Sawamura, Kensuke; Hashimoto, Masahiko
2017-01-01
A fluorescence quenching assay based on a ligase detection reaction was developed for facile and rapid detection of point mutations present in a mixed population of non-variant DNA. If the test DNA carried a targeted mutation, then the two allele-specific primers were ligated to form a molecular beacon resulting in the expected fluorescence quenching signatures. Using this method, we successfully detected as low as 5% mutant DNA in a mixture of wild-type DNA (t test at 99% confidence level).
Song, Yunke; Zhang, Yi; Wang, Tza-Huei
2013-04-08
Gene point mutations present important biomarkers for genetic diseases. However, existing point mutation detection methods suffer from low sensitivity, specificity, and a tedious assay processes. In this report, an assay technology is proposed which combines the outstanding specificity of gap ligase chain reaction (Gap-LCR), the high sensitivity of single-molecule coincidence detection, and the superior optical properties of quantum dots (QDs) for multiplexed detection of point mutations in genomic DNA. Mutant-specific ligation products are generated by Gap-LCR and subsequently captured by QDs to form DNA-QD nanocomplexes that are detected by single-molecule spectroscopy (SMS) through multi-color fluorescence burst coincidence analysis, allowing for multiplexed mutation detection in a separation-free format. The proposed assay is capable of detecting zeptomoles of KRAS codon 12 mutation variants with near 100% specificity. Its high sensitivity allows direct detection of KRAS mutation in crude genomic DNA without PCR pre-amplification. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Hagihara, Kenta; Tsukagoshi, Kazuhiko; Nakajima, Chinami; Esaki, Shinsuke; Hashimoto, Masahiko
2016-01-01
We previously developed a separation-free ligase detection reaction assay based on fluorescence resonance energy transfer from a donor quantum dot to an acceptor fluorescent dye. This assay could successfully detect one cancer mutation among 10 wild-type templates. In the current study, the mutation-discrimination threshold was improved by one order of magnitude by replacing the original acceptor dye (Alexa Fluor 647) with another fluorescent dye (Cyanine 5) that was spectrally similar but more fluorescent.
Sensitive and specific miRNA detection method using SplintR Ligase
Jin, Jingmin; Vaud, Sophie; Zhelkovsky, Alexander M.; Posfai, Janos; McReynolds, Larry A.
2016-01-01
We describe a simple, specific and sensitive microRNA (miRNA) detection method that utilizes Chlorella virus DNA ligase (SplintR® Ligase). This two-step method involves ligation of adjacent DNA oligonucleotides hybridized to a miRNA followed by real-time quantitative PCR (qPCR). SplintR Ligase is 100X faster than either T4 DNA Ligase or T4 RNA Ligase 2 for RNA splinted DNA ligation. Only a 4–6 bp overlap between a DNA probe and miRNA was required for efficient ligation by SplintR Ligase. This property allows more flexibility in designing miRNA-specific ligation probes than methods that use reverse transcriptase for cDNA synthesis of miRNA. The qPCR SplintR ligation assay is sensitive; it can detect a few thousand molecules of miR-122. For miR-122 detection the SplintR qPCR assay, using a FAM labeled double quenched DNA probe, was at least 40× more sensitive than the TaqMan assay. The SplintR method, when coupled with NextGen sequencing, allowed multiplex detection of miRNAs from brain, kidney, testis and liver. The SplintR qPCR assay is specific; individual let-7 miRNAs that differ by one nucleotide are detected. The rapid kinetics and ability to ligate DNA probes hybridized to RNA with short complementary sequences makes SplintR Ligase a useful enzyme for miRNA detection. PMID:27154271
Natural separation of the acyl-CoA ligase reaction results in a non-adenylating enzyme.
Wang, Nan; Rudolf, Jeffrey D; Dong, Liao-Bin; Osipiuk, Jerzy; Hatzos-Skintges, Catherine; Endres, Michael; Chang, Chin-Yuan; Babnigg, Gyorgy; Joachimiak, Andrzej; Phillips, George N; Shen, Ben
2018-06-04
Acyl-coenzyme A (CoA) ligases catalyze the activation of carboxylic acids via a two-step reaction of adenylation followed by thioesterification. Here, we report the discovery of a non-adenylating acyl-CoA ligase PtmA2 and the functional separation of an acyl-CoA ligase reaction. Both PtmA1 and PtmA2, two acyl-CoA ligases from the biosynthetic pathway of platensimycin and platencin, are necessary for the two steps of CoA activation. Gene inactivation of ptmA1 and ptmA2 resulted in the accumulation of free acid and adenylate intermediates, respectively. Enzymatic and structural characterization of PtmA2 confirmed its ability to only catalyze thioesterification. Structural characterization of PtmA2 revealed it binds both free acid and adenylate substrates and undergoes the established mechanism of domain alternation. Finally, site-directed mutagenesis restored both the adenylation and complete CoA activation reactions. This study challenges the currently accepted paradigm of adenylating enzymes and inspires future investigations on functionally separated acyl-CoA ligases and their ramifications in biology.
Das, S.; Pingle, M. R.; Muñoz-Jordán, J.; Rundell, M. S.; Rondini, S.; Granger, K.; Chang, G.-J. J.; Kelly, E.; Spier, E. G.; Larone, D.; Spitzer, E.; Barany, F.; Golightly, L. M.
2008-01-01
The detection and successful typing of dengue virus (DENV) from patients with suspected dengue fever is important both for the diagnosis of the disease and for the implementation of epidemiologic control measures. A technique for the multiplex detection and typing of DENV serotypes 1 to 4 (DENV-1 to DENV-4) from clinical samples by PCR-ligase detection reaction (LDR) has been developed. A serotype-specific PCR amplifies the regions of genes C and E simultaneously. The two amplicons are targeted in a multiplex LDR, and the resultant fluorescently labeled ligation products are detected on a universal array. The assay was optimized using 38 DENV strains and was evaluated with 350 archived acute-phase serum samples. The sensitivity of the assay was 98.7%, and its specificity was 98.4%, relative to the results of real-time PCR. The detection threshold was 0.017 PFU for DENV-1, 0.004 PFU for DENV-2, 0.8 PFU for DENV-3, and 0.7 PFU for DENV-4. The assay is specific; it does not cross-react with the other flaviviruses tested (West Nile virus, St. Louis encephalitis virus, Japanese encephalitis virus, Kunjin virus, Murray Valley virus, Powassan virus, and yellow fever virus). All but 1 of 26 genotypic variants of DENV serotypes in a global DENV panel from different geographic regions were successfully identified. The PCR-LDR assay is a rapid, sensitive, specific, and high-throughput technique for the simultaneous detection of all four serotypes of DENV. PMID:18685000
Rapid Assembly of DNA via Ligase Cycling Reaction (LCR).
Chandran, Sunil
2017-01-01
The assembly of multiple DNA parts into a larger DNA construct is a requirement in most synthetic biology laboratories. Here we describe a method for the efficient, high-throughput, assembly of DNA utilizing the ligase chain reaction (LCR). The LCR method utilizes non-overlapping DNA parts that are ligated together with the guidance of bridging oligos. Using this method, we have successfully assembled up to 20 DNA parts in a single reaction or DNA constructs up to 26 kb in size.
Albrecht, Jennifer Coyne; Kotani, Akira; Lin, Jennifer S.; Soper, Steven A.; Barron, Annelise E.
2015-01-01
We demonstrate here the power and flexibility of free-solution conjugate electrophoresis (FSCE) as a method of separating DNA fragments by electrophoresis with no sieving polymer network. Previous work introduced the coupling of FSCE with ligase detection reaction (LDR) to detect point mutations, even at low abundance compared to the wild-type DNA. Here, four large drag-tags are used to achieve free-solution electrophoretic separation of 19 LDR products ranging in size from 42–66 nt that correspond to mutations in the K-ras oncogene. LDR-FSCE enabled electrophoretic resolution of these 19 LDR-FSCE products by CE in 13.5 minutes (E = 310 V/cm) and by microchip electrophoresis in 140 seconds (E = 350 V/cm). The power of FSCE is demonstrated in the unique characteristic of free-solution separations where the separation resolution is constant no matter the electric field strength. By microchip electrophoresis, the electric field was increased to the maximum of the power supply (E = 700 V/cm), and the 19 LDR-FSCE products were separated in < 70 seconds with almost identical resolution to the separation at E = 350 V/cm. These results will aid the goal of screening K-ras mutations on integrated “sample-in/answer-out” devices with amplification, LDR, and detection all on one platform. PMID:23192597
Sun, Yueying; Lu, Xiaohui; Su, Fengxia; Wang, Limei; Liu, Chenghui; Duan, Xinrui; Li, Zhengping
2015-12-15
Most of practical methods for detection of single nucleotide polymorphism (SNP) need at least two steps: amplification (usually by PCR) and detection of SNP by using the amplification products. Ligase chain reaction (LCR) can integrate the amplification and allele discrimination in one step. However, the detection of LCR products still remains a great challenge for highly sensitive and quantitative SNP detection. Herein, a simple but robust strategy for real-time fluorescence LCR has been developed for highly sensitive and quantitative SNP detection. A pair of LCR probes are firstly labeled with a fluorophore and a quencher, respectively. When the pair of LCR probes are ligated in LCR, the fluorophore will be brought close to the quencher, and thus, the fluorescence will be specifically quenched by fluorescence resonance energy transfer (FRET). The decrease of fluorescence intensity resulted from FRET can be real-time monitored in the LCR process. With the proposed real-time fluorescence LCR assay, 10 aM DNA targets or 100 pg genomic DNA can be accurately determined and as low as 0.1% mutant DNA can be detected in the presence of a large excess of wild-type DNA, indicating the high sensitivity and specificity. The real-time measuring does not require the detection step after LCR and gives a wide dynamic range for detection of DNA targets (from 10 aM to 1 pM). As LCR has been widely used for detection of SNP, DNA methylation, mRNA and microRNA, the real-time fluorescence LCR assay shows great potential for various genetic analysis. Copyright © 2015 Elsevier B.V. All rights reserved.
Efficient DNA ligation in DNA–RNA hybrid helices by Chlorella virus DNA ligase
Lohman, Gregory J. S.; Zhang, Yinhua; Zhelkovsky, Alexander M.; Cantor, Eric J.; Evans, Thomas C.
2014-01-01
Single-stranded DNA molecules (ssDNA) annealed to an RNA splint are notoriously poor substrates for DNA ligases. Herein we report the unexpectedly efficient ligation of RNA-splinted DNA by Chlorella virus DNA ligase (PBCV-1 DNA ligase). PBCV-1 DNA ligase ligated ssDNA splinted by RNA with kcat ≈ 8 x 10−3 s−1 and KM < 1 nM at 25°C under conditions where T4 DNA ligase produced only 5′-adenylylated DNA with a 20-fold lower kcat and a KM ≈ 300 nM. The rate of ligation increased with addition of Mn2+, but was strongly inhibited by concentrations of NaCl >100 mM. Abortive adenylylation was suppressed at low ATP concentrations (<100 µM) and pH >8, leading to increased product yields. The ligation reaction was rapid for a broad range of substrate sequences, but was relatively slower for substrates with a 5′-phosphorylated dC or dG residue on the 3′ side of the ligation junction. Nevertheless, PBCV-1 DNA ligase ligated all sequences tested with 10-fold less enzyme and 15-fold shorter incubation times than required when using T4 DNA ligase. Furthermore, this ligase was used in a ligation-based detection assay system to show increased sensitivity over T4 DNA ligase in the specific detection of a target mRNA. PMID:24203707
A high-throughput assay for the comprehensive profiling of DNA ligase fidelity
Lohman, Gregory J. S.; Bauer, Robert J.; Nichols, Nicole M.; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C.
2016-01-01
DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. PMID:26365241
Xiao, Zhuo; Lie, Puchang; Fang, Zhiyuan; Yu, Luxin; Chen, Junhua; Liu, Jie; Ge, Chenchen; Zhou, Xuemeng; Zeng, Lingwen
2012-09-04
A lateral flow biosensor for detection of single nucleotide polymorphism based on circular strand displacement reaction (CSDPR) has been developed. Taking advantage of high fidelity of T4 DNA ligase, signal amplification by CSDPR, and the optical properties of gold nanoparticles, this assay has reached a detection limit of 0.01 fM.
High-Throughput Screening of HECT E3 Ubiquitin Ligases Using UbFluor.
Foote, Peter K; Krist, David T; Statsyuk, Alexander V
2017-09-14
HECT E3 ubiquitin ligases are responsible for many human disease phenotypes and are promising drug targets; however, screening assays for HECT E3 inhibitors are inherently complex, requiring upstream E1 and E2 enzymes as well as ubiquitin, ATP, and detection reagents. Intermediate ubiquitin thioesters and a complex mixture of polyubiquitin products provide further opportunities for off-target inhibition and increase the complexity of the assay. UbFluor is a novel ubiquitin thioester that bypasses the E1 and E2 enzymes and undergoes direct transthiolation with HECT E3 ligases. The release of fluorophore upon transthiolation allows fluorescence polarization detection of HECT E3 activity. In the presence of inhibitors, HECT E3 activity is ablated, and thus no reaction and no change in FP are observed. This assay has been adapted for high-throughput screening of small molecules against HECT E3 ligases, and its utility has been proven in the discovery of HECT E3 ligase inhibitors. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
A high-throughput assay for the comprehensive profiling of DNA ligase fidelity.
Lohman, Gregory J S; Bauer, Robert J; Nichols, Nicole M; Mazzola, Laurie; Bybee, Joanna; Rivizzigno, Danielle; Cantin, Elizabeth; Evans, Thomas C
2016-01-29
DNA ligases have broad application in molecular biology, from traditional cloning methods to modern synthetic biology and molecular diagnostics protocols. Ligation-based detection of polynucleotide sequences can be achieved by the ligation of probe oligonucleotides when annealed to a complementary target sequence. In order to achieve a high sensitivity and low background, the ligase must efficiently join correctly base-paired substrates, while discriminating against the ligation of substrates containing even one mismatched base pair. In the current study, we report the use of capillary electrophoresis to rapidly generate mismatch fidelity profiles that interrogate all 256 possible base-pair combinations at a ligation junction in a single experiment. Rapid screening of ligase fidelity in a 96-well plate format has allowed the study of ligase fidelity in unprecedented depth. As an example of this new method, herein we report the ligation fidelity of Thermus thermophilus DNA ligase at a range of temperatures, buffer pH and monovalent cation strength. This screen allows the selection of reaction conditions that maximize fidelity without sacrificing activity, while generating a profile of specific mismatches that ligate detectably under each set of conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Kaplan, Engin; Ilkit, Macit; de Hoog, G Sybren
2017-10-26
We developed two ligase-dependent probe amplification assays based on rolling circle amplification (RCA) and the ligase-dependent reaction (LDR) to differentiate species of Exophiala targeting the rDNA internal transcribed spacer region. We focused on Exophiala dermatitidis and E. phaeomuriformis, two opportunistic inhabitants of indoor wet cells, and further detected E. heteromorpha, E. xenobiotica, and E. crusticola; 57 reference isolates representing the five species were tested. Depending on the RCA probes used, the sensitivity was 100%, and the specificity ranged from 3.7% to 88.6% (median: 46.1%). In contrast, the sensitivity and specificity of the LDR probes targeting the same isolates were 88.6-100% (median: 95.8%) and 95.4-100% (median: 97.7%), respectively. We analyzed 198 additional environmental isolates representing the same Exophiala species. Overall, the sensitivity and specificity of LDR ranged from 89.7% to 100% (median: 94.1%) and from 93.9% to 100% (median: 96.9%), respectively. The assessment of performance and validation of LDR probes using SYBR Green quantitative polymerase chain reaction revealed high reproducibility and an acceptable range limit, in line with the guidelines of the European Network of GMO Laboratories. In conclusion, the LDR assay was more reliable and less expensive than RCA for species-level identification of Exophiala isolates. © The Author 2017. Published by Oxford University Press on behalf of The International Society for Human and Animal Mycology. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Li, Kai; Chen, Bei; Zhou, Yuxun; Huang, Rui; Liang, Yinming; Wang, Qinxi; Xiao, Zhenxian; Xiao, Junhua
2009-03-01
A new method, based on ligase detection reaction (LDR), was developed for quantitative detection of multiplex PCR amplicons of 16S rRNA genes present in complex mixtures (specifically feces). LDR has been widely used in single nucleotide polymorphism (SNP) assay but never applied for quantification of multiplex PCR products. This method employs one pair of DNA probes, one of which is labeled with fluorescence for signal capture, complementary to the target sequence. For multiple target sequence analysis, probes were modified with different lengths of polyT at the 5' end and 3' end. Using a DNA sequencer, these ligated probes were separated and identified by size and dye color. Then, relative abundance of target DNA were normalized and quantified based on the fluorescence intensities and exterior size standards. 16S rRNA gene of three preponderant bacteria groups in human feces: Clostridium coccoides, Bacteroides and related genera, and Clostridium leptum group, were amplified and cloned into plasmid DNA so as to make standard curves. After PCR-LDR analysis, a strong linear relationship was found between the florescence intensity and the diluted plasmid DNA concentrations. Furthermore, based on this method, 100 human fecal samples were quantified for the relative abundance of the three bacterial groups. Relative abundance of C. coccoides was significantly higher in elderly people in comparison with young adults, without gender differences. Relative abundance of Bacteroides and related genera and C. leptum group were significantly higher in young and middle aged than in the elderly. Regarding the whole set of sample, C. coccoides showed the highest relative abundance, followed by decreasing groups Bacteroides and related genera, and C. leptum. These results imply that PCR-LDR can be feasible and flexible applied to large scale epidemiological studies.
Peng, Zhiyong; Soper, Steven A.; Pingle, Maneesh R.; Barany, Francis; Davis, Lloyd M.
2015-01-01
Detection of pathogenic bacteria and viruses require strategies that can signal the presence of these targets in near real-time due to the potential threats created by rapid dissemination into water and/or food supplies. In this paper, we report an innovative strategy that can rapidly detect bacterial pathogens using reporter sequences found in their genome without requiring polymerase chain reaction (PCR). A pair of strain-specific primers was designed based on the 16S rRNA gene and were end-labeled with a donor (Cy5) or acceptor (Cy5.5) dye. In the presence of the target bacterium, the primers were joined using a ligase detection reaction (LDR) only when the primers were completely complementary to the target sequence to form a reverse molecular beacon (rMB), thus bringing Cy5 (donor) and Cy5.5 (acceptor) into close proximity to allow fluorescence resonance energy transfer (FRET) to occur. These rMBs were subsequently analyzed using single-molecule detection of the FRET pairs (single-pair FRET; spFRET). The LDR was performed using a continuous flow thermal cycling process configured in a cyclic olefin copolymer (COC) microfluidic device using either 2 or 20 thermal cycles. Single-molecule photon bursts from the resulting rMBs were detected on-chip and registered using a simple laser-induced fluorescence (LIF) instrument. The spFRET signatures from the target pathogens were reported in as little as 2.6 min using spFRET. PMID:21047095
Odell, Mark; Malinina, Lucy; Sriskanda, Verl; Teplova, Marianna; Shuman, Stewart
2003-09-01
Chlorella virus DNA ligase is the smallest eukaryotic ATP-dependent DNA ligase known; it suffices for yeast cell growth in lieu of the essential yeast DNA ligase Cdc9. The Chlorella virus ligase-adenylate intermediate has an intrinsic nick sensing function and its DNA footprint extends 8-9 nt on the 3'-hydroxyl (3'-OH) side of the nick and 11-12 nt on the 5'-phosphate (5'-PO4) side. Here we establish the minimal length requirements for ligatable 3'-OH and 5'-PO4 strands at the nick (6 nt) and describe a new crystal structure of the ligase-adenylate in a state construed to reflect the configuration of the active site prior to nick recognition. Comparison with a previous structure of the ligase-adenylate bound to sulfate (a mimetic of the nick 5'-PO4) suggests how the positions and contacts of the active site components and the bound adenylate are remodeled by DNA binding. We find that the minimal Chlorella virus ligase is capable of catalyzing non-homologous end-joining reactions in vivo in yeast, a process normally executed by the structurally more complex cellular Lig4 enzyme. Our results suggest a model of ligase evolution in which: (i) a small 'pluripotent' ligase is the progenitor of the much larger ligases found presently in eukaryotic cells and (ii) gene duplications, variations within the core ligase structure and the fusion of new domains to the core structure (affording new protein-protein interactions) led to the compartmentalization of eukaryotic ligase function, i.e. by enhancing some components of the functional repertoire of the ancestral ligase while disabling others.
Sinville, Rondedrick; Coyne, Jennifer; Meagher, Robert J.; Cheng, Yu-Wei; Barany, Francis; Barron, Annelise; Soper, Steven A.
2010-01-01
We have developed a new method for the analysis of low abundant point mutations in genomic DNA using a combination of an allele-specific ligase detection reaction (LDR) with free-solution conjugate electrophoresis (FSCE) to generate and analyze the genetic products. FSCE eliminates the need for a polymer sieving matrix by conjugating chemically synthesized polyamide “drag-tags” onto the LDR primers. The additional drag of the charge-neutral drag-tag breaks the linear scaling of the charge-to-friction ratio of DNA and enables size-based separations of DNA in free solution using electrophoresis with no sieving matrix. We successfully demonstrate the conjugation of polyamide drag-tags onto a set of four LDR primers designed to probe the K-ras oncogene for mutations highly associated with colorectal cancer, the simultaneous generation of fluorescently-labeled LDR/drag-tagged (LDR-dt) products in a multiplexed, single-tube format with mutant:wild-type ratios as low as 1:100, respectively, and the single-base, high-resolution separation of all four LDR-dt products. Separations were conducted in free solution with no polymer network using both a commercial capillary array electrophoresis (CAE) system and a poly(methylmethacrylate), PMMA, microchip replicated via hot-embossing with only a Tris-based running buffer containing additives to suppress the electroosmotic flow (EOF). Typical analysis times for LDR-dt conjugates were 11 min using the CAE system and as low as 85 s for the PMMA microchips. With resolution comparable to traditional gel-based CAE, FSCE along with microchip electrophoresis decreased the separation time by more than a factor of 40. PMID:19053073
RNA-templated single-base mutation detection based on T4 DNA ligase and reverse molecular beacon.
Tang, Hongxing; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Huimin; He, Lifang; Liu, Bin
2008-06-15
A novel RNA-templated single-base mutation detection method based on T4 DNA ligase and reverse molecular beacon (rMB) has been developed and successfully applied to identification of single-base mutation in codon 273 of the p53 gene. The discrimination was carried out using allele-specific primers, which flanked the variable position in the target RNA and was ligated using T4 DNA ligase only when the primers perfectly matched the RNA template. The allele-specific primers also carried complementary stem structures with end-labels (fluorophore TAMRA, quencher DABCYL), which formed a molecular beacon after RNase H digestion. One-base mismatch can be discriminated by analyzing the change of fluorescence intensity before and after RNase H digestion. This method has several advantages for practical applications, such as direct discrimination of single-base mismatch of the RNA extracted from cell; no requirement of PCR amplification; performance of homogeneous detection; and easily design of detection probes.
Mondal, Subhanjan; Hsiao, Kevin; Goueli, Said A
Adenosine monophosphate (AMP) is a key cellular metabolite regulating energy homeostasis and signal transduction. AMP is also a product of various enzymatic reactions, many of which are dysregulated during disease conditions. Thus, monitoring the activities of these enzymes is a primary goal for developing modulators for these enzymes. In this study, we demonstrate the versatility of an enzyme-coupled assay that quantifies the amount of AMP produced by any enzymatic reaction regardless of its substrates. We successfully implemented it to enzyme reactions that use adenosine triphosphate (ATP) as a substrate (aminoacyl tRNA synthetase and DNA ligase) by an elaborate strategy of removing residual ATP and converting AMP produced into ATP; so it can be detected using luciferase/luciferin and generating light. We also tested this assay to measure the activities of AMP-generating enzymes that do not require ATP as substrate, including phosphodiesterases (cyclic adenosine monophosphate) and Escherichia coli DNA ligases (nicotinamide adenine dinucleotide [NAD + ]). In a further elaboration of the AMP-Glo platform, we coupled it to E. coli DNA ligase, enabling measurement of NAD + and enzymes that use NAD + like monoadenosine and polyadenosine diphosphate-ribosyltransferases. Sulfotransferases use 3'-phosphoadenosine-5'-phosphosulfate as the universal sulfo-group donor and phosphoadenosine-5'-phosphate (PAP) is the universal product. PAP can be quantified by converting PAP to AMP by a Golgi-resident PAP-specific phosphatase, IMPAD1. By coupling IMPAD1 to the AMP-Glo system, we can measure the activities of sulfotransferases. Thus, by utilizing the combinations of biochemical enzymatic conversion of various cellular metabolites to AMP, we were able to demonstrate the versatility of the AMP-Glo assay.
Chlorella virus DNA ligase: nick recognition and mutational analysis.
Sriskanda, V; Shuman, S
1998-01-15
Chlorella virus PBCV-1 DNA ligase seals nicked DNA substrates consisting of a 5'-phosphate-terminated strand and a 3'-hydroxyl-terminated strand annealed to a bridging DNA template strand. The enzyme discriminates at the DNA binding step between substrates containing a 5'-phosphate versus a 5'-hydroxyl at the nick. Mutational analysis of the active site motif KxDGxR (residues 27-32) illuminates essential roles for the conserved Lys, Asp and Arg moieties at different steps of the ligase reaction. Mutant K27A is unable to form the covalent ligase-(Lys-straightepsilonN-P)-adenylate intermediate and hence cannot activate a nicked DNA substrate via formation of the DNA-adenylate intermediate. Nonetheless, K27A catalyzes phosphodiester bond formation at a pre-adenylated nick. This shows that the active site lysine is not required for the strand closure reaction. K27A binds to nicked DNA-adenylate, but not to a standard DNA nick. This suggests that occupancy of the AMP binding pocket of DNA ligase is important for nick recognition. Mutant D29A is active in enzyme-adenylate formation and binds readily to nicked DNA, but is inert in DNA-adenylate formation. R32A is unable to catalyze any of the three reactions of the ligation pathway and does not bind to nicked DNA.
Consolandi, Clarissa
2009-01-01
One major goal of genetic research is to understand the role of genetic variation in living systems. In humans, by far the most common type of such variation involves differences in single DNA nucleotides, and is thus termed single nucleotide polymorphism (SNP). The need for improvement in throughput and reliability of traditional techniques makes it necessary to develop new technologies. Thus the past few years have witnessed an extraordinary surge of interest in DNA microarray technology. This new technology offers the first great hope for providing a systematic way to explore the genome. It permits a very rapid analysis of thousands genes for the purpose of gene discovery, sequencing, mapping, expression, and polymorphism detection. We generated a series of analytical tools to address the manufacturing, detection and data analysis components of a microarray experiment. In particular, we set up a universal array approach in combination with a PCR-LDR (polymerase chain reaction-ligation detection reaction) strategy for allele identification in the HLA gene.
Detecting UV-lesions in the genome: The modular CRL4 ubiquitin ligase does it best!
Scrima, Andrea; Fischer, Eric S; Lingaraju, Gondichatnahalli M; Böhm, Kerstin; Cavadini, Simone; Thomä, Nicolas H
2011-09-16
The DDB1-DDB2-CUL4-RBX1 complex serves as the primary detection device for UV-induced lesions in the genome. It simultaneously functions as a CUL4 type E3 ubiquitin ligase. We review the current understanding of this dual function ubiquitin ligase and damage detection complex. The DDB2 damage binding module is merely one of a large family of possible DDB1-CUL4 associated factors (DCAF), most of which are substrate receptors for other DDB1-CUL4 complexes. DDB2 and the Cockayne-syndrome A protein (CSA) function in nucleotide excision repair, whereas the remaining receptors operate in a wide range of other biological pathways. We will examine the modular architecture of DDB1-CUL4 in complex with DDB2, CSA and CDT2 focusing on shared architectural, targeting and regulatory principles. Copyright © 2011 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Microfabricated electrochemiluminescence cell for chemical reaction detection
Northrup, M. Allen; Hsueh, Yun-Tai; Smith, Rosemary L.
2003-01-01
A detector cell for a silicon-based or non-silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The detector cell is an electrochemiluminescence cell constructed of layers of silicon with a cover layer of glass, with spaced electrodes located intermediate various layers forming the cell. The cell includes a cavity formed therein and fluid inlets for directing reaction fluid therein. The reaction chamber and detector cell may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The ECL cell may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Shi, Chao; Ge, Yujie; Gu, Hongxi; Ma, Cuiping
2011-08-15
Single nucleotide polymorphism (SNP) genotyping is attracting extensive attentions owing to its direct connections with human diseases including cancers. Here, we have developed a highly sensitive chemiluminescence biosensor based on circular strand-displacement amplification and the separation by magnetic beads reducing the background signal for point mutation detection at room temperature. This method took advantage of both the T4 DNA ligase recognizing single-base mismatch with high selectivity and the strand-displacement reaction of polymerase to perform signal amplification. The detection limit of this method was 1.3 × 10(-16)M, which showed better sensitivity than that of most of those reported detection methods of SNP. Additionally, the magnetic beads as carrier of immobility was not only to reduce the background signal, but also may have potential apply in high through-put screening of SNP detection in human genome. Copyright © 2011 Elsevier B.V. All rights reserved.
From Structure-Function Analyses to Protein Engineering for Practical Applications of DNA Ligase
Tanabe, Maiko; Nishida, Hirokazu
2015-01-01
DNA ligases are indispensable in all living cells and ubiquitous in all organs. DNA ligases are broadly utilized in molecular biology research fields, such as genetic engineering and DNA sequencing technologies. Here we review the utilization of DNA ligases in a variety of in vitro gene manipulations, developed over the past several decades. During this period, fewer protein engineering attempts for DNA ligases have been made, as compared to those for DNA polymerases. We summarize the recent progress in the elucidation of the DNA ligation mechanisms obtained from the tertiary structures solved thus far, in each step of the ligation reaction scheme. We also present some examples of engineered DNA ligases, developed from the viewpoint of their three-dimensional structures. PMID:26508902
Kapala, J.; Copes, D.; Sproston, A.; Patel, J.; Jang, D.; Petrich, A.; Mahony, J.; Biers, K.; Chernesky, M.
2000-01-01
Specimen pooling to achieve efficiency when testing urine specimens for Chlamydia trachomatis nucleic acids has been suggested. We pooled endocervical swabs from 1,288 women and also tested individual swabs by ligase chain reaction (LCR). Out of 53 positive specimens, pools of 4 or 8 specimens missed two positives, providing 96.2% accuracy compared to individual test results. Dilution and positive-control spiking experiments showed that negative specimens with inhibitors of LCR in the pool reduced the signal. Conversely, two extra positives, detected only through pooling, were negative by individual testing but became positive after storage, suggesting that fresh positive specimens with labile inhibitors may be positive in a pool because of dilution of inhibitors. For this population of women with a 4% prevalence of C. trachomatis infection, substantial savings in cost of reagents (55 to 63%) and technologist time (50 to 63%) made pooling strategies a desirable alternative to individual testing. PMID:10878029
Viveiros, M; Pinheiro, S; Moreira, P; Pacheco, T; Brum, L
1999-06-01
Egas Moniz Hospital, Lisbon, Portugal. To evaluate the Ligase Chain Reaction (LCx) Mycobacterium tuberculosis Assay for the direct detection of M. tuberculosis complex in respiratory specimens after smear observation, and its suitability for non-respiratory clinical specimens. Analysis of 156 specimens collected from 123 patients with pulmonary tuberculosis and/or extrapulmonary involvement. Among 93 pulmonary secretions and 63 extra-pulmonary samples and after resolution of discrepancies based on clinical and laboratory findings, two pulmonary samples from a patient with a diagnosis of sarcoidosis, four samples of cerebrospinal and one of seminal fluid were considered as false positives. Two tissue biopsy samples, one pericardial effusion and one pulmonary secretion from patients strongly suspected of having tuberculosis were considered as false negatives for the assay, without inhibition of amplification. All specimens yielding M. avium on culture were LCx negative. The LCx Mycobacterium tuberculosis Assay was found to be useful for the rapid identification of M. tuberculosis complex in all types of specimens. It revealed a high specificity both in pulmonary and extrapulmonary products, and a sensitivity of 97% for the pulmonary secretions and of 75% for the extra-pulmonary specimens, independently of the bacilloscopy results.
Universal ligation-detection-reaction microarray applied for compost microbes
Hultman, Jenni; Ritari, Jarmo; Romantschuk, Martin; Paulin, Lars; Auvinen, Petri
2008-01-01
Background Composting is one of the methods utilised in recycling organic communal waste. The composting process is dependent on aerobic microbial activity and proceeds through a succession of different phases each dominated by certain microorganisms. In this study, a ligation-detection-reaction (LDR) based microarray method was adapted for species-level detection of compost microbes characteristic of each stage of the composting process. LDR utilises the specificity of the ligase enzyme to covalently join two adjacently hybridised probes. A zip-oligo is attached to the 3'-end of one probe and fluorescent label to the 5'-end of the other probe. Upon ligation, the probes are combined in the same molecule and can be detected in a specific location on a universal microarray with complementary zip-oligos enabling equivalent hybridisation conditions for all probes. The method was applied to samples from Nordic composting facilities after testing and optimisation with fungal pure cultures and environmental clones. Results Probes targeted for fungi were able to detect 0.1 fmol of target ribosomal PCR product in an artificial reaction mixture containing 100 ng competing fungal ribosomal internal transcribed spacer (ITS) area or herring sperm DNA. The detection level was therefore approximately 0.04% of total DNA. Clone libraries were constructed from eight compost samples. The LDR microarray results were in concordance with the clone library sequencing results. In addition a control probe was used to monitor the per-spot hybridisation efficiency on the array. Conclusion This study demonstrates that the LDR microarray method is capable of sensitive and accurate species-level detection from a complex microbial community. The method can detect key species from compost samples, making it a basis for a tool for compost process monitoring in industrial facilities. PMID:19116002
An RNA ligase-mediated method for the efficient creation of large, synthetic RNAs
Stark, Martha R.; Pleiss, Jeffrey A.; Deras, Michael; Scaringe, Stephen A.; Rader, Stephen D.
2006-01-01
RNA ligation has been a powerful tool for incorporation of cross-linkers and nonnatural nucleotides into internal positions of RNA molecules. The most widely used method for template-directed RNA ligation uses DNA ligase and a DNA splint. While this method has been used successfully for many years, it suffers from a number of drawbacks, principally, slow and inefficient product formation and slow product release, resulting in a requirement for large quantities of enzyme. We describe an alternative technique catalyzed by T4 RNA ligase instead of DNA ligase. Using a splint design that allows the ligation junction to mimic the natural substrate of RNA ligase, we demonstrate several ligation reactions that appear to go nearly to completion. Furthermore, the reactions generally go to completion within 30 min. We present data evaluating the relative importance of various parameters in this reaction. Finally, we show the utility of this method by generating a 128-nucleotide pre-mRNA from three synthetic oligoribonucleotides. The ability to ligate synthetic or in vitro transcribed RNA with high efficiency has the potential to open up areas of RNA biology to new functional and biophysical investigation. In particular, we anticipate that site-specific incorporation of fluorescent dyes into large RNA molecules will yield a wealth of new information on RNA structure and function. PMID:16983143
Sensitive detection of point mutation by electrochemiluminescence and DNA ligase-based assay
NASA Astrophysics Data System (ADS)
Zhou, Huijuan; Wu, Baoyan
2008-12-01
The technology of single-base mutation detection plays an increasingly important role in diagnosis and prognosis of genetic-based diseases. Here we reported a new method for the analysis of point mutations in genomic DNA through the integration of allele-specific oligonucleotide ligation assay (OLA) with magnetic beads-based electrochemiluminescence (ECL) detection scheme. In this assay the tris(bipyridine) ruthenium (TBR) labeled probe and the biotinylated probe are designed to perfectly complementary to the mutant target, thus a ligation can be generated between those two probes by Taq DNA Ligase in the presence of mutant target. If there is an allele mismatch, the ligation does not take place. The ligation products are then captured onto streptavidin-coated paramagnetic beads, and detected by measuring the ECL signal of the TBR label. Results showed that the new method held a low detection limit down to 10 fmol and was successfully applied in the identification of point mutations from ASTC-α-1, PANC-1 and normal cell lines in codon 273 of TP53 oncogene. In summary, this method provides a sensitive, cost-effective and easy operation approach for point mutation detection.
Montecucco, A; Lestingi, M; Rossignol, J M; Elder, R H; Ciarrocchi, G
1993-04-06
We have measured the effects of eight distamycin and two anthracycline derivatives on polynucleotide joining and self-adenylating activities of human DNA ligase I and rat DNA ligases I and III. All test drugs show good inhibitory activity against the three enzymes in the poly[d(A-T)] joining assay. Several distamycins also inhibit the DNA-independent self-adenylation reaction catalysed by the human enzyme and, to a lesser extent, by rat DNA ligases. These results confirm that anthracyclines and distamycins express their inhibitory action against DNA joining activities mainly via specific interactions with the substrate, and suggest that the three test DNA ligases utilize similar, if not identical, mechanisms of recognition and interaction with DNA-drug complexes. Our findings also indicate that distamycins have a greater affinity for human DNA ligase I than for rat enzymes, suggesting that, in this respect, rat DNA ligase I is more similar to rat DNA ligase III than to human DNA ligase I.
Characterization of a novel eukaryal nick-sealing RNA ligase from Naegleria gruberi
Unciuleac, Mihaela-Carmen; Shuman, Stewart
2015-01-01
The proteome of the amoebo-flagellate protozoan Naegleria gruberi is rich in candidate RNA repair enzymes, including 15 putative RNA ligases, one of which, NgrRnl, is a eukaryal homolog of Deinococcus radiodurans RNA ligase, DraRnl. Here we report that purified recombinant NgrRnl seals nicked 3′-OH/5′-PO4 duplexes in which the 3′-OH strand is RNA. It does so via the “classic” ligase pathway, entailing reaction with ATP to form a covalent NgrRnl–AMP intermediate, transfer of AMP to the nick 5′-PO4, and attack of the RNA 3′-OH on the adenylylated nick to form a 3′–5′ phosphodiester. Unlike members of the four known families of ATP-dependent RNA ligases, NgrRnl lacks a carboxy-terminal appendage to its nucleotidyltransferase domain. Instead, it contains a defining amino-terminal domain that we show is important for 3′-OH/5′-PO4 nick-sealing and ligase adenylylation, but dispensable for phosphodiester synthesis at a preadenylylated nick. We propose that NgrRnl, DraRnl, and their homologs from diverse bacteria, viruses, and unicellular eukarya comprise a new “Rnl5 family” of nick-sealing ligases with a signature domain organization. PMID:25740837
Sriskanda, V; Kelman, Z; Hurwitz, J; Shuman, S
2000-06-01
We report the production, purification and characterization of a DNA ligase encoded by the thermophilic archaeon Methanobacterium thermoautotrophicum. The 561 amino acid MTH: ligase catalyzed strand-joining on a singly nicked DNA in the presence of a divalent cation (magnesium, manganese or cobalt) and ATP (K(m) 1.1 microM). dATP can substitute for ATP, but CTP, GTP, UTP and NAD(+) cannot. MTH: ligase activity is thermophilic in vitro, with optimal nick-joining at 60 degrees C. Mutational analysis of the conserved active site motif I (KxDG) illuminated essential roles for Lys251 and Asp253 at different steps of the ligation reaction. Mutant K251A is unable to form the covalent ligase-adenylate intermediate (step 1) and hence cannot seal a 3'-OH/5'-PO(4) nick. Yet, K251A catalyzes phosphodiester bond formation at a pre-adenylated nick (step 3). Mutant D253A is active in ligase-adenylate formation, but defective in activating the nick via formation of the DNA-adenylate intermediate (step 2). D253A is also impaired in phosphodiester bond formation at a pre-adenylated nick. A profound step 3 arrest, with accumulation of high levels of DNA-adenylate, could be elicited for the wild-type MTH: ligase by inclusion of calcium as the divalent cation cofactor. MTH: ligase sediments as a monomer in a glycerol gradient. Structure probing by limited proteolysis suggested that MTH: ligase is a tightly folded protein punctuated by a surface-accessible loop between nucleotidyl transferase motifs III and IIIa.
Raymond, Amy; Shuman, Stewart
2007-01-01
Deinococcus radiodurans RNA ligase (DraRnl) is a template-directed ligase that seals nicked duplexes in which the 3'-OH strand is RNA. DraRnl is a 342 amino acid polypeptide composed of a C-terminal adenylyltransferase domain fused to a distinctive 126 amino acid N-terminal module (a putative OB-fold). An alanine scan of the C domain identified 9 amino acids essential for nick ligation, which are located within nucleotidyltransferase motifs I, Ia, III, IIIa, IV and V. Seven mutants were dysfunctional by virtue of defects in ligase adenylylation: T163A, H167A, G168A, K186A, E230A, F281A and E305A. Four of these were also defective in phosphodiester formation at a preadenylylated nick: G168A, E230A, F281A and E305A. Two nick sealing-defective mutants were active in ligase adenylylation and sealing a preadenylylated nick, thereby implicating Ser185 and Lys326 in transfer of AMP from the enzyme to the nick 5'-PO(4). Whereas deletion of the N-terminal domain suppressed overall nick ligation and ligase adenylylation, it did not compromise sealing at a preadenylylated nick. Mutational analysis of 15 residues of the N domain identified Lys26, Gln31 and Arg79 as key constituents. Structure-activity relationships at the essential residues were determined via conservative substitutions. We propose that DraRnl typifies a new clade of polynucleotide ligases. DraRnl homologs are detected in several eukaryal proteomes.
Raymond, Amy; Shuman, Stewart
2007-01-01
Deinococcus radiodurans RNA ligase (DraRnl) is a template-directed ligase that seals nicked duplexes in which the 3′-OH strand is RNA. DraRnl is a 342 amino acid polypeptide composed of a C-terminal adenylyltransferase domain fused to a distinctive 126 amino acid N-terminal module (a putative OB-fold). An alanine scan of the C domain identified 9 amino acids essential for nick ligation, which are located within nucleotidyltransferase motifs I, Ia, III, IIIa, IV and V. Seven mutants were dysfunctional by virtue of defects in ligase adenylylation: T163A, H167A, G168A, K186A, E230A, F281A and E305A. Four of these were also defective in phosphodiester formation at a preadenylylated nick: G168A, E230A, F281A and E305A. Two nick sealing-defective mutants were active in ligase adenylylation and sealing a preadenylylated nick, thereby implicating Ser185 and Lys326 in transfer of AMP from the enzyme to the nick 5′-PO4. Whereas deletion of the N-terminal domain suppressed overall nick ligation and ligase adenylylation, it did not compromise sealing at a preadenylylated nick. Mutational analysis of 15 residues of the N domain identified Lys26, Gln31 and Arg79 as key constituents. Structure–activity relationships at the essential residues were determined via conservative substitutions. We propose that DraRnl typifies a new clade of polynucleotide ligases. DraRnl homologs are detected in several eukaryal proteomes. PMID:17204483
Eukaryotic DNA Ligases: Structural and Functional Insights
Ellenberger, Tom; Tomkinson, Alan E.
2010-01-01
DNA ligases are required for DNA replication, repair, and recombination. In eukaryotes, there are three families of ATP-dependent DNA ligases. Members of the DNA ligase I and IV families are found in all eukaryotes, whereas DNA ligase III family members are restricted to vertebrates. These enzymes share a common catalytic region comprising a DNA-binding domain, a nucleotidyltransferase (NTase) domain, and an oligonucleotide/oligosaccharide binding (OB)-fold domain. The catalytic region encircles nicked DNA with each of the domains contacting the DNA duplex. The unique segments adjacent to the catalytic region of eukaryotic DNA ligases are involved in specific protein-protein interactions with a growing number of DNA replication and repair proteins. These interactions determine the specific cellular functions of the DNA ligase isozymes. In mammals, defects in DNA ligation have been linked with an increased incidence of cancer and neurodegeneration. PMID:18518823
UbMES and UbFluor: Novel probes for ring-between-ring (RBR) E3 ubiquitin ligase PARKIN.
Park, Sungjin; Foote, Peter K; Krist, David T; Rice, Sarah E; Statsyuk, Alexander V
2017-10-06
Ring-between-ring (RBR) E3 ligases have been implicated in autoimmune disorders and neurodegenerative diseases. The functions of many RBR E3s are poorly defined, and their regulation is complex, involving post-translational modifications and allosteric regulation with other protein partners. The functional complexity of RBRs, coupled with the complexity of the native ubiquitination reaction that requires ATP and E1 and E2 enzymes, makes it difficult to study these ligases for basic research and therapeutic purposes. To address this challenge, we developed novel chemical probes, ubiquitin C-terminal fluorescein thioesters UbMES and UbFluor, to qualitatively and quantitatively assess the activity of the RBR E3 ligase PARKIN in a simple experimental setup and in real time using fluorescence polarization. First, we confirmed that PARKIN does not require an E2 enzyme for substrate ubiquitination, lysine selection, and polyubiquitin chain formation. Second, we confirmed that UbFluor quantitatively detects naturally occurring activation states of PARKIN caused by Ser 65 phosphorylation (pPARKIN) and phosphorylated ubiquitin (pUb). Third, we showed that both pUb and the ubiquitin-accepting substrate contribute to maximal pPARKIN ubiquitin conjugation turnover. pUb enhances the transthiolation step, whereas the substrate clears the pPARKIN∼Ub thioester intermediate. Finally, we established that UbFluor can quantify activation or inhibition of PARKIN by structural mutations. These results demonstrate the feasibility of using UbFluor for quantitative studies of the biochemistry of RBR E3s and for high-throughput screening of small-molecule activators or inhibitors of PARKIN and other RBR E3 ligases. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Boomsma, Wouter; Nielsen, Sofie V; Lindorff-Larsen, Kresten; Hartmann-Petersen, Rasmus; Ellgaard, Lars
2016-01-01
The ubiquitin-proteasome system targets misfolded proteins for degradation. Since the accumulation of such proteins is potentially harmful for the cell, their prompt removal is important. E3 ubiquitin-protein ligases mediate substrate ubiquitination by bringing together the substrate with an E2 ubiquitin-conjugating enzyme, which transfers ubiquitin to the substrate. For misfolded proteins, substrate recognition is generally delegated to molecular chaperones that subsequently interact with specific E3 ligases. An important exception is San1, a yeast E3 ligase. San1 harbors extensive regions of intrinsic disorder, which provide both conformational flexibility and sites for direct recognition of misfolded targets of vastly different conformations. So far, no mammalian ortholog of San1 is known, nor is it clear whether other E3 ligases utilize disordered regions for substrate recognition. Here, we conduct a bioinformatics analysis to examine >600 human and S. cerevisiae E3 ligases to identify enzymes that are similar to San1 in terms of function and/or mechanism of substrate recognition. An initial sequence-based database search was found to detect candidates primarily based on the homology of their ordered regions, and did not capture the unique disorder patterns that encode the functional mechanism of San1. However, by searching specifically for key features of the San1 sequence, such as long regions of intrinsic disorder embedded with short stretches predicted to be suitable for substrate interaction, we identified several E3 ligases with these characteristics. Our initial analysis revealed that another remarkable trait of San1 is shared with several candidate E3 ligases: long stretches of complete lysine suppression, which in San1 limits auto-ubiquitination. We encode these characteristic features into a San1 similarity-score, and present a set of proteins that are plausible candidates as San1 counterparts in humans. In conclusion, our work indicates that San1 is
Ubiquitin Ligases: Structure, Function, and Regulation.
Zheng, Ning; Shabek, Nitzan
2017-06-20
Ubiquitin E3 ligases control every aspect of eukaryotic biology by promoting protein ubiquitination and degradation. At the end of a three-enzyme cascade, ubiquitin ligases mediate the transfer of ubiquitin from an E2 ubiquitin-conjugating enzyme to specific substrate proteins. Early investigations of E3s of the RING (really interesting new gene) and HECT (homologous to the E6AP carboxyl terminus) types shed light on their enzymatic activities, general architectures, and substrate degron-binding modes. Recent studies have provided deeper mechanistic insights into their catalysis, activation, and regulation. In this review, we summarize the current progress in structure-function studies of ubiquitin ligases as well as exciting new discoveries of novel classes of E3s and diverse substrate recognition mechanisms. Our increased understanding of ubiquitin ligase function and regulation has provided the rationale for developing E3-targeting therapeutics for the treatment of human diseases.
Cherepanov, A V; de Vries, S
2001-01-01
The interaction of nucleotides with T4 DNA and RNA ligases has been characterized using ultraviolet visible (UV-VIS) absorbance and fluorescence spectroscopy. Both enzymes bind nucleotides with the K(d) between 0.1 and 20 microM. Nucleotide binding results in a decrease of absorbance at 260 nm due to pi-stacking with an aromatic residue, possibly phenylalanine, and causes red-shifting of the absorbance maximum due to hydrogen bonding with the exocyclic amino group. T4 DNA ligase is shown to have, besides the catalytic ATP binding site, another noncovalent nucleotide binding site. ATP bound there alters the pi-stacking of the nucleotide in the catalytic site, increasing its optical extinction. The K(d) for the noncovalent site is approximately 1000-fold higher than for the catalytic site. Nucleotides quench the protein fluorescence showing that a tryptophan residue is located in the active site of the ligase. The decrease of absorbance around 298 nm suggests that the hydrogen bonding interactions of this tryptophan residue are weakened in the ligase-nucleotide complex. The excitation/emission properties of T4 RNA ligase indicate that its ATP binding pocket is in contact with solvent, which is excluded upon binding of the nucleotide. Overall, the spectroscopic analysis reveals important similarities between T4 ligases and related nucleotidyltransferases, despite the low sequence similarity. PMID:11721015
Chromosome demise in the wake of ligase-deficient replication.
Kouzminova, Elena A; Kuzminov, Andrei
2012-06-01
Bacterial DNA ligases, NAD⁺-dependent enzymes, are distinct from eukaryotic ATP-dependent ligases, representing promising targets for broad-spectrum antimicrobials. Yet, the chromosomal consequences of ligase-deficient DNA replication, during which Okazaki fragments accumulate, are still unclear. Using ligA251(Ts), the strongest ligase mutant of Escherichia coli, we studied ligase-deficient DNA replication by genetic and physical approaches. Here we show that replication without ligase kills after a short resistance period. We found that double-strand break repair via RecA, RecBCD, RuvABC and RecG explains the transient resistance, whereas irreparable chromosomal fragmentation explains subsequent cell death. Remarkably, death is mostly prevented by elimination of linear DNA degradation activity of ExoV, suggesting that non-allelic double-strand breaks behind replication forks precipitate DNA degradation that enlarge them into allelic double-strand gaps. Marker frequency profiling of synchronized replication reveals stalling of ligase-deficient forks with subsequent degradation of the DNA synthesized without ligase. The mechanism that converts unsealed nicks behind replication forks first into repairable double-strand breaks and then into irreparable double-strand gaps may be behind lethality of any DNA damaging treatment. © 2012 Blackwell Publishing Ltd.
Mitochondrial Ubiquitin Ligase in Cardiovascular Disorders.
Yu, Tao; Zhang, Yinfeng; Li, Pei-Feng
2017-01-01
Mitochondrial dynamics play a critical role in cellular responses and physiological process. However, their dysregulation leads to a functional degradation, which results in a diverse array of common disorders, including cardiovascular disease. In this background, the mitochondrial ubiquitin ligase has been attracting substantial research interest in recent years. Mitochondrial ubiquitin ligase is localized in the mitochondrial outer membrane, where it plays an essential role in the regulation of mitochondrial dynamics and apoptosis. In this chapter, we provide a comprehensive overview of the functions of mitochondrial ubiquitin ligases identified hitherto, with a special focus on cardiovascular disorders.
Bauer, Robert J; Evans, Thomas C; Lohman, Gregory J S
2016-01-01
DNA ligases are essential both to in vivo replication, repair and recombination processes, and in vitro molecular biology protocols. Prior characterization of DNA ligases through gel shift assays has shown the presence of a nick site to be essential for tight binding between the enzyme and its dsDNA substrate, with no interaction evident on dsDNA lacking a nick. In the current study, we observed a significant substrate inhibition effect, as well as the inhibition of both the self-adenylylation and nick-sealing steps of T4 DNA ligase by non-nicked, non-substrate dsDNA. Inhibition by non-substrate DNA was dependent only on the total DNA concentration rather than the structure; with 1 μg/mL of 40-mers, 75-mers, or circular plasmid DNA all inhibiting ligation equally. A >15-fold reduction in T4 DNA ligase self-adenylylation rate when in the presence of high non-nicked dsDNA concentrations was observed. Finally, EMSAs were utilized to demonstrate that non-substrate dsDNA can compete with nicked dsDNA substrates for enzyme binding. Based upon these data, we hypothesize the inhibition of T4 DNA ligase by non-nicked dsDNA is direct evidence for a two-step nick-binding mechanism, with an initial, nick-independent, transient dsDNA-binding event preceding a transition to a stable binding complex in the presence of a nick site.
Bauer, Robert J.; Evans, Thomas C.; Lohman, Gregory J. S.
2016-01-01
DNA ligases are essential both to in vivo replication, repair and recombination processes, and in vitro molecular biology protocols. Prior characterization of DNA ligases through gel shift assays has shown the presence of a nick site to be essential for tight binding between the enzyme and its dsDNA substrate, with no interaction evident on dsDNA lacking a nick. In the current study, we observed a significant substrate inhibition effect, as well as the inhibition of both the self-adenylylation and nick-sealing steps of T4 DNA ligase by non-nicked, non-substrate dsDNA. Inhibition by non-substrate DNA was dependent only on the total DNA concentration rather than the structure; with 1 μg/mL of 40-mers, 75-mers, or circular plasmid DNA all inhibiting ligation equally. A >15-fold reduction in T4 DNA ligase self-adenylylation rate when in the presence of high non-nicked dsDNA concentrations was observed. Finally, EMSAs were utilized to demonstrate that non-substrate dsDNA can compete with nicked dsDNA substrates for enzyme binding. Based upon these data, we hypothesize the inhibition of T4 DNA ligase by non-nicked dsDNA is direct evidence for a two-step nick-binding mechanism, with an initial, nick-independent, transient dsDNA-binding event preceding a transition to a stable binding complex in the presence of a nick site. PMID:26954034
Englert, Markus; Beier, Hildburg
2005-01-01
Pre-tRNA splicing is an essential process in all eukaryotes. It requires the concerted action of an endonuclease to remove the intron and a ligase for joining the resulting tRNA halves as studied best in the yeast Saccharomyces cerevisiae. Here, we report the first characterization of an RNA ligase protein and its gene from a higher eukaryotic organism that is an essential component of the pre-tRNA splicing process. Purification of tRNA ligase from wheat germ by successive column chromatographic steps has identified a protein of 125 kDa by its potentiality to covalently bind AMP, and by its ability to catalyse the ligation of tRNA halves and the circularization of linear introns. Peptide sequences obtained from the purified protein led to the elucidation of the corresponding proteins and their genes in Arabidopsis and Oryza databases. The plant tRNA ligases exhibit no overall sequence homologies to any known RNA ligases, however, they harbour a number of conserved motifs that indicate the presence of three intrinsic enzyme activities: an adenylyltransferase/ligase domain in the N-terminal region, a polynucleotide kinase in the centre and a cyclic phosphodiesterase domain at the C-terminal end. In vitro expression of the recombinant Arabidopsis tRNA ligase and functional analyses revealed all expected individual activities. Plant RNA ligases are active on a variety of substrates in vitro and are capable of inter- and intramolecular RNA joining. Hence, we conclude that their role in vivo might comprise yet unknown essential functions besides their involvement in pre-tRNA splicing. PMID:15653639
Samai, Poulami; Shuman, Stewart
2011-01-01
Chlorella virus DNA ligase (ChVLig) has pluripotent biological activity and an intrinsic nick-sensing function. ChVLig consists of three structural modules that envelop nicked DNA as a C-shaped protein clamp: a nucleotidyltransferase (NTase) domain and an OB domain (these two are common to all DNA ligases) as well as a distinctive β-hairpin latch module. The NTase domain, which performs the chemical steps of ligation, binds the major groove flanking the nick and the minor groove on the 3′-OH side of the nick. Here we performed a structure-guided mutational analysis of the NTase domain, surveying the effects of 35 mutations in 19 residues on ChVLig activity in vivo and in vitro, including biochemical tests of the composite nick sealing reaction and of the three component steps of the ligation pathway (ligase adenylylation, DNA adenylylation, and phosphodiester synthesis). The results highlight (i) key contacts by Thr-84 and Lys-173 to the template DNA strand phosphates at the outer margins of the DNA ligase footprint; (ii) essential contacts of Ser-41, Arg-42, Met-83, and Phe-75 with the 3′-OH strand at the nick; (iii) Arg-176 phosphate contacts at the nick and with ATP during ligase adenylylation; (iv) the role of Phe-44 in forming the protein clamp around the nicked DNA substrate; and (v) the importance of adenine-binding residue Phe-98 in all three steps of ligation. Kinetic analysis of single-turnover nick sealing by ChVLig-AMP underscored the importance of Phe-75-mediated distortion of the nick 3′-OH nucleoside in the catalysis of DNA 5′-adenylylation (step 2) and phosphodiester synthesis (step 3). Induced fit of the nicked DNA into a distorted conformation when bound within the ligase clamp may account for the nick-sensing capacity of ChVLig. PMID:21335605
Samai, Poulami; Shuman, Stewart
2011-04-15
Chlorella virus DNA ligase (ChVLig) has pluripotent biological activity and an intrinsic nick-sensing function. ChVLig consists of three structural modules that envelop nicked DNA as a C-shaped protein clamp: a nucleotidyltransferase (NTase) domain and an OB domain (these two are common to all DNA ligases) as well as a distinctive β-hairpin latch module. The NTase domain, which performs the chemical steps of ligation, binds the major groove flanking the nick and the minor groove on the 3'-OH side of the nick. Here we performed a structure-guided mutational analysis of the NTase domain, surveying the effects of 35 mutations in 19 residues on ChVLig activity in vivo and in vitro, including biochemical tests of the composite nick sealing reaction and of the three component steps of the ligation pathway (ligase adenylylation, DNA adenylylation, and phosphodiester synthesis). The results highlight (i) key contacts by Thr-84 and Lys-173 to the template DNA strand phosphates at the outer margins of the DNA ligase footprint; (ii) essential contacts of Ser-41, Arg-42, Met-83, and Phe-75 with the 3'-OH strand at the nick; (iii) Arg-176 phosphate contacts at the nick and with ATP during ligase adenylylation; (iv) the role of Phe-44 in forming the protein clamp around the nicked DNA substrate; and (v) the importance of adenine-binding residue Phe-98 in all three steps of ligation. Kinetic analysis of single-turnover nick sealing by ChVLig-AMP underscored the importance of Phe-75-mediated distortion of the nick 3'-OH nucleoside in the catalysis of DNA 5'-adenylylation (step 2) and phosphodiester synthesis (step 3). Induced fit of the nicked DNA into a distorted conformation when bound within the ligase clamp may account for the nick-sensing capacity of ChVLig.
Taylor, Mark R; Conrad, John A; Wahl, Daniel; O'Brien, Patrick J
2011-07-01
DNA ligase I (LIG1) catalyzes the ligation of single-strand breaks to complete DNA replication and repair. The energy of ATP is used to form a new phosphodiester bond in DNA via a reaction mechanism that involves three distinct chemical steps: enzyme adenylylation, adenylyl transfer to DNA, and nick sealing. We used steady state and pre-steady state kinetics to characterize the minimal mechanism for DNA ligation catalyzed by human LIG1. The ATP dependence of the reaction indicates that LIG1 requires multiple Mg(2+) ions for catalysis and that an essential Mg(2+) ion binds more tightly to ATP than to the enzyme. Further dissection of the magnesium ion dependence of individual reaction steps revealed that the affinity for Mg(2+) changes along the reaction coordinate. At saturating concentrations of ATP and Mg(2+) ions, the three chemical steps occur at similar rates, and the efficiency of ligation is high. However, under conditions of limiting Mg(2+), the nick-sealing step becomes rate-limiting, and the adenylylated DNA intermediate is prematurely released into solution. Subsequent adenylylation of enzyme prevents rebinding to the adenylylated DNA intermediate comprising an Achilles' heel of LIG1. These ligase-generated 5'-adenylylated nicks constitute persistent breaks that are a threat to genomic stability if they are not repaired. The kinetic and thermodynamic framework that we have determined for LIG1 provides a starting point for understanding the mechanism and specificity of mammalian DNA ligases.
Simple fluorescence-based detection of protein kinase A activity using a molecular beacon probe.
Ma, Changbei; Lv, Xiaoyuan; Wang, Kemin; Jin, Shunxin; Liu, Haisheng; Wu, Kefeng; Zeng, Weimin
2017-11-02
Protein kinase A was detected by quantifying the amount of ATP used after a protein kinase reaction. The ATP assay was performed using the T4 DNA ligase and a molecular beacon (MB). In the presence of ATP, DNA ligase catalyzed the ligation of short DNA. The ligation product then hybridized to MB, resulting in a fluorescence enhancement of the MB. This assay was capable of determining protein kinase A in the range of 12.5∼150 nM, with a detection limit of 1.25 nM. Furthermore, this assay could also be used to investigate the effect of genistein on protein kinase A. It was a universal, non-radioisotopic, and homogeneous method for assaying protein kinase A.
Activity‐Based Probes for HECT E3 Ubiquitin Ligases
Byrne, Robert; Mund, Thomas
2017-01-01
Abstract Activity‐based probes (ABPs) have been used to dissect the biochemical/structural properties and cellular functions of deubiquitinases. However, their utility in studying cysteine‐based E3 ubiquitin ligases has been limited. In this study, we evaluate the use of ubiquitin‐ABPs (Ub‐VME and Ub‐PA) and a novel set of E2–Ub‐ABPs on a panel of HECT E3 ubiquitin ligases. Our in vitro data show that ubiquitin‐ABPs can label HECT domains. We also provide the first evidence that, in addition to the RBR E3 ubiquitin ligase Parkin, E2–Ub‐ABPs can also label the catalytic HECT domains of NEDD4, UBE3C, and HECTD1. Importantly, the endogenous proteasomal E3 ligase UBE3C was also successfully labelled by Ub‐PA and His‐UBE2D2–Ub‐ABP in lysate of cells grown under basal conditions. Our findings provide novel insights into the use of ABPs for the study of HECT E3 ubiquitin ligases. PMID:28425671
Structure-function analysis of the OB and latch domains of chlorella virus DNA ligase.
Samai, Poulami; Shuman, Stewart
2011-06-24
Chlorella virus DNA ligase (ChVLig) is a minimized eukaryal ATP-dependent DNA sealing enzyme with an intrinsic nick-sensing function. ChVLig consists of three structural domains, nucleotidyltransferase (NTase), OB-fold, and latch, that envelop the nicked DNA as a C-shaped protein clamp. The OB domain engages the DNA minor groove on the face of the duplex behind the nick, and it makes contacts to amino acids in the NTase domain surrounding the ligase active site. The latch module occupies the DNA major groove flanking the nick. Residues at the tip of the latch contact the NTase domain to close the ligase clamp. Here we performed a structure-guided mutational analysis of the OB and latch domains. Alanine scanning defined seven individual amino acids as essential in vivo (Lys-274, Arg-285, Phe-286, and Val-288 in the OB domain; Asn-214, Phe-215, and Tyr-217 in the latch), after which structure-activity relations were clarified by conservative substitutions. Biochemical tests of the composite nick sealing reaction and of each of the three chemical steps of the ligation pathway highlighted the importance of Arg-285 and Phe-286 in the catalysis of the DNA adenylylation and phosphodiester synthesis reactions. Phe-286 interacts with the nick 5'-phosphate nucleotide and the 3'-OH base pair and distorts the DNA helical conformation at the nick. Arg-285 is a key component of the OB-NTase interface, where it forms a salt bridge to the essential Asp-29 side chain, which is imputed to coordinate divalent metal catalysts during the nick sealing steps.
Structure-Function Analysis of the OB and Latch Domains of Chlorella Virus DNA Ligase*
Samai, Poulami; Shuman, Stewart
2011-01-01
Chlorella virus DNA ligase (ChVLig) is a minimized eukaryal ATP-dependent DNA sealing enzyme with an intrinsic nick-sensing function. ChVLig consists of three structural domains, nucleotidyltransferase (NTase), OB-fold, and latch, that envelop the nicked DNA as a C-shaped protein clamp. The OB domain engages the DNA minor groove on the face of the duplex behind the nick, and it makes contacts to amino acids in the NTase domain surrounding the ligase active site. The latch module occupies the DNA major groove flanking the nick. Residues at the tip of the latch contact the NTase domain to close the ligase clamp. Here we performed a structure-guided mutational analysis of the OB and latch domains. Alanine scanning defined seven individual amino acids as essential in vivo (Lys-274, Arg-285, Phe-286, and Val-288 in the OB domain; Asn-214, Phe-215, and Tyr-217 in the latch), after which structure-activity relations were clarified by conservative substitutions. Biochemical tests of the composite nick sealing reaction and of each of the three chemical steps of the ligation pathway highlighted the importance of Arg-285 and Phe-286 in the catalysis of the DNA adenylylation and phosphodiester synthesis reactions. Phe-286 interacts with the nick 5′-phosphate nucleotide and the 3′-OH base pair and distorts the DNA helical conformation at the nick. Arg-285 is a key component of the OB-NTase interface, where it forms a salt bridge to the essential Asp-29 side chain, which is imputed to coordinate divalent metal catalysts during the nick sealing steps. PMID:21527793
Enzyme reversal to explore the function of yeast E3 ubiquitin-ligases.
MacDonald, Chris; Winistorfer, Stanley; Pope, Robert M; Wright, Michael E; Piper, Robert C
2017-07-01
The covalent attachment of ubiquitin onto proteins can elicit a variety of downstream consequences. Attachment is mediated by a large array of E3 ubiquitin ligases, each thought be subject to regulatory control and to have a specific repertoire of substrates. Assessing the biological roles of ligases, and in particular, identifying their biologically relevant substrates has been a persistent yet challenging question. In this study, we describe tools that may help achieve both of these goals. We describe a strategy whereby the activity of a ubiquitin ligase has been enzymatically reversed, accomplished by fusing it to a catalytic domain of an exogenous deubiquitinating enzyme. We present a library of 72 "anti-ligases" that appear to work in a dominant-negative fashion to stabilize their cognate substrates against ubiquitin-dependent proteasomal and lysosomal degradation. We then used the ligase-deubiquitinating enzyme (DUb) library to screen for E3 ligases involved in post-Golgi/endosomal trafficking. We identify ligases previously implicated in these pathways (Rsp5 and Tul1), in addition to ligases previously localized to endosomes (Pib1 and Vps8). We also document an optimized workflow for isolating and analyzing the "ubiquitome" of yeast, which can be used with mass spectrometry to identify substrates perturbed by expression of particular ligase-DUb fusions. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Kumar, Atul; Chaugule, Viduth K; Condos, Tara E C; Barber, Kathryn R; Johnson, Clare; Toth, Rachel; Sundaramoorthy, Ramasubramanian; Knebel, Axel; Shaw, Gary S; Walden, Helen
2017-05-01
RING-between-RING (RBR) E3 ligases are a class of ubiquitin ligases distinct from RING or HECT E3 ligases. An important RBR ligase is Parkin, mutations in which lead to early-onset hereditary Parkinsonism. Parkin and other RBR ligases share a catalytic RBR module but are usually autoinhibited and activated via distinct mechanisms. Recent insights into Parkin regulation predict large, unknown conformational changes during Parkin activation. However, current data on active RBR ligases reflect the absence of regulatory domains. Therefore, it remains unclear how individual RBR ligases are activated, and whether they share a common mechanism. We now report the crystal structure of a human Parkin-phosphoubiquitin complex, which shows that phosphoubiquitin binding induces movement in the 'in-between RING' (IBR) domain to reveal a cryptic ubiquitin-binding site. Mutation of this site negatively affects Parkin's activity. Furthermore, ubiquitin binding promotes cooperation between Parkin molecules, which suggests a role for interdomain association in the RBR ligase mechanism.
Enhancement of DNA ligase I level by gemcitabine in human cancer cells.
Sun, Daekyu; Urrabaz, Rheanna; Kelly, Susan; Nguyen, Myhanh; Weitman, Steve
2002-04-01
DNA ligase I is an essential enzyme for completing DNA replication and DNA repair by ligating Okazaki fragments and by joining single-strand breaks formed either directly by DNA-damaging agents or indirectly by DNA repair enzymes, respectively. In this study, we examined whether the DNA ligase I level could be modulated in human tumor cell lines by treatment with gemcitabine (2', 2'-difluoro-2'-deoxycytidine), which is a nucleoside analogue of cytidine with proven antitumor activity against a broad spectrum of human cancers in clinical studies. To determine the effect of gemcitabine on DNA ligase I expression, Western blot analysis was used to measure the DNA ligase I levels in MiaPaCa, NGP, and SK-N-BE cells treated with different concentrations of gemcitabine and harvested at different time intervals. Cell cycle analysis was also performed to determine the underlying mechanism of DNA ligase I level enhancement in response to gemcitabine. In addition, other agents that share the same mechanism of action with gemcitabine were used to elucidate further details. When different types of tumor cell lines, including MiaPaCa, NGP, and SK-N-BE, were treated with gemcitabine, the level of DNA ligase I increased severalfold despite significant cell growth inhibition. In contrast, other DNA ligases (III and IV) either remained unchanged or decreased with treatment. Cell cycle analysis showed that arrest in S-phase corresponded to an increase of DNA ligase I levels in gemcitabine treated cells. Other agents, such as 1-beta-D-arabinofuranosylcytosine and hydroxyurea, which partly share mechanisms of action with gemcitabine by targeting DNA polymerases and ribonucleotide reductase, respectively, also caused an increase of DNA ligase I levels. However, 5-fluorouracil, which predominantly targets thymidylate synthase, did not cause an increase of DNA ligase I level. Our results suggest that an arrest of DNA replication caused by gemcitabine treatment through incorporation of
Zhu, Hui; Shuman, Stewart
2005-04-01
NAD+-dependent DNA ligase (LigA) is essential for bacterial growth and a potential target for antimicrobial drug discovery. Here we queried the role of 14 conserved amino acids of Escherichia coli LigA by alanine scanning and thereby identified five new residues within the nucleotidyltransferase domain as being essential for LigA function in vitro and in vivo. Structure activity relationships were determined by conservative mutagenesis for the Glu-173, Arg-200, Arg-208, and Arg-277 side chains, as well as four other essential side chains that had been identified previously (Lys-115, Asp-117, Asp-285, and Lys-314). In addition, we identified Lys-290 as important for LigA activity. Reference to the structure of Enterococcus faecalis LigA allowed us to discriminate three classes of essential/important side chains that: (i) contact NAD+ directly (Lys-115, Glu-173, Lys-290, and Lys-314); (ii) comprise the interface between the NMN-binding domain (domain Ia) and the nucleotidyltransferase domain or comprise part of a nick-binding site on the surface of the nucleotidyltransferase domain (Arg-200 and Arg-208); or (iii) stabilize the active site fold of the nucleotidyltransferase domain (Arg-277). Analysis of mutational effects on the isolated ligase adenylylation and phosphodiester formation reactions revealed different functions for essential side chains at different steps of the DNA ligase pathway, consistent with the proposal that the active site is serially remodeled as the reaction proceeds.
