would overlap with the beginning of open reading frames and therefore be useful for gene annotation of genomic sequences. The library was also constructed to represent genes expressed under drought, low soil phosphorus and high soil aluminum toxicity. We also undertook comparisons of the full-length cDNA library to two previous non-full clone EST sets for common bean. Results Two full-length cDNA libraries were constructed: one for the drought tolerant Mesoamerican genotype BAT477 and the other one for the acid-soil tolerant Andean genotype G19833 which has been selected for genome sequencing. Plants were grown in three soil types using deep rooting cylinders subjected to drought and non-drought stress and tissues were collected from both roots and above ground parts. A total of 20,000 clones were selected robotically, half from each library. Then, nearly 10,000 clones from the G19833 library were sequenced with an average read length of 850 nucleotides. A total of 4,219 unigenes were identified consisting of 2,981 contigs and 1,238 singletons. These were functionally annotated with gene ontology terms and placed into KEGG pathways. Compared to other EST sequencing efforts in common bean, about half of the sequences were novel or represented the 5' ends of known genes. Conclusions The present full-length cDNA libraries add to the technological toolbox available for common bean and our sequencing of these clones substantially increases the number of unique EST sequences available for the common bean genome. All of this should be useful for both functional gene annotation, analysis of splice site variants and intron/exon boundary determination by comparison to soybean genes or with common bean whole-genome sequences. In addition the library has a large number of transcription factors and will be interesting for discovery and validation of drought or abiotic stress related genes in common bean. PMID:22118559

  1. Construction of high-quality Caco-2 three-frame cDNA library and its application to yeast two-hybrid for the human astrovirus protein-protein interaction.

    PubMed

    Zhao, Wei; Li, Xin; Liu, Wen-Hui; Zhao, Jian; Jin, Yi-Ming; Sui, Ting-Ting

    2014-09-01

    Human epithelial colorectal adenocarcinoma (Caco-2) cells are widely used as an in vitro model of the human small intestinal mucosa. Caco-2 cells are host cells of the human astrovirus (HAstV) and other enteroviruses. High quality cDNA libraries are pertinent resources and critical tools for protein-protein interaction research, but are currently unavailable for Caco-2 cells. To construct a three-open reading frame, full length-expression cDNA library from the Caco-2 cell line for application to HAstV protein-protein interaction screening, total RNA was extracted from Caco-2 cells. The switching mechanism at the 5' end of the RNA transcript technique was used for cDNA synthesis. Double-stranded cDNA was digested by Sfi I and ligated to reconstruct a pGADT7-Sfi I three-frame vector. The ligation mixture was transformed into Escherichia coli HST08 premium electro cells by electroporation to construct the primary cDNA library. The library capacity was 1.0×10(6)clones. Gel electrophoresis results indicated that the fragments ranged from 0.5kb to 4.2kb. Randomly picked clones show that the recombination rate was 100%. The three-frame primary cDNA library plasmid mixture (5×10(5)cfu) was also transformed into E. coli HST08 premium electro cells, and all clones were harvested to amplify the cDNA library. To detect the sufficiency of the cDNA library, HAstV capsid protein as bait was screened and tested against the Caco-2 cDNA library by a yeast two-hybrid (Y2H) system. A total of 20 proteins were found to interact with the capsid protein. These results showed that a high-quality three-frame cDNA library from Caco-2 cells was successfully constructed. This library was efficient for the application to the Y2H system, and could be used for future research. Copyright © 2014 Elsevier B.V. All rights reserved.

