Sample records for large t-antigen atp-binding

  1. Consensus topography in the ATP binding site of the simian virus 40 and polyomavirus large tumor antigens

    SciTech Connect

    Bradley, M.K.; Smith, T.F.; Lathrop, R.H.; Livingston, D.M.; Webster, T.A.


    The location and sequence composition of a consensus element of the nucleotide binding site in both simian virus 40 (SV40) and polyomavirus (PyV) large tumor antigens (T antigens) can be predicted with the assistance of a computer-based pattern-matching system, ARIADNE. The latter was used to optimally align elements of T antigen primary sequence and predicted secondary structure with a descriptor for a mononucleotide binding fold. Additional consensus elements of the nucleotide binding site in these two proteins were derived from comparisons of T antigen primary and predicted secondary structures with x-ray structures of the nucleotide binding sites in four otherwise unrelated proteins. Each of these elements was predicted to be encompassed within a 110-residue segment that is highly conserved between the two T antigens residues 418-528 in SV 40 T antigen and residues 565-675 in PyV. Results of biochemical and immunologic experiments on the nucleotide binding behavior of these proteins using (/sup 32/P)-Amp-labeled SV40 T antigen, were found to be consistent with these predictions. Taken together, the latter have resulted in a topological model of the ATP binding site in these two oncogene products.

  2. A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

    PubMed Central

    Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.


    Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

  3. Mapping of phosphorylation sites in polyomavirus large T antigen

    SciTech Connect

    Hassauer, M.; Scheidtmann, K.H.; Walter, G.


    The phosphorylation sites of polyomavirus large T antigen from infected or transformed cells were investigated. Tryptic digestion of large T antigen from infected, /sup 32/P/sub i/-labeled cells revealed seven major phosphopeptides. Five of these were phosphorylated only at serine residues, and two were phosphorylated at serine and threonine residues. The overall ratio of phosphoserine to phosphothreonine was 6:1. The transformed cell line B4 expressed two polyomavirus-specific phosphoproteins: large T antigen, which was only weakly phosphorylated, and a truncated form of large T antigen of 34,000 molecular weight which was heavily phosphorylated. Both showed phosphorylation patterns similar to that of large T antigen from infected cells. Peptide analyses of large T antigens encoded by the deletion mutants dl8 and dl23 or of specific fragments of wild-type large T antigen indicated that the phosphorylation sites are located in an amino-terminal region upstream of residue 194. The amino acid composition of the phosphopeptides as revealed by differential labeling with various amino acids indicated that several phosphopeptides contain overlapping sequences and that all phosphorylation sites are located in four tryptic peptides derived from a region between Met71 and Arg191. Two of the potential phosphorylation sites were identified as Ser81 and Thr187. The possible role of this modification of large T antigen is discussed.

  4. Nuclear localization of Merkel cell polyomavirus large T antigen in Merkel cell carcinoma

    SciTech Connect

    Nakamura, Tomoyuki; Sato, Yuko; Watanabe, Daisuke; Ito, Hideki; Shimonohara, Nozomi; Tsuji, Takahiro; Nakajima, Noriko; Suzuki, Yoshio; Matsuo, Koma; Nakagawa, Hidemi; Sata, Tetsutaro; Katano, Harutaka


    To clarify whether mutations in the large T gene encoded by Merkel cell polyomavirus affect the expression and function of large T antigen in Merkel cell carcinoma cases, we investigated the expression of large T antigen in vitro and in vivo. Immunohistochemistry using a rabbit polyclonal antibody revealed that large T antigen was expressed in the nuclei of Merkel cell carcinoma cells with Merkel cell polyomavirus infection. Deletion mutant analyses identified an Arg-Lys-Arg-Lys sequence (amino acids 277-280) as a nuclear localization signal in large T antigen. Sequence analyses revealed that there were no mutations in the nuclear localization signal in any of the eleven Merkel cell polyomavirus strains examined. Furthermore, stop codons were not observed in the upstream of the nuclear localization signal in any of the Merkel cell carcinoma cases examined. These data suggest that the nuclear localization signal is highly conserved and functional in Merkel cell carcinoma cases.

  5. A novel translational regulation function for the simian virus 40 large-T antigen gene.

    PubMed Central

    Rajan, P; Swaminathan, S; Zhu, J; Cole, C N; Barber, G; Tevethia, M J; Thimmapaya, B


    Cells use the interferon-induced, double-stranded-RNA-dependent protein kinase PKR as a defense against virus infections. Upon activation, PKR phosphorylates and thereby inactivates the protein synthesis initiation factor eIF-2, resulting in the cessation of protein synthesis. Viruses have evolved various strategies to counteract this cellular defense. In this paper, we show that simian virus 40 (SV40) large-T antigen can antagonize the translational inhibitory effect resulting from the activation of PKR in virus-infected cells. Unlike the situation with other virus-host cell interactions, SV40 large-T antigen does not block the activation of PKR, suggesting that SV40 counteracts the cellular antiviral response mediated by PKR at a step downstream of PKR activation. Mutational analysis of large-T antigen indicates that a domain located between amino acids 400 and 600 of large-T antigen is responsible for this function. These results define a novel translational regulatory function for the SV40 large-T antigen. PMID:7815544

  6. Specific Antibodies Reacting with SV40 Large T Antigen Mimotopes in Serum Samples of Healthy Subjects.


    Tognon, Mauro; Corallini, Alfredo; Manfrini, Marco; Taronna, Angelo; Butel, Janet S; Pietrobon, Silvia; Trevisiol, Lorenzo; Bononi, Ilaria; Vaccher, Emanuela; Barbanti-Brodano, Giuseppe; Martini, Fernanda; Mazzoni, Elisa


    Simian Virus 40, experimentally assayed in vitro in different animal and human cells and in vivo in rodents, was classified as a small DNA tumor virus. In previous studies, many groups identified Simian Virus 40 sequences in healthy individuals and cancer patients using PCR techniques, whereas others failed to detect the viral sequences in human specimens. These conflicting results prompted us to develop a novel indirect ELISA with synthetic peptides, mimicking Simian Virus 40 capsid viral protein antigens, named mimotopes. This immunologic assay allowed us to investigate the presence of serum antibodies against Simian Virus 40 and to verify whether Simian Virus 40 is circulating in humans. In this investigation two mimotopes from Simian Virus 40 large T antigen, the viral replication protein and oncoprotein, were employed to analyze for specific reactions to human sera antibodies. This indirect ELISA with synthetic peptides from Simian Virus 40 large T antigen was used to assay a new collection of serum samples from healthy subjects. This novel assay revealed that serum antibodies against Simian Virus 40 large T antigen mimotopes are detectable, at low titer, in healthy subjects aged from 18-65 years old. The overall prevalence of reactivity with the two Simian Virus 40 large T antigen peptides was 20%. This new ELISA with two mimotopes of the early viral regions is able to detect in a specific manner Simian Virus 40 large T antigen-antibody responses.

  7. Specific Antibodies Reacting with SV40 Large T Antigen Mimotopes in Serum Samples of Healthy Subjects

    PubMed Central

    Tognon, Mauro; Corallini, Alfredo; Manfrini, Marco; Taronna, Angelo; Butel, Janet S.; Pietrobon, Silvia; Trevisiol, Lorenzo; Bononi, Ilaria; Vaccher, Emanuela; Barbanti-Brodano, Giuseppe; Martini, Fernanda; Mazzoni, Elisa


    Simian Virus 40, experimentally assayed in vitro in different animal and human cells and in vivo in rodents, was classified as a small DNA tumor virus. In previous studies, many groups identified Simian Virus 40 sequences in healthy individuals and cancer patients using PCR techniques, whereas others failed to detect the viral sequences in human specimens. These conflicting results prompted us to develop a novel indirect ELISA with synthetic peptides, mimicking Simian Virus 40 capsid viral protein antigens, named mimotopes. This immunologic assay allowed us to investigate the presence of serum antibodies against Simian Virus 40 and to verify whether Simian Virus 40 is circulating in humans. In this investigation two mimotopes from Simian Virus 40 large T antigen, the viral replication protein and oncoprotein, were employed to analyze for specific reactions to human sera antibodies. This indirect ELISA with synthetic peptides from Simian Virus 40 large T antigen was used to assay a new collection of serum samples from healthy subjects. This novel assay revealed that serum antibodies against Simian Virus 40 large T antigen mimotopes are detectable, at low titer, in healthy subjects aged from 18–65 years old. The overall prevalence of reactivity with the two Simian Virus 40 large T antigen peptides was 20%. This new ELISA with two mimotopes of the early viral regions is able to detect in a specific manner Simian Virus 40 large T antigen-antibody responses. PMID:26731525

  8. Precise conditional immortalization of mouse cells using tetracycline-regulated SV40 large T-antigen.


    Anastassiadis, Konstantinos; Rostovskaya, Maria; Lubitz, Sandra; Weidlich, Stefanie; Stewart, A Francis


    Cellular immortalization provides a way for expansion and subsequent molecular characterization of rare cell types. Ideally, immortalization can be achieved by the reversible expression of immortalizing proteins. Here, we describe the use of conditional immortalization based on a modified tetracycline-regulated system for the expression of SV40 large T-antigen in embryonic stem (ES) cells and mice. The modified system relies on a codon improved reverse tetracycline transactivator (irtTA) fused to the ligand-binding domain (LBD) of the androgen receptor (irtTA-ABD) or of a mutated glucocorticoid receptor (irtTA-GBD*). Induction of T-antigen is conferred only after addition of two ligands, one to activate the LBD (mibolerone for irtTA-ABD or dexamethasone for irtTA-GBD*) and one to activate the tetracycline transactivator (doxycycline). In ES cells, changes in gene expression upon large T induction were limited and reversible upon deinduction. Similarly, expression of T-antigen was very tightly regulated in mice. We have isolated and expanded bone marrow mesenchymal stem cells that could be genetically manipulated and maintained their differentiation properties after several passages of expansion under conditions that induce the expression of large T-antigen. 2010 Wiley-Liss, Inc.

  9. Transformation of a continuous rat embryo fibroblast cell line requires three separate domains of simian virus 40 large T antigen.

    PubMed Central

    Zhu, J; Rice, P W; Gorsch, L; Abate, M; Cole, C N


    Mouse C3H 10T1/2 cells and the established rat embryo fibroblast cell line REF-52 are two cell lines widely used in studies of viral transformation. Studies have shown that transformation of 10T1/2 cells requires only the amino-terminal 121 amino acids of simian virus 40 (SV40) large T antigen, while transformation of REF-52 cells requires considerably more of large T antigen, extending from near the N terminus to beyond residue 600. The ability of a large set of linker insertion, small deletion, and point mutants of SV40 T antigen to transform these two cell lines and to bind p105Rb was determined. Transformation of 10T1/2 cells was greatly reduced by mutations within the first exon of the gene for large T antigen but was only modestly affected by mutations affecting the p105Rb binding site or the p53 binding region. All mutants defective for transformation of 10T1/2 cells were also defective for transformation of REF-52 cells. In addition, mutants whose T antigens had alterations in the Rb binding site showed a substantial reduction in transformation of REF-52 cells, and the degree of this reduction could be correlated with the ability of the mutant T antigens to bind p105Rb. There was a tight correlation between the ability of mutants to transform REF-52 cells and the ability of their T antigens to bind p53. These results demonstrate that multiple regions of large T antigen are required for full transformation by SV40. Images PMID:1313902

  10. Polyomavirus large T antigen is prevalent in urothelial carcinoma post-kidney transplant.


    Yan, Ling; Salama, Mohamed E; Lanciault, Christian; Matsumura, Linh; Troxell, Megan L


    Viral pathogens have been associated with both infectious disease and neoplasia in transplant recipients. Polyomavirus is emerging as a potential causative agent for genitourinary tract cancer in post-kidney transplant patients. Human papillomavirus (HPV) has a proven role in squamous cancers, but has not been studied in genitourinary malignancies in transplantation. Of 2345 kidney transplants performed at our center over the past 20 years, we identified 16 patients with 20 genitourinary cancers (0.7%), including 13 bladder/ureter carcinomas, 5 renal cell carcinomas (RCCs), and 2 prostate carcinomas. We performed immunohistochemical staining for polyomavirus large T antigen and p16, followed by in situ hybridization for HPV in p16+ cases. Four cases of high-grade invasive urothelial bladder carcinomas were positive for large T. Large T+ urothelial carcinomas developed at least 8 years posttransplant in young men, 3 with history of BK polyoma viremia, 2 of whom had native kidney failure due to reflux/obstruction. In situ hybridization for high-risk HPV was negative in all tested cases. Overall, 3 patients died of carcinoma. All 5 RCCs were negative for both large T and p16; 2 prostate cancers were p16 negative and p16+/HPV negative, respectively. Thus, our study shows a relatively high prevalence of large T antigen in urothelial carcinoma in kidney transplant patients (31%), but not in RCC. Although sample size is small, young patients with obstructive disease may be at particular risk for developing large T-positive urothelial carcinoma. Overall, our data further support the necessities of long-term cancer surveillance for renal transplant patients. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. Effects of dutasteride on prostate growth in the large probasin-large T antigen mouse model of prostate cancer.


    Shao, T C; Li, H; Ittmann, M; Cunningham, G R


    We evaluated the effects of dutasteride for preventing or delaying prostate growth and neoplastic changes in a transgenic model of prostate cancer. Large probasin-large T antigen mice were treated for 4 or 8 weeks with dutasteride. The prostate and seminal vesicles were compared with those from intact and castrated large probasin-large T antigen mice and WT mice. Dutasteride greatly decreased the transgene induced increase in prostate weight but castration caused greater reduction. Dutasteride inhibited type 1 and 2, 5alpha-reductase activities, decreased DNA and protein, and increased apoptotic bodies and TUNEL staining in the dorsolateral prostate. No evidence of poorly differentiated cancer was seen. Dutasteride did not decrease the weight of the androgen dependent levator ani or bulbocavernosus muscle. Dutasteride inhibited type 1 and 2, 5alpha-reductase activities, and decreased DNA and protein content of the dorsolateral prostate without affecting androgen responsive muscle weight in large probasin-large T antigen mice. These studies provide support for the hypothesis that a 5alpha-reductase inhibitor inhibits the initiation and/or progression of clinical prostate cancers.

  12. Genetic and biochemical analysis of transformation-competent, replication-defective simian virus 40 large T antigen mutants.

    PubMed Central

    Manos, M M; Gluzman, Y


    To study the role of the biochemical and physiological activities of simian virus 40 (SV40) large T antigen in the lytic and transformation processes, we have analyzed DNA replication-defective, transformation-competent T-antigen mutants. Here we describe two such mutants, C8/SV40 and T22/SV40, and also summarize the properties of all of the mutants in this collection. C8/SV40 and T22/SV40 were isolated from C8 and T22 cells (simian cell lines transformed with UV-irradiated SV40). Early regions encoding the defective T antigens were cloned into a plasmid vector to generate pC8 and pT22. The mutations responsible for the defects in viral DNA replication were localized by marker rescue, and subsequent DNA sequencing revealed missense and one nonsense mutation. The T22 mutation predicts a change of histidine to glutamine at residue 203. C8 has two mutations, one predicts lysine224 to glutamamic acid and the other changes the codon for glutamic acid660 to a stop codon; therefore, C8 T antigen lacks the 49 carboxy-terminal amino acids. pC8A and pC8B were constructed to contain the C8 mutations separately. Plasmids pT22, pC8, pC8A, and pC8B were able to transform primary rodent cell cultures. T22 T antigen is defective in binding to the SV40 origin. C8B (49-amino-acid truncation) is a host-range mutant defective in a late function in CV-1 but not BSC cells. Analysis of T antigens in mutant SV40-transformed mouse cells suggests that the replicative function of T antigen is important in generating SV40 DNA rearrangements that allow the expression of "100K" variant T antigens in the transformants. Images PMID:2981330

  13. Crystal Structure of the Simian Virus 40 Large T-Antigen Origin-Binding Domain

    SciTech Connect

    Meinke,G.; Bullock, P.; Bohm, A.


    The origins of replication of DNA tumor viruses have a highly conserved feature, namely, multiple binding sites for their respective initiator proteins arranged as inverted repeats. In the 1.45- Angstroms crystal structure of the simian virus 40 large T-antigen (T-ag) origin-binding domain (obd) reported herein, T-ag obd monomers form a left-handed spiral with an inner channel of 30 Angstroms having six monomers per turn. The inner surface of the spiral is positively charged and includes residues known to bind DNA. Residues implicated in hexamerization of full-length T-ag are located at the interface between adjacent T-ag obd monomers. These data provide a high-resolution model of the hexamer of origin-binding domains observed in electron microscopy studies and allow the obd's to be oriented relative to the hexamer of T-ag helicase domains to which they are connected.

  14. Crystal structure of the simian virus 40 large T-antigen origin-binding domain.


    Meinke, Gretchen; Bullock, Peter A; Bohm, Andrew


    The origins of replication of DNA tumor viruses have a highly conserved feature, namely, multiple binding sites for their respective initiator proteins arranged as inverted repeats. In the 1.45-angstroms crystal structure of the simian virus 40 large T-antigen (T-ag) origin-binding domain (obd) reported herein, T-ag obd monomers form a left-handed spiral with an inner channel of 30 angstroms having six monomers per turn. The inner surface of the spiral is positively charged and includes residues known to bind DNA. Residues implicated in hexamerization of full-length T-ag are located at the interface between adjacent T-ag obd monomers. These data provide a high-resolution model of the hexamer of origin-binding domains observed in electron microscopy studies and allow the obd's to be oriented relative to the hexamer of T-ag helicase domains to which they are connected.

  15. Study of SV40 large T antigen nucleotide specificity for DNA unwinding.


    Wang, Damian; Álvarez-Cabrera, Ana Lucia; Chen, Xiaojiang S


    Simian Virus 40 (SV40) Large Tumor Antigen (LT) is an essential enzyme that plays a vital role in viral DNA replication in mammalian cells. As a replicative helicase and initiator, LT assembles as a double-hexamer at the SV40 origin to initiate genomic replication. In this process, LT converts the chemical energy from ATP binding and hydrolysis into the mechanical work required for unwinding replication forks. It has been demonstrated that even though LT primarily utilizes ATP to unwind DNA, other NTPs can also support low DNA helicase activity. Despite previous studies on specific LT residues involved in ATP hydrolysis, no systematic study has been done to elucidate the residues participating in the selective usage of different nucleotides by LT. In this study, we performed a systematic mutational analysis around the nucleotide pocket and identified residues regulating the specificity for ATP, TTP and UTP in LT DNA unwinding. We performed site-directed mutagenesis to generate 16 LT nucleotide pocket mutants and characterized each mutant's ability to unwind double-stranded DNA, oligomerize, and bind different nucleotides using helicase assays, size-exclusion chromatography, and isothermal titration calorimetry, respectively. We identified four residues in the nucleotide pocket of LT, cS430, tK419, cW393 and cL557 that selectively displayed more profound impact on using certain nucleotides for LT DNA helicase activity. Little is known regarding the mechanisms of nucleotide specificity in SV40 LT DNA unwinding despite the abundance of information available for understanding LT nucleotide hydrolysis. The systematic residue analysis performed in this report provides significant insight into the selective usage of different nucleotides in LT helicase activity, increasing our understanding of how LT may structurally prefer different energy sources for its various targeted cellular activities.

  16. Improved localization of phosphorylation sites in simian virus 40 large T antigen.

    PubMed Central

    van Roy, F; Fransen, L; Fiers, W


    The location of phosphorylation sites in the large T antigen of simian virus 40 has been studied both by partial chemical cleavage and by partial proteolysis of various forms of large T. These included the full-size wild-type molecule with an apparent molecular weight of 88,000, deleted molecules coded for by the mutants dl1265 and dl1263, and several shortened derivatives generated by the action of a cellular protease. These molecules differed from each other by variations in the carboxy-terminal end. In contrast, a ubiquitous but minor large T form with a molecular weight of 91,000 was found to be modified in the amino-terminal half of the molecule. In addition to the phosphorylation of threonine at position 701 (K.-H. Scheidtmann et al., J. Virol. 38:59-69, 1981), two other discrete domains of phosphorylation were recognized, one at either side of the molecule. The amino-terminal region was located between positions 81 and 124 and contained both phosphothreonine and phosphoserine residues. The carboxy-terminal region was located between approximate positions 500 and 640 and contained at least one phosphoserine residue but no phosphothreonine. The presence in the phosphorylated domains of large T of known recognition sequences for different types of protein kinases is discussed, together with possible functions of large T associated with these domains. Images PMID:6296439

  17. Simian virus 40 origin DNA-binding domain on large T antigen.

    PubMed Central

    Paucha, E; Kalderon, D; Harvey, R W; Smith, A E


    Fifty variant forms of simian virus 40 (SV40) large T antigen bearing point, multiple point, deletion, or termination mutations within a region of the protein thought to be involved in DNA binding were tested for their ability to bind to SV40 origin DNA. A number of the mutant large T species including some with point mutations were unable to bind, whereas many were wild type in this activity. The clustering of the mutations that are defective in origin DNA binding both reported here and by others suggests a DNA-binding domain on large T maps between residues 139 and approximately 220, with a particularly sensitive sequence between amino acids 147 and 166. The results indicate that the domain is involved in binding to both site I and site II on SV40 DNA, but it remains unclear whether it is responsible for binding to cellular DNA. Since all the mutants retain the ability to transform Rat-1 cells, we conclude that the ability of large T to bind to SV40 origin DNA is not a prerequisite for its transforming activity. Images PMID:3001365

  18. A model for primitive neuroectodermal tumors in transgenic neural transplants harboring the SV40 large T antigen.

    PubMed Central

    Eibl, R. H.; Kleihues, P.; Jat, P. S.; Wiestler, O. D.


    Using retrovirus-mediated transfer of the SV40 virus large T antigen into neural transplants, we have observed a high incidence of primitive neuroectodermal tumors (PNET). These neoplasms developed in 8 of 14 (57%) neural grafts after latency periods of 176 to 311 days. Histopathologically, the tumors exhibited features of human PNET such as formation of neuroblastic rosettes and immunocytochemical evidence for neuronal differentiation, synaptogenesis, and focal astrocytic differentiation. All neoplasms showed a striking migratory potential. The presence of the large T gene in the tumors was demonstrated by polymerase chain reaction-mediated amplification of a specific 242 bp segment of large T and DNA sequence analysis. Large T antigen was identified in tissue sections using an immunocytochemical reaction with the monoclonal antibody Pab 108. Cell lines were established from several tumors and subjected to G418 selection. Secondary tumors induced by intracerebral transplantation of these cells retained the characteristic morphological and immunocytochemical properties of PNETs. These experiments demonstrate a considerable transforming potential of SV40 large T antigen for neural precursor cells. The long latency period suggests that neoplastic transformation initiated by the large T gene requires additional spontaneous mutations of cooperating cellular genes. Because the mechanism of transformation by large T antigen appears to involve complex formation with and inactivation of cellular tumor suppressor gene products, these cell lines may serve as an interesting tool to search for novel neural tumor suppressor genes. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:8129041

  19. J Domain-Independent Regulation of the Rb Family by Polyomavirus Large T Antigen

    PubMed Central

    Sheng, Qing; Love, Tara M.; Schaffhausen, Brian


    The ability of polyomavirus large T antigen (LT) to promote cell cycling, to immortalize primary cells, and to block differentiation has been linked to its effects on tumor suppressors of the retinoblastoma susceptibility (Rb) gene family. Our previous studies have shown that LT requires an intact N-terminal DnaJ domain, in addition to an Rb binding site, for activation of simple E2F-containing promoters and stimulation of cell cycle progression. Here we show that some LT effects dependent on interaction with the Rb family are largely DnaJ independent. In differentiating C2C12 myoblasts, overexpression of LT caused apoptosis. Although this activity of LT completely depended on Rb binding, LTs with mutations in the J domain remained able to kill. Comparisons of Rb− and J− LTs revealed additional differences. Wild-type but not Rb− LT activated the cyclin A promoter under serum starvation conditions. Genetic analysis of the promoter linked the Rb requirement to an E2F site in the promoter. LTs with mutations in the J domain were still able to activate the promoter. Finally, J mutant LTs caused changes in phosphorylation of both pRb and p130. In the case of p130, Thr-986 was shown to be a site that is regulated by J mutant LT. Taken together, these observations reveal that LT regulation of Rb function can be separated into both DnaJ-dependent and DnaJ-independent pathways. PMID:10799605

  20. Merkel Cell Polyomavirus Large T Antigen Disrupts Host Genomic Integrity and Inhibits Cellular Proliferation

    PubMed Central

    Li, Jing; Wang, Xin; Diaz, Jason; Tsang, Sabrina H.; Buck, Christopher B.


    Clonal integration of Merkel cell polyomavirus (MCV) DNA into the host genome has been observed in at least 80% of Merkel cell carcinoma (MCC). The integrated viral genome typically carries mutations that truncate the C-terminal DNA binding and helicase domains of the MCV large T antigen (LT), suggesting a selective pressure to remove this MCV LT region during tumor development. In this study, we show that MCV infection leads to the activation of host DNA damage responses (DDR). This activity was mapped to the C-terminal helicase-containing region of the MCV LT. The MCV LT-activated DNA damage kinases, in turn, led to enhanced p53 phosphorylation, upregulation of p53 downstream target genes, and cell cycle arrest. Compared to the N-terminal MCV LT fragment that is usually preserved in mutants isolated from MCC tumors, full-length MCV LT shows a decreased potential to support cellular proliferation, focus formation, and anchorage-independent cell growth. These apparently antitumorigenic effects can be reversed by a dominant-negative p53 inhibitor. Our results demonstrate that MCV LT-induced DDR activates p53 pathway, leading to the inhibition of cellular proliferation. This study reveals a key difference between MCV LT and simian vacuolating virus 40 LT, which activates a DDR but inhibits p53 function. This study also explains, in part, why truncation mutations that remove the MCV LT C-terminal region are necessary for the oncogenic progression of MCV-associated cancers. PMID:23760247

  1. The conserved core enzymatic activities and the distinct dynamics of polyomavirus large T antigens

    PubMed Central

    An, Ping; Brodsky, Jeffrey L.; Pipas, James M.


    Several human polyomaviruses including JCV, BKV and TSV are associated with diseases, particularly in immunosuppressed patients. While the large T antigen (LT) encoded by the monkey polyomavirus SV40 is well studied, and possesses intrinsic ATPase and DNA helicase activities, the LTs of the human polyomaviruses are relatively uncharacterized. In order to evaluate whether these enzymatic activities, which are required for viral DNA replication, are conserved between polyomaviruses, we performed a comparative study using the LTs from JCV, TSV and SV40. The ATPase and DNA helicase activities and the interaction with the cellular tumor suppressor p53 were assayed for the purified Zn-ATPase domains of the three LTs. We found that all Zn-ATPases were active ATPases. The Zn-ATPase domains also functioned as DNA helicases, although the measured kinetic constants differed among the three proteins. In addition, when tested against four small molecule ATPase inhibitors, the Zn-ATPase domains of TSV was more resistant than that of SV40 and JCV. Our results show that, while LTs from JCV and TSV share the core ATPase and DNA helicase activities, they possess important functional differences that might translate into their respective abilities to infect and replicate in hosts. PMID:25752954

  2. In vitro transformation of Li-Fraumeni syndrome fibroblasts by SV40 large T antigen mutants.


    Maclean, K; Rogan, E M; Whitaker, N J; Chang, A C; Rowe, P B; Dalla-Pozza, L; Symonds, G; Reddel, R R


    Transfection of SV40 early region DNA into normal human diploid fibroblasts (NHDFs) increases their proliferative potential to a limited extent. We have investigated the roles of the SV40 large T antigen (LTAg) regions responsible for binding to the protein products of the retinoblastoma (Rb) and p53 genes in this temporary escape from senescence. Patients encoding LTAg mutants were transfected into NHDFs and into Li-Fraumeni syndrome (LFS) fibroblasts which are heterozygous wild-type (wt)/null-mutant for p53. A LTAg mutated in the p53-binding region (T402DE) had greatly reduced efficiency of focus formation, and a p110Rb-binding mutant was unable to induce any foci. T402DE-induced NHDF foci senesced at the same time as untransfected cells, but the equivalent LFS foci all had increased proliferative potentials, with the greatest increase being seen in clones that lost the wt p53 allele. One LFS clone expressed the T402DE mutant during focus formation, but later lost both the T402DE DNA and the wt p53 allele. We conclude that SV40-induced focus formation in NHDFs requires the LTAg p110Rb-binding region, and is enhanced by loss of normal p53 function. In contrast, increased proliferative potential is primarily due to loss of p53 function.

  3. Polyomavirus Large T Antigen Binds Cooperatively to Its Multiple Binding Sites in the Viral Origin of DNA Replication

    PubMed Central

    Peng, Yu-Cai; Acheson, Nicholas H.


    Polyomavirus large T antigen binds to multiple 5′-G(A/G)GGC-3′ pentanucleotide sequences in sites 1/2, A, B, and C within and adjacent to the origin of viral DNA replication on the polyomavirus genome. We asked whether the binding of large T antigen to one of these sites could influence binding to other sites. We discovered that binding to origin DNA is substantially stronger at pH 6 to 7 than at pH 7.4 to 7.8, a range often used in DNA binding assays. Large T antigen-DNA complexes formed at pH 6 to 7 were stable, but a fraction of these complexes dissociated at pH 7.6 and above upon dilution or during electrophoresis. Increased binding at low pH is therefore due at least in part to increased stability of protein-DNA complexes, and binding at higher pH values is reversible. Binding to fragments of origin DNA in which one or more sites were deleted or inactivated by point mutations was measured by nitrocellulose filter binding and DNase I footprinting. The results showed that large T antigen binds cooperatively to its four binding sites in viral DNA, suggesting that the binding of this protein to one of these sites stabilizes its binding to other sites via protein-protein contacts. Sites A, B, and C may therefore augment DNA replication by facilitating the binding of large T antigen to site 1/2 at the replication origin. ATP stabilized large T antigen-DNA complexes against dissociation in the presence, but not the absence, of site 1/2, and ATP specifically enhanced protection against DNase I digestion in the central 10 to 12 bp of site 1/2, at which hexamers are believed to form and begin unwinding DNA. We propose that large T antigen molecules bound to these multiple sites on origin DNA interact with each other to form a compact protein-DNA complex and, furthermore, that ATP stimulates their assembly into hexamers at site 1/2 by a “handover” mechanism mediated by these protein-protein contacts. PMID:9696829

  4. Four major sequence elements of simian virus 40 large T antigen coordinate its specific and nonspecific DNA binding.

    PubMed Central

    Simmons, D T; Loeber, G; Tegtmeyer, P


    By mutational analysis, we have identified a motif critical to the proper recognition and binding of simian virus 40 large tumor antigen (T antigen) to virus DNA sequences at the origin of DNA replication. This motif is tripartite and consists of two elements (termed A1 and B2) that are necessary for sequence-specific binding of the origin and a central element (B1) which is required for nonspecific DNA-binding activity. Certain amino acids in elements A1 (residues 152 to 155) and B2 (203 to 207) may make direct contact with the GAGGC pentanucleotide sequences in binding sites I and II on the DNA. Alternatively, these two elements could determine the proper structure of the DNA-binding domain, although for a number of reasons we favor the first possibility. In contrast, element B1 (183 to 187) is most likely important for recognizing a general structural feature of DNA. Elements A1 and B2 are nearly identical in all known papovavirus T antigens, whereas B1 is identical only in the closely related papovaviruses simian virus 40, BK virus, and JC virus. In addition to these three elements, a fourth (B3; residues 215 to 219) is necessary for the binding of T antigen to site II but not to site I. We propose that additional contact sites on T antigen are involved in the interaction with site II to initiate the replication of the viral DNA. PMID:2157865

  5. Polyomavirus Large T Antigen Binds Symmetrical Repeats at the Viral Origin in an Asymmetrical Manner

    PubMed Central

    Harrison, Celia; Jiang, Tao; Banerjee, Pubali; Meinke, Gretchen; D'Abramo, Claudia M.; Schaffhausen, Brian


    Polyomaviruses have repeating sequences at their origins of replication that bind the origin-binding domain of virus-encoded large T antigen. In murine polyomavirus, the central region of the origin contains four copies (P1 to P4) of the sequence G(A/G)GGC. They are arranged as a pair of inverted repeats with a 2-bp overlap between the repeats at the center. In contrast to simian virus 40 (SV40), where the repeats are nonoverlapping and all four repeats can be simultaneously occupied, the crystal structure of the four central murine polyomavirus sequence repeats in complex with the polyomavirus origin-binding domain reveals that only three of the four repeats (P1, P2, and P4) are occupied. Isothermal titration calorimetry confirms that the stoichiometry is the same in solution as in the crystal structure. Consistent with these results, mutation of the third repeat has little effect on DNA replication in vivo. Thus, the apparent 2-fold symmetry within the DNA repeats is not carried over to the protein-DNA complex. Flanking sequences, such as the AT-rich region, are known to be important for DNA replication. When the orientation of the central region was reversed with respect to these flanking regions, the origin was still able to replicate and the P3 sequence (now located at the P2 position with respect to the flanking regions) was again dispensable. This highlights the critical importance of the precise sequence of the region containing the pentamers in replication. PMID:24109229

  6. Polyomavirus large T antigen binds symmetrical repeats at the viral origin in an asymmetrical manner.


    Harrison, Celia; Jiang, Tao; Banerjee, Pubali; Meinke, Gretchen; D'Abramo, Claudia M; Schaffhausen, Brian; Bohm, Andrew


    Polyomaviruses have repeating sequences at their origins of replication that bind the origin-binding domain of virus-encoded large T antigen. In murine polyomavirus, the central region of the origin contains four copies (P1 to P4) of the sequence G(A/G)GGC. They are arranged as a pair of inverted repeats with a 2-bp overlap between the repeats at the center. In contrast to simian virus 40 (SV40), where the repeats are nonoverlapping and all four repeats can be simultaneously occupied, the crystal structure of the four central murine polyomavirus sequence repeats in complex with the polyomavirus origin-binding domain reveals that only three of the four repeats (P1, P2, and P4) are occupied. Isothermal titration calorimetry confirms that the stoichiometry is the same in solution as in the crystal structure. Consistent with these results, mutation of the third repeat has little effect on DNA replication in vivo. Thus, the apparent 2-fold symmetry within the DNA repeats is not carried over to the protein-DNA complex. Flanking sequences, such as the AT-rich region, are known to be important for DNA replication. When the orientation of the central region was reversed with respect to these flanking regions, the origin was still able to replicate and the P3 sequence (now located at the P2 position with respect to the flanking regions) was again dispensable. This highlights the critical importance of the precise sequence of the region containing the pentamers in replication.

  7. Immortalization of human corneal epithelial cells using simian virus 40 large T antigen and cell characterization.


    Kim, Cho-Won; Go, Ryeo-Eun; Lee, Geum-A; Kim, Chang Deok; Chun, Young-Jin; Choi, Kyung-Chul


    Primary cultures of human corneal epithelial (HCE) cells usually cease to grow after four or five passages. This result in a small cell yield for experiments such as the eye irritancy test represents a serious problem for human and animal corneal epithelial research. In the present study, we established an HCE cell line immortalized by simian virus 40 (SV40), a polyomavirus, and characterized the inherent morphologic and cytologic cell properties. Primary cultured HCE cells were infected with a SV40 large T antigen (SV40 T)-expressing retrovirus, and were selected using G418 solution, an aminoglycoside antibiotic. To ensure that the immortalized cell lines express SV40 T and cytokeratin-3, a corneal epithelial-specific marker, we conducted reverse-transcription (RT)-PCR and Western blot analysis. These cell lines continued to grow for more than 50 generations, exhibiting a cobble stone-like appearance similar to normal HCE cells and an increased proliferation rate compared to primary cultured HCE cells. RT-PCR results showed that the immortalized cell lines expressed SV40 T while the primary cultured cells did not. In the Western blot assay, protein levels of phosphorylated (Ser15) p53 protein were significantly decreased in the immortalized cell lines while the expression of total p53 protein was constant. In addition, expression of p21(cip1), a cell cycle protein, was down-regulated in the immortalized cells. Moreover, a cornea epithelium-specific marker, cytokeratin-3 (CK-3), was expressed at equal levels in the immortalized cells and primary HCE cells. Taken together, these results indicate that immortalized HCE cell lines were successfully established using the SV40-retroviral vector. These cells may be an excellent model for detecting the adverse effects of standard toxic materials and could replace the traditional eye irritation test as an animal-free alternative method. Copyright © 2015 Elsevier Inc. All rights reserved.

  8. Quantitative analysis of the binding of simian virus 40 large T antigen to DNA.


    Fradet-Turcotte, Amélie; Vincent, Caroline; Joubert, Simon; Bullock, Peter A; Archambault, Jacques


    SV40 large T antigen (T-ag) is a multifunctional protein that successively binds to 5'-GAGGC-3' sequences in the viral origin of replication, melts the origin, unwinds DNA ahead of the replication fork, and interacts with host DNA replication factors to promote replication of the simian virus 40 genome. The transition of T-ag from a sequence-specific binding protein to a nonspecific helicase involves its assembly into a double hexamer whose formation is likely dictated by the propensity of T-ag to oligomerize and its relative affinities for the origin as well as for nonspecific double- and single-stranded DNA. In this study, we used a sensitive assay based on fluorescence anisotropy to measure the affinities of wild-type and mutant forms of the T-ag origin-binding domain (OBD), and of a larger fragment containing the N-terminal domain (N260), for different DNA substrates. We report that the N-terminal domain does not contribute to binding affinity but reduces the propensity of the OBD to self-associate. We found that the OBD binds with different affinities to its four sites in the origin and determined a consensus binding site by systematic mutagenesis of the 5'-GAGGC-3' sequence and of the residue downstream of it, which also contributes to affinity. Interestingly, the OBD also binds to single-stranded DNA with an approximately 10-fold higher affinity than to nonspecific duplex DNA and in a mutually exclusive manner. Finally, we provide evidence that the sequence specificity of full-length T-ag is lower than that of the OBD. These results provide a quantitative basis onto which to anchor our understanding of the interaction of T-ag with the origin and its assembly into a double hexamer.

  9. Host range and cell cycle activation properties of polyomavirus large T-antigen mutants defective in pRB binding

    SciTech Connect

    Freund, R.; Bauer, P.H.; Benjamin, T.L.; Crissman, H.A.; Bradbury, E.M. |


    The authors have examined the growth properties of polyomavirus large T-antigen mutants that ar unable to bind pRB, the product of the retinoblastoma tumor suppressor gene. These mutants grow poorly on primary mouse cells yet grow well on NIH 3T3 and other established mouse cell lines. Preinfection of primary baby mouse kidney (BMK) epithelial cells with wild-type simian virus 40 renders these cells permissive to growth of pRB-binding polyomavirus mutants. Conversely, NIH 3T3 cells transfected by and expressing wild-type human pRB become nonpermissive. Primary fibroblasts for mouse embryos that carry a homozygous knockout of the RB gene are permissive, while those from normal littermates are nonpermissive. The host range of polyomavirus pRB-binding mutants is thus determined by expression or lack of expression of functional pRB by the host. These results demonstrate the importance of pRB binding by large T antigen for productive viral infection in primary cells. Failure of pRB-binding mutants to grow well in BMK cells correlates with their failure to induce progression from G{sub 0} or G{sub 1} through the S phase of the cell cycle. Time course studies show delayed synthesis and lower levels of accumulation of large T antigen, viral DNA, and VP1 in mutant compared with wild-type virus-infected BMK cells. These results support a model in which productive infection by polyomavirus in normal mouse cells is tightly coupled to the induction and progression of the cell cycle. 48 refs., 6 figs., 5 tabs.

  10. Mutation of large T-antigen-binding site A, but not site B or C, eliminates stalling by RNA polymerase II in the intergenic region of polyomavirus DNA.

    PubMed Central

    Bertin, J; Sunstrom, N A; Acheson, N H


    During transcription of the late strand of polyomavirus DNA, RNA polymerase II stalls and accumulates nearby the binding sites on viral DNA recognized by polyomavirus large T antigen. Stalling by RNA polymerases is eliminated when thermolabile large T antigen is inactivated by using a temperature-sensitive virus mutant (J. Bertin, N.-A. Sunstrom, P. Jain, and N. H. Acheson, Virology 189:715-724, 1992). To determine whether stalling by RNA polymerases is mediated through the interaction of large T antigen with one or more of its binding sites, viable polyomavirus mutants that contain altered large-T-antigen-binding sites were constructed. Point mutations were introduced by site-directed mutagenesis into the multiple, clustered G(A/G)GGC pentanucleotides known to be the target sequence for large T-antigen binding. Mutation of the G(A/G)GGC pentanucleotides in the first two binding sites encountered by RNA polymerases in the intergenic region (sites C and B) had no detectable effect on stalling as measured by transcriptional run-on analysis. However, mutation of the two GAGGC pentanucleotides in binding site A, which lies adjacent to the origin of viral DNA replication, eliminated stalling by RNA polymerases. We conclude that binding of large T antigen to site A blocks elongation by RNA polymerase II. Further characterization of virus containing mutated site A did not reveal any effects on early transcription levels or on virus DNA replication. However, the mutant virus gave rise to small plaques, suggesting impairment in some stage of virus growth. Stalling of RNA polymerases by large T antigen bound to the intergenic region of viral DNA may function to prevent transcription from displacing proteins whose binding is required for the normal growth of polyomavirus. Images PMID:8396655

  11. Asymmetric Assembly of Merkel Cell Polyomavirus Large T-Antigen Origin Binding Domains at the Viral Origin

    SciTech Connect

    C Harrison; G Meinke; H Kwun; H Rogalin; P Phelan; P Bullock; Y Chang; P Moore; A Bohm


    The double-stranded DNA polyomavirus Merkel cell polyomavirus (MCV) causes Merkel cell carcinoma, an aggressive but rare human skin cancer that most often affects immunosuppressed and elderly persons. As in other polyomaviruses, the large T-antigen of MCV recognizes the viral origin of replication by binding repeating G(A/G)GGC pentamers. The spacing, number, orientation, and necessity of repeats for viral replication differ, however, from other family members such as SV40 and murine polyomavirus. We report here the 2.9 {angstrom} crystal structure of the MCV large T-antigen origin binding domain (OBD) in complex with a DNA fragment from the MCV origin of replication. Consistent with replication data showing that three of the G(A/G)GGC-like binding sites near the center of the origin are required for replication, the crystal structure contains three copies of the OBD. This stoichiometry was verified using isothermal titration calorimetry. The affinity for G(A/G)GGC-containing double-stranded DNA was found to be {approx} 740 nM, approximately 8-fold weaker than the equivalent domain in SV40 for the analogous region of the SV40 origin. The difference in affinity is partially attributable to DNA-binding residue Lys331 (Arg154 in SV40). In contrast to SV40, a small protein-protein interface is observed between MCV OBDs when bound to the central region of the origin. This protein-protein interface is reminiscent of that seen in bovine papilloma virus E1 protein. Mutational analysis indicates, however, that this interface contributes little to DNA binding energy.

  12. Asymmetric assembly of Merkel cell polyomavirus large T-antigen origin binding domains at the viral origin.


    Harrison, Celia J; Meinke, Gretchen; Kwun, Hyun Jin; Rogalin, Henry; Phelan, Paul J; Bullock, Peter A; Chang, Yuan; Moore, Patrick S; Bohm, Andrew


    The double-stranded DNA polyomavirus Merkel cell polyomavirus (MCV) causes Merkel cell carcinoma, an aggressive but rare human skin cancer that most often affects immunosuppressed and elderly persons. As in other polyomaviruses, the large T-antigen of MCV recognizes the viral origin of replication by binding repeating G(A/G)GGC pentamers. The spacing, number, orientation, and necessity of repeats for viral replication differ, however, from other family members such as SV40 and murine polyomavirus. We report here the 2.9 Å crystal structure of the MCV large T-antigen origin binding domain (OBD) in complex with a DNA fragment from the MCV origin of replication. Consistent with replication data showing that three of the G(A/G)GGC-like binding sites near the center of the origin are required for replication, the crystal structure contains three copies of the OBD. This stoichiometry was verified using isothermal titration calorimetry. The affinity for G(A/G)GGC-containing double-stranded DNA was found to be ~740 nM, approximately 8-fold weaker than the equivalent domain in SV40 for the analogous region of the SV40 origin. The difference in affinity is partially attributable to DNA-binding residue Lys331 (Arg154 in SV40). In contrast to SV40, a small protein-protein interface is observed between MCV OBDs when bound to the central region of the origin. This protein-protein interface is reminiscent of that seen in bovine papilloma virus E1 protein. Mutational analysis indicates, however, that this interface contributes little to DNA binding energy.

  13. Characterization of the DNA-binding properties of the origin-binding domain of simian virus 40 large T antigen by fluorescence anisotropy.


    Titolo, S; Welchner, E; White, P W; Archambault, J


    The affinity of the origin-binding domain (OBD) of simian virus 40 large T antigen for its cognate origin was measured at equilibrium using a DNA binding assay based on fluorescence anisotropy. At a near-physiological concentration of salt, the affinities of the OBD for site II and the core origin were 31 and 50 nM, respectively. Binding to any of the four 5'-GAGGC-3' binding sites in site II was only slightly weaker, between 57 and 150 nM. Although the OBD was shown previously to assemble as a dimer on two binding sites spaced by 7 bp, we found that increasing the distance between both binding sites by 1 to 3 bp had little effect on affinity. Similar results were obtained for full-length T antigen in absence of nucleotide. Addition of ADP-Mg, which promotes hexamerization of T antigen, greatly increased the affinity of full-length T antigen for the core origin and for nonspecific DNA. The implications of these findings for the assembly of T antigen at the origin and its transition to a non-specific DNA helicase are discussed.

  14. The SV40 large T-antigen origin binding domain directly participates in DNA unwinding.


    Foster, Erin C; Simmons, Daniel T


    The origin binding domain (OBD) of SV40 large T-ag serves a critical role during initiation of DNA replication to position T-ag on the origin. After origin recognition, T-ag forms a double hexamer over the origin. Within each hexamer, the OBD adopts a lock washer structure where the origin recognizing A1 and B2 loops face toward the helicase domain and likely become unavailable for binding DNA. In this study, we investigated the role of the central channel of the OBD hexamer in DNA replication by analyzing the effects of mutations of residues lining the channel. All mutants showed binding defects with origin DNA and ssDNA especially at low protein concentrations, but only half were defective at supporting DNA replication in vitro. All mutants were normal in unwinding linear origin DNA fragments. However, replication defective mutants failed to unwind a small origin containing circular DNA whereas replication competent mutants did so normally. The presence of RPA and/or pol/prim restored circular DNA unwinding activity of compromised mutants probably by interacting with the separated DNA strands on the T-ag surface. We interpret these results to indicate a role for the OBD central channel in binding and threading ssDNA during unwinding of circular SV40 DNA. Mixing experiments suggested that only one monomer in an OBD hexamer was necessary for DNA unwinding. We present a model of DNA threading through the T-ag complex illustrating how single-stranded DNA could pass close to a trough generated by key residues in one monomer of the OBD hexamer.

  15. Removal of a small C-terminal region of JCV and SV40 large T antigens has differential effects on transformation.


    Seneca, Nicole T M; Sáenz Robles, Maria Teresa; Pipas, James M


    The large T antigen (LT) protein of JCV and SV40 polyomaviruses is required to induce tumors in rodents and transform cells in culture. When both LTs are compared side-by-side in cell culture assays, SV40 shows a more robust transformation phenotype even though the LT sequences are highly conserved. A complete understanding of SV40׳s enhanced transforming capabilities relative to JCV is lacking. When the least conserved region of the LT proteins, the variable linker and host range region (VHR), was removed, changes in T antigen expression and cellular p53 post-translational modifications occurred, but interaction with the pRB pathway was unaffected. Transformation assessed by growth in low serum was reduced after VHR truncation of the SV40, but not the JCV, T antigen. Conversely, anchorage independent transformation was enhanced only by truncation of the JCV VHR. This is the first report to link the SV40 or JCV VHR region to transformation potential.

  16. Export-deficient monoubiquitinated PEX5 triggers peroxisome removal in SV40 large T antigen-transformed mouse embryonic fibroblasts

    PubMed Central

    Nordgren, Marcus; Francisco, Tânia; Lismont, Celien; Hennebel, Lore; Brees, Chantal; Wang, Bo; Van Veldhoven, Paul P; Azevedo, Jorge E; Fransen, Marc


    Peroxisomes are ubiquitous cell organelles essential for human health. To maintain a healthy cellular environment, dysfunctional and superfluous peroxisomes need to be selectively removed. Although emerging evidence suggests that peroxisomes are mainly degraded by pexophagy, little is known about the triggers and molecular mechanisms underlying this process in mammalian cells. In this study, we show that PEX5 proteins fused to a bulky C-terminal tag trigger peroxisome degradation in SV40 large T antigen-transformed mouse embryonic fibroblasts. In addition, we provide evidence that this process is autophagy-dependent and requires monoubiquitination of the N-terminal cysteine residue that marks PEX5 for recycling. As our findings also demonstrate that the addition of a bulky tag to the C terminus of PEX5 does not interfere with PEX5 monoubiquitination but strongly inhibits its export from the peroxisomal membrane, we hypothesize that such a tag mimics a cargo protein that cannot be released from PEX5, thus keeping monoubiquitinated PEX5 at the membrane for a sufficiently long time to be recognized by the autophagic machinery. This in turn suggests that monoubiquitination of the N-terminal cysteine of peroxisome-associated PEX5 not only functions to recycle the peroxin back to the cytosol, but also serves as a quality control mechanism to eliminate peroxisomes with a defective protein import machinery. PMID:26086376

  17. Export-deficient monoubiquitinated PEX5 triggers peroxisome removal in SV40 large T antigen-transformed mouse embryonic fibroblasts.


    Nordgren, Marcus; Francisco, Tânia; Lismont, Celien; Hennebel, Lore; Brees, Chantal; Wang, Bo; Van Veldhoven, Paul P; Azevedo, Jorge E; Fransen, Marc


    Peroxisomes are ubiquitous cell organelles essential for human health. To maintain a healthy cellular environment, dysfunctional and superfluous peroxisomes need to be selectively removed. Although emerging evidence suggests that peroxisomes are mainly degraded by pexophagy, little is known about the triggers and molecular mechanisms underlying this process in mammalian cells. In this study, we show that PEX5 proteins fused to a bulky C-terminal tag trigger peroxisome degradation in SV40 large T antigen-transformed mouse embryonic fibroblasts. In addition, we provide evidence that this process is autophagy-dependent and requires monoubiquitination of the N-terminal cysteine residue that marks PEX5 for recycling. As our findings also demonstrate that the addition of a bulky tag to the C terminus of PEX5 does not interfere with PEX5 monoubiquitination but strongly inhibits its export from the peroxisomal membrane, we hypothesize that such a tag mimics a cargo protein that cannot be released from PEX5, thus keeping monoubiquitinated PEX5 at the membrane for a sufficiently long time to be recognized by the autophagic machinery. This in turn suggests that monoubiquitination of the N-terminal cysteine of peroxisome-associated PEX5 not only functions to recycle the peroxin back to the cytosol, but also serves as a quality control mechanism to eliminate peroxisomes with a defective protein import machinery.

  18. Structure of the origin-binding domain of simian virus 40 large T antigen bound to DNA.


    Bochkareva, Elena; Martynowski, Dariusz; Seitova, Almagoul; Bochkarev, Alexey


    The large T antigen (T-ag) protein binds to and activates DNA replication from the origin of DNA replication (ori) in simian virus 40 (SV40). Here, we determined the crystal structures of the T-ag origin-binding domain (OBD) in apo form, and bound to either a 17 bp palindrome (sites 1 and 3) or a 23 bp ori DNA palindrome comprising all four GAGGC binding sites for OBD. The T-ag OBDs were shown to interact with the DNA through a loop comprising Ser147-Thr155 (A1 loop), a combination of a DNA-binding helix and loop (His203-Asn210), and Asn227. The A1 loop traveled back-and-forth along the major groove and accounted for most of the sequence-determining contacts with the DNA. Unexpectedly, in both T-ag-DNA structures, the T-ag OBDs bound DNA independently and did not make direct protein-protein contacts. The T-ag OBD was also captured bound to a non-consensus site ATGGC even in the presence of its canonical site GAGGC. Our observations taken together with the known biochemical and structural features of the T-ag-origin interaction suggest a model for origin unwinding.

  19. Establishment and characterisation of a novel bovine SV40 large T-antigen-transduced foetal hepatocyte-derived cell line.


    Gleich, Alexander; Kaiser, Bastian; Schumann, Julia; Fuhrmann, Herbert


    Due to lack of in vitro models for bovine hepatocytes apart from primary cells, there is demand for a bovine hepatocyte-derived cell line. Transduction of bovine foetal hepatocytes with SV40 large T-antigen was performed using the vector pRetro-E2 SV40. Phase contrast microscopy was carried out to evaluate morphology. Immunofluorescence staining was conducted to study expression of keratins, tight junction proteins zona occludens-1 and claudin-1, glucose transporter-2 and P-glycoprotein as well as phosphoenolpyruvate carboxykinase. Urea and triglyceride production was quantified photometrically. Histochemical staining of glycogen by Periodic acid-Schiff stain and of lipids with Oil red O was performed after 24 h incubation with 20 mM glucose and 85 μM palmitic acid, respectively. Gene expression analysis of hepatocyte-typical genes was conducted by reverse transcription PCR. We obtained a SV40LTAg-transduced extended passage cell line, referred to as BFH12. Polygonal growth, keratins, tight junction proteins zona occludens-1 and claudin-1 and glucose transporter-2 as well as P-glycoprotein and phosphoenolpyruvate carboxykinase were attested positively. Urea production calculated as cell-specific rate was 14.2 ± 2.0 fmol/h (early passage) and 17.6 ± 3.7 fmol/h (late passage). Cell-specific triglyceride production was 1.6 ± 0.5 fmol/h (early passage) and 2.1 ± 0.3 fmol/h (late passage). Additionally, cells were positive for glycogen and lipid storage and showed a gene expression pattern resembling foetal hepatocytes. With the properties described here, the novel cell line BFH12 is a hepatocyte-derived cell line which can be used as an in vitro whole cell model.

  20. A simian virus 40 large T-antigen segment containing amino acids 1 to 127 and expressed under the control of the rat elastase-1 promoter produces pancreatic acinar carcinomas in transgenic mice.

    PubMed Central

    Tevethia, M J; Bonneau, R H; Griffith, J W; Mylin, L


    The simian virus 40 large T antigen induces tumors in a wide variety of tissues in transgenic mice, the precise tissues depending on the tissue specificity of the upstream region controlling T-antigen expression. Expression of mutant T antigens that contain a subset of the protein's activities restricts the spectrum of tumors induced. Others showed previously that expression of a mutant large T antigen containing the N-terminal 121 amino acids (T1-121) under control of the lymphotropic papovavirus promoter resulted in slow-growing choroid plexus tumors, whereas full-length T antigen under the same promoter induced rapidly growing CPR tumors, T-cell lymphomas, and B-cell lymphomas. In those instances, the alteration in tumor induction or progression correlated with inability of the mutant large T antigen to bind the tumor suppressor p53. In the study reported here, we investigated the capacity of an N-terminal T antigen segment (T1-127) expressed in conjunction with small t antigen under control of the rat elastase-1 (E1) promoter to induce pancreatic tumors. The results show that pancreases of transgenic mice expressing T1-127 and small t antigen display acinar cell dysplasia at birth that progresses to neoplasia. The average age to death in these mice is within the range reported for transgenic mice expressing full-length T antigen under control of the E1 promoter. These results indicate that sequestering p53 by binding is not required for the development of rapidly growing acinar cell carcinomas. In addition, we provide evidence that small t antigen is unlikely to be required. Finally, we show that the p53 protein in acinar cell carcinomas is wild type in conformation. PMID:9343166

  1. The ability of simian virus 40 large T antigen to immortalize primary mouse embryo fibroblasts cosegregates with its ability to bind to p53.

    PubMed Central

    Zhu, J Y; Abate, M; Rice, P W; Cole, C N


    The large T antigen encoded by simian virus 40 (SV40) plays essential roles in the infection of permissive cells, leading to production of progeny virions, and in the infection of nonpermissive cells, leading to malignant transformation. Primary mouse embryo fibroblasts (MEFs) are nonpermissive for SV40, and infection by wild-type SV40 leads to immortalization and transformation of a small percentage of infected cells. We examined the ability of an extensive set of mutants whose lesions affect SV40 large T antigen to immortalize MEFs. We found that immortalization activity was retained by all mutants whose lesions are located upstream of codon 346. This includes a mutant lacking amino acids 168 to 346. We previously showed (M. J. Tevethia, J. M. Pipas, T. Kierstead, and C. Cole, Virology 162:76-89, 1988) that sequences downstream of amino acid 626 are not required for immortalization of primary MEFs. Studies by Thompson et al. (D. L. Thompson, D. Kalderon, A. Smith, and M. Tevethia, Virology 178:15-34, 1990) indicate that all sequences upstream of residue 250, including the domain for binding of tumor suppressor protein Rb, are not required for transformation of MEFs. Together, these studies demonstrate that the immortalization activity of large T antigen for MEFs maps to sequences between 347 and 626. Several mutants with lesions between 347 and 626 retained the ability to immortalize at nearly the wild-type frequency, while others, with small insertions at amino acid 409 or 424 or a deletion of residues 587 to 589, failed to immortalize. The abilities of mutant T antigens to form a complex with tumor suppressor protein p53 were examined. We found that all mutants able to immortalize retained the ability to complex with p53, while all mutants which lost the ability to immortalize were no longer able to bind p53. This suggests that inactivation of the growth-suppressive properties of p53 is essential for immortalization of MEFs. Images PMID:1658380

  2. Profiling Protein Kinases and Other ATP Binding Proteins in Arabidopsis Using Acyl-ATP Probes*

    PubMed Central

    Villamor, Joji Grace; Kaschani, Farnusch; Colby, Tom; Oeljeklaus, Julian; Zhao, David; Kaiser, Markus; Patricelli, Matthew P.; van der Hoorn, Renier A. L.


    Many protein activities are driven by ATP binding and hydrolysis. Here, we explore the ATP binding proteome of the model plant Arabidopsis thaliana using acyl-ATP (AcATP)1 probes. These probes target ATP binding sites and covalently label lysine residues in the ATP binding pocket. Gel-based profiling using biotinylated AcATP showed that labeling is dependent on pH and divalent ions and can be competed by nucleotides. The vast majority of these AcATP-labeled proteins are known ATP binding proteins. Our search for labeled peptides upon in-gel digest led to the discovery that the biotin moiety of the labeled peptides is oxidized. The in-gel analysis displayed kinase domains of two receptor-like kinases (RLKs) at a lower than expected molecular weight, indicating that these RLKs lost the extracellular domain, possibly as a result of receptor shedding. Analysis of modified peptides using a gel-free platform identified 242 different labeling sites for AcATP in the Arabidopsis proteome. Examination of each individual labeling site revealed a preference of labeling in ATP binding pockets for a broad diversity of ATP binding proteins. Of these, 24 labeled peptides were from a diverse range of protein kinases, including RLKs, mitogen-activated protein kinases, and calcium-dependent kinases. A significant portion of the labeling sites could not be assigned to known nucleotide binding sites. However, the fact that labeling could be competed with ATP indicates that these labeling sites might represent previously uncharacterized nucleotide binding sites. A plot of spectral counts against expression levels illustrates the high specificity of AcATP probes for protein kinases and known ATP binding proteins. This work introduces profiling of ATP binding activities of a large diversity of proteins in plant proteomes. The data have been deposited in ProteomeXchange with the identifier PXD000188. PMID:23722185

  3. Role of flanking sequences and phosphorylation in the recognition of the simian-virus-40 large T-antigen nuclear localization sequences by importin-alpha.

    PubMed Central

    Fontes, Marcos R M; Teh, Trazel; Toth, Gabor; John, Anna; Pavo, Imre; Jans, David A; Kobe, Bostjan


    The nuclear import of simian-virus-40 large T-antigen (tumour antigen) is enhanced via phosphorylation by the protein kinase CK2 at Ser112 in the vicinity of the NLS (nuclear localization sequence). To determine the structural basis of the effect of the sequences flanking the basic cluster KKKRK, and the effect of phosphorylation on the recognition of the NLS by the nuclear import factor importin-alpha (Impalpha), we co-crystallized non-autoinhibited Impalpha with peptides corresponding to the phosphorylated and non-phosphorylated forms of the NLS, and determined the crystal structures of the complexes. The structures show that the amino acids N-terminally flanking the basic cluster make specific contacts with the receptor that are distinct from the interactions between bipartite NLSs and Impalpha. We confirm the important role of flanking sequences using binding assays. Unexpectedly, the regions of the peptides containing the phosphorylation site do not make specific contacts with the receptor. Binding assays confirm that phosphorylation does not increase the affinity of the T-antigen NLS to Impalpha. We conclude that the sequences flanking the basic clusters in NLSs play a crucial role in nuclear import by modulating the recognition of the NLS by Impalpha, whereas phosphorylation of the T-antigen enhances nuclear import by a mechanism that does not involve a direct interaction of the phosphorylated residue with Impalpha. PMID:12852786

  4. Structure-based design of a disulfide-linked oligomeric form of the simian virus 40 (SV40) large T antigen DNA-binding domain

    SciTech Connect

    Meinke, Gretchen; Phelan, Paul; Fradet-Turcotte, Amélie; Archambault, Jacques; Bullock, Peter A.


    With the aim of forming the ‘lock-washer’ conformation of the origin-binding domain of SV40 large T antigen in solution, using structure-based analysis an intermolecular disulfide bridge was engineered into the origin-binding domain to generate higher order oligomers in solution. The 1.7 Å resolution structure shows that the mutant forms a spiral in the crystal and has the de novo disulfide bond at the protein interface, although structural rearrangements at the interface are observed relative to the wild type. The modular multifunctional protein large T antigen (T-ag) from simian virus 40 orchestrates many of the events needed for replication of the viral double-stranded DNA genome. This protein assembles into single and double hexamers on specific DNA sequences located at the origin of replication. This complicated process begins when the origin-binding domain of large T antigen (T-ag ODB) binds the GAGGC sequences in the central region (site II) of the viral origin of replication. While many of the functions of purified T-ag OBD can be studied in isolation, it is primarily monomeric in solution and cannot assemble into hexamers. To overcome this limitation, the possibility of engineering intermolecular disulfide bonds in the origin-binding domain which could oligomerize in solution was investigated. A recent crystal structure of the wild-type T-ag OBD showed that this domain forms a left-handed spiral in the crystal with six subunits per turn. Therefore, we analyzed the protein interface of this structure and identified two residues that could potentially support an intermolecular disulfide bond if changed to cysteines. SDS–PAGE analysis established that the mutant T-ag OBD formed higher oligomeric products in a redox-dependent manner. In addition, the 1.7 Å resolution crystal structure of the engineered disulfide-linked T-ag OBD is reported, which establishes that oligomerization took place in the expected manner.

  5. Structure-based design of a disulfide-linked oligomeric form of the simian virus 40 (SV40) large T antigen DNA-binding domain.


    Meinke, Gretchen; Phelan, Paul; Fradet-Turcotte, Amélie; Archambault, Jacques; Bullock, Peter A


    The modular multifunctional protein large T antigen (T-ag) from simian virus 40 orchestrates many of the events needed for replication of the viral double-stranded DNA genome. This protein assembles into single and double hexamers on specific DNA sequences located at the origin of replication. This complicated process begins when the origin-binding domain of large T antigen (T-ag ODB) binds the GAGGC sequences in the central region (site II) of the viral origin of replication. While many of the functions of purified T-ag OBD can be studied in isolation, it is primarily monomeric in solution and cannot assemble into hexamers. To overcome this limitation, the possibility of engineering intermolecular disulfide bonds in the origin-binding domain which could oligomerize in solution was investigated. A recent crystal structure of the wild-type T-ag OBD showed that this domain forms a left-handed spiral in the crystal with six subunits per turn. Therefore, we analyzed the protein interface of this structure and identified two residues that could potentially support an intermolecular disulfide bond if changed to cysteines. SDS-PAGE analysis established that the mutant T-ag OBD formed higher oligomeric products in a redox-dependent manner. In addition, the 1.7 Å resolution crystal structure of the engineered disulfide-linked T-ag OBD is reported, which establishes that oligomerization took place in the expected manner.

  6. Structure-based Design of a Disulfide-lined Oligomeric Form of the Simian Virus 40 (SV40) Large T Antigen DNA-Binding Domain

    SciTech Connect

    G Meinke; P Phelan; A Fradet-Turcotte; J Archambault; P Bullock


    The modular multifunctional protein large T antigen (T-ag) from simian virus 40 orchestrates many of the events needed for replication of the viral double-stranded DNA genome. This protein assembles into single and double hexamers on specific DNA sequences located at the origin of replication. This complicated process begins when the origin-binding domain of large T antigen (T-ag ODB) binds the GAGGC sequences in the central region (site II) of the viral origin of replication. While many of the functions of purified T-ag OBD can be studied in isolation, it is primarily monomeric in solution and cannot assemble into hexamers. To overcome this limitation, the possibility of engineering intermolecular disulfide bonds in the origin-binding domain which could oligomerize in solution was investigated. A recent crystal structure of the wild-type T-ag OBD showed that this domain forms a left-handed spiral in the crystal with six subunits per turn. Therefore, we analyzed the protein interface of this structure and identified two residues that could potentially support an intermolecular disulfide bond if changed to cysteines. SDS-PAGE analysis established that the mutant T-ag OBD formed higher oligomeric products in a redox-dependent manner. In addition, the 1.7 {angstrom} resolution crystal structure of the engineered disulfide-linked T-ag OBD is reported, which establishes that oligomerization took place in the expected manner.

  7. Host proteins that bind to or mimic SV40 large T antigen: using antibodies to look at protein interactions and their significance

    PubMed Central

    Mole, S. E.; Gannon, J. V.; Anton, I. A.; Ford, M. J.; Lane, D. P.


    The papovavirus SV40 is able to induce tumours in susceptible hosts and will transform cells in vitro. Its major early protein, large T antigen, is required for viral DNA synthesis, both in vivo and in vitro, and is also responsible for the oncogenic action of the virus. We have made use of an extensive library of anti-T monoclonal antibodies to investigate the cellular effects of T. Large T shares an antigenic determinant with a growth-regulated host protein, p68, which is a member of an expanding super-family of helicases with particular homology to the translation initiation factor elF-4A. We have also studied the binding and interaction of large T with two particular host components: the replicative enzyme DNA polymerase α and the proto-oncogene p53. These two proteins bind to similar regions of T and exert similar effects on its antigenic structure. We found that p53 can block the binding of DNA polymerase α to T as well as co-existing with DNA polymerase α in a trimeric complex with T. This suggests that these interactions may be important in the oncogenic and replicative action of large T.

  8. Association of p53 binding and immortalization of primary C57BL/6 mouse embryo fibroblasts by using simian virus 40 T-antigen mutants bearing internal overlapping deletion mutations.

    PubMed Central

    Kierstead, T D; Tevethia, M J


    To more precisely map the immortalization and p53 binding domains of T antigen, a large series of overlapping deletion mutations were created between codons 251 to 651 by utilizing a combination of Bal 31 deletion and oligonucleotide-directed mutagenesis. Immortalization assay results indicated that amino acids (aa) 252 to 350, 400, and 451 to 532 could be removed without seriously compromising immortalization, although the appearance of immortal colonies was delayed in some cases. Western immunoblotting experiments indicated that the p53 binding capacities of T antigen produced by mutants missing aa 252 to 300, 301 to 350, 400, or 451 to 532 were only slightly reduced relative to that of wild-type T antigen. Within the limits of this deletion analysis, the immortalization and p53 binding domains appear to be colinear and, in fact, may represent two aspects of the same domain. This deletion analysis eliminates the entire zinc finger domain (aa 302 to 320), a small portion of the leucine-rich region (aa 345 to 350), and a large portion of the ATP binding domain (aa 451 to 528) as participants in p53 binding or in the immortalization process. The results also show that removal of T antigen amino acids within the region 451 to 532 appears to alter the capacity of newly synthesized but not older T antigen and p53 molecules to form complexes. Images PMID:8383212

  9. Invited review: Architectures and mechanisms of ATP binding cassette proteins.


    Hopfner, Karl-Peter


    ATP binding cassette (ABC) ATPases form chemo-mechanical engines and switches that function in a broad range of biological processes. Most prominently, a very large family of integral membrane NTPases-ABC transporters-catalyzes the import or export of a diverse molecules across membranes. ABC proteins are also important components of the chromosome segregation, recombination, and DNA repair machineries and regulate or catalyze critical steps of ribosomal protein synthesis. Recent structural and mechanistic studies draw interesting architectural and mechanistic parallels between diverse ABC proteins. Here, I review this state of our understanding how NTP-dependent conformational changes of ABC proteins drive diverse biological processes. © 2016 Wiley Periodicals, Inc. Biopolymers 105: 492-504, 2016. © 2016 Wiley Periodicals, Inc.

  10. Genes involved in nonpermissive temperature-induced cell differentiation in Sertoli TTE3 cells bearing temperature-sensitive simian virus 40 large T-antigen

    SciTech Connect

    Tabuchi, Yoshiaki . E-mail:; Kondo, Takashi; Suzuki, Yoshihisa; Obinata, Masuo


    Sertoli TTE3 cells, derived from transgenic mice bearing temperature-sensitive simian virus 40 large T (tsSV40LT)-antigen, proliferated continuously at a permissive temperature (33 deg C) whereas inactivation of the large T-antigen by a nonpermissive temperature (39 deg C) led to differentiation as judged by elevation of transferrin. To clarify the detailed mechanisms of differentiation, we investigated the time course of changes in gene expression using cDNA microarrays. Of the 865 genes analyzed, 14 genes showed increased levels of expression. Real-time quantitative PCR revealed that the mRNA levels of p21{sup waf1}, milk fat globule membrane protein E8, heat-responsive protein 12, and selenoprotein P were markedly elevated. Moreover, the differentiated condition induced by the nonpermissive temperature significantly increased mRNA levels of these four genes in several cell lines from the transgenic mice bearing the oncogene. The present results regarding changes in gene expression will provide a basis for a further understanding of molecular mechanisms of differentiation in both Sertoli cells and cell lines transformed by tsSV40LT-antigen.

  11. Polyomavirus T Antigens Activate an Antiviral State

    PubMed Central

    Giacobbi, Nicholas S.; Gupta, Tushar; Coxon, Andrew; Pipas, James M.


    Ectopic expression of Simian Virus 40 (SV40) large T antigen (LT) in mouse embryonic fibroblasts (MEFs) increased levels of mRNAs encoding interferon stimulated genes (ISGs). The mechanism by which T antigen increases levels of ISGs in MEFs remains unclear. We present evidence that expression of T antigen from SV40, Human Polyomaviruses BK (BKV) or JC (JCV) upregulate production of ISGs in MEFs, and subsequently result in an antiviral state, as determined by inhibition of VSV or EMCV growth. The first 136 amino acids of LT are sufficient for these activities. Furthermore, increased ISG expression and induction of the antiviral state requires STAT1. Finally, the RB binding motif of LT is necessary for activation of STAT1. We conclude that the induction of the STAT1 mediated innate immune response in MEFs is a common feature shared by SV40, BKV and JCV. PMID:25589241

  12. Cell adhesion markers are expressed by a stable human endothelial cell line transformed by the SV40 large T antigen under vimentin promoter control.


    Vicart, P; Testut, P; Schwartz, B; Llorens-Cortes, C; Perdomo, J J; Paulin, D


    Markers of endothelium have been studied in a new endothelial cell line derived from human umbilical cord vein cells by microinjection of a recombinant gene that includes a deletion mutant of the human vimentin gene regulatory region controlling the large T and small t antigen coding region of the SV40 virus. In culture, this immortalized venous endothelial cell line (IVEC) demonstrated morphological characteristics of endothelium; uptake of acetylated low density lipoprotein and presence of the Factor VIII-related antigen. Treatment of IVEC cells with Interleukin-1 beta (IL-1 beta) at 10 activates the expression of cell adhesion molecules such as endothelial leucocyte adhesion molecule (ELAM-1), intercellular adhesion molecule-1 (ICAM-1), and vascular cell adhesion molecule-1 (VCAM-1), as observed in primary culture. Prostacyclin secretion was induced in the IVEC cells by 100 nM PMA treatment and thrombin at 0.5 U/ml. Angiotensin converting enzyme (ACE) activity detected in IVEC cells was present but lower than ACE activity in primary endothelial cells and was completely blocked by enalaprilat (1 microM), a specific ACE inhibitor. The presence of ACE mRNA was also demonstrated in IVEC cells by RT-PCR amplification. Our data demonstrate that endothelial cells immortalized by use of this recombinant gene retain the morphological organization and numerous differentiated properties of endothelium.

  13. Simian virus 40-like DNA sequences and large-T antigen-retinoblastoma family protein pRb2/p130 interaction in human mesothelioma.


    Mutti, L; De Luca, A; Claudio, P P; Convertino, G; Carbone, M; Giordano, A


    The oncoprotein of the Simian virus 40, SV40 large T-antigen (Tag), is reported to target and inactivate growth-suppressive proteins such as the retinoblastoma (Rb) family and p53 leading to transformation of human cell lines in vitro, to produce tumours in rodents, and to be detected in several human cancers including mesothelioma. In support of the potential role of SV40 Tag in the pathogenesis of certain human cancers, we have found SV40-like sequences in 8/25 bioptic specimens of mesothelioma from patients with exposure to asbestos fibres. We have also demonstrated that the SV40 Tag detected in human mesothelioma binds the retinoblastoma family protein pRb2/p130 in 5/5 specimens studied. We submit that the tumorigenic potential of SV40 Tag in some human mesotheliomas may arise from its ability to interact with and thereby inactivate several tumour and/or growth suppressive proteins in cooperation with asbestos fibres in inducing pleural mesothelioma.

  14. The regions of the retinoblastoma protein needed for binding to adenovirus E1A or SV40 large T antigen are common sites for mutations.

    PubMed Central

    Hu, Q J; Dyson, N; Harlow, E


    The protein product of the retinoblastoma (RB) gene is thought to function in a pathway that restricts cell proliferation. Recently, transforming proteins from three different classes of DNA tumor viruses have been shown to form complexes with the RB protein. Genetic studies suggest that these interactions with the RB protein are important steps in transformation by these viruses. In order to understand better the function of the RB-viral oncoprotein complexes, we have mapped the regions of the RB protein that are necessary for these associations. Two non-contiguous regions of RB were found to be essential for complex formation with adenovirus E1A or SV40 large T antigen. These two regions are found between amino acids 393 and 572 and 646 and 772. Interestingly, these binding sites on RB overlap with the positions of naturally occurring, inactivating mutations of the RB gene. These results strongly suggest that these viral oncoproteins are targeting a protein domain that is an important site in the normal function of the RB protein. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 9. PMID:2138977

  15. Binding to retinoblastoma pocket domain does not alter the inter-domain flexibility of the J domain of SV40 large T antigen.