E3 ubiquitin ligases: key regulators of hormone signaling in plants.
Kelley, Dior
2018-03-07
Ubiquitin-mediated control of protein stability is central to most aspects of plant hormone signaling. Attachment of ubiquitin to target proteins occurs via an enzymatic cascade with the final step being catalyzed by a family of enzymes known as E3 ubiquitin ligases, which have been classified based on their protein domains and structures. While E3 ubiquitin ligases are conserved among eukaryotes, in plants they are well-known to fulfill unique roles as central regulators of phytohormone signaling, including hormone perception and regulation of hormone biosynthesis. This review will highlight up-to-date findings that have refined well-known E3 ligase-substrate interactions and defined novel E3 ligase substrates that mediate numerous hormone signaling pathways. Additionally, examples of how particular E3 ligases may mediate hormone crosstalk will be discussed as an emerging theme. Looking forward, promising experimental approaches and methods that will provide deeper mechanistic insight into the roles of E3 ubiquitin ligases in plants will be considered. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.
Last stop on the road to repair: structure of E. coli DNA ligase bound to nicked DNA-adenylate.
Nandakumar, Jayakrishnan; Nair, Pravin A; Shuman, Stewart
2007-04-27
NAD(+)-dependent DNA ligases (LigA) are ubiquitous in bacteria and essential for growth. Their distinctive substrate specificity and domain organization vis-a-vis human ATP-dependent ligases make them outstanding targets for anti-infective drug discovery. We report here the 2.3 A crystal structure of Escherichia coli LigA bound to an adenylylated nick, which captures LigA in a state poised for strand closure and reveals the basis for nick recognition. LigA envelopes the DNA within a protein clamp. Large protein domain movements and remodeling of the active site orchestrate progression through the three chemical steps of the ligation reaction. The structure inspires a strategy for inhibitor design.
Samai, Poulami; Shuman, Stewart
2012-01-01
Chlorella virus DNA ligase (ChVLig) is an instructive model for mechanistic studies of the ATP-dependent DNA ligase family. ChVLig seals 3′-OH and 5′-PO4 termini via three chemical steps: 1) ligase attacks the ATP α phosphorus to release PPi and form a covalent ligase-adenylate intermediate; 2) AMP is transferred to the nick 5′-phosphate to form DNA-adenylate; 3) the 3′-OH of the nick attacks DNA-adenylate to join the polynucleotides and release AMP. Each chemical step requires Mg2+. Kinetic analysis of nick sealing by ChVLig-AMP revealed that the rate constant for phosphodiester synthesis (kstep3 = 25 s−1) exceeds that for DNA adenylylation (kstep2 = 2.4 s−1) and that Mg2+ binds with similar affinity during step 2 (Kd = 0.77 mm) and step 3 (Kd = 0.87 mm). The rates of DNA adenylylation and phosphodiester synthesis respond differently to pH, such that step 3 becomes rate-limiting at pH ≤ 6.5. The pH profiles suggest involvement of one and two protonation-sensitive functional groups in catalysis of steps 2 and 3, respectively. We suggest that the 5′-phosphate of the nick is the relevant protonation-sensitive moiety and that a dianionic 5′-phosphate is necessary for productive step 2 catalysis. Motif VI, located at the C terminus of the OB-fold domain of ChVLig, is a conserved feature of ATP-dependent DNA ligases and GTP-dependent mRNA capping enzymes. Presteady state and burst kinetic analysis of the effects of deletion and missense mutations highlight the catalytic contributions of ChVLig motif VI, especially the Asp-297 carboxylate, exclusively during the ligase adenylylation step. PMID:22745124
Henke, Sarah K.; Cronan, John E.
2014-01-01
Group II biotin protein ligases (BPLs) are characterized by the presence of an N-terminal DNA binding domain that allows transcriptional regulation of biotin biosynthetic and transport genes whereas Group I BPLs lack this N-terminal domain. The Bacillus subtilis BPL, BirA, is classified as a Group II BPL based on sequence predictions of an N-terminal helix-turn-helix motif and mutational alteration of its regulatory properties. We report evidence that B. subtilis BirA is a Group II BPL that regulates transcription at three genomic sites: bioWAFDBI, yuiG and yhfUTS. Moreover, unlike the paradigm Group II BPL, E. coli BirA, the N-terminal DNA binding domain can be deleted from Bacillus subtilis BirA without adverse effects on its ligase function. This is the first example of successful conversion of a Group II BPL to a Group I BPL with retention of full ligase activity. PMID:24816803
Solution NMR studies of Chlorella virus DNA ligase-adenylate.
Piserchio, Andrea; Nair, Pravin A; Shuman, Stewart; Ghose, Ranajeet
2010-01-15
DNA ligases are essential guardians of genome integrity by virtue of their ability to recognize and seal 3'-OH/5'-phosphate nicks in duplex DNA. The substrate binding and three chemical steps of the ligation pathway are coupled to global and local changes in ligase structure, involving both massive protein domain movements and subtle remodeling of atomic contacts in the active site. Here we applied solution NMR spectroscopy to study the conformational dynamics of the Chlorella virus DNA ligase (ChVLig), a minimized eukaryal ATP-dependent ligase consisting of nucleotidyltransferase, OB, and latch domains. Our analysis of backbone (15)N spin relaxation and (15)N,(1)H residual dipolar couplings of the covalent ChVLig-AMP intermediate revealed conformational sampling on fast (picosecond to nanosecond) and slow timescales (microsecond to millisecond), indicative of interdomain and intradomain flexibility. We identified local and global changes in ChVLig-AMP structure and dynamics induced by phosphate. In particular, the chemical shift perturbations elicited by phosphate were clustered in the peptide motifs that comprise the active site. We hypothesize that phosphate anion mimics some of the conformational transitions that occur when ligase-adenylate interacts with the nick 5'-phosphate. Copyright 2009 Elsevier Ltd. All rights reserved.
Footprinting of Chlorella virus DNA ligase bound at a nick in duplex DNA.
Odell, M; Shuman, S
1999-05-14
The 298-amino acid ATP-dependent DNA ligase of Chlorella virus PBCV-1 is the smallest eukaryotic DNA ligase known. The enzyme has intrinsic specificity for binding to nicked duplex DNA. To delineate the ligase-DNA interface, we have footprinted the enzyme binding site on DNA and the DNA binding site on ligase. The size of the exonuclease III footprint of ligase bound a single nick in duplex DNA is 19-21 nucleotides. The footprint is asymmetric, extending 8-9 nucleotides on the 3'-OH side of the nick and 11-12 nucleotides on the 5'-phosphate side. The 5'-phosphate moiety is essential for the binding of Chlorella virus ligase to nicked DNA. Here we show that the 3'-OH moiety is not required for nick recognition. The Chlorella virus ligase binds to a nicked ligand containing 2',3'-dideoxy and 5'-phosphate termini, but cannot catalyze adenylation of the 5'-end. Hence, the 3'-OH is important for step 2 chemistry even though it is not itself chemically transformed during DNA-adenylate formation. A 2'-OH cannot substitute for the essential 3'-OH in adenylation at a nick or even in strand closure at a preadenylated nick. The protein side of the ligase-DNA interface was probed by limited proteolysis of ligase with trypsin and chymotrypsin in the presence and absence of nicked DNA. Protease accessible sites are clustered within a short segment from amino acids 210-225 located distal to conserved motif V. The ligase is protected from proteolysis by nicked DNA. Protease cleavage of the native enzyme prior to DNA addition results in loss of DNA binding. These results suggest a bipartite domain structure in which the interdomain segment either comprises part of the DNA binding site or undergoes a conformational change upon DNA binding. The domain structure of Chlorella virus ligase inferred from the solution experiments is consistent with the structure of T7 DNA ligase determined by x-ray crystallography.
A Lateral Flow Biosensor for the Detection of Single Nucleotide Polymorphisms.
Zeng, Lingwen; Xiao, Zhuo
2017-01-01
A lateral flow biosensor (LFB) is introduced for the detection of single nucleotide polymorphisms (SNPs). The assay is composed of two steps: circular strand displacement reaction and lateral flow biosensor detection. In step 1, the nucleotide at SNP site is recognized by T4 DNA ligase and the signal is amplified by strand displacement DNA polymerase, which can be accomplished at a constant temperature. In step 2, the reaction product of step 1 is detected by a lateral flow biosensor, which is a rapid and cost effective tool for nuclei acid detection. Comparing with conventional methods, it requires no complicated machines. It is suitable for the use of point of care diagnostics. Therefore, this simple, cost effective, robust, and promising LFB detection method of SNP has great potential for the detection of genetic diseases, personalized medicine, cancer related mutations, and drug-resistant mutations of infectious agents.
Patel, Maha P.; Baum, Dana A.; Silverman, Scott K.
2008-01-01
DNA with a 5′-adenylpyrophosphoryl cap (5′-adenylated DNA; AppDNA) is an activated form of DNA that is the biochemical intermediate of the reactions catalyzed by DNA ligase, RNA ligase, polynucleotide kinase, and other nucleic acid modifying enzymes. 5′-Adenylated DNA is also useful for in vitro selection experiments. Efficient preparation of 5′-adenylated DNA is therefore desirable for several biochemical applications. Here we have developed a DNA adenylation procedure that uses T4 DNA ligase and is more reliable than a previously reported approach that used the 5′-phosphorylated donor DNA substrate to be adenylated, a DNA template, and ATP but no acceptor strand. Our improved DNA adenylation procedure uses the above components as well as an acceptor strand that has a strategically chosen C-T acceptor-template mismatch directly adjacent to the adenylation site. This mismatch permits adenylation of the donor DNA substrate but largely suppresses subsequent ligation of the donor with the acceptor, as assayed on nine different DNA substrates that collectively have all four DNA nucleotides represented at each of the first two positions. The new DNA adenylation procedure is successful using either laboratory-prepared or commercial T4 DNA ligase and works well on the preparative (2 nmol) scale for all nine of the test DNA substrates. PMID:18022669
Potapov, Vladimir; Ong, Jennifer L; Langhorst, Bradley W; Bilotti, Katharina; Cahoon, Dan; Canton, Barry; Knight, Thomas F; Evans, Thomas C; Lohman, Gregory Js
2018-05-08
DNA ligases are key enzymes in molecular and synthetic biology that catalyze the joining of breaks in duplex DNA and the end-joining of DNA fragments. Ligation fidelity (discrimination against the ligation of substrates containing mismatched base pairs) and bias (preferential ligation of particular sequences over others) have been well-studied in the context of nick ligation. However, almost no data exist for fidelity and bias in end-joining ligation contexts. In this study, we applied Pacific Biosciences Single-Molecule Real-Time sequencing technology to directly sequence the products of a highly multiplexed ligation reaction. This method has been used to profile the ligation of all three-base 5'-overhangs by T4 DNA ligase under typical ligation conditions in a single experiment. We report the relative frequency of all ligation products with or without mismatches, the position-dependent frequency of each mismatch, and the surprising observation that 5'-TNA overhangs ligate extremely inefficiently compared to all other Watson-Crick pairings. The method can easily be extended to profile other ligases, end-types (e.g. blunt ends and overhangs of different lengths), and the effect of adjacent sequence on the ligation results. Further, the method has the potential to provide new insights into the thermodynamics of annealing and the kinetics of end-joining reactions.
Park, I S; Lin, C H; Walsh, C T
1997-09-16
The VanC phenotype for clinical resistance of enterococci to vancomycin is exhibited by Enterococcus gallinarum and Enterococcus casseliflavus. Based on the detection of the cell precursor UDP-N-acetylmuramic acid pentapeptide intermediate terminating in D-Ala-D-Ser instead of D-Ala-D-Ala, it has been predicted that the VanC ligase would be a D-Ala-D-Ser rather than a D-Ala-D-Ala ligase. Overproduction of the E. casseliflavus ATCC 25788 vanC2 gene in Escherichia coli and its purification to homogeneity allowed demonstration of ATP-dependent D-Ala-D-Ser ligase activity. The kcat/Km2 (Km2 = Km for D-Ser or C-terminal D-Ala) ratio for D-Ala-D-Ser/D-Ala-D-Ala dipeptide formation is 270/0.69 for a 400-fold selection against D-Ala in the C-terminal position. VanC2 also has substantial D-Ala-D-Asn ligase activity (kcat/Km2 = 74 mM-1min-1).
Wang, Ping; Zhang, Tonghuan; Yang, Taoyi; Jin, Nan; Zhao, Yanjun; Fan, Aiping
2014-08-07
A highly sensitive and selective chemiluminescent (CL) biosensor for adenosine triphosphate (ATP) was developed by taking advantage of the ATP-dependent enzymatic reaction (ATP-DER), the powerful signal amplification capability of rolling circle amplification (RCA), and hydroxylamine-amplified gold nanoparticles (Au NPs). The strategy relies on the ability of ATP, a cofactor of T4 DNA ligase, to trigger the ligation-RCA reaction. In the presence of ATP, the T4 DNA ligase catalyzes the ligation reaction between the two ends of the padlock probe, producing a closed circular DNA template that initiates the RCA reaction with phi29 DNA polymerase and dNTP. Therein, many complementary copies of the circular template can be generated. The ATP-DER is eventually converted into a detectable CL signal after a series of processes, including gold probe hybridization, hydroxylamine amplification, and oxidative gold metal dissolution coupled with a simple and sensitive luminol CL reaction. The CL signal is directly proportional to the ATP level. The results showed that the detection limit of the assay is 100 pM of ATP, which compares favorably with those of other ATP detection techniques. In addition, by taking advantage of ATP-DER, the proposed CL sensing system exhibits extraordinary specificity towards ATP and could distinguish the target molecule ATP from its analogues. The proposed method provides a new and versatile platform for the design of novel DNA ligation reaction-based CL sensing systems for other cofactors. This novel ATP-DER based CL sensing system may find wide applications in clinical diagnosis as well as in environmental and biomedical fields.
Virtual screening for potential inhibitors of bacterial MurC and MurD ligases.
Tomašić, Tihomir; Kovač, Andreja; Klebe, Gerhard; Blanot, Didier; Gobec, Stanislav; Kikelj, Danijel; Mašič, Lucija Peterlin
2012-03-01
Mur ligases are bacterial enzymes involved in the cytoplasmic steps of peptidoglycan biosynthesis and are viable targets for antibacterial drug discovery. We have performed virtual screening for potential ATP-competitive inhibitors targeting MurC and MurD ligases, using a protocol of consecutive hierarchical filters. Selected compounds were evaluated for inhibition of MurC and MurD ligases, and weak inhibitors possessing dual inhibitory activity have been identified. These compounds represent new scaffolds for further optimisation towards multiple Mur ligase inhibitors with improved inhibitory potency.
Wang, Li Kai; Zhu, Hui; Shuman, Stewart
2009-03-27
NAD(+)-dependent DNA ligases (LigA) are ubiquitous in bacteria, where they are essential for growth and present attractive targets for antimicrobial drug discovery. LigA has a distinctive modular structure in which a nucleotidyltransferase catalytic domain is flanked by an upstream NMN-binding module and by downstream OB-fold, zinc finger, helix-hairpin-helix, and BRCT domains. Here we conducted a structure-function analysis of the nucleotidyltransferase domain of Escherichia coli LigA, guided by the crystal structure of the LigA-DNA-adenylate intermediate. We tested the effects of 29 alanine and conservative mutations at 15 amino acids on ligase activity in vitro and in vivo. We thereby identified essential functional groups that coordinate the reactive phosphates (Arg(136)), contact the AMP adenine (Lys(290)), engage the phosphodiester backbone flanking the nick (Arg(218), Arg(308), Arg(97) plus Arg(101)), or stabilize the active domain fold (Arg(171)). Finer analysis of the mutational effects revealed step-specific functions for Arg(136), which is essential for the reaction of LigA with NAD(+) to form the covalent ligase-AMP intermediate (step 1) and for the transfer of AMP to the nick 5'-PO(4) to form the DNA-adenylate intermediate (step 2) but is dispensable for phosphodiester formation at a preadenylylated nick (step 3).
DOE Office of Scientific and Technical Information (OSTI.GOV)
Han, Seungil; Chang, Jeanne S.; Griffor, Matt
DNA ligase catalyzes phosphodiester-bond formation between immediately adjacent 5'-phosphate and 3''-hydroxyl groups in double-stranded DNA and plays a central role in many cellular and biochemical processes, including DNA replication, repair and recombination. Bacterial NAD{sup +}-dependent DNA ligases have been extensively characterized as potential antibacterial targets because of their essentiality and their structural distinction from human ATP-dependent DNA ligases. The high-resolution structure of the adenylation domain of Staphylococcus aureus NAD{sup +}-dependent DNA ligase establishes the conserved domain architecture with other bacterial adenylation domains. Two apo crystal structures revealed that the active site possesses the preformed NAD{sup +}-binding pocket and the 'C2more » tunnel' lined with hydrophobic residues: Leu80, Phe224, Leu287, Phe295 and Trp302. The C2 tunnel is unique to bacterial DNA ligases and the Leu80 side chain at the mouth of the tunnel points inside the tunnel and forms a narrow funnel in the S. aureus DNA ligase structure. Taken together with other DNA ligase structures, the S. aureus DNA ligase structure provides a basis for a more integrated understanding of substrate recognition and catalysis and will be also be of help in the development of small-molecule inhibitors.« less
RtcB is the RNA ligase component of an Escherichia coli RNA repair operon.
Tanaka, Naoko; Shuman, Stewart
2011-03-11
RNA 2',3'-cyclic phosphate ends play important roles in RNA metabolism as substrates for RNA ligases during tRNA restriction-repair and tRNA splicing. Diverse bacteria from multiple phyla encode a two-component RNA repair cassette, comprising Pnkp (polynucleotide kinase-phosphatase-ligase) and Hen1 (RNA 3'-terminal ribose 2'-O-methyltransferase), that heals and then seals broken tRNAs with 2',3'-cyclic phosphate and 5'-OH ends. The Pnkp-Hen1 repair operon is absent in the majority of bacterial species, thereby raising the prospect that other RNA repair systems might be extant. A candidate component is RNA 3'-phosphate cyclase, a widely distributed enzyme that transforms RNA 3'-monophosphate termini into 2',3'-cyclic phosphates but cannot seal the ends it produces. Escherichia coli RNA cyclase (RtcA) is encoded in a σ(54)-regulated operon with RtcB, a protein of unknown function. Taking a cue from Pnkp-Hen1, we purified E. coli RtcB and tested it for RNA ligase activity. We report that RtcB per se seals broken tRNA-like stem-loop structures with 2',3'-cyclic phosphate and 5'-OH ends to form a splice junction with a 2'-OH, 3',5'-phosphodiester. We speculate that: (i) RtcB might afford bacteria a means to recover from stress-induced RNA damage; and (ii) RtcB homologs might catalyze tRNA repair or splicing reactions in archaea and eukarya.
Overview of the membrane-associated RING-CH (MARCH) E3 ligase family.
Bauer, Johannes; Bakke, Oddmund; Morth, J Preben
2017-09-25
E3 ligases are critical checkpoints for protein ubiquitination, a signal that often results in protein sorting and degradation but has also been linked to regulation of transcription and DNA repair. In line with their key role in cellular trafficking and cell-cycle control, malfunction of E3 ligases is often linked to human disease. Thus, they have emerged as prime drug targets. However, the molecular basis of action of membrane-bound E3 ligases is still unknown. Here, we review the current knowledge on the membrane-embedded MARCH E3 ligases (MARCH-1-6,7,8,11) with a focus on how the transmembrane regions can contribute via GxxxG-motifs to the selection and recognition of other membrane proteins as substrates for ubiquitination. Further understanding of the molecular parameters that govern target protein recognition of MARCH E3 ligases will contribute to development of strategies for therapeutic regulation of MARCH-induced ubiquitination. Copyright © 2016 Elsevier B.V. All rights reserved.
DD-ligases as a potential target for antibiotics: past, present and future.
Tytgat, I; Colacino, E; Tulkens, P M; Poupaert, J H; Prévost, M; Van Bambeke, F
2009-01-01
DD-ligases catalyze the synthesis of the D-Ala-D-Ala and D-Ala-D-Ser dipeptides or the D Ala-D-Lac depsipeptide in an early step of peptidoglycan synthesis. Their function is essential for bacterial growth and specific to bacteria, making them attractive targets for the development of novel antibiotics. This review examines the biochemical and structural features of these enzymes and presents the main families of inhibitors described so far. Over the last 20 years, 7 structures of DD-ligases have been solved by X-ray crystallography, giving a detailed view of the general topology of the active site and of the residues in the catalytic pocket that play a central role in substrate recognition. This has paved the way to the rational design of inhibitors, which can be classified as (i) analogues of substrates, (ii) analogues of the product of the reaction, (iii) analogues of the transition state, and (iv) original scaffolds discovered by screening or by rational computer-aided design. The three first strategies have led to molecules that are polar by nature and have therefore poor access to their cytosolic target. The fourth one is potentially most promising as it yields more diverse structures. The most active molecules show affinity constants in the microM range, but microbiological evaluation remains scarce (typical MIC 1-8 mg/L for the tested compounds). These data strongly suggest targeting DD-ligases is a promising approach for discovery of new antibiotics. Future research should, however, aim at finding more potent inhibitors endowed with the appropriate pharmacokinetic properties that ensure access to their intracellular target.
Inhibitors of ubiquitin E3 ligase as potential new antimalarial drug leads.
Jain, Jagrati; Jain, Surendra K; Walker, Larry A; Tekwani, Babu L
2017-06-02
Protein ubiquitylation is an important post-translational regulation, which has been shown to be necessary for life cycle progression and survival of Plasmodium falciparum. Ubiquitin is a highly conserved 76 amino acid polypeptide, which attaches covalently to target proteins through combined action of three classes of enzymes namely, the ubiquitin-activating enzyme (E1), ubiquitin-conjugating enzyme (E2) and ubiquitin-protein ligase (E3). Ubiquitin E1 and E2 are highly conserved within eukaryotes. However, the P. falciparum E3 ligase is substantially variable and divergent compared to the homologs from other eukaryotes, which make the E3 ligase a parasite-specific target. A set of selected E3 ubiquitin ligase inhibitors was tested in vitro against a chloroquine-sensitive P. falciparum D6 strain (PfD6) and a chloroquine-resistant P. falciparum W2 strain (PfW2). The inhibitors were also tested against Vero and transformed THP1 cells for cytotoxicity. The lead antimalarial E3 ubiquitin ligase inhibitors were further evaluated for the stage-specific antimalarial action and effects on cellular development of P. falciparum in vitro. Statistics analysis was done by two-way ANOVA followed by Tukey and Sidak multiple comparison test using GraphPad Prism 6. E3 ligase inhibitors namely, JNJ 26854165, HLI 373 and Nutlin 3 showed prominent antimalarial activity against PfD6 and PfW2. These inhibitors were considerably less cytotoxic to mammalian Vero cells. JNJ 26854165, HLI 373 and Nutlin 3 blocked the development of P. falciparum parasite at the trophozoite and schizont stages, resulting in accumulation of distorted trophozoites and immature schizonts. Interruption of trophozoites and schizont maturation by the antimalarial E3 ligase inhibitors suggest the role of ubiquitin/proteasome functions in the intraerythrocytic development of malaria parasite. The ubiquitin/proteasome functions may be critical for schizont maturation. Further investigations on the lead E3 ligase
Pan, I-Chun; Tsai, Huei-Hsuan; Cheng, Ya-Tan; Wen, Tuan-Nan; Buckhout, Thomas J.; Schmidt, Wolfgang
2015-01-01
Acclimation to changing environmental conditions is mediated by proteins, the abundance of which is carefully tuned by an elaborate interplay of DNA-templated and post-transcriptional processes. To dissect the mechanisms that control and mediate cellular iron homeostasis, we conducted quantitative high-resolution iTRAQ proteomics and microarray-based transcriptomic profiling of iron-deficient Arabidopsis thaliana plants. A total of 13,706 and 12,124 proteins was identified with a quadrupole-Orbitrap hybrid mass spectrometer in roots and leaves, respectively. This deep proteomic coverage allowed accurate estimates of post-transcriptional regulation in response to iron deficiency. Similarly regulated transcripts were detected in only 13% (roots) and 11% (leaves) of the 886 proteins that differentially accumulated between iron-sufficient and iron-deficient plants, indicating that the majority of the iron-responsive proteins was post-transcriptionally regulated. Mutants harboring defects in the RING DOMAIN LIGASE1 (RGLG1)1 and RING DOMAIN LIGASE2 (RGLG2) showed a pleiotropic phenotype that resembled iron-deficient plants with reduced trichome density and the formation of branched root hairs. Proteomic and transcriptomic profiling of rglg1 rglg2 double mutants revealed that the functional RGLG protein is required for the regulation of a large set of iron-responsive proteins including the coordinated expression of ribosomal proteins. This integrative analysis provides a detailed catalog of post-transcriptionally regulated proteins and allows the concept of a chiefly transcriptionally regulated iron deficiency response to be revisited. Protein data are available via ProteomeXchange with identifier PXD002126. PMID:26253232
Biochemical and Structural Characterisation of DNA Ligases from Bacteria and Archaea.
Pergolizzi, Giulia; Wagner, Gerd K; Bowater, Richard Peter
2016-08-31
DNA ligases are enzymes that seal breaks in the backbones of DNA, leading to them being essential for the survival of all organisms. DNA ligases have been studied from many different types of cells and organisms and shown to have diverse sizes and sequences, with well conserved specific sequences that are required for enzymatic activity. A significant number of DNA ligases have been isolated or prepared in recombinant forms and, here, we review their biochemical and structural characterisation. All DNA ligases contain an essential lysine that transfers an adenylate group from a co-factor to the 5'-phosphate of the DNA end that will ultimately be joined to the 3'-hydroxyl of the neighbouring DNA strand. The essential DNA ligases in bacteria use nicotinamide adenine dinucleotide ( β -NAD + ) as their co-factor whereas those that are essential in other cells use adenosine-5'-triphosphate (ATP) as their co-factor. This observation suggests that the essential bacterial enzyme could be targeted by novel antibiotics and the complex molecular structure of β -NAD + affords multiple opportunities for chemical modification. Several recent studies have synthesised novel derivatives and their biological activity against a range of DNA ligases has been evaluated as inhibitors for drug discovery and/or non-natural substrates for biochemical applications. Here, we review the recent advances that herald new opportunities to alter the biochemical activities of these important enzymes. The recent development of modified derivatives of nucleotides highlights that the continued combination of structural, biochemical and biophysical techniques will be useful in targeting these essential cellular enzymes. ©2016 The Author(s).
Gul, Sheraz; Brown, Richard; May, Earl; Mazzulla, Marie; Smyth, Martin G; Berry, Colin; Morby, Andrew; Powell, David J
2004-11-01
DNA ligases are key enzymes involved in the repair and replication of DNA. Prokaryotic DNA ligases uniquely use NAD+ as the adenylate donor during catalysis, whereas eukaryotic enzymes use ATP. This difference in substrate specificity makes the bacterial enzymes potential targets for therapeutic intervention. We have developed a homogeneous chemiluminescence-based hybridization protection assay for Staphylococcus aureus DNA ligase that uses novel acridinium ester technology and demonstrate that it is an alternative to the commonly used radiometric assays for ligases. The assay has been used to determine a number of kinetic constants for S. aureus DNA ligase catalysis. These included the K(m) values for NAD+ (2.75+/-0.1 microM) and the acridinium-ester-labelled DNA substrate (2.5+/-0.2 nM). A study of the pH-dependencies of kcat, K(m) and kcat/K(m) has revealed values of kinetically influential ionizations within the enzyme-substrate complexes (kcat) and free enzyme (kcat/K(m)). In each case, the curves were shown to be composed of one kinetically influential ionization, for k(cat), pK(a)=6.6+/-0.1 and kcat/K(m), pK(a)=7.1+/-0.1. Inhibition characteristics of the enzyme against two Escherichia coli DNA ligase inhibitors have also been determined with IC50 values for these being 3.30+/-0.86 microM for doxorubicin and 1.40+/-0.07 microM for chloroquine diphosphate. The assay has also been successfully miniaturized to a sufficiently low volume to allow it to be utilized in a high-throughput screen (384-well format; 20 microl reaction volume), enabling the assay to be used in screening campaigns against libraries of compounds to discover leads for further drug development.
High-throughput sequencing reveals circular substrates for an archaeal RNA ligase
Becker, Hubert F.; Héliou, Alice; Djaout, Kamel; Lestini, Roxane; Regnier, Mireille; Myllykallio, Hannu
2017-01-01
ABSTRACT It is only recently that the abundant presence of circular RNAs (circRNAs) in all kingdoms of Life, including the hyperthermophilic archaeon Pyrococcus abyssi, has emerged. This led us to investigate the physiologic significance of a previously observed weak intramolecular ligation activity of Pab1020 RNA ligase. Here we demonstrate that this enzyme, despite sharing significant sequence similarity with DNA ligases, is indeed an RNA-specific polynucleotide ligase efficiently acting on physiologically significant substrates. Using a combination of RNA immunoprecipitation assays and RNA-seq, our genome-wide studies revealed 133 individual circRNA loci in P. abyssi. The large majority of these loci interacted with Pab1020 in cells and circularization of selected C/D Box and 5S rRNA transcripts was confirmed biochemically. Altogether these studies revealed that Pab1020 is required for RNA circularization. Our results further suggest the functional speciation of an ancestral NTase domain and/or DNA ligase toward RNA ligase activity and prompt for further characterization of the widespread functions of circular RNAs in prokaryotes. Detailed insight into the cellular substrates of Pab1020 may facilitate the development of new biotechnological applications e.g. in ligation of preadenylated adaptors to RNA molecules. PMID:28277897
DOE Office of Scientific and Technical Information (OSTI.GOV)
Biterova, Ekaterina I.; Barycki, Joseph J.; UNL)
2009-12-01
Glutathione is a thiol-disulfide exchange peptide critical for buffering oxidative or chemical stress, and an essential cofactor in several biosynthesis and detoxification pathways. The rate-limiting step in its de novo biosynthesis is catalyzed by glutamate cysteine ligase, a broadly expressed enzyme for which limited structural information is available in higher eukaryotic species. Structural data are critical to the understanding of clinical glutathione deficiency, as well as rational design of enzyme modulators that could impact human disease progression. Here, we have determined the structures of Saccharomyces cerevisiae glutamate cysteine ligase (ScGCL) in the presence of glutamate and MgCl{sub 2} (2.1 {angstrom};more » R = 18.2%, R{sub free} = 21.9%), and in complex with glutamate, MgCl{sub 2}, and ADP (2.7 {angstrom}; R = 19.0%, R{sub free} = 24.2%). Inspection of these structures reveals an unusual binding pocket for the {alpha}-carboxylate of the glutamate substrate and an ATP-independent Mg{sup 2+} coordination site, clarifying the Mg{sup 2+} dependence of the enzymatic reaction. The ScGCL structures were further used to generate a credible homology model of the catalytic subunit of human glutamate cysteine ligase (hGCLC). Examination of the hGCLC model suggests that post-translational modifications of cysteine residues may be involved in the regulation of enzymatic activity, and elucidates the molecular basis of glutathione deficiency associated with patient hGCLC mutations.« less
Protein Neddylation: Beyond Cullin-RING Ligases
Enchev, Radoslav I.; Schulman, Brenda A.; Peter, Matthias
2016-01-01
NEDD8 is a ubiquitin-like protein that activates the largest ubiquitin E3 ligase family, the cullin RING ligases. Many non-cullin neddylation targets have been proposed in recent years. However, overexpression of exogenous NEDD8 can trigger NEDD8 conjugation through the ubiquitylation machinery, which makes validating potential NEDD8 targets challenging. Here we re-evaluate these studies in light of the current understanding of the neddylation pathway, and suggest criteria for the identification of genuine neddylation substrates under homeostatic conditions. We describe the biological processes that might be regulated by non-cullin neddylation, and the utility of neddylation inhibitors for research and as potential therapies. Understanding the biological significance of non-cullin neddylation is an exciting research prospect primed to reveal fundamental insights. PMID:25531226
Polynucleotide 3′-terminal Phosphate Modifications by RNA and DNA Ligases
Zhelkovsky, Alexander M.; McReynolds, Larry A.
2014-01-01
RNA and DNA ligases catalyze the formation of a phosphodiester bond between the 5′-phosphate and 3′-hydroxyl ends of nucleic acids. In this work, we describe the ability of the thermophilic RNA ligase MthRnl from Methanobacterium thermoautotrophicum to recognize and modify the 3′-terminal phosphate of RNA and single-stranded DNA (ssDNA). This ligase can use an RNA 3′p substrate to generate an RNA 2′,3′-cyclic phosphate or convert DNA3′p to ssDNA3′pp5′A. An RNA ligase from the Thermus scotoductus bacteriophage TS2126 and a predicted T4 Rnl1-like protein from Thermovibrio ammonificans, TVa, were also able to adenylate ssDNA 3′p. These modifications of RNA and DNA 3′-phosphates are similar to the activities of RtcA, an RNA 3′-phosphate cyclase. The initial step involves adenylation of the enzyme by ATP, which is then transferred to either RNA 3′p or DNA 3′p to generate the adenylated intermediate. For RNA 3′pp5′A, the third step involves attack of the adjacent 2′ hydroxyl to generate the RNA 2′,3′-cyclic phosphate. These steps are analogous to those in classical 5′ phosphate ligation. MthRnl and TS2126 RNA ligases were not able to modify a 3′p in nicked double-stranded DNA. However, T4 DNA ligase and RtcA can use 3′-phosphorylated nicks in double-stranded DNA to produce a 3′-adenylated product. These 3′-terminal phosphate-adenylated intermediates are substrates for deadenylation by yeast 5′Deadenylase. Our findings that classic ligases can duplicate the adenylation and phosphate cyclization activity of RtcA suggests that they have an essential role in metabolism of nucleic acids with 3′-terminal phosphates. PMID:25324547
Kim, Hyun Uk; van Oostende, Chloë; Basset, Gilles J C; Browse, John
2008-04-01
Phylloquinone is the one-electron carrier at the A(1) site of photosystem I, and is essential for photosynthesis. Arabidopsis mutants deficient in early steps of phylloquinone synthesis do not become autotrophic and are seedling lethals, even when grown on sucrose-supplemented media. Here, we identify acyl-activating enzyme 14 (AAE14, At1g30520) as the o-succinylbenzoyl-coenzyme A (OSB-CoA) ligase acting in phylloquinone synthesis. Three aae14 mutant alleles, identified by reverse genetics, were found to be seedling lethal, to contain no detectable phylloquinone (< 0.1 pmol mg(-1) fresh weight) compared with 10 pmol mg(-1) fresh weight in wild-type leaves, and to accumulate OSB. AAE14 was able to restore menaquinone biosynthesis when expressed in an Escherichia coli mutant disrupted in the menE gene that encodes the bacterial OSB-CoA ligase. Weak expression of an AAE14 transgene in mutant plants (controlled by the uninduced XVE promoter) resulted in chlorotic, slow-growing plants that accumulated an average of 4.7 pmol mg(-1) fresh weight of phylloquinone. Inducing the XVE promoter in these plants, or expressing an AAE14 transgene under the control of the CaMV 35S promoter, led to full complementation of the mutant phenotype. aae14-mutant plants were also able to synthesize phylloquinone when provided with 1,4-dihydroxy-2-naphthoate, an intermediate in phylloquinone synthesis downstream of the OSB-CoA ligase reaction. Expression of an AAE14:GFP reporter construct indicated that the protein accumulated in discrete foci within the chloroplasts. This and other evidence suggests that the enzymes of phylloquinone synthesis from isochorismate may form a complex in the chloroplast stroma to facilitate the efficient channeling of intermediates through the pathway.
Crowder, Justin J.; Geigges, Marco; Gibson, Ryan T.; Fults, Eric S.; Buchanan, Bryce W.; Sachs, Nadine; Schink, Andrea; Kreft, Stefan G.; Rubenstein, Eric M.
2015-01-01
Aberrant nonstop proteins arise from translation of mRNA molecules beyond the coding sequence into the 3′-untranslated region. If a stop codon is not encountered, translation continues into the poly(A) tail, resulting in C-terminal appendage of a polylysine tract and a terminally stalled ribosome. In Saccharomyces cerevisiae, the ubiquitin ligase Rkr1/Ltn1 has been implicated in the proteasomal degradation of soluble cytosolic nonstop and translationally stalled proteins. Rkr1 is essential for cellular fitness under conditions associated with increased prevalence of nonstop proteins. Mutation of the mammalian homolog causes significant neurological pathology, suggesting broad physiological significance of ribosome-associated quality control. It is not known whether and how soluble or transmembrane nonstop and translationally stalled proteins targeted to the endoplasmic reticulum (ER) are detected and degraded. We generated and characterized model soluble and transmembrane ER-targeted nonstop and translationally stalled proteins. We found that these proteins are indeed subject to proteasomal degradation. We tested three candidate ubiquitin ligases (Rkr1 and ER-associated Doa10 and Hrd1) for roles in regulating abundance of these proteins. Our results indicate that Rkr1 plays the primary role in targeting the tested model ER-targeted nonstop and translationally stalled proteins for degradation. These data expand the catalog of Rkr1 substrates and highlight a previously unappreciated role for this ubiquitin ligase at the ER membrane. PMID:26055716
Busti, Elena; Bordoni, Roberta; Castiglioni, Bianca; Monciardini, Paolo; Sosio, Margherita; Donadio, Stefano; Consolandi, Clarissa; Rossi Bernardi, Luigi; Battaglia, Cristina; De Bellis, Gianluca
2002-01-01
Background PCR amplification of bacterial 16S rRNA genes provides the most comprehensive and flexible means of sampling bacterial communities. Sequence analysis of these cloned fragments can provide a qualitative and quantitative insight of the microbial population under scrutiny although this approach is not suited to large-scale screenings. Other methods, such as denaturing gradient gel electrophoresis, heteroduplex or terminal restriction fragment analysis are rapid and therefore amenable to field-scale experiments. A very recent addition to these analytical tools is represented by microarray technology. Results Here we present our results using a Universal DNA Microarray approach as an analytical tool for bacterial discrimination. The proposed procedure is based on the properties of the DNA ligation reaction and requires the design of two probes specific for each target sequence. One oligo carries a fluorescent label and the other a unique sequence (cZipCode or complementary ZipCode) which identifies a ligation product. Ligated fragments, obtained in presence of a proper template (a PCR amplified fragment of the 16s rRNA gene) contain either the fluorescent label or the unique sequence and therefore are addressed to the location on the microarray where the ZipCode sequence has been spotted. Such an array is therefore "Universal" being unrelated to a specific molecular analysis. Here we present the design of probes specific for some groups of bacteria and their application to bacterial diagnostics. Conclusions The combined use of selective probes, ligation reaction and the Universal Array approach yielded an analytical procedure with a good power of discrimination among bacteria. PMID:12243651
Human DNA ligase III recognizes DNA ends by dynamic switching between two DNA-bound states.
Cotner-Gohara, Elizabeth; Kim, In-Kwon; Hammel, Michal; Tainer, John A; Tomkinson, Alan E; Ellenberger, Tom
2010-07-27
Human DNA ligase III has essential functions in nuclear and mitochondrial DNA replication and repair and contains a PARP-like zinc finger (ZnF) that increases the extent of DNA nick joining and intermolecular DNA ligation, yet the bases for ligase III specificity and structural variation among human ligases are not understood. Here combined crystal structure and small-angle X-ray scattering results reveal dynamic switching between two nick-binding components of ligase III: the ZnF-DNA binding domain (DBD) forms a crescent-shaped surface used for DNA end recognition which switches to a ring formed by the nucleotidyl transferase (NTase) and OB-fold (OBD) domains for catalysis. Structural and mutational analyses indicate that high flexibility and distinct DNA binding domain features in ligase III assist both nick sensing and the transition from nick sensing by the ZnF to nick joining by the catalytic core. The collective results support a "jackknife model" in which the ZnF loads ligase III onto nicked DNA and conformational changes deliver DNA into the active site. This work has implications for the biological specificity of DNA ligases and functions of PARP-like zinc fingers.
Viviani, Vadim R; Scorsato, Valeria; Prado, Rogilene A; Pereira, Jose G C; Niwa, Kazuki; Ohmiya, Yoshihiro; Barbosa, João A R G
2010-08-01
Beetle luciferases evolved from AMP/CoA-ligases. However, it is unclear how the new luciferase activity evolved. In order to clarify this question, we compared the luminescence and catalytic properties of a recently cloned luciferase-like enzyme from Zophobas mealworm, an AMP/CoA-ligase displaying weak luminescence activity, with those of cloned luciferases from the three main families of luminescent beetles: Phrixthrix hirtus railroad worm; Pyrearinus termitilluminans click beetle and Photinus pyralis firefly. The catalytic constant of the mealworm enzyme was 2-4 orders of magnitude lower than that of beetle luciferases, but 3 orders of magnitude above the non-catalyzed chemiluminescence of luciferyl-adenylate in buffer. Studies with D- and L-luciferin and their adenylates show that the luminescence reaction of the luciferase-like enzyme and beetle luciferases are stereoselective for D-luciferin and its adenylate, and that the selectivity is determined mainly at the adenylation step. Modelling studies showed that the luciferin binding site cavity of this enzyme is smaller and more hydrophobic than that of beetle luciferases. Therefore Zophobas mealworm enzyme displays true luciferase activity, keeping the attributes of an ancient protoluciferase. These results suggest that stereoselectivity for D-luciferin may have been a key event for the origin of oxygenase/luciferase activity in AMP/CoA-ligases, and that efficient luciferase activity may have further evolved mainly by increasing the catalytic constant of the oxidative reaction and the quantum yield of bioluminescence.
Osakabe, Yuriko; Osakabe, Keishi; Chiang, Vincent L
2009-01-01
We characterized promoter activity of a phenylpropanoid biosynthetic gene encoding 4-coumarate Co-A ligase (4CL), Pta4Clalpha, from Pinus taeda. Histochemical- and quantitative assays of GUS expression in the vascular tissue were performed using transgenic tobacco plants expressing promoter-GUS reporters. Deletion analysis of the Pta4Clalpha promoter showed that the region -524 to -252, which has two AC elements, controls the high expression levels in ray-parenchyma cells of older tobacco stems. High activity level of the promoter domain of Pta4CLalpha was also detected in the xylem cells under bending stress. DNA-protein complexes were detected in the reactions of the Pta4CLalpha promoter fragments with the nuclear proteins of xylem of P. taeda. The AC elements in the Pta4CLalpha promoter appeared to have individual roles during xylem development that are activated in a coordinated manner in response to stress in transgenic tobacco.
Ubiquitin ligase Nedd4-2 modulates Kv1.3 current amplitude and ion channel protein targeting
Velez, Patricio; Schwartz, Austin B.; Iyer, Subashini R.; Warrington, Anthony
2016-01-01
Voltage-dependent potassium channels (Kv) go beyond the stabilization of the resting potential and regulate biochemical pathways, regulate intracellular signaling, and detect energy homeostasis. Because targeted deletion and pharmacological block of the Kv1.3 channel protein produce marked changes in metabolism, resistance to diet-induced obesity, and changes in olfactory structure and function, this investigation explored Nedd4-2-mediated ubiquitination and degradation to regulate Kv1.3 channel density. Heterologous coexpression of Nedd4-2 ligase and Kv1.3 in HEK 293 cells reduced Kv1.3 current density without modulation of kinetic properties as measured by patch-clamp electrophysiology. Modulation of current density was dependent on ligase activity and was lost through point mutation of cysteine 938 in the catalytic site of the ligase (Nedd4-2CS). Incorporation of adaptor protein Grb10 relieved Nedd4-2-induced current suppression as did application of the proteasome inhibitor Mg-132. SDS-PAGE and immunoprecipitation strategies demonstrated a channel/adaptor/ligase signalplex. Pixel immunodensity was reduced for Kv1.3 in the presence of Nedd4-2, which was eliminated upon additional incorporation of Grb10. We confirmed Nedd4-2/Grb10 coimmunoprecipitation and observed an increased immunodensity for Nedd4-2 in the presence of Kv1.3 plus Grb10, regardless of whether the catalytic site was active. Kv1.3/Nedd4-2 were reciprocally coimmunoprecipated, whereby mutation of the COOH-terminal, SH3-recognition (493–498), or ubiquitination sites on Kv1.3 (lysines 467, 476, 498) retained coimmunoprecipitation, while the latter prevented the reduction in channel density. A model is presented for which an atypical interaction outside the canonical PY motif may permit channel/ligase interaction to lead to protein degradation and reduced current density, which can involve Nedd4-2/Grb10 interactions to disrupt Kv1.3 loss of current density. PMID:27146988
USP19-Mediated Deubiquitination Facilitates the Stabilization of HRD1 Ubiquitin Ligase.
Harada, Kumi; Kato, Masako; Nakamura, Nobuhiro
2016-11-02
In the endoplasmic reticulum (ER), misfolded and unfolded proteins are eliminated by a process called ER-associated protein degradation (ERAD) in order to maintain cell homeostasis. In the ERAD pathway, several ER-localized E3 ubiquitin ligases target ERAD substrate proteins for ubiquitination and subsequent proteasomal degradation. However, little is known about how the functions of the ERAD ubiquitin ligases are regulated. Recently, USP19, an ER-anchored deubiquitinating enzyme (DUB), has been suggested to be involved in the regulation of ERAD. In this study, HRD1, an ERAD ubiquitin ligase, is shown to be a novel substrate for USP19. We demonstrate that USP19 rescues HRD1 from proteasomal degradation by deubiquitination of K48-linked ubiquitin chains. In addition, the altered expression of USP19 affects the steady-state levels of HRD1. These results suggest that USP19 regulates the stability of HRD1 and provide insight into the regulatory mechanism of the ERAD ubiquitin ligases.
Yang, S W; Becker, F F; Chan, J Y
1990-10-25
DNA ligases play obligatory roles during replication, repair, and recombination. Multiple forms of DNA ligase have been reported in mammalian cells including DNA ligase I, the high molecular mass species which functions during replication, and DNA ligase II, the low molecular mass species which is associated with repair. In addition, alterations in DNA ligase activities have been reported in acute lymphocytic leukemia cells, Bloom's syndrome cells, and cells undergoing differentiation and development. To better distinguish the biochemical and molecular properties of the various DNA ligases from human cells, we have developed a method of purifying multiple species of DNA ligase from HeLa cells by chromatography through DEAE-Bio-Gel, CM-Bio-Gel, hydroxylapatite, Sephacryl S-300, Mono P, and DNA-cellulose. DNA-cellulose chromatography of the partially purified enzymes resolved multiple species of DNA ligase after labeling the enzyme with [alpha-32P]ATP to form the ligase-[32P]AMP adduct. The early eluting enzyme activity (0.25 M NaCl) contained a major 67-kDa-labeled protein, while the late eluting activity (0.48 M NaCl) contained two major labeled proteins of 90 and 78 kDa. Neutralization experiments with antiligase I antibodies indicated that the early and late eluting activity peaks were DNA ligase II and I, respectively. The three major ligase-[32P]AMP polypeptides (90, 78, and 67 kDa) were subsequently purified to near homogeneity by elution from preparative sodium dodecyl sulfate-polyacrylamide gels. All three polypeptides retained DNA ligase activities after gel elution and renaturation. To further reveal the relationship between these enzymes, partial digestion by V8-protease was performed. All three purified polypeptides gave rise to a common 22-kDa-labeled fragment for their AMP-binding domains, indicating that the catalytic sites of ligase I and II are quite similar, if not identical. Similar findings were obtained from the two-dimensional gel
Expression and purification of E. coli BirA biotin ligase for in vitro biotinylation.
Li, Yifeng; Sousa, Rui
2012-03-01
The extremely tight binding between biotin and avidin or streptavidin makes labeling proteins with biotin a useful tool for many applications. BirA is the Escherichia coli biotin ligase that site-specifically biotinylates a lysine side chain within a 15-amino acid acceptor peptide (also known as Avi-tag). As a complementary approach to in vivo biotinylation of Avi-tag-bearing proteins, we developed a protocol for producing recombinant BirA ligase for in vitro biotinylation. The target protein was expressed as both thioredoxin and MBP fusions, and was released from the corresponding fusion by TEV protease. The liberated ligase was separated from its carrier using HisTrap HP column. We obtained 24.7 and 27.6 mg BirA ligase per liter of culture from thioredoxin and MBP fusion constructs, respectively. The recombinant enzyme was shown to be highly active in catalyzing in vitro biotinylation. The described protocol provides an effective means for making BirA ligase that can be used for biotinylation of different Avi-tag-bearing substrates. Copyright © 2011 Elsevier Inc. All rights reserved.
SUMOylation Regulates the Homologous to E6-AP Carboxyl Terminus (HECT) Ubiquitin Ligase Rsp5p*
Novoselova, Tatiana Vladislavovna; Rose, Ruth-Sarah; Marks, Helen Margaret; Sullivan, James Andrew
2013-01-01
The post-translational modifiers ubiquitin and small ubiquitin-related modifier (SUMO) regulate numerous critical signaling pathways and are key to controlling the cellular fate of proteins in eukaryotes. The attachment of ubiquitin and SUMO involves distinct, but related, machinery. However, it is now apparent that many substrates can be modified by both ubiquitin and SUMO and that some regulatory interaction takes place between the respective attachment machinery. Here, we demonstrate that the Saccharomyces cerevisiae ubiquitin ligase Rsp5p, a member of the highly conserved Nedd4 family of ubiquitin ligases, is SUMOylated in vivo. We further show that Rsp5p SUMOylation is mediated by the SUMO ligases Siz1p and Siz2p, members of the conserved family of PIAS SUMO ligases that are, in turn, substrates for Rsp5p-mediated ubiquitylation. Our experiments show that SUMOylated Rsp5p has reduced ubiquitin ligase activity, and similarly, ubiquitylated Siz1p demonstrates reduced SUMO ligase activity leading to respective changes in both ubiquitin-mediated sorting of the manganese transporter Smf1p and polySUMO chain formation. This reciprocal regulation of these highly conserved ligases represents an exciting and previously unidentified system of cross talk between the ubiquitin and SUMO systems. PMID:23443663
Williamson, Adele; Rothweiler, Ulli; Leiros, Hanna Kirsti Schrøder
2014-11-01
DNA ligases are a structurally diverse class of enzymes which share a common catalytic core and seal breaks in the phosphodiester backbone of double-stranded DNA via an adenylated intermediate. Here, the structure and activity of a recombinantly produced ATP-dependent DNA ligase from the bacterium Psychromonas sp. strain SP041 is described. This minimal-type ligase, like its close homologues, is able to ligate singly nicked double-stranded DNA with high efficiency and to join cohesive-ended and blunt-ended substrates to a more limited extent. The 1.65 Å resolution crystal structure of the enzyme-adenylate complex reveals no unstructured loops or segments, and suggests that this enzyme binds the DNA without requiring full encirclement of the DNA duplex. This is in contrast to previously characterized minimal DNA ligases from viruses, which use flexible loop regions for DNA interaction. The Psychromonas sp. enzyme is the first structure available for the minimal type of bacterial DNA ligases and is the smallest DNA ligase to be crystallized to date.
Functional characterization of EI24-induced autophagy in the degradation of RING-domain E3 ligases
Devkota, Sushil; Jeong, Hyobin; Kim, Yunmi; Ali, Muhammad; Roh, Jae-il; Hwang, Daehee; Lee, Han-Woong
2016-01-01
ABSTRACT Historically, the ubiquitin-proteasome system (UPS) and autophagy pathways were believed to be independent; however, recent data indicate that these pathways engage in crosstalk. To date, the players mediating this crosstalk have been elusive. Here, we show experimentally that EI24 (EI24, autophagy associated transmembrane protein), a key component of basal macroautophagy/autophagy, degrades 14 physiologically important E3 ligases with a RING (really interesting new gene) domain, whereas 5 other ligases were not degraded. Based on the degradation results, we built a statistical model that predicts the RING E3 ligases targeted by EI24 using partial least squares discriminant analysis. Of 381 RING E3 ligases examined computationally, our model predicted 161 EI24 targets. Those targets are primarily involved in transcription, proteolysis, cellular bioenergetics, and apoptosis and regulated by TP53 and MTOR signaling. Collectively, our work demonstrates that EI24 is an essential player in UPS-autophagy crosstalk via degradation of RING E3 ligases. These results indicate a paradigm shift regarding the fate of E3 ligases. PMID:27541728
Engineering peptide ligase specificity by proteomic identification of ligation sites.
Weeks, Amy M; Wells, James A
2018-01-01
Enzyme-catalyzed peptide ligation is a powerful tool for site-specific protein bioconjugation, but stringent enzyme-substrate specificity limits its utility. We developed an approach for comprehensively characterizing peptide ligase specificity for N termini using proteome-derived peptide libraries. We used this strategy to characterize the ligation efficiency for >25,000 enzyme-substrate pairs in the context of the engineered peptide ligase subtiligase and identified a family of 72 mutant subtiligases with activity toward N-terminal sequences that were previously recalcitrant to modification. We applied these mutants individually for site-specific bioconjugation of purified proteins, including antibodies, and in algorithmically selected combinations for sequencing of the cellular N terminome with reduced sequence bias. We also developed a web application to enable algorithmic selection of the most efficient subtiligase variant(s) for bioconjugation to user-defined sequences. Our methods provide a new toolbox of enzymes for site-specific protein modification and a general approach for rapidly defining and engineering peptide ligase specificity.
An SH2 domain-based tyrosine kinase assay using biotin ligase modified with a terbium(III) complex.
Sueda, Shinji; Shinboku, Yuki; Kusaba, Takeshi
2013-01-01
Src homology 2 (SH2) domains are modules of approximately 100 amino acids and are known to bind phosphotyrosine-containing sequences with high affinity and specificity. In the present work, we developed an SH2 domain-based assay for Src tyrosine kinase using a unique biotinylation reaction from archaeon Sulfolobus tokodaii. S. tokodaii biotinylation has a unique property that biotin protein ligase (BPL) forms a stable complex with its biotinylated substrate protein (BCCP). Here, an SH2 domain from lymphocyte-specific tyrosine kinase was genetically fused to a truncated BCCP, and the resulting fusion protein was labeled through biotinylation with BPL carrying multiple copies of a luminescent Tb(3+) complex. The labeled SH2 fusion proteins were employed to detect a phosphorylated peptide immobilized on the surface of the microtiter plate, where the phosphorylated peptide was produced by phosphorylation to the substrate peptide by Src tyrosine kinase. Our assay allows for a reliable determination of the activity of Src kinase lower than 10 pg/μL by a simple procedure.
Sleeve reaction chamber system
Northrup, M Allen [Berkeley, CA; Beeman, Barton V [San Mateo, CA; Benett, William J [Livermore, CA; Hadley, Dean R [Manteca, CA; Landre, Phoebe [Livermore, CA; Lehew, Stacy L [Livermore, CA; Krulevitch, Peter A [Pleasanton, CA
2009-08-25
A chemical reaction chamber system that combines devices such as doped polysilicon for heating, bulk silicon for convective cooling, and thermoelectric (TE) coolers to augment the heating and cooling rates of the reaction chamber or chambers. In addition the system includes non-silicon-based reaction chambers such as any high thermal conductivity material used in combination with a thermoelectric cooling mechanism (i.e., Peltier device). The heat contained in the thermally conductive part of the system can be used/reused to heat the device, thereby conserving energy and expediting the heating/cooling rates. The system combines a micromachined silicon reaction chamber, for example, with an additional module/device for augmented heating/cooling using the Peltier effect. This additional module is particularly useful in extreme environments (very hot or extremely cold) where augmented heating/cooling would be useful to speed up the thermal cycling rates. The chemical reaction chamber system has various applications for synthesis or processing of organic, inorganic, or biochemical reactions, including the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction.
Adenylylation of small RNA sequencing adapters using the TS2126 RNA ligase I.
Lama, Lodoe; Ryan, Kevin
2016-01-01
Many high-throughput small RNA next-generation sequencing protocols use 5' preadenylylated DNA oligonucleotide adapters during cDNA library preparation. Preadenylylation of the DNA adapter's 5' end frees from ATP-dependence the ligation of the adapter to RNA collections, thereby avoiding ATP-dependent side reactions. However, preadenylylation of the DNA adapters can be costly and difficult. The currently available method for chemical adenylylation of DNA adapters is inefficient and uses techniques not typically practiced in laboratories profiling cellular RNA expression. An alternative enzymatic method using a commercial RNA ligase was recently introduced, but this enzyme works best as a stoichiometric adenylylating reagent rather than a catalyst and can therefore prove costly when several variant adapters are needed or during scale-up or high-throughput adenylylation procedures. Here, we describe a simple, scalable, and highly efficient method for the 5' adenylylation of DNA oligonucleotides using the thermostable RNA ligase 1 from bacteriophage TS2126. Adapters with 3' blocking groups are adenylylated at >95% yield at catalytic enzyme-to-adapter ratios and need not be gel purified before ligation to RNA acceptors. Experimental conditions are also reported that enable DNA adapters with free 3' ends to be 5' adenylylated at >90% efficiency. © 2015 Lama and Ryan; Published by Cold Spring Harbor Laboratory Press for the RNA Society.
Structure of a HOIP/E2~ubiquitin complex reveals RBR E3 ligase mechanism and regulation
Lechtenberg, Bernhard C.; Rajput, Akhil; Sanishvili, Ruslan; Dobaczewska, Małgorzata K.; Ware, Carl F.; Mace, Peter D.; Riedl, Stefan J.
2015-01-01
Ubiquitination is a central process affecting all facets of cellular signaling and function1. A critical step in ubiquitination is the transfer of ubiquitin from an E2 ubiquitin-conjugating enzyme to a substrate or a growing ubiquitin chain, which is mediated by E3 ubiquitin ligases. RING-type E3 ligases typically facilitate the transfer of ubiquitin from the E2 directly to the substrate2,3. The RBR family of RING-type E3 ligases, however, breaks this paradigm by forming a covalent intermediate with ubiquitin similarly to HECT-type E3 ligases4–6. The RBR family includes Parkin4 and HOIP, the central catalytic factor of the linear ubiquitin chain assembly complex (LUBAC)7. While structural insights into the RBR E3 ligases Parkin and HHARI in their overall autoinhibited forms are available8–13, no structures exist of intact fully active RBR E3 ligases or any of their complexes. Thus, the RBR mechanism of action has remained largely enigmatic. Here we present the first structure of the fully active HOIP-RBR in its transfer complex with an E2~ubiquitin conjugate, which elucidates the intricate nature of RBR E3 ligases. The active HOIP-RBR adopts a conformation markedly different from that of autoinhibited RBRs. HOIP-RBR binds the E2~ubiquitin conjugate in an elongated fashion, with the E2 and E3 catalytic centers ideally aligned for ubiquitin transfer, which structurally both requires and enables a HECT-like mechanism. In addition, surprisingly, three distinct helix–IBR-fold motifs inherent to RBRs form ubiquitin-binding regions that engage the activated ubiquitin of the E2~Ub conjugate as well as an additional regulatory ubiquitin molecule. The features uncovered reveal critical states of the HOIP-RBR E3 ligase cycle, and comparison with Parkin and HHARI suggests a general mechanism for RBR E3 ligases. PMID:26789245
Streich, Frederick C; Ronchi, Virginia P; Connick, J Patrick; Haas, Arthur L
2013-03-22
Ligation of polyubiquitin chains to proteins is a fundamental post-translational modification, often resulting in targeted degradation of conjugated proteins. Attachment of polyubiquitin chains requires the activities of an E1 activating enzyme, an E2 carrier protein, and an E3 ligase. The mechanism by which polyubiquitin chains are formed remains largely speculative, especially for RING-based ligases. The tripartite motif (TRIM) superfamily of ligases functions in many cellular processes including innate immunity, cellular localization, development and differentiation, signaling, and cancer progression. The present results show that TRIM ligases catalyze polyubiquitin chain formation in the absence of substrate, the rates of which can be used as a functional readout of enzyme function. Initial rate studies under biochemically defined conditions show that TRIM32 and TRIM25 are specific for the Ubc5 family of E2-conjugating proteins and, along with TRIM5α, exhibit cooperative kinetics with respect to Ubc5 concentration, with submicromolar [S]0.5 and Hill coefficients of 3-5, suggesting they possess multiple binding sites for their cognate E2-ubiquitin thioester. Mutation studies reveal a second, non-canonical binding site encompassing the C-terminal Ubc5α-helix. Polyubiquitin chain formation requires TRIM subunit oligomerization through the conserved coiled-coil domain, but can be partially replaced by fusing the catalytic domain to GST to promote dimerization. Other results suggest that TRIM32 assembles polyubiquitin chains as a Ubc5-linked thioester intermediate. These results represent the first detailed mechanistic study of TRIM ligase activity and provide a functional context for oligomerization observed in the superfamily.
The ubiquitin ligase Cbl-b limits Pseudomonas aeruginosa exotoxin T-mediated virulence.
Balachandran, Priya; Dragone, Leonard; Garrity-Ryan, Lynne; Lemus, Armando; Weiss, Arthur; Engel, Joanne
2007-02-01
Pseudomonas aeruginosa, an important cause of opportunistic infections in humans, delivers bacterial cytotoxins by type III secretion directly into the host cell cytoplasm, resulting in disruption of host cell signaling and host innate immunity. However, little is known about the fate of the toxins themselves following injection into the host cytosol. Here, we show by both in vitro and in vivo studies that the host ubiquitin ligase Cbl-b interacts with the type III-secreted effector exotoxin T (ExoT) and plays a key role in vivo in limiting bacterial dissemination mediated by ExoT. We demonstrate that, following polyubiquitination, ExoT undergoes regulated proteasomal degradation in the host cell cytosol. ExoT interacts with the E3 ubiquitin ligase Cbl-b and Crk, the substrate for the ExoT ADP ribosyltransferase (ADPRT) domain. The efficiency of degradation is dependent upon the activity of the ADPRT domain. In mouse models of acute pneumonia and systemic infection, Cbl-b is specifically required to limit the dissemination of ExoT-producing bacteria whereas c-Cbl plays no detectable role. To the best of our knowledge, this represents the first identification of a mammalian gene product that is specifically required for in vivo resistance to disease mediated by a type III-secreted effector.
The ubiquitin ligase Cbl-b limits Pseudomonas aeruginosa exotoxin T–mediated virulence
Balachandran, Priya; Dragone, Leonard; Garrity-Ryan, Lynne; Lemus, Armando; Weiss, Arthur; Engel, Joanne
2007-01-01
Pseudomonas aeruginosa, an important cause of opportunistic infections in humans, delivers bacterial cytotoxins by type III secretion directly into the host cell cytoplasm, resulting in disruption of host cell signaling and host innate immunity. However, little is known about the fate of the toxins themselves following injection into the host cytosol. Here, we show by both in vitro and in vivo studies that the host ubiquitin ligase Cbl-b interacts with the type III–secreted effector exotoxin T (ExoT) and plays a key role in vivo in limiting bacterial dissemination mediated by ExoT. We demonstrate that, following polyubiquitination, ExoT undergoes regulated proteasomal degradation in the host cell cytosol. ExoT interacts with the E3 ubiquitin ligase Cbl-b and Crk, the substrate for the ExoT ADP ribosyltransferase (ADPRT) domain. The efficiency of degradation is dependent upon the activity of the ADPRT domain. In mouse models of acute pneumonia and systemic infection, Cbl-b is specifically required to limit the dissemination of ExoT-producing bacteria whereas c-Cbl plays no detectable role. To the best of our knowledge, this represents the first identification of a mammalian gene product that is specifically required for in vivo resistance to disease mediated by a type III–secreted effector. PMID:17235393
Rubel, Carrie E.; Schisler, Jonathan C.; Hamlett, Eric D.; DeKroon, Robert M.; Gautel, Mathias; Alzate, Oscar; Patterson, Cam
2013-01-01
The ubiquitin-proteasome system (UPS) plays a central role in maintaining protein homeostasis, emphasized by a myriad of diseases that are associated with altered UPS function such as cancer, muscle-wasting, and neurodegeneration. Protein ubiquitination plays a central role in both the promotion of proteasomal degradation as well as cellular signaling through regulation of the stability of transcription factors and other signaling molecules. Substrate specificity is a critical regulatory step of ubiquitination and is mediated by ubiquitin ligases. Recent studies implicate ubiquitin ligases in multiple models of cardiac diseases such as cardiac hypertrophy, atrophy, and ischemia/reperfusion injury, both in a cardioprotective and maladaptive role. Therefore, identifying physiological substrates of cardiac ubiquitin ligases provides both mechanistic insights into heart disease as well as possible therapeutic targets. Current methods identifying substrates for ubiquitin ligases rely heavily upon non-physiologic in vitro methods, impeding the unbiased discovery of physiological substrates in relevant model systems. Here we describe a novel method for identifying ubiquitin ligase substrates utilizing Tandem Ubiquitin Binding Entities (TUBE) technology, two-dimensional differential in gel electrophoresis (2-D DIGE), and mass spectrometry, validated by the identification of both known and novel physiological substrates of the ubiquitin ligase MuRF1 in primary cardiomyocytes. This method can be applied to any ubiquitin ligase, both in normal and disease model systems, in order to identify relevant physiological substrates under various biological conditions, opening the door to a clearer mechanistic understanding of ubiquitin ligase function and broadening their potential as therapeutic targets. PMID:23695782
Role of SKP1-CUL1-F-Box-Protein (SCF) E3 Ubiquitin Ligases in Skin Cancer
Xie, Chuan-Ming; Wei, Wenyi; Sun, Yi
2013-01-01
Many biological processes such as cell proliferation, differentiation, and cell death depend precisely on the timely synthesis and degradation of key regulatory proteins. While protein synthesis can be regulated at multiple levels, protein degradation is mainly controlled by the ubiquitin—proteasome system (UPS), which consists of two distinct steps: (1) ubiquitylation of targeted protein by E1 ubiquitin-activating enzyme, E2 ubiquitin-conjugating enzyme and E3 ubiquitin ligase, and (2) subsequent degradation by the 26S proteasome. Among all E3 ubiquitin ligases, the SCF (SKP1-CUL1-F-box protein) E3 ligases are the largest family and are responsible for the turnover of many key regulatory proteins. Aberrant regulation of SCF E3 ligases is associated with various human diseases, such as cancers, including skin cancer. In this review, we provide a comprehensive overview of all currently published data to define a promoting role of SCF E3 ligases in the development of skin cancer. The future directions in this area of research are also discussed with an ultimate goal to develop small molecule inhibitors of SCF E3 ligases as a novel approach for the treatment of human skin cancer. Furthermore, altered components or substrates of SCF E3 ligases may also be developed as the biomarkers for early diagnosis or predicting prognosis. PMID:23522382
Kumar, Atul; Chaugule, Viduth K; Condos, Tara E C; Barber, Kathryn R; Johnson, Clare; Toth, Rachel; Sundaramoorthy, Ramasubramanian; Knebel, Axel; Shaw, Gary S; Walden, Helen
2017-01-01
RING-BETWEENRING-RING (RBR) E3 ligases are a class of ubiquitin ligases distinct from RING or HECT E3 ligases. An important RBR is Parkin, mutations in which lead to early onset hereditary Parkinsonism. Parkin and other RBRs share a catalytic RBR module, but are usually autoinhibited and activated via distinct mechanisms. Recent insights into Parkin regulation predict large, unknown conformational changes during activation of Parkin. However, current data on active RBRs are in the absence of regulatory domains. Therefore, how individual RBRs are activated, and whether they share a common mechanism remains unclear. We now report the crystal structure of a human Parkin-phosphoubiquitin complex, which shows that phosphoubiquitin binding induces a movement in the IBR domain to reveal a cryptic ubiquitin binding site. Mutation of this site negatively impacts on Parkin’s activity. Furthermore, ubiquitin binding promotes cooperation between Parkin molecules, suggesting a role for interdomain association in RBR ligase mechanism. PMID:28414322
Hommatsu, Manami; Okahashi, Hisamitsu; Ohta, Keisuke; Tamai, Yusuke; Tsukagoshi, Kazuhiko; Hashimoto, Masahiko
2013-01-01
A polymerase chain reaction (PCR)/ligase detection reaction (LDR)/flow-through hybridization assay using chemiluminescence (CL) detection was developed for analyzing point mutations in gene fragments with high diagnostic value for colorectal cancers. A flow-through hybridization format using a capillary tube, in which probe DNA-immobilized magnetic beads were packed, provided accelerated hybridization kinetics of target DNA (i.e. LDR product) to the probe DNA. Simple fluid manipulations enabled both allele-specific hybridization and the removal of non-specifically bound DNA in the wash step. Furthermore, the use of CL detection greatly simplified the detection scheme, since CL does not require a light source for excitation of the fluorescent dye tags on the LDR products. Preliminary results demonstrated that this analytical system could detect both homozygous and heterozygous mutations, without the expensive instrumentation and cumbersome procedures required by conventional DNA microarray-based methods.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Day, D.J.; Barany, F.; Speiser, P.W.
