Science.gov

Sample records for large t-antigen atp-binding

  1. Consensus topography in the ATP binding site of the simian virus 40 and polyomavirus large tumor antigens

    SciTech Connect

    Bradley, M.K.; Smith, T.F.; Lathrop, R.H.; Livingston, D.M.; Webster, T.A.

    1987-06-01

    The location and sequence composition of a consensus element of the nucleotide binding site in both simian virus 40 (SV40) and polyomavirus (PyV) large tumor antigens (T antigens) can be predicted with the assistance of a computer-based pattern-matching system, ARIADNE. The latter was used to optimally align elements of T antigen primary sequence and predicted secondary structure with a descriptor for a mononucleotide binding fold. Additional consensus elements of the nucleotide binding site in these two proteins were derived from comparisons of T antigen primary and predicted secondary structures with x-ray structures of the nucleotide binding sites in four otherwise unrelated proteins. Each of these elements was predicted to be encompassed within a 110-residue segment that is highly conserved between the two T antigens residues 418-528 in SV 40 T antigen and residues 565-675 in PyV. Results of biochemical and immunologic experiments on the nucleotide binding behavior of these proteins using (/sup 32/P)-Amp-labeled SV40 T antigen, were found to be consistent with these predictions. Taken together, the latter have resulted in a topological model of the ATP binding site in these two oncogene products.

  2. A Computational Analysis of ATP Binding of SV40 Large Tumor Antigen Helicase Motor

    PubMed Central

    Shi, Yemin; Liu, Hanbin; Gai, Dahai; Ma, Jianpeng; Chen, Xiaojiang S.

    2009-01-01

    Simian Virus 40 Large Tumor Antigen (LTag) is an efficient helicase motor that unwinds and translocates DNA. The DNA unwinding and translocation of LTag is powered by ATP binding and hydrolysis at the nucleotide pocket between two adjacent subunits of an LTag hexamer. Based on the set of high-resolution hexameric structures of LTag helicase in different nucleotide binding states, we simulated a conformational transition pathway of the ATP binding process using the targeted molecular dynamics method and calculated the corresponding energy profile using the linear response approximation (LRA) version of the semi-macroscopic Protein Dipoles Langevin Dipoles method (PDLD/S). The simulation results suggest a three-step process for the ATP binding from the initial interaction to the final tight binding at the nucleotide pocket, in which ATP is eventually “locked” by three pairs of charge-charge interactions across the pocket. Such a “cross-locking” ATP binding process is similar to the binding zipper model reported for the F1-ATPase hexameric motor. The simulation also shows a transition mechanism of Mg2+ coordination to form the Mg-ATP complex during ATP binding, which is accompanied by the large conformational changes of LTag. This simulation study of the ATP binding process to an LTag and the accompanying conformational changes in the context of a hexamer leads to a refined cooperative iris model that has been proposed previously. PMID:19779548

  3. Mapping of phosphorylation sites in polyomavirus large T antigen

    SciTech Connect

    Hassauer, M.; Scheidtmann, K.H.; Walter, G.

    1986-06-01

    The phosphorylation sites of polyomavirus large T antigen from infected or transformed cells were investigated. Tryptic digestion of large T antigen from infected, /sup 32/P/sub i/-labeled cells revealed seven major phosphopeptides. Five of these were phosphorylated only at serine residues, and two were phosphorylated at serine and threonine residues. The overall ratio of phosphoserine to phosphothreonine was 6:1. The transformed cell line B4 expressed two polyomavirus-specific phosphoproteins: large T antigen, which was only weakly phosphorylated, and a truncated form of large T antigen of 34,000 molecular weight which was heavily phosphorylated. Both showed phosphorylation patterns similar to that of large T antigen from infected cells. Peptide analyses of large T antigens encoded by the deletion mutants dl8 and dl23 or of specific fragments of wild-type large T antigen indicated that the phosphorylation sites are located in an amino-terminal region upstream of residue 194. The amino acid composition of the phosphopeptides as revealed by differential labeling with various amino acids indicated that several phosphopeptides contain overlapping sequences and that all phosphorylation sites are located in four tryptic peptides derived from a region between Met71 and Arg191. Two of the potential phosphorylation sites were identified as Ser81 and Thr187. The possible role of this modification of large T antigen is discussed.

  4. Nuclear localization of Merkel cell polyomavirus large T antigen in Merkel cell carcinoma

    SciTech Connect

    Nakamura, Tomoyuki; Sato, Yuko; Watanabe, Daisuke; Ito, Hideki; Shimonohara, Nozomi; Tsuji, Takahiro; Nakajima, Noriko; Suzuki, Yoshio; Matsuo, Koma; Nakagawa, Hidemi; Sata, Tetsutaro; Katano, Harutaka

    2010-03-15

    To clarify whether mutations in the large T gene encoded by Merkel cell polyomavirus affect the expression and function of large T antigen in Merkel cell carcinoma cases, we investigated the expression of large T antigen in vitro and in vivo. Immunohistochemistry using a rabbit polyclonal antibody revealed that large T antigen was expressed in the nuclei of Merkel cell carcinoma cells with Merkel cell polyomavirus infection. Deletion mutant analyses identified an Arg-Lys-Arg-Lys sequence (amino acids 277-280) as a nuclear localization signal in large T antigen. Sequence analyses revealed that there were no mutations in the nuclear localization signal in any of the eleven Merkel cell polyomavirus strains examined. Furthermore, stop codons were not observed in the upstream of the nuclear localization signal in any of the Merkel cell carcinoma cases examined. These data suggest that the nuclear localization signal is highly conserved and functional in Merkel cell carcinoma cases.

  5. Specific Antibodies Reacting with SV40 Large T Antigen Mimotopes in Serum Samples of Healthy Subjects

    PubMed Central

    Tognon, Mauro; Corallini, Alfredo; Manfrini, Marco; Taronna, Angelo; Butel, Janet S.; Pietrobon, Silvia; Trevisiol, Lorenzo; Bononi, Ilaria; Vaccher, Emanuela; Barbanti-Brodano, Giuseppe; Martini, Fernanda; Mazzoni, Elisa

    2016-01-01

    Simian Virus 40, experimentally assayed in vitro in different animal and human cells and in vivo in rodents, was classified as a small DNA tumor virus. In previous studies, many groups identified Simian Virus 40 sequences in healthy individuals and cancer patients using PCR techniques, whereas others failed to detect the viral sequences in human specimens. These conflicting results prompted us to develop a novel indirect ELISA with synthetic peptides, mimicking Simian Virus 40 capsid viral protein antigens, named mimotopes. This immunologic assay allowed us to investigate the presence of serum antibodies against Simian Virus 40 and to verify whether Simian Virus 40 is circulating in humans. In this investigation two mimotopes from Simian Virus 40 large T antigen, the viral replication protein and oncoprotein, were employed to analyze for specific reactions to human sera antibodies. This indirect ELISA with synthetic peptides from Simian Virus 40 large T antigen was used to assay a new collection of serum samples from healthy subjects. This novel assay revealed that serum antibodies against Simian Virus 40 large T antigen mimotopes are detectable, at low titer, in healthy subjects aged from 18–65 years old. The overall prevalence of reactivity with the two Simian Virus 40 large T antigen peptides was 20%. This new ELISA with two mimotopes of the early viral regions is able to detect in a specific manner Simian Virus 40 large T antigen-antibody responses. PMID:26731525

  6. Specific Antibodies Reacting with SV40 Large T Antigen Mimotopes in Serum Samples of Healthy Subjects.

    PubMed

    Tognon, Mauro; Corallini, Alfredo; Manfrini, Marco; Taronna, Angelo; Butel, Janet S; Pietrobon, Silvia; Trevisiol, Lorenzo; Bononi, Ilaria; Vaccher, Emanuela; Barbanti-Brodano, Giuseppe; Martini, Fernanda; Mazzoni, Elisa

    2016-01-01

    Simian Virus 40, experimentally assayed in vitro in different animal and human cells and in vivo in rodents, was classified as a small DNA tumor virus. In previous studies, many groups identified Simian Virus 40 sequences in healthy individuals and cancer patients using PCR techniques, whereas others failed to detect the viral sequences in human specimens. These conflicting results prompted us to develop a novel indirect ELISA with synthetic peptides, mimicking Simian Virus 40 capsid viral protein antigens, named mimotopes. This immunologic assay allowed us to investigate the presence of serum antibodies against Simian Virus 40 and to verify whether Simian Virus 40 is circulating in humans. In this investigation two mimotopes from Simian Virus 40 large T antigen, the viral replication protein and oncoprotein, were employed to analyze for specific reactions to human sera antibodies. This indirect ELISA with synthetic peptides from Simian Virus 40 large T antigen was used to assay a new collection of serum samples from healthy subjects. This novel assay revealed that serum antibodies against Simian Virus 40 large T antigen mimotopes are detectable, at low titer, in healthy subjects aged from 18-65 years old. The overall prevalence of reactivity with the two Simian Virus 40 large T antigen peptides was 20%. This new ELISA with two mimotopes of the early viral regions is able to detect in a specific manner Simian Virus 40 large T antigen-antibody responses.

  7. BK Polyomavirus Genomic Integration and Large T Antigen Expression: Evolving Paradigms in Human Oncogenesis.

    PubMed

    Kenan, D J; Mieczkowski, P A; Latulippe, E; Côté, I; Singh, H K; Nickeleit, V

    2016-12-31

    Human polyomaviruses are ubiquitous, with primary infections that typically occur during childhood and subsequent latency that may last a lifetime. Polyomavirus-mediated disease has been described in immunocompromised patients; its relationship to oncogenesis is poorly understood. We present deep sequencing data from a high-grade BK virus-associated tumor expressing large T antigen. The carcinoma arose in a kidney allograft 6 years after transplantation. We identified a novel genotype 1a BK polyomavirus, called Chapel Hill BK polyomavirus 2 (CH-2), that was integrated into the BRE gene in chromosome 2 of tumor cells. At the chromosomal integration site, viral break points were found, disrupting late BK gene sequences encoding capsid proteins VP1 and VP2/3. Immunohistochemistry and in situ hybridization studies demonstrated that the integrated BK virus was replication incompetent. We propose that the BK virus CH-2 was integrated into the human genome as a concatemer, resulting in alterations of feedback loops and overexpression of large T antigen. Collectively, these findings support the emerging understanding that viral integration is a nearly ubiquitous feature in polyomavirus-associated malignancy and that unregulated large T antigen expression drives a proliferative state that is conducive to oncogenesis. Based on the current observations, we present an updated model of polyomavirus-mediated oncogenesis.

  8. Crystal structure of the simian virus 40 large T-antigen origin-binding domain.

    PubMed

    Meinke, Gretchen; Bullock, Peter A; Bohm, Andrew

    2006-05-01

    The origins of replication of DNA tumor viruses have a highly conserved feature, namely, multiple binding sites for their respective initiator proteins arranged as inverted repeats. In the 1.45-angstroms crystal structure of the simian virus 40 large T-antigen (T-ag) origin-binding domain (obd) reported herein, T-ag obd monomers form a left-handed spiral with an inner channel of 30 angstroms having six monomers per turn. The inner surface of the spiral is positively charged and includes residues known to bind DNA. Residues implicated in hexamerization of full-length T-ag are located at the interface between adjacent T-ag obd monomers. These data provide a high-resolution model of the hexamer of origin-binding domains observed in electron microscopy studies and allow the obd's to be oriented relative to the hexamer of T-ag helicase domains to which they are connected.

  9. Crystal Structure of the Simian Virus 40 Large T-Antigen Origin-Binding Domain

    SciTech Connect

    Meinke,G.; Bullock, P.; Bohm, A.

    2006-01-01

    The origins of replication of DNA tumor viruses have a highly conserved feature, namely, multiple binding sites for their respective initiator proteins arranged as inverted repeats. In the 1.45- Angstroms crystal structure of the simian virus 40 large T-antigen (T-ag) origin-binding domain (obd) reported herein, T-ag obd monomers form a left-handed spiral with an inner channel of 30 Angstroms having six monomers per turn. The inner surface of the spiral is positively charged and includes residues known to bind DNA. Residues implicated in hexamerization of full-length T-ag are located at the interface between adjacent T-ag obd monomers. These data provide a high-resolution model of the hexamer of origin-binding domains observed in electron microscopy studies and allow the obd's to be oriented relative to the hexamer of T-ag helicase domains to which they are connected.

  10. Improved localization of phosphorylation sites in simian virus 40 large T antigen.

    PubMed Central

    van Roy, F; Fransen, L; Fiers, W

    1983-01-01

    The location of phosphorylation sites in the large T antigen of simian virus 40 has been studied both by partial chemical cleavage and by partial proteolysis of various forms of large T. These included the full-size wild-type molecule with an apparent molecular weight of 88,000, deleted molecules coded for by the mutants dl1265 and dl1263, and several shortened derivatives generated by the action of a cellular protease. These molecules differed from each other by variations in the carboxy-terminal end. In contrast, a ubiquitous but minor large T form with a molecular weight of 91,000 was found to be modified in the amino-terminal half of the molecule. In addition to the phosphorylation of threonine at position 701 (K.-H. Scheidtmann et al., J. Virol. 38:59-69, 1981), two other discrete domains of phosphorylation were recognized, one at either side of the molecule. The amino-terminal region was located between positions 81 and 124 and contained both phosphothreonine and phosphoserine residues. The carboxy-terminal region was located between approximate positions 500 and 640 and contained at least one phosphoserine residue but no phosphothreonine. The presence in the phosphorylated domains of large T of known recognition sequences for different types of protein kinases is discussed, together with possible functions of large T associated with these domains. Images PMID:6296439

  11. A model for primitive neuroectodermal tumors in transgenic neural transplants harboring the SV40 large T antigen.

    PubMed Central

    Eibl, R. H.; Kleihues, P.; Jat, P. S.; Wiestler, O. D.

    1994-01-01

    Using retrovirus-mediated transfer of the SV40 virus large T antigen into neural transplants, we have observed a high incidence of primitive neuroectodermal tumors (PNET). These neoplasms developed in 8 of 14 (57%) neural grafts after latency periods of 176 to 311 days. Histopathologically, the tumors exhibited features of human PNET such as formation of neuroblastic rosettes and immunocytochemical evidence for neuronal differentiation, synaptogenesis, and focal astrocytic differentiation. All neoplasms showed a striking migratory potential. The presence of the large T gene in the tumors was demonstrated by polymerase chain reaction-mediated amplification of a specific 242 bp segment of large T and DNA sequence analysis. Large T antigen was identified in tissue sections using an immunocytochemical reaction with the monoclonal antibody Pab 108. Cell lines were established from several tumors and subjected to G418 selection. Secondary tumors induced by intracerebral transplantation of these cells retained the characteristic morphological and immunocytochemical properties of PNETs. These experiments demonstrate a considerable transforming potential of SV40 large T antigen for neural precursor cells. The long latency period suggests that neoplastic transformation initiated by the large T gene requires additional spontaneous mutations of cooperating cellular genes. Because the mechanism of transformation by large T antigen appears to involve complex formation with and inactivation of cellular tumor suppressor gene products, these cell lines may serve as an interesting tool to search for novel neural tumor suppressor genes. Images Figure 1 Figure 2 Figure 3 Figure 4 Figure 5 PMID:8129041

  12. In vitro transformation of Li-Fraumeni syndrome fibroblasts by SV40 large T antigen mutants.

    PubMed

    Maclean, K; Rogan, E M; Whitaker, N J; Chang, A C; Rowe, P B; Dalla-Pozza, L; Symonds, G; Reddel, R R

    1994-03-01

    Transfection of SV40 early region DNA into normal human diploid fibroblasts (NHDFs) increases their proliferative potential to a limited extent. We have investigated the roles of the SV40 large T antigen (LTAg) regions responsible for binding to the protein products of the retinoblastoma (Rb) and p53 genes in this temporary escape from senescence. Patients encoding LTAg mutants were transfected into NHDFs and into Li-Fraumeni syndrome (LFS) fibroblasts which are heterozygous wild-type (wt)/null-mutant for p53. A LTAg mutated in the p53-binding region (T402DE) had greatly reduced efficiency of focus formation, and a p110Rb-binding mutant was unable to induce any foci. T402DE-induced NHDF foci senesced at the same time as untransfected cells, but the equivalent LFS foci all had increased proliferative potentials, with the greatest increase being seen in clones that lost the wt p53 allele. One LFS clone expressed the T402DE mutant during focus formation, but later lost both the T402DE DNA and the wt p53 allele. We conclude that SV40-induced focus formation in NHDFs requires the LTAg p110Rb-binding region, and is enhanced by loss of normal p53 function. In contrast, increased proliferative potential is primarily due to loss of p53 function.

  13. Merkel Cell Polyomavirus Large T Antigen Disrupts Host Genomic Integrity and Inhibits Cellular Proliferation

    PubMed Central

    Li, Jing; Wang, Xin; Diaz, Jason; Tsang, Sabrina H.; Buck, Christopher B.

    2013-01-01

    Clonal integration of Merkel cell polyomavirus (MCV) DNA into the host genome has been observed in at least 80% of Merkel cell carcinoma (MCC). The integrated viral genome typically carries mutations that truncate the C-terminal DNA binding and helicase domains of the MCV large T antigen (LT), suggesting a selective pressure to remove this MCV LT region during tumor development. In this study, we show that MCV infection leads to the activation of host DNA damage responses (DDR). This activity was mapped to the C-terminal helicase-containing region of the MCV LT. The MCV LT-activated DNA damage kinases, in turn, led to enhanced p53 phosphorylation, upregulation of p53 downstream target genes, and cell cycle arrest. Compared to the N-terminal MCV LT fragment that is usually preserved in mutants isolated from MCC tumors, full-length MCV LT shows a decreased potential to support cellular proliferation, focus formation, and anchorage-independent cell growth. These apparently antitumorigenic effects can be reversed by a dominant-negative p53 inhibitor. Our results demonstrate that MCV LT-induced DDR activates p53 pathway, leading to the inhibition of cellular proliferation. This study reveals a key difference between MCV LT and simian vacuolating virus 40 LT, which activates a DDR but inhibits p53 function. This study also explains, in part, why truncation mutations that remove the MCV LT C-terminal region are necessary for the oncogenic progression of MCV-associated cancers. PMID:23760247

  14. Four major sequence elements of simian virus 40 large T antigen coordinate its specific and nonspecific DNA binding.

    PubMed Central

    Simmons, D T; Loeber, G; Tegtmeyer, P

    1990-01-01

    By mutational analysis, we have identified a motif critical to the proper recognition and binding of simian virus 40 large tumor antigen (T antigen) to virus DNA sequences at the origin of DNA replication. This motif is tripartite and consists of two elements (termed A1 and B2) that are necessary for sequence-specific binding of the origin and a central element (B1) which is required for nonspecific DNA-binding activity. Certain amino acids in elements A1 (residues 152 to 155) and B2 (203 to 207) may make direct contact with the GAGGC pentanucleotide sequences in binding sites I and II on the DNA. Alternatively, these two elements could determine the proper structure of the DNA-binding domain, although for a number of reasons we favor the first possibility. In contrast, element B1 (183 to 187) is most likely important for recognizing a general structural feature of DNA. Elements A1 and B2 are nearly identical in all known papovavirus T antigens, whereas B1 is identical only in the closely related papovaviruses simian virus 40, BK virus, and JC virus. In addition to these three elements, a fourth (B3; residues 215 to 219) is necessary for the binding of T antigen to site II but not to site I. We propose that additional contact sites on T antigen are involved in the interaction with site II to initiate the replication of the viral DNA. PMID:2157865

  15. Quantitative analysis of the binding of simian virus 40 large T antigen to DNA.

    PubMed

    Fradet-Turcotte, Amélie; Vincent, Caroline; Joubert, Simon; Bullock, Peter A; Archambault, Jacques

    2007-09-01

    SV40 large T antigen (T-ag) is a multifunctional protein that successively binds to 5'-GAGGC-3' sequences in the viral origin of replication, melts the origin, unwinds DNA ahead of the replication fork, and interacts with host DNA replication factors to promote replication of the simian virus 40 genome. The transition of T-ag from a sequence-specific binding protein to a nonspecific helicase involves its assembly into a double hexamer whose formation is likely dictated by the propensity of T-ag to oligomerize and its relative affinities for the origin as well as for nonspecific double- and single-stranded DNA. In this study, we used a sensitive assay based on fluorescence anisotropy to measure the affinities of wild-type and mutant forms of the T-ag origin-binding domain (OBD), and of a larger fragment containing the N-terminal domain (N260), for different DNA substrates. We report that the N-terminal domain does not contribute to binding affinity but reduces the propensity of the OBD to self-associate. We found that the OBD binds with different affinities to its four sites in the origin and determined a consensus binding site by systematic mutagenesis of the 5'-GAGGC-3' sequence and of the residue downstream of it, which also contributes to affinity. Interestingly, the OBD also binds to single-stranded DNA with an approximately 10-fold higher affinity than to nonspecific duplex DNA and in a mutually exclusive manner. Finally, we provide evidence that the sequence specificity of full-length T-ag is lower than that of the OBD. These results provide a quantitative basis onto which to anchor our understanding of the interaction of T-ag with the origin and its assembly into a double hexamer.

  16. Polyomavirus large T antigen binds symmetrical repeats at the viral origin in an asymmetrical manner.

    PubMed

    Harrison, Celia; Jiang, Tao; Banerjee, Pubali; Meinke, Gretchen; D'Abramo, Claudia M; Schaffhausen, Brian; Bohm, Andrew

    2013-12-01

    Polyomaviruses have repeating sequences at their origins of replication that bind the origin-binding domain of virus-encoded large T antigen. In murine polyomavirus, the central region of the origin contains four copies (P1 to P4) of the sequence G(A/G)GGC. They are arranged as a pair of inverted repeats with a 2-bp overlap between the repeats at the center. In contrast to simian virus 40 (SV40), where the repeats are nonoverlapping and all four repeats can be simultaneously occupied, the crystal structure of the four central murine polyomavirus sequence repeats in complex with the polyomavirus origin-binding domain reveals that only three of the four repeats (P1, P2, and P4) are occupied. Isothermal titration calorimetry confirms that the stoichiometry is the same in solution as in the crystal structure. Consistent with these results, mutation of the third repeat has little effect on DNA replication in vivo. Thus, the apparent 2-fold symmetry within the DNA repeats is not carried over to the protein-DNA complex. Flanking sequences, such as the AT-rich region, are known to be important for DNA replication. When the orientation of the central region was reversed with respect to these flanking regions, the origin was still able to replicate and the P3 sequence (now located at the P2 position with respect to the flanking regions) was again dispensable. This highlights the critical importance of the precise sequence of the region containing the pentamers in replication.

  17. Polyomavirus Large T Antigen Binds Symmetrical Repeats at the Viral Origin in an Asymmetrical Manner

    PubMed Central

    Harrison, Celia; Jiang, Tao; Banerjee, Pubali; Meinke, Gretchen; D'Abramo, Claudia M.; Schaffhausen, Brian

    2013-01-01

    Polyomaviruses have repeating sequences at their origins of replication that bind the origin-binding domain of virus-encoded large T antigen. In murine polyomavirus, the central region of the origin contains four copies (P1 to P4) of the sequence G(A/G)GGC. They are arranged as a pair of inverted repeats with a 2-bp overlap between the repeats at the center. In contrast to simian virus 40 (SV40), where the repeats are nonoverlapping and all four repeats can be simultaneously occupied, the crystal structure of the four central murine polyomavirus sequence repeats in complex with the polyomavirus origin-binding domain reveals that only three of the four repeats (P1, P2, and P4) are occupied. Isothermal titration calorimetry confirms that the stoichiometry is the same in solution as in the crystal structure. Consistent with these results, mutation of the third repeat has little effect on DNA replication in vivo. Thus, the apparent 2-fold symmetry within the DNA repeats is not carried over to the protein-DNA complex. Flanking sequences, such as the AT-rich region, are known to be important for DNA replication. When the orientation of the central region was reversed with respect to these flanking regions, the origin was still able to replicate and the P3 sequence (now located at the P2 position with respect to the flanking regions) was again dispensable. This highlights the critical importance of the precise sequence of the region containing the pentamers in replication. PMID:24109229

  18. Host range and cell cycle activation properties of polyomavirus large T-antigen mutants defective in pRB binding

    SciTech Connect

    Freund, R.; Bauer, P.H.; Benjamin, T.L.; Crissman, H.A.; Bradbury, E.M. |

    1994-11-01

    The authors have examined the growth properties of polyomavirus large T-antigen mutants that ar unable to bind pRB, the product of the retinoblastoma tumor suppressor gene. These mutants grow poorly on primary mouse cells yet grow well on NIH 3T3 and other established mouse cell lines. Preinfection of primary baby mouse kidney (BMK) epithelial cells with wild-type simian virus 40 renders these cells permissive to growth of pRB-binding polyomavirus mutants. Conversely, NIH 3T3 cells transfected by and expressing wild-type human pRB become nonpermissive. Primary fibroblasts for mouse embryos that carry a homozygous knockout of the RB gene are permissive, while those from normal littermates are nonpermissive. The host range of polyomavirus pRB-binding mutants is thus determined by expression or lack of expression of functional pRB by the host. These results demonstrate the importance of pRB binding by large T antigen for productive viral infection in primary cells. Failure of pRB-binding mutants to grow well in BMK cells correlates with their failure to induce progression from G{sub 0} or G{sub 1} through the S phase of the cell cycle. Time course studies show delayed synthesis and lower levels of accumulation of large T antigen, viral DNA, and VP1 in mutant compared with wild-type virus-infected BMK cells. These results support a model in which productive infection by polyomavirus in normal mouse cells is tightly coupled to the induction and progression of the cell cycle. 48 refs., 6 figs., 5 tabs.

  19. Asymmetric assembly of Merkel cell polyomavirus large T-antigen origin binding domains at the viral origin.

    PubMed

    Harrison, Celia J; Meinke, Gretchen; Kwun, Hyun Jin; Rogalin, Henry; Phelan, Paul J; Bullock, Peter A; Chang, Yuan; Moore, Patrick S; Bohm, Andrew

    2011-06-17

    The double-stranded DNA polyomavirus Merkel cell polyomavirus (MCV) causes Merkel cell carcinoma, an aggressive but rare human skin cancer that most often affects immunosuppressed and elderly persons. As in other polyomaviruses, the large T-antigen of MCV recognizes the viral origin of replication by binding repeating G(A/G)GGC pentamers. The spacing, number, orientation, and necessity of repeats for viral replication differ, however, from other family members such as SV40 and murine polyomavirus. We report here the 2.9 Å crystal structure of the MCV large T-antigen origin binding domain (OBD) in complex with a DNA fragment from the MCV origin of replication. Consistent with replication data showing that three of the G(A/G)GGC-like binding sites near the center of the origin are required for replication, the crystal structure contains three copies of the OBD. This stoichiometry was verified using isothermal titration calorimetry. The affinity for G(A/G)GGC-containing double-stranded DNA was found to be ~740 nM, approximately 8-fold weaker than the equivalent domain in SV40 for the analogous region of the SV40 origin. The difference in affinity is partially attributable to DNA-binding residue Lys331 (Arg154 in SV40). In contrast to SV40, a small protein-protein interface is observed between MCV OBDs when bound to the central region of the origin. This protein-protein interface is reminiscent of that seen in bovine papilloma virus E1 protein. Mutational analysis indicates, however, that this interface contributes little to DNA binding energy.

  20. Asymmetric Assembly of Merkel Cell Polyomavirus Large T-Antigen Origin Binding Domains at the Viral Origin

    SciTech Connect

    C Harrison; G Meinke; H Kwun; H Rogalin; P Phelan; P Bullock; Y Chang; P Moore; A Bohm

    2011-12-31

    The double-stranded DNA polyomavirus Merkel cell polyomavirus (MCV) causes Merkel cell carcinoma, an aggressive but rare human skin cancer that most often affects immunosuppressed and elderly persons. As in other polyomaviruses, the large T-antigen of MCV recognizes the viral origin of replication by binding repeating G(A/G)GGC pentamers. The spacing, number, orientation, and necessity of repeats for viral replication differ, however, from other family members such as SV40 and murine polyomavirus. We report here the 2.9 {angstrom} crystal structure of the MCV large T-antigen origin binding domain (OBD) in complex with a DNA fragment from the MCV origin of replication. Consistent with replication data showing that three of the G(A/G)GGC-like binding sites near the center of the origin are required for replication, the crystal structure contains three copies of the OBD. This stoichiometry was verified using isothermal titration calorimetry. The affinity for G(A/G)GGC-containing double-stranded DNA was found to be {approx} 740 nM, approximately 8-fold weaker than the equivalent domain in SV40 for the analogous region of the SV40 origin. The difference in affinity is partially attributable to DNA-binding residue Lys331 (Arg154 in SV40). In contrast to SV40, a small protein-protein interface is observed between MCV OBDs when bound to the central region of the origin. This protein-protein interface is reminiscent of that seen in bovine papilloma virus E1 protein. Mutational analysis indicates, however, that this interface contributes little to DNA binding energy.

  1. Characterization of the DNA-binding properties of the origin-binding domain of simian virus 40 large T antigen by fluorescence anisotropy.

    PubMed

    Titolo, S; Welchner, E; White, P W; Archambault, J

    2003-05-01

    The affinity of the origin-binding domain (OBD) of simian virus 40 large T antigen for its cognate origin was measured at equilibrium using a DNA binding assay based on fluorescence anisotropy. At a near-physiological concentration of salt, the affinities of the OBD for site II and the core origin were 31 and 50 nM, respectively. Binding to any of the four 5'-GAGGC-3' binding sites in site II was only slightly weaker, between 57 and 150 nM. Although the OBD was shown previously to assemble as a dimer on two binding sites spaced by 7 bp, we found that increasing the distance between both binding sites by 1 to 3 bp had little effect on affinity. Similar results were obtained for full-length T antigen in absence of nucleotide. Addition of ADP-Mg, which promotes hexamerization of T antigen, greatly increased the affinity of full-length T antigen for the core origin and for nonspecific DNA. The implications of these findings for the assembly of T antigen at the origin and its transition to a non-specific DNA helicase are discussed.

  2. The SV40 large T-antigen origin binding domain directly participates in DNA unwinding.

    PubMed

    Foster, Erin C; Simmons, Daniel T

    2010-03-16

    The origin binding domain (OBD) of SV40 large T-ag serves a critical role during initiation of DNA replication to position T-ag on the origin. After origin recognition, T-ag forms a double hexamer over the origin. Within each hexamer, the OBD adopts a lock washer structure where the origin recognizing A1 and B2 loops face toward the helicase domain and likely become unavailable for binding DNA. In this study, we investigated the role of the central channel of the OBD hexamer in DNA replication by analyzing the effects of mutations of residues lining the channel. All mutants showed binding defects with origin DNA and ssDNA especially at low protein concentrations, but only half were defective at supporting DNA replication in vitro. All mutants were normal in unwinding linear origin DNA fragments. However, replication defective mutants failed to unwind a small origin containing circular DNA whereas replication competent mutants did so normally. The presence of RPA and/or pol/prim restored circular DNA unwinding activity of compromised mutants probably by interacting with the separated DNA strands on the T-ag surface. We interpret these results to indicate a role for the OBD central channel in binding and threading ssDNA during unwinding of circular SV40 DNA. Mixing experiments suggested that only one monomer in an OBD hexamer was necessary for DNA unwinding. We present a model of DNA threading through the T-ag complex illustrating how single-stranded DNA could pass close to a trough generated by key residues in one monomer of the OBD hexamer.

  3. Removal of a small C-terminal region of JCV and SV40 large T antigens has differential effects on transformation.

    PubMed

    Seneca, Nicole T M; Sáenz Robles, Maria Teresa; Pipas, James M

    2014-11-01

    The large T antigen (LT) protein of JCV and SV40 polyomaviruses is required to induce tumors in rodents and transform cells in culture. When both LTs are compared side-by-side in cell culture assays, SV40 shows a more robust transformation phenotype even though the LT sequences are highly conserved. A complete understanding of SV40׳s enhanced transforming capabilities relative to JCV is lacking. When the least conserved region of the LT proteins, the variable linker and host range region (VHR), was removed, changes in T antigen expression and cellular p53 post-translational modifications occurred, but interaction with the pRB pathway was unaffected. Transformation assessed by growth in low serum was reduced after VHR truncation of the SV40, but not the JCV, T antigen. Conversely, anchorage independent transformation was enhanced only by truncation of the JCV VHR. This is the first report to link the SV40 or JCV VHR region to transformation potential.

  4. Export-deficient monoubiquitinated PEX5 triggers peroxisome removal in SV40 large T antigen-transformed mouse embryonic fibroblasts

    PubMed Central

    Nordgren, Marcus; Francisco, Tânia; Lismont, Celien; Hennebel, Lore; Brees, Chantal; Wang, Bo; Van Veldhoven, Paul P; Azevedo, Jorge E; Fransen, Marc

    2015-01-01

    Peroxisomes are ubiquitous cell organelles essential for human health. To maintain a healthy cellular environment, dysfunctional and superfluous peroxisomes need to be selectively removed. Although emerging evidence suggests that peroxisomes are mainly degraded by pexophagy, little is known about the triggers and molecular mechanisms underlying this process in mammalian cells. In this study, we show that PEX5 proteins fused to a bulky C-terminal tag trigger peroxisome degradation in SV40 large T antigen-transformed mouse embryonic fibroblasts. In addition, we provide evidence that this process is autophagy-dependent and requires monoubiquitination of the N-terminal cysteine residue that marks PEX5 for recycling. As our findings also demonstrate that the addition of a bulky tag to the C terminus of PEX5 does not interfere with PEX5 monoubiquitination but strongly inhibits its export from the peroxisomal membrane, we hypothesize that such a tag mimics a cargo protein that cannot be released from PEX5, thus keeping monoubiquitinated PEX5 at the membrane for a sufficiently long time to be recognized by the autophagic machinery. This in turn suggests that monoubiquitination of the N-terminal cysteine of peroxisome-associated PEX5 not only functions to recycle the peroxin back to the cytosol, but also serves as a quality control mechanism to eliminate peroxisomes with a defective protein import machinery. PMID:26086376

  5. Structure of the origin-binding domain of simian virus 40 large T antigen bound to DNA.

    PubMed

    Bochkareva, Elena; Martynowski, Dariusz; Seitova, Almagoul; Bochkarev, Alexey

    2006-12-13

    The large T antigen (T-ag) protein binds to and activates DNA replication from the origin of DNA replication (ori) in simian virus 40 (SV40). Here, we determined the crystal structures of the T-ag origin-binding domain (OBD) in apo form, and bound to either a 17 bp palindrome (sites 1 and 3) or a 23 bp ori DNA palindrome comprising all four GAGGC binding sites for OBD. The T-ag OBDs were shown to interact with the DNA through a loop comprising Ser147-Thr155 (A1 loop), a combination of a DNA-binding helix and loop (His203-Asn210), and Asn227. The A1 loop traveled back-and-forth along the major groove and accounted for most of the sequence-determining contacts with the DNA. Unexpectedly, in both T-ag-DNA structures, the T-ag OBDs bound DNA independently and did not make direct protein-protein contacts. The T-ag OBD was also captured bound to a non-consensus site ATGGC even in the presence of its canonical site GAGGC. Our observations taken together with the known biochemical and structural features of the T-ag-origin interaction suggest a model for origin unwinding.

  6. Establishment and characterisation of a novel bovine SV40 large T-antigen-transduced foetal hepatocyte-derived cell line.

    PubMed

    Gleich, Alexander; Kaiser, Bastian; Schumann, Julia; Fuhrmann, Herbert

    2016-06-01

    Due to lack of in vitro models for bovine hepatocytes apart from primary cells, there is demand for a bovine hepatocyte-derived cell line. Transduction of bovine foetal hepatocytes with SV40 large T-antigen was performed using the vector pRetro-E2 SV40. Phase contrast microscopy was carried out to evaluate morphology. Immunofluorescence staining was conducted to study expression of keratins, tight junction proteins zona occludens-1 and claudin-1, glucose transporter-2 and P-glycoprotein as well as phosphoenolpyruvate carboxykinase. Urea and triglyceride production was quantified photometrically. Histochemical staining of glycogen by Periodic acid-Schiff stain and of lipids with Oil red O was performed after 24 h incubation with 20 mM glucose and 85 μM palmitic acid, respectively. Gene expression analysis of hepatocyte-typical genes was conducted by reverse transcription PCR. We obtained a SV40LTAg-transduced extended passage cell line, referred to as BFH12. Polygonal growth, keratins, tight junction proteins zona occludens-1 and claudin-1 and glucose transporter-2 as well as P-glycoprotein and phosphoenolpyruvate carboxykinase were attested positively. Urea production calculated as cell-specific rate was 14.2 ± 2.0 fmol/h (early passage) and 17.6 ± 3.7 fmol/h (late passage). Cell-specific triglyceride production was 1.6 ± 0.5 fmol/h (early passage) and 2.1 ± 0.3 fmol/h (late passage). Additionally, cells were positive for glycogen and lipid storage and showed a gene expression pattern resembling foetal hepatocytes. With the properties described here, the novel cell line BFH12 is a hepatocyte-derived cell line which can be used as an in vitro whole cell model.

  7. A simian virus 40 large T-antigen segment containing amino acids 1 to 127 and expressed under the control of the rat elastase-1 promoter produces pancreatic acinar carcinomas in transgenic mice.

    PubMed Central

    Tevethia, M J; Bonneau, R H; Griffith, J W; Mylin, L

    1997-01-01

    The simian virus 40 large T antigen induces tumors in a wide variety of tissues in transgenic mice, the precise tissues depending on the tissue specificity of the upstream region controlling T-antigen expression. Expression of mutant T antigens that contain a subset of the protein's activities restricts the spectrum of tumors induced. Others showed previously that expression of a mutant large T antigen containing the N-terminal 121 amino acids (T1-121) under control of the lymphotropic papovavirus promoter resulted in slow-growing choroid plexus tumors, whereas full-length T antigen under the same promoter induced rapidly growing CPR tumors, T-cell lymphomas, and B-cell lymphomas. In those instances, the alteration in tumor induction or progression correlated with inability of the mutant large T antigen to bind the tumor suppressor p53. In the study reported here, we investigated the capacity of an N-terminal T antigen segment (T1-127) expressed in conjunction with small t antigen under control of the rat elastase-1 (E1) promoter to induce pancreatic tumors. The results show that pancreases of transgenic mice expressing T1-127 and small t antigen display acinar cell dysplasia at birth that progresses to neoplasia. The average age to death in these mice is within the range reported for transgenic mice expressing full-length T antigen under control of the E1 promoter. These results indicate that sequestering p53 by binding is not required for the development of rapidly growing acinar cell carcinomas. In addition, we provide evidence that small t antigen is unlikely to be required. Finally, we show that the p53 protein in acinar cell carcinomas is wild type in conformation. PMID:9343166

  8. Structure-based design of a disulfide-linked oligomeric form of the simian virus 40 (SV40) large T antigen DNA-binding domain

    SciTech Connect

    Meinke, Gretchen; Phelan, Paul; Fradet-Turcotte, Amélie; Archambault, Jacques; Bullock, Peter A.

    2011-06-01

    With the aim of forming the ‘lock-washer’ conformation of the origin-binding domain of SV40 large T antigen in solution, using structure-based analysis an intermolecular disulfide bridge was engineered into the origin-binding domain to generate higher order oligomers in solution. The 1.7 Å resolution structure shows that the mutant forms a spiral in the crystal and has the de novo disulfide bond at the protein interface, although structural rearrangements at the interface are observed relative to the wild type. The modular multifunctional protein large T antigen (T-ag) from simian virus 40 orchestrates many of the events needed for replication of the viral double-stranded DNA genome. This protein assembles into single and double hexamers on specific DNA sequences located at the origin of replication. This complicated process begins when the origin-binding domain of large T antigen (T-ag ODB) binds the GAGGC sequences in the central region (site II) of the viral origin of replication. While many of the functions of purified T-ag OBD can be studied in isolation, it is primarily monomeric in solution and cannot assemble into hexamers. To overcome this limitation, the possibility of engineering intermolecular disulfide bonds in the origin-binding domain which could oligomerize in solution was investigated. A recent crystal structure of the wild-type T-ag OBD showed that this domain forms a left-handed spiral in the crystal with six subunits per turn. Therefore, we analyzed the protein interface of this structure and identified two residues that could potentially support an intermolecular disulfide bond if changed to cysteines. SDS–PAGE analysis established that the mutant T-ag OBD formed higher oligomeric products in a redox-dependent manner. In addition, the 1.7 Å resolution crystal structure of the engineered disulfide-linked T-ag OBD is reported, which establishes that oligomerization took place in the expected manner.

  9. Structure-based design of a disulfide-linked oligomeric form of the simian virus 40 (SV40) large T antigen DNA-binding domain.

    PubMed

    Meinke, Gretchen; Phelan, Paul; Fradet-Turcotte, Amélie; Archambault, Jacques; Bullock, Peter A

    2011-06-01

    The modular multifunctional protein large T antigen (T-ag) from simian virus 40 orchestrates many of the events needed for replication of the viral double-stranded DNA genome. This protein assembles into single and double hexamers on specific DNA sequences located at the origin of replication. This complicated process begins when the origin-binding domain of large T antigen (T-ag ODB) binds the GAGGC sequences in the central region (site II) of the viral origin of replication. While many of the functions of purified T-ag OBD can be studied in isolation, it is primarily monomeric in solution and cannot assemble into hexamers. To overcome this limitation, the possibility of engineering intermolecular disulfide bonds in the origin-binding domain which could oligomerize in solution was investigated. A recent crystal structure of the wild-type T-ag OBD showed that this domain forms a left-handed spiral in the crystal with six subunits per turn. Therefore, we analyzed the protein interface of this structure and identified two residues that could potentially support an intermolecular disulfide bond if changed to cysteines. SDS-PAGE analysis established that the mutant T-ag OBD formed higher oligomeric products in a redox-dependent manner. In addition, the 1.7 Å resolution crystal structure of the engineered disulfide-linked T-ag OBD is reported, which establishes that oligomerization took place in the expected manner.

  10. Structure-based Design of a Disulfide-lined Oligomeric Form of the Simian Virus 40 (SV40) Large T Antigen DNA-Binding Domain

    SciTech Connect

    G Meinke; P Phelan; A Fradet-Turcotte; J Archambault; P Bullock

    2011-12-31

    The modular multifunctional protein large T antigen (T-ag) from simian virus 40 orchestrates many of the events needed for replication of the viral double-stranded DNA genome. This protein assembles into single and double hexamers on specific DNA sequences located at the origin of replication. This complicated process begins when the origin-binding domain of large T antigen (T-ag ODB) binds the GAGGC sequences in the central region (site II) of the viral origin of replication. While many of the functions of purified T-ag OBD can be studied in isolation, it is primarily monomeric in solution and cannot assemble into hexamers. To overcome this limitation, the possibility of engineering intermolecular disulfide bonds in the origin-binding domain which could oligomerize in solution was investigated. A recent crystal structure of the wild-type T-ag OBD showed that this domain forms a left-handed spiral in the crystal with six subunits per turn. Therefore, we analyzed the protein interface of this structure and identified two residues that could potentially support an intermolecular disulfide bond if changed to cysteines. SDS-PAGE analysis established that the mutant T-ag OBD formed higher oligomeric products in a redox-dependent manner. In addition, the 1.7 {angstrom} resolution crystal structure of the engineered disulfide-linked T-ag OBD is reported, which establishes that oligomerization took place in the expected manner.

  11. Association of p53 binding and immortalization of primary C57BL/6 mouse embryo fibroblasts by using simian virus 40 T-antigen mutants bearing internal overlapping deletion mutations.

    PubMed Central

    Kierstead, T D; Tevethia, M J

    1993-01-01

    To more precisely map the immortalization and p53 binding domains of T antigen, a large series of overlapping deletion mutations were created between codons 251 to 651 by utilizing a combination of Bal 31 deletion and oligonucleotide-directed mutagenesis. Immortalization assay results indicated that amino acids (aa) 252 to 350, 400, and 451 to 532 could be removed without seriously compromising immortalization, although the appearance of immortal colonies was delayed in some cases. Western immunoblotting experiments indicated that the p53 binding capacities of T antigen produced by mutants missing aa 252 to 300, 301 to 350, 400, or 451 to 532 were only slightly reduced relative to that of wild-type T antigen. Within the limits of this deletion analysis, the immortalization and p53 binding domains appear to be colinear and, in fact, may represent two aspects of the same domain. This deletion analysis eliminates the entire zinc finger domain (aa 302 to 320), a small portion of the leucine-rich region (aa 345 to 350), and a large portion of the ATP binding domain (aa 451 to 528) as participants in p53 binding or in the immortalization process. The results also show that removal of T antigen amino acids within the region 451 to 532 appears to alter the capacity of newly synthesized but not older T antigen and p53 molecules to form complexes. Images PMID:8383212

  12. Host proteins that bind to or mimic SV40 large T antigen: using antibodies to look at protein interactions and their significance

    PubMed Central

    Mole, S. E.; Gannon, J. V.; Anton, I. A.; Ford, M. J.; Lane, D. P.

    1989-01-01

    The papovavirus SV40 is able to induce tumours in susceptible hosts and will transform cells in vitro. Its major early protein, large T antigen, is required for viral DNA synthesis, both in vivo and in vitro, and is also responsible for the oncogenic action of the virus. We have made use of an extensive library of anti-T monoclonal antibodies to investigate the cellular effects of T. Large T shares an antigenic determinant with a growth-regulated host protein, p68, which is a member of an expanding super-family of helicases with particular homology to the translation initiation factor elF-4A. We have also studied the binding and interaction of large T with two particular host components: the replicative enzyme DNA polymerase α and the proto-oncogene p53. These two proteins bind to similar regions of T and exert similar effects on its antigenic structure. We found that p53 can block the binding of DNA polymerase α to T as well as co-existing with DNA polymerase α in a trimeric complex with T. This suggests that these interactions may be important in the oncogenic and replicative action of large T.

  13. Genes involved in nonpermissive temperature-induced cell differentiation in Sertoli TTE3 cells bearing temperature-sensitive simian virus 40 large T-antigen

    SciTech Connect

    Tabuchi, Yoshiaki . E-mail: ytabu@ms.toyama-mpu.ac.jp; Kondo, Takashi; Suzuki, Yoshihisa; Obinata, Masuo

    2005-04-15

    Sertoli TTE3 cells, derived from transgenic mice bearing temperature-sensitive simian virus 40 large T (tsSV40LT)-antigen, proliferated continuously at a permissive temperature (33 deg C) whereas inactivation of the large T-antigen by a nonpermissive temperature (39 deg C) led to differentiation as judged by elevation of transferrin. To clarify the detailed mechanisms of differentiation, we investigated the time course of changes in gene expression using cDNA microarrays. Of the 865 genes analyzed, 14 genes showed increased levels of expression. Real-time quantitative PCR revealed that the mRNA levels of p21{sup waf1}, milk fat globule membrane protein E8, heat-responsive protein 12, and selenoprotein P were markedly elevated. Moreover, the differentiated condition induced by the nonpermissive temperature significantly increased mRNA levels of these four genes in several cell lines from the transgenic mice bearing the oncogene. The present results regarding changes in gene expression will provide a basis for a further understanding of molecular mechanisms of differentiation in both Sertoli cells and cell lines transformed by tsSV40LT-antigen.

  14. Polyomavirus T Antigens Activate an Antiviral State

    PubMed Central

    Giacobbi, Nicholas S.; Gupta, Tushar; Coxon, Andrew; Pipas, James M.

    2014-01-01

    Ectopic expression of Simian Virus 40 (SV40) large T antigen (LT) in mouse embryonic fibroblasts (MEFs) increased levels of mRNAs encoding interferon stimulated genes (ISGs). The mechanism by which T antigen increases levels of ISGs in MEFs remains unclear. We present evidence that expression of T antigen from SV40, Human Polyomaviruses BK (BKV) or JC (JCV) upregulate production of ISGs in MEFs, and subsequently result in an antiviral state, as determined by inhibition of VSV or EMCV growth. The first 136 amino acids of LT are sufficient for these activities. Furthermore, increased ISG expression and induction of the antiviral state requires STAT1. Finally, the RB binding motif of LT is necessary for activation of STAT1. We conclude that the induction of the STAT1 mediated innate immune response in MEFs is a common feature shared by SV40, BKV and JCV. PMID:25589241

  15. Simian virus 40-like DNA sequences and large-T antigen-retinoblastoma family protein pRb2/p130 interaction in human mesothelioma.

    PubMed

    Mutti, L; De Luca, A; Claudio, P P; Convertino, G; Carbone, M; Giordano, A

    1998-01-01

    The oncoprotein of the Simian virus 40, SV40 large T-antigen (Tag), is reported to target and inactivate growth-suppressive proteins such as the retinoblastoma (Rb) family and p53 leading to transformation of human cell lines in vitro, to produce tumours in rodents, and to be detected in several human cancers including mesothelioma. In support of the potential role of SV40 Tag in the pathogenesis of certain human cancers, we have found SV40-like sequences in 8/25 bioptic specimens of mesothelioma from patients with exposure to asbestos fibres. We have also demonstrated that the SV40 Tag detected in human mesothelioma binds the retinoblastoma family protein pRb2/p130 in 5/5 specimens studied. We submit that the tumorigenic potential of SV40 Tag in some human mesotheliomas may arise from its ability to interact with and thereby inactivate several tumour and/or growth suppressive proteins in cooperation with asbestos fibres in inducing pleural mesothelioma.

  16. The regions of the retinoblastoma protein needed for binding to adenovirus E1A or SV40 large T antigen are common sites for mutations.

    PubMed Central

    Hu, Q J; Dyson, N; Harlow, E

    1990-01-01

    The protein product of the retinoblastoma (RB) gene is thought to function in a pathway that restricts cell proliferation. Recently, transforming proteins from three different classes of DNA tumor viruses have been shown to form complexes with the RB protein. Genetic studies suggest that these interactions with the RB protein are important steps in transformation by these viruses. In order to understand better the function of the RB-viral oncoprotein complexes, we have mapped the regions of the RB protein that are necessary for these associations. Two non-contiguous regions of RB were found to be essential for complex formation with adenovirus E1A or SV40 large T antigen. These two regions are found between amino acids 393 and 572 and 646 and 772. Interestingly, these binding sites on RB overlap with the positions of naturally occurring, inactivating mutations of the RB gene. These results strongly suggest that these viral oncoproteins are targeting a protein domain that is an important site in the normal function of the RB protein. Images Fig. 1. Fig. 2. Fig. 3. Fig. 4. Fig. 5. Fig. 6. Fig. 7. Fig. 9. PMID:2138977

  17. Binding to retinoblastoma pocket domain does not alter the inter-domain flexibility of the J domain of SV40 large T antigen.

    PubMed

    Williams, Christina K; Vaithiyalingam, Sivaraja; Hammel, Michal; Pipas, James; Chazin, Walter J

    2012-02-15

    Simian Virus 40 uses the large T antigen (Tag) to bind and inactivate retinoblastoma tumor suppressor proteins (Rb), which can result in cellular transformation. Tag is a modular protein with four domains connected by flexible linkers. The N-terminal J domain of Tag is necessary for Rb inactivation. Binding of Rb is mediated by an LXCXE consensus motif immediately C-terminal to the J domain. Nuclear magnetic resonance (NMR) and small angle X-ray scattering (SAXS) were used to study the structural dynamics and interaction of Rb with the LXCXE motif, the J domain and a construct (N(260)) extending from the J domain through the origin binding domain (OBD). NMR and SAXS data revealed substantial flexibility between the domains in N(260). Binding of pRb to a construct containing the LXCXE motif and the J domain revealed weak interactions between pRb and the J domain. Analysis of the complex of pRb and N(260) indicated that the OBD is not involved and retains its dynamic independence from the remainder of Tag. These results support a 'chaperone' model in which the J domain of Tag changes its orientation as it acts upon different protein complexes.

  18. Cell adhesion markers are expressed by a stable human endothelial cell line transformed by the SV40 large T antigen under vimentin promoter control.

    PubMed

    Vicart, P; Testut, P; Schwartz, B; Llorens-Cortes, C; Perdomo, J J; Paulin, D

    1993-10-01

    Markers of endothelium have been studied in a new endothelial cell line derived from human umbilical cord vein cells by microinjection of a recombinant gene that includes a deletion mutant of the human vimentin gene regulatory region controlling the large T and small t antigen coding region of the SV40 virus. In culture, this immortalized venous endothelial cell line (IVEC) demonstrated morphological characteristics of endothelium; uptake of acetylated low density lipoprotein and presence of the Factor VIII-related antigen. Treatment of IVEC cells with Interleukin-1 beta (IL-1 beta) at 10 U.ml-1 activates the expression of cell adhesion molecules such as endothelial leucocyte adhesion molecule (ELAM-1), intercellular adhesion molecule-1 (ICAM-1), and vascular cell adhesion molecule-1 (VCAM-1), as observed in primary culture. Prostacyclin secretion was induced in the IVEC cells by 100 nM PMA treatment and thrombin at 0.5 U/ml. Angiotensin converting enzyme (ACE) activity detected in IVEC cells was present but lower than ACE activity in primary endothelial cells and was completely blocked by enalaprilat (1 microM), a specific ACE inhibitor. The presence of ACE mRNA was also demonstrated in IVEC cells by RT-PCR amplification. Our data demonstrate that endothelial cells immortalized by use of this recombinant gene retain the morphological organization and numerous differentiated properties of endothelium.

  19. Immortalization of osteoclast precursors by targeting Bcl -XL and Simian virus 40 large T antigen to the osteoclast lineage in transgenic mice.

    PubMed Central

    Hentunen, T A; Reddy, S V; Boyce, B F; Devlin, R; Park, H R; Chung, H; Selander, K S; Dallas, M; Kurihara, N; Galson, D L; Goldring, S R; Koop, B A; Windle, J J; Roodman, G D

    1998-01-01

    Cellular and molecular characterization of osteoclasts (OCL) has been extremely difficult since OCL are rare cells, and are difficult to isolate in large numbers. We used the tartrate-resistant acid phosphatase promoter to target the bcl-XL and/or Simian Virus 40 large T antigen (Tag) genes to cells in the OCL lineage in transgenic mice as a means of immortalizing OCL precursors. Immunocytochemical studies confirmed that we had targeted Bcl-XL and/or Tag to OCL, and transformed and mitotic OCL were readily apparent in bones from both Tag and bcl-XL/Tag mice. OCL formation in primary bone marrow cultures from bcl-XL, Tag, or bcl-XL/Tag mice was twofold greater compared with that of nontransgenic littermates. Bone marrow cells from bcl-XL/Tag mice, but not from singly transgenic bcl-XL or Tag mice, have survived in continuous culture for more than a year. These cells form high numbers of bone-resorbing OCL when cultured using standard conditions for inducing OCL formation, with approximately 50% of the mononuclear cells incorporated into OCL. The OCL that form express calcitonin receptors and contract in response to calcitonin. Studies examining the proliferative capacity and the resistance of OCL precursors from these transgenic mice to apoptosis demonstrated that the increased numbers of OCL precursors in marrow from bcl-XL/Tag mice was due to their increased survival rather than an increased proliferative capacity compared with Tag, bcl-XL, or normal mice. Histomorphometric studies of bones from bcl-XL/Tag mice also confirmed that there were increased numbers of OCL precursors (TRAP + mononuclear cells) present in vivo. These data demonstrate that by targeting both bcl-XL and Tag to cells in the OCL lineage, we have immortalized OCL precursors that form bone-resorbing OCL with an efficiency that is 300-500 times greater than that of normal marrow. PMID:9649561

  20. Establishment of SV40 large T antigen-immortalized bovine liver sinusoidal cell lines and their immunological responses to deoxynivalenol and lipopolysaccharide.

    PubMed

    Yoshioka, Miyako; Takenouchi, Takato; Kitani, Hiroshi; Okada, Hiroyuki; Yamanaka, Noriko

    2016-12-01

    Immortalized bovine sinusoidal cell lines provide useful tools to study the immunological responses in the liver to the gastrointestinal tract-derived toxic substances, which may cause systemic symptoms in the affected livestock. Here, we established two immortalized bovine liver sinusoidal cell lines, endothelial-like B46, and myofibroblast-like A26, from primary cultures of bovine liver cells by the transfection with SV40 large T antigen. The pro-inflammatory cytokine responses in these cell lines to deoxynivalenol (DON) and lipopolysaccharide (LPS) were then compared to those in the primary bovine Kupffer cells (BKC). BKC were highly responsive to LPS, showing increased levels of IL-1α, IL-1β, IL-6, and TNF-α mRNA 3 h after stimulation. DON induced similar pro-inflammatory cytokine responses in BKC, except for IL-6. The endothelial B46 cells exhibited upregulation of IL-1α, IL-1β, and IL-6 3 h after stimulation by LPS. In contrast to the stimulation by LPS, B46 had relatively low pro-inflammatory cytokine responses to DON, except for IL-1α, which was moderately induced at 3 h and increased at 24 h after stimulation. The myofibroblast-like A26 cells exhibited low responses in the induction of pro-inflammatory cytokines to LPS or DON; however, the expression of IL-6 was significantly observed 3 h after DON stimulation. Our results suggest that bovine liver sinusoidal cells have distinctive pro-inflammatory cytokine responses against harmful substances, and these immune responses might determine the consequence of systemic inflammations in the diseased animal.

  1. Computerized segmentation algorithm with personalized atlases of murine MRIs in a SV40 large T-antigen mouse mammary cancer model

    NASA Astrophysics Data System (ADS)

    Sibley, Adam R.; Markiewicz, Erica; Mustafi, Devkumar; Fan, Xiaobing; Conzen, Suzanne; Karczmar, Greg; Giger, Maryellen L.

    2016-03-01

    Quantities of MRI data, much larger than can be objectively and efficiently analyzed manually, are routinely generated in preclinical research. We aim to develop an automated image segmentation and registration pipeline to aid in analysis of image data from our high-throughput 9.4 Tesla small animal MRI imaging center. T2-weighted, fat-suppressed MRIs were acquired over 4 life-cycle time-points [up to 12 to 18 weeks] of twelve C3(1) SV40 Large T-antigen mice for a total of 46 T2-weighted MRI volumes; each with a matrix size of 192 x 256, 62 slices, in plane resolution 0.1 mm, and slice thickness 0.5 mm. These image sets were acquired with the goal of tracking and quantifying progression of mammary intraepithelial neoplasia (MIN) to invasive cancer in mice, believed to be similar to ductal carcinoma in situ (DCIS) in humans. Our segmentation algorithm takes 2D seed-points drawn by the user at the center of the 4 co-registered volumes associated with each mouse. The level set then evolves in 3D from these 2D seeds. The contour evolution incorporates texture information, edge information, and a statistical shape model in a two-step process. Volumetric DICE coefficients comparing the automatic with manual segmentations were computed and ranged between 0.75 and 0.58 for averages over the 4 life-cycle time points of the mice. Incorporation of these personalized atlases with intra and inter mouse registration is expected to enable locally and globally tracking of the morphological and textural changes in the mammary tissue and associated lesions of these mice.

  2. Bilateral retinal and brain tumors in transgenic mice expressing simian virus 40 large T antigen under control of the human interphotoreceptor retinoid-binding protein promoter

    PubMed Central

    1992-01-01

    We have previously shown that postnatal expression of the viral oncoprotein SV40 T antigen in rod photoreceptors (transgene MOT1), at a time when retinal cells have withdrawn from the mitotic cycle, leads to photoreceptor cell death (Al-Ubaidi et al., 1992. Proc. Natl. Acad. Sci. USA. 89:1194-1198). To study the effect of the specificity of the promoter, we replaced the mouse opsin promoter in MOT1 by a 1.3-kb promoter fragment of the human IRBP gene which is expressed in both rod and cone photoreceptors during embryonic development. The resulting construct, termed HIT1, was injected into mouse embryos and five transgenic mice lines were established. Mice heterozygous for HIT1 exhibited early bilateral retinal and brain tumors with varying degrees of incidence. Histopathological examination of the brain and eyes of three of the families showed typical primitive neuroectodermal tumors. In some of the bilateral retinal tumors, peculiar rosettes were observed, which were different from the Flexner-Wintersteiner rosettes typically associated with human retinoblastomas. The ocular and cerebral tumors, however, contained Homer-Wright rosettes, and showed varying degrees of immunoreactivity to antibodies against the neuronal specific antigens, synaptophysin and Leu7, but not to antibodies against photoreceptor specific proteins. Taken together, the results indicate that the specificity of the promoter used for T antigen and/or the time of onset of transgene expression determines the fate of photoreceptor cells expressing T antigen. PMID:1334963

  3. ATP-Binding Cassette Proteins: Towards a Computational View of Mechanism

    NASA Astrophysics Data System (ADS)

    Liao, Jielou

    2004-03-01

    Many large machine proteins can generate mechanical force and undergo large-scale conformational changes (LSCC) to perform varying biological tasks in living cells by utilizing ATP. Important examples include ATP-binding cassette (ABC) transporters. They are membrane proteins that couple ATP binding and hydrolysis to the translocation of substrates across membranes [1]. To interpret how the mechanical force generated by ATP binding and hydrolysis is propagated, a coarse-grained ATP-dependent harmonic network model (HNM) [2,3] is applied to the ABC protein, BtuCD. This protein machine transports vitamin B12 across membranes. The analysis shows that subunits of the protein move against each other in a concerted manner. The lowest-frequency modes of the BtuCD protein are found to link the functionally critical domains, and are suggested to be responsible for large-scale ATP-coupled conformational changes. [1] K. P. Locher, A. T. Lee and D. C. Rees. Science 296, 1091-1098 (2002). [2] Atilgan, A. R., S. R. Durell, R. L. Jernigan, M. C. Demirel, O. Keskin, and I. Bahar. Biophys. J. 80, 505-515(2002); M. M Tirion, Phys. Rev. Lett. 77, 1905-1908 (1996). [3] J. -L. Liao and D. N. Beratan, 2003, to be published.

  4. Isolation of a monoclonal antibody that recognizes the origin binding domain of JCV, but not SV40, large T-antigen.

    PubMed

    Grubman, Shelley A; Shin, Jong; Phelan, Paul J; Gong, Aaron; Can, Hande; Dilworth, Ryan; Kini, Sandeep Kuntadi; Gagnon, David; Archambault, Jacques; Meinke, Gretchen; Bohm, Andrew; Jefferson, Douglas M; Bullock, Peter A

    2016-10-01

    Within immunocompromised populations, the JC polyomavirus is the cause of the often-fatal disease Progressive Multifocal Leukoencephalopathy (PML). JC virus encodes a protein, termed T-antigen (T-ag), which is essential for its replication and pathogenicity. Previous studies of JCV T-ag have, in general, used antibodies raised against SV40 T-ag. Unfortunately, SV40 T-ag is also detected in humans and therefore there have been concerns about cross-reactivity. To address this issue, we have isolated a monoclonal antibody that binds to the JCV, but not the SV40, T-ag origin-binding domain (OBD). Furthermore, the region on the surface of the JCV T-ag OBD that is recognized by the "anti-JCV OBD mAb" has been mapped. We also demonstrate that the "anti-JCV OBD mAb" will be a useful reagent for standard techniques (e.g., Westerns blots and ELISAs). Finally, we note that additional monoclonal Abs that are specific for the T-ags encoded by the other human polyomaviruses could be generated by adopting the approach described herein.

  5. Generation and Characterization of Eptesicus fuscus (Big brown bat) kidney cell lines immortalized using the Myotis polyomavirus large T-antigen.

    PubMed

    Banerjee, Arinjay; Rapin, Noreen; Miller, Megan; Griebel, Philip; Zhou, Yan; Munster, Vincent; Misra, Vikram

    2016-11-01

    It is speculated that bats are important reservoir hosts for numerous viruses, with 27 viral families reportedly detected in bats. Majority of these viruses have not been isolated and there is little information regarding their biology in bats. Establishing a well-characterized bat cell line supporting the replication of bat-borne viruses would facilitate the analysis of virus-host interactions in an in vitro model. Currently, few bat cell lines have been developed and only Tb1-Lu, derived from Tadarida brasiliensis is commercially available. Here we describe a method to establish and immortalize big brown bat (Eptesicus fuscus) kidney (Efk3) cells using the Myotis polyomavirus T-antigen. Subclones of this cell line expressed both epithelial and fibroblast markers to varying extents. Cell clones expressed interferon beta in response to poly(I:C) stimulation and supported the replication of four different viruses, namely, vesicular stomatitis virus (VSV), porcine epidemic diarrhea coronavirus (PED-CoV), Middle-East respiratory syndrome coronavirus (MERS-CoV) and herpes simplex virus (HSV). To our knowledge, this is the first bat cell line from a northern latitude insectivorous bat developed using a novel technology. The cell line has the potential to be used for isolation of bat viruses and for studying virus-bat interactions in culture.

  6. Merkel cell polyomavirus infection in both components of a combined Merkel cell carcinoma and basal cell carcinoma with ductal differentiation; each component had a similar but different novel Merkel cell polyomavirus large T antigen truncating mutation.

    PubMed

    Iwasaki, Takeshi; Kodama, Hajime; Matsushita, Michiko; Kuroda, Naoto; Yamasaki, Yoshikazu; Murakami, Ichiro; Yamamoto, Osamu; Hayashi, Kazuhiko

    2013-03-01

    Merkel cell polyomavirus infects up to 80% of patients with Merkel cell carcinoma. Combined Merkel cell carcinoma and cutaneous tumors occur occasionally. Previous reports have suggested that Merkel cell polyomavirus is absent from combined Merkel cell carcinoma and squamous cell carcinomas. This is the first report that Merkel cell polyomavirus infected in both lesions of a combined Merkel cell carcinoma and basal cell carcinoma. A 92-year-old Japanese man presented with a right thigh small subcutaneous mass. Histologic examination revealed a combined tumor with Merkel cell carcinoma and basal cell carcinoma with ductal differentiation. Both tumors and intermingled Merkel cells in basal cell carcinoma expressed Merkel cell polyomavirus large T antigen, and 17 and 240 copies of Merkel cell polyomavirus/cell were detected in the microdissected Merkel cell carcinoma and basal cell carcinoma specimens, respectively. Mutation analysis of Merkel cell polyomavirus large T antigen revealed a novel truncating mutation in Merkel cell carcinoma and a similar but different mutation in the basal cell carcinoma. These results suggest that each was infected by a different Merkel cell polyomavirus subclone derived from a single Merkel cell polyomavirus.

  7. Formation of a Chloride-conducting State in the Maltose ATP-binding Cassette (ABC) Transporter.

    PubMed

    Carlson, Michael L; Bao, Huan; Duong, Franck

    2016-06-03

    ATP-binding cassette transporters use an alternating access mechanism to move substrates across cellular membranes. This mode of transport ensures the selective passage of molecules while preserving membrane impermeability. The crystal structures of MalFGK2, inward- and outward-facing, show that the transporter is sealed against ions and small molecules. It has yet to be determined whether membrane impermeability is maintained when MalFGK2 cycles between these two conformations. Through the use of a mutant that resides in intermediate conformations close to the transition state, we demonstrate that not only is chloride conductance occurring, but also to a degree large enough to compromise cell viability. Introduction of mutations in the periplasmic gate lead to the formation of a channel that is quasi-permanently open. MalFGK2 must therefore stay away from these ion-conducting conformations to preserve the membrane barrier; otherwise, a few mutations that increase access to the ion-conducting states are enough to convert an ATP-binding cassette transporter into a channel.

  8. ATP binding cassette G transporters and plant male reproduction

    PubMed Central

    Zhao, Guochao; Shi, Jianxin; Liang, Wanqi; Zhang, Dabing

    2016-01-01

    ABSTRACT The function of ATP Binding Cassette G (ABCG) transporters in the regulation of plant vegetative organs development has been well characterized in various plant species. In contrast, their function in reproductive development particularly male reproductive development received considerably less attention till some ABCG transporters was reported to be associated with anther and pollen wall development in Arabidopsis thaliana and rice (Oryza sativa) during the past decade. This mini-review summarizes current knowledge of ABCG transporters regarding to their roles in male reproduction and underlying genetic and biochemical mechanisms, which makes it evident that ABCG transporters represent one of those conserved and divergent components closely related to male reproduction in plants. This mini-review also discusses the current challenges and future perspectives in this particular field. PMID:26906115

  9. Crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus.

    PubMed

    Manjula, M; Pampa, K J; Kumar, S M; Mukherjee, S; Kunishima, N; Rangappa, K S; Lokanath, N K

    2015-03-27

    The ATP binding cassette (ABC) transporters, represent one of the largest superfamilies of primary transporters, which are very essential for various biological functions. The crystal structure of ATP-binding subunit of an ABC transporter from Geobacillus kaustophilus has been determined at 1.77 Å resolution. The crystal structure revealed that the protomer has two thick arms, (arm I and II), which resemble 'L' shape. The ATP-binding pocket is located close to the end of arm I. ATP molecule is docked into the active site of the protein. The dimeric crystal structure of ATP-binding subunit of ABC transporter from G. kaustophilus has been compared with the previously reported crystal structure of ATP-binding subunit of ABC transporter from Salmonella typhimurium.

  10. High-Affinity Rb Binding, p53 Inhibition, Subcellular Localization, and Transformation by Wild-Type or Tumor-Derived Shortened Merkel Cell Polyomavirus Large T Antigens

    PubMed Central

    Borchert, Sophie; Czech-Sioli, Manja; Neumann, Friederike; Schmidt, Claudia; Wimmer, Peter; Dobner, Thomas

    2014-01-01

    ABSTRACT Interference with tumor suppressor pathways by polyomavirus-encoded tumor antigens (T-Ags) can result in transformation. Consequently, it is thought that T-Ags encoded by Merkel cell polyomavirus (MCPyV), a virus integrated in ∼90% of all Merkel cell carcinoma (MCC) cases, are major contributors to tumorigenesis. The MCPyV large T-Ag (LT-Ag) has preserved the key functional domains present in all family members but has also acquired unique regions that flank the LxCxE motif. As these regions may mediate unique functions, or may modulate those shared with T-Ags of other polyomaviruses, functional studies of MCPyV T-Ags are required. Here, we have performed a comparative study of full-length or MCC-derived truncated LT-Ags with regard to their biochemical characteristics, their ability to bind to retinoblastoma (Rb) and p53 proteins, and their transforming potential. We provide evidence that full-length MCPyV LT-Ag may not directly bind to p53 but nevertheless can significantly reduce p53-dependent transcription in reporter assays. Although early region expression constructs harboring either full-length or MCC-derived truncated LT-Ag genes can transform primary baby rat kidney cells, truncated LT-Ags do not bind to p53 or reduce p53-dependent transcription. Interestingly, shortened LT-Ags exhibit a very high binding affinity for Rb, as shown by coimmunoprecipitation and in vitro binding studies. Additionally, we show that truncated MCPyV LT-Ag proteins are expressed at higher levels than those for the wild-type protein and are able to partially relocalize Rb to the cytoplasm, indicating that truncated LT proteins may have gained additional features that distinguish them from the full-length protein. IMPORTANCE MCPyV is one of the 12 known polyomaviruses that naturally infect humans. Among these, it is of particular interest since it is the only human polyomavirus known to be involved in tumorigenesis. MCPyV is thought to be causally linked to MCC, a rare

  11. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    NASA Astrophysics Data System (ADS)

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus

    2014-06-01

    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH. radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD.-, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396-. Its negative charge could trigger conformational changes necessary for signal transduction.

  12. ATP-Binding Cassette Efflux Transporters in Human Placenta

    PubMed Central

    Ni, Zhanglin; Mao, Qingcheng

    2010-01-01

    Pregnant women are often complicated with diseases including viral or bacterial infections, epilepsy, hypertension, or pregnancy-induced conditions such as depression and gestational diabetes that require treatment with medication. In addition, substance abuse during pregnancy remains a major public health problem. Many drugs used by pregnant women are off label without the necessary dose, efficacy, and safety data required for rational dosing regimens of these drugs. Thus, a major concern arising from the widespread use of drugs by pregnant women is the transfer of drugs across the placental barrier, leading to potential toxicity to the developing fetus. Knowledge regarding the ATP-binding cassette (ABC) efflux transporters, which play an important role in drug transfer across the placental barrier, is absolutely critical for optimizing the therapeutic strategy to treat the mother while protecting the fetus during pregnancy. Such transporters include P-glycoprotein (P-gp, gene symbol ABCB1), the breast cancer resistance protein (BCRP, gene symbol ABCG2), and the multidrug resistance proteins (MRPs, gene symbol ABCCs). In this review, we summarize the current knowledge with respect to developmental expression and regulation, membrane localization, functional significance, and genetic polymorphisms of these ABC transporters in the placenta and their relevance to fetal drug exposure and toxicity. PMID:21118087

  13. ATP Binding Turns Plant Cryptochrome Into an Efficient Natural Photoswitch

    PubMed Central

    Müller, Pavel; Bouly, Jean-Pierre; Hitomi, Kenichi; Balland, Véronique; Getzoff, Elizabeth D.; Ritz, Thorsten; Brettel, Klaus

    2014-01-01

    Cryptochromes are flavoproteins that drive diverse developmental light-responses in plants and participate in the circadian clock in animals. Plant cryptochromes have found application as photoswitches in optogenetics. We have studied effects of pH and ATP on the functionally relevant photoreduction of the oxidized FAD cofactor to the semi-reduced FADH· radical in isolated Arabidopsis cryptochrome 1 by transient absorption spectroscopy on nanosecond to millisecond timescales. In the absence of ATP, the yield of light-induced radicals strongly decreased with increasing pH from 6.5 to 8.5. With ATP present, these yields were significantly higher and virtually pH-independent up to pH 9. Analysis of our data in light of the crystallographic structure suggests that ATP-binding shifts the pKa of aspartic acid D396, the putative proton donor to FAD·−, from ~7.4 to >9, and favours a reaction pathway yielding long-lived aspartate D396−. Its negative charge could trigger conformational changes necessary for signal transduction. PMID:24898692

  14. Human polyoma JC virus minor capsid proteins, VP2 and VP3, enhance large T antigen binding to the origin of viral DNA replication: evidence for their involvement in regulation of the viral DNA replication.

    PubMed

    Saribas, A Sami; Mun, Sarah; Johnson, Jaslyn; El-Hajmoussa, Mohammad; White, Martyn K; Safak, Mahmut

    2014-01-20

    JC virus (JCV) lytically infects the oligodendrocytes in the central nervous system in a subset of immunocompromized patients and causes the demyelinating disease, progressive multifocal leukoencephalopathy. JCV replicates and assembles into infectious virions in the nucleus. However, understanding the molecular mechanisms of its virion biogenesis remains elusive. In this report, we have attempted to shed more light on this process by investigating molecular interactions between large T antigen (LT-Ag), Hsp70 and minor capsid proteins, VP2/VP3. We demonstrated that Hsp70 interacts with VP2/VP3 and LT-Ag; and accumulates heavily in the nucleus of the infected cells. We also showed that VP2/VP3 associates with LT-Ag through their DNA binding domains resulting in enhancement in LT-Ag DNA binding to Ori and induction in viral DNA replication. Altogether, our results suggest that VP2/VP3 and Hsp70 actively participate in JCV DNA replication and may play critical roles in coupling of viral DNA replication to virion encapsidation.

  15. Simian Virus Large T Antigen Interacts with the N-Terminal Domain of the 70 kD Subunit of Replication Protein A in the Same Mode as Multiple DNA Damage Response Factors

    PubMed Central

    Ning, Boting; Feldkamp, Michael D.; Cortez, David; Chazin, Walter J.; Friedman, Katherine L.

    2015-01-01

    Simian virus 40 (SV40) serves as an important model organism for studying eukaryotic DNA replication. Its helicase, Large T-antigen (Tag), is a multi-functional protein that interacts with multiple host proteins, including the ubiquitous ssDNA binding protein Replication Protein A (RPA). Tag recruits RPA, actively loads it onto the unwound DNA, and together they promote priming of the template. Although interactions of Tag with RPA have been mapped, no interaction between Tag and the N-terminal protein interaction domain of the RPA 70kDa subunit (RPA70N) has been reported. Here we provide evidence of direct physical interaction of Tag with RPA70N and map the binding sites using a series of pull-down and mutational experiments. In addition, a monoclonal anti-Tag antibody, the epitope of which overlaps with the binding site, blocks the binding of Tag to RPA70N. We use NMR chemical shift perturbation analysis to show that Tag uses the same basic cleft in RPA70N as multiple of DNA damage response proteins. Mutations in the binding sites of both RPA70N and Tag demonstrate that specific charge reversal substitutions in either binding partner strongly diminish the interaction. These results expand the known repertoire of contacts between Tag and RPA, which mediate the many critical roles of Tag in viral replication. PMID:25706313

  16. Complexed Structures of Formylglycinamide Ribonucleotide Amidotransferase from Thermotoga maritima Describe a Novel ATP Binding Protein Superfamily

    SciTech Connect

    Morar, Mariya; Anand, Ruchi; Hoskins, Aaron A.; Stubbe, JoAnne; Ealick, Steven E.

    2008-09-11

    Formylglycinamide ribonucleotide amidotransferase (FGAR-AT) catalyzes the ATP-dependent synthesis of formylglycinamidine ribonucleotide (FGAM) from formylglycinamide ribonucleotide (FGAR) and glutamine in the fourth step of the purine biosynthetic pathway. FGAR-AT is encoded by the purL gene. Two types of PurL have been detected. The first type, found in eukaryotes and Gram-negative bacteria, consists of a single 140 kDa polypeptide chain and is designated large PurL (lgPurL). The second type, small PurL (smPurL), is found in archaea and Gram-positive bacteria and consists of an 80 kDa polypeptide chain. SmPurL requires two additional gene products, PurQ and PurS, for activity. PurL is a member of a protein superfamily that contains a novel ATP-binding domain. Structures of several members of this superfamily are available in the unliganded form. We determined five different structures of FGAR-AT from Thermotoga maritima in the presence of substrates, a substrate analogue, and a product. These complexes have allowed a detailed description of the novel ATP-binding motif. The availability of a ternary complex enabled mapping of the active site, thus identifying potential residues involved in catalysis. The complexes show a conformational change in the active site compared to the unliganded structure. Surprising discoveries, an ATP molecule in an auxiliary site of the protein and the conformational changes associated with its binding, provoke speculation about the regulatory role of the auxiliary site in formation of the PurLSQ complex as well as the evolutionary relationship of PurLs from different organisms.

  17. ATP-binding cassette transporters in reproduction: a new frontier

    PubMed Central

    Bloise, E.; Ortiga-Carvalho, T.M.; Reis, F.M.; Lye, S.J.; Gibb, W.; Matthews, S.G.

    2016-01-01

    BACKGROUND The transmembrane ATP-binding cassette (ABC) transporters actively efflux an array of clinically relevant compounds across biological barriers, and modulate biodistribution of many physiological and pharmacological factors. To date, over 48 ABC transporters have been identified and shown to be directly and indirectly involved in peri-implantation events and fetal/placental development. They efflux cholesterol, steroid hormones, vitamins, cytokines, chemokines, prostaglandins, diverse xenobiotics and environmental toxins, playing a critical role in regulating drug disposition, immunological responses and lipid trafficking, as well as preventing fetal accumulation of drugs and environmental toxins. METHODS This review examines ABC transporters as important mediators of placental barrier functions and key reproductive processes. Expression, localization and function of all identified ABC transporters were systematically reviewed using PubMed and Google Scholar websites to identify relevant studies examining ABC transporters in reproductive tissues in physiological and pathophysiological states. Only reports written in English were incorporated with no restriction on year of publication. While a major focus has been placed on the human, extensive evidence from animal studies is utilized to describe current understanding of the regulation and function of ABC transporters relevant to human reproduction. RESULTS ABC transporters are modulators of steroidogenesis, fertilization, implantation, nutrient transport and immunological responses, and function as ‘gatekeepers’ at various barrier sites (i.e. blood-testes barrier and placenta) against potentially harmful xenobiotic factors, including drugs and environmental toxins. These roles appear to be species dependent and change as a function of gestation and development. The best-described ABC transporters in reproductive tissues (primarily in the placenta) are the multidrug transporters p-glycoprotein and

  18. Isolation and characterization of NIH 3T3 cells expressing polyomavirus small T antigen

    SciTech Connect

    Noda, T.; Satake, M.; Robins, T.; Ito, Y.