    Williams, Christina K; Vaithiyalingam, Sivaraja; Hammel, Michal; Pipas, James; Chazin, Walter J


    Simian Virus 40 uses the large T antigen (Tag) to bind and inactivate retinoblastoma tumor suppressor proteins (Rb), which can result in cellular transformation. Tag is a modular protein with four domains connected by flexible linkers. The N-terminal J domain of Tag is necessary for Rb inactivation. Binding of Rb is mediated by an LXCXE consensus motif immediately C-terminal to the J domain. Nuclear magnetic resonance (NMR) and small angle X-ray scattering (SAXS) were used to study the structural dynamics and interaction of Rb with the LXCXE motif, the J domain and a construct (N(260)) extending from the J domain through the origin binding domain (OBD). NMR and SAXS data revealed substantial flexibility between the domains in N(260). Binding of pRb to a construct containing the LXCXE motif and the J domain revealed weak interactions between pRb and the J domain. Analysis of the complex of pRb and N(260) indicated that the OBD is not involved and retains its dynamic independence from the remainder of Tag. These results support a 'chaperone' model in which the J domain of Tag changes its orientation as it acts upon different protein complexes.

  16. Immortalization of osteoclast precursors by targeting Bcl -XL and Simian virus 40 large T antigen to the osteoclast lineage in transgenic mice.

    PubMed Central

    Hentunen, T A; Reddy, S V; Boyce, B F; Devlin, R; Park, H R; Chung, H; Selander, K S; Dallas, M; Kurihara, N; Galson, D L; Goldring, S R; Koop, B A; Windle, J J; Roodman, G D


    Cellular and molecular characterization of osteoclasts (OCL) has been extremely difficult since OCL are rare cells, and are difficult to isolate in large numbers. We used the tartrate-resistant acid phosphatase promoter to target the bcl-XL and/or Simian Virus 40 large T antigen (Tag) genes to cells in the OCL lineage in transgenic mice as a means of immortalizing OCL precursors. Immunocytochemical studies confirmed that we had targeted Bcl-XL and/or Tag to OCL, and transformed and mitotic OCL were readily apparent in bones from both Tag and bcl-XL/Tag mice. OCL formation in primary bone marrow cultures from bcl-XL, Tag, or bcl-XL/Tag mice was twofold greater compared with that of nontransgenic littermates. Bone marrow cells from bcl-XL/Tag mice, but not from singly transgenic bcl-XL or Tag mice, have survived in continuous culture for more than a year. These cells form high numbers of bone-resorbing OCL when cultured using standard conditions for inducing OCL formation, with approximately 50% of the mononuclear cells incorporated into OCL. The OCL that form express calcitonin receptors and contract in response to calcitonin. Studies examining the proliferative capacity and the resistance of OCL precursors from these transgenic mice to apoptosis demonstrated that the increased numbers of OCL precursors in marrow from bcl-XL/Tag mice was due to their increased survival rather than an increased proliferative capacity compared with Tag, bcl-XL, or normal mice. Histomorphometric studies of bones from bcl-XL/Tag mice also confirmed that there were increased numbers of OCL precursors (TRAP + mononuclear cells) present in vivo. These data demonstrate that by targeting both bcl-XL and Tag to cells in the OCL lineage, we have immortalized OCL precursors that form bone-resorbing OCL with an efficiency that is 300-500 times greater than that of normal marrow. PMID:9649561

  17. Establishment of SV40 large T antigen-immortalized bovine liver sinusoidal cell lines and their immunological responses to deoxynivalenol and lipopolysaccharide.


    Yoshioka, Miyako; Takenouchi, Takato; Kitani, Hiroshi; Okada, Hiroyuki; Yamanaka, Noriko


    Immortalized bovine sinusoidal cell lines provide useful tools to study the immunological responses in the liver to the gastrointestinal tract-derived toxic substances, which may cause systemic symptoms in the affected livestock. Here, we established two immortalized bovine liver sinusoidal cell lines, endothelial-like B46, and myofibroblast-like A26, from primary cultures of bovine liver cells by the transfection with SV40 large T antigen. The pro-inflammatory cytokine responses in these cell lines to deoxynivalenol (DON) and lipopolysaccharide (LPS) were then compared to those in the primary bovine Kupffer cells (BKC). BKC were highly responsive to LPS, showing increased levels of IL-1α, IL-1β, IL-6, and TNF-α mRNA 3 h after stimulation. DON induced similar pro-inflammatory cytokine responses in BKC, except for IL-6. The endothelial B46 cells exhibited upregulation of IL-1α, IL-1β, and IL-6 3 h after stimulation by LPS. In contrast to the stimulation by LPS, B46 had relatively low pro-inflammatory cytokine responses to DON, except for IL-1α, which was moderately induced at 3 h and increased at 24 h after stimulation. The myofibroblast-like A26 cells exhibited low responses in the induction of pro-inflammatory cytokines to LPS or DON; however, the expression of IL-6 was significantly observed 3 h after DON stimulation. Our results suggest that bovine liver sinusoidal cells have distinctive pro-inflammatory cytokine responses against harmful substances, and these immune responses might determine the consequence of systemic inflammations in the diseased animal.

  18. Computerized segmentation algorithm with personalized atlases of murine MRIs in a SV40 large T-antigen mouse mammary cancer model

    NASA Astrophysics Data System (ADS)

    Sibley, Adam R.; Markiewicz, Erica; Mustafi, Devkumar; Fan, Xiaobing; Conzen, Suzanne; Karczmar, Greg; Giger, Maryellen L.


    Quantities of MRI data, much larger than can be objectively and efficiently analyzed manually, are routinely generated in preclinical research. We aim to develop an automated image segmentation and registration pipeline to aid in analysis of image data from our high-throughput 9.4 Tesla small animal MRI imaging center. T2-weighted, fat-suppressed MRIs were acquired over 4 life-cycle time-points [up to 12 to 18 weeks] of twelve C3(1) SV40 Large T-antigen mice for a total of 46 T2-weighted MRI volumes; each with a matrix size of 192 x 256, 62 slices, in plane resolution 0.1 mm, and slice thickness 0.5 mm. These image sets were acquired with the goal of tracking and quantifying progression of mammary intraepithelial neoplasia (MIN) to invasive cancer in mice, believed to be similar to ductal carcinoma in situ (DCIS) in humans. Our segmentation algorithm takes 2D seed-points drawn by the user at the center of the 4 co-registered volumes associated with each mouse. The level set then evolves in 3D from these 2D seeds. The contour evolution incorporates texture information, edge information, and a statistical shape model in a two-step process. Volumetric DICE coefficients comparing the automatic with manual segmentations were computed and ranged between 0.75 and 0.58 for averages over the 4 life-cycle time points of the mice. Incorporation of these personalized atlases with intra and inter mouse registration is expected to enable locally and globally tracking of the morphological and textural changes in the mammary tissue and associated lesions of these mice.

  19. Bilateral retinal and brain tumors in transgenic mice expressing simian virus 40 large T antigen under control of the human interphotoreceptor retinoid-binding protein promoter

    PubMed Central


    We have previously shown that postnatal expression of the viral oncoprotein SV40 T antigen in rod photoreceptors (transgene MOT1), at a time when retinal cells have withdrawn from the mitotic cycle, leads to photoreceptor cell death (Al-Ubaidi et al., 1992. Proc. Natl. Acad. Sci. USA. 89:1194-1198). To study the effect of the specificity of the promoter, we replaced the mouse opsin promoter in MOT1 by a 1.3-kb promoter fragment of the human IRBP gene which is expressed in both rod and cone photoreceptors during embryonic development. The resulting construct, termed HIT1, was injected into mouse embryos and five transgenic mice lines were established. Mice heterozygous for HIT1 exhibited early bilateral retinal and brain tumors with varying degrees of incidence. Histopathological examination of the brain and eyes of three of the families showed typical primitive neuroectodermal tumors. In some of the bilateral retinal tumors, peculiar rosettes were observed, which were different from the Flexner-Wintersteiner rosettes typically associated with human retinoblastomas. The ocular and cerebral tumors, however, contained Homer-Wright rosettes, and showed varying degrees of immunoreactivity to antibodies against the neuronal specific antigens, synaptophysin and Leu7, but not to antibodies against photoreceptor specific proteins. Taken together, the results indicate that the specificity of the promoter used for T antigen and/or the time of onset of transgene expression determines the fate of photoreceptor cells expressing T antigen. PMID:1334963

  20. Distinct roles for ATP binding and hydrolysis at individual subunits of an archaeal clamp loader

    PubMed Central

    Seybert, Anja; Wigley, Dale B


    Circular clamps are utilised by replicative polymerases to enhance processivity. The topological problem of loading a toroidal clamp onto DNA is overcome by ATP-dependent clamp loader complexes. Different organisms use related protein machines to load clamps, but the mechanisms by which they utilise ATP are surprisingly different. Using mutant clamp loaders that are deficient in either ATP binding or hydrolysis in different subunits, we show how the different subunits of an archaeal clamp loader use ATP binding and hydrolysis in distinct ways at different steps in the loading process. Binding of nucleotide by the large subunit and three of the four small subunits is sufficient for clamp loading. However, ATP hydrolysis by the small subunits is required for release of PCNA to allow formation of the complex between PCNA and the polymerase, while hydrolysis by the large subunit is required for catalytic clamp loading. PMID:15014449

  1. ATP-Binding Cassette Proteins: Towards a Computational View of Mechanism

    NASA Astrophysics Data System (ADS)

    Liao, Jielou


    Many large machine proteins can generate mechanical force and undergo large-scale conformational changes (LSCC) to perform varying biological tasks in living cells by utilizing ATP. Important examples include ATP-binding cassette (ABC) transporters. They are membrane proteins that couple ATP binding and hydrolysis to the translocation of substrates across membranes [1]. To interpret how the mechanical force generated by ATP binding and hydrolysis is propagated, a coarse-grained ATP-dependent harmonic network model (HNM) [2,3] is applied to the ABC protein, BtuCD. This protein machine transports vitamin B12 across membranes. The analysis shows that subunits of the protein move against each other in a concerted manner. The lowest-frequency modes of the BtuCD protein are found to link the functionally critical domains, and are suggested to be responsible for large-scale ATP-coupled conformational changes. [1] K. P. Locher, A. T. Lee and D. C. Rees. Science 296, 1091-1098 (2002). [2] Atilgan, A. R., S. R. Durell, R. L. Jernigan, M. C. Demirel, O. Keskin, and I. Bahar. Biophys. J. 80, 505-515(2002); M. M Tirion, Phys. Rev. Lett. 77, 1905-1908 (1996). [3] J. -L. Liao and D. N. Beratan, 2003, to be published.

  2. Conformational change induced by ATP binding in the multidrug ATP-binding cassette transporter BmrA.


    Orelle, Cédric; Gubellini, Francesca; Durand, Anne; Marco, Sergio; Lévy, Daniel; Gros, Philippe; Di Pietro, Attilio; Jault, Jean-Michel


    ATP-binding cassette (ABC) transporters are involved in the transport of a wide variety of substrates, and ATP-driven dimerization of their nucleotide binding domains (NBDs) has been suggested to be one of the most energetic steps of their catalytic cycle. Taking advantage of the propensity of BmrA, a bacterial multidrug resistance ABC transporter, to form stable, highly ordered ring-shaped structures [Chami et al. (2002) J. Mol. Biol. 315, 1075-1085], we show here that addition of ATP in the presence of Mg2+ prevented ring formation or destroyed the previously formed rings. To pinpoint the catalytic step responsible for such an effect, two classes of hydrolysis-deficient mutants were further studied. In contrast to hydrolytically inactive glutamate mutants that behaved essentially as the wild-type, lysine Walker A mutants formed ring-shaped structures even in the presence of ATP-Mg. Although the latter mutants still bound ATP-Mg, and even slowly hydrolyzed it for the K380R mutant, they were most likely unable to undergo a proper NBD dimerization upon ATP-Mg addition. The ATP-driven dimerization step, which was still permitted in glutamate mutants and led to a stable conformation suitable to monitor the growth of 2D crystals, appeared therefore responsible for destabilization of the BmrA ring structures. Our results provide direct visual evidence that the ATP-induced NBD dimerization triggers a conformational change large enough in BmrA to destabilize the rings, which is consistent with the assumption that this step might constitute the "power stroke" for ABC transporters.

  3. Isolation of a monoclonal antibody that recognizes the origin binding domain of JCV, but not SV40, large T-antigen.


    Grubman, Shelley A; Shin, Jong; Phelan, Paul J; Gong, Aaron; Can, Hande; Dilworth, Ryan; Kini, Sandeep Kuntadi; Gagnon, David; Archambault, Jacques; Meinke, Gretchen; Bohm, Andrew; Jefferson, Douglas M; Bullock, Peter A


    Within immunocompromised populations, the JC polyomavirus is the cause of the often-fatal disease Progressive Multifocal Leukoencephalopathy (PML). JC virus encodes a protein, termed T-antigen (T-ag), which is essential for its replication and pathogenicity. Previous studies of JCV T-ag have, in general, used antibodies raised against SV40 T-ag. Unfortunately, SV40 T-ag is also detected in humans and therefore there have been concerns about cross-reactivity. To address this issue, we have isolated a monoclonal antibody that binds to the JCV, but not the SV40, T-ag origin-binding domain (OBD). Furthermore, the region on the surface of the JCV T-ag OBD that is recognized by the "anti-JCV OBD mAb" has been mapped. We also demonstrate that the "anti-JCV OBD mAb" will be a useful reagent for standard techniques (e.g., Westerns blots and ELISAs). Finally, we note that additional monoclonal Abs that are specific for the T-ags encoded by the other human polyomaviruses could be generated by adopting the approach described herein.

  4. Generation and Characterization of Eptesicus fuscus (Big brown bat) kidney cell lines immortalized using the Myotis polyomavirus large T-antigen.


    Banerjee, Arinjay; Rapin, Noreen; Miller, Megan; Griebel, Philip; Zhou, Yan; Munster, Vincent; Misra, Vikram


    It is speculated that bats are important reservoir hosts for numerous viruses, with 27 viral families reportedly detected in bats. Majority of these viruses have not been isolated and there is little information regarding their biology in bats. Establishing a well-characterized bat cell line supporting the replication of bat-borne viruses would facilitate the analysis of virus-host interactions in an in vitro model. Currently, few bat cell lines have been developed and only Tb1-Lu, derived from Tadarida brasiliensis is commercially available. Here we describe a method to establish and immortalize big brown bat (Eptesicus fuscus) kidney (Efk3) cells using the Myotis polyomavirus T-antigen. Subclones of this cell line expressed both epithelial and fibroblast markers to varying extents. Cell clones expressed interferon beta in response to poly(I:C) stimulation and supported the replication of four different viruses, namely, vesicular stomatitis virus (VSV), porcine epidemic diarrhea coronavirus (PED-CoV), Middle-East respiratory syndrome coronavirus (MERS-CoV) and herpes simplex virus (HSV). To our knowledge, this is the first bat cell line from a northern latitude insectivorous bat developed using a novel technology. The cell line has the potential to be used for isolation of bat viruses and for studying virus-bat interactions in culture. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Merkel cell polyomavirus infection in both components of a combined Merkel cell carcinoma and basal cell carcinoma with ductal differentiation; each component had a similar but different novel Merkel cell polyomavirus large T antigen truncating mutation.


    Iwasaki, Takeshi; Kodama, Hajime; Matsushita, Michiko; Kuroda, Naoto; Yamasaki, Yoshikazu; Murakami, Ichiro; Yamamoto, Osamu; Hayashi, Kazuhiko


    Merkel cell polyomavirus infects up to 80% of patients with Merkel cell carcinoma. Combined Merkel cell carcinoma and cutaneous tumors occur occasionally. Previous reports have suggested that Merkel cell polyomavirus is absent from combined Merkel cell carcinoma and squamous cell carcinomas. This is the first report that Merkel cell polyomavirus infected in both lesions of a combined Merkel cell carcinoma and basal cell carcinoma. A 92-year-old Japanese man presented with a right thigh small subcutaneous mass. Histologic examination revealed a combined tumor with Merkel cell carcinoma and basal cell carcinoma with ductal differentiation. Both tumors and intermingled Merkel cells in basal cell carcinoma expressed Merkel cell polyomavirus large T antigen, and 17 and 240 copies of Merkel cell polyomavirus/cell were detected in the microdissected Merkel cell carcinoma and basal cell carcinoma specimens, respectively. Mutation analysis of Merkel cell polyomavirus large T antigen revealed a novel truncating mutation in Merkel cell carcinoma and a similar but different mutation in the basal cell carcinoma. These results suggest that each was infected by a different Merkel cell polyomavirus subclone derived from a single Merkel cell polyomavirus.

  6. Role of ATP binding and hydrolysis in assembly of MacAB-TolC macrolide transporter

    PubMed Central

    Lu, Shuo; Zgurskaya, Helen I.


    Summary MacB is a founding member of the Macrolide Exporter family of transporters belonging to the ATP-Binding Cassette superfamily. These proteins are broadly represented in genomes of both gram-positive and gram-negative bacteria and are implicated in virulence and protection against antibiotics and peptide toxins. MacB transporter functions together with MacA, a periplasmic membrane fusion protein, which stimulates MacB ATPase. In gram-negative bacteria, MacA is believed to couple ATP hydrolysis to transport of substrates across the outer membrane through a TolC-like channel. In this study, we report a real-time analysis of concurrent ATP hydrolysis and assembly of MacAB-TolC complex. MacB binds nucleotides with a low millimolar affinity and fast on- and off-rates. In contrast, MacA-MacB complex is formed with a nanomolar affinity, which further increases in the presence of ATP. Our results strongly suggest that association between MacA and MacB is stimulated by ATP binding to MacB but remains unchanged during ATP hydrolysis cycle. We also found that the large periplasmic loop of MacB plays the major role in coupling reactions separated in two different membranes. This loop is required for MacA-dependent stimulation of MacB ATPase and at the same time, contributes to recruitment of TolC into a trans-envelope complex. PMID:23057817

  7. Conserved mechanisms of microtubule-stimulated ADP release, ATP binding, and force generation in transport kinesins

    PubMed Central

    Atherton, Joseph; Farabella, Irene; Yu, I-Mei; Rosenfeld, Steven S; Houdusse, Anne; Topf, Maya; Moores, Carolyn A


    Kinesins are a superfamily of microtubule-based ATP-powered motors, important for multiple, essential cellular functions. How microtubule binding stimulates their ATPase and controls force generation is not understood. To address this fundamental question, we visualized microtubule-bound kinesin-1 and kinesin-3 motor domains at multiple steps in their ATPase cycles—including their nucleotide-free states—at ∼7 Å resolution using cryo-electron microscopy. In both motors, microtubule binding promotes ordered conformations of conserved loops that stimulate ADP release, enhance microtubule affinity and prime the catalytic site for ATP binding. ATP binding causes only small shifts of these nucleotide-coordinating loops but induces large conformational changes elsewhere that allow force generation and neck linker docking towards the microtubule plus end. Family-specific differences across the kinesin–microtubule interface account for the distinctive properties of each motor. Our data thus provide evidence for a conserved ATP-driven mechanism for kinesins and reveal the critical mechanistic contribution of the microtubule interface. DOI: PMID:25209998

  8. Role of ATP binding and hydrolysis in assembly of MacAB-TolC macrolide transporter.


    Lu, Shuo; Zgurskaya, Helen I


    MacB is a founding member of the Macrolide Exporter family of transporters belonging to the ATP-Binding Cassette superfamily. These proteins are broadly represented in genomes of both Gram-positive and Gram-negative bacteria and are implicated in virulence and protection against antibiotics and peptide toxins. MacB transporter functions together with MacA, a periplasmic membrane fusion protein, which stimulates MacB ATPase. In Gram-negative bacteria, MacA is believed to couple ATP hydrolysis to transport of substrates across the outer membrane through a TolC-like channel. In this study, we report a real-time analysis of concurrent ATP hydrolysis and assembly of MacAB-TolC complex. MacB binds nucleotides with a low millimolar affinity and fast on- and off-rates. In contrast, MacA-MacB complex is formed with a nanomolar affinity, which further increases in the presence of ATP. Our results strongly suggest that association between MacA and MacB is stimulated by ATP binding to MacB but remains unchanged during ATP hydrolysis cycle. We also found that the large periplasmic loop of MacB plays the major role in coupling reactions separated in two different membranes. This loop is required for MacA-dependent stimulation of MacB ATPase and at the same time, contributes to recruitment of TolC into a trans-envelope complex. © 2012 Blackwell Publishing Ltd.

  9. Formation of a Chloride-conducting State in the Maltose ATP-binding Cassette (ABC) Transporter.


    Carlson, Michael L; Bao, Huan; Duong, Franck


    ATP-binding cassette transporters use an alternating access mechanism to move substrates across cellular membranes. This mode of transport ensures the selective passage of molecules while preserving membrane impermeability. The crystal structures of MalFGK2, inward- and outward-facing, show that the transporter is sealed against ions and small molecules. It has yet to be determined whether membrane impermeability is maintained when MalFGK2 cycles between these two conformations. Through the use of a mutant that resides in intermediate conformations close to the transition state, we demonstrate that not only is chloride conductance occurring, but also to a degree large enough to compromise cell viability. Introduction of mutations in the periplasmic gate lead to the formation of a channel that is quasi-permanently open. MalFGK2 must therefore stay away from these ion-conducting conformations to preserve the membrane barrier; otherwise, a few mutations that increase access to the ion-conducting states are enough to convert an ATP-binding cassette transporter into a channel.

  10. ATP binding cassette G transporters and plant male reproduction.


    Zhao, Guochao; Shi, Jianxin; Liang, Wanqi; Zhang, Dabing


    The function of ATP Binding Cassette G (ABCG) transporters in the regulation of plant vegetative organs development has been well characterized in various plant species. In contrast, their function in reproductive development particularly male reproductive development received considerably less attention till some ABCG transporters was reported to be associated with anther and pollen wall development in Arabidopsis thaliana and rice (Oryza sativa) during the past decade. This mini-review summarizes current knowledge of ABCG transporters regarding to their roles in male reproduction and underlying genetic and biochemical mechanisms, which makes it evident that ABCG transporters represent one of those conserved and divergent components closely related to male reproduction in plants. This mini-review also discusses the current challenges and future perspectives in this particular field.

  11. ATP binding cassette G transporters and plant male reproduction

    PubMed Central

    Zhao, Guochao; Shi, Jianxin; Liang, Wanqi; Zhang, Dabing


    ABSTRACT The function of ATP Binding Cassette G (ABCG) transporters in the regulation of plant vegetative organs development has been well characterized in various plant species. In contrast, their function in reproductive development particularly male reproductive development received considerably less attention till some ABCG transporters was reported to be associated with anther and pollen wall development in Arabidopsis thaliana and rice (Oryza sativa) during the past decade. This mini-review summarizes current knowledge of ABCG transporters regarding to their roles in male reproduction and underlying genetic and biochemical mechanisms, which makes it evident that ABCG transporters represent one of those conserved and divergent components closely related to male reproduction in plants. This mini-review also discusses the current challenges and future perspectives in this particular field. PMID:26906115

  12. Crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus.


    Manjula, M; Pampa, K J; Kumar, S M; Mukherjee, S; Kunishima, N; Rangappa, K S; Lokanath, N K


    The ATP binding cassette (ABC) transporters, represent one of the largest superfamilies of primary transporters, which are very essential for various biological functions. The crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus has been determined at 1.77 Å resolution. The crystal structure revealed that the protomer has two thick arms, (arm I and II), which resemble 'L' shape. The ATP-binding pocket is located close to the end of arm I. ATP molecule is docked into the active site of the protein. The dimeric crystal structure of ATP-binding subunit of ABC transporter from G. kaustophilus has been compared with the previously reported crystal structure of ATP-binding subunit of ABC transporter from Salmonella typhimurium.

  13. High-Affinity Rb Binding, p53 Inhibition, Subcellular Localization, and Transformation by Wild-Type or Tumor-Derived Shortened Merkel Cell Polyomavirus Large T Antigens

    PubMed Central

    Borchert, Sophie; Czech-Sioli, Manja; Neumann, Friederike; Schmidt, Claudia; Wimmer, Peter; Dobner, Thomas


    ABSTRACT Interference with tumor suppressor pathways by polyomavirus-encoded tumor antigens (T-Ags) can result in transformation. Consequently, it is thought that T-Ags encoded by Merkel cell polyomavirus (MCPyV), a virus integrated in ∼90% of all Merkel cell carcinoma (MCC) cases, are major contributors to tumorigenesis. The MCPyV large T-Ag (LT-Ag) has preserved the key functional domains present in all family members but has also acquired unique regions that flank the LxCxE motif. As these regions may mediate unique functions, or may modulate those shared with T-Ags of other polyomaviruses, functional studies of MCPyV T-Ags are required. Here, we have performed a comparative study of full-length or MCC-derived truncated LT-Ags with regard to their biochemical characteristics, their ability to bind to retinoblastoma (Rb) and p53 proteins, and their transforming potential. We provide evidence that full-length MCPyV LT-Ag may not directly bind to p53 but nevertheless can significantly reduce p53-dependent transcription in reporter assays. Although early region expression constructs harboring either full-length or MCC-derived truncated LT-Ag genes can transform primary baby rat kidney cells, truncated LT-Ags do not bind to p53 or reduce p53-dependent transcription. Interestingly, shortened LT-Ags exhibit a very high binding affinity for Rb, as shown by coimmunoprecipitation and in vitro binding studies. Additionally, we show that truncated MCPyV LT-Ag proteins are expressed at higher levels than those for the wild-type protein and are able to partially relocalize Rb to the cytoplasm, indicating that truncated LT proteins may have gained additional features that distinguish them from the full-length protein. IMPORTANCE MCPyV is one of the 12 known polyomaviruses that naturally infect humans. Among these, it is of particular interest since it is the only human polyomavirus known to be involved in tumorigenesis. MCPyV is thought to be causally linked to MCC, a rare

  14. ATP-Binding Cassette Efflux Transporters in Human Placenta

    PubMed Central

    Ni, Zhanglin; Mao, Qingcheng


    Pregnant women are often complicated with diseases including viral or bacterial infections, epilepsy, hypertension, or pregnancy-induced conditions such as depression and gestational diabetes that require treatment with medication. In addition, substance abuse during pregnancy remains a major public health problem. Many drugs used by pregnant women are off label without the necessary dose, efficacy, and safety data required for rational dosing regimens of these drugs. Thus, a major concern arising from the widespread use of drugs by pregnant women is the transfer of drugs across the placental barrier, leading to potential toxicity to the developing fetus. Knowledge regarding the ATP-binding cassette (ABC) efflux transporters, which play an important role in drug transfer across the placental barrier, is absolutely critical for optimizing the therapeutic strategy to treat the mother while protecting the fetus during pregnancy. Such transporters include P-glycoprotein (P-gp, gene symbol ABCB1), the breast cancer resistance protein (BCRP, gene symbol ABCG2), and the multidrug resistance proteins (MRPs, gene symbol ABCCs). In this review, we summarize the current knowledge with respect to developmental expression and regulation, membrane localization, functional significance, and genetic polymorphisms of these ABC transporters in the placenta and their relevance to fetal drug exposure and toxicity. PMID:21118087

  15. ABCMdb reloaded: updates on mutations in ATP binding cassette proteins.


    Tordai, Hedvig; Jakab, Kristóf; Gyimesi, Gergely; András, Kinga; Brózik, Anna; Sarkadi, Balázs; Hegedus, Tamás


    ABC (ATP-Binding Cassette) proteins with altered function are responsible for numerous human diseases. To aid the selection of positions and amino acids for ABC structure/function studies we have generated a database, ABCMdb (Gyimesi et al. , ABCMdb: a database for the comparative analysis of protein mutations in ABC transporters, and a potential framework for a general application. Hum Mutat 2012; 33:1547-1556.), with interactive tools. The database has been populated with mentions of mutations extracted from full text papers, alignments and structural models. In the new version of the database we aimed to collect the effect of mutations from databases including ClinVar. Because of the low number of available data, even in the case of the widely studied disease-causing ABC proteins, we also included the possible effects of mutations based on SNAP2 and PROVEAN predictions. To aid the interpretation of variations in non-coding regions, the database was supplemented with related DNA level information. Our results emphasize the importance of in silico predictions because of the sparse information available on variants and suggest that mutations at analogous positions in homologous ABC proteins have a strong predictive power for the effects of mutations. Our improved ABCMdb advances the design of both experimental studies and meta-analyses in order to understand drug interactions of ABC proteins and the effects of mutations on functional expression.

  16. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    NASA Astrophysics Data System (ADS)

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus


    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH. radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD.-, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396-. Its negative charge could trigger conformational changes necessary for signal transduction.

  17. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    PubMed Central

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus


    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH· radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD·−, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396−. Its negative charge could trigger conformational changes necessary for signal transduction. PMID:24898692

  18. Peroxisomal ATP-binding cassette transporters form mainly tetramers.


    Geillon, Flore; Gondcaille, Catherine; Raas, Quentin; Dias, Alexandre M M; Pecqueur, Delphine; Truntzer, Caroline; Lucchi, Géraldine; Ducoroy, Patrick; Falson, Pierre; Savary, Stéphane; Trompier, Doriane


    ABCD1 and its homolog ABCD2 are peroxisomal ATP-binding cassette (ABC) half-transporters of fatty acyl-CoAs with both distinct and overlapping substrate specificities. Although it is established that ABC half-transporters have at least to dimerize to generate a functional unit, functional equivalents of tetramers (i.e. dimers of full-length transporters) have also been reported. However, oligomerization of peroxisomal ABCD transporters is incompletely understood but is of potential significance because more complex oligomerization might lead to differences in substrate specificity. In this work, we have characterized the quaternary structure of the ABCD1 and ABCD2 proteins in the peroxisomal membrane. Using various biochemical approaches, we clearly demonstrate that both transporters exist as both homo- and heterotetramers, with a predominance of homotetramers. In addition to tetramers, some larger molecular ABCD assemblies were also found but represented only a minor fraction. By using quantitative co-immunoprecipitation assays coupled with tandem mass spectrometry, we identified potential binding partners of ABCD2 involved in polyunsaturated fatty-acid metabolism. Interestingly, we identified calcium ATPases as ABCD2-binding partners, suggesting a role of ABCD2 in calcium signaling. In conclusion, we have shown here that ABCD1 and its homolog ABCD2 exist mainly as homotetramers in the peroxisomal membrane. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Conformation of the ATP binding peptide in actin revealed by proton NMR spectroscopy

    SciTech Connect

    Barden, J.A.


    The actin peptide 106-124 exists in a completely conserved region of the sequence and binds strongly to both ATP and tripolyphosphate. Binding particularly affects residues 116 and 118 and generally affects the two segments 115-118 and 121-124. One-dimensional nuclear Overhauser enhancement difference spectroscopy was used to detect molecular interactions between both adjacent and nonadjacent residues. The N-terminal segment 106-112 was found to be largely extended. A sharp bend was detected between Pro-112 and Lys-113. The triphosphate moiety binds to the strongly hydrophilic central segment of the peptide. Evidence was obtained for a reverse turn involving residues 121-124. Amide proton temperature coefficients and coupling constants provide evidence for a type I ..beta..-turn. A model of the ATP binding site is proposed together with its relationship to other parts of the actin structure and to the phalloidin binding site.

  20. Human polyoma JC virus minor capsid proteins, VP2 and VP3, enhance large T antigen binding to the origin of viral DNA replication: evidence for their involvement in regulation of the viral DNA replication.


    Saribas, A Sami; Mun, Sarah; Johnson, Jaslyn; El-Hajmoussa, Mohammad; White, Martyn K; Safak, Mahmut


    JC virus (JCV) lytically infects the oligodendrocytes in the central nervous system in a subset of immunocompromized patients and causes the demyelinating disease, progressive multifocal leukoencephalopathy. JCV replicates and assembles into infectious virions in the nucleus. However, understanding the molecular mechanisms of its virion biogenesis remains elusive. In this report, we have attempted to shed more light on this process by investigating molecular interactions between large T antigen (LT-Ag), Hsp70 and minor capsid proteins, VP2/VP3. We demonstrated that Hsp70 interacts with VP2/VP3 and LT-Ag; and accumulates heavily in the nucleus of the infected cells. We also showed that VP2/VP3 associates with LT-Ag through their DNA binding domains resulting in enhancement in LT-Ag DNA binding to Ori and induction in viral DNA replication. Altogether, our results suggest that VP2/VP3 and Hsp70 actively participate in JCV DNA replication and may play critical roles in coupling of viral DNA replication to virion encapsidation.

  1. Simian Virus Large T Antigen Interacts with the N-Terminal Domain of the 70 kD Subunit of Replication Protein A in the Same Mode as Multiple DNA Damage Response Factors

    PubMed Central

    Ning, Boting; Feldkamp, Michael D.; Cortez, David; Chazin, Walter J.; Friedman, Katherine L.


    Simian virus 40 (SV40) serves as an important model organism for studying eukaryotic DNA replication. Its helicase, Large T-antigen (Tag), is a multi-functional protein that interacts with multiple host proteins, including the ubiquitous ssDNA binding protein Replication Protein A (RPA). Tag recruits RPA, actively loads it onto the unwound DNA, and together they promote priming of the template. Although interactions of Tag with RPA have been mapped, no interaction between Tag and the N-terminal protein interaction domain of the RPA 70kDa subunit (RPA70N) has been reported. Here we provide evidence of direct physical interaction of Tag with RPA70N and map the binding sites using a series of pull-down and mutational experiments. In addition, a monoclonal anti-Tag antibody, the epitope of which overlaps with the binding site, blocks the binding of Tag to RPA70N. We use NMR chemical shift perturbation analysis to show that Tag uses the same basic cleft in RPA70N as multiple of DNA damage response proteins. Mutations in the binding sites of both RPA70N and Tag demonstrate that specific charge reversal substitutions in either binding partner strongly diminish the interaction. These results expand the known repertoire of contacts between Tag and RPA, which mediate the many critical roles of Tag in viral replication. PMID:25706313

  2. Complexed Structures of Formylglycinamide Ribonucleotide Amidotransferase from Thermotoga maritima Describe a Novel ATP Binding Protein Superfamily

    SciTech Connect

    Morar, Mariya; Anand, Ruchi; Hoskins, Aaron A.; Stubbe, JoAnne; Ealick, Steven E.


    Formylglycinamide ribonucleotide amidotransferase (FGAR-AT) catalyzes the ATP-dependent synthesis of formylglycinamidine ribonucleotide (FGAM) from formylglycinamide ribonucleotide (FGAR) and glutamine in the fourth step of the purine biosynthetic pathway. FGAR-AT is encoded by the purL gene. Two types of PurL have been detected. The first type, found in eukaryotes and Gram-negative bacteria, consists of a single 140 kDa polypeptide chain and is designated large PurL (lgPurL). The second type, small PurL (smPurL), is found in archaea and Gram-positive bacteria and consists of an 80 kDa polypeptide chain. SmPurL requires two additional gene products, PurQ and PurS, for activity. PurL is a member of a protein superfamily that contains a novel ATP-binding domain. Structures of several members of this superfamily are available in the unliganded form. We determined five different structures of FGAR-AT from Thermotoga maritima in the presence of substrates, a substrate analogue, and a product. These complexes have allowed a detailed description of the novel ATP-binding motif. The availability of a ternary complex enabled mapping of the active site, thus identifying potential residues involved in catalysis. The complexes show a conformational change in the active site compared to the unliganded structure. Surprising discoveries, an ATP molecule in an auxiliary site of the protein and the conformational changes associated with its binding, provoke speculation about the regulatory role of the auxiliary site in formation of the PurLSQ complex as well as the evolutionary relationship of PurLs from different organisms.

  3. T-antigen-DNA polymerase alpha complex implicated in simian virus 40 DNA replication.

    PubMed Central

    Smale, S T; Tjian, R


    We have combined in vitro DNA replication reactions and immunological techniques to analyze biochemical interactions between simian virus (SV40) large T antigen and components of the cellular replication apparatus. First, in vitro SV40 DNA replication was characterized with specific origin mutants. Next, monoclonal antibodies were used to demonstrate that a specific domain of T antigen formed a complex with cellular DNA polymerase alpha. Several antibodies were identified that coprecipitated T antigen and DNA polymerase alpha, while others were found to selectively prevent this interaction and concomitantly inhibit DNA replication. DNA polymerase alpha also bound efficiently to a T-antigen affinity column, confirming the immunoprecipitation results and providing a useful method for purification of the complete protein complex. Taken together, these results suggest that the T-antigen-polymerase association may be a key step in the initiation of SV40 DNA replication. Images PMID:3025630

  4. ATP-binding cassette transporters in reproduction: a new frontier

    PubMed Central

    Bloise, E.; Ortiga-Carvalho, T.M.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G.


    BACKGROUND The transmembrane ATP-binding cassette (ABC) transporters actively efflux an array of clinically relevant compounds across biological barriers, and modulate biodistribution of many physiological and pharmacological factors. To date, over 48 ABC transporters have been identified and shown to be directly and indirectly involved in peri-implantation events and fetal/placental development. They efflux cholesterol, steroid hormones, vitamins, cytokines, chemokines, prostaglandins, diverse xenobiotics and environmental toxins, playing a critical role in regulating drug disposition, immunological responses and lipid trafficking, as well as preventing fetal accumulation of drugs and environmental toxins. METHODS This review examines ABC transporters as important mediators of placental barrier functions and key reproductive processes. Expression, localization and function of all identified ABC transporters were systematically reviewed using PubMed and Google Scholar websites to identify relevant studies examining ABC transporters in reproductive tissues in physiological and pathophysiological states. Only reports written in English were incorporated with no restriction on year of publication. While a major focus has been placed on the human, extensive evidence from animal studies is utilized to describe current understanding of the regulation and function of ABC transporters relevant to human reproduction. RESULTS ABC transporters are modulators of steroidogenesis, fertilization, implantation, nutrient transport and immunological responses, and function as ‘gatekeepers’ at various barrier sites (i.e. blood-testes barrier and placenta) against potentially harmful xenobiotic factors, including drugs and environmental toxins. These roles appear to be species dependent and change as a function of gestation and development. The best-described ABC transporters in reproductive tissues (primarily in the placenta) are the multidrug transporters p-glycoprotein and

  5. Immortalization-susceptible elements and their binding factors mediate rejuvenation of regulation of the type I collagenase gene in simian virus 40 large T antigen-transformed immortal human fibroblasts.

    PubMed Central

    Imai, S; Fujino, T; Nishibayashi, S; Manabe, T; Takano, T


    Dramatic changes occur in expression of the type I collagenase gene during the process of immortalization in simian virus 40 large T antigen-transformed human fibroblasts (S. Imai and T. Takano, Biochem. Biophys. Res. Commun. 189:148-153, 1992). From transient transfection assays, it was determined that these changes involved the functions of two immortalization-susceptible cis-acting elements, ISE1 and ISE2, located in a 100-bp region about 1.7 kb upstream. The profiles of binding of an activator, Proserpine, to the enhancer ISE1 were similar in the extracts of young, senescent preimmortalized and immortalized cells. ISE2 contained both negative and positive regulatory elements located adjacent to each other. The positive regulatory element consisted of a tandem array of putative Ets family- and AP-1-binding sites. An activator, Pluto, interacted with this positive regulatory element and had an AP-1-related component as a complex. The binding activity of Pluto was predominantly detected only in the extract from senescent preimmortalized cells. In contrast, a repressor, Orpheus, which bound to the ATG-rich negative regulatory element of ISE2, was prominently detected in extracts from both young preimmortalized and immortalized cells and appeared to suppress transcription in an orientation-dependent manner. Thus, the interplay of Pluto and Orpheus was suggested to be crucial for regulation of the collagenase gene accompanying in vitro aging and immortalization. Proserpine seemed to interact with Pluto to mediate strong expression of the collagenase gene in cellular senescence. On the basis of these results, we propose a model for regulation of the collagenase gene during in vitro aging and immortalization. Images PMID:7935433

  6. Isolation and characterization of NIH 3T3 cells expressing polyomavirus small T antigen

    SciTech Connect

    Noda, T.; Satake, M.; Robins, T.; Ito, Y.


    The polyomavirus small T-antigen gene, together with the polyomavirus promoter, was inserted into retrovirus vector pGV16 which contains the Moloney sarcoma virus long terminal repeat and neomycin resistance gene driven by the simian virus 40 promoter. This expression vector, pGVST, was packaged into retrovirus particles by transfection of PSI2 cells which harbor packaging-defective murine retrovirus genome. NIH 3T3 cells were infected by this replication-defective retrovirus containing pGVST. Of the 15 G418-resistant cell clones, 8 express small T antigen at various levels as revealed by immunoprecipitation. A cellular protein with an apparent molecular weight of about 32,000 coprecipitates with small T antigen. Immunofluorescent staining shows that small T antigen is mainly present in the nuclei. Morphologically, cells expressing small T antigen are indistinguishable from parental NIH 3T3 cells and have a microfilament pattern similar to that in parental NIH 3T3 cells. Cells expressing small T antigen form a flat monolayer but continue to grow beyond the saturation density observed for parental NIH 3T3 cells and eventually come off the culture plate as a result of overconfluency. There is some correlation between the level of expression of small T antigen and the growth rate of the cells. Small T-antigen-expressing cells form small colonies in soft agar. However, the proportion of cells which form these small colonies is rather small. A clone of these cells tested did not form tumors in nude mice within 3 months after inoculation of 10/sup 6/ cells per animal. Thus, present studies establish that the small T antigen of polyomavirus is a second nucleus-localized transforming gene product of the virus (the first one being large T antigen) and by itself has a function which is to stimulate the growth of NIH 3T3 cells beyond their saturation density in monolayer culture.

  7. ATP binding/hydrolysis by and phosphorylation of peroxisomal ATP-binding cassette proteins PMP70 (ABCD3) and adrenoleukodystrophy protein (ABCD1).


    Tanaka, Arowu R; Tanabe, Kouichi; Morita, Masashi; Kurisu, Mikinori; Kasiwayama, Yoshinori; Matsuo, Michinori; Kioka, Noriyuki; Amachi, Teruo; Imanaka, Tsuneo; Ueda, Kazumitsu


    The 70-kDa peroxisomal membrane protein (PMP70) and adrenoleukodystrophy protein (ALDP), half-size ATP-binding cassette transporters, are involved in metabolic transport of long and very long chain fatty acids into peroxisomes. We examined the interaction of peroxisomal ATP-binding cassette transporters with ATP using rat liver peroxisomes. PMP70 was photoaffinity-labeled at similar efficiencies with 8-azido-[alpha-32P]ATP and 8-azido-[gamma-32P]ATP when peroxisomes were incubated with these nucleotides at 37 degrees C in the absence Mg2+ and exposed to UV light without removing unbound nucleotides. The photoaffinity-labeled PMP70 and ALDP were co-immunoprecipitated together with other peroxisomal proteins, which also showed tight ATP binding properties. Addition of Mg2+ reduced the photoaffinity labeling of PMP70 with 8-azido-[gamma-32P]ATP by 70%, whereas it reduced photoaffinity labeling with 8-azido-[alpha-32P]ATP by only 20%. However, two-thirds of nucleotide (probably ADP) was dissociated during removal of unbound nucleotides. These results suggest that ATP binds to PMP70 tightly in the absence of Mg2+, the bound ATP is hydrolyzed to ADP in the presence of Mg2+, and the produced ADP is dissociated from PMP70, which allows ATP hydrolysis turnover. Properties of photoaffinity labeling of ALDP were essentially similar to those of PMP70. Vanadate-induced nucleotide trapping in PMP70 and ALDP was not observed. PMP70 and ALDP were also phosphorylated at a tyrosine residue(s). ATP binding/hydrolysis by and phosphorylation of PMP70 and ALDP are involved in the regulation of fatty acid transport into peroxisomes.

  8. ATP Binding and Hydrolysis Properties of ABCB10 and Their Regulation by Glutathione

    PubMed Central

    Qiu, Wei; Liesa, Marc; Carpenter, Elizabeth P.; Shirihai, Orian S.


    ABCB10 (ATP binding cassette sub-family B10) is a mitochondrial inner-membrane ABC transporter. ABCB10 has been shown to protect the heart from the impact of ROS during ischemia-reperfusion and to allow for proper hemoglobin synthesis during erythroid development. ABC transporters are proteins that increase ATP binding and hydrolysis activity in the presence of the transported substrate. However, molecular entities transported by ABCB10 and its regulatory mechanisms are currently unknown. Here we characterized ATP binding and hydrolysis properties of ABCB10 by using the 8-azido-ATP photolabeling technique. This technique can identify potential ABCB10 regulators, transported substrates and amino-acidic residues required for ATP binding and hydrolysis. We confirmed that Gly497 and Lys498 in the Walker A motif, Glu624 in the Walker B motif and Gly602 in the C-Loop motif of ABCB10 are required for proper ATP binding and hydrolysis activity, as their mutation changed ABCB10 8-Azido-ATP photo-labeling. In addition, we show that the potential ABCB10 transported entity and heme precursor delta-aminolevulinic acid (dALA) does not alter 8-azido-ATP photo-labeling. In contrast, oxidized glutathione (GSSG) stimulates ATP hydrolysis without affecting ATP binding, whereas reduced glutathione (GSH) inhibits ATP binding and hydrolysis. Indeed, we detectABCB10 glutathionylation in Cys547 and show that it is one of the exposed cysteine residues within ABCB10 structure. In all, we characterize essential residues for ABCB10 ATPase activity and we provide evidence that supports the exclusion of dALA as a potential substrate directly transported by ABCB10. Last, we show the first molecular mechanism by which mitochondrial oxidative status, through GSH/GSSG, can regulate ABCB10. PMID:26053025

  9. An open conformation of the Thermus thermophilus gyrase B ATP-binding domain.


    Lamour, Valérie; Hoermann, Laurence; Jeltsch, Jean-Marc; Oudet, Pierre; Moras, Dino


    DNA gyrase forms an A(2)B(2) tetramer involved in DNA replication, repair, recombination, and transcription in which the B subunit catalyzes ATP hydrolysis. The Thermus thermophilus and Escherichia coli gyrases are homologues and present the same catalytic activity. When compared with that of the E. coli 43K-5'-adenylyl-beta,gamma-imidodiphosphate complex, the crystal structure of Gyrase B 43K ATPase domain in complex with novobiocin, one of the most potent inhibitors of gyrase shows large conformational changes of the subdomains within the dimer. The stabilization of loop 98-118 closing the active site through dimeric contacts and interaction with domain 2 allows to observe novobiocin-protein interactions that could not be seen in the 24K-inhibitor complexes. Furthermore, this loop adopts a position which defines an "open" conformation of the active site in absence of ATP, in contrast with the "closed" conformation adopted upon ATP binding. All together, these results indicate how the subdomains may propagate conformational changes from the active site and provide crucial information for the design of more specific inhibitors.

  10. Receptor-transporter interactions of canonical ATP-binding cassette import systems in prokaryotes.


    Schneider, Erwin; Eckey, Viola; Weidlich, Daniela; Wiesemann, Nicole; Vahedi-Faridi, Ardeshir; Thaben, Paul; Saenger, Wolfram


    ATP-binding cassette (ABC) transport systems mediate the translocation of solutes across biological membranes at the expense of ATP. They share a common modular architecture comprising two pore-forming transmembrane domains and two nucleotide binding domains. In prokaryotes, ABC transporters are involved in the uptake of a large variety of chemicals, including nutrients, osmoprotectants and signal molecules. In pathogenic bacteria, some ABC importers are virulence factors. Canonical ABC import systems require an additional component, a substrate-specific receptor or binding protein for function. Interaction of the liganded receptor with extracytoplasmic loop regions of the transmembrane domains initiate the transport cycle. In this review we summarize the current knowledge on receptor-transporter interplay provided by crystal structures as well as by biochemical and biophysical means. In particular, we focus on the maltose/maltodextrin transporter of enterobacteria and the transporters for positively charged amino acids from the thermophile Geobacillus stearothermophilus and Salmonella enterica serovar Typhimurium. Copyright © 2011 Elsevier GmbH. All rights reserved.

  11. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum.


    Broehan, Gunnar; Kroeger, Tobias; Lorenzen, Marcé; Merzendorfer, Hans


    The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control.

  12. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum

    PubMed Central


    Background The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. Results We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. Conclusions The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control. PMID:23324493

  13. An ATP-binding cassette transporter is a major glycoprotein of sea urchin sperm membranes.


    Mengerink, Kathryn J; Vacquier, Victor D


    Sperm are terminally differentiated cells that undergo several membrane-altering events before fusion with eggs. One event, the sea urchin sperm acrosome reaction (AR), is blocked by the lectin wheat germ agglutinin (WGA). In an effort to identify proteins involved in the AR induction, the peptide sequence was obtained from a 220-kDa WGA-binding protein. Degenerate PCR and library screening resulted in the full-length deduced amino acid sequence of an ATP-binding cassette transporter, suABCA. The protein of 1,764 residues has two transmembrane regions, two nucleotide-binding domains, and is most closely related to the human ABC subfamily A member 3 transporter (ABCA3). Sequence analysis suggests a large extracellular loop between transmembrane spanning segments 7 and 8, with five N-linked glycosylation sites. An antibody made to the loop region binds to non-permeabilized cells, supporting that this region is extracellular. suABCA is found in sperm membrane vesicles, it can be solubilized with nonionic detergents, and it shifts from 220 to 200 kDa upon protein:N-glycanase F digestion. suABCA localizes to the entire surface of sperm in a punctate pattern, but is not detected in lipid rafts. Based on its relationship to subfamily A, suABCA is most likely involved in phospholipid or cholesterol transport. This is the first investigation of an ABC transporter in animal sperm.

  14. AP1 enhances polyomavirus DNA replication by promoting T-antigen-mediated unwinding of DNA.

    PubMed Central

    Guo, W; Tang, W J; Bu, X; Bermudez, V; Martin, M; Folk, W R


    An early step in the initiation of polyomavirus DNA replication is viral large-T-antigen-mediated unwinding of the origin. We report that components of the AP1 transcription factor, Fos and Jun, interact with T antigen in vitro to enhance unwinding of the viral origin. This provides a biochemical basis for the capacity of AP1 to activate viral DNA replication in vivo. PMID:8763994

  15. Characterization of am404, an amber mutation in the simian virus 40 T antigen gene.

    PubMed Central

    Rawlins, D R; Collis, P; Muzyczka, N


    We analyzed the biological activity of an amber mutation, am404, at map position 0.27 in the T antigen gene of simian virus 40. Immunoprecipitation of extracts from am404-infected cells demonstrated the presence of an amber protein fragment (am T antigen) of the expected molecular weight (67,000). Differential immunoprecipitation with monoclonal antibody demonstrated that am T antigen was missing the carboxy-terminal antigenic determinants. The amber mutant was shown to be defective for most of the functions associated with wild-type T antigen. The mutant did not replicate autonomously, but this defect could be complemented by a helper virus (D. R. Rawlins and N. Muzyczka, J. Virol. 36:611-616, 1980). The mutant failed to transform nonpermissive rodent cells and did not relieve the host range restriction of adenovirus 2 in monkey cells. However, stimulation of host cell DNA, whose functional region domain has been mapped within that portion of the protein synthesized by the mutant, could be demonstrated in am404-infected cells. A number of unexpected observations were made. First, the am T antigen was produced in unusually large amounts in a simian virus 40-transformed monkey cell line (COS-1), but overproduction was not seen in nontransformed monkey cells regardless of whether or not a helper virus was present. This feature of the mutant was presumably the result of the inability of am T antigen to autoregulate, the level of wild-type T antigen in COS-1 cells, and the unusually short half-life of am T antigen in vivo. Pulse-chase experiments indicated that am T antigen had an intracellular half-life of approximately 10 min. In addition, although the am T antigen retained the major phosphorylation site found in simian virus 40 T antigen, it was not phosphorylated. Thus, phosphorylation of simian virus 40 T antigen is not required for the stimulation of host cell DNA synthesis. Finally, fusion of am404-infected monkey cells with Escherichia coli protoplasts

  16. Mutational analysis of simian virus 40 T antigen: isolation and characterization of mutants with deletions in the T-antigen gene.

    PubMed Central

    Pipas, J M; Peden, K W; Nathans, D


    A series of mutants of simian virus 40 has been constructed with deletions in the coding sequence for large T antigen. Nucleotide sequence analysis indicates that 4 mutants have in-phase and 11 have out-of-phase deletions. Mutant DNAs were assayed for the following activities: the ability to form plaques, the ability to produce T antigen as scored by indirect immunofluorescence, viral DNA replication, and morphological transformation of rat cells. Two viable mutants were found, and these had deletions confined to the carboxyl terminus of T antigen. Only those mutants coding for polypeptides greater than 40% of the length of wildtype T antigen produced detectable nuclear fluorescence. The two viable mutants with deletions in the carboxyl terminus of the protein retained the ability both to replicate their DNA, although at a reduced level, and to transform nonpermissive cells. Mutants with sequence changes that result in the loss of more than 117 amino acids from the carboxyl terminus were not viable and were also defective in the DNA replication and transformation functions of T antigen, although several produced detectable nuclear fluorescence. These functions were also sensitive to the removal of amino acids near the amino terminus and in the middle of the protein. Images PMID:6300656

  17. Molecular mechanism of ATP binding and ion channel activation in P2X receptors

    SciTech Connect

    Hattori, Motoyuki; Gouaux, Eric


    P2X receptors are trimeric ATP-activated ion channels permeable to Na{sup +}, K{sup +} and Ca{sup 2+}. The seven P2X receptor subtypes are implicated in physiological processes that include modulation of synaptic transmission, contraction of smooth muscle, secretion of chemical transmitters and regulation of immune responses. Despite the importance of P2X receptors in cellular physiology, the three-dimensional composition of the ATP-binding site, the structural mechanism of ATP-dependent ion channel gating and the architecture of the open ion channel pore are unknown. Here we report the crystal structure of the zebrafish P2X4 receptor in complex with ATP and a new structure of the apo receptor. The agonist-bound structure reveals a previously unseen ATP-binding motif and an open ion channel pore. ATP binding induces cleft closure of the nucleotide-binding pocket, flexing of the lower body {beta}-sheet and a radial expansion of the extracellular vestibule. The structural widening of the extracellular vestibule is directly coupled to the opening of the ion channel pore by way of an iris-like expansion of the transmembrane helices. The structural delineation of the ATP-binding site and the ion channel pore, together with the conformational changes associated with ion channel gating, will stimulate development of new pharmacological agents.

  18. Influence of ATP-binding cassette transporters in root exudation of phytoalexins, signals, and disease resistance

    USDA-ARS?s Scientific Manuscript database

    The roots of plants secrete compounds as a way to exchange information with organ-isms living in the soil. Here, we report the involvement of seven root-expressed ATP-binding cassette (ABC) transporters corresponding to both full and half-size molecules (Atabcg36, Atabcg37, Atabcc5, Atabcf1, Atabcf3...

  19. Elucidating the site of protein-ATP binding by top-down mass spectrometry.


    Yin, Sheng; Loo, Joseph A


    A Fourier-transform ion cyclotron resonance (FT-ICR) top-down mass spectrometry strategy for determining the adenosine triphosphate (ATP)-binding site on chicken adenylate kinase is described. Noncovalent protein-ligand complexes are readily detected by electrospray ionization mass spectrometry (ESI-MS), but the ability to detect protein-ligand complexes depends on their stability in the gas phase. Previously, we showed that collisionally activated dissociation (CAD) of protein-nucleotide triphosphate complexes yield products from the dissociation of a covalent phosphate bond of the nucleotide with subsequent release of the nucleotide monophosphate (Yin, S. et al., J. Am. Soc. Mass Spectrom. 2008, 19, 1199-1208). The intrinsic stability of electrostatic interactions in the gas phase allows the diphosphate group to remain noncovalently bound to the protein. This feature is exploited to yield positional information on the site of ATP-binding on adenylate kinase. CAD and electron capture dissociation (ECD) of the adenylate kinase-ATP complex generate product ions bearing mono- and diphosphate groups from regions previously suggested as the ATP-binding pocket by NMR and crystallographic techniques. Top-down MS may be a viable tool to determine the ATP-binding sites on protein kinases and identify previously unknown protein kinases in a functional proteomics study. Copyright 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.

  20. ATP-binding cassette and multidrug and toxic compound extrusion transporters in plants: a common theme among diverse detoxification mechanisms.


    Shoji, Tsubasa


    Plants have developed elaborate detoxification mechanisms to cope with a large number of potentially toxic compounds, which include exogenous xenobiotics and endogenous metabolites, especially secondary metabolites. After enzymatic modification or synthesis, such compounds are transported and accumulated in apoplastic cell walls or central vacuoles in plant cells. Membrane transporters actively catalyze translocation of a diverse range of these compounds across various membranes within cells. Biochemical, molecular, and genetic studies have begun to reveal functions of a handful of ATP-binding cassette and multidrug and toxic compound extrusion family transporters engaged in transport of organic xenobiotics, heavy metals, metalloids, aluminum, alkaloids, flavonoids, terpenoids, terpenoid-derived phytohormones, cuticle lipids, and monolignols in plants. This detoxification versatility and metabolic diversity may underlie the functional diversification in plants of these families of transporters, which are largely involved in multidrug resistance in microorganisms and animals. © 2014 Elsevier Inc. All rights reserved.

  1. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells

    PubMed Central

    Lara, Flavio Alves; Pohl, Paula C.; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H. F.; Almeida, Igor C.; Vaz, Itabajara da Silva; Oliveira, Pedro L.


    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  2. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells.


    Lara, Flavio Alves; Pohl, Paula C; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H F; Almeida, Igor C; Vaz, Itabajara da Silva; Oliveira, Pedro L


    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  3. Adipocyte ATP-binding cassette G1 promotes triglyceride storage, fat mass growth, and human obesity.


    Frisdal, Eric; Le Lay, Soazig; Hooton, Henri; Poupel, Lucie; Olivier, Maryline; Alili, Rohia; Plengpanich, Wanee; Villard, Elise F; Gilibert, Sophie; Lhomme, Marie; Superville, Alexandre; Miftah-Alkhair, Lobna; Chapman, M John; Dallinga-Thie, Geesje M; Venteclef, Nicolas; Poitou, Christine; Tordjman, Joan; Lesnik, Philippe; Kontush, Anatol; Huby, Thierry; Dugail, Isabelle; Clement, Karine; Guerin, Maryse; Le Goff, Wilfried


    The role of the ATP-binding cassette G1 (ABCG1) transporter in human pathophysiology is still largely unknown. Indeed, beyond its role in mediating free cholesterol efflux to HDL, the ABCG1 transporter equally promotes lipid accumulation in a triglyceride (TG)-rich environment through regulation of the bioavailability of lipoprotein lipase (LPL). Because both ABCG1 and LPL are expressed in adipose tissue, we hypothesized that ABCG1 is implicated in adipocyte TG storage and therefore could be a major actor in adipose tissue fat accumulation. Silencing of Abcg1 expression by RNA interference in 3T3-L1 preadipocytes compromised LPL-dependent TG accumulation during the initial phase of differentiation. Generation of stable Abcg1 knockdown 3T3-L1 adipocytes revealed that Abcg1 deficiency reduces TG storage and diminishes lipid droplet size through inhibition of Pparγ expression. Strikingly, local inhibition of adipocyte Abcg1 in adipose tissue from mice fed a high-fat diet led to a rapid decrease of adiposity and weight gain. Analysis of two frequent ABCG1 single nucleotide polymorphisms (rs1893590 [A/C] and rs1378577 [T/G]) in morbidly obese individuals indicated that elevated ABCG1 expression in adipose tissue was associated with increased PPARγ expression and adiposity concomitant to increased fat mass and BMI (haplotype AT>GC). The critical role of ABCG1 in obesity was further confirmed in independent populations of severe obese and diabetic obese individuals. This study identifies for the first time a major role of adipocyte ABCG1 in adiposity and fat mass growth and suggests that adipose ABCG1 might represent a potential therapeutic target in obesity.

  4. Detergent-free purification of ABC (ATP-binding-cassette) transporters.


    Gulati, Sonali; Jamshad, Mohammed; Knowles, Timothy J; Morrison, Kerrie A; Downing, Rebecca; Cant, Natasha; Collins, Richard; Koenderink, Jan B; Ford, Robert C; Overduin, Michael; Kerr, Ian D; Dafforn, Timothy R; Rothnie, Alice J


    ABC (ATP-binding-cassette) transporters carry out many vital functions and are involved in numerous diseases, but study of the structure and function of these proteins is often hampered by their large size and membrane location. Membrane protein purification usually utilizes detergents to solubilize the protein from the membrane, effectively removing it from its native lipid environment. Subsequently, lipids have to be added back and detergent removed to reconstitute the protein into a lipid bilayer. In the present study, we present the application of a new methodology for the extraction and purification of ABC transporters without the use of detergent, instead, using a copolymer, SMA (polystyrene-co-maleic acid). SMA inserts into a bilayer and assembles into discrete particles, essentially solubilizing the membrane into small discs of bilayer encircled by a polymer, termed SMALPs (SMA lipid particles). We show that this polymer can extract several eukaryotic ABC transporters, P-glycoprotein (ABCB1), MRP1 (multidrug-resistance protein 1; ABCC1), MRP4 (ABCC4), ABCG2 and CFTR (cystic fibrosis transmembrane conductance regulator; ABCC7), from a range of different expression systems. The SMALP-encapsulated ABC transporters can be purified by affinity chromatography, and are able to bind ligands comparably with those in native membranes or detergent micelles. A greater degree of purity and enhanced stability is seen compared with detergent solubilization. The present study demonstrates that eukaryotic ABC transporters can be extracted and purified without ever being removed from their lipid bilayer environment, opening up a wide range of possibilities for the future study of their structure and function.

  5. ATP binding cassette transporters modulate both coelenterazine- and D-luciferin- based bioluminescence imaging

    PubMed Central

    Huang, Ruimin; Vider, Jelena; Serganova, Inna; Blasberg, Ronald G.


    Bioluminescence imaging (BLI) of luciferase reporters provides a cost-effective and sensitive means to image biological processes. However, transport of luciferase substrates across the cell membrane does affect BLI-readout-intensity from intact living cells. To investigate the effect of ATP-binding cassette (ABC) transporters on BLI readout, we generated Click Beetle-(cLuc), Firefly-(fLuc), Renilla-(rLuc), and Gaussia-(gLuc) luciferase HEK-293 reporter cells that overexpressed different ABC-transporters (ABCB1, ABCC1 and ABCG2). In vitro studies showed a significant BLI intensity decrease in intact-cells compared to cell-lysates, when ABCG2 was overexpressed in HEK-293/cLuc, fLuc, and rLuc cells. Selective ABC-transporter inhibitors were also applied. Inhibition of ABCG2 activity increased the BLI intensity >2-fold in HEK-293/cLuc, fLuc and rLuc cells; inhibition of ABCB1 elevated the BLI intensity 2-fold only in HEK-293/rLuc cells. BLI of xenografts derived from HEK-293/ABC-transporter/luciferase-reporter cells confirmed the results of inhibitor treatment in vivo. These findings demonstrate that coelenterazine-based rLuc-BLI intensity can be modulated by ABCB1 and ABCG2. ABCG2 modulates D-luciferin-based BLI in a luciferase-type-independent manner. Little ABC-transporter effect on gLuc-BLI intensity is observed since a large fraction of gLuc is secreted. The expression level of ABC-transporters is one key factor affecting BLI intensity, and this may be particularly important in luciferase-based applications in stem cell research. PMID:21496450

  6. ATP binding cassette modulators control abscisic acid-regulated slow anion channels in guard cells

    PubMed Central

    Leonhardt, N; Vavasseur, A; Forestier, C


    In animal cells, ATP binding cassette (ABC) proteins are a large family of transporters that includes the sulfonylurea receptor and the cystic fibrosis transmembrane conductance regulator (CFTR). These two ABC proteins possess an ion channel activity and bind specific sulfonylureas, such as glibenclamide, but homologs have not been identified in plant cells. We recently have shown that there is an ABC protein in guard cells that is involved in the control of stomatal movements and guard cell outward K+ current. Because the CFTR, a chloride channel, is sensitive to glibenclamide and able to interact with K+ channels, we investigated its presence in guard cells. Potent CFTR inhibitors, such as glibenclamide and diphenylamine-2-carboxylic acid, triggered stomatal opening in darkness. The guard cell protoplast slow anion current that was recorded using the whole-cell patch-clamp technique was inhibited rapidly by glibenclamide in a dose-dependent manner; the concentration producing half-maximum inhibition was at 3 &mgr;M. Potassium channel openers, which bind to and act through the sulfonylurea receptor in animal cells, completely suppressed the stomatal opening induced by glibenclamide and recovered the glibenclamide-inhibited slow anion current. Abscisic acid is known to regulate slow anion channels and in our study was able to relieve glibenclamide inhibition of slow anion current. Moreover, in epidermal strip bioassays, the stomatal closure triggered by Ca2+ or abscisic acid was reversed by glibenclamide. These results suggest that the slow anion channel is an ABC protein or is tightly controlled by such a protein that interacts with the abscisic acid signal transduction pathway in guard cells. PMID:10368184

  7. The Deviant ATP-binding Site of the Multidrug Efflux Pump Pdr5 Plays an Active Role in the Transport Cycle*

    PubMed Central

    Furman, Christopher; Mehla, Jitender; Ananthaswamy, Neeti; Arya, Nidhi; Kulesh, Bridget; Kovach, Ildiko; Ambudkar, Suresh V.; Golin, John


    Pdr5 is the founding member of a large subfamily of evolutionarily distinct, clinically important fungal ABC transporters containing a characteristic, deviant ATP-binding site with altered Walker A, Walker B, Signature (C-loop), and Q-loop residues. In contrast to these motifs, the D-loops of the two ATP-binding sites have similar sequences, including a completely conserved aspartate residue. Alanine substitution mutants in the deviant Walker A and Signature motifs retain significant, albeit reduced, ATPase activity and drug resistance. The D-loop residue mutants D340A and D1042A showed a striking reduction in plasma membrane transporter levels. The D1042N mutation localized properly had nearly WT ATPase activity but was defective in transport and was profoundly hypersensitive to Pdr5 substrates. Therefore, there was a strong uncoupling of ATPase activity and drug efflux. Taken together, the properties of the mutants suggest an additional, critical intradomain signaling role for deviant ATP-binding sites. PMID:24019526

  8. Simulation of the coupling between nucleotide binding and transmembrane domains in the ATP binding cassette transporter BtuCD.


    Sonne, Jacob; Kandt, Christian; Peters, Günther H; Hansen, Flemming Y; Jensen, Morten Ø; Tieleman, D Peter


    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B(12) importer BtuCD using perturbed elastic network calculations and biased molecular dynamics simulations. Both models predict that nucleotide release decreases the tilt between the two transmembrane domains and opens the cytoplasmic gate. Nucleotide binding has the opposite effect. The observed coupling may be relevant for all ABC transporters because of the conservation of nucleotide binding domains and the shared role of ATP in ABC transporters. The rearrangements in the cytoplasmic gate region do not provide enough space for B(12) to diffuse from the transporter pore into the cytoplasm, which could suggest that peristaltic forces are needed to exclude B(12) from the transporter pore.

  9. Characterization and functional analysis of the nucleotide binding fold in human peroxisomal ATP binding cassette transporters.


    Roerig, P; Mayerhofer, P; Holzinger, A; Gärtner, J


    The 70-kDa peroxisomal membrane protein (PMP70) and the adrenoleukodystrophy protein (ALDP) are half ATP binding cassette (ABC) transporters in the peroxisome membrane. Mutations in the ALD gene encoding ALDP result in the X-linked neurodegenerative disorder adrenoleukodystrophy. Plausible models exist to show a role for ATP hydrolysis in peroxisomal ABC transporter functions. Here, we describe the first measurements of the rate of ATP binding and hydrolysis by purified nucleotide binding fold (NBF) fusion proteins of PMP70 and ALDP. Both proteins act as an ATP specific binding subunit releasing ADP after ATP hydrolysis; they did not exhibit GTPase activity. Mutations in conserved residues of the nucleotidases (PMP70: G478R, S572I; ALDP: G512S, S606L) altered ATPase activity. Furthermore, our results indicate that these mutations do not influence homodimerization or heterodimerization of ALDP or PMP70. The study provides evidence that peroxisomal ABC transporters utilize ATP to become a functional transporter.

  10. Molecular determinants for ATP-binding in proteins: a data mining and quantum chemical analysis.


    Mao, Lisong; Wang, Yanli; Liu, Yuemin; Hu, Xiche


    intermolecular interactions of large biomolecular systems becomes computationally feasible. The establishment of the molecular basis for recognition of the adenine moiety of ATP in proteins will directly impact molecular design of ATP-binding site targeted enzyme inhibitors such as kinase inhibitors.

  11. Structure, Function, and Evolution of Bacterial ATP-Binding Cassette Systems

    PubMed Central

    Davidson, Amy L.; Dassa, Elie; Orelle, Cedric; Chen, Jue


    Summary: ATP-binding cassette (ABC) systems are universally distributed among living organisms and function in many different aspects of bacterial physiology. ABC transporters are best known for their role in the import of essential nutrients and the export of toxic molecules, but they can also mediate the transport of many other physiological substrates. In a classical transport reaction, two highly conserved ATP-binding domains or subunits couple the binding/hydrolysis of ATP to the translocation of particular substrates across the membrane, through interactions with membrane-spanning domains of the transporter. Variations on this basic theme involve soluble ABC ATP-binding proteins that couple ATP hydrolysis to nontransport processes, such as DNA repair and gene expression regulation. Insights into the structure, function, and mechanism of action of bacterial ABC proteins are reported, based on phylogenetic comparisons as well as classic biochemical and genetic approaches. The availability of an increasing number of high-resolution structures has provided a valuable framework for interpretation of recent studies, and realistic models have been proposed to explain how these fascinating molecular machines use complex dynamic processes to fulfill their numerous biological functions. These advances are also important for elucidating the mechanism of action of eukaryotic ABC proteins, because functional defects in many of them are responsible for severe human inherited diseases. PMID:18535149

  12. The power stroke driven by ATP binding in CFTR as studied by molecular dynamics simulations.


    Furukawa-Hagiya, Tomoka; Furuta, Tadaomi; Chiba, Shuntaro; Sohma, Yoshiro; Sakurai, Minoru


    Cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel belonging to the ATP binding cassette (ABC) protein superfamily. Currently, it remains unclear how ATP binding causes the opening of the channel gate at the molecular level. To clarify this mechanism, we first constructed an atomic model of the inward-facing CFTR using the X-ray structures of other ABC proteins. Molecular dynamics (MD) simulations were then performed to explore the structure and dynamics of the inward-facing CFTR in a membrane environment. In the MgATP-bound state, two nucleotide-binding domains (NBDs) formed a head-to-tail type of dimer, in which the ATP molecules were sandwiched between the Walker A and signature motifs. Alternatively, one of the final MD structures in the apo state was similar to that of a "closed-apo" conformation found in the X-ray analysis of ATP-free MsbA. Principal component analysis for the MD trajectory indicated that NBD dimerization causes significant structural and dynamical changes in the transmembrane domains (TMDs), which is likely indicative of the formation of a chloride ion access path. This study suggests that the free energy gain from ATP binding acts as a driving force not only for NBD dimerization but also for NBD-TMD concerted motions.

  13. [Detection of T-antigen in colorectal adenocarcinoma and polyps].


    Xu, S; Lu, Y; Wang, Q


    Galactose oxidase method was employed to detect the beta-D-Gal (1-->3) -D-Gal NAc residue of T-antigen present in the large intestinal mucus of 156 subjects. The positive rates of the test were 84.4%, 29.1%, and 7.2% in the mucus samples obtained from 32 patients with colorectal adenocarcinomas, 55 with polyps and 69 controls respectively. Chi-square test demonstrated that there were significant differences between the group of carcinoma and control (P < 0.001) as well as between also polyp and control (P < 0.01). The test had a high sensitivity (84.4%) and specificity (92.8%) in the diagnosis of colorectal cancer and may be used as a practical mass screening test for colorectal neoplasms.

  14. Polyomavirus middle T-antigen NPTY mutants.

    PubMed Central

    Druker, B J; Sibert, L; Roberts, T M


    A polyomavirus middle T-antigen (MTAg) mutant containing a substitution of Leu for Pro at amino acid 248 has previously been described as completely transformation defective (B. J. Druker, L. Ling, B. Cohen, T. M. Roberts, and B. S. Schaffhausen, J. Virol. 64:4454-4461, 1990). This mutant had no alterations in associated proteins or associated kinase activities compared with wild-type MTAg. Pro-248 lies in a tetrameric sequence, NPTY, which is reminiscent of the so-called NPXY sequence in the low-density-lipoprotein receptor. In the low-density-lipoprotein receptor, mutations in the NPXY motif but not in the surrounding amino acids abolish receptor function, apparently by decreasing receptor internalization (W. Chen, J. L. Goldstein, and M. S. Brown, J. Biol. Chem. 265:3116-3123, 1990). To determine whether this sequence represents a functional motif in MTAg as well, a series of single amino acid substitutions was constructed in this region of MTAg. All of the mutations of N, P, T, or Y, including the relatively conservative substitution of Ser for Thr at amino acid 249, resulted in a transformation-defective MTAg, whereas mutations outside of this sequence allowed mutants to retain near-wild-type transformation capabilities. Transformation-defective mutants with mutations in the NPTY region behaved similarly to the mutant with the original Pro-248-to-Leu-248 mutation when assayed for associated proteins and activities in vitro; that is, they retained a full complement of wild-type activities and associated proteins. Further, insertion of the tetrameric sequence NPTY downstream of the mutated motif restored transforming abilities to these mutants. Thus, the tetrameric sequence NPTY in MTAg appears to represent a well-defined functional motif of MTAg. Images PMID:1326642

  15. Structural and Enzymatic Insights into the ATP Binding and Autophosphorylation Mechanism of a Sensor Histidine Kinase*

    PubMed Central

    Trajtenberg, Felipe; Graña, Martin; Ruétalo, Natalia; Botti, Horacio; Buschiazzo, Alejandro


    DesK is a sensor histidine kinase (HK) that allows Bacillus subtilis to respond to cold shock, triggering the adaptation of membrane fluidity via transcriptional control of a fatty acid desaturase. It belongs to the HK family HPK7, which includes the nitrogen metabolism regulators NarX/Q and the antibiotic sensor LiaS among other important sensor kinases. Structural information on different HK families is still scarce and several questions remain, particularly concerning the molecular features that determine HK specificity during its catalytic autophosphorylation and subsequent response-regulator phosphotransfer reactions. To analyze the ATP-binding features of HPK7 HKs and dissect their mechanism of autophosphorylation at the molecular level, we have studied DesK in complex with ATP using high resolution structural approaches in combination with biochemical studies. We report the first crystal structure of an HK in complex with its natural nucleotidic substrate. The general fold of the ATP-binding domain of DesK is conserved, compared with well studied members of other families. Yet, DesK displays a far more compact structure at the ATP-binding pocket: the ATP lid loop is much shorter with no secondary structural organization and becomes ordered upon ATP loading. Sequence conservation mapping onto the molecular surface, semi-flexible protein-protein docking simulations, and structure-based point mutagenesis allow us to propose a specific domain-domain geometry during autophosphorylation catalysis. Supporting our hypotheses, we have been able to trap an autophosphorylating intermediate state, by protein engineering at the predicted domain-domain interaction surface. PMID:20507988

  16. Cystic fibrosis transmembrane conductance regulator: a chloride channel gated by ATP binding and hydrolysis.


    Bompadre, Silvia G; Hwang, Tzyh-Chang


    The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel that belongs to the ATP-binding cassette (ABC) transporter superfamily. Defective function of CFTR is responsible for cystic fibrosis (CF), the most common lethal autosomal recessive disorder in Caucasian populations. The disease is manifested in defective chloride transport across the epithelial cells in various tissues. To date, more than 1400 different mutations have been identified as CF-associated. CFTR is regulated by phosphorylation in its regulatory (R) domain, and gated by ATP binding and hydrolysis at its two nucleotide-binding domains (NBD1 and NBD2). Recent studies reveal that the NBDs of CFTR may dimerize as observed in other ABC proteins. Upon dimerization of CFTR's two NBDs, in a head-to-tail configuration, the two ATP-binding pockets (ABP1 and ABP2) are formed by the canonical Walker A and B motifs from one NBD and the signature sequence from the partner NBD. Mutations of the amino acids that interact with ATP reveal that the two ABPs play distinct roles in controlling ATP-dependent gating of CFTR. It was proposed that binding of ATP to the ABP2, which is formed by the Walker A and B in NBD2 and the signature sequence in NBD1, is critical for catalyzing channel opening. While binding of ATP to the ABP1 alone may not increase the opening rate, it does contribute to the stabilization of the open channel conformation. Several disease-associated mutations of the CFTR channel are characterized by gating defects. Understanding how CFTR's two NBDs work together to gate the channel could provide considerable mechanistic information for future pharmacological studies, which could pave the way for tailored drug design for therapeutical interventions in CF.