Steroid 21-hydroxylase deficiency is the most common cause of congenital adrenal hyperplasia, an inherited inability to synthesize cortisol that occurs in 1 in 10,000-15,000 births. Affected females are born with ambiguous genitalia, a condition that can be ameliorated by administering dexamethasone to the mother for most of gestation. Prenatal diagnosis is required for accurate treatment of affected females as well as for genetic counseling purposes. Approximately 95% of mutations causing this disorder result from recombinations between the gene encoding the 21-hydroxylase enzyme (CYP21) and a linked, highly homologous pseudogene (CYP21P). Approximately 20% of these mutations are gene deletions, and themore » remainder are gene conversions that transfer any of nine deleterious mutations from the CYP21P pseudogene to CYP21. We describe a methodology for genetic diagnosis of 21-hydroxylase deficiency that utilizes gene-specific PCR amplification in conjunction with thermostable DNA ligase to discriminate single nucleotide variations in a multiplexed ligation detection assay. The assay has been designed to be used with either fluorescent or radioactive detection of ligation products by electrophoresis on denaturing acrylamide gels and is readily adaptable for use in other disease systems. 30 refs., 5 figs.« less
Bashiri, Ghader; Rehan, Aisyah M.; Sreebhavan, Sreevalsan; Baker, Heather M.; Baker, Edward N.; Squire, Christopher J.
2016-01-01
Cofactor F420 is an electron carrier with a major role in the oxidoreductive reactions of Mycobacterium tuberculosis, the causative agent of tuberculosis. A γ-glutamyl ligase catalyzes the final steps of the F420 biosynthesis pathway by successive additions of l-glutamate residues to F420-0, producing a poly-γ-glutamate tail. The enzyme responsible for this reaction in archaea (CofE) comprises a single domain and produces F420-2 as the major species. The homologous M. tuberculosis enzyme, FbiB, is a two-domain protein and produces F420 with predominantly 5–7 l-glutamate residues in the poly-γ-glutamate tail. The N-terminal domain of FbiB is homologous to CofE with an annotated γ-glutamyl ligase activity, whereas the C-terminal domain has sequence similarity to an FMN-dependent family of nitroreductase enzymes. Here we demonstrate that full-length FbiB adds multiple l-glutamate residues to F420-0 in vitro to produce F420-5 after 24 h; communication between the two domains is critical for full γ-glutamyl ligase activity. We also present crystal structures of the C-terminal domain of FbiB in apo-, F420-0-, and FMN-bound states, displaying distinct sites for F420-0 and FMN ligands that partially overlap. Finally, we discuss the features of a full-length structural model produced by small angle x-ray scattering and its implications for the role of N- and C-terminal domains in catalysis. PMID:26861878
Yang, Ying; Wu, Nandan; Tian, Sijia; Li, Fan; Hu, Huan; Chen, Pei; Cai, Xiaoxiao; Xu, Lijun; Zhang, Jing; Chen, Zhao; Ge, Jian; Yu, Keming; Zhuang, Jing
2016-11-17
Neurons display genomic fragility and show fragmented DNA in pathological degeneration. A failure to repair DNA breaks may result in cell death or apoptosis. Lithium protects retinal neurocytes following nutrient deprivation or partial nerve crush, but the underlying mechanisms are not well defined. Here we demonstrate that pretreatment with lithium protects retinal neurocytes from ischemia-induced damage and enhances light response in rat retina following ischemia-reperfusion injury. Moreover, we found that DNA nonhomologous end-joining (NHEJ) repair is implicated in this process because in ischemic retinal neurocytes, lithium significantly reduces the number of γ-H2AX foci (well-characterized markers of DNA double-strand breaks in situ) and increases the DNA ligase IV expression level. Furthermore, we also demonstrate that nuclear respiratory factor 1 (Nrf-1) and phosphorylated cyclic AMP-response element binding protein-1 (P-CREB1) bind to ligase IV promoter to cause upregulation of ligase IV in neurocytes. The ischemic upregulation of Nrf-1 and lithium-induced increase of P-CREB1 cooperate to promote transcription of ligase IV. Short hairpin RNAs against Nrf-1 and CREB1 could significantly inhibit the increase in promoter activity and expression of ligase IV observed in the control oligos following lithium treatment in retinal neurocytes. More importantly, ischemic stimulation triggers the expression of ligase IV. Taken together, our results thus reveal a novel mechanism that lithium offers neuroprotection from ischemia-induced damage by enhancing DNA NHEJ repair.
Yang, Ying; Wu, Nandan; Tian, Sijia; Li, Fan; Hu, Huan; Chen, Pei; Cai, Xiaoxiao; Xu, Lijun; Zhang, Jing; Chen, Zhao; Ge, Jian; Yu, Keming; Zhuang, Jing
2016-01-01
Neurons display genomic fragility and show fragmented DNA in pathological degeneration. A failure to repair DNA breaks may result in cell death or apoptosis. Lithium protects retinal neurocytes following nutrient deprivation or partial nerve crush, but the underlying mechanisms are not well defined. Here we demonstrate that pretreatment with lithium protects retinal neurocytes from ischemia-induced damage and enhances light response in rat retina following ischemia–reperfusion injury. Moreover, we found that DNA nonhomologous end-joining (NHEJ) repair is implicated in this process because in ischemic retinal neurocytes, lithium significantly reduces the number of γ-H2AX foci (well-characterized markers of DNA double-strand breaks in situ) and increases the DNA ligase IV expression level. Furthermore, we also demonstrate that nuclear respiratory factor 1 (Nrf-1) and phosphorylated cyclic AMP-response element binding protein-1 (P-CREB1) bind to ligase IV promoter to cause upregulation of ligase IV in neurocytes. The ischemic upregulation of Nrf-1 and lithium-induced increase of P-CREB1 cooperate to promote transcription of ligase IV. Short hairpin RNAs against Nrf-1 and CREB1 could significantly inhibit the increase in promoter activity and expression of ligase IV observed in the control oligos following lithium treatment in retinal neurocytes. More importantly, ischemic stimulation triggers the expression of ligase IV. Taken together, our results thus reveal a novel mechanism that lithium offers neuroprotection from ischemia-induced damage by enhancing DNA NHEJ repair. PMID:27853172
Calcium Activates Nedd4 E3 Ubiquitin Ligases by Releasing the C2 Domain-mediated Auto-inhibition*
Wang, Jian; Peng, Qisheng; Lin, Qiong; Childress, Chandra; Carey, David; Yang, Wannian
2010-01-01
Nedd4 E3 ligases are members of the HECT E3 ubiquitin ligase family and regulate ubiquitination-mediated protein degradation. In this report, we demonstrate that calcium releases the C2 domain-mediated auto-inhibition in both Nedd4-1 and Nedd4-2. Calcium disrupts binding of the C2 domain to the HECT domain. Consistent with this, calcium activates the E3 ubiquitin ligase activity of Nedd4. Elevation of intracellular calcium by ionomycin treatment, or activation of acetylcholine receptor or epidermal growth factor receptor by carbachol or epidermal growth factor stimulation induced activation of endogenous Nedd4 in vivo evaluated by assays of either Nedd4 E3 ligase activity or ubiquitination of Nedd4 substrate ENaC-β. The activation effect of calcium on Nedd4 E3 ligase activity was dramatically enhanced by a membrane-rich fraction, suggesting that calcium-mediated membrane translocation through the C2 domain might be an activation mechanism of Nedd4 in vivo. Our studies have revealed an activation mechanism of Nedd4 E3 ubiquitin ligases and established a connection of intracellular calcium signaling to regulation of protein ubiquitination. PMID:20172859
Silicon-based sleeve devices for chemical reactions
Northrup, M. Allen; Mariella, Jr., Raymond P.; Carrano, Anthony V.; Balch, Joseph W.
1996-01-01
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Silicon-based sleeve devices for chemical reactions
Northrup, M.A.; Mariella, R.P. Jr.; Carrano, A.V.; Balch, J.W.
1996-12-31
A silicon-based sleeve type chemical reaction chamber is described that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis. 32 figs.
Microfabricated sleeve devices for chemical reactions
Northrup, M. Allen
2003-01-01
A silicon-based sleeve type chemical reaction chamber that combines heaters, such as doped polysilicon for heating, and bulk silicon for convection cooling. The reaction chamber combines a critical ratio of silicon and non-silicon based materials to provide the thermal properties desired. For example, the chamber may combine a critical ratio of silicon and silicon nitride to the volume of material to be heated (e.g., a liquid) in order to provide uniform heating, yet low power requirements. The reaction chamber will also allow the introduction of a secondary tube (e.g., plastic) into the reaction sleeve that contains the reaction mixture thereby alleviating any potential materials incompatibility issues. The reaction chamber may be utilized in any chemical reaction system for synthesis or processing of organic, inorganic, or biochemical reactions, such as the polymerase chain reaction (PCR) and/or other DNA reactions, such as the ligase chain reaction, which are examples of a synthetic, thermal-cycling-based reaction. The reaction chamber may also be used in synthesis instruments, particularly those for DNA amplification and synthesis.
Park, Y. N.; Abe, K.; Li, H.; Hsuih, T.; Thung, S. N.; Zhang, D. Y.
1996-01-01
Reverse transcription polymerase chain reaction (RT-PCR) has been used to detect hepatitis C virus (HCV) sequences in liver tissue. However, RT-PCR has a variable detection sensitivity, especially on routinely processed formalin-fixed, paraffin-embedded (FFPE) specimens. RNA-RNA and RNA-protein cross-links formed during formalin fixation is the major limiting factor preventing reverse trans criptase from extending the primers. To overcome this problem, we applied the ligation-dependent PCR (LD-PCR) for the detection of HCV RNA in FFPE liver tissue. This method uses two capture probes for RNA isolation and two hemiprobes for the subsequent PCR. Despite cross-links, the capture probes and the hemiprobes are able to form hybrids with HCV RNAs released from the FFPE tissue. The hybrids are isolated through binding of the capture probes to paramagnetic beads. The hemiprobes are then ligated by a T4 DNA ligase to form a full probe that serves as a template for the Taq DNA polymerase. A total of 22 FFPE liver specimens, 21 with hepatocellular carcinoma (HCC) and 1 with biliary cirrhosis secondary to bile duct atresia were selected for this study, of which 13 patients were HCV seropositive and 9 seronegative. HCV RNA was detectable by ID-PCR from all 13 HCV-seropositive HCCs and from 5 of 8 HCV-seronegative HCCs but not from the HCV-seronegative liver with biliary atresia. By contrast, RT-PCR detected HCV sequences in only 5 of the HCV-sero-positive and in 1 of the HCV-seronegative HCCs. To resolve the discordance between the LD-PCR and RT-PCR results, RT-PCR was performed on frozen liver tissue of the discrepant specimens, which confirmed the LD-PCR positive results. In conclusion, LD-PCR is a more sensitive method than RT-PCR for the detection of HCV sequences in routinely processed liver tissues. A high rate of HCV infection (86%) is found in HCC specimens, indicating a previously underestimated role of HCV in HCC pathogenesis. Images Figure 2 PMID:8909238
Computational design of a red fluorophore ligase for site-specific protein labeling in living cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Daniel S.; Nivon, Lucas G.; Richter, Florian
In this study, chemical fluorophores offer tremendous size and photophysical advantages over fluorescent proteins but are much more challenging to target to specific cellular proteins. Here, we used Rosetta-based computation to design a fluorophore ligase that accepts the red dye resorufin, starting from Escherichia coli lipoic acid ligase. X-ray crystallography showed that the design closely matched the experimental structure. Resorufin ligase catalyzed the site-specific and covalent attachment of resorufin to various cellular proteins genetically fused to a 13-aa recognition peptide in multiple mammalian cell lines and in primary cultured neurons. We used resorufin ligase to perform superresolution imaging of themore » intermediate filament protein vimentin by stimulated emission depletion and electron microscopies. This work illustrates the power of Rosetta for major redesign of enzyme specificity and introduces a tool for minimally invasive, highly specific imaging of cellular proteins by both conventional and superresolution microscopies.« less
Computational design of a red fluorophore ligase for site-specific protein labeling in living cells
Liu, Daniel S.; Nivon, Lucas G.; Richter, Florian; ...
2014-10-13
In this study, chemical fluorophores offer tremendous size and photophysical advantages over fluorescent proteins but are much more challenging to target to specific cellular proteins. Here, we used Rosetta-based computation to design a fluorophore ligase that accepts the red dye resorufin, starting from Escherichia coli lipoic acid ligase. X-ray crystallography showed that the design closely matched the experimental structure. Resorufin ligase catalyzed the site-specific and covalent attachment of resorufin to various cellular proteins genetically fused to a 13-aa recognition peptide in multiple mammalian cell lines and in primary cultured neurons. We used resorufin ligase to perform superresolution imaging of themore » intermediate filament protein vimentin by stimulated emission depletion and electron microscopies. This work illustrates the power of Rosetta for major redesign of enzyme specificity and introduces a tool for minimally invasive, highly specific imaging of cellular proteins by both conventional and superresolution microscopies.« less
A conserved regulatory mechanism in bifunctional biotin protein ligases.
Wang, Jingheng; Beckett, Dorothy
2017-08-01
Class II bifunctional biotin protein ligases (BirA), which catalyze post-translational biotinylation and repress transcription initiation, are broadly distributed in eubacteria and archaea. However, it is unclear if these proteins all share the same molecular mechanism of transcription regulation. In Escherichia coli the corepressor biotinoyl-5'-AMP (bio-5'-AMP), which is also the intermediate in biotin transfer, promotes operator binding and resulting transcription repression by enhancing BirA dimerization. Like E. coli BirA (EcBirA), Staphylococcus aureus, and Bacillus subtilis BirA (Sa and BsBirA) repress transcription in vivo in a biotin-dependent manner. In this work, sedimentation equilibrium measurements were performed to investigate the molecular basis of this biotin-responsive transcription regulation. The results reveal that, as observed for EcBirA, Sa, and BsBirA dimerization reactions are significantly enhanced by bio-5'-AMP binding. Thus, the molecular mechanism of the Biotin Regulatory System is conserved in the biotin repressors from these three organisms. © 2017 The Protein Society.
Reconstitution of the Recombinant RanBP2 SUMO E3 Ligase Complex.
Ritterhoff, Tobias; Das, Hrishikesh; Hao, Yuqing; Sakin, Volkan; Flotho, Annette; Werner, Andreas; Melchior, Frauke
2016-01-01
One of the few proteins that have SUMO E3 ligase activity is the 358 kDa nucleoporin RanBP2 (Nup358). While small fragments of RanBP2 can stimulate SUMOylation in vitro, the physiologically relevant E3 ligase is a stable multi-subunit complex comprised of RanBP2, SUMOylated RanGAP1, and Ubc9. Here, we provide a detailed protocol to in vitro reconstitute the RanBP2 SUMO E3 ligase complex. With the exception of RanBP2, reconstitution involves untagged full-length proteins. We describe the bacterial expression and purification of all complex components, namely an 86 kDa His-tagged RanBP2 fragment, the SUMO E2-conjugating enzyme Ubc9, RanGAP1, and SUMO1, and we provide a protocol for quantitative SUMOylation of RanGAP1. Finally, we present details for the assembly and final purification of the catalytically active RanBP2/RanGAP1*SUMO1/Ubc9 complex.
The biology of Mur ligases as an antibacterial target.
Kouidmi, Imène; Levesque, Roger C; Paradis-Bleau, Catherine
2014-10-01
With antibiotic resistance mechanisms increasing in diversity and spreading among bacterial pathogens, the development of new classes of antibacterial agents against judiciously chosen targets is a high-priority task. The biochemical pathway for peptidoglycan biosynthesis is one of the best sources of antibacterial targets. Within this pathway are the Mur ligases, described in this review as highly suitable targets for the development of new classes of antibacterial agents. The amide ligases MurC, MurD, MurE and MurF function with the same catalytic mechanism and share conserved amino acid regions and structural features that can conceivably be exploited for the design of inhibitors that simultaneously target more than one enzyme. This would provide multi-target antibacterial weapons with minimized likelihood of target-mediated resistance development. © 2014 John Wiley & Sons Ltd.
Xu, Gaolian; You, Qimin; Pickerill, Sam; Zhong, Huayan; Wang, Hongying; Shi, Jian; Luo, Ying; You, Paul; Kong, Huimin; Lu, Fengmin; Hu, Lin
2010-07-01
Chronic hepatitis B virus (CHBV) infection causes cirrhosis and hepatocellular carcinoma. Lamivudine (LAM) has been successfully used to treat CHBV infections but prolonged use leads to the emergence of drug-resistant variants. This is primarily linked to a mutation in the tyrosine-methionine-aspartate-aspartate (YMDD) motif of the HBV polymerase gene at position 204. Rapid diagnosis of drug-resistant HBV is necessary for a prompt treatment response. Common diagnostic methods such as sequencing and restriction fragment length polymorphism (RFLP) analysis lack sensitivity and require significant processing. The aim of this study was to demonstrate the usefulness of a novel diagnostic method that combines polymerase chain reaction (PCR), ligase detection reaction (LDR) and a nucleic acid detection strip (NADS) in detecting site-specific mutations related to HBV LAM resistance. We compared this method (PLNA) to direct sequencing and RFLP analysis in 50 clinical samples from HBV infected patients. There was 90% concordance between all three results. PLNA detected more samples containing mutant variants than both sequencing and RFLP analysis and was more sensitive in detecting mixed variant populations. Plasmid standards indicated that the sensitivity of PLNA is at or below 3,000 copies per ml and that it can detect a minor variant at 5% of the total viral population. This warrants its further development and suggests that the PLNA method could be a useful tool in detecting LAM resistance. (c) 2010 Wiley-Liss, Inc.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lu, Yong-Zhi; Sheng, Yu; Li, Lan-Fen
2007-09-01
A potential target for antibiotic drug design, d-alanine-d-alanine ligase from S. mutans, was expressed in E. coli, purified and crystallized. Diffraction data were collected to 2.4 Å resolution. d-Alanine-d-alanine ligase is encoded by the gene ddl (SMU-599) in Streptococcus mutans. This ligase plays a very important role in cell-wall biosynthesis and may be a potential target for drug design. To study the structure and function of this ligase, the gene ddl was amplified from S. mutans genomic DNA and cloned into the expression vector pET28a. The protein was expressed in soluble form in Escherichia coli strain BL21 (DE3). Homogeneous proteinmore » was obtained using a two-step procedure consisting of Ni{sup 2+}-chelating and size-exclusion chromatography. Purified protein was crystallized and the cube-shaped crystal diffracted to 2.4 Å. The crystal belongs to space group P3{sub 1}21 or P3{sub 2}21, with unit-cell parameters a = b = 79.50, c = 108.97 Å. There is one molecule per asymmetric unit.« less
Bhattarai, Hitesh; Gupta, Richa
2014-01-01
Nonhomologous end joining (NHEJ) is a recently described bacterial DNA double-strand break (DSB) repair pathway that has been best characterized for mycobacteria. NHEJ can religate transformed linear plasmids, repair ionizing radiation (IR)-induced DSBs in nonreplicating cells, and seal I-SceI-induced chromosomal DSBs. The core components of the mycobacterial NHEJ machinery are the DNA end binding protein Ku and the polyfunctional DNA ligase LigD. LigD has three autonomous enzymatic modules: ATP-dependent DNA ligase (LIG), DNA/RNA polymerase (POL), and 3′ phosphoesterase (PE). Although genetic ablation of ku or ligD abolishes NHEJ and sensitizes nonreplicating cells to ionizing radiation, selective ablation of the ligase activity of LigD in vivo only mildly impairs NHEJ of linearized plasmids, indicating that an additional DNA ligase can support NHEJ. Additionally, the in vivo role of the POL and PE domains in NHEJ is unclear. Here we define a LigD ligase-independent NHEJ pathway in Mycobacterium smegmatis that requires the ATP-dependent DNA ligase LigC1 and the POL domain of LigD. Mycobacterium tuberculosis LigC can also support this backup NHEJ pathway. We also demonstrate that, although dispensable for efficient plasmid NHEJ, the activities of the POL and PE domains are required for repair of IR-induced DSBs in nonreplicating cells. These findings define the genetic requirements for a LigD-independent NHEJ pathway in mycobacteria and demonstrate that all enzymatic functions of the LigD protein participate in NHEJ in vivo. PMID:24957619
Invasive reaction assisted strand-displacement signal amplification for sensitive DNA detection.
Zou, Bingjie; Song, Qinxin; Wang, Jianping; Liu, Yunlong; Zhou, Guohua
2014-11-18
A novel DNA detection assay was proposed by invasive reaction coupled with molecular beacon assisted strand-displacement signal amplification (IRASA). Target DNAs are firstly hybridized to two probes to initiate invasive reaction to produce amplified flaps. Then these flaps are further amplified by strand-displacement signal amplification. The detection limit was around 0.2 pM.
Mota, Roberto; Rodríguez, Jessica E; Bonetto, Andrea; O’Connell, Thomas M; Asher, Scott A; Parry, Traci L; Lockyer, Pamela; McCudden, Christopher R; Couch, Marion E; Willis, Monte S
2017-01-01
Cancer cachexia is a severe wasting syndrome characterized by the progressive loss of lean body mass and systemic inflammation. Up to 80% of cancer patients experience cachexia, with 20-30% of cancer-related deaths directly linked to cachexia. Despite efforts to identify early cachexia and cancer relapse, clinically useful markers are lacking. Recently, we identified the role of muscle-specific ubiquitin ligases Atrogin-1 (MAFbx, FBXO32) and Muscle Ring Finger-1 in the pathogenesis of cardiac atrophy and hypertrophy. We hypothesized that during cachexia, the Atrogin-1 and MuRF1 ubiquitin ligases are released from muscle and migrate to the circulation where they could be detected and serve as a cachexia biomarker. To test this, we induced cachexia in mice using the C26 adenocarcinoma cells or vehicle (control). Body weight, tumor volume, and food consumption were measured from inoculation until ~day 14 to document cachexia. Western blot analysis of serum identified the presence of Atrogin-1 and MuRF1 with unique post-translational modifications consistent with mono- and poly- ubiquitination of Atrogin-1 and MuRF1 found only in cachectic serum. These findings suggest that both increased Atrogin-1 and the presence of unique post-translational modifications may serve as a surrogate marker specific for cachexia. PMID:28979816
The E3 Ligase CHIP: Insights into Its Structure and Regulation
Paul, Indranil; Ghosh, Mrinal K.
2014-01-01
The carboxy-terminus of Hsc70 interacting protein (CHIP) is a cochaperone E3 ligase containing three tandem repeats of tetratricopeptide (TPR) motifs and a C-terminal U-box domain separated by a charged coiled-coil region. CHIP is known to function as a central quality control E3 ligase and regulates several proteins involved in a myriad of physiological and pathological processes. Recent studies have highlighted varied regulatory mechanisms operating on the activity of CHIP which is crucial for cellular homeostasis. In this review article, we give a concise account of our current knowledge on the biochemistry and regulation of CHIP. PMID:24868554
Ndung'u, Thumbi
2011-01-01
Tripartite motif-containing (TRIM) E3 ligases are a recently identified family of proteins with potent antiviral activity in mammalian cells. The prototype TRIM E3 ligase, TRIM5α was initially identified as a species-specific antiviral restriction factor but subsequent studies suggest some antiviral activity by several TRIM E3 ligases in human cells. However, the mechanisms of antiviral activity by these proteins and their transcriptional, translational and post-translational regulation are poorly understood. Furthermore, the contribution of TRIM E3 ligases to relative resistance or viral control in vivo is largely unknown. Emerging data from our laboratory and other groups suggests that these proteins may have antiviral activity in vivo and contribute to HIV pathogenesis. Considering the significant difficulties so far encountered in developing an effective HIV vaccine and with the use of antiretroviral therapies, it will be important to further investigate the potential of TRIM E3 ligases as novel prophylactics or therapies.
Aoyama, Shoki; Terada, Saki; Sanagi, Miho; Hasegawa, Yoko; Lu, Yu; Morita, Yoshie; Chiba, Yukako; Sato, Takeo; Yamaguchi, Junji
2017-09-09
Ubiquitin ligases play important roles in regulating various cellular processes by modulating the protein function of specific ubiquitination targets. The Arabidopsis Tóxicos en Levadura (ATL) family is a group of plant-specific RING-type ubiquitin ligases that localize to membranes via their N-terminal transmembrane-like domains. To date, 91 ATL isoforms have been identified in the Arabidopsis genome, with several ATLs reported to be involved in regulating plant responses to environmental stresses. However, the functions of most ATLs remain unknown. This study, involving transcriptome database analysis, identifies ATL15 as a sugar responsive ATL gene in Arabidopsis. ATL15 expression was rapidly down-regulated in the presence of sugar. The ATL15 protein showed ubiquitin ligase activity in vitro and localized to plasma membrane and endomembrane compartments. Further genetic analyses demonstrated that the atl15 knockout mutants are insensitive to high glucose concentrations, whereas ATL15 overexpression depresses plant growth. In addition, endogenous glucose and starch amounts were reciprocally affected in the atl15 knockout mutants and the ATL15 overexpressors. These results suggest that ATL15 protein plays a significant role as a membrane-localized ubiquitin ligase that regulates sugar-responsive plant growth in Arabidopsis. Copyright © 2017 Elsevier Inc. All rights reserved.
Ubiquitin ligase activity of TFIIH and the transcriptional response to DNA damage.
Takagi, Yuichiro; Masuda, Claudio A; Chang, Wei-Hau; Komori, Hirofumi; Wang, Dong; Hunter, Tony; Joazeiro, Claudio A P; Kornberg, Roger D
2005-04-15
Core transcription factor (TF) IIH purified from yeast possesses an E3 ubiquitin (Ub) ligase activity, which resides, at least in part, in a RING finger (RNF) domain of the Ssl1 subunit. Yeast strains mutated in the Ssl1 RNF domain are sensitive to ultraviolet (UV) light and to methyl methanesulfonate (MMS). This increased sensitivity to DNA-damaging agents does not reflect a deficiency in nucleotide excision repair. Rather, it correlates with reduced transcriptional induction of genes involved in DNA repair, suggesting that the E3 Ub ligase activity of TFIIH mediates the transcriptional response to DNA damage.
Causality Patterns for Detecting Adverse Drug Reactions From Social Media: Text Mining Approach.
Bollegala, Danushka; Maskell, Simon; Sloane, Richard; Hajne, Joanna; Pirmohamed, Munir
2018-05-09
Detecting adverse drug reactions (ADRs) is an important task that has direct implications for the use of that drug. If we can detect previously unknown ADRs as quickly as possible, then this information can be provided to the regulators, pharmaceutical companies, and health care organizations, thereby potentially reducing drug-related morbidity and saving lives of many patients. A promising approach for detecting ADRs is to use social media platforms such as Twitter and Facebook. A high level of correlation between a drug name and an event may be an indication of a potential adverse reaction associated with that drug. Although numerous association measures have been proposed by the signal detection community for identifying ADRs, these measures are limited in that they detect correlations but often ignore causality. This study aimed to propose a causality measure that can detect an adverse reaction that is caused by a drug rather than merely being a correlated signal. To the best of our knowledge, this was the first causality-sensitive approach for detecting ADRs from social media. Specifically, the relationship between a drug and an event was represented using a set of automatically extracted lexical patterns. We then learned the weights for the extracted lexical patterns that indicate their reliability for expressing an adverse reaction of a given drug. Our proposed method obtains an ADR detection accuracy of 74% on a large-scale manually annotated dataset of tweets, covering a standard set of drugs and adverse reactions. By using lexical patterns, we can accurately detect the causality between drugs and adverse reaction-related events. ©Danushka Bollegala, Simon Maskell, Richard Sloane, Joanna Hajne, Munir Pirmohamed. Originally published in JMIR Public Health and Surveillance (http://publichealth.jmir.org), 09.05.2018.
Auto-ubiquitination of Mdm2 Enhances Its Substrate Ubiquitin Ligase Activity*
Ranaweera, Ruchira S.; Yang, Xiaolu
2013-01-01
The RING domain E3 ubiquitin ligase Mdm2 is the master regulator of the tumor suppressor p53. It targets p53 for proteasomal degradation, restraining the potent activity of p53 and enabling cell survival and proliferation. Like most E3 ligases, Mdm2 can also ubiquitinate itself. How Mdm2 auto-ubiquitination may influence its substrate ubiquitin ligase activity is undefined. Here we show that auto-ubiquitination of Mdm2 is an activating event. Mdm2 that has been conjugated to polyubiquitin chains, but not to single ubiquitins, exhibits substantially enhanced activity to polyubiquitinate p53. Mechanistically, auto-ubiquitination of Mdm2 facilitates the recruitment of the E2 ubiquitin-conjugating enzyme. This occurs through noncovalent interactions between the ubiquitin chains on Mdm2 and the ubiquitin binding domain on E2s. Mutations that diminish the noncovalent interactions render auto-ubiquitination unable to stimulate Mdm2 substrate E3 activity. These results suggest a model in which polyubiquitin chains on an E3 increase the local concentration of E2 enzymes and permit the processivity of substrate ubiquitination. They also support the notion that autocatalysis may be a prevalent mode for turning on the activity of latent enzymes. PMID:23671280
Structural and Functional Studies of Fatty Acyl Adenylate Ligases from E. coli and L. pneumophila
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Z.; Swaminathan, S.; Zhou, R.
2011-02-18
Fatty acyl-AMP ligase (FAAL) is a new member of a family of adenylate-forming enzymes that were recently discovered in Mycobacterium tuberculosis. They are similar in sequence to fatty acyl-coenzyme A (CoA) ligases (FACLs). However, while FACLs perform a two-step catalytic reaction, AMP ligation followed by CoA ligation using ATP and CoA as cofactors, FAALs produce only the acyl adenylate and are unable to perform the second step. We report X-ray crystal structures of full-length FAAL from Escherichia coli (EcFAAL) and FAAL from Legionella pneumophila (LpFAAL) bound to acyl adenylate, determined at resolution limits of 3.0 and 1.85 {angstrom}, respectively. Themore » structures share a larger N-terminal domain and a smaller C-terminal domain, which together resemble the previously determined structures of FAAL and FACL proteins. Our two structures occur in quite different conformations. EcFAAL adopts the adenylate-forming conformation typical of FACLs, whereas LpFAAL exhibits a unique intermediate conformation. Both EcFAAL and LpFAAL have insertion motifs that distinguish them from the FACLs. Structures of EcFAAL and LpFAAL reveal detailed interactions between this insertion motif and the interdomain hinge region and with the C-terminal domain. We suggest that the insertion motifs support sufficient interdomain motions to allow substrate binding and product release during acyl adenylate formation, but they preclude CoA binding, thereby preventing CoA ligation.« less
Structural and Functional Studies of Fatty Acyl Adenylate Ligases from E. coli and L. pneumophila
DOE Office of Scientific and Technical Information (OSTI.GOV)
Z Zhang; R Zhou; J Sauder
2011-12-31
Fatty acyl-AMP ligase (FAAL) is a new member of a family of adenylate-forming enzymes that were recently discovered in Mycobacterium tuberculosis. They are similar in sequence to fatty acyl-coenzyme A (CoA) ligases (FACLs). However, while FACLs perform a two-step catalytic reaction, AMP ligation followed by CoA ligation using ATP and CoA as cofactors, FAALs produce only the acyl adenylate and are unable to perform the second step. We report X-ray crystal structures of full-length FAAL from Escherichia coli (EcFAAL) and FAAL from Legionella pneumophila (LpFAAL) bound to acyl adenylate, determined at resolution limits of 3.0 and 1.85 {angstrom}, respectively. Themore » structures share a larger N-terminal domain and a smaller C-terminal domain, which together resemble the previously determined structures of FAAL and FACL proteins. Our two structures occur in quite different conformations. EcFAAL adopts the adenylate-forming conformation typical of FACLs, whereas LpFAAL exhibits a unique intermediate conformation. Both EcFAAL and LpFAAL have insertion motifs that distinguish them from the FACLs. Structures of EcFAAL and LpFAAL reveal detailed interactions between this insertion motif and the interdomain hinge region and with the C-terminal domain. We suggest that the insertion motifs support sufficient interdomain motions to allow substrate binding and product release during acyl adenylate formation, but they preclude CoA binding, thereby preventing CoA ligation.« less
NASA Astrophysics Data System (ADS)
Lavrentyev, A. A.; Gabrelian, B. V.; Vu, V. T.; Ananchenko, L. N.; Isaenko, L. I.; Yelisseyev, A. P.; Khyzhun, O. Y.
2017-04-01
We report on measurements of X-ray photoelectron (XP) spectra for pristine and Ar+ ion-irradiated surfaces of LiGaSe2 single crystal grown by Bridgman-Stockbarger method. Electronic structure of the LiGaSe2 compound is studied from a theoretical and experimental viewpoint. In particular, total and partial densities of states of LiGaSe2 are investigated by density functional theory (DFT) calculations employing the augmented plane wave + local orbitals (APW + lo) method and they are verified by data of X-ray spectroscopy measurements. The DFT calculations indicate that the main contributors to the valence band of LiGaSe2 are the Se 4p states, which contribute mainly at the top and in the upper portion of the valence band, with also essential contributions of these states in the lower portion of the band. Other substantial contributions to the valence band of LiGaSe2 emerge from the Ga 4s and Ga 4p states contributing mainly at the lower ant upper portions of the valence band, respectively. With respect to the conduction band, the calculations indicate that its bottom is composed mainly from contributions of the unoccupied Ga s and Se p states. The present calculations are confirmed experimentally when comparing the XP valence-band spectrum of the LiGaS2 single crystal on a common energy scale with the X-ray emission bands representing the energy distribution of the Ga 4p and Se 4p states. Measurements of the fundamental absorption edges at room temperature reveal that bandgap value, Eg, of LiGaSe2 is equal to 3.47 eV and the Eg value increases up to 3.66 eV when decreasing temperature to 80 K. The main optical characteristics of the LiGaSe2 compound are clarified by the DFT calculations.
Calì, Francesco; Ragalmuto, Alda; Chiavetta, Valeria; Calabrese, Giuseppe; Fichera, Marco; Vinci, Mirella; Ruggeri, Giuseppa; Schinocca, Pietro; Sturnio, Maurizio; Romano, Salvatore; Elia, Maurizio
2010-01-01
Angelman syndrome (AS) is a severe neurobehavioural disorder caused by failure of expression of the maternal copy of the imprinted domain located on 15q11-q13. There are different mechanisms leading to AS: maternal microdeletion, uniparental disomy, defects in a putative imprinting centre, mutations of the E3 ubiquitin protein ligase (UBE3A) gene. However, some of suspected cases of AS are still scored negative to all the latter mutations. Recently, it has been shown that a proportion of negative cases bear large deletions overlapping one or more exons of the UBE3A gene. These deletions are difficult to detect by conventional gene-scanning methods due to the masking effect by the non-deleted allele. In this study, we have used for the first time multiplex ligation-dependent probe amplification (MLPA) and comparative multiplex dosage analysis (CMDA) to search for large deletions affecting the UBE3A gene. Using this approach, we identified a novel causative deletion involving exon 8 in an affected sibling. Based on our results, we propose the use of MLPA as a fast, accurate and inexpensive test to detect large deletions in the UBE3A gene in a small but significant percentage of AS patients. PMID:21072004
Binding of Nickel to Testicular Glutamate–Ammonia Ligase Inhibits Its Enzymatic Activity
SUN, YINGBIAO; OU, YOUNG; CHENG, MIN; RUAN, YIBING; VAN DER HOORN, FRANS A.
2016-01-01
SUMMARY Exposure to nickel has been shown to cause damage to the testis in several animal models. It is not known if the testis expresses protein(s) that can bind nickel. To test this, we used a nickel-binding assay to isolate testicular nickel-binding proteins. We identified glutamate–ammonia ligase (GLUL) as a prominent nickel-binding protein by mass spectrometry. Protein analysis and reverse transcriptase polymerase chain reaction showed that GLUL is expressed in the testis, predominantly in interstitial cells. We determined that GLUL has a higher affinity for nickel than for its regular co-factor manganese. We produced an enzymatically active, recombinant GLUL protein. Upon binding, nickel interferes with the manganese-catalyzed enzymatic activity of recombinant GLUL protein. We also determined that GLUL activity in testes of animals exposed to nickel sulfate is reduced. Our results identify testicular GLUL as the first testicular protein shown to be affected by nickel exposure. PMID:21254280
Ube2w and ataxin-3 coordinately regulate the ubiquitin ligase CHIP
Scaglione, K. Matthew; Zavodszky, Eszter; Todi, Sokol V.; Patury, Srikanth; Xu, Ping; Rodríguez-Lebrón, Edgardo; Fischer, Svetlana; Konen, John; Djarmati, Ana; Peng, Junmin; Gestwicki, Jason E.; Paulson, Henry L.
2011-01-01
Summary The mechanisms by which ubiquitin ligases are regulated remain poorly understood. Here we describe a series of molecular events that coordinately regulate CHIP, a neuroprotective E3 implicated in protein quality control. Through their opposing activities, the initiator E2, Ube2w, and the specialized deubiquitinating enzyme (DUB), ataxin-3, participate in initiating, regulating and terminating the CHIP ubiquitination cycle. Monoubiquitination of CHIP by Ube2w stabilizes the interaction between CHIP and ataxin-3, which through its DUB activity limits the length of chains attached to CHIP substrates. Upon completion of substrate ubiquitination ataxin-3 deubiquitinates CHIP, effectively terminating the reaction. Our results suggest that functional pairing of E3s with ataxin-3 or similar DUBs represents an important point of regulation in ubiquitin-dependent protein quality control. In addition, the results shed light on disease pathogenesis in SCA3, a neurodegenerative disorder caused by polyglutamine expansion in ataxin-3. PMID:21855799
Ketosugbo, Kwami F.; Bushnell, Henry L.
2017-01-01
Ubiquitination is a crucial post-translational modification that can target proteins for degradation. The E3 ubiquitin ligases are responsible for recognizing substrate proteins for ubiquitination, hence providing specificity to the process of protein degradation. Here, we describe a genetic modifier screen that identified E3 ligases that modified the rough-eye phenotype generated by expression of cindrRNAi transgenes during Drosophila eye development. In total, we identified 36 E3 ligases, as well as 4 Cullins, that modified the mild cindrRNA mis-patterning phenotype. This indicates possible roles for these E3s/Cullins in processes that require Cindr function, including cytoskeletal regulation, cell adhesion, cell signaling and cell survival. Three E3 ligases identified in our screen had previously been linked to regulating JNK signaling. PMID:29117266
Mukherjee, J J; Dekker, E E
1987-10-25
Starting with 100 g (wet weight) of a mutant of Escherichia coli K-12 forced to grow on L-threonine as sole carbon source, we developed a 6-step procedure that provides 30-40 mg of homogeneous 2-amino-3-ketobutyrate CoA ligase (also called aminoacetone synthetase or synthase). This ligase, which catalyzes the cleavage/condensation reaction between 2-amino-3-ketobutyrate (the presumed product of the L-threonine dehydrogenase-catalyzed reaction) and glycine + acetyl-CoA, has an apparent molecular weight approximately equal to 85,000 and consists of two identical (or nearly identical) subunits with Mr = 42,000. Computer analysis of amino acid composition data, which gives the best fit nearest integer ratio for each residue, indicates a total of 387 amino acids/subunit with a calculated Mr = 42,093. Stepwise Edman degradation provided the N-terminal sequence of the first 21 amino acids. It is a pyridoxal phosphate-dependent enzyme since (a) several carbonyl reagents caused greater than 90% loss of activity, (b) dialysis against buffer containing hydroxylamine resulted in 89% loss of activity coincident with an 86% decrease in absorptivity at 428 nm, (c) incubation of the apoenzyme with 20 microM pyridoxal phosphate showed a parallel recovery (greater than 90%) of activity and 428-nm absorptivity, and (d) reduction of the holoenzyme with NaBH4 resulted in complete inactivation, disappearance of a new absorption maximum at 333 nm. Strict specificity for glycine is shown but acetyl-CoA (100%), n-propionyl-CoA (127%), or n-butyryl-CoA (16%) is utilized in the condensation reaction. Apparent Km values for acetyl-CoA, n-propionyl-CoA, and glycine are 59 microM, 80 microM, and 12 mM, respectively; the pH optimum = 7.5. Added divalent metal ions or sulfhydryl compounds inhibited catalysis of the condensation reaction.
Patin, Delphine; Bostock, Julieanne; Chopra, Ian; Mengin-Lecreulx, Dominique; Blanot, Didier
2012-06-01
Chlamydiaceae are obligate intracellular bacteria that do not synthesise detectable peptidoglycan although they possess an almost complete arsenal of genes encoding peptidoglycan biosynthetic activities. In this paper, the murF gene from Chlamydia trachomatis was shown to be capable of complementing a conditional Escherichia coli mutant impaired in UDP-MurNAc-tripeptide:D-Ala-D-Ala ligase activity. Recombinant MurF from C. trachomatis was overproduced and purified from E. coli. It exhibited ATP-dependent UDP-MurNAc-X-γ-D-Glu-meso-A(2)pm:D-Ala-D-Ala ligase activity in vitro. No significant difference of kinetic parameters was seen when X was L-Ala, L-Ser or Gly. The L-Lys-containing UDP-MurNAc-tripeptide was a poorer substrate as compared to the meso-A(2)pm-containing one. Based on the respective substrate specificities of the chlamydial MurC, MurE, MurF and Ddl enzymes, a sequence L-Ala/L-Ser/Gly-γ-D-Glu-meso-A(2)pm-D-Ala-D-Ala is expected for the chlamydial pentapeptide stem, with Gly at position 1 being less likely.
Jiang, Zheng-Yu; Xu, Li-Li; Lu, Meng-Chen; Pan, Yang; Huang, Hao-Ze; Zhang, Xiao-Jin; Sun, Hao-Peng; You, Qi-Dong
2014-12-01
E3 ubiquitin ligases are attractive drug targets due to their specificity to the ubiquitin machinery. However, the development of E3 ligase inhibitors has proven challenging for the fact that they must disrupt protein-protein interactions (PPIs). The E3 ligase involved in interactome provide new hope for the discovery of the E3 ligase inhibitors. These currently known natural binding partners of the E3 ligase can benefit the discovery of other unknown substrates and also the E3 ligase inhibitors. Herein, we present a novel strategy that using multiple substrates to elucidate the molecular recognition mechanism of E3 ubiquitin ligase. Molecular dynamics simulation, molecular mechanics-generalized born surface area (MM-GBSA) binding energy calculation and energy decomposition scheme were incorporated to evaluate the quantitative contributions of sub-pocket and per-residue to binding. In this case, Kelch-like ECH-associated protein-1 (Keap1), a substrate adaptor component of the Cullin-RING ubiquitin ligases complex, is applied for the investigation of how it recognize its substrates, especially Nrf2, a master regulator of the antioxidant response. By analyzing multiple substrates binding determinants, we found that both the polar sub-pockets (P1 and P2) and the nonpolar sub-pockets (P4 and P5) of Keap1 can make remarkable contributions to intermolecular interactions. This finding stresses the requirement for substrates to interact with the polar and nonpolar sub-pockets simultaneously. The results discussed in this paper not only show the binding determinants of the Keap1 substrates but also provide valuable implications for both Keap1 substrate discovery and PPI inhibitor design.
NASA Astrophysics Data System (ADS)
Jiang, Zheng-Yu; Xu, Li-Li; Lu, Meng-Chen; Pan, Yang; Huang, Hao-Ze; Zhang, Xiao-Jin; Sun, Hao-Peng; You, Qi-Dong
2014-12-01
E3 ubiquitin ligases are attractive drug targets due to their specificity to the ubiquitin machinery. However, the development of E3 ligase inhibitors has proven challenging for the fact that they must disrupt protein-protein interactions (PPIs). The E3 ligase involved in interactome provide new hope for the discovery of the E3 ligase inhibitors. These currently known natural binding partners of the E3 ligase can benefit the discovery of other unknown substrates and also the E3 ligase inhibitors. Herein, we present a novel strategy that using multiple substrates to elucidate the molecular recognition mechanism of E3 ubiquitin ligase. Molecular dynamics simulation, molecular mechanics-generalized born surface area (MM-GBSA) binding energy calculation and energy decomposition scheme were incorporated to evaluate the quantitative contributions of sub-pocket and per-residue to binding. In this case, Kelch-like ECH-associated protein-1 (Keap1), a substrate adaptor component of the Cullin-RING ubiquitin ligases complex, is applied for the investigation of how it recognize its substrates, especially Nrf2, a master regulator of the antioxidant response. By analyzing multiple substrates binding determinants, we found that both the polar sub-pockets (P1 and P2) and the nonpolar sub-pockets (P4 and P5) of Keap1 can make remarkable contributions to intermolecular interactions. This finding stresses the requirement for substrates to interact with the polar and nonpolar sub-pockets simultaneously. The results discussed in this paper not only show the binding determinants of the Keap1 substrates but also provide valuable implications for both Keap1 substrate discovery and PPI inhibitor design.
The substrate binding domains of human SIAH E3 ubiquitin ligases are now crystal clear
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zhang, Qi; Wang, Zhongduo; Hou, Feng
2017-01-01
Seven in absentia homologs (SIAHs) comprise a family of highly conserved E3 ubiquitin ligases that play an important role in regulating signalling pathways in tumorigenesis, including the DNA damage repair and hypoxia response pathways. SIAH1 and SIAH2 have been found to function as a tumour repressor and a proto-oncogene, respectively, despite the high sequence identity of their substrate binding domains (SBDs). Ubiquitin-specific protease USP19 is a deubiquitinase that forms a complex with SIAHs and counteracts the ligase function. Much effort has been made to find selective inhibitors of the SIAHs E3 ligases. Menadione was reported to inhibit SIAH2 specifically. Wemore » used X-ray crystallography, peptide array, bioinformatic analysis, and biophysical techniques to characterize the structure and interaction of SIAHs with deubiquitinases and literature reported compounds. We solved the crystal structures of SIAH1 in complex with a USP19 peptide and of the apo form SIAH2. Phylogenetic analysis revealed the SIAH/USP19 complex is conserved in evolution. We demonstrated that menadione destabilizes both SIAH1 and SIAH2 non-specifically through covalent modification. The SBDs of SIAH E3 ligases are structurally similar with a subtle stability difference. USP19 is the only deubiquitinase that directly binds to SIAHs through the substrate binding pocket. Menadione is not a specific inhibitor for SIAH2. The crystallographic models provide structural insights into the substrate binding of the SIAH family E3 ubiquitin ligases that are critically involved in regulating cancer-related pathways. Our results suggest caution should be taken when using menadione as a specific SIAH2 inhibitor.« less
Henderson, Jordana M; Nisperos, Sean V; Weeks, Joi; Ghulam, Mahjoobah; Marín, Ignacio; Zayas, Ricardo M
2015-08-15
E3 ubiquitin ligases constitute a large family of enzymes that modify specific proteins by covalently attaching ubiquitin polypeptides. This post-translational modification can serve to regulate protein function or longevity. In spite of their importance in cell physiology, the biological roles of most ubiquitin ligases remain poorly understood. Here, we analyzed the function of the HECT domain family of E3 ubiquitin ligases in stem cell biology and tissue regeneration in planarians. Using bioinformatic searches, we identified 17 HECT E3 genes that are expressed in the Schmidtea mediterranea genome. Whole-mount in situ hybridization experiments showed that HECT genes were expressed in diverse tissues and most were expressed in the stem cell population (neoblasts) or in their progeny. To investigate the function of all HECT E3 ligases, we inhibited their expression using RNA interference (RNAi) and determined that orthologs of huwe1, wwp1, and trip12 had roles in tissue regeneration. We show that huwe1 RNAi knockdown led to a significant expansion of the neoblast population and death by lysis. Further, our experiments showed that wwp1 was necessary for both neoblast and intestinal tissue homeostasis as well as uncovered an unexpected role of trip12 in posterior tissue specification. Taken together, our data provide insights into the roles of HECT E3 ligases in tissue regeneration and demonstrate that planarians will be a useful model to evaluate the functions of E3 ubiquitin ligases in stem cell regulation. Copyright © 2015 Elsevier Inc. All rights reserved.
Biotin protein ligase from Corynebacterium glutamicum: role for growth and L: -lysine production.
Peters-Wendisch, P; Stansen, K C; Götker, S; Wendisch, V F
2012-03-01
Corynebacterium glutamicum is a biotin auxotrophic Gram-positive bacterium that is used for large-scale production of amino acids, especially of L-glutamate and L-lysine. It is known that biotin limitation triggers L-glutamate production and that L-lysine production can be increased by enhancing the activity of pyruvate carboxylase, one of two biotin-dependent proteins of C. glutamicum. The gene cg0814 (accession number YP_225000) has been annotated to code for putative biotin protein ligase BirA, but the protein has not yet been characterized. A discontinuous enzyme assay of biotin protein ligase activity was established using a 105aa peptide corresponding to the carboxyterminus of the biotin carboxylase/biotin carboxyl carrier protein subunit AccBC of the acetyl CoA carboxylase from C. glutamicum as acceptor substrate. Biotinylation of this biotin acceptor peptide was revealed with crude extracts of a strain overexpressing the birA gene and was shown to be ATP dependent. Thus, birA from C. glutamicum codes for a functional biotin protein ligase (EC 6.3.4.15). The gene birA from C. glutamicum was overexpressed and the transcriptome was compared with the control strain revealing no significant gene expression changes of the bio-genes. However, biotin protein ligase overproduction increased the level of the biotin-containing protein pyruvate carboxylase and entailed a significant growth advantage in glucose minimal medium. Moreover, birA overexpression resulted in a twofold higher L-lysine yield on glucose as compared with the control strain.
Wang, Cui; Zhou, Hui; Zhu, Wenping; Li, Hongbo; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin
2013-09-15
We developed a novel electrochemical strategy for ultrasensitive DNA detection using a dual amplification strategy based on the circular strand-displacement polymerase reaction (CSDPR) and the hybridization chain reaction (HCR). In this assay, hybridization of hairpin-shaped capture DNA to target DNA resulted in a conformational change of the capture DNA with a concomitant exposure of its stem. The primer was then hybridized with the exposed stem and triggered a polymerization reaction, allowing a cyclic reaction comprising release of target DNA, hybridization of target with remaining capture DNA, polymerization initiated by the primer. Furthermore, the free part of the primer propagated a chain reaction of hybridization events between two DNA hairpin probes with biotin labels, enabling an electrochemical reading using the streptavidin-alkaline phosphatase. The proposed biosensor showed to have very high sensitivity and selectivity with a dynamic response range through 10fM to 1nM, and the detect limit was as low as 8fM. The proposed strategy could have the potential for molecular diagnostics in complex biological systems. Copyright © 2013 Elsevier B.V. All rights reserved.
Pendini, Nicole R; Polyak, Steve W; Booker, Grant W; Wallace, John C; Wilce, Matthew C J
2008-06-01
Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 A resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P4(2)2(1)2, with unit-cell parameters a = b = 93.665, c = 131.95.
Pendini, Nicole R.; Polyak, Steve W.; Booker, Grant W.; Wallace, John C.; Wilce, Matthew C. J.
2008-01-01
Biotin protein ligase from Staphylococcus aureus catalyses the biotinylation of acetyl-CoA carboxylase and pyruvate carboxylase. Recombinant biotin protein ligase from S. aureus has been cloned, expressed and purified. Crystals were grown using the hanging-drop vapour-diffusion method using PEG 8000 as the precipitant at 295 K. X-ray diffraction data were collected to 2.3 Å resolution from crystals using synchrotron X-ray radiation at 100 K. The diffraction was consistent with the tetragonal space group P42212, with unit-cell parameters a = b = 93.665, c = 131.95. PMID:18540065
Dickson; Odom; Ducheneaux; Murray; Milofsky
2000-07-15
Despite the impressive separation efficiency afforded by capillary electrochromatography (CEC), the detection of UV-absorbing compounds following separation in capillary dimensions remains limited by the short path length (5-75 microm) through the column. Moreover, analytes that are poor chromophores present an additional challenge with respect to sensitive detection in CEC. This paper illustrates a new photochemical reaction detection scheme for CEC that takes advantage of the catalytic nature of type II photooxidation reactions. The sensitive detection scheme is selective toward molecules capable of photosensitizing the formation of singlet molecular oxygen (1O2). Following separation by CEC, UV-absorbing analytes promote groundstate 3O2 to an excited state (1O2) which reacts rapidly with tert-butyl-3,4,5-trimethylpyrrolecarboxylate, which is added to the running buffer. Detection is based on the loss of pyrrole. The reaction is catalytic in nature since one analyte molecule may absorb light many times, producing large amounts of 1O2. The detection limit for 9-acetylanthracene, following separation by CEC, is approximately 6 x 10(-9) M (S/N = 3). Optimization of the factors effecting the S/N for four model compounds is discussed.
Pathogen detection in milk samples by ligation detection reaction-mediated universal array method.
Cremonesi, P; Pisoni, G; Severgnini, M; Consolandi, C; Moroni, P; Raschetti, M; Castiglioni, B
2009-07-01
This paper describes a new DNA chip, based on the use of a ligation detection reaction coupled to a universal array, developed to detect and analyze, directly from milk samples, microbial pathogens known to cause bovine, ovine, and caprine mastitis or to be responsible for foodborne intoxication or infection, or both. Probes were designed for the identification of 15 different bacterial groups: Staphylococcus aureus, Streptococcus agalactiae, nonaureus staphylococci, Streptococcus bovis, Streptococcus equi, Streptococcus canis, Streptococcus dysgalactiae, Streptococcus parauberis, Streptococcus uberis, Streptococcus pyogenes, Mycoplasma spp., Salmonella spp., Bacillus spp., Campylobacter spp., and Escherichia coli and related species. These groups were identified based on the 16S rRNA gene. For microarray validation, 22 strains from the American Type Culture Collection or other culture collections and 50 milk samples were tested. The results demonstrated high specificity, with sensitivity as low as 6 fmol. Moreover, the ligation detection reaction-universal array assay allowed for the identification of Mycoplasma spp. in a few hours, avoiding the long incubation times of traditional microbiological identification methods. The universal array described here is a versatile tool able to identify milk pathogens efficiently and rapidly.
ERIC Educational Resources Information Center
Pick, Joseph E.; Malumbres, Marcos; Klann, Eric
2013-01-01
The anaphase promoting complex/cyclosome (APC/C) is an E3 ligase regulated by Cdh1. Beyond its role in controlling cell cycle progression, APC/C-Cdh1 has been detected in neurons and plays a role in long-lasting synaptic plasticity and long-term memory. Herein, we further examined the role of Cdh1 in synaptic plasticity and memory by generating…
RNF38 encodes a nuclear ubiquitin protein ligase that modifies p53
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheren, Jamie E.; Kassenbrock, C. Kenneth, E-mail: ken.kassenbrock@ucdenver.edu; Department of Biology, Colorado State University, Fort Collins, CO 80523-1878
2013-11-01
Highlights: •RNF38 is shown to be a nuclear protein with a bipartite nuclear localization signal. •RNF38 protein is purified and shown to have ubiquitin protein ligase (E3) activity. •We show that RNF38 binds p53 and can ubiquitinate p53 in vitro. •Overexpression of RNF38 increases p53 ubiquitination in HEK293T cells. •Overexpression of RNF38 in HEK293T cells alters p53 localization. -- Abstract: The RNF38 gene encodes a RING finger protein of unknown function. Here we demonstrate that RNF38 is a functional ubiquitin protein ligase (E3). We show that RNF38 isoform 1 is localized to the nucleus by a bipartite nuclear localization sequencemore » (NLS). We confirm that RNF38 is a binding partner of p53 and demonstrate that RNF38 can ubiquitinate p53 in vitro and in vivo. Finally, we show that overexpression of RNF38 in HEK293T cells results in relocalization of p53 to discrete foci associated with PML nuclear bodies. These results suggest RNF38 is an E3 ubiquitin ligase that may play a role in regulating p53.« less
Direct single-molecule dynamic detection of chemical reactions.
Guan, Jianxin; Jia, Chuancheng; Li, Yanwei; Liu, Zitong; Wang, Jinying; Yang, Zhongyue; Gu, Chunhui; Su, Dingkai; Houk, Kendall N; Zhang, Deqing; Guo, Xuefeng
2018-02-01
Single-molecule detection can reveal time trajectories and reaction pathways of individual intermediates/transition states in chemical reactions and biological processes, which is of fundamental importance to elucidate their intrinsic mechanisms. We present a reliable, label-free single-molecule approach that allows us to directly explore the dynamic process of basic chemical reactions at the single-event level by using stable graphene-molecule single-molecule junctions. These junctions are constructed by covalently connecting a single molecule with a 9-fluorenone center to nanogapped graphene electrodes. For the first time, real-time single-molecule electrical measurements unambiguously show reproducible large-amplitude two-level fluctuations that are highly dependent on solvent environments in a nucleophilic addition reaction of hydroxylamine to a carbonyl group. Both theoretical simulations and ensemble experiments prove that this observation originates from the reversible transition between the reactant and a new intermediate state within a time scale of a few microseconds. These investigations open up a new route that is able to be immediately applied to probe fast single-molecule physics or biophysics with high time resolution, making an important contribution to broad fields beyond reaction chemistry.
Direct single-molecule dynamic detection of chemical reactions
Guan, Jianxin; Jia, Chuancheng; Li, Yanwei; Liu, Zitong; Wang, Jinying; Yang, Zhongyue; Gu, Chunhui; Su, Dingkai; Houk, Kendall N.; Zhang, Deqing; Guo, Xuefeng
2018-01-01
Single-molecule detection can reveal time trajectories and reaction pathways of individual intermediates/transition states in chemical reactions and biological processes, which is of fundamental importance to elucidate their intrinsic mechanisms. We present a reliable, label-free single-molecule approach that allows us to directly explore the dynamic process of basic chemical reactions at the single-event level by using stable graphene-molecule single-molecule junctions. These junctions are constructed by covalently connecting a single molecule with a 9-fluorenone center to nanogapped graphene electrodes. For the first time, real-time single-molecule electrical measurements unambiguously show reproducible large-amplitude two-level fluctuations that are highly dependent on solvent environments in a nucleophilic addition reaction of hydroxylamine to a carbonyl group. Both theoretical simulations and ensemble experiments prove that this observation originates from the reversible transition between the reactant and a new intermediate state within a time scale of a few microseconds. These investigations open up a new route that is able to be immediately applied to probe fast single-molecule physics or biophysics with high time resolution, making an important contribution to broad fields beyond reaction chemistry. PMID:29487914
Structure of a BMI-1-Ring1B Polycomb Group Ubiquitin Ligase Complex
DOE Office of Scientific and Technical Information (OSTI.GOV)
Li,Z.; Cao, R.; Wang, M.
2006-01-01
Polycomb group (PcG) proteins Bmi-1 and Ring1B are core subunits of the PRC1 complex which plays important roles in the regulation of Hox gene expression, X-chromosome inactivation, tumorigenesis and stem cell self-renewal. The RING finger protein Ring1B is an E3 ligase that participates in the ubiquitination of lysine 119 of histone H2A, and the binding of Bmi-1 stimulates the E3 ligase activity. We have mapped the regions of Bmi-1 and Ring1B required for efficient ubiquitin transfer and determined a 2.5 Angstroms structure of the Bmi-1-Ring1B core domain complex. The structure reveals that Ring1B 'hugs' Bmi-1 through extensive RING domain contactsmore » and its N-terminal tail wraps around Bmi-1. The two regions of interaction have a synergistic effect on the E3 ligase activity. Our analyses suggest a model where the Bmi-1-Ring1B complex stabilizes the interaction between the E2 enzyme and the nucleosomal substrate to allow efficient ubiquitin transfer.« less
Testing the Effects of SIAH Ubiquitin E3 Ligases on Lysine Acetyl Transferases.
Hagenbucher, Jan; Stekman, Hilda; Rodriguez-Gil, Alfonso; Kracht, Michael; Schmitz, M Lienhard
2017-01-01
The family of seven-in-absentia (SIAH) ubiquitin E3 ligases functions in the control of numerous key signaling pathways. These enzymes belong to the RING (really interesting new gene) group of E3 ligases and mediate the attachment of ubiquitin chains to substrates, which then leads to their proteasomal degradation. Here, we describe a protocol that allows measuring SIAH-mediated ubiquitination and degradation of its client proteins as exemplified by acetyl transferases using simple overexpression experiments. The impact of SIAH expression on the relative amounts of target proteins and their mRNAs can be quantified by Western blotting and quantitative PCR (qPCR) as described here.
Feng, Youjun; Chin, Chui-Yoke; Chakravartty, Vandana; Gao, Rongsui; Crispell, Emily K; Weiss, David S; Cronan, John E
2015-06-09
The physiological function of biotin requires biotin protein ligase activity in order to attach the coenzyme to its cognate proteins, which are enzymes involved in central metabolism. The model intracellular pathogen Francisella novicida is unusual in that it encodes two putative biotin protein ligases rather than the usual single enzyme. F. novicida BirA has a ligase domain as well as an N-terminal DNA-binding regulatory domain, similar to the prototypical BirA protein in E. coli. However, the second ligase, which we name BplA, lacks the N-terminal DNA binding motif. It has been unclear why a bacterium would encode these two disparate biotin protein ligases, since F. novicida contains only a single biotinylated protein. In vivo complementation and enzyme assays demonstrated that BirA and BplA are both functional biotin protein ligases, but BplA is a much more efficient enzyme. BirA, but not BplA, regulated transcription of the biotin synthetic operon. Expression of bplA (but not birA) increased significantly during F. novicida infection of macrophages. BplA (but not BirA) was required for bacterial replication within macrophages as well as in mice. These data demonstrate that F. novicida has evolved two distinct enzymes with specific roles; BplA possesses the major ligase activity, whereas BirA acts to regulate and thereby likely prevent wasteful synthesis of biotin. During infection BplA seems primarily employed to maximize the efficiency of biotin utilization without limiting the expression of biotin biosynthetic genes, representing a novel adaptation strategy that may also be used by other intracellular pathogens. Our findings show that Francisella novicida has evolved two functional biotin protein ligases, BplA and BirA. BplA is a much more efficient enzyme than BirA, and its expression is significantly induced upon infection of macrophages. Only BplA is required for F. novicida pathogenicity, whereas BirA prevents wasteful biotin synthesis. These data
Structural basis for catalytic activation by the human ZNF451 SUMO E3 ligase
Cappadocia, Laurent; Pichler, Andrea; Lima, Christopher D.
2015-11-02
E3 protein ligases enhance transfer of ubiquitin-like (Ubl) proteins from E2 conjugating enzymes to substrates by stabilizing the thioester-charged E2~Ubl in a closed configuration optimally aligned for nucleophilic attack. In this paper, we report biochemical and structural data that define the N-terminal domain of the Homo sapiens ZNF451 as the catalytic module for SUMO E3 ligase activity. The ZNF451 catalytic module contains tandem SUMO-interaction motifs (SIMs) bridged by a Pro-Leu-Arg-Pro (PLRP) motif. The first SIM and PLRP motif engage thioester-charged E2~SUMO while the next SIM binds a second molecule of SUMO bound to the back side of E2. We showmore » that ZNF451 is SUMO2 specific and that SUMO modification of ZNF451 may contribute to activity by providing a second molecule of SUMO that interacts with E2. Finally, our results are consistent with ZNF451 functioning as a bona fide SUMO E3 ligase.« less
Structural basis for catalytic activation by the human ZNF451 SUMO E3 ligase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Cappadocia, Laurent; Pichler, Andrea; Lima, Christopher D.
E3 protein ligases enhance transfer of ubiquitin-like (Ubl) proteins from E2 conjugating enzymes to substrates by stabilizing the thioester-charged E2~Ubl in a closed configuration optimally aligned for nucleophilic attack. In this paper, we report biochemical and structural data that define the N-terminal domain of the Homo sapiens ZNF451 as the catalytic module for SUMO E3 ligase activity. The ZNF451 catalytic module contains tandem SUMO-interaction motifs (SIMs) bridged by a Pro-Leu-Arg-Pro (PLRP) motif. The first SIM and PLRP motif engage thioester-charged E2~SUMO while the next SIM binds a second molecule of SUMO bound to the back side of E2. We showmore » that ZNF451 is SUMO2 specific and that SUMO modification of ZNF451 may contribute to activity by providing a second molecule of SUMO that interacts with E2. Finally, our results are consistent with ZNF451 functioning as a bona fide SUMO E3 ligase.« less
Functional identification of MdSIZ1 as a SUMO E3 ligase in apple.
Zhang, Rui-Fen; Guo, Ying; Li, Yuan-Yuan; Zhou, Li-Jie; Hao, Yu-Jin; You, Chun-Xiang
2016-07-01
SUMOylation, the conjugation of target proteins with SUMO (small ubiquitin-related modifier), is a type of post-translational modification in eukaryotes and involves the sequential action of activation (E1), conjugation (E2) and ligation (E3) enzymes. In Arabidopsis, the AtSIZ1 protein is a SUMO E3 ligase that promotes the conjugation of SUMO proteins to target substrates. Here, we isolated and identified a SUMO E3 ligase, MdSIZ1, in apple, which was similar to AtSIZ1. SUMOylation analysis showed that MdSIZ1 had SUMO E3 ligase activity in vitro and in vivo. SUMO conjugation was increased by high temperatures, low temperatures, and abscisic acid (ABA). The ectopic expression of MdSIZ1 in Arabidopsis siz1-2 mutant plants partially complemented the morphological mutant phenotype and enhanced the levels of SUMO conjugation. Taken together, these results suggest that MdSIZ1-mediated SUMO conjugation of target proteins is an important process that regulates the adaptation of apple plants to various environmental stresses. Copyright © 2016 Elsevier GmbH. All rights reserved.
O'Connor, Hazel F; Huibregtse, Jon M
2017-09-01
Protein ubiquitylation is an important post-translational modification, regulating aspects of virtually every biochemical pathway in eukaryotic cells. Hundreds of enzymes participate in the conjugation and deconjugation of ubiquitin, as well as the recognition, signaling functions, and degradation of ubiquitylated proteins. Regulation of ubiquitylation is most commonly at the level of recognition of substrates by E3 ubiquitin ligases. Characterization of the network of E3-substrate relationships is a major goal and challenge in the field, as this expected to yield fundamental biological insights and opportunities for drug development. There has been remarkable success in identifying substrates for some E3 ligases, in many instances using the standard protein-protein interaction techniques (e.g., two-hybrid screens and co-immunoprecipitations paired with mass spectrometry). However, some E3s have remained refractory to characterization, while others have simply not yet been studied due to the sheer number and diversity of E3s. This review will discuss the range of tools and techniques that can be used for substrate profiling of E3 ligases.
Implication of SUMO E3 ligases in nucleotide excision repair.
Tsuge, Maasa; Kaneoka, Hidenori; Masuda, Yusuke; Ito, Hiroki; Miyake, Katsuhide; Iijima, Shinji
2015-08-01
Post-translational modifications alter protein function to mediate complex hierarchical regulatory processes that are crucial to eukaryotic cellular function. The small ubiquitin-like modifier (SUMO) is an important post-translational modification that affects transcriptional regulation, nuclear localization, and the maintenance of genome stability. Nucleotide excision repair (NER) is a very versatile DNA repair system that is essential for protection against ultraviolet (UV) irradiation. The deficiencies in NER function remarkably increase the risk of skin cancer. Recent studies have shown that several NER factors are SUMOylated, which influences repair efficiency. However, how SUMOylation modulates NER has not yet been elucidated. In the present study, we performed RNAi knockdown of SUMO E3 ligases and found that, in addition to PIASy, the polycomb protein Pc2 affected the repair of cyclobutane pyrimidine dimers. PIAS1 affected both the removal of 6-4 pyrimidine pyrimidone photoproducts and cyclobutane pyrimidine dimers, whereas other SUMO E3 ligases did not affect the removal of either UV lesion.
Contribution of CoA ligases to benzenoid biosynthesis in petunia flowers.
Klempien, Antje; Kaminaga, Yasuhisa; Qualley, Anthony; Nagegowda, Dinesh A; Widhalm, Joshua R; Orlova, Irina; Shasany, Ajit Kumar; Taguchi, Goro; Kish, Christine M; Cooper, Bruce R; D'Auria, John C; Rhodes, David; Pichersky, Eran; Dudareva, Natalia
2012-05-01
Biosynthesis of benzoic acid from Phe requires shortening of the side chain by two carbons, which can occur via the β-oxidative or nonoxidative pathways. The first step in the β-oxidative pathway is cinnamoyl-CoA formation, likely catalyzed by a member of the 4-coumarate:CoA ligase (4CL) family that converts a range of trans-cinnamic acid derivatives into the corresponding CoA thioesters. Using a functional genomics approach, we identified two potential CoA-ligases from petunia (Petunia hybrida) petal-specific cDNA libraries. The cognate proteins share only 25% amino acid identity and are highly expressed in petunia corollas. Biochemical characterization of the recombinant proteins revealed that one of these proteins (Ph-4CL1) has broad substrate specificity and represents a bona fide 4CL, whereas the other is a cinnamate:CoA ligase (Ph-CNL). RNA interference suppression of Ph-4CL1 did not affect the petunia benzenoid scent profile, whereas downregulation of Ph-CNL resulted in a decrease in emission of benzylbenzoate, phenylethylbenzoate, and methylbenzoate. Green fluorescent protein localization studies revealed that the Ph-4CL1 protein is localized in the cytosol, whereas Ph-CNL is in peroxisomes. Our results indicate that subcellular compartmentalization of enzymes affects their involvement in the benzenoid network and provide evidence that cinnamoyl-CoA formation by Ph-CNL in the peroxisomes is the committed step in the β-oxidative pathway.
Guo, Qiuping; Yang, Xiaohai; Wang, Kemin; Tan, Weihong; Li, Wei; Tang, Hongxing; Li, Huimin
2009-02-01
Here we have developed a sensitive DNA amplified detection method based on isothermal strand-displacement polymerization reaction. This method takes advantage of both the hybridization property of DNA and the strand-displacement property of polymerase. Importantly, we demonstrate that our method produces a circular polymerization reaction activated by the target, which essentially allows it to self-detect. Functionally, this DNA system consists of a hairpin fluorescence probe, a short primer and polymerase. Upon recognition and hybridization with the target ssDNA, the stem of the hairpin probe is opened, after which the opened probe anneals with the primer and triggers the polymerization reaction. During this process of the polymerization reaction, a complementary DNA is synthesized and the hybridized target is displaced. Finally, the displaced target recognizes and hybridizes with another probe, triggering the next round of polymerization reaction, reaching a target detection limit of 6.4 x 10(-15) M.
Proteolytic regulation of metabolic enzymes by E3 ubiquitin ligase complexes: lessons from yeast.