    1986-10-01

    The polyomavirus small T-antigen gene, together with the polyomavirus promoter, was inserted into retrovirus vector pGV16 which contains the Moloney sarcoma virus long terminal repeat and neomycin resistance gene driven by the simian virus 40 promoter. This expression vector, pGVST, was packaged into retrovirus particles by transfection of PSI2 cells which harbor packaging-defective murine retrovirus genome. NIH 3T3 cells were infected by this replication-defective retrovirus containing pGVST. Of the 15 G418-resistant cell clones, 8 express small T antigen at various levels as revealed by immunoprecipitation. A cellular protein with an apparent molecular weight of about 32,000 coprecipitates with small T antigen. Immunofluorescent staining shows that small T antigen is mainly present in the nuclei. Morphologically, cells expressing small T antigen are indistinguishable from parental NIH 3T3 cells and have a microfilament pattern similar to that in parental NIH 3T3 cells. Cells expressing small T antigen form a flat monolayer but continue to grow beyond the saturation density observed for parental NIH 3T3 cells and eventually come off the culture plate as a result of overconfluency. There is some correlation between the level of expression of small T antigen and the growth rate of the cells. Small T-antigen-expressing cells form small colonies in soft agar. However, the proportion of cells which form these small colonies is rather small. A clone of these cells tested did not form tumors in nude mice within 3 months after inoculation of 10/sup 6/ cells per animal. Thus, present studies establish that the small T antigen of polyomavirus is a second nucleus-localized transforming gene product of the virus (the first one being large T antigen) and by itself has a function which is to stimulate the growth of NIH 3T3 cells beyond their saturation density in monolayer culture.

  19. AP1 enhances polyomavirus DNA replication by promoting T-antigen-mediated unwinding of DNA.

    PubMed Central

    Guo, W; Tang, W J; Bu, X; Bermudez, V; Martin, M; Folk, W R

    1996-01-01

    An early step in the initiation of polyomavirus DNA replication is viral large-T-antigen-mediated unwinding of the origin. We report that components of the AP1 transcription factor, Fos and Jun, interact with T antigen in vitro to enhance unwinding of the viral origin. This provides a biochemical basis for the capacity of AP1 to activate viral DNA replication in vivo. PMID:8763994

  20. Characterization of am404, an amber mutation in the simian virus 40 T antigen gene.

    PubMed Central

    Rawlins, D R; Collis, P; Muzyczka, N

    1983-01-01

    We analyzed the biological activity of an amber mutation, am404, at map position 0.27 in the T antigen gene of simian virus 40. Immunoprecipitation of extracts from am404-infected cells demonstrated the presence of an amber protein fragment (am T antigen) of the expected molecular weight (67,000). Differential immunoprecipitation with monoclonal antibody demonstrated that am T antigen was missing the carboxy-terminal antigenic determinants. The amber mutant was shown to be defective for most of the functions associated with wild-type T antigen. The mutant did not replicate autonomously, but this defect could be complemented by a helper virus (D. R. Rawlins and N. Muzyczka, J. Virol. 36:611-616, 1980). The mutant failed to transform nonpermissive rodent cells and did not relieve the host range restriction of adenovirus 2 in monkey cells. However, stimulation of host cell DNA, whose functional region domain has been mapped within that portion of the protein synthesized by the mutant, could be demonstrated in am404-infected cells. A number of unexpected observations were made. First, the am T antigen was produced in unusually large amounts in a simian virus 40-transformed monkey cell line (COS-1), but overproduction was not seen in nontransformed monkey cells regardless of whether or not a helper virus was present. This feature of the mutant was presumably the result of the inability of am T antigen to autoregulate, the level of wild-type T antigen in COS-1 cells, and the unusually short half-life of am T antigen in vivo. Pulse-chase experiments indicated that am T antigen had an intracellular half-life of approximately 10 min. In addition, although the am T antigen retained the major phosphorylation site found in simian virus 40 T antigen, it was not phosphorylated. Thus, phosphorylation of simian virus 40 T antigen is not required for the stimulation of host cell DNA synthesis. Finally, fusion of am404-infected monkey cells with Escherichia coli protoplasts

  1. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum

    PubMed Central

    2013-01-01

    Background The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. Results We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. Conclusions The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control. PMID:23324493

  2. An ATP-binding cassette transporter is a major glycoprotein of sea urchin sperm membranes.

    PubMed

    Mengerink, Kathryn J; Vacquier, Victor D

    2002-10-25

    Sperm are terminally differentiated cells that undergo several membrane-altering events before fusion with eggs. One event, the sea urchin sperm acrosome reaction (AR), is blocked by the lectin wheat germ agglutinin (WGA). In an effort to identify proteins involved in the AR induction, the peptide sequence was obtained from a 220-kDa WGA-binding protein. Degenerate PCR and library screening resulted in the full-length deduced amino acid sequence of an ATP-binding cassette transporter, suABCA. The protein of 1,764 residues has two transmembrane regions, two nucleotide-binding domains, and is most closely related to the human ABC subfamily A member 3 transporter (ABCA3). Sequence analysis suggests a large extracellular loop between transmembrane spanning segments 7 and 8, with five N-linked glycosylation sites. An antibody made to the loop region binds to non-permeabilized cells, supporting that this region is extracellular. suABCA is found in sperm membrane vesicles, it can be solubilized with nonionic detergents, and it shifts from 220 to 200 kDa upon protein:N-glycanase F digestion. suABCA localizes to the entire surface of sperm in a punctate pattern, but is not detected in lipid rafts. Based on its relationship to subfamily A, suABCA is most likely involved in phospholipid or cholesterol transport. This is the first investigation of an ABC transporter in animal sperm.

  3. Mutational analysis of simian virus 40 T antigen: isolation and characterization of mutants with deletions in the T-antigen gene.

    PubMed Central

    Pipas, J M; Peden, K W; Nathans, D

    1983-01-01

    A series of mutants of simian virus 40 has been constructed with deletions in the coding sequence for large T antigen. Nucleotide sequence analysis indicates that 4 mutants have in-phase and 11 have out-of-phase deletions. Mutant DNAs were assayed for the following activities: the ability to form plaques, the ability to produce T antigen as scored by indirect immunofluorescence, viral DNA replication, and morphological transformation of rat cells. Two viable mutants were found, and these had deletions confined to the carboxyl terminus of T antigen. Only those mutants coding for polypeptides greater than 40% of the length of wildtype T antigen produced detectable nuclear fluorescence. The two viable mutants with deletions in the carboxyl terminus of the protein retained the ability both to replicate their DNA, although at a reduced level, and to transform nonpermissive cells. Mutants with sequence changes that result in the loss of more than 117 amino acids from the carboxyl terminus were not viable and were also defective in the DNA replication and transformation functions of T antigen, although several produced detectable nuclear fluorescence. These functions were also sensitive to the removal of amino acids near the amino terminus and in the middle of the protein. Images PMID:6300656

  4. Influence of ATP-binding cassette transporters in root exudation of phytoalexins, signals, and disease resistance

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The roots of plants secrete compounds as a way to exchange information with organ-isms living in the soil. Here, we report the involvement of seven root-expressed ATP-binding cassette (ABC) transporters corresponding to both full and half-size molecules (Atabcg36, Atabcg37, Atabcc5, Atabcf1, Atabcf3...

  5. Molecular mechanism of ATP binding and ion channel activation in P2X receptors

    SciTech Connect

    Hattori, Motoyuki; Gouaux, Eric

    2012-10-24

    P2X receptors are trimeric ATP-activated ion channels permeable to Na{sup +}, K{sup +} and Ca{sup 2+}. The seven P2X receptor subtypes are implicated in physiological processes that include modulation of synaptic transmission, contraction of smooth muscle, secretion of chemical transmitters and regulation of immune responses. Despite the importance of P2X receptors in cellular physiology, the three-dimensional composition of the ATP-binding site, the structural mechanism of ATP-dependent ion channel gating and the architecture of the open ion channel pore are unknown. Here we report the crystal structure of the zebrafish P2X4 receptor in complex with ATP and a new structure of the apo receptor. The agonist-bound structure reveals a previously unseen ATP-binding motif and an open ion channel pore. ATP binding induces cleft closure of the nucleotide-binding pocket, flexing of the lower body {beta}-sheet and a radial expansion of the extracellular vestibule. The structural widening of the extracellular vestibule is directly coupled to the opening of the ion channel pore by way of an iris-like expansion of the transmembrane helices. The structural delineation of the ATP-binding site and the ion channel pore, together with the conformational changes associated with ion channel gating, will stimulate development of new pharmacological agents.

  6. Detergent-free purification of ABC (ATP-binding-cassette) transporters.

    PubMed

    Gulati, Sonali; Jamshad, Mohammed; Knowles, Timothy J; Morrison, Kerrie A; Downing, Rebecca; Cant, Natasha; Collins, Richard; Koenderink, Jan B; Ford, Robert C; Overduin, Michael; Kerr, Ian D; Dafforn, Timothy R; Rothnie, Alice J

    2014-07-15

    ABC (ATP-binding-cassette) transporters carry out many vital functions and are involved in numerous diseases, but study of the structure and function of these proteins is often hampered by their large size and membrane location. Membrane protein purification usually utilizes detergents to solubilize the protein from the membrane, effectively removing it from its native lipid environment. Subsequently, lipids have to be added back and detergent removed to reconstitute the protein into a lipid bilayer. In the present study, we present the application of a new methodology for the extraction and purification of ABC transporters without the use of detergent, instead, using a copolymer, SMA (polystyrene-co-maleic acid). SMA inserts into a bilayer and assembles into discrete particles, essentially solubilizing the membrane into small discs of bilayer encircled by a polymer, termed SMALPs (SMA lipid particles). We show that this polymer can extract several eukaryotic ABC transporters, P-glycoprotein (ABCB1), MRP1 (multidrug-resistance protein 1; ABCC1), MRP4 (ABCC4), ABCG2 and CFTR (cystic fibrosis transmembrane conductance regulator; ABCC7), from a range of different expression systems. The SMALP-encapsulated ABC transporters can be purified by affinity chromatography, and are able to bind ligands comparably with those in native membranes or detergent micelles. A greater degree of purity and enhanced stability is seen compared with detergent solubilization. The present study demonstrates that eukaryotic ABC transporters can be extracted and purified without ever being removed from their lipid bilayer environment, opening up a wide range of possibilities for the future study of their structure and function.

  7. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells

    PubMed Central

    Lara, Flavio Alves; Pohl, Paula C.; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H. F.; Almeida, Igor C.; Vaz, Itabajara da Silva; Oliveira, Pedro L.

    2015-01-01

    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  8. ATP Binding Cassette Transporter Mediates Both Heme and Pesticide Detoxification in Tick Midgut Cells.

    PubMed

    Lara, Flavio Alves; Pohl, Paula C; Gandara, Ana Caroline; Ferreira, Jessica da Silva; Nascimento-Silva, Maria Clara; Bechara, Gervásio Henrique; Sorgine, Marcos H F; Almeida, Igor C; Vaz, Itabajara da Silva; Oliveira, Pedro L

    2015-01-01

    In ticks, the digestion of blood occurs intracellularly and proteolytic digestion of hemoglobin takes place in a dedicated type of lysosome, the digest vesicle, followed by transfer of the heme moiety of hemoglobin to a specialized organelle that accumulates large heme aggregates, called hemosomes. In the present work, we studied the uptake of fluorescent metalloporphyrins, used as heme analogs, and amitraz, one of the most regularly used acaricides to control cattle tick infestations, by Rhipicephalus (Boophilus) microplus midgut cells. Both compounds were taken up by midgut cells in vitro and accumulated inside the hemosomes. Transport of both molecules was sensitive to cyclosporine A (CsA), a well-known inhibitor of ATP binding cassette (ABC) transporters. Rhodamine 123, a fluorescent probe that is also a recognized ABC substrate, was similarly directed to the hemosome in a CsA-sensitive manner. Using an antibody against conserved domain of PgP-1-type ABC transporter, we were able to immunolocalize PgP-1 in the digest vesicle membranes. Comparison between two R. microplus strains that were resistant and susceptible to amitraz revealed that the resistant strain detoxified both amitraz and Sn-Pp IX more efficiently than the susceptible strain, a process that was also sensitive to CsA. A transcript containing an ABC transporter signature exhibited 2.5-fold increased expression in the amitraz-resistant strain when compared with the susceptible strain. RNAi-induced down-regulation of this ABC transporter led to the accumulation of metalloporphyrin in the digestive vacuole, interrupting heme traffic to the hemosome. This evidence further confirms that this transcript codes for a heme transporter. This is the first report of heme transport in a blood-feeding organism. While the primary physiological function of the hemosome is to detoxify heme and attenuate its toxicity, we suggest that the use of this acaricide detoxification pathway by ticks may represent a new

  9. Adipocyte ATP-binding cassette G1 promotes triglyceride storage, fat mass growth, and human obesity.

    PubMed

    Frisdal, Eric; Le Lay, Soazig; Hooton, Henri; Poupel, Lucie; Olivier, Maryline; Alili, Rohia; Plengpanich, Wanee; Villard, Elise F; Gilibert, Sophie; Lhomme, Marie; Superville, Alexandre; Miftah-Alkhair, Lobna; Chapman, M John; Dallinga-Thie, Geesje M; Venteclef, Nicolas; Poitou, Christine; Tordjman, Joan; Lesnik, Philippe; Kontush, Anatol; Huby, Thierry; Dugail, Isabelle; Clement, Karine; Guerin, Maryse; Le Goff, Wilfried

    2015-03-01

    The role of the ATP-binding cassette G1 (ABCG1) transporter in human pathophysiology is still largely unknown. Indeed, beyond its role in mediating free cholesterol efflux to HDL, the ABCG1 transporter equally promotes lipid accumulation in a triglyceride (TG)-rich environment through regulation of the bioavailability of lipoprotein lipase (LPL). Because both ABCG1 and LPL are expressed in adipose tissue, we hypothesized that ABCG1 is implicated in adipocyte TG storage and therefore could be a major actor in adipose tissue fat accumulation. Silencing of Abcg1 expression by RNA interference in 3T3-L1 preadipocytes compromised LPL-dependent TG accumulation during the initial phase of differentiation. Generation of stable Abcg1 knockdown 3T3-L1 adipocytes revealed that Abcg1 deficiency reduces TG storage and diminishes lipid droplet size through inhibition of Pparγ expression. Strikingly, local inhibition of adipocyte Abcg1 in adipose tissue from mice fed a high-fat diet led to a rapid decrease of adiposity and weight gain. Analysis of two frequent ABCG1 single nucleotide polymorphisms (rs1893590 [A/C] and rs1378577 [T/G]) in morbidly obese individuals indicated that elevated ABCG1 expression in adipose tissue was associated with increased PPARγ expression and adiposity concomitant to increased fat mass and BMI (haplotype AT>GC). The critical role of ABCG1 in obesity was further confirmed in independent populations of severe obese and diabetic obese individuals. This study identifies for the first time a major role of adipocyte ABCG1 in adiposity and fat mass growth and suggests that adipose ABCG1 might represent a potential therapeutic target in obesity.

  10. ATP binding cassette modulators control abscisic acid-regulated slow anion channels in guard cells

    PubMed Central

    Leonhardt, N; Vavasseur, A; Forestier, C

    1999-01-01

    In animal cells, ATP binding cassette (ABC) proteins are a large family of transporters that includes the sulfonylurea receptor and the cystic fibrosis transmembrane conductance regulator (CFTR). These two ABC proteins possess an ion channel activity and bind specific sulfonylureas, such as glibenclamide, but homologs have not been identified in plant cells. We recently have shown that there is an ABC protein in guard cells that is involved in the control of stomatal movements and guard cell outward K+ current. Because the CFTR, a chloride channel, is sensitive to glibenclamide and able to interact with K+ channels, we investigated its presence in guard cells. Potent CFTR inhibitors, such as glibenclamide and diphenylamine-2-carboxylic acid, triggered stomatal opening in darkness. The guard cell protoplast slow anion current that was recorded using the whole-cell patch-clamp technique was inhibited rapidly by glibenclamide in a dose-dependent manner; the concentration producing half-maximum inhibition was at 3 &mgr;M. Potassium channel openers, which bind to and act through the sulfonylurea receptor in animal cells, completely suppressed the stomatal opening induced by glibenclamide and recovered the glibenclamide-inhibited slow anion current. Abscisic acid is known to regulate slow anion channels and in our study was able to relieve glibenclamide inhibition of slow anion current. Moreover, in epidermal strip bioassays, the stomatal closure triggered by Ca2+ or abscisic acid was reversed by glibenclamide. These results suggest that the slow anion channel is an ABC protein or is tightly controlled by such a protein that interacts with the abscisic acid signal transduction pathway in guard cells. PMID:10368184

  11. The Deviant ATP-binding Site of the Multidrug Efflux Pump Pdr5 Plays an Active Role in the Transport Cycle*

    PubMed Central

    Furman, Christopher; Mehla, Jitender; Ananthaswamy, Neeti; Arya, Nidhi; Kulesh, Bridget; Kovach, Ildiko; Ambudkar, Suresh V.; Golin, John

    2013-01-01

    Pdr5 is the founding member of a large subfamily of evolutionarily distinct, clinically important fungal ABC transporters containing a characteristic, deviant ATP-binding site with altered Walker A, Walker B, Signature (C-loop), and Q-loop residues. In contrast to these motifs, the D-loops of the two ATP-binding sites have similar sequences, including a completely conserved aspartate residue. Alanine substitution mutants in the deviant Walker A and Signature motifs retain significant, albeit reduced, ATPase activity and drug resistance. The D-loop residue mutants D340A and D1042A showed a striking reduction in plasma membrane transporter levels. The D1042N mutation localized properly had nearly WT ATPase activity but was defective in transport and was profoundly hypersensitive to Pdr5 substrates. Therefore, there was a strong uncoupling of ATPase activity and drug efflux. Taken together, the properties of the mutants suggest an additional, critical intradomain signaling role for deviant ATP-binding sites. PMID:24019526

  12. Simulation of the coupling between nucleotide binding and transmembrane domains in the ATP binding cassette transporter BtuCD.

    PubMed

    Sonne, Jacob; Kandt, Christian; Peters, Günther H; Hansen, Flemming Y; Jensen, Morten Ø; Tieleman, D Peter

    2007-04-15

    The nucleotide-induced structural rearrangements in ATP binding cassette (ABC) transporters, leading to substrate translocation, are largely unknown. We have modeled nucleotide binding and release in the vitamin B(12) importer BtuCD using perturbed elastic network calculations and biased molecular dynamics simulations. Both models predict that nucleotide release decreases the tilt between the two transmembrane domains and opens the cytoplasmic gate. Nucleotide binding has the opposite effect. The observed coupling may be relevant for all ABC transporters because of the conservation of nucleotide binding domains and the shared role of ATP in ABC transporters. The rearrangements in the cytoplasmic gate region do not provide enough space for B(12) to diffuse from the transporter pore into the cytoplasm, which could suggest that peristaltic forces are needed to exclude B(12) from the transporter pore.

  13. Molecular determinants for ATP-binding in proteins: a data mining and quantum chemical analysis.

    PubMed

    Mao, Lisong; Wang, Yanli; Liu, Yuemin; Hu, Xiche

    2004-02-20

    intermolecular interactions of large biomolecular systems becomes computationally feasible. The establishment of the molecular basis for recognition of the adenine moiety of ATP in proteins will directly impact molecular design of ATP-binding site targeted enzyme inhibitors such as kinase inhibitors.

  14. The power stroke driven by ATP binding in CFTR as studied by molecular dynamics simulations.

    PubMed

    Furukawa-Hagiya, Tomoka; Furuta, Tadaomi; Chiba, Shuntaro; Sohma, Yoshiro; Sakurai, Minoru

    2013-01-10

    Cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel belonging to the ATP binding cassette (ABC) protein superfamily. Currently, it remains unclear how ATP binding causes the opening of the channel gate at the molecular level. To clarify this mechanism, we first constructed an atomic model of the inward-facing CFTR using the X-ray structures of other ABC proteins. Molecular dynamics (MD) simulations were then performed to explore the structure and dynamics of the inward-facing CFTR in a membrane environment. In the MgATP-bound state, two nucleotide-binding domains (NBDs) formed a head-to-tail type of dimer, in which the ATP molecules were sandwiched between the Walker A and signature motifs. Alternatively, one of the final MD structures in the apo state was similar to that of a "closed-apo" conformation found in the X-ray analysis of ATP-free MsbA. Principal component analysis for the MD trajectory indicated that NBD dimerization causes significant structural and dynamical changes in the transmembrane domains (TMDs), which is likely indicative of the formation of a chloride ion access path. This study suggests that the free energy gain from ATP binding acts as a driving force not only for NBD dimerization but also for NBD-TMD concerted motions.

  15. [Detection of T-antigen in colorectal adenocarcinoma and polyps].

    PubMed

    Xu, S; Lu, Y; Wang, Q

    1995-10-01

    Galactose oxidase method was employed to detect the beta-D-Gal (1-->3) -D-Gal NAc residue of T-antigen present in the large intestinal mucus of 156 subjects. The positive rates of the test were 84.4%, 29.1%, and 7.2% in the mucus samples obtained from 32 patients with colorectal adenocarcinomas, 55 with polyps and 69 controls respectively. Chi-square test demonstrated that there were significant differences between the group of carcinoma and control (P < 0.001) as well as between also polyp and control (P < 0.01). The test had a high sensitivity (84.4%) and specificity (92.8%) in the diagnosis of colorectal cancer and may be used as a practical mass screening test for colorectal neoplasms.

  16. Structural and Enzymatic Insights into the ATP Binding and Autophosphorylation Mechanism of a Sensor Histidine Kinase*

    PubMed Central

    Trajtenberg, Felipe; Graña, Martin; Ruétalo, Natalia; Botti, Horacio; Buschiazzo, Alejandro

    2010-01-01

    DesK is a sensor histidine kinase (HK) that allows Bacillus subtilis to respond to cold shock, triggering the adaptation of membrane fluidity via transcriptional control of a fatty acid desaturase. It belongs to the HK family HPK7, which includes the nitrogen metabolism regulators NarX/Q and the antibiotic sensor LiaS among other important sensor kinases. Structural information on different HK families is still scarce and several questions remain, particularly concerning the molecular features that determine HK specificity during its catalytic autophosphorylation and subsequent response-regulator phosphotransfer reactions. To analyze the ATP-binding features of HPK7 HKs and dissect their mechanism of autophosphorylation at the molecular level, we have studied DesK in complex with ATP using high resolution structural approaches in combination with biochemical studies. We report the first crystal structure of an HK in complex with its natural nucleotidic substrate. The general fold of the ATP-binding domain of DesK is conserved, compared with well studied members of other families. Yet, DesK displays a far more compact structure at the ATP-binding pocket: the ATP lid loop is much shorter with no secondary structural organization and becomes ordered upon ATP loading. Sequence conservation mapping onto the molecular surface, semi-flexible protein-protein docking simulations, and structure-based point mutagenesis allow us to propose a specific domain-domain geometry during autophosphorylation catalysis. Supporting our hypotheses, we have been able to trap an autophosphorylating intermediate state, by protein engineering at the predicted domain-domain interaction surface. PMID:20507988

  17. Cystic fibrosis transmembrane conductance regulator: a chloride channel gated by ATP binding and hydrolysis.

    PubMed

    Bompadre, Silvia G; Hwang, Tzyh-Chang

    2007-08-25

    The cystic fibrosis transmembrane conductance regulator (CFTR) is a chloride channel that belongs to the ATP-binding cassette (ABC) transporter superfamily. Defective function of CFTR is responsible for cystic fibrosis (CF), the most common lethal autosomal recessive disorder in Caucasian populations. The disease is manifested in defective chloride transport across the epithelial cells in various tissues. To date, more than 1400 different mutations have been identified as CF-associated. CFTR is regulated by phosphorylation in its regulatory (R) domain, and gated by ATP binding and hydrolysis at its two nucleotide-binding domains (NBD1 and NBD2). Recent studies reveal that the NBDs of CFTR may dimerize as observed in other ABC proteins. Upon dimerization of CFTR's two NBDs, in a head-to-tail configuration, the two ATP-binding pockets (ABP1 and ABP2) are formed by the canonical Walker A and B motifs from one NBD and the signature sequence from the partner NBD. Mutations of the amino acids that interact with ATP reveal that the two ABPs play distinct roles in controlling ATP-dependent gating of CFTR. It was proposed that binding of ATP to the ABP2, which is formed by the Walker A and B in NBD2 and the signature sequence in NBD1, is critical for catalyzing channel opening. While binding of ATP to the ABP1 alone may not increase the opening rate, it does contribute to the stabilization of the open channel conformation. Several disease-associated mutations of the CFTR channel are characterized by gating defects. Understanding how CFTR's two NBDs work together to gate the channel could provide considerable mechanistic information for future pharmacological studies, which could pave the way for tailored drug design for therapeutical interventions in CF.

  18. ATP binding and hydrolysis by Saccharomyces cerevisiae Msh2-Msh3 are differentially modulated by mismatch and double-strand break repair DNA substrates.

    PubMed

    Kumar, Charanya; Eichmiller, Robin; Wang, Bangchen; Williams, Gregory M; Bianco, Piero R; Surtees, Jennifer A

    2014-06-01

    In Saccharomyces cerevisiae, Msh2-Msh3-mediated mismatch repair (MMR) recognizes and targets insertion/deletion loops for repair. Msh2-Msh3 is also required for 3' non-homologous tail removal (3'NHTR) in double-strand break repair. In both pathways, Msh2-Msh3 binds double-strand/single-strand junctions and initiates repair in an ATP-dependent manner. However, we recently demonstrated that the two pathways have distinct requirements with respect to Msh2-Msh3 activities. We identified a set of aromatic residues in the nucleotide binding pocket (FLY motif) of Msh3 that, when mutated, disrupted MMR, but left 3'NHTR largely intact. One of these mutations, msh3Y942A, was predicted to disrupt the nucleotide sandwich and allow altered positioning of ATP within the pocket. To develop a mechanistic understanding of the differential requirements for ATP binding and/or hydrolysis in the two pathways, we characterized Msh2-Msh3 and Msh2-msh3Y942A ATP binding and hydrolysis activities in the presence of MMR and 3'NHTR DNA substrates. We observed distinct, substrate-dependent ATP hydrolysis and nucleotide turnover by Msh2-Msh3, indicating that the MMR and 3'NHTR DNA substrates differentially modify the ATP binding/hydrolysis activities of Msh2-Msh3. Msh2-msh3Y942A retained the ability to bind DNA and ATP but exhibited altered ATP hydrolysis and nucleotide turnover. We propose that both ATP and structure-specific repair substrates cooperate to direct Msh2-Msh3-mediated repair and suggest an explanation for the msh3Y942A separation-of-function phenotype.

  19. Functionally Important ATP Binding and Hydrolysis Sites in Escherichia coli MsbA †

    PubMed Central

    Westfahl, Kathryn M.; Merten, Jacqueline A.; Buchaklian, Adam H.; Klug, Candice S.

    2009-01-01

    ATP-binding cassette (ABC) transporters make up one of the largest classes of proteins found in nature, and their ability to move a variety of substrates across the membrane using energy from the binding or hydrolysis of ATP is essential to an array of human pathologies and to bacterial viability. MsbA is an essential ABC transporter that specifically transports lipid A across the inner membranes of Gram-negative organisms such as Escherichia coli. The exact mechanisms of function during the binding and hydrolysis of ATP at the molecular level remain unclear. The studies presented and summarized in this work directly address the role and local dynamics of specific residues within the conserved ABC motifs in E. coli MsbA using in vivo growth and biochemical activity assays coupled with site-directed spin labeling electron paramagnetic resonance (EPR) spectroscopy motional and accessibility analysis. This first comprehensive analysis of the specific residues in these motifs within MsbA indicates that closure of the dimer interface does not occur upon ATP binding in this transporter. PMID:19053284

  20. The Lipid Bilayer Modulates the Structure and Function of an ATP-binding Cassette Exporter.

    PubMed

    Zoghbi, Maria E; Cooper, Rebecca S; Altenberg, Guillermo A

    2016-02-26

    ATP-binding cassette exporters use the energy of ATP hydrolysis to transport substrates across membranes by switching between inward- and outward-facing conformations. Essentially all structural studies of these proteins have been performed with the proteins in detergent micelles, locked in specific conformations and/or at low temperature. Here, we used luminescence resonance energy transfer spectroscopy to study the prototypical ATP-binding cassette exporter MsbA reconstituted in nanodiscs at 37 °C while it performs ATP hydrolysis. We found major differences when comparing MsbA in these native-like conditions with double electron-electron resonance data and the crystal structure of MsbA in the open inward-facing conformation. The most striking differences include a significantly smaller separation between the nucleotide-binding domains and a larger fraction of molecules with associated nucleotide-binding domains in the nucleotide-free apo state. These studies stress the importance of studying membrane proteins in an environment that approaches physiological conditions.

  1. Tumorigenic activity of Merkel cell polyomavirus T antigens expressed in the stratified epithelium of mice

    PubMed Central

    Spurgeon, Megan E.; Cheng, Jingwei; Bronson, Roderick T.; Lambert, Paul F.; DeCaprio, James A.

    2015-01-01

    Merkel cell polyomavirus (MCPyV) is frequently associated with Merkel cell carcinoma (MCC), a highly aggressive neuroendocrine skin cancer. Most MCC tumors contain integrated copies of the viral genome with persistent expression of the MCPyV large T (LT) and small T (ST) antigen. MCPyV isolated from MCC typically contain wild type ST but truncated forms of LT that retain the N-terminus but delete the C-terminus and render LT incapable of supporting virus replication. To determine the oncogenic activity of MCC tumor-derived T antigens in vivo, a conditional, tissue-specific mouse model was developed. Keratin 14-mediated Cre recombinase expression induced expression of MCPyV T antigens in stratified squamous epithelial cells and Merkel cells of the skin epidermis. Mice expressing MCPyV T antigens developed hyperplasia, hyperkeratosis, and acanthosis of the skin with additional abnormalities in whisker pads, footpads and eyes. Nearly half of the mice also developed cutaneous papillomas. Evidence for neoplastic progression within stratified epithelia included increased cellular proliferation, unscheduled DNA synthesis, increased E2F-responsive genes levels, disrupted differentiation, and presence of a DNA damage response. These results indicate that MCPyV T antigens are tumorigenic in vivo, consistent with their suspected etiological role in human cancer. PMID:25596282

  2. The nodulin vfENOD18 is an ATP-binding protein in infected cells of Vicia faba L. nodules.

    PubMed

    Becker, J D; Moreira, L M; Kapp, D; Frosch, S C; Pühler, A; Perlic, A M

    2001-12-01

    Recently we described the novel nodulin gene VfENOD18, whose corresponding transcripts were restricted to the nitrogen-fixing zone III of broad bean root nodules. To characterize VfENOD18 on the protein level, polyclonal antibodies were generated using the purified recombinant VfENOD18 protein produced in Escherichia coli by employing the pMAL-c expression system. These antibodies recognized immunoreactive proteins isolated from indeterminate nodules of different leguminous plants, but also from non-symbiotic tissues of Glycine max and from tissues of Arabidopsis thaliana and Zea mays. Using immunogold labelling the nodulin VfENOD18 was localized to the cytoplasm of infected cells in the nitrogen-fixing zone of broad bean nodules. Due to the homology of the VfENOD18 sequence to that of the ATP-binding protein MJ0577 from the hyperthermophile Methanococcus jannaschii the recombinant VfENOD18 protein was tested for ATP-binding. Using the biotin photoaffinity ATP analogue 8N3ATP[gamma]biotin it could be demonstrated that VfENOD18 is an ATP-binding protein. PCR experiments revealed that the amino acid sequences of the putative C-terminal ATP-binding sites of the VfENOD 18 homologues from Lens culinaris, Vicia hirsuta, Vicia sativa and Vicia villosa were conserved. We propose that VfENOD18 is a member of a novel family of ATP-binding proteins in plants.

  3. Whole-genome survey of the putative ATP-binding cassette transporter family genes in Vitis vinifera.

    PubMed

    Çakır, Birsen; Kılıçkaya, Ozan

    2013-01-01

    The ATP-binding cassette (ABC) protein superfamily constitutes one of the largest protein families known in plants. In this report, we performed a complete inventory of ABC protein genes in Vitis vinifera, the whole genome of which has been sequenced. By comparison with ABC protein members of Arabidopsis thaliana, we identified 135 putative ABC proteins with 1 or 2 NBDs in V. vinifera. Of these, 120 encode intrinsic membrane proteins, and 15 encode proteins missing TMDs. V. vinifera ABC proteins can be divided into 13 subfamilies with 79 "full-size," 41 "half-size," and 15 "soluble" putative ABC proteins. The main feature of the Vitis ABC superfamily is the presence of 2 large subfamilies, ABCG (pleiotropic drug resistance and white-brown complex homolog) and ABCC (multidrug resistance-associated protein). We identified orthologs of V. vinifera putative ABC transporters in different species. This work represents the first complete inventory of ABC transporters in V. vinifera. The identification of Vitis ABC transporters and their comparative analysis with the Arabidopsis counterparts revealed a strong conservation between the 2 species. This inventory could help elucidate the biological and physiological functions of these transporters in V. vinifera.

  4. The ATP-binding cassette transporter-2 (ABCA2) regulates esterification of plasma membrane cholesterol by modulation of sphingolipid metabolism.

    PubMed

    Davis, Warren

    2014-01-01

    The ATP-binding cassette transporters are a large family (~48 genes divided into seven families A-G) of proteins that utilize the energy of ATP-hydrolysis to pump substrates across lipid bilayers against a concentration gradient. The ABC "A" subfamily is comprised of 13 members and transport sterols, phospholipids and bile acids. ABCA2 is the most abundant ABC transporter in human and rodent brain with highest expression in oligodendrocytes, although it is also expressed in neurons. Several groups have studied a possible connection between ABCA2 and Alzheimer's disease as well as early atherosclerosis. ABCA2 expression levels have been associated with changes in cholesterol and sphingolipid metabolism. In this paper, we hypothesized that ABCA2 expression level may regulate esterification of plasma membrane-derived cholesterol by modulation of sphingolipid metabolism. ABCA2 overexpression in N2a neuroblastoma cells was associated with an altered bilayer distribution of the sphingolipid ceramide that inhibited acylCoA:cholesterol acyltransferase (ACAT) activity and cholesterol esterification. In contrast, depletion of endogenous ABCA2 in the rat schwannoma cell line D6P2T increased esterification of plasma membrane cholesterol following treatment with exogenous bacterial sphingomyelinase. These findings suggest that control of ABCA2 expression level may be a key locus of regulation for esterification of plasma membrane-derived cholesterol through modulation of sphingolipid metabolism.

  5. Multiple ATP-binding cassette transporters are involved in insecticide resistance in the small brown planthopper, Laodelphax striatellus.

    PubMed

    Sun, H; Pu, J; Chen, F; Wang, J; Han, Z

    2017-03-16

    ATP-binding cassette (ABC) transporters are membrane-bound proteins involved in the movement of various substrates, including drugs and insecticides, across the lipid membrane. Demonstration of the role of human ABC transporters in multidrug resistance has led to speculation that they might be an important mechanism controlling the fate of insecticides in insects. However, the role of ABC transporters in insects remains largely unknown. The small brown planthopper, Laodelphax striatellus Fallén, has developed resistance to most of the insecticides used for its control. Our goals were to identify the ABC transporters in La. striatellus and to examine their involvement in resistance mechanisms, using related strains resistant to chlorpyrifos, deltamethrin and imidacloprid, compared with the susceptible strain. Based on the transcriptome of La. striatellus, 40 full-length ABC transporters belonging to the ABCA-ABCH subfamilies were identified. Quantitative PCR revealed that over 20% of genes were significantly up-regulated in different resistant strains, and eight genes from the ABCB/C/D/G subfamilies were up-regulated in all three resistant strains, compared with the susceptible strain. Furthermore, synergism studies showed verapamil significantly enhanced insecticide toxicity in various resistant strains but not in the susceptible strain. These results suggest that ABC transporters might be involved in resistance to multiple insecticides in La. striatellus.

  6. Trapping the transition state of an ATP-binding cassette transporter: Evidence for a concerted mechanism of maltose transport

    PubMed Central

    Chen, Jue; Sharma, Susan; Quiocho, Florante A.; Davidson, Amy L.

    2001-01-01

    High-affinity uptake into bacterial cells is mediated by a large class of periplasmic binding protein-dependent transport systems, members of the ATP-binding cassette superfamily. In the maltose transport system of Escherichia coli, the periplasmic maltose-binding protein binds its substrate maltose with high affinity and, in addition, stimulates the ATPase activity of the membrane-associated transporter when maltose is present. Vanadate inhibits maltose transport by trapping ADP in one of the two nucleotide-binding sites of the membrane transporter immediately after ATP hydrolysis, consistent with its ability to mimic the transition state of the γ-phosphate of ATP during hydrolysis. Here we report that the maltose-binding protein becomes tightly associated with the membrane transporter in the presence of vanadate and simultaneously loses its high affinity for maltose. These results suggest a general model explaining how ATP hydrolysis is coupled to substrate transport in which a binding protein stimulates the ATPase activity of its cognate transporter by stabilizing the transition state. PMID:11171984

  7. Transport in technicolor: Mapping ATP-binding cassette transporters in sea urchin embryos

    PubMed Central

    Gökirmak, Tufan; Shipp, Lauren E.; Campanale, Joseph P.; Nicklisch, Sascha C.T.; Hamdoun, Amro

    2014-01-01

    One quarter of eukaryotic genes encode membrane proteins. These include nearly 1000 transporters that translocate nutrients, signaling molecules, and xenobiotics across membranes. While it is well appreciated that membrane transport is critical for development, the specific roles of many transporters have remained cryptic, in part because of their abundance and the diversity of their substrates. Multi-drug resistance ATP-binding cassette (ABC) efflux transporters are one example of cryptic membrane proteins. Although most organisms utilize these ABC transporters during embryonic development, many of these transporters have broad substrate specificity, and their developmental functions remain incompletely understood. Here, we review advances in our understanding of ABC transporters in sea urchin embryos, and methods developed to spatially and temporally map these proteins. These studies reveal that multifunctional transporters are required for signaling, homeostasis, and protection of the embryo, and shed light on how they are integrated into ancestral developmental pathways recapitulated in disease. PMID:25156004

  8. ATP-binding cassette transporters in tumor endothelial cells and resistance to metronomic chemotherapy.

    PubMed

    Hida, Kyoko; Kikuchi, Hiroshi; Maishi, Nako; Hida, Yasuhiro

    2017-02-16

    Drug resistance is a major problem in anticancer therapy. ATP-binding cassette (ABC) transporters have a role in the multidrug resistance. A new regimen of chemotherapy has been proposed, called "metronomic chemotherapy". Metronomic chemotherapy is the frequent, regular administration of drug doses designed to maintain low, but active, concentrations of chemotherapeutic drugs over prolonged periods of time, without causing serious toxicities. Metronomic chemotherapy regimens were developed to optimize the antitumor efficacy of agents that target the tumor vasculature instead of tumor cells, and to reduce toxicity of antineoplastic drugs [1]. Nevertheless, recent studies revealed that ABC transporters are expressed at a higher level in the endothelium in the tumor. To avoid resistance to metronomic anti-angiogenic chemotherapy, ABC transporter inhibition of tumor endothelial cells may be a promising strategy. In this mini-review, we discuss the possible mechanism of resistance to metronomic chemotherapy from the viewpoint of tumor endothelial cell biology, focusing on ABC transporters.

  9. Protection against chemotherapy-induced alopecia: targeting ATP-binding cassette transporters in the hair follicle?

    PubMed

    Haslam, Iain S; Pitre, Aaron; Schuetz, John D; Paus, Ralf

    2013-11-01

    Currently, efficacious treatments for chemotherapy-induced alopecia (hair loss) are lacking, and incidences of permanent hair loss following high-dose chemotherapy are on the increase. In this article, we describe mechanisms by which the pharmacological defense status of the hair follicle might be enhanced, thereby reducing the accumulation of cytotoxic cancer drugs and preventing or reducing hair loss and damage. We believe this could be achieved via the selective increase in ATP-binding cassette (ABC) transporter expression within the hair follicle epithelium, following application of topical agonists for regulatory nuclear receptors. Clinical application would require the development of hair follicle-targeted formulations, potentially utilizing nanoparticle technology. This novel approach has the potential to yield entirely new therapeutic options for the treatment and management of chemotherapy-induced alopecia, providing significant psychological and physical benefit to cancer patients.

  10. The ATP binding cassette transporter, ABCG1, localizes to cortical actin filaments

    PubMed Central

    Pandzic, Elvis; Gelissen, Ingrid C.; Whan, Renee; Barter, Philip J.; Sviridov, Dmitri; Gaus, Katharina; Rye, Kerry-Anne; Cochran, Blake J.

    2017-01-01

    The ATP-binding cassette sub-family G member 1 (ABCG1) exports cellular cholesterol to high-density lipoproteins (HDL). However, a number of recent studies have suggested ABCG1 is predominantly localised to intracellular membranes. In this study, we found that ABCG1 was organized into two distinct cellular pools: one at the plasma membrane and the other associated with the endoplasmic reticulum (ER). The plasma membrane fraction was organized into filamentous structures that were associated with cortical actin filaments. Inhibition of actin polymerization resulted in complete disruption of ABCG1 filaments. Cholesterol loading of the cells increased the formation of the filamentous ABCG1, the proximity of filamentous ABCG1 to actin filaments and the diffusion rate of membrane associated ABCG1. Our findings suggest that the actin cytoskeleton plays a critical role in the plasma membrane localization of ABCG1. PMID:28165022

  11. Structural Features of the ATP-Binding Cassette (ABC) Transporter ABCA3

    PubMed Central

    Paolini, Alessandro; Baldassarre, Antonella; Del Gaudio, Ilaria; Masotti, Andrea

    2015-01-01

    In this review we reported and discussed the structural features of the ATP-Binding Cassette (ABC) transporter ABCA3 and how the use of bioinformatics tools could help researchers to obtain a reliable structural model of this important transporter. In fact, a model of ABCA3 is still lacking and no crystallographic structures (of the transporter or of its orthologues) are available. With the advent of next generation sequencing, many disease-causing mutations have been discovered and many more will be found in the future. In the last few years, ABCA3 mutations have been reported to have important pediatric implications. Thus, clinicians need a reliable structure to locate relevant mutations of this transporter and make genotype/phenotype correlations of patients affected by ABCA3-related diseases. In conclusion, we strongly believe that the model preliminarily generated by these novel bioinformatics tools could be the starting point to obtain more refined models of the ABCA3 transporter. PMID:26295388

  12. Microarray study of single nucleotide polymorphisms and expression of ATP-binding cassette genes in breast tumors

    NASA Astrophysics Data System (ADS)

    Tsyganov, M. M.; Ibragimova, M. K.; Karabut, I. V.; Freydin, M. B.; Choinzonov, E. L.; Litvyakov, N. V.

    2015-11-01

    Our previous research establishes that changes of expression of the ATP-binding cassette genes family is connected with the neoadjuvant chemotherapy effect. However, the mechanism of regulation of resistance gene expression remains unclear. As many researchers believe, single nucleotide polymorphisms can be involved in this process. Thereupon, microarray analysis is used to study polymorphisms in ATP-binding cassette genes. It is thus found that MDR gene expression is connected with 5 polymorphisms, i.e. rs241432, rs241429, rs241430, rs3784867, rs59409230, which participate in the regulation of expression of own genes.

  13. Structure-Function Analysis of Peroxisomal ATP-binding Cassette Transporters Using Chimeric Dimers*

    PubMed Central

    Geillon, Flore; Gondcaille, Catherine; Charbonnier, Soëli; Van Roermund, Carlo W.; Lopez, Tatiana E.; Dias, Alexandre M. M.; Pais de Barros, Jean-Paul; Arnould, Christine; Wanders, Ronald J.; Trompier, Doriane; Savary, Stéphane

    2014-01-01

    ABCD1 and ABCD2 are two closely related ATP-binding cassette half-transporters predicted to homodimerize and form peroxisomal importers for fatty acyl-CoAs. Available evidence has shown that ABCD1 and ABCD2 display a distinct but overlapping substrate specificity, although much remains to be learned in this respect as well as in their capability to form functional heterodimers. Using a cell model expressing an ABCD2-EGFP fusion protein, we first demonstrated by proximity ligation assay and co-immunoprecipitation assay that ABCD1 interacts with ABCD2. Next, we tested in the pxa1/pxa2Δ yeast mutant the functionality of ABCD1/ABCD2 dimers by expressing chimeric proteins mimicking homo- or heterodimers. For further structure-function analysis of ABCD1/ABCD2 dimers, we expressed chimeric dimers fused to enhanced GFP in human skin fibroblasts of X-linked adrenoleukodystrophy patients. These cells are devoid of ABCD1 and accumulate very long-chain fatty acids (C26:0 and C26:1). We checked that the chimeric proteins were correctly expressed and targeted to the peroxisomes. Very long-chain fatty acid levels were partially restored in transfected X-linked adrenoleukodystrophy fibroblasts regardless of the chimeric construct used, thus demonstrating functionality of both homo- and heterodimers. Interestingly, the level of C24:6 n-3, the immediate precursor of docosahexaenoic acid, was decreased in cells expressing chimeric proteins containing at least one ABCD2 moiety. Our data demonstrate for the first time that both homo- and heterodimers of ABCD1 and ABCD2 are functionally active. Interestingly, the role of ABCD2 (in homo- and heterodimeric forms) in the metabolism of polyunsaturated fatty acids is clearly evidenced, and the chimeric dimers provide a novel tool to study substrate specificity of peroxisomal ATP-binding cassette transporters. PMID:25043761

  14. Human erythrocyte dematin and protein 4.2 (pallidin) are ATP binding proteins.

    PubMed

    Azim, A C; Marfatia, S M; Korsgren, C; Dotimas, E; Cohen, C M; Chishti, A H

    1996-03-05

    Dematin and protein 4.2 are peripheral membrane proteins associated with the cytoplasmic surface of the human erythrocyte plasma membrane. Isoforms of dematin and protein 4.2 exist in many nonerythroid cells. In solution, dematin is a trimeric protein containing two subunits of 48 kDa and one subunit of 52 kDa. Recent determination of the primary structure of the 52 kDa subunit of dematin showed that it contains an additional 22-amino acid sequence in the headpiece domain. An alignment of the 22-amino acid insertion sequence revealed that the 52 kDa subunit of dematin shares a novel 11-amino acid motif with protein 4.2. In this communication, we report that the conserved 11-amino acid motif in dematin52 and protein 4.2 contains a nucleotide binding P-loop. Direct binding of ATP is demonstrated to the glutathione S-transferase fusion proteins containing corresponding segments of dematin52 and protein 4.2 as well as to purified protein 4.2. The binding of ATP to the recombinant domains of dematin52 and protein 4.2 is specific, saturable, and of high affinity. The nucleotide specificity of the P-loop is restricted to ATP since no detectable binding was observed with GTP. These results show that the 11-amino acid motif provides an ATP binding site in dematin52 and protein 4.2. Although the functional significance of ATP binding is not yet clear, our findings open new perspectives for the function of dematin and protein 4.2 in vivo.

  15. Structure, function, and evolution of bacterial ATP-binding cassette systems

    SciTech Connect

    Davidson, A.L.; Dassa, E.; Orelle, C.; Chen, J.

    2010-07-27

    The ATP-binding cassette (ABC) systems constitute one of the largest superfamilies of paralogous sequences. All ABC systems share a highly conserved ATP-hydrolyzing domain or protein (the ABC; also referred to as a nucleotide-binding domain [NBD]) that is unequivocally characterized by three short sequence motifs (Fig. 1): these are the Walker A and Walker B motifs, indicative of the presence of a nucleotide-binding site, and the signature motif, unique to ABC proteins, located upstream of the Walker B motif (426). Other motifs diagnostic of ABC proteins are also indicated in Fig. 1. The biological significance of these motifs is discussed in Structure, Function, and Dynamics of the ABC. ABC systems are widespread among living organisms and have been detected in all genera of the three kingdoms of life, with remarkable conservation in the primary sequence of the cassette and in the organization of the constitutive domains or subunits (203, 420). ABC systems couple the energy of ATP hydrolysis to an impressively large variety of essential biological phenomena, comprising not only transmembrane (TM) transport, for which they are best known, but also several non-transport-related processes, such as translation elongation (62) and DNA repair (174). Although ABC systems deserve much attention because they are involved in severe human inherited diseases (107), they were first discovered and characterized in detail in prokaryotes, as early as the 1970s (13, 148, 238, 468). The most extensively analyzed systems were the high-affinity histidine and maltose uptake systems of Salmonella enterica serovar Typhimurium and Escherichia coli. Over 2 decades ago, after the completion of the nucleotide sequences encoding these transporters in the respective laboratories of Giovanna Ames and Maurice Hofnung, Hiroshi Nikaido and colleagues noticed that the two systems displayed a global similarity in the nature of their components and, moreover, that the primary sequences of MalK and

  16. ROLE OF ATP BINDING CASSETTE SUB-FAMILY MEMBER 2 (ABCG2) IN MOUSE EMBRYONIC STEM CELL DEVELOPMENT.

    EPA Science Inventory

    ATP binding cassette sub-family member 2 (ABCG2), is a member of the ABC transporter superfamily and a principal xenobiotic transporter. ABCG2 is also highly expressed in certain stem cell populations where it is thought to be related to stem cell plasticity, although the role o...

  17. Identification of ATP-binding regions in the RyR1 Ca²⁺ release channel.

    PubMed

    Popova, Olga B; Baker, Mariah R; Tran, Tina P; Le, Tri; Serysheva, Irina I

    2012-01-01

    ATP is an important modulator of gating in type 1 ryanodine receptor (RyR1), also known as a Ca²⁺ release channel in skeletal muscle cells. The activating effect of ATP on this channel is achieved by directly binding to one or more sites on the RyR1 protein. However, the number and location of these sites have yet to be determined. To identify the ATP-binding regions within RyR1 we used 2N₃ATP-2',3'-Biotin-LC-Hydrazone (BioATP-HDZ), a photo-reactive ATP analog to covalently label the channel. We found that BioATP-HDZ binds RyR1 specifically with an IC₅₀ = 0.6±0.2 mM, comparable with the reported EC50 for activation of RyR1 with ATP. Controlled proteolysis of labeled RyR1 followed by sequence analysis revealed three fragments with apparent molecular masses of 95, 45 and 70 kDa that were crosslinked by BioATP-HDZ and identified as RyR1 sequences. Our analysis identified four glycine-rich consensus motifs that can potentially constitute ATP-binding sites and are located within the N-terminal 95-kDa fragment. These putative nucleotide-binding sequences include amino acids 699-704, 701-706, 1081-1084 and 1195-1200, which are conserved among the three RyR isoforms. Located next to the N-terminal disease hotspot region in RyR1, these sequences may communicate the effects of ATP-binding to channel function by tuning conformational motions within the neighboring cytoplasmic regulatory domains. Two other labeled fragments lack ATP-binding consensus motifs and may form non-canonical ATP-binding sites. Based on domain topology in the 3D structure of RyR1 it is also conceivable that the identified ATP-binding regions, despite their wide separation in the primary sequence, may actually constitute the same non-contiguous ATP-binding pocket within the channel tetramer.

  18. Alternating access to the transmembrane domain of the ATP-binding cassette protein cystic fibrosis transmembrane conductance regulator (ABCC7).

    PubMed

    Wang, Wuyang; Linsdell, Paul

    2012-03-23

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel is a member of the ATP-binding cassette (ABC) protein family, most members of which act as active transporters. Actively transporting ABC proteins are thought to alternate between "outwardly facing" and "inwardly facing" conformations of the transmembrane substrate pathway. In CFTR, it is assumed that the outwardly facing conformation corresponds to the channel open state, based on homology with other ABC proteins. We have used patch clamp recording to quantify the rate of access of cysteine-reactive probes to cysteines introduced into two different transmembrane regions of CFTR from both the intracellular and extracellular solutions. Two probes, the large [2-sulfonatoethyl]methanethiosulfonate (MTSES) molecule and permeant Au(CN)(2)(-) ions, were applied to either side of the membrane to modify cysteines substituted for Leu-102 (first transmembrane region) and Thr-338 (sixth transmembrane region). Channel opening and closing were altered by mutations in the nucleotide binding domains of the channel. We find that, for both MTSES and Au(CN)(2)(-), access to these two cysteines from the cytoplasmic side is faster in open channels, whereas access to these same sites from the extracellular side is faster in closed channels. These results are consistent with alternating access to the transmembrane regions, however with the open state facing inwardly and the closed state facing outwardly. Our findings therefore prompt revision of current CFTR structural and mechanistic models, as well as having broader implications for transport mechanisms in all ABC proteins. Our results also suggest possible locations of both functional and dysfunctional ("vestigial") gates within the CFTR permeation pathway.

  19. A Survey of the ATP-Binding Cassette (ABC) Gene Superfamily in the Salmon Louse (Lepeophtheirus salmonis)

    PubMed Central

    Heumann, Jan; Taggart, John B.; Gharbi, Karim; Bron, James E.; Bekaert, Michaël; Sturm, Armin

    2015-01-01

    Salmon lice, Lepeophtheirus salmonis (Krøyer, 1837), are fish ectoparasites causing significant economic damage in the mariculture of Atlantic salmon, Salmo salar Linnaeus, 1758. The control of L. salmonis at fish farms relies to a large extent on treatment with anti-parasitic drugs. A problem related to chemical control is the potential for development of resistance, which in L. salmonis is documented for a number of drug classes including organophosphates, pyrethroids and avermectins. The ATP-binding cassette (ABC) gene superfamily is found in all biota and includes a range of drug efflux transporters that can confer drug resistance to cancers and pathogens. Furthermore, some ABC transporters are recognised to be involved in conferral of insecticide resistance. While a number of studies have investigated ABC transporters in L. salmonis, no systematic analysis of the ABC gene family exists for this species. This study presents a genome-wide survey of ABC genes in L. salmonis for which, ABC superfamily members were identified through homology searching of the L. salmonis genome. In addition, ABC proteins were identified in a reference transcriptome of the parasite generated by high-throughput RNA sequencing (RNA-seq) of a multi-stage RNA library. Searches of both genome and transcriptome allowed the identification of a total of 33 genes / transcripts coding for ABC proteins, of which 3 were represented only in the genome and 4 only in the transcriptome. Eighteen sequences were assigned to ABC subfamilies known to contain drug transporters, i.e. subfamilies B (4 sequences), C (11) and G (2). The results suggest that the ABC gene family of L. salmonis possesses fewer members than recorded for other arthropods. The present survey of the L. salmonis ABC gene superfamily will provide the basis for further research into potential roles of ABC transporters in the toxicity of salmon delousing agents and as potential mechanisms of drug resistance. PMID:26418738

  20. Small and middle T antigens contribute to lytic and abortive polyomavirus infection

    SciTech Connect

    Tuerler, H.; Salomon, C.

    1985-02-01

    Using three different polyomavirus hr-t mutants and two polyomavirus mlT mutants, the authors studied induction of S-phase by mutants and wild-type virus in quiescent mouse kidney cells, mouse 3T6 cells, and FR 3T3 cells. At different times after infection, they measured the proportion of T-antigen-positive cells, the incorporation of (/sup 3/H)thymidine, the proportion of DNA-synthesizing cells, and the increase in total DNA, RNA, and protein content of the cultures. In permissive mouse cells, they also determined the amount of viral DNA and the proportion of viral capsid-producing cells. In polyomavirus hr-t mutant-infected cultures, the onset of host DNA replication was delayed by several hours, and a smaller proportion of T-antigen-positive cells entered S-phase than in wild-type-infected cultures. Of the two polyomavirus mlT mutants studied, dl-23 behaved similarly to wild-type virus in many, but not all, parameters tested. The poorly replicating but well-transforming mutant dl-8 was able to induce S-phase, and (in permissive cells) progeny virus production, in only about one-third of the T-antigen-positive cells. From the experiments, the authors concluded that mutations affecting small and middle T-antigen cause a reduction in the proportion of cells responding to virus infection and a prolongation of the early phase, i.e., the period before cells center S-phase. In hr-t mutant-infected mouse 3T6 cells, production of viral DNA was <10% of that in wild-type-infected cultures; low hr-t progeny production in 3T6 cells was therefore largely due to poor viral DNA replication.

  1. Agrobacterium rhizogenes GALLS Protein Contains Domains for ATP Binding, Nuclear Localization, and Type IV Secretion▿

    PubMed Central

    Hodges, Larry D.; Vergunst, Annette C.; Neal-McKinney, Jason; den Dulk-Ras, Amke; Moyer, Deborah M.; Hooykaas, Paul J. J.; Ream, Walt

    2006-01-01

    Agrobacterium tumefaciens and Agrobacterium rhizogenes are closely related plant pathogens that cause different diseases, crown gall and hairy root. Both diseases result from transfer, integration, and expression of plasmid-encoded bacterial genes located on the transferred DNA (T-DNA) in the plant genome. Bacterial virulence (Vir) proteins necessary for infection are also translocated into plant cells. Transfer of single-stranded DNA (ssDNA) and Vir proteins requires a type IV secretion system, a protein complex spanning the bacterial envelope. A. tumefaciens translocates the ssDNA-binding protein VirE2 into plant cells, where it binds single-stranded T-DNA and helps target it to the nucleus. Although some strains of A. rhizogenes lack VirE2, they are pathogenic and transfer T-DNA efficiently. Instead, these bacteria express the GALLS protein, which is essential for their virulence. The GALLS protein can complement an A. tumefaciens virE2 mutant for tumor formation, indicating that GALLS can substitute for VirE2. Unlike VirE2, GALLS contains ATP-binding and helicase motifs similar to those in TraA, a strand transferase involved in conjugation. Both GALLS and VirE2 contain nuclear localization sequences and a C-terminal type IV secretion signal. Here we show that mutations in any of these domains abolished the ability of GALLS to substitute for VirE2. PMID:17012398

  2. Biophysical Approaches Facilitate Computational Drug Discovery for ATP-Binding Cassette Proteins

    PubMed Central

    Molinski, Steven V.; Bozóky, Zoltán; Iram, Surtaj H.

    2017-01-01

    Although membrane proteins represent most therapeutically relevant drug targets, the availability of atomic resolution structures for this class of proteins has been limited. Structural characterization has been hampered by the biophysical nature of these polytopic transporters, receptors, and channels, and recent innovations to in vitro techniques aim to mitigate these challenges. One such class of membrane proteins, the ATP-binding cassette (ABC) superfamily, are broadly expressed throughout the human body, required for normal physiology and disease-causing when mutated, yet lacks sufficient structural representation in the Protein Data Bank. However, recent improvements to biophysical techniques (e.g., cryo-electron microscopy) have allowed for previously “hard-to-study” ABC proteins to be characterized at high resolution, providing insight into molecular mechanisms-of-action as well as revealing novel druggable sites for therapy design. These new advances provide ample opportunity for computational methods (e.g., virtual screening, molecular dynamics simulations, and structure-based drug design) to catalyze the discovery of novel small molecule therapeutics that can be easily translated from computer to bench and subsequently to the patient's bedside. In this review, we explore the utility of recent advances in biophysical methods coupled with well-established in silico techniques towards drug development for diseases caused by dysfunctional ABC proteins.

  3. Structure-guided Development of Specific Pyruvate Dehydrogenase Kinase Inhibitors Targeting the ATP-binding Pocket*

    PubMed Central

    Tso, Shih-Chia; Qi, Xiangbing; Gui, Wen-Jun; Wu, Cheng-Yang; Chuang, Jacinta L.; Wernstedt-Asterholm, Ingrid; Morlock, Lorraine K.; Owens, Kyle R.; Scherer, Philipp E.; Williams, Noelle S.; Tambar, Uttam K.; Wynn, R. Max; Chuang, David T.

    2014-01-01

    Pyruvate dehydrogenase kinase isoforms (PDKs 1–4) negatively regulate activity of the mitochondrial pyruvate dehydrogenase complex by reversible phosphorylation. PDK isoforms are up-regulated in obesity, diabetes, heart failure, and cancer and are potential therapeutic targets for these important human diseases. Here, we employed a structure-guided design to convert a known Hsp90 inhibitor to a series of highly specific PDK inhibitors, based on structural conservation in the ATP-binding pocket. The key step involved the substitution of a carbonyl group in the parent compound with a sulfonyl in the PDK inhibitors. The final compound of this series, 2-[(2,4-dihydroxyphenyl)sulfonyl]isoindoline-4,6-diol, designated PS10, inhibits all four PDK isoforms with IC50 = 0.8 μm for PDK2. The administration of PS10 (70 mg/kg) to diet-induced obese mice significantly augments pyruvate dehydrogenase complex activity with reduced phosphorylation in different tissues. Prolonged PS10 treatments result in improved glucose tolerance and notably lessened hepatic steatosis in the mouse model. The results support the pharmacological approach of targeting PDK to control both glucose and fat levels in obesity and type 2 diabetes. PMID:24356970

  4. Caveolin-1 and ATP binding cassette transporter A1 and G1-mediated cholesterol efflux.

    PubMed

    Wang, Faqi; Gu, Hong-mei; Zhang, Da-wei

    2014-01-01

    Atherosclerosis is one major cause of cardiovascular diseases, the leading cause of death in industrialized countries. Reverse cholesterol transport (RCT) is thought to be one primary pathway to protect against atherosclerosis. The first and rate-limiting step of RCT is ATP-binding cassette transport A1 (ABCA1) and ABCG1-mediated cholesterol efflux from the cells. Recently, caveolin-1 (CAV1), a scaffolding protein that organizes and concentrates certain caveolin-interacting signaling molecules and receptors within caveolae membranes, has been shown to regulate ABCA1 and ABCG1-mediated cholesterol efflux probably via interacting with them. In the present review, we summarize the current knowledge and views on the regulatory role of CAV1 on the cholesterol homeostasis with emphasis on the association of CAV1 with ABCA1 and ABCG1. We conclude that the dominance of the positive regulation by CAV1 on the ABCA1 and ABCG1-mediated cholesterol efflux is depending on the species, cell types, as well as the levels of CAV1 expression.

  5. Conformational Changes Produced by ATP Binding to the Plasma Membrane Calcium Pump*

    PubMed Central

    Mangialavori, Irene C.; Ferreira-Gomes, Mariela S.; Saffioti, Nicolás A.; González-Lebrero, Rodolfo M.; Rossi, Rolando C.; Rossi, Juan Pablo F. C.

    2013-01-01

    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[125I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca2+ with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2′(3′)-O-(2,4,6-trinitrophenyl)adenosine 5′-triphosphate. To assess the conformational behavior of the Ca2+ binding domain, we also studied the occlusion of Ca2+, both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca2+ and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only. PMID:24025327

  6. Molecular Characterization of LjABCG1, an ATP-Binding Cassette Protein in Lotus japonicus

    PubMed Central

    Sugiyama, Akifumi; Fukuda, Shoju; Takanashi, Kojiro; Yoshioka, Miki; Yoshioka, Hirofumi; Narusaka, Yoshihiro; Narusaka, Mari; Kojima, Mikiko; Sakakibara, Hitoshi; Shitan, Nobukazu; Sato, Shusei; Tabata, Satoshi; Kawaguchi, Masayoshi; Yazaki, Kazufumi

    2015-01-01

    LjABCG1, a full-size ABCG subfamily of ATP-binding cassette proteins of a model legume, Lotus japonicus, was reported as a gene highly expressed during the early stages of nodulation, but have not been characterized in detail. In this study we showed that the induction of LjABCG1 expression was remarkable by methyl jasmonate treatment, and reporter gene experiments indicated that LjABCG1 was strongly expressed in the nodule parenchyma and cell layers adjacent to the root vascular tissue toward the nodule. LjABCG1 was suggested to be localized at the plasma membrane based on the fractionation of microsomal membranes as well as separation via aqueous two-phase partitioning. The physiological functions of LjABCG1 in symbiosis and pathogenesis were analyzed in homologous and heterologous systems. LjABCG1 knock-down L. japonicus plants did not show clear phenotypic differences in nodule formation, and not in defense against Pseudomonas syringae, either. In contrast, when LjABCG1 was expressed in the Arabidopsis pdr8-1 mutant, the penetration frequency of Phytophthora infestans, a potato late blight pathogen, was significantly reduced in LjABCG1/pdr8-1 than in pdr8-1 plants. This finding indicated that LjABCG1, at least partially, complemented the phenotype of pdr8 in Arabidopsis, suggesting the multiple roles of this protein in plant-microbe interactions. PMID:26418593

  7. A Plant Plasma Membrane ATP Binding Cassette–Type Transporter Is Involved in Antifungal Terpenoid Secretion

    PubMed Central

    Jasiński, Michal; Stukkens, Yvan; Degand, Hervé; Purnelle, Bénédicte; Marchand-Brynaert, Jacqueline; Boutry, Marc

    2001-01-01

    ATP binding cassette (ABC) transporters, which are found in all species, are known mainly for their ability to confer drug resistance. To date, most of the ABC transporters characterized in plants have been localized in the vacuolar membrane and are considered to be involved in the intracellular sequestration of cytotoxins. Working on the assumption that certain ABC transporters might be involved in defense metabolite secretion and their expression might be regulated by the concentration of these metabolites, we treated a Nicotiana plumbaginifolia cell culture with sclareolide, a close analog of sclareol, an antifungal diterpene produced at the leaf surface of Nicotiana spp; this resulted in the appearance of a 160-kD plasma membrane protein, which was partially sequenced. The corresponding cDNA (NpABC1) was cloned and shown to encode an ABC transporter. In vitro and in situ immunodetection showed NpABC1 to be localized in the plasma membrane. Under normal conditions, expression was found in the leaf epidermis. In cell culture and in leaf tissues, NpABC1 expression was strongly enhanced by sclareolide and sclareol. In parallel with NpABC1 induction, cells acquired the ability to excrete a labeled synthetic sclareolide derivative. These data suggest that NpABC1 is involved in the secretion of a secondary metabolite that plays a role in plant defense. PMID:11340184

  8. ATP binding by NLRP7 is required for inflammasome activation in response to bacterial lipopeptides.

    PubMed

    Radian, Alexander D; Khare, Sonal; Chu, Lan H; Dorfleutner, Andrea; Stehlik, Christian

    2015-10-01

    Nucleotide-binding oligimerization domain (NOD)-like receptors (NLRs) are pattern recognition receptors (PRRs) involved in innate immune responses. NLRs encode a central nucleotide-binding domain (NBD) consisting of the NAIP, CIITA, HET-E and TP1 (NACHT) domain and the NACHT associated domain (NAD), which facilitates receptor oligomerization and downstream inflammasome signaling. The NBD contains highly conserved regions, known as Walker motifs, that are required for nucleotide binding and hydrolysis. The NLR containing a PYRIN domain (PYD) 7 (NLRP7) has been recently shown to assemble an ASC and caspase-1-containing high molecular weight inflammasome complex in response to microbial acylated lipopeptides and Staphylococcus aureus infection. However, the molecular mechanism responsible for NLRP7 inflammasome activation is still elusive. Here we demonstrate that the NBD of NLRP7 is an ATP binding domain and has ATPase activity. We further show that an intact nucleotide-binding Walker A motif is required for NBD-mediated nucleotide binding and hydrolysis, oligomerization, and NLRP7 inflammasome formation and activity. Accordingly, THP-1 cells expressing a mutated Walker A motif display defective NLRP7 inflammasome activation, interleukin (IL)-1β release and pyroptosis in response to acylated lipopeptides and S. aureus infection. Taken together, our results provide novel insights into the mechanism of NLRP7 inflammasome assembly.

  9. A conserved mitochondrial ATP-binding cassette transporter exports glutathione polysulfide for cytosolic metal cofactor assembly.

    PubMed

    Schaedler, Theresia A; Thornton, Jeremy D; Kruse, Inga; Schwarzländer, Markus; Meyer, Andreas J; van Veen, Hendrik W; Balk, Janneke

    2014-08-22

    An ATP-binding cassette transporter located in the inner mitochondrial membrane is involved in iron-sulfur cluster and molybdenum cofactor assembly in the cytosol, but the transported substrate is unknown. ATM3 (ABCB25) from Arabidopsis thaliana and its functional orthologue Atm1 from Saccharomyces cerevisiae were expressed in Lactococcus lactis and studied in inside-out membrane vesicles and in purified form. Both proteins selectively transported glutathione disulfide (GSSG) but not reduced glutathione in agreement with a 3-fold stimulation of ATPase activity by GSSG. By contrast, Fe(2+) alone or in combination with glutathione did not stimulate ATPase activity. Arabidopsis atm3 mutants were hypersensitive to an inhibitor of glutathione biosynthesis and accumulated GSSG in the mitochondria. The growth phenotype of atm3-1 was strongly enhanced by depletion of the mitochondrion-localized, GSH-dependent persulfide oxygenase ETHE1, suggesting that the physiological substrate of ATM3 contains persulfide in addition to glutathione. Consistent with this idea, a transportomics approach using mass spectrometry showed that glutathione trisulfide (GS-S-SG) was transported by Atm1. We propose that mitochondria export glutathione polysulfide, containing glutathione and persulfide, for iron-sulfur cluster assembly in the cytosol.

  10. Conformational changes produced by ATP binding to the plasma membrane calcium pump.

    PubMed

    Mangialavori, Irene C; Ferreira-Gomes, Mariela S; Saffioti, Nicolás A; González-Lebrero, Rodolfo M; Rossi, Rolando C; Rossi, Juan Pablo F C

    2013-10-25

    The aim of this work was to study the plasma membrane calcium pump (PMCA) reaction cycle by characterizing conformational changes associated with calcium, ATP, and vanadate binding to purified PMCA. This was accomplished by studying the exposure of PMCA to surrounding phospholipids by measuring the incorporation of the photoactivatable phosphatidylcholine analog 1-O-hexadecanoyl-2-O-[9-[[[2-[(125)I]iodo-4-(trifluoromethyl-3H-diazirin-3-yl)benzyl]oxy]carbonyl]nonanoyl]-sn-glycero-3-phosphocholine to the protein. ATP could bind to the different vanadate-bound states of the enzyme either in the presence or in the absence of Ca(2+) with high apparent affinity. Conformational movements of the ATP binding domain were determined using the fluorescent analog 2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate. To assess the conformational behavior of the Ca(2+) binding domain, we also studied the occlusion of Ca(2+), both in the presence and in the absence of ATP and with or without vanadate. Results show the existence of occluded species in the presence of vanadate and/or ATP. This allowed the development of a model that describes the transport of Ca(2+) and its relation with ATP hydrolysis. This is the first approach that uses a conformational study to describe the PMCA P-type ATPase reaction cycle, adding important features to the classical E1-E2 model devised using kinetics methodology only.

  11. The role of ATP binding cassette transporters in tissue defense and organ regeneration.

    PubMed

    Huls, Miriam; Russel, Frans G M; Masereeuw, Rosalinde

    2009-01-01

    ATP binding cassette (ABC) transporters are ATP-dependent membrane proteins predominantly expressed in excretory organs, such as the liver, intestine, blood-brain barrier, blood-testes barrier, placenta, and kidney. Here, they play an important role in the absorption, distribution, and excretion of drugs, xenobiotics, and endogenous compounds. In addition, the ABC transporters, P-glycoprotein (P-gp/ABCB1) and breast cancer resistance protein (BCRP/ABCG2), are highly expressed in a population of primitive stem cells: the side population (SP). SP cells were originally discovered in bone marrow by their capacity to exclude rhodamine 123 and Hoechst dye 33342; however, extensive research also revealed their presence in other nonhematopoietic tissues. The expression levels of BCRP and P-gp are tightly controlled and may determine the differentiation of SP cells toward other more specialized cell types. Although their exact function in these cells is still not clear, they may protect the cells by pumping out toxicants and harmful products of oxidative stress. Transplantation studies in animals revealed that bone marrow-derived SP cells contribute to organ repopulation and tissue repair after damage, e.g., in liver and heart. The role of SP cells in regeneration of damaged kidney segments is not yet clarified. This review focuses on the role of ABC transporters in tissue defense and regeneration, with specific attention to P-gp and BCRP in organ regeneration and repair.

  12. Three-Dimensional Structures Reveal Multiple ADP/ATP Binding Modes

    SciTech Connect

    C Simmons; C Magee; D Smith; L Lauman; J Chaput; J Allen

    2011-12-31

    The creation of synthetic enzymes with predefined functions represents a major challenge in future synthetic biology applications. Here, we describe six structures of de novo proteins that have been determined using protein crystallography to address how simple enzymes perform catalysis. Three structures are of a protein, DX, selected for its stability and ability to tightly bind ATP. Despite the addition of ATP to the crystallization conditions, the presence of a bound but distorted ATP was found only under excess ATP conditions, with ADP being present under equimolar conditions or when crystallized for a prolonged period of time. A bound ADP cofactor was evident when Asp was substituted for Val at residue 65, but ATP in a linear configuration is present when Phe was substituted for Tyr at residue 43. These new structures complement previously determined structures of DX and the protein with the Phe 43 to Tyr substitution [Simmons, C. R., et al. (2009) ACS Chem. Biol. 4, 649-658] and together demonstrate the multiple ADP/ATP binding modes from which a model emerges in which the DX protein binds ATP in a configuration that represents a transitional state for the catalysis of ATP to ADP through a slow, metal-free reaction capable of multiple turnovers. This unusual observation suggests that design-free methods can be used to generate novel protein scaffolds that are tailor-made for catalysis.

  13. Crystal structures of the ATP-binding and ADP-release dwells of the V1 rotary motor

    PubMed Central

    Suzuki, Kano; Mizutani, Kenji; Maruyama, Shintaro; Shimono, Kazumi; Imai, Fabiana L.; Muneyuki, Eiro; Kakinuma, Yoshimi; Ishizuka-Katsura, Yoshiko; Shirouzu, Mikako; Yokoyama, Shigeyuki; Yamato, Ichiro; Murata, Takeshi

    2016-01-01

    V1-ATPases are highly conserved ATP-driven rotary molecular motors found in various membrane systems. We recently reported the crystal structures for the Enterococcus hirae A3B3DF (V1) complex, corresponding to the catalytic dwell state waiting for ATP hydrolysis. Here we present the crystal structures for two other dwell states obtained by soaking nucleotide-free V1 crystals in ADP. In the presence of 20 μM ADP, two ADP molecules bind to two of three binding sites and cooperatively induce conformational changes of the third site to an ATP-binding mode, corresponding to the ATP-binding dwell. In the presence of 2 mM ADP, all nucleotide-binding sites are occupied by ADP to induce conformational changes corresponding to the ADP-release dwell. Based on these and previous findings, we propose a V1-ATPase rotational mechanism model. PMID:27807367

  14. Structure of an antibacterial peptide ATP-binding cassette transporter in a novel outward occluded state

    PubMed Central

    Choudhury, Hassanul G.; Tong, Zhen; Mathavan, Indran; Li, Yanyan; Iwata, So; Zirah, Séverine; Rebuffat, Sylvie; van Veen, Hendrik W.; Beis, Konstantinos

    2014-01-01

    Enterobacteriaceae produce antimicrobial peptides for survival under nutrient starvation. Microcin J25 (MccJ25) is an antimicrobial peptide with a unique lasso topology. It is secreted by the ATP-binding cassette (ABC) exporter McjD, which ensures self-immunity of the producing strain through efficient export of the toxic mature peptide from the cell. Here we have determined the crystal structure of McjD from Escherichia coli at 2.7-Å resolution, which is to the authors’ knowledge the first structure of an antibacterial peptide ABC transporter. Our functional and biochemical analyses demonstrate McjD-dependent immunity to MccJ25 through efflux of the peptide. McjD can directly bind MccJ25 and displays a basal ATPase activity that is stimulated by MccJ25 in both detergent solution and proteoliposomes. McjD adopts a new conformation, termed nucleotide-bound outward occluded. The new conformation defines a clear cavity; mutagenesis and ligand binding studies of the cavity have identified Phe86, Asn134, and Asn302 as important for recognition of MccJ25. Comparisons with the inward-open MsbA and outward-open Sav1866 structures show that McjD has structural similarities with both states without the intertwining of transmembrane (TM) helices. The occluded state is formed by rotation of TMs 1 and 2 toward the equivalent TMs of the opposite monomer, unlike Sav1866 where they intertwine with TMs 3–6 of the opposite monomer. Cysteine cross-linking studies on the McjD dimer in inside-out membrane vesicles of E. coli confirmed the presence of the occluded state. We therefore propose that the outward-occluded state represents a transition intermediate between the outward-open and inward-open conformation of ABC exporters. PMID:24920594

  15. Small Substrate Transport and Mechanism of a Molybdate ATP Binding Cassette Transporter in a Lipid Environment*

    PubMed Central

    Rice, Austin J.; Harrison, Alistair; Alvarez, Frances J. D.; Davidson, Amy L.; Pinkett, Heather W.

    2014-01-01

    Embedded in the plasma membrane of all bacteria, ATP binding cassette (ABC) importers facilitate the uptake of several vital nutrients and cofactors. The ABC transporter, MolBC-A, imports molybdate by passing substrate from the binding protein MolA to a membrane-spanning translocation pathway of MolB. To understand the mechanism of transport in the biological membrane as a whole, the effects of the lipid bilayer on transport needed to be addressed. Continuous wave-electron paramagnetic resonance and in vivo molybdate uptake studies were used to test the impact of the lipid environment on the mechanism and function of MolBC-A. Working with the bacterium Haemophilus influenzae, we found that MolBC-A functions as a low affinity molybdate transporter in its native environment. In periods of high extracellular molybdate concentration, H. influenzae makes use of parallel molybdate transport systems (MolBC-A and ModBC-A) to take up a greater amount of molybdate than a strain with ModBC-A alone. In addition, the movement of the translocation pathway in response to nucleotide binding and hydrolysis in a lipid environment is conserved when compared with in-detergent analysis. However, electron paramagnetic resonance spectroscopy indicates that a lipid environment restricts the flexibility of the MolBC translocation pathway. By combining continuous wave-electron paramagnetic resonance spectroscopy and substrate uptake studies, we reveal details of molybdate transport and the logistics of uptake systems that employ multiple transporters for the same substrate, offering insight into the mechanisms of nutrient uptake in bacteria. PMID:24722984

  16. The saci_2123 gene of the hyperthermoacidophile Sulfolobus acidocaldarius encodes an ATP-binding cassette multidrug transporter.

    PubMed

    Yang, Nuan; Driessen, Arnold J M

    2015-01-01

    Multidrug resistance (MDR) transporters are capable of secreting structurally and functionally unrelated toxic compounds from the cell. Among this group are ATP-binding cassette (ABC) transporters. These membrane proteins are typically arranged as either hetero- or homo-dimers of ABC half-transporters with each subunit consisting of a membrane domain fused at the C-terminus to an ATP-binding domain, or as full transporters in which the two subunits are fused into a single polypeptide. The saci_2123 gene of the thermoacidophilic archaeon Sulfolobus acidocaldarius is the only gene in the genome that encodes an ATP-binding cassette half-transporter, while a homologous gene is present in the genomes of S. solfataricus, S. tokodaii and S islandicus. Saci_2123 shares homology with well-characterized bacterial and mammalian MDR transporters. The saci_2132 gene is up-regulated when cells are exposed to drugs. A deletion mutant of saci_2132 was found to be more vulnerable to a set of toxic compounds, including detergents, antibiotics and uncouplers as compared to the wild-type strain, while the drug resistance could be restored through the plasmid-based expression of saci_2132. These data demonstrate that Saci_2132 is an archaeal ABC-MDR transporter and therefore it was termed Smr1 (Sulfolobus multidrug resistance transporter 1).

  17. Induction of Duplication Reversion in Human Fibroblasts, by Wild-Type and Mutated Sv40 T Antigen, Covaries with the Ability to Induce Host DNA Synthesis

    PubMed Central

    Shammas, M. A.; Xia, S. J.; Reis, RJS.

    1997-01-01

    Intrachromosomal homologous recombination, manifest as reversion of a 14-kbp duplication in the hypoxanthine phosphoribosyl transferase (HPRT) gene, is elevated in human cells either stably transformed or transiently transfected by the SV40 (simian virus 40) large T antigen gene. Following introduction of wild-type SV40, or any of several T-antigen point mutations in a constant SV40 background, we observed a strong correlation between the stimulation of chromosomal recombination and induction of host-cell DNA synthesis. Moreover, inhibitors of DNA replication (aphidicolin and hydroxyurea) suppress SV40-induced homologous recombination to the extent that they suppress DNA synthesis. Stable integration of plasmids encoding T antigen also augments homologous recombination, which is suppressed by aphidicolin. We infer that the mechanism by which T antigen stimulates homologous recombination in human fibroblasts involves DNA replicative synthesis. PMID:9258684

  18. Activity-Based Proteomics Reveals Heterogeneous Kinome and ATP-Binding Proteome Responses to MEK Inhibition in KRAS Mutant Lung Cancer.