  2. AP2 hemicomplexes contribute independently to synaptic vesicle endocytosis

    PubMed Central

    Gu, Mingyu; Liu, Qiang; Watanabe, Shigeki; Sun, Lin; Hollopeter, Gunther; Grant, Barth D; Jorgensen, Erik M

    2013-01-01

    The clathrin adaptor complex AP2 is thought to be an obligate heterotetramer. We identify null mutations in the α subunit of AP2 in the nematode Caenorhabditis elegans. α-adaptin mutants are viable and the remaining μ2/β hemicomplex retains some function. Conversely, in μ2 mutants, the alpha/sigma2 hemicomplex is localized and is partially functional. α-μ2 double mutants disrupt both halves of the complex and are lethal. The lethality can be rescued by expression of AP2 components in the skin, which allowed us to evaluate the requirement for AP2 subunits at synapses. Mutations in either α or μ2 subunits alone reduce the number of synaptic vesicles by about 30%; however, simultaneous loss of both α and μ2 subunits leads to a 70% reduction in synaptic vesicles and the presence of large vacuoles. These data suggest that AP2 may function as two partially independent hemicomplexes. DOI: http://dx.doi.org/10.7554/eLife.00190.001 PMID:23482940

  3. The linkage between ribosomal crystallography, metal ions, heteropolytungstates and functional flexibility

    PubMed Central

    Bashan, Anat; Yonath, Ada

    2009-01-01

    Crystallography of ribosomes, the universal cell nucleoprotein assemblies facilitating the translation of the genetic-code into proteins, met with severe problems owing to their large size, complex structure, inherent flexibility and high conformational variability. For the case of the small ribosomal subunit, which caused extreme difficulties, post crystallization treatment by minute amounts of a heteropolytungstate cluster allowed structure determination at atomic resolution. This cluster played a dual role in ribosomal crystallography: providing anomalous phasing power and dramatically increased the resolution, by stabilization of a selected functional conformation. Thus, four out of the fourteen clusters that bind to each of the crystallized small subunits are attached to a specific ribosomal protein in a fashion that may control a significant component of the subunit internal flexibility, by “gluing” symmetrical related subunits. Here we highlight basic issues in the relationship between metal ions and macromolecules and present common traits controlling in the interactions between polymetalates and various macromolecules, which may be extended towards the exploitation of polymetalates for therapeutical treatment. PMID:19915655

  4. Tracking protons from respiratory chain complexes to ATP synthase c-subunit: The critical role of serine and threonine residues.

    PubMed

    Panfoli, Isabella; Ponassi, Marco; Ravera, Silvia; Calzia, Daniela; Beitia, Maider; Morelli, Alessandro; Rosano, Camillo

    2017-01-22

    F 1 F o -ATP synthase is a multisubunit enzyme responsible for the synthesis of ATP. Among its multiple subunits (8 in E. coli, 17 in yeast S. cerevisiae, 16 in vertebrates), two subunits a and c are known to play a central role controlling the H + flow through the inner mitochondrial membrane which allows the subsequent synthesis of ATP, but the pathway followed by H + within the two proteins is still a matter of debate. In fact, even though the structure of ATP synthase is now well defined, the molecular mechanisms determining the function of both F 1 and F O domains are still largely unknown. In this study, we propose a pathway for proton migration along the ATP synthase by hydrogen-bonded chain mechanism, with a key role of serine and threonine residues, by X-ray diffraction data on the subunit a of E. coli Fo. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Steady-state fluorescence and phosphorescence spectroscopic studies of bacterial luciferase tryptophan mutants.

    PubMed

    Li, Z; Meighen, E A

    1994-09-01

    Bacterial luciferase, which catalyzes the bioluminescence reaction in luminous bacteria, consists of two nonidentical polypeptides, α and β. Eight mutants of luciferase with each of the tryptophans replaced by tyrosine were generated by site-directed mutagenesis and purified to homogeneity. The steady-state tryptophan fluorescence and low-temperature phosphorescence spectroscopic properties of these mutants were characterized. In some instances, mutation of only a single tryptophan residue resulted in large spectral changes. The tryptophan residues conserved in both the α and the β subunits exhibited distinct fluorescence emission properties, suggesting that these tryptophans have different local enviroments. The low-temperature phosphorescence data suggest that the tryptophans conserved in bot the α and the β subunits are not located at the subunit interface and/or involved in subunit interactions. The differences in the spectral properties of the mutants have provided useful information on the local environment of the individual tryptophan residues as well as on the quaternary structure of the protein.