Nakatsukasa, Kunio; Okumura, Fumihiko; Kamura, Takumi
2015-01-01
Eukaryotic organisms use diverse mechanisms to control metabolic rates in response to changes in the internal and/or external environment. Fine metabolic control is a highly responsive, energy-saving process that is mediated by allosteric inhibition/activation and/or reversible modification of preexisting metabolic enzymes. In contrast, coarse metabolic control is a relatively long-term and expensive process that involves modulating the level of metabolic enzymes. Coarse metabolic control can be achieved through the degradation of metabolic enzymes by the ubiquitin-proteasome system (UPS), in which substrates are specifically ubiquitinated by an E3 ubiquitin ligase and targeted for proteasomal degradation. Here, we review select multi-protein E3 ligase complexes that directly regulate metabolic enzymes in Saccharomyces cerevisiae. The first part of the review focuses on the endoplasmic reticulum (ER) membrane-associated Hrd1 and Doa10 E3 ligase complexes. In addition to their primary roles in the ER-associated degradation pathway that eliminates misfolded proteins, recent quantitative proteomic analyses identified native substrates of Hrd1 and Doa10 in the sterol synthesis pathway. The second part focuses on the SCF (Skp1-Cul1-F-box protein) complex, an abundant prototypical multi-protein E3 ligase complex. While the best-known roles of the SCF complex are in the regulation of the cell cycle and transcription, accumulating evidence indicates that the SCF complex also modulates carbon metabolism pathways. The increasing number of metabolic enzymes whose stability is directly regulated by the UPS underscores the importance of the proteolytic regulation of metabolic processes for the acclimation of cells to environmental changes.
RavN is a member of a previously unrecognized group of Legionella pneumophila E3 ubiquitin ligases
Lin, Yi-Han; Evans, Timothy R.; Doms, Alexandra G.; Beauchene, Nicole A.; Hierro, Aitor
2018-01-01
The eukaryotic ubiquitylation machinery catalyzes the covalent attachment of the small protein modifier ubiquitin to cellular target proteins in order to alter their fate. Microbial pathogens exploit this post-translational modification process by encoding molecular mimics of E3 ubiquitin ligases, eukaryotic enzymes that catalyze the final step in the ubiquitylation cascade. Here, we show that the Legionella pneumophila effector protein RavN belongs to a growing class of bacterial proteins that mimic host cell E3 ligases to exploit the ubiquitylation pathway. The E3 ligase activity of RavN was located within its N-terminal region and was dependent upon interaction with a defined subset of E2 ubiquitin-conjugating enzymes. The crystal structure of the N-terminal region of RavN revealed a U-box-like motif that was only remotely similar to other U-box domains, indicating that RavN is an E3 ligase relic that has undergone significant evolutionary alteration. Substitution of residues within the predicted E2 binding interface rendered RavN inactive, indicating that, despite significant structural changes, the mode of E2 recognition has remained conserved. Using hidden Markov model-based secondary structure analyses, we identified and experimentally validated four additional L. pneumophila effectors that were not previously recognized to possess E3 ligase activity, including Lpg2452/SdcB, a new paralog of SidC. Our study provides strong evidence that L. pneumophila is dedicating a considerable fraction of its effector arsenal to the manipulation of the host ubiquitylation pathway. PMID:29415051
Feng, Youjun; Chin, Chui-Yoke; Chakravartty, Vandana; Gao, Rongsui; Crispell, Emily K.
2015-01-01
ABSTRACT The physiological function of biotin requires biotin protein ligase activity in order to attach the coenzyme to its cognate proteins, which are enzymes involved in central metabolism. The model intracellular pathogen Francisella novicida is unusual in that it encodes two putative biotin protein ligases rather than the usual single enzyme. F. novicida BirA has a ligase domain as well as an N-terminal DNA-binding regulatory domain, similar to the prototypical BirA protein in E. coli. However, the second ligase, which we name BplA, lacks the N-terminal DNA binding motif. It has been unclear why a bacterium would encode these two disparate biotin protein ligases, since F. novicida contains only a single biotinylated protein. In vivo complementation and enzyme assays demonstrated that BirA and BplA are both functional biotin protein ligases, but BplA is a much more efficient enzyme. BirA, but not BplA, regulated transcription of the biotin synthetic operon. Expression of bplA (but not birA) increased significantly during F. novicida infection of macrophages. BplA (but not BirA) was required for bacterial replication within macrophages as well as in mice. These data demonstrate that F. novicida has evolved two distinct enzymes with specific roles; BplA possesses the major ligase activity, whereas BirA acts to regulate and thereby likely prevent wasteful synthesis of biotin. During infection BplA seems primarily employed to maximize the efficiency of biotin utilization without limiting the expression of biotin biosynthetic genes, representing a novel adaptation strategy that may also be used by other intracellular pathogens. PMID:26060274
NASA Astrophysics Data System (ADS)
Granja, Carlos; Kraus, Vaclav; Pugatch, Valery; Kohout, Zdenek
2017-06-01
In low-energy nuclear reactions of astrophysical interest or fusion studies the spatial- and time-correlated detection of two and more reaction products can be a valuable tool in studies of reaction mechanisms, resolving reaction channels and measuring angular distributions of reaction products. For this purpose we constructed a configurable array of position-sensitive detectors based on the hybrid semiconductor pixel detector Timepix. Additional analog-signal electronics provide self-trigger together with extended multi-device control and synchronized readout electronics by a customized control and coincidence unit. The instrumentation, developed and used for detection of fission fragments in spontaneous and neutron induced fission as well as in charged particle detection in neutron induced reactions, is being implemented for low-energy light-ion induced nuclear reactions. Application and demonstration of the technique with two Timepix detectors on p+p elastic scattering at the Van-de-Graaff (VdG) accelerator in Prague is given.
Zhu, Li-Wei; Yang, Xue-Mei; Xu, Xiao-Qin; Xu, Jian; Lu, Huang-Jun; Yan, Li-Xing
2008-10-01
This study was aimed to analyze the results of false positive reaction in bacterial detection of blood samples with BacT/ALERT 3D system, to evaluate the specificity of this system, and to decrease the false positive reaction. Each reaction flasks in past five years were processed for bacteria isolation and identification. When the initial cultures were positive, the remaining samples and the corresponding units were recultured if still available. 11395 blood samples were detected. It is worthy of note that the incubator temperature should be stabilized, avoiding fluctuation; when the cultures were alarmed, the reaction flasks showed be kept some hours for further incubation so as to trace a sharply increasing signal to support the judgement of true bacterial growth. The results indicated that 122 samples (1.07%) wee positive at initial culture, out of them 107 samples (88.7%) were found bacterial, and 15 samples (12.3%) were found nothing. The detection curves of positive samples resulted from bacterial growth showed ascent. In conclusion, maintenance of temperature stability and avoidance of temperature fluctuation in incubator could decrease the occurrence of false-positive reaction in detection process. The reaction flasks with positive results at initial culture should be recultured, and whether existence of a sharply ascending logarilhimic growth phase in bacterial growth curve should be further detected, which are helpful to distinguish false-positive reactions from true positive, and thus increase the specificity of the BacT/ALERT system.
Nested methylation-specific polymerase chain reaction cancer detection method
Belinsky, Steven A [Albuquerque, NM; Palmisano, William A [Edgewood, NM
2007-05-08
A molecular marker-based method for monitoring and detecting cancer in humans. Aberrant methylation of gene promoters is a marker for cancer risk in humans. A two-stage, or "nested" polymerase chain reaction method is disclosed for detecting methylated DNA sequences at sufficiently high levels of sensitivity to permit cancer screening in biological fluid samples, such as sputum, obtained non-invasively. The method is for detecting the aberrant methylation of the p16 gene, O 6-methylguanine-DNA methyltransferase gene, Death-associated protein kinase gene, RAS-associated family 1 gene, or other gene promoters. The method offers a potentially powerful approach to population-based screening for the detection of lung and other cancers.
NASBA: A detection and amplification system uniquely suited for RNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sooknanan, R.; Malek, L.T.
1995-06-01
The invention of PCR (polymerase chain reaction) has revolutionized our ability to amplify and manipulate a nucleic acid sequence in vitro. The commercial rewards of this revolution have driven the development of other nuclei acid amplification and detection methodologies. This has created an alphabet soup of technologies that use different amplification methods, including NASBA (nucleic acid sequence-based amplification), LCR (ligase chain reaction), SDA (strand displacement amplification), QBR (Q-beta replicase), CPR (cycling probe reaction), and bDNA (branched DNA). Despite the differences in their processes, these amplification systems can be separated into two broad categories based on how they achieve their goal:more » sequence-based amplification systems, such as PCR, NASBA, and SDA, amplify a target nucleic acid sequence. Signal-based amplification systems, such as LCR, QBR, CPR and bDNA, amplify or alter a signal from a detection reaction that is target-dependent. While the various methods have relative strengths and weaknesses, only NASBA offers the unique ability to homogeneously amplify an RNA analyte in the presence of homologous genomic DNA under isothermal conditions. Since the detection of RNA sequences almost invariably measures biological activity, it is an excellent prognostic indicator of activities as diverse as virus production, gene expression, and cell viability. The isothermal nature of the reaction makes NASBA especially suitable for large-scale manual screening. These features extend NASBA`s application range from research to commercial diagnostic applications. Field test kits are presently under development for human diagnostics as well as the burgeoning fields of food and environmental diagnostic testing. These developments suggest future integration of NASBA into robotic workstations for high-throughput screening as well. 17 refs., 1 tab.« less
DETECTION OF IDIOTYPIC CROSS-REACTIONS AMONG STREPTOCOCCAL ANTISERA FROM RELATED RABBITS
Kindt, Thomas J.; Seide, Rochelle K.; Bokisch, Viktor A.; Krause, Richard M.
1973-01-01
Idiotypic cross-reactions among antibodies to Group C streptococcal carbohydrate were studied using idiotypic antisera prepared in allotypically matched rabbits. Antibodies with idiotypic cross-specificity to one proband antibody were detected in 58% of the antisera from related rabbits, while approximately 1% of nonrelated rabbits produced antibody with this specificity. The cross-specificity was related to the group a (VH) allotype of 133 rabbits tested with only one exception. Studies utilizing antisera against a second proband antibody failed to detect antibodies with idiotypic cross-reactivity among the same group of related rabbits. This result emphasizes the variation in expression of idiotypic determinants of antibodies. It was further shown that the presence of anti-IgG's in the streptococcal antisera interfere with the detection of idiotypic cross-reactions. These anti-IgG's masked the presence of antibodies with idiotypic cross-specificity when inhibition of precipitation tests were used for their detection. PMID:4727913
Direct detection of Streptococcus mutans in human dental plaque by polymerase chain reaction.
Igarashi, T; Yamamoto, A; Goto, N
1996-10-01
Streptococcus mutans is an etiological agent in human dental caries. A method for the detection of S. mutans directly from human dental plaque by polymerase chain reaction has been developed. Oligonucleotide primers specific for a portion of the dextranase gene (dexA) of S. mutans Ingbritt (serotype c) were designed to amplify a 1272-bp DNA fragment by polymerase chain reaction. The present method specifically detected S. mutans (serotypes c, e and f), but none of the other mutans streptococci: S. cricetus (serotype a), S. rattus (serotype b), S. sobrinus (serotypes d and g), and S. downei (serotype h), other gram-positive bacteria (16 strains of 12 species of cocci and 18 strains of 12 species of bacilli) nor gram-negative bacteria (1 strain of 1 species of cocci and 20 strains of 18 species of bacilli). The method was capable of detecting 1 pg of the chromosomal DNA purified from S. mutans Ingbritt and as few as 12 colony-forming units of S. mutans cells. The S. mutans cells in human dental plaque were also directly detected. Seventy clinical isolates of S. mutans isolated from the dental plaque of 8 patients were all positive by the polymerase chain reaction. These results suggest that the dexA polymerase chain reaction is suitable for the specific detection and identification of S. mutans.
Ritari, Jarmo; Hultman, Jenni; Fingerroos, Rita; Tarkkanen, Jussi; Pullat, Janne; Paulin, Lars; Kivi, Niina; Auvinen, Petri; Auvinen, Eeva
2012-01-01
Sensitive and specific detection of human papillomaviruses (HPV) in cervical samples is a useful tool for the early diagnosis of epithelial neoplasia and anogenital lesions. Recent studies support the feasibility of HPV DNA testing instead of cytology (Pap smear) as a primary test in population screening for cervical cancer. This is likely to be an option in the near future in many countries, and it would increase the efficiency of screening for cervical abnormalities. We present here a microarray test for the detection and typing of 15 most important high-risk HPV types and two low risk types. The method is based on type specific multiplex PCR amplification of the L1 viral genomic region followed by ligation detection reaction where two specific ssDNA probes, one containing a fluorescent label and the other a flanking ZipCode sequence, are joined by enzymatic ligation in the presence of the correct HPV PCR product. Human beta-globin is amplified in the same reaction to control for sample quality and adequacy. The genotyping capacity of our approach was evaluated against Linear Array test using cervical samples collected in transport medium. Altogether 14 out of 15 valid samples (93%) gave concordant results between our test and Linear Array. One sample was HPV56 positive in our test and high-risk positive in Hybrid Capture 2 but remained negative in Linear Array. The preliminary results suggest that our test has accurate multiple HPV genotyping capability with the additional advantages of generic detection format, and potential for high-throughput screening.
Functional role of TRIM E3 ligase oligomerization and regulation of catalytic activity.
Koliopoulos, Marios G; Esposito, Diego; Christodoulou, Evangelos; Taylor, Ian A; Rittinger, Katrin
2016-06-01
TRIM E3 ubiquitin ligases regulate a wide variety of cellular processes and are particularly important during innate immune signalling events. They are characterized by a conserved tripartite motif in their N-terminal portion which comprises a canonical RING domain, one or two B-box domains and a coiled-coil region that mediates ligase dimerization. Self-association via the coiled-coil has been suggested to be crucial for catalytic activity of TRIMs; however, the precise molecular mechanism underlying this observation remains elusive. Here, we provide a detailed characterization of the TRIM ligases TRIM25 and TRIM32 and show how their oligomeric state is linked to catalytic activity. The crystal structure of a complex between the TRIM25 RING domain and an ubiquitin-loaded E2 identifies the structural and mechanistic features that promote a closed E2~Ub conformation to activate the thioester for ubiquitin transfer allowing us to propose a model for the regulation of activity in the full-length protein. Our data reveal an unexpected diversity in the self-association mechanism of TRIMs that might be crucial for their biological function. © 2016 Francis Crick Institute. Published under the terms of the CC BY 4.0 license.
Structurally complex and highly active RNA ligases derived from random RNA sequences
NASA Technical Reports Server (NTRS)
Ekland, E. H.; Szostak, J. W.; Bartel, D. P.
1995-01-01
Seven families of RNA ligases, previously isolated from random RNA sequences, fall into three classes on the basis of secondary structure and regiospecificity of ligation. Two of the three classes of ribozymes have been engineered to act as true enzymes, catalyzing the multiple-turnover transformation of substrates into products. The most complex of these ribozymes has a minimal catalytic domain of 93 nucleotides. An optimized version of this ribozyme has a kcat exceeding one per second, a value far greater than that of most natural RNA catalysts and approaching that of comparable protein enzymes. The fact that such a large and complex ligase emerged from a very limited sampling of sequence space implies the existence of a large number of distinct RNA structures of equivalent complexity and activity.
Pfirrmann, Thorsten; Villavicencio-Lorini, Pablo; Subudhi, Abinash K; Menssen, Ruth; Wolf, Dieter H; Hollemann, Thomas
2015-01-01
In Saccharomyces cerevisiae the Gid-complex functions as an ubiquitin-ligase complex that regulates the metabolic switch between glycolysis and gluconeogenesis. In higher organisms six conserved Gid proteins form the CTLH protein-complex with unknown function. Here we show that Rmnd5, the Gid2 orthologue from Xenopus laevis, is an ubiquitin-ligase embedded in a high molecular weight complex. Expression of rmnd5 is strongest in neuronal ectoderm, prospective brain, eyes and ciliated cells of the skin and its suppression results in malformations of the fore- and midbrain. We therefore suggest that Xenopus laevis Rmnd5, as a subunit of the CTLH complex, is a ubiquitin-ligase targeting an unknown factor for polyubiquitination and subsequent proteasomal degradation for proper fore- and midbrain development.
Photosynthetic Reaction Centers as Active Molecular Electronic Components. Phase I
1993-08-13
lauryl dimethylarnine oxide (LDAO). This is followed by final purification by ion-exchange chromatography. Typical media are DEAE-Sephacel with an...should be less then 0.5 ml. Phenol extract two or three times and ethanol precipitate. Note: sulfates from the agarose inhibiting ligase reactions and...transformations was once a concern. Presently agarose from most sources is pretty sulfate free (BioRad is good in this respect and FMC claims that it is
AQP2 Abundance is Regulated by the E3-Ligase CHIP Via HSP70.
Centrone, Mariangela; Ranieri, Marianna; Di Mise, Annarita; Berlingerio, Sante Princiero; Russo, Annamaria; Deen, Peter M T; Staub, Olivier; Valenti, Giovanna; Tamma, Grazia
2017-01-01
AQP2 expression is mainly controlled by vasopressin-dependent changes in protein abundance which is in turn regulated by AQP2 ubiquitylation and degradation, however the proteins involved in these processes are largely unknown. Here, we investigated the potential role of the CHIP E3 ligase in AQP2 regulation. MCD4 cells and kidney slices were used to study the involvement of the E3 ligase CHIP on AQP2 protein abundance by cell homogenization and immunoprecipitation followed by immunoblotting. We found that AQP2 complexes with CHIP in renal tissue. Expression of CHIP increased proteasomal degradation of AQP2 and HSP70 abundance, a molecular signature of HSP90 inhibition. Increased HSP70 level, secondary to CHIP expression, promoted ERK signaling resulting in increased AQP2 phosphorylation at S261. Phosphorylation of AQP2 at S256 and T269 were instead downregulated. Next, we investigated HSP70 interaction with AQP2, which is important for endocytosis. Compared with AQP2-wt, HSP70 binding decreased in AQP2-S256D and AQP2-S256D-S261D, while increased in AQP2-S256D-S261A. Surprisingly, expression of CHIP-delUbox, displaying a loss of E3 ligase activity, still induced AQP2 degradation, indicating that CHIP does not ubiquitylate and degrade AQP2 itself. Conversely, the AQP2 half-life was increased upon the expression of CHIP-delTPR a domain which binds Hsc70/HSP70 and HSP90. HSP70 has been reported to bind other E3 ligases such as MDM2. Notably, we found that co-expression of CHIP and MDM2 increased AQP2 degradation, whereas co-expression of CHIP with MDM2-delRING, an inactive form of MDM2, impaired AQP2 degradation. Our findings indicate CHIP as a master regulator of AQP2 degradation via HSP70 that has dual functions: (1) as chaperone for AQP2 and (2) as an anchoring protein for MDM2 E3 ligase, which is likely to be involved in AQP2 degradation. © 2017 The Author(s). Published by S. Karger AG, Basel.
Anuradha, C M; Mulakayala, Chaitanya; Babajan, Banaganapalli; Naveen, M; Rajasekhar, Chikati; Kumar, Chitta Suresh
2010-01-01
Multi drug resistance capacity for Mycobacterium tuberculosis (MDR-Mtb) demands the profound need for developing new anti-tuberculosis drugs. The present work is on Mtb-MurC ligase, which is an enzyme involved in biosynthesis of peptidoglycan, a component of Mtb cell wall. In this paper the 3-D structure of Mtb-MurC has been constructed using the templates 1GQQ and 1P31. Structural refinement and energy minimization of the predicted Mtb-MurC ligase model has been carried out by molecular dynamics. The streochemical check failures in the energy minimized model have been evaluated through Procheck, Whatif ProSA, and Verify 3D. Further torsion angles for the side chains of amino acid residues of the developed model were determined using Predictor. Docking analysis of Mtb-MurC model with ligands and natural substrates enabled us to identify specific residues viz. Gly125, Lys126, Arg331, and Arg332, within the Mtb-MurC binding pocket to play an important role in ligand and substrate binding affinity and selectivity. The availability of Mtb-MurC ligase built model, together with insights gained from docking analysis will promote the rational design of potent and selective Mtb-MurC ligase inhibitors as antituberculosis therapeutics.
Ubiquitin protein ligase Nedd4 binds to connexin43 by a phosphorylation-modulated process.
Leykauf, Kerstin; Salek, Mojibrahman; Bomke, Jörg; Frech, Matthias; Lehmann, Wolf-Dieter; Dürst, Matthias; Alonso, Angel
2006-09-01
Connexin43 is degraded by the proteasomal as well as the lysosomal pathway with ubiquitin playing a role in both degradation pathways. So far, no ubiquitin protein ligase has been identified for any of the connexins. By using pull-down assays, here we show binding of a ubiquitin protein ligase, Nedd4, to the C-terminus of connexin43. This observation was confirmed in vivo by coimmunoprecipitation and immunofluorescence, showing colocalization of Nedd4 and connexin43. Binding of Nedd4 to its interaction partners is generally carried out by its WW domains. Our results indicate that the interaction with connexin43 occurs through all three WW domains of Nedd4. Furthermore, whereas WW1 and WW2 domains mainly interact with the unphosphorylated form of connexin43, WW3 binds phosphorylated and unphosphorylated forms equally. In addition, using the surface plasmon resonance approach we show that only the WW2 domain binds to the PY motif located at the C-terminus of connexin43. Suppression of Nedd4 expression with siRNA resulted in an accumulation of gap junction plaques at the plasma membrane, suggesting an involvement of the ubiquitin protein ligase Nedd4 in gap junction internalization.
Polymerase Chain Reaction for Detection of Systemic Plant Pathogens
USDA-ARS?s Scientific Manuscript database
This chapter outlines the advances and application of the polymerase chain reaction (PCR) since its development in 1984 and its enhancements and applications to detection of viruses, viroids and phytoplasma in pome and stone fruits. PCR is probably the most rapidly and widely adopted technology eve...
An E3 Ligase Affects the NLR Receptor Stability and Immunity to Powdery Mildew1
Chang, Cheng; Gu, Cheng; Tang, Sanyuan
2016-01-01
Following the detection of pathogen cognate effectors, plant Nod-like receptors (NLRs) trigger isolate-specific immunity that is generally associated with cell death. The regulation of NLR stability is important to ensure effective immunity. In barley (Hordeum vulgare), the allelic Mildew locus A (MLA) receptors mediate isolate-specific disease resistance against powdery mildew fungus (Blumeria graminis f. sp. hordei). Currently, how MLA stability is controlled remains unknown. Here, we identified an MLA-interacting RING-type E3 ligase, MIR1, that interacts with several MLAs. We showed that the carboxyl-terminal TPR domain of MIR1 mediates the interaction with the coiled-coil domain-containing region of functional MLAs, such as MLA1, MLA6, and MLA10, but not with that of the nonfunctional MLA18-1. MIR1 can ubiquitinate the amino-terminal region of MLAs in vitro and promotes the proteasomal degradation of MLAs in vitro and in planta. Both proteasome inhibitor treatment and virus-induced gene silencing-mediated MIR1 silencing significantly increased MLA abundance in barley transgenic lines. Furthermore, overexpression of MIR1 specifically compromised MLA-mediated disease resistance in barley, while coexpression of MIR1 and MLA10 attenuated MLA10-induced cell death signaling in Nicotiana benthamiana. Together, our data reveal a mechanism for the control of the stability of MLA immune receptors and for the attenuation of MLA-triggered defense signaling by a RING-type E3 ligase via the ubiquitin proteasome system. PMID:27780896
The plant homeodomain fingers of fission yeast Msc1 exhibit E3 ubiquitin ligase activity.
Dul, Barbara E; Walworth, Nancy C
2007-06-22
The DNA damage checkpoint pathway governs how cells regulate cell cycle progression in response to DNA damage. A screen for suppressors of a fission yeast chk1 mutant defective in the checkpoint pathway identified a novel Schizosaccharomyces pombe protein, Msc1. Msc1 contains 3 plant homeodomain (PHD) finger motifs, characteristically defined by a C4HC3 consensus similar to RING finger domains. PHD finger domains in viral proteins and in the cellular protein kinase MEKK1 (mitogen-activated protein kinase/extracellular signal-regulated kinase kinase kinase 1) have been implicated as ubiquitin E3 protein ligases that affect protein stability. The close structural relationship of PHD fingers to RING fingers suggests that other PHD domain-containing proteins might share this activity. We show that each of the three PHD fingers of Msc1 can act as ubiquitin E3 ligases, reporting for the first time that PHD fingers from a nuclear protein exhibit E3 ubiquitin ligase activity. The function of the PHD fingers of Msc1 is needed to rescue the DNA damage sensitivity of a chk1Delta strain. Msc1 co-precipitates Rhp6, the S. pombe homologue of the human ubiquitin-conjugating enzyme Ubc2. Strikingly, deletion of msc1 confers complete suppression of the slow growth phenotype, UV and hydroxyurea sensitivities of an rhp6 deletion strain and restores deficient histone H3 methylation observed in the rhp6Delta mutant. We speculate that the target of the E3 ubiquitin ligase activity of Msc1 is likely to be a chromatin-associated protein.
Sivaramakrishnan, Venkatabalasubramanian; Thiyagarajan, Chinnaiyan; Kalaivanan, Sivakumaran; Selvakumar, Raj; Anusuyadevi, Muthuswamy; Jayachandran, Kesavan Swaminathan
2012-01-01
In spite of availability of moderately protective vaccine and antibiotics, new antibacterial agents are urgently needed to decrease the global incidence of Klebsiella pneumonia infections. MurF ligase, a key enzyme, which participates in the bacterial cell wall assembly, is indispensable to existence of K. pneumonia. MurF ligase lack mammalian vis-à-vis and have high specificity, uniqueness, and occurrence only in eubacteria, epitomizing them as promising therapeutic targets for intervention. In this study, we present a unified approach involving homology modeling and molecular docking studies on MurF ligase enzyme. As part of this study, a homology model of K. pneumonia (MurF ligase) enzyme was predicted for the first time in order to carry out structurebased drug design. The accuracy of the model was further validated using different computational approaches. The comparative molecular docking study on this enzyme was undertaken using different phyto-ligands from Desmodium sp. and a known antibiotic Ciprofloxacin. The docking analysis indicated the importance of hotspots (HIS 281 and ASN 282) within the MurF binding pocket. The Lipinski's rule of five was analyzed for all ligands considered for this study by calculating the ADME/Tox, drug likeliness using Qikprop simulation. Only ten ligands were found to comply with the Lipinski rule of five. Based on the molecular docking results and Lipinki values 6-Methyltetrapterol A was confirmed as a promising lead compound. The present study should therefore play a guiding role in the experimental design and development of 6-Methyltetrapterol A as a bactericidal agent. PMID:22715301
Cerqueira, Sofia A; Tan, Min; Li, Shijun; Juillard, Franceline; McVey, Colin E; Kaye, Kenneth M; Simas, J Pedro
2016-09-01
Viruses have evolved mechanisms to hijack components of cellular E3 ubiquitin ligases, thus modulating the ubiquitination pathway. However, the biological relevance of such mechanisms for viral pathogenesis in vivo remains largely unknown. Here, we utilized murid herpesvirus 4 (MuHV-4) infection of mice as a model system to address the role of MuHV-4 latency-associated nuclear antigen (mLANA) E3 ligase activity in gammaherpesvirus latent infection. We show that specific mutations in the mLANA SOCS box (V199A, V199A/L202A, or P203A/P206A) disrupted mLANA's ability to recruit Elongin C and Cullin 5, thereby impairing the formation of the Elongin BC/Cullin 5/SOCS (EC5S(mLANA)) complex and mLANA's E3 ligase activity on host NF-κB and Myc. Although these mutations resulted in considerably reduced mLANA binding to viral terminal repeat DNA as assessed by electrophoretic mobility shift assay (EMSA), the mutations did not disrupt mLANA's ability to mediate episome persistence. In vivo, MuHV-4 recombinant viruses bearing these mLANA SOCS box mutations exhibited a deficit in latency amplification in germinal center (GC) B cells. These findings demonstrate that the E3 ligase activity of mLANA contributes to gammaherpesvirus-driven GC B cell proliferation. Hence, pharmacological inhibition of viral E3 ligase activity through targeting SOCS box motifs is a putative strategy to control gammaherpesvirus-driven lymphoproliferation and associated disease. The gammaherpesviruses Epstein-Barr virus (EBV) and Kaposi's sarcoma-associated herpesvirus (KSHV) cause lifelong persistent infection and play causative roles in several human malignancies. Colonization of B cells is crucial for virus persistence, and access to the B cell compartment is gained by virus-driven proliferation in germinal center (GC) B cells. Infection of B cells is predominantly latent, with the viral genome persisting as a multicopy episome and expressing only a small subset of viral genes. Here, we focused on
Contribution of CoA Ligases to Benzenoid Biosynthesis in Petunia Flowers[W
Klempien, Antje; Kaminaga, Yasuhisa; Qualley, Anthony; Nagegowda, Dinesh A.; Widhalm, Joshua R.; Orlova, Irina; Shasany, Ajit Kumar; Taguchi, Goro; Kish, Christine M.; Cooper, Bruce R.; D’Auria, John C.; Rhodes, David; Pichersky, Eran; Dudareva, Natalia
2012-01-01
Biosynthesis of benzoic acid from Phe requires shortening of the side chain by two carbons, which can occur via the β-oxidative or nonoxidative pathways. The first step in the β-oxidative pathway is cinnamoyl-CoA formation, likely catalyzed by a member of the 4-coumarate:CoA ligase (4CL) family that converts a range of trans-cinnamic acid derivatives into the corresponding CoA thioesters. Using a functional genomics approach, we identified two potential CoA-ligases from petunia (Petunia hybrida) petal-specific cDNA libraries. The cognate proteins share only 25% amino acid identity and are highly expressed in petunia corollas. Biochemical characterization of the recombinant proteins revealed that one of these proteins (Ph-4CL1) has broad substrate specificity and represents a bona fide 4CL, whereas the other is a cinnamate:CoA ligase (Ph-CNL). RNA interference suppression of Ph-4CL1 did not affect the petunia benzenoid scent profile, whereas downregulation of Ph-CNL resulted in a decrease in emission of benzylbenzoate, phenylethylbenzoate, and methylbenzoate. Green fluorescent protein localization studies revealed that the Ph-4CL1 protein is localized in the cytosol, whereas Ph-CNL is in peroxisomes. Our results indicate that subcellular compartmentalization of enzymes affects their involvement in the benzenoid network and provide evidence that cinnamoyl-CoA formation by Ph-CNL in the peroxisomes is the committed step in the β-oxidative pathway. PMID:22649270
Xie, Wei-Qi; Gong, Yi-Xian; Yu, Kong-Xian
2017-10-20
This work investigates an automated technique for rapid detecting the glucose content in glucose injection by reaction headspace gas chromatography (HS-GC). This method is based on the oxidation reaction of glucose in glucose injection with potassium dichromate. The carbon dioxide (CO 2 ) formed from the oxidation reaction can be quantitatively detected by GC. The results show that the relative standard deviation (RSD) of the present method was within 2.91%, and the measured glucose contents in glucose injection closely match those quantified by the reference method (relative differences <6.45%). The new HS-GC technique is rapid, practical and can be used to the batch detection of the glucose content in glucose injection related applications. Copyright © 2017 Elsevier B.V. All rights reserved.
Suzuki, Shiho; Mimuro, Hitomi; Kim, Minsoo; Ogawa, Michinaga; Ashida, Hiroshi; Toyotome, Takahito; Franchi, Luigi; Suzuki, Masato; Sanada, Takahito; Suzuki, Toshihiko; Tsutsui, Hiroko; Núñez, Gabriel; Sasakawa, Chihiro
2014-01-01
When nucleotide-binding oligomerization domain–like receptors (NLRs) sense cytosolic-invading bacteria, they induce the formation of inflammasomes and initiate an innate immune response. In quiescent cells, inflammasome activity is tightly regulated to prevent excess inflammation and cell death. Many bacterial pathogens provoke inflammasome activity and induce inflammatory responses, including cell death, by delivering type III secreted effectors, the rod component flagellin, and toxins. Recent studies indicated that Shigella deploy multiple mechanisms to stimulate NLR inflammasomes through type III secretion during infection. Here, we show that Shigella induces rapid macrophage cell death by delivering the invasion plasmid antigen H7.8 (IpaH7.8) enzyme 3 (E3) ubiquitin ligase effector via the type III secretion system, thereby activating the NLR family pyrin domain-containing 3 (NLRP3) and NLR family CARD domain-containing 4 (NLRC4) inflammasomes and caspase-1 and leading to macrophage cell death in an IpaH7.8 E3 ligase-dependent manner. Mice infected with Shigella possessing IpaH7.8, but not with Shigella possessing an IpaH7.8 E3 ligase-null mutant, exhibited enhanced bacterial multiplication. We defined glomulin/flagellar-associated protein 68 (GLMN) as an IpaH7.8 target involved in IpaH7.8 E3 ligase-dependent inflammasome activation. This protein originally was identified through its association with glomuvenous malformations and more recently was described as a member of a Cullin ring ligase inhibitor. Modifying GLMN levels through overexpression or knockdown led to reduced or augmented inflammasome activation, respectively. Macrophages stimulated with lipopolysaccharide/ATP induced GLMN puncta that localized with the active form of caspase-1. Macrophages from GLMN+/− mice were more responsive to inflammasome activation than those from GLMN+/+ mice. Together, these results highlight a unique bacterial adaptation that hijacks inflammasome activation via
Nie, Jing; Xie, Ping; Liu, Lin; Xing, Guichun; Chang, Zhijie; Yin, Yuxin; Tian, Chunyan; He, Fuchu; Zhang, Lingqiang
2010-01-01
The tumor suppressor p53 protein is tightly regulated by a ubiquitin-proteasomal degradation mechanism. Several E3 ubiquitin ligases, including MDM2 (mouse double minute 2), have been reported to play an essential role in the regulation of p53 stability. However, it remains unclear how the activity of these E3 ligases is regulated. Here, we show that the HECT-type E3 ligase Smurf1/2 (Smad ubiquitylation regulatory factor 1/2) promotes p53 degradation by enhancing the activity of the E3 ligase MDM2. We provide evidence that the role of Smurf1/2 on the p53 stability is not dependent on the E3 activity of Smurf1/2 but rather is dependent on the activity of MDM2. We find that Smurf1/2 stabilizes MDM2 by enhancing the heterodimerization of MDM2 with MDMX, during which Smurf1/2 interacts with MDM2 and MDMX. We finally provide evidence that Smurf1/2 regulates apoptosis through p53. To our knowledge, this is the first report to demonstrate that Smurf1/2 functions as a factor to stabilize MDM2 protein rather than as a direct E3 ligase in regulation of p53 degradation. PMID:20484049
Fluorogenic, catalytic, photochemical reaction for amplified detection of nucleic acids.
Dutta, Subrata; Fülöp, Annabelle; Mokhir, Andriy
2013-09-18
Photochemical, nucleic acid-induced reactions, which are controlled by nontoxic red light, are well-suited for detection of nucleic acids in live cells, since they do not require any additives and can be spatially and temporally regulated. We have recently described the first reaction of this type, in which a phenylselenyl derivative of thymidine (5'-PhSeT-ODNa) is cleaved in the presence of singlet oxygen (Fülöp, A., Peng, X., Greenberg, M. M., Mokhir, A. (2010) A nucleic acid directed, red light-induced chemical reaction. Chem. Commun. 46, 5659-5661). The latter reagent is produced upon exposure of a photosensitizer 3'-PS-ODNb (PS = Indium(III)-pyropheophorbide-a-chloride: InPPa) to >630 nm light. In 2012 we reported on a fluorogenic version of this reaction (Dutta, S., Flottmann, B., Heilemann, M., Mokhir, A. (2012) Hybridization and reaction-based, fluorogenic nucleic acid probes. Chem. Commun. 47, 9664-9666), which is potentially applicable for the detection of nucleic acids in cells. Unfortunately, its yield does not exceed 25% and no catalytic turnover could be observed in the presence of substrate excess. This problem occurs due to the efficient, competing oxidation of the substrate containing an electron rich carbon-carbon double bonds (SCH═CHS) in the presence of singlet oxygen with formation of a noncleavable product (SCH═CHSO). Herein we describe a related, but substantially improved photochemical, catalytic transformation of a fluorogenic, organic substrate, which consists of 9,10-dialkoxyanthracene linked to fluorescein, with formation of a bright fluorescent dye. In highly dilute solution this reaction occurs only in the presence of a nucleic acid template. We developed three types of such a reaction and demonstrated that they are high yielding and generate over 7.7 catalytic turnovers, are sensitive to single mismatches in nucleic acid targets, and can be applied for determination of both the amount of nucleic acids and potentially their
Zhou, Weihua; Wei, Wenyi; Sun, Yi
2013-05-01
The SCF (SKP1 (S-phase-kinase-associated protein 1), Cullin-1, F-box protein) E3 ubiquitin ligases, the founding member of Cullin-RING ligases (CRLs), are the largest family of E3 ubiquitin ligases in mammals. Each individual SCF E3 ligase consists of one adaptor protein SKP1, one scaffold protein cullin-1 (the first family member of the eight cullins), one F-box protein out of 69 family members, and one out of two RING (Really Interesting New Gene) family proteins RBX1/ROC1 or RBX2/ROC2/SAG/RNF7. Various combinations of these four components construct a large number of SCF E3s that promote the degradation of many key regulatory proteins in cell-context, temporally, and spatially dependent manners, thus controlling precisely numerous important cellular processes, including cell cycle progression, apoptosis, gene transcription, signal transduction, DNA replication, maintenance of genome integrity, and tumorigenesis. To understand how the SCF E3 ligases regulate these cellular processes and embryonic development under in vivo physiological conditions, a number of mouse models with transgenic (Tg) expression or targeted deletion of components of SCF have been established and characterized. In this review, we will provide a brief introduction to the ubiquitin-proteasome system (UPS) and the SCF E3 ubiquitin ligases, followed by a comprehensive overview on the existing Tg and knockout (KO) mouse models of the SCF E3s, and discuss the role of each component in mouse embryogenesis, cell proliferation, apoptosis, carcinogenesis, as well as other pathogenic processes associated with human diseases. We will end with a brief discussion on the future directions of this research area and the potential applications of the knowledge gained to more effective therapeutic interventions of human diseases.
Hermes, Fatemah A; Cronan, John E
2013-10-01
The covalent attachment of lipoate to the lipoyl domains (LDs) of the central metabolism enzymes pyruvate dehydrogenase (PDH) and oxoglutarate dehydrogenase (OGDH) is essential for their activation and thus for respiratory growth in Saccharomyces cerevisiae. A third lipoate-dependent enzyme system, the glycine cleavage system (GCV), is required for utilization of glycine as a nitrogen source. Lipoate is synthesized by extraction of its precursor, octanoyl-acyl carrier protein (ACP), from the pool of fatty acid biosynthetic intermediates. Alternatively, lipoate is salvaged from previously modified proteins or from growth medium by lipoate protein ligases (Lpls). The first Lpl to be characterized, LplA of Escherichia coli, catalyses two partial reactions: activation of the acyl chain by formation of acyl-AMP, followed by transfer of the acyl chain to lipoyl domains (LDs). There is a surprising diversity within the Lpl family of enzymes, several of which catalyse reactions other than ligation reactions. For example, the Bacillus subtilis Lpl homologue LipM is an octanoyltransferase that transfers the octanoyl moiety from octanoyl-ACP to GCV. Another B. subtilis Lpl homologue, LipL, transfers octanoate from octanoyl-GCV to other LDs in an amido-transfer reaction. Study of eukaryotic Lpls has lagged behind studies of the bacterial enzymes. We report that the Lip3 Lpl homologue of the yeast S. cerevisiae has octanoyl-CoA-protein transferase activity, and discuss implications of this activity on the physiological role of Lip3 in lipoate synthesis. Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
Colorimetric Detection of Specific DNA Segments Amplified by Polymerase Chain Reactions
NASA Astrophysics Data System (ADS)
Kemp, David J.; Smith, Donald B.; Foote, Simon J.; Samaras, N.; Peterson, M. Gregory
1989-04-01
The polymerase chain reaction (PCR) procedure has many potential applications in mass screening. We describe here a general assay for colorimetric detection of amplified DNA. The target DNA is first amplified by PCR, and then a second set of oligonucleotides, nested between the first two, is incorporated by three or more PCR cycles. These oligonucleotides bear ligands: for example, one can be biotinylated and the other can contain a site for a double-stranded DNA-binding protein. After linkage to an immobilized affinity reagent (such as a cloned DNA-binding protein, which we describe here) and labeling with a second affinity reagent (for example, avidin) linked to horseradish peroxidase, reaction with a chromogenic substrate allows detection of the amplified DNA. This amplified DNA assay (ADA) is rapid, is readily applicable to mass screening, and uses routine equipment. We show here that it can be used to detect human immunodeficiency virus sequences specifically against a background of human DNA.
Identification of Arabidopsis MYB56 as a novel substrate for CRL3(BPM) E3 ligases.
Chen, Liyuan; Bernhardt, Anne; Lee, JooHyun; Hellmann, Hanjo
2015-02-01
Controlled stability of proteins is a highly efficient mechanism to direct diverse processes in living cells. A key regulatory system for protein stability is given by the ubiquitin proteasome pathway, which uses E3 ligases to mark specific proteins for degradation. In this work, MYB56 is identified as a novel target of a CULLIN3 (CUL3)-based E3 ligase. Its stability depends on the presence of MATH-BTB/POZ (BPM) proteins, which function as substrate adaptors to the E3 ligase. Genetic studies have indicated that MYB56 is a negative regulator of flowering, while BPMs positively affect this developmental program. The interaction between BPMs and MYB56 occurs at the promoter of FLOWERING LOCUS T (FT), a key regulator in initiating flowering in Arabidopsis, and results in instability of MYB56. Overall the work establishes MYB transcription factors as substrates of BPM proteins, and provides novel information on components that participate in controlling flowering time in plants. Copyright © 2015 The Author. Published by Elsevier Inc. All rights reserved.
DNA damage induced by boron neutron capture therapy is partially repaired by DNA ligase IV.
Kondo, Natsuko; Sakurai, Yoshinori; Hirota, Yuki; Tanaka, Hiroki; Watanabe, Tsubasa; Nakagawa, Yosuke; Narabayashi, Masaru; Kinashi, Yuko; Miyatake, Shin-ichi; Hasegawa, Masatoshi; Suzuki, Minoru; Masunaga, Shin-ichiro; Ohnishi, Takeo; Ono, Koji
2016-03-01
Boron neutron capture therapy (BNCT) is a particle radiation therapy that involves the use of a thermal or epithermal neutron beam in combination with a boron ((10)B)-containing compound that specifically accumulates in tumor. (10)B captures neutrons and the resultant fission reaction produces an alpha ((4)He) particle and a recoiled lithium nucleus ((7)Li). These particles have the characteristics of high linear energy transfer (LET) radiation and therefore have marked biological effects. High-LET radiation is a potent inducer of DNA damage, specifically of DNA double-strand breaks (DSBs). The aim of the present study was to clarify the role of DNA ligase IV, a key player in the non-homologous end-joining repair pathway, in the repair of BNCT-induced DSBs. We analyzed the cellular sensitivity of the mouse embryonic fibroblast cell lines Lig4-/- p53-/- and Lig4+/+ p53-/- to irradiation using a thermal neutron beam in the presence or absence of (10)B-para-boronophenylalanine (BPA). The Lig4-/- p53-/- cell line had a higher sensitivity than the Lig4+/+ p53-/-cell line to irradiation with the beam alone or the beam in combination with BPA. In BNCT (with BPA), both cell lines exhibited a reduction of the 50 % survival dose (D 50) by a factor of 1.4 compared with gamma-ray and neutron mixed beam (without BPA). Although it was found that (10)B uptake was higher in the Lig4+/+ p53-/- than in the Lig4-/- p53-/- cell line, the latter showed higher sensitivity than the former, even when compared at an equivalent (10)B concentration. These results indicate that BNCT-induced DNA damage is partially repaired using DNA ligase IV.
Perdih, Andrej; Hodoscek, Milan; Solmajer, Tom
2009-02-15
MurD (UDP-N-acetylmuramoyl-L-alanine:D-glutamate ligase), a three-domain bacterial protein, catalyses a highly specific incorporation of D-glutamate to the cytoplasmic intermediate UDP-N-acetyl-muramoyl-L-alanine (UMA) utilizing ATP hydrolysis to ADP and P(i). This reaction is part of a biosynthetic path yielding bacterial peptidoglycan. On the basis of structural studies of MurD complexes, a stepwise catalytic mechanism was proposed that commences with a formation of the acyl-phosphate intermediate, followed by a nucleophilic attack of D-glutamate that, through the formation of a tetrahedral reaction intermediate and subsequent phosphate dissociation, affords the final product, UDP-N-acetyl-muramoyl-L-alanine-D-glutamate (UMAG). A hybrid quantum mechanical/molecular mechanical (QM/MM) molecular modeling approach was utilized, combining the B3LYP QM level of theory with empirical force field simulations to evaluate three possible reaction pathways leading to tetrahedral intermediate formation. Geometries of the starting structures based on crystallographic experimental data and tetrahedral intermediates were carefully examined together with a role of crucial amino acids and water molecules. The replica path method was used to generate the reaction pathways between the starting structures and the corresponding tetrahedral reaction intermediates, offering direct comparisons with a sequential kinetic mechanism and the available structural data for this enzyme. The acquired knowledge represents new and valuable information to assist in the ongoing efforts leading toward novel inhibitors of MurD as potential antibacterial drugs. (c) 2008 Wiley-Liss, Inc.
Kaddi, Chanchala D.; Bennett, Rachel V.; Paine, Martin R. L.; Banks, Mitchel D.; Weber, Arthur L.; Fernández, Facundo M.; Wang, May D.
2016-01-01
Full characterization of complex reaction mixtures is necessary to understand mechanisms, optimize yields, and elucidate secondary reaction pathways. Molecular-level information for species in such mixtures can be readily obtained by coupling mass spectrometry imaging (MSI) with thin layer chromatography (TLC) separations. User-guided investigation of imaging data for mixture components with known m/z values is generally straightforward; however, spot detection for unknowns is highly tedious, and limits the applicability of MSI in conjunction with TLC. To accelerate imaging data mining, we developed DetectTLC, an approach that automatically identifies m/z values exhibiting TLC spot-like regions in MS molecular images. Furthermore, DetectTLC can also spatially match m/z values for spots acquired during alternating high and low collision-energy scans, pairing product ions with precursors to enhance structural identification. As an example, DetectTLC is applied to the identification and structural confirmation of unknown, yet significant, products of abiotic pyrazinone and aminopyrazine nucleoside analog synthesis. PMID:26508443
Fu, Changlin; Donovan, William P; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H
2014-01-01
Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17-30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50 °C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90-95%.
Yi, Ping; Chen, Zhuqin; Zhao, Yan; Guo, Jianxin; Fu, Huabin; Zhou, Yuanguo; Yu, Lili; Li, Li
2009-03-01
The discovery of fetal DNA in maternal plasma has opened up an approach for noninvasive diagnosis. We have now assessed the possibility of detecting single-nucleotide differences between fetal and maternal DNA in maternal plasma by polymerase chain reaction (PCR)/ligase detection reaction((LDR)/capillary electrophoresis. PCR/LDR/capillary electrophoresis was applied to detect the genotype of c.454-397T>gene (ESR1) from experimental DNA models of maternal plasma at different sensitivity levels and 13 maternal plasma samples.alphaC in estrogen receptor. (1) Our results demonstrated that the technique could discriminate low abundance single-nucleotide mutation with a mutant/normal allele ratio up to 1:10 000. (2) Examination of ESR1 c.454-397T>C genotypes by using the method of restriction fragment length analysis was performed in 25 pregnant women, of whom 13 pregnant women had homozygous genotypes. The c.454-397T>C genotypes of paternally inherited fetal DNA in maternal plasma of these 13 women were detected by PCR/LDR/capillary electrophoresis, which were accordant with the results of umbilical cord blood. PCR/LDR/capillary electrophoresis has very high sensitivity to distinguish low abundance single nucleotide differences and can discriminate point mutations and single-nucleotide polymorphisms(SNPs) of paternally inherited fetal DNA in maternal plasma.
Inhibitors of ubiquitin E3 ligase as potential new antimalarial drug leads
USDA-ARS?s Scientific Manuscript database
The ubiquitin/proteasome pathway is the principal system for degradation of proteins in eukaryotes. Ubiquitin is a highly conserved polypeptide that covalently attaches to target proteins through the combined action ofubiquitin-activating enzyme (E1), conjugating enzyme (E2) and a protein ligase (E...
Jiménez-López, Domingo; Aguilar-Henonin, Laura; González-Prieto, Juan Manuel; Aguilar-Hernández, Victor; Guzmán, Plinio
2018-01-01
RING ubiquitin E3 ligases enclose a RING domain for ubiquitin ligase activity and associated domains and/or conserved motifs outside the RING domain that collectively facilitate their classification and usually reveal some of key information related to mechanism of action. Here we describe a new family of E3 ligases that encodes a RING-H2 domain related in sequence to the ATL and BTL RING-H2 domains. This family, named CTL, encodes a motif designed as YEELL that expands 21 amino acids next to the RING-H2 domain that is present across most eukaryotic lineages. E3 ubiquitin ligase BIG BROTHER is a plant CTL that regulates organ size, and SUMO-targeted ubiquitin E3 ligase RNF111/ARKADIA is a vertebrate CTL. Basal animal and vertebrate, as well as fungi species, encode a single CTL gene that constraints the number of paralogs observed in vertebrates. Conversely, as previously described in ATL and BTL families in plants, CTL genes range from a single copy in green algae and 3 to 5 copies in basal species to 9 to 35 copies in angiosperms. Our analysis describes key structural features of a novel family of E3 ubiquitin ligases as an integral component of the set of core eukaryotic genes.
Jiménez-López, Domingo; Aguilar-Henonin, Laura; González-Prieto, Juan Manuel; Aguilar-Hernández, Victor
2018-01-01
RING ubiquitin E3 ligases enclose a RING domain for ubiquitin ligase activity and associated domains and/or conserved motifs outside the RING domain that collectively facilitate their classification and usually reveal some of key information related to mechanism of action. Here we describe a new family of E3 ligases that encodes a RING-H2 domain related in sequence to the ATL and BTL RING-H2 domains. This family, named CTL, encodes a motif designed as YEELL that expands 21 amino acids next to the RING-H2 domain that is present across most eukaryotic lineages. E3 ubiquitin ligase BIG BROTHER is a plant CTL that regulates organ size, and SUMO-targeted ubiquitin E3 ligase RNF111/ARKADIA is a vertebrate CTL. Basal animal and vertebrate, as well as fungi species, encode a single CTL gene that constraints the number of paralogs observed in vertebrates. Conversely, as previously described in ATL and BTL families in plants, CTL genes range from a single copy in green algae and 3 to 5 copies in basal species to 9 to 35 copies in angiosperms. Our analysis describes key structural features of a novel family of E3 ubiquitin ligases as an integral component of the set of core eukaryotic genes. PMID:29324855
Tuning BRCA1 and BARD1 activity to investigate RING ubiquitin ligase mechanisms.
Stewart, Mikaela D; Duncan, Emily D; Coronado, Ernesto; DaRosa, Paul A; Pruneda, Jonathan N; Brzovic, Peter S; Klevit, Rachel E
2017-03-01
The tumor-suppressor protein BRCA1 works with BARD1 to catalyze the transfer of ubiquitin onto protein substrates. The N-terminal regions of BRCA1 and BARD1 that contain their RING domains are responsible for dimerization and ubiquitin ligase activity. This activity is a common feature among hundreds of human RING domain-containing proteins. RING domains bind and activate E2 ubiquitin-conjugating enzymes to promote ubiquitin transfer to substrates. We show that the identity of residues at specific positions in the RING domain can tune activity levels up or down. We report substitutions that create a structurally intact BRCA1/BARD1 heterodimer that is inactive in vitro with all E2 enzymes. Other substitutions in BRCA1 or BARD1 RING domains result in hyperactivity, revealing that both proteins have evolved attenuated activity. Loss of attenuation results in decreased product specificity, providing a rationale for why nature has tuned BRCA1 activity. The ability to tune BRCA1 provides powerful tools for understanding its biological functions and provides a basis to assess mechanisms for rescuing the activity of cancer-associated variations. Beyond the applicability to BRCA1, we show the identity of residues at tuning positions that can be used to predict and modulate the activity of an unrelated RING E3 ligase. These findings provide valuable insights into understanding the mechanism and function of RING E3 ligases like BRCA1. © 2017 The Protein Society.
Biotin and fluorescent labeling of RNA using T4 RNA ligase.
Richardson, R W; Gumport, R I
1983-01-01
Biotin, fluorescein, and tetramethylrhodamine derivatives of P1-(6-aminohex-1-yl)-P2-(5'-adenosine) pyrophosphate were synthesized and used as substrates with T4 RNA ligase. In the absence of ATP, the non-adenylyl portion of these substrates is transferred to the 3'-hydroxyl of an RNA acceptor to form a phosphodiester bond and the AMP portion is released. E. coli and D. melanogaster 5S RNA, yeast tRNAPhe, (Ap)3C, and (Ap)3A serve as acceptors with yields of products varying from 50 to 100%. Biotin-labeled oligonucleotides are bound selectively and quantitatively to avidin-agarose and may be eluted with 6 M guanidine hydrochloride, pH 2.5. Fluorescein and tetramethylrhodamine-labeled oligonucleotides are highly fluorescent and show no quenching due to attachment to the acceptor. The diverse structures of the appended groups and of the chain lengths and compositions of the acceptor RNAs show that T4 RNA ligase will be a useful modification reagent for the addition of various functional groups to the 3'-terminus of RNA molecules. Images PMID:6194506
Rashid, Ishtiaque; Tomkinson, Alan E.; Pederson, David S.
2017-01-01
Reactive oxygen species generate potentially cytotoxic and mutagenic lesions in DNA, both between and within the nucleosomes that package DNA in chromatin. The vast majority of these lesions are subject to base excision repair (BER). Enzymes that catalyze the first three steps in BER can act at many sites in nucleosomes without the aid of chromatin-remodeling agents and without irreversibly disrupting the host nucleosome. Here we show that the same is true for a protein complex comprising DNA ligase IIIα and the scaffolding protein X-ray repair cross-complementing protein 1 (XRCC1), which completes the fourth and final step in (short-patch) BER. Using in vitro assembled nucleosomes containing discretely positioned DNA nicks, our evidence indicates that the ligase IIIα-XRCC1 complex binds to DNA nicks in nucleosomes only when they are exposed by periodic, spontaneous partial unwrapping of DNA from the histone octamer; that the scaffolding protein XRCC1 enhances the ligation; that the ligation occurs within a complex that ligase IIIα-XRCC1 forms with the host nucleosome; and that the ligase IIIα-XRCC1-nucleosome complex decays when ligation is complete, allowing the host nucleosome to return to its native configuration. Taken together, our results illustrate ways in which dynamic properties intrinsic to nucleosomes may contribute to the discovery and efficient repair of base damage in chromatin. PMID:28184006
Sorting of a multi-subunit ubiquitin ligase complex in the endolysosome system
Yang, Xi; Arines, Felichi Mae; Zhang, Weichao
2018-01-01
The yeast Dsc E3 ligase complex has long been recognized as a Golgi-specific protein ubquitination system. It shares a striking sequence similarity to the Hrd1 complex that plays critical roles in the ER-associated degradation pathway. Using biochemical purification and mass spectrometry, we identified two novel Dsc subunits, which we named as Gld1 and Vld1. Surprisingly, Gld1 and Vld1 do not coexist in the same complex. Instead, they compete with each other to form two functionally independent Dsc subcomplexes. The Vld1 subcomplex takes the AP3 pathway to reach the vacuole membrane, whereas the Gld1 subcomplex travels through the VPS pathway and is cycled between Golgi and endosomes by the retromer. Thus, instead of being Golgi-specific, the Dsc complex can regulate protein levels at three distinct organelles, namely Golgi, endosome, and vacuole. Our study provides a novel model of achieving multi-tasking for transmembrane ubiquitin ligases with interchangeable trafficking adaptors. PMID:29355480
Probes of Ubiquitin E3 ligases distinguish different stages of Parkin activation
Pao, Kuan-Chuan; Stanley, Mathew; Han, Cong; Lai, Yu-Chiang; Murphy, Paul; Balk, Kristin; Wood, Nicola T.; Corti, Olga; Corvol, Jean-Christophe; Muqit, Miratul M.K.; Virdee, Satpal
2016-01-01
E3 ligases represent an important class of enzymes, yet there are currently no chemical probes to profile their activity. We develop a new class of activity-based probe by reengineering of a ubiquitin-charged E2 conjugating enzyme and demonstrate their utility by profiling the transthiolation activity of the RING-in-between-RING (RBR) E3 ligase Parkin in vitro and in cellular extracts. Our study provides valuable insight into the roles, and cellular hierarchy, of distinct phosphorylation events in Parkin activation. We also profile Parkin patient disease-associated mutations and strikingly demonstrate that they largely mediate their effect by altering transthiolation activity. Furthermore, our probes enable direct and quantitative measurement of endogenous Parkin activity revealing that endogenous Parkin is activated in neuronal cell lines (≥75 %) in response to mitochondrial depolarization. This new technology also holds promise as a novel biomarker of PINK1-Parkin signalling as demonstrated by compatibility with Parkinson’s disease patient-derived samples. PMID:26928937
Mechanism and regulation of mycobactin fatty acyl-AMP ligase FadD33.
Vergnolle, Olivia; Xu, Hua; Blanchard, John S
2013-09-27
Mycobacterial siderophores are critical components for bacterial virulence in the host. Pathogenic mycobacteria synthesize iron chelating siderophores named mycobactin and carboxymycobactin to extract intracellular macrophage iron. The two siderophores differ in structure only by a lipophilic aliphatic chain attached on the ε-amino group of the lysine mycobactin core, which is transferred by MbtK. Prior to acyl chain transfer, the lipophilic chain requires activation by a specific fatty acyl-AMP ligase FadD33 (also known as MbtM) and is then loaded onto phosphopantetheinylated acyl carrier protein (holo-MbtL) to form covalently acylated MbtL. We demonstrate that FadD33 prefers long chain saturated lipids and initial velocity studies showed that FadD33 proceeds via a Bi Uni Uni Bi ping-pong mechanism. Inhibition experiments suggest that, during the first half-reaction (adenylation), fatty acid binds first to the free enzyme, followed by ATP and the release of pyrophosphate to form the adenylate intermediate. During the second half-reaction (ligation), holo-MbtL binds to the enzyme followed by the release of products AMP and acylated MbtL. In addition, we characterized a post-translational regulation mechanism of FadD33 by the mycobacterial protein lysine acetyltransferase in a cAMP-dependent manner. FadD33 acetylation leads to enzyme inhibition, which can be reversed by the NAD(+)-dependent deacetylase, MSMEG_5175 (DAc1). To the best of our knowledge, this is the first time that bacterial siderophore synthesis has been shown to be regulated via post-translational protein acetylation.
Credo, Grace M; Su, Xing; Wu, Kai; Elibol, Oguz H; Liu, David J; Reddy, Bobby; Tsai, Ta-Wei; Dorvel, Brian R; Daniels, Jonathan S; Bashir, Rashid; Varma, Madoo
2012-03-21
We introduce a label-free approach for sensing polymerase reactions on deoxyribonucleic acid (DNA) using a chelator-modified silicon-on-insulator field-effect transistor (SOI-FET) that exhibits selective and reversible electrical response to pyrophosphate anions. The chemical modification of the sensor surface was designed to include rolling-circle amplification (RCA) DNA colonies for locally enhanced pyrophosphate (PPi) signal generation and sensors with immobilized chelators for capture and surface-sensitive detection of diffusible reaction by-products. While detecting arrays of enzymatic base incorporation reactions is typically accomplished using optical fluorescence or chemiluminescence techniques, our results suggest that it is possible to develop scalable and portable PPi-specific sensors and platforms for broad biomedical applications such as DNA sequencing and microbe detection using surface-sensitive electrical readout techniques.
Chakkyarath, Vijina; Natarajan, Jeyakumar
2017-10-31
Enterobacter aerogenes have been reported as important opportunistic and multi-resistant bacterial pathogens for humans during the last three decades in hospital wards. The emergence of drug-resistant E. aerogenes demands the need for developing new drugs. Peptidoglycan is an important component of the cell wall of bacteria and the peptidoglycan biochemical pathway is considered as the best source of antibacterial targets. Within this pathway, four Mur ligases MurC, MurD, MurE, and MurF are responsible for the successive additions of L-alanine and suitable targets for developing novel antibacterial drugs. As an inference from this fact, we modeled the three-dimensional structure of above Mur ligases using best template structures available in PDB and analyzed its common binding features. Structural refinement and energy minimization of the predicted Mur ligases models is also being done using molecular dynamics studies. The models of Mur ligases were further investigated for in silico docking studies using bioactive plant compounds from the literature. Interestingly, these results indicate that four plant compounds Isojuripidine, Atroviolacegenin, Porrigenin B, and Nummularogenin showing better docking results in terms of binding energy and number of hydrogen bonds. All these four compounds are spirostan-based compounds with differences in side chains and the amino acid such as ASN, LYS, THR, HIS, ARG (polar) and PHE, GLY, VAL, ALA, MET (non-polar) playing active role in binding site of all four Mur ligases. Overall, in the predicted model, the four plant compounds with its binding features could pave way to design novel multi-targeted antibacterial plant-based bioactive compounds specific to Mur ligases for the treatment of Enterobacter infections.
Denham, K; Milofsky, R E
1998-10-01
A postcolumn photochemical reaction detection scheme, based on the reaction of 3-substituted pyrroles with singlet molecular oxygen ((1)O(2)), has been developed. The method is selective and sensitive for the determination of a class of organic compounds called (1)O(2)-sensitizers and is readily coupled to HPLC. Following separation by HPLC, analytes ((1)O(2)-sensitizers) are excited by a Hg pen-ray lamp. Analytes that are efficient (1)O(2)-sensitizers promote ground-state O(2) ((3)Σ(g)(-)) to an excited state ((1)Σ(g)(+) or (1)Δ(g)), which reacts rapidly with tert-butyl-3,4,5-trimethylpyrrolecarboxylate (BTMPC) or N-benzyl-3-methoxypyrrole-2-tert-carboxylate (BMPC), which is added to the mobile phase. Detection is based on the loss of pyrrole (BTMPC or BMPC). The reaction is catalytic in nature since one analyte molecule may absorb light many times, producing large amounts of (1)O(2). Detection limits for several (1)O(2)-sensitizers were improved by 1-2 orders of magnitude over optimized UV-absorbance detection. This paper discusses the optimization of the reaction conditions for this photochemical reaction detection scheme and its application to the detection of PCBs, nitrogen heterocycles, nitro and chloro aromatics, and other substituted aromatic compounds.
Covalent ISG15 conjugation positively regulates the ubiquitin E3 ligase activity of parkin
Im, Eunju; Yoo, Lang; Hyun, Minju; Shin, Woo Hyun
2016-01-01
Parkinson's disease (PD) is characterized by selective loss of dopaminergic neurons in the pars compacta of the substantia nigra and accumulation of ubiquitinated proteins in aggregates called Lewy bodies. Several mutated genes have been found in familial PD patients, including SNCA (α-synuclein), PARK2 (parkin), PINK1, PARK7 (DJ-1), LRRK2 and ATP13A2. Many pathogenic mutations of PARK2, which encodes the ubiquitin E3 ligase parkin, result in loss of function, leading to accumulation of parkin substrates and consequently contributing to dopaminergic cell death. ISG15 is a member of the ubiquitin-like modifier family and is induced by stimulation with type I interferons. Similar to ubiquitin and ubiquitination, covalent conjugation of ISG15 to target proteins (ISGylation) regulates their biochemical properties. In this study, we identified parkin as a novel target of ISGylation specifically mediated by the ISG15-E3 ligase HERC5. In addition, we identified two ISGylation sites, Lys-349 and Lys-369, in the in-between-ring domain of parkin. ISGylation of these sites promotes parkin's ubiquitin E3 ligase activity by suppressing the intramolecular interaction that maintains its autoinhibited conformation and increases its cytoprotective effect. In conclusion, covalent ISG15 conjugation is a novel mode of modulating parkin activity, and alteration in this pathway may be associated with PD pathogenesis. PMID:27534820
Covalent ISG15 conjugation positively regulates the ubiquitin E3 ligase activity of parkin.
Im, Eunju; Yoo, Lang; Hyun, Minju; Shin, Woo Hyun; Chung, Kwang Chul
2016-08-01
Parkinson's disease (PD) is characterized by selective loss of dopaminergic neurons in the pars compacta of the substantia nigra and accumulation of ubiquitinated proteins in aggregates called Lewy bodies. Several mutated genes have been found in familial PD patients, including SNCA (α-synuclein), PARK2 (parkin), PINK1, PARK7 (DJ-1), LRRK2 and ATP13A2 Many pathogenic mutations of PARK2, which encodes the ubiquitin E3 ligase parkin, result in loss of function, leading to accumulation of parkin substrates and consequently contributing to dopaminergic cell death. ISG15 is a member of the ubiquitin-like modifier family and is induced by stimulation with type I interferons. Similar to ubiquitin and ubiquitination, covalent conjugation of ISG15 to target proteins (ISGylation) regulates their biochemical properties. In this study, we identified parkin as a novel target of ISGylation specifically mediated by the ISG15-E3 ligase HERC5. In addition, we identified two ISGylation sites, Lys-349 and Lys-369, in the in-between-ring domain of parkin. ISGylation of these sites promotes parkin's ubiquitin E3 ligase activity by suppressing the intramolecular interaction that maintains its autoinhibited conformation and increases its cytoprotective effect. In conclusion, covalent ISG15 conjugation is a novel mode of modulating parkin activity, and alteration in this pathway may be associated with PD pathogenesis. © 2016 The Authors.
Method and compositions for detecting of bloodstains using fluorescin-fluorescein reaction
Di Benedetto, John; Kyle, Kevin; Boan, Terry; Marie, Charlene
2004-02-17
A method, compositions and kit are set forth for detecting blood stains. A reactant solution includes fluorescin solubilized (reduced) in acetic acid in ethanol. The solution may be buffered to a pH of approximately 9. After spraying the reactant solution on the suspected area an oxidizer is applied to promote the fluorescin to fluorescein reaction with the blood. The reacted fluorescein is then detected through luminescence for capture by photography.
New strategies to inhibit KEAP1 and the Cul3-based E3 ubiquitin ligases
Canning, Peter; Bullock, Alex N.
2014-01-01
E3 ubiquitin ligases that direct substrate proteins to the ubiquitin–proteasome system are promising, though largely unexplored drug targets both because of their function and their remarkable specificity. CRLs [Cullin–RING (really interesting new gene) ligases] are the largest group of E3 ligases and function as modular multisubunit complexes constructed around a Cullin-family scaffold protein. The Cul3-based CRLs uniquely assemble with BTB (broad complex/tramtrack/bric-à-brac) proteins that also homodimerize and perform the role of both the Cullin adapter and the substrate-recognition component of the E3. The most prominent member is the BTB–BACK (BTB and C-terminal Kelch)–Kelch protein KEAP1 (Kelch-like ECH-associated protein 1), a master regulator of the oxidative stress response and a potential drug target for common conditions such as diabetes, Alzheimer's disease and Parkinson's disease. Structural characterization of BTB–Cul3 complexes has revealed a number of critical assembly mechanisms, including the binding of an N-terminal Cullin extension to a bihelical ‘3-box’ at the C-terminus of the BTB domain. Improved understanding of the structure of these complexes should contribute significantly to the effort to develop novel therapeutics targeted to CRL3-regulated pathways. PMID:24450635
Yama, Tomonari; Ochi, Arisa; Suto, Takuro; Hirasaka, Katsuya; Teshima-Kondo, Shigetada; Okumura, Yuushi; Oarada, Motoko; Choi, Inho; Mukai, Rie; Terao, Junji
2013-01-01
Background. Unloading stress induces skeletal muscle atrophy. We have reported that Cbl-b ubiquitin ligase is a master regulator of unloading-associated muscle atrophy. The present study was designed to elucidate whether dietary soy glycinin protein prevents denervation-mediated muscle atrophy, based on the presence of inhibitory peptides against Cbl-b ubiquitin ligase in soy glycinin protein. Methods. Mice were fed either 20% casein diet, 20% soy protein isolate diet, 10% glycinin diet containing 10% casein, or 20% glycinin diet. One week later, the right sciatic nerve was cut. The wet weight, cross sectional area (CSA), IGF-1 signaling, and atrogene expression in hindlimb muscles were examined at 1, 3, 3.5, or 4 days after denervation. Results. 20% soy glycinin diet significantly prevented denervation-induced decreases in muscle wet weight and myofiber CSA. Furthermore, dietary soy protein inhibited denervation-induced ubiquitination and degradation of IRS-1 in tibialis anterior muscle. Dietary soy glycinin partially suppressed the denervation-mediated expression of atrogenes, such as MAFbx/atrogin-1 and MuRF-1, through the protection of IGF-1 signaling estimated by phosphorylation of Akt-1. Conclusions. Soy glycinin contains a functional inhibitory sequence against muscle-atrophy-associated ubiquitin ligase Cbl-b. Dietary soy glycinin protein significantly prevented muscle atrophy after denervation in mice. PMID:23762056
Structure of Escherichia coli UDP-N-acetylmuramoyl:L-alanine ligase (MurC).
Deva, Taru; Baker, Edward N; Squire, Christopher J; Smith, Clyde A
2006-12-01
The bacterial cell wall provides essential protection from the external environment and confers strength and rigidity to counteract internal osmotic pressure. Without this layer the cell would be easily ruptured and it is for this reason that biosynthetic pathways leading to the formation of peptidoglycan have for many years been a prime target for effective antibiotics. Central to this pathway are four similar ligase enzymes which add peptide groups to glycan moieties. As part of a program to better understand the structure-function relationships in these four enzymes, the crystal structure of Escherichia coli UDP-N-acetylmuramoyl:L-alanine ligase (MurC) has been determined to 2.6 A resolution. The structure was solved by multiwavelength anomalous diffraction methods from a single selenomethionine-substituted crystal and refined to a crystallographic R factor of 0.212 (R(free) = 0.259). The enzyme has a modular multi-domain structure very similar to those of other members of the mur family of ATP-dependent amide-bond ligases. Detailed comparison of these four enzymes shows that considerable conformational changes are possible. These changes, together with the recruitment of two different N-terminal domains, allow this family of enzymes to bind a substrate which is identical at one end and at the other has the growing peptide tail which will ultimately become part of the rigid bacterial cell wall. Comparison of the E. coli and Haemophilus influenzae structures and analysis of the sequences of known MurC enzymes indicate the presence of a ;dimerization' motif in almost 50% of the MurC enzymes and points to a highly conserved loop in domain 3 that may play a key role in amino-acid ligand specificity.