    PubMed

    Kim, Jae-Young; Stewart, Paul A; Borne, Adam L; Fang, Bin; Welsh, Eric A; Chen, Yian Ann; Eschrich, Steven A; Koomen, John M; Haura, Eric B

    2016-06-01

    One way cancer cells can escape from targeted agents is through their ability to evade drug effects by rapidly rewiring signaling networks. Many protein classes, such as kinases and metabolic enzymes, are regulated by ATP binding and hydrolysis. We hypothesized that a system-level profiling of drug-induced alterations in ATP-binding proteomes could offer novel insights into adaptive responses. Here, we mapped global ATP-binding proteomes perturbed by two clinical MEK inhibitors, AZD6244 and MEK162, in KRAS mutant lung cancer cells as a model system harnessing a desthiobiotin-ATP probe coupled with LC-MS/MS. We observed strikingly unique ATP-binding proteome responses to MEK inhibition, which revealed heterogeneous drug-induced pathway signatures in each cell line. We also identified diverse kinome responses, indicating each cell adapts to MEK inhibition in unique ways. Despite the heterogeneity of kinome responses, decreased probe labeling of mitotic kinases and an increase of kinases linked to autophagy were identified to be common responses. Taken together, our study revealed a diversity of adaptive ATP-binding proteome and kinome responses to MEK inhibition in KRAS mutant lung cancer cells, and our study further demonstrated the utility of our approach to identify potential candidates of targetable ATP-binding enzymes involved in adaptive resistance and to develop rational drug combinations.

  19. Simian virus 40 DNA replication correlates with expression of a particular subclass of T antigen in a human glial cell line.

    PubMed

    Deminie, C A; Norkin, L C

    1990-08-01

    Immunocytochemistry and in situ hybridization were used to identify simian virus 40 (SV40) large T-antigen expression and viral DNA replication in individual cells of infected semipermissive human cell lines. SV40 infection aborts before T-antigen expression in many cells of each of the human cell lines examined. In all but one of the human cell lines, most of the T-antigen-producing cells replicated viral DNA. However, in the A172 line of human glial cells only a small percentage of the T-antigen-expressing cells replicated viral DNA. Since different structural and functional classes of T antigen can be recognized with anti-T monoclonal antibodies, we examined infected A172 cells with a panel of 10 anti-T monoclonal antibodies to determine whether viral DNA replication might correlate with the expression of a particular epitope of T antigen. One anti-T monoclonal antibody, PAb 100, did specifically recognize that subset of A172 cells which replicated SV40 DNA. The percentage of PAb 100-reactive A172 cells was dramatically increased by the DNA synthesis inhibitors hydroxyurea and aphidicolin. Removal of the hydroxyurea was followed by an increase in the percentage of cells replicating viral DNA corresponding to the increased percentage reactive with PAb 100. The pattern of SV40 infection in A172 cells was not altered by infection with viable viral mutants containing lesions in the small t protein, the agnoprotein, or the enhancer region. Finally, in situ hybridization was used to show that the percentage of human cells expressing T antigen was similar to the percentage transcribing early SV40 mRNA. Thus, the block to T-antigen expression in human cells is at a stage prior to transcription of early SV40 mRNA.

  20. ATP binding and hydrolysis-driven rate-determining events in the RFC-catalyzed PCNA clamp loading reaction.

    PubMed

    Sakato, Miho; Zhou, Yayan; Hingorani, Manju M

    2012-02-17

    The multi-subunit replication factor C (RFC) complex loads circular proliferating cell nuclear antigen (PCNA) clamps onto DNA where they serve as mobile tethers for polymerases and coordinate the functions of many other DNA metabolic proteins. The clamp loading reaction is complex, involving multiple components (RFC, PCNA, DNA, and ATP) and events (minimally: PCNA opening/closing, DNA binding/release, and ATP binding/hydrolysis) that yield a topologically linked clamp·DNA product in less than a second. Here, we report pre-steady-state measurements of several steps in the reaction catalyzed by Saccharomyces cerevisiae RFC and present a comprehensive kinetic model based on global analysis of the data. Highlights of the reaction mechanism are that ATP binding to RFC initiates slow activation of the clamp loader, enabling it to open PCNA (at ~2 s(-1)) and bind primer-template DNA (ptDNA). Rapid binding of ptDNA leads to formation of the RFC·ATP·PCNA(open)·ptDNA complex, which catalyzes a burst of ATP hydrolysis. Another slow step in the reaction follows ATP hydrolysis and is associated with PCNA closure around ptDNA (8 s(-1)). Dissociation of PCNA·ptDNA from RFC leads to catalytic turnover. We propose that these early and late rate-determining events are intramolecular conformational changes in RFC and PCNA that control clamp opening and closure, and that ATP binding and hydrolysis switch RFC between conformations with high and low affinities, respectively, for open PCNA and ptDNA, and thus bookend the clamp loading reaction.

  1. Formycin triphosphate as a probe for the ATP binding site involved in the activation of guanylate cyclase.

    PubMed

    Chang, C H; Yu, Z N; Song, D L

    1992-10-01

    Formycin A triphosphate (FTP), a fluorescent analog of ATP, slightly increased basal guanylate cyclase activity, but significantly potentiated guanylate cyclase activity stimulated by atrial natriuretic factor (ANF) in rat lung membranes. FTP potentiated ANF-stimulated guanylate cyclase activity with an EC50 at about 90 microM and inhibited ATP-stimulated guanylate cyclase activity with an IC50 at about 100 microM. These results indicate that FTP binds more tightly than ATP for the same binding site. Therefore, FTP would be an excellent tool for studying the ATP binding site.

  2. Activation of ATP binding for the autophosphorylation of DosS, a Mycobacterium tuberculosis histidine kinase lacking an ATP lid motif.

    PubMed

    Cho, Ha Yeon; Lee, Young-Hoon; Bae, Young-Seuk; Kim, Eungbin; Kang, Beom Sik

    2013-05-03

    The sensor histidine kinases of Mycobacterium tuberculosis, DosS and DosT, are responsible for sensing hypoxic conditions and consist of sensor and kinase cores responsible for accepting signals and phosphorylation activity, respectively. The kinase core contains a dimerization and histidine phosphate-accepting (DHp) domain and an ATP binding domain (ABD). The 13 histidine kinase genes of M. tuberculosis can be grouped based on the presence or absence of the ATP lid motif and F box (elements known to play roles in ATP binding) in their ABDs; DosS and DosT have ABDs lacking both these elements, and the crystal structures of their ABDs indicated that they were unsuitable for ATP binding, as a short loop covers the putative ATP binding site. Although the ABD alone cannot bind ATP, the kinase core is functional in autophosphorylation. Appropriate spatial arrangement of the ABD and DHp domain within the kinase core is required for both autophosphorylation and ATP binding. An ionic interaction between Arg(440) in the DHp domain and Glu(537) in the short loop of the ABD is available and may open the ATP binding site, by repositioning the short loop away from the site. Mutations at Arg(440) and Glu(537) reduce autophosphorylation activity. Unlike other histidine kinases containing an ATP lid, which protects bound ATP, DosS is unable to accept ATP until the ABD is properly positioned relative to the histidine; this may prevent unexpected ATP reactions. ATP binding can, therefore, function as a control mechanism for histidine kinase activity.

  3. Induction of interferon-stimulated genes by Simian virus 40 T antigens

    SciTech Connect

    Rathi, Abhilasha V.; Cantalupo, Paul G.; Sarkar, Saumendra N.; Pipas, James M.

    2010-10-25

    Simian virus 40 (SV40) large T antigen (TAg) is a multifunctional oncoprotein essential for productive viral infection and for cellular transformation. We have used microarray analysis to examine the global changes in cellular gene expression induced by wild-type T antigen (TAg{sup wt}) and TAg-mutants in mouse embryo fibroblasts (MEFs). The expression profile of approximately 800 cellular genes was altered by TAg{sup wt} and a truncated TAg (TAg{sup N136}), including many genes that influence cell cycle, DNA-replication, transcription, chromatin structure and DNA repair. Unexpectedly, we found a significant number of immune response genes upregulated by TAg{sup wt} including many interferon-stimulated genes (ISGs) such as ISG56, OAS, Rsad2, Ifi27 and Mx1. Additionally, we also observed activation of STAT1 by TAg{sup wt}. Our genetic studies using several TAg-mutants reveal an unexplored function of TAg and indicate that the LXCXE motif and p53 binding are required for the upregulation of ISGs.

  4. The Tomato R Gene Products I-2 and Mi-1 Are Functional ATP Binding Proteins with ATPase Activity

    PubMed Central

    Tameling, Wladimir I. L.; Elzinga, Sandra D. J.; Darmin, Patricia S.; Vossen, Jack H.; Takken, Frank L. W.; Haring, Michel A.; Cornelissen, Ben J. C.

    2002-01-01

    Most plant disease resistance (R) genes known today encode proteins with a central nucleotide binding site (NBS) and a C-terminal Leu-rich repeat (LRR) domain. The NBS contains three ATP/GTP binding motifs known as the kinase-1a or P-loop, kinase-2, and kinase-3a motifs. In this article, we show that the NBS of R proteins forms a functional nucleotide binding pocket. The N-terminal halves of two tomato R proteins, I-2 conferring resistance to Fusarium oxysporum and Mi-1 conferring resistance to root-knot nematodes and potato aphids, were produced as glutathione S-transferase fusions in Escherichia coli. In a filter binding assay, purified I-2 was found to bind ATP rather than other nucleoside triphosphates. ATP binding appeared to be fully dependent on the presence of a divalent cation. A mutant I-2 protein containing a mutation in the P-loop showed a strongly reduced ATP binding capacity. Thin layer chromatography revealed that both I-2 and Mi-1 exerted ATPase activity. Based on the strong conservation of NBS domains in R proteins of the NBS-LRR class, we propose that they all are capable of binding and hydrolyzing ATP. PMID:12417711

  5. Critical role of γ-phosphate in structural transition of Na,K-ATPase upon ATP binding

    NASA Astrophysics Data System (ADS)

    Petrushanko, Irina Yu.; Mitkevich, Vladimir A.; Anashkina, Anastasia A.; Klimanova, Elizaveta A.; Dergousova, Elena A.; Lopina, Olga D.; Makarov, Alexander A.

    2014-06-01

    Active transport of sodium and potassium ions by Na,K-ATPase is accompanied by the enzyme conformational transition between E1 and E2 states. ATP and ADP bind to Na,K-ATPase in the E1 conformation with similar affinity but the properties of enzyme in complexes with these nucleotides are different. We have studied thermodynamics of Na,K-ATPase binding with adenine nucleotides at different temperatures using isothermal titration calorimetry. Our data indicate that β-phosphate is involved in complex formation by increasing the affinity of adenine nucleotides to Na,K-ATPase by an order of magnitude, while γ-phosphate does not affect it. ATP binding to Na,K-ATPase in contrast to ADP binding generates a structural transition in the enzyme, which is consistent with the movement of a significant portion of the surface area to a solvent-protected state. We propose that ATP binding leads to convergence of the nucleotide-binding and phosphorylation domains transferring the enzyme from the ``E1-open'' to ``E1-closed'' conformation ready for phosphorylation.

  6. In vitro reassembly of the ribose ATP-binding cassette transporter reveals a distinct set of transport complexes.

    PubMed

    Clifton, Matthew C; Simon, Michael J; Erramilli, Satchal K; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A; Stauffacher, Cynthia V

    2015-02-27

    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg(2+). We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg(2+), and VO4); a RbsAC complex in the presence of ADP and Mg(2+); and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters.

  7. ATP-Binding Pocket-Targeted Suppression of Src and Syk by Luteolin Contributes to Its Anti-Inflammatory Action

    PubMed Central

    Lee, Jeong-Oog; Jeong, Deok; Kim, Mi-Yeon; Cho, Jae Youl

    2015-01-01

    Luteolin is a flavonoid identified as a major anti-inflammatory component of Artemisia asiatica. Numerous reports have demonstrated the ability of luteolin to suppress inflammation in a variety of inflammatory conditions. However, its exact anti-inflammatory mechanism has not been fully elucidated. In the present study, the anti-inflammatory mode of action in activated macrophages of luteolin from Artemisia asiatica was examined by employing immunoblotting analysis, a luciferase reporter gene assay, enzyme assays, and an overexpression strategy. Luteolin dose-dependently inhibited the secretion of nitric oxide (NO) and prostaglandin E2 (PGE2) and diminished the levels of mRNA transcripts of inducible NO synthase (iNOS), tumor necrosis factor- (TNF-) α, and cyclooxygenase-2 (COX-2) in lipopolysaccharide- (LPS-) and pam3CSK-treated macrophage-like RAW264.7 cells without displaying cytotoxicity. Luteolin displayed potent NO-inhibitory activity and also suppressed the nuclear translocation of NF-κB (p65 and p50) via blockade of Src and Syk, but not other mitogen-activated kinases. Overexpression of wild type Src and point mutants thereof, and molecular modelling studies, suggest that the ATP-binding pocket may be the luteolin-binding site in Src. These results strongly suggest that luteolin may exert its anti-inflammatory action by suppressing the NF-κB signaling cascade via blockade of ATP binding in Src and Syk. PMID:26236111

  8. Equilibrated atomic models of outward-facing P-glycoprotein and effect of ATP binding on structural dynamics.

    PubMed

    Pan, Lurong; Aller, Stephen G

    2015-01-20

    P-glycoprotein (Pgp) is an ATP-binding cassette (ABC) transporter that alternates between inward- and outward-facing conformations to capture and force substrates out of cells like a peristaltic pump. The high degree of similarity in outward-facing structures across evolution of ABC transporters allowed construction of a high-confidence outward-facing Pgp atomic model based on crystal structures of outward-facing Sav1866 and inward-facing Pgp. The model adhered to previous experimentally determined secondary- and tertiary- configurations during all-atom molecular dynamics simulations in the presence or absence of MgATP. Three long lasting (>100 ns) meta-stable states were apparent in the presence of MgATP revealing new insights into alternating access. The two ATP-binding pockets are highly asymmetric resulting in differential control of overall structural dynamics and allosteric regulation of the drug-binding pocket. Equilibrated Pgp has a considerably different electrostatic profile compared to Sav1866 that implicates significant kinetic and thermodynamic differences in transport mechanisms.

  9. ATP-binding cassette-like transporters are involved in the transport of lignin precursors across plasma and vacuolar membranes

    SciTech Connect

    Miao, Y.C.; Liu, C.

    2010-12-28

    Lignin is a complex biopolymer derived primarily from the condensation of three monomeric precursors, the monolignols. The synthesis of monolignols occurs in the cytoplasm. To reach the cell wall where they are oxidized and polymerized, they must be transported across the cell membrane. However, the molecular mechanisms underlying the transport process are unclear. There are conflicting views about whether the transport of these precursors occurs by passive diffusion or is an energized active process; further, we know little about what chemical forms are required. Using isolated plasma and vacuolar membrane vesicles prepared from Arabidopsis, together with applying different transporter inhibitors in the assays, we examined the uptake of monolignols and their derivatives by these native membrane vesicles. We demonstrate that the transport of lignin precursors across plasmalemma and their sequestration into vacuoles are ATP-dependent primary-transport processes, involving ATP-binding cassette-like transporters. Moreover, we show that both plasma and vacuolar membrane vesicles selectively transport different forms of lignin precursors. In the presence of ATP, the inverted plasma membrane vesicles preferentially take up monolignol aglycones, whereas the vacuolar vesicles are more specific for glucoconjugates, suggesting that the different ATP-binding cassette-like transporters recognize different chemical forms in conveying them to distinct sites, and that glucosylation of monolignols is necessary for their vacuolar storage but not required for direct transport into the cell wall in Arabidopsis.

  10. A 20(S)-protopanoxadiol derivative overcomes multi-drug resistance by antagonizing ATP-binding cassette subfamily B member 1 transporter function

    PubMed Central

    Chen, Wantao; Xu, Qin; Xiao, Meng; Hu, Lihong; Mao, Li; Wang, Xu

    2016-01-01

    In cancer cells, failure of chemotherapy is often caused by the ATP-binding cassette subfamily B member 1 (ABCB1), and few drugs have been successfully developed to overcome ABCB1-mediated multi-drug resistance (MDR). To suppress ABCB1 activity, we previously designed and synthesized a new series of derivatives based on 20(S)-protopanoxadiol (PPD). In the present study, we investigated the role of PPD derivatives in the function of ABC transporters. Non-toxic concentrations of the PPD derivative PPD12 sensitized ABCB1-overexpressing cells to their anti-cancer substrates better than either the parental PPD or inactive PPD11. PPD12 increased intracellular accumulation of adriamycin and rhodamine123 in resistant cancer cells. Although PPD12 did not suppress the expression of ABCB1 mRNA or protein, it stimulated the activity of ABCB1 ATPase. Because PPD12 is a competitive inhibitor, it was predicted to bind to the large hydrophobic cavity of homology-modeled human ABCB1. PPD12 also enhanced the efficacy of adriamycin against ABCB1-overexpressing KB/VCR xenografts in nude mice. In conclusion, PPD12 enhances the efficacy of substrate drugs in ABCB1-overexpressing cancer cells. These findings suggest that a combination therapy consisting of PPD12 with conventional chemotherapeutic agents may be an effective treatment for ABCB1-mediated MDR cancer patients. PMID:26824187

  11. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells.

    PubMed

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao

    2015-01-01

    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  12. Whole-transcriptome survey of the putative ATP-binding cassette (ABC) transporter family genes in the latex-producing laticifers of Hevea brasiliensis.

    PubMed

    Zhiyi, Nie; Guijuan, Kang; Yu, Li; Longjun, Dai; Rizhong, Zeng

    2015-01-01

    The ATP-binding cassette (ABC) proteins or transporters constitute a large protein family in plants and are involved in many different cellular functions and processes, including solute transportation, channel regulation and molecular switches, etc. Through transcriptome sequencing, a transcriptome-wide survey and expression analysis of the ABC protein genes were carried out using the laticiferous latex from Hevea brasiliensis (rubber tree). A total of 46 putative ABC family proteins were identified in the H. brasiliensis latex. These consisted of 12 'full-size', 21 'half-size' and 13 other putative ABC proteins, and all of them showed strong conservation with their Arabidopsis thaliana counterparts. This study indicated that all eight plant ABC protein paralog subfamilies were identified in the H. brasiliensis latex, of which ABCB, ABCG and ABCI were the most abundant. Real-time quantitative reverse transcription-polymerase chain reaction assays demonstrated that gene expression of several latex ABC proteins was regulated by ethylene, jasmonic acid or bark tapping (a wound stress) stimulation, and that HbABCB15, HbABCB19, HbABCD1 and HbABCG21 responded most significantly of all to the abiotic stresses. The identification and expression analysis of the latex ABC family proteins could facilitate further investigation into their physiological involvement in latex metabolism and rubber biosynthesis by H. brasiliensis.

  13. Suppression of c-Myc is involved in multi-walled carbon nanotubes' down-regulation of ATP-binding cassette transporters in human colon adenocarcinoma cells

    SciTech Connect

    Wang, Zhaojing; Xu, Yonghong; Meng, Xiangning; Watari, Fumio; Liu, Hudan; Chen, Xiao

    2015-01-01

    Over-expression of ATP-binding cassette (ABC) transporters, a large family of integral membrane proteins that decrease cellular drug uptake and accumulation by active extrusion, is one of the major causes of cancer multi-drug resistance (MDR) that frequently leads to failure of chemotherapy. Carbon nanotubes (CNTs)-based drug delivery devices hold great promise in enhancing the efficacy of cancer chemotherapy. However, CNTs' effects on the ABC transporters remain under-investigated. In this study, we found that multiwalled carbon nanotubes (MWCNTs) reduced transport activity and expression of ABC transporters including ABCB1/Pgp and ABCC4/MRP4 in human colon adenocarcinoma Caco-2 cells. Proto-oncogene c-Myc, which directly regulates ABC gene expression, was concurrently decreased in MWCNT-treated cells and forced over-expression of c-Myc reversed MWCNTs' inhibitory effects on ABCB1 and ABCC4 expression. MWCNT-cell membrane interaction and cell membrane oxidative damage were observed. However, antioxidants such as vitamin C, β-mecaptoethanol and dimethylthiourea failed to antagonize MWCNTs' down-regulation of ABC transporters. These data suggest that MWCNTs may act on c-Myc, but not through oxidative stress, to down-regulate ABC transporter expression. Our findings thus shed light on CNTs' novel cellular effects that may be utilized to develop CNTs-based drug delivery devices to overcome ABC transporter-mediated cancer chemoresistance.

  14. Discovery of STL polyomavirus, a polyomavirus of ancestral recombinant origin that encodes a unique T antigen by alternative splicing.

    PubMed

    Lim, Efrem S; Reyes, Alejandro; Antonio, Martin; Saha, Debasish; Ikumapayi, Usman N; Adeyemi, Mitchell; Stine, O Colin; Skelton, Rebecca; Brennan, Daniel C; Mkakosya, Rajhab S; Manary, Mark J; Gordon, Jeffrey I; Wang, David

    2013-02-20

    The family Polyomaviridae is comprised of circular double-stranded DNA viruses, several of which are associated with diseases, including cancer, in immunocompromised patients. Here we describe a novel polyomavirus recovered from the fecal microbiota of a child in Malawi, provisionally named STL polyomavirus (STLPyV). We detected STLPyV in clinical stool specimens from USA and The Gambia at up to 1% frequency. Complete genome comparisons of two STLPyV strains demonstrated 5.2% nucleotide divergence. Alternative splicing of the STLPyV early region yielded a unique form of T antigen, which we named 229T, in addition to the expected large and small T antigens. STLPyV has a mosaic genome and shares an ancestral recombinant origin with MWPyV. The discovery of STLPyV highlights a novel alternative splicing strategy and advances our understanding of the complex evolutionary history of polyomaviruses.

  15. ATP binding and hydrolysis steps of the uni-site catalysis by the mitochondrial F(1)-ATPase are affected by inorganic phosphate.

    PubMed

    Milgrom, Yakov M

    2010-10-01

    The effect of inorganic phosphate (P(i)) on uni-site ATP binding and hydrolysis by the nucleotide-depleted F(1)-ATPase from beef heart mitochondria (ndMF(1)) has been investigated. It is shown for the first time that P(i) decreases the apparent rate constant of uni-site ATP binding by ndMF(1) 3-fold with the K(d) of 0.38+/-0.14mM. During uni-site ATP hydrolysis, P(i) also shifts equilibrium between bound ATP and ADP+P(i) in the direction of ATP synthesis with the K(d) of 0.17+/-0.03mM. However, 10mM P(i) does not significantly affect ATP binding during multi-site catalysis.

  16. T antigen origin-binding domain of simian virus 40: determinants of specific DNA binding.

    PubMed

    Bradshaw, Elizabeth M; Sanford, David G; Luo, Xuelian; Sudmeier, James L; Gurard-Levin, Zachary A; Bullock, Peter A; Bachovchin, William W

    2004-06-08

    To better understand origin recognition and initiation of DNA replication, we have examined by NMR complexes formed between the origin-binding domain of SV40 T antigen (T-ag-obd), the initiator protein of the SV40 virus, and cognate and noncognate DNA oligomers. The results reveal two structural effects associated with "origin-specific" binding that are absent in nonspecific DNA binding. The first is the formation of a hydrogen bond (H-bond) involving His 203, a residue that genetic studies have previously identified as crucial to both specific and nonspecific DNA binding in full-length T antigen. In free T-ag-obd, the side chain of His 203 has a pK(a) value of approximately 5, titrating to the N(epsilon)(1)H tautomer at neutral pH (Sudmeier, J. L., et al. (1996) J. Magn. Reson., Ser. B 113, 236-247). In complexes with origin DNA, His 203 N(delta)(1) becomes protonated and remains nontitrating as the imidazolium cation at all pH values from 4 to 8. The H-bonded N(delta1)H resonates at 15.9 ppm, an unusually large N-H proton chemical shift, of a magnitude previously observed only in the catalytic triad of serine proteases at low pH. The formation of this H-bond requires the middle G/C base pair of the recognition pentanucleotide, GAGGC. The second structural effect is a selective distortion of the A/T base pair characterized by a large (0.6 ppm) upfield chemical-shift change of its Watson-Crick proton, while nearby H-bonded protons remain relatively unaffected. The results indicate that T antigen, like many other DNA-binding proteins, may employ "catalytic" or "transition-state-like" interactions in binding its cognate DNA (Jen-Jacobson, L. (1997) Biopolymers 44, 153-180), which may be the solution to the well-known paradox between the relatively modest DNA-binding specificity exhibited by initiator proteins and the high specificity of initiation.

  17. CpABC, a Cryptosporidium parvum ATP-binding cassette protein at the host–parasite boundary in intracellular stages

    PubMed Central

    Perkins, Margaret E.; Riojas, Ynolde A.; Wu, Teresa W.; Le Blancq, Sylvie M.

    1999-01-01

    The intracellular parasite Cryptosporidium parvum develops inside a vacuole at the apex of its epithelial host cell. The developing parasite is separated from the host cell cytoplasm by a zone of attachment that consists of an extensively folded membranous structure known as the feeder organelle. It has been proposed that the feeder organelle is the site of regulation of transport of nutrients and drugs into the parasite. In this report, we localize an ≈200-kDa integral membrane protein, CpABC, from Cryptosporidium parvum to the host–parasite boundary, possibly the feeder organelle. The predicted amino acid sequence of CpABC has significant structural similarity with the cystic fibrosis conductance regulator and the multidrug resistance protein subfamily of ATP-binding cassette proteins. This is an example of a parasite-encoded transport protein localized at the parasite–host interface of an intracellular protozoan. PMID:10318953

  18. The Q Motif Is Involved in DNA Binding but Not ATP Binding in ChlR1 Helicase

    PubMed Central

    Ding, Hao; Guo, Manhong; Vidhyasagar, Venkatasubramanian; Talwar, Tanu; Wu, Yuliang

    2015-01-01

    Helicases are molecular motors that couple the energy of ATP hydrolysis to the unwinding of structured DNA or RNA and chromatin remodeling. The conversion of energy derived from ATP hydrolysis into unwinding and remodeling is coordinated by seven sequence motifs (I, Ia, II, III, IV, V, and VI). The Q motif, consisting of nine amino acids (GFXXPXPIQ) with an invariant glutamine (Q) residue, has been identified in some, but not all helicases. Compared to the seven well-recognized conserved helicase motifs, the role of the Q motif is less acknowledged. Mutations in the human ChlR1 (DDX11) gene are associated with a unique genetic disorder known as Warsaw Breakage Syndrome, which is characterized by cellular defects in genome maintenance. To examine the roles of the Q motif in ChlR1 helicase, we performed site directed mutagenesis of glutamine to alanine at residue 23 in the Q motif of ChlR1. ChlR1 recombinant protein was overexpressed and purified from HEK293T cells. ChlR1-Q23A mutant abolished the helicase activity of ChlR1 and displayed reduced DNA binding ability. The mutant showed impaired ATPase activity but normal ATP binding. A thermal shift assay revealed that ChlR1-Q23A has a melting point value similar to ChlR1-WT. Partial proteolysis mapping demonstrated that ChlR1-WT and Q23A have a similar globular structure, although some subtle conformational differences in these two proteins are evident. Finally, we found ChlR1 exists and functions as a monomer in solution, which is different from FANCJ, in which the Q motif is involved in protein dimerization. Taken together, our results suggest that the Q motif is involved in DNA binding but not ATP binding in ChlR1 helicase. PMID:26474416

  19. In Vitro Reassembly of the Ribose ATP-binding Cassette Transporter Reveals a Distinct Set of Transport Complexes*

    PubMed Central

    Clifton, Matthew C.; Simon, Michael J.; Erramilli, Satchal K.; Zhang, Huide; Zaitseva, Jelena; Hermodson, Mark A.; Stauffacher, Cynthia V.

    2015-01-01

    Bacterial ATP-binding cassette (ABC) importers are primary active transporters that are critical for nutrient uptake. Based on structural and functional studies, ABC importers can be divided into two distinct classes, type I and type II. Type I importers follow a strict alternating access mechanism that is driven by the presence of the substrate. Type II importers accept substrates in a nucleotide-free state, with hydrolysis driving an inward facing conformation. The ribose transporter in Escherichia coli is a tripartite complex consisting of a cytoplasmic ATP-binding cassette protein, RbsA, with fused nucleotide binding domains; a transmembrane domain homodimer, RbsC2; and a periplasmic substrate binding protein, RbsB. To investigate the transport mechanism of the complex RbsABC2, we probed intersubunit interactions by varying the presence of the substrate ribose and the hydrolysis cofactors, ATP/ADP and Mg2+. We were able to purify a full complex, RbsABC2, in the presence of stable, transition state mimics (ATP, Mg2+, and VO4); a RbsAC complex in the presence of ADP and Mg2+; and a heretofore unobserved RbsBC complex in the absence of cofactors. The presence of excess ribose also destabilized complex formation between RbsB and RbsC. These observations suggest that RbsABC2 shares functional traits with both type I and type II importers, as well as possessing unique features, and employs a distinct mechanism relative to other ABC transporters. PMID:25533465

  20. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification

    PubMed Central

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A.; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T.; Ruggles, Kelly V.; DeGiorgis, Joseph A.; Kohlwein, Sepp D.; Schon, Eric A.; Sturley, Stephen L.

    2015-01-01

    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53–36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.—Gulati, S., Balderes, D., Kim, C., Guo, Z. A., Wilcox, L., Area-Gomez, E., Snider, J., Wolinski, H., Stagljar, I., Granato, J. T., Ruggles, K. V., DeGiorgis, J. A., Kohlwein, S. D., Schon, E. A., Sturley, S. L. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification. PMID:26220175

  1. An ATP-binding cassette transporter-like complex governs cell-wall hydrolysis at the bacterial cytokinetic ring.

    PubMed

    Yang, Desirée C; Peters, Nick T; Parzych, Katherine R; Uehara, Tsuyoshi; Markovski, Monica; Bernhardt, Thomas G

    2011-11-08

    ATP-binding cassette transporters are ubiquitous membrane protein complexes that move substrates across membranes. They do so using ATP-induced conformational changes in their nucleotide-binding domains to alter the conformation of the transport cavity formed by their transmembrane domains. In Escherichia coli, an ATP-binding cassette transporter-like complex composed of FtsE (nucleotide-binding domain) and FtsX (transmembrane domain) has long been known to be important for cytokinesis, but its role in the process has remained mysterious. Here we identify FtsEX as a regulator of cell-wall hydrolysis at the division site. Cell-wall material synthesized by the division machinery is shared initially by daughter cells and must be split by hydrolytic enzymes called "amidases" to drive daughter-cell separation. We recently showed that the amidases require activation at the cytokinetic ring by proteins with LytM domains, of which EnvC is the most critical. In this report, we demonstrate that FtsEX directly recruits EnvC to the septum via an interaction between EnvC and a periplasmic loop of FtsX. Importantly, we also show that FtsEX variants predicted to be ATPase defective still recruit EnvC to the septum but fail to promote cell separation. Our results thus suggest that amidase activation via EnvC in the periplasm is regulated by conformational changes in the FtsEX complex mediated by ATP hydrolysis in the cytoplasm. Since FtsE has been reported to interact with the tubulin-like FtsZ protein, our model provides a potential mechanism for coupling amidase activity with the contraction of the FtsZ cytoskeletal ring.

  2. Mycobacterium tuberculosis Universal Stress Protein Rv2623 Regulates Bacillary Growth by ATP Binding: Requirement for Establishing Chronic Persistent Infection

    SciTech Connect

    Drumm, J.; Mi, K; Bilder, P; Sun, M; Lim, J; Bielefeldt-Ohmann, H; Basaraba, R; So, M; Zhu, G; et. al.

    2009-01-01

    Tuberculous latency and reactivation play a significant role in the pathogenesis of tuberculosis, yet the mechanisms that regulate these processes remain unclear. The Mycobacterium tuberculosisuniversal stress protein (USP) homolog, rv2623, is among the most highly induced genes when the tubercle bacillus is subjected to hypoxia and nitrosative stress, conditions thought to promote latency. Induction of rv2623 also occurs when M. tuberculosis encounters conditions associated with growth arrest, such as the intracellular milieu of macrophages and in the lungs of mice with chronic tuberculosis. Therefore, we tested the hypothesis that Rv2623 regulates tuberculosis latency. We observed that an Rv2623-deficient mutant fails to establish chronic tuberculous infection in guinea pigs and mice, exhibiting a hypervirulence phenotype associated with increased bacterial burden and mortality. Consistent with this in vivo growth-regulatory role, constitutive overexpression of rv2623 attenuates mycobacterial growth in vitro. Biochemical analysis of purified Rv2623 suggested that this mycobacterial USP binds ATP, and the 2.9-A-resolution crystal structure revealed that Rv2623 engages ATP in a novel nucleotide-binding pocket. Structure-guided mutagenesis yielded Rv2623 mutants with reduced ATP-binding capacity. Analysis of mycobacteria overexpressing these mutants revealed that the in vitro growth-inhibitory property of Rv2623 correlates with its ability to bind ATP. Together, the results indicate that i M. tuberculosis Rv2623 regulates mycobacterial growth in vitro and in vivo, and ii Rv2623 is required for the entry of the tubercle bacillus into the chronic phase of infection in the host; in addition, iii Rv2623 binds ATP; and iv the growth-regulatory attribute of this USP is dependent on its ATP-binding activity. We propose that Rv2623 may function as an ATP-dependent signaling intermediate in a pathway that promotes persistent infection.

  3. Regulation of ATP-binding cassette transporters and cholesterol efflux by glucose in primary human monocytes and murine bone marrow-derived macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Individuals with type 2 diabetes mellitus are at increased risk of developing atherosclerosis. This may be partially attributable to suppression of macrophage ATP-binding cassette (ABC) transporter mediated cholesterol efflux by sustained elevated blood glucose concentrations. Two models were used...

  4. LrABCF1, a GCN-type ATP-binding cassette transporter from Lilium regale, is involved in defense responses against viral and fungal pathogens

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ATP-binding cassette (ABC) transporters are essential for membrane translocation in diverse biological processes, such as plant development and defense response. Here, a general control non-derepressible (GCN)-type ABC transporter gene, designated LrABCF1, was identified from Cucumber mosaic virus (...

  5. Fructose Uptake in Sinorhizobium meliloti Is Mediated by a High-Affinity ATP-Binding Cassette Transport System

    PubMed Central

    Lambert, Annie; Østerås, Magne; Mandon, Karine; Poggi, Marie-Christine; Le Rudulier, Daniel

    2001-01-01

    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (Km of 6 μM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  6. Fructose uptake in Sinorhizobium meliloti is mediated by a high-affinity ATP-binding cassette transport system.

    PubMed

    Lambert, A; Østerås, M; Mandon, K; Poggi, M C; Le Rudulier, D

    2001-08-01

    By transposon mutagenesis, we have isolated a mutant of Sinorhizobium meliloti which is totally unable to grow on fructose as sole carbon source as a consequence of its inability to transport this sugar. The cloning and sequencing analysis of the chromosomal DNA region flanking the TnphoA insertion revealed the presence of six open reading frames (ORFs) organized in two loci, frcRS and frcBCAK, transcribed divergently. The frcBCA genes encode the characteristic components of an ATP-binding cassette transporter (FrcB, a periplasmic substrate binding protein, FrcC, an integral membrane permease, and FrcA, an ATP-binding cytoplasmic protein), which is the unique high-affinity (K(m) of 6 microM) fructose uptake system in S. meliloti. The FrcK protein shows homology with some kinases, while FrcR is probably a transcriptional regulator of the repressor-ORF-kinase family. The expression of S. meliloti frcBCAK in Escherichia coli, which transports fructose only via the phosphotransferase system, resulted in the detection of a periplasmic fructose binding activity, demonstrating that FrcB is the binding protein of the Frc transporter. The analysis of substrate specificities revealed that the Frc system is also a high-affinity transporter for ribose and mannose, which are both fructose competitors for the binding to the periplasmic FrcB protein. However, the Frc mutant was still able to grow on these sugars as sole carbon source, demonstrating the presence of at least one other uptake system for mannose and ribose in S. meliloti. The expression of the frcBC genes as determined by measurements of alkaline phosphatase activity was shown to be induced by mannitol and fructose, but not by mannose, ribose, glucose, or succinate, suggesting that the Frc system is primarily targeted towards fructose. Neither Nod nor Fix phenotypes were impared in the TnphoA mutant, demonstrating that fructose uptake is not essential for nodulation and nitrogen fixation, although FrcB protein is

  7. The PAL1 gene product is a peroxisomal ATP-binding cassette transporter in the yeast Saccharomyces cerevisiae

    PubMed Central

    1996-01-01

    The PAL1 gene was isolated using PCR and degenerate oligonucleotide primers corresponding to highly conserved amino acid sequence motifs diagnostic of the ATP-binding cassette domain of the superfamily of membrane-bound transport proteins typified by mammalian multidrug resistance transporter 1 and Saccharomyces cerevisiae Ste6. The deduced PAL1 gene product is similar in length to, has the same predicted topology as, and shares the highest degree of amino acid sequence identity with two human proteins, adrenoleukodystrophy protein and peroxisomal membrane protein (70 kD), which are both presumptive ATP- binding cassette transporters thought to be constituents of the peroxisomal membrane. As judged by hybridization of a PAL1 probe to isolated RNA and by expression of a PAL1-lacZ fusion, a PAL1 transcript was only detectable when cells were grown on oleic acid, a carbon source which requires the biogenesis of functional peroxisomes for its metabolism. A pal1delta mutant grew normally on either glucose- or glycerol-containing media; however, unlike PAL1+ cells (or the pal1delta mutant carrying the PAL1 gene on a plasmid), pal1delta cells were unable to grow on either a solid medium or a liquid medium containing oleic acid as the sole carbon source. Antibodies raised against a chimeric protein in which the COOH-terminal domain of Pal1 was fused to glutathione S-transferase specifically recognized a protein in extracts from wild-type cells only when grown on oleic acid; this species represents the PAL1 gene product because it was missing in pal1delta cells and more abundant in pal1delta cells expressing PAL1 from a multicopy plasmid. The Pal1 polypeptide was highly enriched in the organellar pellet fraction prepared from wild-type cells by differential centrifugation and comigrated upon velocity sedimentation in a Nycodenz gradient with a known component of the peroxisomal matrix, e-oxoacyl-CoA thiolase. As judged by both subcellular fractionation and indirect

  8. Molecular phylogenetic study and expression analysis of ATP-binding cassette transporter gene family in Oryza sativa in response to salt stress.

    PubMed

    Saha, Jayita; Sengupta, Atreyee; Gupta, Kamala; Gupta, Bhaskar

    2015-02-01

    ATP-binding cassette (ABC) transporter is a large gene superfamily that utilizes the energy released from ATP hydrolysis for transporting myriad of substrates across the biological membranes. Although many investigations have been done on the structural and functional analysis of the ABC transporters in Oryza sativa, much less is known about molecular phylogenetic and global expression pattern of the complete ABC family in rice. In this study, we have carried out a comprehensive phylogenetic analysis constructing neighbor-joining and maximum-likelihood trees based on various statistical methods of different ABC protein subfamily of five plant lineages including Chlamydomonas reinhardtii (green algae), Physcomitrella patens (moss), Selaginella moellendorffii (lycophyte), Arabidopsis thaliana (dicot) and O. sativa (monocot) to explore the origin and evolutionary patterns of these ABC genes. We have identified several conserved motifs in nucleotide binding domain (NBD) of ABC proteins among all plant lineages during evolution. Amongst the different ABC protein subfamilies, 'ABCE' has not yet been identified in lower plant genomes (algae, moss and lycophytes). The result indicated that gene duplication and diversification process acted upon these genes as a major operative force creating new groups and subgroups and functional divergence during evolution. We have demonstrated that rice ABCI subfamily consists of only half size transporters that represented highly dynamic members showing maximum sequence variations among the other rice ABC subfamilies. The evolutionary and the expression analysis contribute to a deep insight into the evolution and diversity of rice ABC proteins and their roles in response to salt stress that facilitate our further understanding on rice ABC transporters.

  9. Time-resolved Fourier Transform Infrared Spectroscopy of the Nucleotide-binding Domain from the ATP-binding Cassette Transporter MsbA

    PubMed Central

    Syberg, Falk; Suveyzdis, Yan; Kötting, Carsten; Gerwert, Klaus; Hofmann, Eckhard

    2012-01-01

    MsbA is an essential Escherichia coli ATP-binding cassette (ABC) transporter involved in the flipping of lipid A across the cytoplasmic membrane. It is a close homologue of human P-glycoprotein involved in multidrug resistance, and it similarly accepts a variety of small hydrophobic xenobiotics as transport substrates. X-ray structures of three full-length ABC multidrug exporters (including MsbA) have been published recently and reveal large conformational changes during the transport cycle. However, how ATP hydrolysis couples to these conformational changes and finally the transport is still an open question. We employed time-resolved FTIR spectroscopy, a powerful method to elucidate molecular reaction mechanisms of soluble and membrane proteins, to address this question with high spatiotemporal resolution. Here, we monitored the hydrolysis reaction in the nucleotide-binding domain of MsbA at the atomic level. The isolated MsbA nucleotide-binding domain hydrolyzed ATP with Vmax = 45 nmol mg−1 min−1, similar to the full-length transporter. A Hill coefficient of 1.49 demonstrates positive cooperativity between the two catalytic sites formed upon dimerization. Global fit analysis of time-resolved FTIR data revealed two apparent rate constants of ∼1 and 0.01 s−1, which were assigned to formation of the catalytic site and hydrolysis, respectively. Using isotopically labeled ATP, we identified specific marker bands for protein-bound ATP (1245 cm−1), ADP (1101 and 1205 cm−1), and free phosphate (1078 cm−1). Cleavage of the β-phosphate–γ-phosphate bond was found to be the rate-limiting step; no protein-bound phosphate intermediate was resolved. PMID:22593573

  10. AtMRP2, an Arabidopsis ATP binding cassette transporter able to transport glutathione S-conjugates and chlorophyll catabolites: functional comparisons with Atmrp1.

    PubMed Central

    Lu, Y P; Li, Z S; Drozdowicz, Y M; Hortensteiner, S; Martinoia, E; Rea, P A

    1998-01-01

    Three ATP binding cassette (ABC) transporter-like activities directed toward large amphipathic organic anions have recently been identified on the vacuolar membrane of plant cells. These are the Mg-ATP-energized, vanadate-inhibitable vacuolar accumulation of glutathione S-conjugates (GS conjugates), chlorophyll catabolites, and bile acids, respectively. Although each of these activities previously had been assigned to distinct pumps in native plant membranes, we describe here the molecular cloning, physical mapping, and heterologous expression of a gene, AtMRP2, from Arabidopsis thaliana that encodes a multispecific ABC transporter competent in the transport of both GS conjugates and chlorophyll catabolites. Unlike its isoform, AtMRP1, which transports the model Brassica napus chlorophyll catabolite transporter substrate Bn-NCC-1 at low efficiency, heterologously expressed AtMRP2 has the facility for simultaneous high-efficiency parallel transport of GS conjugates and Bn-NCC-1. The properties of AtMRP2 therefore establish a basis for the manipulation of two previously identified plant ABC transporter activities and provide an explanation for how the comparable transporter in native plant membranes would be systematically mistaken for two distinct transporters. These findings are discussed with respect to the functional organization of AtMRP2, the inability of AtMRP2 and AtMRP1 to transport the model bile acid transporter substrate taurocholate (despite the pronounced sensitivity of both to direct inhibition by this agent), the differential patterns of expression of their genes in the intact plant, and the high capacity of AtMRP2 for the transport of glutathionated herbicides and anthocyanins. PMID:9490749

  11. The ABCC6 transporter: what lessons can be learnt from other ATP-binding cassette transporters?

    PubMed Central

    Vanakker, Olivier M.; Hosen, Mohammad J.; Paepe, Anne De

    2013-01-01

    ABC transporters represent a large family of ATP-driven transmembrane transporters involved in uni- or bidirectional transfer of a large variety of substrates. Divided in seven families, they represent 48 transporter proteins, several of which have been associated with human disease. Among the latter is ABCC6, a unidirectional exporter protein primarily expressed in liver and kidney. ABCC6 deficiency has been shown to cause the ectopic mineralization disorder pseudoxanthoma elasticum (PXE), characterized by calcification and fragmentation of elastic fibers, resulting in oculocutaneous and cardiovascular symptoms. Unique in the group of connective tissue disorders, the pathophysiological relation between the ABCC6 transporter and ectopic mineralization in PXE remains enigmatic, not in the least because of lack of knowledge on the substrate(s) of ABCC6 and its unusual expression pattern. Because many features, including structure and transport mechanism, are shared by many ABC transporters, it is worthwhile to evaluate if and to what extent the knowledge on the physiology and pathophysiology of these other transporters may provide useful clues toward understanding the (patho)physiological role of ABCC6 and how its deficiency may be dealt with. PMID:24137173

  12. Heavy metal tolerance in the fission yeast requires an ATP-binding cassette-type vacuolar membrane transporter.

    PubMed Central

    Ortiz, D F; Kreppel, L; Speiser, D M; Scheel, G; McDonald, G; Ow, D W

    1992-01-01

    In response to heavy metal stress, plants and certain fungi, such as the fission yeast Schizosaccharomyces pombe, synthesize small metal-binding peptides known as phytochelatins. We have identified a cadmium sensitive S. pombe mutant deficient in the accumulation of a sulfide-containing phytochelatin-cadmium complex, and have isolated the gene, designated hmt1, that complements this mutant. The deduced protein sequence of the hmt1 gene product shares sequence identity with the family of ABC (ATP-binding cassette)-type transport proteins which includes the mammalian P-glycoproteins and CFTR, suggesting that the encoded product is an integral membrane protein. Analysis of fractionated fission yeast cell components indicates that the HMT1 polypeptide is associated with the vacuolar membrane. Additionally, fission yeast strains harboring an hmt1-expressing multicopy plasmid exhibit enhanced metal tolerance along with a higher intracellular level of cadmium, implying a relationship between HMT1 mediated transport and compartmentalization of heavy metals. This suggests that tissue-specific overproduction of a functional hmt1 product in transgenic plants might be a means to alter the tissue localization of these elements, such as for sequestering heavy metals away from consumable parts of crop plants. Images PMID:1396551

  13. Modulating the function of ATP-binding cassette subfamily G member 2 (ABCG2) with inhibitor cabozantinib.

    PubMed

    Zhang, Guan-Nan; Zhang, Yun-Kai; Wang, Yi-Jun; Barbuti, Anna Maria; Zhu, Xi-Jun; Yu, Xin-Yue; Wen, Ai-Wen; Wurpel, John N D; Chen, Zhe-Sheng

    2017-01-25

    Cabozantinib (XL184) is a small molecule tyrosine kinase receptor inhibitor, which targets c-Met and VEGFR2. Cabozantinib has been approved by the Food and Drug Administration to treat advanced medullary thyroid cancer and renal cell carcinoma. In the present study, we evaluated the ability of cabozantinib to modulate the function of the ATP-binding cassette subfamily G member 2 (ABCG2) by sensitizing cells that are resistant to ABCG2 substrate antineoplastic drugs. We used a drug-selected resistant cell line H460/MX20 and three ABCG2 stable transfected cell lines ABCG2-482-R2, ABCG2-482-G2, and ABCG2-482-T7, which overexpress ABCG2. Cabozantinib, at non-toxic concentrations (3 or 5μM), sensitized the ABCG2-overexpressing cells to mitoxantrone, SN-38, and topotecan. Our results indicate that cabozantinib reverses ABCG2-mediated multidrug resistance by antagonizing the drug efflux function of the ABCG2 transporter instead of downregulating its expression. The molecular docking analysis indicates that cabozantinib binds to the drug-binding site of the ABCG2 transporter. Overall, our findings demonstrate that cabozantinib inhibits the ABCG2 transporter function and consequently enhances the effect of the antineoplastic agents that are substrates of ABCG2. Cabozantinib may be a useful agent in anticancer treatment regimens for patients who are resistant to ABCG2 substrate drugs.

  14. ABCC1, an ATP Binding Cassette Protein from Grape Berry, Transports Anthocyanidin 3-O-Glucosides[W][OA

    PubMed Central

    Francisco, Rita Maria; Regalado, Ana; Ageorges, Agnès; Burla, Bo J.; Bassin, Barbara; Eisenach, Cornelia; Zarrouk, Olfa; Vialet, Sandrine; Marlin, Thérèse; Chaves, Maria Manuela; Martinoia, Enrico; Nagy, Réka

    2013-01-01

    Accumulation of anthocyanins in the exocarp of red grapevine (Vitis vinifera) cultivars is one of several events that characterize the onset of grape berry ripening (véraison). Despite our thorough understanding of anthocyanin biosynthesis and regulation, little is known about the molecular aspects of their transport. The participation of ATP binding cassette (ABC) proteins in vacuolar anthocyanin transport has long been a matter of debate. Here, we present biochemical evidence that an ABC protein, ABCC1, localizes to the tonoplast and is involved in the transport of glucosylated anthocyanidins. ABCC1 is expressed in the exocarp throughout berry development and ripening, with a significant increase at véraison (i.e., the onset of ripening). Transport experiments using microsomes isolated from ABCC1-expressing yeast cells showed that ABCC1 transports malvidin 3-O-glucoside. The transport strictly depends on the presence of GSH, which is cotransported with the anthocyanins and is sensitive to inhibitors of ABC proteins. By exposing anthocyanin-producing grapevine root cultures to buthionine sulphoximine, which reduced GSH levels, a decrease in anthocyanin concentration is observed. In conclusion, we provide evidence that ABCC1 acts as an anthocyanin transporter that depends on GSH without the formation of an anthocyanin-GSH conjugate. PMID:23723325

  15. ATP-binding cassette transporters and sterol O-acyltransferases interact at membrane microdomains to modulate sterol uptake and esterification.

    PubMed

    Gulati, Sonia; Balderes, Dina; Kim, Christine; Guo, Zhongmin A; Wilcox, Lisa; Area-Gomez, Estela; Snider, Jamie; Wolinski, Heimo; Stagljar, Igor; Granato, Juliana T; Ruggles, Kelly V; DeGiorgis, Joseph A; Kohlwein, Sepp D; Schon, Eric A; Sturley, Stephen L

    2015-11-01

    A key component of eukaryotic lipid homeostasis is the esterification of sterols with fatty acids by sterol O-acyltransferases (SOATs). The esterification reactions are allosterically activated by their sterol substrates, the majority of which accumulate at the plasma membrane. We demonstrate that in yeast, sterol transport from the plasma membrane to the site of esterification is associated with the physical interaction of the major SOAT, acyl-coenzyme A:cholesterol acyltransferase (ACAT)-related enzyme (Are)2p, with 2 plasma membrane ATP-binding cassette (ABC) transporters: Aus1p and Pdr11p. Are2p, Aus1p, and Pdr11p, unlike the minor acyltransferase, Are1p, colocalize to sterol and sphingolipid-enriched, detergent-resistant microdomains (DRMs). Deletion of either ABC transporter results in Are2p relocalization to detergent-soluble membrane domains and a significant decrease (53-36%) in esterification of exogenous sterol. Similarly, in murine tissues, the SOAT1/Acat1 enzyme and activity localize to DRMs. This subcellular localization is diminished upon deletion of murine ABC transporters, such as Abcg1, which itself is DRM associated. We propose that the close proximity of sterol esterification and transport proteins to each other combined with their residence in lipid-enriched membrane microdomains facilitates rapid, high-capacity sterol transport and esterification, obviating any requirement for soluble intermediary proteins.

  16. Inventory and general analysis of the ATP-binding cassette (ABC) gene superfamily in maize (Zea mays L.).

    PubMed

    Pang, Kaiyuan; Li, Yanjiao; Liu, Menghan; Meng, Zhaodong; Yu, Yanli

    2013-09-10

    The metabolic functions of ATP-binding cassette (or ABC) proteins, one of the largest families of proteins presented in all organisms, have been investigated in many protozoan, animal and plant species. To facilitate more systematic and complicated studies on maize ABC proteins in the future, we present the first complete inventory of these proteins, including 130 open reading frames (ORFs), and provide general descriptions of their classifications, basic structures, typical functions, evolution track analysis and expression profiles. The 130 ORFs were assigned to eight subfamilies based on their structures and homological features. Five of these subfamilies consist of 109 proteins, containing transmembrane domains (TM) performing as transporters. The rest three subfamilies contain 21 soluble proteins involved in various functions other than molecular transport. A comparison of ABC proteins among nine selected species revealed either convergence or divergence in each of the ABC subfamilies. Generally, plant genomes contain far more ABC genes than animal genomes. The expression profiles and evolution track of each maize ABC gene were further investigated, the results of which could provide clues for analyzing their functions. Quantitative real-time polymerase chain reaction experiments (PCR) were conducted to detect induced expression in select ABC genes under several common stresses. This investigation provides valuable information for future research on stress tolerance in plants and potential strategies for enhancing maize production under stressful conditions.

  17. The ATP-binding cassette transporter OsABCG15 is required for anther development and pollen fertility in rice.

    PubMed

    Niu, Bai-Xiao; He, Fu-Rong; He, Ming; Ren, Ding; Chen, Le-Tian; Liu, Yao-Guang

    2013-08-01

    Plant male reproductive development is a complex biological process, but the underlying mechanism is not well understood. Here, we characterized a rice (Oryza sativa L.) male sterile mutant. Based on map-based cloning and sequence analysis, we identified a 1,459-bp deletion in an adenosine triphosphate (ATP)-binding cassette (ABC) transporter gene, OsABCG15, causing abnormal anthers and male sterility. Therefore, we named this mutant osabcg15. Expression analysis showed that OsABCG15 is expressed specifically in developmental anthers from stage 8 (meiosis II stage) to stage 10 (late microspore stage). Two genes CYP704B2 and WDA1, involved in the biosynthesis of very-long-chain fatty acids for the establishment of the anther cuticle and pollen exine, were downregulated in osabcg15 mutant, suggesting that OsABCG15 may play a key function in the processes related to sporopollenin biosynthesis or sporopollenin transfer from tapetal cells to anther locules. Consistently, histological analysis showed that osabcg15 mutants developed obvious abnormality in postmeiotic tapetum degeneration, leading to rapid degredation of young microspores. The results suggest that OsABCG15 plays a critical role in exine formation and pollen development, similar to the homologous gene of AtABCG26 in Arabidopsis. This work is helpful to understand the regulatory network in rice anther development.

  18. Linsitinib (OSI-906) antagonizes ATP-binding cassette subfamily G member 2 and subfamily C member 10-mediated drug resistance.

    PubMed

    Zhang, Hui; Kathawala, Rishil J; Wang, Yi-Jun; Zhang, Yun-Kai; Patel, Atish; Shukla, Suneet; Robey, Robert W; Talele, Tanaji T; Ashby, Charles R; Ambudkar, Suresh V; Bates, Susan E; Fu, Li-Wu; Chen, Zhe-Sheng

    2014-06-01

    In this study we investigated the effect of linsitinib on the reversal of multidrug resistance (MDR) mediated by the overexpression of the ATP-binding cassette (ABC) subfamily members ABCB1, ABCG2, ABCC1 and ABCC10. Our results indicate for the first time that linsitinib significantly potentiate the effect of anti-neoplastic drugs mitoxantrone (MX) and SN-38 in ABCG2-overexpressing cells; paclitaxel, docetaxel and vinblastine in ABCC10-overexpressing cells. Linsitinib moderately enhanced the cytotoxicity of vincristine in cell lines overexpressing ABCB1, whereas it did not alter the cytotoxicity of substrates of ABCC1. Furthermore, linsitinib significantly increased the intracellular accumulation and decreased the efflux of [(3)H]-MX in ABCG2-overexpressing cells and [(3)H]-paclitaxel in ABCC10-overexpressing cells. However, linsitinib, at a concentration that reversed MDR, did not significantly alter the expression levels of either the ABCG2 or ABCC10 transporter proteins. Furthermore, linsitinib did not significantly alter the intracellular localization of ABCG2 or ABCC10. Moreover, linsitinib stimulated the ATPase activity of ABCG2 in a concentration-dependent manner. Overall, our study suggests that linsitinib attenuates ABCG2- and ABCC10-mediated MDR by directly inhibiting their function as opposed to altering ABCG2 or ABCC10 protein expression.

  19. Simulated microgravity alters the expression of cytoskeleton- and ATP-binding-related genes in MLO-Y4 osteocytes

    NASA Astrophysics Data System (ADS)

    Chen, Zhihao; Zhao, Fan; Qi, Yiduo; Hu, Lifang; Li, Dijie; Yin, Chong; Su, Peihong; Zhang, Yan; Ma, Jianhua; Qian, Jing; Zhou, Hongpo; Zou, Yiwei; Qian, Airong

    2016-12-01

    Bone undergoes dynamic modelling and remodelling processes, and it requires gravity-mediated mechanical stimulation for the maintenance of mineral content and structure. Osteocytes are the most commonly found cells in the mature bone, and they are sensitive to mechanical changes. The purpose of this study was to investigate the effects of microgravity simulated with a random position machine (RPM) on the gene expression profile of osteocytes. Genes sensitive to RPM treatment were sorted on the basis of biological processes, interactions and signalling pathways. Overall, 504 differentially expressed genes (DEGs) in osteocytes cultured under RPM conditions were found. The DEGs were further analysed using bioinformatics tools such as DAVID and iReport. A total of 15 ATP-binding and cytoskeleton-related genes were further confirmed by quantitative real-time PCR (qRT-PCR). Our findings demonstrate that the RPM affected the expression of genes involved in cytoskeleton remodelling and the energy-transfer process in osteocytes. The identification of mechanosensitive genes may enhance our understanding of the roles of osteocytes in mechanosensation and may provide some potential targets for preventing and treating bone-related diseases.

  20. Identification of mutations in regions corresponding to the two putative nucleotide (ATP)-binding folds of the cystic fibrosis gene

    SciTech Connect

    Kerem, B.; Zielenski, J.; Markiewicz, D.; Bozon, D.; Kennedy, D.; Rommens, J.M. ); Gazit, E. ); Yahav, J. ); Riordan, J.R. ); Collins, F.S. ); Tsui, Lapchee Univ. of Toronto, Ontario )

    1990-11-01

    Additional mutations in the cystic fibrosis (CF) gene were identified in the regions corresponding to the two putative nucleotide (ATP)-binding folds (NBFs) of the predicted polypeptide. The patient cohort included 46 Canadian CF families with well-characterized DNA marker haplotypes spanning the disease locus and several other families from Israel. Eleven mutations were found in the first NBF, 2 were found in the second NBF, but none was found in the R-domain. Seven of the mutations were of the missense type affecting some of the highly conserved amino acid residues in the first NBF; 3 were nonsense mutations; 2 would probably affect mRNA splicing; 2 corresponded to small deletions, including another 3-base-pair deletion different from the major mutation ({delta}F508), which could account for 70% of the CF chromosomes in the population. Nine of these mutations accounted for 12 of the 31 non-{delta}F508 CF chromosomes in the Canadian families. The highly heterogeneous nature of the remaining CF mutations provides important insights into the structure and function of the protein, but it also suggests that DNA-based genetic screening for CF carrier status will not be straightforward.

  1. L1198F Mutation Resensitizes Crizotinib to ALK by Altering the Conformation of Inhibitor and ATP Binding Sites

    PubMed Central

    Li, Jian; Sun, Rong; Wu, Yuehong; Song, Mingzhu; Li, Jia; Yang, Qianye; Chen, Xiaoyi; Bao, Jinku; Zhao, Qi

    2017-01-01

    The efficacy of anaplastic lymphoma kinase (ALK) positive non-small-cell lung cancer (NSCLC) treatment with small molecule inhibitors is greatly challenged by acquired resistance. A recent study reported the newest generation inhibitor resistant mutation L1198F led to the resensitization to crizotinib, which is the first Food and Drug Administration (FDA) approved drug for the treatment of ALK-positive NSCLC. It is of great importance to understand how this extremely rare event occurred for the purpose of overcoming the acquired resistance of such inhibitors. In this study, we exploited molecular dynamics (MD) simulation to dissect the molecular mechanisms. Our MD results revealed that L1198F mutation of ALK resulted in the conformational change at the inhibitor site and altered the binding affinity of ALK to crizotinib and lorlatinib. L1198F mutation also affected the autoactivation of ALK as supported by the identification of His1124 and Tyr1278 as critical amino acids involved in ATP binding and phosphorylation. Our findings are valuable for designing more specific and potent inhibitors for the treatment of ALK-positive NSCLC and other types of cancer. PMID:28245558

  2. Isolation and characterization of the ATP-binding cassette (ABC) transporter system genes from loofah witches' broom phytoplasma.

    PubMed

    Huang, Chun-Lin; Ho, Kuo-Chieh

    2007-10-01

    A clone containing a 3903 bp EcoRI-restriction fragment was obtained from a lambda(ZAP) genomic library of loofah witches' broom (LfWB) phytoplasma by plaque hybridization using a PCR fragment as a probe. Sequence analysis revealed that this fragment contained three open reading frames (ORFs). The deduced amino acid sequences of ORF 1 and ORF 2 showed a high homology with the ATP-binding proteins of the ABC transporter system genes of prokaryotes and eukaryotes, and encoded proteins with a molecular mass of 36 and 30 kDa, respectively. Based on amino acid sequence similarity, secondary structure, hydrophilicity and a signal peptide sequence at the N-terminus, we predicted that ORF 3 might encode a specific solute-binding prolipoprotein of the ABC transporter system with a molecular mass of 62 kDa. The cleavage site of this prolipoprotein signal peptide was similar to those of gram-positive bacteria. In addition to nutrient uptake, ABC transporter systems of bacteria also play a role in signal transduction, drug-resistance and perhaps virulence. The possible implications of the system to the survival and the pathogenesis of phytoplasma were discussed.

  3. Genome-wide analysis of the ATP-binding cassette (ABC) transporter gene family in the silkworm, Bombyx mori.

    PubMed

    Xie, Xiaodong; Cheng, Tingcai; Wang, Genhong; Duan, Jun; Niu, Weihuan; Xia, Qingyou

    2012-07-01

    The ATP-binding cassette (ABC) superfamily is a larger protein family with diverse physiological functions in all kingdoms of life. We identified 53 ABC transporters in the silkworm genome, and classified them into eight subfamilies (A-H). Comparative genome analysis revealed that the silkworm has an expanded ABCC subfamily with more members than Drosophila melanogaster, Caenorhabditis elegans, or Homo sapiens. Phylogenetic analysis showed that the ABCE and ABCF genes were highly conserved in the silkworm, indicating possible involvement in fundamental biological processes. Five multidrug resistance-related genes in the ABCB subfamily and two multidrug resistance-associated-related genes in the ABCC subfamily indicated involvement in biochemical defense. Genetic variation analysis revealed four ABC genes that might be evolving under positive selection. Moreover, the silkworm ABCC4 gene might be important for silkworm domestication. Microarray analysis showed that the silkworm ABC genes had distinct expression patterns in different tissues on day 3 of the fifth instar. These results might provide new insights for further functional studies on the ABC genes in the silkworm genome.

  4. Stickleback embryos use ATP-binding cassette transporters as a buffer against exposure to maternally derived cortisol

    PubMed Central

    Bukhari, Syed Abbas; Bell, Alison M.

    2016-01-01

    Offspring from females that experience stressful conditions during reproduction often exhibit altered phenotypes and many of these effects are thought to arise owing to increased exposure to maternal glucocorticoids. While embryos of placental vertebrates are known to regulate exposure to maternal glucocorticoids via placental steroid metabolism, much less is known about how and whether egg-laying vertebrates can control their steroid environment during embryonic development. We tested the hypothesis that threespine stickleback (Gasterosteus aculeatus) embryos can regulate exposure to maternal steroids via active efflux of maternal steroids from the egg. Embryos rapidly (within 72 h) cleared intact steroids, but blocking ATP-binding cassette (ABC) transporters inhibited cortisol clearance. Remarkably, this efflux of cortisol was sufficient to prevent a transcriptional response of embryos to exogenous cortisol. Taken together, these findings suggest that, much like their placental counterparts, developing fish embryos can actively regulate their exposure to maternal cortisol. These findings highlight the fact that even in egg-laying vertebrates, the realized exposure to maternal steroids is mediated by both maternal and embryonic processes and this has important implications for understanding how maternal stress influences offspring development. PMID:26984623

  5. Marine medaka ATP-binding cassette (ABC) superfamily and new insight into teleost Abch nomenclature

    PubMed Central

    Jeong, Chang-Bum; Kim, Bo-Mi; Kang, Hye-Min; Choi, Ik-Young; Rhee, Jae-Sung; Lee, Jae-Seong

    2015-01-01

    The ABC gene family is recognized as one of the largest gene families in all kingdoms of life. Although many genes involved in the ABC superfamily have been annotated from several fish species, information on large sets of the ABC superfamily and their evolutionary characterization are still unclear. In the marine medaka Oryzias melastigma, 50 ABC transporters were identified with bioinformatics-aided in silico analyses, and their full-length cDNA sequences were characterized. Phylogenetic analysis revealed that they could be classified into the eight subfamilies (A–H) that include all members of all ABC subfamilies. Interestingly, several teleosts’ Abcg members were closely clustered with Abch members in a distinctive clade. The abch gene was also observed in the coelacanth and the spotted gar, suggesting that this gene was retained from a bilaterian ancestor and that a gene loss event recently occurred in the tetrapod lineage. In teleosts, the nomenclature of previously annotated abcg genes should be considered carefully, as they form a distinctive clade with the marine medaka abch subfamily and other teleost abch genes, but not with the members of the Abcg subfamily. PMID:26472499

  6. Solution structure and function in trifluoroethanol of PP-50, an ATP-binding peptide from F1ATPase.

    PubMed

    Chuang, W J; Abeygunawardana, C; Gittis, A G; Pedersen, P L; Mildvan, A S

    1995-05-10

    PP-50, a synthetic peptide, based on residues 141-190 of the beta-subunit of mitochondrial F1ATPase, containing the GX4GKT consensus sequence for nucleoside triphosphate binding, binds ATP tightly (Kd = 17.5 microM) as found by fluorescence titration at pH 4.0. CD and 2D proton NMR studies at pH 4.0 revealed two beta-turns, regions of extended secondary structure, transient tertiary structure, and flexibility in the GX4GKT region (W.J. Chuang, C. Abeygunawardana, P. L. Pedersen, and A. S. Mildvan, 1992, Biochemistry 31, 7915-7921). CD titration of PP-50 with trifluoroethanol (TFE) reveals a decrease in ellipticity at 208 and 222 nm, saturating at 25% TFE. Computer analysis indicates that 25% TFE increases the helix content from 5.8 to 28.6%, decreases the beta-structure from 30.2 to 20.2% and decreases the coil content from 64 to 51.2%. Fluorescence titrations of H2ATP2- with PP-50 in 25% TFE yields a Kd of 7.3 microM, 2.4-fold tighter than in H2O, probably due to TFE increasing the activity of H2ATP2- . PP-50 completely quenches the fluorescence of H2ATP2- in 25% TFE, while in H2O the fluorescence quenching is only 62%. In H2O the binding of H2ATP2- increases the structure of PP-50 as detected by CD, but in 25% TFE no significant change in CD is found on binding either H2ATP2- or Mg2+ HATP (Kd = 14 microM). The complete proton NMR spectrum of PP-50 in 25% TFE has been assigned. The solution structure, determined by distance geometry, molecular dynamics with simulated annealing, and energy minimization, consists of a coil (residues 1-8), a strand (residues 9-12), a loop (residues 13-22) containing the GX4GKT consensus sequence (residues 16-23), an alpha-helix (residues 23-36), a turn (residues 38-41), and a coil (residues 42-50), similar to that of the corresponding region of the X-ray structure of F1ATPase (J.P. Abrahams, A.G.W. Leslie, R. Lutter, and J. E. Walker, 1994 Nature 370, 621-628) and to the structure of a homologous peptide from the ATP-binding site of

  7. Optimization of the degenerated interfacial ATP binding site improves the function of disease-related mutant cystic fibrosis transmembrane conductance regulator (CFTR) channels.

    PubMed

    Tsai, Ming-Feng; Jih, Kang-Yang; Shimizu, Hiroyasu; Li, Min; Hwang, Tzyh-Chang

    2010-11-26

    The cystic fibrosis transmembrane conductance regulator (CFTR) chloride channel, an ATP binding cassette (ABC) protein whose defects cause the deadly genetic disease cystic fibrosis (CF), encompasses two nucleotide binding domains (NBD1 and NBD2). Recent studies indicate that in the presence of ATP, the two NBDs coalesce into a dimer, trapping an ATP molecule in each of the two interfacial composite ATP binding sites (site 1 and site 2). Experimental evidence also suggests that CFTR gating is mainly controlled by ATP binding and hydrolysis in site 2, whereas site 1, which harbors several non-canonical substitutions in ATP-interacting motifs, is considered degenerated. The CF-associated mutation G551D, by introducing a bulky and negatively charged side chain into site 2, completely abolishes ATP-induced openings of CFTR. Here, we report a strategy to optimize site 1 for ATP binding by converting two amino acid residues to ABC consensus (i.e. H1348G) or more commonly seen residues in other ABC proteins (i.e. W401Y,W401F). Introducing either one or both of these mutations into G551D-CFTR confers ATP responsiveness for this disease-associated mutant channel. We further showed that the same maneuver also improved the function of WT-CFTR and the most common CF-associated ΔF508 channels, both of which rely on site 2 for gating control. Thus, our results demonstrated that the degenerated site 1 can be rebuilt to complement or support site 2 for CFTR function. Possible approaches for developing CFTR potentiators targeting site 1 will be discussed.

  8. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance.

    PubMed

    Aberuyi, N; Rahgozar, S; Moafi, A

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols.

  9. The role of ATP-binding cassette transporter A2 in childhood acute lymphoblastic leukemia multidrug resistance

    PubMed Central

    Aberuyi, N; Rahgozar, S; Moafi, A

    2014-01-01

    Acute lymphoblastic leukemia (ALL) is one of the most prevalent hematologic malignancies in children. Although the cure rate of ALL has improved over the past decades, the most important reason for ALL treatment failure is multidrug resistance (MDR) phenomenon. The current study aims to explain the mechanisms involved in multidrug resistance of childhood ALL, and introduces ATP-binding cassette transporterA2 (ABCA2) as an ABC transporter gene which may have a high impact on MDR. Benefiting from articles published inreputable journals from1994 to date and experiments newly performed by our group, a comprehensive review is written about ABCA2 and its role in MDR regarding childhood ALL. ABCA2 transports drugs from the cytoplasm into the lysosomal compartment, where they may become degraded and exported from the cell. The aforementioned mechanism may contribute to MDR. It has been reported that ABCA2 may induce resistance to mitoxantrone, estrogen derivatives and estramustine. It is resistant to the aforementioned compounds. Furthermore, the overexpression ofABCA2 in methotrexate, vinblastine and/or doxorubicin treated Jurkat cells are observed in several publications. The recent study of our group showsthatthe overexpression ofABCA2 gene in children with ALL increases the risk of MDR by 15 times. ABCA2 is the second identified member of the ABCA; ABC transporters' subfamily. ABCA2 gene expression profile is suggested to be an unfavorable prognostic factor in ALL treatment. Better understanding of the MDR mechanisms and the factors involved may improve the therapeutic outcome of ALL by modifying the treatment protocols. PMID:25254091

  10. Molecular cloning and functional characterization of an ATP-binding cassette transporter OtrC from Streptomyces rimosus

    PubMed Central

    2012-01-01

    Background The otrC gene of Streptomyces rimosus was previously annotated as an oxytetracycline (OTC) resistance protein. However, the amino acid sequence analysis of OtrC shows that it is a putative ATP-binding cassette (ABC) transporter with multidrug resistance function. To our knowledge, none of the ABC transporters in S. rimosus have yet been characterized. In this study, we aimed to characterize the multidrug exporter function of OtrC and evaluate its relevancy to OTC production. Results In order to investigate OtrC’s function, otrC is cloned and expressed in E. coli The exporter function of OtrC was identified by ATPase activity determination and ethidium bromide efflux assays. Also, the susceptibilities of OtrC-overexpressing cells to several structurally unrelated drugs were compared with those of OtrC-non-expressing cells by minimal inhibitory concentration (MIC) assays, indicating that OtrC functions as a drug exporter with a broad range of drug specificities. The OTC production was enhanced by 1.6-fold in M4018 (P = 0.000877) and 1.4-fold in SR16 (P = 0.00973) duplication mutants, while it decreased to 80% in disruption mutants (P = 0.0182 and 0.0124 in M4018 and SR16, respectively). Conclusions The results suggest that OtrC is an ABC transporter with multidrug resistance function, and plays an important role in self-protection by drug efflux mechanisms. This is the first report of such a protein in S. rimosus, and otrC could be a valuable target for genetic manipulation to improve the production of industrial antibiotics. PMID:22906146

  11. Functional Characterization of ATP-Binding Cassette Transporter A3 Mutations from Infants with Respiratory Distress Syndrome.

    PubMed

    Wambach, Jennifer A; Yang, Ping; Wegner, Daniel J; Heins, Hillary B; Kaliberova, Lyudmila N; Kaliberov, Sergey A; Curiel, David T; White, Frances V; Hamvas, Aaron; Hackett, Brian P; Cole, F Sessions

    2016-11-01

    Mutations in the ATP-binding cassette transporter A3 gene (ABCA3) result in severe neonatal respiratory distress syndrome and childhood interstitial lung disease. As most ABCA3 mutations are rare or private, determination of mutation pathogenicity is often based on results from in silico prediction tools, identification in unrelated diseased individuals, statistical association studies, or expert opinion. Functional biologic studies of ABCA3 mutations are needed to confirm mutation pathogenicity and inform clinical decision making. Our objective was to functionally characterize two ABCA3 mutations (p.R288K and p.R1474W) identified among term and late-preterm infants with respiratory distress syndrome with unclear pathogenicity in a genetically versatile model system. We performed transient transfection of HEK293T cells with wild-type or mutant ABCA3 alleles to assess protein processing with immunoblotting. We used transduction of A549 cells with adenoviral vectors, which concurrently silenced endogenous ABCA3 and expressed either wild-type or mutant ABCA3 alleles (p.R288K and p.R1474W) to assess immunofluorescent localization, ATPase activity, and organelle ultrastructure. Both ABCA3 mutations (p.R288K and p.R1474W) encoded proteins with reduced ATPase activity but with normal intracellular localization and protein processing. Ultrastructural phenotypes of lamellar body-like vesicles in A549 cells transduced with mutant alleles were similar to wild type. Mutant proteins encoded by ABCA3 mutations p.R288K and p.R1474W had reduced ATPase activity, a biologically plausible explanation for disruption of surfactant metabolism by impaired phospholipid transport into the lamellar body. These results also demonstrate the usefulness of a genetically versatile, human model system for functional characterization of ABCA3 mutations with unclear pathogenicity.

  12. Computational characterization of TTHA0379: A potential glycerophosphocholine binding protein of Ugp ATP-binding cassette transporter.

    PubMed

    Chandravanshi, Monika; Gogoi, Prerana; Kanaujia, Shankar Prasad

    2016-11-05

    For the de novo biosynthesis of phospholipids, byproducts such as sn-glycerol-3-phosphate (G3P) and glycerophosphocholine (GPC) of glycerophospholipid metabolic pathway are imported inside the cell by an ATP-binding cassette (ABC) transporter known as UgpABCE. Of which, UgpA and UgpE constitutes the transmembrane domains (TMDs), UgpC forms the dimer of ATP-hydrolyzing component and UgpB is the periplasmic substrate binding protein. Structurally, UgpABCE transporter displays similarity to the maltose ABC transporter of Escherichia coli; thus, has been grouped into the CUT1 (Carbohydrate Uptake Transporter-1) family of bacterial ABC transporters. Being a member of CUT1 family, several Ugp (Uptake glycerol phosphate) protein sequences in biological database(s) exhibit sequence and structure similarity to sugar ABC transporters and have been annotated as sugar binding proteins; one of such proteins is TTHA0379 from Thermus thermophilus HB8. Here, in this study, we used computational method(s) to distinguish UgpB and sugar binding proteins based on their primary and tertiary structure features. A comprehensive analysis of these proteins indicates that they are evolutionarily related to each other having common conserved features at their primary and tertiary structure levels. However, they display differences at their active sites owing to the dissimilarity in their ligand preferences. In addition, phylogenetic analysis of TTHA0379 along with UgpB and sugar binding proteins reveals that both the groups of proteins forms two distinct clades and TTHA0379 groups with UgpB proteins. Furthermore, analysis of the ligand binding pocket shows that all the essential features of glycerophosphocholine binding protein i.e. UgpB, are conserved in TTHA0379 as well. Combining these features, here, we designate TTHA0379 to be a GPC binding protein.

  13. Osimertinib (AZD9291) Attenuates the Function of Multidrug Resistance-Linked ATP-Binding Cassette Transporter ABCB1 in Vitro.

    PubMed

    Hsiao, Sung-Han; Lu, Yu-Jen; Li, Yan-Qing; Huang, Yang-Hui; Hsieh, Chia-Hung; Wu, Chung-Pu

    2016-06-06

    The effectiveness of cancer chemotherapy is often circumvented by multidrug resistance (MDR) caused by the overexpression of ATP-binding cassette (ABC) drug transporter ABCB1 (MDR1, P-glycoprotein). Several epidermal growth factor receptor (EGFR) tyrosine kinase inhibitors (TKIs) have been shown previously capable of modulating the function of ABCB1 and reversing ABCB1-mediated MDR in human cancer cells. Furthermore, some TKIs are transported by ABCB1, which results in low oral bioavailability, reduced distribution, and the development of acquired resistance to these TKIs. In this study, we investigated the interaction between ABCB1 and osimertinib, a novel selective, irreversible third-generation EGFR TKI that has recently been approved by the U.S. Food and Drug Administration. We also evaluated the potential impact of ABCB1 on the efficacy of osimertinib in cancer cells, which can present a therapeutic challenge to clinicians in the future. We revealed that although osimertinib stimulates the ATPase activity of ABCB1, overexpression of ABCB1 does not confer resistance to osimertinib. Our results suggest that it is unlikely that the overexpression of ABCB1 can be a major contributor to the development of osimertinib resistance in cancer patients. More significantly, we revealed an additional action of osimertinib that directly inhibits the function of ABCB1 without affecting the expression level of ABCB1, enhances drug-induced apoptosis, and reverses the MDR phenotype in ABCB1-overexpressing cancer cells. Considering that osimertinib is a clinically approved third-generation EGFR TKI, our findings suggest that a combination therapy with osimertinib and conventional anticancer drugs may be beneficial to patients with MDR tumors.