  17. Topology of ATP-binding domain of adrenoleukodystrophy gene product in peroxisomes.


    Contreras, M; Sengupta, T K; Sheikh, F; Aubourg, P; Singh, I


    Adrenoleukodystrophy (X-ALD) is a demyelinating disorder characterized by the accumulation of saturated very-long-chain fatty acids (> C22:0) due to the impaired activity of lignoceroyl-CoA ligase. The gene responsible for the disease was found to code for a 84-kDa peroxisomal integral membrane protein. Its amino acid sequence has high homology with the ATP-binding cassette superfamily of transporters and it is predicted to have six membrane-spanning segments and a putative ATP-binding domain. To define the function of ALDP, we studied the topology of its ATP-binding domain by using antibodies (1D6) against a hydrophobic domain (amino acid residues 279 to 482) and antibodies (Abct) against the C-terminal 15-amino-acid hydrophilic domain (amino acid residues 731 to 745) of ALDP. The observation of punctate fluorescence in permeabilized ALD fibroblasts, using Abct antibodies but not with antibodies against catalase, suggests that the C-terminal segment of ALDP is projected toward the cytoplasm from the peroxisomal membrane. Trypsinization of intact peroxisomes under isotonic conditions abolishes the Abct antibody recognition site, whereas the 1D6 antibodies identify a degradation product of 43-kDa protein that has been protected and retained by the membrane. This again suggests that the C-terminal portion of the ALDP protein is located on the outside (cytoplasmic) face of the peroxisomal membrane. Additional support for this conclusion was obtained by purification of the ALDP C-terminal domain, released from purified rat liver peroxisomes incubated with the cytosolic fraction, using blue-Sepharose affinity chromatography. A 47-kDa peptide retained by the column was recognized by Western blot analysis with Abct antibodies against the C-terminal sequence of ALDP and this polypeptide on polyvinylidene difluoride membrane was able to bind [gamma-32P]ATP in vitro in the presence of Mg2+. These results demonstrate that the C-terminal peptide containing the ATP-binding

  18. AZT resistance alters enzymatic properties and creates an ATP-binding site in SFVmac reverse transcriptase.


    Schneider, Anna; Schweimer, Kristian; Rösch, Paul; Wöhrl, Birgitta M


    The replication of simian foamy virus from macaques can be inhibited by the nucleoside reverse transcriptase inhibitor azidothymidine (AZT, zidovudine). Four substitutions in the protease-reverse transcriptase (PR-RT) protein (K211I, I224T, S345T, E350K) are necessary to obtain highly AZT resistant and fully replication competent virus. AZT resistance is based on the excision of the incorporated AZTMP in the presence of ATP. I224T is a polymorphism which is not essential for AZT resistance per se, but is important for regaining efficient replication of the resistant virus. We constructed PR-RT enzymes harboring one to four amino acid substitutions to analyze them biochemically and to determine their ability to remove the incorporated AZTMP. S345T is the only single substitution variant exhibiting significant AZTMP excision activity. Although K211I alone showed no AZTMP excision activity, excision efficiency doubled when K211I was present in combination with S345T and E350K. K211I also decreased nucleotide binding affinity and increased fidelity. NMR titration experiments revealed that a truncated version of the highly AZT resistant mt4 variant, comprising only the fingers-palm subdomains was able to bind ATP with a KD-value of ca. 7.6 mM, whereas no ATP binding could be detected in the corresponding wild type protein. We could show by NMR spectroscopy that S345T is responsible for ATP binding, probably by making a tryptophan residue accessible. Although AZT resistance in SFVmac is based on excision of the incorporated AZTMP like in HIV-1, the functions of the resistance substitutions in SFVmac PR-RT appear to be different. No mutation resulting in an aromatic residue like F/Y215 in HIV, which is responsible for π-π-stacking interactions with ATP, is present in SFVmac. Instead, S345T is responsible for creating an ATP binding site, probably by making an already existing tryptophan more accessible, which in turn can interact with ATP. This is in contrast to HIV-1

  19. New ATP-binding cassette A3 mutation causing surfactant metabolism dysfunction pulmonary type 3.


    Piersigilli, Fiammetta; Peca, Donatella; Campi, Francesca; Corsello, Mirta; Landolfo, Francesca; Boldrini, Renata; Danhaive, Olivier; Dotta, Andrea


    Respiratory distress syndrome (RDS) may occur in term and near-term infants because of mutations in surfactant-related genes. ATP-binding cassette A3 (ABCA3), a phospholipid carrier specifically expressed in the alveolar epithelium, is the most frequently involved protein. We report the case of a couple of late-preterm fraternal twin infants of opposite sex carrying the same compound heterozygous ABCA3 mutations, one of which has never been previously reported, with different disease severity, suggesting variable penetrance or sex-related differences. ABCA3 deficiency should be considered in term or near-term babies who develop unexplained RDS. © 2015 Japan Pediatric Society.

  20. Genome-wide identification, characterization and phylogenetic analysis of 50 catfish ATP-binding cassette (ABC) transporter genes.


    Liu, Shikai; Li, Qi; Liu, Zhanjiang


    Although a large set of full-length transcripts was recently assembled in catfish, annotation of large gene families, especially those with duplications, is still a great challenge. Most often, complexities in annotation cause mis-identification and thereby much confusion in the scientific literature. As such, detailed phylogenetic analysis and/or orthology analysis are required for annotation of genes involved in gene families. The ATP-binding cassette (ABC) transporter gene superfamily is a large gene family that encodes membrane proteins that transport a diverse set of substrates across membranes, playing important roles in protecting organisms from diverse environment. In this work, we identified a set of 50 ABC transporters in catfish genome. Phylogenetic analysis allowed their identification and annotation into seven subfamilies, including 9 ABCA genes, 12 ABCB genes, 12 ABCC genes, 5 ABCD genes, 2 ABCE genes, 4 ABCF genes and 6 ABCG genes. Most ABC transporters are conserved among vertebrates, though cases of recent gene duplications and gene losses do exist. Gene duplications in catfish were found for ABCA1, ABCB3, ABCB6, ABCC5, ABCD3, ABCE1, ABCF2 and ABCG2. The whole set of catfish ABC transporters provide the essential genomic resources for future biochemical, toxicological and physiological studies of ABC drug efflux transporters. The establishment of orthologies should allow functional inferences with the information from model species, though the function of lineage-specific genes can be distinct because of specific living environment with different selection pressure.

  1. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.


    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A


    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype.

  2. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by Mismatch and Double-strand Break Repair DNA substrates

    PubMed Central

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M.; Bianco, Piero R.; Surtees, Jennifer A.


    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3′ non-homologous tail removal (3′NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3′ NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3′ NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3′ NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype. PMID:24746922

  3. Solution structure of an ATP-binding RNA aptamer reveals a novel fold.

    PubMed Central

    Dieckmann, T; Suzuki, E; Nakamura, G K; Feigon, J


    In vitro selection has been used to isolate several RNA aptamers that bind specifically to biological cofactors. A well-characterized example in the ATP-binding RNA aptamer family, which contains a conserved 11-base loop opposite a bulged G and flanked by regions of double-stranded RNA. The nucleotides in the consensus sequence provide a binding pocket for ATP (or AMP), which binds with a Kd in the micromolar range. Here we present the three-dimensional solution structure of a 36-nucleotide ATP-binding RNA aptamer complexed with AMP, determined from NMR-derived distance and dihedral angle restraints. The conserved loop and bulged G form a novel compact, folded structure around the AMP. The backbone tracing of the loop nucleotides can be described by a Greek zeta (zeta). Consecutive loop nucleotides G, A, A form a U-turn at the bottom of the zeta, and interact with the AMP to form a structure similar to a GNRA tetraloop, with AMP standing in for the final A. Two asymmetric G. G base pairs close the stems flanking the internal loop. Mutated aptamers support the existence of the tertiary interactions within the consensus nucleotides and with the AMP found in the calculated structures. PMID:8756406

  4. Functionally Important ATP Binding and Hydrolysis Sites in Escherichia coli MsbA †

    PubMed Central

    Westfahl, Kathryn M.; Merten, Jacqueline A.; Buchaklian, Adam H.; Klug, Candice S.


    ATP-binding cassette (ABC) transporters make up one of the largest classes of proteins found in nature, and their ability to move a variety of substrates across the membrane using energy from the binding or hydrolysis of ATP is essential to an array of human pathologies and to bacterial viability. MsbA is an essential ABC transporter that specifically transports lipid A across the inner membranes of Gram-negative organisms such as Escherichia coli. The exact mechanisms of function during the binding and hydrolysis of ATP at the molecular level remain unclear. The studies presented and summarized in this work directly address the role and local dynamics of specific residues within the conserved ABC motifs in E. coli MsbA using in vivo growth and biochemical activity assays coupled with site-directed spin labeling electron paramagnetic resonance (EPR) spectroscopy motional and accessibility analysis. This first comprehensive analysis of the specific residues in these motifs within MsbA indicates that closure of the dimer interface does not occur upon ATP binding in this transporter. PMID:19053284

  5. Origin licensing requires ATP binding and hydrolysis by the MCM replicative helicase.


    Coster, Gideon; Frigola, Jordi; Beuron, Fabienne; Morris, Edward P; Diffley, John F X


    Loading of the six related Minichromosome Maintenance (MCM) proteins as head-to-head double hexamers during DNA replication origin licensing is crucial for ensuring once-per-cell-cycle DNA replication in eukaryotic cells. Assembly of these prereplicative complexes (pre-RCs) requires the Origin Recognition Complex (ORC), Cdc6, and Cdt1. ORC, Cdc6, and MCM are members of the AAA+ family of ATPases, and pre-RC assembly requires ATP hydrolysis. Here we show that ORC and Cdc6 mutants defective in ATP hydrolysis are competent for origin licensing. However, ATP hydrolysis by Cdc6 is required to release nonproductive licensing intermediates. We show that ATP binding stabilizes the wild-type MCM hexamer. Moreover, by analyzing MCM containing mutant subunits, we show that ATP binding and hydrolysis by MCM are required for Cdt1 release and double hexamer formation. This work alters our view of how ATP is used by licensing factors to assemble pre-RCs. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  6. The Lipid Bilayer Modulates the Structure and Function of an ATP-binding Cassette Exporter.


    Zoghbi, Maria E; Cooper, Rebecca S; Altenberg, Guillermo A


    ATP-binding cassette exporters use the energy of ATP hydrolysis to transport substrates across membranes by switching between inward- and outward-facing conformations. Essentially all structural studies of these proteins have been performed with the proteins in detergent micelles, locked in specific conformations and/or at low temperature. Here, we used luminescence resonance energy transfer spectroscopy to study the prototypical ATP-binding cassette exporter MsbA reconstituted in nanodiscs at 37 °C while it performs ATP hydrolysis. We found major differences when comparing MsbA in these native-like conditions with double electron-electron resonance data and the crystal structure of MsbA in the open inward-facing conformation. The most striking differences include a significantly smaller separation between the nucleotide-binding domains and a larger fraction of molecules with associated nucleotide-binding domains in the nucleotide-free apo state. These studies stress the importance of studying membrane proteins in an environment that approaches physiological conditions.

  7. Genome-wide identification of whole ATP-binding cassette (ABC) transporters in the intertidal copepod Tigriopus japonicus.


    Jeong, Chang-Bum; Kim, Bo-Mi; Lee, Jae-Seong; Rhee, Jae-Sung


    The ATP-binding cassette (ABC) transporter superfamily is one of the largest transporter gene families and is observed in all animal taxa. Although a large set of transcriptomic data was recently assembled for several species of crustaceans, identification and annotation of the large ABC transporter gene family have been very challenging. In the intertidal copepod Tigriopus japonicus, 46 putative ABC transporters were identified using in silico analysis, and their full-length cDNA sequences were characterized. Phylogenetic analysis revealed that the 46 T. japonicus ABC transporters are classified into eight subfamilies (A-H) that include all the members of all ABC subfamilies, consisting of five ABCA, five ABCB, 17 ABCC, three ABCD, one ABCE, three ABCF, seven ABCG, and five ABCH subfamilies. Of them, unique isotypic expansion of two clades of ABCC1 proteins was observed. Real-time RT-PCR-based heatmap analysis revealed that most T. japonicus ABC genes showed temporal transcriptional expression during copepod development. The overall transcriptional profile demonstrated that half of all T. japonicus ABC genes were strongly associated with at least one developmental stage. Of them, transcripts TJ-ABCH_88708 and TJ-ABCE1 were highly expressed during all developmental stages. The whole set of T. japonicus ABC genes and their phylogenetic relationships will provide a better understanding of the comparative evolution of essential gene family resources in arthropods, including the crustacean copepods.

  8. Tumorigenic activity of Merkel cell polyomavirus T antigens expressed in the stratified epithelium of mice

    PubMed Central

    Spurgeon, Megan E.; Cheng, Jingwei; Bronson, Roderick T.; Lambert, Paul F.; DeCaprio, James A.


    Merkel cell polyomavirus (MCPyV) is frequently associated with Merkel cell carcinoma (MCC), a highly aggressive neuroendocrine skin cancer. Most MCC tumors contain integrated copies of the viral genome with persistent expression of the MCPyV large T (LT) and small T (ST) antigen. MCPyV isolated from MCC typically contain wild type ST but truncated forms of LT that retain the N-terminus but delete the C-terminus and render LT incapable of supporting virus replication. To determine the oncogenic activity of MCC tumor-derived T antigens in vivo, a conditional, tissue-specific mouse model was developed. Keratin 14-mediated Cre recombinase expression induced expression of MCPyV T antigens in stratified squamous epithelial cells and Merkel cells of the skin epidermis. Mice expressing MCPyV T antigens developed hyperplasia, hyperkeratosis, and acanthosis of the skin with additional abnormalities in whisker pads, footpads and eyes. Nearly half of the mice also developed cutaneous papillomas. Evidence for neoplastic progression within stratified epithelia included increased cellular proliferation, unscheduled DNA synthesis, increased E2F-responsive genes levels, disrupted differentiation, and presence of a DNA damage response. These results indicate that MCPyV T antigens are tumorigenic in vivo, consistent with their suspected etiological role in human cancer. PMID:25596282

  9. Molecular Disruption of the Power Stroke in the ATP-binding Cassette Transport Protein MsbA*

    PubMed Central

    Doshi, Rupak; Ali, Anam; Shi, Wilma; Freeman, Elizabeth V.; Fagg, Lisa A.; van Veen, Hendrik W.


    ATP-binding cassette transporters affect drug pharmacokinetics and are associated with inherited human diseases and impaired chemotherapeutic treatment of cancers and microbial infections. Current alternating access models for ATP-binding cassette exporter activity suggest that ATP binding at the two cytosolic nucleotide-binding domains provides a power stroke for the conformational switch of the two membrane domains from the inward-facing conformation to the outward-facing conformation. In outward-facing crystal structures of the bacterial homodimeric ATP-binding cassette transporters MsbA from Gram-negative bacteria and Sav1866 from Staphylococcus aureus, two transmembrane helices (3 and 4) in the membrane domains have their cytoplasmic extensions in close proximity, forming a tetrahelix bundle interface. In biochemical experiments on MsbA from Escherichia coli, we show for the first time that a robust network of inter-monomer interactions in the tetrahelix bundle is crucial for the transmission of nucleotide-dependent conformational changes to the extracellular side of the membrane domains. Our observations are the first to suggest that modulation of tetrahelix bundle interactions in ATP-binding cassette exporters might offer a potent strategy to alter their transport activity. PMID:23306205

  10. Multiple ATP-binding cassette transporters are involved in insecticide resistance in the small brown planthopper, Laodelphax striatellus.


    Sun, H; Pu, J; Chen, F; Wang, J; Han, Z


    ATP-binding cassette (ABC) transporters are membrane-bound proteins involved in the movement of various substrates, including drugs and insecticides, across the lipid membrane. Demonstration of the role of human ABC transporters in multidrug resistance has led to speculation that they might be an important mechanism controlling the fate of insecticides in insects. However, the role of ABC transporters in insects remains largely unknown. The small brown planthopper, Laodelphax striatellus Fallén, has developed resistance to most of the insecticides used for its control. Our goals were to identify the ABC transporters in La. striatellus and to examine their involvement in resistance mechanisms, using related strains resistant to chlorpyrifos, deltamethrin and imidacloprid, compared with the susceptible strain. Based on the transcriptome of La. striatellus, 40 full-length ABC transporters belonging to the ABCA-ABCH subfamilies were identified. Quantitative PCR revealed that over 20% of genes were significantly up-regulated in different resistant strains, and eight genes from the ABCB/C/D/G subfamilies were up-regulated in all three resistant strains, compared with the susceptible strain. Furthermore, synergism studies showed verapamil significantly enhanced insecticide toxicity in various resistant strains but not in the susceptible strain. These results suggest that ABC transporters might be involved in resistance to multiple insecticides in La. striatellus.

  11. The ATP-binding cassette transporter-2 (ABCA2) regulates esterification of plasma membrane cholesterol by modulation of sphingolipid metabolism.


    Davis, Warren


    The ATP-binding cassette transporters are a large family (~48 genes divided into seven families A-G) of proteins that utilize the energy of ATP-hydrolysis to pump substrates across lipid bilayers against a concentration gradient. The ABC "A" subfamily is comprised of 13 members and transport sterols, phospholipids and bile acids. ABCA2 is the most abundant ABC transporter in human and rodent brain with highest expression in oligodendrocytes, although it is also expressed in neurons. Several groups have studied a possible connection between ABCA2 and Alzheimer's disease as well as early atherosclerosis. ABCA2 expression levels have been associated with changes in cholesterol and sphingolipid metabolism. In this paper, we hypothesized that ABCA2 expression level may regulate esterification of plasma membrane-derived cholesterol by modulation of sphingolipid metabolism. ABCA2 overexpression in N2a neuroblastoma cells was associated with an altered bilayer distribution of the sphingolipid ceramide that inhibited acylCoA:cholesterol acyltransferase (ACAT) activity and cholesterol esterification. In contrast, depletion of endogenous ABCA2 in the rat schwannoma cell line D6P2T increased esterification of plasma membrane cholesterol following treatment with exogenous bacterial sphingomyelinase. These findings suggest that control of ABCA2 expression level may be a key locus of regulation for esterification of plasma membrane-derived cholesterol through modulation of sphingolipid metabolism.

  12. Trapping the transition state of an ATP-binding cassette transporter: Evidence for a concerted mechanism of maltose transport

    PubMed Central

    Chen, Jue; Sharma, Susan; Quiocho, Florante A.; Davidson, Amy L.


    High-affinity uptake into bacterial cells is mediated by a large class of periplasmic binding protein-dependent transport systems, members of the ATP-binding cassette superfamily. In the maltose transport system of Escherichia coli, the periplasmic maltose-binding protein binds its substrate maltose with high affinity and, in addition, stimulates the ATPase activity of the membrane-associated transporter when maltose is present. Vanadate inhibits maltose transport by trapping ADP in one of the two nucleotide-binding sites of the membrane transporter immediately after ATP hydrolysis, consistent with its ability to mimic the transition state of the γ-phosphate of ATP during hydrolysis. Here we report that the maltose-binding protein becomes tightly associated with the membrane transporter in the presence of vanadate and simultaneously loses its high affinity for maltose. These results suggest a general model explaining how ATP hydrolysis is coupled to substrate transport in which a binding protein stimulates the ATPase activity of its cognate transporter by stabilizing the transition state. PMID:11171984

  13. Whole-Genome Survey of the Putative ATP-Binding Cassette Transporter Family Genes in Vitis vinifera

    PubMed Central

    Çakır, Birsen; Kılıçkaya, Ozan


    The ATP-binding cassette (ABC) protein superfamily constitutes one of the largest protein families known in plants. In this report, we performed a complete inventory of ABC protein genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with ABC protein members of Arabidopsis thaliana, we identified 135 putative ABC proteins with 1 or 2 NBDs in V. vinifera. Of these, 120 encode intrinsic membrane proteins, and 15 encode proteins missing TMDs. V. vinifera ABC proteins can be divided into 13 subfamilies with 79 “full-size,” 41 “half-size,” and 15 “soluble” putative ABC proteins. The main feature of the Vitis ABC superfamily is the presence of 2 large subfamilies, ABCG (pleiotropic drug resistance and white-brown complex homolog) and ABCC (multidrug resistance-associated protein). We identified orthologs of V. vinifera putative ABC transporters in different species. This work represents the first complete inventory of ABC transporters in V. vinifera. The identification of Vitis ABC transporters and their comparative analysis with the Arabidopsis counterparts revealed a strong conservation between the 2 species. This inventory could help elucidate the biological and physiological functions of these transporters in V. vinifera. PMID:24244377

  14. Whole-genome survey of the putative ATP-binding cassette transporter family genes in Vitis vinifera.


    Çakır, Birsen; Kılıçkaya, Ozan


    The ATP-binding cassette (ABC) protein superfamily constitutes one of the largest protein families known in plants. In this report, we performed a complete inventory of ABC protein genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with ABC protein members of Arabidopsis thaliana, we identified 135 putative ABC proteins with 1 or 2 NBDs in V. vinifera. Of these, 120 encode intrinsic membrane proteins, and 15 encode proteins missing TMDs. V. vinifera ABC proteins can be divided into 13 subfamilies with 79 "full-size," 41 "half-size," and 15 "soluble" putative ABC proteins. The main feature of the Vitis ABC superfamily is the presence of 2 large subfamilies, ABCG (pleiotropic drug resistance and white-brown complex homolog) and ABCC (multidrug resistance-associated protein). We identified orthologs of V. vinifera putative ABC transporters in different species. This work represents the first complete inventory of ABC transporters in V. vinifera. The identification of Vitis ABC transporters and their comparative analysis with the Arabidopsis counterparts revealed a strong conservation between the 2 species. This inventory could help elucidate the biological and physiological functions of these transporters in V. vinifera.

  15. Structural Features of the ATP-Binding Cassette (ABC) Transporter ABCA3.


    Paolini, Alessandro; Baldassarre, Antonella; Del Gaudio, Ilaria; Masotti, Andrea


    In this review we reported and discussed the structural features of the ATP-Binding Cassette (ABC) transporter ABCA3 and how the use of bioinformatics tools could help researchers to obtain a reliable structural model of this important transporter. In fact, a model of ABCA3 is still lacking and no crystallographic structures (of the transporter or of its orthologues) are available. With the advent of next generation sequencing, many disease-causing mutations have been discovered and many more will be found in the future. In the last few years, ABCA3 mutations have been reported to have important pediatric implications. Thus, clinicians need a reliable structure to locate relevant mutations of this transporter and make genotype/phenotype correlations of patients affected by ABCA3-related diseases. In conclusion, we strongly believe that the model preliminarily generated by these novel bioinformatics tools could be the starting point to obtain more refined models of the ABCA3 transporter.

  16. Role of family D ATP-binding cassette transporters (ABCD) in cancer.


    Hlaváč, Viktor; Souček, Pavel


    ATP-binding cassette (ABC) transporters, belonging to the family D, are expressed in peroxisomes, endoplasmic reticulum or lysosomes. ABCD transporters play a role in transport of lipids, bile acids and vitamin B12 and associate with peroxisomal disorders. ABCD1 performs transport of coenzyme A esters of very-long-chain fatty acids (VLCFA) in peroxisomes and a number of mutations in ABCD1 gene were linked to an X-linked adrenoleucodystrophy (X-ALD). The role of ABCD transporters in tumour growth has not been studied in detail, but there is some evidence that ABCDs levels differ between undifferentiated stem or tumour cells and differentiated cells suggesting a possible link to tumorigenesis. In this mini-review, we discuss the available information about the role of ABCD transporters in cancer. © 2015 Authors; published by Portland Press Limited.

  17. Structural Features of the ATP-Binding Cassette (ABC) Transporter ABCA3

    PubMed Central

    Paolini, Alessandro; Baldassarre, Antonella; Del Gaudio, Ilaria; Masotti, Andrea


    In this review we reported and discussed the structural features of the ATP-Binding Cassette (ABC) transporter ABCA3 and how the use of bioinformatics tools could help researchers to obtain a reliable structural model of this important transporter. In fact, a model of ABCA3 is still lacking and no crystallographic structures (of the transporter or of its orthologues) are available. With the advent of next generation sequencing, many disease-causing mutations have been discovered and many more will be found in the future. In the last few years, ABCA3 mutations have been reported to have important pediatric implications. Thus, clinicians need a reliable structure to locate relevant mutations of this transporter and make genotype/phenotype correlations of patients affected by ABCA3-related diseases. In conclusion, we strongly believe that the model preliminarily generated by these novel bioinformatics tools could be the starting point to obtain more refined models of the ABCA3 transporter. PMID:26295388

  18. ATP-binding cassette transporters in tumor endothelial cells and resistance to metronomic chemotherapy.


    Hida, Kyoko; Kikuchi, Hiroshi; Maishi, Nako; Hida, Yasuhiro


    Drug resistance is a major problem in anticancer therapy. ATP-binding cassette (ABC) transporters have a role in the multidrug resistance. A new regimen of chemotherapy has been proposed, called "metronomic chemotherapy". Metronomic chemotherapy is the frequent, regular administration of drug doses designed to maintain low, but active, concentrations of chemotherapeutic drugs over prolonged periods of time, without causing serious toxicities. Metronomic chemotherapy regimens were developed to optimize the antitumor efficacy of agents that target the tumor vasculature instead of tumor cells, and to reduce toxicity of antineoplastic drugs [1]. Nevertheless, recent studies revealed that ABC transporters are expressed at a higher level in the endothelium in the tumor. To avoid resistance to metronomic anti-angiogenic chemotherapy, ABC transporter inhibition of tumor endothelial cells may be a promising strategy. In this mini-review, we discuss the possible mechanism of resistance to metronomic chemotherapy from the viewpoint of tumor endothelial cell biology, focusing on ABC transporters.

  19. The ATP binding cassette transporter, ABCG1, localizes to cortical actin filaments

    PubMed Central

    Pandzic, Elvis; Gelissen, Ingrid C.; Whan, Renee; Barter, Philip J.; Sviridov, Dmitri; Gaus, Katharina; Rye, Kerry-Anne; Cochran, Blake J.


    The ATP-binding cassette sub-family G member 1 (ABCG1) exports cellular cholesterol to high-density lipoproteins (HDL). However, a number of recent studies have suggested ABCG1 is predominantly localised to intracellular membranes. In this study, we found that ABCG1 was organized into two distinct cellular pools: one at the plasma membrane and the other associated with the endoplasmic reticulum (ER). The plasma membrane fraction was organized into filamentous structures that were associated with cortical actin filaments. Inhibition of actin polymerization resulted in complete disruption of ABCG1 filaments. Cholesterol loading of the cells increased the formation of the filamentous ABCG1, the proximity of filamentous ABCG1 to actin filaments and the diffusion rate of membrane associated ABCG1. Our findings suggest that the actin cytoskeleton plays a critical role in the plasma membrane localization of ABCG1. PMID:28165022

  20. Mouse ATP-Binding Cassette (ABC) Transporters Conferring Multi-Drug Resistance.


    Li, Shuaizhang; Zhang, Wen; Yin, Xuejiao; Xing, Shilai; Xie, Heidi Qunhui; Cao, Zhengyu; Zhao, Bin


    The ABC (ATP-binding cassette) transporter is one of the largest and most ancient protein families with members functioning from protozoa to human. The resistance of cancer and tumor cells to anticancer drugs is due to the over-expression of some ABC transporters, which may finally lead to chemotherapy failure. The mouse ABC transporters are classified into seven subfamilies by phylogenetic analysis. The mouse ABC transporter gene, alias, chromosomal location and function have been determined. Within the ABC super-family, the MDR transporters (Abcb1, Abcc1, Abcg2) in mouse models have been proved to be valuable to investigate the biochemistry and physiological functions. This review concentrates on the multidrug resistance of mouse ABC transporters in cancer and tumor cells.

  1. Mouse ATP-Binding Cassette (ABC) Transporters Conferring Multi-Drug Resistance


    Shuaizhang, L I; Zhang, Wen; Yin, Xuejiao; Xing, Shilai; Xie, Qunhui; Cao, Zhengyu; Zhao, Bin


    The ABC (ATP-binding cassette) transporter is one of the largest and most ancient protein families with members functioning from protozoa to human. The resistance of cancer and tumor cells to anticancer drugs is due to the over-expression of some ABC transporters, which may finally lead to chemotherapy failure. The mouse ABC transporters are classified into seven subfamilies by phylogenetic analysis. The mouse ABC transporter gene, alias, chromosomal location and function have been determined. Within the ABC super-family, the MDR transporters (Abcb1, Abcc1, Abcg2) in mouse models have been proved to be valuable to investigate the biochemistry and physiological functions. This review concentrates on the multidrug resistance of mouse ABC transporters in cancer and tumor cells.

  2. Biophysical characterization of an indolinone inhibitor in the ATP-binding site of DNA gyrase.


    Oblak, Marko; Grdadolnik, Simona Golic; Kotnik, Miha; Poterszman, Arnaud; Atkinson, R Andrew; Nierengarten, Helene; Desplancq, Dominique; Moras, Dino; Solmajer, Tom


    Fighting bacterial resistance is a challenging task in the field of medicinal chemistry. DNA gyrase represents a validated antibacterial target and has drawn much interest in recent years. By a structure-based approach we have previously discovered compound 1, an indolinone derivative, possessing inhibitory activity against DNA gyrase. In the present paper, a detailed biophysical characterization of this inhibitor is described. Using mass spectrometry, NMR spectroscopy, and fluorescence experiments we have demonstrated that compound 1 binds reversibly to the ATP-binding site of the 24 kDa N-terminal fragment of DNA gyrase B from Escherichia coli (GyrB24) with low micromolar affinity. Based on these data, a plausible molecular model of compound 1 in the active site of GyrB24 was constructed. The predicted binding mode explains the competitive inhibitory mechanism with respect to ATP and forms a useful basis for further development of potent DNA gyrase inhibitors.

  3. Green tea catechins inhibit bacterial DNA gyrase by interaction with its ATP binding site.


    Gradisar, Helena; Pristovsek, Primoz; Plaper, Andreja; Jerala, Roman


    Catechins are the main ingredients of green tea extracts and have been shown to possess versatile biological activities, including antimicrobial. We determined that the catechins inhibit bacterial DNA gyrase by binding to the ATP binding site of the gyrase B subunit. In the group of four tested catechins, epigallocatechin gallate (EGCG) had the highest activity, followed by epicatechin gallate (ECG) and epigallocatechin (EGC). Specific binding to the N-terminal 24 kDa fragment of gyrase B was determined by fluorescence spectroscopy and confirmed using heteronuclear two-dimensional NMR spectroscopy of the EGCG-15N-labeled gyrase B fragment complex. Protein residues affected by binding to EGCG were identified through chemical shift perturbation. Molecular docking calculations suggest that the benzopyran ring of EGCG penetrates deeply into the active site while the galloyl moiety anchors it to the cleft through interactions with its hydroxyl groups, which explains the higher activity of EGCG and ECG.

  4. Transport in technicolor: Mapping ATP-binding cassette transporters in sea urchin embryos

    PubMed Central

    Gökirmak, Tufan; Shipp, Lauren E.; Campanale, Joseph P.; Nicklisch, Sascha C.T.; Hamdoun, Amro


    One quarter of eukaryotic genes encode membrane proteins. These include nearly 1000 transporters that translocate nutrients, signaling molecules, and xenobiotics across membranes. While it is well appreciated that membrane transport is critical for development, the specific roles of many transporters have remained cryptic, in part because of their abundance and the diversity of their substrates. Multi-drug resistance ATP-binding cassette (ABC) efflux transporters are one example of cryptic membrane proteins. Although most organisms utilize these ABC transporters during embryonic development, many of these transporters have broad substrate specificity, and their developmental functions remain incompletely understood. Here, we review advances in our understanding of ABC transporters in sea urchin embryos, and methods developed to spatially and temporally map these proteins. These studies reveal that multifunctional transporters are required for signaling, homeostasis, and protection of the embryo, and shed light on how they are integrated into ancestral developmental pathways recapitulated in disease. PMID:25156004

  5. Protection against chemotherapy-induced alopecia: targeting ATP-binding cassette transporters in the hair follicle?


    Haslam, Iain S; Pitre, Aaron; Schuetz, John D; Paus, Ralf


    Currently, efficacious treatments for chemotherapy-induced alopecia (hair loss) are lacking, and incidences of permanent hair loss following high-dose chemotherapy are on the increase. In this article, we describe mechanisms by which the pharmacological defense status of the hair follicle might be enhanced, thereby reducing the accumulation of cytotoxic cancer drugs and preventing or reducing hair loss and damage. We believe this could be achieved via the selective increase in ATP-binding cassette (ABC) transporter expression within the hair follicle epithelium, following application of topical agonists for regulatory nuclear receptors. Clinical application would require the development of hair follicle-targeted formulations, potentially utilizing nanoparticle technology. This novel approach has the potential to yield entirely new therapeutic options for the treatment and management of chemotherapy-induced alopecia, providing significant psychological and physical benefit to cancer patients. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.


    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  7. Structure-function analysis of peroxisomal ATP-binding cassette transporters using chimeric dimers.


    Geillon, Flore; Gondcaille, Catherine; Charbonnier, Soëli; Van Roermund, Carlo W; Lopez, Tatiana E; Dias, Alexandre M M; Pais de Barros, Jean-Paul; Arnould, Christine; Wanders, Ronald J; Trompier, Doriane; Savary, Stéphane


    ABCD1 and ABCD2 are two closely related ATP-binding cassette half-transporters predicted to homodimerize and form peroxisomal importers for fatty acyl-CoAs. Available evidence has shown that ABCD1 and ABCD2 display a distinct but overlapping substrate specificity, although much remains to be learned in this respect as well as in their capability to form functional heterodimers. Using a cell model expressing an ABCD2-EGFP fusion protein, we first demonstrated by proximity ligation assay and co-immunoprecipitation assay that ABCD1 interacts with ABCD2. Next, we tested in the pxa1/pxa2Δ yeast mutant the functionality of ABCD1/ABCD2 dimers by expressing chimeric proteins mimicking homo- or heterodimers. For further structure-function analysis of ABCD1/ABCD2 dimers, we expressed chimeric dimers fused to enhanced GFP in human skin fibroblasts of X-linked adrenoleukodystrophy patients. These cells are devoid of ABCD1 and accumulate very long-chain fatty acids (C26:0 and C26:1). We checked that the chimeric proteins were correctly expressed and targeted to the peroxisomes. Very long-chain fatty acid levels were partially restored in transfected X-linked adrenoleukodystrophy fibroblasts regardless of the chimeric construct used, thus demonstrating functionality of both homo- and heterodimers. Interestingly, the level of C24:6 n-3, the immediate precursor of docosahexaenoic acid, was decreased in cells expressing chimeric proteins containing at least one ABCD2 moiety. Our data demonstrate for the first time that both homo- and heterodimers of ABCD1 and ABCD2 are functionally active. Interestingly, the role of ABCD2 (in homo- and heterodimeric forms) in the metabolism of polyunsaturated fatty acids is clearly evidenced, and the chimeric dimers provide a novel tool to study substrate specificity of peroxisomal ATP-binding cassette transporters. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Structure-Function Analysis of Peroxisomal ATP-binding Cassette Transporters Using Chimeric Dimers*

    PubMed Central

    Geillon, Flore; Gondcaille, Catherine; Charbonnier, Soëli; Van Roermund, Carlo W.; Lopez, Tatiana E.; Dias, Alexandre M. M.; Pais de Barros, Jean-Paul; Arnould, Christine; Wanders, Ronald J.; Trompier, Doriane; Savary, Stéphane


    ABCD1 and ABCD2 are two closely related ATP-binding cassette half-transporters predicted to homodimerize and form peroxisomal importers for fatty acyl-CoAs. Available evidence has shown that ABCD1 and ABCD2 display a distinct but overlapping substrate specificity, although much remains to be learned in this respect as well as in their capability to form functional heterodimers. Using a cell model expressing an ABCD2-EGFP fusion protein, we first demonstrated by proximity ligation assay and co-immunoprecipitation assay that ABCD1 interacts with ABCD2. Next, we tested in the pxa1/pxa2Δ yeast mutant the functionality of ABCD1/ABCD2 dimers by expressing chimeric proteins mimicking homo- or heterodimers. For further structure-function analysis of ABCD1/ABCD2 dimers, we expressed chimeric dimers fused to enhanced GFP in human skin fibroblasts of X-linked adrenoleukodystrophy patients. These cells are devoid of ABCD1 and accumulate very long-chain fatty acids (C26:0 and C26:1). We checked that the chimeric proteins were correctly expressed and targeted to the peroxisomes. Very long-chain fatty acid levels were partially restored in transfected X-linked adrenoleukodystrophy fibroblasts regardless of the chimeric construct used, thus demonstrating functionality of both homo- and heterodimers. Interestingly, the level of C24:6 n-3, the immediate precursor of docosahexaenoic acid, was decreased in cells expressing chimeric proteins containing at least one ABCD2 moiety. Our data demonstrate for the first time that both homo- and heterodimers of ABCD1 and ABCD2 are functionally active. Interestingly, the role of ABCD2 (in homo- and heterodimeric forms) in the metabolism of polyunsaturated fatty acids is clearly evidenced, and the chimeric dimers provide a novel tool to study substrate specificity of peroxisomal ATP-binding cassette transporters. PMID:25043761

  9. Functional hot spots in human ATP-binding cassette transporter nucleotide binding domains

    PubMed Central

    Kelly, Libusha; Fukushima, Hisayo; Karchin, Rachel; Gow, Jason M; Chinn, Leslie W; Pieper, Ursula; Segal, Mark R; Kroetz, Deanna L; Sali, Andrej


    The human ATP-binding cassette (ABC) transporter superfamily consists of 48 integral membrane proteins that couple the action of ATP binding and hydrolysis to the transport of diverse substrates across cellular membranes. Defects in 18 transporters have been implicated in human disease. In hundreds of cases, disease phenotypes and defects in function can be traced to nonsynonymous single nucleotide polymorphisms (nsSNPs). The functional impact of the majority of ABC transporter nsSNPs has yet to be experimentally characterized. Here, we combine experimental mutational studies with sequence and structural analysis to describe the impact of nsSNPs in human ABC transporters. First, the disease associations of 39 nsSNPs in 10 transporters were rationalized by identifying two conserved loops and a small α-helical region that may be involved in interdomain communication necessary for transport of substrates. Second, an approach to discriminate between disease-associated and neutral nsSNPs was developed and tailored to this superfamily. Finally, the functional impact of 40 unannotated nsSNPs in seven ABC transporters identified in 247 ethnically diverse individuals studied by the Pharmacogenetics of Membrane Transporters consortium was predicted. Three predictions were experimentally tested using human embryonic kidney epithelial (HEK) 293 cells stably transfected with the reference multidrug resistance transporter 4 and its variants to examine functional differences in transport of the antiviral drug, tenofovir. The experimental results confirmed two predictions. Our analysis provides a structural and evolutionary framework for rationalizing and predicting the functional effects of nsSNPs in this clinically important membrane transporter superfamily. PMID:20799350

  10. Human erythrocyte dematin and protein 4.2 (pallidin) are ATP binding proteins.


    Azim, A C; Marfatia, S M; Korsgren, C; Dotimas, E; Cohen, C M; Chishti, A H


    Dematin and protein 4.2 are peripheral membrane proteins associated with the cytoplasmic surface of the human erythrocyte plasma membrane. Isoforms of dematin and protein 4.2 exist in many nonerythroid cells. In solution, dematin is a trimeric protein containing two subunits of 48 kDa and one subunit of 52 kDa. Recent determination of the primary structure of the 52 kDa subunit of dematin showed that it contains an additional 22-amino acid sequence in the headpiece domain. An alignment of the 22-amino acid insertion sequence revealed that the 52 kDa subunit of dematin shares a novel 11-amino acid motif with protein 4.2. In this communication, we report that the conserved 11-amino acid motif in dematin52 and protein 4.2 contains a nucleotide binding P-loop. Direct binding of ATP is demonstrated to the glutathione S-transferase fusion proteins containing corresponding segments of dematin52 and protein 4.2 as well as to purified protein 4.2. The binding of ATP to the recombinant domains of dematin52 and protein 4.2 is specific, saturable, and of high affinity. The nucleotide specificity of the P-loop is restricted to ATP since no detectable binding was observed with GTP. These results show that the 11-amino acid motif provides an ATP binding site in dematin52 and protein 4.2. Although the functional significance of ATP binding is not yet clear, our findings open new perspectives for the function of dematin and protein 4.2 in vivo.

  11. Structure, function, and evolution of bacterial ATP-binding cassette systems

    SciTech Connect

    Davidson, A.L.; Dassa, E.; Orelle, C.; Chen, J.


    The ATP-binding cassette (ABC) systems constitute one of the largest superfamilies of paralogous sequences. All ABC systems share a highly conserved ATP-hydrolyzing domain or protein (the ABC; also referred to as a nucleotide-binding domain [NBD]) that is unequivocally characterized by three short sequence motifs (Fig. 1): these are the Walker A and Walker B motifs, indicative of the presence of a nucleotide-binding site, and the signature motif, unique to ABC proteins, located upstream of the Walker B motif (426). Other motifs diagnostic of ABC proteins are also indicated in Fig. 1. The biological significance of these motifs is discussed in Structure, Function, and Dynamics of the ABC. ABC systems are widespread among living organisms and have been detected in all genera of the three kingdoms of life, with remarkable conservation in the primary sequence of the cassette and in the organization of the constitutive domains or subunits (203, 420). ABC systems couple the energy of ATP hydrolysis to an impressively large variety of essential biological phenomena, comprising not only transmembrane (TM) transport, for which they are best known, but also several non-transport-related processes, such as translation elongation (62) and DNA repair (174). Although ABC systems deserve much attention because they are involved in severe human inherited diseases (107), they were first discovered and characterized in detail in prokaryotes, as early as the 1970s (13, 148, 238, 468). The most extensively analyzed systems were the high-affinity histidine and maltose uptake systems of Salmonella enterica serovar Typhimurium and Escherichia coli. Over 2 decades ago, after the completion of the nucleotide sequences encoding these transporters in the respective laboratories of Giovanna Ames and Maurice Hofnung, Hiroshi Nikaido and colleagues noticed that the two systems displayed a global similarity in the nature of their components and, moreover, that the primary sequences of MalK and


    EPA Science Inventory

    ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...


    EPA Science Inventory

    ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...

  14. ATP Binding by Proteasomal ATPases Regulates Cellular Assembly and Substrate-induced Functions of the 26 S Proteasome*

    PubMed Central

    Kim, Young-Chan; Li, Xiaohua; Thompson, David; DeMartino, George N.


    We examined the role of ATP binding by six different ATPase subunits (Rpt1–6) in the cellular assembly and molecular functions of mammalian 26 S proteasome. Four Rpt subunits (Rpt1–4) with ATP binding mutations were incompetent for cellular assembly into 26 S proteasome. In contrast, analogous mutants of Rpt5 and Rpt6 were incorporated normally into 26 S proteasomes in both intact cells and an in vitro assembly assay. Surprisingly, purified 26 S proteasomes containing either mutant Rpt5 or Rpt6 had normal basal ATPase activity and substrate gate opening for hydrolysis of short peptides. However, these mutant 26 S proteasomes were severely defective for ATP-dependent in vitro degradation of ubiquitylated and non-ubiquitylated proteins and did not display substrate-stimulated ATPase and peptidase activities characteristic of normal proteasomes. These results reveal differential roles of ATP binding by various Rpt subunits in proteasome assembly and function. They also indicate that substrate-stimulated ATPase activity and gating depend on the concerted action of a full complement of Rpt subunits competent for ATP binding and that this regulation is essential for normal proteolysis. Thus, protein substrates appear to promote their own degradation by stimulating proteasome functions involved in proteolysis. PMID:23212908

  15. Identification of ATP-binding regions in the RyR1 Ca²⁺ release channel.


    Popova, Olga B; Baker, Mariah R; Tran, Tina P; Le, Tri; Serysheva, Irina I


    ATP is an important modulator of gating in type 1 ryanodine receptor (RyR1), also known as a Ca²⁺ release channel in skeletal muscle cells. The activating effect of ATP on this channel is achieved by directly binding to one or more sites on the RyR1 protein. However, the number and location of these sites have yet to be determined. To identify the ATP-binding regions within RyR1 we used 2N₃ATP-2',3'-Biotin-LC-Hydrazone (BioATP-HDZ), a photo-reactive ATP analog to covalently label the channel. We found that BioATP-HDZ binds RyR1 specifically with an IC₅₀ = 0.6±0.2 mM, comparable with the reported EC50 for activation of RyR1 with ATP. Controlled proteolysis of labeled RyR1 followed by sequence analysis revealed three fragments with apparent molecular masses of 95, 45 and 70 kDa that were crosslinked by BioATP-HDZ and identified as RyR1 sequences. Our analysis identified four glycine-rich consensus motifs that can potentially constitute ATP-binding sites and are located within the N-terminal 95-kDa fragment. These putative nucleotide-binding sequences include amino acids 699-704, 701-706, 1081-1084 and 1195-1200, which are conserved among the three RyR isoforms. Located next to the N-terminal disease hotspot region in RyR1, these sequences may communicate the effects of ATP-binding to channel function by tuning conformational motions within the neighboring cytoplasmic regulatory domains. Two other labeled fragments lack ATP-binding consensus motifs and may form non-canonical ATP-binding sites. Based on domain topology in the 3D structure of RyR1 it is also conceivable that the identified ATP-binding regions, despite their wide separation in the primary sequence, may actually constitute the same non-contiguous ATP-binding pocket within the channel tetramer.

  16. Induction of Interferon-Stimulated Genes by Simian Virus 40 T Antigens

    PubMed Central

    Rathi, Abhilasha V.; Cantalupo, Paul G.; Sarkar, Saumendra N.; Pipas, James M.


    Simian virus 40 (SV40) large T antigen (TAg) is a multifunctional oncoprotein essential for productive viral infection and for cellular transformation. We have used microarray analysis to examine the global changes in cellular gene expression induced by wild-type T antigen (TAgwt) and TAg-mutants in mouse embryo fibroblasts (MEFs). The expression profile of approximately 800 cellular genes was altered by TAgwt and a truncated TAg (TAgN136), including many genes that influence cell cycle, DNA-replication, transcription, chromatin structure and DNA repair. Unexpectedly, we found a significant number of immune response genes upregulated by TAgwt including many interferon stimulated genes (ISGs) such as ISG56, OAS, Rsad2, Ifi27 and Mx1. Additionally, we also observed activation of STAT1 by TAgwt. Our genetic studies using several TAg mutants reveal an unexplored function of TAg and indicate that the LXCXE motif and p53 binding are required for the upregulation of ISGs. PMID:20692676

  17. Insight into Pleiotropic Drug Resistance ATP-binding Cassette Pump Drug Transport through Mutagenesis of Cdr1p Transmembrane Domains*

    PubMed Central

    Rawal, Manpreet Kaur; Khan, Mohammad Firoz; Kapoor, Khyati; Goyal, Neha; Sen, Sobhan; Saxena, Ajay Kumar; Lynn, Andrew M.; Tyndall, Joel D. A.; Monk, Brian C.; Cannon, Richard D.; Komath, Sneha Sudha; Prasad, Rajendra


    The fungal ATP-binding cassette (ABC) transporter Cdr1 protein (Cdr1p), responsible for clinically significant drug resistance, is composed of two transmembrane domains (TMDs) and two nucleotide binding domains (NBDs). We have probed the nature of the drug binding pocket by performing systematic mutagenesis of the primary sequences of the 12 transmembrane segments (TMSs) found in the TMDs. All mutated proteins were expressed equally well and localized properly at the plasma membrane in the heterologous host Saccharomyces cerevisiae, but some variants differed significantly in efflux activity, substrate specificity, and coupled ATPase activity. Replacement of the majority of the amino acid residues with alanine or glycine yielded neutral mutations, but about 42% of the variants lost resistance to drug efflux substrates completely or selectively. A predicted three-dimensional homology model shows that all the TMSs, apart from TMS4 and TMS10, interact directly with the drug-binding cavity in both the open and closed Cdr1p conformations. However, TMS4 and TMS10 mutations can also induce total or selective drug susceptibility. Functional data and homology modeling assisted identification of critical amino acids within a drug-binding cavity that, upon mutation, abolished resistance to all drugs tested singly or in combinations. The open and closed Cdr1p models enabled the identification of amino acid residues that bordered a drug-binding cavity dominated by hydrophobic residues. The disposition of TMD residues with differential effects on drug binding and transport are consistent with a large polyspecific drug binding pocket in this yeast multidrug transporter. PMID:23824183

  18. Alternating access to the transmembrane domain of the ATP-binding cassette protein cystic fibrosis transmembrane conductance regulator (ABCC7).


    Wang, Wuyang; Linsdell, Paul


    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is a member of the ATP-binding cassette (ABC) protein family, most members of which act as active transporters. Actively transporting ABC proteins are thought to alternate between "outwardly facing" and "inwardly facing" conformations of the transmembrane substrate pathway. In CFTR, it is assumed that the outwardly facing conformation corresponds to the channel open state, based on homology with other ABC proteins. We have used patch clamp recording to quantify the rate of access of cysteine-reactive probes to cysteines introduced into two different transmembrane regions of CFTR from both the intracellular and extracellular solutions. Two probes, the large [2-sulfonatoethyl]methanethiosulfonate (MTSES) molecule and permeant Au(CN)(2)(-) ions, were applied to either side of the membrane to modify cysteines substituted for Leu-102 (first transmembrane region) and Thr-338 (sixth transmembrane region). Channel opening and closing were altered by mutations in the nucleotide binding domains of the channel. We find that, for both MTSES and Au(CN)(2)(-), access to these two cysteines from the cytoplasmic side is faster in open channels, whereas access to these same sites from the extracellular side is faster in closed channels. These results are consistent with alternating access to the transmembrane regions, however with the open state facing inwardly and the closed state facing outwardly. Our findings therefore prompt revision of current CFTR structural and mechanistic models, as well as having broader implications for transport mechanisms in all ABC proteins. Our results also suggest possible locations of both functional and dysfunctional ("vestigial") gates within the CFTR permeation pathway.

  19. A Survey of the ATP-Binding Cassette (ABC) Gene Superfamily in the Salmon Louse (Lepeophtheirus salmonis).


    Carmona-Antoñanzas, Greta; Carmichael, Stephen N; Heumann, Jan; Taggart, John B; Gharbi, Karim; Bron, James E; Bekaert, Michaël; Sturm, Armin


    Salmon lice, Lepeophtheirus salmonis (Krøyer, 1837), are fish ectoparasites causing significant economic damage in the mariculture of Atlantic salmon, Salmo salar Linnaeus, 1758. The control of L. salmonis at fish farms relies to a large extent on treatment with anti-parasitic drugs. A problem related to chemical control is the potential for development of resistance, which in L. salmonis is documented for a number of drug classes including organophosphates, pyrethroids and avermectins. The ATP-binding cassette (ABC) gene superfamily is found in all biota and includes a range of drug efflux transporters that can confer drug resistance to cancers and pathogens. Furthermore, some ABC transporters are recognised to be involved in conferral of insecticide resistance. While a number of studies have investigated ABC transporters in L. salmonis, no systematic analysis of the ABC gene family exists for this species. This study presents a genome-wide survey of ABC genes in L. salmonis for which, ABC superfamily members were identified through homology searching of the L. salmonis genome. In addition, ABC proteins were identified in a reference transcriptome of the parasite generated by high-throughput RNA sequencing (RNA-seq) of a multi-stage RNA library. Searches of both genome and transcriptome allowed the identification of a total of 33 genes / transcripts coding for ABC proteins, of which 3 were represented only in the genome and 4 only in the transcriptome. Eighteen sequences were assigned to ABC subfamilies known to contain drug transporters, i.e. subfamilies B (4 sequences), C (11) and G (2). The results suggest that the ABC gene family of L. salmonis possesses fewer members than recorded for other arthropods. The present survey of the L. salmonis ABC gene superfamily will provide the basis for further research into potential roles of ABC transporters in the toxicity of salmon delousing agents and as potential mechanisms of drug resistance.

  20. A Survey of the ATP-Binding Cassette (ABC) Gene Superfamily in the Salmon Louse (Lepeophtheirus salmonis)

    PubMed Central

    Heumann, Jan; Taggart, John B.; Gharbi, Karim; Bron, James E.; Bekaert, Michaël; Sturm, Armin


    Salmon lice, Lepeophtheirus salmonis (Krøyer, 1837), are fish ectoparasites causing significant economic damage in the mariculture of Atlantic salmon, Salmo salar Linnaeus, 1758. The control of L. salmonis at fish farms relies to a large extent on treatment with anti-parasitic drugs. A problem related to chemical control is the potential for development of resistance, which in L. salmonis is documented for a number of drug classes including organophosphates, pyrethroids and avermectins. The ATP-binding cassette (ABC) gene superfamily is found in all biota and includes a range of drug efflux transporters that can confer drug resistance to cancers and pathogens. Furthermore, some ABC transporters are recognised to be involved in conferral of insecticide resistance. While a number of studies have investigated ABC transporters in L. salmonis, no systematic analysis of the ABC gene family exists for this species. This study presents a genome-wide survey of ABC genes in L. salmonis for which, ABC superfamily members were identified through homology searching of the L. salmonis genome. In addition, ABC proteins were identified in a reference transcriptome of the parasite generated by high-throughput RNA sequencing (RNA-seq) of a multi-stage RNA library. Searches of both genome and transcriptome allowed the identification of a total of 33 genes / transcripts coding for ABC proteins, of which 3 were represented only in the genome and 4 only in the transcriptome. Eighteen sequences were assigned to ABC subfamilies known to contain drug transporters, i.e. subfamilies B (4 sequences), C (11) and G (2). The results suggest that the ABC gene family of L. salmonis possesses fewer members than recorded for other arthropods. The present survey of the L. salmonis ABC gene superfamily will provide the basis for further research into potential roles of ABC transporters in the toxicity of salmon delousing agents and as potential mechanisms of drug resistance. PMID:26418738

  1. Conformational Changes Produced by ATP Binding to the Plasma Membrane Calcium Pump*

    PubMed Central

    Mangialavori, Irene C.; Ferreira-Gomes, Mariela S.; Saffioti, Nicolás A.; González-Lebrero, Rodolfo M.; Rossi, Rolando C.; Rossi, Juan Pablo F. C.


    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[125I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca2+ with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2′(3′)-O-(2,4,6-trinitrophenyl)adenosine 5′-triphosphate. To assess the conformational behavior of the Ca2+ binding domain, we also studied the occlusion of Ca2+, both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca2+ and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only. PMID:24025327

  2. Homo- and heterodimerization of peroxisomal ATP-binding cassette half-transporters.


    Liu, L X; Janvier, K; Berteaux-Lecellier, V; Cartier, N; Benarous, R; Aubourg, P


    Mammalian peroxisomal proteins adrenoleukodystrophy protein (ALDP), adrenoleukodystrophy-related protein (ALDRP), and 70-kDa peroxisomal protein (PMP70) belong to the superfamily of ATP-binding cassette (ABC) transporters. Unlike many ABC transporters that are single functional proteins with two related halves, ALDP, ALDRP, and PMP70 have the structure of ABC half-transporters. The dysfunction of ALDP is responsible for X-linked adrenoleukodystrophy (X-ALD), a neurodegenerative disorder in which saturated very long-chain fatty acids accumulate because of their impaired peroxisomal beta-oxidation. No disease has so far been associated with mutations of adrenoleukodystrophy-related or PMP70 genes. It has been proposed that peroxisomal ABC transporters need to dimerize to exert import functions. Using the yeast two-hybrid system, we show that homo- as well as heterodimerization occur between the carboxyl-terminal halves of ALDP, ALDRP, and PMP70. Two X-ALD disease mutations located in the carboxyl-terminal half of ALDP affect both homo- and heterodimerization of ALDP. Co-immunoprecipitation demonstrated the homodimerization of ALDP, the heterodimerization of ALDP with PMP70 or ALDRP, and the heterodimerization of ALDRP with PMP70. These results provide the first evidence of both homo- and heterodimerization of mammalian ABC half-transporters and suggest that the loss of ALDP dimerization plays a role in X-ALD pathogenesis.

  3. Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes

    SciTech Connect

    C Simmons; C Magee; D Smith; L Lauman; J Chaput; J Allen


    The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADP cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.

  4. A-Subclass ATP-Binding Cassette Proteins in Brain Lipid Homeostasis and Neurodegeneration

    PubMed Central

    Piehler, Armin P.; Özcürümez, Mustafa; Kaminski, Wolfgang E.


    The A-subclass of ATP-binding cassette (ABC) transporters comprises 12 structurally related members of the evolutionarily highly conserved superfamily of ABC transporters. ABCA transporters represent a subgroup of “full-size” multispan transporters of which several members have been shown to mediate the transport of a variety of physiologic lipid compounds across membrane barriers. The importance of ABCA transporters in human disease is documented by the observations that so far four members of this protein family (ABCA1, ABCA3, ABCA4, ABCA12) have been causatively linked to monogenetic disorders including familial high-density lipoprotein deficiency, neonatal surfactant deficiency, degenerative retinopathies, and congenital keratinization disorders. Recent research also point to a significant contribution of several A-subfamily ABC transporters to neurodegenerative diseases, in particular Alzheimer’s disease (AD). This review will give a summary of our current knowledge of the A-subclass of ABC transporters with a special focus on brain lipid homeostasis and their involvement in AD. PMID:22403555

  5. Biophysical Approaches Facilitate Computational Drug Discovery for ATP-Binding Cassette Proteins

    PubMed Central

    Molinski, Steven V.; Bozóky, Zoltán; Iram, Surtaj H.


    Although membrane proteins represent most therapeutically relevant drug targets, the availability of atomic resolution structures for this class of proteins has been limited. Structural characterization has been hampered by the biophysical nature of these polytopic transporters, receptors, and channels, and recent innovations to in vitro techniques aim to mitigate these challenges. One such class of membrane proteins, the ATP-binding cassette (ABC) superfamily, are broadly expressed throughout the human body, required for normal physiology and disease-causing when mutated, yet lacks sufficient structural representation in the Protein Data Bank. However, recent improvements to biophysical techniques (e.g., cryo-electron microscopy) have allowed for previously “hard-to-study” ABC proteins to be characterized at high resolution, providing insight into molecular mechanisms-of-action as well as revealing novel druggable sites for therapy design. These new advances provide ample opportunity for computational methods (e.g., virtual screening, molecular dynamics simulations, and structure-based drug design) to catalyze the discovery of novel small molecule therapeutics that can be easily translated from computer to bench and subsequently to the patient's bedside. In this review, we explore the utility of recent advances in biophysical methods coupled with well-established in silico techniques towards drug development for diseases caused by dysfunctional ABC proteins. PMID:28409029

  6. ATP-binding cassette (ABC) proteins in aquatic invertebrates: Evolutionary significance and application in marine ecotoxicology.


    Jeong, Chang-Bum; Kim, Hui-Su; Kang, Hye-Min; Lee, Jae-Seong


    The ATP-binding cassette (ABC) protein superfamily is known to play a fundamental role in biological processes and is highly conserved across animal taxa. The ABC proteins function as active transporters for multiple substrates across the cellular membrane by ATP hydrolysis. As this superfamily is derived from a common ancestor, ABC genes have evolved via lineage-specific duplications through the process of adaptation. In this review, we summarized information about the ABC gene families in aquatic invertebrates, considering their evolution and putative functions in defense mechanisms. Phylogenetic analysis was conducted to examine the evolutionary significance of ABC gene families in aquatic invertebrates. Particularly, a massive expansion of multixenobiotic resistance (MXR)-mediated efflux transporters was identified in the absence of the ABCG2 (BCRP) gene in Ecdysozoa and Platyzoa, suggesting that a loss of Abcg2 gene occurred sporadically in these species during divergence of Protostome to Lophotrochozoa. Furthermore, in aquatic invertebrates, the ecotoxicological significance of MXR is discussed while considering the role of MXR-mediated efflux transporters in response to various environmental pollutants. Copyright © 2017 Elsevier B.V. All rights reserved.

  7. Serum albumin promotes ATP-binding cassette transporter-dependent sterol uptake in yeast.


    Marek, Magdalena; Silvestro, Daniele; Fredslund, Maria D; Andersen, Tonni G; Pomorski, Thomas G


    Sterol uptake in fungi is a multistep process that involves interaction between external sterols and the cell wall, incorporation of sterol molecules into the plasma membrane, and subsequent integration into intracellular membranes for turnover. ATP-binding cassette (ABC) transporters have been implicated in sterol uptake, but key features of their activity remain to be elucidated. Here, we apply fluorescent cholesterol (NBD-cholesterol) to monitor sterol uptake under anaerobic and aerobic conditions in two fungal species, Candida glabrata (Cg) and Saccharomyces cerevisiae (Sc). We found that in both fungal species, ABC transporter-dependent uptake of cholesterol under anaerobic conditions and in mutants lacking HEM1 gene is promoted in the presence of the serum protein albumin that is able to bind the sterol molecule. Furthermore, the C. glabrata ABC transporter CgAus1p expressed in S. cerevisiae requires the presence of serum or albumin for efficient cholesterol uptake. These results suggest that albumin can serve as sterol donor in ABC transporter-dependent sterol uptake, a process potentially important for growth of C. glabrata inside infected humans. © 2014 The Authors. FEMS Yeast Research published by John Wiley & Sons Ltd on behalf of Federation of European Microbiological Societies.

  8. Phylogenetic analysis of the ATP-binding cassette transporter family in three mosquito species.


    Lu, Hong; Xu, Yongyu; Cui, Feng


    The ATP-binding cassette (ABC) transporter family functions in the ATP-dependent transportation of various substrates across biological membranes. ABC proteins participate in various biological processes and insecticide resistance in insects, and are divided into eight subfamilies (A-H). Mosquitoes are important vectors of human diseases, but the mechanism by which the ABC transporter family evolves in mosquitoes is unknown. In this study, we classified and compared the ABC transporter families of three mosquitoes, namely, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus. The three mosquitoes have 55, 69, and 70 ABC genes, respectively. The C. p. quinquefasciatus had approximately 40% and 65% expansion in the ABCG subfamily, mainly in ABCG1/G4, compared with the two other mosquito species. The ABCB, ABCD, ABCE, and ABCF subfamilies were conserved in the three mosquito species. The C. p. quinquefasciatus transcriptomes during development showed that the ABCG and ABCC genes were mainly highly expressed at the egg and pupal stages. The pigment-transport relative brown, white, and scarlet, as well as the ABCF subfamily, were highly expressed at the egg stage. The highly expressed genes in larvae included three ABCA3 genes. The majority of the highly expressed genes in adults were ABCG1/4 genes. These results provided insights into the evolution of the ABC transporter family in mosquitoes. Copyright © 2015 Elsevier B.V. All rights reserved.

  9. Predictive Structure and Topology of Peroxisomal ATP-Binding Cassette (ABC) Transporters.


    Andreoletti, Pierre; Raas, Quentin; Gondcaille, Catherine; Cherkaoui-Malki, Mustapha; Trompier, Doriane; Savary, Stéphane


    The peroxisomal ATP-binding Cassette (ABC) transporters, which are called ABCD1, ABCD2 and ABCD3, are transmembrane proteins involved in the transport of various lipids that allow their degradation inside the organelle. Defective ABCD1 leads to the accumulation of very long-chain fatty acids and is associated with a complex and severe neurodegenerative disorder called X-linked adrenoleukodystrophy (X-ALD). Although the nucleotide-binding domain is highly conserved and characterized within the ABC transporters family, solid data are missing for the transmembrane domain (TMD) of ABCD proteins. The lack of a clear consensus on the secondary and tertiary structure of the TMDs weakens any structure-function hypothesis based on the very diverse ABCD1 mutations found in X-ALD patients. Therefore, we first reinvestigated thoroughly the structure-function data available and performed refined alignments of ABCD protein sequences. Based on the 2.85  Å resolution crystal structure of the mitochondrial ABC transporter ABCB10, here we propose a structural model of peroxisomal ABCD proteins that specifies the position of the transmembrane and coupling helices, and highlight functional motifs and putative important amino acid residues.

  10. The Role of ATP-Binding Cassette Transporters in Neuro-Inflammation: Relevance for Bioactive Lipids.


    Kooij, Gijs; van Horssen, Jack; Bandaru, Veera Venkata Ratnam; Haughey, Norman J; de Vries, Helga E


    ATP-binding cassette (ABC) transporters are highly expressed by brain endothelial cells that form the blood-brain barrier (BBB). These efflux pumps play an important role in maintaining brain homeostasis as they actively hinder the entry of unwanted blood-derived compounds into the central nervous system (CNS). Consequently, their high activity at the BBB has been a major hurdle for the treatment of several brain diseases, as they prevent numerous drugs to reach their site of action within the brain. Importantly, recent data indicate that endogenous substrates for ABC transporters may include inflammatory mediators, such as prostaglandins, leukotrienes, cytokines, chemokines, and bioactive lipids, suggesting a potential role for ABC transporters in immunological responses, and more specifically in inflammatory brain disorders, such as multiple sclerosis (MS). In this review, we will give a comprehensive overview of recent findings that illustrate this novel role for ABC transporters in neuro-inflammatory processes. Moreover, we will provide first insights into underlying mechanisms and focus on the importance for bioactive lipids, in particular platelet-activating factor, herein. A thorough understanding of these events may form the basis for the development for selective treatment modalities to dampen the neuro-inflammatory attack in MS and thereby reducing tissue damage.

  11. Masitinib antagonizes ATP-binding cassette subfamily G member 2-mediated multidrug resistance

    PubMed Central



    In this in vitro study, we determined whether masitinib could reverse multidrug resistance (MDR) in cells overexpressing the ATP binding cassette subfamily G member 2 (ABCG2) transporter. Masitinib (1.25 and 2.5 μM) significantly decreases the resistance to mitoxantrone (MX), SN38 and doxorubicin in HEK293 and H460 cells overexpressing the ABCG2 transporter. In addition, masitinib (2.5 μM) significantly increased the intracellular accumulation of [3H]-MX, a substrate for ABCG2, by inhibiting the function of ABCG2 and significantly decreased the efflux of [3H]-MX. However, masitinib (2.5 μM) did not significantly alter the expression of the ABCG2 protein. In addition, a docking model suggested that masitinib binds within the transmembrane region of a homology-modeled human ABCG2 transporter. Overall, our in vitro findings suggest that masitinib reverses MDR to various anti-neoplastic drugs in HEK293 and H460 cells overexpressing ABCG2 by inhibiting their transport activity as opposed to altering their levels of expression. PMID:24626598

  12. Molecular Characterization of LjABCG1, an ATP-Binding Cassette Protein in Lotus japonicus

    PubMed Central

    Sugiyama, Akifumi; Fukuda, Shoju; Takanashi, Kojiro; Yoshioka, Miki; Yoshioka, Hirofumi; Narusaka, Yoshihiro; Narusaka, Mari; Kojima, Mikiko; Sakakibara, Hitoshi; Shitan, Nobukazu; Sato, Shusei; Tabata, Satoshi; Kawaguchi, Masayoshi; Yazaki, Kazufumi


    LjABCG1, a full-size ABCG subfamily of ATP-binding cassette proteins of a model legume, Lotus japonicus, was reported as a gene highly expressed during the early stages of nodulation, but have not been characterized in detail. In this study we showed that the induction of LjABCG1 expression was remarkable by methyl jasmonate treatment, and reporter gene experiments indicated that LjABCG1 was strongly expressed in the nodule parenchyma and cell layers adjacent to the root vascular tissue toward the nodule. LjABCG1 was suggested to be localized at the plasma membrane based on the fractionation of microsomal membranes as well as separation via aqueous two-phase partitioning. The physiological functions of LjABCG1 in symbiosis and pathogenesis were analyzed in homologous and heterologous systems. LjABCG1 knock-down L. japonicus plants did not show clear phenotypic differences in nodule formation, and not in defense against Pseudomonas syringae, either. In contrast, when LjABCG1 was expressed in the Arabidopsis pdr8-1 mutant, the penetration frequency of Phytophthora infestans, a potato late blight pathogen, was significantly reduced in LjABCG1/pdr8-1 than in pdr8-1 plants. This finding indicated that LjABCG1, at least partially, complemented the phenotype of pdr8 in Arabidopsis, suggesting the multiple roles of this protein in plant-microbe interactions. PMID:26418593

  13. A Plant Plasma Membrane ATP Binding Cassette–Type Transporter Is Involved in Antifungal Terpenoid Secretion

    PubMed Central

    Jasiński, Michal; Stukkens, Yvan; Degand, Hervé; Purnelle, Bénédicte; Marchand-Brynaert, Jacqueline; Boutry, Marc


    ATP binding cassette (ABC) transporters, which are found in all species, are known mainly for their ability to confer drug resistance. To date, most of the ABC transporters characterized in plants have been localized in the vacuolar membrane and are considered to be involved in the intracellular sequestration of cytotoxins. Working on the assumption that certain ABC transporters might be involved in defense metabolite secretion and their expression might be regulated by the concentration of these metabolites, we treated a Nicotiana plumbaginifolia cell culture with sclareolide, a close analog of sclareol, an antifungal diterpene produced at the leaf surface of Nicotiana spp; this resulted in the appearance of a 160-kD plasma membrane protein, which was partially sequenced. The corresponding cDNA (NpABC1) was cloned and shown to encode an ABC transporter. In vitro and in situ immunodetection showed NpABC1 to be localized in the plasma membrane. Under normal conditions, expression was found in the leaf epidermis. In cell culture and in leaf tissues, NpABC1 expression was strongly enhanced by sclareolide and sclareol. In parallel with NpABC1 induction, cells acquired the ability to excrete a labeled synthetic sclareolide derivative. These data suggest that NpABC1 is involved in the secretion of a secondary metabolite that plays a role in plant defense. PMID:11340184

  14. Caveolin-1 and ATP binding cassette transporter A1 and G1-mediated cholesterol efflux.


    Wang, Faqi; Gu, Hong-mei; Zhang, Da-wei


    Atherosclerosis is one major cause of cardiovascular diseases, the leading cause of death in industrialized countries. Reverse cholesterol transport (RCT) is thought to be one primary pathway to protect against atherosclerosis. The first and rate-limiting step of RCT is ATP-binding cassette transport A1 (ABCA1) and ABCG1-mediated cholesterol efflux from the cells. Recently, caveolin-1 (CAV1), a scaffolding protein that organizes and concentrates certain caveolin-interacting signaling molecules and receptors within caveolae membranes, has been shown to regulate ABCA1 and ABCG1-mediated cholesterol efflux probably via interacting with them. In the present review, we summarize the current knowledge and views on the regulatory role of CAV1 on the cholesterol homeostasis with emphasis on the association of CAV1 with ABCA1 and ABCG1. We conclude that the dominance of the positive regulation by CAV1 on the ABCA1 and ABCG1-mediated cholesterol efflux is depending on the species, cell types, as well as the levels of CAV1 expression.