Wong, Jack Jing Lin; Wang, Cheng; Zhang, Heng; Kirilly, Daniel; Wu, Chunlai; Liou, Yih-Cherng; Wang, Hongyan; Yu, Fengwei
2013-01-01
Pruning that selectively eliminates unnecessary axons/dendrites is crucial for sculpting the nervous system during development. During Drosophila metamorphosis, dendrite arborization neurons, ddaCs, selectively prune their larval dendrites in response to the steroid hormone ecdysone, whereas mushroom body γ neurons specifically eliminate their axon branches within dorsal and medial lobes. However, it is unknown which E3 ligase directs these two modes of pruning. Here, we identified a conserved SCF E3 ubiquitin ligase that plays a critical role in pruning of both ddaC dendrites and mushroom body γ axons. The SCF E3 ligase consists of four core components Cullin1/Roc1a/SkpA/Slimb and promotes ddaC dendrite pruning downstream of EcR-B1 and Sox14, but independently of Mical. Moreover, we demonstrate that the Cullin1-based E3 ligase facilitates ddaC dendrite pruning primarily through inactivation of the InR/PI3K/TOR pathway. We show that the F-box protein Slimb forms a complex with Akt, an activator of the InR/PI3K/TOR pathway, and promotes Akt ubiquitination. Activation of the InR/PI3K/TOR pathway is sufficient to inhibit ddaC dendrite pruning. Thus, our findings provide a novel link between the E3 ligase and the InR/PI3K/TOR pathway during dendrite pruning. PMID:24068890
Identification of Arabidopsis MYB56 as a novel substrate for CRL3BPM E3 ligases.
Chen, Liyuan; Bernhardt, Anne; Lee, JooHyun; Hellmann, Hanjo
2014-10-24
Controlled stability of proteins is a highly efficient mechanism to direct diverse processes in living cells. A key regulatory system for protein stability is given by the ubiquitin proteasome pathway, which uses E3 ligases to mark specific proteins for degradation. In this work MYB56 is identified as a novel target of a CULLIN3 (CUL3)-based E3 ligase. Its stability depends on the presence of MATH-BTB/POZ (BPM) proteins, which function as substrate adaptors to the E3 ligase. Genetic studies pointed out that MYB56 is a negative regulator of flowering, while BPMs positively affect this developmental program. The interaction between BPMs and MYB56 occurs at the promoter of FLOWERING LOCUS T (FT), a key regulator in initiating flowering in Arabidopsis, and results in instability of MYB56. Overall the work establishes MYB transcription factors as substrates of BPM proteins, and provides novel information on components that participate in controlling the flowering time point in plants. © The Author 2014. Published by the Molecular Plant Shanghai Editorial Office in association with Oxford University Press on behalf of CSPB and IPPE, SIBS, CAS.
Lévy, Frédéric; Muehlethaler, Katja; Salvi, Suzanne; Peitrequin, Anne-Lise; Lindholm, Cecilia K.; Cerottini, Jean-Charles; Rimoldi, Donata
2005-01-01
The production of pigment by melanocytic cells of the skin involves a series of enzymatic reactions that take place in specialized organelles called melanosomes. Melan-A/MART-1 is a melanocytic transmembrane protein with no enzymatic activity that accumulates in vesicles at the trans side of the Golgi and in melanosomes. We show here that, in melanoma cells, Melan-A associates with two homologous to E6-AP C-terminus (HECT)-E3 ubiquitin ligases, NEDD4 and Itch, and is ubiquitylated. Both NEDD4 and Itch participate in the degradation of Melan-A. A mutant Melan-A lacking ubiquitin-acceptor residues displays increased half-life and, in pigmented cells, accumulates in melanosomes. These results suggest that ubiquitylation regulates the lysosomal sorting and degradation of Melan-A/MART-1 from melanosomes in melanocytic cells. PMID:15703212
Structure and catalytic activation of the TRIM23 RING E3 ubiquitin ligase: DAWIDZIAK et al.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dawidziak, Daria M.; Sanchez, Jacint G.; Wagner, Jonathan M.
Tripartite motif (TRIM) proteins comprise a large family of RING-type ubiquitin E3 ligases that regulate important biological processes. An emerging general model is that TRIMs form elongated antiparallel coiled-coil dimers that prevent interaction of the two attendant RING domains. The RING domains themselves bind E2 conjugating enzymes as dimers, implying that an active TRIM ligase requires higher-order oligomerization of the basal coiled-coil dimers. Here, we report crystal structures of the TRIM23 RING domain in isolation and in complex with an E2–ubiquitin conjugate. Our results indicate that TRIM23 enzymatic activity requires RING dimerization, consistent with the general model of TRIM activation.
Fu, Changlin; Donovan, William P.; Shikapwashya-Hasser, Olga; Ye, Xudong; Cole, Robert H.
2014-01-01
Molecular cloning is utilized in nearly every facet of biological and medical research. We have developed a method, termed Hot Fusion, to efficiently clone one or multiple DNA fragments into plasmid vectors without the use of ligase. The method is directional, produces seamless junctions and is not dependent on the availability of restriction sites for inserts. Fragments are assembled based on shared homology regions of 17–30 bp at the junctions, which greatly simplifies the construct design. Hot Fusion is carried out in a one-step, single tube reaction at 50°C for one hour followed by cooling to room temperature. In addition to its utility for multi-fragment assembly Hot Fusion provides a highly efficient method for cloning DNA fragments containing inverted repeats for applications such as RNAi. The overall cloning efficiency is in the order of 90–95%. PMID:25551825
Yi, Ping; Chen, Zhuqin; Yu, Lili; Zheng, Yingru; Liu, Guodong; Xie, Haichang; Zhou, Yuanguo; Zheng, Xiuhui; Han, Jian; Li, Li
2010-08-01
Analysis of fetal DNA in maternal plasma has recently been introduced for non-invasive prenatal diagnosis. We have now investigated the feasibility of polymerase chain reaction (PCR)/ligase detection reaction (LDR)/capillary electrophoresis for the detection of fetal point mutations, such as the beta-thalassemia mutation, IVS2 654(C --> T), in maternal plasma DNA. The sensitivity of LDR/capillary electrophoresis was examined by quantifying the mutant PCR products in the presence of a vast excess of non-mutant competitor template, a situation that mimics the detection of rare fetal mutations in the presence of excess maternal DNA. PCR/LDR/capillary electrophoresis was applied to detect the mutation, IVS2 654(C --> T), in an experimental model at different sensitivity levels and from 10 maternal plasma samples. Our results demonstrated that this approach to detect a low abundance IVS2 654(C --> T) mutation achieved a sensitivity of approximately 1:10,000. The approach was applied to maternal plasma DNA to detect the paternally inherited fetal IVS2 654(C --> T) mutation, and the results were equivalent to those obtained by PCR/reverse dot blot of amniotic fluid cell DNA. PCR/LDR/capillary electrophoresis has a very high sensitivity that can distinguish low abundance single nucleotide differences and can detect paternally inherited fetal point mutations in maternal plasma.
Zhu, Jing; Gan, Haiying; Wu, Jie; Ju, Huangxian
2018-04-17
A bipedal molecular machine powered surface programmatic chain reaction was designed for electrochemical signal amplification and highly sensitive electrochemical detection of protein. The bipedal molecular machine was built through aptamer-target specific recognition for the binding of one target protein with two DNA probes, which hybridized with surface-tethered hairpin DNA 1 (H1) via proximity effect to expose the prelocked toehold domain of H1 for the hybridization of ferrocene-labeled hairpin DNA 2 (H2-Fc). The toehold-mediated strand displacement reaction brought the electrochemical signal molecule Fc close to the electrode and meanwhile released the bipedal molecular machine to traverse the sensing surface by the surface programmatic chain reaction. Eventually, a large number of duplex structures of H1-H2 with ferrocene groups facing to the electrode were formed on the sensor surface to generate an amplified electrochemical signal. Using thrombin as a model target, this method showed a linear detection range from 2 pM to 20 nM with a detection limit of 0.76 pM. The proposed detection strategy was enzyme-free and allowed highly sensitive and selective detection of a variety of protein targets by using corresponding DNA-based affinity probes, showing potential application in bioanalysis.
Cytoplasmic destruction of p53 by the endoplasmic reticulum-resident ubiquitin ligase 'Synoviolin'.
Yamasaki, Satoshi; Yagishita, Naoko; Sasaki, Takeshi; Nakazawa, Minako; Kato, Yukihiro; Yamadera, Tadayuki; Bae, Eunkyung; Toriyama, Sayumi; Ikeda, Rie; Zhang, Lei; Fujitani, Kazuko; Yoo, Eunkyung; Tsuchimochi, Kaneyuki; Ohta, Tomohiko; Araya, Natsumi; Fujita, Hidetoshi; Aratani, Satoko; Eguchi, Katsumi; Komiya, Setsuro; Maruyama, Ikuro; Higashi, Nobuyo; Sato, Mitsuru; Senoo, Haruki; Ochi, Takahiro; Yokoyama, Shigeyuki; Amano, Tetsuya; Kim, Jaeseob; Gay, Steffen; Fukamizu, Akiyoshi; Nishioka, Kusuki; Tanaka, Keiji; Nakajima, Toshihiro
2007-01-10
Synoviolin, also called HRD1, is an E3 ubiquitin ligase and is implicated in endoplasmic reticulum -associated degradation. In mammals, Synoviolin plays crucial roles in various physiological and pathological processes, including embryogenesis and the pathogenesis of arthropathy. However, little is known about the molecular mechanisms of Synoviolin in these actions. To clarify these issues, we analyzed the profile of protein expression in synoviolin-null cells. Here, we report that Synoviolin targets tumor suppressor gene p53 for ubiquitination. Synoviolin sequestrated and metabolized p53 in the cytoplasm and negatively regulated its cellular level and biological functions, including transcription, cell cycle regulation and apoptosis. Furthermore, these p53 regulatory functions of Synoviolin were irrelevant to other E3 ubiquitin ligases for p53, such as MDM2, Pirh2 and Cop1, which form autoregulatory feedback loops. Our results provide novel insights into p53 signaling mediated by Synoviolin.
Using constrained information entropy to detect rare adverse drug reactions from medical forums.
Yi Zheng; Chaowang Lan; Hui Peng; Jinyan Li
2016-08-01
Adverse drug reactions (ADRs) detection is critical to avoid malpractices yet challenging due to its uncertainty in pre-marketing review and the underreporting in post-marketing surveillance. To conquer this predicament, social media based ADRs detection methods have been proposed recently. However, existing researches are mostly co-occurrence based methods and face several issues, in particularly, leaving out the rare ADRs and unable to distinguish irrelevant ADRs. In this work, we introduce a constrained information entropy (CIE) method to solve these problems. CIE first recognizes the drug-related adverse reactions using a predefined keyword dictionary and then captures high- and low-frequency (rare) ADRs by information entropy. Extensive experiments on medical forums dataset demonstrate that CIE outperforms the state-of-the-art co-occurrence based methods, especially in rare ADRs detection.
The APC/C Ubiquitin Ligase: From Cell Biology to Tumorigenesis
Penas, Clara; Ramachandran, Vimal; Ayad, Nagi George
2011-01-01
The ubiquitin proteasome system (UPS) is required for normal cell proliferation, vertebrate development, and cancer cell transformation. The UPS consists of multiple proteins that work in concert to target a protein for degradation via the 26S proteasome. Chains of an 8.5-kDa protein called ubiquitin are attached to substrates, thus allowing recognition by the 26S proteasome. Enzymes called ubiquitin ligases or E3s mediate specific attachment to substrates. Although there are over 600 different ubiquitin ligases, the Skp1–Cullin–F-box (SCF) complexes and the anaphase promoting complex/cyclosome (APC/C) are the most studied. SCF involvement in cancer has been known for some time while APC/C’s cancer role has recently emerged. In this review we will discuss the importance of APC/C to normal cell proliferation and development, underscoring its possible contribution to transformation. We will also examine the hypothesis that modulating a specific interaction of the APC/C may be therapeutically attractive in specific cancer subtypes. Finally, given that the APC/C pathway is relatively new as a cancer target, therapeutic interventions affecting APC/C activity may be beneficial in cancers that are resistant to classical chemotherapy. PMID:22655255
The role of host DNA ligases in hepadnavirus covalently closed circular DNA formation
Long, Quanxin; Yan, Ran; Hu, Jieli; Cai, Dawei; Kim, Elena S.; Zhang, Hu; Liu, Yuanjie
2017-01-01
Hepadnavirus covalently closed circular (ccc) DNA is the bona fide viral transcription template, which plays a pivotal role in viral infection and persistence. Upon infection, the non-replicative cccDNA is converted from the incoming and de novo synthesized viral genomic relaxed circular (rc) DNA, presumably through employment of the host cell’s DNA repair mechanisms in the nucleus. The conversion of rcDNA into cccDNA requires preparation of the extremities at the nick/gap regions of rcDNA for strand ligation. After screening 107 cellular DNA repair genes, we herein report that the cellular DNA ligase (LIG) 1 and 3 play a critical role in cccDNA formation. Ligase inhibitors or functional knock down/out of LIG1/3 significantly reduced cccDNA production in an in vitro cccDNA formation assay, and in cccDNA-producing cells without direct effect on viral core DNA replication. In addition, transcomplementation of LIG1/3 in the corresponding knock-out or knock-down cells was able to restore cccDNA formation. Furthermore, LIG4, a component in non-homologous end joining DNA repair apparatus, was found to be responsible for cccDNA formation from the viral double stranded linear (dsl) DNA, but not rcDNA. In conclusion, we demonstrate that hepadnaviruses utilize the whole spectrum of host DNA ligases for cccDNA formation, which sheds light on a coherent molecular pathway of cccDNA biosynthesis, as well as the development of novel antiviral strategies for treatment of hepatitis B. PMID:29287110
Zhang, Songyun; Li, Hongyan; Zhang, Lihui; Li, Jie; Wang, Ruiying; Wang, Mian
2017-02-15
Increasing evidence demonstrates an association between diabetes and hippocampal neuron damage. This study aimed to determine the effects of troxerutin on cognitive deficits and glutamate cysteine ligase subunits (GCLM and GCLC) in the hippocampus of streptozotocin-induced type 1 diabetes mellitus (T1DM) rats. At 12weeks after streptozotocin injection, T1DM rats were randomly divided into 4 groups (n=15 each group) to receive no treatment (T1DM), saline (T1DM+saline), alpha-lipoic acid (T1DM+alpha-lipoic acid), and troxerutin (T1DM+troxerutin), respectively, for 6weeks. Meanwhile, 10 control animals (NC group) were assessed in parallel. Learning performance was evaluated by the Morris water maze. After treatment, hippocampi were collected for pathological examination by hematoxylin and eosin (H&E) staining. Next, hippocampal superoxide dismutase (SOD) activity, and malondialdehyde (MDA) and glutathione (GSH) levels were assessed. Finally, glutamate cysteine ligase catalytic (GCLC) and glutamate cysteine ligase modifier (GCLM) subunit mRNA and protein levels were quantified by reverse transcription polymerase chain reaction (RT-PCR) and Western blot, respectively. Compared with T1DM and T1DM+saline groups, escape latency was overtly reduced in T1DM+alpha-lipoic acid and T1DM+troxerutin groups. Significantly increased GCLM and GCLC mRNA levels, GCLC protein amounts, SOD activity, and GSH levels, and reduced MDA amounts were observed in T1DM+alpha-lipoic acid and T1DM+troxerutin groups. In T1DM and T1DM+saline groups, H&E staining showed less pyramidal cells in the hippocampus, with disorganized layers, karyopyknosis, decreased endochylema, and cavitation, effects relieved in T1DM+alpha-lipoic acid and T1DM+troxerutin groups. Troxerutin alleviates oxidative stress and promotes learning in streptozotocin-induced T1DM rats, a process involving GCLC expression. Copyright © 2016 Elsevier B.V. All rights reserved.
Chen, Zhi; Zhang, Wei; Jiang, Kaibiao; Chen, Bin; Wang, Kun; Lao, Lifeng; Hou, Canglong; Wang, Fei; Zhang, Caiguo; Shen, Hongxing
2018-03-02
Cullins, critical members of the cullin-RING ubiquitin ligases (CRLs), are often aberrantly expressed in different cancers. However, the underlying mechanisms regarding aberrant expression of these cullins and the specific substrates of CRLs in different cancers are mostly unknown. Here, we demonstrate that overexpressed CUL4B in human osteosarcoma cells forms an E3 complex with DNA damage binding protein 1 (DDB1) and DDB1- and CUL4-associated factor 13 (DCAF13). In vitro and in vivo analyses indicated that the CRL4B DCAF13 E3 ligase specifically recognized the tumor suppressor PTEN (phosphatase and tensin homolog deleted on chromosome 10) for degradation, and disruption of this E3 ligase resulted in PTEN accumulation. Further analyses indicated that miR-300 directly targeted the 3' UTR of CUL4B, and DNA hypermethylation of a CpG island in the miR-300 promoter region contributed to the downregulation of miR-300. Interestingly, ectopic expression of miR-300 or treatment with 5-AZA-2'-deoxycytidine, a DNA methylation inhibitor, decreased the stability of CRL4B DCAF13 E3 ligase and reduced PTEN ubiquitination. By applying in vitro screening to identify small molecules that specifically inhibit CUL4B-DDB1 interaction, we found that TSC01131 could greatly inhibit osteosarcoma cell growth and could disrupt the stability of the CRL4B DCAF13 E3 ligase. Collectively, our findings shed new light on the molecular mechanism of CUL4B function and might also provide a new avenue for osteosarcoma therapy. Copyright © 2017 The Author(s). Published by Elsevier Inc. All rights reserved.
TMEM129 is a Derlin-1 associated ERAD E3 ligase essential for virus-induced degradation of MHC-I.
van den Boomen, Dick J H; Timms, Richard T; Grice, Guinevere L; Stagg, Helen R; Skødt, Karsten; Dougan, Gordon; Nathan, James A; Lehner, Paul J
2014-08-05
The US11 gene product of human cytomegalovirus promotes viral immune evasion by hijacking the endoplasmic reticulum (ER)-associated degradation (ERAD) pathway. US11 initiates dislocation of newly translocated MHC I from the ER to the cytosol for proteasome-mediated degradation. Despite the critical role for ubiquitin in this degradation pathway, the responsible E3 ligase is unknown. In a forward genetic screen for host ERAD components hijacked by US11 in near-haploid KBM7 cells, we identified TMEM129, an uncharacterized polytopic membrane protein. TMEM129 is essential and rate-limiting for US11-mediated MHC-I degradation and acts as a novel ER resident E3 ubiquitin ligase. TMEM129 contains an unusual cysteine-only RING with intrinsic E3 ligase activity and is recruited to US11 via Derlin-1. Together with its E2 conjugase Ube2J2, TMEM129 is responsible for the ubiquitination, dislocation, and subsequent degradation of US11-associated MHC-I. US11 engages two degradation pathways: a Derlin-1/TMEM129-dependent pathway required for MHC-I degradation and a SEL1L/HRD1-dependent pathway required for "free" US11 degradation. Our data show that TMEM129 is a novel ERAD E3 ligase and the central component of a novel mammalian ERAD complex.
Detection of Trypanosoma cruzi by Polymerase Chain Reaction.
Márquez, María Elizabeth; Concepción, Juan Luis; González-Marcano, Eglys; Mondolfi, Alberto Paniz
2016-01-01
American Trypanosomiasis (Chagas disease) is an infectious disease caused by the hemoflagellate parasite Trypanosoma cruzi which is transmitted by reduviid bugs. T. cruzi infection occurs in a broad spectrum of reservoir animals throughout North, Central, and South America and usually evolves into an asymptomatic chronic clinical stage of the disease in which diagnosis is often challenging. This chapter describes the application of polymerase chain reaction (PCR) for the detection of Trypanosoma cruzi DNA including protocols for sample preparation, DNA extraction, and target amplification methods.
RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants
Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook
2017-01-01
Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. PMID:28712388
Kwun, H J; Wendzicki, J A; Shuda, Y; Moore, P S; Chang, Y
2017-12-07
The formation of a bipolar mitotic spindle is an essential process for the equal segregation of duplicated DNA into two daughter cells during mitosis. As a result of deregulated cellular signaling pathways, cancer cells often suffer a loss of genome integrity that might etiologically contribute to carcinogenesis. Merkel cell polyomavirus (MCV) small T (sT) oncoprotein induces centrosome overduplication, aneuploidy, chromosome breakage and the formation of micronuclei by targeting cellular ligases through a sT domain that also inhibits MCV large T oncoprotein turnover. These results provide important insight as to how centrosome number and chromosomal stability can be affected by the E3 ligase targeting capacity of viral oncoproteins such as MCV sT, which may contribute to Merkel cell carcinogenesis.
Excimer-monomer switch: a reaction-based approach for selective detection of fluoride.
Song, Qiao; Bamesberger, Angela; Yang, Lingyun; Houtwed, Haley; Cao, Haishi
2014-07-21
A N-aryl-1,8-naphthalimide based sensor (ES-1) bearing a trimethylsilyl ether has been synthesized by a two-step reaction for quantitative detection of fluoride (F(-)). ES-1 exhibited monomer/excimer emissions at 410 and 524 nm respectively in CH2Cl2. In the presence of F(-), the desilylation of trimethylsilyl ether caused decay of the excimer emission as well as enhancement of the monomer emission to give a ratiometric signal. The fluoride-triggered desilylation showed a high reaction rate and high affinity to F(-) over nine other interfering anions. ES-1 provided a novel fluorescence assay based on excimer-monomer switch of N-aryl-1,8-naphthalimide to quantitatively measure F(-) with a detection limit of 0.133 ppm.
Ubiquitin Lysine 63 Chain–Forming Ligases Regulate Apical Dominance in Arabidopsis[W][OA
Yin, Xiao-Jun; Volk, Sara; Ljung, Karin; Mehlmer, Norbert; Dolezal, Karel; Ditengou, Franck; Hanano, Shigeru; Davis, Seth J.; Schmelzer, Elmon; Sandberg, Göran; Teige, Markus; Palme, Klaus; Pickart, Cecile; Bachmair, Andreas
2007-01-01
Lys-63–linked multiubiquitin chains play important roles in signal transduction in yeast and in mammals, but the functions for this type of chain in plants remain to be defined. The RING domain protein RGLG2 (for RING domain Ligase2) from Arabidopsis thaliana can be N-terminally myristoylated and localizes to the plasma membrane. It can form Lys-63–linked multiubiquitin chains in an in vitro reaction. RGLG2 has overlapping functions with its closest sequelog, RGLG1, and single mutants in either gene are inconspicuous. rglg1 rglg2 double mutant plants exhibit loss of apical dominance and altered phyllotaxy, two traits critically influenced by the plant hormone auxin. Auxin and cytokinin levels are changed, and the plants show a decreased response to exogenously added auxin. Changes in the abundance of PIN family auxin transport proteins and synthetic lethality with a mutation in the auxin transport regulator BIG suggest that the directional flow of auxin is modulated by RGLG activity. Modification of proteins by Lys-63–linked multiubiquitin chains is thus important for hormone-regulated, basic plant architecture. PMID:17586653
Detection of Listeria monocytogenes by using the polymerase chain reaction
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bessesen, M.T.; Luo, Q.; Blaser, M.J.
1990-09-01
A method was developed for detection of Listeria monocytogens by polymerase chain reaction amplification followed by agarose gel electrophoresis or dot blot analysis with {sup 32}P-labeled internal probe. The technique identified 95 of 95 L. monocytogenes strains, 0 of 12 Listeria strains of other species, and 0 of 12 non-Listeria strains.
Toward multimodal signal detection of adverse drug reactions.
Harpaz, Rave; DuMouchel, William; Schuemie, Martijn; Bodenreider, Olivier; Friedman, Carol; Horvitz, Eric; Ripple, Anna; Sorbello, Alfred; White, Ryen W; Winnenburg, Rainer; Shah, Nigam H
2017-12-01
Improving mechanisms to detect adverse drug reactions (ADRs) is key to strengthening post-marketing drug safety surveillance. Signal detection is presently unimodal, relying on a single information source. Multimodal signal detection is based on jointly analyzing multiple information sources. Building on, and expanding the work done in prior studies, the aim of the article is to further research on multimodal signal detection, explore its potential benefits, and propose methods for its construction and evaluation. Four data sources are investigated; FDA's adverse event reporting system, insurance claims, the MEDLINE citation database, and the logs of major Web search engines. Published methods are used to generate and combine signals from each data source. Two distinct reference benchmarks corresponding to well-established and recently labeled ADRs respectively are used to evaluate the performance of multimodal signal detection in terms of area under the ROC curve (AUC) and lead-time-to-detection, with the latter relative to labeling revision dates. Limited to our reference benchmarks, multimodal signal detection provides AUC improvements ranging from 0.04 to 0.09 based on a widely used evaluation benchmark, and a comparative added lead-time of 7-22 months relative to labeling revision dates from a time-indexed benchmark. The results support the notion that utilizing and jointly analyzing multiple data sources may lead to improved signal detection. Given certain data and benchmark limitations, the early stage of development, and the complexity of ADRs, it is currently not possible to make definitive statements about the ultimate utility of the concept. Continued development of multimodal signal detection requires a deeper understanding the data sources used, additional benchmarks, and further research on methods to generate and synthesize signals. Copyright © 2017 Elsevier Inc. All rights reserved.
Functional characterization of DnSIZ1, a SIZ/PIAS-type SUMO E3 ligase from Dendrobium.
Liu, Feng; Wang, Xiao; Su, Mengying; Yu, Mengyuan; Zhang, Shengchun; Lai, Jianbin; Yang, Chengwei; Wang, Yaqin
2015-09-17
SUMOylation is an important post-translational modification of eukaryotic proteins that involves the reversible conjugation of a small ubiquitin-related modifier (SUMO) polypeptide to its specific protein substrates, thereby regulating numerous complex cellular processes. The PIAS (protein inhibitor of activated signal transducers and activators of transcription [STAT]) and SIZ (scaffold attachment factor A/B/acinus/PIAS [SAP] and MIZ) proteins are SUMO E3 ligases that modulate SUMO conjugation. The characteristic features and SUMOylation mechanisms of SIZ1 protein in monocotyledon are poorly understood. Here, we examined the functions of a homolog of Arabidopsis SIZ1, a functional SIZ/PIAS-type SUMO E3 ligase from Dendrobium. In Dendrobium, the predicted DnSIZ1 protein has domains that are highly conserved among SIZ/PIAS-type proteins. DnSIZ1 is widely expressed in Dendrobium organs and has a up-regulated trend by treatment with cold, high temperature and wounding. The DnSIZ1 protein localizes to the nucleus and shows SUMO E3 ligase activity when expressed in an Escherichia coli reconstitution system. Moreover, ectopic expression of DnSIZ1 in the Arabidopsis siz1-2 mutant partially complements several phenotypes and results in enhanced levels of SUMO conjugates in plants exposed to heat shock conditions. We observed that DnSIZ1 acts as a negative regulator of flowering transition which may be via a vernalization-induced pathway. In addition, ABA-hypersensitivity of siz1-2 seed germination can be partially suppressed by DnSIZ1. Our results suggest that DnSIZ1 is a functional homolog of the Arabidopsis SIZ1 with SUMO E3 ligase activity and may play an important role in the regulation of Dendrobium stress responses, flowering and development.
Detection of Adverse Drug Reactions using Medical Named Entities on Twitter.
MacKinlay, Andrew; Aamer, Hafsah; Yepes, Antonio Jimeno
2017-01-01
Adverse Drug Reactions (ADRs) are unintentional reactions caused by a drug or combination of drugs taken by a patient. The current ADR reporting systems inevitably have delays in reporting such events. The broad scope of social media conversations on sites such as Twitter means that inevitably health-related topics will be covered. This means that these sites could then be used to detect potentially novel ADRs with less latency for subsequent further investigation. In this work, we investigate ADR surveillance using a large corpus of Twitter data, containing around 50 billion tweets spanning 3 years (2012-2014), and evaluate against over 3000 drugs reported in the FAERS database. This is both a larger corpus and broader selection of drugs than previous work in the domain. We compare the ADRs identified using our method to the FDA Adverse Event Reporting System (FAERS) database of ADRs reported using more traditional techniques, and find that Twitter is a useful resource for ADR detection up to 72% micro-averaged precision. Micro-averaged recall of 6% is achievable using only 10% of Twitter, indicating that with a higher-volume or targeted feed it would be possible to detect a large percentage of ADRs.
Ubiquitin ligase parkin promotes Mdm2-arrestin interaction but inhibits arrestin ubiquitination
Ahmed, M. Rafiuddin; Zhan, Xuanzhi; Song, Xiufeng; Kook, Seunghyi; Gurevich, Vsevolod V.; Gurevich, Eugenia V.
2011-01-01
Numerous mutations in E3 ubiquitin ligase parkin were shown to associate with familial Parkinson's disease. Here we show that parkin binds arrestins, versatile regulators of cell signaling. Arrestin-parkin interaction was demonstrated by coimmuno-precipitation of endogenous proteins from brain tissue, and shown to be direct using purified proteins. Parkin binding enhances arrestin interactions with another E3 ubiquitin ligase, Mdm2, apparently by shifting arrestin conformational equilibrium to the basal state preferred by Mdm2. Although Mdm2 was reported to ubiquitinate arrestins, parkin-dependent increase in Mdm2 binding dramatically reduces the ubiquitination of both non-visual arrestins, basal and stimulated by receptor activation, without affecting receptor internalization. Several disease-associated parkin mutations differentially affect the stimulation of Mdm2 binding. All parkin mutants tested effectively suppress arrestin ubiquitination, suggesting that bound parkin shields arrestin lysines targeted by Mdm2. Parkin binding to arrestins along with its effects on arrestin interaction with Mdm2 and ubiquitination is a novel function of this protein with implications for Parkinson's disease pathology. PMID:21466165
Ubiquitin ligase parkin promotes Mdm2-arrestin interaction but inhibits arrestin ubiquitination.
Ahmed, M Rafiuddin; Zhan, Xuanzhi; Song, Xiufeng; Kook, Seunghyi; Gurevich, Vsevolod V; Gurevich, Eugenia V
2011-05-10
Numerous mutations in E3 ubiquitin ligase parkin were shown to associate with familial Parkinson's disease. Here we show that parkin binds arrestins, versatile regulators of cell signaling. Arrestin-parkin interaction was demonstrated by coimmunoprecipitation of endogenous proteins from brain tissue and shown to be direct using purified proteins. Parkin binding enhances arrestin interactions with another E3 ubiquitin ligase, Mdm2, apparently by shifting arrestin conformational equilibrium to the basal state preferred by Mdm2. Although Mdm2 was reported to ubiquitinate arrestins, parkin-dependent increase in Mdm2 binding dramatically reduces the ubiquitination of both nonvisual arrestins, basal and stimulated by receptor activation, without affecting receptor internalization. Several disease-associated parkin mutations differentially affect the stimulation of Mdm2 binding. All parkin mutants tested effectively suppress arrestin ubiquitination, suggesting that bound parkin shields arrestin lysines targeted by Mdm2. Parkin binding to arrestins along with its effects on arrestin interaction with Mdm2 and ubiquitination is a novel function of this protein with implications for Parkinson's disease pathology.
Garg, Pankaj
2017-07-01
Histopathology is commonly used to diagnose tuberculosis in fistula-in-ano. The aim was to compare the sensitivity of polymerase chain reaction and histopathology in detecting tuberculosis in fistula-in-ano. The histopathology and polymerase chain-reaction of tissue (fistula tract) was done in all the consecutive operated cases. When pus sample was also available, polymerase chain reaction-pus was also done RESULTS: Three hundred forty seven samples (179 patients) were tested over 2 years (median 6.5 months). The mean age was 38.8 ± 10.7 years, and male/female was 170/9. Histopathology and polymerase chain reaction of tissue (fistula tract) was done in 152 and 165 patients, respectively. Polymerase chain reaction (pus) could be done in 30 patients. Overall, tuberculosis was detected in 20/179 (11.2%) patients. Of these, tuberculosis was detected by histopathology (tissue) in 1/152 (0.7%) and by polymerase chain reaction (tissue) in 14/165 (8.5%) patients. In pus, polymerase chain reaction detected tuberculosis in 6/30 (20%) patients. Both polymerase chain reaction of tissue and pus were positive in one patient. Polymerase chain reaction (tissue) and polymerase chain reaction (pus) were significantly more sensitive than histopathology (tissue) for detecting tuberculosis [histopathology 1/152 vs. polymerase chain reaction (tissue) 14/165, p = 0.0009] [histopathology 1/152 vs. polymerase chain reaction (pus) 6/30, p < 0.0001]. In 20 patients detected to have tuberculosis, four drug anti-tubercular therapy was recommended for 6 months. The therapy was completed in 13 patients and 12/13 (92.3%) were cured. The therapy is continuing in 3/20 patients. Four patients did not take the therapy. None of them was cured. Polymerase chain reaction was significantly more sensitive than histopathology in detecting tuberculosis in fistula-in-ano. Histopathology might be missing out tuberculosis in many patients leading to recurrence of the fistula.
Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining
Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L.; Tomkinson, Alan E.; Tainer, John A.; Ellenberger, Tom
2015-01-01
Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. PMID:26130724
Kinsella, Sinéad; Fichtner, Michael; Watters, Orla; König, Hans-Georg; Prehn, Jochen H M
2018-05-02
Chronic pro-inflammatory signaling propagates damage to neural tissue and affects the rate of disease progression. Increased activation of Toll-like receptors (TLRs), master regulators of the innate immune response, is implicated in the etiology of several neuropathologies including amyotrophic lateral sclerosis, Alzheimer's disease, and Parkinson's disease. Previously, we identified that the Bcl-2 family protein BH3-interacting domain death agonist (Bid) potentiates the TLR4-NF-κB pro-inflammatory response in glia, and specifically characterized an interaction between Bid and TNF receptor associated factor 6 (TRAF6) in microglia in response to TLR4 activation. We assessed the activation of mitogen-activated protein kinase (MAPK) and interferon regulatory factor 3 (IRF3) inflammatory pathways in response to TLR3 and TLR4 agonists in wild-type (wt) and bid-deficient microglia and macrophages, using Western blot and qPCR, focusing on the response of the E3 ubiquitin ligases Pellino 1 (Peli1) and TRAF3 in the absence of microglial and astrocytic Bid. Additionally, by Western blot, we investigated the Bid-dependent turnover of Peli1 and TRAF3 in wt and bid -/- microglia using the proteasome inhibitor Bortezomib. Interactions between the de-ubiquitinating Smad6-A20 and the E3 ubiquitin ligases, TRAF3 and TRAF6, were determined by FLAG pull-down in TRAF6-FLAG or Smad6-FLAG overexpressing wt and bid-deficient mixed glia. We elucidated a positive role of Bid in both TIR-domain-containing adapter-inducing interferon-β (TRIF)- and myeloid differentiation primary response 88 (MyD88)-dependent pathways downstream of TLR4, concurrently implicating TLR3-induced inflammation. We identified that Peli1 mRNA levels were significantly reduced in PolyI:C- and lipopolysaccharide (LPS)-stimulated bid-deficient microglia, suggesting disturbed IRF3 activation. Differential regulation of TRAF3 and Peli1, both essential E3 ubiquitin ligases facilitating TRIF-dependent signaling, was
Effects of partner proteins on BCA2 RING ligase activity
2012-01-01
Background BCA2 is an E3 ligase linked with hormone responsive breast cancers. We have demonstrated previously that the RING E3 ligase BCA2 has autoubiquitination activity and is a very unstable protein. Previously, only Rab7, tetherin, ubiquitin and UBC9 were known to directly interact with BCA2. Methods Here, additional BCA2 binding proteins were found using yeast two-hybrid and bacterial-II-hybrid screening techniques with Human breast and HeLa cDNA libraries. Co-expression of these proteins was analyzed through IHC of TMAs. Investigation of the molecular interactions and effects were examined through a series of in vivo and in vitro assays. Results Ten unique BCA2 interacting proteins were identified, two of which were hHR23a and 14-3-3sigma. Both hHR23a and 14-3-3sigma are co-expressed with BCA2 in breast cancer cell lines and patient breast tumors (n = 105). hHR23a and BCA2 expression was significantly correlated (P = < 0.0001 and P = 0.0113) in both nucleus and cytoplasm. BCA2 expression showed a statistically significant correlation with tumor grade. High cytoplasmic hHR23a trended towards negative nodal status. Binding to BCA2 by hHR23a and 14-3-3sigma was confirmed in vitro using tagged partner proteins and BCA2. hHR23a and 14-3-3sigma effect the autoubiquitination and auto-degradation activity of BCA2. Ubiquitination of hHR23a-bound BCA2 was found to be dramatically lower than that of free BCA2, suggesting that hHR23a promotes the stabilization of BCA2 by inactivating its autoubiquitination activity, without degradation of hHR23a. On the other hand, phosphorylated BCA2 protein is stabilized by interaction with 14-3-3sigma both with and without proteasome inhibitor MG-132 suggesting that BCA2 is regulated by multiple degradation pathways. Conclusions The interaction between BCA2 and hHR23a in breast cancer cells stabilizes BCA2. High expression of BCA2 is correlated with grade in breast cancer, suggesting regulation of this E3 ligase is important to
Energy transfer of nucleic acid products
NASA Astrophysics Data System (ADS)
Jung, Paul M.; Hu, Hsiang-Yun; Khalil, Omar S.
1995-04-01
Fluorescence energy transfer was investigated as a homogeneous detection method for the gapped ligase chain reaction (G-LCR). Oligonucleotides of a Chlamydia trachomatic G-LCR probe set were labeled with fluorescein as the donor and Texas Red as the acceptor fluorophore. Amplification and detection of 10 molecules of synthetic target was demonstrated in spiked urine samples.
Gaid, Mariam M; Sircar, Debabrata; Müller, Andreas; Beuerle, Till; Liu, Benye; Ernst, Ludger; Hänsch, Robert; Beerhues, Ludger
2012-11-01
Although a number of plant natural products are derived from benzoic acid, the biosynthesis of this structurally simple precursor is poorly understood. Hypericum calycinum cell cultures accumulate a benzoic acid-derived xanthone phytoalexin, hyperxanthone E, in response to elicitor treatment. Using a subtracted complementary DNA (cDNA) library and sequence information about conserved coenzyme A (CoA) ligase motifs, a cDNA encoding cinnamate:CoA ligase (CNL) was isolated. This enzyme channels metabolic flux from the general phenylpropanoid pathway into benzenoid metabolism. HcCNL preferred cinnamic acid as a substrate but failed to activate benzoic acid. Enzyme activity was strictly dependent on the presence of Mg²⁺ and K⁺ at optimum concentrations of 2.5 and 100 mM, respectively. Coordinated increases in the Phe ammonia-lyase and HcCNL transcript levels preceded the accumulation of hyperxanthone E in cell cultures of H. calycinum after the addition of the elicitor. HcCNL contained a carboxyl-terminal type 1 peroxisomal targeting signal made up by the tripeptide Ser-Arg-Leu, which directed an amino-terminal reporter fusion to the peroxisomes. Masking the targeting signal by carboxyl-terminal reporter fusion led to cytoplasmic localization. A phylogenetic tree consisted of two evolutionarily distinct clusters. One cluster was formed by CoA ligases related to benzenoid metabolism, including HcCNL. The other cluster comprised 4-coumarate:CoA ligases from spermatophytes, ferns, and mosses, indicating divergence of the two clades prior to the divergence of the higher plant lineages.
RING E3 ligases: key regulatory elements are involved in abiotic stress responses in plants.
Cho, Seok Keun; Ryu, Moon Young; Kim, Jong Hum; Hong, Jeong Soo; Oh, Tae Rin; Kim, Woo Taek; Yang, Seong Wook
2017-08-01
Plants are constantly exposed to a variety of abiotic stresses, such as drought, heat, cold, flood, and salinity. To survive under such unfavorable conditions, plants have evolutionarily developed their own resistant-mechanisms. For several decades, many studies have clarified specific stress response pathways of plants through various molecular and genetic studies. In particular, it was recently discovered that ubiquitin proteasome system (UPS), a regulatory mechanism for protein turn over, is greatly involved in the stress responsive pathways. In the UPS, many E3 ligases play key roles in recognizing and tethering poly-ubiquitins on target proteins for subsequent degradation by the 26S proteasome. Here we discuss the roles of RING ligases that have been defined in related to abiotic stress responses in plants. [BMB Reports 2017; 50(8): 393-400].
Delli-Bovi, Teegan A; Spalding, Maroya D; Prigge, Sean T
2010-10-11
Biotin is an essential enzyme cofactor that acts as a CO2 carrier in carboxylation and decarboxylation reactions. The E. coli genome encodes a biosynthetic pathway that produces biotin from pimeloyl-CoA in four enzymatic steps. The final step, insertion of sulfur into desthiobiotin to form biotin, is catalyzed by the biotin synthase, BioB. A dedicated biotin ligase (BirA) catalyzes the covalent attachment of biotin to biotin-dependent enzymes. Isotopic labeling has been a valuable tool for probing the details of the biosynthetic process and assaying the activity of biotin-dependent enzymes, however there is currently no established method for 35S labeling of biotin. In this study, we produced [35S]-biotin from Na35SO4 and desthiobiotin with a specific activity of 30.7 Ci/mmol, two orders of magnitude higher than previously published methods. The biotinylation domain (PfBCCP-79) from the Plasmodium falciparum acetyl-CoA carboxylase (ACC) was expressed in E. coli as a biotinylation substrate. We found that overexpression of the E. coli biotin synthase, BioB, and biotin ligase, BirA, increased PfBCCP-79 biotinylation 160-fold over basal levels. Biotinylated PfBCCP-79 was purified by affinity chromatography, and free biotin was liberated using acid hydrolysis. We verified that we had produced radiolabeled biologically active [D]-biotin that specifically labels biotinylated proteins through reuptake in E. coli. The strategy described in our report provides a simple and effective method for the production of [35S]-biotin in E. coli based on affinity chromatography.
Chen, Liyuan; Lee, Joo Hyun; Weber, Henriette; Tohge, Takayuki; Witt, Sandra; Roje, Sanja; Fernie, Alisdair R; Hellmann, Hanjo
2013-06-01
Regulation of transcriptional processes is a critical mechanism that enables efficient coordination of the synthesis of required proteins in response to environmental and cellular changes. Transcription factors require accurate activity regulation because they play a critical role as key mediators assuring specific expression of target genes. In this work, we show that cullin3-based E3 ligases have the potential to interact with a broad range of ethylene response factor (ERF)/APETALA2 (AP2) transcription factors, mediated by Math-BTB/POZ (for Meprin and TRAF [tumor necrosis factor receptor associated factor] homolog)-Broad complex, Tramtrack, Bric-a-brac/Pox virus and Zinc finger) proteins. The assembly with an E3 ligase causes degradation of their substrates via the 26S proteasome, as demonstrated for the wrinkled1 ERF/AP2 protein. Furthermore, loss of Math-BTB/POZ proteins widely affects plant development and causes altered fatty acid contents in mutant seeds. Overall, this work demonstrates a link between fatty acid metabolism and E3 ligase activities in plants and establishes CUL3-based E3 ligases as key regulators in transcriptional processes that involve ERF/AP2 family members.
Ledbetter, Michael P; Hwang, Tony W; Stovall, Gwendolyn M; Ellington, Andrew D
2013-01-01
Evolution is a defining criterion of life and is central to understanding biological systems. However, the timescale of evolutionary shifts in phenotype limits most classroom evolution experiments to simple probability simulations. In vitro directed evolution (IVDE) frequently serves as a model system for the study of Darwinian evolution but produces noticeable phenotypic shifts in a matter of hours. An IVDE demonstration lab would serve to both directly demonstrate how Darwinian selection can act on a pool of variants and introduce students to an essential method of modern molecular biology. To produce an IVDE demonstration lab, continuous IVDE of a T500 ribozyme ligase population has been paired with a fluorescent strand displacement reporter system to visualize the selection of improved catalytic function. A ribozyme population is taken through rounds of isothermal amplification dependent on the self-ligation of a T7 promoter. As the population is selectively enriched with better ligase activity, the strand displacement system allows for the monitoring of the population's ligation rate. The strand displacement reporter system permits the detection of ligated ribozyme. Once ligated with the T7 promoter, the 5' end of the ribozyme displaces paired fluorophore-quencher oligonucleotides, in turn, generating visible signal upon UV light excitation. As the ligation rate of the population increases, due to the selection for faster ligating species, the fluorescent signal develops more rapidly. The pairing of the continuous isothermal system with the fluorescent reporting scheme allows any user, provided with minimal materials, to model the continuous directed evolution of a biomolecule. Copyright © 2013 Wiley-Liss, Inc.
Detection of canine cytokine gene expression by reverse transcription-polymerase chain reaction.
Pinelli, E; van der Kaaij, S Y; Slappendel, R; Fragio, C; Ruitenberg, E J; Bernadina, W; Rutten, V P
1999-08-02
Further characterization of the canine immune system will greatly benefit from the availability of tools to detect canine cytokines. Our interest concerns the study on the role of cytokines in canine visceral leishmaniasis. For this purpose, we have designed specific primers using previously published sequences for the detection of canine IL-2, IFN-gamma and IL10 mRNA by reverse transcription-polymerase chain reaction (RT-PCR). For IL-4, we have cloned and sequenced this cytokine gene, and developed canine-specific primers. To control for sample-to-sample variation in the quantity of mRNA and variation in the RT and PCR reactions, the mRNA levels of glyceraldehyde-3-phosphate dehydrogenase (G3PDH), a housekeeping gene, were determined in parallel. Primers to amplify G3PDH were designed from consensus sequences obtained from the Genbank database. The mRNA levels of the cytokines mentioned here were detected from ConA-stimulated peripheral mononuclear cells derived from Leishmania-infected dogs. A different pattern of cytokine production among infected animals was found.
Molecular insights into RBR E3 ligase ubiquitin transfer mechanisms.
Dove, Katja K; Stieglitz, Benjamin; Duncan, Emily D; Rittinger, Katrin; Klevit, Rachel E
2016-08-01
RING-in-between-RING (RBR) ubiquitin (Ub) ligases are a distinct class of E3s, defined by a RING1 domain that binds E2 Ub-conjugating enzyme and a RING2 domain that contains an active site cysteine similar to HECT-type E3s. Proposed to function as RING/HECT hybrids, details regarding the Ub transfer mechanism used by RBRs have yet to be defined. When paired with RING-type E3s, E2s perform the final step of Ub ligation to a substrate. In contrast, when paired with RBR E3s, E2s must transfer Ub onto the E3 to generate a E3~Ub intermediate. We show that RBRs utilize two strategies to ensure transfer of Ub from the E2 onto the E3 active site. First, RING1 domains of HHARI and RNF144 promote open E2~Ubs. Second, we identify a Ub-binding site on HHARI RING2 important for its recruitment to RING1-bound E2~Ub. Mutations that ablate Ub binding to HHARI RING2 also decrease RBR ligase activity, consistent with RING2 recruitment being a critical step for the RBR Ub transfer mechanism. Finally, we demonstrate that the mechanism defined here is utilized by a variety of RBRs. © 2016 The Authors.
Cytoplasmic destruction of p53 by the endoplasmic reticulum-resident ubiquitin ligase ‘Synoviolin'
Yamasaki, Satoshi; Yagishita, Naoko; Sasaki, Takeshi; Nakazawa, Minako; Kato, Yukihiro; Yamadera, Tadayuki; Bae, Eunkyung; Toriyama, Sayumi; Ikeda, Rie; Zhang, Lei; Fujitani, Kazuko; Yoo, Eunkyung; Tsuchimochi, Kaneyuki; Ohta, Tomohiko; Araya, Natsumi; Fujita, Hidetoshi; Aratani, Satoko; Eguchi, Katsumi; Komiya, Setsuro; Maruyama, Ikuro; Higashi, Nobuyo; Sato, Mitsuru; Senoo, Haruki; Ochi, Takahiro; Yokoyama, Shigeyuki; Amano, Tetsuya; Kim, Jaeseob; Gay, Steffen; Fukamizu, Akiyoshi; Nishioka, Kusuki; Tanaka, Keiji; Nakajima, Toshihiro
2007-01-01
Synoviolin, also called HRD1, is an E3 ubiquitin ligase and is implicated in endoplasmic reticulum -associated degradation. In mammals, Synoviolin plays crucial roles in various physiological and pathological processes, including embryogenesis and the pathogenesis of arthropathy. However, little is known about the molecular mechanisms of Synoviolin in these actions. To clarify these issues, we analyzed the profile of protein expression in synoviolin-null cells. Here, we report that Synoviolin targets tumor suppressor gene p53 for ubiquitination. Synoviolin sequestrated and metabolized p53 in the cytoplasm and negatively regulated its cellular level and biological functions, including transcription, cell cycle regulation and apoptosis. Furthermore, these p53 regulatory functions of Synoviolin were irrelevant to other E3 ubiquitin ligases for p53, such as MDM2, Pirh2 and Cop1, which form autoregulatory feedback loops. Our results provide novel insights into p53 signaling mediated by Synoviolin. PMID:17170702
Pendini, Nicole R; Yap, Min Y; Polyak, Steven W; Cowieson, Nathan P; Abell, Andrew; Booker, Grant W; Wallace, John C; Wilce, Jacqueline A; Wilce, Matthew C J
2013-01-01
The essential metabolic enzyme biotin protein ligase (BPL) is a potential target for the development of new antibiotics required to combat drug-resistant pathogens. Staphylococcus aureus BPL (SaBPL) is a bifunctional protein, possessing both biotin ligase and transcription repressor activities. This positions BPL as a key regulator of several important metabolic pathways. Here, we report the structural analysis of both holo- and apo-forms of SaBPL using X-ray crystallography. We also present small-angle X-ray scattering data of SaBPL in complex with its biotin-carboxyl carrier protein substrate as well as the SaBPL:DNA complex that underlies repression. This has revealed the molecular basis of ligand (biotinyl-5′-AMP) binding and conformational changes associated with catalysis and repressor function. These data provide new information to better understand the bifunctional activities of SaBPL and to inform future strategies for antibiotic discovery. PMID:23559560
Single-molecule detection of dihydroazulene photo-thermal reaction using break junction technique
NASA Astrophysics Data System (ADS)
Huang, Cancan; Jevric, Martyn; Borges, Anders; Olsen, Stine T.; Hamill, Joseph M.; Zheng, Jue-Ting; Yang, Yang; Rudnev, Alexander; Baghernejad, Masoud; Broekmann, Peter; Petersen, Anne Ugleholdt; Wandlowski, Thomas; Mikkelsen, Kurt V.; Solomon, Gemma C.; Brøndsted Nielsen, Mogens; Hong, Wenjing
2017-05-01
Charge transport by tunnelling is one of the most ubiquitous elementary processes in nature. Small structural changes in a molecular junction can lead to significant difference in the single-molecule electronic properties, offering a tremendous opportunity to examine a reaction on the single-molecule scale by monitoring the conductance changes. Here, we explore the potential of the single-molecule break junction technique in the detection of photo-thermal reaction processes of a photochromic dihydroazulene/vinylheptafulvene system. Statistical analysis of the break junction experiments provides a quantitative approach for probing the reaction kinetics and reversibility, including the occurrence of isomerization during the reaction. The product ratios observed when switching the system in the junction does not follow those observed in solution studies (both experiment and theory), suggesting that the junction environment was perturbing the process significantly. This study opens the possibility of using nano-structured environments like molecular junctions to tailor product ratios in chemical reactions.
[Synthesis of Circular DNA Templates with T4 RNA Ligase for Rolling Circle Amplification].
Sakhabutdinova, A R; Maksimova, M A; Garafutdinov, R R
2017-01-01
Currently, isothermal methods of nucleic acid amplification have been well established; in particular, rolling circle amplification is of great interest. In this approach, circular ssDNA molecules have been used as a target that can be obtained by the intramolecular template-dependent ligation of an oligonucleotide C-probe. Here, a new method of synthesizing small circular DNA molecules via the cyclization of ssDNA based on T4 RNA ligase has been proposed. Circular ssDNA is further used as the template for the rolling circle amplification. The maximum yield of the cyclization products was observed in the presence of 5-10% polyethylene glycol 4000, and the optimum DNA length for the cyclization constituted 50 nucleotides. This highly sensitive method was shown to detect less than 10^(2) circular DNA molecules. The method reliability was proved based on artificially destroyed dsDNA, which suggests its implementation for analyzing any significantly fragmented dsDNA.
Kong, Min; Wang, Fengjuan; Tian, Liuying; Tang, Hui; Zhang, Liping
2017-12-15
Glutathione (GSH) fulfills a variety of metabolic functions, participates in oxidative stress response, and defends against toxic actions of heavy metals and xenobiotics. In this study, GSH was detected in Rhodosporidium diobovatum by high-performance liquid chromatography (HPLC). Then, two novel enzymes from R. diobovatum were characterized that convert glutamate, cysteine, and glycine into GSH. Based on reverse transcription PCR, we obtained the glutathione synthetase gene (GSH2), 1866 bp, coding for a 56.6-kDa protein, and the glutamate cysteine ligase gene (GSH1), 2469 bp, coding for a 90.5-kDa protein. The role of GSH1 and GSH2 for the biosynthesis of GSH in the marine yeast R. diobovatum was determined by deletions using the CRISPR-Cas9 nuclease system and enzymatic activity. These results also showed that GSH1 and GSH2 were involved in the production of GSH and are thus being potentially useful to engineer GSH pathways. Alternatively, pET-GSH constructed using vitro recombination could be used to detect the function of genes related to GSH biosynthesis. Finally, the fermentation parameters determined in the present study provide a reference for industrial GSH production in R. diobovatum.
NASA Astrophysics Data System (ADS)
Kong, Min; Wang, Fengjuan; Tian, Liuying; Tang, Hui; Zhang, Liping
2018-02-01
Glutathione (GSH) fulfills a variety of metabolic functions, participates in oxidative stress response, and defends against toxic actions of heavy metals and xenobiotics. In this study, GSH was detected in Rhodosporidium diobovatum by high-performance liquid chromatography (HPLC). Then, two novel enzymes from R. diobovatum were characterized that convert glutamate, cysteine, and glycine into GSH. Based on reverse transcription PCR, we obtained the glutathione synthetase gene ( GSH2), 1866 bp, coding for a 56.6-kDa protein, and the glutamate cysteine ligase gene ( GSH1), 2469 bp, coding for a 90.5-kDa protein. The role of GSH1 and GSH2 for the biosynthesis of GSH in the marine yeast R. diobovatum was determined by deletions using the CRISPR-Cas9 nuclease system and enzymatic activity. These results also showed that GSH1 and GSH2 were involved in the production of GSH and are thus being potentially useful to engineer GSH pathways. Alternatively, pET- GSH constructed using vitro recombination could be used to detect the function of genes related to GSH biosynthesis. Finally, the fermentation parameters determined in the present study provide a reference for industrial GSH production in R. diobovatum.
Use of a trigger tool to detect adverse drug reactions in an emergency department.
de Almeida, Silvana Maria; Romualdo, Aruana; de Abreu Ferraresi, Andressa; Zelezoglo, Giovana Roberta; Marra, Alexandre R; Edmond, Michael B
2017-11-15
Although there are systems for reporting adverse drug reactions (ADR), these safety events remain under reported. The low-cost, low-tech trigger tool method is based on the detection of events through clues, and it seems to increase the detection of adverse events compared to traditional methodologies. This study seeks to estimate the prevalence of adverse reactions to drugs in patients seeking care in the emergency department. Retrospective study from January to December, 2014, applying the Institute for Healthcare Improvement (IHI) trigger tool methodology for patients treated at the emergency room of a tertiary care hospital. The estimated prevalence of adverse reactions in patients presenting to the emergency department was 2.3% [CI 95 1.3% to 3.3%]; 28.6% of cases required hospitalization at an average cost of US$ 5698.44. The most common triggers were hydrocortisone (57% of the cases), diphenhydramine (14%) and fexofenadine (14%). Anti-infectives (19%), cardiovascular agents (14%), and musculoskeletal drugs (14%) were the most common causes of adverse reactions. According to the Naranjo Scale, 71% were classified as possible and 29% as probable. There was no association between adverse reactions and age and sex in the present study. The use of the trigger tool to identify adverse reactions in the emergency department was possible to identify a prevalence of 2.3%. It showed to be a viable method that can provide a better understanding of adverse drug reactions in this patient population.
Wang, Hong; Guo, Haoran; Su, Jiaming; Rui, Yajuan; Zheng, Wenwen; Gao, Wenying; Zhang, Wenyan; Li, Zhaolong; Liu, Guanchen; Markham, Richard B; Wei, Wei; Yu, Xiao-Fang
2017-05-01
The lentiviral accessory proteins Vpx and Vpr are known to utilize CRL4 (DCAF1) E3 ligase to induce the degradation of the host restriction factor SAMHD1 or host helicase transcription factor (HLTF), respectively. Selective disruption of viral CRL4 (DCAF1) E3 ligase could be a promising antiviral strategy. Recently, we have determined that posttranslational modification (neddylation) of Cullin-4 is required for the activation of Vpx-CRL4 (DCAF1) E3 ligase. However, the mechanism of Vpx/Vpr-CRL4 (DCAF1) E3 ligase assembly is still poorly understood. Here, we report that zinc coordination is an important regulator of Vpx-CRL4 E3 ligase assembly. Residues in a conserved zinc-binding motif of Vpx were essential for the recruitment of the CRL4 (DCAF1) E3 complex and Vpx-induced SAMHD1 degradation. Importantly, altering the intracellular zinc concentration by treatment with the zinc chelator N , N , N '-tetrakis-(2'-pyridylmethyl)ethylenediamine (TPEN) potently blocked Vpx-mediated SAMHD1 degradation and inhibited wild-type SIVmac (simian immunodeficiency virus of macaques) infection of myeloid cells, even in the presence of Vpx. TPEN selectively inhibited Vpx and DCAF1 binding but not the Vpx-SAMHD1 interaction or Vpx virion packaging. Moreover, we have shown that zinc coordination is also important for the assembly of the HIV-1 Vpr-CRL4 E3 ligase. In particular, Vpr zinc-binding motif mutation or TPEN treatment efficiently inhibited Vpr-CRL4 (DCAF1) E3 ligase assembly and Vpr-mediated HLTF degradation or Vpr-induced G 2 cell cycle arrest. Collectively, our study sheds light on a conserved strategy by the viral proteins Vpx and Vpr to recruit host CRL4 (DCAF1) E3 ligase, which represents a target for novel anti-human immunodeficiency virus (HIV) drug development. IMPORTANCE The Vpr and its paralog Vpx are accessory proteins encoded by different human immunodeficiency virus (HIV)/simian immunodeficiency virus (SIV) lentiviruses. To facilitate viral replication, Vpx has
Enzyme-linked electrochemical DNA ligation assay using magnetic beads.
Stejskalová, Eva; Horáková, Petra; Vacek, Jan; Bowater, Richard P; Fojta, Miroslav
2014-07-01
DNA ligases are essential enzymes in all cells and have been proposed as targets for novel antibiotics. Efficient DNA ligase activity assays are thus required for applications in biomedical research. Here we present an enzyme-linked electrochemical assay based on two terminally tagged probes forming a nicked junction upon hybridization with a template DNA. Nicked DNA bearing a 5' biotin tag is immobilized on the surface of streptavidin-coated magnetic beads, and ligated product is detected via a 3' digoxigenin tag recognized by monoclonal antibody-alkaline phosphatase conjugate. Enzymatic conversion of napht-1-yl phosphate to napht-1-ol enables sensitive detection of the voltammetric signal on a pyrolytic graphite electrode. The technique was tested under optimal conditions and various situations limiting or precluding the ligation reaction (such as DNA substrates lacking 5'-phosphate or containing a base mismatch at the nick junction, or application of incompatible cofactor), and utilized for the analysis of the nick-joining activity of a range of recombinant Escherichia coli DNA ligase constructs. The novel technique provides a fast, versatile, specific, and sensitive electrochemical assay of DNA ligase activity.
Bul Proteins, a Nonredundant, Antagonistic Family of Ubiquitin Ligase Regulatory Proteins
Novoselova, Tatiana V.; Zahira, Kiran; Rose, Ruth-Sarah
2012-01-01
Like other Nedd4 ligases, Saccharomyces cerevisiae E3 Rsp5p utilizes adaptor proteins to interact with some substrates. Previous studies have indentified Bul1p and Bul2p as adaptor proteins that facilitate the ligase-substrate interaction. Here, we show the identification of a third member of the Bul family, Bul3p, the product of two adjacent open reading frames separated by a stop codon that undergoes readthrough translation. Combinatorial analysis of BUL gene deletions reveals that they regulate some, but not all, of the cellular pathways known to involve Rsp5p. Surprisingly, we find that Bul proteins can act antagonistically to regulate the same ubiquitin-dependent process, and the nature of this antagonistic activity varies between different substrates. We further show, using in vitro ubiquitination assays, that the Bul proteins have different specificities for WW domains and that the two forms of Bul3p interact differently with Rsp5p, potentially leading to alternate functional outcomes. These data introduce a new level of complexity into the regulatory interactions that take place between Rsp5p and its adaptors and substrates and suggest a more critical role for the Bul family of proteins in controlling adaptor-mediated ubiquitination. PMID:22307975
Human DNA ligase III bridges two DNA ends to promote specific intermolecular DNA end joining.
Kukshal, Vandna; Kim, In-Kwon; Hura, Gregory L; Tomkinson, Alan E; Tainer, John A; Ellenberger, Tom
2015-08-18
Mammalian DNA ligase III (LigIII) functions in both nuclear and mitochondrial DNA metabolism. In the nucleus, LigIII has functional redundancy with DNA ligase I whereas LigIII is the only mitochondrial DNA ligase and is essential for the survival of cells dependent upon oxidative respiration. The unique LigIII zinc finger (ZnF) domain is not required for catalytic activity but senses DNA strand breaks and stimulates intermolecular ligation of two DNAs by an unknown mechanism. Consistent with this activity, LigIII acts in an alternative pathway of DNA double strand break repair that buttresses canonical non-homologous end joining (NHEJ) and is manifest in NHEJ-defective cancer cells, but how LigIII acts in joining intermolecular DNA ends versus nick ligation is unclear. To investigate how LigIII efficiently joins two DNAs, we developed a real-time, fluorescence-based assay of DNA bridging suitable for high-throughput screening. On a nicked duplex DNA substrate, the results reveal binding competition between the ZnF and the oligonucleotide/oligosaccharide-binding domain, one of three domains constituting the LigIII catalytic core. In contrast, these domains collaborate and are essential for formation of a DNA-bridging intermediate by adenylated LigIII that positions a pair of blunt-ended duplex DNAs for efficient and specific intermolecular ligation. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.
Hesse, Lars; Bostock, Julieanne; Dementin, Sebastien; Blanot, Didier; Mengin-Lecreulx, Dominique; Chopra, Ian
2003-01-01
Chlamydiae are unusual obligate intracellular bacteria that cause serious infections in humans. Chlamydiae contain genes that appear to encode products with peptidoglycan biosynthetic activity. The organisms are also susceptible to antibiotics that inhibit peptidoglycan synthesis. However, chlamydiae do not synthesize detectable peptidoglycan. The paradox created by these observations is known as the chlamydial anomaly. The MurC enzyme of chlamydiae, which is synthesized as a bifunctional MurC-Ddl product, is expected to possess UDP-N-acetylmuramate (UDP-MurNAc):l-alanine ligase activity. In this paper we demonstrate that the MurC domain of the Chlamydia trachomatis bifunctional protein is functionally expressed in Escherichia coli, since it complements a conditional lethal E. coli mutant possessing a temperature-sensitive lesion in MurC. The recombinant MurC domain was overexpressed in and purified from E. coli. It displayed in vitro ATP-dependent UDP-MurNAc:l-alanine ligase activity, with a pH optimum of 8.0 and dependence upon magnesium ions (optimum concentration, 20 mM). Its substrate specificity was studied with three amino acids (l-alanine, l-serine, and glycine); comparable Vmax/Km values were obtained. Our results are consistent with the synthesis of a muramic acid-containing polymer in chlamydiae with UDP-MurNAc-pentapeptide as a precursor molecule. However, due to the lack of specificity of MurC activity in vitro, it is not obvious which amino acid is present in the first position of the pentapeptide. PMID:14594822
Hesse, Lars; Bostock, Julieanne; Dementin, Sebastien; Blanot, Didier; Mengin-Lecreulx, Dominique; Chopra, Ian
2003-11-01
Chlamydiae are unusual obligate intracellular bacteria that cause serious infections in humans. Chlamydiae contain genes that appear to encode products with peptidoglycan biosynthetic activity. The organisms are also susceptible to antibiotics that inhibit peptidoglycan synthesis. However, chlamydiae do not synthesize detectable peptidoglycan. The paradox created by these observations is known as the chlamydial anomaly. The MurC enzyme of chlamydiae, which is synthesized as a bifunctional MurC-Ddl product, is expected to possess UDP-N-acetylmuramate (UDP-MurNAc):L-alanine ligase activity. In this paper we demonstrate that the MurC domain of the Chlamydia trachomatis bifunctional protein is functionally expressed in Escherichia coli, since it complements a conditional lethal E. coli mutant possessing a temperature-sensitive lesion in MurC. The recombinant MurC domain was overexpressed in and purified from E. coli. It displayed in vitro ATP-dependent UDP-MurNAc:L-alanine ligase activity, with a pH optimum of 8.0 and dependence upon magnesium ions (optimum concentration, 20 mM). Its substrate specificity was studied with three amino acids (L-alanine, L-serine, and glycine); comparable Vmax/Km values were obtained. Our results are consistent with the synthesis of a muramic acid-containing polymer in chlamydiae with UDP-MurNAc-pentapeptide as a precursor molecule. However, due to the lack of specificity of MurC activity in vitro, it is not obvious which amino acid is present in the first position of the pentapeptide.
van de Kooij, Bert; Verbrugge, Inge; de Vries, Evert; Gijsen, Merel; Montserrat, Veronica; Maas, Chiel; Neefjes, Jacques; Borst, Jannie
2013-01-01
The eleven members of the membrane-associated RING-CH (MARCH) ubiquitin ligase family are relatively unexplored. Upon exogenous (over)expression, a number of these ligases can affect the trafficking of membrane molecules. However, only for MARCH-1 endogenous functions have been demonstrated. For the other endogenous MARCH proteins, no functions or substrates are known. We report here that TRAIL-R1 is a physiological substrate of the endogenous MARCH-8 ligase. Human TRAIL-R1 and R2 play a role in immunosurveillance and are targets for cancer therapy, because they selectively induce apoptosis in tumor cells. We demonstrate that TRAIL-R1 is down-regulated from the cell surface, with great preference over TRAIL-R2, by exogenous expression of MARCH ligases that are implicated in endosomal trafficking, such as MARCH-1 and -8. MARCH-8 attenuated TRAIL-R1 cell surface expression and apoptosis signaling by virtue of its ligase activity. This suggested that ubiquitination of TRAIL-R1 was instrumental in its down-regulation by MARCH-8. Indeed, in cells with endogenous MARCH expression, TRAIL-R1 was ubiquitinated at steady-state, with the conserved membrane-proximal lysine 273 as one of the potential acceptor sites. This residue was also essential for the interaction of TRAIL-R1 with MARCH-1 and MARCH-8 and its down-regulation by these ligases. Gene silencing identified MARCH-8 as the endogenous ligase that ubiquitinates TRAIL-R1 and attenuates its cell surface expression. These findings reveal that endogenous MARCH-8 regulates the steady-state cell surface expression of TRAIL-R1. PMID:23300075
2010-01-01
Background Attenuation of the EGFR (Epidermal Growth Factor Receptor) signalling cascade is crucial to control cell fate during development. A candidate-based RNAi approach in C. elegans identified CDT-2 as an attenuator of LET-23 (EGFR) signalling. Human CDT2 is a component of the conserved CDT2/CUL4/DDB1 ubiquitin ligase complex that plays a critical role in DNA replication and G2/M checkpoint. Within this complex, CDT2 is responsible for substrate recognition. This ubiquitin ligase complex has been shown in various organisms, including C. elegans, to target the replication-licensing factor CDT1, and the CDK inhibitor p21. However, no previous link to EGFR signalling has been identified. Results We have characterised CDT-2's role during vulva development and found that it is a novel attenuator of LET-23 signalling. CDT-2 acts redundantly with negative modulators of LET-23 signalling and CDT-2 or CUL-4 downregulation causes persistent expression of the egl-17::cfp transgene, a marker of LET-23 signalling during vulva development. In addition, we show that CDT-2 physically interacts with SEM-5 (GRB2), a known negative modulator of LET-23 signalling that directly binds LET-23, and provide genetic evidence consistent with CDT-2 functioning at or downstream of LET-23. Interestingly, both SEM-5 and CDT-2 were identified independently in a screen for genes involved in receptor-mediated endocytosis in oocytes, suggesting that attenuation of LET-23 by CDT-2 might be through regulation of endocytosis. Conclusions In this study, we have shown that CDT-2 and CUL-4, members of the CUL-4/DDB-1/CDT-2 E3 ubiquitin ligase complex attenuate LET-23 signalling in vulval precursor cells. In future, it will be interesting to investigate the potential link to endocytosis and to determine whether other signalling pathways dependent on endocytosis, e.g. LIN-12 (Notch) could be regulated by this ubiquitin ligase complex. This work has uncovered a novel function for the CUL-4/DDB-1/CDT-2 E
Activation of the Slx5–Slx8 Ubiquitin Ligase by Poly-small Ubiquitin-like Modifier Conjugates*S⃞
Mullen, Janet R.; Brill, Steven J.