  6. Dual functions of a small regulatory subunit in the mitochondrial calcium uniporter complex.

    PubMed

    Tsai, Ming-Feng; Phillips, Charles B; Ranaghan, Matthew; Tsai, Chen-Wei; Wu, Yujiao; Willliams, Carole; Miller, Christopher

    2016-04-21

    Mitochondrial Ca(2+) uptake, a process crucial for bioenergetics and Ca(2+) signaling, is catalyzed by the mitochondrial calcium uniporter. The uniporter is a multi-subunit Ca(2+)-activated Ca(2+) channel, with the Ca(2+) pore formed by the MCU protein and Ca(2+)-dependent activation mediated by MICU subunits. Recently, a mitochondrial inner membrane protein EMRE was identified as a uniporter subunit absolutely required for Ca(2+) permeation. However, the molecular mechanism and regulatory purpose of EMRE remain largely unexplored. Here, we determine the transmembrane orientation of EMRE, and show that its known MCU-activating function is mediated by the interaction of transmembrane helices from both proteins. We also reveal a second function of EMRE: to maintain tight MICU regulation of the MCU pore, a role that requires EMRE to bind MICU1 using its conserved C-terminal polyaspartate tail. This dual functionality of EMRE ensures that all transport-competent uniporters are tightly regulated, responding appropriately to a dynamic intracellular Ca(2+) landscape.

  7. Building a pseudo-atomic model of the anaphase-promoting complex.

    PubMed

    Kulkarni, Kiran; Zhang, Ziguo; Chang, Leifu; Yang, Jing; da Fonseca, Paula C A; Barford, David

    2013-11-01

    The anaphase-promoting complex (APC/C) is a large E3 ubiquitin ligase that regulates progression through specific stages of the cell cycle by coordinating the ubiquitin-dependent degradation of cell-cycle regulatory proteins. Depending on the species, the active form of the APC/C consists of 14-15 different proteins that assemble into a 20-subunit complex with a mass of approximately 1.3 MDa. A hybrid approach of single-particle electron microscopy and protein crystallography of individual APC/C subunits has been applied to generate pseudo-atomic models of various functional states of the complex. Three approaches for assigning regions of the EM-derived APC/C density map to specific APC/C subunits are described. This information was used to dock atomic models of APC/C subunits, determined either by protein crystallography or homology modelling, to specific regions of the APC/C EM map, allowing the generation of a pseudo-atomic model corresponding to 80% of the entire complex.

  8. The human peripheral subunit-binding domain folds rapidly while overcoming repulsive Coulomb forces

    PubMed Central

    Arbely, Eyal; Neuweiler, Hannes; Sharpe, Timothy D; Johnson, Christopher M; Fersht, Alan R

    2010-01-01

    Peripheral subunit binding domains (PSBDs) are integral parts of large multienzyme complexes involved in carbohydrate metabolism. PSBDs facilitate shuttling of prosthetic groups between different catalytic subunits. Their protein surface is characterized by a high density of positive charges required for binding to subunits within the complex. Here, we investigated folding thermodynamics and kinetics of the human PSBD (HSBD) using circular dichroism and tryptophan fluorescence experiments. HSBD was only marginally stable under physiological solvent conditions but folded within microseconds via a barrier-limited apparent two-state transition, analogous to its bacterial homologues. The high positive surface-charge density of HSBD leads to repulsive Coulomb forces that modulate protein stability and folding kinetics, and appear to even induce native-state movement. The electrostatic strain was alleviated at high solution-ionic-strength by Debye-Hückel screening. Differences in ionic-strength dependent characteristics among PSBD homologues could be explained by differences in their surface charge distributions. The findings highlight the trade-off between protein function and stability during protein evolution. PMID:20662005