  15. The Yeast Plasma Membrane ATP Binding Cassette (ABC) Transporter Aus1

    PubMed Central

    Marek, Magdalena; Milles, Sigrid; Schreiber, Gabriele; Daleke, David L.; Dittmar, Gunnar; Herrmann, Andreas; Müller, Peter; Pomorski, Thomas Günther


    The ATP binding cassette (ABC) transporter Aus1 is expressed under anaerobic growth conditions at the plasma membrane of the yeast Saccharomyces cerevisiae and is required for sterol uptake. These observations suggest that Aus1 promotes the translocation of sterols across membranes, but the precise transport mechanism has yet to be identified. In this study, an extraction and purification procedure was developed to characterize the Aus1 transporter. The detergent-solubilized protein was able to bind and hydrolyze ATP. Mutagenesis of the conserved lysine to methionine in the Walker A motif abolished ATP hydrolysis. Likewise, ATP hydrolysis was inhibited by classical inhibitors of ABC transporters. Upon reconstitution into proteoliposomes, the ATPase activity of Aus1 was specifically stimulated by phosphatidylserine (PS) in a stereoselective manner. We also found that Aus1-dependent sterol uptake, but not Aus1 expression and trafficking to the plasma membrane, was affected by changes in cellular PS levels. These results suggest a direct interaction between Aus1 and PS that is critical for the activity of the transporter. PMID:21521689

  16. Agrobacterium rhizogenes GALLS Protein Contains Domains for ATP Binding, Nuclear Localization, and Type IV Secretion▿

    PubMed Central

    Hodges, Larry D.; Vergunst, Annette C.; Neal-McKinney, Jason; den Dulk-Ras, Amke; Moyer, Deborah M.; Hooykaas, Paul J. J.; Ream, Walt


    Agrobacterium tumefaciens and Agrobacterium rhizogenes are closely related plant pathogens that cause different diseases, crown gall and hairy root. Both diseases result from transfer, integration, and expression of plasmid-encoded bacterial genes located on the transferred DNA (T-DNA) in the plant genome. Bacterial virulence (Vir) proteins necessary for infection are also translocated into plant cells. Transfer of single-stranded DNA (ssDNA) and Vir proteins requires a type IV secretion system, a protein complex spanning the bacterial envelope. A. tumefaciens translocates the ssDNA-binding protein VirE2 into plant cells, where it binds single-stranded T-DNA and helps target it to the nucleus. Although some strains of A. rhizogenes lack VirE2, they are pathogenic and transfer T-DNA efficiently. Instead, these bacteria express the GALLS protein, which is essential for their virulence. The GALLS protein can complement an A. tumefaciens virE2 mutant for tumor formation, indicating that GALLS can substitute for VirE2. Unlike VirE2, GALLS contains ATP-binding and helicase motifs similar to those in TraA, a strand transferase involved in conjugation. Both GALLS and VirE2 contain nuclear localization sequences and a C-terminal type IV secretion signal. Here we show that mutations in any of these domains abolished the ability of GALLS to substitute for VirE2. PMID:17012398

  17. Conformational changes produced by ATP binding to the plasma membrane calcium pump.


    Mangialavori, Irene C; Ferreira-Gomes, Mariela S; Saffioti, Nicolás A; González-Lebrero, Rodolfo M; Rossi, Rolando C; Rossi, Juan Pablo F C


    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[(125)I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca(2+) with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate. To assess the conformational behavior of the Ca(2+) binding domain, we also studied the occlusion of Ca(2+), both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca(2+) and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only.

  18. Structure-guided Development of Specific Pyruvate Dehydrogenase Kinase Inhibitors Targeting the ATP-binding Pocket*

    PubMed Central

    Tso, Shih-Chia; Qi, Xiangbing; Gui, Wen-Jun; Wu, Cheng-Yang; Chuang, Jacinta L.; Wernstedt-Asterholm, Ingrid; Morlock, Lorraine K.; Owens, Kyle R.; Scherer, Philipp E.; Williams, Noelle S.; Tambar, Uttam K.; Wynn, R. Max; Chuang, David T.


    Pyruvate dehydrogenase kinase isoforms (PDKs 1–4) negatively regulate activity of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation. PDK isoforms are up-regulated in obesity, diabetes, heart failure, and cancer and are potential therapeutic targets for these important human diseases. Here, we employed a structure-guided design to convert a known Hsp90 inhibitor to a series of highly specific PDK inhibitors, based on structural conservation in the ATP-binding pocket. The key step involved the substitution of a carbonyl group in the parent compound with a sulfonyl in the PDK inhibitors. The final compound of this series, 2-[(2,4-dihydroxyphenyl)sulfonyl]isoindoline-4,6-diol, designated PS10, inhibits all four PDK isoforms with IC50 = 0.8 μm for PDK2. The administration of PS10 (70 mg/kg) to diet-induced obese mice significantly augments pyruvate dehydrogenase complex activity with reduced phosphorylation in different tissues. Prolonged PS10 treatments result in improved glucose tolerance and notably lessened hepatic steatosis in the mouse model. The results support the pharmacological approach of targeting PDK to control both glucose and fat levels in obesity and type 2 diabetes. PMID:24356970

  19. A conserved mitochondrial ATP-binding cassette transporter exports glutathione polysulfide for cytosolic metal cofactor assembly.


    Schaedler, Theresia A; Thornton, Jeremy D; Kruse, Inga; Schwarzländer, Markus; Meyer, Andreas J; van Veen, Hendrik W; Balk, Janneke


    An ATP-binding cassette transporter located in the inner mitochondrial membrane is involved in iron-sulfur cluster and molybdenum cofactor assembly in the cytosol, but the transported substrate is unknown. ATM3 (ABCB25) from Arabidopsis thaliana and its functional orthologue Atm1 from Saccharomyces cerevisiae were expressed in Lactococcus lactis and studied in inside-out membrane vesicles and in purified form. Both proteins selectively transported glutathione disulfide (GSSG) but not reduced glutathione in agreement with a 3-fold stimulation of ATPase activity by GSSG. By contrast, Fe(2+) alone or in combination with glutathione did not stimulate ATPase activity. Arabidopsis atm3 mutants were hypersensitive to an inhibitor of glutathione biosynthesis and accumulated GSSG in the mitochondria. The growth phenotype of atm3-1 was strongly enhanced by depletion of the mitochondrion-localized, GSH-dependent persulfide oxygenase ETHE1, suggesting that the physiological substrate of ATM3 contains persulfide in addition to glutathione. Consistent with this idea, a transportomics approach using mass spectrometry showed that glutathione trisulfide (GS-S-SG) was transported by Atm1. We propose that mitochondria export glutathione polysulfide, containing glutathione and persulfide, for iron-sulfur cluster assembly in the cytosol.

  20. Tracing the structural evolution of eukaryotic ATP binding cassette transporter superfamily

    PubMed Central

    Xiong, Jie; Feng, Jinmei; Yuan, Dongxia; Zhou, Jun; Miao, Wei


    The ATP binding cassette (ABC) transporters superfamily is one of the largest classes of membrane proteins. The core of the ABC transporter protein is composed of transmembrane domains (TMDs) and nucleotide binding domains (NBD). Eukaryotes ABC transporters are classified into seven main families (ABCA to ABCG) based on sequence similarity and domain organizations. With different domain number and domain organizations, eukaryote ABC transporters show diverse structures: the single structure (NBD or TMD), the ABC2 structure (NBD-NBD), the half structure (TMD-NBD or NBD-TMD) and the full structure (TMD-NBD-TMD-NBD or NBD-TMD-NBD-TMD). However, studies on how various ABC transporter gene structures evolved is still absent. Therefore, in this study, we comprehensively investigated the structural evolution of eukaryotic ABC transporters. The seven eukaryote ABC transporter families (A to G) fell into three groups: A&G group, B,C&D group and E&F group. There were at least four times the number of NBD and TMD fusion events in the origin of the half structure transporter. Two fusion modes were found in the full and ABC2 structure origination. Based on these findings, we present a putative structural evolutionary path of eukaryote ABC transporters that will increase our understanding on their origin, divergence and function. PMID:26577702

  1. Inventory and analysis of ATP-binding cassette (ABC) systems in Brugia malayi.


    Ardelli, B F; Stitt, L E; Tompkins, J B


    ABC systems are one of the largest described protein superfamilies. These systems have a domain organization that may contain 1 or more transmembrane domains (ABC_TM1F) and 1 or 2 ATP-binding domains (ABC_2). The functions (e.g., import, export and DNA repair) of these proteins distinguish the 3 classes of ABC systems. Mining and PCR-based cloning were used to identify 33 putative ABC systems from the Brugia malayi genome. There were 31 class 2 genes, commonly called ABC transporters, and 2 class 3 genes. The ABC transporters were divided into subfamilies. Three belonged to subfamily A, 16 to subfamily B, 5 to subfamily C, 1 to subfamily E and 3 to subfamilies F and G, respectively. None were placed in subfamilies D and H. Similar to other ABC systems, the ABC_2 domain of B. malayi genes was conserved and contained the Walker A and B motifs, the signature sequence/linker region and the switch region with the conserved histidine. The ABC_TM1F domain was less conserved. The relative abundance of ABC systems was quantified using real-time reverse transcription PCR and was significantly higher in female adults of B. malayi than in males and microfilaria, particularly those in subfamilies B and C, which are associated with drug resistance.

  2. Akt isoform-dependent regulation of ATP-Binding cassette A1 expression by apolipoprotein E.


    Okoro, Emmanuel U; Guo, Zhongmao; Yang, Hong


    We previously reported that apolipoprotein E (apoE) upregulates ATP-binding cassette transporter A1 (ABCA1) transcription through phosphatidylinositol 3-kinase (PI3K). Here we demonstrate that treatment of murine macrophages with human apoE3 enhanced Akt phosphorylation, and upregulated ABCA1 protein and mRNA expression. Inhibition of PI3K weakened apoE3-induced Akt phosphorylation, and ABCA1 protein and mRNA increase. In contrast, inhibition of Akt only diminished apoE-induced ABCA1 protein but not the mRNA level. Suppression of protein synthesis did not erase the ability of apoE3 to increase ABCA1 protein level. Further, apoE3 increased the resistance of ABCA1 protein to calpain-mediated degradation without affecting calpain activity. Treatment of macrophages with apoE3 selectively enhanced the phosphorylation of Akt1 and Akt2, but not Akt3. Knockdown of Akt1 or Akt2 increased and decreased ABCA1 protein level, respectively; while overexpression of these Akt isoenzymes caused changes in ABCA1 protein level opposite to those induced by knockdown of the corresponding Akt. These data imply that apoE3 guards against calpain-mediated ABCA1 degradation through Akt2.

  3. Small and middle T antigens contribute to lytic and abortive polyomavirus infection

    SciTech Connect

    Tuerler, H.; Salomon, C.


    Using three different polyomavirus hr-t mutants and two polyomavirus mlT mutants, the authors studied induction of S-phase by mutants and wild-type virus in quiescent mouse kidney cells, mouse 3T6 cells, and FR 3T3 cells. At different times after infection, they measured the proportion of T-antigen-positive cells, the incorporation of (/sup 3/H)thymidine, the proportion of DNA-synthesizing cells, and the increase in total DNA, RNA, and protein content of the cultures. In permissive mouse cells, they also determined the amount of viral DNA and the proportion of viral capsid-producing cells. In polyomavirus hr-t mutant-infected cultures, the onset of host DNA replication was delayed by several hours, and a smaller proportion of T-antigen-positive cells entered S-phase than in wild-type-infected cultures. Of the two polyomavirus mlT mutants studied, dl-23 behaved similarly to wild-type virus in many, but not all, parameters tested. The poorly replicating but well-transforming mutant dl-8 was able to induce S-phase, and (in permissive cells) progeny virus production, in only about one-third of the T-antigen-positive cells. From the experiments, the authors concluded that mutations affecting small and middle T-antigen cause a reduction in the proportion of cells responding to virus infection and a prolongation of the early phase, i.e., the period before cells center S-phase. In hr-t mutant-infected mouse 3T6 cells, production of viral DNA was <10% of that in wild-type-infected cultures; low hr-t progeny production in 3T6 cells was therefore largely due to poor viral DNA replication.

  4. Crystal structures of the ATP-binding and ADP-release dwells of the V1 rotary motor

    PubMed Central

    Suzuki, Kano; Mizutani, Kenji; Maruyama, Shintaro; Shimono, Kazumi; Imai, Fabiana L.; Muneyuki, Eiro; Kakinuma, Yoshimi; Ishizuka-Katsura, Yoshiko; Shirouzu, Mikako; Yokoyama, Shigeyuki; Yamato, Ichiro; Murata, Takeshi


    V1-ATPases are highly conserved ATP-driven rotary molecular motors found in various membrane systems. We recently reported the crystal structures for the Enterococcus hirae A3B3DF (V1) complex, corresponding to the catalytic dwell state waiting for ATP hydrolysis. Here we present the crystal structures for two other dwell states obtained by soaking nucleotide-free V1 crystals in ADP. In the presence of 20 μM ADP, two ADP molecules bind to two of three binding sites and cooperatively induce conformational changes of the third site to an ATP-binding mode, corresponding to the ATP-binding dwell. In the presence of 2 mM ADP, all nucleotide-binding sites are occupied by ADP to induce conformational changes corresponding to the ADP-release dwell. Based on these and previous findings, we propose a V1-ATPase rotational mechanism model. PMID:27807367

  5. An ATP-Binding Cassette Transporter and Two rRNA Methyltransferases Are Involved in Resistance to Avilamycin in the Producer Organism Streptomyces viridochromogenes Tü57

    PubMed Central

    Weitnauer, Gabriele; Gaisser, Sibylle; Trefzer, Axel; Stockert, Sigrid; Westrich, Lucy; Quiros, Luis M.; Mendez, Carmen; Salas, Jose A.; Bechthold, Andreas


    Three different resistance factors from the avilamycin biosynthetic gene cluster of Streptomyces viridochromogenes Tü57, which confer avilamycin resistance when expressed in Streptomyces lividans TK66, were isolated. Analysis of the deduced amino acid sequences showed that AviABC1 is similar to a large family of ATP-binding transporter proteins and that AviABC2 resembles hydrophobic transmembrane proteins known to act jointly with the ATP-binding proteins. The deduced amino acid sequence of aviRb showed similarity to those of other rRNA methyltransferases, and AviRa did not resemble any protein in the databases. Independent expression in S. lividans TK66 of aviABC1 plus aviABC2, aviRa, or aviRb conferred different levels of resistance to avilamycin: 5, 10, or 250 μg/ml, respectively. When either aviRa plus aviRb or aviRa plus aviRb plus aviABC1 plus aviABC2 was coexpressed in S. lividans TK66, avilamycin resistance levels reached more than 250 μg/ml. Avilamycin A inhibited poly(U)-directed polyphenylalanine synthesis in an in vitro system using ribosomes of S. lividans TK66(pUWL201) (GWO), S. lividans TK66(pUWL201-Ra) (GWRa), or S. lividans TK66(pUWL201-Rb) (GWRb), whereas ribosomes of S. lividans TK66 containing pUWL201-Ra+Rb (GWRaRb) were highly resistant. aviRa and aviRb were expressed in Escherichia coli, and both enzymes were purified as fusion proteins to near homogeneity. Both enzymes showed rRNA methyltransferase activity using a mixture of 16S and 23S rRNAs from E. coli as the substrate. Coincubation experiments revealed that the enzymes methylate different positions of rRNA. PMID:11181344

  6. Small Substrate Transport and Mechanism of a Molybdate ATP Binding Cassette Transporter in a Lipid Environment*

    PubMed Central

    Rice, Austin J.; Harrison, Alistair; Alvarez, Frances J. D.; Davidson, Amy L.; Pinkett, Heather W.


    Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. PMID:24722984

  7. Small substrate transport and mechanism of a molybdate ATP binding cassette transporter in a lipid environment.


    Rice, Austin J; Harrison, Alistair; Alvarez, Frances J D; Davidson, Amy L; Pinkett, Heather W


    Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  8. Structure of an antibacterial peptide ATP-binding cassette transporter in a novel outward occluded state

    PubMed Central

    Choudhury, Hassanul G.; Tong, Zhen; Mathavan, Indran; Li, Yanyan; Iwata, So; Zirah, Séverine; Rebuffat, Sylvie; van Veen, Hendrik W.; Beis, Konstantinos


    Enterobacteriaceae produce antimicrobial peptides for survival under nutrient starvation. Microcin J25 (MccJ25) is an antimicrobial peptide with a unique lasso topology. It is secreted by the ATP-binding cassette (ABC) exporter McjD, which ensures self-immunity of the producing strain through efficient export of the toxic mature peptide from the cell. Here we have determined the crystal structure of McjD from Escherichia coli at 2.7-Å resolution, which is to the authors’ knowledge the first structure of an antibacterial peptide ABC transporter. Our functional and biochemical analyses demonstrate McjD-dependent immunity to MccJ25 through efflux of the peptide. McjD can directly bind MccJ25 and displays a basal ATPase activity that is stimulated by MccJ25 in both detergent solution and proteoliposomes. McjD adopts a new conformation, termed nucleotide-bound outward occluded. The new conformation defines a clear cavity; mutagenesis and ligand binding studies of the cavity have identified Phe86, Asn134, and Asn302 as important for recognition of MccJ25. Comparisons with the inward-open MsbA and outward-open Sav1866 structures show that McjD has structural similarities with both states without the intertwining of transmembrane (TM) helices. The occluded state is formed by rotation of TMs 1 and 2 toward the equivalent TMs of the opposite monomer, unlike Sav1866 where they intertwine with TMs 3–6 of the opposite monomer. Cysteine cross-linking studies on the McjD dimer in inside-out membrane vesicles of E. coli confirmed the presence of the occluded state. We therefore propose that the outward-occluded state represents a transition intermediate between the outward-open and inward-open conformation of ABC exporters. PMID:24920594

  9. ATP-binding cassette sterol transporters are differentially expressed in normal and diseased human gallbladder.


    Yoon, Jai Hoon; Choi, Ho Soon; Jun, Dae Won; Yoo, Kyo-Sang; Lee, Jin; Yang, Sun Young; Kuver, Rahul


    Gallbladder epithelial cells (GBEC) are exposed to high cholesterol concentrations in bile, and export cholesterol via an ATP-binding cassette (ABC) transporter-mediated pathway in vitro. These findings suggest that aberrant expression and/or function of ABC sterol transporters may be associated with cholesterol-related gallbladder diseases (CAGD). In this study, we investigated the relative levels of the sterol transporters ABCA1, ABCG5, and ABCG8 in human gallbladders in CAGD, and the relationship between ABCA1 and inflammation. Expression of ABCA1, ABCG5, and ABCG8 was evaluated in 31 gallbladders with CAGD and 6 normal gallbladders by western blotting and immunohistochemistry. RT-PCR was used to measure ABCA1 mRNA expression. To investigate the relationship between ABCA1 and inflammation, wWestern blots were performed on cultured dog GBEC treated with lipopolysaccharide (LPS) using an anti-ABCA1 antibody. Immunohistochemistry showed ABCA1 to be localized predominantly to the basolateral membrane, while ABCG8 formed a diffuse intracellular pattern at the apical pole of human GBEC. ABCA1 and ABCG8 expression was more prominent in GBEC that were surrounded by cholesterol-laden macrophages. ABCA1 and ABCG8 expression was increased in gallbladders with CAGD. Western blots showed increased ABCA1, ABCG5, and ABCG8 expression in CAGD. ABCA1 mRNA levels were increased in all gallbladders with CAGD. LPS treatment of cultured dog GBEC enhanced ABCA1 expression. The sterol transporters ABCA1, ABCG5, and ABCG8 may play a role in the pathogenesis of human CAGD. Inflammation appears to be a key factor that increases ABCA1 expression and activity in the human gallbladder.

  10. ATP-binding cassette transporter A7 (ABCA7) loss of function alters Alzheimer amyloid processing.


    Satoh, Kanayo; Abe-Dohmae, Sumiko; Yokoyama, Shinji; St George-Hyslop, Peter; Fraser, Paul E


    The ATP-binding cassette transporter A7 (ABCA7) has been identified as a susceptibility factor of late onset Alzheimer disease in genome-wide association studies. ABCA7 has been shown to mediate phagocytosis and affect membrane trafficking. The current study examined the impact of ABCA7 loss of function on amyloid precursor protein (APP) processing and generation of amyloid-β (Aβ). Suppression of endogenous ABCA7 in several different cell lines resulted in increased β-secretase cleavage and elevated Aβ. ABCA7 knock-out mice displayed an increased production of endogenous murine amyloid Aβ42 species. Crossing ABCA7-deficient animals to an APP transgenic model resulted in significant increases in the soluble Aβ as compared with mice expressing normal levels of ABCA7. Only modest changes in the amount of insoluble Aβ and amyloid plaque densities were observed once the amyloid pathology was well developed, whereas Aβ deposition was enhanced in younger animals. In vitro studies indicated a more rapid endocytosis of APP in ABCA7 knock-out cells that is mechanistically consistent with the increased Aβ production. These in vitro and in vivo findings indicate a direct role of ABCA7 in amyloid processing that may be associated with its primary biological function to regulate endocytic pathways. Several potential loss-of-function ABCA7 mutations and deletions linked to Alzheimer disease that in some instances have a greater impact than apoE allelic variants have recently been identified. A reduction in ABCA7 expression or loss of function would be predicted to increase amyloid production and that may be a contributing factor in the associated Alzheimer disease susceptibility. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  11. Transcriptional Regulation of ATP-binding Cassette Transporter A1 Expression by a Novel Signaling Pathway*

    PubMed Central

    Chen, Xinping; Zhao, Yanfeng; Guo, Zhongmao; Zhou, Lichun; Okoro, Emmanuel U.; Yang, Hong


    ATP-binding cassette transporter A1 (ABCA1) is a membrane-bound protein that regulates the efflux of cholesterol derived from internalized lipoproteins. Using a mouse macrophage cell line, this report studied the impact of low-density lipoproteins (LDL) on ABCA1 expression and the signaling pathway responsible for lipoprotein-induced ABCA1 expression. Our data demonstrated that treatment of macrophages with LDL increased ABCA1 mRNA and protein levels 4.3- and 3.5-fold, respectively. LDL also induced an ∼2-fold increase in macrophage surface expression of ABCA1 and a 14-fold-increase in apolipoprotein AI-mediated cholesterol efflux. In addition, LDL significantly increased the level of phosphorylated specificity protein 1 (Sp1) and the amount of Sp1 bound to the ABCA1 promoter without alteration in total Sp1 protein level. Mutation of the Sp1 binding site in the ABCA1 promoter and inhibition of Sp1 DNA binding with mithramycin A suppressed the ABCA1 promoter activity and reduced the ABCA1 expression level induced by LDL. LDL treatment also elevated protein kinase C-ζ (PKC-ζ) phosphorylation and induced PKC-ζ binding with Sp1. Inhibition of PKC-ζ with kinase inhibitors or overexpression of kinase-dead PKC-ζ attenuated Sp1 phosphorylation and ABCA1 expression induced by LDL. These results demonstrate for the first time that activation of the PKCζ-Sp1 signaling cascade is a mechanism for regulation of LDL-induced ABCA1 expression. PMID:21257755

  12. A Novel Function of Apolipoprotein E: Upregulation of ATP-Binding Cassette Transporter A1 Expression

    PubMed Central

    Yang, Hong; Zhou, Lichun; Okoro, Emmanuel U.; Guo, Zhongmao


    Despite the well known importance of apolipoprotein (Apo) E in cholesterol efflux, the effect of ApoE on the expression of ATP-binding cassette transporter A1 (ABCA1) has never been investigated. The objective of this study was to determine the effect of ApoE on ApoB-carrying lipoprotein-induced expression of ABCA1, a protein that mediates cholesterol efflux. Our data demonstrate that ApoB-carrying lipoproteins obtained from both wild-type and ApoE knockout mice induced ApoAI-mediated cholesterol efflux in mouse macrophages, which was associated with an enhanced ABCA1 promoter activity, and an increased ABCA1 mRNA and protein expression. In addition, these lipoproteins increased the level of phosphorylated specificity protein 1 (Sp1) and the amount of Sp1 bound to the ABCA1 promoter. However, all these inductions were significantly diminished in cells treated with ApoE-free lipoproteins, when compared to those treated with wild-type lipoproteins. Enrichment with human ApoE3 reversed the reduced inducibility of ApoE-free lipoproteins. Moreover, we observed that inhibition of Sp1 DNA-binding by mithramycin A diminished ABCA1 expression and ApoAI-mediated cholesterol efflux induced by ApoB-carrying lipoproteins, and that mutation of the Sp1-binding motif in the ABCA1 promoter region diminished ApoB-carrying lipoprotein-induced ABCA1 promoter activity. Collectively, these data suggest that ApoE associated with ApoB-carrying lipoproteins has an upregulatory role on ABCA1 expression, and that induction of Sp1 phosphorylation is a mechanism by which ApoE upregulates ABCA1 expression. PMID:21779326

  13. The saci_2123 gene of the hyperthermoacidophile Sulfolobus acidocaldarius encodes an ATP-binding cassette multidrug transporter.


    Yang, Nuan; Driessen, Arnold J M


    Multidrug resistance (MDR) transporters are capable of secreting structurally and functionally unrelated toxic compounds from the cell. Among this group are ATP-binding cassette (ABC) transporters. These membrane proteins are typically arranged as either hetero- or homo-dimers of ABC half-transporters with each subunit consisting of a membrane domain fused at the C-terminus to an ATP-binding domain, or as full transporters in which the two subunits are fused into a single polypeptide. The saci_2123 gene of the thermoacidophilic archaeon Sulfolobus acidocaldarius is the only gene in the genome that encodes an ATP-binding cassette half-transporter, while a homologous gene is present in the genomes of S. solfataricus, S. tokodaii and S islandicus. Saci_2123 shares homology with well-characterized bacterial and mammalian MDR transporters. The saci_2132 gene is up-regulated when cells are exposed to drugs. A deletion mutant of saci_2132 was found to be more vulnerable to a set of toxic compounds, including detergents, antibiotics and uncouplers as compared to the wild-type strain, while the drug resistance could be restored through the plasmid-based expression of saci_2132. These data demonstrate that Saci_2132 is an archaeal ABC-MDR transporter and therefore it was termed Smr1 (Sulfolobus multidrug resistance transporter 1).

  14. Induction of Duplication Reversion in Human Fibroblasts, by Wild-Type and Mutated Sv40 T Antigen, Covaries with the Ability to Induce Host DNA Synthesis

    PubMed Central

    Shammas, M. A.; Xia, S. J.; Reis, RJS.


    Intrachromosomal homologous recombination, manifest as reversion of a 14-kbp duplication in the hypoxanthine phosphoribosyl transferase (HPRT) gene, is elevated in human cells either stably transformed or transiently transfected by the SV40 (simian virus 40) large T antigen gene. Following introduction of wild-type SV40, or any of several T-antigen point mutations in a constant SV40 background, we observed a strong correlation between the stimulation of chromosomal recombination and induction of host-cell DNA synthesis. Moreover, inhibitors of DNA replication (aphidicolin and hydroxyurea) suppress SV40-induced homologous recombination to the extent that they suppress DNA synthesis. Stable integration of plasmids encoding T antigen also augments homologous recombination, which is suppressed by aphidicolin. We infer that the mechanism by which T antigen stimulates homologous recombination in human fibroblasts involves DNA replicative synthesis. PMID:9258684

  15. Endothelial ATP-binding cassette G1 in mouse endothelium protects against hemodynamic-induced atherosclerosis

    SciTech Connect

    Xue, Shanshan; Wang, Jiaxing; Zhang, Xu; Shi, Ying; Li, Bochuan; Bao, Qiankun; Pang, Wei; Ai, Ding; Zhu, Yi; He, Jinlong


    Activated vascular endothelium inflammation under persistent hyperlipidemia is the initial step of atherogenesis. ATP-binding cassette G1 (ABCG1) is a crucial factor maintaining sterol and lipid homeostasis by transporting cholesterol efflux to high-density lipoprotein. In this study, we investigated the protective effects of ABCG1 in endothelial inflammation activation during early-stage atherogenesis in mice and the underlying mechanisms. Endothelial cell (EC)-specific ABCG1 transgenic (EC-ABCG1-Tg) mice were generated and cross-bred with low-density lipoprotein receptor–deficient (Ldlr{sup −/−}) mice. After a 4-week Western-type diet, the mice were sacrificed for assessing atherosclerosis. Human umbilical vein ECs were treated with different flows, and ABCG1 was adenovirally overexpressed to investigate the mechanism in vitro. Compared with Ldlr{sup −/−} mouse aortas, EC-ABCG1-Tg/Ldlr{sup −/−} aortas showed decreased early-stage lesions. Furthermore, the lesion area in the EC-ABCG1-Tg/Ldlr{sup −/−} mouse aortic arch but not thoracic aorta was significantly reduced, which suggests a protective role of ABCG1 under atheroprone flow. In vitro, overexpression of ABCG1 attenuated EC activation caused by oscillatory shear stress. Overexpression of ABCG1 blunted cholesterol-activated ECs in vitro. In exploring the mechanisms of ABCG1 attenuating endothelial inflammation, we found that ABCG1 inhibited oscillatory flow-activated nuclear factor kappa B and NLRP3 inflammasome in ECs. ABCG1 may play a protective role in early-stage atherosclerosis by reducing endothelial activation induced by oscillatory shear stress via suppressing the inflammatory response. - Highlights: • EC-ABCG1-Tg mice in a Ldlr{sup −/−} background showed decreased atherosclerosis. • Overexpression of ABCG1 in ECs decreased OSS-induced EC activation. • NLRP3 and NF-κB might be an underlying mechanism of ABCG1 protective role.

  16. Simian virus 40 DNA replication correlates with expression of a particular subclass of T antigen in a human glial cell line.


    Deminie, C A; Norkin, L C


    Immunocytochemistry and in situ hybridization were used to identify simian virus 40 (SV40) large T-antigen expression and viral DNA replication in individual cells of infected semipermissive human cell lines. SV40 infection aborts before T-antigen expression in many cells of each of the human cell lines examined. In all but one of the human cell lines, most of the T-antigen-producing cells replicated viral DNA. However, in the A172 line of human glial cells only a small percentage of the T-antigen-expressing cells replicated viral DNA. Since different structural and functional classes of T antigen can be recognized with anti-T monoclonal antibodies, we examined infected A172 cells with a panel of 10 anti-T monoclonal antibodies to determine whether viral DNA replication might correlate with the expression of a particular epitope of T antigen. One anti-T monoclonal antibody, PAb 100, did specifically recognize that subset of A172 cells which replicated SV40 DNA. The percentage of PAb 100-reactive A172 cells was dramatically increased by the DNA synthesis inhibitors hydroxyurea and aphidicolin. Removal of the hydroxyurea was followed by an increase in the percentage of cells replicating viral DNA corresponding to the increased percentage reactive with PAb 100. The pattern of SV40 infection in A172 cells was not altered by infection with viable viral mutants containing lesions in the small t protein, the agnoprotein, or the enhancer region. Finally, in situ hybridization was used to show that the percentage of human cells expressing T antigen was similar to the percentage transcribing early SV40 mRNA. Thus, the block to T-antigen expression in human cells is at a stage prior to transcription of early SV40 mRNA.

  17. Simian virus 40 DNA replication correlates with expression of a particular subclass of T antigen in a human glial cell line.

    PubMed Central

    Deminie, C A; Norkin, L C


    Immunocytochemistry and in situ hybridization were used to identify simian virus 40 (SV40) large T-antigen expression and viral DNA replication in individual cells of infected semipermissive human cell lines. SV40 infection aborts before T-antigen expression in many cells of each of the human cell lines examined. In all but one of the human cell lines, most of the T-antigen-producing cells replicated viral DNA. However, in the A172 line of human glial cells only a small percentage of the T-antigen-expressing cells replicated viral DNA. Since different structural and functional classes of T antigen can be recognized with anti-T monoclonal antibodies, we examined infected A172 cells with a panel of 10 anti-T monoclonal antibodies to determine whether viral DNA replication might correlate with the expression of a particular epitope of T antigen. One anti-T monoclonal antibody, PAb 100, did specifically recognize that subset of A172 cells which replicated SV40 DNA. The percentage of PAb 100-reactive A172 cells was dramatically increased by the DNA synthesis inhibitors hydroxyurea and aphidicolin. Removal of the hydroxyurea was followed by an increase in the percentage of cells replicating viral DNA corresponding to the increased percentage reactive with PAb 100. The pattern of SV40 infection in A172 cells was not altered by infection with viable viral mutants containing lesions in the small t protein, the agnoprotein, or the enhancer region. Finally, in situ hybridization was used to show that the percentage of human cells expressing T antigen was similar to the percentage transcribing early SV40 mRNA. Thus, the block to T-antigen expression in human cells is at a stage prior to transcription of early SV40 mRNA. Images PMID:2164596

  18. ATP binding and hydrolysis-driven rate-determining events in the RFC-catalyzed PCNA clamp loading reaction.


    Sakato, Miho; Zhou, Yayan; Hingorani, Manju M


    The multi-subunit replication factor C (RFC) complex loads circular proliferating cell nuclear antigen (PCNA) clamps onto DNA where they serve as mobile tethers for polymerases and coordinate the functions of many other DNA metabolic proteins. The clamp loading reaction is complex, involving multiple components (RFC, PCNA, DNA, and ATP) and events (minimally: PCNA opening/closing, DNA binding/release, and ATP binding/hydrolysis) that yield a topologically linked clamp·DNA product in less than a second. Here, we report pre-steady-state measurements of several steps in the reaction catalyzed by Saccharomyces cerevisiae RFC and present a comprehensive kinetic model based on global analysis of the data. Highlights of the reaction mechanism are that ATP binding to RFC initiates slow activation of the clamp loader, enabling it to open PCNA (at ~2 s(-1)) and bind primer-template DNA (ptDNA). Rapid binding of ptDNA leads to formation of the RFC·ATP·PCNA(open)·ptDNA complex, which catalyzes a burst of ATP hydrolysis. Another slow step in the reaction follows ATP hydrolysis and is associated with PCNA closure around ptDNA (8 s(-1)). Dissociation of PCNA·ptDNA from RFC leads to catalytic turnover. We propose that these early and late rate-determining events are intramolecular conformational changes in RFC and PCNA that control clamp opening and closure, and that ATP binding and hydrolysis switch RFC between conformations with high and low affinities, respectively, for open PCNA and ptDNA, and thus bookend the clamp loading reaction.

  19. Distribution and characterisation of [3H]alpha,beta-methylene ATP binding sites in the rat.


    Michel, A D; Humphrey, P P


    Radioligand binding studies have been performed to study the distribution of the binding sites for the P2x purinoceptor selective agonist radioligand, [3H]alpha,beta-methylene ATP ([3H]alpha beta-meATP), in membranes prepared from various peripheral organs and several brain regions of the rat. In agreement with previous studies in the rat vas deferens, [3H]alpha beta-meATP labelled two populations of sites. One site exhibited high affinity for the ligand (Kd = 0.7 nM; Bmax = 1012 protein) while the other site exhibited lower affinity (Kd = 70.8 nM) and higher capacity (Bmax) = 7470 protein). In competition studies, using a low concentration of radioligand (1 nM), the high affinity alpha beta-meATP binding sites in vas deferens membranes could be preferentially labelled (84-91%). Under these conditions, the P2x purinoceptor agonists, alpha beta-meATP and beta, gamma-methylene ATP, had the highest affinity with pIC50 values of 8.3 and 7.3 respectively. The P2y purinoceptor agonist, 2-methyl-thio-ATP (2-me-S-ATP), had lower affinity (pIC50 = 6.7), while uridine triphosphate, adenosine diphosphate and adenosine, agonists at the P2u, P2t and P1 purinoceptors, respectively, possessed low affinity (pIC50 values < 5.6). In addition, the P2 purinoceptor antagonists, cibacron blue and suramin, inhibited binding over the same concentration range at which they behave as functional antagonists at the P2x purinoceptor. High and low affinity binding sites for [3H]alpha beta-meATP were also identified in a range of other peripheral tissues (spleen, heart and liver) and in several brain regions (striatum, cerebral cortex, hippocampus). In the spleen, heart, cerebral cortex and liver the Kd values at both the high affinity binding sites (Kd = 1-1.2 nM) and the low affinity binding sites (Kd = 98-158 nM) were similar to the respective Kd values at the high and low affinity binding sites in the vas deferens. In competition studies performed using a low

  20. Formycin triphosphate as a probe for the ATP binding site involved in the activation of guanylate cyclase.


    Chang, C H; Yu, Z N; Song, D L


    Formycin A triphosphate (FTP), a fluorescent analog of ATP, slightly increased basal guanylate cyclase activity, but significantly potentiated guanylate cyclase activity stimulated by atrial natriuretic factor (ANF) in rat lung membranes. FTP potentiated ANF-stimulated guanylate cyclase activity with an EC50 at about 90 microM and inhibited ATP-stimulated guanylate cyclase activity with an IC50 at about 100 microM. These results indicate that FTP binds more tightly than ATP for the same binding site. Therefore, FTP would be an excellent tool for studying the ATP binding site.

  1. Activation of ATP binding for the autophosphorylation of DosS, a Mycobacterium tuberculosis histidine kinase lacking an ATP lid motif.


    Cho, Ha Yeon; Lee, Young-Hoon; Bae, Young-Seuk; Kim, Eungbin; Kang, Beom Sik


    The sensor histidine kinases of Mycobacterium tuberculosis, DosS and DosT, are responsible for sensing hypoxic conditions and consist of sensor and kinase cores responsible for accepting signals and phosphorylation activity, respectively. The kinase core contains a dimerization and histidine phosphate-accepting (DHp) domain and an ATP binding domain (ABD). The 13 histidine kinase genes of M. tuberculosis can be grouped based on the presence or absence of the ATP lid motif and F box (elements known to play roles in ATP binding) in their ABDs; DosS and DosT have ABDs lacking both these elements, and the crystal structures of their ABDs indicated that they were unsuitable for ATP binding, as a short loop covers the putative ATP binding site. Although the ABD alone cannot bind ATP, the kinase core is functional in autophosphorylation. Appropriate spatial arrangement of the ABD and DHp domain within the kinase core is required for both autophosphorylation and ATP binding. An ionic interaction between Arg(440) in the DHp domain and Glu(537) in the short loop of the ABD is available and may open the ATP binding site, by repositioning the short loop away from the site. Mutations at Arg(440) and Glu(537) reduce autophosphorylation activity. Unlike other histidine kinases containing an ATP lid, which protects bound ATP, DosS is unable to accept ATP until the ABD is properly positioned relative to the histidine; this may prevent unexpected ATP reactions. ATP binding can, therefore, function as a control mechanism for histidine kinase activity.

  2. The allosteric regulatory mechanism of the Escherichia coli MetNI methionine ATP binding cassette (ABC) transporter.


    Yang, Janet G; Rees, Douglas C


    The MetNI methionine importer of Escherichia coli, an ATP binding cassette (ABC) transporter, uses the energy of ATP binding and hydrolysis to catalyze the high affinity uptake of D- and L-methionine. Early in vivo studies showed that the uptake of external methionine is repressed by the level of the internal methionine pool, a phenomenon termed transinhibition. Our understanding of the MetNI mechanism has thus far been limited to a series of crystal structures in an inward-facing conformation. To understand the molecular mechanism of transinhibition, we studied the kinetics of ATP hydrolysis using detergent-solubilized MetNI. We find that transinhibition is due to noncompetitive inhibition by L-methionine, much like a negative feedback loop. Thermodynamic analyses revealed two allosteric methionine binding sites per transporter. This quantitative analysis of transinhibition, the first to our knowledge for a structurally defined transporter, builds upon the previously proposed structurally based model for regulation. This mechanism of regulation at the transporter activity level could be applicable to not only ABC transporters but other types of membrane transporters as well. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  3. Critical role of γ-phosphate in structural transition of Na,K-ATPase upon ATP binding

    NASA Astrophysics Data System (ADS)

    Petrushanko, Irina Yu.; Mitkevich, Vladimir A.; Anashkina, Anastasia A.; Klimanova, Elizaveta A.; Dergousova, Elena A.; Lopina, Olga D.; Makarov, Alexander A.


    Active transport of sodium and potassium ions by Na,K-ATPase is accompanied by the enzyme conformational transition between E1 and E2 states. ATP and ADP bind to Na,K-ATPase in the E1 conformation with similar affinity but the properties of enzyme in complexes with these nucleotides are different. We have studied thermodynamics of Na,K-ATPase binding with adenine nucleotides at different temperatures using isothermal titration calorimetry. Our data indicate that β-phosphate is involved in complex formation by increasing the affinity of adenine nucleotides to Na,K-ATPase by an order of magnitude, while γ-phosphate does not affect it. ATP binding to Na,K-ATPase in contrast to ADP binding generates a structural transition in the enzyme, which is consistent with the movement of a significant portion of the surface area to a solvent-protected state. We propose that ATP binding leads to convergence of the nucleotide-binding and phosphorylation domains transferring the enzyme from the ``E1-open'' to ``E1-closed'' conformation ready for phosphorylation.

  4. ATP-binding cassette-like transporters are involved in the transport of lignin precursors across plasma and vacuolar membranes.


    Miao, Yu-Chen; Liu, Chang-Jun


    Lignin is a complex biopolymer derived primarily from the condensation of three monomeric precursors, the monolignols. The synthesis of monolignols occurs in the cytoplasm. To reach the cell wall where they are oxidized and polymerized, they must be transported across the cell membrane. However, the molecular mechanisms underlying the transport process are unclear. There are conflicting views about whether the transport of these precursors occurs by passive diffusion or is an energized active process; further, we know little about what chemical forms are required. Using isolated plasma and vacuolar membrane vesicles prepared from Arabidopsis, together with applying different transporter inhibitors in the assays, we examined the uptake of monolignols and their derivatives by these native membrane vesicles. We demonstrate that the transport of lignin precursors across plasmalemma and their sequestration into vacuoles are ATP-dependent primary-transport processes, involving ATP-binding cassette-like transporters. Moreover, we show that both plasma and vacuolar membrane vesicles selectively transport different forms of lignin precursors. In the presence of ATP, the inverted plasma membrane vesicles preferentially take up monolignol aglycones, whereas the vacuolar vesicles are more specific for glucoconjugates, suggesting that the different ATP-binding cassette-like transporters recognize different chemical forms in conveying them to distinct sites, and that glucosylation of monolignols is necessary for their vacuolar storage but not required for direct transport into the cell wall in Arabidopsis.

  5. Equilibrated atomic models of outward-facing P-glycoprotein and effect of ATP binding on structural dynamics.


    Pan, Lurong; Aller, Stephen G


    P-glycoprotein (Pgp) is an ATP-binding cassette (ABC) transporter that alternates between inward- and outward-facing conformations to capture and force substrates out of cells like a peristaltic pump. The high degree of similarity in outward-facing structures across evolution of ABC transporters allowed construction of a high-confidence outward-facing Pgp atomic model based on crystal structures of outward-facing Sav1866 and inward-facing Pgp. The model adhered to previous experimentally determined secondary- and tertiary- configurations during all-atom molecular dynamics simulations in the presence or absence of MgATP. Three long lasting (>100 ns) meta-stable states were apparent in the presence of MgATP revealing new insights into alternating access. The two ATP-binding pockets are highly asymmetric resulting in differential control of overall structural dynamics and allosteric regulation of the drug-binding pocket. Equilibrated Pgp has a considerably different electrostatic profile compared to Sav1866 that implicates significant kinetic and thermodynamic differences in transport mechanisms.

  6. The Tomato R Gene Products I-2 and Mi-1 Are Functional ATP Binding Proteins with ATPase Activity

    PubMed Central

    Tameling, Wladimir I. L.; Elzinga, Sandra D. J.; Darmin, Patricia S.; Vossen, Jack H.; Takken, Frank L. W.; Haring, Michel A.; Cornelissen, Ben J. C.


    Most plant disease resistance (R) genes known today encode proteins with a central nucleotide binding site (NBS) and a C-terminal Leu-rich repeat (LRR) domain. The NBS contains three ATP/GTP binding motifs known as the kinase-1a or P-loop, kinase-2, and kinase-3a motifs. In this article, we show that the NBS of R proteins forms a functional nucleotide binding pocket. The N-terminal halves of two tomato R proteins, I-2 conferring resistance to Fusarium oxysporum and Mi-1 conferring resistance to root-knot nematodes and potato aphids, were produced as glutathione S-transferase fusions in Escherichia coli. In a filter binding assay, purified I-2 was found to bind ATP rather than other nucleoside triphosphates. ATP binding appeared to be fully dependent on the presence of a divalent cation. A mutant I-2 protein containing a mutation in the P-loop showed a strongly reduced ATP binding capacity. Thin layer chromatography revealed that both I-2 and Mi-1 exerted ATPase activity. Based on the strong conservation of NBS domains in R proteins of the NBS-LRR class, we propose that they all are capable of binding and hydrolyzing ATP. PMID:12417711

  7. ATP-Binding Pocket-Targeted Suppression of Src and Syk by Luteolin Contributes to Its Anti-Inflammatory Action

    PubMed Central

    Lee, Jeong-Oog; Jeong, Deok; Kim, Mi-Yeon; Cho, Jae Youl


    Luteolin is a flavonoid identified as a major anti-inflammatory component of Artemisia asiatica. Numerous reports have demonstrated the ability of luteolin to suppress inflammation in a variety of inflammatory conditions. However, its exact anti-inflammatory mechanism has not been fully elucidated. In the present study, the anti-inflammatory mode of action in activated macrophages of luteolin from Artemisia asiatica was examined by employing immunoblotting analysis, a luciferase reporter gene assay, enzyme assays, and an overexpression strategy. Luteolin dose-dependently inhibited the secretion of nitric oxide (NO) and prostaglandin E2 (PGE2) and diminished the levels of mRNA transcripts of inducible NO synthase (iNOS), tumor necrosis factor- (TNF-) α, and cyclooxygenase-2 (COX-2) in lipopolysaccharide- (LPS-) and pam3CSK-treated macrophage-like RAW264.7 cells without displaying cytotoxicity. Luteolin displayed potent NO-inhibitory activity and also suppressed the nuclear translocation of NF-κB (p65 and p50) via blockade of Src and Syk, but not other mitogen-activated kinases. Overexpression of wild type Src and point mutants thereof, and molecular modelling studies, suggest that the ATP-binding pocket may be the luteolin-binding site in Src. These results strongly suggest that luteolin may exert its anti-inflammatory action by suppressing the NF-κB signaling cascade via blockade of ATP binding in Src and Syk. PMID:26236111

  8. In vitro reassembly of the ribose ATP-binding cassette transporter reveals a distinct set of transport complexes.


    Clifton, Matthew C; Simon, Michael J; Erramilli, Satchal K; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A; Stauffacher, Cynthia V


    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg(2+). We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg(2+), and VO4); a RbsAC complex in the presence of ADP and Mg(2+); and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters.

  9. Cloning and Iron Transportation of Nucleotide Binding Domain of Cryptosporidium andersoni ATP-Binding Cassette (CaABC) Gene.


    Wang, Ju-Hua; Xue, Xiu-Heng; Zhou, Jie; Fan, Cai-Yun; Xie, Qian-Qian; Wang, Pan


    Cryptosporidium andersoni ATP-binding cassette (CaABC) is an important membrane protein involved in substrate transport across the membrane. In this research, the nucleotide binding domain (NBD) of CaABC gene was amplified by PCR, and the eukaryotic expression vector of pEGFP-C1-CaNBD was reconstructed. Then, the recombinant plasmid of pEGFP-C1-CaNBD was transformed into the mouse intestinal epithelial cells (IECs) to study the iron transportation function of CaABC. The results indicated that NBD region of CaABC gene can significantly elevate the transport efficiency of Ca(2+), Mg(2+), K(+), and HCO3 (-) in IECs (P<0.05). The significance of this study is to find the ATPase inhibitors for NBD region of CaABC gene and to inhibit ATP binding and nutrient transport of CaABC transporter. Thus, C. andersoni will be killed by inhibition of nutrient uptake. This will open up a new way for treatment of cryptosporidiosis.

  10. Exploiting the Unique ATP-Binding Pocket of Toxoplasma Calcium-Dependent Protein Kinase 1 To Identify Its Substrates

    PubMed Central


    Apicomplexan parasites rely on calcium as a second messenger to regulate a variety of essential cellular processes. Calcium-dependent protein kinases (CDPK), which transduce these signals, are conserved among apicomplexans but absent from mammalian hosts, making them attractive targets for therapeutic intervention. Despite their importance, the signaling pathways CDPK regulate remain poorly characterized, and their protein substrates are completely unknown. In Toxoplasma gondii, CDPK1 is required for calcium-regulated secretion from micronemes, thereby controlling motility, invasion, and egress from host cells. CDPK1 is unique among parasite and mammalian kinases in containing glycine at the key “gatekeeper” residue, which results in an expanded ATP-binding pocket. In the present study, we use a synthetic ATPγS analogue that displays steric complementarity to the ATP-binding pocket and hence allows identification of protein substrates based on selective thiophosphorylation. The specificity of this approach was validated by the concordance between the identified phosphorylation sites and the in vitro substrate preference of CDPK1. We further demonstrate that the phosphorylation of predicted substrates is dependent on CDPK1 both in vivo and in vitro. This combined strategy for identifying the targets of specific protein kinases provides a platform for defining the roles of CDPKs in apicomplexans. PMID:23530747

  11. ATP-binding cassette-like transporters are involved in the transport of lignin precursors across plasma and vacuolar membranes

    SciTech Connect

    Miao, Y.C.; Liu, C.


    Lignin is a complex biopolymer derived primarily from the condensation of three monomeric precursors, the monolignols. The synthesis of monolignols occurs in the cytoplasm. To reach the cell wall where they are oxidized and polymerized, they must be transported across the cell membrane. However, the molecular mechanisms underlying the transport process are unclear. There are conflicting views about whether the transport of these precursors occurs by passive diffusion or is an energized active process; further, we know little about what chemical forms are required. Using isolated plasma and vacuolar membrane vesicles prepared from Arabidopsis, together with applying different transporter inhibitors in the assays, we examined the uptake of monolignols and their derivatives by these native membrane vesicles. We demonstrate that the transport of lignin precursors across plasmalemma and their sequestration into vacuoles are ATP-dependent primary-transport processes, involving ATP-binding cassette-like transporters. Moreover, we show that both plasma and vacuolar membrane vesicles selectively transport different forms of lignin precursors. In the presence of ATP, the inverted plasma membrane vesicles preferentially take up monolignol aglycones, whereas the vacuolar vesicles are more specific for glucoconjugates, suggesting that the different ATP-binding cassette-like transporters recognize different chemical forms in conveying them to distinct sites, and that glucosylation of monolignols is necessary for their vacuolar storage but not required for direct transport into the cell wall in Arabidopsis.

  12. Induction of interferon-stimulated genes by Simian virus 40 T antigens

    SciTech Connect

    Rathi, Abhilasha V.; Cantalupo, Paul G.; Sarkar, Saumendra N.; Pipas, James M.


    Simian virus 40 (SV40) large T antigen (TAg) is a multifunctional oncoprotein essential for productive viral infection and for cellular transformation. We have used microarray analysis to examine the global changes in cellular gene expression induced by wild-type T antigen (TAg{sup wt}) and TAg-mutants in mouse embryo fibroblasts (MEFs). The expression profile of approximately 800 cellular genes was altered by TAg{sup wt} and a truncated TAg (TAg{sup N136}), including many genes that influence cell cycle, DNA-replication, transcription, chromatin structure and DNA repair. Unexpectedly, we found a significant number of immune response genes upregulated by TAg{sup wt} including many interferon-stimulated genes (ISGs) such as ISG56, OAS, Rsad2, Ifi27 and Mx1. Additionally, we also observed activation of STAT1 by TAg{sup wt}. Our genetic studies using several TAg-mutants reveal an unexplored function of TAg and indicate that the LXCXE motif and p53 binding are required for the upregulation of ISGs.

  13. Genome-wide analysis of ATP-binding cassette (ABC) proteins in a model legume plant, Lotus japonicus: comparison with Arabidopsis ABC protein family.


    Sugiyama, Akifumi; Shitan, Nobukazu; Sato, Shusei; Nakamura, Yasukazu; Tabata, Satoshi; Yazaki, Kazufumi


    ATP-binding cassette (ABC) proteins constitute a large family in plants with more than 120 members each in Arabidopsis and rice, and have various functions including the transport of auxin and alkaloid, as well as the regulation of stomata movement. In this report, we carried out genome-wide analysis of ABC protein genes in a model legume plant, Lotus japonicus. For analysis of the Lotus genome sequence, we devised a new method 'domain-based clustering analysis', where domain structures like the nucleotide-binding domain (NBD) and transmembrane domain (TMD), instead of full-length amino acid sequences, are used to compare phylogenetically each other. This method enabled us to characterize fragments of ABC proteins, which frequently appear in a draft sequence of the Lotus genome. We identified 91 putative ABC proteins in L. japonicus, i.e. 43 'full-size', 40 'half-size' and 18 'soluble' putative ABC proteins. The characteristic feature of the composition is that Lotus has extraordinarily many paralogs similar to AtMRP14 and AtPDR12, which are at least six and five members, respectively. Expression analysis of the latter genes performed with real-time quantitative reverse transcription-PCR revealed their putative involvement in the nodulation process.

  14. Whole-transcriptome survey of the putative ATP-binding cassette (ABC) transporter family genes in the latex-producing laticifers of Hevea brasiliensis.


    Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng


    The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 'full-size', 21 'half-size' and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis.

  15. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells

    SciTech Connect

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao


    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  16. Pathogen-responsive expression of a putative ATP-binding cassette transporter gene conferring resistance to the diterpenoid sclareol is regulated by multiple defense signaling pathways in Arabidopsis.


    Campbell, Emma J; Schenk, Peer M; Kazan, Kemal; Penninckx, Iris A M A; Anderson, Jonathan P; Maclean, Don J; Cammue, Bruno P A; Ebert, Paul R; Manners, John M


    The ATP-binding cassette (ABC) transporters are encoded by large gene families in plants. Although these proteins are potentially involved in a number of diverse plant processes, currently, very little is known about their actual functions. In this paper, through a cDNA microarray screening of anonymous cDNA clones from a subtractive library, we identified an Arabidopsis gene (AtPDR12) putatively encoding a member of the pleiotropic drug resistance (PDR) subfamily of ABC transporters. AtPDR12 displayed distinct induction profiles after inoculation of plants with compatible and incompatible fungal pathogens and treatments with salicylic acid, ethylene, or methyl jasmonate. Analysis of AtPDR12 expression in a number of Arabidopsis defense signaling mutants further revealed that salicylic acid accumulation, NPR1 function, and sensitivity to jasmonates and ethylene were all required for pathogen-responsive expression of AtPDR12. Germination assays using seeds from an AtPDR12 insertion line in the presence of sclareol resulted in lower germination rates and much stronger inhibition of root elongation in the AtPDR12 insertion line than in wild-type plants. These results suggest that AtPDR12 may be functionally related to the previously identified ABC transporters SpTUR2 and NpABC1, which transport sclareol. Our data also point to a potential role for terpenoids in the Arabidopsis defensive armory.

  17. Whole-Transcriptome Survey of the Putative ATP-Binding Cassette (ABC) Transporter Family Genes in the Latex-Producing Laticifers of Hevea brasiliensis

    PubMed Central

    Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng


    The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 ‘full-size’, 21 ‘half-size’ and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis. PMID:25615936

  18. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells.


    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao


    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  19. A 20(S)-protopanoxadiol derivative overcomes multi-drug resistance by antagonizing ATP-binding cassette subfamily B member 1 transporter function

    PubMed Central

    Chen, Wantao; Xu, Qin; Xiao, Meng; Hu, Lihong; Mao, Li; Wang, Xu


    In cancer cells, failure of chemotherapy is often caused by the ATP-binding cassette subfamily B member 1 (ABCB1), and few drugs have been successfully developed to overcome ABCB1-mediated multi-drug resistance (MDR). To suppress ABCB1 activity, we previously designed and synthesized a new series of derivatives based on 20(S)-protopanoxadiol (PPD). In the present study, we investigated the role of PPD derivatives in the function of ABC transporters. Non-toxic concentrations of the PPD derivative PPD12 sensitized ABCB1-overexpressing cells to their anti-cancer substrates better than either the parental PPD or inactive PPD11. PPD12 increased intracellular accumulation of adriamycin and rhodamine123 in resistant cancer cells. Although PPD12 did not suppress the expression of ABCB1 mRNA or protein, it stimulated the activity of ABCB1 ATPase. Because PPD12 is a competitive inhibitor, it was predicted to bind to the large hydrophobic cavity of homology-modeled human ABCB1. PPD12 also enhanced the efficacy of adriamycin against ABCB1-overexpressing KB/VCR xenografts in nude mice. In conclusion, PPD12 enhances the efficacy of substrate drugs in ABCB1-overexpressing cancer cells. These findings suggest that a combination therapy consisting of PPD12 with conventional chemotherapeutic agents may be an effective treatment for ABCB1-mediated MDR cancer patients. PMID:26824187

  20. Discovery of STL polyomavirus, a polyomavirus of ancestral recombinant origin that encodes a unique T antigen by alternative splicing.


    Lim, Efrem S; Reyes, Alejandro; Antonio, Martin; Saha, Debasish; Ikumapayi, Usman N; Adeyemi, Mitchell; Stine, O Colin; Skelton, Rebecca; Brennan, Daniel C; Mkakosya, Rajhab S; Manary, Mark J; Gordon, Jeffrey I; Wang, David


    The family Polyomaviridae is comprised of circular double-stranded DNA viruses, several of which are associated with diseases, including cancer, in immunocompromised patients. Here we describe a novel polyomavirus recovered from the fecal microbiota of a child in Malawi, provisionally named STL polyomavirus (STLPyV). We detected STLPyV in clinical stool specimens from USA and The Gambia at up to 1% frequency. Complete genome comparisons of two STLPyV strains demonstrated 5.2% nucleotide divergence. Alternative splicing of the STLPyV early region yielded a unique form of T antigen, which we named 229T, in addition to the expected large and small T antigens. STLPyV has a mosaic genome and shares an ancestral recombinant origin with MWPyV. The discovery of STLPyV highlights a novel alternative splicing strategy and advances our understanding of the complex evolutionary history of polyomaviruses.

  1. ATP binding and hydrolysis steps of the uni-site catalysis by the mitochondrial F(1)-ATPase are affected by inorganic phosphate.


    Milgrom, Yakov M


    The effect of inorganic phosphate (P(i)) on uni-site ATP binding and hydrolysis by the nucleotide-depleted F(1)-ATPase from beef heart mitochondria (ndMF(1)) has been investigated. It is shown for the first time that P(i) decreases the apparent rate constant of uni-site ATP binding by ndMF(1) 3-fold with the K(d) of 0.38+/-0.14mM. During uni-site ATP hydrolysis, P(i) also shifts equilibrium between bound ATP and ADP+P(i) in the direction of ATP synthesis with the K(d) of 0.17+/-0.03mM. However, 10mM P(i) does not significantly affect ATP binding during multi-site catalysis.

  2. Polyoma small T antigen triggers cell death via mitotic catastrophe

    PubMed Central

    Fernando, Arun T Pores; Andrabi, Shaida; Cizmecioglu, Onur; Zhu, Cailei; Livingston, David M.; Higgins, Jonathan M.G; Schaffhausen, Brian S; Roberts, Thomas M


    Polyoma small T antigen (PyST), an early gene product of the polyoma virus, has been shown to cause cell death in a number of mammalian cells in a protein phosphatase 2A (PP2A)-dependent manner. In the current study, using a cell line featuring regulated expression of PyST, we found that PyST arrests cells in mitosis. Live-cell and immunofluorescence studies showed that the majority of the PyST-expressing cells were arrested in prometaphase with almost no cells progressing beyond metaphase. These cells exhibited defects in chromosomal congression, sister chromatid cohesion and spindle positioning, resulting in the activation of the Spindle Assembly Checkpoint (SAC). Prolonged mitotic arrest then led to cell death via mitotic catastrophe. Cell cycle inhibitors that block cells in G1/S prevented PyST-induced death. PyST-induced cell death that occurs during M is not dependent on p53 status. These data suggested, and our results confirmed that, PP2A inhibition could be used to preferentially kill cancer cells with p53 mutations that proliferate normally in the presence of cell cycle inhibitors. PMID:24998850

  3. T antigen origin-binding domain of simian virus 40: determinants of specific DNA binding.


    Bradshaw, Elizabeth M; Sanford, David G; Luo, Xuelian; Sudmeier, James L; Gurard-Levin, Zachary A; Bullock, Peter A; Bachovchin, William W


    To better understand origin recognition and initiation of DNA replication, we have examined by NMR complexes formed between the origin-binding domain of SV40 T antigen (T-ag-obd), the initiator protein of the SV40 virus, and cognate and noncognate DNA oligomers. The results reveal two structural effects associated with "origin-specific" binding that are absent in nonspecific DNA binding. The first is the formation of a hydrogen bond (H-bond) involving His 203, a residue that genetic studies have previously identified as crucial to both specific and nonspecific DNA binding in full-length T antigen. In free T-ag-obd, the side chain of His 203 has a pK(a) value of approximately 5, titrating to the N(epsilon)(1)H tautomer at neutral pH (Sudmeier, J. L., et al. (1996) J. Magn. Reson., Ser. B 113, 236-247). In complexes with origin DNA, His 203 N(delta)(1) becomes protonated and remains nontitrating as the imidazolium cation at all pH values from 4 to 8. The H-bonded N(delta1)H resonates at 15.9 ppm, an unusually large N-H proton chemical shift, of a magnitude previously observed only in the catalytic triad of serine proteases at low pH. The formation of this H-bond requires the middle G/C base pair of the recognition pentanucleotide, GAGGC. The second structural effect is a selective distortion of the A/T base pair characterized by a large (0.6 ppm) upfield chemical-shift change of its Watson-Crick proton, while nearby H-bonded protons remain relatively unaffected. The results indicate that T antigen, like many other DNA-binding proteins, may employ "catalytic" or "transition-state-like" interactions in binding its cognate DNA (Jen-Jacobson, L. (1997) Biopolymers 44, 153-180), which may be the solution to the well-known paradox between the relatively modest DNA-binding specificity exhibited by initiator proteins and the high specificity of initiation.

  4. Repositioning of Tyrosine Kinase Inhibitors as Antagonists of ATP-Binding Cassette Transporters in Anticancer Drug Resistance

    PubMed Central

    Wang, Yi-Jun; Zhang, Yun-Kai; Kathawala, Rishil J.; Chen, Zhe-Sheng


    The phenomenon of multidrug resistance (MDR) has attenuated the efficacy of anticancer drugs and the possibility of successful cancer chemotherapy. ATP-binding cassette (ABC) transporters play an essential role in mediating MDR in cancer cells by increasing efflux of drugs from cancer cells, hence reducing the intracellular accumulation of chemotherapeutic drugs. Interestingly, small-molecule tyrosine kinase inhibitors (TKIs), such as AST1306, lapatinib, linsitinib, masitinib, motesanib, nilotinib, telatinib and WHI-P154, have been found to have the capability to overcome anticancer drug resistance by inhibiting ABC transporters in recent years. This review will focus on some of the latest and clinical developments with ABC transporters, TKIs and anticancer drug resistance. PMID:25268163

  5. CpABC, a Cryptosporidium parvum ATP-binding cassette protein at the host–parasite boundary in intracellular stages

    PubMed Central

    Perkins, Margaret E.; Riojas, Ynolde A.; Wu, Teresa W.; Le Blancq, Sylvie M.


    The intracellular parasite Cryptosporidium parvum develops inside a vacuole at the apex of its epithelial host cell. The developing parasite is separated from the host cell cytoplasm by a zone of attachment that consists of an extensively folded membranous structure known as the feeder organelle. It has been proposed that the feeder organelle is the site of regulation of transport of nutrients and drugs into the parasite. In this report, we localize an ≈200-kDa integral membrane protein, CpABC, from Cryptosporidium parvum to the host–parasite boundary, possibly the feeder organelle. The predicted amino acid sequence of CpABC has significant structural similarity with the cystic fibrosis conductance regulator and the multidrug resistance protein subfamily of ATP-binding cassette proteins. This is an example of a parasite-encoded transport protein localized at the parasite–host interface of an intracellular protozoan. PMID:10318953

  6. Evidence for a Molecular Diode-based Mechanism in a Multispecific ATP-binding cassette (ABC) Exporter

    PubMed Central

    Mehla, Jitender; Ernst, Robert; Moore, Rachel; Wakschlag, Adina; Marquis, Mary Kate; Ambudkar, Suresh V.; Golin, John


    ATP-binding cassette multidrug efflux pumps transport a wide range of substrates. Current models suggest that a drug binds relatively tightly to a transport site in the transmembrane domains when the protein is in the closed inward facing conformation. Upon binding of ATP, the transporter can switch to an outward facing (drug off or drug releasing) structure of lower affinity. ATP hydrolysis is critically important for remodeling the drug-binding site to facilitate drug release and to reset the transporter for a new transport cycle. We characterized the novel phenotype of an S1368A mutant that lies in the putative drug-binding pocket of the yeast multidrug transporter Pdr5. This substitution created broad, severe drug hypersensitivity, although drug binding, ATP hydrolysis, and intradomain signaling were indistinguishable from the wild-type control. Several different rhodamine 6G efflux and accumulation assays yielded evidence consistent with the possibility that Ser-1368 prevents reentry of the excluded drug. PMID:25112867

  7. Mycobacterium tuberculosis Universal Stress Protein Rv2623 Regulates Bacillary Growth by ATP Binding: Requirement for Establishing Chronic Persistent Infection

    SciTech Connect

    Drumm, J.; Mi, K; Bilder, P; Sun, M; Lim, J; Bielefeldt-Ohmann, H; Basaraba, R; So, M; Zhu, G; et. al.


    Tuberculous latency and reactivation play a significant role in the pathogenesis of tuberculosis, yet the mechanisms that regulate these processes remain unclear. The Mycobacterium tuberculosisuniversal stress protein (USP) homolog, rv2623, is among the most highly induced genes when the tubercle bacillus is subjected to hypoxia and nitrosative stress, conditions thought to promote latency. Induction of rv2623 also occurs when M. tuberculosis encounters conditions associated with growth arrest, such as the intracellular milieu of macrophages and in the lungs of mice with chronic tuberculosis. Therefore, we tested the hypothesis that Rv2623 regulates tuberculosis latency. We observed that an Rv2623-deficient mutant fails to establish chronic tuberculous infection in guinea pigs and mice, exhibiting a hypervirulence phenotype associated with increased bacterial burden and mortality. Consistent with this in vivo growth-regulatory role, constitutive overexpression of rv2623 attenuates mycobacterial growth in vitro. Biochemical analysis of purified Rv2623 suggested that this mycobacterial USP binds ATP, and the 2.9-A-resolution crystal structure revealed that Rv2623 engages ATP in a novel nucleotide-binding pocket. Structure-guided mutagenesis yielded Rv2623 mutants with reduced ATP-binding capacity. Analysis of mycobacteria overexpressing these mutants revealed that the in vitro growth-inhibitory property of Rv2623 correlates with its ability to bind ATP. Together, the results indicate that i M. tuberculosis Rv2623 regulates mycobacterial growth in vitro and in vivo, and ii Rv2623 is required for the entry of the tubercle bacillus into the chronic phase of infection in the host; in addition, iii Rv2623 binds ATP; and iv the growth-regulatory attribute of this USP is dependent on its ATP-binding activity. We propose that Rv2623 may function as an ATP-dependent signaling intermediate in a pathway that promotes persistent infection.

  8. In Vitro Reassembly of the Ribose ATP-binding Cassette Transporter Reveals a Distinct Set of Transport Complexes*

    PubMed Central

    Clifton, Matthew C.; Simon, Michael J.; Erramilli, Satchal K.; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A.; Stauffacher, Cynthia V.


    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg2+. We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg2+, and VO4); a RbsAC complex in the presence of ADP and Mg2+; and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters. PMID:25533465

  9. The Q Motif Is Involved in DNA Binding but Not ATP Binding in ChlR1 Helicase

    PubMed Central

    Ding, Hao; Guo, Manhong; Vidhyasagar, Venkatasubramanian; Talwar, Tanu; Wu, Yuliang


    Helicases are molecular motors that couple the energy of ATP hydrolysis to the unwinding of structured DNA or RNA and chromatin remodeling. The conversion of energy derived from ATP hydrolysis into unwinding and remodeling is coordinated by seven sequence motifs (I, Ia, II, III, IV, V, and VI). The Q motif, consisting of nine amino acids (GFXXPXPIQ) with an invariant glutamine (Q) residue, has been identified in some, but not all helicases. Compared to the seven well-recognized conserved helicase motifs, the role of the Q motif is less acknowledged. Mutations in the human ChlR1 (DDX11) gene are associated with a unique genetic disorder known as Warsaw Breakage Syndrome, which is characterized by cellular defects in genome maintenance. To examine the roles of the Q motif in ChlR1 helicase, we performed site directed mutagenesis of glutamine to alanine at residue 23 in the Q motif of ChlR1. ChlR1 recombinant protein was overexpressed and purified from HEK293T cells. ChlR1-Q23A mutant abolished the helicase activity of ChlR1 and displayed reduced DNA binding ability. The mutant showed impaired ATPase activity but normal ATP binding. A thermal shift assay revealed that ChlR1-Q23A has a melting point value similar to ChlR1-WT. Partial proteolysis mapping demonstrated that ChlR1-WT and Q23A have a similar globular structure, although some subtle conformational differences in these two proteins are evident. Finally, we found ChlR1 exists and functions as a monomer in solution, which is different from FANCJ, in which the Q motif is involved in protein dimerization. Taken together, our results suggest that the Q motif is involved in DNA binding but not ATP binding in ChlR1 helicase. PMID:26474416

  10. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification

    PubMed Central

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A.; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T.; Ruggles, Kelly V.; DeGiorgis, Joseph A.; Kohlwein, Sepp D.; Schon, Eric A.; Sturley, Stephen L.


    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53–36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.—Gulati, S., Balderes, D., Kim, C., Guo, Z. A., Wilcox, L., Area-Gomez, E., Snider, J., Wolinski, H., Stagljar, I., Granato, J. T., Ruggles, K. V., DeGiorgis, J. A., Kohlwein, S. D., Schon, E. A., Sturley, S. L. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification. PMID:26220175

  11. An ATP-binding cassette transporter-like complex governs cell-wall hydrolysis at the bacterial cytokinetic ring.


    Yang, Desirée C; Peters, Nick T; Parzych, Katherine R; Uehara, Tsuyoshi; Markovski, Monica; Bernhardt, Thomas G


    ATP-binding cassette transporters are ubiquitous membrane protein complexes that move substrates across membranes. They do so using ATP-induced conformational changes in their nucleotide-binding domains to alter the conformation of the transport cavity formed by their transmembrane domains. In Escherichia coli, an ATP-binding cassette transporter-like complex composed of FtsE (nucleotide-binding domain) and FtsX (transmembrane domain) has long been known to be important for cytokinesis, but its role in the process has remained mysterious. Here we identify FtsEX as a regulator of cell-wall hydrolysis at the division site. Cell-wall material synthesized by the division machinery is shared initially by daughter cells and must be split by hydrolytic enzymes called "amidases" to drive daughter-cell separation. We recently showed that the amidases require activation at the cytokinetic ring by proteins with LytM domains, of which EnvC is the most critical. In this report, we demonstrate that FtsEX directly recruits EnvC to the septum via an interaction between EnvC and a periplasmic loop of FtsX. Importantly, we also show that FtsEX variants predicted to be ATPase defective still recruit EnvC to the septum but fail to promote cell separation. Our results thus suggest that amidase activation via EnvC in the periplasm is regulated by conformational changes in the FtsEX complex mediated by ATP hydrolysis in the cytoplasm. Since FtsE has been reported to interact with the tubulin-like FtsZ protein, our model provides a potential mechanism for coupling amidase activity with the contraction of the FtsZ cytoskeletal ring.

  12. JC virus T-antigen regulates glucose metabolic pathways in brain tumor cells.


    Noch, Evan; Sariyer, Ilker Kudret; Gordon, Jennifer; Khalili, Kamel


    Recent studies have reported the detection of the human neurotropic virus, JCV, in a significant population of brain tumors, including medulloblastomas. Accordingly, expression of the JCV early protein, T-antigen, which has transforming activity in cell culture and in transgenic mice, results in the development of a broad range of tumors of neural crest and glial origin. Evidently, the association of T-antigen with a range of tumor-suppressor proteins, including p53 and pRb, and signaling molecules, such as β-catenin and IRS-1, plays a role in the oncogenic function of JCV T-antigen. We demonstrate that T-antigen expression is suppressed by glucose deprivation in medulloblastoma cells and in glioblastoma xenografts that both endogenously express T-antigen. Mechanistic studies indicate that glucose deprivation-mediated suppression of T-antigen is partly influenced by 5'-activated AMP kinase (AMPK), an important sensor of the AMP/ATP ratio in cells. In addition, glucose deprivation-induced cell cycle arrest in the G1 phase is blocked with AMPK inhibition, which also prevents T-antigen downregulation. Furthermore, T-antigen prevents G1 arrest and sustains cells in the G2 phase during glucose deprivation. On a functional level, T-antigen downregulation is partially dependent on reactive oxygen species (ROS) production during glucose deprivation, and T-antigen prevents ROS induction, loss of ATP production, and cytotoxicity induced by glucose deprivation. Additionally, we have found that T-antigen is downregulated by the glycolytic inhibitor, 2-deoxy-D-glucose (2-DG), and the pentose phosphate inhibitors, 6-aminonicotinamide and oxythiamine, and that T-antigen modulates expression of the glycolytic enzyme, hexokinase 2 (HK2), and the pentose phosphate enzyme, transaldolase-1 (TALDO1), indicating a potential link between T-antigen and metabolic regulation. These studies point to the possible involvement of JCV T-antigen in medulloblastoma proliferation and the metabolic

  13. ATP-binding motifs play key roles in Krp1p, kinesin-related protein 1, function for bi-polar growth control in fission yeast

    SciTech Connect

    Rhee, Dong Keun; Cho, Bon A; Kim, Hyong Bai . E-mail:


    Kinesin is a microtubule-based motor protein with various functions related to the cell growth and division. It has been reported that Krp1p, kinesin-related protein 1, which belongs to the kinesin heavy chain superfamily, localizes on microtubules and may play an important role in cytokinesis. However, the function of Krp1p has not been fully elucidated. In this study, we overexpressed an intact form and three different mutant forms of Krp1p in fission yeast constructed by site-directed mutagenesis in two ATP-binding motifs or by truncation of the leucine zipper-like motif (LZiP). We observed hyper-extended microtubules and the aberrant nuclear shape in Krp1p-overexpressed fission yeast. As a functional consequence, a point mutation of ATP-binding domain 1 (G89E) in Krp1p reversed the effect of Krp1p overexpression in fission yeast, whereas the specific mutation in ATP-binding domain 2 (G238E) resulted in the altered cell polarity. Additionally, truncation of the leucine zipper-like domain (LZiP) at the C-terminal of Krp1p showed a normal nuclear division. Taken together, we suggest that krp1p is involved in regulation of cell-polarized growth through ATP-binding motifs in fission yeast.

  14. LrABCF1, a GCN-type ATP-binding cassette transporter from Lilium regale, is involved in defense responses against viral and fungal pathogens

    USDA-ARS?s Scientific Manuscript database

    ATP-binding cassette (ABC) transporters are essential for membrane translocation in diverse biological processes, such as plant development and defense response. Here, a general control non-derepressible (GCN)-type ABC transporter gene, designated LrABCF1, was identified from Cucumber mosaic virus (...

  15. Regulation of ATP-binding cassette transporters and cholesterol efflux by glucose in primary human monocytes and murine bone marrow-derived macrophages

    USDA-ARS?s Scientific Manuscript database

    Individuals with type 2 diabetes mellitus are at increased risk of developing atherosclerosis. This may be partially attributable to suppression of macrophage ATP-binding cassette (ABC) transporter mediated cholesterol efflux by sustained elevated blood glucose concentrations. Two models were used...