  14. Genome-Wide Identification, Evolution, and Expression Analysis of the ATP-Binding Cassette Transporter Gene Family in Brassica rapa

    PubMed Central

    Yan, Chao; Duan, Weike; Lyu, Shanwu; Li, Ying; Hou, Xilin

    2017-01-01

    ATP-binding cassette (ABC) proteins can act as transporters of different substrates across biological membranes by hydrolyzing ATP. However, little information is available about ABC transporters in Brassica rapa, an important leafy vegetable. In the present study, we carried out genome-wide identification, characterization and molecular evolution analyses of ABC gene family in B. rapa and 9 other plant species. A total of 179 B. rapa ABC genes (BraABCs) were identified. Among them, 173 BraABCs were identified on 10 chromosomes. Based on phylogenetic analysis and domain organization, the BraABC family could be grouped into eight subfamilies. BraABCs in the same subfamily showed similar motif composition and exon-intron organization. Common and unique cis-elements involved in the transcriptional regulation were also identified in the promoter regions of BraABCs. Tissue-expression analysis of BraABCs demonstrated their diverse spatiotemporal expression profiles. Influences of the whole genome triplication (WGT) on the evolution of BraABCs were studied in detail. BraABCs were preferentially retained compared with their neighboring genes during diploidization after WGT. Synteny analysis identified 76 pairs of syntenic BraABC paralogs among the three subgenomes of B. rapa, and 10 paralog pairs underwent positive selection with ω (= Ka/Ks) ratios greater than 1. Analyses of the expression patterns of syntenic BraABC paralogs pairs across five tissues and under stress treatments revealed their functional conservation, sub-functionalization, neo-functionalization and pseudogenization during evolution. Our study presents a comprehensive overview of the ABC gene family in B. rapa and will be helpful for the further functional study of BraABCs in plant growth, development, and stress responses. PMID:28367152

  15. Identification of a MAP 2-like ATP-binding protein associated with axoplasmic vesicles that translocate on isolated microtubules

    PubMed Central

    1986-01-01

    Axoplasmic vesicles were purified and observed to translocate on isolated microtubules in an ATP-dependent, trypsin-sensitive manner, implying that ATP-binding polypeptides essential for force generation were present on the vesicle surface. To identify these proteins [alpha 32P]8-azidoadenosine 5'-triphosphate ([alpha 32P]8-N3ATP), a photoaffinity analogue of ATP, was used. The results presented here identify and characterize a vesicle-associated polypeptide having a relative molecular mass of 292 kD that bound [alpha 32P]8-N3ATP. The incorporation of label is ultraviolet light-dependent and ATP- sensitive. Moreover, the 292-kD polypeptide could be isolated in association with vesicles or microtubules, depending on the conditions used, and the data indicate that the 292-kD polypeptide is similar to mammalian brain microtubule-associated protein 2 (MAP 2) for the following reasons: The 292-kD polypeptide isolated from either squid axoplasm or optic lobe cross-reacts with antiserum to porcine brain MAP 2. Furthermore, it purifies with taxol-stabilized microtubules and is released with salt. Based on these characteristics, the 292-kD polypeptide is distinct from the known force-generating molecules myosin and flagellar dynein, as well as the 110-130-kD kinesin-like polypeptides that have recently been described (Brady, S. T., 1985, Nature (Lond.), 317:73-75; Vale, R. D., T. S. Reese, and M. P. Sheetz, 1985b, Cell, 42:39-50; Scholey, J. M., M. E. Porter, P. M. Grissom, and J. R. McIntosh, 1985, Nature (Lond.), 318:483-486). Because the 292-kD polypeptide binds ATP and is associated with vesicles that translocate on purified MAP-free microtubules in an ATP-dependent fashion, it is therefore believed to be involved in vesicle-microtubule interactions that promote organelle motility. PMID:3091608

  16. HER2 as therapeutic target for overcoming ATP-binding cassette transporter-mediated chemoresistance in small cell lung cancer.

    PubMed

    Minami, Toshiyuki; Kijima, Takashi; Otani, Yasushi; Kohmo, Satoshi; Takahashi, Ryo; Nagatomo, Izumi; Hirata, Haruhiko; Suzuki, Mayumi; Inoue, Koji; Takeda, Yoshito; Kida, Hiroshi; Tachibana, Isao; Kumanogoh, Atsushi

    2012-04-01

    Small cell lung cancer (SCLC) easily acquires multidrug resistance after successful initial therapy. Overexpression of ATP-binding cassette (ABC) transporters is important for the multidrug resistance. Among them, ABCB1 and ABCG2 are known to be upregulated in chemoresistant SCLC cells. We found that human epidermal growth factor receptor 2 (HER2) expressions are also upregulated in chemoresistant SBC-3/ETP, SBC-3/SN-38, and SBC-3/CDDP cells, compared with chemosensitive SBC-3 cells. Lapatinib, a tyrosine kinase inhibitor of HER2, could not suppress proliferation of these HER2-positive SCLC cells alone but successfully restored chemosensitivity to etoposide and SN-38 with a clinically applicable concentration. The reversal effect of lapatinib was thought to be caused by inhibition of drug efflux pump functions of ABC transporters, although lapatinib itself has been reported to be a substrate for them. Moreover, knocking down of HER2 by an short interfering RNA weakened the effect of lapatinib on ABCB1, indicating the involvement of HER2 in the inhibitory mechanisms. Notably, we showed that caveolin-1 and Src play key roles in modulating ABCB1 function via HER2 inactivation. In SBC-3/ETP cells, dephosphorylation of HER2 by lapatinib activates Src and successively leads to increased caveolin-1 phosphorylation. Through this process, caveolin-1 dissociates from HER2 and strengthens association with ABCB1, and finally impairs the pump functions. Furthermore, we showed that treatment by lapatinib in combination with etoposide or irinotecan significantly suppresses the growth of subcutaneous SBC-3/ETP and SBC-3/SN-38 tumors in mice, respectively. Collectively, these results indicate that combination therapy with lapatinib and cytotoxic agents could conquer ABC transporter-mediated chemoresistance especially in HER2-positive SCLC.

  17. ATP-Binding Cassette (ABC) Transporters of the Human Respiratory Tract Pathogen, Moraxella catarrhalis: Role in Virulence

    PubMed Central

    Murphy, Timothy F; Brauer, Aimee L.; Johnson, Antoinette; Kirkham, Charmaine

    2016-01-01

    Moraxella catarrhalis is a human respiratory tract pathogen that causes otitis media (middle ear infections) in children and respiratory tract infections in adults with chronic obstructive pulmonary disease. In view of the huge global burden of disease caused by M. catarrhalis, the development of vaccines to prevent these infections and better approaches to treatment have become priorities. In previous work, we used a genome mining approach that identified three substrate binding proteins (SBPs) of ATP-binding cassette (ABC) transporters as promising candidate vaccine antigens. In the present study, we performed a comprehensive assessment of 19 SBPs of 15 ABC transporter systems in the M. catarrhalis genome by engineering knockout mutants and studying their role in assays that assess mechanisms of infection. The capacity of M. catarrhalis to survive and grow in the nutrient-limited and hostile environment of the human respiratory tract, including intracellular growth, account in part for its virulence. The results show that ABC transporters that mediate uptake of peptides, amino acids, cations and anions play important roles in pathogenesis by enabling M. catarrhalis to 1) grow in nutrient-limited conditions, 2) invade and survive in human respiratory epithelial cells and 3) persist in the lungs in a murine pulmonary clearance model. The knockout mutants of SBPs and ABC transporters showed different patterns of activity in the assay systems, supporting the conclusion that different SBPs and ABC transporters function at different stages in the pathogenesis of infection. These results indicate that ABC transporters are nutritional virulence factors, functioning to enable the survival of M catarrhalis in the diverse microenvironments of the respiratory tract. Based on the role of ABC transporters as virulence factors of M. catarrhalis, these molecules represent potential drug targets to eradicate the organism from the human respiratory tract. PMID:27391026

  18. A Novel ATP-Binding Cassette Transporter Involved in Multidrug Resistance in the Phytopathogenic Fungus Penicillium digitatum

    PubMed Central

    Nakaune, Ryoji; Adachi, Kiichi; Nawata, Osamu; Tomiyama, Masamitsu; Akutsu, Katsumi; Hibi, Tadaaki

    1998-01-01

    Demethylation inhibitor (DMI)-resistant strains of the plant pathogenic fungus Penicillium digitatum were shown to be simultaneously resistant to cycloheximide, 4-nitroquinoline-N-oxide (4NQO), and acriflavine. A PMR1 (Penicillium multidrug resistance) gene encoding an ATP-binding cassette (ABC) transporter (P-glycoprotein) was cloned from a genomic DNA library of a DMI-resistant strain (LC2) of Penicillium digitatum by heterologous hybridization with a DNA fragment containing an ABC-encoding region from Botrytis cinerea. Sequence analysis revealed significant amino acid homology to the primary structures of PMR1 (protein encoded by the PMR1 gene) and ABC transporters of Saccharomyces cerevisiae (PDR5 and SNQ2), Schizosaccharomyces pombe (HBA2), Candida albicans (CDR1), and Aspergillus nidulans (AtrA and AtrB). Disruption of the PMR1 gene of P. digitatum DMI-resistant strain LC2 demonstrated that PMR1 was an important determinant of resistance to DMIs. The effective concentrations inhibiting radial growth by 50% (EC50s) and the MICs of fenarimol and bitertanol for the PMR1 disruptants (Δpmr1 mutants) were equivalent to those for DMI-sensitive strains. Northern blot analysis indicated that severalfold more PMR1 transcript accumulated in the DMI-resistant strains compared with those in DMI-sensitive strains in the absence of fungicide. In both DMI-resistant and -sensitive strains, transcription of PMR1 was strongly enhanced within 10 min after treatment with the DMI fungicide triflumizole. These results suggested that the toxicant efflux system comprised of PMR1 participates directly in the DMI resistance of the fungus. PMID:9758830

  19. Multidrug resistance in cancer chemotherapy and xenobiotic protection mediated by the half ATP-binding cassette transporter ABCG2.

    PubMed

    Han, B; Zhang, J-T

    2004-01-01

    ABCG2, also termed BCRP/MXR/ABCP, is a half ATP-binding cassette (ABC) transporter expressed on plasma membranes. ABCG2 was independently cloned from placenta as well as cell lines selected for resistance to mitoxantrone or anthracyclines. ABCG2 consists of a nucleotide-binding domain (NBD) at the amino terminus and a transmembrane domain (TMD) at the carboxyl terminus and it is postulated to form a homodimer to perform its biological functions. Over-expression of ABCG2 in cell lines confers resistance on a wide variety of anticancer drugs including mitoxantrone, daunorubicin, doxorubicin, topotecan and epirubicin. The expression of ABCG2 has been implicated in multidrug resistance (MDR) of acute myeloid leukemia and some solid tumors. In addition, ABCG2 can transport several fluorescent dyes or toxins. ABCG2 is found to be expressed in epithelial cells of intestine and colon, liver canaliculi, and renal tubules, where it serves to eliminate the plasma level of orally administered anticancer drugs as well as ingested toxins. ABCG2 is found to be highly expressed in placenta and the luminal surface of microvessel endothelium blood-brain barrier where it may play a role in limiting the penetration of drugs, such as topotecan from the maternal plasma into the fetus and from blood to brain. A variety of inhibitors for ABCG2 including GF120918 may prove useful for sensitizing cancer cells to chemotherapy or altering the distribution of orally administered drug substrates of ABCG2. Interestingly, ABCG2 is also expressed highly in hematopoietic stem cells. However, the function of ABCG2 in stem cells is currently unknown, although it may provide protection to stem cells from a variety of xenobiotics.

  20. The Hypertrophic Cardiomyopathy Myosin Mutation R453C Alters ATP Binding and Hydrolysis of Human Cardiac β-Myosin*

    PubMed Central

    Bloemink, Marieke; Deacon, John; Langer, Stephen; Vera, Carlos; Combs, Ariana; Leinwand, Leslie; Geeves, Michael A.

    2014-01-01

    The human hypertrophic cardiomyopathy mutation R453C results in one of the more severe forms of the myopathy. Arg-453 is found in a conserved surface loop of the upper 50-kDa domain of the myosin motor domain and lies between the nucleotide binding pocket and the actin binding site. It connects to the cardiomyopathy loop via a long α-helix, helix O, and to Switch-2 via the fifth strand of the central β-sheet. The mutation is, therefore, in a position to perturb a wide range of myosin molecular activities. We report here the first detailed biochemical kinetic analysis of the motor domain of the human β-cardiac myosin carrying the R453C mutation. A recent report of the same mutation (Sommese, R. F., Sung, J., Nag, S., Sutton, S., Deacon, J. C., Choe, E., Leinwand, L. A., Ruppel, K., and Spudich, J. A. (2013) Proc. Natl. Acad. Sci. U.S.A. 110, 12607–12612) found reduced ATPase and in vitro motility but increased force production using an optical trap. Surprisingly, our results show that the mutation alters few biochemical kinetic parameters significantly. The exceptions are the rate constants for ATP binding to the motor domain (reduced by 35%) and the ATP hydrolysis step/recovery stroke (slowed 3-fold), which could be the rate-limiting step for the ATPase cycle. Effects of the mutation on the recovery stroke are consistent with a perturbation of Switch-2 closure, which is required for the recovery stroke and the subsequent ATP hydrolysis. PMID:24344137

  1. Variations in ATP-Binding Cassette Transporter Regulation during the Progression of Human Nonalcoholic Fatty Liver DiseaseS⃞

    PubMed Central

    Hardwick, Rhiannon N.; Fisher, Craig D.; Canet, Mark J.; Scheffer, George L.

    2011-01-01

    Transporters located on the sinusoidal and canalicular membranes of hepatocytes regulate the efflux of drugs and metabolites into blood and bile, respectively. Changes in the expression or function of these transporters during liver disease may lead to a greater risk of adverse drug reactions. Nonalcoholic fatty liver disease (NAFLD) is a progressive condition encompassing the relatively benign steatosis and the more severe, inflammatory state of nonalcoholic steatohepatitis (NASH). Here, we present an analysis of the effect of NAFLD progression on the major ATP-binding cassette (ABC) efflux transport proteins ABCC1–6, ABCB1, and ABCG2. Human liver samples diagnosed as normal, steatotic, NASH (fatty), and NASH (not fatty) were analyzed. Increasing trends in mRNA expression of ABCC1, ABCC4–5, ABCB1, and ABCG2 were found with NAFLD progression, whereas protein levels of all transporters exhibited increasing trends with disease progression. Immunohistochemical staining of ABCC3, ABCB1, and ABCG2 revealed no alterations in cellular localization during NAFLD progression. ABCC2 staining revealed an alternative mechanism of regulation in NASH in which the transporter appears to be internalized away from the canalicular membrane. This correlated with a preferential shift in the molecular mass of ABCC2 from 200 to 180 kDa in NASH, which has been shown to be associated with a loss of glycosylation and internalization of the protein. These data demonstrate increased expression of multiple efflux transporters as well as altered cellular localization of ABCC2 in NASH, which may have profound effects on the ability of patients with NASH to eliminate drugs in an appropriate manner. PMID:21878559

  2. Overexpression and functional characterization of an ABC (ATP-binding cassette) transporter encoded by the genes drrA and drrB of Mycobacterium tuberculosis.

    PubMed Central

    Choudhuri, Baisakhee Saha; Bhakta, Sanjib; Barik, Rajib; Basu, Joyoti; Kundu, Manikuntala; Chakrabarti, Parul

    2002-01-01

    The genes encoding ATP-binding cassette (ABC) transporters occupy 2.5% of the genome of Mycobacterium tuberculosis. However, none of these putative ABC transporters has been characterized so far. We describe the development of expression systems for simultaneous expression of the ATP-binding protein DrrA and the membrane integral protein DrrB which together behave as a functional doxorubicin efflux pump. Doxorubicin uptake in Escherichia coli or Mycobacterium smegmatis expressing DrrAB was inhibited by reserpine, an inhibitor of ABC transporters. The localization of DrrA to the membrane depended on the simultaneous expression of DrrB. ATP binding was positively regulated by doxorubicin and daunorubicin. At the same time, DrrB appeared to be sensitive to proteolysis when expressed alone in the absence of DrrA. Simultaneous expression of the two polypeptides was essential to obtain a functional doxorubicin efflux pump. Expression of DrrAB in E. coli conferred 8-fold increased resistance to ethidium bromide, a cationic compound. 2',7'-bis-(2-Carboxyethyl)-5(6)-carboxyfluorescein (BCECF), a neutral compound, also behaved as a substrate of the reconstituted efflux pump. When expressed in M. smegmatis, DrrAB conferred resistance to a number of clinically relevant, structurally unrelated antibiotics. The resistant phenotype could be reversed by verapamil and reserpine, two potent inhibitors of ABC transporters. PMID:12057006

  3. Hydrolysis at One of the Two Nucleotide-binding Sites Drives the Dissociation of ATP-binding Cassette Nucleotide-binding Domain Dimers

    SciTech Connect

    Zoghbi, M. E.; Altenberg, G. A.

    2013-10-15

    The functional unit of ATP-binding cassette (ABC) transporters consists of two transmembrane domains and two nucleotide-binding domains (NBDs). ATP binding elicits association of the two NBDs, forming a dimer in a head-to-tail arrangement, with two nucleotides “sandwiched” at the dimer interface. Each of the two nucleotide-binding sites is formed by residues from the two NBDs. We recently found that the prototypical NBD MJ0796 from Methanocaldococcus jannaschii dimerizes in response to ATP binding and dissociates completely following ATP hydrolysis. However, it is still unknown whether dissociation of NBD dimers follows ATP hydrolysis at one or both nucleotide-binding sites. Here, we used luminescence resonance energy transfer to study heterodimers formed by one active (donor-labeled) and one catalytically defective (acceptor-labeled) NBD. Rapid mixing experiments in a stop-flow chamber showed that NBD heterodimers with one functional and one inactive site dissociated at a rate indistinguishable from that of dimers with two hydrolysis-competent sites. Comparison of the rates of NBD dimer dissociation and ATP hydrolysis indicated that dissociation followed hydrolysis of one ATP. We conclude that ATP hydrolysis at one nucleotide-binding site drives NBD dimer dissociation.

  4. Relationship between a point mutation S97C in CK1δ protein and its affect on ATP-binding affinity.

    PubMed

    Kumar, Ambuj; Rajendran, Vidya; Sethumadhavan, Rao; Purohit, Rituraj

    2014-01-01

    CK1δ (Casein kinase I isoform delta) is a member of CK1 kinase family protein that mediates neurite outgrowth and the function as brain-specific microtubule-associated protein. ATP binding kinase domain of CK1δ is essential for regulating several key cell cycle signal transduction pathways. Mutation in CK1δ protein is reported to cause cancers and affects normal brain development. S97C mutation in kinase domain of CK1δ protein has been involved to induce breast cancer and ductal carcinoma. We performed molecular docking studies to examine the effect of this mutation on its ATP-binding affinity. Further, we conducted molecular dynamics simulations to understand the structural consequences of S97C mutation over the kinase domain of CK1δ protein. Docking results indicated the loss of ATP-binding affinity of mutant structure, which were further rationalized by molecular dynamics simulations, where a notable loss in 3-D conformation of CK1δ kinase domain was observed in mutant as compared to native. Our results explained the underlying molecular mechanism behind the observed cancer associated phenotype caused by S97C mutation in CK1δ protein.

  5. Discovery of a novel allosteric inhibitor-binding site in ERK5: comparison with the canonical kinase hinge ATP-binding site

    PubMed Central

    Chen, Hongming; Tucker, Julie; Wang, Xiaotao; Gavine, Paul R.; Phillips, Chris; Augustin, Martin A.; Schreiner, Patrick; Steinbacher, Stefan; Preston, Marian; Ogg, Derek

    2016-01-01

    MAP kinases act as an integration point for multiple biochemical signals and are involved in a wide variety of cellular processes such as proliferation, differentiation, regulation of transcription and development. As a member of the MAP kinase family, ERK5 (MAPK7) is involved in the downstream signalling pathways of various cell-surface receptors, including receptor tyrosine kinases and G protein-coupled receptors. In the current study, five structures of the ERK5 kinase domain co-crystallized with ERK5 inhibitors are reported. Interestingly, three of the compounds bind at a novel allosteric binding site in ERK5, while the other two bind at the typical ATP-binding site. Binding of inhibitors at the allosteric site is accompanied by displacement of the P-loop into the ATP-binding site and is shown to be ATP-competitive in an enzymatic assay of ERK5 kinase activity. Kinase selectivity data show that the most potent allosteric inhibitor exhibits superior kinase selectivity compared with the two inhibitors that bind at the canonical ATP-binding site. An analysis of these structures and comparison with both a previously published ERK5–inhibitor complex structure (PDB entry 4b99) and the structures of three other kinases (CDK2, ITK and MEK) in complex with allosteric inhibitors are presented. PMID:27139631

  6. About a switch: how P-glycoprotein (ABCB1) harnesses the energy of ATP binding and hydrolysis to do mechanical work.

    PubMed

    Sauna, Zuben E; Ambudkar, Suresh V

    2007-01-01

    The efflux of drugs by the multidrug transporter P-glycoprotein (Pgp; ABCB1) is one of the principal means by which cancer cells evade chemotherapy and exhibit multidrug resistance. Mechanistic studies of Pgp-mediated transport, however, transcend the importance of this protein per se as they help us understand the transport pathway of the ATP-binding cassette proteins in general. The ATP-binding cassette proteins comprise one of the largest protein families, are central to cellular physiology, and constitute important drug targets. The functional unit of Pgp consists of two nucleotide-binding domains (NBD) and two transmembrane domains that are involved in the transport of drug substrates. Early studies postulated that conformational changes as a result of ATP hydrolysis were transmitted to the transmembrane domains bringing about drug transport. More recent structural and biochemical studies on the other hand suggested that ATP binds at the interface of the two NBDs and induces the formation of a closed dimer, and it has been hypothesized that this dimerization and subsequent ATP hydrolysis powers transport. Based on the mutational and biochemical work on Pgp and structural studies with isolated NBDs, we review proposed schemes for the catalytic cycle of ATP hydrolysis and the transport pathway.

  7. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels

    PubMed Central

    Wei, Shipeng; Roessler, Bryan C.; Icyuz, Mert; Chauvet, Sylvain; Tao, Binli; Hartman, John L.; Kirk, Kevin L.

    2015-01-01

    The ABCC transporter subfamily includes pumps, the long and short multidrug resistance proteins (MRPs), and an ATP-gated anion channel, the cystic fibrosis transmembrane conductance regulator (CFTR). We show that despite their thermodynamic differences, these ABCC transporter subtypes use broadly similar mechanisms to couple their extracellular gates to the ATP occupancies of their cytosolic nucleotide binding domains. A conserved extracellular phenylalanine at this gate was a prime location for producing gain of function (GOF) mutants of a long MRP in yeast (Ycf1p cadmium transporter), a short yeast MRP (Yor1p oligomycin exporter), and human CFTR channels. Extracellular gate mutations rescued ATP binding mutants of the yeast MRPs and CFTR by increasing ATP sensitivity. Control ATPase-defective MRP mutants could not be rescued by this mechanism. A CFTR double mutant with an extracellular gate mutation plus a cytosolic GOF mutation was highly active (single-channel open probability >0.3) in the absence of ATP and protein kinase A, each normally required for CFTR activity. We conclude that all 3 ABCC transporter subtypes use similar mechanisms to couple their extracellular gates to ATP occupancy, and highly active CFTR channels that bypass defects in ATP binding or phosphorylation can be produced.—Wei, S., Roessler, B. C., Icyuz, M., Chauvet, S., Tao, B., Hartman IV, J. L., Kirk, K. L. Long-range coupling between the extracellular gates and the intracellular ATP binding domains of multidrug resistance protein pumps and cystic fibrosis transmembrane conductance regulator channels. PMID:26606940

  8. Expression of the small T antigen of Lymphotropic Papovavirus is sufficient to transform primary mouse embryo fibroblasts

    SciTech Connect

    Gupta, Tushar; Robles, Maria Teresa Sáenz; Schowalter, Rachel M.; Buck, Christopher B.; Pipas, James M.

    2016-01-15

    Polyomaviruses induce cell proliferation and transformation through different oncoproteins encoded within the early region (ER): large T antigen (LT), small T antigen (sT) and, in some cases, additional components. Each virus utilizes different mechanisms to achieve transformation. For instance, the LTs of Simian virus 40 (SV40), BK and/or JC virus can induce transformation; but Merkel Cell Polyomavirus (MCPyV) requires expression of sT. Lymphotropic Papovavirus (LPV) is closely related to Human Polyomavirus 9 (HuPyV9) and, under similar conditions, mice expressing LPV.ER exhibit higher rates of tumor formation than mice expressing SV40.ER. We have investigated the contributions of individual LPV.ER components to cell transformation. In contrast to SV40, LPV.ER transforms mouse embryonic fibroblasts (MEFs), but expression of LPV LT is insufficient to transform MEFs. Furthermore, LPV sT induces immortalization and transformation of MEFs. Thus, in the case of LPV, sT is the main mediator of oncogenesis. - Highlights: • Characterization of early region products from the Lymphotropic Polyomavirus (LPV). • On its own, sT immortalizes and transforms mouse primary cells, and is able to block p53 activation. • Combined LT and sT expression induces a greater rate of proliferation than either LT or sT alone.

  9. Expression of the Small T antigen of Lymphotropic Papovavirus is Sufficient to Transform Primary Mouse Embryo Fibroblasts

    PubMed Central

    Gupta, Tushar; Robles, Maria Teresa Sáenz; Schowalter, Rachel M.; Buck, Christopher B.; Pipas, James M.

    2015-01-01

    Polyomaviruses induce cell proliferation and transformation through different oncoproteins encoded within the early region (ER): large T antigen (LT), small T antigen (sT) and, in some cases, additional components. Each virus utilizes different mechanisms to achieve transformation. For instance, the LTs of Simian virus 40 (SV40), BK and/or JC virus can induce transformation; but Merkel Cell Polyomavirus (MCPyV) requires expression of sT. Lymphotropic Papovavirus (LPV) is closely related to Human Polyomavirus 9 (HuPyV9) and, under similar conditions, mice expressing LPV.ER exhibit higher rates of tumor formation than mice expressing SV40.ER. We have investigated the contributions of individual LPV.ER components to cell transformation. In contrast to SV40, LPV.ER transforms mouse embryonic fibroblasts (MEFs), but expression of LPV LT is insufficient to transform MEFs. Furthermore, LPV sT induces immortalization and transformation of MEFs. Thus, in the case of LPV, sT is the main mediator of oncogenesis. PMID:26517398

  10. Up-Regulation of the ATP-Binding Cassette Transporter A1 Inhibits Hepatitis C Virus Infection

    PubMed Central

    Gondeau, Claire; Douam, Florian; Lebreton, Stéphanie; Lagaye, Sylvie; Pol, Stanislas; Helle, François; Plengpanich, Wanee; Guérin, Maryse; Bourgine, Maryline; Michel, Marie Louise; Lavillette, Dimitri; Roingeard, Philippe; le Goff, Wilfried; Budkowska, Agata

    2014-01-01

    Hepatitis C virus (HCV) establishes infection using host lipid metabolism pathways that are thus considered potential targets for indirect anti-HCV strategies. HCV enters the cell via clathrin-dependent endocytosis, interacting with several receptors, and virus-cell fusion, which depends on acidic pH and the integrity of cholesterol-rich domains of the hepatocyte membrane. The ATP-binding Cassette Transporter A1 (ABCA1) mediates cholesterol efflux from hepatocytes to extracellular Apolipoprotein A1 and moves cholesterol within cell membranes. Furthermore, it generates high-density lipoprotein (HDL) particles. HDL protects against arteriosclerosis and cardiovascular disease. We show that the up-regulation of ABCA1 gene expression and its cholesterol efflux function in Huh7.5 hepatoma cells, using the liver X receptor (LXR) agonist GW3965, impairs HCV infection and decreases levels of virus produced. ABCA1-stimulation inhibited HCV cell entry, acting on virus-host cell fusion, but had no impact on virus attachment, replication, or assembly/secretion. It did not affect infectivity or properties of virus particles produced. Silencing of the ABCA1 gene and reduction of the specific cholesterol efflux function counteracted the inhibitory effect of the GW3965 on HCV infection, providing evidence for a key role of ABCA1 in this process. Impaired virus-cell entry correlated with the reorganisation of cholesterol-rich membrane microdomains (lipid rafts). The inhibitory effect could be reversed by an exogenous cholesterol supply, indicating that restriction of HCV infection was induced by changes of cholesterol content/distribution in membrane regions essential for virus-cell fusion. Stimulation of ABCA1 expression by GW3965 inhibited HCV infection of both human primary hepatocytes and isolated human liver slices. This study reveals that pharmacological stimulation of the ABCA1-dependent cholesterol efflux pathway disrupts membrane cholesterol homeostasis, leading to the

  11. Poloxamines display a multiple inhibitory activity of ATP-binding cassette (ABC) transporters in cancer cell lines.

    PubMed

    Cuestas, María L; Sosnik, Alejandro; Mathet, Verónica L

    2011-08-01

    Primary hepatocellular carcinoma is the third most common fatal cancer worldwide with more than 500,000 annual deaths. Approximately 40% of the patients with HCC showed tumoral overexpression of transmembrane proteins belonging to the ATP-binding cassette protein superfamily (ABC) which pump drugs out of cells. The overexpression of these efflux transporters confers on the cells a multiple drug resistance phenotype, which is considered a crucial cause of treatment refractoriness in patients with cancer. The aim of this study was to investigate the inhibitory effect of different concentrations of pH- and temperature-responsive X-shaped poly(ethylene oxide)-poly(propylene oxide) block copolymers (poloxamines, Tetronic, PEO-PPO) showing a wide range of molecular weights and EO/PO ratios on the functional activity of three different ABC proteins, namely P-glycoprotein (P-gp or MDR1), breast cancer resistance protein (BCRP), and multidrug resistance-associated protein MRP1, in two human hepatocarcinoma cell lines, HepG2 and Huh7. First, the cytotoxicity of the different copolymers (at different concentrations) on both liver carcinoma cell lines was thoroughly evaluated by means of apoptosis analysis using annexin V and propidium iodide (PI). Thus, viable cells (AV-/PI-), early apoptotic cells (AV+/PI-) and late apoptotic cells (V-FITC+/PI+) were identified. Results pointed out copolymers of intermediate to high hydrophobicity and intermediate molecular weight (e.g., T904) as the most cytotoxic. Then, DiOC2, rhodamine 123 and vinblastine were used as differential substrates of these pumps. HeLa, an epithelial cell line of human cervical cancer that does not express P-gp, was used exclusively as a control and enabled the discerning between P-gp and MRP1 inhibition. Moderate to highly hydrophobic poloxamines T304, T904 and T1301 showed inhibitory activity against P-gp and BCRP but not against MRP1 in both hepatic cell lines. A remarkable dependence of this effect on the

  12. T-antigen-independent replication of polyomavirus DNA in murine embryonal carcinoma cells

    SciTech Connect

    Dandolo, L.; Aghion, J.; Blangy, D.

    1984-02-01

    Expression of wild-type polyomavirus (Py) is restricted in murine embryonal carcinoma (EC) cells. The block appears to be located at the level of early transcription. Since no T antigen is produced, the authors investigated the fate of viral DNA upon infection of these cells; they showed that wild-type Py DNA replicates efficiently in all EC cells, probably via a T-antigen-independent mechanism. Furthermore, they studied, at permissive and restrictive temperatures, the replication of tsa (thermosensitive for T antigen) viral DNA of an in vitro-constructed deletion mutant lacking part of the early region coding sequences and of a double mutant carrying both the tsa mutation and the PyEC F9 mutation (allowing expression of early and late viral functions in EC cells). The results imply that replication of wild-type A2 strain Py DNA can occur in EC cells in the absence of a functional T antigen. However, this protein clearly enhances viral DNA replication and is absolutely required in differentiated cells.

  13. Structural Models of Zebrafish (Danio rerio) NOD1 and NOD2 NACHT Domains Suggest Differential ATP Binding Orientations: Insights from Computational Modeling, Docking and Molecular Dynamics Simulations

    PubMed Central

    Maharana, Jitendra; Sahoo, Bikash Ranjan; Bej, Aritra; Sahoo, Jyoti Ranjan; Dehury, Budheswar; Patra, Mahesh Chandra; Martha, Sushma Rani; Balabantray, Sucharita; Pradhan, Sukanta Kumar; Behera, Bijay Kumar

    2015-01-01

    Nucleotide-binding oligomerization domain-containing protein 1 (NOD1) and NOD2 are cytosolic pattern recognition receptors playing pivotal roles in innate immune signaling. NOD1 and NOD2 recognize bacterial peptidoglycan derivatives iE-DAP and MDP, respectively and undergoes conformational alternation and ATP-dependent self-oligomerization of NACHT domain followed by downstream signaling. Lack of structural adequacy of NACHT domain confines our understanding about the NOD-mediated signaling mechanism. Here, we predicted the structure of NACHT domain of both NOD1 and NOD2 from model organism zebrafish (Danio rerio) using computational methods. Our study highlighted the differential ATP binding modes in NOD1 and NOD2. In NOD1, γ-phosphate of ATP faced toward the central nucleotide binding cavity like NLRC4, whereas in NOD2 the cavity was occupied by adenine moiety. The conserved ‘Lysine’ at Walker A formed hydrogen bonds (H-bonds) and Aspartic acid (Walker B) formed electrostatic interaction with ATP. At Sensor 1, Arg328 of NOD1 exhibited an H-bond with ATP, whereas corresponding Arg404 of NOD2 did not. ‘Proline’ of GxP motif (Pro386 of NOD1 and Pro464 of NOD2) interacted with adenine moiety and His511 at Sensor 2 of NOD1 interacted with γ-phosphate group of ATP. In contrast, His579 of NOD2 interacted with the adenine moiety having a relatively inverted orientation. Our findings are well supplemented with the molecular interaction of ATP with NLRC4, and consistent with mutagenesis data reported for human, which indicates evolutionary shared NOD signaling mechanism. Together, this study provides novel insights into ATP binding mechanism, and highlights the differential ATP binding modes in zebrafish NOD1 and NOD2. PMID:25811192

  14. Structural characterization of an MJ1267 ATP-binding cassette crystal with a complex pattern of twinning caused by promiscuous fiber packing.

    PubMed

    Yuan, Yu-Ren; Martsinkevich, Oskana; Hunt, John F

    2003-02-01

    ATP-binding cassettes represent the motor domains in ABC transporters, a superfamily of integral membrane-protein pumps that couple the hydrolysis of ATP to transmembrane solute translocation. A crystal of a Mg-ADP complex of the MJ1267 ATP-binding cassette was obtained that produced a diffraction pattern characterized by pathological streaking of the spots in the a* x b* plane. While the Laue symmetry of the diffraction pattern was P3;1m, the crystal was determined to be twinned based on intensity statistics, molecular-replacement analysis and difference Fourier analysis of an engineered single-site methylmercury derivative. The unit cell contains three similar 3(1) fibers, with two of them related by primarily translational non-crystallographic symmetry (NCS) and the third related to the first two by approximate twofold screw operations whose rotational components are very similar to the twinning operator. The promiscuous packing of these 3(1) fibers, which make both parallel and antiparallel interactions in the primary crystal lattice, can explain the twinning tendency based on the ability of the twin-related lattices to interact with one another while making only one slightly sub-optimal intermolecular contact per unit cell in the boundary region. The promiscuous fiber packing can also explain the streaking in the diffraction pattern based on the ability to form a variety of different lattices with similar inter-fiber packing interactions. The crystal structure was refined as a twin in space group P3(1) using the program CNS, yielding a free R factor of 28.9% at 2.6 A and a refined twin fraction of 0.50. The structure shows a rigid-body rotation of the ABC-transporter-specific alpha-helical subdomain (ABCalpha subdomain) in MJ1267 compared with the conformation observed for the same protein in a C2 crystal lattice; this observation suggests that the ABCalpha subdomain is flexibly attached to the F1-type ATP-binding core of the ATP-binding cassette when Mg

  15. Evaluation of the role of ATP-binding cassette transporters as a defence mechanism against temephos in populations of Aedes aegypti

    PubMed Central

    Lima, Estelita Pereira; Goulart, Marília Oliveira Fonseca; Rolim, Modesto Leite

    2014-01-01

    The role of ATP-binding cassette (ABC) transporters in the efflux of the insecticide, temephos, was assessed in the larvae of Aedes aegypti. Bioassays were conducted using mosquito populations that were either susceptible or resistant to temephos by exposure to insecticide alone or in combination with sublethal doses of the ABC transporter inhibitor, verapamil (30, 35 and 40 μM). The best result in the series was obtained with the addition of verapamil (40 μM), which led to a 2x increase in the toxicity of temephos, suggesting that ABC transporters may be partially involved in conferring resistance to the populations evaluated.

  16. Two Independent Regions of Simian Virus 40 T Antigen Increase CBP/p300 Levels, Alter Patterns of Cellular Histone Acetylation, and Immortalize Primary Cells

    PubMed Central

    Sáenz Robles, Maria Teresa; Shivalila, Chikdu; Wano, Jeremy; Sorrells, Shelly; Roos, Alison

    2013-01-01

    Simian virus 40 (SV40) large T antigen (SVT) interferes with normal cell regulation and thus has been used to identify cellular components controlling proliferation and homeostasis. We have previously shown that SVT-mediated transformation requires interaction with the histone acetyltransferases (HATs) CBP/p300 and now report that the ectopic expression of SVT in several cell types in vivo and in vitro results in a significant increase in the steady-state levels of CBP/p300. Furthermore, SVT-expressing cells contain higher levels of acetylated CBP/p300, a modification that has been linked to increased HAT activity. Concomitantly, the acetylation levels of histone residues H3K56 and H4K12 are markedly increased in SVT-expressing cells. Other polyomavirus-encoded large T antigens also increase the levels of CBP/p300 and sustain a rise in the acetylation levels of H3K56 and H4K12. SVT does not affect the transcription of CBP/p300, but rather, alters their overall levels through increasing the loading of CBP/p300 mRNAs onto polysomes. Two distinct regions within SVT, one located in the amino terminus and one in the carboxy terminus, can independently alter both the levels of CBP/p300 and the loading of CBP/p300 transcripts onto polysomes. Within the amino-terminal fragment, a functional J domain is necessary for increasing CBP/p300 and specific histone acetylation levels, as well as for immortalizing primary cells. These studies uncover the action of polyomavirus T antigens on cellular CBP/p300 and suggest that additional mechanisms are used by T antigens to induce cell immortalization and transformation. PMID:24089570

  17. Inactivation of T Antigen-Forming Capacities of Simian Virus 40 and Adenovirus 12 by Ultraviolet Irradiation

    PubMed Central

    Yamamoto, Hiroshi; Shimojo, Hiroto

    1971-01-01

    Methods to measure T antigen-forming capacities of simian virus 40 (SV40) and adenovirus 12 (Ad12) were investigated, and a method to measure the capacity in terms of T antigen-forming units was employed by the use of cytosine arabinoside. Plaque-forming units and T antigen-forming units of SV40, SV40 deoxyribonucleic acid, or Ad12 were inactivated by ultraviolet (UV) irradiation at the same rate, roughly following a single-hit curve. T-antigen formation by UV-irradiated SV40 and Ad12 was enhanced in cells multiply infected and in cells in a growing state. These observations showed that it was difficult or impossible to estimate the size of the gene for T antigen by UV inactivation. PMID:4329559

  18. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.

    PubMed

    Fry, D C; Kuby, S A; Mildvan, A S

    1986-02-01

    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme.

  19. The rem mutations in the ATP-binding groove of the Rad3/XPD helicase lead to Xeroderma pigmentosum-Cockayne syndrome-like phenotypes.

    PubMed

    Herrera-Moyano, Emilia; Moriel-Carretero, María; Montelone, Beth A; Aguilera, Andrés

    2014-12-01

    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease.

  20. NpPDR1, a Pleiotropic Drug Resistance-Type ATP-Binding Cassette Transporter from Nicotiana plumbaginifolia, Plays a Major Role in Plant Pathogen Defense1

    PubMed Central

    Stukkens, Yvan; Bultreys, Alain; Grec, Sébastien; Trombik, Tomasz; Vanham, Delphine; Boutry, Marc

    2005-01-01

    Nicotiana plumbaginifolia NpPDR1, a plasma membrane pleiotropic drug resistance-type ATP-binding cassette transporter formerly named NpABC1, has been suggested to transport the diterpene sclareol, an antifungal compound. However, direct evidence for a role of pleiotropic drug resistance transporters in the plant defense is still lacking. In situ immunolocalization and histochemical analysis using the gusA reporter gene showed that NpPDR1 was constitutively expressed in the whole root, in the leaf glandular trichomes, and in the flower petals. However, NpPDR1 expression was induced in the whole leaf following infection with the fungus Botrytis cinerea, and the bacteria Pseudomonas syringae pv tabaci, Pseudomonas fluorescens, and Pseudomonas marginalis pv marginalis, which do not induce a hypersensitive response in N. plumbaginifolia, whereas a weaker response was observed using P. syringae pv syringae, which does induce a hypersensitive response. Induced NpPDR1 expression was more associated with the jasmonic acid than the salicylic acid signaling pathway. These data suggest that NpPDR1 is involved in both constitutive and jasmonic acid-dependent induced defense. Transgenic plants in which NpPDR1 expression was prevented by RNA interference showed increased sensitivity to sclareol and reduced resistance to B. cinerea. These data show that NpPDR1 is involved in pathogen resistance and thus demonstrate a new role for the ATP-binding cassette transporter family. PMID:16126865

  1. The rem Mutations in the ATP-Binding Groove of the Rad3/XPD Helicase Lead to Xeroderma pigmentosum-Cockayne Syndrome-Like Phenotypes

    PubMed Central

    Montelone, Beth A.; Aguilera, Andrés

    2014-01-01

    The eukaryotic TFIIH complex is involved in Nucleotide Excision Repair and transcription initiation. We analyzed three yeast mutations of the Rad3/XPD helicase of TFIIH known as rem (recombination and mutation phenotypes). We found that, in these mutants, incomplete NER reactions lead to replication fork breaking and the subsequent engagement of the homologous recombination machinery to restore them. Nevertheless, the penetrance varies among mutants, giving rise to a phenotype gradient. Interestingly, the mutations analyzed reside at the ATP-binding groove of Rad3 and in vivo experiments reveal a gain of DNA affinity upon damage of the mutant Rad3 proteins. Since mutations at the ATP-binding groove of XPD in humans are present in the Xeroderma pigmentosum-Cockayne Syndrome (XP-CS), we recreated rem mutations in human cells, and found that these are XP-CS-like. We propose that the balance between the loss of helicase activity and the gain of DNA affinity controls the capacity of TFIIH to open DNA during NER, and its persistence at both DNA lesions and promoters. This conditions NER efficiency and transcription resumption after damage, which in human cells would explain the XP-CS phenotype, opening new perspectives to understand the molecular basis of the role of XPD in human disease. PMID:25500814

  2. ATP-binding site of adenylate kinase: mechanistic implications of its homology with ras-encoded p21, F1-ATPase, and other nucleotide-binding proteins.

    PubMed Central

    Fry, D C; Kuby, S A; Mildvan, A S

    1986-01-01

    The MgATP binding site of adenylate kinase, located by a combination of NMR and x-ray diffraction, is near three protein segments, five to seven amino acids in length, that are homologous in sequence to segments found in other nucleotide-binding phosphotransferases, such as myosin and F1-ATPase, ras p21 and transducin GTPases, and cAMP-dependent and src protein kinases, suggesting equivalent mechanistic roles of these segments in all of these proteins. Segment 1 is a glycine-rich flexible loop that, on adenylate kinase, may control access to the ATP-binding site by changing its conformation. Segment 2 is an alpha-helix containing two hydrophobic residues that interact with the adenine-ribose moiety of ATP, and a lysine that may bind to the beta- and gamma-phosphates of ATP. Segment 3 is a hydrophobic strand of parallel beta-pleated sheet, terminated by a carboxylate, that flanks the triphosphate binding site. The various reported mutations of ras p21 that convert it to a transforming agent all appear to involve segment 1, and such substitutions may alter the properties of p21 by hindering a conformational change at this segment. In F1-ATPase, the flexible loop may, by its position, control both the accessibility and the ATP/ADP equilibrium constant on the enzyme. Images PMID:2869483

  3. Conservation of an ATP-binding domain among RecA proteins from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r.

    PubMed

    Knight, K L; Hess, R M; McEntee, K

    1988-06-01

    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N3ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the [alpha-32P]8N3ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T31 of the E. coli K-12 RecA protein, which was the unique site of 8N3ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10(7) years.

  4. Conservation of an ATP-binding domain among recA proteins from Proteus vulgaris, erwinia carotovora, Shigella flexneri, and Escherichia coli K-12 and B/r

    SciTech Connect

    Knight, K.L.; Hess, R.M.; McEntee, K.

    1988-06-01

    The purified RecA proteins encoded by the cloned genes from Proteus vulgaris, Erwinia carotovora, Shigella flexneri, and Escherichia coli B/r were compared with the RecA protein from E. coli K-12. Each of the proteins hydrolyzed ATP in the presence of single-stranded DNA, and each was covalently modified with the photoaffinity ATP analog 8-azidoadenosine 5'-triphosphate (8N/sub 3/ATP). Two-dimensional tryptic maps of the four heterologous RecA proteins demonstrated considerable structural conservation among these bacterial genera. Moreover, when the (..cap alpha..-/sup 32/P)8N/sub 3/ATP-modified proteins were digested with trypsin and analyzed by high-performance liquid chromatography, a single peak of radioactivity was detected in each of the digests and these peptides eluted identically with the tryptic peptide T/sub 31/ of the E. coli K-12 RecA protein, which was the unique site of 8N/sub 3/ATP photolabeling. Each of the heterologous recA genes hybridized to oligonucleotide probes derived from the ATP-binding domain sequence of the E. coli K-12 gene. These last results demonstrate that the ATP-binding domain of the RecA protein has been strongly conserved for greater than 10/sup 7/ years.

  5. Characterization of a T-antigen-negative revertant isolated from a mouse cell line which undergoes rearrangement of integrated simian virus 40 DNA.

    PubMed Central

    Bender, M A; Christensen, J; Brockman, W W

    1983-01-01

    A transformation revertant has been isolated from an unusual line of simian virus 40 (SV40)-transformed BALB/c-3T3 cells in which rearrangements of integrated viral sequences are common. The revertant produces no SV40 T antigens, yields no virus on fusion with permissive cells, and can be retransformed by SV40 virions. SV40 DNA sequences are present within the cellular DNA, but interruption of the viral early transcription region by deletion and recombination with cellular sequences precludes the synthesis of T antigens. Analysis of this revertant lends further support to the notion that large T antigen plays an essential role in the maintenance of transformation in SV40-transformed BALB/c-3T3 cells. Examination of integration of SV40 DNA in this revertant, as well as in a temperature-sensitive A transformant, after retransformation by SV40 confirms that sequence homology plays little role in the insertion of SV40 DNA into cellular chromosomes. Images PMID:6306268

  6. Expression and structural characterization of anti-T-antigen single-chain antibodies (scFvs) and analysis of their binding to T-antigen by surface plasmon resonance and NMR spectroscopy.

    PubMed

    Yuasa, Noriyuki; Koyama, Tsubasa; Subedi, Ganesh P; Yamaguchi, Yoshiki; Matsushita, Misao; Fujita-Yamaguchi, Yoko

    2013-12-01

    T-antigen (Galβ1-3GalNAcα-1-Ser/Thr), also known as Thomsen-Friedenreich antigen (TF antigen), is an oncofetal antigen commonly found in cancerous tissues. Availability of anti-T-antigen human antibodies could lead to the development of cancer diagnostics and therapeutics. Four groups of single-chain variable fragment (scFv) genes were previously isolated from a phage library (Matsumoto-Takasaki et al. (2009) Isolation and characterization of anti-T-antigen single chain antibodies from a phage library. BioSci Trends 3:87-95.). Here, four anti-T-antigen scFv genes belonging to Group 1-4 were expressed and produced in a Drosophila S2 cell expression system. ELISA and surface plasmon resonance (SPR) analyses confirmed the binding activity of 1E8 scFv protein to various T-antigen presenting conjugates. NMR experiments provided evidence of the folded nature of the 1E8 scFv protein. ScFv-ligand contact was identified by STD NMR, indicating that the galactose unit of T-antigen at the non-reducing end was primarily recognized by 1E8 scFv. This thus provides direct evidence of T-antigen specificity.

  7. Merkel Cell Polyomavirus Small T Antigen Mediates Microtubule Destabilization To Promote Cell Motility and Migration

    PubMed Central

    Knight, Laura M.; Stakaityte, Gabriele; Wood, Jennifer, J.; Abdul-Sada, Hussein; Griffiths, David A.; Howell, Gareth J.; Wheat, Rachel; Blair, G. Eric; Steven, Neil M.; Macdonald, Andrew; Blackbourn, David J.

    2014-01-01

    ABSTRACT Merkel cell carcinoma (MCC) is an aggressive skin cancer of neuroendocrine origin with a high propensity for recurrence and metastasis. Merkel cell polyomavirus (MCPyV) causes the majority of MCC cases due to the expression of the MCPyV small and large tumor antigens (ST and LT, respectively). Although a number of molecular mechanisms have been attributed to MCPyV tumor antigen-mediated cellular transformation or replication, to date, no studies have investigated any potential link between MCPyV T antigen expression and the highly metastatic nature of MCC. Here we use a quantitative proteomic approach to show that MCPyV ST promotes differential expression of cellular proteins implicated in microtubule-associated cytoskeletal organization and dynamics. Intriguingly, we demonstrate that MCPyV ST expression promotes microtubule destabilization, leading to a motile and migratory phenotype. We further highlight the essential role of the microtubule-associated protein stathmin in MCPyV ST-mediated microtubule destabilization and cell motility and implicate the cellular phosphatase catalytic subunit protein phosphatase 4C (PP4C) in the regulation of this process. These findings suggest a possible molecular mechanism for the highly metastatic phenotype associated with MCC. IMPORTANCE Merkel cell polyomavirus (MCPyV) causes the majority of cases of Merkel cell carcinoma (MCC), an aggressive skin cancer with a high metastatic potential. However, the molecular mechanisms leading to virally induced cancer development have yet to be fully elucidated. In particular, no studies have investigated any potential link between the virus and the highly metastatic nature of MCC. We demonstrate that the MCPyV small tumor antigen (ST) promotes the destabilization of the host cell microtubule network, which leads to a more motile and migratory cell phenotype. We further show that MCPyV ST induces this process by regulating the phosphorylation status of the cellular microtubule

  8. Reversible transport by the ATP-binding cassette multidrug export pump LmrA: ATP synthesis at the expense of downhill ethidium uptake.

    PubMed

    Balakrishnan, Lekshmy; Venter, Henrietta; Shilling, Richard A; van Veen, Hendrik W

    2004-03-19

    The ATP dependence of ATP-binding cassette (ABC) transporters has led to the widespread acceptance that these systems are unidirectional. Interestingly, in the presence of an inwardly directed ethidium concentration gradient in ATP-depleted cells of Lactococcus lactis, the ABC multidrug transporter LmrA mediated the reverse transport (or uptake) of ethidium with an apparent K(t) of 2.0 microm. This uptake reaction was competitively inhibited by the LmrA substrate vinblastine and was significantly reduced by an E314A substitution in the membrane domain of the transporter. Similar to efflux, LmrA-mediated ethidium uptake was inhibited by the E512Q replacement in the Walker B region of the nucleotide-binding domain of the protein, which strongly reduced its drug-stimulated ATPase activity, consistent with published observations for other ABC transporters. The notion that ethidium uptake is coupled to the catalytic cycle in LmrA was further corroborated by studies in LmrA-containing cells and proteoliposomes in which reverse transport of ethidium was associated with the net synthesis of ATP. Taken together, these data demonstrate that the conformational changes required for drug transport by LmrA are (i) not too far from equilibrium under ATP-depleted conditions to be reversed by appropriate changes in ligand concentrations and (ii) not necessarily coupled to ATP hydrolysis, but associated with a reversible catalytic cycle. These findings and their thermodynamic implications shed new light on the mechanism of energy coupling in ABC transporters and have implications for the development of new modulators that could enable reverse transport-associated drug delivery in cells through their ability to uncouple ATP binding/hydrolysis from multidrug efflux.

  9. Maltose-binding protein effectively stabilizes the partially closed conformation of the ATP-binding cassette transporter MalFGK2.

    PubMed

    Weng, Jingwei; Gu, Shuo; Gao, Xin; Huang, Xuhui; Wang, Wenning

    2017-04-05

    Maltose transporter MalFGK2 is a type-I importer in the ATP-binding cassette (ABC) transporter superfamily. Upon the binding of its periplasmic binding protein, MalE, the ATPase activity of MalFGK2 can be greatly enhanced. Crystal structures of the MalFGK2-MalE-maltose complex in a so-called "pretranslocation" ("pre-T") state with a partially closed conformation suggest that the formation of this MalE-stabilized intermediate state is a key step leading to the outward-facing catalytic state. On the contrary, crosslinking and fluorescence studies suggest that ATP binding alone is sufficient to promote the outward-facing catalytic state, thereby doubting the role of MalE binding. To clarify the role of MalE binding and to gain deeper understanding of the molecular mechanisms of MalFGK2, we calculated the free energy surfaces (FESs) related to the lateral motion in the presence and absence of MalE using atomistic metadynamics simulations. The results showed that, in the absence of MalE, laterally closing motion was energetically forbidden but, upon MalE binding, more closed conformations similar to the pre-T state become more stable. The significant effect of MalE binding on the free energy landscapes was in agreement with crystallographic studies and confirmed the important role of MalE in stabilizing the pre-T state. Our simulations also revealed that the allosteric effect of MalE stimulation originates from the MalE-binding-promoted vertical motion between MalF and MalG cores, which was further supported by MD simulation of the MalE-independent mutant MalF500.

  10. Domain Interactions in the Yeast ATP Binding Cassette Transporter Ycf1p: Intragenic Suppressor Analysis of Mutations in the Nucleotide Binding Domains

    PubMed Central

    Falcón-Pérez, Juan M.; Martínez-Burgos, Mónica; Molano, Jesús; Mazón, María J.; Eraso, Pilar

    2001-01-01

    The yeast cadmium factor (Ycf1p) is a vacuolar ATP binding cassette (ABC) transporter required for heavy metal and drug detoxification. Cluster analysis shows that Ycf1p is strongly related to the human multidrug-associated protein (MRP1) and cystic fibrosis transmembrane conductance regulator and therefore may serve as an excellent model for the study of eukaryotic ABC transporter structure and function. Identifying intramolecular interactions in these transporters may help to elucidate energy transfer mechanisms during transport. To identify regions in Ycf1p that may interact to couple ATPase activity to substrate binding and/or movement across the membrane, we sought intragenic suppressors of ycf1 mutations that affect highly conserved residues presumably involved in ATP binding and/or hydrolysis. Thirteen intragenic second-site suppressors were identified for the D777N mutation which affects the invariant Asp residue in the Walker B motif of the first nucleotide binding domain (NBD1). Two of the suppressor mutations (V543I and F565L) are located in the first transmembrane domain (TMD1), nine (A1003V, A1021T, A1021V, N1027D, Q1107R, G1207D, G1207S, S1212L, and W1225C) are found within TMD2, one (S674L) is in NBD1, and another one (R1415G) is in NBD2, indicating either physical proximity or functional interactions between NBD1 and the other three domains. The original D777N mutant protein exhibits a strong defect in the apparent affinity for ATP and Vmax of transport. The phenotypic characterization of the suppressor mutants shows that suppression does not result from restoring these alterations but rather from a change in substrate specificity. We discuss the possible involvement of Asp777 in coupling ATPase activity to substrate binding and/or transport across the membrane. PMID:11466279

  11. ATP utilization by yeast replication factor C. IV. RFC ATP-binding mutants show defects in DNA replication, DNA repair, and checkpoint regulation.

    PubMed

    Schmidt, S L; Pautz, A L; Burgers, P M

    2001-09-14

    Replication factor C is required to load proliferating cell nuclear antigen onto primer-template junctions, using the energy of ATP hydrolysis. Four of the five RFC genes have consensus ATP-binding motifs. To determine the relative importance of these sites for proper DNA metabolism in the cell, the conserved lysine in the Walker A motif of RFC1, RFC2, RFC3, or RFC4 was mutated to either arginine or glutamic acid. Arginine mutations in all RFC genes tested permitted cell growth, although poor growth was observed for rfc2-K71R. A glutamic acid substitution resulted in lethality in RFC2 and RFC3 but not in RFC1 or RFC4. Most double mutants combining mutations in two RFC genes were inviable. Except for the rfc1-K359R and rfc4-K55E mutants, which were phenotypically similar to wild type in every assay, the mutants were sensitive to DNA-damaging agents. The rfc2-K71R and rfc4-K55R mutants show checkpoint defects, most likely in the intra-S phase checkpoint. Regulation of the damage-inducible RNR3 promoter was impaired in these mutants, and phosphorylation of Rad53p in response to DNA damage was specifically defective when cells were in S phase. No dramatic defects in telomere length regulation were detected in the mutants. These data demonstrate that the ATP binding function of RFC2 is important for both DNA replication and checkpoint function and, for the first time, that RFC4 also plays a role in checkpoint regulation.

  12. Immortalization of neuronal progenitors using SV40 large T antigen and differentiation towards dopaminergic neurons

    PubMed Central

    Alwin Prem Anand, A; Gowri Sankar, S; Kokila Vani, V

    2012-01-01

    Transplantation is common in clinical practice where there is availability of the tissue and organ. In the case of neurodegenerative disease such as Parkinson's disease (PD), transplantation is not possible as a result of the non-availability of tissue or organ and therefore, cell therapy is an innovation in clinical practice. However, the availability of neuronal cells for transplantation is very limited. Alternatively, immortalized neuronal progenitors could be used in treating PD. The neuronal progenitor cells can be differentiated into dopaminergic phenotype. Here in this article, the current understanding of the molecular mechanisms involved in the differentiation of dopaminergic phenotype from the neuronal progenitors immortalized with SV40 LT antigen is discussed. In addition, the methods of generating dopaminergic neurons from progenitor cells and the factors that govern their differentiation are elaborated. Recent advances in cell-therapy based transplantation in PD patients and future prospects are discussed. PMID:22863662

  13. Relationship between expression of epidermal growth factor and simian virus 40 T antigen in a line of transgenic mice.

    PubMed

    Lafond, R E; Giammalvo, J T; Norkin, L C

    1995-09-01

    The pattern of expression of the simian virus 40 (SV40) T antigen gene and resultant dysplasia were re-examined in a line of transgenic mice in which the T antigen gene was under the control of the SV40 early promoter. We found that T antigen expression in the kidney, and resulting dysplastic lesions, occurred exclusively in the distal convoluted tubules and the ascending limbs of Henle. Epidermal growth factor (EGF) expression in the kidney of normal mice was similarly immunolocalized. The correlation between high EGF immunoreactivity in normal mouse tissues and T antigen expression in the transgenic counterpart was also seen in the choroid plexus epithelium and in the submandibular glands of male mice. T antigen was not found in the submandibular gland of transgenic females. Similarly, EGF was only rarely detected in the normal female submandibular gland. In contrast to the correlation between T antigen expression in the transgenic mice and EGF expression in the corresponding tissues of the normal mice, within the dysplastic lesions of the transgenic mice EGF expression was severely diminished. Adenocarcinomas of the male submandibular gland from another line of transgenic mice that expresses the Int-1 transgene, showed similarly reduced levels of immunostaining for EGF. Thus, reduced expression of EGF might be a general feature of dysplasia and tumorigenesis in those tissues that normally express EGF.

  14. Improved Serodiagnosis of Cystic Echinococcosis Using the New Recombinant 2B2t Antigen

    PubMed Central

    Hernández-González, Ana; Santivañez, Saúl; García, Héctor H.; Rodríguez, Silvia; Muñoz, Santiago; Ramos, Guillermo; Orduña, Antonio; Siles-Lucas, Mar

    2012-01-01

    A standardized test for the serodiagnosis of human cystic echinococcosis (CE) is still needed, because of the low specificity and sensitivity of the currently available commercial tools and the lack of proper evaluation of the existing recombinant antigens. In a previous work, we defined the new ELISA-B2t diagnostic tool for the detection of specific IgGs in CE patients, which showed high sensitivity and specificity, and was useful in monitoring the clinical evolution of surgically treated CE patients. Nevertheless, this recombinant antigen gave rise to false-negative results in a percentage of CE patients. Therefore, in an attempt to improve its sensitivity, we constructed B2t-derived recombinant antigens with two, four and eight tandem repeat of B2t units, and tested them by ELISA on serum samples of CE patients and patients with related parasites. The best diagnostic values were obtained with the two tandem repeat 2B2t antigen. The influence of several clinical variables on the performance of the tests was also evaluated. Finally, the diagnostic performance of the 2B2t-ELISA was compared with that of an indirect haemagglutination commercial test. The 2B2t recombinant antigen performed better than the HF and B2t antigens, and the IHA commercial kit. Therefore, this new 2B2t-ELISA is a promising candidate test for the serodiagnosis of CE in clinical settings. PMID:22802975

  15. Computer modelling reveals new conformers of the ATP binding loop of Na+/K+-ATPase involved in the transphosphorylation process of the sodium pump

    PubMed Central

    Tejral, Gracian; Sopko, Bruno; Necas, Alois; Schoner, Wilhelm

    2017-01-01

    Hydrolysis of ATP by Na+/K+-ATPase, a P-Type ATPase, catalyzing active Na+ and K+ transport through cellular membranes leads transiently to a phosphorylation of its catalytical α-subunit. Surprisingly, three-dimensional molecular structure analysis of P-type ATPases reveals that binding of ATP to the N-domain connected by a hinge to the P-domain is much too far away from the Asp369 to allow the transfer of ATP’s terminal phosphate to its aspartyl-phosphorylation site. In order to get information for how the transfer of the γ-phosphate group of ATP to the Asp369 is achieved, analogous molecular modeling of the M4–M5 loop of ATPase was performed using the crystal data of Na+/K+-ATPase of different species. Analogous molecular modeling of the cytoplasmic loop between Thr338 and Ile760 of the α2-subunit of Na+/K+-ATPase and the analysis of distances between the ATP binding site and phosphorylation site revealed the existence of two ATP binding sites in the open conformation; the first one close to Phe475 in the N-domain, the other one close to Asp369 in the P-domain. However, binding of Mg2+•ATP to any of these sites in the “open conformation” may not lead to phosphorylation of Asp369. Additional conformations of the cytoplasmic loop were found wobbling between “open conformation” <==> “semi-open conformation <==> “closed conformation” in the absence of 2Mg2+•ATP. The cytoplasmic loop’s conformational change to the “semi-open conformation”—characterized by a hydrogen bond between Arg543 and Asp611—triggers by binding of 2Mg2+•ATP to a single ATP site and conversion to the “closed conformation” the phosphorylation of Asp369 in the P-domain, and hence the start of Na+/K+-activated ATP hydrolysis. PMID:28316890

  16. Role of Single-Stranded DNA Binding Activity of T Antigen in Simian Virus 40 DNA Replication

    PubMed Central

    Wu, Chunxiao; Roy, Rupa; Simmons, Daniel T.

    2001-01-01

    We have previously mapped the single-stranded DNA binding domain of large T antigen to amino acid residues 259 to 627. By using internal deletion mutants, we show that this domain most likely begins after residue 301 and that the region between residues 501 and 550 is not required. To study the function of this binding activity, a series of single-point substitutions were introduced in this domain, and the mutants were tested for their ability to support simian virus 40 (SV40) replication and to bind to single-stranded DNA. Two replication-defective mutants (429DA and 460EA) were grossly impaired in single-stranded DNA binding. These two mutants were further tested for other biochemical activities needed for viral DNA replication. They bound to origin DNA and formed double hexamers in the presence of ATP. Their ability to unwind origin DNA and a helicase substrate was severely reduced, although they still had ATPase activity. These results suggest that the single-stranded DNA binding activity is involved in DNA unwinding. The two mutants were also very defective in structural distortion of origin DNA, making it likely that single-stranded DNA binding is also required for this process. These data show that single-stranded DNA binding is needed for at least two steps during SV40 DNA replication. PMID:11222709

  17. Targeted expression of SV40 T antigen in the hair follicle of transgenic mice produces an aberrant hair phenotype.

    PubMed

    Keough, R; Powell, B; Rogers, G

    1995-03-01

    Directed expression of SV40 large T antigen (TAg) in transgenic mice can induce tissue-specific tumorigenesis and useful cell lines exhibiting differentiated characteristics can be established from resultant tumor cells. In an attempt to produce an immortalised mouse hair follicle cortical cell line for the study of hair keratin gene control, SV40 TAg expression was targeted to the hair follicles of transgenic mice using a sheep hair gene promoter. Expression of SV40 TAg in the follicle cortex disrupted normal fiber ultrastructure, producing a marked phenotypic effect. Affected hairs were wavy or severely kinked (depending on the severity of the phenotype) producing an appearance ranging from a ruffled coat to a stubble covering the back of the mouse. The transgenic hairs appeared to be weakened at the base of the fibers, leading to premature hair-loss and a thinner pelage, or regions of temporary nudity. No follicle tumors or neoplasia were apparent and immortalisation of cortical cells could not be established in culture. In situ hybridisation studies in the hair follicle using histone H3 as a cell proliferation marker suggested that cell proliferation had ceased prior to commencement of K2.10-TAg expression and was not re-established in the differentiating cortical cells. Hence, TAg was unable to induce cell immortalisation at that stage of cortical cell differentiation. However, transgenic mice developed various other abnormalities including vertebral abnormalities and bladder, liver and intestinal tumors, which resulted in reduced life expectancy.

  18. Establishment of renal proximal tubule cell lines by targeted oncogenesis in transgenic mice using the L-pyruvate kinase-SV40 (T) antigen hybrid gene.

    PubMed

    Cartier, N; Lacave, R; Vallet, V; Hagege, J; Hellio, R; Robine, S; Pringault, E; Cluzeaud, F; Briand, P; Kahn, A

    1993-03-01

    Targeted oncogenesis allowed us to obtain two cell lines which have been derived from the proximal tubule of kidney from transgenic mice harbouring the simian virus (SV40) large T and small t antigens placed under the control of the 5' regulatory sequence from the rat L-type pyruvate kinase (L-PK) gene. The cell lines (PKSV-PCT and PKSV-PR cells) were derived from early (PCT) and late (Pars Recta, PR) microdissected proximal tubules grown in D-glucose-enriched medium. In such conditions of culture, both cell lines exhibited L-PK transcripts, a stable expression of SV40-encoded nuclear large T antigen, a prolonged life span but failed to induce tumors when injected sub-cutaneously into athymic (nu-nu) mice. Confluent cells, grown on plastic support or porous filters, were organized as monolayers of polarized cuboid cells with well developed apical microvilli and formed domes. Both cell lines exhibited morphological features of proximal tubule cells with villin located in the apical brush-border and substantial amounts of hydrolase activity. By immunofluorescence studies using specific antibodies, aminopeptidase N appeared restricted to the apical microvillar domain, whereas the H2 histocompatibility antigen was distributed in the cytoplasm and lateral membranes. These results demonstrate that the proximal morphological phenotype has been fully preserved in these cultured cells derived from tissue-specific targeted oncogenesis in transgenic mice.

  19. Transformation by Polyomavirus Middle T Antigen Involves a Unique Bimodal Interaction with the Hippo Effector YAP

    PubMed Central

    Rouleau, Cecile; Pores Fernando, Arun T.; Hwang, Justin H.; Faure, Nathalie; Jiang, Tao; White, Elizabeth A.

    2016-01-01

    ABSTRACT Murine polyomavirus has repeatedly provided insights into tumorigenesis, revealing key control mechanisms such as tyrosine phosphorylation and phosphoinositide 3-kinase (PI3K) signaling. We recently demonstrated that polyomavirus small T antigen (ST) binds YAP, a major effector of Hippo signaling, to regulate differentiation. Here we characterize YAP as a target of middle T antigen (MT) important for transformation. Through a surface including residues R103 and D182, wild-type MT binds to the YAP WW domains. Mutation of either R103 or D182 of MT abrogates YAP binding without affecting binding to other signaling molecules or the strength of PI3K or Ras signaling. Either genetic abrogation of YAP binding to MT or silencing of YAP via short hairpin RNA (shRNA) reduced MT transformation, suggesting that YAP makes a positive contribution to the transformed phenotype. MT targets YAP both by activating signaling pathways that affect it and by binding to it. MT signaling, whether from wild-type MT or the YAP-binding MT mutant, promoted YAP phosphorylation at S127 and S381/397 (YAP2/YAP1). Consistent with the known functions of these phosphorylated serines, MT signaling leads to the loss of YAP from the nucleus and degradation. Binding of YAP to MT brings it together with protein phosphatase 2A (PP2A), leading to the dephosphorylation of YAP in the MT complex. It also leads to the enrichment of YAP in membranes. Taken together, these results indicate that YAP promotes MT transformation via mechanisms that may depart from YAP's canonical oncogenic transcriptional activation functions. IMPORTANCE The highly conserved Hippo/YAP pathway is important for tissue development and homeostasis. Increasingly, changes in this pathway are being associated with cancer. Middle T antigen (MT) is the primary polyomavirus oncogene responsible for tumor formation. In this study, we show that MT signaling promotes YAP phosphorylation, loss from the nucleus, and increased turnover

  20. Exploring new molecular architectures for anion recognition: synthesis and ATP binding properties of new cyclam-based ditopic polyammonium receptors.

    PubMed

    Pouessel, Jacky; Bazzicalupi, Carla; Bencini, Andrea; Bernard, Hélène; Giorgi, Claudia; Handel, Henri; Matera, Irene; Le Bris, Nathalie; Tripier, Raphaël; Valtancoli, Barbara

    2011-06-06

    Synthesis and characterization of three new polyamine receptors, composed of a cyclam unit (cyclam=1,4,8,11-tetraazacyclotetradecane) linked by a 2,6-dimethylpyridinyl spacer to the linear polyamines 1,4,8,11-tetraazaundecane (L1py), 1,4,7-triazaheptane (L2py), and to a quaternary ammonium group (L3py(+)), are reported. All receptors form highly charged polyammonium cations at neutral pH, suitable for anion recognition studies. ATP recognition was analyzed by using potentiometric, calorimetric, (1)H and (31)P NMR measurements in aqueous solution. All receptors form 1:1 adducts with ATP in aqueous solution, stabilized by charge-charge and hydrogen-bonding interactions between their ammonium groups and the anionic triphosphate chain of ATP. The binding ability of the three receptors for ATP increases in the order of L3py(+)largely favourable entropic contributions, probably due to the large desolvation of the host and guest species upon complexation. The sequence observed for the binding affinity is explained in terms of the different ability of the three receptors to wrap around the phosphate chain of ATP.

  1. Lipid absorption defects in intestine-specific microsomal triglyceride transfer protein and ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Iqbal, Jahangir; Parks, John S; Hussain, M Mahmood

    2013-10-18

    We have previously described apolipoprotein B (apoB)-dependent and -independent cholesterol absorption pathways and the role of microsomal triglyceride transfer protein (MTP) and ATP-binding cassette transporter A1 (ABCA1) in these pathways. To assess the contribution of these pathways to cholesterol absorption and to determine whether there are other pathways, we generated mice that lack MTP and ABCA1, individually and in combination, in the intestine. Intestinal deletions of Mttp and Abca1 decreased plasma cholesterol concentrations by 45 and 24%, respectively, whereas their combined deletion reduced it by 59%. Acute cholesterol absorption was reduced by 28% in the absence of ABCA1, and it was reduced by 92-95% when MTP was deleted in the intestine alone or together with ABCA1. MTP deficiency significantly reduced triglyceride absorption, although ABCA1 deficiency had no effect. ABCA1 deficiency did not affect cellular lipids, but Mttp deficiency significantly increased intestinal levels of triglycerides and free fatty acids. Accumulation of intestinal free fatty acids, but not triglycerides, in Mttp-deficient intestines was prevented when mice were also deficient in intestinal ABCA1. Combined deficiency of these genes increased intestinal fatty acid oxidation as a consequence of increased expression of peroxisome proliferator-activated receptor-γ (PPARγ) and carnitine palmitoyltransferase 1α (CPT1α). These studies show that intestinal MTP and ABCA1 are critical for lipid absorption and are the main determinants of plasma and intestinal lipid levels. Reducing their activities might lower plasma lipid concentrations.

  2. Identification and analysis of the sap genes from Vibrio fischeri belonging to the ATP-binding cassette gene family required for peptide transport and resistance to antimicrobial peptides.

    PubMed

    Chen, H Y; Weng, S F; Lin, J W

    2000-03-24

    Partial nucleotide sequences of the sapD and sapF genes of the sap operon (GenBank Accession No. AF178651) from Vibrio fischeri ATCC 7744 have been determined, and the peptide transport system of ATP-binding proteins SapD and SapF encoded by the genes have been deduced. Alignment and comparison of the Sap proteins of V. fischeri, Escherichia coli, Salmonella typhimurium, and Haemophilus influenzae Rd show that these proteins are homologous. The sap operon residing in the genome enables V. fischeri to transport peptides and resist antimicrobial peptides. Nucleotide sequence and functional analyses confirm that the specific regulatory-region-like sequence R&R* that resides inside the sapD gene and before the sapF gene functions in gene expression and regulation; also, it is regulated by the LuxR-AI complex of the V. fischeri lux regulon. The putative upstream activator binding sequences SigmaUASI, SigmaUASII, SigmaUASIII TGTCGACTTGGGCCTCGCTGTCCGTATGCACA (72nd to 103rd bp), TGTCCGTATGCACA (90th to 103rd bp), and TGTTCAAGTACCAGAAAGACA (111st to 133rd bp) in the R&R* sequence, which are similar to the two-component regulator binding sequence TGT-N(8-12)-ACA and the LuxR-AI binding sequence ACCTGTAGGATCGTACAGGT in the regulatory region of the V. fischeri lux regulon, might be the specific sequences recognized by the LuxR-AI complex for enhancement.

  3. Block of ATP-binding cassette B19 ion channel activity by 5-nitro-2-(3-phenylpropylamino)-benzoic acid impairs polar auxin transport and root gravitropism.

    PubMed

    Cho, Misuk; Henry, Elizabeth M; Lewis, Daniel R; Wu, Guosheng; Muday, Gloria K; Spalding, Edgar P

    2014-12-01

    Polar transport of the hormone auxin through tissues and organs depends on membrane proteins, including some B-subgroup members of the ATP-binding cassette (ABC) transporter family. The messenger RNA level of at least one B-subgroup ABCB gene in Arabidopsis (Arabidopsis thaliana), ABCB19, increases upon treatment with the anion channel blocker 5-nitro-2-(3-phenylpropylamino)-benzoic acid (NPPB), possibly to compensate for an inhibitory effect of the drug on ABCB19 activity. Consistent with this hypothesis, NPPB blocked ion channel activity associated with ABCB19 expressed in human embryonic kidney cells as measured by patch-clamp electrophysiology. NPPB inhibited polar auxin transport through Arabidopsis seedling roots similarly to abcb19 mutations. NPPB also inhibited shootward auxin transport, which depends on the related ABCB4 protein. NPPB substantially decreased ABCB4 and ABCB19 protein levels when cycloheximide concomitantly inhibited new protein synthesis, indicating that blockage by NPPB enhances the degradation of ABCB transporters. Impairing the principal auxin transport streams in roots with NPPB caused aberrant patterns of auxin signaling reporters in root apices. Formation of the auxin-signaling gradient across the tips of gravity-stimulated roots, and its developmental consequence (gravitropism), were inhibited by micromolar concentrations of NPPB that did not affect growth rate. These results identify ion channel activity of ABCB19 that is blocked by NPPB, a compound that can now be considered an inhibitor of polar auxin transport with a defined molecular target.

  4. Lobular Distribution and Variability in Hepatic ATP Binding Cassette Protein B1 (ABCB1, P-gp): Ontogenetic Differences and Potential for Toxicity

    PubMed Central

    Abanda, Ngu Njei; Riches, Zoe; Collier, Abby C.

    2017-01-01

    The ATP Binding Cassette B1 (ABCB1) transporter has critical roles in endo- and xenobiotic efficacy and toxicity. To understand population variability in hepatic transport we determined ABCB1 mRNA and protein levels in total liver lysates sampled from 8 pre-defined sites (n = 24, 18–69 years), and in S9 from randomly acquired samples (n = 87, 7 days–87 years). ABCB1 levels did not differ significantly throughout individual livers and showed 4.4-fold protein variation between subjects. Neither mRNA nor protein levels varied with sex, ethnicity, obesity or triglycerides in lysates or S9 (that showed the same relationships), but protein levels were lower in pediatric S9 (p < 0.0001), with 76% of adult ABCB1 present at birth and predicted to mature in 5 years. Pediatric total liver lysates were not available. In summary, opportunistic collection for studying human hepatic ABCB1 is acceptable. Additionally, ABCB1 may be lower in children, indicating differential potential for toxicity and response to therapy in this special population. PMID:28218636

  5. Structural and functional characterization of an orphan ATP-binding cassette ATPase involved in manganese utilization and tolerance in Leptospira spp.

    PubMed

    Benaroudj, Nadia; Saul, Frederick; Bellalou, Jacques; Miras, Isabelle; Weber, Patrick; Bondet, Vincent; Murray, Gerald L; Adler, Ben; Ristow, Paula; Louvel, Hélène; Haouz, Ahmed; Picardeau, Mathieu

    2013-12-01

    Pathogenic Leptospira species are the etiological agents of the widespread zoonotic disease leptospirosis. Most organisms, including Leptospira, require divalent cations for proper growth, but because of their high reactivity, these metals are toxic at high concentrations. Therefore, bacteria have acquired strategies to maintain metal homeostasis, such as metal import and efflux. By screening Leptospira biflexa transposon mutants for their ability to use Mn(2+), we have identified a gene encoding a putative orphan ATP-binding cassette (ABC) ATPase of unknown function. Inactivation of this gene in both L. biflexa and L. interrogans strains led to mutants unable to grow in medium in which iron was replaced by Mn(2+), suggesting an involvement of this ABC ATPase in divalent cation uptake. A mutation in this ATPase-coding gene increased susceptibility to Mn(2+) toxicity. Recombinant ABC ATPase of the pathogen L. interrogans exhibited Mg(2+)-dependent ATPase activity involving a P-loop motif. The structure of this ATPase was solved from a crystal containing two monomers in the asymmetric unit. Each monomer adopted a canonical two-subdomain organization of the ABC ATPase fold with an α/β subdomain containing the Walker motifs and an α subdomain containing the ABC signature motif (LSSGE). The two monomers were arranged in a head-to-tail orientation, forming a V-shaped particle with all the conserved ABC motifs at the dimer interface, similar to functional ABC ATPases. These results provide the first structural and functional characterization of a leptospiral ABC ATPase.

  6. Hop resistance in the beer spoilage bacterium Lactobacillus brevis is mediated by the ATP-binding cassette multidrug transporter HorA.

    PubMed

    Sakamoto, K; Margolles, A; van Veen, H W; Konings, W N

    2001-09-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters.

  7. Hop Resistance in the Beer Spoilage Bacterium Lactobacillus brevis Is Mediated by the ATP-Binding Cassette Multidrug Transporter HorA

    PubMed Central

    Sakamoto, Kanta; Margolles, Abelardo; van Veen, Hendrik W.; Konings, Wil N.

    2001-01-01

    Lactobacillus brevis is a major contaminant of spoiled beer. The organism can grow in beer in spite of the presence of antibacterial hop compounds that give the beer a bitter taste. The hop resistance in L. brevis is, at least in part, dependent on the expression of the horA gene. The deduced amino acid sequence of HorA is 53% identical to that of LmrA, an ATP-binding cassette multidrug transporter in Lactococcus lactis. To study the role of HorA in hop resistance, HorA was functionally expressed in L. lactis as a hexa-histidine-tagged protein using the nisin-controlled gene expression system. HorA expression increased the resistance of L. lactis to hop compounds and cytotoxic drugs. Drug transport studies with L. lactis cells and membrane vesicles and with proteoliposomes containing purified HorA protein identified HorA as a new member of the ABC family of multidrug transporters. PMID:11514522

  8. An ATP Binding Cassette Transporter Is Required for Cuticular Wax Deposition and Desiccation Tolerance in the Moss Physcomitrella patens[W

    PubMed Central

    Buda, Gregory J.; Barnes, William J.; Fich, Eric A.; Park, Sungjin; Yeats, Trevor H.; Zhao, Lingxia; Domozych, David S.; Rose, Jocelyn K.C.

    2013-01-01

    The plant cuticle is thought to be a critical evolutionary adaptation that allowed the first plants to colonize land, because of its key roles in regulating plant water status and providing protection from biotic and abiotic stresses. Much has been learned about cuticle composition and structure through genetic and biochemical studies of angiosperms, as well as underlying genetic pathways, but little is known about the cuticles of early diverging plant lineages. Here, we demonstrate that the moss Physcomitrella patens, an extant relative of the earliest terrestrial plants, has a cuticle that is analogous in both structure and chemical composition to those of angiosperms. To test whether the underlying cuticle biosynthetic pathways were also shared among distant plant lineages, we generated a genetic knockout of the moss ATP binding cassette subfamily G (ABCG) transporter Pp-ABCG7, a putative ortholog of Arabidopsis thaliana ABCG transporters involved in cuticle precursor trafficking. We show that this mutant is severely deficient in cuticular wax accumulation and has a reduced tolerance of desiccation stress compared with the wild type. This work provides evidence that the cuticle was an adaptive feature present in the first terrestrial plants and that the genes involved in their formation have been functionally conserved for over 450 million years. PMID:24163310

  9. Direct evidence in vivo of impaired macrophage-specific reverse cholesterol transport in ATP-binding cassette transporter A1-deficient mice.