  9. Structural and Functional Architecture of AMPA-Type Glutamate Receptors and Their Auxiliary Proteins.

    PubMed

    Greger, Ingo H; Watson, Jake F; Cull-Candy, Stuart G

    2017-05-17

    AMPA receptors (AMPARs) are tetrameric ion channels that together with other ionotropic glutamate receptors (iGluRs), the NMDA and kainate receptors, mediate a majority of excitatory neurotransmission in the central nervous system. Whereas NMDA receptors gate channels with slow kinetics, responsible primarily for generating long-term synaptic potentiation and depression, AMPARs are the main fast transduction elements at synapses and are critical for the expression of plasticity. The kinetic and conductance properties of AMPARs are laid down during their biogenesis and are regulated by post-transcriptional RNA editing, splice variation, post-translational modification, and subunit composition. Furthermore, AMPAR assembly, trafficking, and functional heterogeneity depends on a large repertoire of auxiliary subunits-a feature that is particularly striking for this type of iGluR. Here, we discuss how the subunit structure, stoichiometry, and auxiliary subunits generate a heterogeneous plethora of receptors, each tailored to fulfill a vital role in fast synaptic signaling and plasticity. Copyright © 2017 Elsevier Inc. All rights reserved.

  10. Tracking protons from respiratory chain complexes to ATP synthase c-subunit: The critical role of serine and threonine residues

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Panfoli, Isabella; Ponassi, Marco; Ravera, Silvia

    F{sub 1}F{sub o}-ATP synthase is a multisubunit enzyme responsible for the synthesis of ATP. Among its multiple subunits (8 in E. coli, 17 in yeast S. cerevisiae, 16 in vertebrates), two subunits a and c are known to play a central role controlling the H{sup +} flow through the inner mitochondrial membrane which allows the subsequent synthesis of ATP, but the pathway followed by H{sup +} within the two proteins is still a matter of debate. In fact, even though the structure of ATP synthase is now well defined, the molecular mechanisms determining the function of both F{sub 1} andmore » F{sub O} domains are still largely unknown. In this study, we propose a pathway for proton migration along the ATP synthase by hydrogen-bonded chain mechanism, with a key role of serine and threonine residues, by X-ray diffraction data on the subunit a of E. coli Fo.« less

  11. Characterization of Zea mays endosperm C-24 sterol methyltransferase: one of two types of sterol methyltransferase in higher plants.

    PubMed

    Grebenok, R J; Galbraith, D W; Penna, D D

    1997-08-01

    We report the characterization of a higher-plant C-24 sterol methyltransferase by yeast complementation. A Zea mays endosperm expressed sequence tag (EST) was identified which, upon complete sequencing, showed 46% identity to the yeast C-24 methyltransferase gene (ERG6) and 75% and 37% amino acid identity to recently isolated higher-plant sterol methyltransferases from soybean and Arabidopsis, respectively. When placed under GALA regulation, the Z. mays cDNA functionally complemented the erg6 mutation, restoring ergosterol production and conferring resistance to cycloheximide. Complementation was both plasmid-dependent and galactose-inducible. The Z. mays cDNA clone contains an open reading frame encoding a 40 kDa protein containing motifs common to a large number of S-adenosyl-L-methionine methyltransferases (SMTs). Sequence comparisons and functional studies of the maize, soybean and Arabidopsis cDNAs indicates two types of C-24 SMTs exist in higher plants.

  12. Protein synthesis during acquisition of long-term facilitation is needed for the persistent loss of regulatory subunits of the Aplysia cAMP-dependent protein kinase.