  16. The PAL1 gene product is a peroxisomal ATP-binding cassette transporter in the yeast Saccharomyces cerevisiae

    PubMed Central


    The PAL1 gene was isolated using PCR and degenerate oligonucleotide primers corresponding to highly conserved amino acid sequence motifs diagnostic of the ATP-binding cassette domain of the superfamily of membrane-bound transport proteins typified by mammalian multidrug resistance transporter 1 and Saccharomyces cerevisiae Ste6. The deduced PAL1 gene product is similar in length to, has the same predicted topology as, and shares the highest degree of amino acid sequence identity with two human proteins, adrenoleukodystrophy protein and peroxisomal membrane protein (70 kD), which are both presumptive ATP- binding cassette transporters thought to be constituents of the peroxisomal membrane. As judged by hybridization of a PAL1 probe to isolated RNA and by expression of a PAL1-lacZ fusion, a PAL1 transcript was only detectable when cells were grown on oleic acid, a carbon source which requires the biogenesis of functional peroxisomes for its metabolism. A pal1delta mutant grew normally on either glucose- or glycerol-containing media; however, unlike PAL1+ cells (or the pal1delta mutant carrying the PAL1 gene on a plasmid), pal1delta cells were unable to grow on either a solid medium or a liquid medium containing oleic acid as the sole carbon source. Antibodies raised against a chimeric protein in which the COOH-terminal domain of Pal1 was fused to glutathione S-transferase specifically recognized a protein in extracts from wild-type cells only when grown on oleic acid; this species represents the PAL1 gene product because it was missing in pal1delta cells and more abundant in pal1delta cells expressing PAL1 from a multicopy plasmid. The Pal1 polypeptide was highly enriched in the organellar pellet fraction prepared from wild-type cells by differential centrifugation and comigrated upon velocity sedimentation in a Nycodenz gradient with a known component of the peroxisomal matrix, e-oxoacyl-CoA thiolase. As judged by both subcellular fractionation and indirect

  17. Fructose Uptake in Sinorhizobium meliloti Is Mediated by a High-Affinity ATP-Binding Cassette Transport System

    PubMed Central

    Lambert, Annie; Østerås, Magne; Mandon, Karine; Poggi, Marie-Christine; Le Rudulier, Daniel


    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (Km of 6 μM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  18. Fructose uptake in Sinorhizobium meliloti is mediated by a high-affinity ATP-binding cassette transport system.


    Lambert, A; Østerås, M; Mandon, K; Poggi, M C; Le Rudulier, D


    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (K(m) of 6 microM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  19. Fasting Induces Nuclear Factor E2-Related Factor 2 and ATP-Binding Cassette Transporters via Protein Kinase A and Sirtuin-1 in Mouse and Human

    PubMed Central

    Kulkarni, Supriya R.; Donepudi, Ajay C.; Xu, Jialin; Wei, Wei; Cheng, Qiuqiong C.; Driscoll, Maureen V.; Johnson, Delinda A.; Johnson, Jeffrey A.; Li, Xiaoling


    Abstract Aims: The purpose of this study was to determine whether 3′-5′-cyclic adenosine monophosphate (cAMP)-protein kinase A (PKA) and Sirtuin-1 (SIRT1) dependent mechanisms modulate ATP-binding Cassette (ABC) transport protein expression. ABC transport proteins (ABCC2–4) are essential for chemical elimination from hepatocytes and biliary excretion. Nuclear factor-E2 related-factor 2 (NRF2) is a transcription factor that mediates ABCC induction in response to chemical inducers and liver injury. However, a role for NRF2 in the regulation of transporter expression in nonchemical models of liver perturbation is largely undescribed. Results: Here we show that fasting increased NRF2 target gene expression through NRF2- and SIRT1–dependent mechanisms. In intact mouse liver, fasting induces NRF2 target gene expression by at least 1.5 to 5-fold. In mouse and human hepatocytes, treatment with 8-Bromoadenosine-cAMP, a cAMP analogue, increased NRF2 target gene expression and antioxidant response element activity, which was decreased by the PKA inhibitor, H-89. Moreover, fasting induced NRF2 target gene expression was decreased in liver and hepatocytes of SIRT1 liver-specific null mice and NRF2-null mice. Lastly, NRF2 and SIRT1 were recruited to MAREs and Antioxidant Response Elements (AREs) in the human ABCC2 promoter. Innovation: Oxidative stress mediated NRF2 activation is well described, yet the influence of basic metabolic processes on NRF2 activation is just emerging. Conclusion: The current data point toward a novel role of nutrient status in regulation of NRF2 activity and the antioxidant response, and indicates that cAMP/PKA and SIRT1 are upstream regulators for fasting-induced activation of the NRF2-ARE pathway. Antioxid. Redox Signal. 20, 15–30. PMID:23725046

  20. AtMRP2, an Arabidopsis ATP binding cassette transporter able to transport glutathione S-conjugates and chlorophyll catabolites: functional comparisons with Atmrp1.

    PubMed Central

    Lu, Y P; Li, Z S; Drozdowicz, Y M; Hortensteiner, S; Martinoia, E; Rea, P A


    Three ATP binding cassette (ABC) transporter-like activities directed toward large amphipathic organic anions have recently been identified on the vacuolar membrane of plant cells. These are the Mg-ATP-energized, vanadate-inhibitable vacuolar accumulation of glutathione S-conjugates (GS conjugates), chlorophyll catabolites, and bile acids, respectively. Although each of these activities previously had been assigned to distinct pumps in native plant membranes, we describe here the molecular cloning, physical mapping, and heterologous expression of a gene, AtMRP2, from Arabidopsis thaliana that encodes a multispecific ABC transporter competent in the transport of both GS conjugates and chlorophyll catabolites. Unlike its isoform, AtMRP1, which transports the model Brassica napus chlorophyll catabolite transporter substrate Bn-NCC-1 at low efficiency, heterologously expressed AtMRP2 has the facility for simultaneous high-efficiency parallel transport of GS conjugates and Bn-NCC-1. The properties of AtMRP2 therefore establish a basis for the manipulation of two previously identified plant ABC transporter activities and provide an explanation for how the comparable transporter in native plant membranes would be systematically mistaken for two distinct transporters. These findings are discussed with respect to the functional organization of AtMRP2, the inability of AtMRP2 and AtMRP1 to transport the model bile acid transporter substrate taurocholate (despite the pronounced sensitivity of both to direct inhibition by this agent), the differential patterns of expression of their genes in the intact plant, and the high capacity of AtMRP2 for the transport of glutathionated herbicides and anthocyanins. PMID:9490749

  1. Molecular phylogenetic study and expression analysis of ATP-binding cassette transporter gene family in Oryza sativa in response to salt stress.


    Saha, Jayita; Sengupta, Atreyee; Gupta, Kamala; Gupta, Bhaskar


    ATP-binding cassette (ABC) transporter is a large gene superfamily that utilizes the energy released from ATP hydrolysis for transporting myriad of substrates across the biological membranes. Although many investigations have been done on the structural and functional analysis of the ABC transporters in Oryza sativa, much less is known about molecular phylogenetic and global expression pattern of the complete ABC family in rice. In this study, we have carried out a comprehensive phylogenetic analysis constructing neighbor-joining and maximum-likelihood trees based on various statistical methods of different ABC protein subfamily of five plant lineages including Chlamydomonas reinhardtii (green algae), Physcomitrella patens (moss), Selaginella moellendorffii (lycophyte), Arabidopsis thaliana (dicot) and O. sativa (monocot) to explore the origin and evolutionary patterns of these ABC genes. We have identified several conserved motifs in nucleotide binding domain (NBD) of ABC proteins among all plant lineages during evolution. Amongst the different ABC protein subfamilies, 'ABCE' has not yet been identified in lower plant genomes (algae, moss and lycophytes). The result indicated that gene duplication and diversification process acted upon these genes as a major operative force creating new groups and subgroups and functional divergence during evolution. We have demonstrated that rice ABCI subfamily consists of only half size transporters that represented highly dynamic members showing maximum sequence variations among the other rice ABC subfamilies. The evolutionary and the expression analysis contribute to a deep insight into the evolution and diversity of rice ABC proteins and their roles in response to salt stress that facilitate our further understanding on rice ABC transporters.

  2. Time-resolved Fourier Transform Infrared Spectroscopy of the Nucleotide-binding Domain from the ATP-binding Cassette Transporter MsbA

    PubMed Central

    Syberg, Falk; Suveyzdis, Yan; Kötting, Carsten; Gerwert, Klaus; Hofmann, Eckhard


    MsbA is an essential Escherichia coli ATP-binding cassette (ABC) transporter involved in the flipping of lipid A across the cytoplasmic membrane. It is a close homologue of human P-glycoprotein involved in multidrug resistance, and it similarly accepts a variety of small hydrophobic xenobiotics as transport substrates. X-ray structures of three full-length ABC multidrug exporters (including MsbA) have been published recently and reveal large conformational changes during the transport cycle. However, how ATP hydrolysis couples to these conformational changes and finally the transport is still an open question. We employed time-resolved FTIR spectroscopy, a powerful method to elucidate molecular reaction mechanisms of soluble and membrane proteins, to address this question with high spatiotemporal resolution. Here, we monitored the hydrolysis reaction in the nucleotide-binding domain of MsbA at the atomic level. The isolated MsbA nucleotide-binding domain hydrolyzed ATP with Vmax = 45 nmol mg−1 min−1, similar to the full-length transporter. A Hill coefficient of 1.49 demonstrates positive cooperativity between the two catalytic sites formed upon dimerization. Global fit analysis of time-resolved FTIR data revealed two apparent rate constants of ∼1 and 0.01 s−1, which were assigned to formation of the catalytic site and hydrolysis, respectively. Using isotopically labeled ATP, we identified specific marker bands for protein-bound ATP (1245 cm−1), ADP (1101 and 1205 cm−1), and free phosphate (1078 cm−1). Cleavage of the β-phosphate–γ-phosphate bond was found to be the rate-limiting step; no protein-bound phosphate intermediate was resolved. PMID:22593573

  3. The ABCC6 transporter: what lessons can be learnt from other ATP-binding cassette transporters?

    PubMed Central

    Vanakker, Olivier M.; Hosen, Mohammad J.; Paepe, Anne De


    ABC transporters represent a large family of ATP-driven transmembrane transporters involved in uni- or bidirectional transfer of a large variety of substrates. Divided in seven families, they represent 48 transporter proteins, several of which have been associated with human disease. Among the latter is ABCC6, a unidirectional exporter protein primarily expressed in liver and kidney. ABCC6 deficiency has been shown to cause the ectopic mineralization disorder pseudoxanthoma elasticum (PXE), characterized by calcification and fragmentation of elastic fibers, resulting in oculocutaneous and cardiovascular symptoms. Unique in the group of connective tissue disorders, the pathophysiological relation between the ABCC6 transporter and ectopic mineralization in PXE remains enigmatic, not in the least because of lack of knowledge on the substrate(s) of ABCC6 and its unusual expression pattern. Because many features, including structure and transport mechanism, are shared by many ABC transporters, it is worthwhile to evaluate if and to what extent the knowledge on the physiology and pathophysiology of these other transporters may provide useful clues toward understanding the (patho)physiological role of ABCC6 and how its deficiency may be dealt with. PMID:24137173

  4. An Operon for a Putative ATP-Binding Cassette Transport System Involved in Acetoin Utilization of Bacillus subtilis

    PubMed Central

    Yoshida, Ken-Ichi; Fujita, Yasutaro; Ehrlich, S. Dusko


    The ytrABCDEF operon of Bacillus subtilis was deduced to encode a putative ATP-binding cassette (ABC) transport system. YtrB and YtrE could be the ABC subunits, and YtrC and YtrD are highly hydrophobic and could form a channel through the cell membrane, while YtrF could be a periplasmic lipoprotein for substrate binding. Expression of the operon was examined in cells grown in a minimal medium. The results indicate that the expression was induced only early in the stationary phase. The six ytr genes form a single operon, transcribed from a putative ςA-dependent promoter present upstream of ytrA. YtrA, which possesses a helix-turn-helix motif of the GntR family, acts probably as a repressor and regulates its own transcription. Inactivation of the operon led to a decrease in maximum cell yield and less-efficient sporulation, suggesting its involvement in the growth in stationary phase and sporulation. It is known that B. subtilis produces acetoin as an external carbon storage compound and then reuses it later during stationary phase and sporulation. When either the entire ytr operon or its last gene, ytrF, was inactivated, the production of acetoin was not affected, but the reuse of acetoin became less efficient. We suggest that the Ytr transport system plays a role in acetoin utilization during stationary phase and sporulation. PMID:10986249

  5. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in the silkworm, Bombyx mori.


    Xie, Xiaodong; Cheng, Tingcai; Wang, Genhong; Duan, Jun; Niu, Weihuan; Xia, Qingyou


    The ATP-binding cassette (ABC) superfamily is a larger protein family with diverse physiological functions in all kingdoms of life. We identified 53 ABC transporters in the silkworm genome, and classified them into eight subfamilies (A-H). Comparative genome analysis revealed that the silkworm has an expanded ABCC subfamily with more members than Drosophila melanogaster, Caenorhabditis elegans, or Homo sapiens. Phylogenetic analysis showed that the ABCE and ABCF genes were highly conserved in the silkworm, indicating possible involvement in fundamental biological processes. Five multidrug resistance-related genes in the ABCB subfamily and two multidrug resistance-associated-related genes in the ABCC subfamily indicated involvement in biochemical defense. Genetic variation analysis revealed four ABC genes that might be evolving under positive selection. Moreover, the silkworm ABCC4 gene might be important for silkworm domestication. Microarray analysis showed that the silkworm ABC genes had distinct expression patterns in different tissues on day 3 of the fifth instar. These results might provide new insights for further functional studies on the ABC genes in the silkworm genome.

  6. L1198F Mutation Resensitizes Crizotinib to ALK by Altering the Conformation of Inhibitor and ATP Binding Sites.


    Li, Jian; Sun, Rong; Wu, Yuehong; Song, Mingzhu; Li, Jia; Yang, Qianye; Chen, Xiaoyi; Bao, Jinku; Zhao, Qi


    The efficacy of anaplastic lymphoma kinase (ALK) positive non-small-cell lung cancer (NSCLC) treatment with small molecule inhibitors is greatly challenged by acquired resistance. A recent study reported the newest generation inhibitor resistant mutation L1198F led to the resensitization to crizotinib, which is the first Food and Drug Administration (FDA) approved drug for the treatment of ALK-positive NSCLC. It is of great importance to understand how this extremely rare event occurred for the purpose of overcoming the acquired resistance of such inhibitors. In this study, we exploited molecular dynamics (MD) simulation to dissect the molecular mechanisms. Our MD results revealed that L1198F mutation of ALK resulted in the conformational change at the inhibitor site and altered the binding affinity of ALK to crizotinib and lorlatinib. L1198F mutation also affected the autoactivation of ALK as supported by the identification of His1124 and Tyr1278 as critical amino acids involved in ATP binding and phosphorylation. Our findings are valuable for designing more specific and potent inhibitors for the treatment of ALK-positive NSCLC and other types of cancer.

  7. A Saccharomyces cerevisiae homolog of the human adrenoleukodystrophy transporter is a heterodimer of two half ATP-binding cassette transporters.

    PubMed Central

    Shani, N; Valle, D


    The adrenoleukodystrophy protein (ALDP) and the 70-kDa peroxisomal membrane protein (PMP70) are half ATP-binding cassette (ABC) transporters in the human peroxisome membrane. ALDP and PMP70 share sequence homology and both are implicated in genetic diseases. PXA1 and YKL741 are Saccharomyces cerevisiae genes that encode homologs of ALDP and PMP70. Pxa1p, a putative ortholog of ALDP, is involved in peroxisomal beta-oxidation of fatty acids while YKL741 is an open reading frame found by the yeast genome sequencing project. Here we designate YKL741 as PXA2 and show that its protein product, Pxa2p, like Pxa1p, is associated with peroxisomes but not required for their assembly. Yeast strains carrying gene disruption of PXA1, PXA2, or both have similar and, in the case of the latter, nonadditive phenotypes. We also find that the stability of Pxa1p, but not Pxa2p, is markedly reduced in the absence of the other. Finally, we find that Pxa1p and Pxa2p coimmuno-precipitate. These genetic and physical data suggest that Pxa1p and Pxa2p heterodimerize to form a complete peroxisomal ABC transporter involved in fatty acid beta-oxidation. This result predicts the presence of similar heterodimeric ABC transporters in the mammalian peroxisome membrane. Images Fig. 1 Fig. 2 Fig. 3 Fig. 4 Fig. 5 Fig. 6 Fig. 7 PMID:8876235

  8. Simulated microgravity alters the expression of cytoskeleton- and ATP-binding-related genes in MLO-Y4 osteocytes

    NASA Astrophysics Data System (ADS)

    Chen, Zhihao; Zhao, Fan; Qi, Yiduo; Hu, Lifang; Li, Dijie; Yin, Chong; Su, Peihong; Zhang, Yan; Ma, Jianhua; Qian, Jing; Zhou, Hongpo; Zou, Yiwei; Qian, Airong


    Bone undergoes dynamic modelling and remodelling processes, and it requires gravity-mediated mechanical stimulation for the maintenance of mineral content and structure. Osteocytes are the most commonly found cells in the mature bone, and they are sensitive to mechanical changes. The purpose of this study was to investigate the effects of microgravity simulated with a random position machine (RPM) on the gene expression profile of osteocytes. Genes sensitive to RPM treatment were sorted on the basis of biological processes, interactions and signalling pathways. Overall, 504 differentially expressed genes (DEGs) in osteocytes cultured under RPM conditions were found. The DEGs were further analysed using bioinformatics tools such as DAVID and iReport. A total of 15 ATP-binding and cytoskeleton-related genes were further confirmed by quantitative real-time PCR (qRT-PCR). Our findings demonstrate that the RPM affected the expression of genes involved in cytoskeleton remodelling and the energy-transfer process in osteocytes. The identification of mechanosensitive genes may enhance our understanding of the roles of osteocytes in mechanosensation and may provide some potential targets for preventing and treating bone-related diseases.

  9. The ATP-binding cassette transporter OsABCG15 is required for anther development and pollen fertility in rice.


    Niu, Bai-Xiao; He, Fu-Rong; He, Ming; Ren, Ding; Chen, Le-Tian; Liu, Yao-Guang


    Plant male reproductive development is a complex biological process, but the underlying mechanism is not well understood. Here, we characterized a rice (Oryza sativa L.) male sterile mutant. Based on map-based cloning and sequence analysis, we identified a 1,459-bp deletion in an adenosine triphosphate (ATP)-binding cassette (ABC) transporter gene, OsABCG15, causing abnormal anthers and male sterility. Therefore, we named this mutant osabcg15. Expression analysis showed that OsABCG15 is expressed specifically in developmental anthers from stage 8 (meiosis II stage) to stage 10 (late microspore stage). Two genes CYP704B2 and WDA1, involved in the biosynthesis of very-long-chain fatty acids for the establishment of the anther cuticle and pollen exine, were downregulated in osabcg15 mutant, suggesting that OsABCG15 may play a key function in the processes related to sporopollenin biosynthesis or sporopollenin transfer from tapetal cells to anther locules. Consistently, histological analysis showed that osabcg15 mutants developed obvious abnormality in postmeiotic tapetum degeneration, leading to rapid degredation of young microspores. The results suggest that OsABCG15 plays a critical role in exine formation and pollen development, similar to the homologous gene of AtABCG26 in Arabidopsis. This work is helpful to understand the regulatory network in rice anther development.

  10. Linsitinib (OSI-906) antagonizes ATP-binding cassette subfamily G member 2 and subfamily C member 10-mediated drug resistance.


    Zhang, Hui; Kathawala, Rishil J; Wang, Yi-Jun; Zhang, Yun-Kai; Patel, Atish; Shukla, Suneet; Robey, Robert W; Talele, Tanaji T; Ashby, Charles R; Ambudkar, Suresh V; Bates, Susan E; Fu, Li-Wu; Chen, Zhe-Sheng


    In this study we investigated the effect of linsitinib on the reversal of multidrug resistance (MDR) mediated by the overexpression of the ATP-binding cassette (ABC) subfamily members ABCB1, ABCG2, ABCC1 and ABCC10. Our results indicate for the first time that linsitinib significantly potentiate the effect of anti-neoplastic drugs mitoxantrone (MX) and SN-38 in ABCG2-overexpressing cells; paclitaxel, docetaxel and vinblastine in ABCC10-overexpressing cells. Linsitinib moderately enhanced the cytotoxicity of vincristine in cell lines overexpressing ABCB1, whereas it did not alter the cytotoxicity of substrates of ABCC1. Furthermore, linsitinib significantly increased the intracellular accumulation and decreased the efflux of [(3)H]-MX in ABCG2-overexpressing cells and [(3)H]-paclitaxel in ABCC10-overexpressing cells. However, linsitinib, at a concentration that reversed MDR, did not significantly alter the expression levels of either the ABCG2 or ABCC10 transporter proteins. Furthermore, linsitinib did not significantly alter the intracellular localization of ABCG2 or ABCC10. Moreover, linsitinib stimulated the ATPase activity of ABCG2 in a concentration-dependent manner. Overall, our study suggests that linsitinib attenuates ABCG2- and ABCC10-mediated MDR by directly inhibiting their function as opposed to altering ABCG2 or ABCC10 protein expression.

  11. An operon for a putative ATP-binding cassette transport system involved in acetoin utilization of Bacillus subtilis.


    Yoshida, K I; Fujita, Y; Ehrlich, S D


    The ytrABCDEF operon of Bacillus subtilis was deduced to encode a putative ATP-binding cassette (ABC) transport system. YtrB and YtrE could be the ABC subunits, and YtrC and YtrD are highly hydrophobic and could form a channel through the cell membrane, while YtrF could be a periplasmic lipoprotein for substrate binding. Expression of the operon was examined in cells grown in a minimal medium. The results indicate that the expression was induced only early in the stationary phase. The six ytr genes form a single operon, transcribed from a putative sigma(A)-dependent promoter present upstream of ytrA. YtrA, which possesses a helix-turn-helix motif of the GntR family, acts probably as a repressor and regulates its own transcription. Inactivation of the operon led to a decrease in maximum cell yield and less-efficient sporulation, suggesting its involvement in the growth in stationary phase and sporulation. It is known that B. subtilis produces acetoin as an external carbon storage compound and then reuses it later during stationary phase and sporulation. When either the entire ytr operon or its last gene, ytrF, was inactivated, the production of acetoin was not affected, but the reuse of acetoin became less efficient. We suggest that the Ytr transport system plays a role in acetoin utilization during stationary phase and sporulation.

  12. L1198F Mutation Resensitizes Crizotinib to ALK by Altering the Conformation of Inhibitor and ATP Binding Sites

    PubMed Central

    Li, Jian; Sun, Rong; Wu, Yuehong; Song, Mingzhu; Li, Jia; Yang, Qianye; Chen, Xiaoyi; Bao, Jinku; Zhao, Qi


    The efficacy of anaplastic lymphoma kinase (ALK) positive non-small-cell lung cancer (NSCLC) treatment with small molecule inhibitors is greatly challenged by acquired resistance. A recent study reported the newest generation inhibitor resistant mutation L1198F led to the resensitization to crizotinib, which is the first Food and Drug Administration (FDA) approved drug for the treatment of ALK-positive NSCLC. It is of great importance to understand how this extremely rare event occurred for the purpose of overcoming the acquired resistance of such inhibitors. In this study, we exploited molecular dynamics (MD) simulation to dissect the molecular mechanisms. Our MD results revealed that L1198F mutation of ALK resulted in the conformational change at the inhibitor site and altered the binding affinity of ALK to crizotinib and lorlatinib. L1198F mutation also affected the autoactivation of ALK as supported by the identification of His1124 and Tyr1278 as critical amino acids involved in ATP binding and phosphorylation. Our findings are valuable for designing more specific and potent inhibitors for the treatment of ALK-positive NSCLC and other types of cancer. PMID:28245558

  13. Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter.

    PubMed Central

    Ortiz, D F; Kreppel, L; Speiser, D M; Scheel, G; McDonald, G; Ow, D W


    In response to heavy metal stress, plants and certain fungi, such as the fission yeast Schizosaccharomyces pombe, synthesize small metal-binding peptides known as phytochelatins. We have identified a cadmium sensitive S. pombe mutant deficient in the accumulation of a sulfide-containing phytochelatin-cadmium complex, and have isolated the gene, designated hmt1, that complements this mutant. The deduced protein sequence of the hmt1 gene product shares sequence identity with the family of ABC (ATP-binding cassette)-type transport proteins which includes the mammalian P-glycoproteins and CFTR, suggesting that the encoded product is an integral membrane protein. Analysis of fractionated fission yeast cell components indicates that the HMT1 polypeptide is associated with the vacuolar membrane. Additionally, fission yeast strains harboring an hmt1-expressing multicopy plasmid exhibit enhanced metal tolerance along with a higher intracellular level of cadmium, implying a relationship between HMT1 mediated transport and compartmentalization of heavy metals. This suggests that tissue-specific overproduction of a functional hmt1 product in transgenic plants might be a means to alter the tissue localization of these elements, such as for sequestering heavy metals away from consumable parts of crop plants. Images PMID:1396551

  14. ABCC1, an ATP Binding Cassette Protein from Grape Berry, Transports Anthocyanidin 3-O-Glucosides[W][OA

    PubMed Central

    Francisco, Rita Maria; Regalado, Ana; Ageorges, Agnès; Burla, Bo J.; Bassin, Barbara; Eisenach, Cornelia; Zarrouk, Olfa; Vialet, Sandrine; Marlin, Thérèse; Chaves, Maria Manuela; Martinoia, Enrico; Nagy, Réka


    Accumulation of anthocyanins in the exocarp of red grapevine (Vitis vinifera) cultivars is one of several events that characterize the onset of grape berry ripening (véraison). Despite our thorough understanding of anthocyanin biosynthesis and regulation, little is known about the molecular aspects of their transport. The participation of ATP binding cassette (ABC) proteins in vacuolar anthocyanin transport has long been a matter of debate. Here, we present biochemical evidence that an ABC protein, ABCC1, localizes to the tonoplast and is involved in the transport of glucosylated anthocyanidins. ABCC1 is expressed in the exocarp throughout berry development and ripening, with a significant increase at véraison (i.e., the onset of ripening). Transport experiments using microsomes isolated from ABCC1-expressing yeast cells showed that ABCC1 transports malvidin 3-O-glucoside. The transport strictly depends on the presence of GSH, which is cotransported with the anthocyanins and is sensitive to inhibitors of ABC proteins. By exposing anthocyanin-producing grapevine root cultures to buthionine sulphoximine, which reduced GSH levels, a decrease in anthocyanin concentration is observed. In conclusion, we provide evidence that ABCC1 acts as an anthocyanin transporter that depends on GSH without the formation of an anthocyanin-GSH conjugate. PMID:23723325

  15. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification.


    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T; Ruggles, Kelly V; DeGiorgis, Joseph A; Kohlwein, Sepp D; Schon, Eric A; Sturley, Stephen L


    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53-36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.

  16. ATP Binding to Hemoglobin Response Gene 1 Protein Is Necessary for Regulation of the Mating Type Locus in Candida albicans*

    PubMed Central

    Peterson, Alexander W.; Pendrak, Michael L.; Roberts, David D.


    HBR1 (hemoglobin response gene 1) is an essential gene in Candida albicans that positively regulates mating type locus MTLα gene expression and thereby regulates cell type-specific developmental genes. Hbr1p contains a phosphate-binding loop (P-loop), a highly conserved motif characteristic of ATP- and GTP-binding proteins. Recombinant Hbr1p was isolated in an oligomeric state that specifically bound ATP with Kd ∼2 μm. ATP but not ADP, AMP, GTP, or dATP specifically protected Hbr1p from proteolysis by trypsin. Site-directed mutagenesis of the highly conserved P-loop lysine (K22Q) and the less conserved glycine (G19S) decreased the binding affinity for soluble ATP and ATP immobilized through its γ-phosphate. ATP bound somewhat more avidly than ATPγS to wild type and mutant Hbr1p. Although Hbr1p exhibits sequence motifs characteristic of adenylate kinases, and adenylate kinase and ATPase activities have been reported for the apparent human ortholog of Hbr1p, assays for adenylate kinase activity, autophosphorylation, and ATPase activity proved negative. Overexpression of wild type but not the mutant forms of Hbr1p restored MTlα2 expression in an HBR1/hbr1 mutant, indicating that ATP binding to the P-loop is necessary for this function of Hbr1p. PMID:21372131

  17. Citrulline increases cholesterol efflux from macrophages in vitro and ex vivo via ATP-binding cassette transporters

    PubMed Central

    Uto-Kondo, Harumi; Ayaori, Makoto; Nakaya, Kazuhiro; Takiguchi, Shunichi; Yakushiji, Emi; Ogura, Masatsune; Terao, Yoshio; Ozasa, Hideki; Sasaki, Makoto; Komatsu, Tomohiro; Sotherden, Grace Megumi; Hosoai, Tamaki; Sakurada, Masami; Ikewaki, Katsunori


    Reverse cholesterol transport (RCT) is a mechanism critical to the anti-atherogenic property of HDL. Although citrulline contributes to the amelioration of atherosclerosis via endothelial nitric oxide production, it remains unclear whether it affects RCT. This study was undertaken to clarify the effects of citrulline on expressions of specific transporters such as ATP binding cassette transporters (ABC)A1 and ABCG1, and the cholesterol efflux from macrophages to apolipoprotein (apo) A-I or HDL in vitro and ex vivo. Citrulline increased ABCA1 and ABCG1 mRNA and protein levels in THP-1 macrophages, translating into enhanced apoA-I- and HDL-mediated cholesterol efflux. In the human crossover study, 8 healthy male volunteers (age 30–49 years) consumed either 3.2 g/day citrulline or placebo for 1 week. Citrulline consumption brought about significant increases in plasma levels of citrulline and arginine. Supporting the in vitro data, monocyte-derived macrophages (MDM) differentiated under autologous post-citrulline sera demonstrated enhancement of both apoA-I- and HDL-mediated cholesterol efflux through increased ABCA1 and ABCG1 expressions, compared to MDM differentiated under pre-citrulline sera. However, the placebo did not modulate these parameters. Therefore, in addition to improving endothelium function, citrulline might have an anti-atherogenic property by increasing RCT of HDL. PMID:25120277

  18. HMG-CoA reductase inhibitors enhance phagocytosis by upregulating ATP-binding cassette transporter A7

    PubMed Central

    Tanaka, Nobukiyo; Abe-Dohmae, Sumiko; Iwamoto, Noriyuki; Fitzgerald, Michael L.; Yokoyama, Shinji


    We recently reported that the endogenous ATP-binding cassette transporter (ABC) A7 strongly associates with phagocytosis, being regulated by sterol regulatory element binding protein 2. We therefore examined the effect of statins on phagocytosis in vitro and in vivo through the SREBP-ABCA7. Phagocytosis was found to be enhanced by pravastatin, rosuvastatin and simvastatin and cyclodextrin in J774 macrophages, as cellular cholesterol was reduced and expressions of the cholesterol-related genes were modulated, including an increase of ABCA7 mRNA and decrease of ABCA1 mRNA. Conversely, knock-down of ABCA7 expression by siRNA ablated enhancement of phagocytosis by statins. In vivo, pravastatin enhanced phagocytosis in wild-type mice, but not in ABCA7-knockout mice. We thus concluded that statins enhance phagocytosis through the SREBP-ABCA7 pathway. These findings provide a molecular basis for enhancement of the host-defense system by statins showing that one of their “pleiotropic” effects is in fact achieved through their reaction to a primary target. PMID:21762915

  19. Helical apolipoproteins stabilize ATP-binding cassette transporter A1 by protecting it from thiol protease-mediated degradation.


    Arakawa, Reijiro; Yokoyama, Shinji


    ATP-binding cassette transporter (ABC) A1 was increased by apolipoprotein A-I without an increase of its message in THP-1 cells. The pulse label study demonstrated that apoA-I retarded degradation of ABCA1. Similar changes were demonstrated by apoA-II, but the effect of high density lipoprotein was almost negligible on the basis of equivalent protein concentration. Thiol protease inhibitors (leupeptin and N-acetyl-Leu-Leu-norleucinal (ALLN)) increased ABCA1 and slowed its decay in the cells, whereas none of the proteosome-specific inhibitor lactacystin, other protease inhibitors, or the lysosomal inhibitor NH(4)Cl showed such effects. The effects of apoA-I and ALLN were additive for the increase of ABCA1, and the apoA-I-mediated cellular lipid release was enhanced by ALLN. The data suggest that ABCA1 is rapidly degraded by a thiol protease(s) in the cells unless helical apolipoproteins in their lipid-free form stabilize ABCA1 by protecting it from protease-mediated degradation.

  20. Identification of mutations in regions corresponding to the two putative nucleotide (ATP)-binding folds of the cystic fibrosis gene

    SciTech Connect

    Kerem, B.; Zielenski, J.; Markiewicz, D.; Bozon, D.; Kennedy, D.; Rommens, J.M. ); Gazit, E. ); Yahav, J. ); Riordan, J.R. ); Collins, F.S. ); Tsui, Lapchee Univ. of Toronto, Ontario )


    Additional mutations in the cystic fibrosis (CF) gene were identified in the regions corresponding to the two putative nucleotide (ATP)-binding folds (NBFs) of the predicted polypeptide. The patient cohort included 46 Canadian CF families with well-characterized DNA marker haplotypes spanning the disease locus and several other families from Israel. Eleven mutations were found in the first NBF, 2 were found in the second NBF, but none was found in the R-domain. Seven of the mutations were of the missense type affecting some of the highly conserved amino acid residues in the first NBF; 3 were nonsense mutations; 2 would probably affect mRNA splicing; 2 corresponded to small deletions, including another 3-base-pair deletion different from the major mutation ({delta}F508), which could account for 70% of the CF chromosomes in the population. Nine of these mutations accounted for 12 of the 31 non-{delta}F508 CF chromosomes in the Canadian families. The highly heterogeneous nature of the remaining CF mutations provides important insights into the structure and function of the protein, but it also suggests that DNA-based genetic screening for CF carrier status will not be straightforward.

  1. A critical role of a carboxylate in proton conduction by the ATP-binding cassette multidrug transporter LmrA.


    Shilling, Richard; Federici, Luca; Walas, Fabien; Venter, Henrietta; Velamakanni, Saroj; Woebking, Barbara; Balakrishnan, Lekshmy; Luisi, Ben; van Veen, Hendrik W


    The ATP binding cassette (ABC) transporter LmrA from the bacterium Lactococcus lactis is a homolog of the human multidrug resistance P-glycoprotein (ABCB1), the activity of which impairs the efficacy of chemotherapy. In a previous study, LmrA was shown to mediate ethidium efflux by an ATP-dependent proton-ethidium symport reaction in which the carboxylate E314 is critical. The functional importance of this key residue for ABC proteins was suggested by its conservation in a wider family of related transporters; however, the structural basis of its role was not apparent. Here, we have used homology modeling to define the structural environment of E314. The residue is nested in a hydrophobic environment that probably elevates its pKa, accounting for the pH dependency of drug efflux that we report in this work. Functional analyses of wild-type and mutant proteins in cells and proteoliposomes support our proposal for the mechanistic role of E314 in proton-coupled ethidium transport. As the carboxylate is known to participate in proton translocation by secondary-active transporters, our observations suggest that this substituent can play a similar role in the activity of ABC transporters.

  2. ATP-binding cassette transporter A7 enhances phagocytosis of apoptotic cells and associated ERK signaling in macrophages.


    Jehle, Andreas W; Gardai, Shyra J; Li, Suzhao; Linsel-Nitschke, Patrick; Morimoto, Konosuke; Janssen, William J; Vandivier, R William; Wang, Nan; Greenberg, Steven; Dale, Benjamin M; Qin, Chunbo; Henson, Peter M; Tall, Alan R


    The mammalian ATP-binding cassette transporters A1 and A7 (ABCA1 and -A7) show sequence similarity to CED-7, a Caenorhabditis elegans gene that mediates the clearance of apoptotic cells. Using RNA interference or gene targeting, we show that knock down of macrophage ABCA7 but not -A1 results in defective engulfment of apoptotic cells. In response to apoptotic cells, ABCA7 moves to the macrophage cell surface and colocalizes with the low-density lipoprotein receptor-related protein 1 (LRP1) in phagocytic cups. The cell surface localization of ABCA7 and LRP1 is defective in ABCA7-deficient cells. C1q is an opsonin of apoptotic cells that acts via phagocyte LRP1 to induce extracellular signal-regulated kinase (ERK) signaling. We show that ERK signaling is required for phagocytosis of apoptotic cells and that ERK phosphorylation in response to apoptotic cells or C1q is defective in ABCA7-deficient cells. These studies reveal a major role of ABCA7 and not -A1 in the clearance of apoptotic cells and therefore suggest that ABCA7 is an authentic orthologue of CED-7.

  3. ATP-binding cassette transporter A7 enhances phagocytosis of apoptotic cells and associated ERK signaling in macrophages

    PubMed Central

    Jehle, Andreas W.; Gardai, Shyra J.; Li, Suzhao; Linsel-Nitschke, Patrick; Morimoto, Konosuke; Janssen, William J.; Vandivier, R. William; Wang, Nan; Greenberg, Steven; Dale, Benjamin M.; Qin, Chunbo; Henson, Peter M.; Tall, Alan R.


    The mammalian ATP-binding cassette transporters A1 and A7 (ABCA1 and -A7) show sequence similarity to CED-7, a Caenorhabditis elegans gene that mediates the clearance of apoptotic cells. Using RNA interference or gene targeting, we show that knock down of macrophage ABCA7 but not -A1 results in defective engulfment of apoptotic cells. In response to apoptotic cells, ABCA7 moves to the macrophage cell surface and colocalizes with the low-density lipoprotein receptor–related protein 1 (LRP1) in phagocytic cups. The cell surface localization of ABCA7 and LRP1 is defective in ABCA7-deficient cells. C1q is an opsonin of apoptotic cells that acts via phagocyte LRP1 to induce extracellular signal–regulated kinase (ERK) signaling. We show that ERK signaling is required for phagocytosis of apoptotic cells and that ERK phosphorylation in response to apoptotic cells or C1q is defective in ABCA7-deficient cells. These studies reveal a major role of ABCA7 and not -A1 in the clearance of apoptotic cells and therefore suggest that ABCA7 is an authentic orthologue of CED-7. PMID:16908670

  4. Inventory and general analysis of the ATP-binding cassette (ABC) gene superfamily in maize (Zea mays L.).


    Pang, Kaiyuan; Li, Yanjiao; Liu, Menghan; Meng, Zhaodong; Yu, Yanli


    The metabolic functions of ATP-binding cassette (or ABC) proteins, one of the largest families of proteins presented in all organisms, have been investigated in many protozoan, animal and plant species. To facilitate more systematic and complicated studies on maize ABC proteins in the future, we present the first complete inventory of these proteins, including 130 open reading frames (ORFs), and provide general descriptions of their classifications, basic structures, typical functions, evolution track analysis and expression profiles. The 130 ORFs were assigned to eight subfamilies based on their structures and homological features. Five of these subfamilies consist of 109 proteins, containing transmembrane domains (TM) performing as transporters. The rest three subfamilies contain 21 soluble proteins involved in various functions other than molecular transport. A comparison of ABC proteins among nine selected species revealed either convergence or divergence in each of the ABC subfamilies. Generally, plant genomes contain far more ABC genes than animal genomes. The expression profiles and evolution track of each maize ABC gene were further investigated, the results of which could provide clues for analyzing their functions. Quantitative real-time polymerase chain reaction experiments (PCR) were conducted to detect induced expression in select ABC genes under several common stresses. This investigation provides valuable information for future research on stress tolerance in plants and potential strategies for enhancing maize production under stressful conditions. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Modulating the function of ATP-binding cassette subfamily G member 2 (ABCG2) with inhibitor cabozantinib.


    Zhang, Guan-Nan; Zhang, Yun-Kai; Wang, Yi-Jun; Barbuti, Anna Maria; Zhu, Xi-Jun; Yu, Xin-Yue; Wen, Ai-Wen; Wurpel, John N D; Chen, Zhe-Sheng


    Cabozantinib (XL184) is a small molecule tyrosine kinase receptor inhibitor, which targets c-Met and VEGFR2. Cabozantinib has been approved by the Food and Drug Administration to treat advanced medullary thyroid cancer and renal cell carcinoma. In the present study, we evaluated the ability of cabozantinib to modulate the function of the ATP-binding cassette subfamily G member 2 (ABCG2) by sensitizing cells that are resistant to ABCG2 substrate antineoplastic drugs. We used a drug-selected resistant cell line H460/MX20 and three ABCG2 stable transfected cell lines ABCG2-482-R2, ABCG2-482-G2, and ABCG2-482-T7, which overexpress ABCG2. Cabozantinib, at non-toxic concentrations (3 or 5μM), sensitized the ABCG2-overexpressing cells to mitoxantrone, SN-38, and topotecan. Our results indicate that cabozantinib reverses ABCG2-mediated multidrug resistance by antagonizing the drug efflux function of the ABCG2 transporter instead of downregulating its expression. The molecular docking analysis indicates that cabozantinib binds to the drug-binding site of the ABCG2 transporter. Overall, our findings demonstrate that cabozantinib inhibits the ABCG2 transporter function and consequently enhances the effect of the antineoplastic agents that are substrates of ABCG2. Cabozantinib may be a useful agent in anticancer treatment regimens for patients who are resistant to ABCG2 substrate drugs.

  6. Decreased expression of an ATP-binding cassette transporter, MRP2, in human livers with hepatitis C virus infection.


    Hinoshita, E; Taguchi, K; Inokuchi, A; Uchiumi, T; Kinukawa, N; Shimada, M; Tsuneyoshi, M; Sugimachi, K; Kuwano, M


    To understand hepatic injury during the process of hepatitis viral infection, determination of liver-specific functions at molecular levels is critical. Because the transport of endogenous/exogenous toxic substances is an intrinsically important hepatic function, we examined whether expression of the ATP-binding cassette (ABC) transporter gene was affected in patients with hepatitis viral infection. To determine which ABC transporter was expressed differently in patients with hepatic viral infection, we assayed the expression of MDR1, MDR3, MRP1, MRP2, and MRP3 in non-cancerous regions in the liver of 42 patients with hepatic tumors using both quantitative RT-PCR and immunological staining analysis, and compared the hepatic expression levels between patients with hepatitis viral infection and non-infected controls. Of the five ABC transporter genes studied, the mRNAs of MRP2 and MRP3 were highly expressed in the human liver. There was a significant reduction in MRP2 expression to 29% in the virus-infected liver. Treatment of hepatic cells with inflammatory cytokines resulted in decreased mRNA levels of MRP2 and decreased MRP2 promoter activity. The down-regulation of MRP2 might induce a failure in the transport of various genotoxic substances in the liver with hepatitis virus infection.

  7. Association of ATP-Binding Cassette Transporter A1 Gene Polymorphisms in Type 2 Diabetes Mellitus among Malaysians.


    Haghvirdizadeh, Polin; Ramachandran, Vasudevan; Etemad, Ali; Heidari, Farzad; Ghodsian, Nooshin; Bin Ismail, Norzian; Ismail, Patimah


    Type 2 diabetes mellitus (T2DM) is a complex polygenic disorder characterized by impaired insulin resistance, insulin secretion, and dysregulation of lipid and protein metabolism with environmental and genetic factors. ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms are reported as the one of the genetic risk factors for T2DM in various populations with conflicting results. This study was conducted based on PCR-HRM to determine the frequency of ABCA1 gene by rs2230806 (R219K), rs1800977 (C69T), and rs9282541 (R230C) polymorphisms Malaysian subjects. A total of 164 T2DM and 165 controls were recruited and their genotypes for ABCA1 gene polymorphisms were determined based on the real time high resolution melting analysis. There was a significant difference between the subjects in terms of age, BMI, FPG, HbA1c, HDL, LDL, and TG (P < 0.05). There was a significant association between HOM of R219K (P = 0.005), among Malaysian subjects; moreover, allele frequency revealed the significant difference in A allele of R219K (P = 0.003). But, there was no significant difference in genotypic and allelic frequencies of C69T and R230C polymorphism. R219K polymorphism of ABCA1 gene can be considered as a genetic risk factor for T2DM subjects among Malaysians.

  8. Association of ATP-Binding Cassette Transporter A1 Gene Polymorphisms in Type 2 Diabetes Mellitus among Malaysians

    PubMed Central

    Haghvirdizadeh, Polin; Etemad, Ali; Heidari, Farzad; Ghodsian, Nooshin; Bin Ismail, Norzian


    Background. Type 2 diabetes mellitus (T2DM) is a complex polygenic disorder characterized by impaired insulin resistance, insulin secretion, and dysregulation of lipid and protein metabolism with environmental and genetic factors. ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms are reported as the one of the genetic risk factors for T2DM in various populations with conflicting results. This study was conducted based on PCR-HRM to determine the frequency of ABCA1 gene by rs2230806 (R219K), rs1800977 (C69T), and rs9282541 (R230C) polymorphisms Malaysian subjects. Methods. A total of 164 T2DM and 165 controls were recruited and their genotypes for ABCA1 gene polymorphisms were determined based on the real time high resolution melting analysis. Results. There was a significant difference between the subjects in terms of age, BMI, FPG, HbA1c, HDL, LDL, and TG (P < 0.05). There was a significant association between HOM of R219K (P = 0.005), among Malaysian subjects; moreover, allele frequency revealed the significant difference in A allele of R219K (P = 0.003). But, there was no significant difference in genotypic and allelic frequencies of C69T and R230C polymorphism. Conclusion. R219K polymorphism of ABCA1 gene can be considered as a genetic risk factor for T2DM subjects among Malaysians. PMID:26451383

  9. Exosomal evasion of humoral immunotherapy in aggressive B-cell lymphoma modulated by ATP-binding cassette transporter A3

    PubMed Central

    Aung, Thiha; Chapuy, Bjoern; Vogel, Daniel; Wenzel, Dirk; Oppermann, Martin; Lahmann, Marlen; Weinhage, Toni; Menck, Kerstin; Hupfeld, Timo; Koch, Raphael; Trümper, Lorenz; Wulf, Gerald G.


    Targeting the surface of malignant cells has evolved into a cornerstone in cancer therapy, paradigmatically introduced by the success of humoral immunotherapy against CD20 in malignant lymphoma. However, tumor cell susceptibility to immunochemotherapy varies, with mostly a fatal outcome in cases of resistant disease. Here, we show that lymphoma exosomes shield target cells from antibody attack and that exosome biogenesis is modulated by the lysosome-related organelle-associated ATP-binding cassette (ABC) transporter A3 (ABCA3). B-cell lymphoma cells released exosomes that carried CD20, bound therapeutic anti-CD20 antibodies, consumed complement, and protected target cells from antibody attack. ABCA3, previously shown to mediate resistance to chemotherapy, was critical for the amounts of exosomes released, and both pharmacological blockade and the silencing of ABCA3 enhanced susceptibility of target cells to antibody-mediated lysis. Mechanisms of cancer cell resistance to drugs and antibodies are linked in an ABCA3-dependent pathway of exosome secretion. PMID:21873242

  10. Stickleback embryos use ATP-binding cassette transporters as a buffer against exposure to maternally derived cortisol

    PubMed Central

    Bukhari, Syed Abbas; Bell, Alison M.


    Offspring from females that experience stressful conditions during reproduction often exhibit altered phenotypes and many of these effects are thought to arise owing to increased exposure to maternal glucocorticoids. While embryos of placental vertebrates are known to regulate exposure to maternal glucocorticoids via placental steroid metabolism, much less is known about how and whether egg-laying vertebrates can control their steroid environment during embryonic development. We tested the hypothesis that threespine stickleback (Gasterosteus aculeatus) embryos can regulate exposure to maternal steroids via active efflux of maternal steroids from the egg. Embryos rapidly (within 72 h) cleared intact steroids, but blocking ATP-binding cassette (ABC) transporters inhibited cortisol clearance. Remarkably, this efflux of cortisol was sufficient to prevent a transcriptional response of embryos to exogenous cortisol. Taken together, these findings suggest that, much like their placental counterparts, developing fish embryos can actively regulate their exposure to maternal cortisol. These findings highlight the fact that even in egg-laying vertebrates, the realized exposure to maternal steroids is mediated by both maternal and embryonic processes and this has important implications for understanding how maternal stress influences offspring development. PMID:26984623

  11. Isolation and characterization of the ATP-binding cassette (ABC) transporter system genes from loofah witches' broom phytoplasma.


    Huang, Chun-Lin; Ho, Kuo-Chieh


    A clone containing a 3903 bp EcoRI-restriction fragment was obtained from a lambda(ZAP) genomic library of loofah witches' broom (LfWB) phytoplasma by plaque hybridization using a PCR fragment as a probe. Sequence analysis revealed that this fragment contained three open reading frames (ORFs). The deduced amino acid sequences of ORF 1 and ORF 2 showed a high homology with the ATP-binding proteins of the ABC transporter system genes of prokaryotes and eukaryotes, and encoded proteins with a molecular mass of 36 and 30 kDa, respectively. Based on amino acid sequence similarity, secondary structure, hydrophilicity and a signal peptide sequence at the N-terminus, we predicted that ORF 3 might encode a specific solute-binding prolipoprotein of the ABC transporter system with a molecular mass of 62 kDa. The cleavage site of this prolipoprotein signal peptide was similar to those of gram-positive bacteria. In addition to nutrient uptake, ABC transporter systems of bacteria also play a role in signal transduction, drug-resistance and perhaps virulence. The possible implications of the system to the survival and the pathogenesis of phytoplasma were discussed.

  12. Marine medaka ATP-binding cassette (ABC) superfamily and new insight into teleost Abch nomenclature

    PubMed Central

    Jeong, Chang-Bum; Kim, Bo-Mi; Kang, Hye-Min; Choi, Ik-Young; Rhee, Jae-Sung; Lee, Jae-Seong


    The ABC gene family is recognized as one of the largest gene families in all kingdoms of life. Although many genes involved in the ABC superfamily have been annotated from several fish species, information on large sets of the ABC superfamily and their evolutionary characterization are still unclear. In the marine medaka Oryzias melastigma, 50 ABC transporters were identified with bioinformatics-aided in silico analyses, and their full-length cDNA sequences were characterized. Phylogenetic analysis revealed that they could be classified into the eight subfamilies (A–H) that include all members of all ABC subfamilies. Interestingly, several teleosts’ Abcg members were closely clustered with Abch members in a distinctive clade. The abch gene was also observed in the coelacanth and the spotted gar, suggesting that this gene was retained from a bilaterian ancestor and that a gene loss event recently occurred in the tetrapod lineage. In teleosts, the nomenclature of previously annotated abcg genes should be considered carefully, as they form a distinctive clade with the marine medaka abch subfamily and other teleost abch genes, but not with the members of the Abcg subfamily. PMID:26472499

  13. Marine medaka ATP-binding cassette (ABC) superfamily and new insight into teleost Abch nomenclature.


    Jeong, Chang-Bum; Kim, Bo-Mi; Kang, Hye-Min; Choi, Ik-Young; Rhee, Jae-Sung; Lee, Jae-Seong


    The ABC gene family is recognized as one of the largest gene families in all kingdoms of life. Although many genes involved in the ABC superfamily have been annotated from several fish species, information on large sets of the ABC superfamily and their evolutionary characterization are still unclear. In the marine medaka Oryzias melastigma, 50 ABC transporters were identified with bioinformatics-aided in silico analyses, and their full-length cDNA sequences were characterized. Phylogenetic analysis revealed that they could be classified into the eight subfamilies (A-H) that include all members of all ABC subfamilies. Interestingly, several teleosts' Abcg members were closely clustered with Abch members in a distinctive clade. The abch gene was also observed in the coelacanth and the spotted gar, suggesting that this gene was retained from a bilaterian ancestor and that a gene loss event recently occurred in the tetrapod lineage. In teleosts, the nomenclature of previously annotated abcg genes should be considered carefully, as they form a distinctive clade with the marine medaka abch subfamily and other teleost abch genes, but not with the members of the Abcg subfamily.

  14. Mutations in the phosphorylation sites of simian virus 40 (SV40) T antigen alter its origin DNA-binding specificity for sites I or II and affect SV40 DNA replication activity.

    PubMed Central

    Schneider, J; Fanning, E


    A series of mutants of simian virus 40 was constructed by oligonucleotide-directed mutagenesis to study the role of phosphorylation in the functions of large T antigen. Each of the previously mapped phosphorylated serine and threonine residues in large T antigen was replaced by an alanine or cysteine residue or, in one case, by glutamic acid. Mutant DNAs were assayed for plaque-forming activity, viral DNA replication, expression of T antigen, and morphological transformation of rat cells. Viable mutants were isolated, suggesting that modification of some residues is not essential for the biological functions of T antigen. Two of these mutants replicated more efficiently than did the wild type. Seven mutants were partially or completely deficient in viral DNA replication but retained cell transformation activity comparable with that of the wild-type protein. Biochemical analysis of the mutant T antigens demonstrated novel origin DNA-binding properties of several mutant proteins. The results are consistent with the idea that differential phosphorylation defines several functional subclasses of T-antigen molecules. Images PMID:3357207

  15. Solution structure and function in trifluoroethanol of PP-50, an ATP-binding peptide from F1ATPase.


    Chuang, W J; Abeygunawardana, C; Gittis, A G; Pedersen, P L; Mildvan, A S


    PP-50, a synthetic peptide, based on residues 141-190 of the beta-subunit of mitochondrial F1ATPase, containing the GX4GKT consensus sequence for nucleoside triphosphate binding, binds ATP tightly (Kd = 17.5 microM) as found by fluorescence titration at pH 4.0. CD and 2D proton NMR studies at pH 4.0 revealed two beta-turns, regions of extended secondary structure, transient tertiary structure, and flexibility in the GX4GKT region (W.J. Chuang, C. Abeygunawardana, P. L. Pedersen, and A. S. Mildvan, 1992, Biochemistry 31, 7915-7921). CD titration of PP-50 with trifluoroethanol (TFE) reveals a decrease in ellipticity at 208 and 222 nm, saturating at 25% TFE. Computer analysis indicates that 25% TFE increases the helix content from 5.8 to 28.6%, decreases the beta-structure from 30.2 to 20.2% and decreases the coil content from 64 to 51.2%. Fluorescence titrations of H2ATP2- with PP-50 in 25% TFE yields a Kd of 7.3 microM, 2.4-fold tighter than in H2O, probably due to TFE increasing the activity of H2ATP2- . PP-50 completely quenches the fluorescence of H2ATP2- in 25% TFE, while in H2O the fluorescence quenching is only 62%. In H2O the binding of H2ATP2- increases the structure of PP-50 as detected by CD, but in 25% TFE no significant change in CD is found on binding either H2ATP2- or Mg2+ HATP (Kd = 14 microM). The complete proton NMR spectrum of PP-50 in 25% TFE has been assigned. The solution structure, determined by distance geometry, molecular dynamics with simulated annealing, and energy minimization, consists of a coil (residues 1-8), a strand (residues 9-12), a loop (residues 13-22) containing the GX4GKT consensus sequence (residues 16-23), an alpha-helix (residues 23-36), a turn (residues 38-41), and a coil (residues 42-50), similar to that of the corresponding region of the X-ray structure of F1ATPase (J.P. Abrahams, A.G.W. Leslie, R. Lutter, and J. E. Walker, 1994 Nature 370, 621-628) and to the structure of a homologous peptide from the ATP-binding site of

  16. Osimertinib (AZD9291) Attenuates the Function of Multidrug Resistance-Linked ATP-Binding Cassette Transporter ABCB1 in Vitro.


    Hsiao, Sung-Han; Lu, Yu-Jen; Li, Yan-Qing; Huang, Yang-Hui; Hsieh, Chia-Hung; Wu, Chung-Pu


    The effectiveness of cancer chemotherapy is often circumvented by multidrug resistance (MDR) caused by the overexpression of ATP-binding cassette (ABC) drug transporter ABCB1 (MDR1, P-glycoprotein). Several epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) have been shown previously capable of modulating the function of ABCB1 and reversing ABCB1-mediated MDR in human cancer cells. Furthermore, some TKIs are transported by ABCB1, which results in low oral bioavailability, reduced distribution, and the development of acquired resistance to these TKIs. In this study, we investigated the interaction between ABCB1 and osimertinib, a novel selective, irreversible third-generation EGFR TKI that has recently been approved by the U.S. Food and Drug Administration. We also evaluated the potential impact of ABCB1 on the efficacy of osimertinib in cancer cells, which can present a therapeutic challenge to clinicians in the future. We revealed that although osimertinib stimulates the ATPase activity of ABCB1, overexpression of ABCB1 does not confer resistance to osimertinib. Our results suggest that it is unlikely that the overexpression of ABCB1 can be a major contributor to the development of osimertinib resistance in cancer patients. More significantly, we revealed an additional action of osimertinib that directly inhibits the function of ABCB1 without affecting the expression level of ABCB1, enhances drug-induced apoptosis, and reverses the MDR phenotype in ABCB1-overexpressing cancer cells. Considering that osimertinib is a clinically approved third-generation EGFR TKI, our findings suggest that a combination therapy with osimertinib and conventional anticancer drugs may be beneficial to patients with MDR tumors.

  17. Synthetic Analogs of Curcumin Modulate the Function of Multidrug Resistance-Linked ATP-Binding Cassette Transporter ABCG2.


    Murakami, Megumi; Ohnuma, Shinobu; Fukuda, Michihiro; Chufan, Eduardo E; Kudoh, Katsuyoshi; Kanehara, Keigo; Sugisawa, Norihiko; Ishida, Masaharu; Naitoh, Takeshi; Shibata, Hiroyuki; Iwabuchi, Yoshiharu; Ambudkar, Suresh V; Unno, Michiaki


    Multidrug resistance (MDR) caused by the overexpression of ATP-binding cassette (ABC) transporters in cancer cells is a major obstacle in cancer chemotherapy. Previous studies have shown that curcumin, a natural product and a dietary constituent of turmeric, inhibits the function of MDR-related ABC transporters, including ABCB1, ABCC1, and especially ABCG2. However, the limited bioavailability of curcumin prevents its use for modulation of the function of these transporters in the clinical setting. In this study, we investigated the effects of 24 synthetic curcumin analogs with increased bioavailability on the transport function of ABCG2. The screening of the 24 synthetic analogs by means of flow cytometry revealed that four of the curcumin analogs (GO-Y030, GO-Y078, GO-Y168, and GO-Y172) significantly inhibited the efflux of the ABCG2 substrates, mitoxantrone and pheophorbide A, from ABCG2-overexpressing K562/breast cancer resistance protein (BCRP) cells. Biochemical analyses showed that GO-Y030, GO-Y078, and GO-Y172 stimulated the ATPase activity of ABCG2 at nanomolar concentrations and inhibited the photolabeling of ABCG2 with iodoarylazidoprazosin, suggesting that these analogs interact with the substrate-binding sites of ABCG2. In addition, when used in cytotoxicity assays, GO-Y030 and GO-Y078 were found to improve the sensitivity of the anticancer drug, SN-38, in K562/BCRP cells. Taken together, these results suggest that nontoxic synthetic curcumin analogs with increased bioavailability, especially GO-Y030 and GO-Y078, inhibit the function of ABCG2 by directly interacting at the substrate-binding site. These synthetic curcumin analogs could therefore be developed as potent modulators to overcome ABCG2-mediated MDR in cancer cells. Copyright © 2017 by The American Society for Pharmacology and Experimental Therapeutics.

  18. Molecular cloning and functional characterization of an ATP-binding cassette transporter OtrC from Streptomyces rimosus

    PubMed Central


    Background The otrC gene of Streptomyces rimosus was previously annotated as an oxytetracycline (OTC) resistance protein. However, the amino acid sequence analysis of OtrC shows that it is a putative ATP-binding cassette (ABC) transporter with multidrug resistance function. To our knowledge, none of the ABC transporters in S. rimosus have yet been characterized. In this study, we aimed to characterize the multidrug exporter function of OtrC and evaluate its relevancy to OTC production. Results In order to investigate OtrC’s function, otrC is cloned and expressed in E. coli The exporter function of OtrC was identified by ATPase activity determination and ethidium bromide efflux assays. Also, the susceptibilities of OtrC-overexpressing cells to several structurally unrelated drugs were compared with those of OtrC-non-expressing cells by minimal inhibitory concentration (MIC) assays, indicating that OtrC functions as a drug exporter with a broad range of drug specificities. The OTC production was enhanced by 1.6-fold in M4018 (P = 0.000877) and 1.4-fold in SR16 (P = 0.00973) duplication mutants, while it decreased to 80% in disruption mutants (P = 0.0182 and 0.0124 in M4018 and SR16, respectively). Conclusions The results suggest that OtrC is an ABC transporter with multidrug resistance function, and plays an important role in self-protection by drug efflux mechanisms. This is the first report of such a protein in S. rimosus, and otrC could be a valuable target for genetic manipulation to improve the production of industrial antibiotics. PMID:22906146

  19. Variations in ATP-Binding Cassette Transporter Regulation during the Progression of Human Nonalcoholic Fatty Liver DiseaseS⃞

    PubMed Central

    Hardwick, Rhiannon N.; Fisher, Craig D.; Canet, Mark J.; Scheffer, George L.


    Transporters located on the sinusoidal and canalicular membranes of hepatocytes regulate the efflux of drugs and metabolites into blood and bile, respectively. Changes in the expression or function of these transporters during liver disease may lead to a greater risk of adverse drug reactions. Nonalcoholic fatty liver disease (NAFLD) is a progressive condition encompassing the relatively benign steatosis and the more severe, inflammatory state of nonalcoholic steatohepatitis (NASH). Here, we present an analysis of the effect of NAFLD progression on the major ATP-binding cassette (ABC) efflux transport proteins ABCC1–6, ABCB1, and ABCG2. Human liver samples diagnosed as normal, steatotic, NASH (fatty), and NASH (not fatty) were analyzed. Increasing trends in mRNA expression of ABCC1, ABCC4–5, ABCB1, and ABCG2 were found with NAFLD progression, whereas protein levels of all transporters exhibited increasing trends with disease progression. Immunohistochemical staining of ABCC3, ABCB1, and ABCG2 revealed no alterations in cellular localization during NAFLD progression. ABCC2 staining revealed an alternative mechanism of regulation in NASH in which the transporter appears to be internalized away from the canalicular membrane. This correlated with a preferential shift in the molecular mass of ABCC2 from 200 to 180 kDa in NASH, which has been shown to be associated with a loss of glycosylation and internalization of the protein. These data demonstrate increased expression of multiple efflux transporters as well as altered cellular localization of ABCC2 in NASH, which may have profound effects on the ability of patients with NASH to eliminate drugs in an appropriate manner. PMID:21878559

  20. The Hypertrophic Cardiomyopathy Myosin Mutation R453C Alters ATP Binding and Hydrolysis of Human Cardiac β-Myosin*

    PubMed Central

    Bloemink, Marieke; Deacon, John; Langer, Stephen; Vera, Carlos; Combs, Ariana; Leinwand, Leslie; Geeves, Michael A.


    The human hypertrophic cardiomyopathy mutation R453C results in one of the more severe forms of the myopathy. Arg-453 is found in a conserved surface loop of the upper 50-kDa domain of the myosin motor domain and lies between the nucleotide binding pocket and the actin binding site. It connects to the cardiomyopathy loop via a long α-helix, helix O, and to Switch-2 via the fifth strand of the central β-sheet. The mutation is, therefore, in a position to perturb a wide range of myosin molecular activities. We report here the first detailed biochemical kinetic analysis of the motor domain of the human β-cardiac myosin carrying the R453C mutation. A recent report of the same mutation (Sommese, R. F., Sung, J., Nag, S., Sutton, S., Deacon, J. C., Choe, E., Leinwand, L. A., Ruppel, K., and Spudich, J. A. (2013) Proc. Natl. Acad. Sci. U.S.A. 110, 12607–12612) found reduced ATPase and in vitro motility but increased force production using an optical trap. Surprisingly, our results show that the mutation alters few biochemical kinetic parameters significantly. The exceptions are the rate constants for ATP binding to the motor domain (reduced by 35%) and the ATP hydrolysis step/recovery stroke (slowed 3-fold), which could be the rate-limiting step for the ATPase cycle. Effects of the mutation on the recovery stroke are consistent with a perturbation of Switch-2 closure, which is required for the recovery stroke and the subsequent ATP hydrolysis. PMID:24344137

  1. ATP-Binding Cassette (ABC) Transporters of the Human Respiratory Tract Pathogen, Moraxella catarrhalis: Role in Virulence.


    Murphy, Timothy F; Brauer, Aimee L; Johnson, Antoinette; Kirkham, Charmaine


    Moraxella catarrhalis is a human respiratory tract pathogen that causes otitis media (middle ear infections) in children and respiratory tract infections in adults with chronic obstructive pulmonary disease. In view of the huge global burden of disease caused by M. catarrhalis, the development of vaccines to prevent these infections and better approaches to treatment have become priorities. In previous work, we used a genome mining approach that identified three substrate binding proteins (SBPs) of ATP-binding cassette (ABC) transporters as promising candidate vaccine antigens. In the present study, we performed a comprehensive assessment of 19 SBPs of 15 ABC transporter systems in the M. catarrhalis genome by engineering knockout mutants and studying their role in assays that assess mechanisms of infection. The capacity of M. catarrhalis to survive and grow in the nutrient-limited and hostile environment of the human respiratory tract, including intracellular growth, account in part for its virulence. The results show that ABC transporters that mediate uptake of peptides, amino acids, cations and anions play important roles in pathogenesis by enabling M. catarrhalis to 1) grow in nutrient-limited conditions, 2) invade and survive in human respiratory epithelial cells and 3) persist in the lungs in a murine pulmonary clearance model. The knockout mutants of SBPs and ABC transporters showed different patterns of activity in the assay systems, supporting the conclusion that different SBPs and ABC transporters function at different stages in the pathogenesis of infection. These results indicate that ABC transporters are nutritional virulence factors, functioning to enable the survival of M catarrhalis in the diverse microenvironments of the respiratory tract. Based on the role of ABC transporters as virulence factors of M. catarrhalis, these molecules represent potential drug targets to eradicate the organism from the human respiratory tract.

  2. Determination of the quaternary structure of a bacterial ATP-binding cassette (ABC) transporter in living cells.


    Singh, Deo R; Mohammad, Mohammad M; Patowary, Suparna; Stoneman, Michael R; Oliver, Julie A; Movileanu, Liviu; Raicu, Valerică


    Pseudomonas aeruginosa is a pathogenic Gram-negative bacterium that affects patients with cystic fibrosis and immunocompromised individuals. This bacterium coexpresses two unique forms of lipopolysaccharides (LPSs) on its surface, the A- and B-band LPS, which are among the main virulence factors that contribute to its pathogenicity. The polysaccharides in A-band LPSs are synthesized in the cytoplasm and translocated into the periplasm via an ATP-binding cassette (ABC) transporter consisting of a transmembrane protein, Wzm, and a cytoplasmic nucleotide-binding protein, Wzt. Most of the biochemical studies of A-band PSs in Pseudomonas aeruginosa are focused on the stages of the synthesis and ligation of PS, leaving the export stage involving the ABC transporter mostly unexplored. This difficulty is compounded by the fact that the subunit composition and structure of this bi-component ABC transporter are still unknown. Here we propose a simple but powerful method, based on Förster Resonance Energy Transfer (FRET) and optical micro-spectroscopy technology, to probe the structure of dynamic (as opposed to static) protein complexes in living cells. We use this method to determine the association stoichiometry and quaternary structure of the Wzm-Wzt complex in living cells. It is found that Wzt forms a rhombus-shaped homo-tetramer which becomes a square upon co-expression with Wzm, and that Wzm forms a square-shaped homo-tetramer both in the presence and absence of Wzt. Based on these results, we propose a structural model for the double-tetramer complex formed by the bi-component ABC transporter in living cells. An understanding of the structure and behavior of this ABC transporter will help develop antibiotics targeting the biosynthesis of the A-band LPS endotoxin.

  3. ATP-Binding Cassette (ABC) Transporters of the Human Respiratory Tract Pathogen, Moraxella catarrhalis: Role in Virulence

    PubMed Central

    Murphy, Timothy F; Brauer, Aimee L.; Johnson, Antoinette; Kirkham, Charmaine


    Moraxella catarrhalis is a human respiratory tract pathogen that causes otitis media (middle ear infections) in children and respiratory tract infections in adults with chronic obstructive pulmonary disease. In view of the huge global burden of disease caused by M. catarrhalis, the development of vaccines to prevent these infections and better approaches to treatment have become priorities. In previous work, we used a genome mining approach that identified three substrate binding proteins (SBPs) of ATP-binding cassette (ABC) transporters as promising candidate vaccine antigens. In the present study, we performed a comprehensive assessment of 19 SBPs of 15 ABC transporter systems in the M. catarrhalis genome by engineering knockout mutants and studying their role in assays that assess mechanisms of infection. The capacity of M. catarrhalis to survive and grow in the nutrient-limited and hostile environment of the human respiratory tract, including intracellular growth, account in part for its virulence. The results show that ABC transporters that mediate uptake of peptides, amino acids, cations and anions play important roles in pathogenesis by enabling M. catarrhalis to 1) grow in nutrient-limited conditions, 2) invade and survive in human respiratory epithelial cells and 3) persist in the lungs in a murine pulmonary clearance model. The knockout mutants of SBPs and ABC transporters showed different patterns of activity in the assay systems, supporting the conclusion that different SBPs and ABC transporters function at different stages in the pathogenesis of infection. These results indicate that ABC transporters are nutritional virulence factors, functioning to enable the survival of M catarrhalis in the diverse microenvironments of the respiratory tract. Based on the role of ABC transporters as virulence factors of M. catarrhalis, these molecules represent potential drug targets to eradicate the organism from the human respiratory tract. PMID:27391026

  4. Computational characterization of TTHA0379: A potential glycerophosphocholine binding protein of Ugp ATP-binding cassette transporter.


    Chandravanshi, Monika; Gogoi, Prerana; Kanaujia, Shankar Prasad


    For the de novo biosynthesis of phospholipids, byproducts such as sn-glycerol-3-phosphate (G3P) and glycerophosphocholine (GPC) of glycerophospholipid metabolic pathway are imported inside the cell by an ATP-binding cassette (ABC) transporter known as UgpABCE. Of which, UgpA and UgpE constitutes the transmembrane domains (TMDs), UgpC forms the dimer of ATP-hydrolyzing component and UgpB is the periplasmic substrate binding protein. Structurally, UgpABCE transporter displays similarity to the maltose ABC transporter of Escherichia coli; thus, has been grouped into the CUT1 (Carbohydrate Uptake Transporter-1) family of bacterial ABC transporters. Being a member of CUT1 family, several Ugp (Uptake glycerol phosphate) protein sequences in biological database(s) exhibit sequence and structure similarity to sugar ABC transporters and have been annotated as sugar binding proteins; one of such proteins is TTHA0379 from Thermus thermophilus HB8. Here, in this study, we used computational method(s) to distinguish UgpB and sugar binding proteins based on their primary and tertiary structure features. A comprehensive analysis of these proteins indicates that they are evolutionarily related to each other having common conserved features at their primary and tertiary structure levels. However, they display differences at their active sites owing to the dissimilarity in their ligand preferences. In addition, phylogenetic analysis of TTHA0379 along with UgpB and sugar binding proteins reveals that both the groups of proteins forms two distinct clades and TTHA0379 groups with UgpB proteins. Furthermore, analysis of the ligand binding pocket shows that all the essential features of glycerophosphocholine binding protein i.e. UgpB, are conserved in TTHA0379 as well. Combining these features, here, we designate TTHA0379 to be a GPC binding protein.

  5. Functional Characterization of ATP-Binding Cassette Transporter A3 Mutations from Infants with Respiratory Distress Syndrome.


    Wambach, Jennifer A; Yang, Ping; Wegner, Daniel J; Heins, Hillary B; Kaliberova, Lyudmila N; Kaliberov, Sergey A; Curiel, David T; White, Frances V; Hamvas, Aaron; Hackett, Brian P; Cole, F Sessions


    Mutations in the ATP-binding cassette transporter A3 gene (ABCA3) result in severe neonatal respiratory distress syndrome and childhood interstitial lung disease. As most ABCA3 mutations are rare or private, determination of mutation pathogenicity is often based on results from in silico prediction tools, identification in unrelated diseased individuals, statistical association studies, or expert opinion. Functional biologic studies of ABCA3 mutations are needed to confirm mutation pathogenicity and inform clinical decision making. Our objective was to functionally characterize two ABCA3 mutations (p.R288K and p.R1474W) identified among term and late-preterm infants with respiratory distress syndrome with unclear pathogenicity in a genetically versatile model system. We performed transient transfection of HEK293T cells with wild-type or mutant ABCA3 alleles to assess protein processing with immunoblotting. We used transduction of A549 cells with adenoviral vectors, which concurrently silenced endogenous ABCA3 and expressed either wild-type or mutant ABCA3 alleles (p.R288K and p.R1474W) to assess immunofluorescent localization, ATPase activity, and organelle ultrastructure. Both ABCA3 mutations (p.R288K and p.R1474W) encoded proteins with reduced ATPase activity but with normal intracellular localization and protein processing. Ultrastructural phenotypes of lamellar body-like vesicles in A549 cells transduced with mutant alleles were similar to wild type. Mutant proteins encoded by ABCA3 mutations p.R288K and p.R1474W had reduced ATPase activity, a biologically plausible explanation for disruption of surfactant metabolism by impaired phospholipid transport into the lamellar body. These results also demonstrate the usefulness of a genetically versatile, human model system for functional characterization of ABCA3 mutations with unclear pathogenicity.

  6. HER2 as therapeutic target for overcoming ATP-binding cassette transporter-mediated chemoresistance in small cell lung cancer.


    Minami, Toshiyuki; Kijima, Takashi; Otani, Yasushi; Kohmo, Satoshi; Takahashi, Ryo; Nagatomo, Izumi; Hirata, Haruhiko; Suzuki, Mayumi; Inoue, Koji; Takeda, Yoshito; Kida, Hiroshi; Tachibana, Isao; Kumanogoh, Atsushi


    Small cell lung cancer (SCLC) easily acquires multidrug resistance after successful initial therapy. Overexpression of ATP-binding cassette (ABC) transporters is important for the multidrug resistance. Among them, ABCB1 and ABCG2 are known to be upregulated in chemoresistant SCLC cells. We found that human epidermal growth factor receptor 2 (HER2) expressions are also upregulated in chemoresistant SBC-3/ETP, SBC-3/SN-38, and SBC-3/CDDP cells, compared with chemosensitive SBC-3 cells. Lapatinib, a tyrosine kinase inhibitor of HER2, could not suppress proliferation of these HER2-positive SCLC cells alone but successfully restored chemosensitivity to etoposide and SN-38 with a clinically applicable concentration. The reversal effect of lapatinib was thought to be caused by inhibition of drug efflux pump functions of ABC transporters, although lapatinib itself has been reported to be a substrate for them. Moreover, knocking down of HER2 by an short interfering RNA weakened the effect of lapatinib on ABCB1, indicating the involvement of HER2 in the inhibitory mechanisms. Notably, we showed that caveolin-1 and Src play key roles in modulating ABCB1 function via HER2 inactivation. In SBC-3/ETP cells, dephosphorylation of HER2 by lapatinib activates Src and successively leads to increased caveolin-1 phosphorylation. Through this process, caveolin-1 dissociates from HER2 and strengthens association with ABCB1, and finally impairs the pump functions. Furthermore, we showed that treatment by lapatinib in combination with etoposide or irinotecan significantly suppresses the growth of subcutaneous SBC-3/ETP and SBC-3/SN-38 tumors in mice, respectively. Collectively, these results indicate that combination therapy with lapatinib and cytotoxic agents could conquer ABC transporter-mediated chemoresistance especially in HER2-positive SCLC.