    PubMed

    Calpe-Berdiel, Laura; Rotllan, Noemi; Palomer, Xavier; Ribas, Vicent; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles

    2005-12-30

    The ATP-binding cassette transporter A1 (ABCA1) is a key regulator of high-density lipoprotein (HDL) metabolism. There is strong evidence that ABCA1 is a key regulator of reverse cholesterol transport (RCT). However, this could not be proved in vivo since hepatobiliary cholesterol transport was unchanged in ABCA1-deficient mice (ABCA1-/-). We used ABCA1-/- mice to test the hypothesis that ABCA1 is a critical determinant of macrophage-specific RCT. Although this cell-specific RCT only accounts for a tiny part of total RCT, it is widely accepted that it may have a major impact on atherosclerosis susceptibility. [(3)H]cholesterol-labeled endogenous macrophages were injected intraperitoneally into wild-type ABCA1+/+, ABCA1+/- and ABCA1-/- mice maintained on a chow diet. A direct relationship was observed between ABCA1 gene dose and plasma [(3)H]cholesterol at 24 and 48 h after the injection of tracer into the mice. Forty-eight hours after this injection, ABCA1-/- mice had significantly reduced [(3)H]cholesterol in liver (2.8-fold), small intestine enterocytes (1.7-fold) and feces (2-fold). To our knowledge, this is the first direct in vivo quantitative evidence that ABCA1 is a critical determinant of macrophage-specific RCT.

  10. The Arabidopsis pxa1 Mutant Is Defective in an ATP-Binding Cassette Transporter-Like Protein Required for Peroxisomal Fatty Acid β-Oxidation1

    PubMed Central

    Zolman, Bethany K.; Silva, Illeana D.; Bartel, Bonnie

    2001-01-01

    Peroxisomes are important organelles in plant metabolism, containing all the enzymes required for fatty acid β-oxidation. More than 20 proteins are required for peroxisomal biogenesis and maintenance. The Arabidopsis pxa1 mutant, originally isolated because it is resistant to the auxin indole-3-butyric acid (IBA), developmentally arrests when germinated without supplemental sucrose, suggesting defects in fatty acid β-oxidation. Because IBA is converted to the more abundant auxin, indole-3-acetic acid (IAA), in a mechanism that parallels β-oxidation, the mutant is likely to be IBA resistant because it cannot convert IBA to IAA. Adult pxa1 plants grow slowly compared with wild type, with smaller rosettes, fewer leaves, and shorter inflorescence stems, indicating that PXA1 is important throughout development. We identified the molecular defect in pxa1 using a map-based positional approach. PXA1 encodes a predicted peroxisomal ATP-binding cassette transporter that is 42% identical to the human adrenoleukodystrophy (ALD) protein, which is defective in patients with the demyelinating disorder X-linked ALD. Homology to ALD protein and other human and yeast peroxisomal transporters suggests that PXA1 imports coenzyme A esters of fatty acids and IBA into the peroxisome for β-oxidation. The pxa1 mutant makes fewer lateral roots than wild type, both in response to IBA and without exogenous hormones, suggesting that the IAA derived from IBA during seedling development promotes lateral root formation. PMID:11706205

  11. Genome-wide identification of ATP-binding cassette (ABC) transporters and their roles in response to polycyclic aromatic hydrocarbons (PAHs) in the copepod Paracyclopina nana.

    PubMed

    Jeong, Chang-Bum; Kim, Duck-Hyun; Kang, Hye-Min; Lee, Young Hwan; Kim, Hui-Su; Kim, Il-Chan; Lee, Jae-Seong

    2017-02-01

    The ATP-binding cassette (ABC) protein superfamily is one of the largest gene families and is highly conserved in all domains. The ABC proteins play roles in several biological processes, including multi-xenobiotic resistance (MXR), by functioning as transporters in the cellular membrane. They also mediate the cellular efflux of a wide range of substrates against concentration gradients. In this study, 37 ABC genes belonging to eight distinct subfamilies were identified in the marine copepod Paracyclopina nana and annotated based on a phylogenetic analysis. Also, the functions of P-glycoproteins (P-gp) and multidrug resistance-associated proteins (MRPs), conferring MXR, were verified using fluorescent substrates and specific inhibitors. The activities of MXR-mediated ABC proteins and their transcriptional level were examined in response to polyaromatic hydrocarbons (PAHs), main components of the water-accommodated fraction. This study increases the understanding of the protective role of MXR in response to PAHs over the comparative evolution of ABC gene families.

  12. Involvement of CjMDR1, a plant multidrug-resistance-type ATP-binding cassette protein, in alkaloid transport in Coptis japonica

    PubMed Central

    Shitan, Nobukazu; Bazin, Ingrid; Dan, Kazuyuki; Obata, Kazuaki; Kigawa, Koji; Ueda, Kazumitsu; Sato, Fumihiko; Forestier, Cyrille; Yazaki, Kazufumi

    2003-01-01

    Alkaloids comprise one of the largest groups of plant secondary metabolites. Berberine, a benzylisoquinoline alkaloid, is preferentially accumulated in the rhizome of Coptis japonica, a ranunculaceous plant, whereas gene expression for berberine biosynthetic enzymes has been observed specifically in root tissues, which suggests that berberine synthesized in the root is transported to the rhizome, where there is high accumulation. We recently isolated a cDNA encoding a multidrug-resistance protein (MDR)-type ATP-binding cassette (ABC) transporter (Cjmdr1) from berberine-producing cultured C. japonica cells, which is highly expressed in the rhizome. Functional analysis of Cjmdr1 by using a Xenopus oocyte expression system showed that CjMDR1 transported berberine in an inward direction, resulting in a higher accumulation of berberine in Cjmdr1-injected oocytes than in the control. Typical inhibitors of ABC proteins, such as vanadate, nifedipine, and glibenclamide, as well as ATP depletion, clearly inhibited this CjMDR1-dependent berberine uptake, suggesting that CjMDR1 functioned as an ABC transporter. Conventional membrane separation methods showed that CjMDR1 was localized in the plasma membrane of C. japonica cells. In situ hybridization indicated that Cjmdr1 mRNA was expressed preferentially in xylem tissues of the rhizome. These findings strongly suggest that CjMDR1 is involved in the translocation of berberine from the root to the rhizome. PMID:12524452

  13. Genome-wide identification of ATP-binding cassette (ABC) transporters and conservation of their xenobiotic transporter function in the monogonont rotifer (Brachionus koreanus).

    PubMed

    Jeong, Chang-Bum; Kim, Hui-Su; Kang, Hye-Min; Lee, Young Hwan; Zhou, Bingsheng; Choe, Joonho; Lee, Jae-Seong

    2017-03-01

    The ATP-binding cassette (ABC) transporter family is one of the largest gene family in animals, and members of this family are known to be involved in various biological processes due to their ability to transport a wide range of substrates across membranes using ATP cleavage-derived energy. We identified 61 ABC transporters in the genome of the monogonont rotifer Brachionus koreanus, and classified these into eight distinct subfamilies (A-H) by phylogenetic analysis. ABC transporters in the rotifer B. koreanus are comprised of 11 ABCA genes, 19 ABCB genes, 14 ABCC genes, 3 ABCD genes, 1 ABCE gene, 3 ABCF genes, 8 ABCG genes, and 2 ABCH genes. Extensive gene duplication and loss events in synteny were observed in several subfamilies. In particular, massive gene duplications of P-glycoproteins (P-gps), multidrug resistance proteins (MRPs), and Bk-Abcg-like proteins were observed. The ability of these B. koreanus proteins to function as multixenobiotic resistance (MXR) ABC transporters was validated using specific fluorescence substrates/inhibitors. The ABC transporter superfamily members identified in this study will be useful in future toxicological studies, and will facilitate comparative studies of the evolution of the ABC transporter superfamily in invertebrates.

  14. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter

    PubMed Central

    Alvarez, Frances Joan D.; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R. Michael; Klug, Candice S.; Davidson, Amy L.

    2015-01-01

    Summary MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance (EPR) spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP. PMID:26268698

  15. Roles of aldo-keto reductases 1B10 and 1C3 and ATP-binding cassette transporter in docetaxel tolerance.

    PubMed

    Matsunaga, Toshiyuki; Saito, Haruhi; Endo, Satoshi; Iguchi, Kazuhiro; Soda, Midori; El-Kabbani, Ossama; Hara, Akira; Ikari, Akira

    2016-12-01

    Docetaxel (DTX) is widely used for treatment of inveterate lung and prostate cancers, but its continuous administration elicits the hyposensitivity. Here, we established the DTX-resistant variants of human lung cancer A549 and androgen-independent prostate cancer Du145 cells and found that the resistance development provoked aberrant up-regulations of aldo-keto reductase (AKR) 1B10 and AKR1C3 in A549 and Du145 cells, respectively. In addition, the sensitivity to the DTX toxicity was significantly decreased and increased by overexpression and knockdown of the two AKR isoforms, respectively. Furthermore, the resistant cells exhibited a decreased level of reactive 4-hydroxy-2-nonenal formed during DTX treatment, and the decrease was alleviated by adding the AKR inhibitors, inferring that the two AKRs confer the chemoresistance through elevating the antioxidant properties. The development of DTX resistance was also associated with enhanced expression of an ATP-binding cassette (ABC) transporter ABCB1 among the ABC transporter isoforms. The combined treatment with inhibitors of the two AKRs and ABCB1 additively sensitized the resistant cells to DTX. Intriguingly, the AKR1B10 inhibitor also suppressed the lung cancer cross-resistance against cisplatin. The results suggest that combined treatment with AKRs (1B10 and 1C3) and ABCB1 inhibitors exerts overcoming effect against the cancer resistance to DTX and cisplatin, and can be used as the adjuvant therapy.

  16. Role of NH{sub 2}-terminal hydrophobic motif in the subcellular localization of ATP-binding cassette protein subfamily D: Common features in eukaryotic organisms

    SciTech Connect

    Lee, Asaka; Asahina, Kota; Okamoto, Takumi; Kawaguchi, Kosuke; Kostsin, Dzmitry G.; Kashiwayama, Yoshinori; Takanashi, Kojiro; Yazaki, Kazufumi; Imanaka, Tsuneo; Morita, Masashi

    2014-10-24

    Highlights: • ABCD proteins classifies based on with or without NH{sub 2}-terminal hydrophobic segment. • The ABCD proteins with the segment are targeted peroxisomes. • The ABCD proteins without the segment are targeted to the endoplasmic reticulum. • The role of the segment in organelle targeting is conserved in eukaryotic organisms. - Abstract: In mammals, four ATP-binding cassette (ABC) proteins belonging to subfamily D have been identified. ABCD1–3 possesses the NH{sub 2}-terminal hydrophobic region and are targeted to peroxisomes, while ABCD4 lacking the region is targeted to the endoplasmic reticulum (ER). Based on hydropathy plot analysis, we found that several eukaryotes have ABCD protein homologs lacking the NH{sub 2}-terminal hydrophobic segment (H0 motif). To investigate whether the role of the NH{sub 2}-terminal H0 motif in subcellular localization is conserved across species, we expressed ABCD proteins from several species (metazoan, plant and fungi) in fusion with GFP in CHO cells and examined their subcellular localization. ABCD proteins possessing the NH{sub 2}-terminal H0 motif were localized to peroxisomes, while ABCD proteins lacking this region lost this capacity. In addition, the deletion of the NH{sub 2}-terminal H0 motif of ABCD protein resulted in their localization to the ER. These results suggest that the role of the NH{sub 2}-terminal H0 motif in organelle targeting is widely conserved in living organisms.

  17. Inherited surfactant deficiency due to uniparental disomy of rare mutations in the surfactant protein-B and ATP binding cassette, subfamily A, member 3 genes

    PubMed Central

    Hamvas, Aaron; Nogee, Lawrence M.; Wegner, Daniel J.; DePass, Kelcey; Christodoulou, John; Bennetts, Bruce; McQuade, Leon R.; Gray, Peter H.; Deterding, Robin R.; Carroll, Travis R.; Kammesheidt, Anja; Kasch, Laura M.; Kulkarni, Shashikant; Cole, F. Sessions

    2009-01-01

    Objective To characterize inheritance of homozygous, rare, recessive loss-of-function mutations in the surfactant protein-B (SFTPB) or ATP binding cassette, subfamily A, member 3 (ABCA3) genes in newborns with lethal respiratory failure. Study design We resequenced parents whose infants were homozygous for mutations in SFTPB or ABCA3. For infants with only one heterozygous parent, we performed microsatellite analysis for chromosomes 2 (SFTPB) and 16 (ABCA3). Results We identified one infant homozygous for the c.1549C>GAA mutation (121ins2) in SFTPB for whom only the mother was heterozygous and 3 infants homozygous for mutations in ABCA3 (p.K914R, p.P147L, and c.806_7insGCT) for whom only the fathers were heterozygous. For the SP-B deficient infant, microsatellite markers confirmed maternal heterodisomy with segmental isodisomy. Microsatellite analysis confirmed paternal isodisomy for the three ABCA3 deficient infants. Two ABCA3 deficient infants underwent lung transplantation at 3 and 5 months of age, respectively, and two infants died. None exhibited any non-pulmonary phenotype. Conclusions Uniparental disomy should be suspected in infants with rare homozygous mutations in SFTPB or ABCA3. Confirmation of parental carrier status is important to provide recurrence risk and to monitor expression of other phenotypes that may emerge through reduction to homozygosity of recessive alleles. PMID:19647838

  18. Evaluation of a Brucella melitensis mutant deficient in O-polysaccharide export system ATP-binding protein as a rough vaccine candidate.

    PubMed

    Wang, Zhen; Niu, Jian Rui; Wang, Xiao Lei; Wu, Tong Lei; Cheng, Jie; Lu, Lin; Wu, Qing Min

    2014-08-01

    Rough Brucella mutants have been sought as vaccine candidates that do not interfere with the conventional serological diagnosis of brucellosis. In this study, a rough mutant of Brucella melitensis was generated by the disruption of the wzt gene, which encodes the O-polysaccharide (O-PS) export system ATP-binding protein. In vivo, the mutant 16MΔwzt was attenuated and conferred a level of protection against B. melitensis 16M challenge similar to that conferred by the vaccine strain B. melitensis M5 in mice. In pregnant sheep, the mutant 16MΔwzt did not induce abortion. In vitro, 16MΔwzt was more susceptible to polymyxin B and complement-mediated killing than B. melitensis 16M was. Most importantly, although 16MΔwzt had a rough phenotype, it was able to synthesize O-PS and did not induce detectable specific antibodies in sheep. These results suggested that 16MΔwzt deserved to further systematic evaluation as a vaccine for target animal hosts due to its promising features.

  19. Altered Profile of Secondary Metabolites in the Root Exudates of Arabidopsis ATP-Binding Cassette Transporter Mutants1[C][W][OA

    PubMed Central

    Badri, Dayakar V.; Loyola-Vargas, Victor M.; Broeckling, Corey D.; De-la-Peña, Clelia; Jasinski, Michal; Santelia, Diana; Martinoia, Enrico; Sumner, Lloyd W.; Banta, Lois M.; Stermitz, Frank; Vivanco, Jorge M.

    2008-01-01

    Following recent indirect evidence suggesting a role for ATP-binding cassette (ABC) transporters in root exudation of phytochemicals, we identified 25 ABC transporter genes highly expressed in the root cells most likely to be involved in secretion processes. Of these 25 genes, we also selected six full-length ABC transporters and a half-size transporter for in-depth molecular and biochemical analyses. We compared the exuded root phytochemical profiles of these seven ABC transporter mutants to those of the wild type. There were three nonpolar phytochemicals missing in various ABC transporter mutants compared to the wild type when the samples were analyzed by high-performance liquid chromatography-mass spectrometry. These data suggest that more than one ABC transporter can be involved in the secretion of a given phytochemical and that a transporter can be involved in the secretion of more than one secondary metabolite. The primary and secondary metabolites present in the root exudates of the mutants were also analyzed by gas chromatography-mass spectrometry, which allowed for the identification of groups of compounds differentially found in some of the mutants compared to the wild type. For instance, the mutant Atpdr6 secreted a lower level of organic acids and Atmrp2 secreted a higher level of amino acids as compared to the wild type. We conclude that the release of phytochemicals by roots is partially controlled by ABC transporters. PMID:18065561

  20. Endocytosis and vacuolar degradation of the plasma membrane-localized Pdr5 ATP-binding cassette multidrug transporter in Saccharomyces cerevisiae.

    PubMed Central

    Egner, R; Mahé, Y; Pandjaitan, R; Kuchler, K

    1995-01-01

    Multidrug resistance (MDR) to different cytotoxic compounds in the yeast Saccharomyces cerevisiae can arise from overexpression of the Pdr5 (Sts1, Ydr1, or Lem1) ATP-binding cassette (ABC) multidrug transporter. We have raised polyclonal antibodies recognizing the yeast Pdr5 ABC transporter to study its biogenesis and to analyze the molecular mechanisms underlying MDR development. Subcellular fractionation and indirect immunofluorescence experiments showed that Pdr5 is localized in the plasma membrane. In addition, pulse-chase radiolabeling of cells and immunoprecipitation indicated that Pdr5 is a short-lived membrane protein with a half-life of about 60 to 90 min. A dramatic metabolic stabilization of Pdr5 was observed in delta pep4 mutant cells defective in vacuolar proteinases, and indirect immunofluorescence showed that Pdr5 accumulates in vacuoles of stationary-phase delta pep4 mutant cells, demonstrating that Pdr5 turnover requires vacuolar proteolysis. However, Pdr5 turnover does not require a functional proteasome, since the half-life of Pdr5 was unaffected in either pre1-1 or pre1-1 pre2-1 mutants defective in the multicatalytic cytoplasmic proteasome that is essential for cytoplasmic protein degradation. Immunofluorescence analysis revealed that vacuolar delivery of Pdr5 is blocked in conditional end4 endocytosis mutants at the restrictive temperature, showing that endocytosis delivers Pdr5 from the plasma membrane to the vacuole. PMID:7565740

  1. The maltose ATP-binding cassette transporter in the 21st century--towards a structural dynamic perspective on its mode of action.

    PubMed

    Bordignon, Enrica; Grote, Mathias; Schneider, Erwin

    2010-09-01

    The maltose/maltodextrin transport system of Escherichia coli/Salmonella, composed of periplasmic maltose-binding protein, MalE, the pore-forming subunits MalF and MalG, and a homodimer of the nucleotide-binding subunit, MalK, serves as a model for canonical ATP-binding cassette importers in general. The wealth of knowledge accumulated on the maltose transporter in more than three decades by genetic, molecular genetic and biochemical means was complemented more recently by crystal structures of the isolated MalK dimer and of two conformational states of the full transporter. Here, we summarize insights into the transport mechanism provided by these structures and draw the reader's attention to experimental tools by which the dynamics of the transporter can be studied during substrate translocation. A transport model is presented that integrates currently available biochemical, biophysical and structural data. We also present the state of knowledge on regulatory functions of the maltose transporter associated with the C-terminal domain of MalK. Finally, we will address the application of coarse-grained modelling to visualize the progression of the conformational changes of an ABC transporter with special emphasis on the maltose system, which can provide a model platform for testing and validating the bioinformatic tools.

  2. Full engagement of liganded maltose-binding protein stabilizes a semi-open ATP-binding cassette dimer in the maltose transporter.

    PubMed

    Alvarez, Frances Joan D; Orelle, Cédric; Huang, Yan; Bajaj, Ruchika; Everly, R Michael; Klug, Candice S; Davidson, Amy L

    2015-12-01

    MalFGK2 is an ATP-binding cassette (ABC) transporter that mediates the uptake of maltose/maltodextrins into Escherichia coli. A periplasmic maltose-binding protein (MBP) delivers maltose to the transmembrane subunits (MalFG) and stimulates the ATPase activity of the cytoplasmic nucleotide-binding subunits (MalK dimer). This MBP-stimulated ATPase activity is independent of maltose for purified transporter in detergent micelles. However, when the transporter is reconstituted in membrane bilayers, only the liganded form of MBP efficiently stimulates its activity. To investigate the mechanism of maltose stimulation, electron paramagnetic resonance spectroscopy was used to study the interactions between the transporter and MBP in nanodiscs and in detergent. We found that full engagement of both lobes of maltose-bound MBP unto MalFGK2 is facilitated by nucleotides and stabilizes a semi-open MalK dimer. Maltose-bound MBP promotes the transition to the semi-open state of MalK when the transporter is in the membrane, whereas such regulation does not require maltose in detergent. We suggest that stabilization of the semi-open MalK2 conformation by maltose-bound MBP is key to the coupling of maltose transport to ATP hydrolysis in vivo, because it facilitates the progression of the MalK dimer from the open to the semi-open conformation, from which it can proceed to hydrolyze ATP.

  3. Cuticular Defects in Oryza sativa ATP-binding Cassette Transporter G31 Mutant Plants Cause Dwarfism, Elevated Defense Responses and Pathogen Resistance.

    PubMed

    Garroum, Imène; Bidzinski, Przemyslaw; Daraspe, Jean; Mucciolo, Antonio; Humbel, Bruno M; Morel, Jean-Benoit; Nawrath, Christiane

    2016-06-01

    The cuticle covers the surface of the polysaccharide cell wall of leaf epidermal cells and forms an essential diffusion barrier between plant and environment. Homologs of the ATP-binding cassette (ABC) transporter AtABCG32/HvABCG31 clade are necessary for the formation of a functional cuticle in both monocots and dicots. Here we characterize the osabcg31 knockout mutant and hairpin RNA interference (RNAi)-down-regulated OsABCG31 plant lines having reduced plant growth and a permeable cuticle. The reduced content of cutin in leaves and structural alterations in the cuticle and at the cuticle-cell wall interface in plants compromised in OsABCG31 expression explain the cuticle permeability. Effects of modifications of the cuticle on plant-microbe interactions were evaluated. The cuticular alterations in OsABCG31-compromised plants did not cause deficiencies in germination of the spores or the formation of appressoria of Magnaporthe oryzae on the leaf surface, but a strong reduction of infection structures inside the plant. Genes involved in pathogen resistance were constitutively up-regulated in OsABCG31-compromised plants, thus being a possible cause of the resistance to M. oryzae and the dwarf growth phenotype. The findings show that in rice an abnormal cuticle formation may affect the signaling of plant growth and defense.

  4. A member of the PLEIOTROPIC DRUG RESISTANCE family of ATP binding cassette transporters is required for the formation of a functional cuticle in Arabidopsis.

    PubMed

    Bessire, Michael; Borel, Sandra; Fabre, Guillaume; Carraça, Luis; Efremova, Nadia; Yephremov, Alexander; Cao, Yan; Jetter, Reinhard; Jacquat, Anne-Claude; Métraux, Jean-Pierre; Nawrath, Christiane

    2011-05-01

    Although the multilayered structure of the plant cuticle was discovered many years ago, the molecular basis of its formation and the functional relevance of the layers are not understood. Here, we present the permeable cuticle1 (pec1) mutant of Arabidopsis thaliana, which displays features associated with a highly permeable cuticle in several organs. In pec1 flowers, typical cutin monomers, such as ω-hydroxylated fatty acids and 10,16-dihydroxypalmitate, are reduced to 40% of wild-type levels and are accompanied by the appearance of lipidic inclusions within the epidermal cell. The cuticular layer of the cell wall, rather than the cuticle proper, is structurally altered in pec1 petals. Therefore, a significant role for the formation of the diffusion barrier in petals can be attributed to this layer. Thus, pec1 defines a new class of mutants. The phenotypes of the pec1 mutant are caused by the knockout of ATP BINDING CASSETTEG32 (ABCG32), an ABC transporter from the PLEIOTROPIC DRUG RESISTANCE family that is localized at the plasma membrane of epidermal cells in a polar manner toward the surface of the organs. Our results suggest that ABCG32 is involved in the formation of the cuticular layer of the cell wall, most likely by exporting particular cutin precursors from the epidermal cell.

  5. Identification of a gene linked to Rhizobium meliloti ntrA whose product is homologous to a family to ATP-binding proteins.

    PubMed Central

    Albright, L M; Ronson, C W; Nixon, B T; Ausubel, F M

    1989-01-01

    The ntrA gene of Rhizobium meliloti has recently been identified and shown to be required for a diverse set of metabolic functions (C. W. Ronson, B. T. Nixon, L. M. Albright, and F. M. Ausubel, J. Bacteriol. 169:2424-2431, 1987). As a result of sequencing the ntrA gene and its flanking regions from R. meliloti, we identified an open reading frame directly upstream of ntrA, ORF1, whose predicted product is homologous to a superfamily of ATP-binding proteins involved in transport, cell division, nodulation, and DNA repair. The homology of ORF1 to this superfamily and its proximity to ntrA led us to investigate its role in symbiosis by mutagenesis and expression studies. We were unable to isolate an insertion mutation in ORF1, suggesting that ORF1 may code for an essential function. We identified the start of transcription for the ntrA gene in vegetative cells and bacteroids and showed that ORF1 and ntrA are transcriptionally unlinked. ORF1 appears to be in an operon with one or more upstream genes. Images PMID:2703463

  6. Transgenic hybrid aspen overexpressing the Atwbc19 gene encoding an ATP-binding cassette transporter confers resistance to four aminoglycoside antibiotics.

    PubMed

    Kang, Byung-Guk; Ye, Xia; Osburn, Lori D; Stewart, C N; Cheng, Zong-Ming

    2010-06-01

    Antibiotic-resistance genes of bacterial origin are invaluable markers for plant genetic engineering. However, these genes are feared to pose possible risk to human health by horizontal gene transfer from transgenic plants to bacteria, potentially resulting in antibiotic-resistant pathogenic bacteria; this is a considerable regulatory concern in some countries. The Atwbc19 gene, encoding an Arabidopsis thaliana ATP-binding cassette transporter, has been reported to confer resistance to kanamycin specifically as an alternative to bacterial antibiotic-resistance genes. In this report, we transformed hybrid aspen (Populus canescens x P. grandidentata) with the Atwbc19 gene. Unlike Atwbc19-transgenic tobacco that was only resistant to kanamycin, the transgenic Populus plants also showed resistance to three other aminoglycoside antibiotics (neomycin, geneticin, and paromomycin) at comparable levels to plants containing a CaMV35S-nptII cassette. Although it is unknown why the transgenic Populus with the Atwbc19 gene is resistant to all aminoglycoside antibiotics tested, the broad utility of the Atwbc19 gene as a reporter gene is confirmed here in a second dicot species. Because the Atwbc19 gene is plant-ubiquitous, it might serve as an alternative selectable marker to current bacterial antibiotic-resistance marker genes and alleviate the potential risk for horizontal transfer of bacterial-resistance genes in transgenic plants.

  7. The Role of Arabidopsis ABCG9 and ABCG31 ATP Binding Cassette Transporters in Pollen Fitness and the Deposition of Steryl Glycosides on the Pollen Coat[W

    PubMed Central

    Choi, Hyunju; Ohyama, Kiyoshi; Kim, Yu-Young; Jin, Jun-Young; Lee, Saet Buyl; Yamaoka, Yasuyo; Muranaka, Toshiya; Suh, Mi Chung; Fujioka, Shozo; Lee, Youngsook

    2014-01-01

    The pollen coat protects pollen grains from harmful environmental stresses such as drought and cold. Many compounds in the pollen coat are synthesized in the tapetum. However, the pathway by which they are transferred to the pollen surface remains obscure. We found that two Arabidopsis thaliana ATP binding cassette transporters, ABCG9 and ABCG31, were highly expressed in the tapetum and are involved in pollen coat deposition. Upon exposure to dry air, many abcg9 abcg31 pollen grains shriveled up and collapsed, and this phenotype was restored by complementation with ABCG9pro:GFP:ABCG9. GFP-tagged ABCG9 or ABCG31 localized to the plasma membrane. Electron microscopy revealed that the mutant pollen coat resembled the immature coat of the wild type, which contained many electron-lucent structures. Steryl glycosides were reduced to about half of wild-type levels in the abcg9 abcg31 pollen, but no differences in free sterols or steryl esters were observed. A mutant deficient in steryl glycoside biosynthesis, ugt80A2 ugt80B1, exhibited a similar phenotype. Together, these results indicate that steryl glycosides are critical for pollen fitness, by supporting pollen coat maturation, and that ABCG9 and ABCG31 contribute to the accumulation of this sterol on the surface of pollen. PMID:24474628

  8. Effect of tacrolimus on activity and expression of P-glycoprotein and ATP-binding cassette transporter A5 (ABCA5) proteins in hematoencephalic barrier cells.

    PubMed

    Quezada, Claudia Andrea; Garrido, Wallys Ximena; González-Oyarzún, Mauricio Alejandro; Rauch, María Cecilia; Salas, Mónica Roxana; San Martín, Rody Enrique; Claude, Alejandro Andrés; Yañez, Alejandro Javier; Slebe, Juan Carlos; Cárcamo, Juan Guillermo

    2008-10-01

    Tacrolimus is an agent used in clinical immunosuppressive drug therapies. A wide spectrum of adverse effects has been reported in association with this immunosuppressor, including neurotoxic effect. The upper limit of therapeutic blood concentrations of tacrolimus has been described as 30 ng/ml in immunosuppressed patients. We investigated the effect of this therapeutic dose of tacrolimus on the expression and activity of the multidrug resistance protein 1 (MDR1 or Pgp, P-glycoprotein) and ATP-binding cassette transporters A5 (ABCA5) in human brain microvascular endothelial cells (HBMEC), derived from Blood-Brain Barrier (BBB) endothelium, these being the most predominantly expressed transcripts in these cells. The expression and activity of MDR1 transporter decreased with 30 ng/ml tacrolimus. The cell viability was not changed with the therapeutic dose used. By contrast, ABCA5 transcripts, of unknown role as yet, increased their expression at this concentration. We propose that the secondary cytotoxic effects of this immunosuppressor on CSN, besides the functional blockade related to multidrug resistance proteins, such as MDR1, and probably ABCA5, could be linked to variations in the expression levels of these proteins at the BBB.

  9. Limited variation during circulation of a polyomavirus in the human population involves the COCO-VA toggling site of Middle and Alternative T-antigen(s).

    PubMed

    Kazem, Siamaque; Lauber, Chris; van der Meijden, Els; Kooijman, Sander; Kravchenko, Alexander A; Feltkamp, Mariet C W; Gorbalenya, Alexander E

    2016-01-01

    We have recently shown that the trichodysplasia spinulosa-associated polyomavirus (TSPyV) belongs to a large monophyletic group of mammalian polyomaviruses that experienced accelerated codon-constrained Val-Ala (COCO-VA) toggling at a protein site common to both Middle and Alternative T-antigens (MT/ALTO). Here we analyzed thirteen, mostly newly sequenced TSPyV genomes, representing ~40% of reported TS disease cases world-wide. We found two deletions and 30 variable sites (≤0.6%) that included only four sites with non-synonymous substitutions (NSS). One NSS site was under positive selection in the exon shared by Small and Middle T antigens, while three others were segregated in MT/ALTO. Two MT/ALTO sites covaried with five sites elsewhere in the genome and determined separation of twelve TSPyVs into two most populous phylogenetic lineages. The other, most distant TSPyV was distinguished by NSS at the COCO-VA site, observed for the first time during intra-species evolution. Our findings reveal a connection between micro- and macro-evolution of polyomaviruses.

  10. Characterization of [35S]-ATP alpha S and [3H]-alpha, beta-MeATP binding sites in rat brain cortical synaptosomes: regulation of ligand binding by divalent cations.

    PubMed

    Schäfer, R; Reiser, G

    1997-07-01

    1. We made a comparative analysis of the binding characteristics of the radioligands [35S]-ATP alpha S and [3H]-alpha, beta-MeATP in order to test whether these ligands can be used to analyse P2-purinoceptors in synaptosomal membranes from rat brain cortex. 2. Synaptosomes possess sites with high affinity for [35S]-ATP alpha S (Kd = 22.2 +/- 9.1 nM, Bmax = 14.8 pmol mg-1 protein). The rank order of the competition potency of the different compounds (ATP alpha S, ATP, ATP gamma S > ADP beta S, 2-MeSATP > deoxyATP, ADP > > UTP, alpha, beta-MeATP, AMP, Reactive Blue-2, suramin, isoPPADS) is consistent with pharmacological properties of P2Y-purinoceptors. 3. Under identical conditions [35S]-ATP alpha S and [3H]-alpha, beta-MeATP bind to different binding sites at synaptosomal membranes from rat brain cortex. The affinity of the [3H]-alpha, beta-MeATP binding sites (Kd = 13.7 +/- 1.8 nM, Bmax = 6.34 +/- 0.28 pmol mg-1 protein) was 38 fold higher than the potency of alpha, beta-MeATP to displace [35S]-ATP alpha S binding (Ki = 0.52 microM). ATP and ADP beta S competed at both binding sites with different affinities, 60 fold and 175 fold, respectively. The other agonists tested (2-MeSATP, UTP, GTP) did not affect specific [35H]-alpha, beta-MeATP binding at concentrations up to 100 microM. The antagonists (suramin, isoPPADS, Evan's Blue) showed completely different affinities for both binding sites. 4. Binding of [35S]-ATP alpha S on synaptosomes was regulated by GTP, which is indicative for G-protein coupled receptors. The Kd value for the high affinity binding site was reduced in the presence of GTP about 5 fold (from 1.8 nM to 8.6 nM). In the presence of Mg2+ the affinity was increased (Kd 1.8 nM versus 22 nM in the absence of Mg2+). 5. The binding of both radioligands was regulated in an opposite manner by physiological concentrations of Ca2+ and Mg2+. Binding of [3H]-alpha, beta-MeATP to synaptosomal membranes was increased 3 fold by raising the Ca2+ concentration

  11. Functional and Structural Characterization of Polysaccharide Co-polymerase Proteins Required for Polymer Export in ATP-binding Cassette Transporter-dependent Capsule Biosynthesis Pathways*

    PubMed Central

    Larue, Kane; Ford, Robert C.; Willis, Lisa M.; Whitfield, Chris

    2011-01-01

    Neisseria meningitidis serogroup B and Escherichia coli K1 bacteria produce a capsular polysaccharide (CPS) that is composed of α2,8-linked polysialic acid (PSA). Biosynthesis of PSA in these bacteria occurs via an ABC (ATP-binding cassette) transporter-dependent pathway. In N. meningitidis, export of PSA to the surface of the bacterium requires two proteins that form an ABC transporter (CtrC and CtrD) and two additional proteins, CtrA and CtrB, that are proposed to form a cell envelope-spanning export complex. CtrA is a member of the outer membrane polysaccharide export (OPX) family of proteins, which are proposed to form a pore to mediate export of CPSs across the outer membrane. CtrB is an inner membrane protein belonging to the polysaccharide co-polymerase (PCP) family. PCP proteins involved in other bacterial polysaccharide assembly systems form structures that extend into the periplasm from the inner membrane. There is currently no structural information available for PCP or OPX proteins involved in an ABC transporter-dependent CPS biosynthesis pathway to support their proposed roles in polysaccharide export. Here, we report cryo-EM images of purified CtrB reconstituted into lipid bilayers. These images contained molecular top and side views of CtrB and showed that it formed a conical oligomer that extended ∼125 Å from the membrane. This structure is consistent with CtrB functioning as a component of an envelope-spanning complex. Cross-complementation of CtrA and CtrB in E. coli mutants with defects in genes encoding the corresponding PCP and OPX proteins show that PCP-OPX pairs require interactions with their cognate partners to export polysaccharide. These experiments add further support for the model of an ABC transporter-PCP-OPX multiprotein complex that functions to export CPS across the cell envelope. PMID:21454677

  12. The ATP-binding cassette transporter-2 (ABCA2) regulates cholesterol homeostasis and low-density lipoprotein receptor metabolism in N2a neuroblastoma cells.

    PubMed

    Davis, Warren

    2011-12-01

    The ATP-binding cassette transporter-2 (ABCA2) has been identified as a possible regulator of lipid metabolism. ABCA2 is most highly expressed in the brain but its effects on cholesterol homeostasis in neuronal-type cells have not been characterized. It is important to study the role of ABCA2 in regulating cholesterol homeostasis in neuronal-type cells because ABCA2 has been identified as a possible genetic risk factor for Alzheimer's disease. In this study, the effects of ABCA2 expression on cholesterol homeostasis were examined in mouse N2a neuroblastoma cells. ABCA2 reduced total, free- and esterified cholesterol levels as well as membrane cholesterol but did not perturb cholesterol distribution in organelle or lipid raft compartments. ABCA2 did not modulate de novo cholesterol biosynthesis from acetate. Cholesterol trafficking to the plasma membrane was not affected by ABCA2 but efflux to the physiological acceptor ApoE3 and mobilization of plasma membrane cholesterol to the endoplasmic reticulum for esterification were reduced by ABCA2. ABCA2 reduced esterification of serum and low-density lipoprotein-derived cholesterol but not 25-hydroxycholesterol. ABCA2 decreased low-density lipoprotein receptor (LDLR) mRNA and protein levels and increased its turnover rate. The surface expression of LDLR as well as the uptake of fluroresecent DiI-LDL was also reduced by ABCA2. Reduction of endogenous ABCA2 expression by RNAi treatment of N2a cells and rat primary cortical neurons produced the opposite effects of over-expression of ABCA2, increasing LDLR protein levels. This report identifies ABCA2 as a key regulator of cholesterol homeostasis and LDLR metabolism in neuronal cells.

  13. The Myxococcus xanthus rfbABC operon encodes an ATP-binding cassette transporter homolog required for O-antigen biosynthesis and multicellular development.

    PubMed Central

    Guo, D; Bowden, M G; Pershad, R; Kaplan, H B

    1996-01-01

    A wild-type sasA locus is critical for Myxococcus xanthus multicellular development. Mutations in the sasA locus cause defective fruiting body formation, reduce sporulation, and restore developmental expression of the early A-signal-dependent gene 4521 in the absence of A signal. The wild-type sasA locus has been located on a 14-kb cloned fragment of the M. xanthus chromosome. The nucleotide sequence of a 7-kb region containing the complete sasA locus was determined. Three open reading frames encoded by the genes, designated rfbA, B and C were identified. The deduced amino acid sequences of rfbA and rfbB show identity to the integral membrane domains and ATPase domains, respectively, of the ATP-binding cassette (ABC) transporter family. The highest identities are to a set of predicted ABC transporters required for the biosynthesis of lipopolysaccharide O-antigen in certain gram-negative bacteria. The rfbC gene encodes a predicted protein of 1,276 amino acids. This predicted protein contains a region of 358 amino acids that is 33.8% identical to the Yersinia enterocolitica O3 rfbH gene product, which is also required for O-antigen biosynthesis. Immunoblot analysis revealed that the sasA1 mutant, which was found to encode a nonsense codon in the beginning of rfbA, produced less O-antigen than sasA+ strains. These data indicate that the sasA locus is required for the biosynthesis of O-antigen and, when mutated, results in A-signal-independent expression of 4521. PMID:8626291

  14. A Mutation within the Extended X Loop Abolished Substrate-induced ATPase Activity of the Human Liver ATP-binding Cassette (ABC) Transporter MDR3*

    PubMed Central

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-01-01

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain. PMID:25533467

  15. A mutation within the extended X loop abolished substrate-induced ATPase activity of the human liver ATP-binding cassette (ABC) transporter MDR3.

    PubMed

    Kluth, Marianne; Stindt, Jan; Dröge, Carola; Linnemann, Doris; Kubitz, Ralf; Schmitt, Lutz

    2015-02-20

    The human multidrug resistance protein 3 (MDR3/ABCB4) belongs to the ubiquitous family of ATP-binding cassette (ABC) transporters and is located in the canalicular membrane of hepatocytes. There it flops the phospholipids of the phosphatidylcholine (PC) family from the inner to the outer leaflet. Here, we report the characterization of wild type MDR3 and the Q1174E mutant, which was identified previously in a patient with progressive familial intrahepatic cholestasis type 3 (PFIC-3). We expressed different variants of MDR3 in the yeast Pichia pastoris, purified the proteins via tandem affinity chromatography, and determined MDR3-specific ATPase activity in the presence or absence of phospholipids. The ATPase activity of wild type MDR3 was stimulated 2-fold by liver PC or 1,2-dioleoyl-sn-glycero-3-phosphatidylethanolamine lipids. Furthermore, the cross-linking of MDR3 with a thiol-reactive fluorophore blocked ATP hydrolysis and exhibited no PC stimulation. Similarly, phosphatidylethanolamine, phosphatidylserine, and sphingomyelin lipids did not induce an increase of wild type MDR3 ATPase activity. The phosphate analogues beryllium fluoride and aluminum fluoride led to complete inhibition of ATPase activity, whereas orthovanadate inhibited exclusively the PC-stimulated ATPase activity of MDR3. The Q1174E mutation is located in the nucleotide-binding domain in direct proximity of the leucine of the ABC signature motif and extended the X loop, which is found in ABC exporters. Our data on the Q1174E mutant demonstrated basal ATPase activity, but PC lipids were incapable of stimulating ATPase activity highlighting the role of the extended X loop in the cross-talk of the nucleotide-binding domain and the transmembrane domain.

  16. Polycyclic aromatic hydrocarbons (PAHs) mediate transcriptional activation of the ATP binding cassette transporter ABCB6 gene via the aryl hydrocarbon receptor (AhR).

    PubMed

    Chavan, Hemantkumar; Krishnamurthy, Partha

    2012-09-14

    Liver is endowed with a mechanism to induce hepatic cytochromes P450 (CYP450s) in response to therapeutic drugs and environmental contaminants, leading to increased detoxification and elimination of the xenobiotics. Each CYP450 is composed of an apoprotein moiety and a heme prosthetic group, which is required for CYP450 activity. Thus, under conditions of CYP450 induction, there is a coordinate increase in heme biosynthesis to compensate for the increased expression of CYP450s. ABCB6, a mitochondrial ATP binding cassette transporter, which regulates coproporphyrinogen transport from the cytoplasm into the mitochondria to complete heme biosynthesis, represents a previously unrecognized rate-limiting step in heme biosynthesis. However, it is not known if exposure to drugs and environmental contaminants induces ABCB6 expression, to assure an adequate and apparently coordinated supply of heme for the generation of functional cytochrome holoprotein. In the present study, we demonstrate that polycyclic aromatic hydrocarbons (PAHs), the widely distributed environmental toxicants shown to induce porphyrin accumulation causing hepatic porphyria, up-regulate ABCB6 expression in both mice and humans. Using siRNA technology and Abcb6 knock-out mice, we demonstrate that PAH-mediated increase in hepatic porphyrins is compromised in the absence of ABCB6. Moreover, in vivo studies in aryl hydrocarbon receptor (AhR) knock-out mice demonstrate that PAH induction of ABCB6 is mediated by AhR. Promoter activation studies combined with electrophoretic mobility shift assay and chromatin immunoprecipitation assay demonstrate direct interactions between the AhR binding sites in the ABCB6 promoter and the AhR receptor, implicating drug activation mechanisms for ABCB6 similar to those found in inducible cytochrome P450s. These studies are the first to describe direct transcriptional activation of both mouse and human ABCB6 by xenobiotics.

  17. Effects of silencing the ATP-binding cassette protein E1 gene by electroporation on the proliferation and migration of EC109 human esophageal cancer cells.

    PubMed

    Li, Xiao-Rui; Yang, Liu-Zhong; Huo, Xiao-Qing; Wang, Ying; Yang, Qing-Hui; Zhang, Qing-Qin

    2015-07-01

    In the present study, the gene expression of ATP-binding cassette protein E1 (ABCE1) in the EC109 human esophageal cancer cell line was silenced using electroporation to examine the effect if the ABCE1 gene on the growth migration and cell cycle of cancer cells. The small interference (si)RNA sequence of ABCE1 was designed and synthesized to transfect the EC109 cells by electroporation. The mRNA and protein expression levels of ABCE1 were then detected by reverse transcription quantitative polymerase chain reaction (RT-qPCR) and western blot analysis. The analysis of the cell cycle and apoptosis was performed using flow cytometry. The effect of silencing the ABCE1 gene on the proliferation, migration and invasive ability of the EC109 human esophageal cancer cells were assessed using a Cell counting kit-8 (CCK-8) and with proliferation, wound-healing and cell invasion assays. The mRNA and protein expression levels of ABCE1 were significantly lower in the experimental group compared with the control group (P<0.05). The apoptotic rate of the experimental group was markedly higher than the control group and blank group (P<0.01). The CCK-8 proliferation assay revealed that, compared with the control and blank groups, the proliferation of the EC109 cells in the experimental group was significantly inhibited (P<0.05). The wound healing assay revealed that the migration capacity of the cells in the experimental group was significantly decreased (P<0.05). The Transwell chamber assay demonstrated that the invasive ability of the EC109 cells in the experimental group was significantly decreased (P<0.01). These results revealed that ABCE1 is closely associated with cell proliferation, invasion and migration in esophageal cancer and silencing the ABCE1 gene by electroporation can significantly reduce the proliferation, invasion and migration capacity of EC109 cells in vitro.

  18. Immature human chorionic gonadotropin (hCG) in first trimester placental cells is bound to an ATP-binding protein forming high-molecular-weight hCG.

    PubMed

    Shimojo, M; Sakakibara, R; Ishiguro, M

    1993-07-01

    Human chorionic gonadotropin (hCG) in first trimester placental cells is made up of immature alpha- and beta-subunits containing only N-linked high-mannose sugar chains, which are of 21 kDa for the alpha-subunit and 23 and 19 kDa for the beta-subunit. However, the apparent molecular weight of immature hCG from placental cell extracts has been estimated from gel filtration to be much higher (100-200 kDa; high molecular weight-hCG, HMW-hCG) based on gel filtration than the theoretical value (approximately 44 kDa) of the alpha beta dimer (alpha beta-hCG). We prepared a gel-filtered fraction containing HMW-hCG and investigated treatments for converting it to alpha beta-hCG. We found that the molecular weight of HMW-hCG was decreased to close to that of alpha beta-hCG by treatment with acetone, proteases, or chelating agents. These treatments also shifted the isoelectric point of HMW-hCG from the acidic region (pI = 4-6) to the alkaline (pI = 9-11), approximating to that of alpha beta-hCG. We also found that HMW-hCG, but not acetone-treated HMW-hCG, bound to ATP-agarose resin. These results suggested that the immature alpha beta-hCG molecule in placental cells may be bound to an acidic ATP-binding protein to form HMW-hCG.

  19. ATP binding by the P-loop NTPase OsYchF1 (an unconventional G protein) contributes to biotic but not abiotic stress responses

    PubMed Central

    Cheung, Ming-Yan; Li, Xiaorong; Miao, Rui; Fong, Yu-Hang; Li, Kwan-Pok; Yung, Yuk-Lin; Yu, Mei-Hui; Wong, Kam-Bo; Lam, Hon-Ming

    2016-01-01

    G proteins are involved in almost all aspects of the cellular regulatory pathways through their ability to bind and hydrolyze GTP. The YchF subfamily, interestingly, possesses the unique ability to bind both ATP and GTP, and is possibly an ancestral form of G proteins based on phylogenetic studies and is present in all kingdoms of life. However, the biological significance of such a relaxed ligand specificity has long eluded researchers. Here, we have elucidated the different conformational changes caused by the binding of a YchF homolog in rice (OsYchF1) to ATP versus GTP by X-ray crystallography. Furthermore, by comparing the 3D relationships of the ligand position and the various amino acid residues at the binding sites in the crystal structures of the apo-bound and ligand-bound versions, a mechanism for the protein’s ability to bind both ligands is revealed. Mutation of the noncanonical G4 motif of the OsYchF1 to the canonical sequence for GTP specificity precludes the binding/hydrolysis of ATP and prevents OsYchF1 from functioning as a negative regulator of plant-defense responses, while retaining its ability to bind/hydrolyze GTP and its function as a negative regulator of abiotic stress responses, demonstrating the specific role of ATP-binding/hydrolysis in disease resistance. This discovery will have a significant impact on our understanding of the structure–function relationships of the YchF subfamily of G proteins in all kingdoms of life. PMID:26912459

  20. Association of ATP-Binding Cassette Transporter A1 (ABCA1)-565 C/T Gene Polymorphism with Hypoalphalipoproteinemia and Serum Lipids, IL-6 and CRP Levels

    PubMed Central

    Babashamsi, Mohammad Mahdi; Halalkhor, Sohrab; Moradi Firouzjah, Hamid; Parsian, Hadi; Jalali, Seyed Farzad; Babashamsi, Mohammad

    2017-01-01

    Background: ATP-binding cassette transporter A1 (ABCA1) is a membrane integral protein which plays a vital role in High Density Lipoprotein (HDL) metabolism and exerts a protective effect against Hypoalphalipoproteinemia (HA) by mediation of rate-limiting step in HDL biogenesis. In addition, this protein possesses anti-inflammatory effects by inhibiting the production of some inflammatory cytokines in macrophages. This study investigated the association of ABCA1-565 C/T gene polymorphism with HA and serum lipids, IL-6 and CRP levels. Methods: A population which consisted of 101 HA and 95 normal subjects were genotyped for ABCA1-565C/T polymorphism by Polymerase Chain Reaction-Restriction Fragment Length Polymorphism (PCR-RFLP). The serum concentrations of lipids, IL-6 and high sensitive-CRP (hs-CRP) were measured by the relevant methods. Results: The frequency of T allele was significantly higher in the HA group than the controls (31.7 vs. 19.5%, p=0.002). Thus, carriers of the T allele (CT and TT genotypes) had a higher risk for HA (p=0.016, OR=2.04, 95% CI=1.14–3.63). T allele carriers demonstrated decreased HDL-C and increased triglyceride, IL-6 and CRP levels than those with the CC genotype. Conclusion: This study suggests that the-565 C/T polymorphism of ABCA1 gene is associated with an increased risk of HA, decreased HDL-C and increased TG, IL-6 and CRP. PMID:28090279

  1. Human Immunodeficiency Virus Protease Inhibitors Interact with ATP Binding Cassette Transporter 4/Multidrug Resistance Protein 4: A Basis for Unanticipated Enhanced Cytotoxicity

    PubMed Central

    Fukuda, Yu; Takenaka, Kazumasa; Sparreboom, Alex; Cheepala, Satish B.; Wu, Chung-Pu; Ekins, Sean; Ambudkar, Suresh V.

    2013-01-01

    Human immunodeficiency virus (HIV) pharmacotherapy, by combining different drug classes such as nucleoside analogs and HIV protease inhibitors (PIs), has increased HIV-patient life expectancy. Consequently, among these patients, an increase in non-HIV–associated cancers has produced a patient cohort requiring both HIV and cancer chemotherapy. We hypothesized that multidrug resistance protein 4/ATP binding cassette transporter 4 (MRP4/ABCC4), a widely expressed transporter of nucleoside-based antiviral medications as well as cancer therapeutics might interact with PIs. Among the PIs evaluated (nelfinavir, ritonavir, amprenavir, saquinavir, and indinavir), only nelfinavir both effectively stimulated MRP4 ATPase activity and inhibited substrate-stimulated ATPase activity. Saos2 and human embryonic kidney 293 cells engineered to overexpress MRP4 were then used to assess transport and cytotoxicity. MRP4 expression reduced intracellular accumulation of nelfinavir and consequently conferred survival advantage to nelfinavir cytotoxicity. Nelfinavir blocked Mrp4-mediated export, which is consistent with its ability to increase the sensitivity of MRP4-expressing cells to methotrexate. In contrast, targeted inactivation of Abcc4/Mrp4 in mouse cells specifically enhanced nelfinavir and 9-(2-phosphonylmethoxyethyl) adenine cytotoxicity. These results suggest that nelfinavir is both an inhibitor and substrate of MRP4. Because nelfinavir is a new MRP4/ABCC4 substrate, we developed a MRP4/ABCC4 pharmacophore model, which showed that the nelfinavir binding site is shared with chemotherapeutic substrates such as adefovir and methotrexate. Our studies reveal, for the first time, that nelfinavir, a potent and cytotoxic PI, is both a substrate and inhibitor of MRP4. These findings suggest that HIV-infected cancer patients receiving nelfinavir might experience both enhanced antitumor efficacy and unexpected adverse toxicity given the role of MRP4/ABCC4 in exporting nucleoside

  2. Functional interplay between the ATP binding cassette Msr(D) protein and the membrane facilitator superfamily Mef(E) transporter for macrolide resistance in Escherichia coli.

    PubMed

    Nunez-Samudio, Virginia; Chesneau, Olivier

    2013-04-01

    Macrolides have wide clinical applications in the treatment of community-acquired respiratory tract infections, among which streptococci are the most frequent causative agents. An active efflux-based mechanism of macrolide resistance, referred to as the M phenotype in streptococcal isolates, has been associated with the presence of mef genes that encode a subset of major facilitator superfamily (MFS) transporters like Mef(E). An msr(D) gene, adjacent to and co-transcribed with mef in the presence of erythromycin, has also been implicated in drug efflux, but its role remains elusive. Msr(D) belongs to the ATP binding cassette (ABC) proteins and harbors two fused nucleotide-binding domains with no membrane-spanning domains. The present work indicates that the major resistance traits of the M phenotype in Escherichia coli may be due to Msr(D) and not to Mef(E). Fluorescence microscopy using Mef(E) tagged with GFP linked low efficacy of the chimera in conferring macrolide resistance with improper subcellular localization. The active role of Msr(D) in directing Mef(E)-GFP to the cell poles was demonstrated, as was synergistic effect in terms of levels of resistance when both proteins were expressed. A trans-dominant negative mutation within ABC Msr(D) affecting MFS Mef(E) strongly suggests that both proteins can interact in vivo, and such a physical interaction was supported in vitro. This is the first reported example of a functional interplay between an ABC component and an MFS transporter. The direct involvement of Msr(D) in the efflux of macrolides remains to be demonstrated.

  3. Bacteriophage-mediated Glucosylation Can Modify Lipopolysaccharide O-Antigens Synthesized by an ATP-binding Cassette (ABC) Transporter-dependent Assembly Mechanism.

    PubMed

    Mann, Evan; Ovchinnikova, Olga G; King, Jerry D; Whitfield, Chris

    2015-10-16

    Lysogenic bacteriophages may encode enzymes that modify the structures of lipopolysaccharide O-antigen glycans, altering the structure of the bacteriophage receptor and resulting in serotype conversion. This can enhance virulence and has implications for antigenic diversity and vaccine development. Side chain glucosylation is a common modification strategy found in a number of bacterial species. To date, glucosylation has only been observed in O-antigens synthesized by Wzy-dependent pathways, one of the two most prevalent O-antigen synthesis systems. Here we exploited a heterologous system to study the glucosylation potential of a model O-antigen produced in an ATP-binding cassette (ABC) transporter-dependent system. Although O-antigen production is cryptic in Escherichia coli K-12, because of a mutation in the synthesis genes, it possesses a prophage glucosylation cluster, which modifies the GlcNAc residue in an α-l-Rha-(1→3)-d-GlcNAc motif found in the original O16 antigen. Raoultella terrigena ATCC 33257 produces an O-antigen possessing the same disaccharide motif, but its assembly uses an ABC transporter-dependent system. E. coli harboring the R. terrigena O-antigen biosynthesis genes produced an O-antigen displaying reduced reactivity toward antisera raised against the native R. terrigena repeat structure, indicative of an altered chemical structure. Structural determination using NMR revealed the addition of glucose side chains to the repeat units. O-antigen modification was dependent on a functional ABC transporter, consistent with modification in the periplasm, and was eliminated by deletion of the glucosylation genes from the E. coli chromosome, restoring native level antisera sensitivity and structure. There are therefore no intrinsic mechanistic barriers for bacteriophage-mediated O-antigen glucosylation in ABC transporter-dependent pathways.

  4. Seminal Plasma Characteristics and Expression of ATP-binding Cassette Transporter A1 (ABCA1) in Canine Spermatozoa from Ejaculates with Good and Bad Freezability.

    PubMed

    Schäfer-Somi, S; Palme, N

    2016-04-01

    The composition of seminal plasma and the localization of the ATP-binding cassette transporter A1 (ABCA1) in spermatozoa from good and bad freezers were compared to frozen-thawed spermatozoa from the same dog. Ejaculates were obtained from 31 stud dogs, and the sperm-rich fraction (SRF) was kept for analysis. One aliquot was used for the analysis of concentration, progressive motility (P; CASA), viability (V; CASA) and leucocyte count, and the analysis was performed by flow cytometry (FITC-PNA/PI), SCSA and HOST. In seminal plasma, concentration of albumin, cholesterol, calcium, inorganic phosphate, sodium, potassium, zinc and copper was measured. Semen smears were prepared and evaluated for the expression of ABCA1. The remainder of each ejaculate was frozen. After thawing, the quality assessment was repeated and further smears were prepared. According to post-thaw semen quality, dogs were assigned to good freezers (n = 20) or bad freezers (n = 11), the latter were defined as < 50% progressive motility and/or > 40% morphologically abnormal sperm and/or < 50% viability. Bad freezers were older than good freezers (5.3 vs 3.4 years, p < 0.05). In bad freezers, the percentage of sperm with ABCA1 signal in the acrosome was lower (26.3% vs 35.7%, p < 0.01) and the percentage of sperm with complete loss of ABCA1 signal higher (46.7% vs 30%, p < 0.01); the percentage of dead spermatozoa was higher (36.1% vs 25.5%, p < 0.05), and the concentration of cholesterol and sodium in seminal plasma was lower than in good freezers (p < 0.05). We conclude that in thawed bad freezer sperm, an increase in acrosome damages coincided with an increased loss of cholesterol transporters and cell death, and a lower cholesterol concentration in seminal plasma. Follow-up studies revealed whether a relation exists between these findings.

  5. ATP-binding Cassette (ABC) Transport System Solute-binding Protein-guided Identification of Novel d-Altritol and Galactitol Catabolic Pathways in Agrobacterium tumefaciens C58*

    PubMed Central

    Wichelecki, Daniel J.; Vetting, Matthew W.; Chou, Liyushang; Al-Obaidi, Nawar; Bouvier, Jason T.; Almo, Steven C.; Gerlt, John A.

    2015-01-01

    Innovations in the discovery of the functions of uncharacterized proteins/enzymes have become increasingly important as advances in sequencing technology flood protein databases with an exponentially growing number of open reading frames. This study documents one such innovation developed by the Enzyme Function Initiative (EFI; U54GM093342), the use of solute-binding proteins for transport systems to identify novel metabolic pathways. In a previous study, this strategy was applied to the tripartite ATP-independent periplasmic transporters. Here, we apply this strategy to the ATP-binding cassette transporters and report the discovery of novel catabolic pathways for d-altritol and galactitol in Agrobacterium tumefaciens C58. These efforts resulted in the description of three novel enzymatic reactions as follows: 1) oxidation of d-altritol to d-tagatose via a dehydrogenase in Pfam family PF00107, a previously unknown reaction; 2) phosphorylation of d-tagatose to d-tagatose 6-phosphate via a kinase in Pfam family PF00294, a previously orphan EC number; and 3) epimerization of d-tagatose 6-phosphate C-4 to d-fructose 6-phosphate via a member of Pfam family PF08013, another previously unknown reaction. The epimerization reaction catalyzed by a member of PF08013 is especially noteworthy, because the functions of members of PF08013 have been unknown. These discoveries were assisted by the following two synergistic bioinformatics web tools made available by the Enzyme Function Initiative: the EFI-Enzyme Similarity Tool and the EFI-Genome Neighborhood Tool. PMID:26472925

  6. Drug interaction between sunitinib and cimetidine and contribution of the efflux transporter ATP-binding cassette C2 to biliary excretion of sunitinib in rats.

    PubMed

    Arakawa-Todo, Maki; Ueyama, Jun; Nomura, Hiroshi; Abe, Fumie; Tsukiyama, Ikuto; Matsuura, Katsuhiko; Hasegawa, Takaaki

    2013-08-01

    The present study investigated the effect of the H2 antagonist cimetidine on the pharmacokinetics of a multi-targeted receptor tyrosine kinase (RTK) inhibitor, sunitinib, in Sprague-Dawley (SD) rats and Eisai hyperbilirubinemic mutant rats (EHBR) lacking the efflux transporter, ATP-binding cassette C2 protein (ABCC2). Rats received an intraperitoneal injection of cimetidine (10 mg/kg) once a day for three days. On day 4, sunitinib (3 mg/kg) was administered intravenously 30 min after the final injection of cimetidine or saline to SD rats. Disappearance of sunitinib from plasma was significantly delayed by cimetidine. The pharmacokinetic parameter of sunitinib, systemic clearance (CLSYS), was significantly reduced and the half-life was significantly prolonged, with no change in the volume of distribution at steady-state (VSS). When the effect of cimetidine on the biliary excretion of sunitinib at steady-state condition was investigated in SD rats, cimetidine had no effect on some transporter-mediated biliary excretion of sunitinib. Furthermore, the contribution of ABCC2 to the biliary excretion of sunitinib was also examined in SD rats and EHBR. The biliary clearance of sunitinib was significantly lower in EHBR, but the biliary excretion rate of EHBR was not different from that of SD rats, and the contribution of biliary excretion to systemic elimination was small, suggesting that sunitinib is mainly eliminated by cytochrome P450 3A4 (CYP3A4)-mediated metabolism and is not excreted into the bile via ABCC2. These findings indicate that co-administration of cimetidine alters the pharmacokinetics of sunitinib probably due to inhibition of CYP3A4, suggesting the possibility that cimetidine should be used carefully for patients with cancer being treated with sunitinib therapy.

  7. Vacuolar Transport of Abscisic Acid Glucosyl Ester Is Mediated by ATP-Binding Cassette and Proton-Antiport Mechanisms in Arabidopsis1[W][OPEN

    PubMed Central

    Burla, Bo; Pfrunder, Stefanie; Nagy, Réka; Francisco, Rita Maria; Lee, Youngsook; Martinoia, Enrico

    2013-01-01

    Abscisic acid (ABA) is a key plant hormone involved in diverse physiological and developmental processes, including abiotic stress responses and the regulation of stomatal aperture and seed germination. Abscisic acid glucosyl ester (ABA-GE) is a hydrolyzable ABA conjugate that accumulates in the vacuole and presumably also in the endoplasmic reticulum. Deconjugation of ABA-GE by the endoplasmic reticulum and vacuolar β-glucosidases allows the rapid formation of free ABA in response to abiotic stress conditions such as dehydration and salt stress. ABA-GE further contributes to the maintenance of ABA homeostasis, as it is the major ABA catabolite exported from the cytosol. In this work, we identified that the import of ABA-GE into vacuoles isolated from Arabidopsis (Arabidopsis thaliana) mesophyll cells is mediated by two distinct membrane transport mechanisms: proton gradient-driven and ATP-binding cassette (ABC) transporters. Both systems have similar Km values of approximately 1 mm. According to our estimations, this low affinity appears nevertheless to be sufficient for the continuous vacuolar sequestration of ABA-GE produced in the cytosol. We further demonstrate that two tested multispecific vacuolar ABCC-type ABC transporters from Arabidopsis exhibit ABA-GE transport activity when expressed in yeast (Saccharomyces cerevisiae), which also supports the involvement of ABC transporters in ABA-GE uptake. Our findings suggest that the vacuolar ABA-GE uptake is not mediated by specific, but rather by several, possibly multispecific, transporters that are involved in the general vacuolar sequestration of conjugated metabolites. PMID:24028845

  8. Drug resistance is conferred on the model yeast Saccharomyces cerevisiae by expression of full-length melanoma-associated human ATP-binding cassette transporter ABCB5.

    PubMed

    Keniya, Mikhail V; Holmes, Ann R; Niimi, Masakazu; Lamping, Erwin; Gillet, Jean-Pierre; Gottesman, Michael M; Cannon, Richard D

    2014-10-06

    ABCB5, an ATP-binding cassette (ABC) transporter, is highly expressed in melanoma cells, and may contribute to the extreme resistance of melanomas to chemotherapy by efflux of anti-cancer drugs. Our goal was to determine whether we could functionally express human ABCB5 in the model yeast Saccharomyces cerevisiae, in order to demonstrate an efflux function for ABCB5 in the absence of background pump activity from other human transporters. Heterologous expression would also facilitate drug discovery for this important target. DNAs encoding ABCB5 sequences were cloned into the chromosomal PDR5 locus of a S. cerevisiae strain in which seven endogenous ABC transporters have been deleted. Protein expression in the yeast cells was monitored by immunodetection using both a specific anti-ABCB5 antibody and a cross-reactive anti-ABCB1 antibody. ABCB5 function in recombinant yeast cells was measured by determining whether the cells possessed increased resistance to known pump substrates, compared to the host yeast strain, in assays of yeast growth. Three ABCB5 constructs were made in yeast. One was derived from the ABCB5-β mRNA, which is highly expressed in human tissues but is a truncation of a canonical full-size ABC transporter. Two constructs contained full-length ABCB5 sequences: either a native sequence from cDNA or a synthetic sequence codon-harmonized for S. cerevisiae. Expression of all three constructs in yeast was confirmed by immunodetection. Expression of the codon-harmonized full-length ABCB5 DNA conferred increased resistance, relative to the host yeast strain, to the putative substrates rhodamine 123, daunorubicin, tetramethylrhodamine, FK506, or clorgyline. We conclude that full-length ABCB5 can be functionally expressed in S. cerevisiae and confers drug resistance.

  9. Effect of ATP-binding Cassette Transporter A1 (ABCA1) Gene Polymorphisms on Plasma Lipid Variables and Common Demographic Parameters in Greek Nurses

    PubMed Central

    Kolovou, Vana; Marvaki, Apostolia; Boutsikou, Maria; Vasilopoulos, Georgios; Degiannis, Dimitrios; Marvaki, Christina; Kolovou, Genovefa

    2016-01-01

    Objective: The present study is on line with our previous studies evaluating the influence of ATP-binding cassette transporter A1 (ABCA1) gene polymorphisms on the lipid variables of Greek student-nurses. The current study was undertaken to (1) estimate the influence of variant(s) such as rs2066715 (V825I), R219K, R1587K, I883M of ABCA1 gene on lipid variables and (2) evaluate the effect of all four ABCA1 polymorphisms on common demographic parameters. Methods: The study population involved 432 unrelated nurses (86 men) who were genotyped for ABCA1 polymorphisms and correlated according to lipid variables [total cholesterol (TC), triglycerides (TGs), high density lipoprotein cholesterol (HDL-C), low density lipoprotein cholesterol (LDL-C) and apolipoprotein (apo) A] and demographic parameters (age, gender, BMI, waist circumference). Results: According to lipid variables concentration there was no difference between genotypes and alleles of V825I, R219K and I883M polymorphisms. The LDL-C concentration was 13% lower in RR compared with RK genotype (100.7 vs. 113.9 mg/dl, p=0.013) of R1587K gene polymorphism. In regression analysis the effects of age, gender and only R1587K gene polymorphism on LDL-C concentrations were proved significant. Additionally, LDL-C was increased (by 1.29 mg/dl on average) by every year of increase of age. Moreover, females had lower LDL-C concentrations as compared with males. Conclusion: Findings suggested that only R1587K polymorphism of ABCA1 gene was associated with lipid variables, age, and gender of Greek nurses. These findings may be helpful in assessing the risk factors for premature coronary heart disease and distinct individuals with lower/higher atherosclerotic burden. PMID:27990182

  10. Polycyclic Aromatic Hydrocarbons—Induced ROS Accumulation Enhances Mutagenic Potential of T-Antigen From Human Polyomavirus JC

    PubMed Central

    WILK, ANNA; RSKI, PIOTR WALIGÓ; LASSAK, ADAM; VASHISTHA, HIMANSHU; LIRETTE, DAVID; TATE, DAVID; ZEA, ARNOLD H.; KOOCHEKPOUR, SHAHRIAR; RODRIGUEZ, PAULO; MEGGS, LEONARD G.; ESTRADA, JOHN J.; OCHOA, AUGUSTO; REISS, KRZYSZTOF

    2014-01-01

    Polycyclic aromatic hydrocarbons (PAHs) are the products of incomplete combustion of organic materials, which are present in cigarette smoke, deep-fried food, and in natural crude oil. Since PAH-metabolites form DNA adducts and cause oxidative DNA damage, we asked if these environmental carcinogens could affect transforming potential of the human Polyomavirus JC oncoprotein, T-antigen (JCV T-antigen). We extracted DMSO soluble PAHs from Deepwater Horizon oil spill in the Gulf of Mexico (oil-PAHs), and detected several carcinogenic PAHs. The oil-PAHs were tested in exponentially growing cultures of normal mouse fibroblasts (R508), and in R508 stably expressing JCV T-antigen (R508/T). The oil-PAHs were cytotoxic only at relatively high doses (1:50–1:100 dilution), and at 1:500 dilution the growth and cell survival rates were practically unaffected. This non-toxic dose triggered however, a significant accumulation of reactive oxygen species (ROS), caused oxidative DNA damage and the formation of DNA double strand breaks (DSBs). Although oil-PAHs induced similar levels of DNA damage in R508 and R508/T cells, only T-antigen expressing cells demonstrated inhibition of high fidelity DNA repair by homologous recombination (HRR). In contrast, low-fidelity repair by non-homologous end joining (NHEJ) was unaffected. This potential mutagenic shift between DNA repair mechanisms was accompanied by a significant increase in clonal growth of R508/T cells chronically exposed to low doses of the oil-PAHs. Our results indicate for the first time carcinogenic synergy in which oil-PAHs trigger oxidative DNA damage and JCV T-antigen compromises DNA repair fidelity. PMID:23558788

  11. Polycyclic aromatic hydrocarbons-induced ROS accumulation enhances mutagenic potential of T-antigen from human polyomavirus JC.

    PubMed

    Wilk, Anna; Waligórski, Piotr; Lassak, Adam; Vashistha, Himanshu; Lirette, David; Tate, David; Zea, Arnold H; Koochekpour, Shahriar; Rodriguez, Paulo; Meggs, Leonard G; Estrada, John J; Ochoa, Augusto; Reiss, Krzysztof

    2013-11-01

    Polycyclic aromatic hydrocarbons (PAHs) are the products of incomplete combustion of organic materials, which are present in cigarette smoke, deep-fried food, and in natural crude oil. Since PAH-metabolites form DNA adducts and cause oxidative DNA damage, we asked if these environmental carcinogens could affect transforming potential of the human Polyomavirus JC oncoprotein, T-antigen (JCV T-antigen). We extracted DMSO soluble PAHs from Deepwater Horizon oil spill in the Gulf of Mexico (oil-PAHs), and detected several carcinogenic PAHs. The oil-PAHs were tested in exponentially growing cultures of normal mouse fibroblasts (R508), and in R508 stably expressing JCV T-antigen (R508/T). The oil-PAHs were cytotoxic only at relatively high doses (1:50-1:100 dilution), and at 1:500 dilution the growth and cell survival rates were practically unaffected. This non-toxic dose triggered however, a significant accumulation of reactive oxygen species (ROS), caused oxidative DNA damage and the formation of DNA double strand breaks (DSBs). Although oil-PAHs induced similar levels of DNA damage in R508 and R508/T cells, only T-antigen expressing cells demonstrated inhibition of high fidelity DNA repair by homologous recombination (HRR). In contrast, low-fidelity repair by non-homologous end joining (NHEJ) was unaffected. This potential mutagenic shift between DNA repair mechanisms was accompanied by a significant increase in clonal growth of R508/T cells chronically exposed to low doses of the oil-PAHs. Our results indicate for the first time carcinogenic synergy in which oil-PAHs trigger oxidative DNA damage and JCV T-antigen compromises DNA repair fidelity.

  12. Solution structure of the 45-residue MgATP-binding peptide of adenylate kinase as examined by 2-D NMR, FTIR, and CD spectroscopy.

    PubMed

    Fry, D C; Byler, D M; Susi, H; Brown, E M; Kuby, S A; Mildvan, A S

    1988-05-17

    The structure of a synthetic peptide corresponding to residues 1-45 of rabbit muscle adenylate kinase has been studied in aqueous solution by two-dimensional NMR, FTIR, and CD spectroscopy. This peptide, which binds MgATP and is believed to represent most of the MgATP-binding site of the enzyme [Fry, D.C., Kuby, S.A., & Mildvan, A.S. (1985) Biochemistry 24, 4680-4694], appears to maintain a conformation similar to that of residues 1-45 in the X-ray structure of intact porcine adenylate kinase [Sachsenheimer, W., & Schulz, G.E. (1977) J. Mol. Biol. 114, 23-26], with 42% of the residues of the peptide showing NOEs indicative of phi and psi angles corresponding to those found in the protein. The NMR studies suggest that the peptide is composed of two helical regions of residues 4-7 and 23-29, and three stretches of beta-strand at residues 8-15, 30-32, and 35-40, yielding an overall secondary structure consisting of 24% alpha-helix, 38% beta-structure, and 38% aperiodic. Although the resolution-enhanced amide I band of the peptide FTIR spectrum is broad and rather featureless, possibly due to disorder, it can be fit by using methods developed on well-characterized globular proteins. On this basis, the peptide consists of 35 +/- 10% beta-structure, 60 +/- 12% turns and aperiodic structure, and not more than 10% alpha-helix. The CD spectrum is best fit by assuming the presence of at most 13% alpha-helix in the peptide, 24 +/- 2% beta-structure, and 66 +/- 4% aperiodic. The inability of the high-frequency FTIR and CD methods to detect helices in the amount found by NMR may result from the short helical lengths as well as from static and dynamic disorder in the peptide. Upon binding of MgATP, numerous conformational changes in the backbone of the peptide are detected by NMR, with smaller alterations in the overall secondary structure as assessed by CD. Detailed assignments of resonances in the peptide spectrum and intermolecular NOEs between protons of bound MgATP and

  13. Mycophenolic acid induces ATP-binding cassette transporter A1 (ABCA1) expression through the PPAR{gamma}-LXR{alpha}-ABCA1 pathway

    SciTech Connect

    Xu, Yanni; Lai, Fangfang; Xu, Yang; Wu, Yexiang; Liu, Qi; Li, Ni; Wei, Yuzhen; Feng, Tingting; Zheng, Zhihui; Jiang, Wei; Yu, Liyan; Hong, Bin; Si, Shuyi

    2011-11-04

    Highlights: Black-Right-Pointing-Pointer Using an ABCA1p-LUC HepG2 cell line, we found that MPA upregulated ABCA1 expression. Black-Right-Pointing-Pointer MPA induced ABCA1 and LXR{alpha} protein expression in HepG2 cells. Black-Right-Pointing-Pointer PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. Black-Right-Pointing-Pointer The effect of MPA upregulating ABCA1 was due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 pathway. -- Abstract: ATP-binding cassette transporter A1 (ABCA1) promotes cholesterol and phospholipid efflux from cells to lipid-poor apolipoprotein A-I and plays an important role in atherosclerosis. In a previous study, we developed a high-throughput screening method using an ABCA1p-LUC HepG2 cell line to find upregulators of ABCA1. Using this method in the present study, we found that mycophenolic acid (MPA) upregulated ABCA1 expression (EC50 = 0.09 {mu}M). MPA upregulation of ABCA1 expression was confirmed by real-time quantitative reverse transcription-PCR and Western blot analysis in HepG2 cells. Previous work has indicated that MPA is a potent agonist of peroxisome proliferator-activated receptor gamma (PPAR{gamma}; EC50 = 5.2-9.3 {mu}M). Liver X receptor {alpha} (LXR{alpha}) is a target gene of PPAR{gamma} and may directly regulate ABCA1 expression. Western blot analysis showed that MPA induced LXR{alpha} protein expression in HepG2 cells. Addition of PPAR{gamma} antagonist GW9662 markedly inhibited MPA-induced ABCA1 and LXR{alpha} protein expression. These data suggest that MPA increased ABCA1 expression mainly through activation of PPAR{gamma}. Thus, the effects of MPA on upregulation of ABCA1 expression were due mainly to activation of the PPAR{gamma}-LXR{alpha}-ABCA1 signaling pathway. This is the first report that the antiatherosclerosis activity of MPA is due to this mechanism.

  14. Polyomavirus middle-T antigen associates with the kinase domain of Src-related tyrosine kinases.

    PubMed Central

    Dunant, N M; Senften, M; Ballmer-Hofer, K

    1996-01-01

    Middle-T antigen of mouse polyomavirus, an oncogenic DNA virus, associates with and activates the cellular tyrosine kinases c-Src, c-Yes, and Fyn. This interaction is essential for polyomavirus-mediated transformation of cells in culture and tumor formation in animals. To determine the domain of c-Src directing association with middle-T, mutant c-Src proteins lacking the amino-terminal unique domain and the myristylation signal, the SH2 domain, the SH3 domain, or all three of these domains were coexpressed with middle-T in NIH 3T3 cells. All mutants were found to associate with middle-T, demonstrating that the kinase domain of c-Src, including the carboxy-terminal regulatory tail, is sufficient for association with middle-T. Moreover, we found that Hck, another member of the Src kinase family, does not bind middle-T, while chimeric kinases consisting of the amino-terminal domains of c-Src fused to the kinase domain of Hck or the amino-terminal domains of Hck fused to the kinase domain of c-Src associated with middle-T. Hck mutated at its carboxy-terminal regulatory residue, tyrosine 501, was also found to associate with middle-T. These results suggest that in Hck, the postulated intramolecular interaction between the carboxy-terminal regulatory tyrosine and the SH2 domain prevents association with middle-T. This intramolecular interaction apparently also limits the ability of c-Src to associate with middle-T, since removal of the SH2 or SH3 domain increases the efficiency with which middle-T binds c-Src. PMID:8627648

  15. c-myc protein can be substituted for SV40 T antigen in SV40 DNA replication.

    PubMed Central

    Iguchi-Ariga, S M; Itani, T; Yamaguchi, M; Ariga, H

    1987-01-01

    Replicating activity of SV40 origin-containing plasmid was tested in human cells as well as in monkey CosI cells. All the plasmids possessing SV40 ori sequences could replicate, even in the absence of SV40 T antigen, in human HL-60 and Raji cells which are expressing c-myc gene at high level. The copy numbers of the replicated plasmids in these human cells were 1/100 as high as in monkey CosI cells which express SV40 T antigen constitutively. Exactly the same plasmids as the transfected original ones were recovered from the Hirt supernatant of the transfected HL-60 cells. Furthermore, replication of the SV40 ori-containing plasmids in HL-60 cells was inhibited by anti-c-myc antibody co-transfected into the cells. These results indicate that the c-myc protein can be substituted for SV40 T antigen in SV40 DNA replication. Images PMID:3037484

  16. Dephosphorylation of JC virus agnoprotein by protein phosphatase 2A: Inhibition by small t antigen

    PubMed Central

    Sariyer, Ilker K.; Khalili, Kamel; Safak, Mahmut

    2009-01-01

    Previous studies have demonstrated that the JC virus (JCV) late regulatory protein agnoprotein is phosphorylated by the serine/threonine-specific protein kinase-C (PKC) and mutants of this protein at the PKC phosphorylation sites exhibit defects in the viral replication cycle. We have now investigated whether agnoprotein phosphorylation is regulated by PP2A, a serine/threonine-specific protein phosphatase and whether JCV small t antigen (Sm t-Ag) is involved in this regulation. Protein–protein interaction studies demonstrated that PP2A associates with agnoprotein and dephosphorylates it at PKC-specific sites. Sm t-Ag was also found to interact with PP2A and this interaction inhibited the dephosphorylation of agnoprotein by PP2A. The interaction domains of Sm t-Ag and agnoprotein with PP2A were mapped, as were the interaction domains of Sm t-Ag with agnoprotein. The middle portion of Sm t-Ag (aa 82–124) was found to be critical for the interaction with both agnoprotein and PP2A and the N-terminal region of agnoprotein for interaction with Sm t-Ag. To further understand the role of Sm t-Ag in JCV regulation, a stop codon was introduced at Ser90 immediately after splice donor site of the JCV early gene and the functional consequences of this mutation were investigated. The ability of this mutant virus to replicate was substantially reduced compared to WT. Next, the functional significance of PP2A in JCV replication was examined by siRNA targeting. Downregulation of PP2A caused a significant reduction in the level of JCV replication. Moreover, the impact of Sm t-Ag on agnoprotein phosphorylation was investigated by creating a double mutant of JCV, where Sm t-Ag stop codon mutant was combined with an agnoprotein triple phosphorylation mutant (Ser7, Ser11 and Thr21 to Ala). Results showed that double mutant behaves much like the triple phosphorylation mutant of agnoprotein during viral replication cycle, which suggests that agnoprotein might be an important target of

  17. Purification and refolding of anti-T-antigen single chain antibodies (scFvs) expressed in Escherichia coli as inclusion bodies.