    PubMed Central

    Bergold, P J; Sweatt, J D; Winicov, I; Weiss, K R; Kandel, E R; Schwartz, J H

    1990-01-01

    Depending on the number or the length of exposure, application of serotonin can produce either short-term or long-term presynaptic facilitation of Aplysia sensory-to-motor synapses. The cAMP-dependent protein kinase, a heterodimer of two regulatory and two catalytic subunits, has been shown to become stably activated only during long-term facilitation. Both acquisition of long-term facilitation and persistent activation of the kinase is blocked by anisomycin, an effective, reversible, and specific inhibitor of protein synthesis in Aplysia. We report here that 2-hr exposure of pleural sensory cells to serotonin lowers the concentration of regulatory subunits but does not change the concentration of catalytic subunits, as assayed 24 hr later; 5-min exposure to serotonin has no effect on either type of subunit. Increasing intracellular cAMP with a permeable analog of cAMP together with the phosphodiesterase inhibitor isobutyl methylxanthine also decreased regulatory subunits, suggesting that cAMP is the second messenger mediating serotonin action. Anisomycin blocked the loss of regulatory subunits only when applied with serotonin; application after the 2-hr treatment with serotonin had no effect. In the Aplysia accessory radula contractor muscle, prolonged exposure to serotonin or to the peptide transmitter small cardioactive peptide B, both of which produce large increases in intracellular cAMP, does not decrease regulatory subunits. This mechanism of regulating the cAMP-dependent protein kinase therefore may be specific to the nervous system. We conclude that during long-term facilitation, new protein is synthesized in response to the facilitatory stimulus, which changes the ratio of subunits of the cAMP-dependent protein kinase. This alteration in ratio could persistently activate the kinase and produce the persistent phosphorylation seen in long-term facilitated sensory cells. Images PMID:1692622

  13. Defining the transcriptome assembly and its use for genome dynamics and transcriptome profiling studies in pigeonpea (Cajanus cajan L.)

    USDA-ARS?s Scientific Manuscript database

    This study reports generation of large-scale genomic resources for pigeonpea, a so-called ‘orphan crop species’ of the semi-arid tropic regions. Roche FLX/454 sequencing was carried out on a normalized cDNA pool prepared from 31 tissues produced 494,353 short transcript reads (STRs). Cluster analysi...

  14. Optimization of cDNA-AFLP experiments using genomic sequence data.

    PubMed

    Kivioja, Teemu; Arvas, Mikko; Saloheimo, Markku; Penttilä, Merja; Ukkonen, Esko

    2005-06-01

    cDNA amplified fragment length polymorphism (cDNA-AFLP) is one of the few genome-wide level expression profiling methods capable of finding genes that have not yet been cloned or even predicted from sequence but have interesting expression patterns under the studied conditions. In cDNA-AFLP, a complex cDNA mixture is divided into small subsets using restriction enzymes and selective PCR. A large cDNA-AFLP experiment can require a substantial amount of resources, such as hundreds of PCR amplifications and gel electrophoresis runs, followed by manual cutting of a large number of bands from the gels. Our aim was to test whether this workload can be reduced by rational design of the experiment. We used the available genomic sequence information to optimize cDNA-AFLP experiments beforehand so that as many transcripts as possible could be profiled with a given amount of resources. Optimization of the selection of both restriction enzymes and selective primers for cDNA-AFLP experiments has not been performed previously. The in silico tests performed suggest that substantial amounts of resources can be saved by the optimization of cDNA-AFLP experiments.

  15. Cloning and Expression of cDNA for Rat Heme Oxygenase

    NASA Astrophysics Data System (ADS)

    Shibahara, Shigeki; Muller, Rita; Taguchi, Hayao; Yoshida, Tadashi

    1985-12-01

    Two cDNA clones for rat heme oxygenase have been isolated from a rat spleen cDNA library in λ gt11 by immunological screening using a specific polyclonal antibody. One of these clones has an insert of 1530 nucleotides that contains the entire protein-coding region. To confirm that the isolated cDNA encodes heme oxygenase, we transfected monkey kidney cells (COS-7) with the cDNA carried in a simian virus 40 vector. The heme oxygenase was highly expressed in endoplasmic reticulum of transfected cells. The nucleotide sequence of the cloned cDNA was determined and the primary structure of heme oxygenase was deduced. Heme oxygenase is composed of 289 amino acids and has one hydrophobic segment at its carboxyl terminus, which is probably important for the insertion of heme oxygenase into endoplasmic reticulum. The cloned cDNA was used to analyze the induction of heme oxygenase in rat liver by treatment with CoCl2 or with hemin. RNA blot analysis showed that both CoCl2 and hemin increased the amount of hybridizable mRNA, suggesting that these substances may act at the transcriptional level to increase the amount of heme oxygenase.