  7. A Novel ATP-Binding Cassette Transporter Involved in Multidrug Resistance in the Phytopathogenic Fungus Penicillium digitatum

    PubMed Central

    Nakaune, Ryoji; Adachi, Kiichi; Nawata, Osamu; Tomiyama, Masamitsu; Akutsu, Katsumi; Hibi, Tadaaki


    Demethylation inhibitor (DMI)-resistant strains of the plant pathogenic fungus Penicillium digitatum were shown to be simultaneously resistant to cycloheximide, 4-nitroquinoline-N-oxide (4NQO), and acriflavine. A PMR1 (Penicillium multidrug resistance) gene encoding an ATP-binding cassette (ABC) transporter (P-glycoprotein) was cloned from a genomic DNA library of a DMI-resistant strain (LC2) of Penicillium digitatum by heterologous hybridization with a DNA fragment containing an ABC-encoding region from Botrytis cinerea. Sequence analysis revealed significant amino acid homology to the primary structures of PMR1 (protein encoded by the PMR1 gene) and ABC transporters of Saccharomyces cerevisiae (PDR5 and SNQ2), Schizosaccharomyces pombe (HBA2), Candida albicans (CDR1), and Aspergillus nidulans (AtrA and AtrB). Disruption of the PMR1 gene of P. digitatum DMI-resistant strain LC2 demonstrated that PMR1 was an important determinant of resistance to DMIs. The effective concentrations inhibiting radial growth by 50% (EC50s) and the MICs of fenarimol and bitertanol for the PMR1 disruptants (Δpmr1 mutants) were equivalent to those for DMI-sensitive strains. Northern blot analysis indicated that severalfold more PMR1 transcript accumulated in the DMI-resistant strains compared with those in DMI-sensitive strains in the absence of fungicide. In both DMI-resistant and -sensitive strains, transcription of PMR1 was strongly enhanced within 10 min after treatment with the DMI fungicide triflumizole. These results suggested that the toxicant efflux system comprised of PMR1 participates directly in the DMI resistance of the fungus. PMID:9758830

  8. Overexpression of the ATP binding cassette gene ABCA1 determines resistance to Curcumin in M14 melanoma cells.


    Bachmeier, Beatrice E; Iancu, Cristina M; Killian, Peter H; Kronski, Emanuel; Mirisola, Valentina; Angelini, Giovanna; Jochum, Marianne; Nerlich, Andreas G; Pfeffer, Ulrich


    Curcumin induces apoptosis in many cancer cells and it reduces xenograft growth and the formation of lung metastases in nude mice. Moreover, the plant derived polyphenol has been reported to be able to overcome drug resistance to classical chemotherapy. These features render the drug a promising candidate for tumor therapy especially for cancers known for their high rates concerning therapy resistance like melanoma. We show here that the melanoma cell line M14 is resistant to Curcumin induced apoptosis, which correlates with the absence of any effect on NFkappaB signaling. We show that CXCL1 a chemokine that is down regulated in breast cancer cells by Curcumin in an NFkappaB dependent manner is expressed at variable levels in human melanomas. Yet in M14 cells, CXCL1 expression did not change upon Curcumin treatment. Following the hypothesis that Curcumin is rapidly removed from the resistant cells, we analyzed expression of known multi drug resistance genes and cellular transporters in M14 melanoma cells and in the Curcumin sensitive breast cancer cell line MDA-MB-231. ATP-binding cassette transporter ABCA1, a gene involved in the cellular lipid removal pathway is over-expressed in resistant M14 melanoma as compared to the sensitive MDA-MB-231 breast cancer cells. Gene silencing of ABCA1 by siRNA sensitizes M14 cells to the apoptotic effect of Curcumin most likely as a result of reduced basal levels of active NFkappaB. Moreover, ABCA1 silencing alone also induces apoptosis and reduces p65 expression. Resistance to Curcumin thus follows classical pathways and ABCA1 expression should be considered as response marker.

  9. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance.


    Aberuyi, N; Rahgozar, S; Moafi, A


    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols.

  10. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance

    PubMed Central

    Aberuyi, N; Rahgozar, S; Moafi, A


    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols. PMID:25254091

  11. Identification of a MAP 2-like ATP-binding protein associated with axoplasmic vesicles that translocate on isolated microtubules

    PubMed Central


    Axoplasmic vesicles were purified and observed to translocate on isolated microtubules in an ATP-dependent, trypsin-sensitive manner, implying that ATP-binding polypeptides essential for force generation were present on the vesicle surface. To identify these proteins [alpha 32P]8-azidoadenosine 5'-triphosphate ([alpha 32P]8-N3ATP), a photoaffinity analogue of ATP, was used. The results presented here identify and characterize a vesicle-associated polypeptide having a relative molecular mass of 292 kD that bound [alpha 32P]8-N3ATP. The incorporation of label is ultraviolet light-dependent and ATP- sensitive. Moreover, the 292-kD polypeptide could be isolated in association with vesicles or microtubules, depending on the conditions used, and the data indicate that the 292-kD polypeptide is similar to mammalian brain microtubule-associated protein 2 (MAP 2) for the following reasons: The 292-kD polypeptide isolated from either squid axoplasm or optic lobe cross-reacts with antiserum to porcine brain MAP 2. Furthermore, it purifies with taxol-stabilized microtubules and is released with salt. Based on these characteristics, the 292-kD polypeptide is distinct from the known force-generating molecules myosin and flagellar dynein, as well as the 110-130-kD kinesin-like polypeptides that have recently been described (Brady, S. T., 1985, Nature (Lond.), 317:73-75; Vale, R. D., T. S. Reese, and M. P. Sheetz, 1985b, Cell, 42:39-50; Scholey, J. M., M. E. Porter, P. M. Grissom, and J. R. McIntosh, 1985, Nature (Lond.), 318:483-486). Because the 292-kD polypeptide binds ATP and is associated with vesicles that translocate on purified MAP-free microtubules in an ATP-dependent fashion, it is therefore believed to be involved in vesicle-microtubule interactions that promote organelle motility. PMID:3091608

  12. Biotin uptake in prokaryotes by solute transporters with an optional ATP-binding cassette-containing module.


    Hebbeln, Peter; Rodionov, Dmitry A; Alfandega, Anja; Eitinger, Thomas


    BioMNY proteins are considered to constitute tripartite biotin transporters in prokaryotes. Recent comparative genomic and experimental analyses pointed to the similarity of BioMN to homologous modules of prokaryotic transporters mediating uptake of metals, amino acids, and vitamins. These systems resemble ATP-binding cassette-containing transporters and include typical ATPases (e.g., BioM). Absence of extracytoplasmic solute-binding proteins among the members of this group, however, is a distinctive feature. Genome context analyses uncovered that only one-third of the widespread bioY genes are linked to bioMN. Many bioY genes are located at loci encoding biotin biosynthesis, and others are unlinked to biotin metabolic or transport genes. Heterologous expression of the bioMNY operon and of the single bioY of the alpha-proteobacterium Rhodobacter capsulatus conferred biotin-transport activity on recombinant Escherichia coli cells. Kinetic analyses identified BioY as a high-capacity transporter that was converted into a high-affinity system in the presence of BioMN. BioMNY-mediated biotin uptake was severely impaired by replacement of the Walker A lysine residue in BioM, demonstrating dependency of high-affinity transport on a functional ATPase. Biochemical assays revealed that BioM, BioN, and BioY proteins form stable complexes in membranes of the heterologous host. Expression of truncated bio transport operons, each with one gene deleted, resulted in stable BioMN complexes but revealed only low amounts of BioMY and BioNY aggregates in the absence of the respective third partner. The results substantiate our earlier suggestion of a mechanistically novel group of membrane transporters.

  13. Biotin uptake in prokaryotes by solute transporters with an optional ATP-binding cassette-containing module

    PubMed Central

    Hebbeln, Peter; Rodionov, Dmitry A.; Alfandega, Anja; Eitinger, Thomas


    BioMNY proteins are considered to constitute tripartite biotin transporters in prokaryotes. Recent comparative genomic and experimental analyses pointed to the similarity of BioMN to homologous modules of prokaryotic transporters mediating uptake of metals, amino acids, and vitamins. These systems resemble ATP-binding cassette-containing transporters and include typical ATPases (e.g., BioM). Absence of extracytoplasmic solute-binding proteins among the members of this group, however, is a distinctive feature. Genome context analyses uncovered that only one-third of the widespread bioY genes are linked to bioMN. Many bioY genes are located at loci encoding biotin biosynthesis, and others are unlinked to biotin metabolic or transport genes. Heterologous expression of the bioMNY operon and of the single bioY of the α-proteobacterium Rhodobacter capsulatus conferred biotin-transport activity on recombinant Escherichia coli cells. Kinetic analyses identified BioY as a high-capacity transporter that was converted into a high-affinity system in the presence of BioMN. BioMNY-mediated biotin uptake was severely impaired by replacement of the Walker A lysine residue in BioM, demonstrating dependency of high-affinity transport on a functional ATPase. Biochemical assays revealed that BioM, BioN, and BioY proteins form stable complexes in membranes of the heterologous host. Expression of truncated bio transport operons, each with one gene deleted, resulted in stable BioMN complexes but revealed only low amounts of BioMY and BioNY aggregates in the absence of the respective third partner. The results substantiate our earlier suggestion of a mechanistically novel group of membrane transporters. PMID:17301237

  14. Genome-Wide Identification, Evolution, and Expression Analysis of the ATP-Binding Cassette Transporter Gene Family in Brassica rapa

    PubMed Central

    Yan, Chao; Duan, Weike; Lyu, Shanwu; Li, Ying; Hou, Xilin


    ATP-binding cassette (ABC) proteins can act as transporters of different substrates across biological membranes by hydrolyzing ATP. However, little information is available about ABC transporters in Brassica rapa, an important leafy vegetable. In the present study, we carried out genome-wide identification, characterization and molecular evolution analyses of ABC gene family in B. rapa and 9 other plant species. A total of 179 B. rapa ABC genes (BraABCs) were identified. Among them, 173 BraABCs were identified on 10 chromosomes. Based on phylogenetic analysis and domain organization, the BraABC family could be grouped into eight subfamilies. BraABCs in the same subfamily showed similar motif composition and exon-intron organization. Common and unique cis-elements involved in the transcriptional regulation were also identified in the promoter regions of BraABCs. Tissue-expression analysis of BraABCs demonstrated their diverse spatiotemporal expression profiles. Influences of the whole genome triplication (WGT) on the evolution of BraABCs were studied in detail. BraABCs were preferentially retained compared with their neighboring genes during diploidization after WGT. Synteny analysis identified 76 pairs of syntenic BraABC paralogs among the three subgenomes of B. rapa, and 10 paralog pairs underwent positive selection with ω (= Ka/Ks) ratios greater than 1. Analyses of the expression patterns of syntenic BraABC paralogs pairs across five tissues and under stress treatments revealed their functional conservation, sub-functionalization, neo-functionalization and pseudogenization during evolution. Our study presents a comprehensive overview of the ABC gene family in B. rapa and will be helpful for the further functional study of BraABCs in plant growth, development, and stress responses. PMID:28367152

  15. Optimization of the degenerated interfacial ATP binding site improves the function of disease-related mutant cystic fibrosis transmembrane conductance regulator (CFTR) channels.


    Tsai, Ming-Feng; Jih, Kang-Yang; Shimizu, Hiroyasu; Li, Min; Hwang, Tzyh-Chang


    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel, an ATP binding cassette (ABC) protein whose defects cause the deadly genetic disease cystic fibrosis (CF), encompasses two nucleotide binding domains (NBD1 and NBD2). Recent studies indicate that in the presence of ATP, the two NBDs coalesce into a dimer, trapping an ATP molecule in each of the two interfacial composite ATP binding sites (site 1 and site 2). Experimental evidence also suggests that CFTR gating is mainly controlled by ATP binding and hydrolysis in site 2, whereas site 1, which harbors several non-canonical substitutions in ATP-interacting motifs, is considered degenerated. The CF-associated mutation G551D, by introducing a bulky and negatively charged side chain into site 2, completely abolishes ATP-induced openings of CFTR. Here, we report a strategy to optimize site 1 for ATP binding by converting two amino acid residues to ABC consensus (i.e. H1348G) or more commonly seen residues in other ABC proteins (i.e. W401Y,W401F). Introducing either one or both of these mutations into G551D-CFTR confers ATP responsiveness for this disease-associated mutant channel. We further showed that the same maneuver also improved the function of WT-CFTR and the most common CF-associated ΔF508 channels, both of which rely on site 2 for gating control. Thus, our results demonstrated that the degenerated site 1 can be rebuilt to complement or support site 2 for CFTR function. Possible approaches for developing CFTR potentiators targeting site 1 will be discussed.

  16. Biophysical changes of ATP binding pocket may explain loss of kinase activity in mutant DAPK3 in cancer: A molecular dynamic simulation analysis.


    Agarwal, Tarun; Annamalai, Nithyanan; Maiti, Tapas Kumar; Arsad, Hasni


    DAPK3 belongs to family of DAPK (death-associated protein kinases) and is involved in the regulation of progression of the cell cycle, cell proliferation, apoptosis and autophagy. It is considered as a tumor suppressor kinase, suggesting the loss of its function in case of certain specific mutations. The T112M, D161N and P216S mutations in DAPK3 have been observed in cancer patients. These DAPK3 mutants have been associated with very low kinase activity, which results in the cellular progression towards cancer. However, a clear understanding of the structural and biophysical variations that occur in DAPK3 with these mutations, resulting in the decreased kinase activity has yet not been deciphered. We performed a molecular dynamic simulation study to investigate such structural variations. Our results revealed that mutations caused a significant structural variation in DAPK3, majorly concentrated in the flexible loops that form part of the ATP binding pocket. Interestingly, D161N and P216S mutations collapsed the ATP binding pocket through flexible loops invasion, hindering ATP binding which resulted in very low kinase activity. On the contrary, T112M mutant DAPK3 reduces ATP binding potential through outward distortion of flexible loops. In addition, the mutant lacked characteristic features of the active protein kinase including proper interaction between HR/FD and DFG motifs, well structured hydrophobic spine and Lys42-Glu64 salt bridge interaction. These observations could possibly explain the underlying mechanism associated with the loss of kinase activity with T112M, D161N and P216S mutation in DAPK3. Copyright © 2016 Elsevier B.V. All rights reserved.

  17. About a switch: how P-glycoprotein (ABCB1) harnesses the energy of ATP binding and hydrolysis to do mechanical work.


    Sauna, Zuben E; Ambudkar, Suresh V


    The efflux of drugs by the multidrug transporter P-glycoprotein (Pgp; ABCB1) is one of the principal means by which cancer cells evade chemotherapy and exhibit multidrug resistance. Mechanistic studies of Pgp-mediated transport, however, transcend the importance of this protein per se as they help us understand the transport pathway of the ATP-binding cassette proteins in general. The ATP-binding cassette proteins comprise one of the largest protein families, are central to cellular physiology, and constitute important drug targets. The functional unit of Pgp consists of two nucleotide-binding domains (NBD) and two transmembrane domains that are involved in the transport of drug substrates. Early studies postulated that conformational changes as a result of ATP hydrolysis were transmitted to the transmembrane domains bringing about drug transport. More recent structural and biochemical studies on the other hand suggested that ATP binds at the interface of the two NBDs and induces the formation of a closed dimer, and it has been hypothesized that this dimerization and subsequent ATP hydrolysis powers transport. Based on the mutational and biochemical work on Pgp and structural studies with isolated NBDs, we review proposed schemes for the catalytic cycle of ATP hydrolysis and the transport pathway.

  18. Discovery of a novel allosteric inhibitor-binding site in ERK5: comparison with the canonical kinase hinge ATP-binding site

    PubMed Central

    Chen, Hongming; Tucker, Julie; Wang, Xiaotao; Gavine, Paul R.; Phillips, Chris; Augustin, Martin A.; Schreiner, Patrick; Steinbacher, Stefan; Preston, Marian; Ogg, Derek


    MAP kinases act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, regulation of transcription and development. As a member of the MAP kinase family, ERK5 (MAPK7) is involved in the downstream signalling pathways of various cell-surface receptors, including receptor tyrosine kinases and G protein-coupled receptors. In the current study, five structures of the ERK5 kinase domain co-crystallized with ERK5 inhibitors are reported. Interestingly, three of the compounds bind at a novel allosteric binding site in ERK5, while the other two bind at the typical ATP-binding site. Binding of inhibitors at the allosteric site is accompanied by displacement of the P-loop into the ATP-binding site and is shown to be ATP-competitive in an enzymatic assay of ERK5 kinase activity. Kinase selectivity data show that the most potent allosteric inhibitor exhibits superior kinase selectivity compared with the two inhibitors that bind at the canonical ATP-binding site. An analysis of these structures and comparison with both a previously published ERK5–inhibitor complex structure (PDB entry 4b99) and the structures of three other kinases (CDK2, ITK and MEK) in complex with allosteric inhibitors are presented. PMID:27139631

  19. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    SciTech Connect

    Zoghbi, M. E.; Altenberg, G. A.


    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we used luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.

  20. Relationship between a point mutation S97C in CK1δ protein and its affect on ATP-binding affinity.


    Kumar, Ambuj; Rajendran, Vidya; Sethumadhavan, Rao; Purohit, Rituraj


    CK1δ (Casein kinase I isoform delta) is a member of CK1 kinase family protein that mediates neurite outgrowth and the function as brain-specific microtubule-associated protein. ATP binding kinase domain of CK1δ is essential for regulating several key cell cycle signal transduction pathways. Mutation in CK1δ protein is reported to cause cancers and affects normal brain development. S97C mutation in kinase domain of CK1δ protein has been involved to induce breast cancer and ductal carcinoma. We performed molecular docking studies to examine the effect of this mutation on its ATP-binding affinity. Further, we conducted molecular dynamics simulations to understand the structural consequences of S97C mutation over the kinase domain of CK1δ protein. Docking results indicated the loss of ATP-binding affinity of mutant structure, which were further rationalized by molecular dynamics simulations, where a notable loss in 3-D conformation of CK1δ kinase domain was observed in mutant as compared to native. Our results explained the underlying molecular mechanism behind the observed cancer associated phenotype caused by S97C mutation in CK1δ protein.

  1. The crustacean gill (Na+,K+)-ATPase: allosteric modulation of high- and low-affinity ATP-binding sites by sodium and potassium.


    Masui, D C; Silva, E C C; Mantelatto, F L M; McNamara, J C; Barrabin, H; Scofano, H M; Fontes, C F L; Furriel, R P M; Leone, F A


    The blue crab, Callinectes danae, tolerates exposure to a wide salinity range employing mechanisms of compensatory ion uptake when in dilute media. Although the gill (Na+,K+)-ATPase is vital to hyperosmoregulatory ability, the interactions occurring at the sites of ATP binding on the molecule itself are unknown. Here, we investigate the modulation by Na+ and K+ of homotropic interactions between the ATP-binding sites, and of phosphoenzyme formation of the (Na+,K+)-ATPase from the posterior gills of this euryhaline crab. The contribution of the high- and low-affinity ATP-binding sites to maximum velocity was similar for both Na+ and K+. However, in contrast to Na+, a threshold K+ concentration triggers the appearance of the high-affinity binding sites, displacing the saturation curve to lower ATP concentrations.Further, a low-affinity site for phosphorylation is present on the enzyme. These findings reveal notable differences in the catalytic mechanism of the crustacean (Na+,K+)-ATPase compared to the vertebrate enzyme.

  2. Overexpression and functional characterization of an ABC (ATP-binding cassette) transporter encoded by the genes drrA and drrB of Mycobacterium tuberculosis.


    Choudhuri, Baisakhee Saha; Bhakta, Sanjib; Barik, Rajib; Basu, Joyoti; Kundu, Manikuntala; Chakrabarti, Parul


    The genes encoding ATP-binding cassette (ABC) transporters occupy 2.5% of the genome of Mycobacterium tuberculosis. However, none of these putative ABC transporters has been characterized so far. We describe the development of expression systems for simultaneous expression of the ATP-binding protein DrrA and the membrane integral protein DrrB which together behave as a functional doxorubicin efflux pump. Doxorubicin uptake in Escherichia coli or Mycobacterium smegmatis expressing DrrAB was inhibited by reserpine, an inhibitor of ABC transporters. The localization of DrrA to the membrane depended on the simultaneous expression of DrrB. ATP binding was positively regulated by doxorubicin and daunorubicin. At the same time, DrrB appeared to be sensitive to proteolysis when expressed alone in the absence of DrrA. Simultaneous expression of the two polypeptides was essential to obtain a functional doxorubicin efflux pump. Expression of DrrAB in E. coli conferred 8-fold increased resistance to ethidium bromide, a cationic compound. 2',7'-bis-(2-Carboxyethyl)-5(6)-carboxyfluorescein (BCECF), a neutral compound, also behaved as a substrate of the reconstituted efflux pump. When expressed in M. smegmatis, DrrAB conferred resistance to a number of clinically relevant, structurally unrelated antibiotics. The resistant phenotype could be reversed by verapamil and reserpine, two potent inhibitors of ABC transporters.

  3. Overexpression and functional characterization of an ABC (ATP-binding cassette) transporter encoded by the genes drrA and drrB of Mycobacterium tuberculosis.

    PubMed Central

    Choudhuri, Baisakhee Saha; Bhakta, Sanjib; Barik, Rajib; Basu, Joyoti; Kundu, Manikuntala; Chakrabarti, Parul


    The genes encoding ATP-binding cassette (ABC) transporters occupy 2.5% of the genome of Mycobacterium tuberculosis. However, none of these putative ABC transporters has been characterized so far. We describe the development of expression systems for simultaneous expression of the ATP-binding protein DrrA and the membrane integral protein DrrB which together behave as a functional doxorubicin efflux pump. Doxorubicin uptake in Escherichia coli or Mycobacterium smegmatis expressing DrrAB was inhibited by reserpine, an inhibitor of ABC transporters. The localization of DrrA to the membrane depended on the simultaneous expression of DrrB. ATP binding was positively regulated by doxorubicin and daunorubicin. At the same time, DrrB appeared to be sensitive to proteolysis when expressed alone in the absence of DrrA. Simultaneous expression of the two polypeptides was essential to obtain a functional doxorubicin efflux pump. Expression of DrrAB in E. coli conferred 8-fold increased resistance to ethidium bromide, a cationic compound. 2',7'-bis-(2-Carboxyethyl)-5(6)-carboxyfluorescein (BCECF), a neutral compound, also behaved as a substrate of the reconstituted efflux pump. When expressed in M. smegmatis, DrrAB conferred resistance to a number of clinically relevant, structurally unrelated antibiotics. The resistant phenotype could be reversed by verapamil and reserpine, two potent inhibitors of ABC transporters. PMID:12057006

  4. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers*

    PubMed Central

    Zoghbi, Maria E.; Altenberg, Guillermo A.


    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we used luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation. PMID:24129575

  5. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels

    PubMed Central

    Wei, Shipeng; Roessler, Bryan C.; Icyuz, Mert; Chauvet, Sylvain; Tao, Binli; Hartman, John L.; Kirk, Kevin L.


    The ABCC transporter subfamily includes pumps, the long and short multidrug resistance proteins (MRPs), and an ATP-gated anion channel, the cystic fibrosis transmembrane conductance regulator (CFTR). We show that despite their thermodynamic differences, these ABCC transporter subtypes use broadly similar mechanisms to couple their extracellular gates to the ATP occupancies of their cytosolic nucleotide binding domains. A conserved extracellular phenylalanine at this gate was a prime location for producing gain of function (GOF) mutants of a long MRP in yeast (Ycf1p cadmium transporter), a short yeast MRP (Yor1p oligomycin exporter), and human CFTR channels. Extracellular gate mutations rescued ATP binding mutants of the yeast MRPs and CFTR by increasing ATP sensitivity. Control ATPase-defective MRP mutants could not be rescued by this mechanism. A CFTR double mutant with an extracellular gate mutation plus a cytosolic GOF mutation was highly active (single-channel open probability >0.3) in the absence of ATP and protein kinase A, each normally required for CFTR activity. We conclude that all 3 ABCC transporter subtypes use similar mechanisms to couple their extracellular gates to ATP occupancy, and highly active CFTR channels that bypass defects in ATP binding or phosphorylation can be produced.—Wei, S., Roessler, B. C., Icyuz, M., Chauvet, S., Tao, B., Hartman IV, J. L., Kirk, K. L. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels. PMID:26606940

  6. Neural Crest Cells Isolated from the Bone Marrow of Transgenic Mice Express JCV T-Antigen

    PubMed Central

    Gordon, Jennifer; Sariyer, Ilker K.; De La Fuente-Granada, Marisol; Augelli, Brian J.; Otte, Jessica; Azizi, S. Ausim; Amini, Shohreh; Khalili, Kamel; Krynska, Barbara


    JC virus (JCV), a common human polyomavirus, is the etiological agent of the demyelinating disease, progressive multifocal leukoencephalopathy (PML). In addition to its role in PML, studies have demonstrated the transforming ability of the JCV early protein, T-antigen, and its association with some human cancers. JCV infection occurs in childhood and latent virus is thought to be maintained within the bone marrow, which harbors cells of hematopoietic and non-hematopoietic lineages. Here we show that non-hematopoietic mesenchymal stem cells (MSCs) isolated from the bone marrow of JCV T-antigen transgenic mice give rise to JCV T-antigen positive cells when cultured under neural conditions. JCV T-antigen positive cells exhibited neural crest characteristics and demonstrated p75, SOX-10 and nestin positivity. When cultured in conditions typical for mesenchymal cells, a population of T-antigen negative cells, which did not express neural crest markers arose from the MSCs. JCV T-antigen positive cells could be cultured long-term while maintaining their neural crest characteristics. When these cells were induced to differentiate into neural crest derivatives, JCV T-antigen was downregulated in cells differentiating into bone and maintained in glial cells expressing GFAP and S100. We conclude that JCV T-antigen can be stably expressed within a fraction of bone marrow cells differentiating along the neural crest/glial lineage when cultured in vitro. These findings identify a cell population within the bone marrow permissible for JCV early gene expression suggesting the possibility that these cells could support persistent viral infection and thus provide clues toward understanding the role of the bone marrow in JCV latency and reactivation. Further, our data provides an excellent experimental model system for studying the cell-type specificity of JCV T-antigen expression, the role of bone marrow-derived stem cells in the pathogenesis of JCV-related diseases and the

  7. Two homologous ATP-binding cassette transporter proteins, AtMDR1 and AtPGP1, regulate Arabidopsis photomorphogenesis and root development by mediating polar auxin transport.


    Lin, Rongcheng; Wang, Haiyang


    Light and auxin control many aspects of plant growth and development in an overlapping manner. We report here functional characterization of two closely related ABC (ATP-binding cassette) transporter genes, AtMDR1 and AtPGP1, in light and auxin responses. We showed that loss-of-function atmdr1 and atpgp1 mutants display hypersensitivity to far-red, red, and blue-light inhibition of hypocotyl elongation, reduced chlorophyll and anthocyanin accumulation, and abnormal expression of several light-responsive genes, including CAB3, RBCS, CHS, and PORA, under both darkness and far-red light conditions. In addition, we showed that the atmdr1-100 and atmdr1-100/atpgp1-100 mutants are defective in multiple aspects of root development, including increased root-growth sensitivity to 1-naphthalene acetic acid (1-NAA), and decreased sensitivity to naphthylphthalamic acid (NPA)-mediated inhibition of root elongation. Consistent with the proposed role of AtMDR1 in basipetal auxin transport, we found that expression of the auxin responsive DR5::GUS reporter gene in the central elongation zone is significantly reduced in the atmdr1-100 mutant roots treated with 1-NAA at the root tips, compared to similarly treated wild-type plants. Moreover, atmdr1-100, atpgp1-100, and their double mutants produced fewer lateral roots, in the presence or absence of 1-NAA or NPA. The atmdr1-100 and atmdr1-100/atpgp1-100 mutants also displayed enhanced root gravitropism. Genetic-epistasis analysis revealed that mutations in phyA largely suppress the randomized-hypocotyl growth and the short-hypocotyl phenotype of the atmdr1-100 mutants under far-red light, suggesting that phyA acts downstream of AtMDR1. Together, our results suggest that AtMDR1 and AtPGP1 regulate Arabidopsis (Arabidopsis thaliana) photomorphogenesis and multiple aspects of root development by mediating polar auxin transport.

  8. Association of ATP binding cassette transporter G8 rs4148217 SNP and serum lipid levels in Mulao and Han nationalities.


    Li, Qing; Wei, Xian-Liang; Yin, Rui-Xing


    The association of ATP binding cassette transporter G8 gene (ABCG8) rs4148217 single nucleotide polymorphism (SNP) and serum lipid profiles is still controversial in diverse racial/ethnic groups. Mulao nationality is an isolated minority in China. The aim of this study was to evaluate the association of ABCG8 rs4148217 SNP and several environmental factors with serum lipid levels in the Guangxi Mulao and Han populations. A total of 634 subjects of Mulao nationality and 717 participants of Han nationality were randomly selected from our previous samples. Genotyping of the ABCG8 rs4148217 SNP was performed by polymerase chain reaction and restriction fragment length polymorphism combined with gel electrophoresis, and then confirmed by direct sequencing. The genotypic and allelic frequencies of ABCG8 rs4148217 SNP were different between the two nationalities (P < 0.01 for each), the frequency of A allele was higher in Mulao than in Han. The A allele carriers in Han had lower high-density lipoprotein cholesterol (HDL-C) and apolipoprotein (Apo) A1 levels than the A allele noncarriers (P < 0.05 for each), whereas the A allele carriers in Mulao had lower ApoA1 levels than the A allele noncarriers (P < 0.05). Subgroup analyses showed that the A allele carriers in Han had lower HDL-C and higher triglyceride (TG) levels in females but not in males than the A allele noncarriers (P < 0.05 for each), and the A allele carriers in Mulao had lower ApoA1 levels in females but not in males than the A allele noncarriers (P < 0.05). The levels of TG and HDL-C in Han, and ApoA1 in Mulao were associated with genotypes in females but not in males (P < 0.05-0.01). Serum lipid parameters were also correlated with several environmental factors (P < 0.05-0.001). The ABCG8 rs4148217 SNP is associated with serum TG, HDL-C and ApoA1 levels in our study populations, but this association is different between the Mulao and Han populations. There is a sex (female

  9. Poloxamines display a multiple inhibitory activity of ATP-binding cassette (ABC) transporters in cancer cell lines.


    Cuestas, María L; Sosnik, Alejandro; Mathet, Verónica L


    Primary hepatocellular carcinoma is the third most common fatal cancer worldwide with more than 500,000 annual deaths. Approximately 40% of the patients with HCC showed tumoral overexpression of transmembrane proteins belonging to the ATP-binding cassette protein superfamily (ABC) which pump drugs out of cells. The overexpression of these efflux transporters confers on the cells a multiple drug resistance phenotype, which is considered a crucial cause of treatment refractoriness in patients with cancer. The aim of this study was to investigate the inhibitory effect of different concentrations of pH- and temperature-responsive X-shaped poly(ethylene oxide)-poly(propylene oxide) block copolymers (poloxamines, Tetronic, PEO-PPO) showing a wide range of molecular weights and EO/PO ratios on the functional activity of three different ABC proteins, namely P-glycoprotein (P-gp or MDR1), breast cancer resistance protein (BCRP), and multidrug resistance-associated protein MRP1, in two human hepatocarcinoma cell lines, HepG2 and Huh7. First, the cytotoxicity of the different copolymers (at different concentrations) on both liver carcinoma cell lines was thoroughly evaluated by means of apoptosis analysis using annexin V and propidium iodide (PI). Thus, viable cells (AV-/PI-), early apoptotic cells (AV+/PI-) and late apoptotic cells (V-FITC+/PI+) were identified. Results pointed out copolymers of intermediate to high hydrophobicity and intermediate molecular weight (e.g., T904) as the most cytotoxic. Then, DiOC2, rhodamine 123 and vinblastine were used as differential substrates of these pumps. HeLa, an epithelial cell line of human cervical cancer that does not express P-gp, was used exclusively as a control and enabled the discerning between P-gp and MRP1 inhibition. Moderate to highly hydrophobic poloxamines T304, T904 and T1301 showed inhibitory activity against P-gp and BCRP but not against MRP1 in both hepatic cell lines. A remarkable dependence of this effect on the

  10. Up-Regulation of the ATP-Binding Cassette Transporter A1 Inhibits Hepatitis C Virus Infection

    PubMed Central

    Gondeau, Claire; Douam, Florian; Lebreton, Stéphanie; Lagaye, Sylvie; Pol, Stanislas; Helle, François; Plengpanich, Wanee; Guérin, Maryse; Bourgine, Maryline; Michel, Marie Louise; Lavillette, Dimitri; Roingeard, Philippe; le Goff, Wilfried; Budkowska, Agata


    Hepatitis C virus (HCV) establishes infection using host lipid metabolism pathways that are thus considered potential targets for indirect anti-HCV strategies. HCV enters the cell via clathrin-dependent endocytosis, interacting with several receptors, and virus-cell fusion, which depends on acidic pH and the integrity of cholesterol-rich domains of the hepatocyte membrane. The ATP-binding Cassette Transporter A1 (ABCA1) mediates cholesterol efflux from hepatocytes to extracellular Apolipoprotein A1 and moves cholesterol within cell membranes. Furthermore, it generates high-density lipoprotein (HDL) particles. HDL protects against arteriosclerosis and cardiovascular disease. We show that the up-regulation of ABCA1 gene expression and its cholesterol efflux function in Huh7.5 hepatoma cells, using the liver X receptor (LXR) agonist GW3965, impairs HCV infection and decreases levels of virus produced. ABCA1-stimulation inhibited HCV cell entry, acting on virus-host cell fusion, but had no impact on virus attachment, replication, or assembly/secretion. It did not affect infectivity or properties of virus particles produced. Silencing of the ABCA1 gene and reduction of the specific cholesterol efflux function counteracted the inhibitory effect of the GW3965 on HCV infection, providing evidence for a key role of ABCA1 in this process. Impaired virus-cell entry correlated with the reorganisation of cholesterol-rich membrane microdomains (lipid rafts). The inhibitory effect could be reversed by an exogenous cholesterol supply, indicating that restriction of HCV infection was induced by changes of cholesterol content/distribution in membrane regions essential for virus-cell fusion. Stimulation of ABCA1 expression by GW3965 inhibited HCV infection of both human primary hepatocytes and isolated human liver slices. This study reveals that pharmacological stimulation of the ABCA1-dependent cholesterol efflux pathway disrupts membrane cholesterol homeostasis, leading to the

  11. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in sea lamprey and Japanese lamprey.


    Ren, Jianfeng; Chung-Davidson, Yu-Wen; Yeh, Chu-Yin; Scott, Camille; Brown, Titus; Li, Weiming


    Lampreys are extant representatives of the jawless vertebrate lineage that diverged from jawed vertebrates around 500 million years ago. Lamprey genomes contain information crucial for understanding the evolution of gene families in vertebrates. The ATP-binding cassette (ABC) gene family is found from prokaryotes to eukaryotes. The recent availability of two lamprey draft genomes from sea lamprey Petromyzon marinus and Japanese lamprey Lethenteron japonicum presents an opportunity to infer early evolutionary events of ABC genes in vertebrates. We conducted a genome-wide survey of the ABC gene family in two lamprey draft genomes. A total of 37 ABC transporters were identified and classified into seven subfamilies; namely seven ABCA genes, 10 ABCB genes, 10 ABCC genes, three ABCD genes, one ABCE gene, three ABCF genes, and three ABCG genes. The ABCA subfamily has expanded from three genes in sea squirts, seven and nine in lampreys and zebrafish, to 13 and 16 in human and mouse. Conversely, the multiple copies of ABCB1-, ABCG1-, and ABCG2-like genes found in sea squirts have contracted in the other species examined. ABCB2 and ABCB3 seem to be new additions in gnathostomes (not in sea squirts or lampreys), which coincides with the emergence of the gnathostome-specific adaptive immune system. All the genes in the ABCD, ABCE and ABCF subfamilies were conserved and had undergone limited duplication and loss events. In the sea lamprey transcriptomes, the ABCE and ABCF gene subfamilies were ubiquitously and highly expressed in all tissues while the members in other gene subfamilies were differentially expressed. Thirteen more lamprey ABC transporter genes were identified in this study compared with a previous study. By concatenating the same gene sequences from the two lampreys, more full length sequences were obtained, which significantly improved both the assignment of gene names and the phylogenetic trees compared with a previous analysis using partial sequences. The ABC

  12. Characterization and expression profiling of ATP-binding cassette transporter genes in the diamondback moth, Plutella xylostella (L.).


    Qi, Weiping; Ma, Xiaoli; He, Weiyi; Chen, Wei; Zou, Mingmin; Gurr, Geoff M; Vasseur, Liette; You, Minsheng


    ATP-binding cassette (ABC) transporters are one of the major transmembrane protein families found in all organisms and play important roles in transporting a variety of compounds across intra and extra cellular membranes. In some species, ABC transporters may be involved in the detoxification of substances such as insecticides. The diamondback moth, Plutella xylostella (L.), a destructive pest of cruciferous crops worldwide, is an important species to study as it is resistant to many types of insecticides as well as biological control Bacillus thuringiensis toxins. A total of 82 ABC genes were identified from our published P. xylostella genome, and grouped into eight subfamilies (ABCA-H) based on phylogenetic analysis. Genes of subfamilies ABCA, ABCC and ABCH were found to be expanded in P. xylostella compared with those in Bombyx mori, Manduca sexta, Heliconius melpomene, Danaus plexippus, Drosophila melanogaster, Tetranychus urticae and Homo sapiens. Phylogenetic analysis indicated that many of the ABC transporters in P. xylostella are orthologous to the well-studied ABC transporter genes in the seven other species. Transcriptome- and qRT-PCR-based analysis elucidated physiological effects of ABC gene expressions of P. xylostella which were developmental stage- and tissue-specific as well as being affected by whether or not the insects were from an insecticide-resistant strain. Two ABCC and one ABCA genes were preferentially expressed in midgut of the 4th-instar larvae of a susceptible strain (Fuzhou-S) suggesting their potential roles in metabolizing plant defensive chemicals. Most of the highly expressed genes in insecticide-resistant strains were also predominantly expressed in the tissues of Malpighian tubules and midgut. This is the most comprehensive study on identification, characterization and expression profiling of ABC transporter genes in P. xylostella to date. The diversified features and expression patterns of this gene family may be associated with

  13. Expression of the small T antigen of Lymphotropic Papovavirus is sufficient to transform primary mouse embryo fibroblasts

    SciTech Connect

    Gupta, Tushar; Robles, Maria Teresa Sáenz; Schowalter, Rachel M.; Buck, Christopher B.; Pipas, James M.


    Polyomaviruses induce cell proliferation and transformation through different oncoproteins encoded within the early region (ER): large T antigen (LT), small T antigen (sT) and, in some cases, additional components. Each virus utilizes different mechanisms to achieve transformation. For instance, the LTs of Simian virus 40 (SV40), BK and/or JC virus can induce transformation; but Merkel Cell Polyomavirus (MCPyV) requires expression of sT. Lymphotropic Papovavirus (LPV) is closely related to Human Polyomavirus 9 (HuPyV9) and, under similar conditions, mice expressing LPV.ER exhibit higher rates of tumor formation than mice expressing SV40.ER. We have investigated the contributions of individual LPV.ER components to cell transformation. In contrast to SV40, LPV.ER transforms mouse embryonic fibroblasts (MEFs), but expression of LPV LT is insufficient to transform MEFs. Furthermore, LPV sT induces immortalization and transformation of MEFs. Thus, in the case of LPV, sT is the main mediator of oncogenesis. - Highlights: • Characterization of early region products from the Lymphotropic Polyomavirus (LPV). • On its own, sT immortalizes and transforms mouse primary cells, and is able to block p53 activation. • Combined LT and sT expression induces a greater rate of proliferation than either LT or sT alone.

  14. Expression of the Small T antigen of Lymphotropic Papovavirus is Sufficient to Transform Primary Mouse Embryo Fibroblasts

    PubMed Central

    Gupta, Tushar; Robles, Maria Teresa Sáenz; Schowalter, Rachel M.; Buck, Christopher B.; Pipas, James M.


    Polyomaviruses induce cell proliferation and transformation through different oncoproteins encoded within the early region (ER): large T antigen (LT), small T antigen (sT) and, in some cases, additional components. Each virus utilizes different mechanisms to achieve transformation. For instance, the LTs of Simian virus 40 (SV40), BK and/or JC virus can induce transformation; but Merkel Cell Polyomavirus (MCPyV) requires expression of sT. Lymphotropic Papovavirus (LPV) is closely related to Human Polyomavirus 9 (HuPyV9) and, under similar conditions, mice expressing LPV.ER exhibit higher rates of tumor formation than mice expressing SV40.ER. We have investigated the contributions of individual LPV.ER components to cell transformation. In contrast to SV40, LPV.ER transforms mouse embryonic fibroblasts (MEFs), but expression of LPV LT is insufficient to transform MEFs. Furthermore, LPV sT induces immortalization and transformation of MEFs. Thus, in the case of LPV, sT is the main mediator of oncogenesis. PMID:26517398

  15. Characterization of T Antigens, Including Middle T and Alternative T, Expressed by the Human Polyomavirus Associated with Trichodysplasia Spinulosa

    PubMed Central

    van der Meijden, Els; Kazem, Siamaque; Dargel, Christina A.; van Vuren, Nick; Hensbergen, Paul J.


    ABSTRACT The polyomavirus tumor (T) antigens play crucial roles in viral replication, transcription, and cellular transformation. They are encoded by partially overlapping open reading frames (ORFs) located in the early region through alternative mRNA splicing. The T expression pattern of the trichodysplasia spinulosa-associated polyomavirus (TSPyV) has not been established yet, hampering further study of its pathogenic mechanisms and taxonomic relationship. Here, we characterized TSPyV T antigen expression in human cell lines transfected with the TSPyV early region. Sequencing of T antigen-encoded reverse transcription-PCR (RT-PCR) products revealed three splice donor and acceptor sites creating six mRNA splice products that potentially encode the antigens small T (ST), middle T (MT), large T (LT), tiny T, 21kT, and alternative T (ALTO). Except for 21kT, these splice products were also detected in skin of TSPyV-infected patients. At least three splice products were confirmed by Northern blotting, likely encoding LT, MT, ST, 21kT, and ALTO. Protein expression was demonstrated for LT, ALTO, and possibly MT, with LT detected in the nucleus and ALTO in the cytoplasm of transfected cells. Splice site and start codon mutations indicated that ALTO is encoded by the same splice product that encodes LT and uses internal start codons for initiation. The genuineness of ALTO was indicated by the identification of acetylated N-terminal ALTO peptides by mass spectrometry. Summarizing, TSPyV exhibits an expression pattern characterized by both MT and ALTO expression, combining features of rodent and human polyomaviruses. This unique expression pattern provides important leads for further study of polyomavirus-related disease and for an understanding of polyomavirus evolution. IMPORTANCE The human trichodysplasia spinulosa-associated polyomavirus (TSPyV) is distinguished among polyomaviruses for combining productive infection with cell-transforming properties. In the research

  16. T-antigen-independent replication of polyomavirus DNA in murine embryonal carcinoma cells

    SciTech Connect

    Dandolo, L.; Aghion, J.; Blangy, D.


    Expression of wild-type polyomavirus (Py) is restricted in murine embryonal carcinoma (EC) cells. The block appears to be located at the level of early transcription. Since no T antigen is produced, the authors investigated the fate of viral DNA upon infection of these cells; they showed that wild-type Py DNA replicates efficiently in all EC cells, probably via a T-antigen-independent mechanism. Furthermore, they studied, at permissive and restrictive temperatures, the replication of tsa (thermosensitive for T antigen) viral DNA of an in vitro-constructed deletion mutant lacking part of the early region coding sequences and of a double mutant carrying both the tsa mutation and the PyEC F9 mutation (allowing expression of early and late viral functions in EC cells). The results imply that replication of wild-type A2 strain Py DNA can occur in EC cells in the absence of a functional T antigen. However, this protein clearly enhances viral DNA replication and is absolutely required in differentiated cells.

  17. ATP binding and hydrolysis disrupt the high-affinity interaction between the heme ABC transporter HmuUV and its cognate substrate-binding protein.


    Qasem-Abdullah, Hiba; Perach, Michal; Livnat-Levanon, Nurit; Lewinson, Oded


    Using the energy of ATP hydrolysis, ABC transporters catalyze the trans-membrane transport of molecules. In bacteria, these transporters partner with a high-affinity substrate-binding protein (SBP) to import essential micronutrients. ATP binding by Type I ABC transporters (importers of amino acids, sugars, peptides, and small ions) stabilizes the interaction between the transporter and the SBP, thus allowing transfer of the substrate from the latter to the former. In Type II ABC transporters (importers of trace elements, e.g. vitamin B12, heme, and iron-siderophores) the role of ATP remains debatable. Here we studied the interaction between the Yersinia pestis ABC heme importer (HmuUV) and its partner substrate-binding protein (HmuT). Using real-time surface plasmon resonance experiments and interaction studies in membrane vesicles, we find that in the absence of ATP the transporter and the SBP tightly bind. Substrate in excess inhibits this interaction, and ATP binding by the transporter completely abolishes it. To release the stable docked SBP from the transporter hydrolysis of ATP is required. Based on these results we propose a mechanism for heme acquisition by HmuUV-T where the substrate-loaded SBP docks to the nucleotide-free outward-facing conformation of the transporter. ATP binding leads to formation of an occluded state with the substrate trapped in the trans-membrane translocation cavity. Subsequent ATP hydrolysis leads to substrate delivery to the cytoplasm, release of the SBP, and resetting of the system. We propose that other Type II ABC transporters likely share the fundamentals of this mechanism. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  18. Hyperactivity of the Arabidopsis cryptochrome (cry1) L407F mutant is caused by a structural alteration close to the cry1 ATP-binding site.


    Orth, Christian; Niemann, Nils; Hennig, Lars; Essen, Lars-Oliver; Batschauer, Alfred


    Plant cryptochromes (cry) act as UV-A/blue light receptors. The prototype, Arabidopsis thaliana cry1, regulates several light responses during the life cycle, including de-etiolation, and is also involved in regulating flowering time. The cry1 photocycle is initiated by light absorption by its FAD chromophore, which is most likely fully oxidized (FADox) in the dark state and photoreduced to the neutral flavin semiquinone (FADH°) in its lit state. Cryptochromes lack the DNA-repair activity of the closely related DNA photolyases, but they retain the ability to bind nucleotides such as ATP. The previously characterized L407F mutant allele of Arabidopsis cry1 is biologically hyperactive and seems to mimic the ATP-bound state of cry1, but the reason for this phenotypic change is unclear. Here, we show that cry1L407F can still bind ATP, has less pronounced photoreduction and formation of FADH° than wild-type cry1, and has a dark reversion rate 1.7 times lower than that of the wild type. The hyperactivity of cry1L407F is not related to a higher FADH° occupancy of the photoreceptor but is caused by a structural alteration close to the ATP-binding site. Moreover, we show that ATP binds to cry1 in both the dark and the lit states. This binding was not affected by cry1's C-terminal extension, which is important for signal transduction. Finally, we show that a recently discovered chemical inhibitor of cry1, 3-bromo-7-nitroindazole, competes for ATP binding and thereby diminishes FADH° formation, which demonstrates that both processes are important for cry1 function. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  19. Structural Models of Zebrafish (Danio rerio) NOD1 and NOD2 NACHT Domains Suggest Differential ATP Binding Orientations: Insights from Computational Modeling, Docking and Molecular Dynamics Simulations

    PubMed Central

    Maharana, Jitendra; Sahoo, Bikash Ranjan; Bej, Aritra; Sahoo, Jyoti Ranjan; Dehury, Budheswar; Patra, Mahesh Chandra; Martha, Sushma Rani; Balabantray, Sucharita; Pradhan, Sukanta Kumar; Behera, Bijay Kumar


    Nucleotide-binding oligomerization domain-containing protein 1 (NOD1) and NOD2 are cytosolic pattern recognition receptors playing pivotal roles in innate immune signaling. NOD1 and NOD2 recognize bacterial peptidoglycan derivatives iE-DAP and MDP, respectively and undergoes conformational alternation and ATP-dependent self-oligomerization of NACHT domain followed by downstream signaling. Lack of structural adequacy of NACHT domain confines our understanding about the NOD-mediated signaling mechanism. Here, we predicted the structure of NACHT domain of both NOD1 and NOD2 from model organism zebrafish (Danio rerio) using computational methods. Our study highlighted the differential ATP binding modes in NOD1 and NOD2. In NOD1, γ-phosphate of ATP faced toward the central nucleotide binding cavity like NLRC4, whereas in NOD2 the cavity was occupied by adenine moiety. The conserved ‘Lysine’ at Walker A formed hydrogen bonds (H-bonds) and Aspartic acid (Walker B) formed electrostatic interaction with ATP. At Sensor 1, Arg328 of NOD1 exhibited an H-bond with ATP, whereas corresponding Arg404 of NOD2 did not. ‘Proline’ of GxP motif (Pro386 of NOD1 and Pro464 of NOD2) interacted with adenine moiety and His511 at Sensor 2 of NOD1 interacted with γ-phosphate group of ATP. In contrast, His579 of NOD2 interacted with the adenine moiety having a relatively inverted orientation. Our findings are well supplemented with the molecular interaction of ATP with NLRC4, and consistent with mutagenesis data reported for human, which indicates evolutionary shared NOD signaling mechanism. Together, this study provides novel insights into ATP binding mechanism, and highlights the differential ATP binding modes in zebrafish NOD1 and NOD2. PMID:25811192

  20. [The effect of soy isoflavones on ATP binding cassette A1 expression level in rats without ovaries with atherosclerotic plaque].


    Li, Xian-biao; Ji, Li-li; Li, Yong; Zhang, Yu-mei


    To study the effect of soy isoflavones (SI) on ATP binding cassette A1 (ABCA1) expression in rats without ovary with atherosclerosis. After they were raised for a week by given basic feed, the ovaries of 50 12-week old SPF rats were removed. The rats were randomly divided into groups by weight. Ten rats were selected as the basic control group (A) that basic feed was given all through the research. The other 40 rats were given high-fat diets and at the end of 4 weeks, these rats were randomly divided into four groups by blood lipid level: atherosclerotic model group (B) that was given high-fat diets through the research, low isoflavones group (C) that was given high-fat diets plus 30 mg/kg SI, middle isoflavones group (D) that was given high-fat diets plus 90 mg/kg SI, and high isoflavones group (E) that was given high-fat diets plus 270 mg/kg SI. After 22 weeks, all rats were executed to measure morphological change on the aorta wall, assessing the ABCA1 gene expression in aorta wall by real-time PCR and protein expression by Western blotting in aorta wall, small intestine and liver. Serum lipid level of A, B, C, D, E groups: TC levels were (6.82 +/- 0.22), (15.73 +/- 1.51), (10.77 +/- 1.12), (9.95 +/- 1.18), (9.11 +/- 1.12) mmol/L respectively (F = 72.882, P < 0.01); TG levels were: (2.49 +/- 0.24), (0.78 +/- 0.13), (0.39 +/- 0.08), (0.29 +/- 0.09), (0.24 +/- 0.09) mmol/L respectively (F = 378.515, P < 0.01); LDL-C levels were (1.29 +/- 0.08), (14.76 +/- 1.23), (8.18 +/- 0.80), (7.85 +/- 0.72), (7.16 +/- 0.64)mmol/L respectively (F = 320.936, P < 0.01); HDL-C levels were (1.94 +/- 0.18), (1.04 +/- 0.10), (1.55 +/- 0.14), (1.88 +/- 0.17), (2.11 +/- 0.22) mmol/L respectively (F = 49.450, P < 0.01). ABCA1 protein expression in intestine, liver and aorta: for A, B, C, E groups in intestine were 96.577 +/- 9.743, 5.218 +/- 2.048, 18.060 +/- 5.179, 54.725 +/- 8.960, respectively (F = 172.272, P < 0.01); ABCA1 protein expression in liver of groups of A, B, C, E were: 13

  1. Evaluation of the role of ATP-binding cassette transporters as a defence mechanism against temephos in populations of Aedes aegypti

    PubMed Central

    Lima, Estelita Pereira; Goulart, Marília Oliveira Fonseca; Rolim, Modesto Leite


    The role of ATP-binding cassette (ABC) transporters in the efflux of the insecticide, temephos, was assessed in the larvae of Aedes aegypti. Bioassays were conducted using mosquito populations that were either susceptible or resistant to temephos by exposure to insecticide alone or in combination with sublethal doses of the ABC transporter inhibitor, verapamil (30, 35 and 40 μM). The best result in the series was obtained with the addition of verapamil (40 μM), which led to a 2x increase in the toxicity of temephos, suggesting that ABC transporters may be partially involved in conferring resistance to the populations evaluated.

  2. Structural characterization of an MJ1267 ATP-binding cassette crystal with a complex pattern of twinning caused by promiscuous fiber packing.


    Yuan, Yu-Ren; Martsinkevich, Oskana; Hunt, John F


    ATP-binding cassettes represent the motor domains in ABC transporters, a superfamily of integral membrane-protein pumps that couple the hydrolysis of ATP to transmembrane solute translocation. A crystal of a Mg-ADP complex of the MJ1267 ATP-binding cassette was obtained that produced a diffraction pattern characterized by pathological streaking of the spots in the a* x b* plane. While the Laue symmetry of the diffraction pattern was P3;1m, the crystal was determined to be twinned based on intensity statistics, molecular-replacement analysis and difference Fourier analysis of an engineered single-site methylmercury derivative. The unit cell contains three similar 3(1) fibers, with two of them related by primarily translational non-crystallographic symmetry (NCS) and the third related to the first two by approximate twofold screw operations whose rotational components are very similar to the twinning operator. The promiscuous packing of these 3(1) fibers, which make both parallel and antiparallel interactions in the primary crystal lattice, can explain the twinning tendency based on the ability of the twin-related lattices to interact with one another while making only one slightly sub-optimal intermolecular contact per unit cell in the boundary region. The promiscuous fiber packing can also explain the streaking in the diffraction pattern based on the ability to form a variety of different lattices with similar inter-fiber packing interactions. The crystal structure was refined as a twin in space group P3(1) using the program CNS, yielding a free R factor of 28.9% at 2.6 A and a refined twin fraction of 0.50. The structure shows a rigid-body rotation of the ABC-transporter-specific alpha-helical subdomain (ABCalpha subdomain) in MJ1267 compared with the conformation observed for the same protein in a C2 crystal lattice; this observation suggests that the ABCalpha subdomain is flexibly attached to the F1-type ATP-binding core of the ATP-binding cassette when Mg

  3. Two Independent Regions of Simian Virus 40 T Antigen Increase CBP/p300 Levels, Alter Patterns of Cellular Histone Acetylation, and Immortalize Primary Cells

    PubMed Central

    Sáenz Robles, Maria Teresa; Shivalila, Chikdu; Wano, Jeremy; Sorrells, Shelly; Roos, Alison


    Simian virus 40 (SV40) large T antigen (SVT) interferes with normal cell regulation and thus has been used to identify cellular components controlling proliferation and homeostasis. We have previously shown that SVT-mediated transformation requires interaction with the histone acetyltransferases (HATs) CBP/p300 and now report that the ectopic expression of SVT in several cell types in vivo and in vitro results in a significant increase in the steady-state levels of CBP/p300. Furthermore, SVT-expressing cells contain higher levels of acetylated CBP/p300, a modification that has been linked to increased HAT activity. Concomitantly, the acetylation levels of histone residues H3K56 and H4K12 are markedly increased in SVT-expressing cells. Other polyomavirus-encoded large T antigens also increase the levels of CBP/p300 and sustain a rise in the acetylation levels of H3K56 and H4K12. SVT does not affect the transcription of CBP/p300, but rather, alters their overall levels through increasing the loading of CBP/p300 mRNAs onto polysomes. Two distinct regions within SVT, one located in the amino terminus and one in the carboxy terminus, can independently alter both the levels of CBP/p300 and the loading of CBP/p300 transcripts onto polysomes. Within the amino-terminal fragment, a functional J domain is necessary for increasing CBP/p300 and specific histone acetylation levels, as well as for immortalizing primary cells. These studies uncover the action of polyomavirus T antigens on cellular CBP/p300 and suggest that additional mechanisms are used by T antigens to induce cell immortalization and transformation. PMID:24089570

  4. Inactivation of T Antigen-Forming Capacities of Simian Virus 40 and Adenovirus 12 by Ultraviolet Irradiation

    PubMed Central

    Yamamoto, Hiroshi; Shimojo, Hiroto


    Methods to measure T antigen-forming capacities of simian virus 40 (SV40) and adenovirus 12 (Ad12) were investigated, and a method to measure the capacity in terms of T antigen-forming units was employed by the use of cytosine arabinoside. Plaque-forming units and T antigen-forming units of SV40, SV40 deoxyribonucleic acid, or Ad12 were inactivated by ultraviolet (UV) irradiation at the same rate, roughly following a single-hit curve. T-antigen formation by UV-irradiated SV40 and Ad12 was enhanced in cells multiply infected and in cells in a growing state. These observations showed that it was difficult or impossible to estimate the size of the gene for T antigen by UV inactivation. PMID:4329559

  5. Conservation of an ATP-binding domain among RecA proteins from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r.


    Knight, K L; Hess, R M; McEntee, K


    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N3ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the [alpha-32P]8N3ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T31 of the E. coli K-12 RecA protein, which was the unique site of 8N3ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10(7) years.

  6. NpPDR1, a pleiotropic drug resistance-type ATP-binding cassette transporter from Nicotiana plumbaginifolia, plays a major role in plant pathogen defense.


    Stukkens, Yvan; Bultreys, Alain; Grec, Sébastien; Trombik, Tomasz; Vanham, Delphine; Boutry, Marc


    Nicotiana plumbaginifolia NpPDR1, a plasma membrane pleiotropic drug resistance-type ATP-binding cassette transporter formerly named NpABC1, has been suggested to transport the diterpene sclareol, an antifungal compound. However, direct evidence for a role of pleiotropic drug resistance transporters in the plant defense is still lacking. In situ immunolocalization and histochemical analysis using the gusA reporter gene showed that NpPDR1 was constitutively expressed in the whole root, in the leaf glandular trichomes, and in the flower petals. However, NpPDR1 expression was induced in the whole leaf following infection with the fungus Botrytis cinerea, and the bacteria Pseudomonas syringae pv tabaci, Pseudomonas fluorescens, and Pseudomonas marginalis pv marginalis, which do not induce a hypersensitive response in N. plumbaginifolia, whereas a weaker response was observed using P. syringae pv syringae, which does induce a hypersensitive response. Induced NpPDR1 expression was more associated with the jasmonic acid than the salicylic acid signaling pathway. These data suggest that NpPDR1 is involved in both constitutive and jasmonic acid-dependent induced defense. Transgenic plants in which NpPDR1 expression was prevented by RNA interference showed increased sensitivity to sclareol and reduced resistance to B. cinerea. These data show that NpPDR1 is involved in pathogen resistance and thus demonstrate a new role for the ATP-binding cassette transporter family.

  7. NpPDR1, a Pleiotropic Drug Resistance-Type ATP-Binding Cassette Transporter from Nicotiana plumbaginifolia, Plays a Major Role in Plant Pathogen Defense1

    PubMed Central

    Stukkens, Yvan; Bultreys, Alain; Grec, Sébastien; Trombik, Tomasz; Vanham, Delphine; Boutry, Marc


    Nicotiana plumbaginifolia NpPDR1, a plasma membrane pleiotropic drug resistance-type ATP-binding cassette transporter formerly named NpABC1, has been suggested to transport the diterpene sclareol, an antifungal compound. However, direct evidence for a role of pleiotropic drug resistance transporters in the plant defense is still lacking. In situ immunolocalization and histochemical analysis using the gusA reporter gene showed that NpPDR1 was constitutively expressed in the whole root, in the leaf glandular trichomes, and in the flower petals. However, NpPDR1 expression was induced in the whole leaf following infection with the fungus Botrytis cinerea, and the bacteria Pseudomonas syringae pv tabaci, Pseudomonas fluorescens, and Pseudomonas marginalis pv marginalis, which do not induce a hypersensitive response in N. plumbaginifolia, whereas a weaker response was observed using P. syringae pv syringae, which does induce a hypersensitive response. Induced NpPDR1 expression was more associated with the jasmonic acid than the salicylic acid signaling pathway. These data suggest that NpPDR1 is involved in both constitutive and jasmonic acid-dependent induced defense. Transgenic plants in which NpPDR1 expression was prevented by RNA interference showed increased sensitivity to sclareol and reduced resistance to B. cinerea. These data show that NpPDR1 is involved in pathogen resistance and thus demonstrate a new role for the ATP-binding cassette transporter family. PMID:16126865

  8. The rem Mutations in the ATP-Binding Groove of the Rad3/XPD Helicase Lead to Xeroderma pigmentosum-Cockayne Syndrome-Like Phenotypes

    PubMed Central

    Montelone, Beth A.; Aguilera, Andrés


    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease. PMID:25500814

  9. The rem mutations in the ATP-binding groove of the Rad3/XPD helicase lead to Xeroderma pigmentosum-Cockayne syndrome-like phenotypes.


    Herrera-Moyano, Emilia; Moriel-Carretero, María; Montelone, Beth A; Aguilera, Andrés


    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease.

  10. Conservation of an ATP-binding domain among recA proteins from Proteus vulgaris, erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r

    SciTech Connect

    Knight, K.L.; Hess, R.M.; McEntee, K.


    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N/sub 3/ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the (..cap alpha..-/sup 32/P)8N/sub 3/ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T/sub 31/ of the E. coli K-12 RecA protein, which was the unique site of 8N/sub 3/ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10/sup 7/ years.

  11. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.


    Fry, D C; Kuby, S A; Mildvan, A S


    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme.

  12. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.

    PubMed Central

    Fry, D C; Kuby, S A; Mildvan, A S


    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme. Images PMID:2869483

  13. Characterization of a T-antigen-negative revertant isolated from a mouse cell line which undergoes rearrangement of integrated simian virus 40 DNA.

    PubMed Central

    Bender, M A; Christensen, J; Brockman, W W


    A transformation revertant has been isolated from an unusual line of simian virus 40 (SV40)-transformed BALB/c-3T3 cells in which rearrangements of integrated viral sequences are common. The revertant produces no SV40 T antigens, yields no virus on fusion with permissive cells, and can be retransformed by SV40 virions. SV40 DNA sequences are present within the cellular DNA, but interruption of the viral early transcription region by deletion and recombination with cellular sequences precludes the synthesis of T antigens. Analysis of this revertant lends further support to the notion that large T antigen plays an essential role in the maintenance of transformation in SV40-transformed BALB/c-3T3 cells. Examination of integration of SV40 DNA in this revertant, as well as in a temperature-sensitive A transformant, after retransformation by SV40 confirms that sequence homology plays little role in the insertion of SV40 DNA into cellular chromosomes. Images PMID:6306268

  14. Expression and structural characterization of anti-T-antigen single-chain antibodies (scFvs) and analysis of their binding to T-antigen by surface plasmon resonance and NMR spectroscopy.


    Yuasa, Noriyuki; Koyama, Tsubasa; Subedi, Ganesh P; Yamaguchi, Yoshiki; Matsushita, Misao; Fujita-Yamaguchi, Yoko


    T-antigen (Galβ1-3GalNAcα-1-Ser/Thr), also known as Thomsen-Friedenreich antigen (TF antigen), is an oncofetal antigen commonly found in cancerous tissues. Availability of anti-T-antigen human antibodies could lead to the development of cancer diagnostics and therapeutics. Four groups of single-chain variable fragment (scFv) genes were previously isolated from a phage library (Matsumoto-Takasaki et al. (2009) Isolation and characterization of anti-T-antigen single chain antibodies from a phage library. BioSci Trends 3:87-95.). Here, four anti-T-antigen scFv genes belonging to Group 1-4 were expressed and produced in a Drosophila S2 cell expression system. ELISA and surface plasmon resonance (SPR) analyses confirmed the binding activity of 1E8 scFv protein to various T-antigen presenting conjugates. NMR experiments provided evidence of the folded nature of the 1E8 scFv protein. ScFv-ligand contact was identified by STD NMR, indicating that the galactose unit of T-antigen at the non-reducing end was primarily recognized by 1E8 scFv. This thus provides direct evidence of T-antigen specificity.

  15. Pathogen-Responsive Expression of a Putative ATP-Binding Cassette Transporter Gene Conferring Resistance to the Diterpenoid Sclareol Is Regulated by Multiple Defense Signaling Pathways in Arabidopsis1

    PubMed Central

    Campbell, Emma J.; Schenk, Peer M.; Kazan, Kemal; Penninckx, Iris A.M.A.; Anderson, Jonathan P.; Maclean, Don J.; Cammue, Bruno P.A.; Ebert, Paul R.; Manners, John M.


    The ATP-binding cassette (ABC) transporters are encoded by large gene families in plants. Although these proteins are potentially involved in a number of diverse plant processes, currently, very little is known about their actual functions. In this paper, through a cDNA microarray screening of anonymous cDNA clones from a subtractive library, we identified an Arabidopsis gene (AtPDR12) putatively encoding a member of the pleiotropic drug resistance (PDR) subfamily of ABC transporters. AtPDR12 displayed distinct induction profiles after inoculation of plants with compatible and incompatible fungal pathogens and treatments with salicylic acid, ethylene, or methyl jasmonate. Analysis of AtPDR12 expression in a number of Arabidopsis defense signaling mutants further revealed that salicylic acid accumulation, NPR1 function, and sensitivity to jasmonates and ethylene were all required for pathogen-responsive expression of AtPDR12. Germination assays using seeds from an AtPDR12 insertion line in the presence of sclareol resulted in lower germination rates and much stronger inhibition of root elongation in the AtPDR12 insertion line than in wild-type plants. These results suggest that AtPDR12 may be functionally related to the previously identified ABC transporters SpTUR2 and NpABC1, which transport sclareol. Our data also point to a potential role for terpenoids in the Arabidopsis defensive armory. PMID:14526118

  16. T antigen expression and tumorigenesis in transgenic mice containing a mouse major urinary protein/SV40 T antigen hybrid gene.

    PubMed Central

    Held, W A; Mullins, J J; Kuhn, N J; Gallagher, J F; Gu, G D; Gross, K W


    A hybrid mouse major urinary protein (MUP)/SV40 T antigen gene was microinjected into fertilized mouse embryos and the resulting transgenic mice analyzed for the regulated expression of the transgene. Available evidence indicates that the MUP gene used for the hybrid gene construct is expressed in both male and female liver and possibly mammary gland. Three different transgenic lines exhibited a consistent pattern of tissue specific expression of the transgene. As a consequence of transgene expression and T antigen synthesis in the liver, both male and female transgenic animals developed liver hyperplasia and tumors. Transgene expression and liver hyperplasia commenced at approximately 2-4 weeks of age, the same time that MUP gene expression is first detected in the liver. The expression of the transgene resulted in an immediate strong suppression of liver MUP mRNA levels but had relatively little effect on other liver specific mRNAs. From 4 to 8 weeks, the liver increased several fold in size, relative to non-transgenic littermates. Definitive tumor nodules were not apparent until 8-10 weeks. The transgene was also consistently found to be expressed in the skin sebaceous glands and the preputial gland, a modified sebaceous gland. The expression of the transgene in the skin sebaceous glands is consistent with the presence of MUP mRNA in the skin and a putative role for MUPs in the transport and excretion of small molecules. Occasional expression of the transgene in other tissues (kidney and mammary connective tissues) was also noted.(ABSTRACT TRUNCATED AT 250 WORDS) Images PMID:2714250

  17. Merkel Cell Polyomavirus Small T Antigen Mediates Microtubule Destabilization To Promote Cell Motility and Migration

    PubMed Central

    Knight, Laura M.; Stakaityte, Gabriele; Wood, Jennifer, J.; Abdul-Sada, Hussein; Griffiths, David A.; Howell, Gareth J.; Wheat, Rachel; Blair, G. Eric; Steven, Neil M.; Macdonald, Andrew; Blackbourn, David J.


    ABSTRACT Merkel cell carcinoma (MCC) is an aggressive skin cancer of neuroendocrine origin with a high propensity for recurrence and metastasis. Merkel cell polyomavirus (MCPyV) causes the majority of MCC cases due to the expression of the MCPyV small and large tumor antigens (ST and LT, respectively). Although a number of molecular mechanisms have been attributed to MCPyV tumor antigen-mediated cellular transformation or replication, to date, no studies have investigated any potential link between MCPyV T antigen expression and the highly metastatic nature of MCC. Here we use a quantitative proteomic approach to show that MCPyV ST promotes differential expression of cellular proteins implicated in microtubule-associated cytoskeletal organization and dynamics. Intriguingly, we demonstrate that MCPyV ST expression promotes microtubule destabilization, leading to a motile and migratory phenotype. We further highlight the essential role of the microtubule-associated protein stathmin in MCPyV ST-mediated microtubule destabilization and cell motility and implicate the cellular phosphatase catalytic subunit protein phosphatase 4C (PP4C) in the regulation of this process. These findings suggest a possible molecular mechanism for the highly metastatic phenotype associated with MCC. IMPORTANCE Merkel cell polyomavirus (MCPyV) causes the majority of cases of Merkel cell carcinoma (MCC), an aggressive skin cancer with a high metastatic potential. However, the molecular mechanisms leading to virally induced cancer development have yet to be fully elucidated. In particular, no studies have investigated any potential link between the virus and the highly metastatic nature of MCC. We demonstrate that the MCPyV small tumor antigen (ST) promotes the destabilization of the host cell microtubule network, which leads to a more motile and migratory cell phenotype. We further show that MCPyV ST induces this process by regulating the phosphorylation status of the cellular microtubule

  18. Decipher the Mechanisms of Protein Conformational Changes Induced by Nucleotide Binding through Free-Energy Landscape Analysis: ATP Binding to Hsp70

    PubMed Central

    Nicolaï, Adrien; Delarue, Patrice; Senet, Patrick


    ATP regulates the function of many proteins in the cell by transducing its binding and hydrolysis energies into protein conformational changes by mechanisms which are challenging to identify at the atomic scale. Based on molecular dynamics (MD) simulations, a method is proposed to analyze the structural changes induced by ATP binding to a protein by computing the effective free-energy landscape (FEL) of a subset of its coordinates along its amino-acid sequence. The method is applied to characterize the mechanism by which the binding of ATP to the nucleotide-binding domain (NBD) of Hsp70 propagates a signal to its substrate-binding domain (SBD). Unbiased MD simulations were performed for Hsp70-DnaK chaperone in nucleotide-free, ADP-bound and ATP-bound states. The simulations revealed that the SBD does not interact with the NBD for DnaK in its nucleotide-free and ADP-bound states whereas the docking of the SBD was found in the ATP-bound state. The docked state induced by ATP binding found in MD is an intermediate state between the initial nucleotide-free and final ATP-bound states of Hsp70. The analysis of the FEL projected along the amino-acid sequence permitted to identify a subset of 27 protein internal coordinates corresponding to a network of 91 key residues involved in the conformational change induced by ATP binding. Among the 91 residues, 26 are identified for the first time, whereas the others were shown relevant for the allosteric communication of Hsp70 s in several experiments and bioinformatics analysis. The FEL analysis revealed also the origin of the ATP-induced structural modifications of the SBD recently measured by Electron Paramagnetic Resonance. The pathway between the nucleotide-free and the intermediate state of DnaK was extracted by applying principal component analysis to the subset of internal coordinates describing the transition. The methodology proposed is general and could be applied to analyze allosteric communication in other proteins

  19. Biochemical studies on the structure-function relationship of major drug transporters in the ATP-binding cassette family and solute carrier family.


    Hong, Mei


    Human drug transporters often play key roles in determining drug accumulation within cells. Their activities are often directly related to therapeutic efficacy, drug toxicity as well as drug-drug interactions. However, the progress for interpretation of their crystal structures is relatively slow. Hence, conventional biochemical studies together with computer modeling became useful manners to reveal essential structures of these membrane proteins. Over the years, quite a few structure-function relationship information had been obtained for members of the two major transporter families: the ATP-binding cassette family and the solute carrier family. Critical structural features of drug transporters include transmembrane domains, post-translational modification sites and domains for cell surface assembly and protein-protein interactions. Alterations at these important sites may affect protein stability, trafficking to the plasma membrane and/or ability of transporters to interact with substrates. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.


    Lu, Y P; Li, Z S; Rea, P A


    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  1. Demonstration of phosphoryl group transfer indicates that the ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) exhibits adenylate kinase activity.


    Randak, Christoph O; Ver Heul, Amanda R; Welsh, Michael J


    Cystic fibrosis transmembrane conductance regulator (CFTR) is a membrane-spanning adenosine 5'-triphosphate (ATP)-binding cassette (ABC) transporter. ABC transporters and other nuclear and cytoplasmic ABC proteins have ATPase activity that is coupled to their biological function. Recent studies with CFTR and two nonmembrane-bound ABC proteins, the DNA repair enzyme Rad50 and a structural maintenance of chromosome (SMC) protein, challenge the model that the function of all ABC proteins depends solely on their associated ATPase activity. Patch clamp studies indicated that in the presence of physiologically relevant concentrations of adenosine 5'-monophosphate (AMP), CFTR Cl(-) channel function is coupled to adenylate kinase activity (ATP+AMP <==> 2 ADP). Work with Rad50 and SMC showed that these enzymes catalyze both ATPase and adenylate kinase reactions. However, despite the supportive electrophysiological results with CFTR, there are no biochemical data demonstrating intrinsic adenylate kinase activity of a membrane-bound ABC transporter. We developed a biochemical assay for adenylate kinase activity, in which the radioactive γ-phosphate of a nucleotide triphosphate could transfer to a photoactivatable AMP analog. UV irradiation could then trap the (32)P on the adenylate kinase. With this assay, we discovered phosphoryl group transfer that labeled CFTR, thereby demonstrating its adenylate kinase activity. Our results also suggested that the interaction of nucleotide triphosphate with CFTR at ATP-binding site 2 is required for adenylate kinase activity. These biochemical data complement earlier biophysical studies of CFTR and indicate that the ABC transporter CFTR can function as an adenylate kinase.