    PubMed

    Yuasa, Noriyuki; Koyama, Tsubasa; Fujita-Yamaguchi, Yoko

    2014-02-01

    T-antigen (Galβ1-3GalNAcα-1-Ser/Thr) is an oncofetal antigen that is commonly expressed as a carbohydrate determinant in many adenocarcinomas. Since it is associated with tumor progression and metastasis, production of recombinant antibodies specific for T-antigen could lead to the development of cancer diagnostics and therapeutics. Previously, we isolated and characterized 11 anti-T-antigen phage clones from a phage library displaying human single-chain antibodies (scFvs) and purified one scFv protein, 1G11. More recently, we purified and characterized 1E8 scFv protein using a Drosophila S2 expression system. In the current study, four anti-T-antigen scFv genes belonging to Groups 1-4 were purified from inclusion bodies expressed in Escherichia coli cells. Inclusion bodies isolated from E. coli cells were denatured in 3.5 M Gdn-HCl. Solubilized His-tagged scFv proteins were purified using Ni(2+)-Sepharose column chromatography in the presence of 3.5 M Gdn-HCl. Purified scFv proteins were refolded according to a previously published method of step-wise dialysis. Two anti-T-antigen scFv proteins, 1E6 and 1E8 that belong to Groups 1 and 2, respectively, were produced in sufficient amounts, thus allowing further characterization of their binding activity with T-antigen. Specificity and affinity constants determined using enzyme-linked immunosorbent assay (ELISA) and surface plasmon resonance (SPR), respectively, provided evidence that both 1E8 and 1E6 scFv proteins are T-antigen specific and suggested that 1E8 scFv protein has a higher affinity for T-antigen than 1E6 scFv protein.

  18. Activation of the pp60c-src kinase by middle T antigen binding or by dephosphorylation.

    PubMed Central

    Courtneidge, S A

    1985-01-01

    The transforming protein of polyoma virus, middle T antigen, associates with the protein tyrosine kinase pp60c-src, and analysis of mutants of middle T suggests that this complex plays an important role in transformation by polyoma. It has recently been reported that pp60c-src from polyoma virus-transformed cells has enhanced tyrosine kinase activity in vitro. The data presented here confirm these findings and show that the enhanced kinase activity of pp60c-src is due to an increase in the Vmax of the enzyme. Sucrose density gradient analysis demonstrates that only the form of pp60c-src which is bound to middle T antigen is activated. The difference in enzyme activity between pp60c-src from normal and middle T-transformed cells is more marked when the enzyme is prepared from lysates containing the phosphotyrosine protein phosphatase inhibitor, sodium orthovanadate. pp60c-src from middle T transformed cells is unaffected, but pp60c-src from normal cells has reduced kinase activity if dephosphorylation is prevented. The kinase activity of pp60c-src thus appears to be regulated by its degree of phosphorylation at tyrosine, and data are presented which support this hypothesis. pp60c-src is the first example of a protein tyrosine kinase whose activity is inhibited by phosphorylation at tyrosine. Middle T antigen may increase the kinase activity of pp60c-src by preventing phosphorylation at this regulatory site. Images Fig. 4. Fig. 7. Fig. 8. PMID:2411538

  19. Interspecific adaptation by binary choice at de novo polyomavirus T antigen site through accelerated codon-constrained Val-Ala toggling within an intrinsically disordered region.

    PubMed

    Lauber, Chris; Kazem, Siamaque; Kravchenko, Alexander A; Feltkamp, Mariet C W; Gorbalenya, Alexander E

    2015-05-26

    It is common knowledge that conserved residues evolve slowly. We challenge generality of this central tenet of molecular biology by describing the fast evolution of a conserved nucleotide position that is located in the overlap of two open reading frames (ORFs) of polyomaviruses. The de novo ORF is expressed through either the ALTO protein or the Middle T antigen (MT/ALTO), while the ancestral ORF encodes the N-terminal domain of helicase-containing Large T (LT) antigen. In the latter domain the conserved Cys codon of the LXCXE pRB-binding motif constrains codon evolution in the overlapping MT/ALTO ORF to a binary choice between Val and Ala codons, termed here as codon-constrained Val-Ala (COCO-VA) toggling. We found the rate of COCO-VA toggling to approach the speciation rate and to be significantly accelerated compared to the baseline rate of chance substitution in a large monophyletic lineage including all viruses encoding MT/ALTO and three others. Importantly, the COCO-VA site is located in a short linear motif (SLiM) of an intrinsically disordered region, a typical characteristic of adaptive responders. These findings provide evidence that the COCO-VA toggling is under positive selection in many polyomaviruses, implying its critical role in interspecific adaptation, which is unprecedented for conserved residues.

  20. Identification of the Drosophila core 1 beta1,3-galactosyltransferase gene that synthesizes T antigen in the embryonic central nervous system and hemocytes.

    PubMed

    Yoshida, Hideki; Fuwa, Takashi J; Arima, Mikiko; Hamamoto, Hiroshi; Sasaki, Norihiko; Ichimiya, Tomomi; Osawa, Ken-Ichi; Ueda, Ryu; Nishihara, Shoko

    2008-12-01

    T antigen (Galbeta1-3GalNAcalpha1-Ser/Thr), the well-known tumor-associated antigen, is a core 1 mucin-type O-glycan structure that is synthesized by core 1 beta1,3-galactosyltransferase (C1beta3GalT), which transfers Gal from UDP-Gal to Tn antigen (GalNAcalpha1-Ser/Thr). Three putative C1beta3GalTs have been identified in Drosophila. However, although all three are expressed in embryos, their roles during embryogenesis have not yet been clarified. In this study, we used P-element inserted mutants to show that CG9520, one of the three putative C1beta3GalTs, synthesizes T antigen expressed on the central nervous system (CNS) during embryogenesis. We also found that T antigen was expressed on a subset of the embryonic hemocytes. CG9520 mutant embryos showed the loss of T antigens on the CNS and on a subset of hemocytes. Then, the loss of T antigens was rescued by precise excision of the P-element inserted into the CG9520 gene. Our data demonstrate that T antigens expressed on the CNS and on a subset of hemocytes are synthesized by CG9520 in the Drosophila embryo. In addition, we found that the number of circulating hemocytes was reduced in third instar larvae of CG9520 mutant. We, therefore, named the CG9520 gene Drosophila core 1 beta1,3-galactosyltransferase 1 because it is responsible for the synthesis and function of T antigen in vivo.

  1. Expression of SV40 T antigen polypeptides in cells biochemically transformed by plasmids containing the herpes simplex virus thymidine kinase gene and the genome of an SV40tsA mutant.

    PubMed

    Kit, S; Otsuka, H; Qavi, H; Trkula, D; Dubbs, D R

    1981-10-15

    degrees C, labelling of the 50-55K cellular protein was markedly reduced in TF pSB10 C7 and pSB15 C10 cells. The results suggest that SV40 large T antigen (92K) induces and/or stabilizes the 50-55K cellular protein in these mouse cells.

  2. Structure-Based Analysis of the Interaction between the Simian Virus 40 T-Antigen Origin Binding Domain and Single-Stranded DNA▿ †

    PubMed Central

    Meinke, Gretchen; Phelan, Paul J.; Fradet-Turcotte, Amélie; Bohm, Andrew; Archambault, Jacques; Bullock, Peter A.

    2011-01-01

    The origin-binding domain (OBD) of simian virus 40 (SV40) large T-antigen (T-Ag) is essential for many of T-Ag's interactions with DNA. Nevertheless, many important issues related to DNA binding, for example, how single-stranded DNA (ssDNA) transits along the T-Ag OBD, have yet to be established. Therefore, X-ray crystallography was used to determine the costructure of the T-Ag OBD bound to DNA substrates such as the single-stranded region of a forked oligonucleotide. A second structure of the T-Ag OBD crystallized in the presence of poly(dT)12 is also reported. To test the conclusions derived from these structures, residues identified as being involved in binding to ssDNA by crystallography or by an earlier nuclear magnetic resonance study were mutated, and their binding to DNA was characterized via fluorescence anisotropy. In addition, these mutations were introduced into full-length T-Ag, and these mutants were tested for their ability to support replication. When considered in terms of additional homology-based sequence alignments, our studies refine our understanding of how the T-Ag OBDs encoded by the polyomavirus family interact with ssDNA, a critical step during the initiation of DNA replication. PMID:20980496

  3. Structure-based analysis of the interaction between the simian virus 40 T-antigen origin binding domain and single-stranded DNA.

    PubMed

    Meinke, Gretchen; Phelan, Paul J; Fradet-Turcotte, Amélie; Bohm, Andrew; Archambault, Jacques; Bullock, Peter A

    2011-01-01

    The origin-binding domain (OBD) of simian virus 40 (SV40) large T-antigen (T-Ag) is essential for many of T-Ag's interactions with DNA. Nevertheless, many important issues related to DNA binding, for example, how single-stranded DNA (ssDNA) transits along the T-Ag OBD, have yet to be established. Therefore, X-ray crystallography was used to determine the costructure of the T-Ag OBD bound to DNA substrates such as the single-stranded region of a forked oligonucleotide. A second structure of the T-Ag OBD crystallized in the presence of poly(dT)(12) is also reported. To test the conclusions derived from these structures, residues identified as being involved in binding to ssDNA by crystallography or by an earlier nuclear magnetic resonance study were mutated, and their binding to DNA was characterized via fluorescence anisotropy. In addition, these mutations were introduced into full-length T-Ag, and these mutants were tested for their ability to support replication. When considered in terms of additional homology-based sequence alignments, our studies refine our understanding of how the T-Ag OBDs encoded by the polyomavirus family interact with ssDNA, a critical step during the initiation of DNA replication.

  4. Structure-Based Analysis of the Interaction between the Simian Virus 40 T-Antigen Origin Binding Domain and Single-Stranded DNA

    SciTech Connect

    G Meinke; P Phelan; A Fradet-Turcotte; A Bohm; J Archambault; P Bullock

    2011-12-31

    The origin-binding domain (OBD) of simian virus 40 (SV40) large T-antigen (T-Ag) is essential for many of T-Ag's interactions with DNA. Nevertheless, many important issues related to DNA binding, for example, how single-stranded DNA (ssDNA) transits along the T-Ag OBD, have yet to be established. Therefore, X-ray crystallography was used to determine the costructure of the T-Ag OBD bound to DNA substrates such as the single-stranded region of a forked oligonucleotide. A second structure of the T-Ag OBD crystallized in the presence of poly(dT){sub 12} is also reported. To test the conclusions derived from these structures, residues identified as being involved in binding to ssDNA by crystallography or by an earlier nuclear magnetic resonance study were mutated, and their binding to DNA was characterized via fluorescence anisotropy. In addition, these mutations were introduced into full-length T-Ag, and these mutants were tested for their ability to support replication. When considered in terms of additional homology-based sequence alignments, our studies refine our understanding of how the T-Ag OBDs encoded by the polyomavirus family interact with ssDNA, a critical step during the initiation of DNA replication.

  5. CryoEM and Molecular Dynamics of the Circadian KaiB-KaiC Complex Indicates That KaiB Monomers Interact with KaiC and Block ATP Binding Clefts

    SciTech Connect

    Villarreal, Seth A.; Pattanayek, Rekha; Williams, Dewight R.; Mori, Tetsuya; Qin, Ximing; Johnson, Carl H.; Egli, Martin; Stewart, Phoebe L.

    2014-10-02

    The circadian control of cellular processes in cyanobacteria is regulated by a posttranslational oscillator formed by three Kai proteins. During the oscillator cycle, KaiA serves to promote autophosphorylation of KaiC while KaiB counteracts this effect. Here, we present a crystallographic structure of the wild-type Synechococcus elongatus KaiB and a cryo-electron microscopy (cryoEM) structure of a KaiBC complex. The crystal structure shows the expected dimer core structure and significant conformational variations of the KaiB C-terminal region, which is functionally important in maintaining rhythmicity. The KaiBC sample was formed with a C-terminally truncated form of KaiC, KaiC-Δ489, which is persistently phosphorylated. The KaiB–KaiC-Δ489 structure reveals that the KaiC hexamer can bind six monomers of KaiB, which form a continuous ring of density in the KaiBC complex. We performed cryoEM-guided molecular dynamics flexible fitting simulations with crystal structures of KaiB and KaiC to probe the KaiBC protein–protein interface. This analysis indicated a favorable binding mode for the KaiB monomer on the CII end of KaiC, involving two adjacent KaiC subunits and spanning an ATP binding cleft. A KaiC mutation, R468C, which has been shown to affect the affinity of KaiB for KaiC and lengthen the period in a bioluminescence rhythm assay, is found within the middle of the predicted KaiBC interface. The proposed KaiB binding mode blocks access to the ATP binding cleft in the CII ring of KaiC, which provides insight into how KaiB might influence the phosphorylation status of KaiC.

  6. Phosphorylation at Ser²⁶ in the ATP-binding site of Ca²⁺/calmodulin-dependent kinase II as a mechanism for switching off the kinase activity.

    PubMed

    Yilmaz, Mehtap; Gangopadhyay, Samudra S; Leavis, Paul; Grabarek, Zenon; Morgan, Kathleen G

    2013-02-07

    CaMKII (Ca²⁺/calmodulin-dependent kinase II) is a serine/threonine phosphotransferase that is capable of long-term retention of activity due to autophosphorylation at a specific threonine residue within each subunit of its oligomeric structure. The γ isoform of CaMKII is a significant regulator of vascular contractility. Here, we show that phosphorylation of CaMKII γ at Ser²⁶, a residue located within the ATP-binding site, terminates the sustained activity of the enzyme. To test the physiological importance of phosphorylation at Ser²⁶, we generated a phosphospecific Ser²⁶ antibody and demonstrated an increase in Ser²⁶ phosphorylation upon depolarization and contraction of blood vessels. To determine if the phosphorylation of Ser²⁶ affects the kinase activity, we mutated Ser²⁶ to alanine or aspartic acid. The S26D mutation mimicking the phosphorylated state of CaMKII causes a dramatic decrease in Thr²⁸⁷ autophosphorylation levels and greatly reduces the catalytic activity towards an exogenous substrate (autocamtide-3), whereas the S26A mutation has no effect. These data combined with molecular modelling indicate that a negative charge at Ser²⁶ of CaMKII γ inhibits the catalytic activity of the enzyme towards its autophosphorylation site at Thr²⁸⁷ most probably by blocking ATP binding. We propose that Ser²⁶ phosphorylation constitutes an important mechanism for switching off CaMKII activity.

  7. Antibodies to merkel cell polyomavirus T antigen oncoproteins reflect tumor burden in merkel cell carcinoma patients.

    PubMed

    Paulson, Kelly G; Carter, Joseph J; Johnson, Lisa G; Cahill, Kevin W; Iyer, Jayasri G; Schrama, David; Becker, Juergen C; Madeleine, Margaret M; Nghiem, Paul; Galloway, Denise A

    2010-11-01

    Merkel cell polyomavirus (MCPyV) is a common infectious agent that is likely involved in the etiology of most Merkel cell carcinomas (MCC). Serum antibodies recognizing the MCPyV capsid protein VP1 are detectable at high titer in nearly all MCC patients and remain stable over time. Although antibodies to the viral capsid indicate prior MCPyV infection, they provide limited clinical insight into MCC because they are also detected in more than half of the general population. We investigated whether antibodies recognizing MCPyV large and small tumor-associated antigens (T-Ag) would be more specifically associated with MCC. Among 530 population control subjects, these antibodies were present in only 0.9% and were of low titer. In contrast, among 205 MCC cases, 40.5% had serum IgG antibodies that recognize a portion of T-Ag shared between small and large T-Ags. Among cases, titers of T-Ag antibodies fell rapidly (∼8-fold per year) in patients whose cancer did not recur, whereas they rose rapidly in those with progressive disease. Importantly, in several patients who developed metastases, the rise in T-Ag titer preceded clinical detection of disease spread. These results suggest that antibodies recognizing T-Ag are relatively specifically associated with MCC, do not effectively protect against disease progression, and may serve as a clinically useful indicator of disease status.

  8. Human COL2A1-directed SV40 T antigen expression in transgenic and chimeric mice results in abnormal skeletal development

    PubMed Central

    1995-01-01

    The ability of SV40 T antigen to cause abnormalities in cartilage development in transgenic mice and chimeras has been tested. The cis- regulatory elements of the COL2A1 gene were used to target expression of SV40 T antigen to differentiating chondrocytes in transgenic mice and chimeras derived from embryonal stem (ES) cells bearing the same transgene. The major phenotypic consequences of transgenic (pAL21) expression are malformed skeleton, disproportionate dwarfism, and perinatal/neonatal death. Expression of T antigen was tissue specific and in the main characteristic of the mouse alpha 1(II) collagen gene. Chondrocyte densities and levels of alpha 1(II) collagen mRNAs were reduced in the transgenic mice. Islands of cells which express cartilage characteristic genes such as type IIB procollagen, long form alpha 1(IX) collagen, alpha 2(XI) collagen, and aggrecan were found in the articular and growth cartilages of pAL21 chimeric fetuses and neonates. But these cells, which were expressing T antigen, were not properly organized into columns of proliferating chondrocytes. Levels of alpha 1(II) collagen mRNA were reduced in these chondrocytes. In addition, these cells did not express type X collagen, a marker for hypertrophic chondrocytes. The skeletal abnormality in pAL21 mice may therefore be due to a retardation of chondrocyte maturation or an impaired ability of chondrocytes to complete terminal differentiation and an associated paucity of some cartilage matrix components. PMID:7822417

  9. JC Virus T-Antigen in Colorectal Cancer Is Associated with p53 Expression and Chromosomal Instability, Independent of CpG Island Methylator Phenotype1

    PubMed Central

    Nosho, Katsuhiko; Shima, Kaori; Kure, Shoko; Irahara, Natsumi; Baba, Yoshifumi; Chen, Li; Kirkner, Gregory J; Fuchs, Charles S; Ogino, Shuji

    2009-01-01

    JC virus has a transforming gene encoding JC virus T-antigen (JCVT). JCVT may inactivate wild-type p53, cause chromosomal instability (CIN), and stabilize β-catenin. A link between JCVT and CpG island methylator phenotype (CIMP) has been suggested. However, no large-scale study has examined the relations of JCVT with molecular alterations, clinical outcome, or prognosis in colon cancer. We detected JCVT expression (by immunohistochemistry) in 271 (35%) of 766 colorectal cancers. We quantified DNA methylation in eight CIMP-specific promoters (CACNA1G, CDKN2A, CRABP1, IGF2, MLH1, NEUROG1, RUNX3, and SOCS1) and eight other loci (CHFR, HIC1, IGFBP3, MGMT, MINT1, MINT31, p14, WRN) by MethyLight. We examined loss of heterozygosity in 2p, 5q, 17q, and 18q. JCVT was significantly associated with p53 expression (P < .0001), p21 loss (P < .0001), CIN (≥2 chromosomal segments with LOH; P < .0001), nuclear β-catenin (P = .006), LINE-1 hypomethylation (P = .002), and inversely with CIMP-high (P = .0005) and microsatellite instability (MSI) (P < .0001), but not with PIK3CA mutation. In multivariate logistic regression analysis, the associations of JCVT with p53 [adjusted odds ratio (OR), 8.45; P < .0001], CIN (adjusted OR, 2.53; P = .003), cyclin D1 (adjusted OR, 1.57; P = .02), LINE-1 hypomethylation (adjusted OR, 1.97 for a 30% decline as a unit; P = .03), BRAF mutation (adjusted OR, 2.20; P = .04), and family history of colorectal cancer (adjusted OR, 0.64; P = .04) remained statistically significant. However, JCVT was no longer significantly associated with CIMP, MSI, β-catenin, or cyclooxygenase-2 expression in multivariate analysis. JCVT was unrelated with patient survival. In conclusion, JCVT expression in colorectal cancer is independently associated with p53 expression and CIN, which may lead to uncontrolled cell proliferation. PMID:19107235

  10. An attenuated mutant of the Rv1747 ATP-binding cassette transporter of Mycobacterium tuberculosis and a mutant of its cognate kinase, PknF, show increased expression of the efflux pump-related iniBAC operon

    PubMed Central

    Spivey, Vicky L; Whalan, Rachael H; Hirst, Elizabeth M A; Smerdon, Stephen J; Buxton, Roger S

    2013-01-01

    The ATP-binding cassette transporter Rv1747 is required for the growth of Mycobacterium tuberculosis in mice and in macrophages. Its structure suggests it is an exporter. Rv1747 forms a two-gene operon with pknF coding for the serine/threonine protein kinase PknF, which positively modulates the function of the transporter. We show that deletion of Rv1747 or pknF results in a number of transcriptional changes which could be complemented by the wild type allele, most significantly up-regulation of the iniBAC genes. This operon is inducible by isoniazid and ethambutol and by a broad range of inhibitors of cell wall biosynthesis and is required for efflux pump functioning. However, neither the Rv1747 or pknF mutant showed increased susceptibility to a range of drugs and cell wall stress reagents including isoniazid and ethambutol, cell wall structure and cell division appear normal by electron microscopy, and no differences in lipoarabinomannan were found. Transcription from the pknF promoter was not induced by a range of stress reagents. We conclude that the loss of Rv1747 affects cell wall biosynthesis leading to the production of intermediates that cause induction of iniBAC transcription and implicates it in exporting a component of the cell wall, which is necessary for virulence. PMID:23915284

  11. Cross-reactivity of Antibodies Directed to the Gram-Negative Bacterium Neisseria gonorrhoeae With Heat Shock Protein 60 and ATP-Binding Protein Correlates to Reduced Mitochondrial Activity in HIBCPP Choroid Plexus Papilloma Cells.

    PubMed

    Reuss, B; Schroten, H; Ishikawa, H; Asif, A R

    2015-09-01

    Antibacterial antibodies can cause neurologic side-effects by cross-reactivity with cellular antigens. Here we investigated interactions of antibodies to Neisseria gonorrhoeae (α-NG) - maternal infections by which increases the offspring's risk for later psychosis-with HIBCPP cells, a cell culture model of choroid plexus epithelium. Immunocytochemistry and Western blotting with α-NG, revealed organelle-like intracellular staining in HIBCPP cells, and labelling of several immunoreactive bands in cellular protein. Two-dimensional Western blotting revealed several immunopositive spots, most prominent of which were identified by mass spectrometry as mitochondrially localized proteins heat shock protein 60 (Hsp60) and ATP-binding protein β-subunit (ATPB). Similarly α-NG interacted with commercial samples of these proteins as revealed by Western blotting. Three alternative methods (JC-1, Janus green and MTT staining) revealed α-NG to cause in HIBCPP cells a significant decrease in mitochondrial activity, which could be reverted by neuroleptic drugs. Immunoreactivity of α-NG with choroid plexus epithelium in human post mortem samples suggests in vivo relevance of these findings. Finally, distinctly different staining patterns of antibodies against Neisseria meningitidis (α-NM), confirmed antibody specificity. To our knowledge this is the first report that α-NG cross-reactivity with Hsp60 and ATPB impairs mitochondrial activity in choroid plexus epithelial cells, pathogenetic relevance of which needs further clarification.

  12. Change in ATP-binding cassette B1/19, glutamine synthetase and alcohol dehydrogenase gene expression during root elongation in Betula pendula Roth and Alnus glutinosa L. Gaertn in response to leachate and leonardite humic substances.

    PubMed

    Tahiri, Abdelghani; Delporte, Fabienne; Muhovski, Yordan; Ongena, Marc; Thonart, Philippe; Druart, Philippe

    2016-01-01

    Humic substances (HS) are complex and heterogeneous compounds of humified organic matter resulting from the chemical and microbiological decomposition of organic residues. HS have a positive effect on plant growth and development by improving soil structure and fertility. They have long been recognized as plant growth-promoting substances, particularly with regard to influencing nutrient uptake, root growth and architecture. The biochemical and molecular mechanisms through which HS influence plant physiology are not well understood. This study evaluated the bioactivity of landfill leachate and leonardite HS on alder (Alnus glutinosa L. Gaertn) and birch (Betula pendula Roth) during root elongation in vitro. Changes in root development were studied in relation to auxin, carbon and nitrogen metabolisms, as well as to the stress adaptive response. The cDNA fragments of putative genes encoding two ATP-binding cassette (ABC) transporters (ABCB1 and ABCB19) belonging to the B subfamily of plant ABC auxin transporters were cloned and sequenced. Molecular data indicate that HS and their humic acid (HA) fractions induce root growth by influencing polar auxin transport (PAT), as illustrated by the modulation of the ABCB transporter transcript levels (ABCB1 and ABCB19). There were also changes in alcohol dehydrogenase (ADH) and glutamine synthetase (GS) gene transcript levels in response to HS exposure. These findings confirmed that humic matter affects plant growth and development through various metabolic pathways, including hormonal, carbon and nitrogen metabolisms and stress response or signalization.

  13. 4,6-Substituted-1,3,5-triazin-2(1H)-ones as monocyclic catalytic inhibitors of human DNA topoisomerase IIα targeting the ATP binding site.

    PubMed

    Pogorelčnik, Barbara; Janežič, Matej; Sosič, Izidor; Gobec, Stanislav; Solmajer, Tom; Perdih, Andrej

    2015-08-01

    Human DNA topoisomerase IIα (htIIα) is a validated target for the development of novel anticancer agents. Starting from our discovered 4-amino-1,3,5-triazine inhibitors of htIIα, we investigated a library of 2,4,6-trisubstituted-1,3,5-triazines for novel inhibitors that bind to the htIIα ATP binding site using a combination of structure-based and ligand-based pharmacophore models and molecular docking. 4,6-substituted-1,3,5-triazin-2(1H)-ones 8, 9 and 14 were identified as novel inhibitors with activity comparable to the established drug etoposide (1). Compound 8 inhibits the htIIα decatenation in a superior fashion to etoposide. Cleavage assays demonstrated that selected compounds 8 and 14 do not act as poisons and antagonize the poison effect of etoposide. Microscale thermophoresis (MST) confirmed binding of compound 8 to the htIIα ATPase domain and compound 14 effectively inhibits the htIIα mediated ATP hydrolysis. The molecular dynamics simulation study provides further insight into the molecular recognition. The 4,6-disubstituted-1,3,5-triazin-2(1H)-ones represent the first validated monocyclic class of catalytic inhibitors that bind to the to the htIIα ATPase domain.

  14. Functional Dynamics Revealed by the Structure of the SufBCD Complex, a Novel ATP-binding Cassette (ABC) Protein That Serves as a Scaffold for Iron-Sulfur Cluster Biogenesis*

    PubMed Central

    Hirabayashi, Kei; Yuda, Eiki; Tanaka, Naoyuki; Katayama, Sumie; Iwasaki, Kenji; Matsumoto, Takashi; Kurisu, Genji; Outten, F. Wayne; Fukuyama, Keiichi; Takahashi, Yasuhiro; Wada, Kei

    2015-01-01

    ATP-binding cassette (ABC)-type ATPases are chemomechanical engines involved in diverse biological pathways. Recent genomic information reveals that ABC ATPase domains/subunits act not only in ABC transporters and structural maintenance of chromosome proteins, but also in iron-sulfur (Fe-S) cluster biogenesis. A novel type of ABC protein, the SufBCD complex, functions in the biosynthesis of nascent Fe-S clusters in almost all Eubacteria and Archaea, as well as eukaryotic chloroplasts. In this study, we determined the first crystal structure of the Escherichia coli SufBCD complex, which exhibits the common architecture of ABC proteins: two ABC ATPase components (SufC) with function-specific components (SufB-SufD protomers). Biochemical and physiological analyses based on this structure provided critical insights into Fe-S cluster assembly and revealed a dynamic conformational change driven by ABC ATPase activity. We propose a molecular mechanism for the biogenesis of the Fe-S cluster in the SufBCD complex. PMID:26472926

  15. Differential affinities of simian virus 40 large tumor antigen for DNA.

    PubMed Central

    Oren, M; Winocour, E; Prives, C

    1980-01-01

    The binding of simian virus 40 (SV40) large tumor antigen (T antigen) to DNA was analyzed by using the salt-sensitive affinities of the protein for various DNAs immobilized on cellulose. At least two types of interactions could be distinguished that differed in their stability. Higher salt concentrations were required to elute T antigen from SV40 DNA than from calf thymus DNA; and even greater salt concentrations were required for the lution of T antigen from multiorigin SV 40 DNA compared to wild-type SV40 DNA. This would indicate that T antigen can bind weakly or strongly to DNA, depending on the DNA sequence. It was also found that a greater proportion of rapidly labeled or newly synthesized T antigen binds more efficiently and tightly to multiorigin SV40 DNA than to long-labeled or older forms of T antigen. This approach can be utilized not only to distinguish between different forms of T antigens which vary in their affinities for DNA but also for rapidly obtaining highly enriched T antigen preparations. Images PMID:6244545

  16. Merkel Cell Polyomavirus Small T Antigen Induces Cancer and Embryonic Merkel Cell Proliferation in a Transgenic Mouse Model

    PubMed Central

    Geng, Xuehui; Shuda, Yoko; Ostrowski, Stephen M.; Lukianov, Stefan; Jenkins, Frank J.; Honda, Kord; Maricich, Stephen M.; Moore, Patrick S.; Chang, Yuan

    2015-01-01

    Merkel cell polyomavirus (MCV) causes the majority of human Merkel cell carcinomas (MCC) and encodes a small T (sT) antigen that transforms immortalized rodent fibroblasts in vitro. To develop a mouse model for MCV sT-induced carcinogenesis, we generated transgenic mice with a flox-stop-flox MCV sT sequence homologously recombined at the ROSA locus (ROSAsT), allowing Cre-mediated, conditional MCV sT expression. Standard tamoxifen (TMX) administration to adult UbcCreERT2; ROSAsT mice, in which Cre is ubiquitously expressed, resulted in MCV sT expression in multiple organs that was uniformly lethal within 5 days. Conversely, most adult UbcCreERT2; ROSAsT mice survived low-dose tamoxifen administration but developed ear lobe dermal hyperkeratosis and hypergranulosis. Simultaneous MCV sT expression and conditional homozygous p53 deletion generated multi-focal, poorly-differentiated, highly anaplastic tumors in the spleens and livers of mice after 60 days of TMX treatment. Mouse embryonic fibroblasts from these mice induced to express MCV sT exhibited anchorage-independent cell growth. To examine Merkel cell pathology, MCV sT expression was also induced during mid-embryogenesis in Merkel cells of Atoh1CreERT2/+; ROSAsT mice, which lead to significantly increased Merkel cell numbers in touch domes at late embryonic ages that normalized postnatally. Tamoxifen administration to adult Atoh1CreERT2/+; ROSAsT and Atoh1CreERT2/+; ROSAsT; p53flox/flox mice had no effects on Merkel cell numbers and did not induce tumor formation. Taken together, these results show that MCV sT stimulates progenitor Merkel cell proliferation in embryonic mice and is a bona fide viral oncoprotein that induces full cancer cell transformation in the p53-null setting. PMID:26544690

  17. Functional Analysis of the Glucuronyltransferases GlcAT-P and GlcAT-S of Drosophila melanogaster: Distinct Activities towards the O-linked T-antigen.

    PubMed

    Breloy, Isabelle; Schwientek, Tilo; Althoff, Deborah; Holz, Marvin; Koppen, Tim; Krupa, Angelika; Hanisch, Franz-Georg

    2016-01-06

    The Drosophila melanogaster glucuronyltransferases dGlcAT-S and dGlcAT-P were reported to be expressed ubiquitously and results of in vitro activity assays indicate a functional redundancy. We analyzed both transferases in vivo and in vitro and could show significant differences in their activity towards N-and O-glycoproteins in vivo. While GlcAT-P is able to use N-linked N-acetyllactosamine chains and the O-linked T-antigen as a substrate to form non-sulfated HNK1- (GlcAβ1-3Galβ1-4GlcNAcβ1-) and glucuronyl-T-antigens in vivo, GlcAT-S adds glucuronic acid only to N-linked chains, thereby synthesizing only the non-sulfated HNK1-antigen.

  18. Multiple-step kinetic mechanism of DNA-independent ATP binding and hydrolysis by Escherichia coli replicative helicase DnaB protein: quantitative analysis using the rapid quench-flow method.

    PubMed

    Rajendran, S; Jezewska, M J; Bujalowski, W

    2000-11-10

    The kinetic mechanism of DNA-independent binding and hydrolysis of ATP by the E. coli replicative helicase DnaB protein has been quantitatively examined using the rapid quench-flow technique. Single-turnover studies of ATP hydrolysis, in a non-interacting active site of the helicase, indicate that bimolecular association of ATP with the site is followed by the reversible hydrolysis of nucleotide triphosphate and subsequent conformational transition of the enzyme-product complex. The simplest mechanism, which describes the data, is a three-step sequential process defined by:¿eqalign¿¿¿rm Helicase+ATP¿&¿mathop¿¿rightleftharpoons¿ ¿k_1¿_¿k_¿-1¿¿¿¿rm (H-ATP)¿¿mathop¿¿rightleftharpoons¿ ¿k_2¿_¿k_¿-2¿¿¿¿rm (H-ADP¿cdot Pi)¿¿cr &¿mathop¿¿rightleftharpoons¿ ¿k_3¿_¿k_¿-3¿¿¿¿rm (H-ADP¿cdot Pi)¿ *¿The sequential character of the mechanism excludes conformational transitions of the DnaB helicase prior to ATP binding. Analysis of relaxation times and amplitudes of the reaction allowed us to estimate all rate and equilibrium constants of partial steps of the proposed mechanism. The intrinsic binding constant for the formation of the (H-ATP) complex is K(ATP)=(1.3+/-0.5)x10(5) M(-1). The analysis of the data indicates that a part of the ATP binding energy originates from induced structural changes of the DnaB protein-ATP complex prior to ATP hydrolysis. The equilibrium constant of the chemical interconversion is K(H)=k(2)/k(-2) approximately 2 while the subsequent conformational transition is characterized by K(3)=k(3)/k(-3) approximately 30. The low value of K(H) and the presence of the subsequent energetically favorable conformational step(s) strongly suggest that free energy is released from the enzyme-product complex in the conformational transitions following the chemical step and before the product release.The combined application of single and multiple-turnover approaches show that all six nucleotide-binding sites of the Dna

  19. Quercetin up-regulates expressions of peroxisome proliferator-activated receptor γ, liver X receptor α, and ATP binding cassette transporter A1 genes and increases cholesterol efflux in human macrophage cell line.

    PubMed

    Lee, Seung-Min; Moon, Jiyoung; Cho, Yoonsu; Chung, Ji Hyung; Shin, Min-Jeong

    2013-02-01

    Cholesterol-laden macrophages trigger accumulation of foam cells and increase the risk of developing atherosclerosis. We hypothesized that quercetin could lower the content of cholesterol in macrophages by regulating the expression of the ATP binding cassette transporter A1 (ABCA1) gene in differentiated human acute monocyte leukemia cell line (THP-1) cells and thereby reducing the chance of forming foam cells. Quercetin, in concentrations up to 30 μM, was not cytotoxic to differentiated THP-1 cells. Quercetin up-regulated both ABCA1 messenger RNA and protein expression in differentiated THP-1 cells, and its maximum effects were demonstrated at 0.3 μM for 4 to 8 hours in incubation. In addition, quercetin increased protein levels of peroxisome proliferator-activated receptor γ (PPARγ) and liver X receptor α (LXRα) within 2 hours of treatment. Because PPARγ and LXRα are important transcriptional factors for ABCA1, quercetin-induced up-regulation of ABCA1 may be mediated by increased expression levels of the PPARγ and LXRα genes. Furthermore, quercetin-enhanced cholesterol efflux from differentiated THP-1 cells to both high-density lipoprotein (HDL) and apolipoprotein A1. Quercetin at the dose of 0.15 μM elevated the cholesterol efflux only for HDL. At the dose of 0.3 μM, quercetin demonstrated effects both on HDL and apolipoprotein A1. Our data demonstrated that quercetin increased the expressions of PPARγ, LXRα, and ABCA1 genes and cholesterol efflux from THP-1 macrophages. Quercetin-induced expression of PPARγ and LXRα might subsequently affect up-regulation of their target gene ABCA1. Taken together, ingestion of quercetin or quercetin-rich foods could be an effective way to improve cholesterol efflux from macrophages, which would contribute to lowering the risk of atherosclerosis.

  20. Inducer exclusion in Firmicutes: Insights into the regulation of a carbohydrate ATP binding cassette transporter from Lactobacillus casei BL23 by the signal transducing protein P-Ser46-HPr.

    PubMed

    Homburg, Constanze; Bommer, Martin; Wuttge, Steven; Hobe, Carolin; Beck, Sebastian; Dobbek, Holger; Deutscher, Josef; Licht, Anke; Schneider, Erwin

    2017-03-30

    Catabolite repression is a mechanism that enables bacteria to control carbon utilization. As part of this global regulatory network, components of the phosphoenolpyruvate:carbohydrate phosphotransferase system inhibit the uptake of less favourable sugars when a preferred carbon source such as glucose is available. This process is termed inducer exclusion. In bacteria belonging to the phylum Firmicutes, HPr, phosphorylated at serine 46 (P-Ser46-HPr) is the key player but its mode of action is elusive. To address this question at the level of purified protein components, we have chosen a homolog of the E. coli maltose/maltodextrin ATP-binding cassette transporter from Lactobacillus casei (MalE1-MalF1G1K12 ) as a model system. We show that the solute binding protein, MalE1, binds linear and cyclic maltodextrins but not maltose. Crystal structures of MalE1 complexed with these sugars provide a clue why maltose is not a substrate. P-Ser46-HPr inhibited MalE1/maltotetraose-stimulated ATPase activity of the transporter incorporated in proteoliposomes. Furthermore, cross-linking experiments revealed that P-Ser46-HPr contacts the nucleotide-binding subunit, MalK1, in proximity to the Walker A motif. However, P-Ser46-HPr did not block binding of ATP to MalK1. Together, our findings provide first biochemical evidence that P-Ser-HPr arrests the transport cycle by preventing ATP hydrolysis at the MalK1 subunits of the transporter. This article is protected by copyright. All rights reserved.

  1. Hedyotis diffusa Willd overcomes 5-fluorouracil resistance in human colorectal cancer HCT-8/5-FU cells by downregulating the expression of P-glycoprotein and ATP-binding casette subfamily G member 2

    PubMed Central

    LI, QIONGYU; WANG, XIANGFENG; SHEN, ALING; ZHANG, YUCHEN; CHEN, YOUQIN; SFERRA, THOMAS J.; LIN, JIUMAO; PENG, JUN

    2015-01-01

    Previous studies have demonstrated that Hedyotis diffusa Willd (HDW), a traditional Chinese herbal medicine, exhibits potent anticancer activity in models of colorectal cancer (CRC). Aggressive forms of CRC exhibit resistance to widely used chemotherapeutic drugs, including the antimetabolite, 5-fluorouracil (5-FU); however, less is known with regard to the activity of HDW against 5-FU-resistant cancer. In the present study, the mechanism of action and the potency of ethanol extracts of HDW (EEHDW) were investigated on a multidrug-resistant CRC HCT-8/5-FU cell line. Using an MTT cell proliferation assay, EEHDW treatment was shown to significantly reduce the cell viability of HCT-8/5-FU cells in a dose- and time-dependent manner. Furthermore, EEHDW significantly increased the retention of the ATP-binding cassette (ABC) transporter substrate, rhodamine-123, as compared with the untreated controls. To further investigate the molecular mechanisms targeted by EEHDW in the resistant cells, the expression levels of the ABC drug transporter protein, P-glycoprotein (P-gp), and ABC subfamily G member 2 (ABCG2), were analyzed using reverse-transcription polymerase chain reaction and western blot analysis. The mRNA and protein expression levels of P-gp and ABCG2 were reduced in the HCT-8/5-FU cells following EEHDW treatment, indicating that EEHDW inhibits ABCG2-mediated drug resistance by downregulating the expression of ABCG2 and P-gp. Therefore, the potential application of EEHDW as a chemotherapeutic adjuvant represents a promising alternative approach to the treatment of drug-resistant CRC. PMID:26640560

  2. Hedyotis diffusa Willd overcomes 5-fluorouracil resistance in human colorectal cancer HCT-8/5-FU cells by downregulating the expression of P-glycoprotein and ATP-binding casette subfamily G member 2.

    PubMed

    Li, Qiongyu; Wang, Xiangfeng; Shen, Aling; Zhang, Yuchen; Chen, Youqin; Sferra, Thomas J; Lin, Jiumao; Peng, Jun

    2015-11-01

    Previous studies have demonstrated that Hedyotis diffusa Willd (HDW), a traditional Chinese herbal medicine, exhibits potent anticancer activity in models of colorectal cancer (CRC). Aggressive forms of CRC exhibit resistance to widely used chemotherapeutic drugs, including the antimetabolite, 5-fluorouracil (5-FU); however, less is known with regard to the activity of HDW against 5-FU-resistant cancer. In the present study, the mechanism of action and the potency of ethanol extracts of HDW (EEHDW) were investigated on a multidrug-resistant CRC HCT-8/5-FU cell line. Using an MTT cell proliferation assay, EEHDW treatment was shown to significantly reduce the cell viability of HCT-8/5-FU cells in a dose- and time-dependent manner. Furthermore, EEHDW significantly increased the retention of the ATP-binding cassette (ABC) transporter substrate, rhodamine-123, as compared with the untreated controls. To further investigate the molecular mechanisms targeted by EEHDW in the resistant cells, the expression levels of the ABC drug transporter protein, P-glycoprotein (P-gp), and ABC subfamily G member 2 (ABCG2), were analyzed using reverse-transcription polymerase chain reaction and western blot analysis. The mRNA and protein expression levels of P-gp and ABCG2 were reduced in the HCT-8/5-FU cells following EEHDW treatment, indicating that EEHDW inhibits ABCG2-mediated drug resistance by downregulating the expression of ABCG2 and P-gp. Therefore, the potential application of EEHDW as a chemotherapeutic adjuvant represents a promising alternative approach to the treatment of drug-resistant CRC.

  3. Natural allelic variants of bovine ATP-binding cassette transporter ABCG2: increased activity of the Ser581 variant and development of tools for the discovery of new ABCG2 inhibitors.

    PubMed

    Merino, Gracia; Real, Rebeca; Baro, Marta F; Gonzalez-Lobato, Lucia; Prieto, Julio G; Alvarez, Ana I; Marques, Margarita M

    2009-01-01

    ATP-binding cassette transporter ABCG2 [breast cancer resistance protein (BCRP)] is a member of the ABC transporter superfamily that actively extrudes xenotoxins from cells and is a major determinant of the bioavailability of many compounds. ABCG2 expression is strongly induced during lactation in the mammary gland and is related to the active secretion of drugs into the milk. The presence of drug residues and environmental pollutants in milk is an outstanding problem for human milk consumption and milk industrial processes, involving important risks to public health and the dairy industry. In cows, a single nucleotide polymorphism (SNP) in this protein has been described previously (Tyr581) and is associated with higher fat and protein percentages and lower milk yield. However, whether this amino acid substitution affects ABCG2-mediated drug transport in cows, including milk secretion, required further exploration. We cloned the two variants of bovine ABCG2 and evaluated the effect of this SNP on mitoxantrone accumulation assays performed in ovine primary fibroblasts transiently expressing either of the variants. It is interesting to note that statistically significant differences in activity between both variants were observed, and the Ser581 variant was related with an increased efflux activity. In addition, we demonstrated that genistein is a very good inhibitor of bovine ABCG2 and identified new inhibitors of the transporter, such as the macrocyclic lactones, ivermectin, and selamectin. Moreover, the inhibitory effect of these compounds on human and murine ABCG2 homologs was confirmed using transduced Marbin-Dabin canine kidney II cells. These findings may have important implications regarding the presence of drug residues in milk and drug interactions affecting the pharmacological behavior of ABCG2 substrates.

  4. Protein Kinase C Is Involved in the Induction of ATP-Binding Cassette Transporter A1 Expression by Liver X Receptor/Retinoid X Receptor Agonist in Human Macrophages.

    PubMed

    Huwait, Etimad A; Singh, Nishi N; Michael, Daryn R; Davies, Thomas S; Moss, Joe W E; Ramji, Dipak P

    2015-05-07

    The transcription of the ATP-binding cassette transporter A1 (ABCA1) gene, which plays a key anti-atherogenic role, is known to be induced by agonists of liver X receptors (LXRs). LXRs form obligate heterodimers with retinoid X receptors (RXRs) and interact with their recognition sequences in the regulatory regions of key genes implicated in the control of cholesterol, fatty acid and glucose homeostasis. We have previously shown a novel role for c-Jun N-terminal kinase (JNK) and phosphoinositide 3-kinase (PI3K) in the LXRs-mediated induction of macrophage gene expression. Protein kinase C (PKC) is often found to regulate the action of nuclear receptors and cross talk between this kinase family and JNK and/or PI3K has been shown in several settings. We have therefore investigated a potential role for PKC in the action of LXR/RXR agonist 22-(R)-hydroxycholesterol (22-(R)-HC)/9-cis-retinoic acid (9cRA) in THP-1 macrophages, including the induction of ABCA1 expression. The pan PKC inhibitor bisindoylmaleimide was found to attenuate the induction of ABCA1 protein expression, the activation of the JNK signaling pathway and the stimulation of activator protein-1 (AP-1) DNA binding activity in macrophages treated with 22-(R)-HC and 9cRA. The role of PKC in the action of these ligands was confirmed further by the use of more isotype-specific inhibitors. These studies therefore reveal a potentially important role for PKC in the action of 22-(R)-HC and 9cRA in human macrophages. This article is protected by copyright. All rights reserved.

  5. Protein Kinase C Is Involved in the Induction of ATP-Binding Cassette Transporter A1 Expression by Liver X Receptor/Retinoid X Receptor Agonist in Human Macrophages.

    PubMed

    Huwait, Etimad A; Singh, Nishi N; Michael, Daryn R; Davies, Thomas S; Moss, Joe W E; Ramji, Dipak P

    2015-09-01

    The transcription of the ATP-binding cassette transporter A1 (ABCA1) gene, which plays a key anti-atherogenic role, is known to be induced by agonists of liver X receptors (LXRs). LXRs form obligate heterodimers with retinoid X receptors (RXRs) and interact with their recognition sequences in the regulatory regions of key genes implicated in the control of cholesterol, fatty acid and glucose homeostasis. We have previously shown a novel role for c-Jun N-terminal kinase (JNK) and phosphoinositide 3-kinase (PI3K) in the LXRs-mediated induction of macrophage gene expression. Protein kinase C (PKC) is often found to regulate the action of nuclear receptors and cross talk between this kinase family and JNK and/or PI3K has been shown in several settings. We have, therefore, investigated a potential role for PKC in the action of LXR/RXR agonist 22-(R)-hydroxycholesterol (22-(R)-HC)/9-cis-retinoic acid (9cRA) in THP-1 macrophages, including the induction of ABCA1 expression. The pan PKC inhibitor bisindoylmaleimide was found to attenuate the induction of ABCA1 protein expression, the activation of the JNK signaling pathway and the stimulation of activator protein-1 (AP-1) DNA binding activity in macrophages treated with 22-(R)-HC and 9cRA. The role of PKC in the action of these ligands was confirmed further by the use of more isotype-specific inhibitors. These studies, therefore, reveal a potentially important role for PKC in the action of 22-(R)-HC and 9cRA in human macrophages.

  6. Modulation of microRNA Expression in Subjects with Metabolic Syndrome and Decrease of Cholesterol Efflux from Macrophages via microRNA-33-Mediated Attenuation of ATP-Binding Cassette Transporter A1 Expression by Statins

    PubMed Central

    Tseng, Pei-Chi; Lee, Tzong-Shyuan; Lee, Wen-Jane; Chang, Pey-Jium; Chiang, An-Na

    2016-01-01

    Metabolic syndrome (MetS) is a complicated health problem that encompasses a variety of metabolic disorders. In this study, we analyzed the relationship between the major biochemical parameters associated with MetS and circulating levels of microRNA (miR)-33, miR-103, and miR-155. We found that miRNA-33 levels were positively correlated with levels of fasting blood glucose, glycosylated hemoglobin A1c, total cholesterol, LDL-cholesterol, and triacylglycerol, but negatively correlated with HDL-cholesterol levels. In the cellular study, miR-33 levels were increased in macrophages treated with high glucose and cholesterol-lowering drugs atorvastatin and pitavastatin. miR-33 has been reported to play an essential role in cholesterol homeostasis through ATP-binding cassette transporter A1 (ABCA1) regulation and reverse cholesterol transport. However, the molecular mechanism underlying the linkage between miR-33 and statin treatment remains unclear. In the present study, we investigated whether atorvastatin and pitavastatin exert their functions through the modulation of miR-33 and ABCA1-mediated cholesterol efflux from macrophages. The results showed that treatment of the statins up-regulated miR-33 expression, but down-regulated ABCA1 mRNA levels in RAW264.7 cells and bone marrow-derived macrophages. Statin-mediated ABCA1 regulation occurs at the post-transcriptional level through targeting of the 3′-UTR of the ABCA1 transcript by miR-33. Additionally, we found significant down-regulation of ABCA1 protein expression in macrophages treated with statins. Finally, we showed that high glucose and statin treatment significantly suppressed cholesterol efflux from macrophages. These findings have highlighted the complexity of statins, which may exert detrimental effects on metabolic abnormalities through regulation of miR-33 target genes. PMID:27139226

  7. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia.

    PubMed

    Dong, Qian; Ernst, Sarah E; Ostedgaard, Lynda S; Shah, Viral S; Ver Heul, Amanda R; Welsh, Michael J; Randak, Christoph O

    2015-05-29

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P(1),P(5)-di(adenosine-5') pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5'-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5'-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl(-) channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia.

  8. Mutating the Conserved Q-loop Glutamine 1291 Selectively Disrupts Adenylate Kinase-dependent Channel Gating of the ATP-binding Cassette (ABC) Adenylate Kinase Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) and Reduces Channel Function in Primary Human Airway Epithelia*

    PubMed Central

    Dong, Qian; Ernst, Sarah E.; Ostedgaard, Lynda S.; Shah, Viral S.; Ver Heul, Amanda R.; Welsh, Michael J.; Randak, Christoph O.

    2015-01-01

    The ATP-binding cassette (ABC) transporter cystic fibrosis transmembrane conductance regulator (CFTR) and two other non-membrane-bound ABC proteins, Rad50 and a structural maintenance of chromosome (SMC) protein, exhibit adenylate kinase activity in the presence of physiologic concentrations of ATP and AMP or ADP (ATP + AMP ⇆ 2 ADP). The crystal structure of the nucleotide-binding domain of an SMC protein in complex with the adenylate kinase bisubstrate inhibitor P1,P5-di(adenosine-5′) pentaphosphate (Ap5A) suggests that AMP binds to the conserved Q-loop glutamine during the adenylate kinase reaction. Therefore, we hypothesized that mutating the corresponding residue in CFTR, Gln-1291, selectively disrupts adenylate kinase-dependent channel gating at physiologic nucleotide concentrations. We found that substituting Gln-1291 with bulky side-chain amino acids abolished the effects of Ap5A, AMP, and adenosine 5′-monophosphoramidate on CFTR channel function. 8-Azidoadenosine 5′-monophosphate photolabeling of the AMP-binding site and adenylate kinase activity were disrupted in Q1291F CFTR. The Gln-1291 mutations did not alter the potency of ATP at stimulating current or ATP-dependent gating when ATP was the only nucleotide present. However, when physiologic concentrations of ADP and AMP were added, adenylate kinase-deficient Q1291F channels opened significantly less than wild type. Consistent with this result, we found that Q1291F CFTR displayed significantly reduced Cl− channel function in well differentiated primary human airway epithelia. These results indicate that a highly conserved residue of an ABC transporter plays an important role in adenylate kinase-dependent CFTR gating. Furthermore, the results suggest that adenylate kinase activity is important for normal CFTR channel function in airway epithelia. PMID:25887396

  9. Brucella abortus mutants lacking ATP-binding cassette transporter proteins are highly attenuated in virulence and confer protective immunity against virulent B. abortus challenge in BALB/c mice.

    PubMed

    Truong, Quang Lam; Cho, Youngjae; Park, Soyeon; Park, Bo-Kyoung; Hahn, Tae-Wook

    2016-06-01

    Brucella abortus RB51 is an attenuated vaccine strain that has been most frequently used for bovine brucellosis. Although it is known to provide good protection in cattle, it still has some drawbacks including resistance to rifampicin, residual virulence and pathogenicity in humans. Thus, there has been a continuous interest on new safe and effective bovine vaccine candidates. In the present study, we have constructed unmarked mutants by deleting singly cydD and cydC genes, which encode ATP-binding cassette transporter proteins, from the chromosome of the virulent Brucella abortus isolate from Korean cow (referred to as IVK15). Both IVK15ΔcydD and ΔcydC mutants showed increased sensitivity to metal ions, hydrogen peroxide and acidic pH, which are mimic to intracellular environment during host infection. Additionally, the mutants exhibited a significant growth defect in RAW264.7 cells and greatly attenuated in mice. Vaccination of mice with either IVK15ΔcydC or IVK15ΔcydD mutant could elicit an anti-Brucella specific immunoglobulin G (IgG) and IgG subclass responses as well as enhance the secretion of interferon-gamma, and provided better protection against challenge with B. abortus strain 2308 than with the commercial B. abortus strain RB51 vaccine. Collectively, these results suggest that both IVK15ΔcydC and IVK15ΔcydD mutants could be an attenuated vaccine candidate against B. abortus.

  10. Phytosterols reduce cholesterol absorption by inhibition of 27-hydroxycholesterol generation, liver X receptor α activation, and expression of the basolateral sterol exporter ATP-binding cassette A1 in Caco-2 enterocytes.

    PubMed

    Brauner, Reinhard; Johannes, Christian; Ploessl, Florian; Bracher, Franz; Lorenz, Reinhard L

    2012-06-01

    Phytosterol-enriched foods are increasingly marketed to lower cholesterol levels and atherosclerosis in the general population. Phytosterols reduce cholesterol absorption, but the molecular mechanism is controversial. We therefore investigated the phytosterol effects on cholesterol metabolism in human enterocyte, hepatocyte, and macrophage models relevant for sterol absorption, reverse transport, and excretion. Isomolar sitosterol (50 μmol/L) was less effectively taken up by enterocytes than cholesterol but suppressed apical cholesterol uptake by 50% (P < 0.01) and basolateral secretion by two-thirds (P < 0.01) whether added in micelles or ethanol or complexed to cyclodextrin. In contrast, enterocytes handled nanomolar (3)H-sitosterol similarly to cholesterol. Enterocytes selectively oxidized all sterols to 27-hydroxy- and 27-carboxy-sterols. Conversion rates were much lower for sitosterol (0.05 ± 0.02 nmol/mg protein) and campesterol (0.48 ± 0.10) compared with cholesterol (3.73 ± 0.60) (P < 0.001). 27-Hydroxycholesterol (27OH-C) activated liver-X-receptor alpha (LXRα) (P < 0.01) and stimulated ATP-binding cassette transporter (ABC) A1 expression (P < 0.001) and basolateral systemic cholesterol secretion from enterocytes (P < 0.05). In co-incubations, phytosterols inhibited 27OH-C generation by sterol 27-hydroxylase (P < 0.001) and reduced LXRα-mediated ABCA1 expression (P < 0.01) and basolateral systemic cholesterol secretion. In contrast, ABCG8 transcription and apical sterol resecretion was unchanged by LXRα activation in human enterocytes. Exogenous LXRα agonists reverted sterol selectivity and phytosterol cholesterol interaction. Due to constitutive apical expression of ABCG5/G8 and LXRα-enhanced basolateral expression of ABCA1 in enterocytes, interference of phytosterols with the generation of the dominating LXRα-agonist 27OH-C blocks the self-priming component of cholesterol absorption. This local LXRα antagonism of dietary phytosterols

  11. Hospicells promote upregulation of the ATP-binding cassette genes by insulin-like growth factor-I via the JAK2/STAT3 signaling pathway in an ovarian cancer cell line

    PubMed Central

    BENABBOU, NADIA; MIRSHAHI, PEZHMAN; CADILLON, MÉLODIE; SORIA, JEANNETTE; THERWATH, AMU; MIRSHAHI, MASSOUD

    2013-01-01

    Interaction between tumor cells and their microenvironment has a crucial role in the development, progression and drug resistance of cancer. Our objective was to confirm the role of Hospicells, which are stromal cells from the cancer microenvironment, in drug resistance and tumor cell growth. We demonstrated that soluble factors secreted by Hospicells activate several genes and upregulate the JAK/STAT signaling pathway in ovarian cancer cell lines. Hospicells express all insulin-like growth factor (IGF) family as detected by gene array, RT-PCR, protein array and immunocytochemistry. While focusing attention on the microenvironment, we considered the role of IGF-I in proliferation and survival of ovarian cancer cells. Indeed, IGF-I is a major regulator of different stages of cancer development. We studied the effect of exogenously added IGF-I on the regulation of ATP-binding cassette (ABC) genes (MDR1, MRP1, MRP2, MRP3, MRP5 and BCRP) in the ovarian cancer cell line OVCAR3 and validated the results obtained using the IGF-IR antagonist picropodophyllin. IGF-I regulates the expression of ABC genes in OVCAR3 cells via the PI3-kinase, MEK and JAK2/STAT3 signaling pathways. The OVCAR3 cell line when co-cultured with Hospicells showed a marked degree of drug resistance. The drug resistance observed could be amplified with exogenous IGF-I. Addition of IGF-IR inhibitor, however, reduced the degree of resistance in these exposed cells. Cells that were treated with anticancer drugs and then exposed to IGF-I showed an increase in drug resistance and, thereby, an increase in cell survival. This observation indicates that drug resistance of OVCAR3 cells increases when there is synergy between OVCAR3 cells and Hospicells and it is amplified when IGF-I was exogenously added. In conclusion, inhibition of IGF-IR and targeting of the JAK2/STAT3 signaling pathway can be a target for ovarian cancer therapy. PMID:23857432

  12. Pharmacophore modeling of nilotinib as an inhibitor of ATP-binding cassette drug transporters and BCR-ABL kinase using a three-dimensional quantitative structure-activity relationship approach.

    PubMed

    Shukla, Suneet; Kouanda, Abdul; Silverton, Latoya; Talele, Tanaji T; Ambudkar, Suresh V

    2014-07-07

    Nilotinib (Tasigna) is a tyrosine kinase inhibitor approved by the FDA to treat chronic phase chronic myeloid leukemia patients. It is also a transport substrate of the ATP-binding cassette (ABC) drug efflux transporters ABCB1 (P-glycoprotein, P-gp) and ABCG2 (BCRP), which may have an effect on the pharmacokinetics and toxicity of this drug. The goal of this study was to identify pharmacophoric features of nilotinib in order to potentially develop specific inhibitors of BCR-ABL kinase with minimal interactions with ABC drug transporters. Three-dimensional pharmacophore modeling and quantitative structure-activity relationship (QSAR) studies were carried out on a series of nilotinib analogues to identify chemical features that contribute to inhibitory activity of nilotinib against BCR-ABL kinase activity, P-gp, and ABCG2. Twenty-five derivatives of nilotinib were synthesized and were then tested to measure their activity to inhibit BCR-ABL kinase and to inhibit the function of ABC drug transporters. A set of in vitro experiments including kinase activity and cell-based transport assays and photolabeling of P-gp and ABCG2 with a transport substrate, [(125)I]-iodoarylazido-prazosin (IAAP), were carried out in isolated membranes to evaluate the potency of the derivatives to inhibit the function of ABC drug transporters and BCR-ABL kinase. Sixteen, fourteen, and ten compounds were selected as QSAR data sets, respectively, to generate PHASE v3.1 pharmacophore models for BCR-ABL kinase, ABCG2, and P-gp inhibitors. The IC50 values of these derivatives against P-gp, ABCG2, or BCR-ABL kinase were used to generate pharmacophore features required for optimal interactions with these targets. A seven-point pharmacophore (AADDRRR) for BCR-ABL kinase inhibitory activity, a six-point pharmacophore (ADHRRR) for ABCG2 inhibitory activity, and a seven-point pharmacophore (AADDRRR) for P-gp inhibitory activity were generated. The derived models clearly demonstrate high predictive power

  13. Pharmacophore Modeling of Nilotinib as an Inhibitor of ATP-Binding Cassette Drug Transporters and BCR-ABL Kinase Using a Three-Dimensional Quantitative Structure–Activity Relationship Approach

    PubMed Central

    2015-01-01

    Nilotinib (Tasigna) is a tyrosine kinase inhibitor approved by the FDA to treat chronic phase chronic myeloid leukemia patients. It is also a transport substrate of the ATP-binding cassette (ABC) drug efflux transporters ABCB1 (P-glycoprotein, P-gp) and ABCG2 (BCRP), which may have an effect on the pharmacokinetics and toxicity of this drug. The goal of this study was to identify pharmacophoric features of nilotinib in order to potentially develop specific inhibitors of BCR-ABL kinase with minimal interactions with ABC drug transporters. Three-dimensional pharmacophore modeling and quantitative structure–activity relationship (QSAR) studies were carried out on a series of nilotinib analogues to identify chemical features that contribute to inhibitory activity of nilotinib against BCR-ABL kinase activity, P-gp, and ABCG2. Twenty-five derivatives of nilotinib were synthesized and were then tested to measure their activity to inhibit BCR-ABL kinase and to inhibit the function of ABC drug transporters. A set of in vitro experiments including kinase activity and cell-based transport assays and photolabeling of P-gp and ABCG2 with a transport substrate, [125I]-iodoarylazido-prazosin (IAAP), were carried out in isolated membranes to evaluate the potency of the derivatives to inhibit the function of ABC drug transporters and BCR-ABL kinase. Sixteen, fourteen, and ten compounds were selected as QSAR data sets, respectively, to generate PHASE v3.1 pharmacophore models for BCR-ABL kinase, ABCG2, and P-gp inhibitors. The IC50 values of these derivatives against P-gp, ABCG2, or BCR-ABL kinase were used to generate pharmacophore features required for optimal interactions with these targets. A seven-point pharmacophore (AADDRRR) for BCR-ABL kinase inhibitory activity, a six-point pharmacophore (ADHRRR) for ABCG2 inhibitory activity, and a seven-point pharmacophore (AADDRRR) for P-gp inhibitory activity were generated. The derived models clearly demonstrate high predictive power

  14. Co-expression of pregnane X receptor and ATP-binding cassette sub-family B member 1 in peripheral blood: A prospective indicator for drug resistance prediction in non-small cell lung cancer

    PubMed Central

    KONG, QINGNUAN; HAN, ZENGLEI; ZUO, XIAOLI; WEI, HONGJUN; HUANG, WEIQING

    2016-01-01

    The aim of the present study was to investigate the protein expression profiling of pregnane X receptor (PXR) and ATP-binding cassette sub-family B member 1 (ABCB1; also known as MDR1 or P-gp), present in the peripheral blood mononuclear cells (PBMCs) and cancerous tissues of cases of non-small cell lung cancer (NSCLC). Furthermore, the study aimed to assess the feasibility of predicting drug resistance through the medium of PBMCs. Of the subjects included in the study, 37 were histopathologically diagnosed with NSCLC and 17 were control patients without cancer. ThinPrep liquid-based smears with cytosine were applied in the examination of the PBMCs and proved quite effective in preserving the morphology and surface antigens of the lymphocytes. Measurements of expression levels in the PBMCs and cancerous tissues were obtained by immunohistochemical means. The results showed that, with the exception of the selective PXR expression in the normal lung tissues, the two types of proteins existed extensively throughout the PBMCs, normal tissues and tumors. Among the cancer patients, prior to chemotherapy, a significant rise in ABCB1 expression could be observed in the PBMCs, together with a similar rise in ABCB1 and PXR expression in the tumor specimens. Marked upregulation of the two proteins was detected in the PBMCs following 1 cycle of first-line chemotherapy. ABCB1 expression, correlated with PXR, persisted mostly in the PBMCs and tissue samples. When bound to and activated by ligands, PXR translocates from the cytoplasm to the nucleus of the cells. PXR subsequently binds to its DNA response elements as a heterodimer with the retinoid X receptor. A PXR translocation of moderate or low differentiation was identified in 3 cases of adenocarcinoma, which were co-expressing the two genes in the PBMCs prior to chemotherapy. During follow-up visits, tumor recurrence was observed within 3 months in 5 cases, which were characterized by PXR translocation. These findings

  15. Co-expression of pregnane X receptor and ATP-binding cassette sub-family B member 1 in peripheral blood: A prospective indicator for drug resistance prediction in non-small cell lung cancer.

    PubMed

    Kong, Qingnuan; Han, Zenglei; Zuo, Xiaoli; Wei, Hongjun; Huang, Weiqing

    2016-05-01

    The aim of the present study was to investigate the protein expression profiling of pregnane X receptor (PXR) and ATP-binding cassette sub-family B member 1 (ABCB1; also known as MDR1 or P-gp), present in the peripheral blood mononuclear cells (PBMCs) and cancerous tissues of cases of non-small cell lung cancer (NSCLC). Furthermore, the study aimed to assess the feasibility of predicting drug resistance through the medium of PBMCs. Of the subjects included in the study, 37 were histopathologically diagnosed with NSCLC and 17 were control patients without cancer. ThinPrep liquid-based smears with cytosine were applied in the examination of the PBMCs and proved quite effective in preserving the morphology and surface antigens of the lymphocytes. Measurements of expression levels in the PBMCs and cancerous tissues were obtained by immunohistochemical means. The results showed that, with the exception of the selective PXR expression in the normal lung tissues, the two types of proteins existed extensively throughout the PBMCs, normal tissues and tumors. Among the cancer patients, prior to chemotherapy, a significant rise in ABCB1 expression could be observed in the PBMCs, together with a similar rise in ABCB1 and PXR expression in the tumor specimens. Marked upregulation of the two proteins was detected in the PBMCs following 1 cycle of first-line chemotherapy. ABCB1 expression, correlated with PXR, persisted mostly in the PBMCs and tissue samples. When bound to and activated by ligands, PXR translocates from the cytoplasm to the nucleus of the cells. PXR subsequently binds to its DNA response elements as a heterodimer with the retinoid X receptor. A PXR translocation of moderate or low differentiation was identified in 3 cases of adenocarcinoma, which were co-expressing the two genes in the PBMCs prior to chemotherapy. During follow-up visits, tumor recurrence was observed within 3 months in 5 cases, which were characterized by PXR translocation. These findings

  16. Kaempferol suppresses lipid accumulation in macrophages through the downregulation of cluster of differentiation 36 and the upregulation of scavenger receptor class B type I and ATP-binding cassette transporters A1 and G1.

    PubMed

    Li, Xiu-Ying; Kong, Ling-Xi; Li, Juan; He, Hai-Xia; Zhou, Yuan-Da

    2013-02-01

    The accumulation of foam cells in atherosclerotic lesions is a hallmark of early-stage atherosclerosis. Kaempferol has been shown to inhibit oxidized low-density lipoprotein (oxLDL) uptake by macrophages; however, the underlying molecular mechanisms are not yet fully investigated. In this study, we shown that treatment with kaempferol markedly suppresses oxLDL-induced macrophage foam cell formation, which occurs due to a decrease in lipid accumulation and an increase in cholesterol efflux from THP-1-derived macrophages. Additionally, the kaempferol treatment of macrophages led to the downregulation of cluster of differentiation 36 (CD36) protein levels, the upregulation of ATP-binding cassette (ABC) transporter A1 (ABCA1), scavenger receptor class B type I (SR-BI) and ABCG1 protein levels, while no effects on scavenger receptor A (SR-A) expression were observed. Kaempferol had similar effects on the mRNA and protein expression of ABCA1, SR-BI, SR-A, CD36 and ABCG1. The reduced CD36 expression following kaempferol treatment involved the inhibition of c-Jun-activator protein-1 (AP-1) nuclear translocation. The inhibition of AP-1 using the inhibitor, SP600125, confirmed this involvement, as the AP-1 inhibition significantly augmented the kaempferol-induced reduction in CD36 expression. Accordingly, the kaempferol-mediated suppression of lipid accumulation in macrophages was also augmented by SP600125. The increased expression of ABCA1, SR-BI and ABCG1 following kaempferol treatment was accompanied by the enhanced protein expression of heme oxygenase-1 (HO-1). This increase was reversed following the knockdown of the HO-1 gene using small hairpin RNA (shRNA). Moreover, the kaempferol-mediated attenuation of lipid accumulation and the promotion of cholesterol efflux was also inhibited by HO-1 shRNA. In conclusion, the c-Jun-AP‑1-dependent downregulation of CD36 and the HO-1-dependent upregulation of ABCG1, SR-BI and ABCA1 may mediate the beneficial effects of

  17. The rate of nuclear cytoplasmic protein transport is determined by the casein kinase II site flanking the nuclear localization sequence of the SV40 T-antigen.

    PubMed Central

    Rihs, H P; Jans, D A; Fan, H; Peters, R

    1991-01-01

    We have previously demonstrated [Rihs, H.-P. and Peters, R. (1989) EMBO J., 8, 1479-1484] that the nuclear transport of recombinant proteins in which short fragments of the SV40 T-antigen are fused to the amino terminus of Escherichia coli beta-galactosidase is dependent on both the nuclear localization sequence (NLS, T-antigen residues 126-132) and a phosphorylation-site-containing sequence (T-antigen residues 111-125). While the NLS determines the specificity, the rate of transport is controlled by the phosphorylation-site-containing sequence. The present study furthers this observation and examines the role of the various phosphorylation sites. Purified, fluorescently labeled recombinant proteins were injected into the cytoplasm of Vero or hepatoma (HTC) cells and the kinetics of nuclear transport measured by laser microfluorimetry. By replacing serine and threonine residues known to be phosphorylated in vivo, we identified the casein kinase II (CK-II) site S111/S112 to be the determining factor in the enhancement of the transport. Either of the residues 111 or 112 was sufficient to elicit the maximum transport enhancement. The other phosphorylation sites (S120, S123, T124) had no influence on the transport rate. Examination of the literature suggested that many proteins harboring a nuclear localization sequence also contain putative CK-II sites at a distance of approximately 10-30 amino acid residues from the NLS. CK-II has been previously implicated in the transmission of growth signals to the nucleus. Our results suggest that CK-II may exert this role by controlling the rate of nuclear protein transport. Images PMID:1848177

  18. Insights into the initiation of JC virus DNA replication derived from the crystal structure of the T-antigen origin binding domain.

    PubMed

    Meinke, Gretchen; Phelan, Paul J; Kalekar, Radha; Shin, Jong; Archambault, Jacques; Bohm, Andrew; Bullock, Peter A

    2014-02-01

    JC virus is a member of the Polyomavirus family of DNA tumor viruses and the causative agent of progressive multifocal leukoencephalopathy (PML). PML is a disease that occurs primarily in people who are immunocompromised and is usually fatal. As with other Polyomavirus family members, the replication of JC virus (JCV) DNA is dependent upon the virally encoded protein T-antigen. To further our understanding of JCV replication, we have determined the crystal structure of the origin-binding domain (OBD) of JCV T-antigen. This structure provides the first molecular understanding of JCV T-ag replication functions; for example, it suggests how the JCV T-ag OBD site-specifically binds to the major groove of GAGGC sequences in the origin. Furthermore, these studies suggest how the JCV OBDs interact during subsequent oligomerization events. We also report that the OBD contains a novel "pocket"; which sequesters the A1 & B2 loops of neighboring molecules. Mutagenesis of a residue in the pocket associated with the JCV T-ag OBD interfered with viral replication. Finally, we report that relative to the SV40 OBD, the surface of the JCV OBD contains one hemisphere that is highly conserved and one that is highly variable.

  19. Insights into the Initiation of JC Virus DNA Replication Derived from the Crystal Structure of the T-Antigen Origin Binding Domain

    PubMed Central

    Meinke, Gretchen; Phelan, Paul J.; Kalekar, Radha; Shin, Jong; Archambault, Jacques; Bohm, Andrew; Bullock, Peter A.

    2014-01-01

    JC virus is a member of the Polyomavirus family of DNA tumor viruses and the causative agent of progressive multifocal leukoencephalopathy (PML). PML is a disease that occurs primarily in people who are immunocompromised and is usually fatal. As with other Polyomavirus family members, the replication of JC virus (JCV) DNA is dependent upon the virally encoded protein T-antigen. To further our understanding of JCV replication, we have determined the crystal structure of the origin-binding domain (OBD) of JCV T-antigen. This structure provides the first molecular understanding of JCV T-ag replication functions; for example, it suggests how the JCV T-ag OBD site-specifically binds to the major groove of GAGGC sequences in the origin. Furthermore, these studies suggest how the JCV OBDs interact during subsequent oligomerization events. We also report that the OBD contains a novel “pocket”; which sequesters the A1 & B2 loops of neighboring molecules. Mutagenesis of a residue in the pocket associated with the JCV T-ag OBD interfered with viral replication. Finally, we report that relative to the SV40 OBD, the surface of the JCV OBD contains one hemisphere that is highly conserved and one that is highly variable. PMID:24586168

  20. Genetic variant of V825I in the ATP-binding cassette transporter A1 gene and serum lipid levels in the Guangxi Bai Ku Yao and Han populations

    PubMed Central

    2011-01-01

    Background Several genetic variants in the ATP-binding cassette transporter A1 (ABCA1) gene have associated with modifications of serum high-density lipoprotein cholesterol (HDL-C) levels and the susceptibility for coronary heart disease, but the findings are still controversial in diverse racial/ethnic groups. Bai Ku Yao is an isolated subgroup of the Yao minority in southern China. The present study was undertaken to detect the possible association of V825I (rs2066715) polymorphism in the ABCA1 gene and several environmental factors with serum lipid levels in the Guangxi Bai Ku Yao and Han populations. Methods A total of 677 subjects of Bai Ku Yao and 646 participants of Han Chinese were randomly selected from our previous stratified randomized cluster samples. Polymerase chain reaction and restriction fragment length polymorphism assay combined with gel electrophoresis were performed for the genotyping of V825I variant, and then confirmed by direct sequencing. Results The levels of serum total cholesterol (TC), HDL-C, apolipoprotein (Apo) AI and ApoB were lower in Bai Ku Yao than in Han (P < 0.01 for all). The frequency of G and A alleles was 57.4% and 42.6% in Bai Ku Yao, and 57.7% and 42.3% in Han (P > 0.05); respectively. The frequency of GG, GA and AA genotypes was 33.7%, 47.4% and 18.9% in Bai Ku Yao, and 33.4%, 48.6% and 18.0% in Han (P > 0.05); respectively. There was no difference in the genotypic and allelic frequencies between males and females in the both ethnic groups. The subjects with AA genotype in Bai Ku Yao had higher serum TC levels than the subjects with GG and GA genotypes (P < 0.05). The participants with AA genotype in Han had lower serum HDL-C and ApoAI levels than the participants with GG and GA genotypes (P < 0.05 for each), but these results were found in males but not in females. Multivariate linear regression analysis showed that the levels of TC in Bai Ku Yao and HDL-C and ApoAI in male Han were correlated with genotypes (P < 0

  1. A large-tumor-antigen-specific monoclonal antibody inhibits DNA replication of simian virus 40 minichromosomes in an in vitro elongation system.

    PubMed Central

    Stahl, H; Dröge, P; Zentgraf, H; Knippers, R

    1985-01-01

    In productively infected cells, a fraction of large-tumor antigen (T antigen) is tightly bound to replicating simian virus 40 (SV40) minichromosomes and does not dissociate at salt concentrations of greater than 1 M NaCl. We present electronmicrograms demonstrating the presence of T antigen on the replicated sections of replicating SV40 minichromosomes. We also show that the fraction of tightly bound T antigen is recognized by antibodies from mouse tumor serum and, more specifically, by a particular T-antigen-specific monoclonal antibody, PAb 1630. A second T-antigen-specific monoclonal antibody, PAb 101, does not react with the T-antigen fraction remaining on replicating SV40 chromatin at high salt concentrations. We used an in vitro replication system which allows, via semiconservative DNA replication, the completion of in vivo-initiated replicative intermediate DNA molecules. We show that monoclonal antibody PAb 1630, but not monoclonal antibody PAb 101, inhibits viral DNA replication. We discuss the possibility that SV40 T antigen may play a role in chain elongation during SV40 chromatin replication. Images PMID:2985809

  2. Existence of a low-affinity ATP-binding site in the unphosphorylated Ca2(+)-ATPase of sarcoplasmic reticulum vesicles: evidence from binding of 2',3'-O-(2,4,6-trinitrocyclohexadienylidene)-[3H]AMP and -[3H]ATP.

    PubMed

    Suzuki, H; Kubota, T; Kubo, K; Kanazawa, T

    1990-07-31

    ATP-binding sites in the unphosphorylated Ca2(+)-ATPase of sarcoplasmic reticulum vesicles were titrated with 2',3'-O-(2,4,6-trinitrocyclohexadienylidene)-[3H]AMP (TNP-AMP) or -[3H]ATP (TNP-ATP) in the absence of Ca2+ at pH 7.0 and 0 degrees C by using a centrifugation procedure. In some measurements, the bound TNP-nucleotides were chased with ATP. The data were analyzed by best-fit computer programs as well as by Scatchard plots. The results showed the existence of 1 mol of TNP-AMP binding sites with high affinity (Kd = 7.62 nM) per mole of phosphorylatable sites. The affinity of these sites for ATP (Kd = 10.1 microM) agreed with that of catalytic sites for ATP in the absence of Ca2+. The results further showed the existence of 2 mol of TNP-ATP binding sites with uniform affinity (Kd = 156 nM) per mole of phosphorylatable sites. Half of the bound TNP-ATP was fully chased by low concentrations of ATP. The affinity of this class of the sites for ATP (Kd = 8.9 microM) again agreed with that of catalytic sites for ATP. The other half of the bound TNP-ATP was fully chased only by much higher concentrations of ATP. Thus, the affinity of this class of the sites for ATP (Kd = 791 microM) was much lower than that of catalytic sites for ATP. Similar measurements were performed with sarcoplasmic reticulum vesicles pretreated by N-(iodoacetyl)-N'-(5-sulfo-1-naphthyl)ethylenediamine. Although the affinities for TNP-ATP and for ATP were appreciably altered by this pretreatment, the results were essentially the same as those obtained with native vesicles.(ABSTRACT TRUNCATED AT 250 WORDS)

  3. The cellular proteins which can associate specifically with polyomavirus middle T antigen in human 293 cells include the major human 70-kilodalton heat shock proteins.

    PubMed

    Pallas, D C; Morgan, W; Roberts, T M

    1989-11-01

    We compared the proteins which associate with middle T antigen (MT) of polyomavirus in human cells infected with Ad5(pymT), a recombinant adenovirus which directs the overexpression of MT, with the MT-associated proteins (MTAPs) previously identified in murine fibroblasts expressing MT. MTAPs of 27, 29, 36, and 63 kilodaltons (kDa) appeared to be fairly well conserved between the two species, as judged by comigration on two-dimensional gels. Several 61-kDa MTAP species detected in MT immunoprecipitates from both cell sources also comigrated on these gels. However, no protein comigrating precisely with the murine 85-kDa MTAP could be detected in the human cells. Furthermore, two proteins of 72 and 74 kDa associated with wild-type MT in the infected human cells but not in murine fibroblasts expressing MT. It had been previously reported for murine cells that the 70-kDa heat shock protein associates with a particular mutant MT but not with wild-type MT (G. Walter, A. Carbone, and W.J. Welch, J. Virol. 61:405-410, 1987). By the criteria of comigration on two-dimensional gels, tryptic peptide mapping, and immunoblotting, we showed that the 72- and 74-kDa proteins that associate with wild-type MT in human cells are the major human 70-kDa heat shock proteins.

  4. Model for T-Antigen-Dependent Melting of the Simian Virus 40 Core Origin Based on Studies of the Interaction of the Beta-Hairpin with DNA▿

    PubMed Central

    Kumar, Anuradha; Meinke, Gretchen; Reese, Danielle K.; Moine, Stephanie; Phelan, Paul J.; Fradet-Turcotte, Amélie; Archambault, Jacques; Bohm, Andrew; Bullock, Peter A.

    2007-01-01

    The interaction of simian virus 40 (SV40) T antigen (T-ag) with the viral origin has served as a model for studies of site-specific recognition of a eukaryotic replication origin and the mechanism of DNA unwinding. These studies have revealed that a motif termed the “beta-hairpin” is necessary for assembly of T-ag on the SV40 origin. Herein it is demonstrated that residues at the tip of the “beta-hairpin” are needed to melt the origin-flanking regions and that the T-ag helicase domain selectively assembles around one of the newly generated single strands in a manner that accounts for its 3′-to-5′ helicase activity. Furthermore, T-ags mutated at the tip of the “beta-hairpin” are defective for oligomerization on duplex DNA; however, they can assemble on hybrid duplex DNA or single-stranded DNA (ssDNA) substrates provided the strand containing the 3′ extension is present. Collectively, these experiments indicate that residues at the tip of the beta-hairpin generate ssDNA in the core origin and that the ssDNA is essential for subsequent oligomerization events. PMID:17287270

  5. Analysis of the Costructure of the Simian Virus 40 T-Antigen Origin Binding Domain with Site I Reveals a Correlation between GAGGC Spacing and Spiral Assembly

    PubMed Central

    Meinke, Gretchen; Phelan, Paul J.; Harrison, Celia J.