  16. Fabrication of high quality cDNA microarray using a small amount of cDNA.

    PubMed

    Park, Chan Hee; Jeong, Ha Jin; Jung, Jae Jun; Lee, Gui Yeon; Kim, Sang-Chul; Kim, Tae Soo; Yang, Sang Hwa; Chung, Hyun Cheol; Rha, Sun Young

    2004-05-01

    DNA microarray technology has become an essential part of biological research. It enables the genome-scale analysis of gene expression in various types of model systems. Manufacturing high quality cDNA microarrays of microdeposition type depends on some key factors including a printing device, spotting pins, glass slides, spotting solution, and humidity during spotting. UsingEthe Microgrid II TAS model printing device, this study defined the optimal conditions for producing high density, high quality cDNA microarrays with the least amount of cDNA product. It was observed that aminosilane-modified slides were superior to other types of surface modified-slides. A humidity of 30+/-3% in a closed environment and the overnight drying of the spotted slides gave the best conditions for arraying. In addition, the cDNA dissolved in 30% DMSO gave the optimal conditions for spotting compared to the 1X ArrayIt, 3X SSC and 50% DMSO. Lastly, cDNA in the concentration range of 100-300 ng/ micro l was determined to be best for arraying and post-processing. Currently, the printing system in this study yields reproducible 9000 spots with a spot size 150 mm diameter, and a 200 nm spot spacing.

  17. [Structure and function of eukaryotic nuclear DNA-dependent RNA polymerase I].

    PubMed

    Shematorova, E K; Shpakovskiĭ, G V

    2002-01-01

    In the eukaryotic cell, normal protein biosynthesis is sustained by several million ribosomes, which contain rRNA as an essential component. The high-molecular-weight precursor of large and 5.8S rRNAs is synthesized by DNA-dependent RNA polymerase I (Pol I) in the nucleolus. Data on DNA regulatory elements, protein factors involved in rDNA transcription by Pol I, subunit composition of Pol I, and on the interactions and possible functions of individual subunits are summarized.

  18. Hyperthyroidism secondary to a pituitary adenoma secreting TSH, FSH, alpha-subunit and GH.

    PubMed

    Patrick, A W; Atkin, S L; MacKenzie, J; Foy, P M; White, M C; MacFarlane, I A

    1994-02-01

    A 51-year-old man had been treated for hyperthyroidism with antithyroid drugs for 8 years. He was then found to have a large pituitary adenoma with biochemical evidence of overproduction of TSH, FSH and alpha-subunit. Subsequent immunocytochemical and tissue culture studies confirmed secretion of these hormones. In addition, the tumour stained for GH and was capable of GH production in vitro. This combination of hormones produced by a pituitary adenoma has not been previously reported.

  19. Normalized cDNA libraries

    DOEpatents

    Soares, Marcelo B.; Efstratiadis, Argiris

    1997-01-01

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3' noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library.

  20. Normalized cDNA libraries

    DOEpatents

    Soares, M.B.; Efstratiadis, A.

    1997-06-10

    This invention provides a method to normalize a directional cDNA library constructed in a vector that allows propagation in single-stranded circle form comprising: (a) propagating the directional cDNA library in single-stranded circles; (b) generating fragments complementary to the 3{prime} noncoding sequence of the single-stranded circles in the library to produce partial duplexes; (c) purifying the partial duplexes; (d) melting and reassociating the purified partial duplexes to moderate Cot; and (e) purifying the unassociated single-stranded circles, thereby generating a normalized cDNA library. 4 figs.

Top