  2. Elevated rates of force development and MgATP binding in F764L and S532P myosin mutations causing dilated cardiomyopathy.


    Palmer, Bradley M; Schmitt, Joachim P; Seidman, Christine E; Seidman, J G; Wang, Yuan; Bell, Stephen P; Lewinter, Martin M; Maughan, David W


    Dilated cardiomyopathy (DCM) is a disease characterized by dilation of the ventricular chambers and reduced contractile function. We examined the contractile performance of chemically-skinned ventricular strips from two heterozygous murine models of DCM-causing missense mutations of myosin, F764L/+ and S532P/+, in an α-myosin heavy chain (MyHC) background. In Ca(2+)-activated skinned myocardial strips, the maximum developed tension in F764L/+ was only ~50% that of litter-mate controls (+/+). The F764L/+ also exhibited significantly reduced rigor stiffness, loaded shortening velocity and power output. Corresponding indices for S532P/+ strips were not different from controls. Manipulation of MgATP concentration in conjunction with measures of viscoelasticity, which provides estimates of myosin detachment rate 2πc, allowed us to probe the molecular basis of changes in crossbridge kinetics that occur with the myosin mutations. By examining the response of detachment rate to varying MgATP we found the rate of MgADP release was unaffected by the myosin mutations. However, MgATP binding rate was higher in the DCM groups compared to controls (422±109mM(-1)·s(-1) in F764L/+, 483±74mM(-1)·s(-1) in S532P/+ and 303±18mM(-1)·s(-1) in +/+). In addition, the rate constant of force development, 2πb, was significantly higher in DCM groups compared to controls (at 5mM MgATP: 36.9±4.9s(-1) in F764L/+, 32.9±4.5s(-1) in S532P/+ and 18.2±1.7s(-1) in +/+). These results suggest that elevated rates of force development and MgATP binding are features of cardiac myofilament function that underlie the development of DCM.

  3. Maltose-binding protein effectively stabilizes the partially closed conformation of the ATP-binding cassette transporter MalFGK2.


    Weng, Jingwei; Gu, Shuo; Gao, Xin; Huang, Xuhui; Wang, Wenning


    Maltose transporter MalFGK2 is a type-I importer in the ATP-binding cassette (ABC) transporter superfamily. Upon the binding of its periplasmic binding protein, MalE, the ATPase activity of MalFGK2 can be greatly enhanced. Crystal structures of the MalFGK2-MalE-maltose complex in a so-called "pretranslocation" ("pre-T") state with a partially closed conformation suggest that the formation of this MalE-stabilized intermediate state is a key step leading to the outward-facing catalytic state. On the contrary, crosslinking and fluorescence studies suggest that ATP binding alone is sufficient to promote the outward-facing catalytic state, thereby doubting the role of MalE binding. To clarify the role of MalE binding and to gain deeper understanding of the molecular mechanisms of MalFGK2, we calculated the free energy surfaces (FESs) related to the lateral motion in the presence and absence of MalE using atomistic metadynamics simulations. The results showed that, in the absence of MalE, laterally closing motion was energetically forbidden but, upon MalE binding, more closed conformations similar to the pre-T state become more stable. The significant effect of MalE binding on the free energy landscapes was in agreement with crystallographic studies and confirmed the important role of MalE in stabilizing the pre-T state. Our simulations also revealed that the allosteric effect of MalE stimulation originates from the MalE-binding-promoted vertical motion between MalF and MalG cores, which was further supported by MD simulation of the MalE-independent mutant MalF500.

  4. Reversible transport by the ATP-binding cassette multidrug export pump LmrA: ATP synthesis at the expense of downhill ethidium uptake.


    Balakrishnan, Lekshmy; Venter, Henrietta; Shilling, Richard A; van Veen, Hendrik W


    The ATP dependence of ATP-binding cassette (ABC) transporters has led to the widespread acceptance that these systems are unidirectional. Interestingly, in the presence of an inwardly directed ethidium concentration gradient in ATP-depleted cells of Lactococcus lactis, the ABC multidrug transporter LmrA mediated the reverse transport (or uptake) of ethidium with an apparent K(t) of 2.0 microm. This uptake reaction was competitively inhibited by the LmrA substrate vinblastine and was significantly reduced by an E314A substitution in the membrane domain of the transporter. Similar to efflux, LmrA-mediated ethidium uptake was inhibited by the E512Q replacement in the Walker B region of the nucleotide-binding domain of the protein, which strongly reduced its drug-stimulated ATPase activity, consistent with published observations for other ABC transporters. The notion that ethidium uptake is coupled to the catalytic cycle in LmrA was further corroborated by studies in LmrA-containing cells and proteoliposomes in which reverse transport of ethidium was associated with the net synthesis of ATP. Taken together, these data demonstrate that the conformational changes required for drug transport by LmrA are (i) not too far from equilibrium under ATP-depleted conditions to be reversed by appropriate changes in ligand concentrations and (ii) not necessarily coupled to ATP hydrolysis, but associated with a reversible catalytic cycle. These findings and their thermodynamic implications shed new light on the mechanism of energy coupling in ABC transporters and have implications for the development of new modulators that could enable reverse transport-associated drug delivery in cells through their ability to uncouple ATP binding/hydrolysis from multidrug efflux.

  5. Computer modelling reveals new conformers of the ATP binding loop of Na(+)/K(+)-ATPase involved in the transphosphorylation process of the sodium pump.


    Tejral, Gracian; Sopko, Bruno; Necas, Alois; Schoner, Wilhelm; Amler, Evzen


    Hydrolysis of ATP by Na(+)/K(+)-ATPase, a P-Type ATPase, catalyzing active Na(+) and K(+) transport through cellular membranes leads transiently to a phosphorylation of its catalytical α-subunit. Surprisingly, three-dimensional molecular structure analysis of P-type ATPases reveals that binding of ATP to the N-domain connected by a hinge to the P-domain is much too far away from the Asp(369) to allow the transfer of ATP's terminal phosphate to its aspartyl-phosphorylation site. In order to get information for how the transfer of the γ-phosphate group of ATP to the Asp(369) is achieved, analogous molecular modeling of the M4-M5 loop of ATPase was performed using the crystal data of Na(+)/K(+)-ATPase of different species. Analogous molecular modeling of the cytoplasmic loop between Thr(338) and Ile(760) of the α2-subunit of Na(+)/K(+)-ATPase and the analysis of distances between the ATP binding site and phosphorylation site revealed the existence of two ATP binding sites in the open conformation; the first one close to Phe(475) in the N-domain, the other one close to Asp(369) in the P-domain. However, binding of Mg(2+)•ATP to any of these sites in the "open conformation" may not lead to phosphorylation of Asp(369). Additional conformations of the cytoplasmic loop were found wobbling between "open conformation" <==> "semi-open conformation <==> "closed conformation" in the absence of 2Mg(2+)•ATP. The cytoplasmic loop's conformational change to the "semi-open conformation"-characterized by a hydrogen bond between Arg(543) and Asp(611)-triggers by binding of 2Mg(2+)•ATP to a single ATP site and conversion to the "closed conformation" the phosphorylation of Asp(369) in the P-domain, and hence the start of Na(+)/K(+)-activated ATP hydrolysis.

  6. The human malaria parasite Plasmodium falciparum exports the ATP-binding cassette protein PFGCN20 to membrane structures in the host red blood cell.


    Bozdech, Z; VanWye, J; Haldar, K; Schurr, E


    PFGCN20 is a member of the ATP-binding cassette family of proteins that is closely related to the yeast translational regulator Gcn20p. We have generated a polyclonal antibody against the N-terminal region of PFGCN20 and studied the cellular localization of PFGCN20 throughout the erythrocytic life cycle of Plasmodium falciparum. PFGCN20 was found to be present at all stages and a pronounced export of PFGCN20 into the erythrocyte was observed in the trophozoite and schizont stages. In the indirect immunofluorescence assay, PFGCN20 was found to display significant colocalization with antigens detected by the monoclonal antibody 41E11. In contrast, there was only a minimal overlap of PFGCN20 localization with EMP2 and HRP2. Immunoelectron microscopy demonstrated a pronounced accumulation of PFGCN20 in the lumen of the parasitophorous vacuole and deconvolution fluorescence microscopy showed membrane association with selective regions of a tubovesicular network in the red cell. We also observed a concentration of PFGCN20 in electron-dense plaques just underneath the parasite's plasma membrane and an association of PFGCN20 with cytoplasmic vesicular structures within the parasite. The observed export of PFGCN20 and its association with the tubovesicular network in host red cells, may be indicative of the fact that PFGCN20 functions as ATP-binding subunit of an unknown multimeric ABC-transporter. The cytoplasmic localization of PFGCN20 in the parasite, however, suggests that the involvement of PFGCN20 in translational regulation or other cytoplasmic biological functions cannot be ruled out.

  7. A novel ATP-binding cassette transporter is responsible for resistance to viologen herbicides in the cyanobacterium Synechocystis sp. PCC 6803.


    Prosecka, Jana; Orlov, Artem V; Fantin, Yuri S; Zinchenko, Vladislav V; Babykin, Michael M; Tichy, Martin


    The charged quaternary ammonium compounds--methyl, ethyl and benzyl viologens--generate reactive oxygen species in photosynthetic cells. Three independent methyl viologen-resistant spontaneous mutants of Synechocystis sp. PCC 6803 were identified, in which the conserved R115 residue of the Slr1174 protein was replaced with G115, L115 and C115. The Slr1174 protein of the DUF990 family is related to the permease subunit of an ABC-2-type transporter and its R115 mutation was found to be solely responsible for the observed methyl viologen resistance. Bioinformatic analysis showed that in various bacterial genomes, two genes encoding another permease subunit and the ATPase component of an ATP-binding cassette transporter form putative operons with slr1174 orthologs, suggesting that the protein products of these genes may form functional transporters. The corresponding genes in Synechocystis sp. PCC 6803, i.e. slr0610 for the permease and slr1901 for the ATPase, did not form such an operon. However, insertional inactivation of any slr1174, slr0610 or slr1901 genes in both the wild-type and the R115-resistant mutant resulted in increased sensitivity to methyl, ethyl and benzyl viologens; moreover, single- and double-insertion mutants did not differ in their viologen sensitivity. Our data suggest that Slr1901, Slr1174 and Slr0610 form a heteromeric ATP-binding cassette-type viologen exporter, in which each component is critical for viologen extrusion. Because the greatest increase in mutant sensitivity was observed in the case of ethyl viologen, the three proteins have been named EvrA (Slr1901), EvrB (Slr1174) and EvrC (Slr0610). This is the first report of a function for a DUF990 family protein.

  8. ATP utilization by yeast replication factor C. IV. RFC ATP-binding mutants show defects in DNA replication, DNA repair, and checkpoint regulation.


    Schmidt, S L; Pautz, A L; Burgers, P M


    Replication factor C is required to load proliferating cell nuclear antigen onto primer-template junctions, using the energy of ATP hydrolysis. Four of the five RFC genes have consensus ATP-binding motifs. To determine the relative importance of these sites for proper DNA metabolism in the cell, the conserved lysine in the Walker A motif of RFC1, RFC2, RFC3, or RFC4 was mutated to either arginine or glutamic acid. Arginine mutations in all RFC genes tested permitted cell growth, although poor growth was observed for rfc2-K71R. A glutamic acid substitution resulted in lethality in RFC2 and RFC3 but not in RFC1 or RFC4. Most double mutants combining mutations in two RFC genes were inviable. Except for the rfc1-K359R and rfc4-K55E mutants, which were phenotypically similar to wild type in every assay, the mutants were sensitive to DNA-damaging agents. The rfc2-K71R and rfc4-K55R mutants show checkpoint defects, most likely in the intra-S phase checkpoint. Regulation of the damage-inducible RNR3 promoter was impaired in these mutants, and phosphorylation of Rad53p in response to DNA damage was specifically defective when cells were in S phase. No dramatic defects in telomere length regulation were detected in the mutants. These data demonstrate that the ATP binding function of RFC2 is important for both DNA replication and checkpoint function and, for the first time, that RFC4 also plays a role in checkpoint regulation.

  9. Domain Interactions in the Yeast ATP Binding Cassette Transporter Ycf1p: Intragenic Suppressor Analysis of Mutations in the Nucleotide Binding Domains

    PubMed Central

    Falcón-Pérez, Juan M.; Martínez-Burgos, Mónica; Molano, Jesús; Mazón, María J.; Eraso, Pilar


    The yeast cadmium factor (Ycf1p) is a vacuolar ATP binding cassette (ABC) transporter required for heavy metal and drug detoxification. Cluster analysis shows that Ycf1p is strongly related to the human multidrug-associated protein (MRP1) and cystic fibrosis transmembrane conductance regulator and therefore may serve as an excellent model for the study of eukaryotic ABC transporter structure and function. Identifying intramolecular interactions in these transporters may help to elucidate energy transfer mechanisms during transport. To identify regions in Ycf1p that may interact to couple ATPase activity to substrate binding and/or movement across the membrane, we sought intragenic suppressors of ycf1 mutations that affect highly conserved residues presumably involved in ATP binding and/or hydrolysis. Thirteen intragenic second-site suppressors were identified for the D777N mutation which affects the invariant Asp residue in the Walker B motif of the first nucleotide binding domain (NBD1). Two of the suppressor mutations (V543I and F565L) are located in the first transmembrane domain (TMD1), nine (A1003V, A1021T, A1021V, N1027D, Q1107R, G1207D, G1207S, S1212L, and W1225C) are found within TMD2, one (S674L) is in NBD1, and another one (R1415G) is in NBD2, indicating either physical proximity or functional interactions between NBD1 and the other three domains. The original D777N mutant protein exhibits a strong defect in the apparent affinity for ATP and Vmax of transport. The phenotypic characterization of the suppressor mutants shows that suppression does not result from restoring these alterations but rather from a change in substrate specificity. We discuss the possible involvement of Asp777 in coupling ATPase activity to substrate binding and/or transport across the membrane. PMID:11466279

  10. Immortalization of neuronal progenitors using SV40 large T antigen and differentiation towards dopaminergic neurons

    PubMed Central

    Alwin Prem Anand, A; Gowri Sankar, S; Kokila Vani, V


    Transplantation is common in clinical practice where there is availability of the tissue and organ. In the case of neurodegenerative disease such as Parkinson's disease (PD), transplantation is not possible as a result of the non-availability of tissue or organ and therefore, cell therapy is an innovation in clinical practice. However, the availability of neuronal cells for transplantation is very limited. Alternatively, immortalized neuronal progenitors could be used in treating PD. The neuronal progenitor cells can be differentiated into dopaminergic phenotype. Here in this article, the current understanding of the molecular mechanisms involved in the differentiation of dopaminergic phenotype from the neuronal progenitors immortalized with SV40 LT antigen is discussed. In addition, the methods of generating dopaminergic neurons from progenitor cells and the factors that govern their differentiation are elaborated. Recent advances in cell-therapy based transplantation in PD patients and future prospects are discussed. PMID:22863662

  11. Discovery of African bat polyomaviruses and infrequent recombination in the large T antigen in the Polyomaviridae.


    Carr, Michael; Gonzalez, Gabriel; Sasaki, Michihito; Ito, Kimihito; Ishii, Akihiro; Hang'ombe, Bernard M; Mweene, Aaron S; Orba, Yasuko; Sawa, Hirofumi


    Bat species represent natural reservoirs for a number of high-consequence human pathogens. The present study investigated the diversity of polyomaviruses (PyVs) in Zambian insectivorous and fruit bat species. We describe the complete genomes from four newly proposed African bat PyV species employing the recently recommended criteria provided by the Polyomaviridae Study Group of the International Committee on Taxonomy of Viruses. A comprehensive phylogenetic and recombination analysis was performed to determine genetic relationships and the distribution of recombination events in PyV from mammalian and avian species. The novel species of PyV from Zambian bats segregated with members of the genera Alphapolyomavirus and Betapolyomavirus, forming monophyletic clades with bat and non-human primate PyVs. Miniopterus schreibersii polyomavirus 1 and 2 segregated in a clade with South American bat PyV species, Old World monkey and chimpanzee PyVs and Human polyomavirus 13 (New Jersey PyV). Interestingly, the newly described Egyptian fruit bat PyV, tentatively named Rousettus aegyptiacus polyomavirus 1, had the highest nucleotide sequence identity to species of PyV from Indonesian fruit bats, and Rhinolophus hildebrandtii polyomavirus 1 was most closely related to New World monkey PyVs. The distribution of recombination events in PyV genomes was non-random: recombination boundaries existed in the intergene region between VP1 and LTAg and also at the 3' end of VP2/3 in the structural genes, whereas infrequent recombination was present within the LTAg gene. These findings indicate that recombination within the LTAg gene has been negatively selected against during polyomaviral evolution and support the recent proposal for taxonomic classification based on LTAg to define novel PyV species.

  12. Replication of Chinese hamster embryo cells transformed by temperature-sensitive T-antigen mutants of simian virus 40.

    PubMed Central

    Robinson, C C; Swartzendruber, D E; Lehman, J M


    Chinese hamster embryo cells transformed by simian virus 40 temperature-sensitive T-antigen mutants replicated when confluent at 40.5 degrees C, regardless of the selection method, selection temperature, or virus strain used. Images PMID:6251272

  13. Relationship between expression of epidermal growth factor and simian virus 40 T antigen in a line of transgenic mice.


    Lafond, R E; Giammalvo, J T; Norkin, L C


    The pattern of expression of the simian virus 40 (SV40) T antigen gene and resultant dysplasia were re-examined in a line of transgenic mice in which the T antigen gene was under the control of the SV40 early promoter. We found that T antigen expression in the kidney, and resulting dysplastic lesions, occurred exclusively in the distal convoluted tubules and the ascending limbs of Henle. Epidermal growth factor (EGF) expression in the kidney of normal mice was similarly immunolocalized. The correlation between high EGF immunoreactivity in normal mouse tissues and T antigen expression in the transgenic counterpart was also seen in the choroid plexus epithelium and in the submandibular glands of male mice. T antigen was not found in the submandibular gland of transgenic females. Similarly, EGF was only rarely detected in the normal female submandibular gland. In contrast to the correlation between T antigen expression in the transgenic mice and EGF expression in the corresponding tissues of the normal mice, within the dysplastic lesions of the transgenic mice EGF expression was severely diminished. Adenocarcinomas of the male submandibular gland from another line of transgenic mice that expresses the Int-1 transgene, showed similarly reduced levels of immunostaining for EGF. Thus, reduced expression of EGF might be a general feature of dysplasia and tumorigenesis in those tissues that normally express EGF.

  14. Improved Serodiagnosis of Cystic Echinococcosis Using the New Recombinant 2B2t Antigen

    PubMed Central

    Hernández-González, Ana; Santivañez, Saúl; García, Héctor H.; Rodríguez, Silvia; Muñoz, Santiago; Ramos, Guillermo; Orduña, Antonio; Siles-Lucas, Mar


    A standardized test for the serodiagnosis of human cystic echinococcosis (CE) is still needed, because of the low specificity and sensitivity of the currently available commercial tools and the lack of proper evaluation of the existing recombinant antigens. In a previous work, we defined the new ELISA-B2t diagnostic tool for the detection of specific IgGs in CE patients, which showed high sensitivity and specificity, and was useful in monitoring the clinical evolution of surgically treated CE patients. Nevertheless, this recombinant antigen gave rise to false-negative results in a percentage of CE patients. Therefore, in an attempt to improve its sensitivity, we constructed B2t-derived recombinant antigens with two, four and eight tandem repeat of B2t units, and tested them by ELISA on serum samples of CE patients and patients with related parasites. The best diagnostic values were obtained with the two tandem repeat 2B2t antigen. The influence of several clinical variables on the performance of the tests was also evaluated. Finally, the diagnostic performance of the 2B2t-ELISA was compared with that of an indirect haemagglutination commercial test. The 2B2t recombinant antigen performed better than the HF and B2t antigens, and the IHA commercial kit. Therefore, this new 2B2t-ELISA is a promising candidate test for the serodiagnosis of CE in clinical settings. PMID:22802975

  15. Immortalization of epithelial-like cells from human liver tissue with SV40 T-antigen gene.


    Miyazaki, M; Mihara, K; Bai, L; Kano, Y; Tsuboi, S; Endo, A; Seshimo, K; Yoshioka, T; Namba, M


    The cells derived from the human embryo liver tissue were transfected with a plasmid pSV3neo containing both the large and small T-antigen gene of the early region of simian virus 40 (SV40), and two cell strains, OUMS-21 and -22, were obtained. OUMS-22 cells, to date, have reached over 100 population doublings through a culture crisis and are considered to have become an immortal cell line. However, OUMS-21 cells failed to become an immortal cell line. Both OUMS-21 and -22 cells were SV40 T-antigen-positive, epithelial-like, and immunoreactive against an anti-keratin 18 monoclonal antibody but against neither an anti-vimentin nor an anti-von Willebrandt factor VIII monoclonal antibody. The staining pattern of cytokeratin in these cells was similar to that in the differentiated human hepatoblastoma and hepatocellular carcinoma cell lines but not to that in the human cholangiocellular carcinoma cell lines. OUMS-21 and -22 cells expressed neither alpha-fetoprotein nor albumin mRNAs. These cells showed no tyrosine aminotransferase activity. However, both OUMS-21 and -22 cells were sensitive to cytotoxicity of aflatoxin B1, 3-amino-1,4-dimethyl-5H-pyrido[4,3-b]indole, and benzo[a]pyrene, whereas human embryo lung fibroblasts were insensitive to the cytotoxicity of these carcinogens. These findings suggest that OUMS-21 and -22 cells may arise from undifferentiated liver stem cells or from hepatocytes that lost their ability to express the liver-specific functions prior to immortalization. Both OUMS-21 and -22 cells expressed glutathione S-transferase pi (GST-pi) mRNA. The expression of GST-pi mRNA highly increased in OUMS-22 cells with their immortalization. Karyotypic analysis showed that numerical and structural aberrations of the chromosomes were profound, but neither specific events nor marker chromosomes were found in OUMS-21 and -22 cells. Both OUMS-21 and -22 cells could grow in soft agar, but they were not tumorigenic when transplanted into nude mice.

  16. Computer modelling reveals new conformers of the ATP binding loop of Na+/K+-ATPase involved in the transphosphorylation process of the sodium pump

    PubMed Central

    Tejral, Gracian; Sopko, Bruno; Necas, Alois; Schoner, Wilhelm


    Hydrolysis of ATP by Na+/K+-ATPase, a P-Type ATPase, catalyzing active Na+ and K+ transport through cellular membranes leads transiently to a phosphorylation of its catalytical α-subunit. Surprisingly, three-dimensional molecular structure analysis of P-type ATPases reveals that binding of ATP to the N-domain connected by a hinge to the P-domain is much too far away from the Asp369 to allow the transfer of ATP’s terminal phosphate to its aspartyl-phosphorylation site. In order to get information for how the transfer of the γ-phosphate group of ATP to the Asp369 is achieved, analogous molecular modeling of the M4–M5 loop of ATPase was performed using the crystal data of Na+/K+-ATPase of different species. Analogous molecular modeling of the cytoplasmic loop between Thr338 and Ile760 of the α2-subunit of Na+/K+-ATPase and the analysis of distances between the ATP binding site and phosphorylation site revealed the existence of two ATP binding sites in the open conformation; the first one close to Phe475 in the N-domain, the other one close to Asp369 in the P-domain. However, binding of Mg2+•ATP to any of these sites in the “open conformation” may not lead to phosphorylation of Asp369. Additional conformations of the cytoplasmic loop were found wobbling between “open conformation” <==> “semi-open conformation <==> “closed conformation” in the absence of 2Mg2+•ATP. The cytoplasmic loop’s conformational change to the “semi-open conformation”—characterized by a hydrogen bond between Arg543 and Asp611—triggers by binding of 2Mg2+•ATP to a single ATP site and conversion to the “closed conformation” the phosphorylation of Asp369 in the P-domain, and hence the start of Na+/K+-activated ATP hydrolysis. PMID:28316890

  17. Targeted expression of SV40 T antigen in the hair follicle of transgenic mice produces an aberrant hair phenotype.


    Keough, R; Powell, B; Rogers, G


    Directed expression of SV40 large T antigen (TAg) in transgenic mice can induce tissue-specific tumorigenesis and useful cell lines exhibiting differentiated characteristics can be established from resultant tumor cells. In an attempt to produce an immortalised mouse hair follicle cortical cell line for the study of hair keratin gene control, SV40 TAg expression was targeted to the hair follicles of transgenic mice using a sheep hair gene promoter. Expression of SV40 TAg in the follicle cortex disrupted normal fiber ultrastructure, producing a marked phenotypic effect. Affected hairs were wavy or severely kinked (depending on the severity of the phenotype) producing an appearance ranging from a ruffled coat to a stubble covering the back of the mouse. The transgenic hairs appeared to be weakened at the base of the fibers, leading to premature hair-loss and a thinner pelage, or regions of temporary nudity. No follicle tumors or neoplasia were apparent and immortalisation of cortical cells could not be established in culture. In situ hybridisation studies in the hair follicle using histone H3 as a cell proliferation marker suggested that cell proliferation had ceased prior to commencement of K2.10-TAg expression and was not re-established in the differentiating cortical cells. Hence, TAg was unable to induce cell immortalisation at that stage of cortical cell differentiation. However, transgenic mice developed various other abnormalities including vertebral abnormalities and bladder, liver and intestinal tumors, which resulted in reduced life expectancy.

  18. Role of Single-Stranded DNA Binding Activity of T Antigen in Simian Virus 40 DNA Replication

    PubMed Central

    Wu, Chunxiao; Roy, Rupa; Simmons, Daniel T.


    We have previously mapped the single-stranded DNA binding domain of large T antigen to amino acid residues 259 to 627. By using internal deletion mutants, we show that this domain most likely begins after residue 301 and that the region between residues 501 and 550 is not required. To study the function of this binding activity, a series of single-point substitutions were introduced in this domain, and the mutants were tested for their ability to support simian virus 40 (SV40) replication and to bind to single-stranded DNA. Two replication-defective mutants (429DA and 460EA) were grossly impaired in single-stranded DNA binding. These two mutants were further tested for other biochemical activities needed for viral DNA replication. They bound to origin DNA and formed double hexamers in the presence of ATP. Their ability to unwind origin DNA and a helicase substrate was severely reduced, although they still had ATPase activity. These results suggest that the single-stranded DNA binding activity is involved in DNA unwinding. The two mutants were also very defective in structural distortion of origin DNA, making it likely that single-stranded DNA binding is also required for this process. These data show that single-stranded DNA binding is needed for at least two steps during SV40 DNA replication. PMID:11222709

  19. Two classes of transformation-deficient, immortalization-positive simian virus 40 mutants constructed by making three-base insertions in the T antigen gene.

    PubMed Central

    Sugano, S; Yamaguchi, N


    We constructed two mutants of simian virus 40 (SV40) by introducing a three-base duplication at AvaII cutting sites within the large T antigen coding region, and we examined these mutants for their abilities to replicate in monkey GC7 cells, to transform rat cell line 3Y1 cells, and to transform and immortalize primary cells from newborn rats. Neither of the mutants could replicate in GC7 cells. One mutant with the duplication at 0.335 SV40 map units (m.u.) (inA942) could transform 3Y1 cells, but the other mutant with the duplication at 0.636 m.u. (inA941) could not. The two mutants could not transform primary rat cells but retained immortalization activity. The results suggest that transformation of primary cells by SV40 requires at least two distinct activities of the large T antigen, one of which can be replaced by a cellular function(s) expressed in immortalized 3Y1 cells. Images PMID:6092718

  20. Establishment of renal proximal tubule cell lines by targeted oncogenesis in transgenic mice using the L-pyruvate kinase-SV40 (T) antigen hybrid gene.


    Cartier, N; Lacave, R; Vallet, V; Hagege, J; Hellio, R; Robine, S; Pringault, E; Cluzeaud, F; Briand, P; Kahn, A


    Targeted oncogenesis allowed us to obtain two cell lines which have been derived from the proximal tubule of kidney from transgenic mice harbouring the simian virus (SV40) large T and small t antigens placed under the control of the 5' regulatory sequence from the rat L-type pyruvate kinase (L-PK) gene. The cell lines (PKSV-PCT and PKSV-PR cells) were derived from early (PCT) and late (Pars Recta, PR) microdissected proximal tubules grown in D-glucose-enriched medium. In such conditions of culture, both cell lines exhibited L-PK transcripts, a stable expression of SV40-encoded nuclear large T antigen, a prolonged life span but failed to induce tumors when injected sub-cutaneously into athymic (nu-nu) mice. Confluent cells, grown on plastic support or porous filters, were organized as monolayers of polarized cuboid cells with well developed apical microvilli and formed domes. Both cell lines exhibited morphological features of proximal tubule cells with villin located in the apical brush-border and substantial amounts of hydrolase activity. By immunofluorescence studies using specific antibodies, aminopeptidase N appeared restricted to the apical microvillar domain, whereas the H2 histocompatibility antigen was distributed in the cytoplasm and lateral membranes. These results demonstrate that the proximal morphological phenotype has been fully preserved in these cultured cells derived from tissue-specific targeted oncogenesis in transgenic mice.

  1. Transformation by Polyomavirus Middle T Antigen Involves a Unique Bimodal Interaction with the Hippo Effector YAP

    PubMed Central

    Rouleau, Cecile; Pores Fernando, Arun T.; Hwang, Justin H.; Faure, Nathalie; Jiang, Tao; White, Elizabeth A.


    ABSTRACT Murine polyomavirus has repeatedly provided insights into tumorigenesis, revealing key control mechanisms such as tyrosine phosphorylation and phosphoinositide 3-kinase (PI3K) signaling. We recently demonstrated that polyomavirus small T antigen (ST) binds YAP, a major effector of Hippo signaling, to regulate differentiation. Here we characterize YAP as a target of middle T antigen (MT) important for transformation. Through a surface including residues R103 and D182, wild-type MT binds to the YAP WW domains. Mutation of either R103 or D182 of MT abrogates YAP binding without affecting binding to other signaling molecules or the strength of PI3K or Ras signaling. Either genetic abrogation of YAP binding to MT or silencing of YAP via short hairpin RNA (shRNA) reduced MT transformation, suggesting that YAP makes a positive contribution to the transformed phenotype. MT targets YAP both by activating signaling pathways that affect it and by binding to it. MT signaling, whether from wild-type MT or the YAP-binding MT mutant, promoted YAP phosphorylation at S127 and S381/397 (YAP2/YAP1). Consistent with the known functions of these phosphorylated serines, MT signaling leads to the loss of YAP from the nucleus and degradation. Binding of YAP to MT brings it together with protein phosphatase 2A (PP2A), leading to the dephosphorylation of YAP in the MT complex. It also leads to the enrichment of YAP in membranes. Taken together, these results indicate that YAP promotes MT transformation via mechanisms that may depart from YAP's canonical oncogenic transcriptional activation functions. IMPORTANCE The highly conserved Hippo/YAP pathway is important for tissue development and homeostasis. Increasingly, changes in this pathway are being associated with cancer. Middle T antigen (MT) is the primary polyomavirus oncogene responsible for tumor formation. In this study, we show that MT signaling promotes YAP phosphorylation, loss from the nucleus, and increased turnover

  2. Exploring new molecular architectures for anion recognition: synthesis and ATP binding properties of new cyclam-based ditopic polyammonium receptors.


    Pouessel, Jacky; Bazzicalupi, Carla; Bencini, Andrea; Bernard, Hélène; Giorgi, Claudia; Handel, Henri; Matera, Irene; Le Bris, Nathalie; Tripier, Raphaël; Valtancoli, Barbara


    Synthesis and characterization of three new polyamine receptors, composed of a cyclam unit (cyclam=1,4,8,11-tetraazacyclotetradecane) linked by a 2,6-dimethylpyridinyl spacer to the linear polyamines 1,4,8,11-tetraazaundecane (L1py), 1,4,7-triazaheptane (L2py), and to a quaternary ammonium group (L3py(+)), are reported. All receptors form highly charged polyammonium cations at neutral pH, suitable for anion recognition studies. ATP recognition was analyzed by using potentiometric, calorimetric, (1)H and (31)P NMR measurements in aqueous solution. All receptors form 1:1 adducts with ATP in aqueous solution, stabilized by charge-charge and hydrogen-bonding interactions between their ammonium groups and the anionic triphosphate chain of ATP. The binding ability of the three receptors for ATP increases in the order of L3py(+)largely favourable entropic contributions, probably due to the large desolvation of the host and guest species upon complexation. The sequence observed for the binding affinity is explained in terms of the different ability of the three receptors to wrap around the phosphate chain of ATP.

  3. Hop Resistance in the Beer Spoilage Bacterium Lactobacillus brevis Is Mediated by the ATP-Binding Cassette Multidrug Transporter HorA

    PubMed Central

    Sakamoto, Kanta; Margolles, Abelardo; van Veen, Hendrik W.; Konings, Wil N.


    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters. PMID:11514522

  4. ATP-binding and -hydrolysis activities of ALDP (ABCD1) and ALDRP (ABCD2), human peroxisomal ABC proteins, overexpressed in Sf21 cells.


    Morita, Masashi; Kurisu, Mikinori; Kashiwayama, Yoshinori; Yokota, Sadaki; Imanaka, Tsuneo


    The peroxisomal ATP-binding cassette (ABC) proteins, adrenoleukodystrophy protein (ALDP, ABCD1) and ALD-related protein (ALDRP, ABCD2), were expressed in Spodoptera frugiperda 21 (Sf21) insect cells using a baculovirus-mediated expression system. Immunoelectron microscopy and subcellular fractionation revealed that the overexpressed ALDP was distributed in various subcellular organelles including mitochondria, nucleus and peroxisomes. The ALDP was not extractable with Na(2)CO(3) treatment, suggesting that it integrated into membranes. ATPase activity was detected in the membrane fraction expressing ALDP. The nucleotide-binding capacities of the expressed ALDP were estimated by the binding to ATP- or ADP-agarose. ALDP exhibited an affinity to both ADP and ATP. In contrast, ALDRP exhibited an affinity to ADP but scarcely to ATP. The ALDP in the Sf21 membrane fraction was extracted with n-dodecyl-beta-maltoside and successively purified with a chelate column. The nucleotide-binding and ATPase activities of the purified ALDP were, however, not detected. It may be that certain membranous components are required for the activity. We demonstrate for the first time that the peroxisomal ABC proteins can be expressed in Sf21 membranes maintaining their nucleotide-binding abilities and ATPase activities, and the expressed proteins will be of use for further characterization.

  5. Lobular Distribution and Variability in Hepatic ATP Binding Cassette Protein B1 (ABCB1, P-gp): Ontogenetic Differences and Potential for Toxicity

    PubMed Central

    Abanda, Ngu Njei; Riches, Zoe; Collier, Abby C.


    The ATP Binding Cassette B1 (ABCB1) transporter has critical roles in endo- and xenobiotic efficacy and toxicity. To understand population variability in hepatic transport we determined ABCB1 mRNA and protein levels in total liver lysates sampled from 8 pre-defined sites (n = 24, 18–69 years), and in S9 from randomly acquired samples (n = 87, 7 days–87 years). ABCB1 levels did not differ significantly throughout individual livers and showed 4.4-fold protein variation between subjects. Neither mRNA nor protein levels varied with sex, ethnicity, obesity or triglycerides in lysates or S9 (that showed the same relationships), but protein levels were lower in pediatric S9 (p < 0.0001), with 76% of adult ABCB1 present at birth and predicted to mature in 5 years. Pediatric total liver lysates were not available. In summary, opportunistic collection for studying human hepatic ABCB1 is acceptable. Additionally, ABCB1 may be lower in children, indicating differential potential for toxicity and response to therapy in this special population. PMID:28218636

  6. Evaluation of a Brucella melitensis mutant deficient in O-polysaccharide export system ATP-binding protein as a rough vaccine candidate.


    Wang, Zhen; Niu, Jian Rui; Wang, Xiao Lei; Wu, Tong Lei; Cheng, Jie; Lu, Lin; Wu, Qing Min


    Rough Brucella mutants have been sought as vaccine candidates that do not interfere with the conventional serological diagnosis of brucellosis. In this study, a rough mutant of Brucella melitensis was generated by the disruption of the wzt gene, which encodes the O-polysaccharide (O-PS) export system ATP-binding protein. In vivo, the mutant 16MΔwzt was attenuated and conferred a level of protection against B. melitensis 16M challenge similar to that conferred by the vaccine strain B. melitensis M5 in mice. In pregnant sheep, the mutant 16MΔwzt did not induce abortion. In vitro, 16MΔwzt was more susceptible to polymyxin B and complement-mediated killing than B. melitensis 16M was. Most importantly, although 16MΔwzt had a rough phenotype, it was able to synthesize O-PS and did not induce detectable specific antibodies in sheep. These results suggested that 16MΔwzt deserved to further systematic evaluation as a vaccine for target animal hosts due to its promising features.

  7. Roles of aldo-keto reductases 1B10 and 1C3 and ATP-binding cassette transporter in docetaxel tolerance.


    Matsunaga, Toshiyuki; Saito, Haruhi; Endo, Satoshi; Iguchi, Kazuhiro; Soda, Midori; El-Kabbani, Ossama; Hara, Akira; Ikari, Akira


    Docetaxel (DTX) is widely used for treatment of inveterate lung and prostate cancers, but its continuous administration elicits the hyposensitivity. Here, we established the DTX-resistant variants of human lung cancer A549 and androgen-independent prostate cancer Du145 cells and found that the resistance development provoked aberrant up-regulations of aldo-keto reductase (AKR) 1B10 and AKR1C3 in A549 and Du145 cells, respectively. In addition, the sensitivity to the DTX toxicity was significantly decreased and increased by overexpression and knockdown of the two AKR isoforms, respectively. Furthermore, the resistant cells exhibited a decreased level of reactive 4-hydroxy-2-nonenal formed during DTX treatment, and the decrease was alleviated by adding the AKR inhibitors, inferring that the two AKRs confer the chemoresistance through elevating the antioxidant properties. The development of DTX resistance was also associated with enhanced expression of an ATP-binding cassette (ABC) transporter ABCB1 among the ABC transporter isoforms. The combined treatment with inhibitors of the two AKRs and ABCB1 additively sensitized the resistant cells to DTX. Intriguingly, the AKR1B10 inhibitor also suppressed the lung cancer cross-resistance against cisplatin. The results suggest that combined treatment with AKRs (1B10 and 1C3) and ABCB1 inhibitors exerts overcoming effect against the cancer resistance to DTX and cisplatin, and can be used as the adjuvant therapy.

  8. Crystal structure of the peptidase domain of Streptococcus ComA, a bifunctional ATP-binding cassette transporter involved in the quorum-sensing pathway.


    Ishii, Seiji; Yano, Takato; Ebihara, Akio; Okamoto, Akihiro; Manzoku, Miho; Hayashi, Hideyuki


    ComA of Streptococcus is a member of the bacteriocin-associated ATP-binding cassette transporter family and is postulated to be responsible for both the processing of the propeptide ComC and secretion of the mature quorum-sensing signal. The 150-amino acid peptidase domain (PEP) of ComA specifically recognizes an extended region of ComC that is 15 amino acids in length. It has been proposed that an amphipathic alpha-helix formed by the N-terminal leader region of ComC, as well as the Gly-Gly motif at the cleavage site, is critical for the PEP-ComC interaction. To elucidate the substrate recognition mechanism, we determined the three-dimensional crystal structure of Streptococcus mutans PEP and then constructed models for the PEP.ComC complexes. PEP had an overall structure similar to the papain-like cysteine proteases as has long been predicted. The active site was located at the bottom of a narrow cleft, which is suitable for binding the Gly-Gly motif. Together with the results from mutational experiments, a shallow hydrophobic concave surface of PEP was proposed as a site that accommodates the N-terminal helix of ComC. This dual mode of substrate recognition would provide the small PEP domain with an extremely high substrate specificity.

  9. Endocytosis and vacuolar degradation of the plasma membrane-localized Pdr5 ATP-binding cassette multidrug transporter in Saccharomyces cerevisiae.

    PubMed Central

    Egner, R; Mahé, Y; Pandjaitan, R; Kuchler, K


    Multidrug resistance (MDR) to different cytotoxic compounds in the yeast Saccharomyces cerevisiae can arise from overexpression of the Pdr5 (Sts1, Ydr1, or Lem1) ATP-binding cassette (ABC) multidrug transporter. We have raised polyclonal antibodies recognizing the yeast Pdr5 ABC transporter to study its biogenesis and to analyze the molecular mechanisms underlying MDR development. Subcellular fractionation and indirect immunofluorescence experiments showed that Pdr5 is localized in the plasma membrane. In addition, pulse-chase radiolabeling of cells and immunoprecipitation indicated that Pdr5 is a short-lived membrane protein with a half-life of about 60 to 90 min. A dramatic metabolic stabilization of Pdr5 was observed in delta pep4 mutant cells defective in vacuolar proteinases, and indirect immunofluorescence showed that Pdr5 accumulates in vacuoles of stationary-phase delta pep4 mutant cells, demonstrating that Pdr5 turnover requires vacuolar proteolysis. However, Pdr5 turnover does not require a functional proteasome, since the half-life of Pdr5 was unaffected in either pre1-1 or pre1-1 pre2-1 mutants defective in the multicatalytic cytoplasmic proteasome that is essential for cytoplasmic protein degradation. Immunofluorescence analysis revealed that vacuolar delivery of Pdr5 is blocked in conditional end4 endocytosis mutants at the restrictive temperature, showing that endocytosis delivers Pdr5 from the plasma membrane to the vacuole. PMID:7565740

  10. An ATP Binding Cassette Transporter Is Required for Cuticular Wax Deposition and Desiccation Tolerance in the Moss Physcomitrella patens[W

    PubMed Central

    Buda, Gregory J.; Barnes, William J.; Fich, Eric A.; Park, Sungjin; Yeats, Trevor H.; Zhao, Lingxia; Domozych, David S.; Rose, Jocelyn K.C.


    The plant cuticle is thought to be a critical evolutionary adaptation that allowed the first plants to colonize land, because of its key roles in regulating plant water status and providing protection from biotic and abiotic stresses. Much has been learned about cuticle composition and structure through genetic and biochemical studies of angiosperms, as well as underlying genetic pathways, but little is known about the cuticles of early diverging plant lineages. Here, we demonstrate that the moss Physcomitrella patens, an extant relative of the earliest terrestrial plants, has a cuticle that is analogous in both structure and chemical composition to those of angiosperms. To test whether the underlying cuticle biosynthetic pathways were also shared among distant plant lineages, we generated a genetic knockout of the moss ATP binding cassette subfamily G (ABCG) transporter Pp-ABCG7, a putative ortholog of Arabidopsis thaliana ABCG transporters involved in cuticle precursor trafficking. We show that this mutant is severely deficient in cuticular wax accumulation and has a reduced tolerance of desiccation stress compared with the wild type. This work provides evidence that the cuticle was an adaptive feature present in the first terrestrial plants and that the genes involved in their formation have been functionally conserved for over 450 million years. PMID:24163310

  11. The E23 early gene of Drosophila encodes an ecdysone-inducible ATP-binding cassette transporter capable of repressing ecdysone-mediated gene activation

    PubMed Central

    Hock, Tommy; Cottrill, Tracy; Keegan, John; Garza, Dan


    At the onset of Drosophila metamorphosis, the steroid hormone 20-OH ecdysone directly induces a small number of early puffs in the polytene chromosomes of the larval salivary gland. Proteins encoded by the early genes corresponding to these transcriptional puffs then regulate the activity of both the early puffs themselves and a much larger set of late puffs. Three of these early genes encode transcription factors that play critical regulatory roles during metamorphosis. Here we report the cloning, DNA sequence, genomic structure, ecdysone inducibility, and temporal expression of an early gene residing in the 23E early puff and denoted E23 (Early gene at 23). In contrast to other early genes, E23 encodes a protein with similarity to ATP-binding cassette transporters. Using heat shock-inducible transgenes, we found that E23 overexpression not only produces phenotypic abnormalities and lethality, but also interferes with ecdysone-mediated gene activation, demonstrating that E23 is capable of modulating the ecdysone response. Our results suggest the existence of a previously unrecognized regulatory mechanism for modulating steroid hormone signaling in Drosophila. PMID:10931948

  12. The Arabidopsis PLEIOTROPIC DRUG RESISTANCE8/ABCG36 ATP binding cassette transporter modulates sensitivity to the auxin precursor indole-3-butyric acid.


    Strader, Lucia C; Bartel, Bonnie


    Plants have developed numerous mechanisms to store hormones in inactive but readily available states, enabling rapid responses to environmental changes. The phytohormone auxin has a number of storage precursors, including indole-3-butyric acid (IBA), which is apparently shortened to active indole-3-acetic acid (IAA) in peroxisomes by a process similar to fatty acid beta-oxidation. Whereas metabolism of auxin precursors is beginning to be understood, the biological significance of the various precursors is virtually unknown. We identified an Arabidopsis thaliana mutant that specifically restores IBA, but not IAA, responsiveness to auxin signaling mutants. This mutant is defective in PLEIOTROPIC DRUG RESISTANCE8 (PDR8)/PENETRATION3/ABCG36, a plasma membrane-localized ATP binding cassette transporter that has established roles in pathogen responses and cadmium transport. We found that pdr8 mutants display defects in efflux of the auxin precursor IBA and developmental defects in root hair and cotyledon expansion that reveal previously unknown roles for IBA-derived IAA in plant growth and development. Our results are consistent with the possibility that limiting accumulation of the IAA precursor IBA via PDR8-promoted efflux contributes to auxin homeostasis.

  13. Lipid Absorption Defects in Intestine-specific Microsomal Triglyceride Transfer Protein and ATP-binding Cassette Transporter A1-deficient Mice*

    PubMed Central

    Iqbal, Jahangir; Parks, John S.; Hussain, M. Mahmood


    We have previously described apolipoprotein B (apoB)-dependent and -independent cholesterol absorption pathways and the role of microsomal triglyceride transfer protein (MTP) and ATP-binding cassette transporter A1 (ABCA1) in these pathways. To assess the contribution of these pathways to cholesterol absorption and to determine whether there are other pathways, we generated mice that lack MTP and ABCA1, individually and in combination, in the intestine. Intestinal deletions of Mttp and Abca1 decreased plasma cholesterol concentrations by 45 and 24%, respectively, whereas their combined deletion reduced it by 59%. Acute cholesterol absorption was reduced by 28% in the absence of ABCA1, and it was reduced by 92–95% when MTP was deleted in the intestine alone or together with ABCA1. MTP deficiency significantly reduced triglyceride absorption, although ABCA1 deficiency had no effect. ABCA1 deficiency did not affect cellular lipids, but Mttp deficiency significantly increased intestinal levels of triglycerides and free fatty acids. Accumulation of intestinal free fatty acids, but not triglycerides, in Mttp-deficient intestines was prevented when mice were also deficient in intestinal ABCA1. Combined deficiency of these genes increased intestinal fatty acid oxidation as a consequence of increased expression of peroxisome proliferator-activated receptor-γ (PPARγ) and carnitine palmitoyltransferase 1α (CPT1α). These studies show that intestinal MTP and ABCA1 are critical for lipid absorption and are the main determinants of plasma and intestinal lipid levels. Reducing their activities might lower plasma lipid concentrations. PMID:24019513

  14. The Arabidopsis pxa1 Mutant Is Defective in an ATP-Binding Cassette Transporter-Like Protein Required for Peroxisomal Fatty Acid β-Oxidation1

    PubMed Central

    Zolman, Bethany K.; Silva, Illeana D.; Bartel, Bonnie


    Peroxisomes are important organelles in plant metabolism, containing all the enzymes required for fatty acid β-oxidation. More than 20 proteins are required for peroxisomal biogenesis and maintenance. The Arabidopsis pxa1 mutant, originally isolated because it is resistant to the auxin indole-3-butyric acid (IBA), developmentally arrests when germinated without supplemental sucrose, suggesting defects in fatty acid β-oxidation. Because IBA is converted to the more abundant auxin, indole-3-acetic acid (IAA), in a mechanism that parallels β-oxidation, the mutant is likely to be IBA resistant because it cannot convert IBA to IAA. Adult pxa1 plants grow slowly compared with wild type, with smaller rosettes, fewer leaves, and shorter inflorescence stems, indicating that PXA1 is important throughout development. We identified the molecular defect in pxa1 using a map-based positional approach. PXA1 encodes a predicted peroxisomal ATP-binding cassette transporter that is 42% identical to the human adrenoleukodystrophy (ALD) protein, which is defective in patients with the demyelinating disorder X-linked ALD. Homology to ALD protein and other human and yeast peroxisomal transporters suggests that PXA1 imports coenzyme A esters of fatty acids and IBA into the peroxisome for β-oxidation. The pxa1 mutant makes fewer lateral roots than wild type, both in response to IBA and without exogenous hormones, suggesting that the IAA derived from IBA during seedling development promotes lateral root formation. PMID:11706205

  15. Conformational shift in the closed state of GroEL induced by ATP-binding triggers a transition to the open state

    PubMed Central

    Suzuki, Yuka; Yura, Kei


    We investigated the effect of ATP binding to GroEL and elucidated a role of ATP in the conformational change of GroEL. GroEL is a tetradecamer chaperonin that helps protein folding by undergoing a conformational change from a closed state to an open state. This conformational change requires ATP, but does not require the hydrolysis of the ATP. The following three types of conformations are crystalized and the atomic coordinates are available; closed state without ATP, closed state with ATP and open state with ADP. We conducted simulations of the conformational change using Elastic Network Model from the closed state without ATP targeting at the open state, and from the closed state with ATP targeting at the open state. The simulations emphasizing the lowest normal mode showed that the one started with the closed state with ATP, rather than the one without ATP, reached a conformation closer to the open state. This difference was mainly caused by the changes in the positions of residues in the initial structure rather than the changes in “connectivity” of residues within the subunit. Our results suggest that ATP should behave as an insulator to induce conformation population shift in the closed state to the conformation that has a pathway leading to the open state. PMID:27924266

  16. Inherited surfactant deficiency due to uniparental disomy of rare mutations in the surfactant protein-B and ATP binding cassette, subfamily A, member 3 genes

    PubMed Central

    Hamvas, Aaron; Nogee, Lawrence M.; Wegner, Daniel J.; DePass, Kelcey; Christodoulou, John; Bennetts, Bruce; McQuade, Leon R.; Gray, Peter H.; Deterding, Robin R.; Carroll, Travis R.; Kammesheidt, Anja; Kasch, Laura M.; Kulkarni, Shashikant; Cole, F. Sessions


    Objective To characterize inheritance of homozygous, rare, recessive loss-of-function mutations in the surfactant protein-B (SFTPB) or ATP binding cassette, subfamily A, member 3 (ABCA3) genes in newborns with lethal respiratory failure. Study design We resequenced parents whose infants were homozygous for mutations in SFTPB or ABCA3. For infants with only one heterozygous parent, we performed microsatellite analysis for chromosomes 2 (SFTPB) and 16 (ABCA3). Results We identified one infant homozygous for the c.1549C>GAA mutation (121ins2) in SFTPB for whom only the mother was heterozygous and 3 infants homozygous for mutations in ABCA3 (p.K914R, p.P147L, and c.806_7insGCT) for whom only the fathers were heterozygous. For the SP-B deficient infant, microsatellite markers confirmed maternal heterodisomy with segmental isodisomy. Microsatellite analysis confirmed paternal isodisomy for the three ABCA3 deficient infants. Two ABCA3 deficient infants underwent lung transplantation at 3 and 5 months of age, respectively, and two infants died. None exhibited any non-pulmonary phenotype. Conclusions Uniparental disomy should be suspected in infants with rare homozygous mutations in SFTPB or ABCA3. Confirmation of parental carrier status is important to provide recurrence risk and to monitor expression of other phenotypes that may emerge through reduction to homozygosity of recessive alleles. PMID:19647838

  17. Genome-wide identification of ATP-binding cassette (ABC) transporters and their roles in response to polycyclic aromatic hydrocarbons (PAHs) in the copepod Paracyclopina nana.


    Jeong, Chang-Bum; Kim, Duck-Hyun; Kang, Hye-Min; Lee, Young Hwan; Kim, Hui-Su; Kim, Il-Chan; Lee, Jae-Seong


    The ATP-binding cassette (ABC) protein superfamily is one of the largest gene families and is highly conserved in all domains. The ABC proteins play roles in several biological processes, including multi-xenobiotic resistance (MXR), by functioning as transporters in the cellular membrane. They also mediate the cellular efflux of a wide range of substrates against concentration gradients. In this study, 37 ABC genes belonging to eight distinct subfamilies were identified in the marine copepod Paracyclopina nana and annotated based on a phylogenetic analysis. Also, the functions of P-glycoproteins (P-gp) and multidrug resistance-associated proteins (MRPs), conferring MXR, were verified using fluorescent substrates and specific inhibitors. The activities of MXR-mediated ABC proteins and their transcriptional level were examined in response to polyaromatic hydrocarbons (PAHs), main components of the water-accommodated fraction. This study increases the understanding of the protective role of MXR in response to PAHs over the comparative evolution of ABC gene families.

  18. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter

    PubMed Central

    Alvarez, Frances Joan D.; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R. Michael; Klug, Candice S.; Davidson, Amy L.


    Summary MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance (EPR) spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP. PMID:26268698

  19. Block of ATP-binding cassette B19 ion channel activity by 5-nitro-2-(3-phenylpropylamino)-benzoic acid impairs polar auxin transport and root gravitropism.


    Cho, Misuk; Henry, Elizabeth M; Lewis, Daniel R; Wu, Guosheng; Muday, Gloria K; Spalding, Edgar P


    Polar transport of the hormone auxin through tissues and organs depends on membrane proteins, including some B-subgroup members of the ATP-binding cassette (ABC) transporter family. The messenger RNA level of at least one B-subgroup ABCB gene in Arabidopsis (Arabidopsis thaliana), ABCB19, increases upon treatment with the anion channel blocker 5-nitro-2-(3-phenylpropylamino)-benzoic acid (NPPB), possibly to compensate for an inhibitory effect of the drug on ABCB19 activity. Consistent with this hypothesis, NPPB blocked ion channel activity associated with ABCB19 expressed in human embryonic kidney cells as measured by patch-clamp electrophysiology. NPPB inhibited polar auxin transport through Arabidopsis seedling roots similarly to abcb19 mutations. NPPB also inhibited shootward auxin transport, which depends on the related ABCB4 protein. NPPB substantially decreased ABCB4 and ABCB19 protein levels when cycloheximide concomitantly inhibited new protein synthesis, indicating that blockage by NPPB enhances the degradation of ABCB transporters. Impairing the principal auxin transport streams in roots with NPPB caused aberrant patterns of auxin signaling reporters in root apices. Formation of the auxin-signaling gradient across the tips of gravity-stimulated roots, and its developmental consequence (gravitropism), were inhibited by micromolar concentrations of NPPB that did not affect growth rate. These results identify ion channel activity of ABCB19 that is blocked by NPPB, a compound that can now be considered an inhibitor of polar auxin transport with a defined molecular target.

  20. Differential Phospholipid Substrates and Directional Transport by ATP-binding Cassette Proteins ABCA1, ABCA7, and ABCA4 and Disease-causing Mutants*♦

    PubMed Central

    Quazi, Faraz; Molday, Robert S.


    ABCA1, ABCA7, and ABCA4 are members of the ABCA subfamily of ATP-binding cassette transporters that share extensive sequence and structural similarity. Mutations in ABCA1 cause Tangier disease characterized by defective cholesterol homeostasis and high density lipoprotein (HDL) deficiency. Mutations in ABCA4 are responsible for Stargardt disease, a degenerative disorder associated with severe loss in central vision. Although cell-based studies have implicated ABCA proteins in lipid transport, the substrates and direction of transport have not been firmly established. We have purified and reconstituted ABCA1, ABCA7, and ABCA4 into liposomes for fluorescent-lipid transport studies. ABCA1 actively exported or flipped phosphatidylcholine, phosphatidylserine, and sphingomyelin from the cytoplasmic to the exocytoplasmic leaflet of membranes, whereas ABCA7 preferentially exported phosphatidylserine. In contrast, ABCA4 transported phosphatidylethanolamine in the reverse direction. The same phospholipids stimulated the ATPase activity of these ABCA transporters. The transport and ATPase activities of ABCA1 and ABCA4 were reduced by 25% in the presence of 20% cholesterol. Nine ABCA1 Tangier mutants and the corresponding ABCA4 Stargardt mutants showed significantly reduced phospholipid transport activity and subcellular mislocalization. These studies provide the first direct evidence for ABCA1 and ABCA7 functioning as phospholipid transporters and suggest that this activity is an essential step in the loading of apoA-1 with phospholipids for HDL formation. PMID:24097981

  1. Interaction of extracellular domain 2 of the human retina-specific ATP-binding cassette transporter (ABCA4) with all-trans-retinal.


    Biswas-Fiss, Esther E; Kurpad, Deepa S; Joshi, Kinjalben; Biswas, Subhasis B


    The retina-specific ATP-binding cassette (ABC) transporter, ABCA4, is essential for transport of all-trans-retinal from the rod outer segment discs in the retina and is associated with a broad range of inherited retinal diseases, including Stargardt disease, autosomal recessive cone rod dystrophy, and fundus flavimaculatus. A unique feature of the ABCA subfamily of ABC transporters is the presence of highly conserved, long extracellular loops or domains (ECDs) with unknown function. The high degree of sequence conservation and mapped disease-associated mutations in these domains suggests an important physiological significance. Conformational analysis using CD spectroscopy of purified, recombinant ECD2 protein demonstrated that it has an ordered and stable structure composed of 27 +/- 3% alpha-helix, 20 +/- 3% beta-pleated sheet, and 53 +/- 3% coil. Significant conformational changes were observed in disease-associated mutant proteins. Using intrinsic tryptophan fluorescence emission spectrum of ECD2 polypeptide and fluorescence anisotropy, we have demonstrated that this domain specifically interacts with all-trans-retinal. Furthermore, the retinal interaction appeared preferential for the all-trans-isomer and was directly measurable through fluorescence anisotropy analysis. Our results demonstrate that the three macular degeneration-associated mutations lead to significant changes in the secondary structure of the ECD2 domain of ABCA4, as well as in its interaction with all-trans-retinal.

  2. Structural and functional characterization of an orphan ATP-binding cassette ATPase involved in manganese utilization and tolerance in Leptospira spp.


    Benaroudj, Nadia; Saul, Frederick; Bellalou, Jacques; Miras, Isabelle; Weber, Patrick; Bondet, Vincent; Murray, Gerald L; Adler, Ben; Ristow, Paula; Louvel, Hélène; Haouz, Ahmed; Picardeau, Mathieu


    Pathogenic Leptospira species are the etiological agents of the widespread zoonotic disease leptospirosis. Most organisms, including Leptospira, require divalent cations for proper growth, but because of their high reactivity, these metals are toxic at high concentrations. Therefore, bacteria have acquired strategies to maintain metal homeostasis, such as metal import and efflux. By screening Leptospira biflexa transposon mutants for their ability to use Mn(2+), we have identified a gene encoding a putative orphan ATP-binding cassette (ABC) ATPase of unknown function. Inactivation of this gene in both L. biflexa and L. interrogans strains led to mutants unable to grow in medium in which iron was replaced by Mn(2+), suggesting an involvement of this ABC ATPase in divalent cation uptake. A mutation in this ATPase-coding gene increased susceptibility to Mn(2+) toxicity. Recombinant ABC ATPase of the pathogen L. interrogans exhibited Mg(2+)-dependent ATPase activity involving a P-loop motif. The structure of this ATPase was solved from a crystal containing two monomers in the asymmetric unit. Each monomer adopted a canonical two-subdomain organization of the ABC ATPase fold with an α/β subdomain containing the Walker motifs and an α subdomain containing the ABC signature motif (LSSGE). The two monomers were arranged in a head-to-tail orientation, forming a V-shaped particle with all the conserved ABC motifs at the dimer interface, similar to functional ABC ATPases. These results provide the first structural and functional characterization of a leptospiral ABC ATPase.

  3. Hop resistance in the beer spoilage bacterium Lactobacillus brevis is mediated by the ATP-binding cassette multidrug transporter HorA.


    Sakamoto, K; Margolles, A; van Veen, H W; Konings, W N


    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters.

  4. The ATP-binding cassette transporter A1 regulates phosphoantigen release and Vγ9Vδ2 T cell activation by dendritic cells

    PubMed Central

    Castella, Barbara; Kopecka, Joanna; Sciancalepore, Patrizia; Mandili, Giorgia; Foglietta, Myriam; Mitro, Nico; Caruso, Donatella; Novelli, Francesco; Riganti, Chiara; Massaia, Massimo


    Vγ9Vδ2 T cells are activated by phosphoantigens, such as isopentenyl pyrophosphate (IPP), which is generated in the mevalonate pathway of antigen-presenting cells. IPP is released in the extracellular microenvironment via unknown mechanisms. Here we show that the ATP-binding cassette transporter A1 (ABCA1) mediates extracellular IPP release from dendritic cells (DC) in cooperation with apolipoprotein A-I (apoA-I) and butyrophilin-3A1. IPP concentrations in the supernatants are sufficient to induce Vγ9Vδ2 T cell proliferation after DC mevalonate pathway inhibition with zoledronic acid (ZA). ZA treatment increases ABCA1 and apoA-I expression via IPP-dependent LXRα nuclear translocation and PI3K/Akt/mTOR pathway inhibition. These results close the mechanistic gap in our understanding of extracellular IPP release from DC and provide a framework to fine-tune Vγ9Vδ2 T cell activation via mevalonate and PI3K/Akt/mTOR pathway modulation. PMID:28580927

  5. Suppression of the ATP-binding cassette transporter ABCC4 impairs neuroblastoma tumour growth and sensitises to irinotecan in vivo.


    Murray, Jayne; Valli, Emanuele; Yu, Denise M T; Truong, Alan M; Gifford, Andrew J; Eden, Georgina L; Gamble, Laura D; Hanssen, Kimberley M; Flemming, Claudia L; Tan, Alvin; Tivnan, Amanda; Allan, Sophie; Saletta, Federica; Cheung, Leanna; Ruhle, Michelle; Schuetz, John D; Henderson, Michelle J; Byrne, Jennifer A; Norris, Murray D; Haber, Michelle; Fletcher, Jamie I


    The ATP-binding cassette transporter ABCC4 (multidrug resistance protein 4, MRP4) mRNA level is a strong predictor of poor clinical outcome in neuroblastoma which may relate to its export of endogenous signalling molecules and chemotherapeutic agents. We sought to determine whether ABCC4 contributes to development, growth and drug response in neuroblastoma in vivo. In neuroblastoma patients, high ABCC4 protein levels were associated with reduced overall survival. Inducible knockdown of ABCC4 strongly inhibited the growth of human neuroblastoma cells in vitro and impaired the growth of neuroblastoma xenografts. Loss of Abcc4 in the Th-MYCN transgenic neuroblastoma mouse model did not impact tumour formation; however, Abcc4-null neuroblastomas were strongly sensitised to the ABCC4 substrate drug irinotecan. Our findings demonstrate a role for ABCC4 in neuroblastoma cell proliferation and chemoresistance and provide rationale for a strategy where inhibition of ABCC4 should both attenuate the growth of neuroblastoma and sensitise tumours to ABCC4 chemotherapeutic substrates. Copyright © 2017 Elsevier Ltd. All rights reserved.

  6. Involvement of CjMDR1, a plant multidrug-resistance-type ATP-binding cassette protein, in alkaloid transport in Coptis japonica

    PubMed Central

    Shitan, Nobukazu; Bazin, Ingrid; Dan, Kazuyuki; Obata, Kazuaki; Kigawa, Koji; Ueda, Kazumitsu; Sato, Fumihiko; Forestier, Cyrille; Yazaki, Kazufumi


    Alkaloids comprise one of the largest groups of plant secondary metabolites. Berberine, a benzylisoquinoline alkaloid, is preferentially accumulated in the rhizome of Coptis japonica, a ranunculaceous plant, whereas gene expression for berberine biosynthetic enzymes has been observed specifically in root tissues, which suggests that berberine synthesized in the root is transported to the rhizome, where there is high accumulation. We recently isolated a cDNA encoding a multidrug-resistance protein (MDR)-type ATP-binding cassette (ABC) transporter (Cjmdr1) from berberine-producing cultured C. japonica cells, which is highly expressed in the rhizome. Functional analysis of Cjmdr1 by using a Xenopus oocyte expression system showed that CjMDR1 transported berberine in an inward direction, resulting in a higher accumulation of berberine in Cjmdr1-injected oocytes than in the control. Typical inhibitors of ABC proteins, such as vanadate, nifedipine, and glibenclamide, as well as ATP depletion, clearly inhibited this CjMDR1-dependent berberine uptake, suggesting that CjMDR1 functioned as an ABC transporter. Conventional membrane separation methods showed that CjMDR1 was localized in the plasma membrane of C. japonica cells. In situ hybridization indicated that Cjmdr1 mRNA was expressed preferentially in xylem tissues of the rhizome. These findings strongly suggest that CjMDR1 is involved in the translocation of berberine from the root to the rhizome. PMID:12524452

  7. Identification of an Amino Acid Residue Critical for Plasma Membrane Localization of ATP-Binding Cassette Transporter G1--Brief Report.


    Gu, Hong-mei; Wang, Faqi; Alabi, Adekunle; Deng, Shijun; Qin, Shucun; Zhang, Da-wei


    ATP-binding cassette transporter G1 (ABCG1) mediates cholesterol efflux to lipidated lipoproteins. Conflicting data about cellular localization of ABCG1 and its effect on cholesterol efflux have been reported. Here, we investigated the underlying mechanisms for these different observations. Confocal microscopy and biotinylation were used to assess cell surface localization of ABCG1. We found that mouse ABCG1 (mABCG1) used in one previous study has a substitution of Leu to Pro at position 550 (mG1-L550P). When the corresponding Leu at position 562 in human ABCG1 (hABCG1) was mutated to Pro (hG1-L562P), the mutant hABCG1, like mG1-L550P, mainly resided intracellularly, whereas wild-type mABCG1 and hABCG1 were localized on the plasma membrane. However, replacement of this Leu with Pro had no significant effect on mABCG1- and hABCG1-mediated cholesterol efflux. Leu at position 550/562 in mABCG1/hABCG1 is critical for their plasma membrane localization but not for ABCG1-mediated cholesterol efflux. Our findings indicate that the substitution of Leu to Pro at position 550 in mABCG1 may contribute to the non-cell surface localization of mABCG1 observed in the previous study. © 2015 American Heart Association, Inc.

  8. Genome-wide identification of ATP-binding cassette (ABC) transporters and conservation of their xenobiotic transporter function in the monogonont rotifer (Brachionus koreanus).


    Jeong, Chang-Bum; Kim, Hui-Su; Kang, Hye-Min; Lee, Young Hwan; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong


    The ATP-binding cassette (ABC) transporter family is one of the largest gene family in animals, and members of this family are known to be involved in various biological processes due to their ability to transport a wide range of substrates across membranes using ATP cleavage-derived energy. We identified 61 ABC transporters in the genome of the monogonont rotifer Brachionus koreanus, and classified these into eight distinct subfamilies (A-H) by phylogenetic analysis. ABC transporters in the rotifer B. koreanus are comprised of 11 ABCA genes, 19 ABCB genes, 14 ABCC genes, 3 ABCD genes, 1 ABCE gene, 3 ABCF genes, 8 ABCG genes, and 2 ABCH genes. Extensive gene duplication and loss events in synteny were observed in several subfamilies. In particular, massive gene duplications of P-glycoproteins (P-gps), multidrug resistance proteins (MRPs), and Bk-Abcg-like proteins were observed. The ability of these B. koreanus proteins to function as multixenobiotic resistance (MXR) ABC transporters was validated using specific fluorescence substrates/inhibitors. The ABC transporter superfamily members identified in this study will be useful in future toxicological studies, and will facilitate comparative studies of the evolution of the ABC transporter superfamily in invertebrates.

  9. The Yersiniabactin-Associated ATP Binding Cassette Proteins YbtP and YbtQ Enhance Escherichia coli Fitness during High-Titer Cystitis

    PubMed Central

    Koh, Eun-Ik; Hung, Chia S.


    The Yersinia high-pathogenicity island (HPI) is common to multiple virulence strategies used by Escherichia coli strains associated with urinary tract infection (UTI). Among the genes in this island are ybtP and ybtQ, encoding distinctive ATP binding cassette (ABC) proteins associated with iron(III)-yersiniabactin import in Yersinia pestis. In this study, we compared the impact of ybtPQ on a model E. coli cystitis strain during in vitro culture and experimental murine infections. A ybtPQ-null mutant exhibited no growth defect under standard culture conditions, consistent with nonessentiality in this background. A growth defect phenotype was observed and genetically complemented in vitro during iron(III)-yersiniabactin-dependent growth. Following inoculation into the bladders of C3H/HEN and C3H/HeOuJ mice, this strain exhibited a profound, 106-fold competitive infection defect in the subgroup of mice that progressed to high-titer bladder infections. These results identify a virulence role for YbtPQ in the highly inflammatory microenvironment characteristic of high-titer cystitis. The profound competitive defect may relate to the apparent selection of Yersinia HPI-positive E. coli in uncomplicated clinical UTIs. PMID:26883590

  10. Intracellular ATP-binding cassette transporter A3 is expressed in lung cancer cells and modulates susceptibility to cisplatin and paclitaxel.


    Overbeck, Tobias R; Hupfeld, Timo; Krause, Doris; Waldmann-Beushausen, Regina; Chapuy, Bjoern; Güldenzoph, Bjoern; Aung, Thiha; Inagaki, Nobuya; Schöndube, Friedrich A; Danner, Bernhard C; Truemper, Lorenz; Wulf, Gerald G


    Patients with advanced-stage bronchial cancer benefit from systemic cytostatic therapy, in particular from regimens integrating cisplatin and taxanes. However, eventual disease progression leads to a fatal outcome in most cases, originating from tumor cells resisting chemotherapy. We here show that the intracellular ATP-binding cassette transporter A3 (ABCA3), previously recognized as critical for the secretion of surfactant components from type 2 pneumocytes, is expressed in non-small-cell lung cancer (NSCLC) cells. With some heterogeneity in a given specimen, expression levels detected immunohistochemically in primary cancer tissue were highest in adenocarcinomas and lowest in small cell lung cancers. Genetic silencing of ABCA3 in the NSCLC cell line models A549, NCI-H1650 and NCI-H1975 significantly increased tumor cell susceptibility to the cytostatic effects of both cisplatin (in all cell lines) and paclitaxel (in two of three cell lines). Taken together, ABCA3 emerges as a modulator of NSCLC cell susceptibility to cytostatic therapy. Copyright © 2013 S. Karger AG, Basel.

  11. Genome-Wide Identification, Characterization and Phylogenetic Analysis of ATP-Binding Cassette (ABC) Transporter Genes in Common Carp (Cyprinus carpio).


    Liu, Xiang; Li, Shangqi; Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A; Xu, Peng


    The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.

  12. Genome-Wide Identification, Characterization and Phylogenetic Analysis of ATP-Binding Cassette (ABC) Transporter Genes in Common Carp (Cyprinus carpio)

    PubMed Central

    Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A.


    The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp. PMID:27058731

  13. Reversal of multidrug resistance by the inhibition of ATP-binding cassette pumps employing "Generally Recognized As Safe" (GRAS) nanopharmaceuticals: A review.


    Sosnik, Alejandro


    Pumps of the ATP-binding cassette superfamily (ABCs) regulate the access of drugs to the intracellular space. In this context, the overexpression of ABCs is a well-known mechanism of multidrug resistance (MDR) in cancer and infectious diseases (e.g., viral hepatitis and the human immunodeficiency virus) and is associated with therapeutic failure. Since their discovery, ABCs have emerged as attractive therapeutic targets and the search of compounds that inhibit their genetic expression and/or their functional activity has gained growing interest. Different generations of pharmacological ABC inhibitors have been explored over the last four decades to address resistance in cancer, though clinical results have been somehow disappointing. "Generally Recognized As Safe" (GRAS) is a U.S. Food and Drug Administration designation for substances that are accepted as safe for addition in food. Far from being "inert", some amphiphilic excipients used in the production of pharmaceutical products have been shown to inhibit the activity of ABCs in MDR tumors, emerging as a clinically translatable approach to overcome resistance. The present article initially overviews the classification, structure and function of the different ABCs, with emphasis on those pumps related to drug resistance. Then, the different attempts to capitalize on the activity of GRAS nanopharmaceuticals as ABC inhibitors are discussed. © 2013.

  14. Direct evidence in vivo of impaired macrophage-specific reverse cholesterol transport in ATP-binding cassette transporter A1-deficient mice.


    Calpe-Berdiel, Laura; Rotllan, Noemi; Palomer, Xavier; Ribas, Vicent; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles


    The ATP-binding cassette transporter A1 (ABCA1) is a key regulator of high-density lipoprotein (HDL) metabolism. There is strong evidence that ABCA1 is a key regulator of reverse cholesterol transport (RCT). However, this could not be proved in vivo since hepatobiliary cholesterol transport was unchanged in ABCA1-deficient mice (ABCA1-/-). We used ABCA1-/- mice to test the hypothesis that ABCA1 is a critical determinant of macrophage-specific RCT. Although this cell-specific RCT only accounts for a tiny part of total RCT, it is widely accepted that it may have a major impact on atherosclerosis susceptibility. [(3)H]cholesterol-labeled endogenous macrophages were injected intraperitoneally into wild-type ABCA1+/+, ABCA1+/- and ABCA1-/- mice maintained on a chow diet. A direct relationship was observed between ABCA1 gene dose and plasma [(3)H]cholesterol at 24 and 48 h after the injection of tracer into the mice. Forty-eight hours after this injection, ABCA1-/- mice had significantly reduced [(3)H]cholesterol in liver (2.8-fold), small intestine enterocytes (1.7-fold) and feces (2-fold). To our knowledge, this is the first direct in vivo quantitative evidence that ABCA1 is a critical determinant of macrophage-specific RCT.

  15. ATP-binding cassette G-subfamily transporter 2 regulates cell cycle progression and asymmetric division in mouse cardiac side population progenitor cells.