    2013-01-01

    Polyomavirus origins of replication contain multiple occurrences of G(A/G)GGC, the high-affinity binding element for the viral initiator T-antigen (T-ag). The site I regulatory region of simian virus 40, involved in the repression of transcription and the enhancement of DNA replication initiation, contains two GAGGC sequences arranged head to tail and separated by a 7-bp AT-rich sequence. We have solved a 3.2-Å costructure of the SV40 origin-binding domain (OBD) bound to site I. We have also established that T-ag assembly on site I is limited to the formation of a single hexamer. These observations have enabled an analysis of the role(s) of the OBDs bound to the site I pentanucleotides in hexamer formation. Of interest, they reveal a correlation between the OBDs bound to site I and a pair of OBD subunits in the previously described hexameric spiral structure. Based on these findings, we propose that spiral assembly is promoted by pentanucleotide pairs arranged in a head-to-tail manner. Finally, the possibility that spiral assembly by OBD subunits accounts for the heterogeneous distribution of pentanucleotides found in the origins of replication of polyomaviruses is discussed. PMID:23269808

  6. Analysis of the costructure of the simian virus 40 T-antigen origin binding domain with site I reveals a correlation between GAGGC spacing and spiral assembly.

    PubMed

    Meinke, Gretchen; Phelan, Paul J; Harrison, Celia J; Bullock, Peter A

    2013-03-01

    Polyomavirus origins of replication contain multiple occurrences of G(A/G)GGC, the high-affinity binding element for the viral initiator T-antigen (T-ag). The site I regulatory region of simian virus 40, involved in the repression of transcription and the enhancement of DNA replication initiation, contains two GAGGC sequences arranged head to tail and separated by a 7-bp AT-rich sequence. We have solved a 3.2-Å costructure of the SV40 origin-binding domain (OBD) bound to site I. We have also established that T-ag assembly on site I is limited to the formation of a single hexamer. These observations have enabled an analysis of the role(s) of the OBDs bound to the site I pentanucleotides in hexamer formation. Of interest, they reveal a correlation between the OBDs bound to site I and a pair of OBD subunits in the previously described hexameric spiral structure. Based on these findings, we propose that spiral assembly is promoted by pentanucleotide pairs arranged in a head-to-tail manner. Finally, the possibility that spiral assembly by OBD subunits accounts for the heterogeneous distribution of pentanucleotides found in the origins of replication of polyomaviruses is discussed.

  7. Cooperation between the polyomavirus Middle-T-antigen gene and the human c-myc oncogene in a rat thyroid epithelial differentiated cell line: Model of in vitro progression

    SciTech Connect

    Berlingieri, M.T.; Portella, G.; Grieco, M.; Santoro, M.; Fusco, A.

    1988-05-01

    Two rat thyroid epithelial differentiated cell lines, PC CI 3 and PC myc, were infected with the polyoma murine leukemia virus (PyMLV) carrying the Middle-T-antigen gene of polyomavirus. After infection, both cell lines acquired the typical markers of neoplastic transformation; however, the PC myc cells showed a greater malignant phenotype. Furthermore, the thyroid differentiated functions were completely suppressed in PC myc cells transformed by PyMLV, whereas they were, at least partially, retained in PC CI 3 cells transformed by PyMLV, and in particular, thyroglobulin synthesis and secretion were not affected at all. Since no differences in the expression of the middle-T-antigen gene were observed in the two PyMLV-transformed cell lines, the different properties shown by these two infected cell lines must be ascribed to the expression of the c-myc oncogene.

  8. Overexpression of α2,3sialyl T-antigen in breast cancer determined by miniaturized glycosyltransferase assays and confirmed using tissue microarray immunohistochemical analysis

    PubMed Central

    Patil, Shilpa A.; Bshara, Wiam; Morrison, Carl; Chandrasekaran, E. V.; Matta, Khushi L.; Neelamegham, Sriram

    2014-01-01

    Glycan structure alterations during cancer regulate disease progression and represent clinical biomarkers. The study determined the degree to which changes in glycosyl transferase activities during cancer can be related to aberrant cell-surface tumor associated carbohydrate structures (TACA). To this end, changes in sialyltransferase (sialylT), fucosyltransferase (fucT) and galactosyltransferase (galT) activity were measured in normal and tumor tissue using a miniaturized enzyme activity assay and synthetic glycoconjugates bearing terminal LacNAc Type-I (Galβ1,3GlcNAc), LacNAc Type-II (Galβ1,4GlcNAc), and mucin core-1/Type-III (Galβ1,3GalNAc) structures. These data were related to TACA using tissue microarrays containing 115 breast and 26 colon cancer specimen. The results show that primary human breast and colon tumors, but not adjacent normal tissue, express elevated β1,3 galT and α2,3sialylT activity that can form α2,3sialylated Type-III glycans (Siaα2,3Galβ1,3GalNAc). Prostate tumors did not exhibit such elevated enzymatic activities. α1,3/4fucT activity was higher in breast, but not colon tissue. The enzymology based prediction of enhanced α2,3sialylated Type-III structures in breast tumors was verified using histochemical analysis of tissue sections and tissue microarrays. Here, the binding of two markers that recognize Galβ1,3GalNAc (peanut lectin and mAb A78-G/A7) was elevated in breast tumor, but not normal control, only upon sialidase treatment. These antigens were also upregulated in colon tumors though to a lesser extent. α2,3sialylated Type-III expression correlated inversely with patient HER2 expression and breast metastatic potential. Overall, enzymology measurements of glycoT activity predict glycan structure changes during cancer. High expression of the α2,3sialylated T-antigen O-glycans occur in breast tumors. A transformation from linear core-1 glycan to other epitopes may accompany metastasis. PMID:25142811

  9. Pathologic progression of mammary carcinomas in a C3(1)/SV40 T/t-antigen transgenic rat model of human triple-negative and Her2-positive breast cancer.

    PubMed

    Hoenerhoff, M J; Shibata, M A; Bode, A; Green, J E

    2011-04-01

    The C3(1) component of the rat prostate steroid binding protein has been used to target expression of the SV40 T/t-antigen to the mammary epithelium of mice resulting in pre-neoplastic lesions that progress to invasive and metastatic cancer with molecular features of human basal-type breast cancer. However, there are major differences in the histologic architecture of the stromal and epithelial elements between the mouse and human mammary glands. The rat mammary gland is more enriched with epithelial and stromal components than the mouse and more closely resembles the cellular composition of the human gland. Additionally, existing rat models of mammary cancer are typically estrogen receptor positive and hormone responsive, unlike most genetically engineered mouse mammary cancer models. In an attempt to develop a mammary cancer model that might more closely resemble the pathology of human breast cancer, we generated a novel C3(1)/SV40 T/t-antigen transgenic rat model that developed progressive mammary lesions leading to highly invasive adenocarcinomas. However, aggressive tumor development prevented the establishment of transgenic lines. Characterization of the tumors revealed that they were primarily estrogen receptor and progesterone receptor negative, and either her2/neu positive or negative, resembling human triple-negative or Her2 positive breast cancer. Tumors expressed the basal marker K14, as well as the luminal marker K18, and were negative for smooth muscle actin. The triple negative phenotype has not been previously reported in a rat mammary cancer model. Further development of a C3(1)SV40 T/t-antigen based model could establish valuable transgenic rat lines that develop basal-type mammary tumors.

  10. MicroRNA-320a and microRNA-4496 attenuate Helicobacter pylori cytotoxin-associated gene A (CagA)-induced cancer-initiating potential and chemoresistance by targeting β-catenin and ATP-binding cassette, subfamily G, member 2.

    PubMed

    Kang, Dong Woo; Yang, Eun Sun; Noh, Yu Na; Hwang, Won Chan; Jo, Se-Young; Suh, Young-Ah; Park, Won Sang; Choi, Kang-Yell; Min, Do Sik

    2017-04-01

    Infection with Helicobacter pylori is closely linked to an increased risk of gastric cancer. Although cytotoxin-associated gene A (CagA), a major virulence factor of H. pylori, is known to be a causal factor for gastric carcinogenesis, the molecular link between CagA and gastric cancer-initiating cell (CIC)-like properties remains elusive. Here, we demonstrate that CagA is required for increased expression of β-catenin and its target CIC markers via downregulation of microRNA (miR)-320a and miR-4496. CagA promoted gastric CIC properties and was responsible for chemoresistance. miR-320a and miR-4496 attenuated the in vitro self-renewal and tumour-initiating capacity of CagA-expressing CICs by targeting β-catenin. Moreover, miR-320a and miR-4496 decreased CagA-induced chemoresistance by targeting ATP-binding cassette, subfamily G, member 2 (ABCG2) at the transcriptional and post-transcriptional levels, respectively. Combination therapy with 5-fluorouracil and miR-320a/miR-4496 suppressed gastric tumourigenesis and metastatic potential in an orthotopic mouse model, probably via suppression of CagA-induced CIC properties and chemoresistance. Our results provide novel evidence that CIC properties, chemoresistance and tumourigenesis associated with H. pylori are linked to CagA-induced upregulation of β-catenin and ABCG2. These data provide novel insights into the molecular mechanisms of CagA-induced carcinogenisis and the therapeutic potential of of miR-320a and miR-4496. Copyright © 2016 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.

  11. Template Supercoiling during ATP-Dependent DNA Helix Tracking: Studies with Simian Virus 40 Large Tumor Antigen

    NASA Astrophysics Data System (ADS)

    Yang, Liu; Jessee, C. Bret; Lau, Kawai; Zhang, Hui; Liu, Leroy F.

    1989-08-01

    Incubation of topologically relaxed plasmid DNA with simian virus 40 (SV40) large tumor antigen (T antigen), ATP, and eubacterial DNA topoisomerase I resulted in the formation of highly positively supercoiled DNA. Eukaryotic DNA topoisomerase I could not substitute for eubacterial DNA topoisomerase I in this reaction. Furthermore, the addition of eukaryotic topoisomerase I to a preincubated reaction mixture containing both T antigen and eubacterial topoisomerase I caused rapid relaxation of the positively supercoiled DNA. These results suggest that SV40 T antigen can introduce topoisomerase-relaxable supercoils into DNA in a reaction coupled to ATP hydrolysis. We interpret the observed T antigen supercoiling reaction in terms of a recently proposed twin-supercoiled-domain model that describes the mechanics of DNA helix-tracking processes. According to this model, positive and negative supercoils are generated ahead of and behind the moving SV40 T antigen, respectively. The preferential relaxation of negative supercoils by eubacterial DNA topoisomerase I explains the accumulation of positive supercoils in the DNA template. The supercoiling assay using DNA conformation-specific eubacterial DNA topoisomerase I may be of general use for the detection of ATP-dependent DNA helix-tracking proteins.

  12. Synthesis and Structure-Activity Relationships of Small Molecule Inhibitors of the Simian Virus 40 T Antigen Oncoprotein, an Anti-Polyomaviral Target

    PubMed Central

    Gupta, Tushar; Seguin, Sandlin P.; Liang, Mary; Resnick, Lynn; Goldberg, Margot T.; Manos-Turvey, Alexandra; Pipas, James M.; Wipf, Peter; Brodsky, Jeffrey L.

    2014-01-01

    Polyomavirus infections are common and relatively benign in the general human population but can become pathogenic in immunosuppressed patients. Because most treatments for polyomavirus-associated diseases nonspecifically target DNA replication, existing treatments for polyomavirus infection possess undesirable side effects. However, all polyomaviruses express Large Tumor Antigen (T Ag), which is unique to this virus family and may serve as a therapeutic target. Previous screening of pyrimidinone-peptoid hybrid compounds identified MAL2-11B and a MAL2-11B tetrazole derivative as inhibitors of viral replication and T Ag ATPase activity (IC50 of ~20-50μM). To improve upon this scaffold and to develop a structure-activity relationship for this new class of antiviral agents, several iterative series of MAL2-11B derivatives were synthesized. The replacement of a flexible methylene chain linker with a benzyl group or, alternatively, the addition of an ortho-methyl substituent on the biphenyl side chain in MAL2-11B yielded analogs with modestly improved IC50s (~15 μM), which retained antiviral activity. After combining both structural motifs, a new lead compound was identified that inhibited T Ag ATPase activity with an IC50 of ~5 μM. We suggest that the knowledge gained from the structure-activity relationship and a further refinement cycle of the MAL2-11B scaffold will provide a specific, novel therapeutic treatment option for polyomavirus infections and their associated diseases. PMID:25440730

  13. Purified JC virus T antigen derived from insect cells preferentially interacts with binding site II of the viral core origin under replication conditions.

    PubMed

    Bollag, B; Mackeen, P C; Frisque, R J

    1996-04-01

    The human polyomavirus JC virus (JCV) establishes persistent, asymptomatic infections in most individuals, but in severely immunocompromised hosts it may cause the fatal demyelinating brain disease progressive multifocal leukoencephalopathy. In cell culture JCV multiplies inefficiently and exhibits a narrow host range. This restricted behavior occurs, in part, at the level of DNA replication, which is regulated by JCV's multifunctional large tumor protein (TAg). To prepare purified JCV TAg (JCT) for biochemical analyses, the recombinant baculovirus B-JCT was generated by cotransfection of insect cells with wild-type baculovirus and the vector pVL-JCT(Int-) containing the JCT-coding sequence downstream of the efficient polyhedrin promoter. JCT expressed in infected cells was immunoaffinity purified using the anti-JCT monoclonal antibody PAb 2000. Characterization of the viral oncoprotein indicated that it exists in solution as a mixture of monomeric and oligomeric species. With the addition of ATP, the population of monomers decreased and that of hexamers and double hexamers increased. A DNA mobility shift assay indicated that origin binding occurred primarily with the double-hexamer form. A comparison of the specific DNA-binding activities of JCT and SV40 TAg (SVT) revealed that JCT generally exhibited greater affinity for binding site II relative to binding site I (B.S. I) of both viral origin regions, whereas SVT preferentially bound B.S. I. Furthermore, JCT bound nonviral DNA more efficiently than did SVT. These functional differences between the two TAgs may contribute to the reduced DNA replication potential of JCV in vitro, and to the virus' ability to establish persistent infections in vivo.

  14. Analyses of the interaction between the origin binding domain from simian virus 40 T antigen and single-stranded DNA provide insights into DNA unwinding and initiation of DNA replication.

    PubMed

    Reese, Danielle K; Meinke, Gretchen; Kumar, Anuradha; Moine, Stephanie; Chen, Kathleen; Sudmeier, James L; Bachovchin, William; Bohm, Andrew; Bullock, Peter A

    2006-12-01

    DNA helicases are essential for DNA metabolism; however, at the molecular level little is known about how they assemble or function. Therefore, as a model for a eukaryotic helicase, we are analyzing T antigen (T-ag) the helicase encoded by simian virus 40. In this study, nuclear magnetic resonance (NMR) methods were used to investigate the transit of single-stranded DNA (ssDNA) through the T-ag origin-binding domain (T-ag OBD). When the residues that interact with ssDNA are viewed in terms of the structure of a hexamer of the T-ag OBD, comprised of residues 131 to 260, they indicate that ssDNA passes over one face of the T-ag OBD and then transits through a gap in the open ring structure. The NMR-based conclusions are supported by an analysis of previously described mutations that disrupt critical steps during the initiation of DNA replication. These and related observations are discussed in terms of the threading of DNA through T-ag hexamers and the initiation of viral DNA replication.

  15. Analyses of the Interaction between the Origin Binding Domain from Simian Virus 40 T Antigen and Single-Stranded DNA Provide Insights into DNA Unwinding and Initiation of DNA Replication▿

    PubMed Central

    Reese, Danielle K.; Meinke, Gretchen; Kumar, Anuradha; Moine, Stephanie; Chen, Kathleen; Sudmeier, James L.; Bachovchin, William; Bohm, Andrew; Bullock, Peter A.

    2006-01-01

    DNA helicases are essential for DNA metabolism; however, at the molecular level little is known about how they assemble or function. Therefore, as a model for a eukaryotic helicase, we are analyzing T antigen (T-ag) the helicase encoded by simian virus 40. In this study, nuclear magnetic resonance (NMR) methods were used to investigate the transit of single-stranded DNA (ssDNA) through the T-ag origin-binding domain (T-ag OBD). When the residues that interact with ssDNA are viewed in terms of the structure of a hexamer of the T-ag OBD, comprised of residues 131 to 260, they indicate that ssDNA passes over one face of the T-ag OBD and then transits through a gap in the open ring structure. The NMR-based conclusions are supported by an analysis of previously described mutations that disrupt critical steps during the initiation of DNA replication. These and related observations are discussed in terms of the threading of DNA through T-ag hexamers and the initiation of viral DNA replication. PMID:17005644

  16. Structural Based Analyses of the JC Virus T-Antigen F258L Mutant Provides Evidence for DNA Dependent Conformational Changes in the C-Termini of Polyomavirus Origin Binding Domains

    PubMed Central

    Meinke, Gretchen; Phelan, Paul J.; Shin, Jong; Gagnon, David; Archambault, Jacques; Bohm, Andrew; Bullock, Peter A.

    2016-01-01

    The replication of human polyomavirus JCV, which causes Progressive Multifocal Leukoencephalopathy, is initiated by the virally encoded T-antigen (T-ag). The structure of the JC virus T-ag origin-binding domain (OBD) was recently solved by X-ray crystallography. This structure revealed that the OBD contains a C-terminal pocket, and that residues from the multifunctional A1 and B2 motifs situated on a neighboring OBD molecule dock into the pocket. Related studies established that a mutation in a pocket residue (F258L) rendered JCV T-ag unable to support JCV DNA replication. To establish why this mutation inactivated JCV T-ag, we have solved the structure of the F258L JCV T-ag OBD mutant. Based on this structure, it is concluded that the structural consequences of the F258L mutation are limited to the pocket region. Further analyses, utilizing the available polyomavirus OBD structures, indicate that the F258 region is highly dynamic and that the relative positions of F258 are governed by DNA binding. The possible functional consequences of the DNA dependent rearrangements, including promotion of OBD cycling at the replication fork, are discussed. PMID:26735515

  17. Structural Based Analyses of the JC Virus T-Antigen F258L Mutant Provides Evidence for DNA Dependent Conformational Changes in the C-Termini of Polyomavirus Origin Binding Domains.

    PubMed

    Meinke, Gretchen; Phelan, Paul J; Shin, Jong; Gagnon, David; Archambault, Jacques; Bohm, Andrew; Bullock, Peter A

    2016-01-01

    The replication of human polyomavirus JCV, which causes Progressive Multifocal Leukoencephalopathy, is initiated by the virally encoded T-antigen (T-ag). The structure of the JC virus T-ag origin-binding domain (OBD) was recently solved by X-ray crystallography. This structure revealed that the OBD contains a C-terminal pocket, and that residues from the multifunctional A1 and B2 motifs situated on a neighboring OBD molecule dock into the pocket. Related studies established that a mutation in a pocket residue (F258L) rendered JCV T-ag unable to support JCV DNA replication. To establish why this mutation inactivated JCV T-ag, we have solved the structure of the F258L JCV T-ag OBD mutant. Based on this structure, it is concluded that the structural consequences of the F258L mutation are limited to the pocket region. Further analyses, utilizing the available polyomavirus OBD structures, indicate that the F258 region is highly dynamic and that the relative positions of F258 are governed by DNA binding. The possible functional consequences of the DNA dependent rearrangements, including promotion of OBD cycling at the replication fork, are discussed.

  18. 12-O-tetradecanoylphorbol-13-acetate stimulates phosphorylation of the 58,000-M/sub r/ form of polyomavirus middle T antigen in vivo: implications for a possible role of protein kinase C in Middle T function

    SciTech Connect

    Matthews, J.T.; Benjamin, T.L.

    1986-05-01

    The 58,000-M/sub r/ form (58K form) of the polyomavirus middle T antigen (mT) is a minor species distinguished by its phosphorylation in vivo on serine and by its efficient phosphorylation on tyrosine in immune complexes. The authors report that the tumor promoter 12-O-tetradecanoylphorbol-13-acetate (TPA), an activator of protein kinase C, rapidly stimulates phosphorylation of this mT species when added to cultures of wild-type polyomavirus-infected or polyomavirus-transformed 3T3 cells. Incubation with TPA leads to an accumulation of the 58K mT species to levels 1.5- to 5-fold higher than that in untreated cells within 15 min. TPA specifically stimulates phosphorylation of the 58K mT species without affecting that of the 56K species. Mapping by partial proteolysis shows that TPA-stimulated phosphorylation occurs at or near the site in 58K mT that is normally phosphorylated in the absence of TPA. A synthetic diacyl glycerol, 1-oleoyl-2-acetyl-glycerol, also specifically stimulates phosphorylation of 58K mT in vivo, while an inactive phorbol analog does not. TPA fails to induce phosphorylation of a 58K mT species encoded by certain nontransforming virus mutants with altered mT proteins that normally fail to undergo phosphorylation at the 58K site. These results indicate that the 58K form of mT is phosphorylated by or through the action of protein kinase C. TPA treatment of infected cells also leads to increased levels of 58K mT as measured in the immune complex kinase reaction, in which mT becomes phosphorylated on tyrosine by pp60/sup c-src/.

  19. The simian virus 40 minimal origin and the 72-base-pair repeat are required simultaneously for efficient induction of late gene expression with large tumor antigen.

    PubMed

    Hartzell, S W; Byrne, B J; Subramanian, K N

    1984-10-01

    We have studied the temporal regulation of simian virus 40 (SV40) late gene expression by construction and transient expression analysis of plasmids containing the transposon Tn9 chloramphenicol acetyltransferase gene placed downstream from the late control region. The SV40 origin region in the early (but not the late) orientation promotes chloramphenicol acetyltransferase gene expression efficiently in monkey cells lacking large tumor (T) antigen. In monkey cells producing T antigen, the promoter activity of the late control region is induced by approximately 1,000-fold above the basal level. By deletion and point mutagenesis, we define two domains of the late control region required for efficient induction with T antigen. Domain I is the minimal replication origin containing T-antigen binding site II. Domain II consists of the 72-base-pair (bp) repeat and a 19-bp downstream sequence up to nucleotide 270. Domains I and II should act synergistically because the absence of either one or the other decreases induction efficiency by 2 orders of magnitude. Though a complete copy of domain II is optimal, the origin-proximal 22-bp portion of this domain is sufficient. The 21-bp repeat, located between domains I and II, is dispensable for this induction, as are sequences located downstream from nucleotide 270 in the late orientation.

  20. Coupling between ATP Binding and DNA Cleavage by DNA Topoisomerase II

    PubMed Central

    Mueller-Planitz, Felix; Herschlag, Daniel

    2008-01-01

    DNA topoisomerase II is a molecular machine that couples ATP hydrolysis to the transport of one DNA segment through a transient break in another segment. To learn about the energetic connectivity that underlies this coupling, we investigated how the ATPase domains exert control over DNA cleavage. We dissected the DNA cleavage reaction by measuring rate and equilibrium constants for the individual reaction steps utilizing defined DNA duplexes in the presence and absence of the nonhydrolyzable ATP analog 5′-adenylyl-β,γ-imidodiphosphate (AMPPNP). Our results revealed the existence of two enzyme conformations whose relative abundance is sensitive to the presence of nucleotides. The predominant species in the absence of nucleotides binds DNA at a diffusion limited rate but cannot efficiently cleave DNA. In the presence of AMPPNP, most of the enzyme is converted to a state in which DNA binding and release is extremely slow but which allows DNA cleavage. A minimal kinetic and thermodynamic framework is established that accounts for the cooperativity of cleavage of the two DNA strands in the presence and absence of bound AMPPNP and includes conformational steps revealed in the kinetic studies. The model unifies available kinetic, thermodynamic, and structural data to provide a description for the reaction in terms of the order and rate of individual reaction steps and the physical nature of the species on the reaction path. Furthermore, this reaction framework provides a foundation for a future in-depth analysis of energy transduction by topoisomerase II, for guiding and interpreting future structural studies, and for analyzing the mechanism of drugs that convert topoisomerase into a cellular poison. PMID:18403371

  1. ATP-binding cassette G5/G8 deficiency causes hypertriglyceridemia by affecting multiple metabolic pathways.

    PubMed

    Méndez-González, Jesús; Julve, Josep; Rotllan, Noemí; Llaverias, Gemma; Blanco-Vaca, Francisco; Escolà-Gil, Joan Carles

    2011-12-01

    Mutations in ABCG5 or ABCG8 transporters are responsible for sitosterolemia, an autosomal recessive disease characterized by the accumulation of plant sterols. The aim of this study was to investigate the effects of ABCG5 and ABCG8 deficiency on TG metabolism in mice. Experiments were carried out in wild-type (G5/G8+/+) mice, mice heterozygous for ABCG5 and ABCG8 deficiency (G5/G8+/-) and ABCG5/G8-deficient (G5/G8-/-) mice fed a chow diet. Plasma TG were 2.6 and 4.3-fold higher in fasted G5/G8+/- and G5/G8-/- mice, respectively, than in G5/G8+/+ mice. Postprandial TG were 5-fold higher in G5/G8-/- mice. TG metabolism studies indicate that: first, the fractional catabolic rate was significantly lower in G5/G8+/- (1.3-fold) and G5/G8-/- mice (1.5-fold) compared to G5/G8+/+ and postheparin plasma lipoprotein lipase activities were significantly lower in G5/G8+/- (1.8-fold) and G5/G8-/- mice (5.4-fold) than in G5/G8+/+. Second, liver TG secretion was 1.3-fold higher in G5/G8+/- and G5/G8-/- than in G5/G8+/+ mice and this was associated with an increase in liver LXR, FAS, ACAC and CD36 gene expression. Third, TG intestinal secretion, determined after an oral fat gavage of glycerol tri[9,10(n)-(3)H] oleate, was 5.8-fold higher in G5/G8-/- than in G5/G8+/+ mice. Also, the HOMA index was 2.6-fold higher in G5/G8-/- than in G5/G8+/+ mice, reflecting a degree of insulin resistance. In conclusion, ABCG5/G8 deficiency in mice fed a chow diet markedly raises TG levels by impairing TG catabolism and by increasing liver and intestinal TG secretion.

  2. ATP-binding cassette transporter enhances tolerance to DDT in Tetrahymena.

    PubMed

    Ning, YingZhi; Dang, Huai; Liu, GuangLong; Xiong, Jie; Yuan, DongXia; Feng, LiFang; Miao, Wei

    2015-03-01

    The reuse of dichlorodiphenyltrichloroethane (DDT) as an indoor residual spray was permitted by the World Health Organization in 2007, and approximately 14 countries still use DDT to control disease vectors. The extensive exposure of insects to DDT has resulted in the emergence of DDT resistance, especially in mosquitoes, and the mechanism for this resistance in mosquitoes has been widely reported. Spraying can also introduce DDT directly into surface water, and DDT can subsequently accumulate in microorganisms, but the mechanism for the resistance to DDT degradation in microorganisms is unclear. Using whole-genome microarray analysis, we detected an abcb15 gene that was up-regulated in a specific manner by DDT treatment in T. thermophile. The deduced ABCB15 peptide sequence had two transmembrane domains (TMDs) and two nucleotide-binding domains (NBDs) to form the structure TMD-NBD-TMD-NBD, and each NBD contained three conserved motifs: Walker-A, C-loop, and Walker-B, which indicated the T. thermophila abcb15 was a typical ABC transporter gene. The expression of ABCB15 fused with a C-terminal green fluorescent protein was found to be on the periphery of the cell, suggesting that ABCB15 was a membrane pump protein. In addition, cells with abcb15 partially knocked down (abcb15-KD) grew slower than wild-type cells in the presence of 256 mg L(-1) DDT, indicating the tolerance of abcb15-KD strain to DDT exposure was decreased. Thus, we suggest that in Tetrahymena, the membrane pump protein encoded by ABCT gene abcb15 can enhance the tolerance to DDT and protect cells from this exogenous toxin by efficiently pumping it to the extracellular space.

  3. The Streptomyces ATP-binding component MsiK assists in cellobiose and maltose transport.

    PubMed Central

    Schlösser, A; Kampers, T; Schrempf, H

    1997-01-01

    Streptomyces reticuli harbors an msiK gene which encodes a protein with an amino acid identify of 90% to a corresponding protein previously identified in Streptomyces lividans. Immunological studies revealed that S. lividans and S. reticuli synthesize their highest levels of MsiK during growth with cellobiose, but not with glucose. Moreover, moderate amounts of MsiK are produced by both species in the course of growth with maltose, melibiose, and xylose and by S. lividans in the presence of xylobiose and raffinose. In contrast, a recently identified cellobiose-binding protein and its distantly related homolog were only found if S. reticuli or S. lividans, respectively, was cultivated with cellobiose. Uptake of cellobiose and maltose was tested and ascertained for S. reticuli and S. lividans, but not for an msiK S. lividans mutant. However, transformants of this mutant carrying the S. reticuli or S. lividans msiK gene on a multicopy plasmid had regained the ability to transport both sugars. The data show that MsiK assists two ABC transport systems. PMID:9068663

  4. Coordinating Role of His216 in MgATP Binding and Cleavage in Pyruvate Carboxylase

    PubMed Central

    2015-01-01

    His216 is a well-conserved residue in pyruvate carboxylases and, on the basis of structures of the enzyme, appears to have a role in the binding of MgATP, forming an interaction with the 3′-hydroxyl group of the ribose ring. Mutation of this residue to asparagine results in a 9-fold increase in the Km for MgATP in its steady-state cleavage in the absence of pyruvate and a 3-fold increase in the Km for MgADP in its steady-state phosphorylation by carbamoyl phosphate. However, from single-turnover experiments of MgATP cleavage, the Kd of the enzyme·MgATP complex is essentially the same in the wild-type enzyme and H216N. Direct stopped-flow measurements of nucleotide binding and release using the fluorescent analogue FTP support these observations. However, the first-order rate constant for MgATP cleavage in the single-turnover experiments in H216N is only 0.75% of that for the wild-type enzyme, and thus, the MgATP cleavage step is rate-limiting in the steady state for H216N but not for the wild-type enzyme. Close examination of the structure of the enzyme suggested that His216 may also interact with Glu218, which in turn interacts with Glu305 to form a proton relay system involved in the deprotonation of bicarbonate. Single-turnover MgATP cleavage experiments with mutations of these two residues resulted in kinetic parameters similar to those observed in H216N. We suggest that the primary role of His216 is to coordinate the binding of MgATP and the deprotonation of bicarbonate in the reaction to form the putative carboxyphosphate intermediate by participation in a proton relay system involving Glu218 and Glu305. PMID:24460480

  5. ATP alone triggers the outward facing conformation of the maltose ATP-binding cassette transporter.

    PubMed

    Bao, Huan; Duong, Franck

    2013-02-01

    The maltose transporter MalFGK(2) is a study prototype for ABC importers. During catalysis, the MalFG membrane domain alternates between inward and outward facing conformations when the MalK dimer closes and hydrolyzes ATP. Because a rapid ATP hydrolysis depends on MalE and maltose, it has been proposed that closed liganded MalE facilitates the transition to the outward facing conformation. Here we find that, in contrast to the expected, ATP is sufficient for the closure of MalK and for the conversion of MalFG to the outward facing state. The outward facing transporter binds MalE with nanomolar affinity, yet neither MalE nor maltose is necessary or facilitates the transition. Thus, the rapid hydrolysis of ATP observed in the presence of MalE and maltose is not because closed liganded MalE accelerates the formation of the outward facing conformation. These findings have fundamental implications for the description of the transport reaction.

  6. Probing the ATP-Binding Pocket of Protein Kinase DYRK1A with Benzothiazole Fragment Molecules.

    PubMed

    Rothweiler, Ulli; Stensen, Wenche; Brandsdal, Bjørn Olav; Isaksson, Johan; Leeson, Frederick Alan; Engh, Richard Alan; Svendsen, John S Mjøen

    2016-11-10

    DYRK1A has emerged as a potential target for therapies of Alzheimer's disease using small molecules. On the basis of the observation of selective DYRK1A inhibition by firefly d-luciferin, we have explored static and dynamic structural properties of fragment sized variants of the benzothiazole scaffold with respect to DYRK1A using X-ray crystallography and NMR techniques. The compounds have excellent ligand efficiencies and show a remarkable diversity of binding modes in dynamic equilibrium. Binding geometries are determined in part by interactions often considered "weak", including "orthogonal multipolar" types represented by, for example, F-CO, sulfur-aromatic, and halogen-aromatic interactions, together with hydrogen bonds that are modulated by variation of electron withdrawing groups. These studies show how the benzothiazole scaffold is highly promising for the development of therapeutic DYRK1A inhibitors. In addition, the subtleties of the binding interactions, including dynamics, show how full structural studies are required to fully interpret the essential physical determinants of binding.

  7. Neoadjuvant chemotherapy in women with large and locally advanced breast cancer: chemoresistance and prediction of response to drug therapy.

    PubMed

    Chuthapisith, S; Eremin, J M; El-Sheemy, M; Eremin, O

    2006-08-01

    Patients with large and locally advanced breast cancer (LLABC) present with a therapeutic challenge and undergo multimodality treatment. Many such patients receive neoadjuvant chemotherapy (NAC) prior to surgery. However, a number of these patients do not respond well to NAC and only a percentage (usually less than 30%) obtains a complete or optimal response. A range of mechanisms are believed to be involved in this chemoresistance, including ATP binding cassette (ABC) transporter overexpression, dysregulation of apoptosis and possibly increased numbers of cancer stem cells. The chemoresistant processes may be due to more than one mechanism. The ability to predict a response to NAC would be beneficial, targeting expensive and toxic drug treatment to those likely to respond and providing a therapeutic strategy for further post-operative chemotherapy. Currently, many biomarkers have been studied with a view to establishing a predictor of response. However, no single biomarker appears to be effective. Genomics is a novel biotechnological process which is being used to predict response to drug therapy; this work is currently at an early stage of development

  8. Postprandial lipemia enhances the capacity of large HDL2 particles to mediate free cholesterol efflux via SR-BI and ABCG1 pathways in type IIB hyperlipidemia.

    PubMed

    Julia, Zélie; Duchene, Emilie; Fournier, Natalie; Bellanger, Natacha; Chapman, M John; Le Goff, Wilfried; Guerin, Maryse

    2010-11-01

    Lipid and cholesterol metabolism in the postprandial phase is associated with both quantitative and qualitative remodeling of HDL particle subspecies that may influence their anti-atherogenic functions in the reverse cholesterol transport pathway. We evaluated the capacity of whole plasma or isolated HDL particles to mediate cellular free cholesterol (FC) efflux, cholesteryl ester transfer protein (CETP)-mediated cholesteryl ester (CE) transfer, and selective hepatic CE uptake during the postprandial phase in subjects displaying type IIB hyperlipidemia (n = 16). Postprandial, large HDL2 displayed an enhanced capacity to mediate FC efflux via both scavenger receptor class B type I (SR-BI)-dependent (+12%; P < 0.02) and ATP binding cassette transporter G1 (ABCG1)-dependent (+31%; P < 0.008) pathways in in vitro cell systems. In addition, the capacity of whole postprandial plasma (4 h and 8 h postprandially) to mediate cellular FC efflux via the ABCA1-dependent pathway was significantly increased (+19%; P < 0.0003). Concomitantly, postprandial lipemia was associated with elevated endogenous CE transfer rates from HDL2 to apoB lipoproteins and with attenuated capacity (-17%; P < 0.02) of total HDL to deliver CE to hepatic cells. Postprandial lipemia enhanced SR-BI and ABCG1-dependent efflux to large HDL2 particles. However, postprandial lipemia is equally associated with deleterious features by enhancing formation of CE-enriched, triglyceride-rich lipoprotein particles through the action of CETP and by reducing the direct return of HDL-CE to the liver.

  9. Do ATP-binding cassette transporters cause pharmacoresistance in epilepsy? Problems and approaches in determining which antiepileptic drugs are affected.

    PubMed

    Löscher, Wolfgang; Luna-Tortós, Carlos; Römermann, Kerstin; Fedrowitz, Maren

    2011-01-01

    Resistance to multiple antiepileptic drugs (AEDs) is a common problem in epilepsy, affecting at least 30% of patients. One prominent hypothesis to explain this resistance suggests an inadequate penetration or excess efflux of AEDs across the blood - brain barrier (BBB) as a result of overexpressed efflux transporters such as P-glycoprotein (Pgp), the encoded product of the multidrug resistance- 1 (MDR1, ABCB1) gene. Pgp and MDR1 are markedly increased in epileptogenic brain tissue of patients with AED-resistant partial epilepsy and following seizures in rodent models of partial epilepsy. In rodent models, AED-resistant rats exhibit higher Pgp levels than responsive animals; increased Pgp expression is associated with lower brain levels of AEDs; and, most importantly, co-administration of Pgp inhibitors reverses AED resistance. Thus, it is reasonable to conclude that Pgp plays a significant role in mediating resistance to AEDs in rodent models of epilepsy - however, whether this phenomenon extends to at least some human refractory epilepsy remains unclear, particularly because it is still a matter of debate which AEDs, if any, are transported by human Pgp. The difficulty in determining which AEDs are substrates of human Pgp is mainly a consequence of the fact that AEDs are highly permeable compounds, which are not easily identified as Pgp substrates in in vitro models of the BBB, such as monolayer (Transwell(®)) efflux assays. By using a modified assay (concentration equilibrium transport assay; CETA), which minimizes the influence of high transcellular permeability, two groups have recently demonstrated that several major AEDs are transported by human Pgp. Importantly, it was demonstrated in these studies that Pgp-mediated transport highly depends on the AED concentration and may not be identified if concentrations below or above the therapeutic range are used. In addition to the efflux transporters, seizure-induced alterations in BBB integrity and activity of drug metabolizing enzymes (CYPs) affect the brain uptake of AEDs. For translating these findings to the clinical arena, in vivo imaging studies using positron emission tomography (PET) with (11)C-labelled AEDs in epileptic patients are under way.

  10. Structures of the Multidrug Transporter P-glycoprotein Reveal Asymmetric ATP Binding and the Mechanism of Polyspecificity.

    PubMed

    Esser, Lothar; Zhou, Fei; Pluchino, Kristen M; Shiloach, Joseph; Ma, Jichun; Tang, Wai-Kwan; Gutierrez, Camilo; Zhang, Alex; Shukla, Suneet; Madigan, James P; Zhou, Tongqing; Kwong, Peter D; Ambudkar, Suresh V; Gottesman, Michael M; Xia, Di

    2017-01-13

    P-glycoprotein (P-gp) is a polyspecific ATP-dependent transporter linked to multidrug resistance in cancer; it plays important roles in determining the pharmacokinetics of many drugs. Understanding the structural basis of P-gp, substrate polyspecificity has been hampered by its intrinsic flexibility, which is facilitated by a 75-residue linker that connects the two halves of P-gp. Here we constructed a mutant murine P-gp with a shortened linker to facilitate structural determination. Despite dramatic reduction in rhodamine 123 and calcein-AM transport, the linker-shortened mutant P-gp possesses basal ATPase activity and binds ATP only in its N-terminal nucleotide-binding domain. Nine independently determined structures of wild type, the linker mutant, and a methylated P-gp at up to 3.3 Å resolution display significant movements of individual transmembrane domain helices, which correlated with the opening and closing motion of the two halves of P-gp. The open-and-close motion alters the surface topology of P-gp within the drug-binding pocket, providing a mechanistic explanation for the polyspecificity of P-gp in substrate interactions.

  11. Linoleic acid suppresses cholesterol efflux and ATP-binding cassette transporters in murine bone marrow-derived macrophages

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Individuals with type 2 diabetes mellitus (T2DM) are at increased risk of developing cardiovascular disease (CVD), possibly associated with elevated plasma free fatty acid concentrations. Paradoxically, evidence suggests that unsaturated, compared to saturated fatty acids, suppress macrophage chole...

  12. Structures of the Multidrug Transporter P-glycoprotein Reveal Asymmetric ATP Binding and the Mechanism of Polyspecificity*♦

    PubMed Central

    Esser, Lothar; Zhou, Fei; Pluchino, Kristen M.; Shiloach, Joseph; Ma, Jichun; Tang, Wai-kwan; Gutierrez, Camilo; Zhang, Alex; Shukla, Suneet; Madigan, James P.; Zhou, Tongqing; Kwong, Peter D.; Ambudkar, Suresh V.; Gottesman, Michael M.; Xia, Di

    2017-01-01

    P-glycoprotein (P-gp) is a polyspecific ATP-dependent transporter linked to multidrug resistance in cancer; it plays important roles in determining the pharmacokinetics of many drugs. Understanding the structural basis of P-gp, substrate polyspecificity has been hampered by its intrinsic flexibility, which is facilitated by a 75-residue linker that connects the two halves of P-gp. Here we constructed a mutant murine P-gp with a shortened linker to facilitate structural determination. Despite dramatic reduction in rhodamine 123 and calcein-AM transport, the linker-shortened mutant P-gp possesses basal ATPase activity and binds ATP only in its N-terminal nucleotide-binding domain. Nine independently determined structures of wild type, the linker mutant, and a methylated P-gp at up to 3.3 Å resolution display significant movements of individual transmembrane domain helices, which correlated with the opening and closing motion of the two halves of P-gp. The open-and-close motion alters the surface topology of P-gp within the drug-binding pocket, providing a mechanistic explanation for the polyspecificity of P-gp in substrate interactions. PMID:27864369

  13. An Allosteric Cross-Talk Between the Activation Loop and the ATP Binding Site Regulates the Activation of Src Kinase

    PubMed Central

    Pucheta-Martínez, Encarna; Saladino, Giorgio; Morando, Maria Agnese; Martinez-Torrecuadrada, Jorge; Lelli, Moreno; Sutto, Ludovico; D’Amelio, Nicola; Gervasio, Francesco Luigi

    2016-01-01

    Phosphorylation of the activation loop is a fundamental step in the activation of most protein kinases. In the case of the Src tyrosine kinase, a prototypical kinase due to its role in cancer and its historic importance, phosphorylation of tyrosine 416 in the activation loop is known to rigidify the structure and contribute to the switch from the inactive to a fully active form. However, whether or not phosphorylation is able per-se to induce a fully active conformation, that efficiently binds ATP and phosphorylates the substrate, is less clear. Here we employ a combination of solution NMR and enhanced-sampling molecular dynamics simulations to fully map the effects of phosphorylation and ATP/ADP cofactor loading on the conformational landscape of Src tyrosine kinase. We find that both phosphorylation and cofactor binding are needed to induce a fully active conformation. What is more, we find a complex interplay between the A-loop and the hinge motion where the phosphorylation of the activation-loop has a significant allosteric effect on the dynamics of the C-lobe. PMID:27063862

  14. Heterocyclic cyclohexanone monocarbonyl analogs of curcumin can inhibit the activity of ATP-binding cassette transporters in cancer multidrug resistance.

    PubMed

    Revalde, Jezrael L; Li, Yan; Hawkins, Bill C; Rosengren, Rhonda J; Paxton, James W

    2015-02-01

    Curcumin (CUR) is a phytochemical that inhibits the xenobiotic ABC efflux transporters implicated in cancer multidrug resistance (MDR), such as P-glycoprotein (P-gp), breast cancer resistance protein (BCRP) and multidrug resistance-associated proteins 1 and 5 (MRP1 and MRP5). The use of CUR in the clinic however, is complicated by its instability and poor pharmacokinetic profile. Monocarbonyl analogs of CUR (MACs) are compounds without CUR's unstable β-diketone moiety and were reported to have improved stability and in vivo disposition. Whether the MACs can be used as MDR reversal agents is less clear, as the absence of a β-diketone may negatively impact transporter inhibition. In this study, we investigated 23 heterocyclic cyclohexanone MACs for inhibitory effects against P-gp, BCRP, MRP1 and MRP5. Using flow cytometry and resistance reversal assays, we found that many of these compounds inhibited the transport activity of the ABC transporters investigated, often with much greater potency than CUR. Overall the analogs were most effective at inhibiting BCRP and we identified three compounds, A12 (2,6-bis((E)-2,5-dimethoxy-benzylidene)cyclohexanone), A13 (2,6-bis((E)-4-hydroxyl-3-methoxybenzylidene)-cyclohexanone) and B11 (3,5-bis((E)-2-fluoro-4,5-dimethoxybenzylidene)-1-methylpiperidin-4-one), as the most promising BCRP inhibitors. These compounds inhibited BCRP activity in a non-cell line, non-substrate-specific manner. Their inhibition occurred by direct transporter interaction rather than modulating protein or cell surface expression. From these results, we concluded that MACs, such as the heterocyclic cyclohexanone analogs in this study, also have potential as MDR reversal agents and may be superior alternatives to the unstable parent compound, CUR.

  15. An Allosteric Cross-Talk Between the Activation Loop and the ATP Binding Site Regulates the Activation of Src Kinase

    NASA Astrophysics Data System (ADS)

    Pucheta-Martínez, Encarna; Saladino, Giorgio; Morando, Maria Agnese; Martinez-Torrecuadrada, Jorge; Lelli, Moreno; Sutto, Ludovico; D’Amelio, Nicola; Gervasio, Francesco Luigi

    2016-04-01

    Phosphorylation of the activation loop is a fundamental step in the activation of most protein kinases. In the case of the Src tyrosine kinase, a prototypical kinase due to its role in cancer and its historic importance, phosphorylation of tyrosine 416 in the activation loop is known to rigidify the structure and contribute to the switch from the inactive to a fully active form. However, whether or not phosphorylation is able per-se to induce a fully active conformation, that efficiently binds ATP and phosphorylates the substrate, is less clear. Here we employ a combination of solution NMR and enhanced-sampling molecular dynamics simulations to fully map the effects of phosphorylation and ATP/ADP cofactor loading on the conformational landscape of Src tyrosine kinase. We find that both phosphorylation and cofactor binding are needed to induce a fully active conformation. What is more, we find a complex interplay between the A-loop and the hinge motion where the phosphorylation of the activation-loop has a significant allosteric effect on the dynamics of the C-lobe.

  16. Gene expression profiling of transporters in the solute carrier and ATP-binding cassette superfamilies in human eye substructures.

    PubMed

    Dahlin, Amber; Geier, Ethan; Stocker, Sophie L; Cropp, Cheryl D; Grigorenko, Elena; Bloomer, Michele; Siegenthaler, Julie; Xu, Lu; Basile, Anthony S; Tang-Liu, Diane D-S; Giacomini, Kathleen M

    2013-02-04

    The barrier epithelia of the cornea and retina control drug and nutrient access to various compartments of the human eye. While ocular transporters are likely to play a critical role in homeostasis and drug delivery, little is known about their expression, localization and function. In this study, the mRNA expression levels of 445 transporters, metabolic enzymes, transcription factors and nuclear receptors were profiled in five regions of the human eye: cornea, iris, ciliary body, choroid and retina. Through RNA expression profiling and immunohistochemistry, several transporters were identified as putative targets for drug transport in ocular tissues. Our analysis identified SLC22A7 (OAT2), a carrier for the antiviral drug acyclovir, in the corneal epithelium, in addition to ABCG2 (BCRP), an important xenobiotic efflux pump, in retinal nerve fibers and the retinal pigment epithelium. Collectively, our results provide an understanding of the transporters that serve to maintain ocular homeostasis and which may be potential targets for drug delivery to deep compartments of the eye.

  17. Regulation and expression of the ATP-binding cassette transporter ABCG2 in human embryonic stem cells.

    PubMed

    Padmanabhan, Raji; Chen, Kevin G; Gillet, Jean-Pierre; Handley, Misty; Mallon, Barbara S; Hamilton, Rebecca S; Park, Kyeyoon; Varma, Sudhir; Mehaffey, Michele G; Robey, Pamela G; McKay, Ronald D G; Gottesman, Michael M

    2012-10-01

    The expression and function of several multidrug transporters (including ABCB1 and ABCG2) have been studied in human cancer cells and in mouse and human adult stem cells. However, the expression of ABCG2 in human embryonic stem cells (hESCs) remains unclear. Limited and contradictory results in the literature from two research groups have raised questions regarding its expression and function. In this study, we used quantitative real-time PCR, Northern blots, whole genome RNA sequencing, Western blots, and immunofluorescence microscopy to study ABCG2 expression in hESCs. We found that full-length ABCG2 mRNA transcripts are expressed in undifferentiated hESC lines. However, ABCG2 protein was undetectable even under embryoid body differentiation or cytotoxic drug induction. Moreover, surface ABCG2 protein was coexpressed with the differentiation marker stage-specific embryonic antigen-1 of hESCs, following constant BMP-4 signaling at days 4 and 6. This expression was tightly correlated with the downregulation of two microRNAs (miRNAs) (i.e., hsa-miR-519c and hsa-miR-520h). Transfection of miRNA mimics and inhibitors of these two miRNAs confirmed their direct involvement in the regulation ABCG2 translation. Our findings clarify the controversy regarding the expression of the ABCG2 gene and also provide new insights into translational control of the expression of membrane transporter mRNAs by miRNAs in hESCs.

  18. Functional roles of ATP-binding residues in the catalytic site of human mitochondrial NAD(P)+-dependent malic enzyme.

    PubMed

    Hung, Hui-Chih; Chien, Yu-Ching; Hsieh, Ju-Yi; Chang, Gu-Gang; Liu, Guang-Yaw

    2005-09-27

    Human mitochondrial NAD(P)+-dependent malic enzyme is inhibited by ATP. The X-ray crystal structures have revealed that two ATP molecules occupy both the active and exo site of the enzyme, suggesting that ATP might act as an allosteric inhibitor of the enzyme. However, mutagenesis studies and kinetic evidences indicated that the catalytic activity of the enzyme is inhibited by ATP through a competitive inhibition mechanism in the active site and not in the exo site. Three amino acid residues, Arg165, Asn259, and Glu314, which are hydrogen-bonded with NAD+ or ATP, are chosen to characterize their possible roles on the inhibitory effect of ATP for the enzyme. Our kinetic data clearly demonstrate that Arg165 is essential for catalysis. The R165A enzyme had very low enzyme activity, and it was only slightly inhibited by ATP and not activated by fumarate. The values of K(m,NAD) and K(i,ATP) to both NAD+ and malate were elevated. Elimination of the guanidino side chain of R165 made the enzyme defective on the binding of NAD+ and ATP, and it caused the charge imbalance in the active site. These effects possibly caused the enzyme to malfunction on its catalytic power. The N259A enzyme was less inhibited by ATP but could be fully activated by fumarate at a similar extent compared with the wild-type enzyme. For the N259A enzyme, the value of K(i,ATP) to NAD+ but not to malate was elevated, indicating that the hydrogen bonding between ATP and the amide side chain of this residue is important for the binding stability of ATP. Removal of this side chain did not cause any harmful effect on the fumarate-induced activation of the enzyme. The E314A enzyme, however, was severely inhibited by ATP and only slightly activated by fumarate. The values of K(m,malate), K(m,NAD), and K(i,ATP) to both NAD+ and malate for E314A were reduced to about 2-7-folds compared with those of the wild-type enzyme. It can be concluded that mutation of Glu314 to Ala eliminated the repulsive effects between Glu314 and malate, NAD+, or ATP, and thus the binding affinities of malate, NAD+, and ATP in the active site of the enzyme were enhanced.

  19. Expression of ATP-Binding Cassette Transporters B1 and C1 after Severe Traumatic Brain Injury in Humans

    PubMed Central

    Willyerd, F. Anthony; Empey, Philip E.; Philbrick, Ashley; Ikonomovic, Milos D.; Puccio, Ava M.; Kochanek, Patrick M.; Okonkwo, David O.

    2016-01-01

    Abstract Adenosine triphosphate-binding cassette (ABC) transport proteins ABCC1 and ABCB1 (also known as multidrug resistance-associated protein 1 and p-glycoprotein, respectively), are key membrane efflux transporters of drugs and endogenous substrates, including in the brain. The impact of traumatic brain injury (TBI) on ABCC1 and ABCB1 expression in humans is unknown. We hypothesized that ABCC1 and ABCB1 expression would be altered in brain tissue from patients acutely after severe TBI. Archived TBI samples (n=10) from our Brain Trauma Research Center and control samples (n=7) from our Alzheimer Disease Research Center were obtained under Institutional Review Board approval. Protein was extracted from fresh frozen cortical brain tissue for Western blot analysis and sections were obtained from fixed cortical tissue for immunohistochemistry. Relative abundance of ABCC1 was increased in samples from TBI versus controls (2.8±2.5 fold; p=0.005). ABCC1 immunohistochemistry was consistent with Western blot data, with increased immunoreactivity in cerebral blood vessel walls, as well as cells with the morphological appearance of neurons and glia in TBI versus controls. Relative abundance of ABCB1 was similar between TBI and controls (p=0.76), and ABCB1 immunoreactivity was primarily associated with cerebral blood vessels in both groups. These human data show that TBI increases ABCC1 expression in the brain, consistent with possible implications for both patients receiving pharmacological inhibitors and/or substrates of ABCC1 after TBI. PMID:25891836

  20. Three high-lysine mutations control the level of ATP-binding HSP70-like proteins in the maize endosperm.

    PubMed

    Marocco, A; Santucci, A; Cerioli, S; Motto, M; Di Fonzo, N; Thompson, R; Salamini, F

    1991-05-01

    The synthesis and deposition of seed storage proteins in maize are affected by several dominant and recessive mutants. The effect of three independent mutations, floury-2 (fl2), Defective endosperm-B30 (De-B30), and Mucronate (Mc), that reduce zein level in the endosperm were investigated. These mutations also control the level of b-70, a polypeptide bound to protein bodies, which is separable into the two isoforms b-70I and b-70II by two-dimensional gel electrophoresis. Both isoforms are overexpressed 10-fold in fl2; however, only b-70I is present in De-B30 and Mc, which contain an amount of total b-70 isoforms fivefold higher than in the wild type. Both b-70I and b-70II resemble heat shock protein (HSP70) in that they bind ATP, cross-react with anti-HSP antibodies, and have N-terminal sequence homology to HSP70. All maize protein body-located b-70 characteristics are typical of those of chaperone-like HSPs. A third protein, b-70III, similar in size to but slightly more acidic than b-70I and b-70II, also binds ATP and reacts with the same antibody, providing evidence for the presence in endosperm extracts of a cytosolic chaperone-like protein. The level of b-70III was not altered by the mutations studied. The results suggested that the repression effect of the three mutations on zein accumulation may be mediated by the alteration of a zein transport or zein assembly process involving b-70I and b-70II.

  1. Universal stress protein Rv2624c alters abundance of arginine and enhances intracellular survival by ATP binding in mycobacteria

    PubMed Central

    Jia, Qiong; Hu, Xinling; Shi, Dawei; Zhang, Yan; Sun, Meihao; Wang, Jianwei; Mi, Kaixia; Zhu, Guofeng

    2016-01-01

    The universal stress protein family is a family of stress-induced proteins. Universal stress proteins affect latency and antibiotic resistance in mycobacteria. Here, we showed that Mycobacterium smegmatis overexpressing M. tuberculosis universal stress protein Rv2624c exhibits increased survival in human monocyte THP-1 cells. Transcriptome analysis suggested that Rv2624c affects histidine metabolism, and arginine and proline metabolism. LC-MS/MS analysis showed that Rv2624c affects the abundance of arginine, a modulator of both mycobacteria and infected THP-1 cells. Biochemical analysis showed that Rv2624c is a nucleotide-binding universal stress protein, and an Rv2624c mutant incapable of binding ATP abrogated the growth advantage in THP-1 cells. Rv2624c may therefore modulate metabolic pathways in an ATP-dependent manner, changing the abundance of arginine and thus increasing survival in THP-1 cells. PMID:27762279

  2. Probabilistic orthology analysis of the ATP-binding cassette transporters: implications for the development of multiple drug resistance phenotype.

    PubMed

    Fisher, Ciaran; Coleman, Tanya; Plant, Nick

    2012-07-01

    Drug transporters are rapidly becoming recognized as central to determining a chemical's fate within the body. This action is a double-edged sword, protecting the body from toxicants, but also potentially leading to reduced clinical efficacy of drugs through multiple drug resistance phenotype. To examine the interrelationship of this superfamily, we have constructed phylogenetic trees over an extended evolutionary distance representing each of the seven subfamilies. In addition, using protein sequences from species important in the design and evaluation of novel chemicals, namely human, macaque, rat, mouse, and dog, we have undertaken probabilistic orthology analysis to examine speciation probabilities within this phylogeny. These data allow us to accurately predict orthologous sequences across these species, an important confirmatory step with implications for cross-species extrapolation of data during drug safety testing. Finally, we present the first complete phylogeny for subfamilies within humans constructed using the entire coding sequences, at both the DNA and protein levels. We demonstrate for the first time that genes associated with the multiple drug resistance phenotype cluster separately from other genes within the same subfamily, suggestive of a conserved, fundamental, difference in these proteins. Such work may help guide future studies on the mechanisms underlying multiple drug resistance as well as the development of novel therapeutic approaches to mitigate against its development.

  3. Enhancement of avermectin and ivermectin production by overexpression of the maltose ATP-binding cassette transporter in Streptomyces avermitilis.

    PubMed

    Li, Meng; Chen, Zhi; Zhang, Xuan; Song, Yuan; Wen, Ying; Li, Jilun

    2010-12-01

    We investigated the function of maltose ABC transporter system encoded by malEFG-a and the effect of its overexpression on antibiotic production in Streptomyces avermitilis. A malEFG-a deletion mutant was unable to grow in a minimal medium with maltose as sole carbon source and produce avermectin. Maltose utilization and avermectin production were restored by introduction of a single copy of malEFG-a. RT-PCR analysis showed that the expression of malE-a was induced by maltose, and was strongly repressed by glucose. When multi-copy, integrative malEFG-a gene expression vectors were introduced into wild-type strain ATCC31267 and ivermectin-producer OI-31, antibiotic production increased by 2.6- to 3.3-fold and the time required for fermentation decreased by about 10%. The overexpression of malEFG-a improved the utilization rate of starch, and thereby enhanced avermectin production. Such an approach would be useful for the improvement of commercial antibiotic production using starch as the main carbon source in the fermentation process.

  4. Whole-exome and transcriptome sequencing of refractory diffuse large B-cell lymphoma

    PubMed Central

    Park, Ha Young; Lee, Seung-Bok; Yoo, Hae-Yong; Kim, Seok-Jin; Kim, Won-Seog; Kim, Jong-Il; Ko, Young-Hyeh

    2016-01-01

    Diffuse large B-cell lymphoma (DLBCL) is the most common type of non-Hodgkin lymphoma. Although rituximab therapy improves clinical outcome, some patients develop resistant DLBCL; however, the genetic alterations in these patients are not well documented. To identify the genetic background of refractory DLBCL, we conducted whole-exome sequencing and transcriptome sequencing for six patients with refractory and seven with responsive DLBCL. The average numbers of pathogenic somatic single nucleotide variants and indels in coding regions were 71 in refractory patients (range 28–120) and 38 (range 19–66) in responsive patients. Missense mutations of TP53 were exclusive in 50% (3/6) of refractory patients and involved the DNA-binding domain of TP53. All missense mutations of TP53 were accompanied by copy number deletions. RAB11FIP5, PRKCB, PRDM15, FNBP4, AHR, CEP128, BRE, DHX16, MYO6, and NMT1 mutations were recurrent in refractory patients. MYD88, B2M, SORCS3, and WDFY3 mutations were more frequent in refractory patients than in responsive patients. REL–BCL11A fusion was found in two refractory patients; one had both fusion and copy number gain. Recurrent copy gains of POU2AF1, SLC1A4, REL11, FANCL, CACNA1D, TRRAP, and CUX1 with significantly increased average expression were found in refractory patients. The expression profile revealed enriched gene sets associated with treatment resistance, including oxidative phosphorylation and ATP-binding cassette transporters. In conclusion, this study integrated both genomic and transcriptomic alterations associated with refractory DLBCL and found several treatment-resistance alterations that may contribute to refractoriness. PMID:27835906

  5. The novel kinesin spindle protein (KSP) inhibitor SB-743921 exhibits marked activity in in vivo and in vitro models of aggressive large B-cell lymphoma.

    PubMed

    Bongero, Danielle; Paoluzzi, Luca; Marchi, Enrica; Zullo, Kelly M; Neisa, Roberto; Mao, Yinghui; Escandon, Rafael; Wood, Ken; O'Connor, Owen A

    2015-01-01

    The kinesin spindle protein (KSP) is a mitotic protein essential for cell cycle control and motility. SB-743921 (hereafter SB-921) is an inhibitor that selectively targets the ATP-binding domain of the KSP. The preclinical activity of SB-921 was evaluated in models of diffuse large B-cell lymphoma (DLBCL). The cytotoxicity of SB-921 was evaluated in a series of germinal center (GC-DLBCL) and post-germinal center (ABC-DLBCL) DLBCL cell lines and a murine lymphoma xenograft model. GC-DLBCL lines generally demonstrated greater sensitivity to SB-921. IC50 values ranged between 1 nM and 900 nM for GC-DLBCL compared to 1 nM to 10 μM for ABC lines. SB-921 demonstrated marked activity in a xenograft model of Ly-1 (GC-DLBCL). While SB-921 was relatively more active in GC derived cell lines, ABC-derived lines still underwent apoptosis at higher concentrations. These results demonstrate that SB-921 inhibits proliferation and induces apoptosis in both GC-DLBCL and ABC-DLBCL.

  6. Drug Transporters and Na+/H+ Exchange Regulatory Factor PSD-95/Drosophila Discs Large/ZO-1 Proteins

    PubMed Central

    Walsh, Dustin R.; Nolin, Thomas D.

    2015-01-01

    Drug transporters govern the absorption, distribution, and elimination of pharmacologically active compounds. Members of the solute carrier and ATP binding-cassette drug transporter family mediate cellular drug uptake and efflux processes, thereby coordinating the vectorial movement of drugs across epithelial barriers. To exert their physiologic and pharmacological function in polarized epithelia, drug transporters must be targeted and stabilized to appropriate regions of the cell membrane (i.e., apical versus basolateral). Despite the critical importance of drug transporter membrane targeting, the mechanisms that underlie these processes are largely unknown. Several clinically significant drug transporters possess a recognition sequence that binds to PSD-95/Drosophila discs large/ZO-1 (PDZ) proteins. PDZ proteins, such as the Na+/H+ exchanger regulatory factor (NHERF) family, act to stabilize and organize membrane targeting of multiple transmembrane proteins, including many clinically relevant drug transporters. These PDZ proteins are normally abundant at apical membranes, where they tether membrane-delimited transporters. NHERF expression is particularly high at the apical membrane in polarized tissue such as intestinal, hepatic, and renal epithelia, tissues important to drug disposition. Several recent studies have highlighted NHERF proteins as determinants of drug transporter function secondary to their role in controlling membrane abundance and localization. Mounting evidence strongly suggests that NHERF proteins may have clinically significant roles in pharmacokinetics and pharmacodynamics of several pharmacologically active compounds and may affect drug action in cancer and chronic kidney disease. For these reasons, NHERF proteins represent a novel class of post-translational mediators of drug transport and novel targets for new drug development. PMID:26092975

  7. Large N

    NASA Astrophysics Data System (ADS)

    't Hooft, Gerard

    2002-09-01

    In the first part of this lecture, the 1/N expansion technique is illustrated for the case of the large-N sigma model. In large-N gauge theories, the 1/N expansion is tantamount to sorting the Feynman diagrams according to their degree of planarity, that is, the minimal genus of the plane onto which the diagram can be mapped without any crossings. This holds both for the usual perturbative expansion with respect to powers of ˜ {g}2 = g2N, as well as for the expansion of lattice theories in positive powers of 1/˜ {g}2. If there were no renormalization effects, the ˜ {g} expansion would have a finite radius of convergence. The zero-dimensional theory can be used for counting planar diagrams. It can be solved explicitly, so that the generating function for the number of diagrams with given 3-vertices and 4-vertices, can be derived exactly. This can be done for various kinds of Feynman diagrams. We end with some remarks about planar renormalization.

  8. Crystal Structures of Proto-oncogene Kinase Pim1: A Target of Aberrant Somatic Hypermutations in Diffuse Large Cell Lymphoma

    SciTech Connect

    Kumar, Abhinav; Mandiyan, Valsan; Suzuki, Yoshihisa; Zhang, Chao; Rice, Julie; Tsai, James; Artis, Dean R.; Ibrahim, Prabha; Bremer, Ryan

    2010-07-19

    Pim1, a serine/threonine kinase, is involved in several biological functions including cell survival, proliferation, and differentiation. While pim1 has been shown to be involved in several hematopoietic cancers, it was also recently identified as a target of aberrant somatic hypermutation in diffuse large cell lymphoma (DLCL), the most common form of non-Hodgkin's lymphoma. The crystal structures of Pim1 in apo form and bound with AMPPNP have been solved and several unique features of Pim1 were identified, including the presence of an extra {beta}-hairpin in the N-terminal lobe and an unusual conformation of the hinge connecting the two lobes of the enzyme. While the apo Pim1 structure is nearly identical with that reported recently, the structure of AMPPNP bound to Pim1 is significantly different. Pim1 is unique among protein kinases due to the presence of a proline residue at position 123 that precludes the formation of the canonical second hydrogen bond between the hinge backbone and the adenine moiety of ATP. One crystal structure reported here shows that changing P123 to methionine, a common residue that offers the backbone hydrogen bond to ATP, does not restore the ATP binding pocket of Pim1 to that of a typical kinase. These unique structural features in Pim1 result in novel binding modes of AMP and a known kinase inhibitor scaffold, as shown by co-crystallography. In addition, the kinase activities of five Pim1 mutants identified in DLCL patients have been determined. In each case, the observed effects on kinase activity are consistent with the predicted consequences of the mutation on the Pim1 structure. Finally, 70 co-crystal structures of low molecular mass, low-affinity compounds with Pim1 have been solved in order to identify novel chemical classes as potential Pim1 inhibitors. Based on the structural information, opportunities for optimization of one specific example are discussed.

  9. Characterization of Murine Thymic Stromal-Cell Lines Immortalized by Temperature-Sensitive Simian Virus 40 Large T or Adenovirus 5 E1a

    PubMed Central

    Larsson, Lena; Timms, Emma; Blight, Kenneth; Restall, Deborah E.; Jat, Parmjit S.; Fisher, Amanda G.

    1991-01-01

    The heterogeneity of thymic stromal cells is probably related to their role in providing different microenvironments where T cells can develop. We have immortalized thymic stromal elements using recombinant retroviral constructs containing a temperature-sensitive simian virus 40 (SV40tsA58) large-T antigen gene or the adenovirus 5 E1a region linked to the gene coding for resistance to G418. Cell lines containing the thermolabile large T antigen encoded by SV40 proliferate at the permissive temperature of 33°C and arrest growth when transferred to the nonpermissive temperature of 39°C. At the nonpermissive temperature, ts-derived cell lines are shown to alter their phenotype but remain metabolically active, as indicated by the inducible expression of class I and class II MHC antigens. Here we describe the generation of a total of 84 thymic stromal-cell lines, many of which show distinct morphologic, phenotypic, and functional properties consistent with fibroblastoid, epithelial, or monocytoid origins. Several E1a and SV40tsA58-derived cell lines generated exhibit the epithelial characteristic of desmosome formation and, in addition, two of these lines (15.5 and 15.18) form multicellular complexes (rosettes) when incubated with unfractionated thymocytes from syngeneic mice. A single line (14.5) displays very strong nonspecific esterase activity, suggesting it may represent a macrophagelike cell type. We describe the generation of stromal cell lines with different properties, which is consistent with the heterogeneity found in the thymic microenvironment. In addition to documenting this diversity, these cell lines may be useful tools for studying T-cell development in vitro and give access to model systems in which stromal-thymocyte interactions can be examined. PMID:1668372

  10. Transition from reversible to irreversible attachment during biofilm formation by Pseudomonas fluorescens WCS365 requires an ABC transporter and a large secreted protein.

    PubMed

    Hinsa, Shannon M; Espinosa-Urgel, Manuel; Ramos, Juan L; O'Toole, George A

    2003-08-01

    We report the identification of an ATP-binding cassette (ABC) transporter and an associated large cell-surface protein that are required for biofilm formation by Pseudomonas fluorescens WCS365. The genes coding for these proteins are designated lap for large adhesion protein. The LapA protein, with a predicted molecular weight of approximately 900 kDa, is found to be loosely associated with the cell surface and present in the culture supernatant. The LapB, LapC and LapE proteins are predicted to be the cytoplasmic membrane-localized ATPase, membrane fusion protein and outer membrane protein component, respectively, of an ABC transporter. Consistent with this prediction, LapE, like other members of this family, is localized to the outer membrane. We propose that the lapEBC-encoded ABC transporter participates in the secretion of LapA, as strains with mutations in the lapEBC genes do not have detectable LapA associated with the cell surface or in the supernatant. The lap genes are conserved among environmental pseudomonads such as P. putida KT2440, P. fluorescens PfO1 and P. fluorescens WCS365, but are absent from pathogenic pseudomonads such as P. aeruginosa and P. syringae. The wild-type strain of P. fluorescens WCS365 and its lap mutant derivatives were assessed for their biofilm forming ability in static and flow systems. The lap mutant strains are impaired in an early step in biofilm formation and are unable to develop the mature biofilm structure seen for the wild-type bacterium. Time-lapse microscopy studies determined that the lap mutants are unable to progress from reversible (or transient) attachment to the irreversible attachment stage of biofilm development. The lap mutants were also found to be defective in attachment to quartz sand, an abiotic surface these organisms likely encounter in the environment.

  11. Merkel Cell Polyomavirus Small T Antigen Promotes Pro-Glycolytic Metabolic Perturbations Required for Transformation

    PubMed Central

    Keibler, Mark A.; Park, Donglim Esther; Molla, Vadim; Cheng, Jingwei; Stephanopoulos, Gregory

    2016-01-01

    Merkel cell polyomavirus (MCPyV) is an etiological agent of Merkel cell carcinoma (MCC), a highly aggressive skin cancer. The MCPyV small tumor antigen (ST) is required for maintenance of MCC and can transform normal cells. To gain insight into cellular perturbations induced by MCPyV ST, we performed transcriptome analysis of normal human fibroblasts with inducible expression of ST. MCPyV ST dynamically alters the cellular transcriptome with increased levels of glycolytic genes, including the monocarboxylate lactate transporter SLC16A1 (MCT1). Extracellular flux analysis revealed increased lactate export reflecting elevated aerobic glycolysis in ST expressing cells. Inhibition of MCT1 activity suppressed the growth of MCC cell lines and impaired MCPyV-dependent transformation of IMR90 cells. Both NF-κB and MYC have been shown to regulate MCT1 expression. While MYC was required for MCT1 induction, MCPyV-induced MCT1 levels decreased following knockdown of the NF-κB subunit RelA, supporting a synergistic activity between MCPyV and MYC in regulating MCT1 levels. Several MCC lines had high levels of MYCL and MYCN but not MYC. Increased levels of MYCL was more effective than MYC or MYCN in increasing extracellular acidification in MCC cells. Our results demonstrate the effects of MCPyV ST on the cellular transcriptome and reveal that transformation is dependent, at least in part, on elevated aerobic glycolysis. PMID:27880818

  12. Cellular proteins that associate with the middle and small T antigens of polyomavirus.

    PubMed

    Pallas, D C; Cherington, V; Morgan, W; DeAnda, J; Kaplan, D; Schaffhausen, B; Roberts, T M

    1988-11-01

    We have used two-dimensional gel electrophoresis to analyze in more detail the cellular proteins which associate with the middle and small tumor antigens (MT and ST, respectively) of polyomavirus. Proteins with molecular masses of 27, 29, 36, 51, 61, 63, and 85 kilodaltons (kDa) that specifically coimmunoprecipitated with MT were identified on these gels. The 36-, 51-, 61-, 63-, and 85-kDa proteins are probably the same as the proteins of similar sizes previously reported by a number of groups, whereas the 27- and 29-kDa proteins represent proteins that are heretofore undescribed. The 27- and 29-kDa proteins were abundant cellular proteins, whereas the others were minor cellular constituents. The association of each of these proteins with MT was sensitive to one or more mutations in MT that rendered it transformation defective. The association of the 85-kDa protein was the most sensitive indicator of the transformation competence of MT mutants. In addition, the 85-kDa protein was the only associated protein whose association with MT changed consistently in parallel with MT-associated phosphatidylinositol kinase activity. Furthermore, the fraction of the 85-kDa protein which was found associated with the MT complex contained 15 to 20% of its phosphate content on tyrosine. The 36- and 63-kDa proteins complexed with both polyomavirus MT and ST and comigrated on two-dimensional gels with two simian virus 40 ST-associated proteins originally described by Rundell and coworkers (K. Rundell, E. O. Major, and M. Lampert, J. Virol. 37:1090-1093, 1981). None of the other MT-associated proteins associated significantly with ST.

  13. Large scale free energy calculations for blind predictions of protein-ligand binding: the D3R Grand Challenge 2015

    NASA Astrophysics Data System (ADS)

    Deng, Nanjie; Flynn, William F.; Xia, Junchao; Vijayan, R. S. K.; Zhang, Baofeng; He, Peng; Mentes, Ahmet; Gallicchio, Emilio; Levy, Ronald M.

    2016-09-01

    We describe binding free energy calculations in the D3R Grand Challenge 2015 for blind prediction of the binding affinities of 180 ligands to Hsp90. The present D3R challenge was built around experimental datasets involving Heat shock protein (Hsp) 90, an ATP-dependent molecular chaperone which is an important anticancer drug target. The Hsp90 ATP binding site is known to be a challenging target for accurate calculations of ligand binding affinities because of the ligand-dependent conformational changes in the binding site, the presence of ordered waters and the broad chemical diversity of ligands that can bind at this site. Our primary focus here is to distinguish binders from nonbinders. Large scale absolute binding free energy calculations that cover over 3000 protein-ligand complexes were performed using the BEDAM method starting from docked structures generated by Glide docking. Although the ligand dataset in this study resembles an intermediate to late stage lead optimization project while the BEDAM method is mainly developed for early stage virtual screening of hit molecules, the BEDAM binding free energy scoring has resulted in a moderate enrichment of ligand screening against this challenging drug target. Results show that, using a statistical mechanics based free energy method like BEDAM starting from docked poses offers better enrichment than classical docking scoring functions and rescoring methods like Prime MM-GBSA for the Hsp90 data set in this blind challenge. Importantly, among the three methods tested here, only the mean value of the BEDAM binding free energy scores is able to separate the large group of binders from the small group of nonbinders with a gap of 2.4 kcal/mol. None of the three methods that we have tested provided accurate ranking of the affinities of the 147 active compounds. We discuss the possible sources of errors in the binding free energy calculations. The study suggests that BEDAM can be used strategically to discriminate

  14. Large scale free energy calculations for blind predictions of protein-ligand binding: the D3R Grand Challenge 2015.

    PubMed

    Deng, Nanjie; Flynn, William F; Xia, Junchao; Vijayan, R S K; Zhang, Baofeng; He, Peng; Mentes, Ahmet; Gallicchio, Emilio; Levy, Ronald M

    2016-09-01

    We describe binding free energy calculations in the D3R Grand Challenge 2015 for blind prediction of the binding affinities of 180 ligands to Hsp90. The present D3R challenge was built around experimental datasets involving Heat shock protein (Hsp) 90, an ATP-dependent molecular chaperone which is an important anticancer drug target. The Hsp90 ATP binding site is known to be a challenging target for accurate calculations of ligand binding affinities because of the ligand-dependent conformational changes in the binding site, the presence of ordered waters and the broad chemical diversity of ligands that can bind at this site. Our primary focus here is to distinguish binders from nonbinders. Large scale absolute binding free energy calculations that cover over 3000 protein-ligand complexes were performed using the BEDAM method starting from docked structures generated by Glide docking. Although the ligand dataset in this study resembles an intermediate to late stage lead optimization project while the BEDAM method is mainly developed for early stage virtual screening of hit molecules, the BEDAM binding free energy scoring has resulted in a moderate enrichment of ligand screening against this challenging drug target. Results show that, using a statistical mechanics based free energy method like BEDAM starting from docked poses offers better enrichment than classical docking scoring functions and rescoring methods like Prime MM-GBSA for the Hsp90 data set in this blind challenge. Importantly, among the three methods tested here, only the mean value of the BEDAM binding free energy scores is able to separate the large group of binders from the small group of nonbinders with a gap of 2.4 kcal/mol. None of the three methods that we have tested provided accurate ranking of the affinities of the 147 active compounds. We discuss the possible sources of errors in the binding free energy calculations. The study suggests that BEDAM can be used strategically to discriminate

  15. Neither arginine nor histidine can carry out the function of lysine-295 in the ATP-binding site of p60src.

    PubMed Central

    Kamps, M P; Sefton, B M

    1986-01-01

    All 15 protein kinases whose amino acid sequence is known contain a lysine residue at a position homologous to that of lysine-295 in p60src, the transforming protein of Rous sarcoma virus. The ATP analog p-fluorosulfonyl 5'-benzoyl adenosine inactivates both p60src and the catalytic subunit of the cyclic AMP-dependent protein kinase by modification of this lysine. We used oligonucleotide-directed mutagenesis to examine the possible functions of this residue. Lysine-295 in p60src was replaced with a glutamic acid, an arginine, or a histidine residue, and mutant p60src proteins were characterized in chicken cells infected by mutant viruses. None of these three mutant p60src proteins had tyrosine protein kinase activity in vitro, and none induced morphological transformation of infected cells. Since neither a histidine nor an arginine residue can replace the function of lysine-295, we suggest that it carries out the specialized function of proton transfer in the phosphotransferase reaction. All three mutant viruses underwent reversion to wild type during passage in tissue culture. Because the rate with which this occurred differed significantly among the mutants, reversion appears to have resulted from errors in transcription, rather than from recombination with the cellular src gene. Images PMID:2430174

  16. Variants in the ATP-Binding Cassette Transporter (ABCA7), Apolipoprotein E ε4, and the Risk of Late-Onset Alzheimer Disease in African Americans

    PubMed Central

    Reitz, Christiane; Jun, Gyungah; Naj, Adam; Rajbhandary, Ruchita; Vardarajan, Badri Narayan; Wang, Li-San; Valladares, Otto; Lin, Chiao-Feng; Larson, Eric B.; Graff-Radford, Neill R.; Evans, Denis; De Jager, Philip L.; Crane, Paul K.; Buxbaum, Joseph D.; Murrell, Jill R.; Raj, Towfique; Ertekin-Taner, Nilufer; Logue, Mark; Baldwin, Clinton T.; Green, Robert C.; Barnes, Lisa L.; Cantwell, Laura B.; Fallin, M. Daniele; Go, Rodney C. P.; Griffith, Patrick; Obisesan, Thomas O.; Manly, Jennifer J.; Lunetta, Kathryn L.; Kamboh, M. Ilyas; Lopez, Oscar L.; Bennett, David A.; Hendrie, Hugh; Hall, Kathleen S.; Goate, Alison M.; Byrd, Goldie S.; Kukull, Walter A.; Foroud, Tatiana M.; Haines, Jonathan L.; Farrer, Lindsay A.; Pericak-Vance, Margaret A.; Schellenberg, Gerard D.; Mayeux, Richard

    2013-01-01

    Importance Genetic variants associated with susceptibility to late-onset Alzheimer disease are known for individuals of European ancestry, but whether the same or different variants account for the genetic risk of Alzheimer disease in African American individuals is unknown. Identification of disease-associated variants helps identify targets for genetic testing, prevention, and treatment. Objective To identify genetic loci associated with late-onset Alzheimer disease in African Americans. Design, Setting, and Participants The Alzheimer Disease Genetics Consortium (ADGC) assembled multiple data sets representing a total of 5896 African Americans (1968 case participants, 3928 control participants) 60 years or older that were collected between 1989 and 2011 at multiple sites. The association of Alzheimer disease with genotyped and imputed single-nucleotide polymorphisms (SNPs) was assessed in case-control and in family-based data sets. Results from individual data sets were combined to perform an inverse variance–weighted meta-analysis, first with genome-wide analyses and subsequently with gene-based tests for previously reported loci. Main Outcomes and Measures Presence of Alzheimer disease according to standardized criteria. Results Genome-wide significance in fully adjusted models (sex, age, APOE genotype, population stratification) was observed for a SNP in ABCA7 (rs115550680, allele = G; frequency, 0.09 cases and 0.06 controls; odds ratio [OR], 1.79 [95% CI, 1.47-2.12]; P = 2.2 × 10–9), which is in linkage disequilibrium with SNPs previously associated with Alzheimer disease in Europeans (0.8

  17. NMR studies of the MgATP binding site of adenylate kinase and of a 45-residue peptide fragment of the enzyme.

    PubMed

    Fry, D C; Kuby, S A; Mildvan, A S

    1985-08-13

    Proton NMR was used to study the interaction of beta,gamma-bidentate Cr3+ATP and MgATP with rabbit muscle adenylate kinase, which has 194 amino acids, and with a synthetic peptide consisting of residues 1-45 of the enzyme, which has previously been shown to bind MgepsilonATP [Hamada, M., Palmieri, R. H., Russell, G. A., & Kuby, S. A. (1979) Arch. Biochem. Biophys. 195, 155-177]. The peptide is globular and binds Cr3+ATP competitively with MgATP with a dissociation constant, KD(Cr3+ATP) = 35 microM, comparable to that of the complete enzyme [KI(Cr3+ATP) = 12 microM]. Time-dependent nuclear Overhauser effects (NOE's) were used to measure interproton distances on enzyme- and peptide-bound MgATP. The correlation time was measured directly for peptide-bound MgATP by studying the frequency dependence of the NOE's at 250 and 500 MHz. The H2' to H1' distance so obtained (3.07 A) was within the range established by X-ray and model-building studies of nucleotides (2.9 +/- 0.2 A). Interproton distances yielded conformations of enzyme- and peptide-bound MgATP with indistinguishable anti-glycosyl torsional angles (chi = 63 +/- 12 degrees) and 3'-endo/O1'-endo ribose puckers (sigma = 96 +/- 12 degrees). Enzyme- and peptide-bound MgATP molecules exhibited different C4'-C5' torsional angles (gamma) of 170 degrees and 50 degrees, respectively. Ten intermolecular NOE's from protons of the enzyme and four such NOE's from protons of the peptide to protons of bound MgATP were detected, which indicated proximity of the adenine ribose moiety to the same residues on both the enzyme and the peptide. Paramagnetic effects of beta,gamma-bidentate Cr3+ATP on the longitudinal relaxation rates of protons of the peptide provided a set of distances to the side chains of five residues, which allowed the location of the bound Cr3+ atom to be uniquely defined. Distances from enzyme-bound Cr3+ATP to the side chains of three residues of the protein agreed with those measured for the peptide. The mutual consistency of interproton and Cr3+ to proton distances obtained in metal-ATP complexes of both the enzyme and the peptide suggests that the conformation of the peptide is very similar to that of residues 1-45 of the enzyme. When this was assumed to be the case and when molecular models and a computer graphics system were used, MgATP could be fit into the X-ray structure of adenylate kinase in a unique manner such that all of the distances determined by NMR were accommodated.(ABSTRACT TRUNCATED AT 400 WORDS)

  18. Inhibitory Potential of Antifungal Drugs on ATP-Binding Cassette Transporters P-Glycoprotein, MRP1 to MRP5, BCRP, and BSEP

    PubMed Central

    Lempers, Vincent J. C.; van den Heuvel, Jeroen J. M. W.; Russel, Frans G. M.; Aarnoutse, Rob E.; Burger, David M.; Koenderink, Jan B.