2008-01-01
Protein sumoylation is a regulated process that is important for the health of human and yeast cells. In budding yeast, a subset of sumoylated proteins is targeted for ubiquitination by a conserved heterodimeric ubiquitin (Ub) ligase, Slx5–Slx8, which is needed to suppress the accumulation of high molecular weight small ubiquitin-like modifier (SUMO) conjugates. Structure-function analysis indicates that the Slx5–Slx8 complex contains multiple SUMO-binding domains that are collectively required for in vivo function. To determine the specificity of Slx5–Slx8, we assayed its Ub ligase activity using sumoylated Siz2 as an in vitro substrate. In contrast to unsumoylated or multisumoylated Siz2, substrates containing poly-SUMO conjugates were efficiently ubiquitinated by Slx5–Slx8. Although Siz2 itself was ubiquitinated, the bulk of the Ub was conjugated to SUMO residues. Slx5–Slx8 primarily mono-ubiquitinated the N-terminal SUMO moiety of the chain. These data indicate that the Slx5–Slx8 Ub ligase is stimulated by poly-SUMO conjugates and that it can ubiquitinate a poly-SUMO chain. PMID:18499666
Chen, Liyuan; Lee, Joo Hyun; Weber, Henriette; Tohge, Takayuki; Witt, Sandra; Roje, Sanja; Fernie, Alisdair R.; Hellmann, Hanjo
2013-01-01
Regulation of transcriptional processes is a critical mechanism that enables efficient coordination of the synthesis of required proteins in response to environmental and cellular changes. Transcription factors require accurate activity regulation because they play a critical role as key mediators assuring specific expression of target genes. In this work, we show that CULLIN3-based E3 ligases have the potential to interact with a broad range of ETHYLENE RESPONSE FACTOR (ERF)/APETALA2 (AP2) transcription factors, mediated by MATH-BTB/POZ (for Meprin and TRAF [tumor necrosis factor receptor associated factor] homolog)-Broad complex, Tramtrack, Bric-a-brac/Pox virus and Zinc finger) proteins. The assembly with an E3 ligase causes degradation of their substrates via the 26S proteasome, as demonstrated for the WRINKLED1 ERF/AP2 protein. Furthermore, loss of MATH-BTB/POZ proteins widely affects plant development and causes altered fatty acid contents in mutant seeds. Overall, this work demonstrates a link between fatty acid metabolism and E3 ligase activities in plants and establishes CUL3-based E3 ligases as key regulators in transcriptional processes that involve ERF/AP2 family members. PMID:23792371
Siah1/2 Ubiquitin Ligases in ER Stress Signaling in Melanoma
2016-12-01
studies identify distinct taxa that are enriched in the RNF5 KO gut microbiome , suggesting that such populations may be responsible for the changes...ligase which coordinates immune checkpoint and gut microbiota activity which defines degree of melanoma development. 2. KEYWORDS Siah1, Siah2, UPR...whose presence has decreased in the tumors grown in the RNF5 KO mice. Further, recent reports point to the role of gut microbiota in the response
Aurora Kinase A Promotes AR Degradation via the E3 Ligase CHIP.
Sarkar, Sukumar; Brautigan, David L; Larner, James M
2017-08-01
Reducing the levels of the androgen receptor (AR) is one of the most viable approaches to combat castration-resistant prostate cancer. Previously, we observed that proteasomal-dependent degradation of AR in response to 2-methoxyestradiol (2-ME) depends primarily on the E3 ligase C-terminus of HSP70-interacting protein (STUB1/CHIP). Here, 2-ME stimulation activates CHIP by phosphorylation via Aurora kinase A (AURKA). Aurora A kinase inhibitors and RNAi knockdown of Aurora A transcript selectively blocked CHIP phosphorylation and AR degradation. Aurora A kinase is activated by 2-ME in the S-phase as well as during mitosis, and phosphorylates CHIP at S273. Prostate cancer cells expressing an S273A mutant of CHIP have attenuated AR degradation upon 2-ME treatment compared with cells expressing wild-type CHIP, supporting the idea that CHIP phosphorylation by Aurora A activates its E3 ligase activity for the AR. These results reveal a novel 2-ME→Aurora A→CHIP→AR pathway that promotes AR degradation via the proteasome that may offer novel therapeutic opportunities for prostate cancer. Mol Cancer Res; 15(8); 1063-72. ©2017 AACR . ©2017 American Association for Cancer Research.
Aβ-Induced Synaptic Alterations Require the E3 Ubiquitin Ligase Nedd4-1.
Rodrigues, Elizabeth M; Scudder, Samantha L; Goo, Marisa S; Patrick, Gentry N
2016-02-03
Alzheimer's disease (AD) is a neurodegenerative disease in which patients experience progressive cognitive decline. A wealth of evidence suggests that this cognitive impairment results from synaptic dysfunction in affected brain regions caused by cleavage of amyloid precursor protein into the pathogenic peptide amyloid-β (Aβ). Specifically, it has been shown that Aβ decreases surface AMPARs, dendritic spine density, and synaptic strength, and also alters synaptic plasticity. The precise molecular mechanisms by which this occurs remain unclear. Here we demonstrate a role for ubiquitination in Aβ-induced synaptic dysfunction in cultured rat neurons. We find that Aβ promotes the ubiquitination of AMPARs, as well as the redistribution and recruitment of Nedd4-1, a HECT E3 ubiquitin ligase we previously demonstrated to target AMPARs for ubiquitination and degradation. Strikingly, we show that Nedd4-1 is required for Aβ-induced reductions in surface AMPARs, synaptic strength, and dendritic spine density. Our findings, therefore, indicate an important role for Nedd4-1 and ubiquitin in the synaptic alterations induced by Aβ. Synaptic changes in Alzheimer's disease (AD) include surface AMPAR loss, which can weaken synapses. In a cell culture model of AD, we found that AMPAR loss correlates with increased AMPAR ubiquitination. In addition, the ubiquitin ligase Nedd4-1, known to ubiquitinate AMPARs, is recruited to synapses in response to Aβ. Strikingly, reducing Nedd4-1 levels in this model prevented surface AMPAR loss and synaptic weakening. These findings suggest that, in AD, Nedd4-1 may ubiquitinate AMPARs to promote their internalization and weaken synaptic strength, similar to what occurs in Nedd4-1's established role in homeostatic synaptic scaling. This is the first demonstration of Aβ-mediated control of a ubiquitin ligase to regulate surface AMPAR expression. Copyright © 2016 the authors 0270-6474/16/361590-06$15.00/0.
Pendini, Nicole R; Yap, Min Y; Traore, D A K; Polyak, Steven W; Cowieson, Nathan P; Abell, Andrew; Booker, Grant W; Wallace, John C; Wilce, Jacqueline A; Wilce, Matthew C J
2013-06-01
The essential metabolic enzyme biotin protein ligase (BPL) is a potential target for the development of new antibiotics required to combat drug-resistant pathogens. Staphylococcus aureus BPL (SaBPL) is a bifunctional protein, possessing both biotin ligase and transcription repressor activities. This positions BPL as a key regulator of several important metabolic pathways. Here, we report the structural analysis of both holo- and apo-forms of SaBPL using X-ray crystallography. We also present small-angle X-ray scattering data of SaBPL in complex with its biotin-carboxyl carrier protein substrate as well as the SaBPL:DNA complex that underlies repression. This has revealed the molecular basis of ligand (biotinyl-5'-AMP) binding and conformational changes associated with catalysis and repressor function. These data provide new information to better understand the bifunctional activities of SaBPL and to inform future strategies for antibiotic discovery. © 2013 The Protein Society.
Allosteric auto-inhibition and activation of the Nedd4 family E3 ligase Itch.
Zhu, Kang; Shan, Zelin; Chen, Xing; Cai, Yuqun; Cui, Lei; Yao, Weiyi; Wang, Zhen; Shi, Pan; Tian, Changlin; Lou, Jizhong; Xie, Yunli; Wen, Wenyu
2017-09-01
The Nedd4 family E3 ligases are key regulators of cell growth and proliferation and are often misregulated in human cancers and other diseases. The ligase activities of Nedd4 E3s are tightly controlled via auto-inhibition. However, the molecular mechanism underlying Nedd4 E3 auto-inhibition and activation is poorly understood. Here, we show that the WW domains proceeding the catalytic HECT domain play an inhibitory role by binding directly to HECT in the Nedd4 E3 family member Itch. Our structural and biochemical analyses of Itch reveal that the WW2 domain and a following linker allosterically lock HECT in an inactive state inhibiting E2-E3 transthiolation. Binding of the Ndfip1 adaptor or JNK1-mediated phosphorylation relieves the auto-inhibition of Itch in a WW2-dependent manner. Aberrant activation of Itch leads to migration defects of cortical neurons during development. Our study provides a new mechanism governing the regulation of Itch. © 2017 The Authors.
Blocking an N-terminal acetylation–dependent protein interaction inhibits an E3 ligase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Scott, Daniel C.; Hammill, Jared T.; Min, Jaeki
N-terminal acetylation is an abundant modification influencing protein functions. Because ~80% of mammalian cytosolic proteins are N-terminally acetylated, this modification is potentially an untapped target for chemical control of their functions. Structural studies have revealed that, like lysine acetylation, N-terminal acetylation converts a positively charged amine into a hydrophobic handle that mediates protein interactions; hence, this modification may be a druggable target. We report the development of chemical probes targeting the N-terminal acetylation–dependent interaction between an E2 conjugating enzyme (UBE2M or UBC12) and DCN1 (DCUN1D1), a subunit of a multiprotein E3 ligase for the ubiquitin-like protein NEDD8. The inhibitors aremore » highly selective with respect to other protein acetyl-amide–binding sites, inhibit NEDD8 ligation in vitro and in cells, and suppress anchorage-independent growth of a cell line with DCN1 amplification. Overall, our data demonstrate that N-terminal acetyl-dependent protein interactions are druggable targets and provide insights into targeting multiprotein E2–E3 ligases.« less
Weber, Annika; Cohen, Itamar; Popp, Oliver; Dittmar, Gunnar; Reiss, Yuval; Sommer, Thomas; Ravid, Tommer; Jarosch, Ernst
2016-09-01
The Doa10 quality control ubiquitin (Ub) ligase labels proteins with uniform lysine 48-linked poly-Ub (K48-pUB) chains for proteasomal degradation. Processing of Doa10 substrates requires the activity of two Ub conjugating enzymes. Here we show that the non-canonical conjugating enzyme Ubc6 attaches single Ub molecules not only to lysines but also to hydroxylated amino acids. These Ub moieties serve as primers for subsequent poly-ubiquitylation by Ubc7. We propose that the evolutionary conserved propensity of Ubc6 to mount Ub on diverse amino acids augments the number of ubiquitylation sites within a substrate and thereby increases the target range of Doa10. Our work provides new insights on how the consecutive activity of two specialized conjugating enzymes facilitates the attachment of poly-Ub to very heterogeneous client molecules. Such stepwise ubiquitylation reactions most likely represent a more general cellular phenomenon that extends the versatility yet sustains the specificity of the Ub conjugation system. Copyright © 2016 Elsevier Inc. All rights reserved.
Sullivan, James A; Lewis, Michael J; Nikko, Elina; Pelham, Hugh R B
2007-07-01
Recognition of membrane proteins by the Nedd4/Rsp5 ubiquitin ligase family is a critical step in their targeting to the multivesicular body pathway. Some substrates contain "PY" motifs (PPxY), which bind to WW domains in the ligase. Others lack PY motifs and instead rely on adaptors that recruit the ligase to them. To investigate the mechanism of adaptor-mediated ubiquitination, we have characterized the interactions between the adaptor Bsd2, the ubiquitin ligase Rsp5, and the membrane proteins Cps1, Tre1, and Smf1 from Saccharomyces cerevisiae. We have reconstituted adaptor-mediated modification of Cps1 and Tre1 in vitro, and we show that two PY motifs in Bsd2 and two WW domains (WW2 and WW3) in Rsp5 are crucial for this. The binding of a weak noncanonical DMAPSY motif in Bsd2 to WW3 is an absolute requirement for Bsd2 adaptor function. We show that sorting of the manganese transporter Smf1, which requires both Bsd2 and Tre1, depends upon two PY motifs in Bsd2 and one motif in Tre1 but only two WW domains in Rsp5. We suggest that sequential assembly of first a Bsd2/Rsp5 complex, then a Tre1/Bsd2/Rsp5 complex followed by a rearrangement of PY-WW interactions is required for the ubiquitination of Smf1.
Sullivan, James A.; Lewis, Michael J.; Nikko, Elina
2007-01-01
Recognition of membrane proteins by the Nedd4/Rsp5 ubiquitin ligase family is a critical step in their targeting to the multivesicular body pathway. Some substrates contain “PY” motifs (PPxY), which bind to WW domains in the ligase. Others lack PY motifs and instead rely on adaptors that recruit the ligase to them. To investigate the mechanism of adaptor-mediated ubiquitination, we have characterized the interactions between the adaptor Bsd2, the ubiquitin ligase Rsp5, and the membrane proteins Cps1, Tre1, and Smf1 from Saccharomyces cerevisiae. We have reconstituted adaptor-mediated modification of Cps1 and Tre1 in vitro, and we show that two PY motifs in Bsd2 and two WW domains (WW2 and WW3) in Rsp5 are crucial for this. The binding of a weak noncanonical DMAPSY motif in Bsd2 to WW3 is an absolute requirement for Bsd2 adaptor function. We show that sorting of the manganese transporter Smf1, which requires both Bsd2 and Tre1, depends upon two PY motifs in Bsd2 and one motif in Tre1 but only two WW domains in Rsp5. We suggest that sequential assembly of first a Bsd2/Rsp5 complex, then a Tre1/Bsd2/Rsp5 complex followed by a rearrangement of PY–WW interactions is required for the ubiquitination of Smf1. PMID:17429078
Medrano‐Casique, Nicolás; Tong, Hoi Y.; Bellón, Teresa; Cabañas, Rosario; Fiandor, Ana; González‐Ramos, Jessica; Herranz, Pedro; Trigo, Elena; Muñoz, Mario; Borobia, Alberto M.; Carcas, Antonio J.
2016-01-01
Aim We conducted a prospective evaluation of all eosinophilic drug reactions (EDRs) through the Prospective Pharmacovigilance Program from Laboratory Signals at Hospital to find out the incidence and distribution of these entities in our hospital, their causative drugs, and predictors. Methods All peripheral eosinophilia >700 × 106 cells l−1 detected at admission or during hospitalisation, were prospectively monitored over 42 months. The spectrum of the localised or systemic manifestation of EDR, the incidence, the distribution of causative drugs, and the predictors were analysed. Results The incidence of EDR was 16.67 (95% Poisson confidence interval [CI]: 9.90–25.98) per 10 000 admissions. Of 274 cases of EDR, 154 (56.2%) cases in 148 patients were asymptomatic hypereosinophilia. In the remaining 120 (43.8%) cases, there was other involvement. Skin and soft tissue reactions were detected in 36 (13.1%) cases; visceral EDRs in 19(7.0%) cases; and drug‐induced eosinophilic cutaneous and visceral manifestations were detected in the remaining 65 (23.7%) cases, 64 of which were potential drug reaction with eosinophilia and systemic symptoms (DRESS). After adjusting for age, sex, and hospitalisation wards, predictors of symptomatic eosinophilia were earlier onset of eosinophilia (hazard ratio [HR], 10.49; 95%CI: 3.13–35.16) higher eosinophil count (HR, 8.51; 95%CI: 3.28–22.08), and a delayed onset of corticosteroids (HR, 1.34; 95%CI: 1.01–1.73). A higher eosinophil count in patients with DRESS was significantly associated with greater impairment of liver function, prolonged hospitalisation, higher cumulative doses of corticosteroids, and if hypogammaglobinaemia was detected, a reactivation of human‐herpesvirus 6 was subsequently detected. Conclusions Half (53.3%, 64/120 cases) of symptomatic EDRs were potential DRESS. The main predictor of severity of EDR was an early severe eosinophilia. PMID:27543764
Enzyme-mediated assimilation of DNA-functionalized single-walled carbon nanotubes.
Arnett, Clint M; Marsh, Charles P; Welch, Charles R; Strano, Michael S; Han, Jae-Hee; Gray, Jeffry H; Carlson, Thomas A
2010-01-19
When pyrimidine-functionalized carbon nanotubes were incubated with single-stranded DNA ligase, formations of macroscopic aggregates were observed. Wet-cell transmission electron microscopy imaging revealed that the nanotubes were radially bound to form a 3D latticelike structure. These structures were not observed in control reactions lacking ligase or adenosine triphosphate. Raman spectroscopy analysis revealed no spectra indicative of carbon nanotubes in ligase-unamended controls; however, spectra were observed in radial breathing mode and in the G and G' bands in reactions containing ligase. Furthermore, the addition of deoxyribonuclease to the ligated reactions dispersed the aggregates, and a reduction in Raman spectral intensity was observed.
Zang, Hong-Liang; Ren, Sheng-Nan; Cao, Hong; Tian, Xiao-Feng
2017-10-01
Metastasis associated 1 protein (MTA1) is one of the prime facilitators of metastatic progression in all solid tumors including hepatocellular carcinoma (HCC). However, the underlying regulatory mechanism of MTA1 expression in HCC is not clear. In this study, we evaluated MTA1 transcript and protein expression in HCC and normal hepatic cell lines. The results revealed that MTA1 protein expression had a significantly increase in HCC cell line, HuH6, compared with that in normal hepatic cell line, THLE-2. Determination of protein half-life using cycloheximide (CHX) treatment did not reveal any statistically significant difference in protein turn-over rates between THLE-2 (3.3 ± 0.25 h) and HuH6 (3.6 ± 0.15 h) cell lines. MTA1 protein level was stabilized in THLE-2 cells after treatment with MG-132 to levels similar to those observed in HuH6 cells. Mass spectrometric analysis of FLAG immunoprecipitates of FLAG-MTA1 transfected THLE-2 cells after MG-132 treated revealed candidate ubiquitin ligases that were interacting with MTA1. RNAi-mediated silencing of each prospective ubiquitin ligase in THLE-2 cells indicated that knockdown of TRIM25 resulted in stabilization of MTA1 protein, indicating TRIM25 as a putative E3 ligase for MTA1. Coimmunoprecipitation of FLAG-tagged MTA1, but not IgG, in MG-132 treated and untreated THLE-2 cells cotransfected with either FLAG-MTA1 or Myc-TRIM25 revealed robust polyubiquitinated MTA1, confirming that the TRIM25 is the ubiquitin ligase for MTA1 degradation. Overexpression of TRIM25 in HuH6 and RNAi mediated silencing of TRIM25 in THLE-2 cells inhibited and increased the cell migration and invasion, respectively. Analysis of The Cancer Genome Atlas data for assessment of TRIM25 transcript level and MTA1 protein expression in 25 HCC patients confirmed an inverse correlation between the expression of TRIM25 and MTA1. Cumulatively, our data reveal a novel mechanism of post-translational to regulate MTA1 expression in normal
Wang, Xin; Lau, Choiwan; Kai, Masaaki; Lu, Jianzhong
2013-05-07
We propose here a new amplifying strategy that uses hybridization chain reaction (HCR) to detect specific sequences of DNA, where stable DNA monomers assemble on the magnetic beads only upon exposure to a target DNA. Briefly, in the HCR process, two complementary stable species of hairpins coexist in solution until the introduction of initiator reporter strands triggers a cascade of hybridization events that yield nicked double helices analogous to alternating copolymers. Moreover, a "sandwich-type" detection strategy is employed in our design. Magnetic beads, which are functionalized with capture DNA, are reacted with the target, and sandwiched with the above nicked double helices. Then, chemiluminescence (CL) detection proceeds via an instantaneous derivatization reaction between a specific CL reagent, 3,4,5-trimethoxylphenylglyoxal (TMPG), and the guanine nucleotides within the target DNA, reporter strands and DNA monomers for the generation of light. Our results clearly show that the amplification detection of specific sequences of DNA achieves a better performance (e.g. wide linear response range, low detection limit, and high specificity) as compared to the traditional sandwich type (capture/target/reporter) assays. Upon modification, the approach presented could be extended to detect other types of targets. We believe that this simple technique is promising for improving medical diagnosis and treatment.
A graphene-based platform for single nucleotide polymorphism (SNP) genotyping.
Liu, Meng; Zhao, Huimin; Chen, Shuo; Yu, Hongtao; Zhang, Yaobin; Quan, Xie
2011-06-15
A facile, rapid, stable and sensitive approach for fluorescent detection of single nucleotide polymorphism (SNP) is designed based on DNA ligase reaction and π-stacking between the graphene and the nucleotide bases. In the presence of perfectly matched DNA, DNA ligase can catalyze the linkage of fluorescein amidite-labeled single-stranded DNA (ssDNA) and a phosphorylated ssDNA, and thus the formation of a stable duplex in high yield. However, the catalytic reaction cannot effectively carry out with one-base mismatched DNA target. In this case, we add graphene to the system in order to produce different quenching signals due to its different adsorption affinity for ssDNA and double-stranded DNA. Taking advantage of the unique surface property of graphene and the high discriminability of DNA ligase, the proposed protocol exhibits good performance in SNP genotyping. The results indicate that it is possible to accurately determine SNP with frequency as low as 2.6% within 40 min. Furthermore, the presented flexible strategy facilitates the development of other biosensing applications in the future. Copyright © 2011 Elsevier B.V. All rights reserved.
Ossareh-Nazari, Batool; Katsiarimpa, Anthi; Merlet, Jorge; Pintard, Lionel
2016-10-13
Cullin-RING E3-Ligases (CRLs), the largest family of E3 ubiquitin-Ligases, regulate diverse cellular processes by promoting ubiquitination of target proteins. The evolutionarily conserved Leucine Rich Repeat protein 1 (LRR-1) is a substrate-recognition subunit of a CRL2 LRR-1 E3-ligase. Here we provide genetic evidence supporting a role of this E3-enzyme in the maintenance of DNA replication integrity in Caenorhabditis elegans Through RNAi-based suppressor screens of lrr-1(0) and cul-2(or209ts) mutants, we identified two genes encoding components of the GINS complex, which is part of the Cdc45-MCM-GINS (CMG) replicative helicase, as well as CDC-7 and MUS-101, which drives the assembly of the CMG helicase during DNA replication. In addition, we identified the core components of the ATR/ATL-1 DNA replication checkpoint pathway (MUS-101, ATL-1, CLSP-1, CHK-1). These results suggest that the CRL2 LRR-1 E3-ligase acts to modify or degrade factor(s) that would otherwise misregulate the replisome, eventually leading to the activation of the DNA replication checkpoint. Copyright © 2016 Ossareh-Nazari et al.
Ossareh-Nazari, Batool; Katsiarimpa, Anthi; Merlet, Jorge; Pintard, Lionel
2016-01-01
Cullin-RING E3-Ligases (CRLs), the largest family of E3 ubiquitin-Ligases, regulate diverse cellular processes by promoting ubiquitination of target proteins. The evolutionarily conserved Leucine Rich Repeat protein 1 (LRR-1) is a substrate-recognition subunit of a CRL2LRR-1 E3-ligase. Here we provide genetic evidence supporting a role of this E3-enzyme in the maintenance of DNA replication integrity in Caenorhabditis elegans. Through RNAi-based suppressor screens of lrr-1(0) and cul-2(or209ts) mutants, we identified two genes encoding components of the GINS complex, which is part of the Cdc45-MCM-GINS (CMG) replicative helicase, as well as CDC-7 and MUS-101, which drives the assembly of the CMG helicase during DNA replication. In addition, we identified the core components of the ATR/ATL-1 DNA replication checkpoint pathway (MUS-101, ATL-1, CLSP-1, CHK-1). These results suggest that the CRL2LRR-1 E3-ligase acts to modify or degrade factor(s) that would otherwise misregulate the replisome, eventually leading to the activation of the DNA replication checkpoint. PMID:27543292
Gorelik, Maryna; Orlicky, Stephen; Sartori, Maria A.; ...
2016-03-14
Skp1–Cul1–F-box (SCF) E3 ligases play key roles in multiple cellular processes through ubiquitination and subsequent degradation of substrate proteins. Although Skp1 and Cul1 are invariant components of all SCF complexes, the 69 different human F-box proteins are variable substrate binding modules that determine specificity. SCF E3 ligases are activated in many cancers and inhibitors could have therapeutic potential. Here, we used phage display to develop specific ubiquitin-based inhibitors against two F-box proteins, Fbw7 and Fbw11. Unexpectedly, the ubiquitin variants bind at the interface of Skp1 and F-box proteins and inhibit ligase activity by preventing Cul1 binding to the same surface.more » Using structure-based design and phage display, we modified the initial inhibitors to generate broad-spectrum inhibitors that targeted many SCF ligases, or conversely, a highly specific inhibitor that discriminated between even the close homologs Fbw11 and Fbw1. We propose that most F-box proteins can be targeted by this approach for basic research and for potential cancer therapies.« less
Distribution and survival of Pseudomonas sp. on Italian ryegrass and Curly dock in Georgia
USDA-ARS?s Scientific Manuscript database
Yellow bud, caused by Pseudomonas sp. is an emerging bacterial disease of onion. Polymerase chain reaction (PCR) assay based on the coronafacate ligase (cfl) and HrpZ genes were used to detect initial suspected bacteria on weeds. Growth on an agar medium, ability to cause a hypersensitive response i...
Relayed 13C magnetization transfer: Detection of malate dehydrogenase reaction in vivo
NASA Astrophysics Data System (ADS)
Yang, Jehoon; Shen, Jun
2007-02-01
Malate dehydrogenase catalyzes rapid interconversion between dilute metabolites oxaloacetate and malate. Both oxaloacetate and malate are below the detection threshold of in vivo MRS. Oxaloacetate is also in rapid exchange with aspartate catalyzed by aspartate aminotransferase, the latter metabolite is observable in vivo using 13C MRS. We hypothesized that the rapid turnover of oxaloacetate can effectively relay perturbation of magnetization between malate and aspartate. Here, we report indirect observation of the malate dehydrogenase reaction by saturating malate C2 resonance at 71.2 ppm and detecting a reduced aspartate C2 signal at 53.2 ppm due to relayed magnetization transfer via oxaloacetate C2 at 201.3 ppm. Using this strategy the rate of the cerebral malate dehydrogenase reaction was determined to be 9 ± 2 μmol/g wet weight/min (means ± SD, n = 5) at 11.7 Tesla in anesthetized adult rats infused with [1,6- 13C 2]glucose.
The ubiquitin ligase Siah2 regulates obesity-induced adipose tissue inflammation.
Kilroy, Gail; Carter, Lauren E; Newman, Susan; Burk, David H; Manuel, Justin; Möller, Andreas; Bowtell, David D; Mynatt, Randall L; Ghosh, Sujoy; Floyd, Z Elizabeth
2015-11-01
Chronic, low-grade adipose tissue inflammation associated with adipocyte hypertrophy is an important link in the relationship between obesity and insulin resistance. Although ubiquitin ligases regulate inflammatory processes, the role of these enzymes in metabolically driven adipose tissue inflammation is relatively unexplored. Herein, the effect of the ubiquitin ligase Siah2 on obesity-related adipose tissue inflammation was examined. Wild-type and Siah2KO mice were fed a low- or high-fat diet for 16 weeks. Indirect calorimetry, body composition, and glucose and insulin tolerance were assayed along with glucose and insulin levels. Gene and protein expression, immunohistochemistry, adipocyte size distribution, and lipolysis were also analyzed. Enlarged adipocytes in obese Siah2KO mice were not associated with obesity-induced insulin resistance. Proinflammatory gene expression, stress kinase signaling, fibrosis, and crown-like structures were reduced in the Siah2KO adipose tissue, and Siah2KO adipocytes were more responsive to insulin-dependent inhibition of lipolysis. Loss of Siah2 increased expression of PPARγ target genes involved in lipid metabolism and decreased expression of proinflammatory adipokines regulated by PPARγ. Siah2 links adipocyte hypertrophy with adipocyte dysfunction and recruitment of proinflammatory immune cells to adipose tissue. Selective regulation of PPARγ activity is a Siah2-mediated mechanism contributing to obesity-induced adipose tissue inflammation. © 2015 The Obesity Society.
Liu, Yaobin; Huang, Xiangao; He, Xian; Zhou, Yanqing; Jiang, Xiaogang; Chen-Kiang, Selina; Jaffrey, Samie R.; Xu, Guoqiang
2015-01-01
The immunomodulatory drug (IMiD) thalidomide and its structural analogs lenalidomide and pomalidomide are highly effective in treating clinical indications. Thalidomide binds to cereblon (CRBN), a substrate receptor of the cullin-4 really interesting new gene (RING) E3 ligase complex. Here, we examine the effect of thalidomide and its analogs on CRBN ubiquitination and its functions in human cell lines. We find that the ubiquitin modification of CRBN includes K48-linked polyubiquitin chains and that thalidomide blocks the formation of CRBN-ubiquitin conjugates. Furthermore, we show that ubiquitinated CRBN is targeted for proteasomal degradation. Treatment of human myeloma cell lines such as MM1.S, OPM2, and U266 with thalidomide (100 μM) and its structural analog lenalidomide (10 μM) results in stabilization of CRBN and elevation of CRBN protein levels. This in turn leads to the reduced level of CRBN target proteins and enhances the sensitivity of human multiple myeloma cells to IMiDs. Our results reveal a novel mechanism by which thalidomide and its analogs modulate the CRBN function in cells. Through inhibition of CRBN ubiquitination, thalidomide and its analogs allow CRBN to accumulate, leading to the increased cullin-4 RING E3 ligase-mediated degradation of target proteins.—Liu, Y., Huang, X., He, X., Zhou, Y., Jiang, X., Chen-Kiang, S., Jaffrey, S. R., Xu, G. A novel effect of thalidomide and its analogs: suppression of cereblon ubiquitination enhances ubiquitin ligase function. PMID:26231201
Herrera, Alfa; Vu, Bao G; Stach, Christopher S; Merriman, Joseph A; Horswill, Alexander R; Salgado-Pabón, Wilmara; Schlievert, Patrick M
2016-05-03
β-Toxin is an important virulence factor of Staphylococcus aureus, contributing to colonization and development of disease [Salgado-Pabon, W., et al. (2014) J. Infect. Dis. 210, 784-792; Huseby, M. J., et al. (2010) Proc. Natl. Acad. Sci. U.S.A. 107, 14407-14412; Katayama, Y., et al. (2013) J. Bacteriol. 195, 1194-1203]. This cytotoxin has two distinct mechanisms of action: sphingomyelinase activity and DNA biofilm ligase activity. However, the distinct mechanism that is most important for its role in infective endocarditis is unknown. We characterized the active site of β-toxin DNA biofilm ligase activity by examining deficiencies in site-directed mutants through in vitro DNA precipitation and biofilm formation assays. Possible conformational changes in mutant structure compared to that of wild-type toxin were assessed preliminarily by trypsin digestion analysis, retention of sphingomyelinase activity, and predicted structures based on the native toxin structure. We addressed the contribution of each mechanism of action to producing infective endocarditis and sepsis in vivo in a rabbit model. The H289N β-toxin mutant, lacking sphingomyelinase activity, exhibited lower sepsis lethality and infective endocarditis vegetation formation compared to those of the wild-type toxin. β-Toxin mutants with disrupted biofilm ligase activity did not exhibit decreased sepsis lethality but were deficient in infective endocarditis vegetation formation compared to the wild-type protein. Our study begins to characterize the DNA biofilm ligase active site of β-toxin and suggests β-toxin functions importantly in infective endocarditis through both of its mechanisms of action.
NASA Technical Reports Server (NTRS)
McGinness, Kathleen E.; Wright, Martin C.; Joyce, Gerald F.
2002-01-01
Variants of the class I ligase ribozyme, which catalyzes joining of the 3' end of a template bound oligonucleotide to its own 5' end, have been made to evolve in a continuous manner by a simple serial transfer procedure that can be carried out indefinitely. This process was expanded to allow the evolution of ribozymes that catalyze three successive nucleotidyl addition reactions, two template-directed mononucleotide additions followed by RNA ligation. During the development of this behavior, a population of ribozymes was maintained against an overall dilution of more than 10(exp 406). The resulting ribozymes were capable of catalyzing the three-step reaction pathway, with nucleotide addition occurring in either a 5' yieldig 3' or a 3' yielding 5' direction. This purely chemical system provides a functional model of a multi-step reaction pathway that is undergoing Darwinian evolution.
SCFSlmb E3 ligase-mediated degradation of Expanded is inhibited by the Hippo pathway in Drosophila
Zhang, Hongtao; Li, Changqing; Chen, Hanqing; Wei, Chuanxian; Dai, Fei; Wu, Honggang; Dui, Wen; Deng, Wu-Min; Jiao, Renjie
2015-01-01
Deregulation of the evolutionarily conserved Hippo pathway has been implicated in abnormal development of animals and in several types of cancer. One mechanism of Hippo pathway regulation is achieved by controlling the stability of its regulatory components. However, the executive E3 ligases that are involved in this process, and how the process is regulated, remain poorly defined. In this study, we identify, through a genetic candidate screen, the SCFSlmb E3 ligase as a novel negative regulator of the Hippo pathway in Drosophila imaginal tissues via mediation of the degradation of Expanded (Ex). Mechanistic study shows that Slmb-mediated degradation of Ex is inhibited by the Hippo signaling. Considering the fact that Hippo signaling suppresses the transcription of ex, we propose that the Hippo pathway employs a double security mechanism to ensure fine-tuned homeostasis during development. PMID:25522691
Lim, J H; Choi, J; Kim, W; Ahn, B Y; Han, Y S
2001-04-15
We constructed nine deletion mutants of NAD+-dependent DNA ligase from Aquifex pyrophilus to characterize the functional domains. All of DNA ligase deletion mutants were analyzed in biochemical assays for NAD+-dependent self-adenylation, DNA binding, and nick-closing activity. Although the mutant lsub1 (91-362) included the active site lysine (KxDG), self-adenylation was not shown. However, the mutants lsub6 (1-362), lsub7 (1-516), and lsub9 (1-635) showed the same adenylation activity as that of wild type. The lsub5 (91-719), which has the C-terminal domain (487-719) as to lsub4 (91-486), showed minimal adenylation activity. These results suggest that the presence of N-terminal 90 residues is essential for the formation of an enzyme-AMP complex, while C-terminal domain (487-719) appears to play a minimal role in adenylation. It was found that the presence of C-terminal domain (487-719) is indispensable for DNA binding activity of lsub5 (91-719). The mutant lsub9 (1-635) showed reduced DNA binding activity compared to that of wild type, suggesting the contribution of the domain (636-719) for the DNA binding activity. Thus, we concluded that the N-terminal 90 residues and C-terminal domain (487-719) of NAD+-dependent DNA ligase from A. pyrophilus are mutually indispensable for binding of DNA substrate.
Detection of human Pneumocystis carinii by the polymerase chain reaction.
Becker-Hapak, M; Liberator, P; Graves, D
1991-01-01
Oligonucleotide primers were prepared from a clone (B12) which has been shown to be a repetitive sequence in the rat P. carinii genome. Polymerase chain reaction was employed to amplify both rat and human P. carinii DNA. The detection limit of the assay was approximately 600 ng of total nucleic acid. Amplification products from both the rat and human isolates (ca. 780 bp) were characterized by denaturing gradient gel electrophoresis after digestion with Sau3A. No amplification products were obtained when DNA from the following potential pulmonary pathogens were used in identical reactions: Aspergillus fumigatus, Cryptococcus neoformans, Candida albicans, Mycobacterium avium-intracellulare and cytomegalovirus. In a blind study using the B12 primers, P. carinii DNA was successfully amplified in clinical samples which were positive by direct immunofluorescence assay (IFA) as well as in some specimens not identified by direct IFA.
Polyubiquitylation of AMF requires cooperation between the gp78 and TRIM25 ubiquitin ligases.
Wang, Ying; Ha, Seung-Wook; Zhang, Tianpeng; Kho, Dhong-Hyo; Raz, Avraham; Xie, Youming
2014-04-30
gp78 is a ubiquitin ligase that plays a vital role in endoplasmic reticulum (ER)-associated degradation (ERAD). Here we report that autocrine motility factor (AMF), also known as phosphoglucose isomerase (PGI), is a novel substrate of gp78. We show that polyubiquitylation of AMF requires cooperative interaction between gp78 and the ubiquitin ligase TRIM25 (tripartite motif-containing protein 25). While TRIM25 mediates the initial round of ubiquitylation, gp78 catalyzes polyubiquitylation of AMF. The E4-like activity of gp78 was illustrated by an in vitro polyubiquitylation assay using Ub-DHFR as a model substrate. We further demonstrate that TRIM25 ubiquitylates gp78 and that overexpression of TRIM25 accelerates the degradation of gp78. Our data suggest that TRIM25 not only cooperates with gp78 in polyubiquitylation of AMF but also gauges the steady-state level of gp78. This study uncovers a previously unknown functional link between gp78 and TRIM25 and provides mechanistic insight into gp78-mediated protein ubiquitylation.
Polyubiquitylation of AMF requires cooperation between the gp78 and TRIM25 ubiquitin ligases
Kho, Dhong-Hyo; Raz, Avraham; Xie, Youming
2014-01-01
gp78 is a ubiquitin ligase that plays a vital role in endoplasmic reticulum (ER)-associated degradation (ERAD). Here we report that autocrine motility factor (AMF), also known as phosphoglucose isomerase (PGI), is a novel substrate of gp78. We show that polyubiquitylation of AMF requires cooperative interaction between gp78 and the ubiquitin ligase TRIM25 (tripartite motif-containing protein 25). While TRIM25 mediates the initial round of ubiquitylation, gp78 catalyzes polyubiquitylation of AMF. The E4-like activity of gp78 was illustrated by an in vitro polyubiquitylation assay using Ub-DHFR as a model substrate. We further demonstrate that TRIM25 ubiquitylates gp78 and that overexpression of TRIM25 accelerates the degradation of gp78. Our data suggest that TRIM25 not only cooperates with gp78 in polyubiquitylation of AMF but also gauges the steady-state level of gp78. This study uncovers a previously unknown functional link between gp78 and TRIM25 and provides mechanistic insight into gp78-mediated protein ubiquitylation. PMID:24810856
NASA Astrophysics Data System (ADS)
Amador-Muñoz, Omar; Misztal, Pawel K.; Weber, Robin; Worton, David R.; Zhang, Haofei; Drozd, Greg; Goldstein, Allen H.
2016-11-01
Proton-transfer-reaction mass spectrometry (PTR-MS) is a technique that is widely used to detect volatile organic compounds (VOCs) with proton affinities higher than water. However, n-alkanes generally have a lower proton affinity than water and therefore proton transfer (PT) by reaction with H3O+ is not an effective mechanism for their detection. In this study, we developed a method using a conventional PTR-MS to detect n-alkanes by optimizing ion source and drift tube conditions to vary the relative amounts of different primary ions (H3O+, O2+, NO+) in the reaction chamber (drift tube). There are very few studies on O2+ detection of alkanes and the mixed mode has never been proposed before. We determined the optimum conditions and the resulting reaction mechanisms, allowing detection of n-alkanes from n-pentane to n-tridecane. These compounds are mostly emitted by evaporative/combustion process from fossil fuel use. The charge transfer (CT) mechanism observed with O2+ was the main reaction channel for n-heptane and longer n-alkanes, while for n-pentane and n-hexane the main reaction channel was hydride abstraction (HA). Maximum sensitivities were obtained at low E / N ratios (83 Td), low water flow (2 sccm) and high O2+ / NO+ ratios (Uso = 180 V). Isotopic 13C contribution was taken into account by subtracting fractions of the preceding 12C ion signal based on the number of carbon atoms and the natural abundance of 13C (i.e., 5.6 % for n-pentane and 14.5 % for n-tridecane). After accounting for isotopic distributions, we found that PT cannot be observed for n-alkanes smaller than n-decane. Instead, protonated water clusters of n-alkanes (M ṡ H3O+) species were observed with higher abundance using lower O2+ and higher water cluster fractions. M ṡ H3O+ species are probably the source for the M + H+ species observed from n-decane to n-tridecane. Normalized sensitivities to O2+ or to the sum of O2++ NO+ were determined to be a good metric with which
Purification and biochemical characterization of Mur ligases from Staphylococcus aureus.
Patin, Delphine; Boniface, Audrey; Kovač, Andreja; Hervé, Mireille; Dementin, Sébastien; Barreteau, Hélène; Mengin-Lecreulx, Dominique; Blanot, Didier
2010-12-01
The Mur ligases (MurC, MurD, MurE and MurF) catalyze the stepwise synthesis of the UDP-N-acetylmuramoyl-pentapeptide precursor of peptidoglycan. The murC, murD, murE and murF genes from Staphylococcus aureus, a major pathogen, were cloned and the corresponding proteins were overproduced in Escherichia coli and purified as His(6)-tagged forms. Their biochemical properties were investigated and compared to those of the E. coli enzymes. Staphylococcal MurC accepted L-Ala, L-Ser and Gly as substrates, as the E. coli enzyme does, with a strong preference for L-Ala. S. aureus MurE was very specific for L-lysine and in particular did not accept meso-diaminopimelic acid as a substrate. This mirrors the E. coli MurE specificity, for which meso-diaminopimelic acid is the preferred substrate and L-lysine a very poor one. S. aureus MurF appeared less specific and accepted both forms (L-lysine and meso-diaminopimelic acid) of UDP-MurNAc-tripeptide, as the E. coli MurF does. The inverse and strict substrate specificities of the two MurE orthologues is thus responsible for the presence of exclusively meso-diaminopimelic acid and L-lysine at the third position of the peptide in the peptidoglycans of E. coli and S. aureus, respectively. The specific activities of the four Mur ligases were also determined in crude extracts of S. aureus and compared to cell requirements for peptidoglycan biosynthesis. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
García-González, Elena; Aramendía, Maite; González-Tarancón, Ricardo; Romero-Sánchez, Naiara; Rello, Luis
2017-07-26
The direct bilirubin (D-Bil) assay on the AU Beckman Coulter instrumentation can be interfered by paraproteins, which may result in spurious D-Bil results. In a previous work, we took advantage of this fact to detect this interference, thus helping with the identification of patients with unsuspected monoclonal gammopathies. In this work, we investigate the possibility to detect interference based on the review of the photometric reactions, regardless of the D-Bil result. The D-Bil assay was carried out in a set of 2164 samples. It included a group of 164 samples with paraproteins (67 of which caused interference on the assay), as well as different groups of samples for which high absorbance background readings could also be expected (i.e. hemolyzed, lipemic, or icteric samples). Photometric reaction data were reviewed and receiver operating characteristics (ROC) curves were used to establish a cut-off for absorbance that best discriminates interference. The best cut-off was 0.0100 for the absorbance at the first photometric point of the complementary wavelength in the blank cuvette. Once the optimal cut-off for probable interference was selected, all samples analyzed in our laboratory that provided absorbance values above this cut-off were further investigated to try to discover paraproteins. During a period of 6 months, we detected 44 samples containing paraproteins, five of which belonged to patients with non-diagnosed monoclonal gammopathies. Review of the photometric reaction data permits the systematic detection of paraprotein interference on the D-Bil AU assay, even for samples for which reasonable results are obtained.
UV-B induction of the E3 ligase ARIADNE12 depends on CONSTITUTIVELY PHOTOMORPHOGENIC 1
Xie, Lisi; Lang-Mladek, Christina; Richter, Julia; Nigam, Neha; Hauser, Marie-Theres
2015-01-01
The UV-B inducible ARIADNE12 (ARI12) gene of Arabidopsis thaliana is a member of the RING-between-RING (RBR) family of E3 ubiquitin ligases for which a novel ubiquitination mechanism was identified in mammalian homologs. This RING-HECT hybrid mechanism needs a conserved cysteine which is replaced by serine in ARI12 and might affect the E3 ubiquitin ligase activity. We have shown that under photomorphogenic UV-B, ARI12 is a downstream target of the classical ultraviolet B (UV-B) UV RESISTANCE LOCUS 8 (UVR8) pathway. However, under high fluence rate of UV-B ARI12 was induced independently of UVR8 and the UV-A/blue light and red/far-red photoreceptors. A key component of several light signaling pathways is CONSTITUTIVELY PHOTOMORPHOGENIC 1 (COP1). Upon UV-B COP1 is trapped in the nucleus through interaction with UVR8 permitting the activation of genes that regulate the biosynthesis of UV-B protective metabolites and growth adaptations. To clarify the role of COP1 in the regulation of ARI12 mRNA expression and ARI12 protein stability, localization and interaction with COP1 was assessed with and without UV-B. We found that COP1 controls ARI12 in white light, low and high fluence rate of UV-B. Furthermore we show that ARI12 is indeed an E3 ubiquitin ligase which is mono-ubiquitinated, a prerequisite for the RING-HECT hybrid mechanism. Finally, genetic analyses with transgenes expressing a genomic pmARI12:ARI12-GFP construct confirm the epistatic interaction between COP1 and ARI12 in growth responses to high fluence rate UV-B. PMID:25817546
Characterization and Promoter Analysis of a Cotton Ring-Type Ubiquitin Ligase (E3) Gene
USDA-ARS?s Scientific Manuscript database
A cotton fiber cDNA, GhRING1, and its corresponding gene have been cloned and characterized. The GhRING1 gene encodes a RING-type ubiquitin ligase (E3) containing 337 amino acids (aa). The GhRING1 protein contains a RING finger motif with conserved cysteine and histine residues at the C-terminus a...
The E3 ubiquitin ligase NEDD4 is an LC3-interactive protein and regulates autophagy.
Sun, Aiqin; Wei, Jing; Childress, Chandra; Shaw, John H; Peng, Ke; Shao, Genbao; Yang, Wannian; Lin, Qiong
2017-03-04
The MAP1LC3/LC3 family plays an essential role in autophagosomal biogenesis and transport. In this report, we show that the HECT family E3 ubiquitin ligase NEDD4 interacts with LC3 and is involved in autophagosomal biogenesis. NEDD4 binds to LC3 through a conserved WXXL LC3-binding motif in a region between the C2 and the WW2 domains. Knockdown of NEDD4 impaired starvation- or rapamycin-induced activation of autophagy and autophagosomal biogenesis and caused aggregates of the LC3 puncta colocalized with endoplasmic reticulum membrane markers. Electron microscopy observed gigantic deformed mitochondria in NEDD4 knockdown cells, suggesting that NEDD4 might function in mitophagy. Furthermore, SQSTM1 is ubiquitinated by NEDD4 while LC3 functions as an activator of NEDD4 ligase activity. Taken together, our studies define an important role of NEDD4 in regulation of autophagy.
Mur Ligase Inhibitors as Anti-bacterials: A Comprehensive Review.
Sangshetti, Jaiprakash N; Joshi, Suyog S; Patil, Rajendra H; Moloney, Mark G; Shinde, Devanand B
2017-01-01
Exploring a new target for antibacterial drug discovery has gained much attention because of the emergence of Multidrug Resistance (MDR) strains of bacteria. To overcome this problem the development of novel antibacterial was considered as highest priority task and was one of the biggest challenge since multiple factors were involved. The bacterial peptidoglycan biosynthetic pathway has been well documented in the last few years and has been found to be imperative source for the development of novel antibacterial agents with high target specificity as they are essential for bacterial survival and have no homologs in humans. We have therefore reviewed the process of peptidoglycan biosynthesis which involves various steps like formation of UDP-Nacetylglucosamine (GlcNAc), UDP-N-acetylmuramic acid (MurNAc) and lipid intermediates (Lipid I and Lipid II) which are controlled by various enzymes like GlmS, GlmM, GlmU enzyme, followed by Mur Ligases (MurAMurF) and finally by MraY and MurG respectively. These four amide ligases MurC-MurF can be used as the source for the development of novel multi-target antibacterial agents as they shared and conserved amino acid regions, catalytic mechanisms and structural features. This review begins with the need for novel antibacterial agents and challenges in their development even after the development of bacterial genomic studies. An overview of the peptidoglycan monomer formation, as a source of disparity in this process is presented, followed by detailed discussion of structural and functional aspects of all Mur enzymes and different chemical classes of their inhibitors along with their SAR studies and inhibitory potential. This review finally emphasizes on different patents and novel Mur inhibitors in the development phase. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Nakano, Masahito; Oda, Kenji; Mukaihara, Takafumi
2017-07-01
Ralstonia solanacearum is the causal agent of bacterial wilt in solanaceous crops. This pathogen injects more than 70 effector proteins into host plant cells via the Hrp type III secretion system to cause a successful infection. However, the function of these effectors in plant cells, especially in the suppression of plant immunity, remains largely unknown. In this study, we characterized two Ralstonia solanacearum effectors, RipAW and RipAR, which share homology with the IpaH family of effectors from animal and plant pathogenic bacteria, that have a novel E3 ubiquitin ligase (NEL) domain. Recombinant RipAW and RipAR show E3 ubiquitin ligase activity in vitro. RipAW and RipAR localized to the cytoplasm of plant cells and significantly suppressed pattern-triggered immunity (PTI) responses such as the production of reactive oxygen species and the expression of defence-related genes when expressed in leaves of Nicotiana benthamiana. Mutation in the conserved cysteine residue in the NEL domain of RipAW completely abolished the E3 ubiquitin ligase activity in vitro and the ability to suppress PTI responses in plant leaves. These results indicate that RipAW suppresses plant PTI responses through the E3 ubiquitin ligase activity. Unlike other members of the IpaH family of effectors, RipAW and RipAR had no leucine-rich repeat motifs in their amino acid sequences. A conserved C-terminal region of RipAW is indispensable for PTI suppression. Transgenic Arabidopsis plants expressing RipAW and RipAR showed increased disease susceptibility, suggesting that RipAW and RipAR contribute to bacterial virulence in plants.
Cruz-Perez, Patricia; Buttner, Mark P.
2004-05-11
A method for detecting the fungus Stachybotrys chartarum includes isolating DNA from a sample suspected of containing the fungus Stachybotrys chartarum. The method further includes subjecting the DNA to polymerase chain reaction amplification utilizing at least one of several primers, the several primers each including one of the base sequences 5'GTTGCTTCGGCGGGAAC3', 5'TTTGCGTTTGCCACTCAGAG3', 5'ACCTATCGTTGCTTCGGCG3', and 5'GCGTTTGCCACTCAGAGAATACT3'. The method additionally includes detecting the fungus Stachybotrys chartarum by visualizing the product of the polymerase chain reaction.
Lv, Yun; Yang, Lili; Mao, Xiaoxia; Lu, Mengjia; Zhao, Jing; Yin, Yongmei
2016-11-15
Glutathione (GSH) plays an important role in numerous cellular functions, and the abnormal GSH expression is closely related with many dangerous human diseases. In this work, we have proposed a simple but sensitive electrochemical method for quantitative detection of GSH based on an Hg(2+)-mediated strand displacement reaction. Owing to the specific binding of Hg(2+) with T-T mismatches, helper DNA can bind to 3' terminal of probe DNA 1 and initiate the displacement of probe DNA 2 immobilized on an electrode surface. However, Hg(2+)-mediated strand displacement reaction can be inhibited by the chelation of GSH with Hg(2+), thereby leading to an obvious electrochemical response obtained from methylene blue that is modified onto the probe DNA. Our method can sensitively detect GSH in a wide linear range from 0.5nM to 5μM with a low detection limit of 0.14nM, which can also easily distinguish target molecules in complex serum samples and even cell extractions. Therefore, this method may have great potential to monitor GSH in the physiological and pathological condition in the future. Copyright © 2016 Elsevier B.V. All rights reserved.
Luteijn, Rutger David; Drexler, Ingo; Smith, Geoffrey L; Lebbink, Robert Jan; Wiertz, Emmanuel J H J
2018-06-01
Poxviruses comprise a group of large dsDNA viruses that include members relevant to human and animal health, such as variola virus, monkeypox virus, cowpox virus and vaccinia virus (VACV). Poxviruses are remarkable for their unique replication cycle, which is restricted to the cytoplasm of infected cells. The independence from the host nucleus requires poxviruses to encode most of the enzymes involved in DNA replication, transcription and processing. Here, we use the CRISPR/Cas9 genome engineering system to induce DNA damage to VACV (strain Western Reserve) genomes. We show that targeting CRISPR/Cas9 to essential viral genes limits virus replication efficiently. Although VACV is a strictly cytoplasmic pathogen, we observed extensive viral genome editing at the target site; this is reminiscent of a non-homologous end-joining DNA repair mechanism. This pathway was not dependent on the viral DNA ligase, but critically involved the cellular DNA ligase IV. Our data show that DNA ligase IV can act outside of the nucleus to allow repair of dsDNA breaks in poxvirus genomes. This pathway might contribute to the introduction of mutations within the genome of poxviruses and may thereby promote the evolution of these viruses.
The pineal gland: A model for adrenergic modulation of ubiquitin ligases.
Vriend, Jerry; Liu, Wenjun; Reiter, Russel J
2017-01-01
A recent study of the pineal gland of the rat found that the expression of more than 3000 genes showed significant day/night variations (The Hartley dataset). The investigators of this report made available a supplemental table in which they tabulated the expression of many genes that they did not discuss, including those coding for components of the ubiquitin proteasome system. Herein we identify the genes of the ubiquitin proteasome system whose expression were significantly influenced by environmental lighting in the Hartley dataset, those that were stimulated by DBcAMP in pineal glands in culture, and those that were stimulated by norepinephrine. Using the Ubiquitin and Ubiquitin-like Conjugation Database (UUCA) we identified ubiquitin ligases and conjugases, and deubiquitinases in the Hartley dataset for the purpose of determining whether expression of genes of the ubiquitin proteasome pathway were significantly influenced by day/night variations and if these variations were regulated by autonomic innervation of the pineal gland from the superior cervical ganglia. In the Hartley experiments pineal glands groups of rats sacrificed during the day and groups sacrificed during the night were examined for gene expression. Additional groups of rats had their superior cervical ganglia removed surgically or surgically decentralized and the pineal glands likewise examined for gene expression. The genes with at least a 2-fold day/night significant difference in expression included genes for 5 ubiquitin conjugating enzymes, genes for 58 ubiquitin E3 ligases and genes for 6 deubiquitinases. A 35-fold day/night difference was noted in the expression of the gene Sik1, which codes for a protein containing both an ubiquitin binding domain (UBD) and an ubiquitin-associated (UBA) domain. Most of the significant differences in these genes were prevented by surgical removal, or disconnection, of the superior cervical ganglia, and most were responsive, in vitro, to treatment with
The pineal gland: A model for adrenergic modulation of ubiquitin ligases
Liu, Wenjun; Reiter, Russel J.
2017-01-01
Introduction A recent study of the pineal gland of the rat found that the expression of more than 3000 genes showed significant day/night variations (The Hartley dataset). The investigators of this report made available a supplemental table in which they tabulated the expression of many genes that they did not discuss, including those coding for components of the ubiquitin proteasome system. Herein we identify the genes of the ubiquitin proteasome system whose expression were significantly influenced by environmental lighting in the Hartley dataset, those that were stimulated by DBcAMP in pineal glands in culture, and those that were stimulated by norepinephrine. Purpose Using the Ubiquitin and Ubiquitin-like Conjugation Database (UUCA) we identified ubiquitin ligases and conjugases, and deubiquitinases in the Hartley dataset for the purpose of determining whether expression of genes of the ubiquitin proteasome pathway were significantly influenced by day/night variations and if these variations were regulated by autonomic innervation of the pineal gland from the superior cervical ganglia. Methods In the Hartley experiments pineal glands groups of rats sacrificed during the day and groups sacrificed during the night were examined for gene expression. Additional groups of rats had their superior cervical ganglia removed surgically or surgically decentralized and the pineal glands likewise examined for gene expression. Results The genes with at least a 2-fold day/night significant difference in expression included genes for 5 ubiquitin conjugating enzymes, genes for 58 ubiquitin E3 ligases and genes for 6 deubiquitinases. A 35-fold day/night difference was noted in the expression of the gene Sik1, which codes for a protein containing both an ubiquitin binding domain (UBD) and an ubiquitin-associated (UBA) domain. Most of the significant differences in these genes were prevented by surgical removal, or disconnection, of the superior cervical ganglia, and most were
Autoubiquitination of feline E3 ubiquitin ligase BCA2.
Wang, Weiran; Qu, Meng; Wang, Jiawen; Zhang, Xin; Zhang, Haihong; Wu, Jiaxin; Yu, Bin; Wu, Hui; Kong, Wei; Yu, Xianghui
2018-01-05
BCA2/RNF115/Rabring7 is a RING type E3 ubiquitin ligase that is overexpressed in human breast tumors and is important for regulating breast cancer cell migration. In the present investigation, feline BCA2 (fBCA2) was identified and characterized. Compared with its human counterpart, the fBCA2 cDNA was confirmed to be 918 base pairs in length showing 92.6% consensus and identity positions, encoding a protein of 305 amino acids with 96.7% consensus and 93.1% identity positions. The fBCA2 protein contains a RING domain at the C-terminus, which was found to be essential for its autoubiquitination. Copyright © 2017. Published by Elsevier B.V.
E3 ubiquitin ligase SP1 regulates peroxisome biogenesis in Arabidopsis
Pan, Ronghui; Satkovich, John; Hu, Jianping
2016-10-31
Peroxisomes are ubiquitous eukaryotic organelles that play pivotal roles in a suite of metabolic processes and often act coordinately with other organelles, such as chloroplasts and mitochondria. Peroxisomes import proteins to the peroxisome matrix by peroxins (PEX proteins), but how the function of the PEX proteins is regulated is poorly understood. In this study, we identified the Arabidopsis RING (really interesting new gene) type E3 ubiquitin ligase SP1 [suppressor of plastid protein import locus 1 (ppi1) 1] as a peroxisome membrane protein with a regulatory role in peroxisome protein import. SP1 interacts physically with the two components of the peroxisomemore » protein docking complex PEX13–PEX14 and the (RING)-finger peroxin PEX2. Loss of SP1 function suppresses defects of the pex14-2 and pex13-1 mutants, and SP1 is involved in the degradation of PEX13 and possibly PEX14 and all three RING peroxins. An in vivo ubiquitination assay showed that SP1 has the ability to promote PEX13 ubiquitination. Our study has revealed that, in addition to its previously reported function in chloroplast biogenesis, SP1 plays a role in peroxisome biogenesis. The same E3 ubiquitin ligase promotes the destabilization of components of two distinct protein-import machineries, indicating that degradation of organelle biogenesis factors by the ubiquitin–proteasome system may constitute an important regulatory mechanism in coordinating the biogenesis of metabolically linked organelles in eukaryotes.« less
Melnik, Andre; Wilson-Zbinden, Caroline; Schellhaas, René; Kastner, Lisa; Piwko, Wojciech; Dees, Martina; Picotti, Paola; Maric, Marija; Labib, Karim; Luke, Brian; Peter, Matthias
2016-01-01
Faithful DNA replication and repair requires the activity of cullin 4-based E3 ubiquitin ligases (CRL4), but the underlying mechanisms remain poorly understood. The budding yeast Cul4 homologue, Rtt101, in complex with the linker Mms1 and the putative substrate adaptor Mms22 promotes progression of replication forks through damaged DNA. Here we characterized the interactome of Mms22 and found that the Rtt101Mms22 ligase associates with the replisome progression complex during S-phase via the amino-terminal WD40 domain of Ctf4. Moreover, genetic screening for suppressors of the genotoxic sensitivity of rtt101Δ cells identified a cluster of replication proteins, among them a component of the fork protection complex, Mrc1. In contrast to rtt101Δ and mms22Δ cells, mrc1Δ rtt101Δ and mrc1Δ mms22Δ double mutants complete DNA replication upon replication stress by facilitating the repair/restart of stalled replication forks using a Rad52-dependent mechanism. Our results suggest that the Rtt101Mms22 E3 ligase does not induce Mrc1 degradation, but specifically counteracts Mrc1’s replicative function, possibly by modulating its interaction with the CMG (Cdc45-MCM-GINS) complex at stalled forks. PMID:26849847
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Yechun; Yi, Hankuil; Wang, Melissa
2012-10-24
To increase the biochemical efficiency of biosynthetic systems, metabolic engineers have explored different approaches for organizing enzymes, including the generation of unnatural fusion proteins. Previous work aimed at improving the biosynthesis of resveratrol, a stilbene associated a range of health-promoting activities, in yeast used an unnatural engineered fusion protein of Arabidopsis thaliana (thale cress) 4-coumaroyl-CoA ligase (At4CL1) and Vitis vinifera (grape) stilbene synthase (VvSTS) to increase resveratrol levels 15-fold relative to yeast expressing the individual enzymes. Here we present the crystallographic and biochemical analysis of the 4CL::STS fusion protein. Determination of the X-ray crystal structure of 4CL::STS provides the firstmore » molecular view of an artificial didomain adenylation/ketosynthase fusion protein. Comparison of the steady-state kinetic properties of At4CL1, VvSTS, and 4CL::STS demonstrates that the fusion protein improves catalytic efficiency of either reaction less than 3-fold. Structural and kinetic analysis suggests that colocalization of the two enzyme active sites within 70 {angstrom} of each other provides the basis for enhanced in vivo synthesis of resveratrol.« less
Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR
Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao
2012-01-01
AIM: To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. METHODS: Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. RESULTS: cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. CONCLUSION: The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well. PMID:22294830
Comparative quantification of human intestinal bacteria based on cPCR and LDR/LCR.
Tang, Zhou-Rui; Li, Kai; Zhou, Yu-Xun; Xiao, Zhen-Xian; Xiao, Jun-Hua; Huang, Rui; Gu, Guo-Hao
2012-01-21
To establish a multiple detection method based on comparative polymerase chain reaction (cPCR) and ligase detection reaction (LDR)/ligase chain reaction (LCR) to quantify the intestinal bacterial components. Comparative quantification of 16S rDNAs from different intestinal bacterial components was used to quantify multiple intestinal bacteria. The 16S rDNAs of different bacteria were amplified simultaneously by cPCR. The LDR/LCR was examined to actualize the genotyping and quantification. Two beneficial (Bifidobacterium, Lactobacillus) and three conditionally pathogenic bacteria (Enterococcus, Enterobacterium and Eubacterium) were used in this detection. With cloned standard bacterial 16S rDNAs, standard curves were prepared to validate the quantitative relations between the ratio of original concentrations of two templates and the ratio of the fluorescence signals of their final ligation products. The internal controls were added to monitor the whole detection flow. The quantity ratio between two bacteria was tested. cPCR and LDR revealed obvious linear correlations with standard DNAs, but cPCR and LCR did not. In the sample test, the distributions of the quantity ratio between each two bacterial species were obtained. There were significant differences among these distributions in the total samples. But these distributions of quantity ratio of each two bacteria remained stable among groups divided by age or sex. The detection method in this study can be used to conduct multiple intestinal bacteria genotyping and quantification, and to monitor the human intestinal health status as well.
Lokesh, N; Seegerer, Andreas; Hioe, Johnny; Gschwind, Ruth M
2018-02-07
The low sensitivity of NMR and transient key intermediates below detection limit are the central problems studying reaction mechanisms by NMR. Sensitivity can be enhanced by hyperpolarization techniques such as dynamic nuclear polarization or the incorporation/interaction of special hyperpolarized molecules. However, all of these techniques require special equipment, are restricted to selective reactions, or undesirably influence the reaction pathways. Here, we apply the chemical exchange saturation transfer (CEST) technique for the first time to NMR detect and characterize previously unobserved transient reaction intermediates in organocatalysis. The higher sensitivity of CEST and chemical equilibria present in the reaction pathway are exploited to access population and kinetics information on low populated intermediates. The potential of the method is demonstrated on the proline-catalyzed enamine formation for unprecedented in situ detection of a DPU stabilized zwitterionic iminium species, the elusive key intermediate between enamine and oxazolidinones. The quantitative analysis of CEST data at 250 K revealed the population ratio of [Z-iminium]/[exo-oxazolidinone] 0.02, relative free energy +8.1 kJ/mol (calculated +7.3 kJ/mol), and free energy barrier of +45.9 kJ/mol (ΔG ⧧ calc. (268 K) = +42.2 kJ/mol) for Z-iminium → exo-oxazolidinone. The findings underpin the iminium ion participation in enamine formation pathway corroborating our earlier theoretical prediction and help in better understanding. The reliability of CEST is validated using 1D EXSY-build-up techniques at low temperature (213 K). The CEST method thus serves as a new tool for mechanistic investigations in organocatalysis to access key information, such as chemical shifts, populations, and reaction kinetics of intermediates below the standard NMR detection limit.
NASA Astrophysics Data System (ADS)
Colizza, Kevin; Yevdokimov, Alexander; McLennan, Lindsay; Smith, James L.; Oxley, Jimmie C.
2018-01-01
Our efforts to lower the detection limits of hexamethylene triperoxide diamine (HMTD) have uncovered previously unreported gas-phase reactions of primary and secondary amines with one of the six methylene carbons. The reaction occurs primarily in the atmospheric pressure chemical ionization (APCI) source and is similar to the behavior of alcohols with HMTD [1]. However, unlike alcohols, the amine reaction conserves the hydrogen peroxide on the intact product. Furthermore, with or without amines, HMTD is oxidized to tetramethylene diperoxide diamine dialdehyde (TMDDD) in a temperature-dependent fashion in the APCI source. Synthesized TMDDD forms very strong adducts (not products) to ammonium and amine ions in the electrospray ionization (ESI) source. Attempts to improve HMTD detection by generating TMDDD in the APCI source with post-column addition of amines were not successful. Signal intensity of the solvent related HMTD product in methanol, [HMTD+MeOH2-H2O2]+ (m/z 207.0975), was understandably related to the amount of methanol in the HMTD environment as it elutes into the source. With conditions optimized for this product, the detection of 100 pg on column was accomplished with a robust analysis of 300 pg (1.44 pmol) routinely performed on the Orbitrap mass spectrometers. [Figure not available: see fulltext.
Yu, Xu; Zhang, Zhi-Ling; Zheng, Si-Yang
2014-01-01
A novel highly sensitive colorimetric assay for DNA detection using cascade amplification strategy based on hybridization chain reaction and enzyme-induced metallization was established. The DNA modified superparamagnetic beads were demonstrated to capture and enrich the target DNA in the hybridization buffer or human plasma. The hybridization chain reaction and enzyme-induced silver metallization on the gold nanoparticles were used as cascade signal amplification for the detection of target DNA. The metalization of silver on the gold nanoparticles induced a significant colour change from red to yellow until black depending on the concentration of the target DNA, which could be recognized by naked eyes. This method showed a good specificity for the target DNA detection, with the capabilty to discriminate single-base-pair mismatched DNA mutation (single nucleotide polymorphism). Meanwhile, this approach exhibited an excellent anti-interference capability with the convenience of the magentic seperation and washing, which enabled its usage in complex biological systems such as human blood plasma. As an added benefit, the utilization of hybridization chain reaction and enzyme-induced metallization improved detection sensitivity down to 10 pM, which is about 100-fold lower than that of traditional unamplified homogeneous assays. PMID:25500528
Electrochemical product detection of an asymmetric convective polymerase chain reaction.
Duwensee, Heiko; Mix, Maren; Stubbe, Marco; Gimsa, Jan; Adler, Marcel; Flechsig, Gerd-Uwe
2009-10-15
For the first time, we describe the application of heated microwires for an asymmetric convective polymerase chain reaction (PCR) in a modified PCR tube in a small volume. The partly single-stranded product was labeled with the electrochemically active compound osmium tetroxide bipyridine using a partially complementary protective strand with five mismatches compared to the single-stranded product. The labeled product could be successfully detected at a gold electrode modified with a complementary single-stranded capture probe immobilized via a thiol-linker. Our simple thermo-convective PCR yielded electrochemically detectable products after only 5-10 min. A significant discrimination between complementary and non-complementary target was possible using different immobilized capture probes. The total product yield was approx. half the amount of the classical thermocycler PCR. Numerical simulations describing the thermally driven convective PCR explain the received data. Discrimination between complementary capture probes and non-complementary capture probes was performed using square-wave voltammetry. The coupling of asymmetric thermo-convective PCR with electrochemical detection is very promising for future compact DNA sensor devices.
Méndez, María C; Domingo, Cristina; Tenorio, Antonio; Pardo, Lissethe C; Rey, Gloria J; Méndez, Jairo A
2013-09-01
Yellow fever is considered a re-emerging disease and is endemic in tropical regions of Africa and South America. At present, there are no standardized or commercialized kits available for yellow fever virus detection. Therefore, diagnosis must be made by time-consuming routine techniques, and sometimes, the virus or its proteins are not detected. Furthermore, co-circulation with other flaviviruses, including dengue virus, increases the difficulty of diagnosis. To develop a specific reverse transcriptase-polymerase chain reaction (RT-PCR) and nested PCR-based assay to improve the detection and diagnosis of yellow fever virus using both serum and fresh tissue samples. RT-PCR primers were designed to amplify a short fragment of all yellow fever virus genotypes reported. A second set of primers was used in a nested PCR to increase sensitivity. Thirty-three clinical samples were tested with the standardized reaction. The expected amplicon was obtained in 25 out of 33 samples analyzed using this approach, and 2 more samples tested positive after a subsequent nested PCR approach. This improved technique not only ensures the specific detection of a wide range of yellow fever virus genotypes but also may increase the sensitivity of detection by introducing a second round of amplification, allowing a rapid differential diagnosis between dengue and yellow fever infection, which is required for effective surveillance and opportune epidemiologic measures.
NASA Astrophysics Data System (ADS)
Xu, Meng-Lei; Gao, Yu; Li, Yali; Li, Xueliang; Zhang, Huanjie; Han, Xiao Xia; Zhao, Bing; Su, Liang
2018-05-01
Glyphosate is one of the most commonly-used and non-selective herbicides in agriculture, which may directly pollute the environment and threaten human health. A simple and effective approach to assessment of its damage to the natural environment is thus quite necessary. However, traditional chromatography-based detection methods usually suffer from complex pretreatment procedures. Herein, we propose a simple and sensitive method for the determination of glyphosate by combining ninhydrin reaction and surface-enhanced Raman scattering (SERS) spectroscopy. The product (purple color dye, PD) of the ninhydrin reaction is found to SERS-active and directly correlate with the glyphosate concentration. The limit of detection of the proposed method for glyphosate is as low as 1.43 × 10- 8 mol·L- 1 with a relatively wider linear concentration range (1.0 × 10- 7-1.0 × 10- 4 mol·L- 1), which demonstrates its great potential in rapid, highly sensitive concentration determination of glyphosate in practical applications for safety assessment of food and environment.
The E3 Ligase CHIP Mediates p21 Degradation to Maintain Radioresistance
Biswas, Kuntal; Sarkar, Sukumar; Du, Kangping; Brautigan, David L.; Abbas, Tarek; Larner, James M.