    Sereti, Konstantina-Ioanna; Oikonomopoulos, Angelos; Unno, Kazumasa; Cao, Xin; Qiu, Yiling; Liao, Ronglih


    After cardiac injury, cardiac progenitor cells are acutely reduced and are replenished in part by regulated self-renewal and proliferation, which occurs through symmetric and asymmetric cellular division. Understanding the molecular cues controlling progenitor cell self-renewal and lineage commitment is critical for harnessing these cells for therapeutic regeneration. We previously have found that the cell surface ATP-binding cassette G-subfamily transporter 2 (Abcg2) influences the proliferation of cardiac side population (CSP) progenitor cells, but through unclear mechanisms. To determine the role of Abcg2 on cell cycle progression and mode of division in mouse CSP cells. Herein, using CSP cells isolated from wild-type and Abcg2 knockout mice, we found that Abcg2 regulates G1-S cell cycle transition by fluorescence ubiquitination cell cycle indicators, cell cycle-focused gene expression arrays, and confocal live-cell fluorescent microscopy. Moreover, we found that modulation of cell cycle results in transition from symmetric to asymmetric cellular division in CSP cells lacking Abcg2. Abcg2 modulates CSP cell cycle progression and asymmetric cell division, establishing a mechanistic link between this surface transporter and cardiac progenitor cell function. Greater understanding of progenitor cell biology and, in particular, the regulation of resident progenitor cell homeostasis is vital for guiding the future development of cell-based therapies for cardiac regeneration.

  16. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.


    Chen, H Y; Weng, S F; Lin, J W


    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  17. The ATP-binding cassette transporter ABCG2 protects against pressure overload-induced cardiac hypertrophy and heart failure by promoting angiogenesis and antioxidant response.


    Higashikuni, Yasutomi; Sainz, Julie; Nakamura, Kazuto; Takaoka, Minoru; Enomoto, Soichiro; Iwata, Hiroshi; Tanaka, Kimie; Sahara, Makoto; Hirata, Yasunobu; Nagai, Ryozo; Sata, Masataka


    ATP-binding cassette transporter subfamily G member 2 (ABCG2), expressed in microvascular endothelial cells in the heart, has been suggested to regulate several tissue defense mechanisms. This study was performed to elucidate its role in pressure overload-induced cardiac hypertrophy. Pressure overload was induced in 8- to 12-week-old wild-type and Abcg2-/- mice by transverse aortic constriction (TAC). Abcg2-/- mice showed exaggerated cardiac hypertrophy and ventricular remodeling after TAC compared with wild-type mice. In the early phase after TAC, functional impairment in angiogenesis and antioxidant response in myocardium was found in Abcg2-/- mice. In vitro experiments demonstrated that ABCG2 regulates transport of glutathione, an important endogenous antioxidant, from microvascular endothelial cells. Besides, glutathione transported from microvascular endothelial cells in ABCG2-dependent manner ameliorated oxidative stress-induced cardiomyocyte hypertrophy. In vivo, glutathione levels in plasma and the heart were increased in wild-type mice but not in Abcg2-/- mice after TAC. Treatment with the superoxide dismutase mimetic ameliorated cardiac hypertrophy in Abcg2-/- mice after TAC to the same extent as that in wild-type mice, although cardiac dysfunction with impaired angiogenesis was observed in Abcg2-/- mice. ABCG2 protects against pressure overload-induced cardiac hypertrophy and heart failure by promoting angiogenesis and antioxidant response.

  18. Lipid absorption defects in intestine-specific microsomal triglyceride transfer protein and ATP-binding cassette transporter A1-deficient mice.


    Iqbal, Jahangir; Parks, John S; Hussain, M Mahmood


    We have previously described apolipoprotein B (apoB)-dependent and -independent cholesterol absorption pathways and the role of microsomal triglyceride transfer protein (MTP) and ATP-binding cassette transporter A1 (ABCA1) in these pathways. To assess the contribution of these pathways to cholesterol absorption and to determine whether there are other pathways, we generated mice that lack MTP and ABCA1, individually and in combination, in the intestine. Intestinal deletions of Mttp and Abca1 decreased plasma cholesterol concentrations by 45 and 24%, respectively, whereas their combined deletion reduced it by 59%. Acute cholesterol absorption was reduced by 28% in the absence of ABCA1, and it was reduced by 92-95% when MTP was deleted in the intestine alone or together with ABCA1. MTP deficiency significantly reduced triglyceride absorption, although ABCA1 deficiency had no effect. ABCA1 deficiency did not affect cellular lipids, but Mttp deficiency significantly increased intestinal levels of triglycerides and free fatty acids. Accumulation of intestinal free fatty acids, but not triglycerides, in Mttp-deficient intestines was prevented when mice were also deficient in intestinal ABCA1. Combined deficiency of these genes increased intestinal fatty acid oxidation as a consequence of increased expression of peroxisome proliferator-activated receptor-γ (PPARγ) and carnitine palmitoyltransferase 1α (CPT1α). These studies show that intestinal MTP and ABCA1 are critical for lipid absorption and are the main determinants of plasma and intestinal lipid levels. Reducing their activities might lower plasma lipid concentrations.

  19. A Member of the PLEIOTROPIC DRUG RESISTANCE Family of ATP Binding Cassette Transporters Is Required for the Formation of a Functional Cuticle in Arabidopsis[W

    PubMed Central

    Bessire, Michael; Borel, Sandra; Fabre, Guillaume; Carraça, Luis; Efremova, Nadia; Yephremov, Alexander; Cao, Yan; Jetter, Reinhard; Jacquat, Anne-Claude; Métraux, Jean-Pierre; Nawrath, Christiane


    Although the multilayered structure of the plant cuticle was discovered many years ago, the molecular basis of its formation and the functional relevance of the layers are not understood. Here, we present the permeable cuticle1 (pec1) mutant of Arabidopsis thaliana, which displays features associated with a highly permeable cuticle in several organs. In pec1 flowers, typical cutin monomers, such as ω-hydroxylated fatty acids and 10,16-dihydroxypalmitate, are reduced to 40% of wild-type levels and are accompanied by the appearance of lipidic inclusions within the epidermal cell. The cuticular layer of the cell wall, rather than the cuticle proper, is structurally altered in pec1 petals. Therefore, a significant role for the formation of the diffusion barrier in petals can be attributed to this layer. Thus, pec1 defines a new class of mutants. The phenotypes of the pec1 mutant are caused by the knockout of ATP BINDING CASSETTEG32 (ABCG32), an ABC transporter from the PLEIOTROPIC DRUG RESISTANCE family that is localized at the plasma membrane of epidermal cells in a polar manner toward the surface of the organs. Our results suggest that ABCG32 is involved in the formation of the cuticular layer of the cell wall, most likely by exporting particular cutin precursors from the epidermal cell. PMID:21628525

  20. Transgenic hybrid aspen overexpressing the Atwbc19 gene encoding an ATP-binding cassette transporter confers resistance to four aminoglycoside antibiotics.


    Kang, Byung-Guk; Ye, Xia; Osburn, Lori D; Stewart, C N; Cheng, Zong-Ming


    Antibiotic-resistance genes of bacterial origin are invaluable markers for plant genetic engineering. However, these genes are feared to pose possible risk to human health by horizontal gene transfer from transgenic plants to bacteria, potentially resulting in antibiotic-resistant pathogenic bacteria; this is a considerable regulatory concern in some countries. The Atwbc19 gene, encoding an Arabidopsis thaliana ATP-binding cassette transporter, has been reported to confer resistance to kanamycin specifically as an alternative to bacterial antibiotic-resistance genes. In this report, we transformed hybrid aspen (Populus canescens x P. grandidentata) with the Atwbc19 gene. Unlike Atwbc19-transgenic tobacco that was only resistant to kanamycin, the transgenic Populus plants also showed resistance to three other aminoglycoside antibiotics (neomycin, geneticin, and paromomycin) at comparable levels to plants containing a CaMV35S-nptII cassette. Although it is unknown why the transgenic Populus with the Atwbc19 gene is resistant to all aminoglycoside antibiotics tested, the broad utility of the Atwbc19 gene as a reporter gene is confirmed here in a second dicot species. Because the Atwbc19 gene is plant-ubiquitous, it might serve as an alternative selectable marker to current bacterial antibiotic-resistance marker genes and alleviate the potential risk for horizontal transfer of bacterial-resistance genes in transgenic plants.

  1. The Role of Arabidopsis ABCG9 and ABCG31 ATP Binding Cassette Transporters in Pollen Fitness and the Deposition of Steryl Glycosides on the Pollen Coat[W

    PubMed Central

    Choi, Hyunju; Ohyama, Kiyoshi; Kim, Yu-Young; Jin, Jun-Young; Lee, Saet Buyl; Yamaoka, Yasuyo; Muranaka, Toshiya; Suh, Mi Chung; Fujioka, Shozo; Lee, Youngsook


    The pollen coat protects pollen grains from harmful environmental stresses such as drought and cold. Many compounds in the pollen coat are synthesized in the tapetum. However, the pathway by which they are transferred to the pollen surface remains obscure. We found that two Arabidopsis thaliana ATP binding cassette transporters, ABCG9 and ABCG31, were highly expressed in the tapetum and are involved in pollen coat deposition. Upon exposure to dry air, many abcg9 abcg31 pollen grains shriveled up and collapsed, and this phenotype was restored by complementation with ABCG9pro:GFP:ABCG9. GFP-tagged ABCG9 or ABCG31 localized to the plasma membrane. Electron microscopy revealed that the mutant pollen coat resembled the immature coat of the wild type, which contained many electron-lucent structures. Steryl glycosides were reduced to about half of wild-type levels in the abcg9 abcg31 pollen, but no differences in free sterols or steryl esters were observed. A mutant deficient in steryl glycoside biosynthesis, ugt80A2 ugt80B1, exhibited a similar phenotype. Together, these results indicate that steryl glycosides are critical for pollen fitness, by supporting pollen coat maturation, and that ABCG9 and ABCG31 contribute to the accumulation of this sterol on the surface of pollen. PMID:24474628

  2. Role of NH{sub 2}-terminal hydrophobic motif in the subcellular localization of ATP-binding cassette protein subfamily D: Common features in eukaryotic organisms

    SciTech Connect

    Lee, Asaka; Asahina, Kota; Okamoto, Takumi; Kawaguchi, Kosuke; Kostsin, Dzmitry G.; Kashiwayama, Yoshinori; Takanashi, Kojiro; Yazaki, Kazufumi; Imanaka, Tsuneo; Morita, Masashi


    Highlights: • ABCD proteins classifies based on with or without NH{sub 2}-terminal hydrophobic segment. • The ABCD proteins with the segment are targeted peroxisomes. • The ABCD proteins without the segment are targeted to the endoplasmic reticulum. • The role of the segment in organelle targeting is conserved in eukaryotic organisms. - Abstract: In mammals, four ATP-binding cassette (ABC) proteins belonging to subfamily D have been identified. ABCD1–3 possesses the NH{sub 2}-terminal hydrophobic region and are targeted to peroxisomes, while ABCD4 lacking the region is targeted to the endoplasmic reticulum (ER). Based on hydropathy plot analysis, we found that several eukaryotes have ABCD protein homologs lacking the NH{sub 2}-terminal hydrophobic segment (H0 motif). To investigate whether the role of the NH{sub 2}-terminal H0 motif in subcellular localization is conserved across species, we expressed ABCD proteins from several species (metazoan, plant and fungi) in fusion with GFP in CHO cells and examined their subcellular localization. ABCD proteins possessing the NH{sub 2}-terminal H0 motif were localized to peroxisomes, while ABCD proteins lacking this region lost this capacity. In addition, the deletion of the NH{sub 2}-terminal H0 motif of ABCD protein resulted in their localization to the ER. These results suggest that the role of the NH{sub 2}-terminal H0 motif in organelle targeting is widely conserved in living organisms.

  3. Identification of a gene linked to Rhizobium meliloti ntrA whose product is homologous to a family to ATP-binding proteins.

    PubMed Central

    Albright, L M; Ronson, C W; Nixon, B T; Ausubel, F M


    The ntrA gene of Rhizobium meliloti has recently been identified and shown to be required for a diverse set of metabolic functions (C. W. Ronson, B. T. Nixon, L. M. Albright, and F. M. Ausubel, J. Bacteriol. 169:2424-2431, 1987). As a result of sequencing the ntrA gene and its flanking regions from R. meliloti, we identified an open reading frame directly upstream of ntrA, ORF1, whose predicted product is homologous to a superfamily of ATP-binding proteins involved in transport, cell division, nodulation, and DNA repair. The homology of ORF1 to this superfamily and its proximity to ntrA led us to investigate its role in symbiosis by mutagenesis and expression studies. We were unable to isolate an insertion mutation in ORF1, suggesting that ORF1 may code for an essential function. We identified the start of transcription for the ntrA gene in vegetative cells and bacteroids and showed that ORF1 and ntrA are transcriptionally unlinked. ORF1 appears to be in an operon with one or more upstream genes. Images PMID:2703463

  4. Cuticular Defects in Oryza sativa ATP-binding Cassette Transporter G31 Mutant Plants Cause Dwarfism, Elevated Defense Responses and Pathogen Resistance.


    Garroum, Imène; Bidzinski, Przemyslaw; Daraspe, Jean; Mucciolo, Antonio; Humbel, Bruno M; Morel, Jean-Benoit; Nawrath, Christiane


    The cuticle covers the surface of the polysaccharide cell wall of leaf epidermal cells and forms an essential diffusion barrier between plant and environment. Homologs of the ATP-binding cassette (ABC) transporter AtABCG32/HvABCG31 clade are necessary for the formation of a functional cuticle in both monocots and dicots. Here we characterize the osabcg31 knockout mutant and hairpin RNA interference (RNAi)-down-regulated OsABCG31 plant lines having reduced plant growth and a permeable cuticle. The reduced content of cutin in leaves and structural alterations in the cuticle and at the cuticle-cell wall interface in plants compromised in OsABCG31 expression explain the cuticle permeability. Effects of modifications of the cuticle on plant-microbe interactions were evaluated. The cuticular alterations in OsABCG31-compromised plants did not cause deficiencies in germination of the spores or the formation of appressoria of Magnaporthe oryzae on the leaf surface, but a strong reduction of infection structures inside the plant. Genes involved in pathogen resistance were constitutively up-regulated in OsABCG31-compromised plants, thus being a possible cause of the resistance to M. oryzae and the dwarf growth phenotype. The findings show that in rice an abnormal cuticle formation may affect the signaling of plant growth and defense.

  5. A member of the PLEIOTROPIC DRUG RESISTANCE family of ATP binding cassette transporters is required for the formation of a functional cuticle in Arabidopsis.


    Bessire, Michael; Borel, Sandra; Fabre, Guillaume; Carraça, Luis; Efremova, Nadia; Yephremov, Alexander; Cao, Yan; Jetter, Reinhard; Jacquat, Anne-Claude; Métraux, Jean-Pierre; Nawrath, Christiane


    Although the multilayered structure of the plant cuticle was discovered many years ago, the molecular basis of its formation and the functional relevance of the layers are not understood. Here, we present the permeable cuticle1 (pec1) mutant of Arabidopsis thaliana, which displays features associated with a highly permeable cuticle in several organs. In pec1 flowers, typical cutin monomers, such as ω-hydroxylated fatty acids and 10,16-dihydroxypalmitate, are reduced to 40% of wild-type levels and are accompanied by the appearance of lipidic inclusions within the epidermal cell. The cuticular layer of the cell wall, rather than the cuticle proper, is structurally altered in pec1 petals. Therefore, a significant role for the formation of the diffusion barrier in petals can be attributed to this layer. Thus, pec1 defines a new class of mutants. The phenotypes of the pec1 mutant are caused by the knockout of ATP BINDING CASSETTEG32 (ABCG32), an ABC transporter from the PLEIOTROPIC DRUG RESISTANCE family that is localized at the plasma membrane of epidermal cells in a polar manner toward the surface of the organs. Our results suggest that ABCG32 is involved in the formation of the cuticular layer of the cell wall, most likely by exporting particular cutin precursors from the epidermal cell.

  6. The maltose ATP-binding cassette transporter in the 21st century--towards a structural dynamic perspective on its mode of action.


    Bordignon, Enrica; Grote, Mathias; Schneider, Erwin


    The maltose/maltodextrin transport system of Escherichia coli/Salmonella, composed of periplasmic maltose-binding protein, MalE, the pore-forming subunits MalF and MalG, and a homodimer of the nucleotide-binding subunit, MalK, serves as a model for canonical ATP-binding cassette importers in general. The wealth of knowledge accumulated on the maltose transporter in more than three decades by genetic, molecular genetic and biochemical means was complemented more recently by crystal structures of the isolated MalK dimer and of two conformational states of the full transporter. Here, we summarize insights into the transport mechanism provided by these structures and draw the reader's attention to experimental tools by which the dynamics of the transporter can be studied during substrate translocation. A transport model is presented that integrates currently available biochemical, biophysical and structural data. We also present the state of knowledge on regulatory functions of the maltose transporter associated with the C-terminal domain of MalK. Finally, we will address the application of coarse-grained modelling to visualize the progression of the conformational changes of an ABC transporter with special emphasis on the maltose system, which can provide a model platform for testing and validating the bioinformatic tools.

  7. Peroxisomal ATP-Binding Cassette Transporter COMATOSE and the Multifunctional Protein ABNORMAL INFLORESCENCE MERISTEM Are Required for the Production of Benzoylated Metabolites in Arabidopsis Seeds1[W

    PubMed Central

    Bussell, John D.; Reichelt, Michael; Wiszniewski, Andrew A.G.; Gershenzon, Jonathan; Smith, Steven M.


    Secondary metabolites derived from benzoic acid (BA) are of central importance in the interactions of plants with pests, pathogens, and symbionts and are potentially important in plant development. Peroxisomal β-oxidation has recently been shown to contribute to BA biosynthesis in plants, but not all of the enzymes involved have been defined. In this report, we demonstrate that the peroxisomal ATP-binding cassette transporter COMATOSE is required for the accumulation of benzoylated secondary metabolites in Arabidopsis (Arabidopsis thaliana) seeds, including benzoylated glucosinolates and substituted hydroxybenzoylcholines. The ABNORMAL INFLORESCENCE MERISTEM protein, one of two multifunctional proteins encoded by Arabidopsis, is essential for the accumulation of these compounds, and MULTIFUNCTIONAL PROTEIN2 contributes to the synthesis of substituted hydroxybenzoylcholines. Of the two major 3-ketoacyl coenzyme A thiolases, KAT2 plays the primary role in BA synthesis. Thus, BA biosynthesis in Arabidopsis employs the same core set of β-oxidation enzymes as in the synthesis of indole-3-acetic acid from indole-3-butyric acid. PMID:24254312

  8. Effect of tacrolimus on activity and expression of P-glycoprotein and ATP-binding cassette transporter A5 (ABCA5) proteins in hematoencephalic barrier cells.


    Quezada, Claudia Andrea; Garrido, Wallys Ximena; González-Oyarzún, Mauricio Alejandro; Rauch, María Cecilia; Salas, Mónica Roxana; San Martín, Rody Enrique; Claude, Alejandro Andrés; Yañez, Alejandro Javier; Slebe, Juan Carlos; Cárcamo, Juan Guillermo


    Tacrolimus is an agent used in clinical immunosuppressive drug therapies. A wide spectrum of adverse effects has been reported in association with this immunosuppressor, including neurotoxic effect. The upper limit of therapeutic blood concentrations of tacrolimus has been described as 30 ng/ml in immunosuppressed patients. We investigated the effect of this therapeutic dose of tacrolimus on the expression and activity of the multidrug resistance protein 1 (MDR1 or Pgp, P-glycoprotein) and ATP-binding cassette transporters A5 (ABCA5) in human brain microvascular endothelial cells (HBMEC), derived from Blood-Brain Barrier (BBB) endothelium, these being the most predominantly expressed transcripts in these cells. The expression and activity of MDR1 transporter decreased with 30 ng/ml tacrolimus. The cell viability was not changed with the therapeutic dose used. By contrast, ABCA5 transcripts, of unknown role as yet, increased their expression at this concentration. We propose that the secondary cytotoxic effects of this immunosuppressor on CSN, besides the functional blockade related to multidrug resistance proteins, such as MDR1, and probably ABCA5, could be linked to variations in the expression levels of these proteins at the BBB.

  9. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter.


    Alvarez, Frances Joan D; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R Michael; Klug, Candice S; Davidson, Amy L


    MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP.

  10. Altered Profile of Secondary Metabolites in the Root Exudates of Arabidopsis ATP-Binding Cassette Transporter Mutants1[C][W][OA

    PubMed Central

    Badri, Dayakar V.; Loyola-Vargas, Victor M.; Broeckling, Corey D.; De-la-Peña, Clelia; Jasinski, Michal; Santelia, Diana; Martinoia, Enrico; Sumner, Lloyd W.; Banta, Lois M.; Stermitz, Frank; Vivanco, Jorge M.


    Following recent indirect evidence suggesting a role for ATP-binding cassette (ABC) transporters in root exudation of phytochemicals, we identified 25 ABC transporter genes highly expressed in the root cells most likely to be involved in secretion processes. Of these 25 genes, we also selected six full-length ABC transporters and a half-size transporter for in-depth molecular and biochemical analyses. We compared the exuded root phytochemical profiles of these seven ABC transporter mutants to those of the wild type. There were three nonpolar phytochemicals missing in various ABC transporter mutants compared to the wild type when the samples were analyzed by high-performance liquid chromatography-mass spectrometry. These data suggest that more than one ABC transporter can be involved in the secretion of a given phytochemical and that a transporter can be involved in the secretion of more than one secondary metabolite. The primary and secondary metabolites present in the root exudates of the mutants were also analyzed by gas chromatography-mass spectrometry, which allowed for the identification of groups of compounds differentially found in some of the mutants compared to the wild type. For instance, the mutant Atpdr6 secreted a lower level of organic acids and Atmrp2 secreted a higher level of amino acids as compared to the wild type. We conclude that the release of phytochemicals by roots is partially controlled by ABC transporters. PMID:18065561

  11. Limited variation during circulation of a polyomavirus in the human population involves the COCO-VA toggling site of Middle and Alternative T-antigen(s).


    Kazem, Siamaque; Lauber, Chris; van der Meijden, Els; Kooijman, Sander; Kravchenko, Alexander A; Feltkamp, Mariet C W; Gorbalenya, Alexander E


    We have recently shown that the trichodysplasia spinulosa-associated polyomavirus (TSPyV) belongs to a large monophyletic group of mammalian polyomaviruses that experienced accelerated codon-constrained Val-Ala (COCO-VA) toggling at a protein site common to both Middle and Alternative T-antigens (MT/ALTO). Here we analyzed thirteen, mostly newly sequenced TSPyV genomes, representing ~40% of reported TS disease cases world-wide. We found two deletions and 30 variable sites (≤0.6%) that included only four sites with non-synonymous substitutions (NSS). One NSS site was under positive selection in the exon shared by Small and Middle T antigens, while three others were segregated in MT/ALTO. Two MT/ALTO sites covaried with five sites elsewhere in the genome and determined separation of twelve TSPyVs into two most populous phylogenetic lineages. The other, most distant TSPyV was distinguished by NSS at the COCO-VA site, observed for the first time during intra-species evolution. Our findings reveal a connection between micro- and macro-evolution of polyomaviruses.

  12. Characterization of [35S]-ATP alpha S and [3H]-alpha, beta-MeATP binding sites in rat brain cortical synaptosomes: regulation of ligand binding by divalent cations.


    Schäfer, R; Reiser, G


    1. We made a comparative analysis of the binding characteristics of the radioligands [35S]-ATP alpha S and [3H]-alpha, beta-MeATP in order to test whether these ligands can be used to analyse P2-purinoceptors in synaptosomal membranes from rat brain cortex. 2. Synaptosomes possess sites with high affinity for [35S]-ATP alpha S (Kd = 22.2 +/- 9.1 nM, Bmax = 14.8 pmol mg-1 protein). The rank order of the competition potency of the different compounds (ATP alpha S, ATP, ATP gamma S > ADP beta S, 2-MeSATP > deoxyATP, ADP > > UTP, alpha, beta-MeATP, AMP, Reactive Blue-2, suramin, isoPPADS) is consistent with pharmacological properties of P2Y-purinoceptors. 3. Under identical conditions [35S]-ATP alpha S and [3H]-alpha, beta-MeATP bind to different binding sites at synaptosomal membranes from rat brain cortex. The affinity of the [3H]-alpha, beta-MeATP binding sites (Kd = 13.7 +/- 1.8 nM, Bmax = 6.34 +/- 0.28 pmol mg-1 protein) was 38 fold higher than the potency of alpha, beta-MeATP to displace [35S]-ATP alpha S binding (Ki = 0.52 microM). ATP and ADP beta S competed at both binding sites with different affinities, 60 fold and 175 fold, respectively. The other agonists tested (2-MeSATP, UTP, GTP) did not affect specific [35H]-alpha, beta-MeATP binding at concentrations up to 100 microM. The antagonists (suramin, isoPPADS, Evan's Blue) showed completely different affinities for both binding sites. 4. Binding of [35S]-ATP alpha S on synaptosomes was regulated by GTP, which is indicative for G-protein coupled receptors. The Kd value for the high affinity binding site was reduced in the presence of GTP about 5 fold (from 1.8 nM to 8.6 nM). In the presence of Mg2+ the affinity was increased (Kd 1.8 nM versus 22 nM in the absence of Mg2+). 5. The binding of both radioligands was regulated in an opposite manner by physiological concentrations of Ca2+ and Mg2+. Binding of [3H]-alpha, beta-MeATP to synaptosomal membranes was increased 3 fold by raising the Ca2+ concentration

  13. Intrinsic acyl-CoA thioesterase activity of a peroxisomal ATP binding cassette transporter is required for transport and metabolism of fatty acids.


    De Marcos Lousa, Carine; van Roermund, Carlo W T; Postis, Vincent L G; Dietrich, Daniela; Kerr, Ian D; Wanders, Ronald J A; Baldwin, Stephen A; Baker, Alison; Theodoulou, Frederica L


    Peroxisomes are organelles that perform diverse metabolic functions in different organisms, but a common function is β-oxidation of a variety of long chain aliphatic, branched, and aromatic carboxylic acids. Import of substrates into peroxisomes for β-oxidation is mediated by ATP binding cassette (ABC) transporter proteins of subfamily D, which includes the human adrenoleukodystropy protein (ALDP) defective in X-linked adrenoleukodystrophy (X-ALD). Whether substrates are transported as CoA esters or free acids has been a matter of debate. Using COMATOSE (CTS), a plant representative of the ABCD family, we demonstrate that there is a functional and physical interaction between the ABC transporter and the peroxisomal long chain acyl-CoA synthetases (LACS)6 and -7. We expressed recombinant CTS in insect cells and showed that membranes from infected cells possess fatty acyl-CoA thioesterase activity, which is stimulated by ATP. A mutant, in which Serine 810 is replaced by asparagine (S810N) is defective in fatty acid degradation in vivo, retains ATPase activity but has strongly reduced thioesterase activity, providing strong evidence for the biological relevance of this activity. Thus, CTS, and most likely the other ABCD family members, represent rare examples of polytopic membrane proteins with an intrinsic additional enzymatic function that may regulate the entry of substrates into the β-oxidation pathway. The cleavage of CoA raises questions about the side of the membrane where this occurs and this is discussed in the context of the peroxisomal coenzyme A (CoA) budget.

  14. Intrinsic acyl-CoA thioesterase activity of a peroxisomal ATP binding cassette transporter is required for transport and metabolism of fatty acids

    PubMed Central

    De Marcos Lousa, Carine; van Roermund, Carlo W. T.; Postis, Vincent L. G.; Dietrich, Daniela; Kerr, Ian D.; Wanders, Ronald J. A.; Baldwin, Stephen A.; Baker, Alison; Theodoulou, Frederica L.


    Peroxisomes are organelles that perform diverse metabolic functions in different organisms, but a common function is β-oxidation of a variety of long chain aliphatic, branched, and aromatic carboxylic acids. Import of substrates into peroxisomes for β-oxidation is mediated by ATP binding cassette (ABC) transporter proteins of subfamily D, which includes the human adrenoleukodystropy protein (ALDP) defective in X-linked adrenoleukodystrophy (X-ALD). Whether substrates are transported as CoA esters or free acids has been a matter of debate. Using COMATOSE (CTS), a plant representative of the ABCD family, we demonstrate that there is a functional and physical interaction between the ABC transporter and the peroxisomal long chain acyl-CoA synthetases (LACS)6 and -7. We expressed recombinant CTS in insect cells and showed that membranes from infected cells possess fatty acyl-CoA thioesterase activity, which is stimulated by ATP. A mutant, in which Serine 810 is replaced by asparagine (S810N) is defective in fatty acid degradation in vivo, retains ATPase activity but has strongly reduced thioesterase activity, providing strong evidence for the biological relevance of this activity. Thus, CTS, and most likely the other ABCD family members, represent rare examples of polytopic membrane proteins with an intrinsic additional enzymatic function that may regulate the entry of substrates into the β-oxidation pathway. The cleavage of CoA raises questions about the side of the membrane where this occurs and this is discussed in the context of the peroxisomal coenzyme A (CoA) budget. PMID:23288899

  15. Vacuolar Transport of Abscisic Acid Glucosyl Ester Is Mediated by ATP-Binding Cassette and Proton-Antiport Mechanisms in Arabidopsis1[W][OPEN

    PubMed Central

    Burla, Bo; Pfrunder, Stefanie; Nagy, Réka; Francisco, Rita Maria; Lee, Youngsook; Martinoia, Enrico


    Abscisic acid (ABA) is a key plant hormone involved in diverse physiological and developmental processes, including abiotic stress responses and the regulation of stomatal aperture and seed germination. Abscisic acid glucosyl ester (ABA-GE) is a hydrolyzable ABA conjugate that accumulates in the vacuole and presumably also in the endoplasmic reticulum. Deconjugation of ABA-GE by the endoplasmic reticulum and vacuolar β-glucosidases allows the rapid formation of free ABA in response to abiotic stress conditions such as dehydration and salt stress. ABA-GE further contributes to the maintenance of ABA homeostasis, as it is the major ABA catabolite exported from the cytosol. In this work, we identified that the import of ABA-GE into vacuoles isolated from Arabidopsis (Arabidopsis thaliana) mesophyll cells is mediated by two distinct membrane transport mechanisms: proton gradient-driven and ATP-binding cassette (ABC) transporters. Both systems have similar Km values of approximately 1 mm. According to our estimations, this low affinity appears nevertheless to be sufficient for the continuous vacuolar sequestration of ABA-GE produced in the cytosol. We further demonstrate that two tested multispecific vacuolar ABCC-type ABC transporters from Arabidopsis exhibit ABA-GE transport activity when expressed in yeast (Saccharomyces cerevisiae), which also supports the involvement of ABC transporters in ABA-GE uptake. Our findings suggest that the vacuolar ABA-GE uptake is not mediated by specific, but rather by several, possibly multispecific, transporters that are involved in the general vacuolar sequestration of conjugated metabolites. PMID:24028845

  16. Bacteriophage-mediated Glucosylation Can Modify Lipopolysaccharide O-Antigens Synthesized by an ATP-binding Cassette (ABC) Transporter-dependent Assembly Mechanism.


    Mann, Evan; Ovchinnikova, Olga G; King, Jerry D; Whitfield, Chris


    Lysogenic bacteriophages may encode enzymes that modify the structures of lipopolysaccharide O-antigen glycans, altering the structure of the bacteriophage receptor and resulting in serotype conversion. This can enhance virulence and has implications for antigenic diversity and vaccine development. Side chain glucosylation is a common modification strategy found in a number of bacterial species. To date, glucosylation has only been observed in O-antigens synthesized by Wzy-dependent pathways, one of the two most prevalent O-antigen synthesis systems. Here we exploited a heterologous system to study the glucosylation potential of a model O-antigen produced in an ATP-binding cassette (ABC) transporter-dependent system. Although O-antigen production is cryptic in Escherichia coli K-12, because of a mutation in the synthesis genes, it possesses a prophage glucosylation cluster, which modifies the GlcNAc residue in an α-l-Rha-(1→3)-d-GlcNAc motif found in the original O16 antigen. Raoultella terrigena ATCC 33257 produces an O-antigen possessing the same disaccharide motif, but its assembly uses an ABC transporter-dependent system. E. coli harboring the R. terrigena O-antigen biosynthesis genes produced an O-antigen displaying reduced reactivity toward antisera raised against the native R. terrigena repeat structure, indicative of an altered chemical structure. Structural determination using NMR revealed the addition of glucose side chains to the repeat units. O-antigen modification was dependent on a functional ABC transporter, consistent with modification in the periplasm, and was eliminated by deletion of the glucosylation genes from the E. coli chromosome, restoring native level antisera sensitivity and structure. There are therefore no intrinsic mechanistic barriers for bacteriophage-mediated O-antigen glucosylation in ABC transporter-dependent pathways. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. A new strategy of high-speed screening and quantitative structure-activity relationship analysis to evaluate human ATP-binding cassette transporter ABCG2-drug interactions.


    Saito, Hikaru; Hirano, Hiroyuki; Nakagawa, Hiroshi; Fukami, Takeaki; Oosumi, Keisuke; Murakami, Kaori; Kimura, Hiroko; Kouchi, Takayuki; Konomi, Mami; Tao, Eriko; Tsujikawa, Noboru; Tarui, Shigeki; Nagakura, Makoto; Osumi, Masako; Ishikawa, Toshihisa


    The human ATP-binding cassette (ABC) transporter ABCG2 (BCRP/MXR1/ABCP) plays a critical role in cellular protection against xenobiotics as well as pharmacokinetics of drugs in our body. In the present study, we aimed to analyze the quantitative structure-activity relationship (QSAR) latently residing in ABCG2-drug interactions. We first established standard methods for expression of human ABCG2 in insect cells, quality control of plasma membrane samples by using electron microscopy techniques, and high-speed screening of ABCG2 inhibition with test compounds. Plasma membrane vesicles prepared from ABCG2-expressing Sf9 cells were used as a model system to measure the ATP-dependent transport of [3H]methotrexate (MTX). Forty-nine different therapeutic drugs and natural compounds were tested for their ability to inhibit ABCG2-mediated MTX transport. Based on their inhibition profiles, we performed QSAR analysis using chemical fragmentation codes deduced from the structures of test compounds. Multiple linear regression analysis delineated a relationship between the structural components and the extent of ABCG2 inhibition, allowing us to identify one set of structure-specific chemical fragmentation codes that are closely correlated with the inhibition of ABCG2 transport activity. Based on the QSAR analysis data, we predicted the potency of gefitinib to inhibit ABCG2. The validity of our QSAR-based prediction for gefitinib was examined by actual experiments. Our kinetic analysis experiments suggest that the ABCG2-ATP complex binds gefitinib. The present study provides a new strategy for analyzing ABCG2-drug interactions. This strategy is considered to be practical and useful for the molecular designing of new ABCG2 modulators.

  18. An ATP Binding Cassette Transporter Mediates the Uptake of α-(1,6)-Linked Dietary Oligosaccharides in Bifidobacterium and Correlates with Competitive Growth on These Substrates*

    PubMed Central

    Fredslund, Folmer; Vujičić Žagar, Andreja; Andersen, Thomas Lars; Svensson, Birte; Slotboom, Dirk Jan


    The molecular details and impact of oligosaccharide uptake by distinct human gut microbiota (HGM) are currently not well understood. Non-digestible dietary galacto- and gluco-α-(1,6)-oligosaccharides from legumes and starch, respectively, are preferentially fermented by mainly bifidobacteria and lactobacilli in the human gut. Here we show that the solute binding protein (BlG16BP) associated with an ATP binding cassette (ABC) transporter from the probiotic Bifidobacterium animalis subsp. lactis Bl-04 binds α-(1,6)-linked glucosides and galactosides of varying size, linkage, and monosaccharide composition with preference for the trisaccharides raffinose and panose. This preference is also reflected in the α-(1,6)-galactoside uptake profile of the bacterium. Structures of BlG16BP in complex with raffinose and panose revealed the basis for the remarkable ligand binding plasticity of BlG16BP, which recognizes the non-reducing α-(1,6)-diglycoside in its ligands. BlG16BP homologues occur predominantly in bifidobacteria and a few Firmicutes but lack in other HGMs. Among seven bifidobacterial taxa, only those possessing this transporter displayed growth on α-(1,6)-glycosides. Competition assays revealed that the dominant HGM commensal Bacteroides ovatus was out-competed by B. animalis subsp. lactis Bl-04 in mixed cultures growing on raffinose, the preferred ligand for the BlG16BP. By comparison, B. ovatus mono-cultures grew very efficiently on this trisaccharide. These findings suggest that the ABC-mediated uptake of raffinose provides an important competitive advantage, particularly against dominant Bacteroides that lack glycan-specific ABC-transporters. This novel insight highlights the role of glycan transport in defining the metabolic specialization of gut bacteria. PMID:27502277

  19. Functional interplay between the ATP binding cassette Msr(D) protein and the membrane facilitator superfamily Mef(E) transporter for macrolide resistance in Escherichia coli.


    Nunez-Samudio, Virginia; Chesneau, Olivier


    Macrolides have wide clinical applications in the treatment of community-acquired respiratory tract infections, among which streptococci are the most frequent causative agents. An active efflux-based mechanism of macrolide resistance, referred to as the M phenotype in streptococcal isolates, has been associated with the presence of mef genes that encode a subset of major facilitator superfamily (MFS) transporters like Mef(E). An msr(D) gene, adjacent to and co-transcribed with mef in the presence of erythromycin, has also been implicated in drug efflux, but its role remains elusive. Msr(D) belongs to the ATP binding cassette (ABC) proteins and harbors two fused nucleotide-binding domains with no membrane-spanning domains. The present work indicates that the major resistance traits of the M phenotype in Escherichia coli may be due to Msr(D) and not to Mef(E). Fluorescence microscopy using Mef(E) tagged with GFP linked low efficacy of the chimera in conferring macrolide resistance with improper subcellular localization. The active role of Msr(D) in directing Mef(E)-GFP to the cell poles was demonstrated, as was synergistic effect in terms of levels of resistance when both proteins were expressed. A trans-dominant negative mutation within ABC Msr(D) affecting MFS Mef(E) strongly suggests that both proteins can interact in vivo, and such a physical interaction was supported in vitro. This is the first reported example of a functional interplay between an ABC component and an MFS transporter. The direct involvement of Msr(D) in the efflux of macrolides remains to be demonstrated.

  20. Association of ATP-Binding Cassette Transporter A1 (ABCA1)-565 C/T Gene Polymorphism with Hypoalphalipoproteinemia and Serum Lipids, IL-6 and CRP Levels

    PubMed Central

    Babashamsi, Mohammad Mahdi; Halalkhor, Sohrab; Moradi Firouzjah, Hamid; Parsian, Hadi; Jalali, Seyed Farzad; Babashamsi, Mohammad


    Background: ATP-binding cassette transporter A1 (ABCA1) is a membrane integral protein which plays a vital role in High Density Lipoprotein (HDL) metabolism and exerts a protective effect against Hypoalphalipoproteinemia (HA) by mediation of rate-limiting step in HDL biogenesis. In addition, this protein possesses anti-inflammatory effects by inhibiting the production of some inflammatory cytokines in macrophages. This study investigated the association of ABCA1-565 C/T gene polymorphism with HA and serum lipids, IL-6 and CRP levels. Methods: A population which consisted of 101 HA and 95 normal subjects were genotyped for ABCA1-565C/T polymorphism by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP). The serum concentrations of lipids, IL-6 and high sensitive-CRP (hs-CRP) were measured by the relevant methods. Results: The frequency of T allele was significantly higher in the HA group than the controls (31.7 vs. 19.5%, p=0.002). Thus, carriers of the T allele (CT and TT genotypes) had a higher risk for HA (p=0.016, OR=2.04, 95% CI=1.14–3.63). T allele carriers demonstrated decreased HDL-C and increased triglyceride, IL-6 and CRP levels than those with the CC genotype. Conclusion: This study suggests that the-565 C/T polymorphism of ABCA1 gene is associated with an increased risk of HA, decreased HDL-C and increased TG, IL-6 and CRP. PMID:28090279

  1. ATP binding by the P-loop NTPase OsYchF1 (an unconventional G protein) contributes to biotic but not abiotic stress responses

    PubMed Central

    Cheung, Ming-Yan; Li, Xiaorong; Miao, Rui; Fong, Yu-Hang; Li, Kwan-Pok; Yung, Yuk-Lin; Yu, Mei-Hui; Wong, Kam-Bo; Lam, Hon-Ming


    G proteins are involved in almost all aspects of the cellular regulatory pathways through their ability to bind and hydrolyze GTP. The YchF subfamily, interestingly, possesses the unique ability to bind both ATP and GTP, and is possibly an ancestral form of G proteins based on phylogenetic studies and is present in all kingdoms of life. However, the biological significance of such a relaxed ligand specificity has long eluded researchers. Here, we have elucidated the different conformational changes caused by the binding of a YchF homolog in rice (OsYchF1) to ATP versus GTP by X-ray crystallography. Furthermore, by comparing the 3D relationships of the ligand position and the various amino acid residues at the binding sites in the crystal structures of the apo-bound and ligand-bound versions, a mechanism for the protein’s ability to bind both ligands is revealed. Mutation of the noncanonical G4 motif of the OsYchF1 to the canonical sequence for GTP specificity precludes the binding/hydrolysis of ATP and prevents OsYchF1 from functioning as a negative regulator of plant-defense responses, while retaining its ability to bind/hydrolyze GTP and its function as a negative regulator of abiotic stress responses, demonstrating the specific role of ATP-binding/hydrolysis in disease resistance. This discovery will have a significant impact on our understanding of the structure–function relationships of the YchF subfamily of G proteins in all kingdoms of life. PMID:26912459

  2. Seminal Plasma Characteristics and Expression of ATP-binding Cassette Transporter A1 (ABCA1) in Canine Spermatozoa from Ejaculates with Good and Bad Freezability.


    Schäfer-Somi, S; Palme, N


    The composition of seminal plasma and the localization of the ATP-binding cassette transporter A1 (ABCA1) in spermatozoa from good and bad freezers were compared to frozen-thawed spermatozoa from the same dog. Ejaculates were obtained from 31 stud dogs, and the sperm-rich fraction (SRF) was kept for analysis. One aliquot was used for the analysis of concentration, progressive motility (P; CASA), viability (V; CASA) and leucocyte count, and the analysis was performed by flow cytometry (FITC-PNA/PI), SCSA and HOST. In seminal plasma, concentration of albumin, cholesterol, calcium, inorganic phosphate, sodium, potassium, zinc and copper was measured. Semen smears were prepared and evaluated for the expression of ABCA1. The remainder of each ejaculate was frozen. After thawing, the quality assessment was repeated and further smears were prepared. According to post-thaw semen quality, dogs were assigned to good freezers (n = 20) or bad freezers (n = 11), the latter were defined as < 50% progressive motility and/or > 40% morphologically abnormal sperm and/or < 50% viability. Bad freezers were older than good freezers (5.3 vs 3.4 years, p < 0.05). In bad freezers, the percentage of sperm with ABCA1 signal in the acrosome was lower (26.3% vs 35.7%, p < 0.01) and the percentage of sperm with complete loss of ABCA1 signal higher (46.7% vs 30%, p < 0.01); the percentage of dead spermatozoa was higher (36.1% vs 25.5%, p < 0.05), and the concentration of cholesterol and sodium in seminal plasma was lower than in good freezers (p < 0.05). We conclude that in thawed bad freezer sperm, an increase in acrosome damages coincided with an increased loss of cholesterol transporters and cell death, and a lower cholesterol concentration in seminal plasma. Follow-up studies revealed whether a relation exists between these findings.

  3. Residues of a proposed gate region in type I ATP-binding cassette import systems are crucial for function as revealed by mutational analysis.


    Weidlich, Daniela; Wiesemann, Nicole; Heuveling, Johanna; Wardelmann, Kristina; Landmesser, Heidi; Sani, Katayoun Behnam; Worth, Catherine L; Preissner, Robert; Schneider, Erwin


    The type I ATP-binding cassette (ABC) importer for positively charged amino acids of the thermophilic bacterium Geobacillus stearothermophilus consists of the extracellular solute binding protein, ArtJ, and a homodimer each of the transmembrane subunit, ArtM, and the nucleotide-binding and -hydrolyzing subunit, ArtP. We have investigated the functional consequences of mutations affecting conserved residues from two peptide regions in ArtM, recently proposed to form a 'gate' by which access of a substrate to the translocation path is controlled (Hollenstein et al., 2007 [14]). Transporter variants were reconstituted into proteoliposomes and assayed for ArtJ/arginine-stimulated ATPase activity. Replacement of residues from region 1 (Arg-63, Pro-66) caused no or only moderate reduction in ATPase activity. In contrast, mutating residues from gate region 2 (Lys-159, Leu-163) resulted in a substantial increase in ATPase activity which, however, as demonstrated for variants ArtM(K159I) and ArtM(K159E), is not coupled to transport. Replacing homologous residues in the closely related histidine transporter of Salmonella enterica serovar Typhimurium (HisJ-QMP2) caused different phenotypes. Mutation to isoleucine of HisQ(K163) or HisM(H172), both homologous to ArtM(K159), abolished ATPase activity. The mutations most likely caused a structural change as revealed by limited proteolysis. In contrast, substantial, albeit reduced, enzymatic activity was observed with variants of HisQ(L167→G) or HisM(L176→G), both homologous to ArtM(L163). Our study provides the first experimental evidence in favor of a crucial role of residues from the proposed gate region in type I ABC importer function. Copyright © 2013 Elsevier B.V. All rights reserved.

  4. MicroRNA-144 regulates hepatic ATP binding cassette transporter A1 and plasma high-density lipoprotein after activation of the nuclear receptor farnesoid X receptor.


    de Aguiar Vallim, Thomas Q; Tarling, Elizabeth J; Kim, Tammy; Civelek, Mete; Baldán, Ángel; Esau, Christine; Edwards, Peter A


    The bile acid receptor farnesoid X receptor (FXR) regulates many aspects of lipid metabolism by variouscomplex and incompletely understood molecular mechanisms. We set out to investigate the molecular mechanisms for FXR-dependent regulation of lipid and lipoprotein metabolism. To identify FXR-regulated microRNAs that were subsequently involved in regulating lipid metabolism. ATP binding cassette transporter A1 (ABCA1) is a major determinant of plasma high-density lipoprotein (HDL)-cholesterol levels. Here, we show that activation of the nuclear receptor FXR in vivo increases hepatic levels of miR-144, which in turn lowers hepatic ABCA1 and plasma HDL levels. We identified 2 complementary sequences to miR-144 in the 3' untranslated region of ABCA1 mRNA that are necessary for miR-144-dependent regulation. Overexpression of miR-144 in vitro decreased both cellular ABCA1 protein and cholesterol efflux to lipid-poor apolipoprotein A-I protein, whereas overexpression in vivo reduced hepatic ABCA1 protein and plasma HDL-cholesterol. Conversely, silencing miR-144 in mice increased hepatic ABCA1 protein and HDL-cholesterol. In addition, we used tissue-specific FXR-deficient mice to show that induction of miR-144 and FXR-dependent hypolipidemia requires hepatic, but not intestinal, FXR. Finally, we identified functional FXR response elements upstream of the miR-144 locus, consistent with direct FXR regulation. We have identified a novel pathway involving FXR, miR-144, and ABCA1 that together regulate plasma HDL-cholesterol.

  5. Drug interaction between sunitinib and cimetidine and contribution of the efflux transporter ATP-binding cassette C2 to biliary excretion of sunitinib in rats.


    Arakawa-Todo, Maki; Ueyama, Jun; Nomura, Hiroshi; Abe, Fumie; Tsukiyama, Ikuto; Matsuura, Katsuhiko; Hasegawa, Takaaki


    The present study investigated the effect of the H2 antagonist cimetidine on the pharmacokinetics of a multi-targeted receptor tyrosine kinase (RTK) inhibitor, sunitinib, in Sprague-Dawley (SD) rats and Eisai hyperbilirubinemic mutant rats (EHBR) lacking the efflux transporter, ATP-binding cassette C2 protein (ABCC2). Rats received an intraperitoneal injection of cimetidine (10 mg/kg) once a day for three days. On day 4, sunitinib (3 mg/kg) was administered intravenously 30 min after the final injection of cimetidine or saline to SD rats. Disappearance of sunitinib from plasma was significantly delayed by cimetidine. The pharmacokinetic parameter of sunitinib, systemic clearance (CLSYS), was significantly reduced and the half-life was significantly prolonged, with no change in the volume of distribution at steady-state (VSS). When the effect of cimetidine on the biliary excretion of sunitinib at steady-state condition was investigated in SD rats, cimetidine had no effect on some transporter-mediated biliary excretion of sunitinib. Furthermore, the contribution of ABCC2 to the biliary excretion of sunitinib was also examined in SD rats and EHBR. The biliary clearance of sunitinib was significantly lower in EHBR, but the biliary excretion rate of EHBR was not different from that of SD rats, and the contribution of biliary excretion to systemic elimination was small, suggesting that sunitinib is mainly eliminated by cytochrome P450 3A4 (CYP3A4)-mediated metabolism and is not excreted into the bile via ABCC2. These findings indicate that co-administration of cimetidine alters the pharmacokinetics of sunitinib probably due to inhibition of CYP3A4, suggesting the possibility that cimetidine should be used carefully for patients with cancer being treated with sunitinib therapy.

  6. Human Immunodeficiency Virus Protease Inhibitors Interact with ATP Binding Cassette Transporter 4/Multidrug Resistance Protein 4: A Basis for Unanticipated Enhanced Cytotoxicity

    PubMed Central

    Fukuda, Yu; Takenaka, Kazumasa; Sparreboom, Alex; Cheepala, Satish B.; Wu, Chung-Pu; Ekins, Sean; Ambudkar, Suresh V.


    Human immunodeficiency virus (HIV) pharmacotherapy, by combining different drug classes such as nucleoside analogs and HIV protease inhibitors (PIs), has increased HIV-patient life expectancy. Consequently, among these patients, an increase in non-HIV–associated cancers has produced a patient cohort requiring both HIV and cancer chemotherapy. We hypothesized that multidrug resistance protein 4/ATP binding cassette transporter 4 (MRP4/ABCC4), a widely expressed transporter of nucleoside-based antiviral medications as well as cancer therapeutics might interact with PIs. Among the PIs evaluated (nelfinavir, ritonavir, amprenavir, saquinavir, and indinavir), only nelfinavir both effectively stimulated MRP4 ATPase activity and inhibited substrate-stimulated ATPase activity. Saos2 and human embryonic kidney 293 cells engineered to overexpress MRP4 were then used to assess transport and cytotoxicity. MRP4 expression reduced intracellular accumulation of nelfinavir and consequently conferred survival advantage to nelfinavir cytotoxicity. Nelfinavir blocked Mrp4-mediated export, which is consistent with its ability to increase the sensitivity of MRP4-expressing cells to methotrexate. In contrast, targeted inactivation of Abcc4/Mrp4 in mouse cells specifically enhanced nelfinavir and 9-(2-phosphonylmethoxyethyl) adenine cytotoxicity. These results suggest that nelfinavir is both an inhibitor and substrate of MRP4. Because nelfinavir is a new MRP4/ABCC4 substrate, we developed a MRP4/ABCC4 pharmacophore model, which showed that the nelfinavir binding site is shared with chemotherapeutic substrates such as adefovir and methotrexate. Our studies reveal, for the first time, that nelfinavir, a potent and cytotoxic PI, is both a substrate and inhibitor of MRP4. These findings suggest that HIV-infected cancer patients receiving nelfinavir might experience both enhanced antitumor efficacy and unexpected adverse toxicity given the role of MRP4/ABCC4 in exporting nucleoside

  7. ATP-binding Cassette (ABC) Transport System Solute-binding Protein-guided Identification of Novel d-Altritol and Galactitol Catabolic Pathways in Agrobacterium tumefaciens C58*

    PubMed Central

    Wichelecki, Daniel J.; Vetting, Matthew W.; Chou, Liyushang; Al-Obaidi, Nawar; Bouvier, Jason T.; Almo, Steven C.; Gerlt, John A.


    Innovations in the discovery of the functions of uncharacterized proteins/enzymes have become increasingly important as advances in sequencing technology flood protein databases with an exponentially growing number of open reading frames. This study documents one such innovation developed by the Enzyme Function Initiative (EFI; U54GM093342), the use of solute-binding proteins for transport systems to identify novel metabolic pathways. In a previous study, this strategy was applied to the tripartite ATP-independent periplasmic transporters. Here, we apply this strategy to the ATP-binding cassette transporters and report the discovery of novel catabolic pathways for d-altritol and galactitol in Agrobacterium tumefaciens C58. These efforts resulted in the description of three novel enzymatic reactions as follows: 1) oxidation of d-altritol to d-tagatose via a dehydrogenase in Pfam family PF00107, a previously unknown reaction; 2) phosphorylation of d-tagatose to d-tagatose 6-phosphate via a kinase in Pfam family PF00294, a previously orphan EC number; and 3) epimerization of d-tagatose 6-phosphate C-4 to d-fructose 6-phosphate via a member of Pfam family PF08013, another previously unknown reaction. The epimerization reaction catalyzed by a member of PF08013 is especially noteworthy, because the functions of members of PF08013 have been unknown. These discoveries were assisted by the following two synergistic bioinformatics web tools made available by the Enzyme Function Initiative: the EFI-Enzyme Similarity Tool and the EFI-Genome Neighborhood Tool. PMID:26472925

  8. Polycyclic aromatic hydrocarbons (PAHs) mediate transcriptional activation of the ATP binding cassette transporter ABCB6 gene via the aryl hydrocarbon receptor (AhR).


    Chavan, Hemantkumar; Krishnamurthy, Partha


    Liver is endowed with a mechanism to induce hepatic cytochromes P450 (CYP450s) in response to therapeutic drugs and environmental contaminants, leading to increased detoxification and elimination of the xenobiotics. Each CYP450 is composed of an apoprotein moiety and a heme prosthetic group, which is required for CYP450 activity. Thus, under conditions of CYP450 induction, there is a coordinate increase in heme biosynthesis to compensate for the increased expression of CYP450s. ABCB6, a mitochondrial ATP binding cassette transporter, which regulates coproporphyrinogen transport from the cytoplasm into the mitochondria to complete heme biosynthesis, represents a previously unrecognized rate-limiting step in heme biosynthesis. However, it is not known if exposure to drugs and environmental contaminants induces ABCB6 expression, to assure an adequate and apparently coordinated supply of heme for the generation of functional cytochrome holoprotein. In the present study, we demonstrate that polycyclic aromatic hydrocarbons (PAHs), the widely distributed environmental toxicants shown to induce porphyrin accumulation causing hepatic porphyria, up-regulate ABCB6 expression in both mice and humans. Using siRNA technology and Abcb6 knock-out mice, we demonstrate that PAH-mediated increase in hepatic porphyrins is compromised in the absence of ABCB6. Moreover, in vivo studies in aryl hydrocarbon receptor (AhR) knock-out mice demonstrate that PAH induction of ABCB6 is mediated by AhR. Promoter activation studies combined with electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrate direct interactions between the AhR binding sites in the ABCB6 promoter and the AhR receptor, implicating drug activation mechanisms for ABCB6 similar to those found in inducible cytochrome P450s. These studies are the first to describe direct transcriptional activation of both mouse and human ABCB6 by xenobiotics.

  9. A Mutation within the Extended X Loop Abolished Substrate-induced ATPase Activity of the Human Liver ATP-binding Cassette (ABC) Transporter MDR3*

    PubMed Central

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz


    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. PMID:25533467

  10. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.


    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz


    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain.

  11. Effects of silencing the ATP-binding cassette protein E1 gene by electroporation on the proliferation and migration of EC109 human esophageal cancer cells.


    Li, Xiao-Rui; Yang, Liu-Zhong; Huo, Xiao-Qing; Wang, Ying; Yang, Qing-Hui; Zhang, Qing-Qin


    In the present study, the gene expression of ATP-binding cassette protein E1 (ABCE1) in the EC109 human esophageal cancer cell line was silenced using electroporation to examine the effect if the ABCE1 gene on the growth migration and cell cycle of cancer cells. The small interference (si)RNA sequence of ABCE1 was designed and synthesized to transfect the EC109 cells by electroporation. The mRNA and protein expression levels of ABCE1 were then detected by reverse transcription quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The analysis of the cell cycle and apoptosis was performed using flow cytometry. The effect of silencing the ABCE1 gene on the proliferation, migration and invasive ability of the EC109 human esophageal cancer cells were assessed using a Cell counting kit-8 (CCK-8) and with proliferation, wound-healing and cell invasion assays. The mRNA and protein expression levels of ABCE1 were significantly lower in the experimental group compared with the control group (P<0.05). The apoptotic rate of the experimental group was markedly higher than the control group and blank group (P<0.01). The CCK-8 proliferation assay revealed that, compared with the control and blank groups, the proliferation of the EC109 cells in the experimental group was significantly inhibited (P<0.05). The wound healing assay revealed that the migration capacity of the cells in the experimental group was significantly decreased (P<0.05). The Transwell chamber assay demonstrated that the invasive ability of the EC109 cells in the experimental group was significantly decreased (P<0.01). These results revealed that ABCE1 is closely associated with cell proliferation, invasion and migration in esophageal cancer and silencing the ABCE1 gene by electroporation can significantly reduce the proliferation, invasion and migration capacity of EC109 cells in vitro.

  12. Effect of ATP-binding Cassette Transporter A1 (ABCA1) Gene Polymorphisms on Plasma Lipid Variables and Common Demographic Parameters in Greek Nurses

    PubMed Central

    Kolovou, Vana; Marvaki, Apostolia; Boutsikou, Maria; Vasilopoulos, Georgios; Degiannis, Dimitrios; Marvaki, Christina; Kolovou, Genovefa


    Objective: The present study is on line with our previous studies evaluating the influence of ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms on the lipid variables of Greek student-nurses. The current study was undertaken to (1) estimate the influence of variant(s) such as rs2066715 (V825I), R219K, R1587K, I883M of ABCA1 gene on lipid variables and (2) evaluate the effect of all four ABCA1 polymorphisms on common demographic parameters. Methods: The study population involved 432 unrelated nurses (86 men) who were genotyped for ABCA1 polymorphisms and correlated according to lipid variables [total cholesterol (TC), triglycerides (TGs), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and apolipoprotein (apo) A] and demographic parameters (age, gender, BMI, waist circumference). Results: According to lipid variables concentration there was no difference between genotypes and alleles of V825I, R219K and I883M polymorphisms. The LDL-C concentration was 13% lower in RR compared with RK genotype (100.7 vs. 113.9 mg/dl, p=0.013) of R1587K gene polymorphism. In regression analysis the effects of age, gender and only R1587K gene polymorphism on LDL-C concentrations were proved significant. Additionally, LDL-C was increased (by 1.29 mg/dl on average) by every year of increase of age. Moreover, females had lower LDL-C concentrations as compared with males. Conclusion: Findings suggested that only R1587K polymorphism of ABCA1 gene was associated with lipid variables, age, and gender of Greek nurses. These findings may be helpful in assessing the risk factors for premature coronary heart disease and distinct individuals with lower/higher atherosclerotic burden. PMID:27990182

  13. Mutant Allele-Specific Uncoupling of PENETRATION3 Functions Reveals Engagement of the ATP-Binding Cassette Transporter in Distinct Tryptophan Metabolic Pathways1[OPEN

    PubMed Central

    Lu, Xunli; Dittgen, Jan; Piślewska-Bednarek, Mariola; Molina, Antonio; Schneider, Bernd; Doubský, Jan; Schneeberger, Korbinian; Schulze-Lefert, Paul


    Arabidopsis (Arabidopsis thaliana) PENETRATION (PEN) genes quantitatively contribute to the execution of different forms of plant immunity upon challenge with diverse leaf pathogens. PEN3 encodes a plasma membrane-resident pleiotropic drug resistance-type ATP-binding cassette transporter and is thought to act in a pathogen-inducible and PEN2 myrosinase-dependent metabolic pathway in extracellular defense. This metabolic pathway directs the intracellular biosynthesis and activation of tryptophan-derived indole glucosinolates for subsequent PEN3-mediated efflux across the plasma membrane at pathogen contact sites. However, PEN3 also functions in abiotic stress responses to cadmium and indole-3-butyric acid (IBA)-mediated auxin homeostasis in roots, raising the possibility that PEN3 exports multiple functionally unrelated substrates. Here, we describe the isolation of a pen3 allele, designated pen3-5, that encodes a dysfunctional protein that accumulates in planta like wild-type PEN3. The specific mutation in pen3-5 uncouples PEN3 functions in IBA-stimulated root growth modulation, callose deposition induced with a conserved peptide epitope of bacterial flagellin (flg22), and pathogen-inducible salicylic acid accumulation from PEN3 activity in extracellular defense, indicating the engagement of multiple PEN3 substrates in different PEN3-dependent biological processes. We identified 4-O-β-d-glucosyl-indol-3-yl formamide (4OGlcI3F) as a pathogen-inducible, tryptophan-derived compound that overaccumulates in pen3 leaf tissue and has biosynthesis that is dependent on an intact PEN2 metabolic pathway. We propose that a precursor of 4OGlcI3F is the PEN3 substrate in extracellular pathogen defense. These precursors, the shared indole core present in IBA and 4OGlcI3F, and allele-specific uncoupling of a subset of PEN3 functions suggest that PEN3 transports distinct indole-type metabolites in distinct biological processes. PMID:26023163

  14. MicroRNA-20a/b regulates cholesterol efflux through post-transcriptional repression of ATP-binding cassette transporter A1.


    Liang, Bin; Wang, Xin; Song, Xiaosu; Bai, Rui; Yang, Huiyu; Yang, Zhiming; Xiao, Chuanshi; Bian, Yunfei


    ATP-binding cassette transporter A1 (ABCA1) plays a crucial role in reverse cholesterol transport and exhibits anti-atherosclerosis effects. Some microRNAs (miRs) regulate ABCA1 expression, and recent studies have shown that miR-20a/b might play a critical role in atherosclerotic diseases. Here, we attempted to clarify the potential contribution of miR-20a/b in post-transcriptional regulation of ABCA1, cholesterol efflux, and atherosclerosis. We performed bioinformatics analysis and found that miR-20a/b was highly conserved and directly bound to ABCA1 mRNA with low binding free energy. Luciferase-reporter assay also confirmed that miR-20a/b significantly reduced luciferase activity associated with the ABCA1 3' untranslated region reporter construct. Additionally, miR-20a/b decreased ABCA1 expression, which, in turn, decreased cholesterol efflux and increased cholesterol content in THP-1 and RAW 264.7 macrophage-derived foam cells. In contrast, miR-20a/b inhibitors increased ABCA1 expression and cholesterol efflux, decreased cholesterol content, and inhibited foam-cell formation. Consistent with our in vitro results, miR-20a/b-treated ApoE(-/-) mice showed decreased ABCA1expression in the liver and reductions of reverse cholesterol transport in vivo. Furthermore, miR-20a/b regulated the formation of nascent high-density lipoprotein and promoted atherosclerotic development, whereas miR-20a/b knockdown attenuated atherosclerotic formation. miR-20 is a new miRNA capable of targeting ABCA1 and regulating ABCA1 expression. Therefore, miR-20 inhibition constitutes a new strategy for ABCA1-based treatment of atherosclerosis. Copyright © 2017 Elsevier B.V. All rights reserved.

  15. Evaluation of the in vitro expression of ATP binding-cassette (ABC) proteins in an Ixodes ricinus cell line exposed to ivermectin.


    Mangia, Carlo; Vismarra, Alice; Kramer, Laura; Bell-Sakyi, Lesley; Porretta, Daniele; Otranto, Domenico; Epis, Sara; Grandi, Giulio


    Ticks are among the most important vectors of pathogens causing human and animal disease. Acaricides are used to control tick infestation, although there are increasing reports of resistance. Recently, over-expression of ATP-binding cassette (ABC) transporter proteins (P-glycoproteins, PgP) has been implicated in resistance to the acaricide ivermectin in the ticks Rhipicephalus (Boophilus) microplus and Rhipicephalus sanguineus sensu lato. Ixodid tick cell lines have been used to investigate drug resistance mechanisms. The aim of the present study was to evaluate expression of several PgPs in the Ixodes ricinus-derived cell line IRE/CTVM19 and to determine modulation of expression following treatment with ivermectin. IRE/CTVM19 cells were treated with different concentrations of ivermectin (0, 11, 22 or 33 μM) and incubated for 10 days. Evaluation of viability and relative expression of ABCB1, ABCB6, ABCB8 and ABCB10 genes were carried out at day 10 post treatment. Cell viability ranged between 84% and 92% with no significant differences between untreated and treated cells. qRT-PCR showed that ABC pump expression was not significantly modulated by ivermectin treatment. Expression of the ABCB8 PgP subfamily revealed a biphasic trend, based on the ivermectin concentration. ABCB6 and ABCB10 gene expression was not modulated by ivermectin treatment and ABCB1 expression was not detected. This is the first report of PgP expression in an I. ricinus-derived tick cell line. Development of an in vitro model for the study of acaricide resistance mechanisms would greatly facilitate screening for drug resistance in ticks.

  16. Detoxification of ivermectin by ATP binding cassette transporter C4 and cytochrome P450 monooxygenase 6CJ1 in the human body louse, Pediculus humanus humanus.


    Kim, J H; Gellatly, K J; Lueke, B; Kohler, M; Nauen, R; Murenzi, E; Yoon, K S; Clark, J M


    We previously observed that ivermectin-induced detoxification genes, including ATP binding cassette transporter C4 (PhABCC4) and cytochrome P450 6CJ1 (CYP6CJ1) were identified from body lice following a brief exposure to a sublethal dose of ivermectin using a non-invasive induction assay. In this current study, the functional properties of PhABCC4 and CYP6CJ1 were investigated after expression in either X. laevis oocytes or using a baculovirus expression system, respectively. Efflux of [(3) H]-9-(2-phosphonomethoxyethyl) adenine ([(3) H]-PMEA), a known ABCC4 substrate in humans, was detected from PhABCC4 cRNA-injected oocytes by liquid scintillation spectrophotometric analysis and PhABCC4 expression in oocytes was confirmed using ABC transporter inhibitors. Efflux was also determined to be ATP-dependent. Using a variety of insecticides in a competition assay, only co-injection of ivermectin and dichlorodiphenyltrichloroethane led to decreased efflux of [(3) H]-PMEA. PhABCC4-expressing oocytes also directly effluxed [(3) H]-ivermectin, which increased over time. In addition, ivermectin appeared to be oxidatively metabolized and/or sequestered, although at low levels, following functional expression of CYP6CJ1 along with cytochrome P450 reductase in Sf9 cells. Our study suggests that PhABCC4 and perhaps CYP6CJ1 are involved in the Phase III and Phase I xenobiotic metabolism of ivermectin, respectively, and may play an important role in the evolution of ivermectin resistance in lice and other insects as field selection occurs. © 2017 The Royal Entomological Society.

  17. Reduced platelet count, but no major platelet function abnormalities, are associated with loss-of-function ATP-binding cassette-1 gene mutations.


    Minuz, Pietro; Meneguzzi, Alessandra; Femia, Eti Alessandra; Fava, Cristiano; Calabria, Stefano; Scavone, Mariangela; Benati, Donatella; Poli, Giovanni; Zancanaro, Carlo; Calandra, Sebastiano; Lucchi, Tiziano; Cattaneo, Marco


    Loss-of-function mutations of the the ATP-binding cassette-1 (ABCA1) gene are the cause of Tangier disease (TD) in homozygous subjects and familial HDL deficiency (FHD) in heterozygous subjects. These disorders are characterized by reduced plasma HDL-cholesterol (HDL-C) and altered efflux of cholesterol from cells. Previous studies in TD patients and ABCA1(-/-) murine models reported defects in platelet count, morphology, and function, but the issue is still controversial. We analyzed three subjects with low to very low HDL-C levels due to the loss-of-function mutations of the ABCA1 gene. Two related patients with FHD were heterozygous carriers of two mutations on the same ABCA1 allele; one, with TD, was homozygous for a different mutation. Mild to moderate thrombocytopenia was observed in all the patients. No morphological platelet abnormalities were detected under optical or EM. History of moderate bleeding tendency was recorded only in one of the FHD patients. Only limited alterations in platelet aggregation and activation of the integrin αIIbβ3 were observed in one FHD patient. While α-granule secretion (P-selectin), content, and secretion of platelet δ-granules (serotonin, ATP, and ADP) and thromboxane (TX) A2 synthesis were normal in all the patients, the expression of lysosomal CD63, in response to some agonists, was reduced in TD patients. In conclusion, three patients carrying ABCA1 genetic variants had low platelet count, with the lowest values observed in TD, not associated with major alterations in platelet morphology and response to agonists or bleeding. © 2017 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

  18. Functional and Structural Characterization of Polysaccharide Co-polymerase Proteins Required for Polymer Export in ATP-binding Cassette Transporter-dependent Capsule Biosynthesis Pathways*

    PubMed Central

    Larue, Kane; Ford, Robert C.; Willis, Lisa M.; Whitfield, Chris


    Neisseria meningitidis serogroup B and Escherichia coli K1 bacteria produce a capsular polysaccharide (CPS) that is composed of α2,8-linked polysialic acid (PSA). Biosynthesis of PSA in these bacteria occurs via an ABC (ATP-binding cassette) transporter-dependent pathway. In N. meningitidis, export of PSA to the surface of the bacterium requires two proteins that form an ABC transporter (CtrC and CtrD) and two additional proteins, CtrA and CtrB, that are proposed to form a cell envelope-spanning export complex. CtrA is a member of the outer membrane polysaccharide export (OPX) family of proteins, which are proposed to form a pore to mediate export of CPSs across the outer membrane. CtrB is an inner membrane protein belonging to the polysaccharide co-polymerase (PCP) family. PCP proteins involved in other bacterial polysaccharide assembly systems form structures that extend into the periplasm from the inner membrane. There is currently no structural information available for PCP or OPX proteins involved in an ABC transporter-dependent CPS biosynthesis pathway to support their proposed roles in polysaccharide export. Here, we report cryo-EM images of purified CtrB reconstituted into lipid bilayers. These images contained molecular top and side views of CtrB and showed that it formed a conical oligomer that extended ∼125 Å from the membrane. This structure is consistent with CtrB functioning as a component of an envelope-spanning complex. Cross-complementation of CtrA and CtrB in E. coli mutants with defects in genes encoding the corresponding PCP and OPX proteins show that PCP-OPX pairs require interactions with their cognate partners to export polysaccharide. These experiments add further support for the model of an ABC transporter-PCP-OPX multiprotein complex that functions to export CPS across the cell envelope. PMID:21454677

  19. The ATP-binding cassette transporter-2 (ABCA2) regulates cholesterol homeostasis and low-density lipoprotein receptor metabolism in N2a neuroblastoma cells.


    Davis, Warren


    The ATP-binding cassette transporter-2 (ABCA2) has been identified as a possible regulator of lipid metabolism. ABCA2 is most highly expressed in the brain but its effects on cholesterol homeostasis in neuronal-type cells have not been characterized. It is important to study the role of ABCA2 in regulating cholesterol homeostasis in neuronal-type cells because ABCA2 has been identified as a possible genetic risk factor for Alzheimer's disease. In this study, the effects of ABCA2 expression on cholesterol homeostasis were examined in mouse N2a neuroblastoma cells. ABCA2 reduced total, free- and esterified cholesterol levels as well as membrane cholesterol but did not perturb cholesterol distribution in organelle or lipid raft compartments. ABCA2 did not modulate de novo cholesterol biosynthesis from acetate. Cholesterol trafficking to the plasma membrane was not affected by ABCA2 but efflux to the physiological acceptor ApoE3 and mobilization of plasma membrane cholesterol to the endoplasmic reticulum for esterification were reduced by ABCA2. ABCA2 reduced esterification of serum and low-density lipoprotein-derived cholesterol but not 25-hydroxycholesterol. ABCA2 decreased low-density lipoprotein receptor (LDLR) mRNA and protein levels and increased its turnover rate. The surface expression of LDLR as well as the uptake of fluroresecent DiI-LDL was also reduced by ABCA2. Reduction of endogenous ABCA2 expression by RNAi treatment of N2a cells and rat primary cortical neurons produced the opposite effects of over-expression of ABCA2, increasing LDLR protein levels. This report identifies ABCA2 as a key regulator of cholesterol homeostasis and LDLR metabolism in neuronal cells.

  20. The Myxococcus xanthus rfbABC operon encodes an ATP-binding cassette transporter homolog required for O-antigen biosynthesis and multicellular development.

    PubMed Central

    Guo, D; Bowden, M G; Pershad, R; Kaplan, H B


    A wild-type sasA locus is critical for Myxococcus xanthus multicellular development. Mutations in the sasA locus cause defective fruiting body formation, reduce sporulation, and restore developmental expression of the early A-signal-dependent gene 4521 in the absence of A signal. The wild-type sasA locus has been located on a 14-kb cloned fragment of the M. xanthus chromosome. The nucleotide sequence of a 7-kb region containing the complete sasA locus was determined. Three open reading frames encoded by the genes, designated rfbA, B and C were identified. The deduced amino acid sequences of rfbA and rfbB show identity to the integral membrane domains and ATPase domains, respectively, of the ATP-binding cassette (ABC) transporter family. The highest identities are to a set of predicted ABC transporters required for the biosynthesis of lipopolysaccharide O-antigen in certain gram-negative bacteria. The rfbC gene encodes a predicted protein of 1,276 amino acids. This predicted protein contains a region of 358 amino acids that is 33.8% identical to the Yersinia enterocolitica O3 rfbH gene product, which is also required for O-antigen biosynthesis. Immunoblot analysis revealed that the sasA1 mutant, which was found to encode a nonsense codon in the beginning of rfbA, produced less O-antigen than sasA+ strains. These data indicate that the sasA locus is required for the biosynthesis of O-antigen and, when mutated, results in A-signal-independent expression of 4521. PMID:8626291

  1. Association of ATP-Binding Cassette Transporter (ABC) Gene Polymorphisms with Viral Load in Patients with Genotype 1 Hepatitis C Virus Infection.


    Chen, Long; Rao, Huiying; Zhang, Wei; Liu, Feng; Jiang, Dong; Wei, Lai


    ATP-binding cassette transporters (ABC) gene polymorphisms are associated with various biological functions, including hepatitis C virus (HCV) infection. This study aims to explore the impact of ABC transporters polymorphisms on HCV viral load in chronic treatment-naïve hepatitis C patients. We recruited 347 Chinese Han patients chronically infected with genotype 1 HCV in this study. Ten single nucleotide polymorphism (SNPs) in ABCA1, ABCB5, ABCB11, ABCG2, ABCG5, ABCG10 were analyzed by custom chip from Illumina. Allele frequency analysis and genotype frequency analysis were performed. Patients were categorized according to pretreatment HCV viral load (VL) with a cutoff level 600 000 IU/mL. No significant variations on gender and age were observed in the two groups. G allele of rs3890182 and C allele of rs1883025 in ABCA1 gene were significantly associated with lower HCV viral load (p = 0.013 and p = 0.006) in allele frequency analysis. GG genotype of rs3890182 and CC genotype of rs1883025 in ABCA1 gene