    2016-01-01

    Inhibition of ABC transporters is a common mechanism underlying drug-drug interactions (DDIs). We determined the inhibitory potential of antifungal drugs currently used for invasive fungal infections on ABC transporters P-glycoprotein (P-gp), MRP1 to MRP5, BCRP, and BSEP in vitro. Membrane vesicles isolated from transporter-overexpressing HEK 293 cells were used to investigate the inhibitory potential of antifungal drugs (250 μM) on transport of model substrates. Concentration-inhibition curves were determined if transport inhibition was >60%. Fifty percent inhibitory concentrations (IC50s) for P-gp and BCRP were both 2 μM for itraconazole, 5 and 12 μM for hydroxyitraconazole, 3 and 6 μM for posaconazole, and 3 and 11 μM for isavuconazole, respectively. BSEP was strongly inhibited by itraconazole and hydroxyitraconazole (3 and 17 μM, respectively). Fluconazole and voriconazole did not inhibit any transport for >60%. Micafungin uniquely inhibited all transporters, with strong inhibition of MRP4 (4 μM). Anidulafungin and caspofungin showed strong inhibition of BCRP (7 and 6 μM, respectively). Amphotericin B only weakly inhibited BCRP-mediated transport (127 μM). Despite their wide range of DDIs, azole antifungals exhibit selective inhibition on efflux transporters. Although echinocandins display low potential for clinically relevant DDIs, they demonstrate potent in vitro inhibitory activity. This suggests that inhibition of ABC transporters plays a crucial role in the inexplicable (non-cytochrome P450-mediated) DDIs with antifungal drugs. PMID:27001813

  19. Inhibitory Potential of Antifungal Drugs on ATP-Binding Cassette Transporters P-Glycoprotein, MRP1 to MRP5, BCRP, and BSEP.

    PubMed

    Lempers, Vincent J C; van den Heuvel, Jeroen J M W; Russel, Frans G M; Aarnoutse, Rob E; Burger, David M; Brüggemann, Roger J; Koenderink, Jan B

    2016-06-01

    Inhibition of ABC transporters is a common mechanism underlying drug-drug interactions (DDIs). We determined the inhibitory potential of antifungal drugs currently used for invasive fungal infections on ABC transporters P-glycoprotein (P-gp), MRP1 to MRP5, BCRP, and BSEP in vitro Membrane vesicles isolated from transporter-overexpressing HEK 293 cells were used to investigate the inhibitory potential of antifungal drugs (250 μM) on transport of model substrates. Concentration-inhibition curves were determined if transport inhibition was >60%. Fifty percent inhibitory concentrations (IC50s) for P-gp and BCRP were both 2 μM for itraconazole, 5 and 12 μM for hydroxyitraconazole, 3 and 6 μM for posaconazole, and 3 and 11 μM for isavuconazole, respectively. BSEP was strongly inhibited by itraconazole and hydroxyitraconazole (3 and 17 μM, respectively). Fluconazole and voriconazole did not inhibit any transport for >60%. Micafungin uniquely inhibited all transporters, with strong inhibition of MRP4 (4 μM). Anidulafungin and caspofungin showed strong inhibition of BCRP (7 and 6 μM, respectively). Amphotericin B only weakly inhibited BCRP-mediated transport (127 μM). Despite their wide range of DDIs, azole antifungals exhibit selective inhibition on efflux transporters. Although echinocandins display low potential for clinically relevant DDIs, they demonstrate potent in vitro inhibitory activity. This suggests that inhibition of ABC transporters plays a crucial role in the inexplicable (non-cytochrome P450-mediated) DDIs with antifungal drugs.

  20. Construction of Listeria monocytogenes mutants with in-frame deletions in putative ATP-binding cassette (ABC) transporters and analysis of their growth under stress conditions

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Listeria monocytogenes is a foodborne pathogen that is difficult to eliminate since it can survive under multiple stress conditions such as low pH and low temperature. Understanding its survival under stress conditions is important to control this pathogen in food. ABC transporters have been shown...

  1. Discovery of 4,5,6,7-Tetrahydrobenzo[1,2-d]thiazoles as Novel DNA Gyrase Inhibitors Targeting the ATP-Binding Site.

    PubMed

    Tomašič, Tihomir; Katsamakas, Sotirios; Hodnik, Žiga; Ilaš, Janez; Brvar, Matjaž; Solmajer, Tom; Montalvão, Sofia; Tammela, Päivi; Banjanac, Mihailo; Ergović, Gabrijela; Anderluh, Marko; Peterlin Mašič, Lucija; Kikelj, Danijel

    2015-07-23

    Bacterial DNA gyrase and topoisomerase IV are essential enzymes that control the topological state of DNA during replication and validated antibacterial drug targets. Starting from a library of marine alkaloid oroidin analogues, we identified low micromolar inhibitors of Escherichia coli DNA gyrase based on the 5,6,7,8-tetrahydroquinazoline and 4,5,6,7-tetrahydrobenzo[1,2-d]thiazole scaffolds. Structure-based optimization of the initial hits resulted in low nanomolar E. coli DNA gyrase inhibitors, some of which exhibited micromolar inhibition of E. coli topoisomerase IV and of Staphylococcus aureus homologues. Some of the compounds possessed modest antibacterial activity against Gram positive bacterial strains, while their evaluation against wild-type, impA and ΔtolC E. coli strains suggests that they are efflux pump substrates and/or do not possess the physicochemical properties necessary for cell wall penetration. Our study provides a rationale for optimization of this class of compounds toward balanced dual DNA gyrase and topoisomerase IV inhibitors with antibacterial activity.

  2. ATP binding and hydrolysis and autophosphorylation of CbbQ encoded by the gene located downstream of RubisCO genes.

    PubMed

    Hayashi, Nobuhiro R; Igarashi, Yasuo

    2002-02-08

    CbbQ is encoded by the gene located downstream of ribulose 1,5-bisphosphate carboxylase/oxygenase genes (cbbLS) in the thermophilic hydrogen-oxidizing bacterium, Hydrogenophilus thermoluteolus. The protein possesses two nucleotide-binding motifs in its amino acid sequence, and it posttranslationally activates RubisCO. We present ATP hydrolysis and binding of CbbQ. CbbQ releases P(i) from ATP only in the presence of Mg(2+). CbbQ interacts with an 2'(3')-O-(2,4,6-trinitrophenyl)adenosine 5'-triphosphate in the presence or absence of Mg(2+). The interaction with Mg(2+) and/or a nucleotide induces a conformational change in CbbQ. Autophosphorylation of CbbQ occurs only in the absence of Mg(2+).

  3. Up-regulation of ATP-binding cassette transporters in the THP-1 human macrophage cell line by the antichagasic benznidazole

    PubMed Central

    Perdomo, Virginia G; Rigalli, Juan P; Luquita, Marcelo G; Pellegrino, José M; Ruiz, María Laura; Catania, Viviana A

    2016-01-01

    The effect of benznidazole (BZL) on the expression and activity of P-glycoprotein (P-gp, ABCB1) and multidrug resistance-associated protein 2 (MRP2, ABCC2), the two major transporters of endogenous and exogenous compounds, was evaluated in differentiated THP-1 cells. BZL induced P-gp and MRP2 proteins in a concentration-dependent manner. The increase in mRNA levels of both transporters suggests transcriptional regulation. P-gp and MRP2 activities correlated with increased protein levels. BZL intracellular accumulation was significantly lower in BZL-pre-treated cells than in control cells. PSC833 (a P-gp inhibitor) increased the intracellular BZL concentration in both pre-treated and control cells, confirming P-gp participation in BZL efflux. PMID:27783718

  4. Effects of a fixed-intensity of endurance training and pistacia atlantica supplementation on ATP-binding cassette G4 expression

    PubMed Central

    2013-01-01

    Background Adenosine triphosphate-cassette binding protein (ABC) type G is considered as a part of reverse cholesterol transport (RCT) process in modification and metabolism of plasma and tissue cholesterol. This study aims to evaluate the effect of endurance training with or without Pistacia atlantica (Baneh) supplementation on the female rat tissues ABC type G expression and its correlation with plasma high-density lipoprotein cholesterol (HDL-C) concentration. Methods Twenty Wistar rats (six to eight weeks old, 125–135 g weight) were arbitrarily allocated into training (n = 10) and control (n = 10) groups and further divided into saline-control (n = 5), saline-training (n = 5), Baneh-control (n = 5), and Baneh-training (n = 5). The training groups were given exercise on a motor-driven treadmill at 25 m/min (0% grade) for 60 min/day, 5 days/week for eight weeks. The rats were fed orally with Baneh extract and saline for six weeks. Seventy-two hours after the last training session, the rats were sacrificed and their tissues were excised for tissues ABCG4 expression which was detected by Real-time PCR method. Results The ABCG4 gene expressions were significantly higher in liver (P = 02), small intestine (P = 06), and visceral fat tissues (P = 04) of the trained rats compared to the tissues of the control rats, but were lower in Baneh treated rats (liver P = 045, small intestine P = 06 and visceral fat P = 004) with lower HDL-C concentrations (P = 008). Conclusions The Baneh administration lowered tissues ABCG4 expression and plasma HDL-C concentrations while endurance training increased the expression in female rat tissues. PMID:24267473

  5. ATP Binding Cassette Transporter ABCA7 Regulates NKT Cell Development and Function by Controlling CD1d Expression and Lipid Raft Content

    PubMed Central

    Nowyhed, Heba N.; Chandra, Shilpi; Kiosses, William; Marcovecchio, Paola; Andary, Farah; Zhao, Meng; Fitzgerald, Michael L.; Kronenberg, Mitchell; Hedrick, Catherine C.

    2017-01-01

    ABCA7 is an ABC transporter expressed on the plasma membrane, and actively exports phospholipid complexes from the cytoplasmic to the exocytoplasmic leaflet of membranes. Invariant NKT (iNKT) cells are a subpopulation of T lymphocytes that recognize glycolipid antigens in the context of CD1d-mediated antigen presentation. In this study, we demonstrate that ABCA7 regulates the development of NKT cells in a cell-extrinsic manner. We found that in Abca7−/− mice there is reduced expression of CD1d accompanied by an alteration in lipid raft content on the plasma membrane of thymocytes and antigen presenting cells. Together, these alterations caused by absence of ABCA7 negatively affect NKT cell development and function. PMID:28091533

  6. The bovine ATP-binding cassette transporter ABCG2 Tyr581Ser single-nucleotide polymorphism increases milk secretion of the fluoroquinolone danofloxacin.

    PubMed

    Otero, Jon A; Real, Rebeca; de la Fuente, Álvaro; Prieto, Julio G; Marqués, Margarita; Álvarez, Ana I; Merino, Gracia

    2013-03-01

    The bovine adenosine triphosphate-binding cassette transporter G2 (ABCG2/breast cancer resistance protein) polymorphism Tyr581Ser (Y581S) has recently been shown to increase in vitro transepithelial transport of antibiotics. Since this transporter has been extensively related to the active secretion of drugs into milk, the potential in vivo effect of this polymorphism on secretion of xenobiotics in livestock could have striking consequences for milk production, the dairy industry, and public health. Our purpose was to study the in vivo effect of this polymorphism on the secretion of danofloxacin, a widely used veterinary antibiotic, into milk. Danofloxacin (1.25 mg/kg) was administered to six Y/Y 581 homozygous and six Y/S 581 heterozygous lactating cows, and plasma and milk samples were collected and analyzed by high-performance liquid chromatography. No differences were found in the pharmacokinetic parameters of danofloxacin in plasma between the two groups of animals. In contrast, Y/S heterozygous cows showed a 2-fold increase in danofloxacin levels in milk. In addition, the pharmacokinetic elimination parameters, mean residence time and elimination half-life, were significantly lower in the milk of the animals carrying the Y/S polymorphism. These in vivo results are in agreement with our previously published in vitro data, which showed a greater capacity of the S581 variant in accumulation assays, and demonstrate, for the first time, an important effect of the Y581S single-nucleotide polymorphism on antibiotic secretion into cow milk. These findings could be extended to other ABCG2 substrates, and may be relevant for the treatment of mastitis and for the design of accurate and novel strategies to handle milk residues.

  7. Encapsulated Brucella ovis Lacking a Putative ATP-Binding Cassette Transporter (ΔabcBA) Protects against Wild Type Brucella ovis in Rams

    PubMed Central

    Silva, Ana Patrícia C.; Macêdo, Auricélio A.; Costa, Luciana F.; Rocha, Cláudia E.; Garcia, Luize N. N.; Farias, Jade R. D.; Gomes, Priscilla P. R.; Teixeira, Gustavo C.; Fonseca, Kessler W. J.; Maia, Andréa R. F.; Neves, Gabriela G.; Romão, Everton L.; Silva, Teane M. A.; Mol, Juliana P. S.; Oliveira, Renata M.; Araújo, Márcio S. S.; Nascimento, Ernane F.; Martins-Filho, Olindo A.; Brandão, Humberto M.; Paixão, Tatiane A.; Santos, Renato L.

    2015-01-01

    This study aimed to evaluate protection induced by the vaccine candidate B. ovis ΔabcBA against experimental challenge with wild type B. ovis in rams. Rams were subcutaneously immunized with B. ovis ΔabcBA encapsulated with sterile alginate or with the non encapsulated vaccine strain. Serum, urine, and semen samples were collected during two months after immunization. The rams were then challenged with wild type B. ovis (ATCC25840), and the results were compared to non immunized and experimentally challenged rams. Immunization, particularly with encapsulated B. ovis ΔabcBA, prevented infection, secretion of wild type B. ovis in the semen and urine, shedding of neutrophils in the semen, and the development of clinical changes, gross and microscopic lesions induced by the wild type B. ovis reference strain. Collectively, our data indicates that the B. ovis ΔabcBA strain is an exceptionally good vaccine strain for preventing brucellosis caused by B. ovis infection in rams. PMID:26317399

  8. A double blinded, placebo-controlled pilot study to examine reduction of CD34 +/CD117 +/CD133 + lymphoma progenitor cells and duration of remission induced by neoadjuvant valspodar in dogs with large B-cell lymphoma

    PubMed Central

    Ito, Daisuke; Childress, Michael; Mason, Nicola; Winter, Amber; O’Brien, Timothy; Henson, Michael; Borgatti, Antonella; Lewellen, Mitzi; Krick, Erika; Stewart, Jane; Lahrman, Sarah; Rajwa, Bartek; Scott, Milcah C; Seelig, Davis; Koopmeiners, Joseph; Ruetz, Stephan; Modiano, Jaime

    2017-01-01

    We previously described a population of lymphoid progenitor cells (LPCs) in canine B-cell lymphoma defined by retention of the early progenitor markers CD34 and CD117 and “slow proliferation” molecular signatures that persist in the xenotransplantation setting. We examined whether valspodar, a selective inhibitor of the ATP binding cassette B1 transporter (ABCB1, a.k.a., p-glycoprotein/multidrug resistance protein-1) used in the neoadjuvant setting would sensitize LPCs to doxorubicin and extend the length of remission in dogs with therapy naïve large B-cell lymphoma. Twenty dogs were enrolled into a double-blinded, placebo controlled study where experimental and control groups received oral valspodar (7.5 mg/kg) or placebo, respectively, twice daily for five days followed by five treatments with doxorubicin 21 days apart with a reduction in the first dose to mitigate the potential side effects of ABCB1 inhibition. Lymph node and blood LPCs were quantified at diagnosis, on the fourth day of neoadjuvant period, and 1-week after the first chemotherapy dose. Valspodar therapy was well tolerated. There were no differences between groups in total LPCs in lymph nodes or peripheral blood, nor in event-free survival or overall survival. Overall, we conclude that valspodar can be administered safely in the neoadjuvant setting for canine B-cell lymphoma; however, its use to attenuate ABCB1 + cells does not alter the composition of lymph node or blood LPCs, and it does not appear to be sufficient to prolong doxorubicin-dependent remissions in this setting. PMID:28357033

  9. Self-association of isolated large cytoplasmic domain of plasma membrane H+ -ATPase from Saccharomyces cerevisiae: role of the phosphorylation domain in a general dimeric model for P-ATPases.

    PubMed

    Almeida, W I; Martins, O B; Carvalho-Alves, P C

    2006-11-01

    Large cytoplasmic domain (LCD) plasma membrane H+ -ATPase from S. cerevisiae was expressed as two fusion polypeptides in E. coli: a DNA sequence coding for Leu353-Ileu674 (LCDh), comprising both nucleotide (N) and phosphorylation (P) domains, and a DNA sequence coding for Leu353-Thr543 (LCDDeltah, lacking the C-terminus of P domain), were inserted in expression vectors pDEST-17, yielding the respective recombinant plasmids. Overexpressed fusion polypeptides were solubilized with 6 M urea and purified on affinity columns, and urea was removed by dialysis. Their predicted secondary structure contents were confirmed by CD spectra. In addition, both recombinant polypeptides exhibited high-affinity 2',3'-O-(2,4,6-trinitrophenyl)adenosine-5'-triphosphate (TNP-ATP) binding (Kd = 1.9 microM and 2.9 microM for LCDh and LCDDeltah, respectively), suggesting that they have native-like folding. The gel filtration profile (HPLC) of purified LCDh showed two main peaks, with molecular weights of 95 kDa and 39 kDa, compatible with dimeric and monomeric forms, respectively. However, a single elution peak was observed for purified LCDDeltah, with an estimated molecular weight of 29 kDa, as expected for a monomer. Together, these data suggest that LCDh exist in monomer-dimer equilibrium, and that the C-terminus of P domain is necessary for self-association. We propose that such association is due to interaction between vicinal P domains, which may be of functional relevance for H+ -ATPase in native membranes. We discuss a general dimeric model for P-ATPases with interacting P domains, based on published crystallography and cryo-electron microscopy evidence.

  10. Instantons and Large N

    NASA Astrophysics Data System (ADS)

    Mariño, Marcos

    2015-09-01

    Preface; Part I. Instantons: 1. Instantons in quantum mechanics; 2. Unstable vacua in quantum field theory; 3. Large order behavior and Borel summability; 4. Non-perturbative aspects of Yang-Mills theories; 5. Instantons and fermions; Part II. Large N: 6. Sigma models at large N; 7. The 1=N expansion in QCD; 8. Matrix models and matrix quantum mechanics at large N; 9. Large N QCD in two dimensions; 10. Instantons at large N; Appendix A. Harmonic analysis on S3; Appendix B. Heat kernel and zeta functions; Appendix C. Effective action for large N sigma models; References; Author index; Subject index.

  11. The structure of SV40 large T hexameric helicase in complex with AT-rich origin DNA

    PubMed Central

    Gai, Dahai; Wang, Damian; Li, Shu-Xing; Chen, Xiaojiang S

    2016-01-01

    DNA replication is a fundamental biological process. The initial step in eukaryotic DNA replication is the assembly of the pre-initiation complex, including the formation of two head-to-head hexameric helicases around the replication origin. How these hexameric helicases interact with their origin dsDNA remains unknown. Here, we report the co-crystal structure of the SV40 Large-T Antigen (LT) hexameric helicase bound to its origin dsDNA. The structure shows that the six subunits form a near-planar ring that interacts with the origin, so that each subunit makes unique contacts with the DNA. The origin dsDNA inside the narrower AAA+ domain channel shows partial melting due to the compression of the two phosphate backbones, forcing Watson-Crick base-pairs within the duplex to flip outward. This structure provides the first snapshot of a hexameric helicase binding to origin dsDNA, and suggests a possible mechanism of origin melting by LT during SV40 replication in eukaryotic cells. DOI: http://dx.doi.org/10.7554/eLife.18129.001 PMID:27921994

  12. Large displacement spherical joint

    DOEpatents

    Bieg, Lothar F.; Benavides, Gilbert L.

    2002-01-01

    A new class of spherical joints has a very large accessible full cone angle, a property which is beneficial for a wide range of applications. Despite the large cone angles, these joints move freely without singularities.

  13. Large mode radius resonators

    NASA Technical Reports Server (NTRS)

    Harris, Michael R.

    1987-01-01

    Resonator configurations permitting operation with large mode radius while maintaining good transverse mode discrimination are considered. Stable resonators incorporating an intracavity telescope and unstable resonator geometries utilizing an output coupler with a Gaussian reflectivity profile are shown to enable large radius single mode laser operation. Results of heterodyne studies of pulsed CO2 lasers with large (11mm e sup-2 radius) fundamental mode sizes are presented demonstrating minimal frequency sweeping in accordance with the theory of laser-induced medium perturbations.

  14. LARGE BUILDING RADON MANUAL

    EPA Science Inventory

    The report summarizes information on how bilding systems -- especially the heating, ventilating, and air-conditioning (HVAC) system -- inclurence radon entry into large buildings and can be used to mitigate radon problems. It addresses the fundamentals of large building HVAC syst...

  15. Large wind turbine generators

    NASA Technical Reports Server (NTRS)

    Thomas, R. L.; Donovon, R. M.

    1978-01-01

    The development associated with large wind turbine systems is briefly described. The scope of this activity includes the development of several large wind turbines ranging in size from 100 kW to several megawatt levels. A description of the wind turbine systems, their programmatic status and a summary of their potential costs is included.

  16. Large Print Bibliography, 1990.

    ERIC Educational Resources Information Center

    South Dakota State Library, Pierre.

    This bibliography lists materials that are available in large print format from the South Dakota State Library. The annotated entries are printed in large print and include the title of the material and its author, call number, publication date, and type of story or subject area covered. Some recorded items are included in the list. The entries…

  17. Large Customers (DR Sellers)

    SciTech Connect

    Kiliccot, Sila

    2011-10-25

    State of the large customers for demand response integration of solar and wind into electric grid; openADR; CAISO; DR as a pseudo generation; commercial and industrial DR strategies; California regulations

  18. Closed Large Cell Clouds

    Atmospheric Science Data Center

    2013-04-19

    article title:  Closed Large Cell Clouds in the South Pacific     ... unperturbed by cyclonic or frontal activity. When the cell centers are cloudy and the main sinking motion is concentrated at cell ...

  19. Large scale dynamic systems

    NASA Technical Reports Server (NTRS)

    Doolin, B. F.

    1975-01-01

    Classes of large scale dynamic systems were discussed in the context of modern control theory. Specific examples discussed were in the technical fields of aeronautics, water resources and electric power.

  20. Large bowel resection - discharge

    MedlinePlus

    ... 26. Read More Colon cancer Colostomy Crohn disease Intestinal obstruction Large bowel resection Ulcerative colitis Patient Instructions Bland ... Diseases Colonic Polyps Colorectal Cancer Diverticulosis and Diverticulitis Intestinal Obstruction Ulcerative Colitis Browse the Encyclopedia A.D.A. ...

  1. Large Deployable Shroud

    NASA Technical Reports Server (NTRS)

    Jacquemin, G. G.

    1987-01-01

    Preliminary design proposed for large, lightweight telescope shroud or light shield carried to orbit in single Space Shuttle cargo load. Shroud concept applied on Earth in portable, compactly storable displays or projection screens. Large telescope shroud includes four deployable masts erecting eight walls of hinged panels of polyimide film. Panels stored fanfolded before deployment and threaded on guide wires unwinding from spools and remain taut during deployment.

  2. Large electrostatic accelerators

    SciTech Connect

    Jones, C.M.

    1984-01-01

    The increasing importance of energetic heavy ion beams in the study of atomic physics, nuclear physics, and materials science has partially or wholly motivated the construction of a new generation of large electrostatic accelerators designed to operate at terminal potentials of 20 MV or above. In this paper, the author briefly discusses the status of these new accelerators and also discusses several recent technological advances which may be expected to further improve their performance. The paper is divided into four parts: (1) a discussion of the motivation for the construction of large electrostatic accelerators, (2) a description and discussion of several large electrostatic accelerators which have been recently completed or are under construction, (3) a description of several recent innovations which may be expected to improve the performance of large electrostatic accelerators in the future, and (4) a description of an innovative new large electrostatic accelerator whose construction is scheduled to begin next year. Due to time and space constraints, discussion is restricted to consideration of only tandem accelerators.

  3. Large-Scale Disasters

    NASA Astrophysics Data System (ADS)

    Gad-El-Hak, Mohamed

    "Extreme" events - including climatic events, such as hurricanes, tornadoes, and drought - can cause massive disruption to society, including large death tolls and property damage in the billions of dollars. Events in recent years have shown the importance of being prepared and that countries need to work together to help alleviate the resulting pain and suffering. This volume presents a review of the broad research field of large-scale disasters. It establishes a common framework for predicting, controlling and managing both manmade and natural disasters. There is a particular focus on events caused by weather and climate change. Other topics include air pollution, tsunamis, disaster modeling, the use of remote sensing and the logistics of disaster management. It will appeal to scientists, engineers, first responders and health-care professionals, in addition to graduate students and researchers who have an interest in the prediction, prevention or mitigation of large-scale disasters.

  4. Death Writ Large

    ERIC Educational Resources Information Center

    Kastenbaum, Robert

    2004-01-01

    Mainstream thanatology has devoted its efforts to improving the understanding, care, and social integration of people who are confronted with life-threatening illness or bereavement. This article suggests that it might now be time to expand the scope and mission to include large-scale death and death that occurs through complex and multi-domain…

  5. Developing Large CAI Packages.

    ERIC Educational Resources Information Center

    Reed, Mary Jac M.; Smith, Lynn H.

    1983-01-01

    When developing large computer-assisted instructional (CAI) courseware packages, it is suggested that there be more attentive planning to the overall package design before actual lesson development is begun. This process has been simplified by modifying the systems approach used to develop single CAI lessons, followed by planning for the…

  6. Risks of Large Portfolios

    PubMed Central

    Fan, Jianqing; Liao, Yuan; Shi, Xiaofeng

    2014-01-01

    The risk of a large portfolio is often estimated by substituting a good estimator of the volatility matrix. However, the accuracy of such a risk estimator is largely unknown. We study factor-based risk estimators under a large amount of assets, and introduce a high-confidence level upper bound (H-CLUB) to assess the estimation. The H-CLUB is constructed using the confidence interval of risk estimators with either known or unknown factors. We derive the limiting distribution of the estimated risks in high dimensionality. We find that when the dimension is large, the factor-based risk estimators have the same asymptotic variance no matter whether the factors are known or not, which is slightly smaller than that of the sample covariance-based estimator. Numerically, H-CLUB outperforms the traditional crude bounds, and provides an insightful risk assessment. In addition, our simulated results quantify the relative error in the risk estimation, which is usually negligible using 3-month daily data. PMID:26195851

  7. Estimating Large Numbers

    ERIC Educational Resources Information Center

    Landy, David; Silbert, Noah; Goldin, Aleah

    2013-01-01

    Despite their importance in public discourse, numbers in the range of 1 million to 1 trillion are notoriously difficult to understand. We examine magnitude estimation by adult Americans when placing large numbers on a number line and when qualitatively evaluating descriptions of imaginary geopolitical scenarios. Prior theoretical conceptions…

  8. LARGE BUILDING HVAC SIMULATION

    EPA Science Inventory

    The report discusses the monitoring and collection of data relating to indoor pressures and radon concentrations under several test conditions in a large school building in Bartow, Florida. The Florida Solar Energy Center (FSEC) used an integrated computational software, FSEC 3.0...

  9. Large, Easily Deployable Structures

    NASA Technical Reports Server (NTRS)

    Agan, W. E.

    1983-01-01

    Study of concepts for large space structures will interest those designing scaffolding, radio towers, rescue equipment, and prefabricated shelters. Double-fold, double-cell module was selected for further design and for zero gravity testing. Concept is viable for deployment by humans outside space vehicle as well as by remotely operated manipulator.

  10. Teaching Very Large Classes

    ERIC Educational Resources Information Center

    DeRogatis, Amy; Honerkamp, Kenneth; McDaniel, Justin; Medine, Carolyn; Nyitray, Vivian-Lee; Pearson, Thomas

    2014-01-01

    The editor of "Teaching Theology and Religion" facilitated this reflective conversation with five teachers who have extensive experience and success teaching extremely large classes (150 students or more). In the course of the conversation these professors exchange and analyze the effectiveness of several active learning strategies they…

  11. Teaching Large Evening Classes

    ERIC Educational Resources Information Center

    Wambuguh, Oscar

    2008-01-01

    High enrollments, conflicting student work schedules, and the sheer convenience of once-a-week classes are pushing many colleges to schedule evening courses. Held from 6 to 9 pm or 7 to 10 pm, these classes are typically packed, sometimes with more than 150 students in a large lecture theater. How can faculty effectively teach, control, or even…

  12. Risks of Large Portfolios.

    PubMed

    Fan, Jianqing; Liao, Yuan; Shi, Xiaofeng

    2015-06-01

    The risk of a large portfolio is often estimated by substituting a good estimator of the volatility matrix. However, the accuracy of such a risk estimator is largely unknown. We study factor-based risk estimators under a large amount of assets, and introduce a high-confidence level upper bound (H-CLUB) to assess the estimation. The H-CLUB is constructed using the confidence interval of risk estimators with either known or unknown factors. We derive the limiting distribution of the estimated risks in high dimensionality. We find that when the dimension is large, the factor-based risk estimators have the same asymptotic variance no matter whether the factors are known or not, which is slightly smaller than that of the sample covariance-based estimator. Numerically, H-CLUB outperforms the traditional crude bounds, and provides an insightful risk assessment. In addition, our simulated results quantify the relative error in the risk estimation, which is usually negligible using 3-month daily data.

  13. Large bouncing jets

    NASA Astrophysics Data System (ADS)

    Cardin, Karl; Weislogel, Mark

    2016-11-01

    We experimentally investigate the phenomena of large jet rebound (bounce), a mode of fluid transfer following oblique jet impacts on hydrophobic surfaces. We initially seek to describe the regimes of such jet bounce in tests conducted in the weightless environment of a drop tower. A parametric study reveals the dependence of the rebound mode on the relevant dimensionless groups such as Weber number We⊥ defined on the velocity component perpendicular to the surface. We show that significantly larger diameter jets behave similarly as much smaller jets demonstrated during previous terrestrial investigations when We⊥ 1 . For We⊥ > 1 , large jet impacts create fishbone-like structures. We also explore rebounds from nonplanar substrates. Improving our understanding of such jet rebound opens avenues for unique transport capabilities. NASA Cooperative Agreement NNX12A047A.

  14. Large area mass analyzer

    NASA Astrophysics Data System (ADS)

    Rachev, Mikhail; Srama, Ralf; Srowig, Andre; Grün, Eberhard

    2004-12-01

    A new time-of-flight spectrometer for the chemical analysis of cosmic dust particles in space has been simulated by Simion 7.0. The instrument is based upon impact ionization. This method is a reliable method for in situ dust detection and is well established. Instruments using the impact ionization flew on board of Helios and Galileo and are still in operation on board of the Ulysses and Cassini-Huygens missions. The new instrument has a large sensitive area of 0.1 m2 in order to achieve a significant number of measurements. The mass resolution M/ΔM>100 and the mass range covers the most relevant elements expected in cosmic dust. The instrument has a reflectron configuration which increases the mass resolution. Most of the ions released during the impact are focused to the detector. The ion detector consists of a large area ion-to-electron converter, an electron reflectron and a microchannel plate detector.

  15. The Universe at Large

    NASA Astrophysics Data System (ADS)

    Münch, Guido; Mampaso, Antonio; Sánchez, Francisco

    1997-11-01

    The Universe at Large presents a unique survey of key questions outstanding in contemporary astronomy and cosmology. In this timely volume, eleven of the world's greatest living astronomers and cosmologists present personal views of what problems must be addressed by future research. Allan Sandage presents a 23-point plan to reach a full understanding of the large-scale structure in the Universe; Geoffrey Burbidge looks at the future of the Quasi Steady State alternative to the Big Bang; E. Margaret Burbidge, Donald Osterbrock and Malcolm Longair discuss active galactic nuclei (AGN); Igor Novikov, Donald Lynden-Bell, Martin Rees and Rashid Sunyaev look at the physics of black holes; and Bernard Pagel and Hubert Reeves concentrate on what we don't yet understand about elements in the cosmos. This book provides a unique review of our current understanding in astronomy and cosmology and a host of profitable research ideas for graduate students and researchers.

  16. Large Magellanic Cloud

    NASA Astrophysics Data System (ADS)

    Murdin, P.

    2000-11-01

    The larger of two nearby companions of the Milky Way Galaxy that can be seen with the naked eye in the southern hemisphere sky and which are named after the Portuguese navigator, Ferdinand Magellan, who observed them in 1519 during his circumnavigation of the world. Located in the constellation of Dorado, at a distance of about 170 000 light-years, the Large Magellanic Cloud (LMC) has an overall ...

  17. Large area LED package

    NASA Astrophysics Data System (ADS)

    Goullon, L.; Jordan, R.; Braun, T.; Bauer, J.; Becker, F.; Hutter, M.; Schneider-Ramelow, M.; Lang, K.-D.

    2015-03-01

    Solid state lighting using LED-dies is a rapidly growing market. LED-dies with the needed increasing luminous flux per chip area produce a lot of heat. Therefore an appropriate thermal management is required for general lighting with LEDdies. One way to avoid overheating and shorter lifetime is the use of many small LED-dies on a large area heat sink (down to 70 μm edge length), so that heat can spread into a large area while at the same time light also appears on a larger area. The handling with such small LED-dies is very difficult because they are too small to be picked with common equipment. Therefore a new concept called collective transfer bonding using a temporary carrier chip was developed. A further benefit of this new technology is the high precision assembly as well as the plane parallel assembly of the LED-dies which is necessary for wire bonding. It has been shown that hundred functional LED-dies were transferred and soldered at the same time. After the assembly a cost effective established PCB-technology was applied to produce a large-area light source consisting of many small LED-dies and electrically connected on a PCB-substrate. The top contacts of the LED-dies were realized by laminating an adhesive copper sheet followed by LDI structuring as known from PCB-via-technology. This assembly can be completed by adding converting and light forming optical elements. In summary two technologies based on standard SMD and PCB technology have been developed for panel level LED packaging up to 610x 457 mm2 area size.

  18. The Large Area Telescope

    SciTech Connect

    Michelson, Peter F.; /KIPAC, Menlo Park /Stanford U., HEPL

    2007-11-13

    The Large Area Telescope (LAT), one of two instruments on the Gamma-ray Large Area Space Telescope (GLAST) mission, is an imaging, wide field-of-view, high-energy pair-conversion telescope, covering the energy range from {approx}20 MeV to more than 300 GeV. The LAT is being built by an international collaboration with contributions from space agencies, high-energy particle physics institutes, and universities in France, Italy, Japan, Sweden, and the United States. The scientific objectives the LAT will address include resolving the high-energy gamma-ray sky and determining the nature of the unidentified gamma-ray sources and the origin of the apparently isotropic diffuse emission observed by EGRET; understanding the mechanisms of particle acceleration in celestial sources, including active galactic nuclei, pulsars, and supernovae remnants; studying the high-energy behavior of gamma-ray bursts and transients; using high-energy gamma-rays to probe the early universe to z {ge} 6; and probing the nature of dark matter. The components of the LAT include a precision silicon-strip detector tracker and a CsI(Tl) calorimeter, a segmented anticoincidence shield that covers the tracker array, and a programmable trigger and data acquisition system. The calorimeter's depth and segmentation enable the high-energy reach of the LAT and contribute significantly to background rejection. The aspect ratio of the tracker (height/width) is 0.4, allowing a large field-of-view and ensuring that nearly all pair-conversion showers initiated in the tracker will pass into the calorimeter for energy measurement. This paper includes a description of each of these LAT subsystems as well as a summary of the overall performance of the telescope.

  19. The large pursuit rotor.

    PubMed

    Williams, L R; Grbin, I R

    1976-09-01

    The question of whether certain phenomena that occur on the conventional rotary pursuit and other small apparatus also appear on a gross motor task was examined using a large pursuit rotor that required whole-body movements. College males (n=29) were given 90 10-sec trials over three consecutive days with 30 trials of continuous practice per day. The existence of reactive inhibition, reminiscence, and warmup decrement was confirmed, indicating that common mechanisms underlie both fine and gross bodily movements. In addition, the substantial amounts of learning and the high reliabilities for performance and learning indicated that the present apparatus has considerable potential for motor-learning research.

  20. Large character sums

    NASA Astrophysics Data System (ADS)

    Granville, Andrew; Soundararajan, K.

    2007-04-01

    In 1918 Polya and Vinogradov gave an upper bound for the maximal size of character sums, which still remains the best known general estimate. One of the main results of this paper provides a substantial improvement of the Polya-Vinogradov bound for characters of odd, bounded order. In 1977 Montgomery and Vaughan showed how the Polya-Vinogradov inequality may be sharpened assuming the Generalized Riemann Hypothesis. We give a simple proof of their estimate and provide an improvement for characters of odd, bounded order. The paper also gives characterizations of the characters for which the maximal character sum is large, and it finds a hidden structure among these characters.

  1. Large Optics Technology.

    DTIC Science & Technology

    1986-05-22

    EEEEEEEEEEmhEE SENSEffl -2-5 12" 110111111 LLLo 111M1. 2 15 .1 111-= NATIONAL BUREAU OF S Mouopy *9sO9u TESI , C N LARGE OPTICS TECHNOLOGY FINAL...Degree of DOCTOR OF PHILOSOPHY In the Graduate College THE UNIVERSITY OF ARIZONA 1981 !mw ’(’* 17 ABSTRACT The mirrors used in high energy laser systems...SCIENCES (GRADUATE) In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY In the Graduate College THE UNIVERSITY OF ARIZONA 1982

  2. Large coil test facility

    SciTech Connect

    Nelms, L.W.; Thompson, P.B.

    1980-01-01

    Final design of the facility is nearing completion, and 20% of the construction has been accomplished. A large vacuum chamber, houses the test assembly which is coupled to appropriate cryogenic, electrical, instrumentation, diagnostc systems. Adequate assembly/disassembly areas, shop space, test control center, offices, and test support laboratories are located in the same building. Assembly and installation operations are accomplished with an overhead crane. The major subsystems are the vacuum system, the test stand assembly, the cryogenic system, the experimental electric power system, the instrumentation and control system, and the data aquisition system.

  3. Large right ventricular thrombus.

    PubMed

    Sousa, Carla; Almeida, Pedro; Gonçalves, Alexandra; Rodrigues, João; Rangel, Inês; Macedo, Filipe; Maciel, M Júlia

    2014-01-01

    Right ventricular thrombosis is a rare yet potentially fatal condition. It has been described in association with hypercoagulability states, autoimmune diseases and dilated cardiomyopathy. Echocardiography constitutes the election tool for diagnosis and characterization of these entities, allowing for the differentiation between the various types of thrombi. We present a case of a patient with alcoholic dilated cardiomyopathy admitted for congestive heart failure and lower respiratory infection. In the diagnostic approach, a routine echocardiography revealed a large mural right ventricular thrombus in association with severe biventricular dysfunction. The patient was proposed for anticoagulation strategy, which he refused.

  4. A large thumb mass.

    PubMed

    Shah, Amit K; Macnair, Rory; Figus, Andrea

    2012-02-01

    A 31-year-old man presented with a 5-year history of a spontaneously occurring soft tissue mass on the palmar aspect of his left non dominant thumb. Over 5 months he was having progressive difficulty flexing at the interphalangeal joint. Magnetic resonance imaging demonstrated an heterogeneously enhancing soft tissue mass likely to be either a peripheral fibromatosis or giant cell tumour of the flexor tendon (Figure 1). Intraoperatively a large neuroma in continuity with the ulnar digital nerve was found and debulked (Figure 2). The diagnosis was confirmed histologically.

  5. Large Spectral Library Problem

    SciTech Connect

    Chilton, Lawrence K.; Walsh, Stephen J.

    2008-10-03

    Hyperspectral imaging produces a spectrum or vector at each image pixel. These spectra can be used to identify materials present in the image. In some cases, spectral libraries representing atmospheric chemicals or ground materials are available. The challenge is to determine if any of the library chemicals or materials exist in the hyperspectral image. The number of spectra in these libraries can be very large, far exceeding the number of spectral channels collected in the ¯eld. Suppose an image pixel contains a mixture of p spectra from the library. Is it possible to uniquely identify these p spectra? We address this question in this paper and refer to it as the Large Spectral Library (LSL) problem. We show how to determine if unique identi¯cation is possible for any given library. We also show that if p is small compared to the number of spectral channels, it is very likely that unique identi¯cation is possible. We show that unique identi¯cation becomes less likely as p increases.

  6. Infinitely Large New Dimensions

    SciTech Connect

    Arkani-Hamed, Nima; Dimopoulos, Savas; Dvali, Gia; Kaloper, Nemanja

    1999-07-29

    We construct intersecting brane configurations in Anti-de-Sitter space localizing gravity to the intersection region, with any number n of extra dimensions. This allows us to construct two kinds of theories with infinitely large new dimensions, TeV scale quantum gravity and sub-millimeter deviations from Newton's Law. The effective 4D Planck scale M{sub Pl} is determined in terms of the fundamental Planck scale M{sub *} and the AdS radius of curvature L via the familiar relation M{sub Pl}{sup 2} {approx} M{sub *}{sup 2+n} L{sup n}; L acts as an effective radius of compactification for gravity on the intersection. Taking M{sub *} {approx} TeV and L {approx} sub-mm reproduces the phenomenology of theories with large extra dimensions. Alternately, taking M{sub *} {approx} L{sup -1} {approx} M{sub Pl}, and placing our 3-brane a distance {approx} 100M{sub Pl}{sup -1} away from the intersection gives us a theory with an exponential determination of the Weak/Planck hierarchy.

  7. Large Particle Titanate Sorbents

    SciTech Connect

    Taylor-Pashow, K.

    2015-10-08

    This research project was aimed at developing a synthesis technique for producing large particle size monosodium titanate (MST) to benefit high level waste (HLW) processing at the Savannah River Site (SRS). Two applications were targeted, first increasing the size of the powdered MST used in batch contact processing to improve the filtration performance of the material, and second preparing a form of MST suitable for deployment in a column configuration. Increasing the particle size should lead to improvements in filtration flux, and decreased frequency of filter cleaning leading to improved throughput. Deployment of MST in a column configuration would allow for movement from a batch process to a more continuous process. Modifications to the typical MST synthesis led to an increase in the average particle size. Filtration testing on dead-end filters showed improved filtration rates with the larger particle material; however, no improvement in filtration rate was realized on a crossflow filter. In order to produce materials suitable for column deployment several approaches were examined. First, attempts were made to coat zirconium oxide microspheres (196 µm) with a layer of MST. This proved largely unsuccessful. An alternate approach was then taken synthesizing a porous monolith of MST which could be used as a column. Several parameters were tested, and conditions were found that were able to produce a continuous structure versus an agglomeration of particles. This monolith material showed Sr uptake comparable to that of previously evaluated samples of engineered MST in batch contact testing.

  8. Large Quantum Gravity Effects

    NASA Astrophysics Data System (ADS)

    Angulo, María E.; Mena Marugán, Guillermo A.; Ashtekar, A.

    Linearly polarized cylindrical waves in four-dimensional vacuum gravity are mathematically equivalent to rotationally symmetric gravity coupled to a Maxwell (or Klein-Gordon) field in three dimensions. The quantization of this latter system was performed by Ashtekar and Pierri in a recent work. Employing that quantization, we obtain here a complete quantum theory which describes the four-dimensional geometry of the Einstein-Rosen waves. In particular, we construct regularized operators to represent the metric. It is shown that the results achieved by Ashtekar about the existence of important quantum gravity effects in the Einstein-Maxwell system at large distances from the symmetry axis continue to be valid from a four-dimensional point of view. The only significant difference is that, in order to admit an approximate classical description in the asymptotic region, states that are coherent in the Maxwell field need not contain a large number of photons anymore. We also analyze the metric fluctuations on the symmetry axis and argue that they are generally relevant for all of the coherent states.

  9. Interaction of sugar stabilized silver nanoparticles with the T-antigen specific lectin, jacalin from Artocarpus integrifolia.

    PubMed

    Ayaz Ahmed, Khan Behlol; Mohammed, Ansari Sulthan; Veerappan, Anbazhagan

    2015-06-15

    The advances in nanomedicine demonstrate the anticancer properties of silver nanoparticles (AgNPs) and considered as an alternative to the available chemotherapeutic agents. Owing to the preferential interaction of Artocarpus integrifolia lectin (jacalin) with Galβ1-3GalNAcα (a chemically well-defined tumor associated antigen), a study was undertaken to understand the interaction mechanism of AgNPs with jacalin in presence of specific sugar, galactose. Fluorescence spectroscopic analysis revealed that the AgNPs binding significantly quenched the intrinsic fluorescence of jacalin through a static quenching mechanism, and a non-radiative energy transfer occurred within the molecules. Association constants obtained from the interaction of different sugar-stabilized AgNPs with jacalin are in the order of 10(4)M(-1), this is in the same range as those obtained for the interaction of lectin with carbohydrate and hydrophobic ligand. Each subunit of the tetrameric jacalin binds one AgNPs, and the stoichiometry was unaffected by the presence of the specific sugar, galactose. Hemagglutination assay shows that sugar stabilized AgNPs interacts to jacalin at a site that is different from the saccharide-binding site. Analysis of the FTIR spectra of jacalin indicates that the binding of AgNPs does not alter the secondary structure of jacalin. More importantly, AgNPs exists in nano form even after interacting with the lectin. These results suggest that the development of lectin-AgNPs conjugate would be possible for diagnosis and treatment of cancer.

  10. Interaction of sugar stabilized silver nanoparticles with the T-antigen specific lectin, jacalin from Artocarpus integrifolia

    NASA Astrophysics Data System (ADS)

    Ayaz Ahmed, Khan Behlol; Mohammed, Ansari Sulthan; Veerappan, Anbazhagan

    2015-06-01

    The advances in nanomedicine demonstrate the anticancer properties of silver nanoparticles (AgNPs) and considered as an alternative to the available chemotherapeutic agents. Owing to the preferential interaction of Artocarpus integrifolia lectin (jacalin) with Galβ1-3GalNAcα (a chemically well-defined tumor associated antigen), a study was undertaken to understand the interaction mechanism of AgNPs with jacalin in presence of specific sugar, galactose. Fluorescence spectroscopic analysis revealed that the AgNPs binding significantly quenched the intrinsic fluorescence of jacalin through a static quenching mechanism, and a non-radiative energy transfer occurred within the molecules. Association constants obtained from the interaction of different sugar-stabilized AgNPs with jacalin are in the order of 104 M-1, this is in the same range as those obtained for the interaction of lectin with carbohydrate and hydrophobic ligand. Each subunit of the tetrameric jacalin binds one AgNPs, and the stoichiometry was unaffected by the presence of the specific sugar, galactose. Hemagglutination assay shows that sugar stabilized AgNPs interacts to jacalin at a site that is different from the saccharide-binding site. Analysis of the FTIR spectra of jacalin indicates that the binding of AgNPs does not alter the secondary structure of jacalin. More importantly, AgNPs exists in nano form even after interacting with the lectin. These results suggest that the development of lectin-AgNPs conjugate would be possible for diagnosis and treatment of cancer.

  11. Contrasting Large Solar Events

    NASA Astrophysics Data System (ADS)

    Lanzerotti, Louis J.

    2010-10-01

    After an unusually long solar minimum, solar cycle 24 is slowly beginning. A large coronal mass ejection (CME) from sunspot 1092 occurred on 1 August 2010, with effects reaching Earth on 3 August and 4 August, nearly 38 years to the day after the huge solar event of 4 August 1972. The prior event, which those of us engaged in space research at the time remember well, recorded some of the highest intensities of solar particles and rapid changes of the geomagnetic field measured to date. What can we learn from the comparisons of these two events, other than their essentially coincident dates? One lesson I took away from reading press coverage and Web reports of the August 2010 event is that the scientific community and the press are much more aware than they were nearly 4 decades ago that solar events can wreak havoc on space-based technologies.

  12. Large area plasma source

    NASA Technical Reports Server (NTRS)

    Foster, John (Inventor); Patterson, Michael (Inventor)

    2008-01-01

    An all permanent magnet Electron Cyclotron Resonance, large diameter (e.g., 40 cm) plasma source suitable for ion/plasma processing or electric propulsion, is capable of producing uniform ion current densities at its exit plane at very low power (e.g., below 200 W), and is electrodeless to avoid sputtering or contamination issues. Microwave input power is efficiently coupled with an ionizing gas without using a dielectric microwave window and without developing a throat plasma by providing a ferromagnetic cylindrical chamber wall with a conical end narrowing to an axial entrance hole for microwaves supplied on-axis from an open-ended waveguide. Permanent magnet rings are attached inside the wall with alternating polarities against the wall. An entrance magnet ring surrounding the entrance hole has a ferromagnetic pole piece that extends into the chamber from the entrance hole to a continuing second face that extends radially across an inner pole of the entrance magnet ring.

  13. Large solar arrays

    NASA Technical Reports Server (NTRS)

    Crabtree, W. L.

    1980-01-01

    A spectrophotovoltaic converter, a thermophotovoltaic converter, a cassegrainian concentrator, a large silicon cell blanket, and a high flux approach are among the concepts being investigated as part of the multihundred kW solar array program for reducing the cost of photovoltaic energy in space. These concepts involve a range of technology risks, the highest risk being represented by the thermophotovoltaics and spectrophotovoltaics approaches which involve manipulation to of the incoming spectrum to enhance system efficiency. The planar array (solar blanket) has no technology risk and a moderate payback. The primary characteristics, components, and technology concerns of each of these concepts are summarized. An orbital power platform mission in the late 1980's is being used to allow a coherent technology advancement program in order to achieve a ten year life with maintenance at a capital recurring cost of $30/watt based on 1978 dollars.

  14. Large area Czochralski silicon

    NASA Technical Reports Server (NTRS)

    Rea, S. N.; Gleim, P. S.

    1977-01-01

    The overall cost effectiveness of the Czochralski process for producing large-area silicon was determined. The feasibility of growing several 12 cm diameter crystals sequentially at 12 cm/h during a furnace run and the subsequent slicing of the ingot using a multiblade slurry saw were investigated. The goal of the wafering process was a slice thickness of 0.25 mm with minimal kerf. A slice + kerf of 0.56 mm was achieved on 12 cm crystal using both 400 grit B4C and SiC abrasive slurries. Crystal growth experiments were performed at 12 cm diameter in a commercially available puller with both 10 and 12 kg melts. Several modifications to the puller hoz zone were required to achieve stable crystal growth over the entire crystal length and to prevent crystallinity loss a few centimeters down the crystal. The maximum practical growth rate for 12 cm crystal in this puller design was 10 cm/h, with 12 to 14 cm/h being the absolute maximum range at which melt freeze occurred.

  15. Very Large Scale Optimization

    NASA Technical Reports Server (NTRS)

    Vanderplaats, Garrett; Townsend, James C. (Technical Monitor)

    2002-01-01

    The purpose of this research under the NASA Small Business Innovative Research program was to develop algorithms and associated software to solve very large nonlinear, constrained optimization tasks. Key issues included efficiency, reliability, memory, and gradient calculation requirements. This report describes the general optimization problem, ten candidate methods, and detailed evaluations of four candidates. The algorithm chosen for final development is a modern recreation of a 1960s external penalty function method that uses very limited computer memory and computational time. Although of lower efficiency, the new method can solve problems orders of magnitude larger than current methods. The resulting BIGDOT software has been demonstrated on problems with 50,000 variables and about 50,000 active constraints. For unconstrained optimization, it has solved a problem in excess of 135,000 variables. The method includes a technique for solving discrete variable problems that finds a "good" design, although a theoretical optimum cannot be guaranteed. It is very scalable in that the number of function and gradient evaluations does not change significantly with increased problem size. Test cases are provided to demonstrate the efficiency and reliability of the methods and software.

  16. The large binocular telescope.

    PubMed

    Hill, John M

    2010-06-01

    The Large Binocular Telescope (LBT) Observatory is a collaboration among institutions in Arizona, Germany, Italy, Indiana, Minnesota, Ohio, and Virginia. The telescope on Mount Graham in Southeastern Arizona uses two 8.4 m diameter primary mirrors mounted side by side. A unique feature of the LBT is that the light from the two Gregorian telescope sides can be combined to produce phased-array imaging of an extended field. This cophased imaging along with adaptive optics gives the telescope the diffraction-limited resolution of a 22.65 m aperture and a collecting area equivalent to an 11.8 m circular aperture. This paper describes the design, construction, and commissioning of this unique telescope. We report some sample astronomical results with the prime focus cameras. We comment on some of the technical challenges and solutions. The telescope uses two F/15 adaptive secondaries to correct atmospheric turbulence. The first of these adaptive mirrors has completed final system testing in Firenze, Italy, and is planned to be at the telescope by Spring 2010.

  17. Large Databases in Astronomy

    NASA Astrophysics Data System (ADS)

    Szalay, Alexander S.; Gray, Jim; Kunszt, Peter; Thakar, Anirudha; Slutz, Don

    The next-generation astronomy digital archives will cover most of the sky at fine resolution in many wavelengths, from X-rays through ultraviolet, optical, and infrared. The archives will be stored at diverse geographical locations. The intensive use of advanced data archives will enable astronomers to explore their data interactively. Data access will be aided by multidimensional spatial and attribute indices. The data will be partitioned in many ways. Small tag indices consisting of the most popular attributes will accelerate frequent searches. Splitting the data among multiple servers will allow parallel, scalable I/O and parallel data analysis. Hashing techniques will allow efficient clustering, and pair-wise comparison algorithms that should parallelize nicely. Randomly sampled subsets will allow debugging otherwise large queries at the desktop. Central servers will operate a data pump to support sweep searches touching most of the data. The anticipated queries will require special operators related to angular distances and complex similarity tests of object properties, like shapes, colors, velocity vectors, or temporal behaviors. These issues pose interesting data management challenges.

  18. Large forging manufacturing process

    DOEpatents

    Thamboo, Samuel V.; Yang, Ling

    2002-01-01

    A process for forging large components of Alloy 718 material so that the components do not exhibit abnormal grain growth includes the steps of: a) providing a billet with an average grain size between ASTM 0 and ASTM 3; b) heating the billet to a temperature of between 1750.degree. F. and 1800.degree. F.; c) upsetting the billet to obtain a component part with a minimum strain of 0.125 in at least selected areas of the part; d) reheating the component part to a temperature between 1750.degree. F. and 1800.degree. F.; e) upsetting the component part to a final configuration such that said selected areas receive no strains between 0.01 and 0.125; f) solution treating the component part at a temperature of between 1725.degree. F. and 1750.degree. F.; and g) aging the component part over predetermined times at different temperatures. A modified process achieves abnormal grain growth in selected areas of a component where desirable.

  19. Large building characterization

    SciTech Connect

    Menetrez, M.Y.; Sanchez, D.C.; Kulp, R.N.; Pyle, B.; Williamson, A.; McDonough, S.

    1994-12-31

    Buildings are characterized in this project by examining radon concentrations and indoor air quality (IAQ) levels as affected by building ventilation dynamics. IAQ data collection stations (IAQDS), for monitoring and data logging, remote switches (pressure and sail switches), and a weather station were installed. Measurements of indoor radon, carbon dioxide (CO{sub 2}), and particle concentrations; temperature; humidity; indoor to outdoor or sub-slab pressure differentials; ambient and sub-slab radon concentrations; and outdoor air intake flow rates were collected. The outdoor air intake was adjusted, and fan cycles were controlled while tracer gas measurements were taken in all zones and IAQDS data are processed. Ventilation, infiltration, mixing rates, radon entry, pressure/temperature convective driving forces, CO{sub 2} generation/decay concentrations, and IAQ levels were defined. These dynamic interacting processes characterize the behavior of this and similar large buildings. The techniques incorporated into the experimental plan are discussed with project rationale. Results and the discussion of those results are beyond the limits of this paper.

  20. Large scale traffic simulations

    SciTech Connect

    Nagel, K.; Barrett, C.L. |; Rickert, M. |

    1997-04-01

    Large scale microscopic (i.e. vehicle-based) traffic simulations pose high demands on computational speed in at least two application areas: (i) real-time traffic forecasting, and (ii) long-term planning applications (where repeated {open_quotes}looping{close_quotes} between the microsimulation and the simulated planning of individual person`s behavior is necessary). As a rough number, a real-time simulation of an area such as Los Angeles (ca. 1 million travellers) will need a computational speed of much higher than 1 million {open_quotes}particle{close_quotes} (= vehicle) updates per second. This paper reviews how this problem is approached in different projects and how these approaches are dependent both on the specific questions and on the prospective user community. The approaches reach from highly parallel and vectorizable, single-bit implementations on parallel supercomputers for Statistical Physics questions, via more realistic implementations on coupled workstations, to more complicated driving dynamics implemented again on parallel supercomputers. 45 refs., 9 figs., 1 tab.

  1. Large scale tracking algorithms

    SciTech Connect

    Hansen, Ross L.; Love, Joshua Alan; Melgaard, David Kennett; Karelitz, David B.; Pitts, Todd Alan; Zollweg, Joshua David; Anderson, Dylan Z.; Nandy, Prabal; Whitlow, Gary L.; Bender, Daniel A.; Byrne, Raymond Harry

    2015-01-01

    Low signal-to-noise data processing algorithms for improved detection, tracking, discrimination and situational threat assessment are a key research challenge. As sensor technologies progress, the number of pixels will increase signi cantly. This will result in increased resolution, which could improve object discrimination, but unfortunately, will also result in a significant increase in the number of potential targets to track. Many tracking techniques, like multi-hypothesis trackers, suffer from a combinatorial explosion as the number of potential targets increase. As the resolution increases, the phenomenology applied towards detection algorithms also changes. For low resolution sensors, "blob" tracking is the norm. For higher resolution data, additional information may be employed in the detection and classfication steps. The most challenging scenarios are those where the targets cannot be fully resolved, yet must be tracked and distinguished for neighboring closely spaced objects. Tracking vehicles in an urban environment is an example of such a challenging scenario. This report evaluates several potential tracking algorithms for large-scale tracking in an urban environment.

  2. Large Binocular Telescope Project

    NASA Astrophysics Data System (ADS)

    Hill, John M.

    1997-03-01

    The large binocular telescope (LBT) project have evolved from concepts first proposed in 1985. The present partners involved in the design and construction of this 2 by 8.4 meter binocular telescope are the University of Arizona, Italy represented by the Osservatorio Astrofisico di Arcetri and the Research Corporation based in Tucson, Arizona. These three partners have committed sufficient funds to build the enclosure and the telescope populated with a single 8.4 meter optical train -- approximately 40 million dollars (1989). Based on this commitment, design and construction activities are now moving forward. Additional partners are being sought. The next mirror to be cast at the Steward Observatory Mirror Lab in the fall of 1996 will be the first borosilicate honeycomb primary for LBT. The baseline optical configuration of LBT includes wide field Cassegrain secondaries with optical foci above the primaries to provide a corrected one degree field at F/4. The infrared F/15 secondaries are a Gregorian design to allow maximum flexibility for adaptive optics. The F/15 secondaries are undersized to provide a low thermal background focal plane which is unvignetted over a 4 arcminute diameter field-of-view. The interferometric focus combining the light from the two 8.4 meter primaries will reimage two folded Gregorian focal planes to a central location. The telescope elevation structure accommodates swing arms which allow rapid interchange of the various secondary and tertiary mirrors. Maximum stiffness and minimal thermal disturbance continue to be important drivers for the detailed design of the telescope. The telescope structure accommodates installation of a vacuum bell jar for aluminizing the primary mirrors in-situ on the telescope. The detailed design of the telescope structure will be completed in 1996 by ADS Italia (Lecco) and European Industrial Engineering (Mestre). The final enclosure design is now in progress at M3 Engineering (Tucson), EIE and ADS Italia

  3. Applied large eddy simulation.

    PubMed

    Tucker, Paul G; Lardeau, Sylvain

    2009-07-28

    Large eddy simulation (LES) is now seen more and more as a viable alternative to current industrial practice, usually based on problem-specific Reynolds-averaged Navier-Stokes (RANS) methods. Access to detailed flow physics is attractive to industry, especially in an environment in which computer modelling is bound to play an ever increasing role. However, the improvement in accuracy and flow detail has substantial cost. This has so far prevented wider industrial use of LES. The purpose of the applied LES discussion meeting was to address questions regarding what is achievable and what is not, given the current technology and knowledge, for an industrial practitioner who is interested in using LES. The use of LES was explored in an application-centred context between diverse fields. The general flow-governing equation form was explored along with various LES models. The errors occurring in LES were analysed. Also, the hybridization of RANS and LES was considered. The importance of modelling relative to boundary conditions, problem definition and other more mundane aspects were examined. It was to an extent concluded that for LES to make most rapid industrial impact, pragmatic hybrid use of LES, implicit LES and RANS elements will probably be needed. Added to this further, highly industrial sector model parametrizations will be required with clear thought on the key target design parameter(s). The combination of good numerical modelling expertise, a sound understanding of turbulence, along with artistry, pragmatism and the use of recent developments in computer science should dramatically add impetus to the industrial uptake of LES. In the light of the numerous technical challenges that remain it appears that for some time to come LES will have echoes of the high levels of technical knowledge required for safe use of RANS but with much greater fidelity.

  4. Large for Gestational Age (LGA)

    MedlinePlus

    ... 5 Additional Content Medical News Large for Gestational Age (LGA) By Arthur E. Kopelman, MD, The Brody ... Newborns Birth Injury Prematurity Postmaturity Small for Gestational Age (SGA) Large for Gestational Age (LGA) Respiratory Distress ...

  5. Large for gestational age (LGA)

    MedlinePlus

    ... gov/ency/article/002248.htm Large for gestational age (LGA) To use the sharing features on this page, please enable JavaScript. Large for gestational age means that a fetus or infant is larger ...

  6. Large Deviations for Random Trees

    PubMed Central

    Heitsch, Christine

    2010-01-01

    We consider large random trees under Gibbs distributions and prove a Large Deviation Principle (LDP) for the distribution of degrees of vertices of the tree. The LDP rate function is given explicitly. An immediate consequence is a Law of Large Numbers for the distribution of vertex degrees in a large random tree. Our motivation for this study comes from the analysis of RNA secondary structures. PMID:20216937

  7. Large landslides from oceanic volcanoes

    USGS Publications Warehouse

    Holcomb, R.T.; Searle, R.C.

    1991-01-01

    Large landslides are ubiquitous around the submarine flanks of Hawaiian volcanoes, and GLORIA has also revealed large landslides offshore from Tristan da Cunha and El Hierro. On both of the latter islands, steep flanks formerly attributed to tilting or marine erosion have been reinterpreted as landslide headwalls mantled by younger lava flows. These landslides occur in a wide range of settings and probably represent only a small sample from a large population. They may explain the large volumes of archipelagic aprons and the stellate shapes of many oceanic volcanoes. Large landslides and associated tsunamis pose hazards to many islands. -from Authors

  8. Health impacts of large dams

    SciTech Connect

    Lerer, L.B.; Scudder, T.

    1999-03-01

    Large dams have been criticized because of their negative environmental and social impacts. Public health interest largely has focused on vector-borne diseases, such as schistosomiasis, associated with reservoirs and irrigation projects. Large dams also influence health through changes in water and food security, increases in communicable diseases, and the social disruption caused by construction and involuntary resettlement. Communities living in close proximity to large dams often do not benefit from water transfer and electricity generation revenues. A comprehensive health component is required in environmental and social impact assessments for large dam projects.

  9. Computational Analysis of the Ligand Binding Site of the Extracellular ATP Receptor, DORN1

    PubMed Central

    Cao, Yangrong; Cho, Sung-Hwan; Xu, Dong; Stacey, Gary

    2016-01-01

    DORN1 (also known as P2K1) is a plant receptor for extracellular ATP, which belongs to a large gene family of legume-type (L-type) lectin receptor kinases. Extracellular ATP binds to DORN1 with strong affinity through its lectin domain, and the binding triggers a variety of intracellular activities in response to biotic and abiotic stresses. However, information on the tertiary structure of the ligand binding site of DORN1is lacking, which hampers efforts to fully elucidate the mechanism of receptor action. Available data of the crystal structures from more than 50 L-type lectins enable us to perform an in silico study of molecular interaction between DORN1 and ATP. In this study, we employed a computational approach to develop a tertiary structure model of the DORN1 lectin domain. A blind docking analysis demonstrated that ATP binds to a cavity made by four loops (defined as loops A B, C and D) of the DORN1 lectin domain with high affinity. In silico target docking of ATP to the DORN1 binding site predicted interaction with 12 residues, located on the four loops, via hydrogen bonds and hydrophobic interactions. The ATP binding pocket is structurally similar in location to the carbohydrate binding pocket of the canonical L-type lectins. However, four of the residues predicted to interact with ATP are not conserved between DORN1 and the other carbohydrate-binding lectins, suggesting that diversifying selection acting on these key residues may have led to the ATP binding activity of DORN1. The in silico model was validated by in vitro ATP binding assays using the purified extracellular lectin domain of wild-type DORN1, as well as mutated DORN1 lacking key ATP binding residues. PMID:27583834

  10. Large Extremity Peripheral Nerve Repair

    DTIC Science & Technology

    2015-10-01

    regeneration using our approach with an acellular nerve allograft to be equivalent to standard autograft repair in rodent models. An ongoing large animal ...be clinically acceptable for use in the animal studies in Aim 2. The anatomy of HAM is shown pictorially in Figure 7. In vivo, the epithelial...product. Given that the large animal studies with large caliber nerves in Aim 3 will use AxoGuard we feel that the single layer SIS material is totally

  11. Querying Large Biological Network Datasets

    ERIC Educational Resources Information Center

    Gulsoy, Gunhan

    2013-01-01

    New experimental methods has resulted in increasing amount of genetic interaction data to be generated every day. Biological networks are used to store genetic interaction data gathered. Increasing amount of data available requires fast large scale analysis methods. Therefore, we address the problem of querying large biological network datasets.…

  12. Students' Perceptions of Large Classes.

    ERIC Educational Resources Information Center

    Wulff, Donald H.; And Others

    1987-01-01

    Students' perceptions of instruction in large classes are summarized, based on standardized questionnaires administered in lower-division large classes. Students' ratings of classes and responses to open-ended questions are discussed in terms of content and amount learned, specific instructional dimensions, and evaluation processes. (MLW)

  13. Team Learning in Large Classes.

    ERIC Educational Resources Information Center

    Roueche, Suanne D., Ed.

    1984-01-01

    Information and suggestions are provided on the use of team learning in large college classes. Introductory material discusses the negative cycle of student-teacher interaction that may be provoked by large classes, and the use of permanent, heterogeneous, six- or seven-member student learning groups as the central focus of class activity as a…

  14. Sharpen Your Skills: Large Type.

    ERIC Educational Resources Information Center

    Knisely, Phyllis

    1983-01-01

    Three short articles about large type transcribing are provided for braille transcribers and teachers of the visually handicapped. The first article explains section IV-B-2 of the National Braille Association Manual for Large Type Transcribing. The second article presents the results of a survey on the kinds of typewriters, types of…

  15. Sharpen Your Skills: Large Type.

    ERIC Educational Resources Information Center

    Knisely, Phillis; Wickham, Marian

    1984-01-01

    Three short articles about large type transcribing are provided for braille transcribers and teachers of the visually handicapped. The first article lists general suggestions for simple typewriter maintenance. The second article reviews the guidelines for typing fractions in large type for mathematics exercises. The third article describes a…

  16. The oxidation-state-dependent ATP-binding site of cytochrome c. Implication of an essential arginine residue and the effect of occupancy on the oxidation-reduction potential.

    PubMed Central

    Corthésy, B E; Wallace, C J

    1988-01-01

    Arg-91 is not part of the active site of cytochrome c that mediates binding and electron transfer, yet it is absolutely conserved in eukaryotic cytochromes c, indicating a special function. The physicochemical properties of analogues are unaffected by the modification of this residue, so they can be used with confidence to study the role of Arg-91. We have established limiting conditions under which this residue alone is specifically modified by cyclohexane-1,2-dione, and have subsequently shown that ATP, and to a lesser extent ADP or Pi, protects it from the action of the reagent in an oxidation-state-dependent manner. These observations strongly support the idea that this site exerts a controlling influence on cytochrome c activity in the electron transport or other cellular redox systems, and we have commenced a study of how that influence might operate. We find that the redox potentials of both cytochrome c and analogue are little affected by changing ATP or Pi concentrations. PMID:2843168

  17. Sensitivity of a renal K+ channel (ROMK2) to the inhibitory sulfonylurea compound glibenclamide is enhanced by coexpression with the ATP-binding cassette transporter cystic fibrosis transmembrane regulator.

    PubMed Central

    McNicholas, C M; Guggino, W B; Schwiebert, E M; Hebert, S C; Giebisch, G; Egan, M E

    1996-01-01

    We demonstrate here that coexpression of ROMK2, an inwardly rectifying ATP-sensitive renal K+ channel (IKATP) with cystic fibrosis transmembrane regulator (CFTR) significantly enhances the sensitivity of ROMK2 to the sulfonylurea compound glibenclamide. When expressed alone, ROMK2 is relatively insensitive to glibenclamide. The interaction between ROMK2, CFTR, and glibenclamide is modulated by altering the phosphorylation state of either ROMK2, CFTR, or an associated protein, as exogenous MgATP and the catalytic subunit of protein kinase A significantly attenuate the inhibitory effect of glibenclamide on ROMK2. Thus CFTR, which has been demonstrated to interact with both Na+ and Cl- channels in airway epithelium, modulates the function of renal ROMK2 K+ channels. PMID:8755607

  18. AtMRP6/AtABCC6, an ATP-Binding Cassette transporter gene expressed during early steps of seedling development and up-regulated by cadmium in Arabidopsis thaliana

    PubMed Central

    Gaillard, Stéphane; Jacquet, Hélène; Vavasseur, Alain; Leonhardt, Nathalie; Forestier, Cyrille

    2008-01-01

    Background ABC proteins constitute one of the largest families of transporters found in all living organisms. In Arabidopsis thaliana, 120 genes encoding ABC transporters have been identified. Here, the characterization of one member of the MRP subclass, AtMRP6, is described. Results This gene, located on chromosome 3, is bordered by AtMRP3 and AtMRP7. Using real-time quantitative PCR (RT-Q-PCR) and the GUS reporter gene, we found that this gene is essentially expressed during early seedling development, in the apical meristem and at initiation point of secondary roots, especially in xylem-opposite pericycle cells where lateral roots initiate. The level of expression of AtMRP6 in response to various stresses was explored and a significant up-regulation after cadmium (Cd) treatment was detected. Among the three T-DNA insertion lines available from the Salk Institute library, two knock-out mutants, Atmrp6.1 and Atmrp6.2 were invalidated for the AtMRP6 gene. In the presence of Cd, development of leaves was more affected in the mutants than wild-type plants, whereas root elongation and ramification was comparable. Conclusion The position of AtMRP6 on chromosome 3, flanked by two other MRP genes, (all of which being induced by Cd) suggests that AtMRP6 is part of a cluster involved in metal tolerance, although additional functions in planta cannot be discarded. PMID:18307782

  19. Evidence of a calcium-induced structural change in the ATP-binding site of the sarcoplasmic-reticulum Ca2+-ATPase using terbium formycin triphosphate as an analogue of Mg-ATP.

    PubMed

    Girardet, J L; Dupont, Y; Lacapere, J J

    1989-09-01

    Terbium ions and terbium formycin triphosphate have been used to investigate the interactions between the cation and nucleotide binding sites of the sarcoplasmic reticulum Ca2+-ATPase. Three classes of Tb3+-binding sites have been found: a first class of low-affinity (Kd = 10 microM) corresponds to magnesium binding sites, located near a tryptophan residue of the protein; a second class of much higher affinity (less than 0.1 microM) corresponds to the calcium transport sites, their occupancy by terbium induces the E1 to E2 conformational change of the Ca2+-ATPase; a third class of sites is revealed by following the fluorescence transfer from formycin triphosphate (FTP) to terbium, evidencing that terbium ions can also bind into the nucleotide binding site at the same time as FTP. Substitution of H2O by D2O shows that Tb-FTP binding to the enzyme nucleotide site is associated with an important dehydration of the terbium ions associated with FTP. Two terbium ions, at least, bind to the Ca2+-ATPase in the close vicinity of FTP when this nucleotide is bound to the ATPase nucleotide site. Addition of calcium quenches the fluorescence signal of the terbium-FTP complex bound to the enzyme. Calcium concentration dependence shows that this effect is associated with the replacement of terbium by calcium in the transport sites, inducing the E2----E1 transconformation when calcium is bound. One interpretation of this fluorescence quenching is that the E1----E2 transition induces an important structural change in the nucleotide site. Another interpretation is that the high-affinity calcium sites are located very close to the Tb-FTP complex bound to the nucleotide site.

  20. Transcriptome-based identification of ABC transporters in the western tarnished plant bug lygus hesperus

    Technology Transfer Automated Retrieval System (TEKTRAN)

    ATP-binding cassette (ABC) transporters are a large superfamily of proteins that mediate diverse physiological functions by coupling ATP hydrolysis with substrate transport across lipid membranes. In insects, these proteins play roles in metabolism, development, eye pigmentation, and xenobiotic cle...

  1. Measuring happiness in large population

    NASA Astrophysics Data System (ADS)

    Wenas, Annabelle; Sjahputri, Smita; Takwin, Bagus; Primaldhi, Alfindra; Muhamad, Roby

    2016-01-01

    The ability to know emotional states for large number of people is important, for example, to ensure the effectiveness of public policies. In this study, we propose a measure of happiness that can be used in large scale population that is based on the analysis of Indonesian language lexicons. Here, we incorporate human assessment of Indonesian words, then quantify happiness on large-scale of texts gathered from twitter conversations. We used two psychological constructs to measure happiness: valence and arousal. We found that Indonesian words have tendency towards positive emotions. We also identified several happiness patterns during days of the week, hours of the day, and selected conversation topics.

  2. Large engines and vehicles, 1958

    NASA Technical Reports Server (NTRS)

    1978-01-01

    During the mid-1950s, the Air Force sponsored work on the feasibility of building large, single-chamber engines, presumably for boost-glide aircraft or spacecraft. In 1956, the Army missile development group began studies of large launch vehicles. The possibilities opened up by Sputnik accelerated this work and gave the Army an opportunity to bid for the leading role in launch vehicles. The Air Force had the responsibility for the largest ballistic missiles and hence a ready-made base for extending their capability for spaceflight. During 1958, actions taken to establish a civilian space agency, and the launch vehicle needs seen by its planners, added a third contender to the space vehicle competition. These activities during 1958 are examined as to how they resulted in the initiation of a large rocket engine and the first large launch vehicle.

  3. Personalized Teaching in Large Classes.

    ERIC Educational Resources Information Center

    Silvia, Evelyn M.; Hom, Carole L.

    1996-01-01

    Refutes the assumption that large classes must be impersonal, characterized by lecture style, and presented in a theorem-proof-example format. Discusses successful strategies for space use, classroom management, and collecting student feedback. (DDR)

  4. Large Extremity Peripheral Nerve Repair

    DTIC Science & Technology

    2015-10-01

    approach with an acellular nerve allograft to be equivalent to standard autograft repair in rodent models. An ongoing large animal validation study...the animal studies in Aim 2. The anatomy of HAM is shown pictorially in Figure 7. In vivo, the epithelial layer is in contact with the amniotic...AxoGuard and Oasis SIS products are manufactured by Cook Medical. AxoGuard is simply a multi-layered SIS product. Given that the large animal studies with

  5. Large Extremity Peripheral Nerve Repair

    DTIC Science & Technology

    2015-10-01

    in rodent models. An ongoing large animal validation study will pave the way for human studies of this technology. 15. SUBJECT TERMS 16. SECURITY...to be clinically acceptable for use in the animal studies in Aim 2. The anatomy of HAM is shown pictorially in Figure 7. In vivo, the epithelial... animal studies with large caliber nerves in Aim 3 will use AxoGuard we feel that the single layer SIS material is totally appropriate for these small

  6. Laparoscopic Management of Large Myomas

    PubMed Central

    Sinha, Rakesh; Sundaram, Meenakshi

    2009-01-01

    The objective of this article is to review the different techniques that have been adopted for removal of large myomas laparoscopically. We have also quoted literature about the impact of myomas on Pregnancy and obstetrical outcome and the effect of laparoscopic myomectomy on the same. Technical modifications to remove large myomas have been described along with methods to reduce intraoperative bleeding. This comprehensive review describes all possibilities of laparoscopic myomectomy irrespective of size, site and number. PMID:22442517

  7. Does Yellowstone need large fires

    SciTech Connect

    Romme, W.H. ); Turner, M.G.; Gardner, R.H.; Hargrove, W.W. )

    1994-06-01

    This paper synthesizes several studies initiated after the 1988 Yellowstone fires, to address the question whether the ecological effects of large fires differ qualitatively as well as quantitatively from small fires. Large burn patches had greater dominance and contagion of burn severity classes, and a higher proportion of crown fire. Burned aspen stands resprouted vigorously over an extensive area, but heavy ungulate browsing prevented establishment of new tree-sized stems. A burst of sexual reproduction occurred in forest herbs that usually reproduce vegetatively, and new aspen clones became established from seed - a rare event in this region. We conclude that the effects of large fires are qualitatively different, but less dramatically so than expected.

  8. Phenomenology of Large Nc QCD

    NASA Astrophysics Data System (ADS)

    Lebed, Richard F.

    1999-09-01

    These lectures are designed to introduce the methods and results of large N c QCD in a presentation intended for nuclear and particle physicists alike. Beginning with definitions and motivations of the approach, we demonstrate that all quark and gluon Feynman diagrams are organized into classes based on powers of 1/N c. We then show that this result can be translated into definite statements about mesons and baryons containing arbitrary numbers of consti