2017-01-01
Lung cancer resists radiation therapy, making it one of the deadliest forms of cancer. Here we show that human lung cancer cell lines can be rendered sensitive to ionizing radiation (IR) by RNAi knockdown of C-terminus of Hsc70-interacting protein (CHIP/STUB1), a U-box-type E3 ubiquitin ligase that targets a number of stress-induced proteins. Mechanistically ubiquitin-dependent degradation of the cyclin-dependent kinase (CDK) inhibitor p21 protein is reduced by CHIP knockdown, leading to enhanced senescence of cells in response to exposure to IR. Cellular senescence and sensitivity to IR is prevented by CRISPR/Cas9-mediated deletion of the p21 gene (CDKN1A) in CHIP knockdown cells. Conversely, over-expression of CHIP potentiates p21 degradation and promotes greater radioresistance of lung cancer cells. In vitro and cell-based assays demonstrate that p21 is a novel and direct ubiquitylation substrate of CHIP that also requires the CHIP-associated chaperone heat shock protein 70 (HSP70). These data reveal that the inhibition of the E3 ubiquitin ligase CHIP promotes radiosensitivity; thus, suggesting a novel strategy for the treatment of lung cancer. Implications The CHIP-HSP70-p21 ubiquitylation/degradation axis identified here could be exploited to enhance the efficacy of radiotherapy in patients with non-small cell lung cancer. PMID:28232384
Molecular cloning and expression of rat liver bile acid CoA ligase.
Falany, Charles N; Xie, Xiaowei; Wheeler, James B; Wang, Jin; Smith, Michelle; He, Dongning; Barnes, Stephen
2002-12-01
Bile acid CoA ligase (BAL) is responsible for catalyzing the first step in the conjugation of bile acids with amino acids. Sequencing of putative rat liver BAL cDNAs identified a cDNA (rBAL-1) possessing a 51 nucleotide 5'-untranslated region, an open reading frame of 2,070 bases encoding a 690 aa protein with a molecular mass of 75,960 Da, and a 138 nucleotide 3'-nontranslated region followed by a poly(A) tail. Identity of the cDNA was established by: 1) the rBAL-1 open reading frame encoded peptides obtained by chemical sequencing of the purified rBAL protein; 2) expressed rBAL-1 protein comigrated with purified rBAL during SDS-polyacrylamide gel electrophoresis; and 3) rBAL-1 expressed in insect Sf9 cells had enzymatic properties that were comparable to the enzyme isolated from rat liver. Evidence for a relationship between fatty acid and bile acid metabolism is suggested by specific inhibition of rBAL-1 by cis-unsaturated fatty acids and its high homology to a human very long chain fatty acid CoA ligase. In summary, these results indicate that the cDNA for rat liver BAL has been isolated and expression of the rBAL cDNA in insect Sf9 cells results in a catalytically active enzyme capable of utilizing several different bile acids as substrates.
Perdih, Andrej; Hrast, Martina; Pureber, Kaja; Barreteau, Hélène; Grdadolnik, Simona Golič; Kocjan, Darko; Gobec, Stanislav; Solmajer, Tom; Wolber, Gerhard
2015-06-01
Bacterial resistance to the available antibiotic agents underlines an urgent need for the discovery of novel antibacterial agents. Members of the bacterial Mur ligase family MurC-MurF involved in the intracellular stages of the bacterial peptidoglycan biosynthesis have recently emerged as a collection of attractive targets for novel antibacterial drug design. In this study, we have first extended the knowledge of the class of furan-based benzene-1,3-dicarboxylic acid derivatives by first showing a multiple MurC-MurF ligase inhibition for representatives of the extended series of this class. Steady-state kinetics studies on the MurD enzyme were performed for compound 1, suggesting a competitive inhibition with respect to ATP. To the best of our knowledge, compound 1 represents the first ATP-competitive MurD inhibitor reported to date with concurrent multiple inhibition of all four Mur ligases (MurC-MurF). Subsequent molecular dynamic (MD) simulations coupled with interaction energy calculations were performed for two alternative in silico models of compound 1 in the UMA/D-Glu- and ATP-binding sites of MurD, identifying binding in the ATP-binding site as energetically more favorable in comparison to the UMA/D-Glu-binding site, which was in agreement with steady-state kinetic data. In the final stage, based on the obtained MD data novel furan-based benzene monocarboxylic acid derivatives 8-11, exhibiting multiple Mur ligase (MurC-MurF) inhibition with predominantly superior ligase inhibition over the original series, were discovered and for compound 10 it was shown to possess promising antibacterial activity against S. aureus. These compounds represent novel leads that could by further optimization pave the way to novel antibacterial agents.
NASA Astrophysics Data System (ADS)
Perdih, Andrej; Hrast, Martina; Pureber, Kaja; Barreteau, Hélène; Grdadolnik, Simona Golič; Kocjan, Darko; Gobec, Stanislav; Solmajer, Tom; Wolber, Gerhard
2015-06-01
Bacterial resistance to the available antibiotic agents underlines an urgent need for the discovery of novel antibacterial agents. Members of the bacterial Mur ligase family MurC-MurF involved in the intracellular stages of the bacterial peptidoglycan biosynthesis have recently emerged as a collection of attractive targets for novel antibacterial drug design. In this study, we have first extended the knowledge of the class of furan-based benzene-1,3-dicarboxylic acid derivatives by first showing a multiple MurC-MurF ligase inhibition for representatives of the extended series of this class. Steady-state kinetics studies on the MurD enzyme were performed for compound 1, suggesting a competitive inhibition with respect to ATP. To the best of our knowledge, compound 1 represents the first ATP-competitive MurD inhibitor reported to date with concurrent multiple inhibition of all four Mur ligases (MurC-MurF). Subsequent molecular dynamic (MD) simulations coupled with interaction energy calculations were performed for two alternative in silico models of compound 1 in the UMA/ d-Glu- and ATP-binding sites of MurD, identifying binding in the ATP-binding site as energetically more favorable in comparison to the UMA/ d-Glu-binding site, which was in agreement with steady-state kinetic data. In the final stage, based on the obtained MD data novel furan-based benzene monocarboxylic acid derivatives 8- 11, exhibiting multiple Mur ligase (MurC-MurF) inhibition with predominantly superior ligase inhibition over the original series, were discovered and for compound 10 it was shown to possess promising antibacterial activity against S. aureus. These compounds represent novel leads that could by further optimization pave the way to novel antibacterial agents.
The E3 ubiquitin ligase NEDD4 is an LC3-interactive protein and regulates autophagy
Sun, Aiqin; Wei, Jing; Childress, Chandra; Shaw, John H.; Peng, Ke; Shao, Genbao; Yang, Wannian; Lin, Qiong
2017-01-01
ABSTRACT The MAP1LC3/LC3 family plays an essential role in autophagosomal biogenesis and transport. In this report, we show that the HECT family E3 ubiquitin ligase NEDD4 interacts with LC3 and is involved in autophagosomal biogenesis. NEDD4 binds to LC3 through a conserved WXXL LC3-binding motif in a region between the C2 and the WW2 domains. Knockdown of NEDD4 impaired starvation- or rapamycin-induced activation of autophagy and autophagosomal biogenesis and caused aggregates of the LC3 puncta colocalized with endoplasmic reticulum membrane markers. Electron microscopy observed gigantic deformed mitochondria in NEDD4 knockdown cells, suggesting that NEDD4 might function in mitophagy. Furthermore, SQSTM1 is ubiquitinated by NEDD4 while LC3 functions as an activator of NEDD4 ligase activity. Taken together, our studies define an important role of NEDD4 in regulation of autophagy. PMID:28085563
Kim, Tae-Hoon; Hwang, Hyun Jin; Kim, Jeong Hee
2017-10-01
Salmonella enterica serovars Enteritidis and Typhimurium are the most common causative agents of human nontyphoidal salmonellosis. The rapid detection and timely treatment of salmonellosis are important to increase the curative ratio and prevent spreading of the disease. In this study, we developed a rapid multiplex convection polymerase chain reaction (PCR) method to detect Salmonella spp. and differentiate Salmonella Enteritidis and Salmonella Typhimurium. We used the invA gene for Salmonella spp. detection. Salmonella Enteritidis-specific primers and Salmonella Typhimurium-specific primers were designed using the insertion element (IE) and spy genes, respectively. The primer set for Salmonella spp. detection clearly detected both Salmonella Enteritidis and Salmonella Typhimurium after a 21-min amplification reaction. Serovar-specific primer sets for Salmonella Enteritidis and Salmonella Typhimurium specifically detected each target species in a 21-min amplification reaction. We were able to detect Salmonella spp. at a single copy level in the singleplex mode. The limits of detection for Salmonella Enteritidis and Salmonella Typhimurium were 30 copies in both the singleplex and multiplex modes. The PCR run time could be reduced to 10.5 min/15 cycles. The multiplex convection PCR method developed in this study could detect the Salmonella spp. Salmonella Enteritidis and Salmonella Typhimurium in artificially contaminated milk with as few as 10 0 colony-forming unit/mL after 4-h enrichment. The PCR assay developed in this study provides a rapid, specific, and sensitive method for the detection of Salmonella spp. and the differentiation of Salmonella Enteritidis and Salmonella Typhimurium.
Polymerase chain reaction-based detection of B-cell monoclonality in cytologic specimens.
Chen, Y T; Mercer, G O; Chen, Y
1993-11-01
Thirty-seven cytologic cell blocks were evaluated for B-cell monoclonality by polymerase chain reaction (PCR), 16 of them cytologically positive for lymphoma, and 21 suspicious for lymphoma but morphologically nondiagnostic. Of 37 specimens, 13 (35%) showed B-cell monoclonality, including six of 16 cytologically positive samples and seven of 21 cytologically suspicious ones. Of these 13 positive samples, seven were positive using crude lysates as substrates, and six additional positive samples were identified only when DNAs were purified and concentrated. Analysis of the DNAs further revealed poor polymerase chain reaction amplifiability and low DNA yield in many samples, indicating that cell block materials are suboptimal for this assay. We concluded that B-cell monoclonality can be detected in ethanol-fixed cytologic samples, and usage of unembedded material will likely improve the sensitivity. In specimens cytologically suspicious for lymphoma, polymerase chain reaction-based identification of monoclonal B-cell population supports the diagnosis of B-cell lymphoma and is a potentially useful test in solving this diagnostic dilemma.
Degradation of phosphorylated p53 by viral protein-ECS E3 ligase complex.
Sato, Yoshitaka; Kamura, Takumi; Shirata, Noriko; Murata, Takayuki; Kudoh, Ayumi; Iwahori, Satoko; Nakayama, Sanae; Isomura, Hiroki; Nishiyama, Yukihiro; Tsurumi, Tatsuya
2009-07-01
p53-signaling is modulated by viruses to establish a host cellular environment advantageous for their propagation. The Epstein-Barr virus (EBV) lytic program induces phosphorylation of p53, which prevents interaction with MDM2. Here, we show that induction of EBV lytic program leads to degradation of p53 via an ubiquitin-proteasome pathway independent of MDM2. The BZLF1 protein directly functions as an adaptor component of the ECS (Elongin B/C-Cul2/5-SOCS-box protein) ubiquitin ligase complex targeting p53 for degradation. Intringuingly, C-terminal phosphorylation of p53 resulting from activated DNA damage response by viral lytic replication enhances its binding to BZLF1 protein. Purified BZLF1 protein-associated ECS could be shown to catalyze ubiquitination of phospho-mimetic p53 more efficiently than the wild-type in vitro. The compensation of p53 at middle and late stages of the lytic infection inhibits viral DNA replication and production during lytic infection, suggesting that the degradation of p53 is required for efficient viral propagation. Taken together, these findings demonstrate a role for the BZLF1 protein-associated ECS ligase complex in regulation of p53 phosphorylated by activated DNA damage signaling during viral lytic infection.
Method for detecting pollutants. [through chemical reactions and heat treatment
NASA Technical Reports Server (NTRS)
Rogowski, R. S.; Richards, R. R.; Conway, E. J. (Inventor)
1976-01-01
A method is described for detecting and measuring trace amounts of pollutants of the group consisting of ozone, nitrogen dioxide, and carbon monoxide in a gaseous environment. A sample organic solid material that will undergo a chemical reaction with the test pollutant is exposed to the test environment and thereafter, when heated in the temperature range of 100-200 C., undergoes chemiluminescence that is measured and recorded as a function of concentration of the test pollutant. The chemiluminescence of the solid organic material is specific to the pollutant being tested.
Structure of the DDB1-CRBN E3 ubiquitin ligase in complex with thalidomide
Fischer, Eric S.; Böhm, Kerstin; Lydeard, John R.; Yang, Haidi; Stadler, Michael B.; Cavadini, Simone; Nagel, Jane; Serluca, Fabrizio; Acker, Vincent; Lingaraju, Gondichatnahalli M.; Tichkule, Ritesh B.; Schebesta, Michael; Forrester, William C.; Schirle, Markus; Hassiepen, Ulrich; Ottl, Johannes; Hild, Marc; Beckwith, Rohan E. J.; Harper, J. Wade; Jenkins, Jeremy L.; Thomä, Nicolas H.
2015-01-01
In the 1950s the drug thalidomide administered as a sedative to pregnant women led to the birth of thousands of children with multiple defects. Despite its teratogenicity, thalidomide and its derivatives lenalidomide and pomalidomide (together known as Immunomodulatory Drugs: IMiDs) recently emerged as effective treatments for multiple myeloma and 5q-dysplasia. IMiDs target the CUL4-RBX1-DDB1-CRBN (CRL4CRBN) E3 ubiquitin ligase and promote the ubiquitination of Ikaros/Aiolos transcription factors by CRL4CRBN. Here we present the crystal structure of the DDB1-CRBN complex bound to thalidomide, lenalidomide and pomalidomide. The structure establishes CRBN as a CRL4CRBN substrate receptor, which enantioselectively binds IMiDs. Through an unbiased screen we identify the homeobox transcription factor MEIS2 as an endogenous substrate of CRL4CRBN. Our studies suggest that IMiDs block endogenous substrates (MEIS2) from binding to CRL4CRBN when recruiting Ikaros/Aiolos for degradation. This dual activity implies that small molecules can principally modulate a ligase to up- or down-regulate the ubiquitination of proteins. PMID:25043012
RNA sensor LGP2 inhibits TRAF ubiquitin ligase to negatively regulate innate immune signaling.
Parisien, Jean-Patrick; Lenoir, Jessica J; Mandhana, Roli; Rodriguez, Kenny R; Qian, Kenin; Bruns, Annie M; Horvath, Curt M
2018-06-01
The production of type I interferon (IFN) is essential for cellular barrier functions and innate and adaptive antiviral immunity. In response to virus infections, RNA receptors RIG-I and MDA5 stimulate a mitochondria-localized signaling apparatus that uses TRAF family ubiquitin ligase proteins to activate master transcription regulators IRF3 and NFκB, driving IFN and antiviral target gene expression. Data indicate that a third RNA receptor, LGP2, acts as a negative regulator of antiviral signaling by interfering with TRAF family proteins. Disruption of LGP2 expression in cells results in earlier and overactive transcriptional responses to virus or dsRNA LGP2 associates with the C-terminus of TRAF2, TRAF3, TRAF5, and TRAF6 and interferes with TRAF ubiquitin ligase activity. TRAF interference is independent of LGP2 ATP hydrolysis, RNA binding, or its C-terminal domain, and LGP2 can regulate TRAF-mediated signaling pathways in trans , including IL-1β, TNFα, and cGAMP These findings provide a unique mechanism for LGP2 negative regulation through TRAF suppression and extend the potential impact of LGP2 negative regulation beyond the IFN antiviral response. © 2018 The Authors.
USDA-ARS?s Scientific Manuscript database
Polyoxin (POL) is an unusual nucleoside antibiotic, in which peptidyl moiety and nucleoside skeleton are linked by an amide bond. However, their biosynthesis remains poorly understood. Here, we report the deciphering of PolG as an ATP-dependent ligase responsible for the assembly of POL. A polG muta...
NASA Astrophysics Data System (ADS)
Park, Yeonkyung; Lee, Chang Yeol; Kang, Shinyoung; Kim, Hansol; Park, Ki Soo; Park, Hyun Gyu
2018-02-01
In this work, we developed a novel, label-free, and enzyme-free strategy for the colorimetric detection of microRNA (miRNA), which relies on a target-catalyzed toehold-mediated strand displacement (TMSD) reaction. The system employs a detection probe that specifically binds to the target miRNA and sequentially releases a catalyst strand (CS) intended to trigger the subsequent TMSD reaction. Thus, the presence of target miRNA releases the CS that mediates the formation of an active G-quadruplex DNAzyme which is initially caged and inactivated by a blocker strand. In addition, a fuel strand that is supplemented for the recycling of the CS promotes another TMSD reaction, consequently generating a large number of active G-quadruplex DNAzymes. As a result, a distinct colorimetric signal is produced by the ABTS oxidation promoted by the peroxidase mimicking activity of the released G-quadruplex DNAzymes. Based on this novel strategy, we successfully detected miR-141, a promising biomarker for human prostate cancer, with high selectivity. The diagnostic capability of this system was also demonstrated by reliably determining target miR-141 in human serum, showing its great potential towards real clinical applications. Importantly, the proposed approach is composed of separate target recognition and signal transduction modules. Thus, it could be extended to analyze different target miRNAs by simply redesigning the detection probe while keeping the same signal transduction module as a universal signal amplification unit, which was successfully demonstrated by analyzing another target miRNA, let-7d.
Park, Yeonkyung; Lee, Chang Yeol; Kang, Shinyoung; Kim, Hansol; Park, Ki Soo; Park, Hyun Gyu
2018-02-23
In this work, we developed a novel, label-free, and enzyme-free strategy for the colorimetric detection of microRNA (miRNA), which relies on a target-catalyzed toehold-mediated strand displacement (TMSD) reaction. The system employs a detection probe that specifically binds to the target miRNA and sequentially releases a catalyst strand (CS) intended to trigger the subsequent TMSD reaction. Thus, the presence of target miRNA releases the CS that mediates the formation of an active G-quadruplex DNAzyme which is initially caged and inactivated by a blocker strand. In addition, a fuel strand that is supplemented for the recycling of the CS promotes another TMSD reaction, consequently generating a large number of active G-quadruplex DNAzymes. As a result, a distinct colorimetric signal is produced by the ABTS oxidation promoted by the peroxidase mimicking activity of the released G-quadruplex DNAzymes. Based on this novel strategy, we successfully detected miR-141, a promising biomarker for human prostate cancer, with high selectivity. The diagnostic capability of this system was also demonstrated by reliably determining target miR-141 in human serum, showing its great potential towards real clinical applications. Importantly, the proposed approach is composed of separate target recognition and signal transduction modules. Thus, it could be extended to analyze different target miRNAs by simply redesigning the detection probe while keeping the same signal transduction module as a universal signal amplification unit, which was successfully demonstrated by analyzing another target miRNA, let-7d.
Brzezinski, Jennifer L
2006-01-01
The detection of potentially allergenic foods, such as tree nuts, in food products is a major concern for the food processing industry. A real-time polymerase chain reaction (PCR) method was designed to determine the presence of cashew DNA in food products. The PCR amplifies a 67 bp fragment of the cashew 2S albumin gene, which is detected with a cashew-specific, dual-labeled TaqMan probe. This reaction will not amplify DNA derived from other tree nut species, such as almond, Brazil nut, hazelnut, and walnut, as well as 4 varieties of peanut. This assay was sensitive enough to detect 5 pg purified cashew DNA as well as cashew DNA in a spiked chocolate cookie sample containing 0.01% (100 mg/kg) cashew.
Havens, Courtney G.; Shobnam, Nadia; Guarino, Estrella; Centore, Richard C.; Zou, Lee; Kearsey, Stephen E.; Walter, Johannes C.
2012-01-01
The E3 ubiquitin ligase Cullin-ring ligase 4-Cdt2 (CRL4Cdt2) is emerging as an important cell cycle regulator that targets numerous proteins for destruction in S phase and after DNA damage, including Cdt1, p21, and Set8. CRL4Cdt2 substrates contain a “PIP degron,” which consists of a canonical proliferating cell nuclear antigen (PCNA) interaction motif (PIP box) and an adjacent basic amino acid. Substrates use their PIP box to form a binary complex with PCNA on chromatin and the basic residue to recruit CRL4Cdt2 for substrate ubiquitylation. Using Xenopus egg extracts, we identify an acidic residue in PCNA that is essential to support destruction of all CRL4Cdt2 substrates. This PCNA residue, which adjoins the basic amino acid of the bound PIP degron, is dispensable for substrate binding to PCNA but essential for CRL4Cdt2 recruitment to chromatin. Our data show that the interaction of CRL4Cdt2 with substrates requires molecular determinants not only in the substrate degron but also on PCNA. The results illustrate a potentially general mechanism by which E3 ligases can couple ubiquitylation to the formation of protein-protein interactions. PMID:22303007
GNIP1 E3 ubiquitin ligase is a novel player in regulating glycogen metabolism in skeletal muscle.
Montori-Grau, Marta; Pedreira-Casahuga, Robert; Boyer-Díaz, Zoé; Lassot, Iréna; García-Martínez, Celia; Orozco, Anna; Cebrià, Judith; Osorio-Conles, Oscar; Chacón, Matilde R; Vendrell, Joan; Vázquez-Carrera, Manuel; Desagher, Solange; Jiménez-Chillarón, Josep Carles; Gómez-Foix, Anna Ma
2018-06-01
Glycogenin-interacting protein 1 (GNIP1) is a tripartite motif (TRIM) protein with E3 ubiquitin ligase activity that interacts with glycogenin. These data suggest that GNIP1 could play a major role in the control of glycogen metabolism. However, direct evidence based on functional analysis remains to be obtained. The aim of this study was 1) to define the expression pattern of glycogenin-interacting protein/Tripartite motif containing protein 7 (GNIP/TRIM7) isoforms in humans, 2) to test their ubiquitin E3 ligase activity, and 3) to analyze the functional effects of GNIP1 on muscle glucose/glycogen metabolism both in human cultured cells and in vivo in mice. We show that GNIP1 was the most abundant GNIP/TRIM7 isoform in human skeletal muscle, whereas in cardiac muscle only TRIM7 was expressed. GNIP1 and TRIM7 had autoubiquitination activity in vitro and were localized in the Golgi apparatus and cytosol respectively in LHCN-M2 myoblasts. GNIP1 overexpression increased glucose uptake in LHCN-M2 myotubes. Overexpression of GNIP1 in mouse muscle in vivo increased glycogen content, glycogen synthase (GS) activity and phospho-GSK-3α/β (Ser21/9) and phospho-Akt (Ser473) content, whereas decreased GS phosphorylation in Ser640. These modifications led to decreased blood glucose levels, lactate levels and body weight, without changing whole-body insulin or glucose tolerance in mouse. GNIP1 is an ubiquitin ligase with a markedly glycogenic effect in skeletal muscle. Copyright © 2018 Elsevier Inc. All rights reserved.
Ataxia and hypogonadism caused by the loss of ubiquitin ligase activity of the U box protein CHIP.
Shi, Chang-He; Schisler, Jonathan C; Rubel, Carrie E; Tan, Song; Song, Bo; McDonough, Holly; Xu, Lei; Portbury, Andrea L; Mao, Cheng-Yuan; True, Cadence; Wang, Rui-Hao; Wang, Qing-Zhi; Sun, Shi-Lei; Seminara, Stephanie B; Patterson, Cam; Xu, Yu-Ming
2014-02-15
Gordon Holmes syndrome (GHS) is a rare Mendelian neurodegenerative disorder characterized by ataxia and hypogonadism. Recently, it was suggested that disordered ubiquitination underlies GHS though the discovery of exome mutations in the E3 ligase RNF216 and deubiquitinase OTUD4. We performed exome sequencing in a family with two of three siblings afflicted with ataxia and hypogonadism and identified a homozygous mutation in STUB1 (NM_005861) c.737C→T, p.Thr246Met, a gene that encodes the protein CHIP (C-terminus of HSC70-interacting protein). CHIP plays a central role in regulating protein quality control, in part through its ability to function as an E3 ligase. Loss of CHIP function has long been associated with protein misfolding and aggregation in several genetic mouse models of neurodegenerative disorders; however, a role for CHIP in human neurological disease has yet to be identified. Introduction of the Thr246Met mutation into CHIP results in a loss of ubiquitin ligase activity measured directly using recombinant proteins as well as in cell culture models. Loss of CHIP function in mice resulted in behavioral and reproductive impairments that mimic human ataxia and hypogonadism. We conclude that GHS can be caused by a loss-of-function mutation in CHIP. Our findings further highlight the role of disordered ubiquitination and protein quality control in the pathogenesis of neurodegenerative disease and demonstrate the utility of combining whole-exome sequencing with molecular analyses and animal models to define causal disease polymorphisms.
Ataxia and hypogonadism caused by the loss of ubiquitin ligase activity of the U box protein CHIP
Shi, Chang-He; Schisler, Jonathan C.; Rubel, Carrie E.; Tan, Song; Song, Bo; McDonough, Holly; Xu, Lei; Portbury, Andrea L.; Mao, Cheng-Yuan; True, Cadence; Wang, Rui-Hao; Wang, Qing-Zhi; Sun, Shi-Lei; Seminara, Stephanie B.; Patterson, Cam; Xu, Yu-Ming
2014-01-01
Gordon Holmes syndrome (GHS) is a rare Mendelian neurodegenerative disorder characterized by ataxia and hypogonadism. Recently, it was suggested that disordered ubiquitination underlies GHS though the discovery of exome mutations in the E3 ligase RNF216 and deubiquitinase OTUD4. We performed exome sequencing in a family with two of three siblings afflicted with ataxia and hypogonadism and identified a homozygous mutation in STUB1 (NM_005861) c.737C→T, p.Thr246Met, a gene that encodes the protein CHIP (C-terminus of HSC70-interacting protein). CHIP plays a central role in regulating protein quality control, in part through its ability to function as an E3 ligase. Loss of CHIP function has long been associated with protein misfolding and aggregation in several genetic mouse models of neurodegenerative disorders; however, a role for CHIP in human neurological disease has yet to be identified. Introduction of the Thr246Met mutation into CHIP results in a loss of ubiquitin ligase activity measured directly using recombinant proteins as well as in cell culture models. Loss of CHIP function in mice resulted in behavioral and reproductive impairments that mimic human ataxia and hypogonadism. We conclude that GHS can be caused by a loss-of-function mutation in CHIP. Our findings further highlight the role of disordered ubiquitination and protein quality control in the pathogenesis of neurodegenerative disease and demonstrate the utility of combining whole-exome sequencing with molecular analyses and animal models to define causal disease polymorphisms. PMID:24113144
The E3 ubiquitin ligase, HECTD1, is involved in ABCA1-mediated cholesterol export from macrophages.
Aleidi, Shereen M; Yang, Alryel; Sharpe, Laura J; Rao, Geetha; Cochran, Blake J; Rye, Kerry-Anne; Kockx, Maaike; Brown, Andrew J; Gelissen, Ingrid C
2018-04-01
The ABC lipid transporters, ABCA1 and ABCG1, are essential for maintaining lipid homeostasis in cells such as macrophages by exporting excess cholesterol to extracellular acceptors. These transporters are highly regulated at the post-translational level, including protein ubiquitination. Our aim was to investigate the role of the E3 ubiquitin ligase HECTD1, recently identified as associated with ABCG1, on ABCG1 and ABCA1 protein levels and cholesterol export function. Here, we show that HECTD1 protein is widely expressed in a range of human and murine primary cells and cell lines, including macrophages, neuronal cells and insulin secreting β-cells. siRNA knockdown of HECTD1 unexpectedly decreased overexpressed ABCG1 protein levels and cell growth, but increased native ABCA1 protein in CHO-K1 cells. Knockdown of HECTD1 in unloaded THP-1 macrophages did not affect ABCG1 but significantly increased ABCA1 protein levels, in wild-type as well as THP-1 cells that do not express ABCG1. Cholesterol export from macrophages to apoA-I over time was increased after knockdown of HECTD1, however these effects were not sustained in cholesterol-loaded cells. In conclusion, we have identified a new candidate, the E3 ubiquitin ligase HECTD1, that may be involved in the regulation of ABCA1-mediated cholesterol export from unloaded macrophages to apoA-I. The exact mechanism by which this ligase affects this pathway remains to be elucidated. Copyright © 2018 Elsevier B.V. All rights reserved.
Niu, Shuyan; Qu, Lijing; Zhang, Qing; Lin, Jiehua
2012-02-15
A sensitive and specific sandwich assay for the detection of thrombin is described. Two affiliative aptamers were used to increase the assay specificity through sandwich recognition. Recognition DNA loaded on gold nanoparticles (AuNPs) partially hybridized with the initiator DNA, which was displaced by surviving DNA. After the initiator DNA was released into the solution, one hairpin structure was opened, which in turn opened another hairpin structure. The initiator DNA was displaced and released into the solution again by another hairpin structure because of the hybridized reaction. Then the released initiator DNA initiated another autocatalytic strand displacement reaction. A sophisticated network of three such duplex formation cycles was designed to amplify the fluorescence signal. Other proteins, such as bovine serum albumin and lysozyme, did not interfere with the detection of thrombin. This approach enables rapid and specific thrombin detection with reduced costs and minimized material consumption compared with traditional assay processes. The detection limit of thrombin was as low as 4.3 × 10⁻¹³ M based on the AuNP amplification and the autocatalytic strand displacement cycle reaction. This method could be used in biological samples with excellent selectivity. Copyright © 2011 Elsevier Inc. All rights reserved.
Chauleau, Mathieu; Shuman, Stewart
2013-01-01
T4 RNA ligase 2 (Rnl2) repairs 3′-OH/5′-PO4 nicks in duplex nucleic acids in which the broken 3′-OH strand is RNA. Ligation entails three chemical steps: reaction of Rnl2 with ATP to form a covalent Rnl2–(lysyl-Nζ)–AMP intermediate (step 1); transfer of AMP to the 5′-PO4 of the nick to form an activated AppN– intermediate (step 2); and attack by the nick 3′-OH on the AppN– strand to form a 3′–5′ phosphodiester (step 3). Here we used rapid mix-quench methods to analyze the kinetic mechanism and fidelity of single-turnover nick sealing by Rnl2–AMP. For substrates with correctly base-paired 3′-OH nick termini, kstep2 was fast (9.5 to 17.9 sec−1) and similar in magnitude to kstep3 (7.9 to 32 sec−1). Rnl2 fidelity was enforced mainly at the level of step 2 catalysis, whereby 3′-OH base mispairs and oxoguanine, oxoadenine, or abasic lesions opposite the nick 3′-OH elicited severe decrements in the rate of 5′-adenylylation and relatively modest slowing of the rate of phosphodiester synthesis. The exception was the noncanonical A:oxoG base pair, which Rnl2 accepted as a correctly paired end for rapid sealing. These results underscore (1) how Rnl2 requires proper positioning of the 3′-terminal ribonucleoside at the nick for optimal 5′-adenylylation and (2) the potential for nick-sealing ligases to embed mutations during the repair of oxidative damage. PMID:24158792
Detection of ultratrace phosphorus and sulfur by quadrupole ICPMS with dynamic reaction cell.
Bandura, Dmitry R; Baranov, Vladimir I; Tanner, Scott D
2002-04-01
A method of detection of ultratrace phosphorus and sulfur that uses reaction with O2 in a dynamic reaction cell (DRC) to oxidize S+ and P+ to allow their detection as SO+ and PO+ is described. The method reduces the effect of polyatomic isobaric interferences at m/z = 31 and 32 by detecting P+ and S+ as the product oxide ions that are less interfered. Use of an axial field in the DRC improves transmission of the product oxide ions 4-6 times. With no axial field, detection limits (3sigma, 5-s integration) of 0.20 and 0.52 ng/mL, with background equivalent concentrations of 0.53 and 4.8 ng/mL, respectively, are achieved. At an optimum axial field potential (200 V), the detection limits are 0.06 ng/mL for P and 0.2 ng/mL for S, respectively. The method is used for determining the degree of phosphorylation of beta-casein, and regular and dephosphorylated alpha-caseins at 10-1000 fmol/microL concentration, with 5-10% v/v organic sample matrix (acetonitrile, formic acid, ammonium bicarbonate). The measured degree of phosphorylation for beta-casein (4.9 phosphorus atoms/molecule) and regular alpha-casein (8.8 phoshorus atoms/molecule) are in good agreement with the structural data for the proteins. The P/S ratio for regular alpha-casein (1.58) is in good agreement with the ratio of the number of phosphorylation sites to the number of sulfur-containing amino acid residues cysteine and methionine. The P/S ratio for commercially available dephosphorylated alpha-casein is measured at 0.41 (approximately 26% residual phosphate).
van der Sluis, Rencia; Erasmus, Elardus
2016-10-01
Activation of fatty acids by the acyl-CoA synthetases (ACSs) is the vital first step in fatty acid metabolism. The enzymatic and physiological characterization of the human xenobiotic/medium chain fatty acid: CoA ligases (ACSMs) has been severely neglected even though xenobiotics, such as benzoate and salicylate, are detoxified through this pathway. This review will focus on the nomenclature and substrate specificity of the human ACSM ligases; the biochemical and enzymatic characterization of ACSM1 and ACSM2B; the high sequence homology of the ACSM2 genes (ACSM2A and ACSM2B) as well as what is currently known regarding disease association studies. Several discrepancies exist in the current literature that should be taken note of. For example, the single nucleotide polymorphisms (SNPs) reported to be associated with aspirin metabolism and multiple risk factors of metabolic syndrome are incorrect. Kinetic data on the substrate specificity of the human ACSM ligases are non-existent and currently no data exist on the influence of SNPs on the enzyme activity of these ligases. One of the biggest obstacles currently in the field is that glycine conjugation is continuously studied as a one-step process, which means that key regulatory factors of the two individual steps remain unknown.
Concordance of polymerase chain reaction with human immunodeficiency virus antibody detection.
Horsburgh, C R; Ou, C Y; Jason, J; Holmberg, S D; Lifson, A R; Moore, J L; Ward, J W; Seage, G R; Mayer, K H; Evatt, B L
1990-08-01
To evaluate the correlation of detection of human immunodeficiency virus (HIV) by polymerase chain reaction (PCR) with detection of HIV antibody, 271 simultaneous serum and peripheral blood mononuclear cell samples were examined from 242 persons whose activities placed them at increased risk for HIV infection: 142 from homosexual men, 86 from hemophilic men, and 43 from heterosexual partners of HIV-infected persons. PCR was performed using the gag region primer pair SK38/39 and the env region primer pairs SK68/69 and CO71/72. Amplified HIV DNA was detected using specific oligomer probes. Of 63 HIV antibody-positive samples, 58 (92%) had HIV DNA by PCR. Of 208 HIV antibody-negative samples, 7 (3.4%) had HIV DNA by PCR. On follow-up, 4 of the latter persons were seropositive when next tested; 2 were well and antibody- and PCR-negative; 1 had died of a stroke before retesting. Thus, PCR detects HIV in most antibody-positive persons; detection is increased by use of multiple primer pairs. PCR-positive antibody-negative specimens may indicate HIV infection in which antibody has not yet developed or may be false-positive PCR results. When PCR is discordant with HIV antibody, testing of additional specimens and clinical follow-up are necessary to assess HIV infection status.
Luo, Yuqiong; Shen, Suqin; Luo, Jiwen; Wang, Xiaoying; Sun, Runcang
2015-01-14
This work reported a facile and green method to prepare highly stable and uniformly distributed Ag nanoparticles (AgNPs), in which a biopolymer xylan was used as the stabilizing and reducing agent via the Tollens reaction under microwave irradiation. Different variables were evaluated to optimize the reaction conditions. Complete characterization was performed using UV-Vis, XRD, TEM, size distribution analysis and XPS. The results revealed that AgNPs were well dispersed with diameters of 20-35 nm due to the packing of xylan. The optimal conditions were as follows: microwave irradiation temperature was 60-70 °C, microwave power was 800 W, microwave time was 30 min, the ratio of xylan to AgNO3 was 50 mg: 0.13 mmol, and ammonia concentration was 2%. In addition, the AgNPs were collected via high-speed centrifugal separation, and the supernatant was tested by HPAEC, GPC, FT-IR, and NMR. By comparing the structure of xylan before and after the reaction, the reaction mechanism was discussed. It was noted that the xylan-AgNPs composites showed high selectivity and sensitivity for Hg(2+) detection. The other 15 metal ions used had no obvious effect on the detection of Hg(2+), and the limit of detection (LOD) was 4.6 nM, which is lower than the allowed maximum level of 30 nM for drinking water by WHO. In addition, the xylan-AgNPs composites can be applied for Hg(2+) detection in real water samples. This study provides a novel way for the high-value utilization of a rich biomass resource, and a green method for the synthesis of AgNPs for the selective and sensitive detection of harmful heavy metals.
Phylogenetic analysis of the SINA/SIAH ubiquitin E3 ligase family in Metazoa.
Pepper, Ian J; Van Sciver, Robert E; Tang, Amy H
2017-08-07
The RAS signaling pathway is a pivotal developmental pathway that controls many fundamental biological processes including cell proliferation, differentiation, movement and apoptosis. Drosophila Seven-IN-Absentia (SINA) is a ubiquitin E3 ligase that is the most downstream signaling "gatekeeper" whose biological activity is essential for proper RAS signal transduction. Vertebrate SINA homologs (SIAHs) share a high degree of amino acid identity with that of Drosophila SINA. SINA/SIAH is the most conserved signaling component in the canonical EGFR/RAS/RAF/MAPK signal transduction pathway. Vertebrate SIAH1, 2, and 3 are the three orthologs to invertebrate SINA protein. SINA and SIAH1 orthologs are found in all major taxa of metazoans. These proteins have four conserved functional domains, known as RING (Really Interesting New Gene), SZF (SIAH-type zinc finger), SBS (substrate binding site) and DIMER (Dimerization). In addition to the siah1 gene, most vertebrates encode two additional siah genes (siah2 and siah3) in their genomes. Vertebrate SIAH2 has a highly divergent and extended N-terminal sequence, while its RING, SZF, SBS and DIMER domains maintain high amino acid identity/similarity to that of SIAH1. But unlike vertebrate SIAH1 and SIAH2, SIAH3 lacks a functional RING domain, suggesting that SIAH3 may be an inactive E3 ligase. The SIAH3 subtree exhibits a high degree of amino acid divergence when compared to the SIAH1 and SIAH2 subtrees. We find that SIAH1 and SIAH2 are expressed in all human epithelial cell lines examined thus far, while SIAH3 is only expressed in a limited subset of cancer cell lines. Through phylogenetic analyses of metazoan SINA and SIAH E3 ligases, we identified many invariant and divergent amino acid residues, as well as the evolutionarily conserved functional motifs in this medically relevant gene family. Our phylomedicinal study of this unique metazoan SINA/SIAH protein family has provided invaluable evolution-based support towards future
Mori, Jinichi; Tanimoto, Tetsuya; Miura, Yuji; Kami, Masahiro
2015-06-01
All-case post-marketing surveillance of newly approved anticancer drugs is usually conducted on all patients in Japan. The present study investigates whether all-case post-marketing surveillance identifies fatal adverse drug reactions undetected before market entry. We examined fatal adverse drug reactions identified via all-case post-marketing surveillance by reviewing the disclosed post-marketing surveillance results, and determined the time points in which the fatal adverse drug reactions were initially reported by reviewing drug labels. We additionally scanned emergency alerts on the Japanese regulatory authority website to assess the relationship between all-case post-marketing surveillance and regulatory action. Twenty-five all-case post-marketing surveillances were performed between January 1999 and December 2009. Eight all-case post-marketing surveillances with final results included information on all fatal cases. Of these, the median number of patients was 1287 (range: 106-4998), the median number of fatal adverse drug reactions was 14.5 (range: 4-23). Of the 111 fatal adverse drug reactions detected in the eight post-marketing surveillances, only 28 (25.0%) and 22 (19.6%) were described on the initial global and the initial Japanese drug label, respectively, and 58 (52.3%) fatal adverse drug reactions were first described in the all-case post-marketing surveillance reports. Despite this, the regulatory authority issued only four warning letters, and two of these were prompted by case reports from the all-case post-marketing surveillance. All-case post-marketing surveillance of newly approved anticancer drugs in Japan was useful for the rigorous compilation of non-specific adverse drug reactions, but it rarely detected clinically significant fatal adverse drug reactions. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
The Ubiquitin Ligase CHIP Prevents SirT6 Degradation through Noncanonical Ubiquitination
Ronnebaum, Sarah M.; Wu, Yaxu; McDonough, Holly
2013-01-01
The ubiquitin ligase CHIP (carboxyl terminus of Hsp70-interacting protein) regulates protein quality control, and CHIP deletion accelerates aging and reduces the life span in mice. Here, we reveal a mechanism for CHIP's influence on longevity by demonstrating that CHIP stabilizes the sirtuin family member SirT6, a lysine deacetylase/ADP ribosylase involved in DNA repair, metabolism, and longevity. In CHIP-deficient cells, SirT6 protein half-life is substantially reduced due to increased proteasome-mediated degradation, but CHIP overexpression in these cells increases SirT6 protein expression without affecting SirT6 transcription. CHIP noncanonically ubiquitinates SirT6 at K170, which stabilizes SirT6 and prevents SirT6 canonical ubiquitination by other ubiquitin ligases. In CHIP-depleted cells, SirT6 K170 mutation increases SirT6 half-life and prevents proteasome-mediated degradation. The global decrease in SirT6 expression in the absence of CHIP is associated with decreased SirT6 promoter occupancy, which increases histone acetylation and promotes downstream gene transcription in CHIP-depleted cells. Cells lacking CHIP are hypersensitive to DNA-damaging agents, but DNA repair and cell viability are rescued by enforced expression of SirT6. The discovery of this CHIP-SirT6 interaction represents a novel protein-stabilizing mechanism and defines an intersection between protein quality control and epigenetic regulation to influence pathways that regulate the biology of aging. PMID:24043303
The E3 Ligase CHIP Mediates p21 Degradation to Maintain Radioresistance.
Biswas, Kuntal; Sarkar, Sukumar; Du, Kangping; Brautigan, David L; Abbas, Tarek; Larner, James M
2017-06-01
Lung cancer resists radiotherapy, making it one of the deadliest forms of cancer. Here, we show that human lung cancer cell lines can be rendered sensitive to ionizing radiation (IR) by RNAi knockdown of C-terminus of Hsc70-interacting protein (CHIP/STUB1), a U-box-type E3 ubiquitin ligase that targets a number of stress-induced proteins. Mechanistically, ubiquitin-dependent degradation of the cyclin-dependent kinase (CDK) inhibitor, p21 protein, is reduced by CHIP knockdown, leading to enhanced senescence of cells in response to exposure to IR. Cellular senescence and sensitivity to IR is prevented by CRISPR/Cas9-mediated deletion of the p21 gene ( CDKN1A) in CHIP knockdown cells. Conversely, overexpression of CHIP potentiates p21 degradation and promotes greater radioresistance of lung cancer cells. In vitro and cell-based assays demonstrate that p21 is a novel and direct ubiquitylation substrate of CHIP that also requires the CHIP-associated chaperone HSP70. These data reveal that the inhibition of the E3 ubiquitin ligase CHIP promotes radiosensitivity, thus suggesting a novel strategy for the treatment of lung cancer. Implications: The CHIP-HSP70-p21 ubiquitylation/degradation axis identified here could be exploited to enhance the efficacy of radiotherapy in patients with non-small cell lung cancer. Mol Cancer Res; 15(6); 651-9. ©2017 AACR . ©2017 American Association for Cancer Research.
Total amino acid stabilization during cell-free protein synthesis reactions.
Calhoun, Kara A; Swartz, James R
2006-05-17
Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.
Boboila, Cristian; Jankovic, Mila; Yan, Catherine T; Wang, Jing H; Wesemann, Duane R; Zhang, Tingting; Fazeli, Alex; Feldman, Lauren; Nussenzweig, Andre; Nussenzweig, Michel; Alt, Frederick W
2010-02-16
Class switch recombination (CSR) in B lymphocytes is initiated by introduction of multiple DNA double-strand breaks (DSBs) into switch (S) regions that flank immunoglobulin heavy chain (IgH) constant region exons. CSR is completed by joining a DSB in the donor S mu to a DSB in a downstream acceptor S region (e.g., S gamma1) by end-joining. In normal cells, many CSR junctions are mediated by classical nonhomologous end-joining (C-NHEJ), which employs the Ku70/80 complex for DSB recognition and XRCC4/DNA ligase 4 for ligation. Alternative end-joining (A-EJ) mediates CSR, at reduced levels, in the absence of C-NHEJ, even in combined absence of Ku70 and ligase 4, demonstrating an A-EJ pathway totally distinct from C-NHEJ. Multiple DSBs are introduced into S mu during CSR, with some being rejoined or joined to each other to generate internal switch deletions (ISDs). In addition, S-region DSBs can be joined to other chromosomes to generate translocations, the level of which is increased by absence of a single C-NHEJ component (e.g., XRCC4). We asked whether ISD and S-region translocations occur in the complete absence of C-NHEJ (e.g., in Ku70/ligase 4 double-deficient B cells). We found, unexpectedly, that B-cell activation for CSR generates substantial ISD in both S mu and S gamma1 and that ISD in both is greatly increased by the absence of C-NHEJ. IgH chromosomal translocations to the c-myc oncogene also are augmented in the combined absence of Ku70 and ligase 4. We discuss the implications of these findings for A-EJ in normal and abnormal DSB repair.
Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources.
Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam
2017-01-01
Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli . PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources.
Kleinbaum, Daniel J; Miller, Gregory P; Kool, Eric T
2010-06-16
Quenched autoligation probes have been employed previously in a target-templated nonenzymatic ligation strategy for detecting nucleic acids in cells by fluorescence. A common source of background signal in such probes is the undesired reaction with water and other cellular nucleophiles. Here, we describe a new class of self-ligating probes, double displacement (DD) probes, that rely on two displacement reactions to fully unquench a nearby fluorophore. Three potential double displacement architectures, all possessing two fluorescence quencher/leaving groups (dabsylate groups), were synthesized and evaluated for templated reaction with nucleophile (phosphorothioate) probes both in vitro and in intact bacterial cells. All three DD probe designs provided substantially better initial quenching than a single-Dabsyl control. In isothermal templated reactions in vitro, double displacement probes yielded considerably lower background signal than previous single displacement probes; investigation into the mechanism revealed that one dabsylate acts as a sacrificial leaving group, reacting nonspecifically with water, but yielding little signal because another quencher group remains. Templated reaction with the specific nucleophile probe is required to activate a signal. The double displacement probes provided a ca. 80-fold turn-on signal and yielded a 2-4-fold improvement in signal/background over single Dabsyl probes. The best-performing probe architecture was demonstrated in a two-color, FRET-based two-allele discrimination system in vitro and was shown to be capable of discriminating between two closely related species of bacteria differing by a single nucleotide at an rRNA target site.
Rapid Detection of Candida albicans by Polymerase Spiral Reaction Assay in Clinical Blood Samples
Jiang, Xiaoqun; Dong, Derong; Bian, Lihong; Zou, Dayang; He, Xiaoming; Ao, Da; Yang, Zhan; Huang, Simo; Liu, Ningwei; Liu, Wei; Huang, Liuyu
2016-01-01
Candida albicans is the most common human yeast pathogen which causes mucosal infections and invasive fungal diseases. Early detection of this pathogen is needed to guide preventative and therapeutic treatment. The aim of this study was to establish a polymerase spiral reaction (PSR) assay that rapidly and accurately detects C. albicans and to assess the clinical applicability of PSR-based diagnostic testing. Internal transcribed spacer 2 (ITS2), a region between 5.8S and 28S fungal ribosomal DNA, was used as the target sequence. Four primers were designed for amplification of ITS2 with the PSR method, which was evaluated using real time turbidity monitoring and visual detection using a pH indicator. Fourteen non-C. albicans yeast strains were negative for detection, which indicated the specificity of PSR assay was 100%. A 10-fold serial dilution of C. albicans genomic DNA was subjected to PSR and conventional polimerase chain reaction (PCR) to compare their sensitivities. The detection limit of PSR was 6.9 pg/μl within 1 h, 10-fold higher than that of PCR (69.0 pg/μl). Blood samples (n = 122) were collected from intensive care unit and hematological patients with proven or suspected C. albicans infection at two hospitals in Beijing, China. Both PSR assay and the culture method were used to analyze the samples. Of the 122 clinical samples, 34 were identified as positive by PSR. The result was consistent with those obtained by the culture method. In conclusion, a novel and effective C. albicans detection assay was developed that has a great potential for clinical screening and point-of-care testing. PMID:27379048
Wu, Yushu; Wang, Lei; Jiang, Wei
2017-03-15
Sensitive detection of uracil-DNA glycosylase (UDG) activity is beneficial for evaluating the repairing process of DNA lesions. Here, toehold-mediated strand displacement reaction (TSDR)-dependent fluorescent strategy was constructed for sensitive detection of UDG activity. A single-stranded DNA (ssDNA) probe with two uracil bases and a trigger sequence were designed. A hairpin probe with toehold domain was designed, and a reporter probe was also designed. Under the action of UDG, two uracil bases were removed from ssDNA probe, generating apurinic/apyrimidinic (AP) sites. Then, the AP sites could inhibit the TSDR between ssDNA probe and hairpin probe, leaving the trigger sequence in ssDNA probe still free. Subsequently, the trigger sequence was annealed with the reporter probe, initiating the polymerization and nicking amplification reaction. As a result, numerous G-quadruplex (G4) structures were formed, which could bind with N-methyl-mesoporphyrin IX (NMM) to generate enhanced fluorescent signal. In the absence of UDG, the ssDNA probe could hybridize with the toehold domain of the hairpin probe to initiate TSDR, blocking the trigger sequence, and then the subsequent amplification reaction would not occur. The proposed strategy was successfully implemented for detecting UDG activity with a detection limit of 2.7×10 -5 U/mL. Moreover, the strategy could distinguish UDG well from other interference enzymes. Furthermore, the strategy was also applied for detecting UDG activity in HeLa cells lysate with low effect of cellular components. These results indicated that the proposed strategy offered a promising tool for sensitive quantification of UDG activity in UDG-related function study and disease prognosis. Copyright © 2016 Elsevier B.V. All rights reserved.
Zhou, Zhide; Zhao, Le; Wang, Zhihong; Xue, Wen; Wang, Yunxiao; Huang, Yong; Liang, Jintao; Chen, Jiejing; Li, Guiyin
2018-06-01
Early diagnosis of diabetes yields significant clinical benefits. The serum level of 1,5‑anhydroglucitol (1,5‑AG) has been a new biochemical marker for postprandial hyperglycemia. In this study, a simple colorimetric method for 1,5‑AG detection has been designed based on highly efficient peroxidase mimetic activity of GQDs and enzyme-catalyzed reaction. By the catalytic action of pyranose oxidase (PROD), the 1,5‑AG was oxidized to 1,5‑anhydrofuctose and H 2 O 2 . The GQDs in the presence of H 2 O 2 exhibited highly efficient catalytic activity toward the oxidation of 3, 3', 5, 5'‑tetramethylbenzidine (TMB) to a blue colored product. The influence of relevant experimental variables was optimized. A linear relationship of optical signal with the concentration of 1,5‑AG in the range of 20.0-100.0μg/mL with the regression correlation coefficient of 0.9985 was obtained which could be monitored by colorimetry detection. The limit of detection (LOD) for 1,5‑AG detection was approximately 0.144μg/mL. All in all, the proposed 1,5‑AG detection system based on GQDs and PROD-catalyzed reaction showed better performances with simple operation, low-cost, higher selectivity. Copyright © 2018 Elsevier B.V. All rights reserved.
A complex ligase ribozyme evolved in vitro from a group I ribozyme domain
NASA Technical Reports Server (NTRS)
Jaeger, L.; Wright, M. C.; Joyce, G. F.; Bada, J. L. (Principal Investigator)
1999-01-01
Like most proteins, complex RNA molecules often are modular objects made up of distinct structural and functional domains. The component domains of a protein can associate in alternative combinations to form molecules with different functions. These observations raise the possibility that complex RNAs also can be assembled from preexisting structural and functional domains. To test this hypothesis, an in vitro evolution procedure was used to isolate a previously undescribed class of complex ligase ribozymes, starting from a pool of 10(16) different RNA molecules that contained a constant region derived from a large structural domain that occurs within self-splicing group I ribozymes. Attached to this constant region were three hypervariable regions, totaling 85 nucleotides, that gave rise to the catalytic motif within the evolved catalysts. The ligase ribozymes catalyze formation of a 3',5'-phosphodiester linkage between adjacent template-bound oligonucleotides, one bearing a 3' hydroxyl and the other a 5' triphosphate. Ligation occurs in the context of a Watson-Crick duplex, with a catalytic rate of 0.26 min(-1) under optimal conditions. The constant region is essential for catalytic activity and appears to retain the tertiary structure of the group I ribozyme. This work demonstrates that complex RNA molecules, like their protein counterparts, can share common structural domains while exhibiting distinct catalytic functions.
Inhibiting Mitochondrial DNA Ligase IIIα Activates Caspase 1-Dependent Apoptosis in Cancer Cells.
Sallmyr, Annahita; Matsumoto, Yoshihiro; Roginskaya, Vera; Van Houten, Bennett; Tomkinson, Alan E
2016-09-15
Elevated levels of DNA ligase IIIα (LigIIIα) have been identified as a biomarker of an alteration in DNA repair in cancer cells that confers hypersensitivity to a LigIIIα inhibitor, L67, in combination with a poly (ADP-ribose) polymerase inhibitor. Because LigIIIα functions in the nucleus and mitochondria, we examined the effect of L67 on these organelles. Here, we show that, although the DNA ligase inhibitor selectively targets mitochondria, cancer and nonmalignant cells respond differently to disruption of mitochondrial DNA metabolism. Inhibition of mitochondrial LigIIIα in cancer cells resulted in abnormal mitochondrial morphology, reduced levels of mitochondrial DNA, and increased levels of mitochondrially generated reactive oxygen species that caused nuclear DNA damage. In contrast, these effects did not occur in nonmalignant cells. Furthermore, inhibition of mitochondrial LigIIIα activated a caspase 1-dependent apoptotic pathway, which is known to be part of inflammatory responses induced by pathogenic microorganisms in cancer, but not nonmalignant cells. These results demonstrate that the disruption of mitochondrial DNA metabolism elicits different responses in nonmalignant and cancer cells and suggests that the abnormal response in cancer cells may be exploited in the development of novel therapeutic strategies that selectively target cancer cells. Cancer Res; 76(18); 5431-41. ©2016 AACR. ©2016 American Association for Cancer Research.
Jang, Sang-Min; Redon, Christophe E.; Aladjem, Mirit I.
2018-01-01
Cullin-RING (Really Interesting New Gene) E3 ubiquitin ligases (CRLs), the largest family of E3 ubiquitin ligases, are functional multi-subunit complexes including substrate receptors, adaptors, cullin scaffolds, and RING-box proteins. CRLs are responsible for ubiquitination of ~20% of cellular proteins and are involved in diverse biological processes including cell cycle progression, genome stability, and oncogenesis. Not surprisingly, cullins are deregulated in many diseases and instances of cancer. Recent studies have highlighted the importance of CRL-mediated ubiquitination in the regulation of DNA replication/repair, including specific roles in chromatin assembly and disassembly of the replication machinery. The development of novel therapeutics targeting the CRLs that regulate the replication machinery and chromatin in cancer is now an attractive therapeutic strategy. In this review, we summarize the structure and assembly of CRLs and outline their cellular functions and their diverse roles in cancer, emphasizing the regulatory functions of nuclear CRLs in modulating the DNA replication machinery. Finally, we discuss the current strategies for targeting CRLs against cancer in the clinic. PMID:29594129
The E3 ubiquitin ligase Trim7 mediates c-Jun/AP-1 activation by Ras signalling
Chakraborty, Atanu; Diefenbacher, Markus E.; Mylona, Anastasia; Kassel, Olivier; Behrens, Axel
2015-01-01
The c-Jun/AP-1 transcription factor controls key cellular behaviours, including proliferation and apoptosis, in response to JNK and Ras/MAPK signalling. While the JNK pathway has been well characterised, the mechanism of activation by Ras was elusive. Here we identify the uncharacterised ubiquitin ligase Trim7 as a critical component of AP-1 activation via Ras. We found that MSK1 directly phosphorylates Trim7 in response to direct activation by the Ras–Raf–MEK–ERK pathway, and this modification stimulates Trim7 E3 ubiquitin ligase activity. Trim7 mediates Lys63-linked ubiquitination of the AP-1 coactivator RACO-1, leading to RACO-1 protein stabilisation. Consequently, Trim7 depletion reduces RACO-1 levels and AP-1-dependent gene expression. Moreover, transgenic overexpression of Trim7 increases lung tumour burden in a Ras-driven cancer model, and knockdown of Trim7 in established xenografts reduces tumour growth. Thus, phosphorylation-ubiquitination crosstalk between MSK1, Trim7 and RACO-1 completes the long sought-after mechanism linking growth factor signalling and AP-1 activation. PMID:25851810
McCoy, Andrea J; Maurelli, Anthony T
2005-07-01
Recent characterization of chlamydial genes encoding functional peptidoglycan (PG)-synthesis proteins suggests that the Chlamydiaceae possess the ability to synthesize PG yet biochemical evidence for the synthesis of PG has yet to be demonstrated. The presence of D-amino acids in PG is a hallmark of bacteria. Chlamydiaceae do not appear to encode amino acid racemases however, a D-alanyl-D-alanine (D-Ala-D-Ala) ligase homologue (Ddl) is encoded in the genome. Thus, we undertook a genetics-based approach to demonstrate and characterize the D-Ala-D-Ala ligase activity of chlamydial Ddl, a protein encoded as a fusion with MurC. The full-length murC-ddl fusion gene from Chlamydia trachomatis serovar L2 was cloned and placed under the control of the arabinose-inducible ara promoter and transformed into a D-Ala-D-Ala ligase auxotroph of Escherichia coli possessing deletions of both the ddlA and ddlB genes. Viability of the E. coliDeltaddlADeltaddlB mutant in the absence of exogenous D-Ala-D-Ala dipeptide became dependent on the expression of the chlamydial murC-ddl thus demonstrating functional ligase activity. Domain mapping of the full-length fusion protein and site-directed mutagenesis of the MurC domain revealed that the structure of the full fusion protein but not MurC enzymatic activity was required for ligase activity in vivo. Recombinant MurC-Ddl exhibited substrate specificity for D-Ala. Chlamydia growth is inhibited by D-cycloserine (DCS) and in vitro analysis provided evidence for the chlamydial MurC-Ddl as the target for DCS sensitivity. In vivo sensitivity to DCS could be reversed by addition of exogenous D-Ala and D-Ala-D-Ala. Together, these findings further support our hypothesis that PG is synthesized by members of the Chlamydiaceae family and suggest that D-amino acids, specifically D-Ala, are present in chlamydial PG.
USDA-ARS?s Scientific Manuscript database
We cloned the full length 4CL ortholog encoding 4-coumarate: coenzymeA ligase from kenaf (Hibiscus cannabiuns) using degenerate primers and RACE (rapid amplification of cDNA ends) systems. The 4CL is a key regulatory enzyme of the phenylpropanoid pathway that regulates the activation of cinnamic ac...
Chaure, Shweta; Paul, Deepen; Vadagma, Pankaj; Ray, Asim K
2010-01-15
Optical absorption and Raman spectra of the sulfonated copper phthalocyanine (CuTsPc) layer were exploited for detection of cadmium (Cd) contaminants in water. Acetylcholine esterase was immobilized by freely suspending them in calcium alginate microbeads and this gel was then spincoated on the drop cast sulfonated copper phthalocyanine film on a glass substrate to form a bilayer. The inhibition of catalytic reaction between acetylcholine chloride and enzyme due to Cd contaminants was monitored by recording changes in spectra of drop cast CuTsPc as an indicator. The detection limit of cadmium content in water was found to be 1 ppm.
Mudgil, Yashwanti; Shiu, Shin-Han; Stone, Sophia L; Salt, Jennifer N; Goring, Daphne R
2004-01-01
The Arabidopsis genome was searched to identify predicted proteins containing armadillo (ARM) repeats, a motif known to mediate protein-protein interactions in a number of different animal proteins. Using domain database predictions and models generated in this study, 108 Arabidopsis proteins were identified that contained a minimum of two ARM repeats with the majority of proteins containing four to eight ARM repeats. Clustering analysis showed that the 108 predicted Arabidopsis ARM repeat proteins could be divided into multiple groups with wide differences in their domain compositions and organizations. Interestingly, 41 of the 108 Arabidopsis ARM repeat proteins contained a U-box, a motif present in a family of E3 ligases, and these proteins represented the largest class of Arabidopsis ARM repeat proteins. In 14 of these U-box/ARM repeat proteins, there was also a novel conserved domain identified in the N-terminal region. Based on the phylogenetic tree, representative U-box/ARM repeat proteins were selected for further study. RNA-blot analyses revealed that these U-box/ARM proteins are expressed in a variety of tissues in Arabidopsis. In addition, the selected U-box/ARM proteins were found to be functional E3 ubiquitin ligases. Thus, these U-box/ARM proteins represent a new family of E3 ligases in Arabidopsis.
A Plasmodium yoelii HECT-like E3 ubiquitin ligase regulates parasite growth and virulence.
Nair, Sethu C; Xu, Ruixue; Pattaradilokrat, Sittiporn; Wu, Jian; Qi, Yanwei; Zilversmit, Martine; Ganesan, Sundar; Nagarajan, Vijayaraj; Eastman, Richard T; Orandle, Marlene S; Tan, John C; Myers, Timothy G; Liu, Shengfa; Long, Carole A; Li, Jian; Su, Xin-Zhuan
2017-08-09
Infection of mice with strains of Plasmodium yoelii parasites can result in different pathology, but molecular mechanisms to explain this variation are unclear. Here we show that a P. yoelii gene encoding a HECT-like E3 ubiquitin ligase (Pyheul) influences parasitemia and host mortality. We genetically cross two lethal parasites with distinct disease phenotypes, and identify 43 genetically diverse progeny by typing with microsatellites and 9230 single-nucleotide polymorphisms. A genome-wide quantitative trait loci scan links parasite growth and host mortality to two major loci on chromosomes 1 and 7 with LOD (logarithm of the odds) scores = 6.1 and 8.1, respectively. Allelic exchange of partial sequences of Pyheul in the chromosome 7 locus and modification of the gene expression alter parasite growth and host mortality. This study identifies a gene that may have a function in parasite growth, virulence, and host-parasite interaction, and therefore could be a target for drug or vaccine development.Many strains of Plasmodium differ in virulence, but factors that control these distinctions are not known. Here the authors comparatively map virulence loci using the offspring from a P. yoelii YM and N67 genetic cross, and identify a putative HECT E3 ubiquitin ligase that may explain the variance.
Liger, D; Masson, A; Blanot, D; van Heijenoort, J; Parquet, C
1996-01-01
The UDP-N-acetylmuramate:L-alanine ligase of Escherichia coli is responsible for the addition of the first amino acid of the peptide moiety in the assembly of the monomer unit of peptidoglycan. It catalyzes the formation of the amide bond between UDP-N-acetylmuramic acid (UDP-MurNAc) and L-alanine. The UDP-MurNAc-L-alanine ligase was overproduced 2000-fold in a strain harboring a recombinant plasmid (pAM1005) with the murC gene under the control of the inducible promoter trc. The murC gene product appears as a 50-kDa protein accounting for ca. 50% of total cell proteins. A two-step purification led to 1 g of a homogeneous protein from an 8-liter culture. The N-terminal sequence of the purified protein correlated with the nucleotide sequence of the gene. The stability of the enzymatic activity is strictly dependent on the presence of 2-mercaptoethanol. The K(m) values for substrates UDP-N-acetylmuramic acid, L-alanine, and ATP were estimated; 100, 20, and 450 microM, respectively. The specificity of the enzyme for its substrates was investigated with various analogues. Preliminary experiments attempting to elucidate the enzymatic mechanism were consistent with the formation of an acylphosphate intermediate.
Ubiquitin ligase Nedd4L targets activated Smad2/3 to limit TGF-beta signaling.
Gao, Sheng; Alarcón, Claudio; Sapkota, Gopal; Rahman, Sadia; Chen, Pan-Yu; Goerner, Nina; Macias, Maria J; Erdjument-Bromage, Hediye; Tempst, Paul; Massagué, Joan
2009-11-13
TGF-beta induces phosphorylation of the transcription factors Smad2 and Smad3 at the C terminus as well as at an interdomain linker region. TGF-beta-induced linker phosphorylation marks the activated Smad proteins for proteasome-mediated destruction. Here, we identify Nedd4L as the ubiquitin ligase responsible for this step. Through its WW domain, Nedd4L specifically recognizes a TGF-beta-induced phosphoThr-ProTyr motif in the linker region, resulting in Smad2/3 polyubiquitination and degradation. Nedd4L is not interchangeable with Smurf1, a ubiquitin ligase that targets BMP-activated, linker-phosphorylated Smad1. Nedd4L limits the half-life of TGF-beta-activated Smads and restricts the amplitude and duration of TGF-beta gene responses, and in mouse embryonic stem cells, it limits the induction of mesoendodermal fates by Smad2/3-activating factors. Hierarchical regulation is provided by SGK1, which phosphorylates Nedd4L to prevent binding of Smad2/3. Previously identified as a regulator of renal sodium channels, Nedd4L is shown here to play a broader role as a general modulator of Smad turnover during TGF-beta signal transduction.
Arvind, Akanksha; Kumar, Vivek; Saravanan, Parameswaran; Mohan, C Gopi
2012-09-01
The cell wall of mycobacterium offers well validated targets which can be exploited for discovery of new lead compounds. MurC-MurF ligases catalyze a series of irreversible steps in the biosynthesis of peptidoglycan precursor, i.e. MurD catalyzes the ligation of D-glutamate to the nucleotide precursor UMA. The three dimensional structure of Mtb-MurD is not known and was predicted by us for the first time using comparative homology modeling technique. The accuracy and stability of the predicted Mtb-MurD structure was validated using Procheck and molecular dynamics simulation. Key interactions in Mtb-MurD were studied using docking analysis of available transition state inhibitors of E.coli-MurD. The docking analysis revealed that analogues of both L and D forms of glutamic acid have similar interaction profiles with Mtb-MurD. Further, residues His192, Arg382, Ser463, and Tyr470 are proposed to be important for inhibitor-(Mtb-MurD) interactions. We also identified few pharmacophoric features essential for Mtb-MurD ligase inhibitory activity and which can further been utilized for the discovery of putative antitubercular chemotherapy.
Unexpected substrate specificity of T4 DNA ligase revealed by in vitro selection
NASA Technical Reports Server (NTRS)
Harada, Kazuo; Orgel, Leslie E.
1993-01-01
We have used in vitro selection techniques to characterize DNA sequences that are ligated efficiently by T4 DNA ligase. We find that the ensemble of selected sequences ligates about 50 times as efficiently as the random mixture of sequences used as the input for selection. Surprisingly many of the selected sequences failed to produce a match at or close to the ligation junction. None of the 20 selected oligomers that we sequenced produced a match two bases upstream from the ligation junction.
Shah, Meera; Stebbins, John L; Dewing, Antimone; Qi, Jianfei; Pellecchia, Maurizio; Ronai, Ze'ev A
2009-12-01
The E3 ubiquitin ligase Siah2 has been implicated in the regulation of the hypoxia response, as well as in the control of Ras, JNK/p38/NF-kappaB signaling pathways. Both Ras/mitogen-activated protein kinase (MAPK) and hypoxia pathways are important for melanoma development and progression, pointing to the possible use of Siah2 as target for treatment of this tumor type. In the present study, we have established a high-throughput electro-chemiluninescent-based assay in order to screen and identify inhibitors of Siah2 ubiquitin ligase activity. Of 1840 compounds screened, we identified and characterized menadione (MEN) as a specific inhibitor of Siah2 ligase activity. MEN attenuated Siah2 self-ubiquitination, and increased expression of its substrates PHD3 and Sprouty2, with concomitant decrease in levels of HIF-1alpha and pERK, the respective downstream effectors. MEN treatment no longer affected PHD3 or Sprouty2 in Siah-KO cells, pointing to its Siah-dependent effects. Further, MEN inhibition of Siah2 was not attenuated by free radical scavenger, suggesting it is ROS-independent. Significantly, growth of xenograft melanoma tumors was inhibited following the administration of MEN or its derivative. These findings reveal an efficient platform for the identification of Siah inhibitors while identifying and characterizing MEN as Siah inhibitor that attenuates hypoxia and MAPK signaling, and inhibits melanoma tumorigenesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Liu, Yongchang; Zhang, Xinyu; Zhu, Shouhong
Ubiquitination plays a very important role in the response to abiotic stresses of plant. To identify key regulators of salt stress, a gene GhSARP1(Salt-Associated Ring finger Protein)encoding C3H2C3-type E3 ligase, was cloned from cotton. Transcription level of GhSARP1 was high in leaf, flower and fiber of 24,27 and 27DPA (Days Post-Anthesis), but low in root and stem. Except PEG6000 treatment, the expression of GhSARP1 was down-regulated by NaCl, cold and ABA after being treated for 1 h. GhSARP1-GFP fusion protein located on the plasma membrane, which was dependent on trans-membrane motif. In vitro ubiquitination assay showed that GhSARP1 had E3 ligase activity.more » Heterogeneous overexpression of GhSARP1reduced salt tolerance of transgenic Arabidopsis in germination and post-germination stage. Our results suggested that the GhSARP1 might negatively regulate the response to salt stress mediated by the ubiquitination in cotton. - Highlights: • GhSARP1 expression was regulated by various abiotic stresses. • GhSARP1 have E3 ligase activity in vitro and locate on the plasma membrane. • Overexpression of GhSARP1 in Arabidopsis reduced the salt tolerance.« less
Kledmanee, Kan; Suwanpakdee, Sarin; Krajangwong, Sakranmanee; Chatsiriwech, Jarin; Suksai, Parut; Suwannachat, Pongpun; Sariya, Ladawan; Buddhirongawatr, Ruangrat; Charoonrut, Phingphol; Chaichoun, Kridsada
2009-01-01
A multiplex polymerase chain reaction (PCR) has been developed for simultaneous detection of canine blood parasites, Ehrlichia canis, Babesia spp and Hepatozoon canis, from blood samples in a single reaction. The multiplex PCR primers were specific to E. canis VirB9, Babesia spp 16S rRNA and H. canis 16S rRNA genes. Specificity of the amplicons was confirmed by DNA sequencing. The assay was evaluated using normal canine and infected blood samples, which were detected by microscopic examination. This multiplex PCR offers scope for simultaneous detection of three important canine blood parasites and should be valuable in monitoring parasite infections in dogs and ticks.
DLG1 is an anchor for the E3 ligase MARCH2 at sites of cell-cell contact
Cao, Zhifang; Huett, Alan; Kuballa, Petric; Giallourakis, Cosmas; Xavier, Ramnik J.
2008-01-01
PDZ domain containing molecular scaffolds play a central role in organizing synaptic junctions. Observations in Drosophila and mammalian cells have implicated that ubiquitination and endosomal trafficking, of molecular scaffolds are critical to the development and maintenance of cell-cell junctions and cell polarity. To elucidate if there is a connection between these pathways, we applied an integrative genomic strategy, which combined comparative genomics and proteomics with cell biological assays. Given the importance of ubiquitin in regulating endocytic processes, we first identified the subset of E3 ligases with conserved PDZ binding motifs. Among this subset, the MARCH family ubiquitin ligases account for the largest family and MARCH2 has been previously implicated in endosomal trafficking. Next, we tested in an unbiased fashion, if MARCH2 binds PDZ proteins in vivo using a modified tandem affinity purification strategy followed by mass spectrometry. Of note, DLG1 was co-purified from MARCH2, with subsequent confirmation that MARCH2 interacts with full-length DLG1 in a PDZ domain dependent manner. Furthermore, we demonstrated that MARCH2 co-localized with DLG1 at sites of cell-cell contact. In addition, loss of the MARCH2 PDZ binding motif led to loss of MARCH2 localization at cell-cell contact sites and MARCH2 appeared to localize away from cell-cell junctions. In in vivo ubiquitination assays we show that MARCH2 promotes DLG1 ubiquitination Overall, these results suggest that PDZ ligands with E3 ligase activity may link PDZ domain containing tumor suppressors to endocytic pathways and cell polarity determination. PMID:17980554
E2-EPF UCP Possesses E3 Ubiquitin Ligase Activity via Its Cysteine 118 Residue.
Lim, Jung Hwa; Shin, Hee Won; Chung, Kyung-Sook; Kim, Nam-Soon; Kim, Ju Hee; Jung, Hong-Ryul; Im, Dong-Soo; Jung, Cho-Rok
Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended on not only Lys11 linkage but also the Lys6, Lys48 and Lys63 residues of ubiquitin, which were involved in polyubiquitin chain formation on UCP itself. UCP self-association occurred through the UBC domain, which also contributed to the interaction with pVHL. The polyubiquitin chains appeared on the N-terminus of UCP in vivo, which indicated that the N-terminus of UCP contains target lysines for polyubiquitination. The Lys76 residue of UCP was the most critical site for auto-ubiquitination, whereas the polyubiquitin chain formation on pVHL occurred on all three of its lysines (Lys159, Lys171 and Lys196). A UCP mutant in which Cys118 was changed to alanine (UCPC118A) did not form a polyubiquitin chain but did strongly accumulate mono- and di-ubiquitin via auto-ubiquitination. Polyubiquitin chain formation required the coordination of Cys95 and Cys118 between two interacting molecules. The mechanism of the polyubiquitin chain reaction of UCP may involve the transfer of ubiquitin from Cys95 to Cys118 by trans-thiolation, with polyubiquitin chains forming at Cys118 by reversible thioester bonding. The polyubiquitin chains are then moved to the lysine residues of the substrate by irreversible isopeptide bonding. During the elongation of the ubiquitin chain, an active Cys118 residue is required in both parts of UCP, namely, the catalytic enzyme and the substrate. In conclusion, UCP possesses not only E2 ubiquitin conjugating enzyme activity but also E3 ubiquitin ligase activity, and Cys118 is critical for polyubiquitin chain formation.
E2-EPF UCP Possesses E3 Ubiquitin Ligase Activity via Its Cysteine 118 Residue
Lim, Jung Hwa; Shin, Hee Won; Chung, Kyung-Sook; Kim, Nam-Soon; Kim, Ju Hee; Jung, Hong-Ryul; Im, Dong-Soo; Jung, Cho-Rok
2016-01-01
Here, we show that E2-EPF ubiquitin carrier protein (UCP) elongated E3-independent polyubiquitin chains on the lysine residues of von Hippel-Lindau protein (pVHL) and its own lysine residues both in vitro and in vivo. The initiation of the ubiquitin reaction depended on not only Lys11 linkage but also the Lys6, Lys48 and Lys63 residues of ubiquitin, which were involved in polyubiquitin chain formation on UCP itself. UCP self-association occurred through the UBC domain, which also contributed to the interaction with pVHL. The polyubiquitin chains appeared on the N-terminus of UCP in vivo, which indicated that the N-terminus of UCP contains target lysines for polyubiquitination. The Lys76 residue of UCP was the most critical site for auto-ubiquitination, whereas the polyubiquitin chain formation on pVHL occurred on all three of its lysines (Lys159, Lys171 and Lys196). A UCP mutant in which Cys118 was changed to alanine (UCPC118A) did not form a polyubiquitin chain but did strongly accumulate mono- and di-ubiquitin via auto-ubiquitination. Polyubiquitin chain formation required the coordination of Cys95 and Cys118 between two interacting molecules. The mechanism of the polyubiquitin chain reaction of UCP may involve the transfer of ubiquitin from Cys95 to Cys118 by trans-thiolation, with polyubiquitin chains forming at Cys118 by reversible thioester bonding. The polyubiquitin chains are then moved to the lysine residues of the substrate by irreversible isopeptide bonding. During the elongation of the ubiquitin chain, an active Cys118 residue is required in both parts of UCP, namely, the catalytic enzyme and the substrate. In conclusion, UCP possesses not only E2 ubiquitin conjugating enzyme activity but also E3 ubiquitin ligase activity, and Cys118 is critical for polyubiquitin chain formation. PMID:27685940
Chase, D.M.; Elliott, D.G.; Pascho, R.J.
2006-01-01
Renibacterium salmoninarum is an important salmonid pathogen that is difficult to culture. We developed and assessed a real-time, quantitative, polymerase chain reaction (qPCR) assay for the detection and enumeration of R. salmoninarum. The qPCR is based on TaqMan technology and amplifies a 69-base pair (bp) region of the gene encoding the major soluble antigen (MSA) of R. salmoninarum. The qPCR assay consistently detected as few as 5 R. salmoninarum cells per reaction in kidney tissue. The specificity of the qPCR was confirmed by testing the DNA extracts from a panel of microorganisms that were either common fish pathogens or reported to cause false-positive reactions in the enzyme-linked immunosorbent assay (ELISA). Kidney samples from 38 juvenile Chinook salmon (Oncorhynchus tshawytscha) in a naturally infected population were examined by real-time qPCR, a nested PCR, and ELISA, and prevalences of R. salmoninarum detected were 71, 66, and 71%, respectively. The qPCR should be a valuable tool for evaluating the R. salmoninarum infection status of salmonids.
USDA-ARS?s Scientific Manuscript database
The ubiquitin-proteasome proteolysis pathway is responsible for the degradation of abnormal and short-lived proteins to regulate many important biochemical activities in eukaryotes. By employing affymetrix microarray analysis, we have identified a novel ubiquitin ligase E3 gene GhRING2 that is diffe...
Myers, Margaret D; Sosinowski, Tomasz; Dragone, Leonard L; White, Carmen; Band, Hamid; Gu, Hua; Weiss, Arthur
2006-01-01
The adaptor molecule SLAP and E3 ubiquitin ligase c-Cbl each regulate expression of T cell receptor (TCR)-CD3 on thymocytes. Here we provide genetic and biochemical evidence that both molecules function in the same pathway. TCR-CD3 expression was similar in the absence of SLAP and/or c-Cbl. SLAP and c-Cbl were found to interact, and their expression together downregulated CD3epsilon. This required multiple domains in SLAP and the ring finger of c-Cbl. Furthermore, expression of SLAP and c-Cbl together induced TCRzeta ubiquitination and degradation, preventing the accumulation of fully assembled recycling TCR complexes. These studies indicate that SLAP links the E3 ligase activity of c-Cbl to the TCR, allowing for stage-specific regulation of TCR expression.
Evaluation of Polymerase Chain Reaction for Detecting Coliform Bacteria in Drinking Water Sources
Isfahani, Bahram Nasr; Fazeli, Hossein; Babaie, Zeinab; Poursina, Farkhondeh; Moghim, Sharareh; Rouzbahani, Meisam
2017-01-01
Background: Coliform bacteria are used as indicator organisms for detecting fecal pollution in water. Traditional methods including microbial culture tests in lactose-containing media and enzyme-based tests for the detection of β-galactosidase; however, these methods are time-consuming and less specific. The aim of this study was to evaluate polymerase chain reaction (PCR) for detecting coliform. Materials and Methods: Totally, 100 of water samples from Isfahan drinking water source were collected. Coliform bacteria and Escherichia coli were detected in drinking water using LacZ and LamB genes in PCR method performed in comparison with biochemical tests for all samples. Results: Using phenotyping, 80 coliform isolates were found. The results of the biochemical tests illustrated 78.7% coliform bacteria and 21.2% E. coli. PCR results for LacZ and LamB genes were 67.5% and 17.5%, respectively. Conclusion: The PCR method was shown to be an effective, sensitive, and rapid method for detecting coliform and E. coli in drinking water from the Isfahan drinking water sources. PMID:29142893
Tron, Adriana E; Arai, Takehiro; Duda, David M; Kuwabara, Hiroshi; Olszewski, Jennifer L; Fujiwara, Yuko; Bahamon, Brittany N; Signoretti, Sabina; Schulman, Brenda A; DeCaprio, James A
2012-04-13
Fbw7, a substrate receptor for Cul1-RING-ligase (CRL1), facilitates the ubiquitination and degradation of several proteins, including Cyclin E and c-Myc. In spite of much effort, the mechanisms underlying Fbw7 regulation are mostly unknown. Here, we show that Glomulin (Glmn), a protein found mutated in the vascular disorder glomuvenous malformation (GVM), binds directly to the RING domain of Rbx1 and inhibits its E3 ubiquitin ligase activity. Loss of Glmn in a variety of cells, tissues, and GVM lesions results in decreased levels of Fbw7 and increased levels of Cyclin E and c-Myc. The increased turnover of Fbw7 is dependent on CRL and proteasome activity, indicating that Glmn modulates the E3 activity of CRL1(Fbw7). These data reveal an unexpected functional connection between Glmn and Rbx1 and demonstrate that defective regulation of Fbw7 levels contributes to GVM. Copyright © 2012 Elsevier Inc. All rights reserved.
Tron, Adriana E.; Arai, Takehiro; Duda, David M.; Kuwabara, Hiroshi; Olszewski, Jennifer L.; Fujiwara, Yuko; Bahamon, Brittany N.; Signoretti, Sabina; Schulman, Brenda A.; DeCaprio, James A.
2012-01-01
SUMMARY Fbw7, a substrate receptor for Cul1-RING-ligase (CRL1), facilitates the ubiquitination and degradation of several proteins including Cyclin E and c-Myc. In spite of much effort, the mechanisms underlying Fbw7 regulation are mostly unknown. Here we show that Glomulin (Glmn), a protein found mutated in the vascular disorder Glomuvenous Malformation (GVM), binds directly to the RING domain of Rbx1 and inhibits its E3 ubiquitin ligase activity. Loss of Glmn in a variety of cells, tissues and GVM lesions results in decreased levels of Fbw7 and increased levels of Cyclin E and c-Myc. The increased turnover of Fbw7 is dependent on CRL and proteasome activity indicating that Glmn modulates the E3 activity of CRL1Fbw7. These data reveal an unexpected functional connection between Glmn and Rbx1 and demonstrate that defective regulation of Fbw7 levels contributes to GVM. PMID:22405651
Ivanov, Alexey V; Peng, Hongzhuang; Yurchenko, Vyacheslav; Yap, Kyoko L; Negorev, Dmitri G; Schultz, David C; Psulkowski, Elyse; Fredericks, William J; White, David E; Maul, Gerd G; Sadofsky, Moshe J; Zhou, Ming-Ming; Rauscher, Frank J
2007-12-14
Tandem PHD and bromodomains are often found in chromatin-associated proteins and have been shown to cooperate in gene silencing. Each domain can bind specifically modified histones: the mechanisms of cooperation between these domains are unknown. We show that the PHD domain of the KAP1 corepressor functions as an intramolecular E3 ligase for sumoylation of the adjacent bromodomain. The RING finger-like structure of the PHD domain is required for both Ubc9 binding and sumoylation and directs modification to specific lysine residues in the bromodomain. Sumoylation is required for KAP1-mediated gene silencing and functions by directly recruiting the SETDB1 histone methyltransferase and the CHD3/Mi2 component of the NuRD complex via SUMO-interacting motifs. Sumoylated KAP1 stimulates the histone methyltransferase activity of SETDB1. These data provide a mechanistic explanation for the cooperation of PHD and bromodomains in gene regulation and describe a function of the PHD domain as an intramolecular E3 SUMO ligase.
Bièche, I; Olivi, M; Champème, M H; Vidaud, D; Lidereau, R; Vidaud, M
1998-11-23
Gene amplification is a common event in the progression of human cancers, and amplified oncogenes have been shown to have diagnostic, prognostic and therapeutic relevance. A kinetic quantitative polymerase-chain-reaction (PCR) method, based on fluorescent TaqMan methodology and a new instrument (ABI Prism 7700 Sequence Detection System) capable of measuring fluorescence in real-time, was used to quantify gene amplification in tumor DNA. Reactions are characterized by the point during cycling when PCR amplification is still in the exponential phase, rather than the amount of PCR product accumulated after a fixed number of cycles. None of the reaction components is limited during the exponential phase, meaning that values are highly reproducible in reactions starting with the same copy number. This greatly improves the precision of DNA quantification. Moreover, real-time PCR does not require post-PCR sample handling, thereby preventing potential PCR-product carry-over contamination; it possesses a wide dynamic range of quantification and results in much faster and higher sample throughput. The real-time PCR method, was used to develop and validate a simple and rapid assay for the detection and quantification of the 3 most frequently amplified genes (myc, ccndl and erbB2) in breast tumors. Extra copies of myc, ccndl and erbB2 were observed in 10, 23 and 15%, respectively, of 108 breast-tumor DNA; the largest observed numbers of gene copies were 4.6, 18.6 and 15.1, respectively. These results correlated well with those of Southern blotting. The use of this new semi-automated technique will make molecular analysis of human cancers simpler and more reliable, and should find broad applications in clinical and research settings.
Vasil'eva, G I; Doroshenko, E P; Kiseleva, A K; Pustovalov, V L
1990-12-01
The possibility of using the reaction of macrophage disappearance (RMD) for the detection of delayed hypersensitivity (DH) to Y. pestis has been studied. As the result of these studies, RMD has been found suitable, in principle, for use in the quantitative evaluation of DH to Y. pestis. High sensitivity and specificity of this reaction have been established. The presence of DH in the process of the formation of immunity after immunization with Y. pestis antigen FIA has been shown. RMD can be observed during 28 days after immunization (the term of observation).
Wang, F; Zhang, Y Q; Ding, J; Yu, L X
2017-10-18
To evaluate the ability of multiplex competitive fluorescence polymerase chain reaction in detection of large deletion and duplication genotypes of X-linked Alport syndrome. Clinical diagnosis of X-linked Alport syndrome was based on either abnormal staining of type IV collagen α5 chain in the epidermal basement membrane alone or with abnormal staining of type IV collagen α5 chain in the glomerular basement membrane and Bowman's capsule/ultrastructural changes in the glomerular basement membrane typical of Alport syndrome. A total of 20 unrelated Chinese patients (13 males and 7 females) clinically diagnosed as X-linked Alport syndrome were included in the study. Their genotypes were unknown. Control subjects included a male patient with other renal disease and two patients who had large deletions in COL4A5 gene detected by multiplex ligation-dependent probe amplification. Genomic DNA was isolated from peripheral blood leukocytes in all the participants. Multiplex competitive fluorescence polymerase chain reaction was used to coamplify 53 exons of COL4A5 gene and four reference genes in a single reaction. When a deletion removed exon 1 of COL4A5 gene was identified, the same method was used to coamplify the first 4 exons of COL4A5 and COL4A6 genes, a promoter shared by COL4A5 and COL4A6 genes, and three reference genes in a single reaction. Any copy number loss suggested by this method was verified by electrophoresis of corresponding polymerase chain reaction amplified products or DNA sequencing to exclude possible DNA variations in the primer regions. Genotypes of two positive controls identified by multiplex competitive fluorescence polymerase chain reaction were consistent with those detected by multiplex ligation-dependent probe amplification. Deletions were identified in 6 of the 20 patients, including two large deletions removing the 5' part of both COL4A5 and COL4A6 genes with the breakpoint located in the second intron of COL4A6, two large deletions
Nilsson, G; Wang, M; Wejde, J; Kanter, L; Karlén, J; Tani, E; Kreicbergs, A; Larsson, O
1998-01-01
To evaluate the utilization of fine needle aspiration (FNA) biopsy to obtain material for reverse-transcriptase polymerase chain reaction (RT-PCR) in the detection of the t(X;18)(p11.2;q11.2) translocation in synovial sarcomas. We applied RT-PCR to detection of synovial sarcoma fusion gene transcripts on fine needle aspirates. Five clinical samples were first analyzed: one was a tumor previously diagnosed as malignant hemangiopericytoma, one was a poorly defined tumor, and three were suspected synovial sarcomas. FNA material was transferred directly to the RT-PCR reaction tube without RNA extraction. The t(X;18) translocation could be detected on the limited amount of material that FNA provides. In each of the cases studied the representivity of the tumor samples was confirmed microscopically. Our protocol permits analysis directly on representative samples without extraction of RNA. The results imply that RT-PCR offers reliable detection of sarcoma fusion gene transcripts on fine needle aspirates. The procedure, apart from being applicable to outpatients, is rapid and sensitive.
Liu, Qing; Wang, Qin; Liu, Bin; Wang, Wei; Wang, Xu; Park, Joon; Yang, Zhenming; Du, Xinglin; Bian, Mingdi; Lin, Chentao
2016-10-01
Cryptochromes are blue light receptors regulated by light-dependent ubiquitination and degradation in both plant and animal lineages. The Arabidopsis genome encodes two cryptochromes, CRY1 and CRY2, of which CRY2 undergoes blue light-dependent ubiquitination and 26S proteasome-dependent degradation. The molecular mechanism regulating blue light-dependent proteolysis of CRY2 is still not fully understood. We found that the F-box proteins ZEITLUPE (ZTL) and Lov Kelch Protein2 (LKP2), which mediate blue light suppression of degradation of the CRY2 signaling partner CIB1, are not required for the blue light-dependent CRY2 degradation. We further showed that the previously reported function of the COP1-SPA1 protein complex in blue light-dependent CRY2 degradation is more likely to be attributable to its cullin 4 (CUL4)-based E3 ubiquitin ligase activity than its activity as the cryptochrome signaling partner. However, the blue light-dependent CRY2 degradation is only partially impaired in the cul4 mutant, the cop1-5 null mutant and the spa1234 quadruple mutant, suggesting a possible involvement of additional E3 ubiquitin ligases in the regulation of CRY2. Consistent with this hypothesis, we demonstrated that the blue light-dependent CRY2 degradation is significantly impaired in the temperature-sensitive cul1 mutant allele (axr6-3), especially under the non-permissive temperature. Based on these and other results presented, we propose that photoexcited CRY2 undergoes Lys48-linked polyubiquitination catalyzed by the CUL4- and CUL1-based E3 ubiquitin ligases. © The Author 2016. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Dissecting the function of Cullin-RING ubiquitin ligase complex genes in planarian regeneration.
Strand, Nicholas S; Allen, John M; Ghulam, Mahjoobah; Taylor, Matthew R; Munday, Roma K; Carrillo, Melissa; Movsesyan, Artem; Zayas, Ricardo M
2018-01-15
The ubiquitin system plays a role in nearly every aspect of eukaryotic cell biology. The enzymes responsible for transferring ubiquitin onto specific substrates are the E3 ubiquitin ligases, a large and diverse family of proteins, for which biological roles and target substrates remain largely undefined. Studies using model organisms indicate that ubiquitin signaling mediates key steps in developmental processes and tissue regeneration. Here, we used the freshwater planarian, Schmidtea mediterranea, to investigate the role of Cullin-RING ubiquitin ligase (CRL) complexes in stem cell regulation during regeneration. We identified six S. mediterranea cullin genes, and used RNAi to uncover roles for homologs of Cullin-1, -3 and -4 in planarian regeneration. The cullin-1 RNAi phenotype included defects in blastema formation, organ regeneration, lesions, and lysis. To further investigate the function of cullin-1-mediated cellular processes in planarians, we examined genes encoding the adaptor protein Skp1 and F-box substrate-recognition proteins that are predicted to partner with Cullin-1. RNAi against skp1 resulted in phenotypes similar to cullin-1 RNAi, and an RNAi screen of the F-box genes identified 19 genes that recapitulated aspects of cullin-1 RNAi, including ones that in mammals are involved in stem cell regulation and cancer biology. Our data provides evidence that CRLs play discrete roles in regenerative processes and provide a platform to investigate how CRLs regulate stem cells in vivo. Copyright © 2017 Elsevier Inc. All rights reserved.
Masani, Shahnaz; Han, Li; Meek, Katheryn; Yu, Kefei
2016-02-02
Nonhomologous end-joining (NHEJ) is the major DNA double-strand break (DSB) repair pathway in mammals and resolves the DSBs generated during both V(D)J recombination in developing lymphocytes and class switch recombination (CSR) in antigen-stimulated B cells. In contrast to the absolute requirement for NHEJ to resolve DSBs associated with V(D)J recombination, DSBs associated with CSR can be resolved in NHEJ-deficient cells (albeit at a reduced level) by a poorly defined alternative end-joining (A-EJ) pathway. Deletion of DNA ligase IV (Lig4), a core component of the NHEJ pathway, reduces CSR efficiency in a mouse B-cell line capable of robust cytokine-stimulated CSR in cell culture. Here, we report that CSR levels are not further reduced by deletion of either of the two remaining DNA ligases (Lig1 and nuclear Lig3) in Lig4(-/-) cells. We conclude that in the absence of Lig4, Lig1, and Lig3 function in a redundant manner in resolving switch region DSBs during CSR.
Shi, Hui; Shen, Xing; Liu, Renlu; Xue, Chang; Wei, Ning; Deng, Xing Wang; Zhong, Shangwei
2016-12-05
Plants germinating under subterranean darkness assume skotomorphogenesis, a developmental program strengthened by ethylene in response to mechanical pressure of soil. Upon reaching the surface, light triggers a dramatic developmental transition termed de-etiolation that requires immediate termination of ethylene responses. Here, we report that light activation of photoreceptor phyB results in rapid degradation of EIN3, the master transcription factor in the ethylene signaling pathway. As a result, light rapidly and efficiently represses ethylene actions. Specifically, phyB directly interacts with EIN3 in a light-dependent manner and also physically associates with F box protein EBFs. The light-activated association of phyB, EIN3, and EBF1/EBF2 proteins stimulates robust EIN3 degradation by SCF EBF1/EBF2 E3 ligases. We reveal that phyB manipulates substrate-E3 ligase interactions in a light-dependent manner, thus directly controlling the stability of EIN3. Our findings illustrate a mechanistic model of how plants transduce light information to immediately turn off ethylene signaling for de-etiolation initiation. Copyright © 2016 Elsevier Inc. All rights reserved.
Castro-Hartmann, Pablo; Daban, Joan-Ramon
2004-08-01
The high-energy intermediates generated in the reaction of bis(2,4,6-trichlorophenyl)oxalate (TCPO) with H2O2 can excite electronically different fluorophores with a high quantum yield in organic solvents. We have previously applied this peroxyoxalate chemiluminescent reaction to the detection of proteins labeled with the fluorescent dye 2-methoxy-2,4-diphenyl-3(2H)-furanone (MDPF) on polyvinylidene difluoride (PVDF) membranes. In this work, we have investigated the possibility to enhance the sensitivity of this detection method using specially designed cells in which the reagents TCPO and H2O2 in acetone are continuously renewed. In the flow cell, two syringes are used to renew the reagents in the reaction chamber containing the PVDF membrane with blotted proteins labeled with MDPF. In the evaporation cell, a fresh solution of reagents continuously replaces the volume of acetone evaporated in the reaction chamber. Both cells show a low emission background but the observed elution of proteins from the membrane produced by the flow of reagents in acetone limits the maximum sensitivity attainable with these cells. The best result (detection of 1 ng of MDPF-labeled protein) has been obtained with the evaporation cell. Copyright 2004 Wiley-VCH Verlag GmbH and Co.
Balasubramanian, Sundaravadivel; Mani, Santhoshkumar; Shiraishi, Hirokazu; Johnston, Rebecca K; Yamane, Kentaro; Willey, Christopher D; Cooper, George; Tuxworth, William J; Kuppuswamy, Dhandapani
2006-10-01
Ubiquitin conjugation of proteins is critical for cell homeostasis and contributes to both cell survival and death. Here we studied ubiquitination of proteins in pressure overloaded (PO) myocardium in the context of cardiomyocyte survival. Analysis using a feline right ventricular pressure overload (RVPO) model revealed a robust and transient increase in ubiquitination of proteins present in the Triton X-100-insoluble fraction in 24 to 48 h PO myocardium, and confocal micrographs indicate this increase in ubiquitination occurs subsarcolemmaly near the intercalated disc area of cardiomyocytes. The ubiquitination was accompanied by changes in E3 ligases including Cbl, E6AP, Mdm2 and cIAP in the same period of PO, although atrophy-related E3 ligases, MuRF1 and MuRF3 were unaltered. Furthermore, Cbl displayed a substantial increase in both levels of expression and tyrosine phosphorylation in 48 h PO myocardium. Confocal studies revealed enrichment of Cbl at the intercalated discs of 48 h PO cardiomyocytes, as evidenced by its colocalization with N-cadherin. Although apoptosis was observed in 48 h PO myocardium by TUNEL staining, cardiomyocytes showing ubiquitin staining were not positive for TUNEL staining. Furthermore, 48 h PO resulted in the phosphorylation of inhibitor of nuclear factor kappa B (IkappaB), suggesting its ubiquitin-mediated degradation and the nuclear localization of NFkappaB for the expression of specific cell survival factors such as cIAPs. Together these data indicate that increased levels of E3 ligases that regulate cell homeostasis and promote cell survival could ubiquitinate multiple cytoskeletal protein targets and that these events that occur during the early phase of PO may contribute to both cardiomyocyte survival and hypertrophy.
NASA Astrophysics Data System (ADS)
Pan, Yue; Zhang, Qiangling; Zhou, Wenzhao; Zou, Xue; Wang, Hongmei; Huang, Chaoqun; Shen, Chengyin; Chu, Yannan
2017-05-01
Proton transfer reaction mass spectrometry (PTR-MS) has played an important role in the field of real-time monitoring of trace volatile organic compounds (VOCs) due to its advantages such as low limit of detection (LOD) and fast time response. Recently, a new technology of proton extraction reaction mass spectrometry (PER-MS) with negative ions OH- as the reagent ions has also been presented, which can be applied to the detection of VOCs and even inorganic compounds. In this work, we combined the functions of PTR-MS and PER-MS in one instrument, thereby developing a novel technology called dipolar proton transfer reaction mass spectrometry (DP-PTR-MS). The selection of PTR-MS mode and PER-MS mode was achieved in DP-PTR-MS using only water vapor in the ion source and switching the polarity. In this experiment, ketones (denoted by M) were selected as analytes. The ketone (molecular weight denoted by m) was ionized as protonated ketone [M + H]+ [mass-to-charge ratio ( m/z) m + 1] in PTR-MS mode and deprotonated ketone [M - H]- ( m/z m - 1) in PER-MS mode. By comparing the m/z value of the product ions in the two modes, the molecular weight of the ketone can be positively identified as m. Results showed that whether it is a single ketone sample or a mixed sample of eight kinds of ketones, the molecular weights can be detected with DP-PTR-MS. The newly developed DP-PTR-MS not only maintains the original advantages of PTR-MS and PER-MS in sensitive and rapid detection of ketones, but also can estimate molecular weight of ketones.
Siqueira, José F; Rôças, Isabela N
2003-08-01
Propionibacterium propionicus and the recently described species Actinomyces radicidentis have been isolated from infections of endodontic origin; nevertheless, the possibility exists that their actual prevalence may have been underestimated by culture. The purpose of our study was to assess the occurrence of these 2 species in different types of endodontic infections by using the sensitive 16S rDNA-based nested polymerase chain reaction approach. To detect these 2 species, nested polymerase chain reaction was performed directly in samples taken from primary endodontic infections associated with asymptomatic periradicular lesions, acute apical periodontitis, or acute periradicular abscesses and in samples from patients in whom endodontic therapy had failed. DNA was extracted from the samples and initially amplified by using universal 16S rDNA primers. In the second round of amplification, the first polymerase chain reaction products were used to detect a specific 16S rDNA fragment of either P propionicus or A radicidentis. P propionicus was detected in 6/21 (29%) root canal samples from teeth with chronic periradicular lesions, in 5/10 (50%) cases diagnosed as acute apical periodontitis, and in 7/19 (37%) pus samples aspirated from acute periradicular abscesses. Overall, this species was found in 18/50 (36%) samples taken from primary endodontic infections. Of the root canal samples obtained from root-filled teeth with chronic periradicular lesions, P propionicus was detected in 7/12 (58%) cases. A radicidentis was detected in 1/21 (5%) root canal samples from teeth with chronic periradicular lesions and in 1/10 (10%) cases of acute apical periodontitis. No pus sample yielded this species. In general, A radicidentis was detected in 2/50 (4%) samples taken from primary endodontic infections and in 1/12 (8%) root canal samples taken from patients in whom endodontic treatment had failed. P propionicus was found in a relatively large number of patients with primary and
Shah, Meera; Stebbins, John L.; Dewing, Antimone; Qi, Jianfei; Pellecchia, Maurizio; Ronai, Ze’ev A.
2010-01-01
Summary The E3 ubiquitin ligase Siah2 has been implicated in the regulation of the hypoxia response, as well as in the control of Ras, JNK/p38/NF-κB signaling pathways. Both Ras/mitogen-activated protein kinase (MAPK) and hypoxia pathways are important for melanoma development and progression, pointing to the possible use of Siah2 as target for treatment of this tumor type. In the present study, we have established a high-throughput electro-chemiluninescent-based assay in order to screen and identify inhibitors of Siah2 ubiquitin ligase activity. Of 1840 compounds screened, we identified and characterized menadione (MEN) as a specific inhibitor of Siah2 ligase activity. MEN attenuated Siah2 self-ubiquitination, and increased expression of its substrates PHD3 and Sprouty2, with concomitant decrease in levels of HIF-1α and pERK, the respective downstream effectors. MEN treatment no longer affected PHD3 or Sprouty2 in Siah-KO cells, pointing to its Siah-dependent effects. Further, MEN inhibition of Siah2 was not attenuated by free radical scavenger, suggesting it is ROS-independent. Significantly, growth of xenograft melanoma tumors was inhibited following the administration of MEN or its derivative. These findings reveal an efficient platform for the identification of Siah inhibitors while identifying and characterizing MEN as Siah inhibitor that attenuates hypoxia and MAPK signaling, and inhibits melanoma tumorigenesis. PMID:19712206
A C2HC zinc finger is essential for the RING-E2 interaction of the ubiquitin ligase RNF125
Bijlmakers, Marie-José; Teixeira, João M. C.; Boer, Roeland; Mayzel, Maxim; Puig-Sàrries, Pilar; Karlsson, Göran; Coll, Miquel; Pons, Miquel; Crosas, Bernat
2016-01-01
The activity of RING ubiquitin ligases (E3s) depends on an interaction between the RING domain and ubiquitin conjugating enzymes (E2), but posttranslational events or additional structural elements, yet largely undefined, are frequently required to enhance or regulate activity. Here, we show for the ubiquitin ligase RNF125 that, in addition to the RING domain, a C2HC Zn finger (ZnF) is crucial for activity, and a short linker sequence (Li2120-128) enhances activity. The contribution of these regions was first shown with truncated proteins, and the essential role of the ZnF was confirmed with mutations at the Zn chelating Cys residues. Using NMR, we established that the C2HC ZnF/Li2120-128 region is crucial for binding of the RING domain to the E2 UbcH5a. The partial X-ray structure of RNF125 revealed the presence of extensive intramolecular interactions between the RING and C2HC ZnF. A mutation at one of the contact residues in the C2HC ZnF, a highly conserved M112, resulted in the loss of ubiquitin ligase activity. Thus, we identified the structural basis for an essential role of the C2HC ZnF and conclude that this domain stabilizes the RING domain, and is therefore required for binding of RNF125 to an E2. PMID:27411375
Jiang, Lu-Yi; Jiang, Wei; Tian, Na; Xiong, Yan-Ni; Liu, Jie; Wei, Jian; Wu, Kai-Yue; Luo, Jie; Shi, Xiong-Jie; Song, Bao-Liang
2018-03-16
Cholesterol biosynthesis is tightly regulated in the cell. For example, high sterol concentrations can stimulate degradation of the rate-limiting cholesterol biosynthetic enzyme 3-hydroxy-3-methylglutaryl-coenzyme A reductase (HMG-CoA reductase, HMGCR). HMGCR is broken down by the endoplasmic reticulum membrane-associated protein complexes consisting of insulin-induced genes (Insigs) and the E3 ubiquitin ligase gp78. Here we found that HMGCR degradation is partially blunted in Chinese hamster ovary (CHO) cells lacking gp78 ( gp78 -KO). To identify other ubiquitin ligase(s) that may function together with gp78 in triggering HMGCR degradation, we performed a small-scale short hairpin RNA-based screening targeting endoplasmic reticulum-localized E3s. We found that knockdown of both ring finger protein 145 ( Rnf145 ) and gp78 genes abrogates sterol-induced degradation of HMGCR in CHO cells. We also observed that RNF145 interacts with Insig-1 and -2 proteins and ubiquitinates HMGCR. Moreover, the tetrapeptide sequence YLYF in the sterol-sensing domain and the Cys-537 residue in the RING finger domain were essential for RNF145 binding to Insigs and RNF145 E3 activity, respectively. Of note, amino acid substitutions in the YLYF or of Cys-537 completely abolished RNF145-mediated HMGCR degradation. In summary, our study reveals that RNF145, along with gp78, promotes HMGCR degradation in response to elevated sterol levels and identifies residues essential for RNF145 function. © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Recognition mechanism of p63 by the E3 ligase Itch
Bellomaria, Alessia; Barbato, Gaetano; Melino, Gerry; Paci, Maurizio; Melino, Sonia
2012-01-01
The HECT-containing E3 ubiquitin ligase Itch mediates the degradation of several proteins, including p63 and p73, involved in cell specification and fate. Itch contains four WW domains, which are essential for recognition on the target substrate, which contains a short proline-rich sequence. Several signaling complexes containing these domains have been associated with human diseases such as muscular dystrophy, Alzheimer’s or Huntington’s diseases. To gain further insight into the structural determinants of the Itch-WW2 domain, we investigated its interaction with p63. We assigned, by 3D heteronuclear NMR experiments, the backbone and side chains of the uniformly ¹³C-¹⁵N-labeled Itch-WW2. In vitro interaction of Itch-WW2 domain with p63 was studied using its interactive p63 peptide, pep63. Pep63 is an 18-mer peptide corresponding to the region from 534–551 residue of p63, encompassing the PPxY motif that interacts with the Itch-WW domains, and we identified the residues involved in this molecular recognition. Moreover, here, a strategy of stabilization of the conformation of the PPxY peptide has been adopted, increasing the WW-ligand binding. We demonstrated that cyclization of pep63 leads to an increase of both the biological stability of the peptide and of the WW-ligand complex. Stable metal-binding complexes of the pep63 have been also obtained, and localized oxidative damage on Itch-WW2 domain has been induced, demonstrating the possibility of use of metal-pep63 complexes as models for the design of metal drugs to inhibit the Itch-WW-p63 recognition in vivo. Thus, our data suggest a novel strategy to study and inhibit the recognition mechanism of Itch E3-ligase. PMID:22935697
Smurf E3 ubiquitin ligases at the cross roads of oncogenesis and tumor suppression.
David, Diana; Nair, S Asha; Pillai, M Radhakrishna
2013-01-01
Smad ubiquitin regulatory factors (Smurfs) belong to the HECT- family of E3 ubiquitin ligases and comprise mainly of two members, Smurf1 and Smurf2. Initially, Smurfs have been implicated in determining the competence of cells to respond to TGF-β/BMP signaling pathway. Nevertheless, the intrinsic catalytic activity has extended the repertoire of Smurf substrates beyond the TGF-β/BMP super family expanding its realm further to epigenetic modifications of histones governing the chromatin landscape. Through regulation of a large number of proteins in multiple cellular compartments, Smurfs regulate diverse cellular processes, including cell-cycle progression, cell proliferation, differentiation, DNA damage response, maintenance of genomic stability, and metastasis. As the genomic ablation of Smurfs leads to global changes in histone modifications and predisposition to a wide spectrum of tumors, Smurfs are also considered to have a novel tumor suppressor function. This review focuses on regulation network and biological functions of Smurfs in connection with its role in cancer progression. By providing a portrait of their protein targets, we intend to link the substrate specificity of Smurfs with their contribution to tumorigenesis. Since the regulation and biological functions of Smurfs are quite complex, understanding the oncogenic potential of these E3 ubiquitin ligases may facilitate the development of mechanism-based drugs in cancer treatment. Copyright © 2012 Elsevier B.V. All rights reserved.
Yan, Hua; Jahanshahi, Maryam; Horvath, Elizabeth A; Liu, Hsiu-Yu; Pfleger, Cathie M
2010-08-10
The Ras signaling pathway allows cells to translate external cues into diverse biological responses. Depending on context and the threshold reached, Ras signaling can promote growth, proliferation, differentiation, or cell survival. Failure to maintain precise control of Ras can have adverse physiological consequences. Indeed, excess Ras signaling disrupts developmental patterning and causes developmental disorders [1, 2], and in mature tissues, it can lead to cancer [3-5]. We identify Rabex-5 as a new component of Ras signaling crucial for achieving proper pathway outputs in multiple contexts in vivo. We show that Drosophila Rabex-5 restricts Ras signaling to establish organism size, wing vein pattern, and eye versus antennal fate. Rabex-5 has both Rab5 guanine nucleotide exchange factor (GEF) activity that regulates endocytic trafficking [6] and ubiquitin ligase activity [7, 8]. Surprisingly, overexpression studies demonstrate that Rabex-5 ubiquitin ligase activity, not its Rab5 GEF activity, is required to restrict wing vein specification and to suppress the eye phenotypes of oncogenic Ras expression. Furthermore, genetic interaction experiments indicate that Rabex-5 acts at the step of Ras, and tissue culture studies show that Rabex-5 promotes Ras ubiquitination. Together, these findings reveal a new mechanism for attenuating Ras signaling in vivo and suggest an important role for Rabex-5-mediated Ras ubiquitination in pathway homeostasis. Copyright (c) 2010 Elsevier Ltd. All rights reserved.
Tang, Fei; Wang, Bin; Li, Na; Wu, Yanfang; Jia, Junying; Suo, Talin; Chen, Quan; Liu, Yong-Jun; Tang, Jie
2011-01-01
Autophagy is an evolutionarily conserved catabolic process that allows recycling of cytoplasmic organelles, such as mitochondria, to offer a bioenergetically efficient pathway for cell survival. Considerable progress has been made in characterizing mitochondrial autophagy. However, the dedicated ubiquitin E3 ligases targeting mitochondria for autophagy have not been revealed. Here we show that human RNF185 is a mitochondrial ubiquitin E3 ligase that regulates selective mitochondrial autophagy in cultured cells. The two C-terminal transmembrane domains of human RNF185 mediate its localization to mitochondrial outer membrane. RNF185 stimulates LC3II accumulation and the formation of autophagolysosomes in human cell lines. We further identified the Bcl-2 family protein BNIP1 as one of the substrates for RNF185. Human BNIP1 colocalizes with RNF185 at mitochondria and is polyubiquitinated by RNF185 through K63-based ubiquitin linkage in vivo. The polyubiquitinated BNIP1 is capable of recruiting autophagy receptor p62, which simultaneously binds both ubiquitin and LC3 to link ubiquitination and autophagy. Our study might reveal a novel RNF185-mediated mechanism for modulating mitochondrial homeostasis through autophagy. PMID:21931693
Bi, Sai; Zhang, Zhipeng; Dong, Ying; Wang, Zonghua
2015-03-15
A novel ligation chain reaction (LCR) methodology for single-nucleotide polymorphism (SNP) detection was developed based on luminol-H2O2-horseradish peroxidase (HRP)-mimicking DNAzyme-fluorescein chemiluminescence resonance energy transfer (CRET) imaging on magnetic particles. For LCR, four unique target-complement probes (X and X(⁎), YG and Y(⁎)) for the amplification of K-ras (G12C) were designed by modifying G-quadruplex sequence at 3'-end of YG and fluorescein at 5'-end of Y(⁎). After the LCR, the resulting products of XYG/X(⁎)Y(⁎) with biotin-labeled X(⁎) were captured onto streptavidin-coated magnetic particles (SA-MPs) via specific biotin-SA interaction, which stimulated the CRET reaction from hemin/G-quadruplex-catalyzed luminol-H2O2 CL system to fluorescein. By collecting signals by a cooled low-light CCD, a CRET imaging method was proposed for visual detection and quantitative analysis of SNP. As low as 0.86fM mutant DNA was detected by this assay, and positive mutation detection was achieved with a wild-type to mutant ratio of 10,000:1. This high sensitivity and specificity could be attributed to not only the exponential amplification and excellent discrimination of LCR but also the employment of SA-MPs. SA-MPs ensured the feasibility of the proposed strategy, which also simplified the operations through magnetic separation and separated the reaction and detection procedures to improve sensitivity. The proposed LCR-CRET imaging strategy extends the application of signal amplification techniques to SNP detection, providing a promising platform for effective and high-throughput genetic diagnosis. Copyright © 2014 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Soorkia, Satchin; Taatjes, Craig A.; Osborn, David L.
The reaction of the ground state methylidyne radical CH (X2Pi) with pyrrole (C4H5N) has been studied in a slow flow tube reactor using Multiplexed Photoionization Mass Spectrometry coupled to quasi-continuous tunable VUV synchrotron radiation at room temperature (295 K) and 90 oC (363 K), at 4 Torr (533 Pa). Laser photolysis of bromoform (CHBr3) at 248 nm (KrF excimer laser) is used to produce CH radicals that are free to react with pyrrole molecules in the gaseous mixture. A signal at m/z = 79 (C5H5N) is identified as the product of the reaction and resolved from 79Br atoms, and themore » result is consistent with CH addition to pyrrole followed by Helimination. The Photoionization Efficiency curve unambiguously identifies m/z = 79 as pyridine. With deuterated methylidyne radicals (CD), the product mass peak is shifted by +1 mass unit, consistent with the formation of C5H4DN and identified as deuterated pyridine (dpyridine). Within detection limits, there is no evidence that the addition intermediate complex undergoes hydrogen scrambling. The results are consistent with a reaction mechanism that proceeds via the direct CH (CD) cycloaddition or insertion into the five-member pyrrole ring, giving rise to ring expansion, followed by H atom elimination from the nitrogen atom in the intermediate to form the resonance stabilized pyridine (d-pyridine) molecule. Implications to interstellar chemistry and planetary atmospheres, in particular Titan, as well as in gas-phase combustion processes, are discussed.« less
The Ubiquitin Ligase Nedd4-1 Participates in Denervation-Induced Skeletal Muscle Atrophy in Mice
Nagpal, Preena; Plant, Pamela J.; Correa, Judy; Bain, Alexandra; Takeda, Michiko; Kawabe, Hiroshi; Rotin, Daniela; Bain, James R.; Batt, Jane A. E.
2012-01-01
Skeletal muscle atrophy is a consequence of muscle inactivity resulting from denervation, unloading and immobility. It accompanies many chronic disease states and also occurs as a pathophysiologic consequence of normal aging. In all these conditions, ubiquitin-dependent proteolysis is a key regulator of the loss of muscle mass, and ubiquitin ligases confer specificity to this process by interacting with, and linking ubiquitin moieties to target substrates through protein∶protein interaction domains. Our previous work suggested that the ubiquitin-protein ligase Nedd4-1 is a potential mediator of skeletal muscle atrophy associated with inactivity (denervation, unloading and immobility). Here we generated a novel tool, the Nedd4-1 skeletal muscle-specific knockout mouse (myoCre;Nedd4-1flox/flox) and subjected it to a well validated model of denervation induced skeletal muscle atrophy. The absence of Nedd4-1 resulted in increased weights and cross-sectional area of type II fast twitch fibres of denervated gastrocnemius muscle compared with wild type littermates controls, at seven and fourteen days following tibial nerve transection. These effects are not mediated by the Nedd4-1 substrates MTMR4, FGFR1 and Notch-1. These results demonstrate that Nedd4-1 plays an important role in mediating denervation-induced skeletal muscle atrophy in vivo. PMID:23110050
Viviani, V R; Prado, R A; Neves, D R; Kato, D; Barbosa, J A
2013-06-11
The origin of luciferases and of bioluminescence is enigmatic. In beetles, luciferases seem to have evolved from AMP-CoA-ligases. How the new oxygenase luminogenic function originated from AMP-ligases leading to luciferases is one of the most challenging mysteries of bioluminescence. Comparison of the cloned luciferase-like enzyme from the nonluminescent Zophobas morio mealworm and beetle luciferases showed that the oxygenase activity may have emerged as a stereoselective oxidative drift with d-luciferin, a substrate that cannot be easily thioesterified to CoA as in the case of the l-isomer. While the overall kcat displayed by beetle luciferases is orders of magnitude greater than that of the luciferase-like enzyme, the respective oxidation rates and quantum yields of bioluminescence are roughly similar, suggesting that the rate constant of the AMP-ligase activity exerted on the new d-luciferin substrate in beetle protoluciferases was the main enzymatic property that suffered optimization during the evolution of luciferases. The luciferase-like enzyme and luciferases boost the rate of luciferyl-adenylate chemiluminescent oxidation by factors of 10(6) and 10(7), respectively, as compared to the substrate spontaneous oxidation in buffer. A similar enhancement of luciferyl-adenylate chemiluminescence is provided by nucleophilic aprotic solvents, implying that the peptide bonds in the luciferin binding site of beetle luciferase could provide a similar catalytically favorable environment. These data suggest that the luciferase-like enzyme and other similar AMP-ligases are potential alternative oxygenases. Site-directed mutagenesis studies of the luciferase-like enzyme and the red light-producing luciferase of Phrixotrix hirtus railroadworm confirm here a critical role for T/S345 in luciferase function. Mutations such as I327T/S in the luciferase-like enzyme, which simultaneously increases luciferase activity and promotes blue shifts in the emission spectrum, could have
Franzini, Raphael M.
2015-01-01
We report a new strategy for template-mediated fluorogenic chemistry that results in enhanced performance for the fluorescence detection of nucleic acids. In this approach, two successive templated reactions are required to induce a fluorescence signal, rather than only one. These novel fluorescein-labeled oligonucleotide probes, termed 2-STAR probes, contain two quencher groups tethered by separate reductively cleavable linkers. When a 2-STAR quenched probe binds adjacent to either two successive mono triphenyl-phosphine (TPP)-DNAs or a dual TPP-DNA, the two quenchers are released, resulting in a fluorescence signal. Because of the requirement for two consecutive reactions, 2-STAR probes display an unprecedented level of sequence-specificity for template-mediated probe designs. At the same time, background emission generated by off-template reactions or incomplete quenching is among the lowest of any fluorogenic reactive probes for the detection of DNA or RNA. PMID:21294182
Azeman, Nur Hidayah; Yusof, Nor Azah; Abdullah, Jaafar; Yunus, Robiah; Hamidon, Mohd Nizar; Hajian, Reza
2015-07-07
In this paper, a comprehensive study has been made on the detection of free fatty acids (FFAs) in palm oil via an optical technique based on enzymatic aminolysis reactions. FFAs in crude palm oil (CPO) were converted into fatty hydroxamic acids (FHAs) in a biphasic lipid/aqueous medium in the presence of immobilized lipase. The colored compound formed after complexation between FHA and vanadium (V) ion solution was proportional to the FFA content in the CPO samples and was analyzed using a spectrophotometric method. In order to develop a rapid detection system, the parameters involved in the aminolysis process were studied. The utilization of immobilized lipase as catalyst during the aminolysis process offers simplicity in the product isolation and the possibility of conducting the process under extreme reaction conditions. A good agreement was found between the developed method using immobilized Thermomyces lanuginose lipase as catalyst for the aminolysis process and the Malaysian Palm Oil Board (MPOB) standard titration method (R2 = 0.9453).
Oberg, Elizabeth A.; Nifoussi, Shanna K.; Gingras, Anne-Claude; Strack, Stefan
2012-01-01
Protein phosphatase 2A (PP2A), a ubiquitous and pleiotropic regulator of intracellular signaling, is composed of a core dimer (AC) bound to a variable (B) regulatory subunit. PP2A is an enzyme family of dozens of heterotrimers with different subcellular locations and cellular substrates dictated by the B subunit. B′β is a brain-specific PP2A regulatory subunit that mediates dephosphorylation of Ca2+/calmodulin-dependent protein kinase II and tyrosine hydroxylase. Unbiased proteomic screens for B′β interactors identified Cullin3 (Cul3), a scaffolding component of E3 ubiquitin ligase complexes, and the previously uncharacterized Kelch-like 15 (KLHL15). KLHL15 is one of ∼40 Kelch-like proteins, many of which have been identified as adaptors for the recruitment of substrates to Cul3-based E3 ubiquitin ligases. Here, we report that KLHL15-Cul3 specifically targets B′β to promote turnover of the PP2A subunit by ubiquitylation and proteasomal degradation. Comparison of KLHL15 and B′β tissue expression profiles suggests that the E3 ligase adaptor contributes to selective expression of the PP2A/B′β holoenzyme in the brain. We mapped KLHL15 residues critical for homodimerization as well as interaction with Cul3 and B′β. Explaining PP2A subunit selectivity, the divergent N terminus of B′β was found necessary and sufficient for KLHL15-mediated degradation, with Tyr-52 having an obligatory role. Although KLHL15 can interact with the PP2A/B′β heterotrimer, it only degrades B′β, thus promoting exchange with other regulatory subunits. E3 ligase adaptor-mediated control of PP2A holoenzyme composition thereby adds another layer of regulation to cellular dephosphorylation events. PMID:23135275
Zhu, Yanfei; Li, Yingbo; Fei, Fei; Wang, Zongkuan; Wang, Wei; Cao, Aizhong; Liu, Yuan; Han, Shuang; Xing, Liping; Wang, Haiyan; Chen, Wei; Tang, Sanyuan; Huang, Xiahe; Shen, Qianhua; Xie, Qi; Wang, Xiue
2015-10-01
Powdery mildew is one of the most devastating wheat fungal diseases. A diploid wheat relative, Haynaldia villosa L., is highly resistant to powdery mildew, and its genetic resource of resistances, such as the Pm21 locus, is now widely used in wheat breeding. Here we report the cloning of a resistance gene from H. villosa, designated CMPG1-V, that encodes a U-box E3 ubiquitin ligase. Expression of the CMPG1-V gene was induced in the leaf and stem of H. villosa upon inoculation with Blumeria graminis f. sp. tritici (Bgt) fungus, and the presence of Pm21 is essential for its rapid induction of expression. CMPG1-V has conserved key residues for E3 ligase, and possesses E3 ligase activity in vitro and in vivo. CMPG1-V is localized in the nucleus, endoplasmic reticulum, plasma membrane and partially in trans-Golgi network/early endosome vesicles. Transgenic wheat over-expressing CMPG1-V showed improved broad-spectrum powdery mildew resistance at seedling and adult stages, associated with an increase in expression of salicylic acid-responsive genes, H2 O2 accumulation, and cell-wall protein cross-linking at the Bgt infection sites, and the expression of CMPG1-V in H. villosa was increased when treated with salicylic acid, abscisic acid and H2 O2 . These results indicate the involvement of E3 ligase in defense responses to Bgt fungus in wheat, particularly in broad-spectrum disease resistance, and suggest association of reactive oxidative species and the phytohormone pathway with CMPG1-V-mediated powdery mildew resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.
Sumi, Ryosuke; Miyake, Ariko; Endo, Taiji; Ohsato, Yoshiharu; Ngo, Minh Ha; Nishigaki, Kazuo
2018-04-01
Feline lymphomas are associated with the transduction and activation of cellular proto-oncogenes, such as c-myc, by feline leukemia virus (FeLV). We describe a polymerase chain reaction assay for detection of myc transduction usable in clinical diagnosis. The assay targets c-myc exons 2 and 3, which together result in a FeLV-specific fusion gene following c-myc transduction. When this assay was conducted on FeLV-infected feline tissues submitted for clinical diagnosis of tumors, myc transduction was detected in 14% of T-cell lymphoma/leukemias. This newly established system could become a useful diagnostic tool in veterinary medicine.
Di Fiore, F; Blanchard, F; Charbonnier, F; Le Pessot, F; Lamy, A; Galais, M P; Bastit, L; Killian, A; Sesboüé, R; Tuech, J J; Queuniet, A M; Paillot, B; Sabourin, J C; Michot, F; Michel, P; Frebourg, T
2007-01-01
The predictive value of KRAS mutation in metastatic colorectal cancer (MCRC) patients treated with cetuximab plus chemotherapy has recently been suggested. In our study, 59 patients with a chemotherapy-refractory MCRC treated with cetuximab plus chemotherapy were included and clinical response was evaluated according to response evaluation criteria in solid tumours (RECIST). Tumours were screened for KRAS mutations using first direct sequencing, then two sensitive methods based on SNaPshot and PCR-ligase chain reaction (LCR) assays. Clinical response was evaluated according to gene mutations using the Fisher exact test. Times to progression (TTP) were calculated using the Kaplan–Meier method and compared with log-rank test. A KRAS mutation was detected in 22 out of 59 tumours and, in six cases, was missed by sequencing analysis but detected using the SNaPshot and PCR-LCR assays. Remarkably, no KRAS mutation was found in the 12 patients with clinical response. KRAS mutation was associated with disease progression (P=0.0005) and TTP was significantly decreased in mutated KRAS patients (3 vs 5.5 months, P=0.015). Our study confirms that KRAS mutation is highly predictive of a non-response to cetuximab plus chemotherapy in MCRC and highlights the need to use sensitive molecular methods, such as SNaPshot or PCR-LCR assays, to ensure an efficient mutation detection. PMID:17375050
Mahapatra, Sebabrata; Crick, Dean C.; Brennan, Patrick J.
2000-01-01
In the peptidoglycan of Mycobacterium leprae, l-alanine of the side chain is replaced by glycine. When expressed in Escherichia coli, MurC (UDP-N-acetyl-muramate:l-alanine ligase) of M. leprae showed Km and Vmax for l-alanine and glycine similar to those of Mycobacterium tuberculosis MurC, suggesting that another explanation should be sought for the presence of glycine. PMID:11073931
Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios
2011-01-19
Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food.
Bluhm, B H; Flaherty, J E; Cousin, M A; Woloshuk, C P
2002-12-01
The genus Fusarium comprises a diverse group of fungi including several species that produce mycotoxins in food commodities. In this study, a multiplex polymerase chain reaction (PCR) assay was developed for the group-specific detection of fumonisin-producing and trichothecene-producing species of Fusarium. Primers for genus-level recognition of Fusarium spp. were designed from the internal transcribed spacer regions (ITS1 and ITS2) of rDNA. Primers for group-specific detection were designed from the TRI6 gene involved in trichothecene biosynthesis and the FUM5 gene involved in fumonisin biosynthesis. Primer specificity was determined by testing for cross-reactivity against purified genomic DNA from 43 fungal species representing 14 genera, including 9 Aspergillus spp., 9 Fusarium spp., and 10 Penicillium spp. With purified genomic DNA as a template, genus-specific recognition was observed at 10 pg per reaction; group-specific recognition occurred at 100 pg of template per reaction for the trichothecene producer Fusarium graminearum and at 1 ng of template per reaction for the fumonisin producer Fusarium verticillioides. For the application of the PCR assay, a protocol was developed to isolate fungal DNA from cornmeal. The detection of F. graminearum and its differentiation from F. verticillioides were accomplished prior to visible fungal growth at <10(5) CFU/g of cornmeal. This level of detection is comparable to those of other methods such as enzyme-linked immunosorbent assay, and the assay described here can be used in the food industry's effort to monitor quality and safety.
Polymerase chain reaction for detection of Leptospira spp. in clinical samples.
Mérien, F; Amouriaux, P; Perolat, P; Baranton, G; Saint Girons, I
1992-01-01
A sensitive assay for Leptospira spp., the causative agent of leptospirosis, was developed on the basis of the polymerase chain reaction (PCR). A 331-bp sequence from the Leptospira interrogans serovar canicola rrs (16S) gene was amplified, and the PCR products were analyzed by DNA-DNA hybridization by using a 289-bp fragment internal to the amplified DNA. Specific PCR products also were obtained with DNA from the closely related nonpathogenic Leptospira biflexa but not with DNA from other spirochetes, such as Borrelia burgdorferi, Borrelia hermsii, Treponema denticola, Treponema pallidum, Spirochaeta aurantia, or more distant organisms such as Escherichia coli, Staphylococcus aureus, Mycobacterium tuberculosis, and Proteus mirabilis. The assay was able to detect as few as 10 bacteria. Leptospira DNA was detected in urine from experimentally infected mice. In addition, the test was found to be suitable for diagnosing leptospirosis in humans. Cerebrospinal fluid and urine from patients with leptospirosis were positive, whereas samples from control uninfected patients were negative. Images PMID:1400983
Wu, Jie; Zhao, Fang; Xia, Liangyu; Cheng, Xinqi; Liu, Qian; Liu, Li; Xu, Ermu; Qiu, Ling
2018-01-01
Previously, we reported the strong negative interference of calcium dobesilate, a vasoprotective agent, in creatinine assays involving the Trinder reaction. It is hypothesized that a similar effect occurs in the detection of uric acid (UA), total cholesterol (TC), triglycerides (TG), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C). The interferences of calcium dobesilate during the detection of the five serum analytes were investigated on automated systems/analysers, and the effects were compared among eight different assay systems for each analyte. A calcium dobesilate standard was added into two sets of the blank serum pools of each analyte at final concentrations of 0, 2, 4, 8, 16, 32, and 64 μg/mL. The percentage deviation of each analyte value was calculated between each drug concentration and the drug-free samples. The clinically acceptable error levels for UA, TC, TG, HDL-C, and LDL-C were defined as ±4.87%, ±4.1%, ±9.57%, ±5.61%, and ±5.46%, respectively. The observed interference was concentration dependent for each analyte. In the presence of 16 μg/mL calcium dobesilate, which was within the therapeutic range, all seven Trinder reaction-based UA assay systems, two TG assay systems, two HDL-C assay systems and one TC assay system exhibited negative drug interferences. Calcium dobesilate negatively interferes with the detection of UA, TG, TC, and HDL-C in assay systems based on the Trinder reaction. The effect was most significant in UA and TG detection. PMID:29432460
A web-based quantitative signal detection system on adverse drug reaction in China.
Li, Chanjuan; Xia, Jielai; Deng, Jianxiong; Chen, Wenge; Wang, Suzhen; Jiang, Jing; Chen, Guanquan
2009-07-01
To establish a web-based quantitative signal detection system for adverse drug reactions (ADRs) based on spontaneous reporting to the Guangdong province drug-monitoring database in China. Using Microsoft Visual Basic and Active Server Pages programming languages and SQL Server 2000, a web-based system with three software modules was programmed to perform data preparation and association detection, and to generate reports. Information component (IC), the internationally recognized measure of disproportionality for quantitative signal detection, was integrated into the system, and its capacity for signal detection was tested with ADR reports collected from 1 January 2002 to 30 June 2007 in Guangdong. A total of 2,496 associations including known signals were mined from the test database. Signals (e.g., cefradine-induced hematuria) were found early by using the IC analysis. In addition, 291 drug-ADR associations were alerted for the first time in the second quarter of 2007. The system can be used for the detection of significant associations from the Guangdong drug-monitoring database and could be an extremely useful adjunct to the expert assessment of very large numbers of spontaneously reported ADRs for the first time in China.
Bruemmer, Kevin J; Merrikhihaghi, Sara; Lollar, Christina T; Morris, Siti Nur Sarah; Bauer, Johannes H; Lippert, Alexander R
2014-10-21
We report a newly discovered oxidative decarbonylation reaction of isatins that is selectively mediated by peroxynitrite (ONOO(-)) to provide anthranilic acid derivatives. We have harnessed this rapid and selective transformation to develop two reaction-based probes, 5-fluoroisatin and 6-fluoroisatin, for the low-background readout of ONOO(-) using (19)F magnetic resonance spectroscopy. 5-fluoroisatin was used to non-invasively detect ONOO(-) formation in living lung epithelial cells stimulated with interferon-γ (IFN-γ).
Mudgil, Yashwanti; Shiu, Shin-Han; Stone, Sophia L.; Salt, Jennifer N.; Goring, Daphne R.
2004-01-01
The Arabidopsis genome was searched to identify predicted proteins containing armadillo (ARM) repeats, a motif known to mediate protein-protein interactions in a number of different animal proteins. Using domain database predictions and models generated in this study, 108 Arabidopsis proteins were identified that contained a minimum of two ARM repeats with the majority of proteins containing four to eight ARM repeats. Clustering analysis showed that the 108 predicted Arabidopsis ARM repeat proteins could be divided into multiple groups with wide differences in their domain compositions and organizations. Interestingly, 41 of the 108 Arabidopsis ARM repeat proteins contained a U-box, a motif present in a family of E3 ligases, and these proteins represented the largest class of Arabidopsis ARM repeat proteins. In 14 of these U-box/ARM repeat proteins, there was also a novel conserved domain identified in the N-terminal region. Based on the phylogenetic tree, representative U-box/ARM repeat proteins were selected for further study. RNA-blot analyses revealed that these U-box/ARM proteins are expressed in a variety of tissues in Arabidopsis. In addition, the selected U-box/ARM proteins were found to be functional E3 ubiquitin ligases. Thus, these U-box/ARM proteins represent a new family of E3 ligases in Arabidopsis. PMID:14657406
Li, Zhen; Zhu, Wenping; Zhang, Jinwen; Jiang, Jianhui; Shen, Guoli; Yu, Ruqin
2013-07-07
A label-free fluorescent DNA biosensor has been presented based on isothermal circular strand-displacement polymerization reaction (ICSDPR) combined with graphene oxide (GO) binding. The proposed method is simple and cost-effective with a low detection limit of 4 pM, which compares favorably with other GO-based homogenous DNA detection methods.
A Tail of Two Sites: A Bipartite Mechanism for Recognition of Notch Ligands by Mind Bomb E3 Ligases
McMillan, Brian J.; Schnute, Björn; Ohlenhard, Nadja; Zimmerman, Brandon; Miles, Laura; Beglova, Natalia; Klein, Thomas; Blacklow, Stephen C.
2015-01-01
Summary Mind bomb (Mib) proteins are large, multi-domain E3 ligases that promote ubiquitination of the cytoplasmic tails of Notch ligands. This ubiquitination step marks the ligand proteins for epsin-dependent endocytosis, which is critical for in vivo Notch receptor activation. We present here crystal structures of the substrate recognition domains of Mib1, both in isolation and in complex with peptides derived from Notch ligands. The structures, in combination with biochemical, cellular and in vivo assays, show that Mib1 contains two independent substrate recognition domains that engage two distinct epitopes from the cytoplasmic tail of the ligand Jagged1, one in the intracellular membrane proximal region and the other near the C-terminus. Together, these studies provide new insights into the mechanism of ubiquitin transfer by Mind bomb E3 ligases, illuminate a key event in ligand-induced activation of Notch receptors, and identify a potential new target for therapeutic modulation of Notch signal transduction in disease. PMID:25747658
A Tail of Two Sites: A Bipartite Mechanism for Recognition of Notch Ligands by Mind Bomb E3 Ligases
DOE Office of Scientific and Technical Information (OSTI.GOV)
McMillan, Brian J.; Schnute, Björn; Ohlenhard, Nadja
Mind bomb (Mib) proteins are large, multi-domain E3 ligases that promote ubiquitination of the cytoplasmic tails of Notch ligands. This ubiquitination step marks the ligand proteins for epsin-dependent endocytosis, which is critical for in vivo Notch receptor activation. Here we present crystal structures of the substrate recognition domains of Mib1, both in isolation and in complex with peptides derived from Notch ligands. The structures, in combination with biochemical, cellular, and in vivo assays, show that Mib1 contains two independent substrate recognition domains that engage two distinct epitopes from the cytoplasmic tail of the ligand Jagged1, one in the intracellular membranemore » proximal region and the other near the C terminus. Together, these studies provide insights into the mechanism of ubiquitin transfer by Mind bomb E3 ligases, illuminate a key event in ligand-induced activation of Notch receptors, and identify a potential target for therapeutic modulation of Notch signal transduction in disease.« less
A Tail of Two Sites: A Bipartite Mechanism for Recognition of Notch Ligands by Mind Bomb E3 Ligases
McMillan, Brian J.; Schnute, Björn; Ohlenhard, Nadja; ...
2015-03-05
Mind bomb (Mib) proteins are large, multi-domain E3 ligases that promote ubiquitination of the cytoplasmic tails of Notch ligands. This ubiquitination step marks the ligand proteins for epsin-dependent endocytosis, which is critical for in vivo Notch receptor activation. Here we present crystal structures of the substrate recognition domains of Mib1, both in isolation and in complex with peptides derived from Notch ligands. The structures, in combination with biochemical, cellular, and in vivo assays, show that Mib1 contains two independent substrate recognition domains that engage two distinct epitopes from the cytoplasmic tail of the ligand Jagged1, one in the intracellular membranemore » proximal region and the other near the C terminus. Together, these studies provide insights into the mechanism of ubiquitin transfer by Mind bomb E3 ligases, illuminate a key event in ligand-induced activation of Notch receptors, and identify a potential target for therapeutic modulation of Notch signal transduction in disease.« less
Yunus, Ali A.; Lima, Christopher D.
2009-01-01
Summary Siz1 is a founding member of the Siz/PIAS RING family of SUMO E3 ligases. The x-ray structure of an active Siz1 ligase revealed an elongated tripartite architecture comprised of an N-terminal PINIT domain, a central zinc-containing RING-like SP-RING domain, and a C-terminal domain we term the SP-CTD. Structure-based mutational analysis and biochemical studies show that the SP-RING and SP-CTD are required for activation of the E2~SUMO thioester while the PINIT domain is essential for redirecting SUMO conjugation to the proliferating cell nuclear antigen (PCNA) at lysine 164, a non-consensus lysine residue that is not modified by the SUMO E2 in the absence of Siz1. Mutational analysis of Siz1 and PCNA revealed surfaces on both proteins that are required for efficient SUMO modification of PCNA in vitro and in vivo. PMID:19748360
Jalal, Hamid; Stephen, Hannah; Curran, Martin D.; Burton, Janet; Bradley, Michelle; Carne, Christopher
2006-01-01
A multitarget real-time PCR (MRT-PCR) for detection of Chlamydia trachomatis DNA was developed and validated. There were three targets for amplification in a single reaction: the cryptic plasmid (CP), the major outer membrane protein (MOMP) gene, and an internal control. The assay had the following characteristics: (i) detection and confirmation of the presence of C. trachomatis DNA in a single reaction, (ii) detection of all genovars of C. trachomatis without any cross-reactivity with pathogenic bacteria or commensal organisms of the oropharynx and genital tract, (iii) a 95% probability of detection with three copies of MOMP and one copy of CP per reaction mixture, (iv) identification of the inhibition of amplification, (v) a quantitative dynamic range of 25 to 250,000 genome copies per reaction mixture, (vi) high intra- and interassay reproducibilities, and (vii) correct identification of all samples in the validation panel. There were 146 COBAS Amplicor PCR (Amplicor PCR)-positive samples and 122 Amplicor PCR-negative samples in the panel. MRT-PCR detected CP DNA alone in 6 (4%) Amplicor PCR-positive samples and both CP and MOMP DNAs in 140 (96%) of 146 Amplicor PCR-positive samples. The quantity of MOMP DNA in 95 (68%) of 140 samples was within the dynamic range of the assay. The median C. trachomatis load in these samples was 321 genome copies per reaction mixture (range, 26 to 40,137 genome copies per reaction mixture). Due to the inclusion of two different C. trachomatis-specific targets, the assay confirmed 259 (97%) of 268 results in a single reaction. This assay could be used in the qualitative format for the routine detection of C. trachomatis and in the quantitative format for study of the pathogenesis of C. trachomatis-associated diseases. The assay demonstrated the potential to eliminate the need for confirmatory testing in almost all samples, thus reducing the turnaround time and the workload. PMID:16390971
Lotfy, S; Lofty, S; Fleuriet, A; Ramos, T; Macheix, J J
1989-02-01
In cell suspensions cultures from grape berry pulp (Vitis vinifera cv. Gamay fréaux)hydroxycinnamoyl CoA ligase (CoAL) displayed maximum activity (100 %) forp-coumaric acid and then, in decreasing order, for ferulic acid (81.3 %) and caffeic acid (60.4 %). No activity was detected with sinapic and cinnamic acids. The changes in CoAL activity during the growth cycle of the culture displayed two peaks : the highest (6 h after subculturing) was linked with a strong increase in protein caused by dilution ; the second was weaker and occurred on the 7th day of culture.Grape cell suspension accumulated mainly peonidin (Pn) and cyanidin (Cy) glucosides (Pn 3-glucoside, Cy 3-glucoside, Pn 3-acetylglucoside, Pn 3-caffeylglucoside, Pn 3-p-coumarylglucoside, and Cy 3-p-coumarylglucoside). Maximum accumulation of anthocyanins was associated with the exponential growth phase of the culture and might be the result of the substantial increase in CoAL activity resulting from the effect of dilution. The second enzyme activity peak was probably oriented towards the acylation of anthocyanins since the percentage of acylated forms increased with time after subculturing.
Wu, Fengchi; Wu, Yuqiang; Niu, Zhongwei; Vollmer, Frank
2016-07-29
Mercury is an extremely toxic chemical pollutant of our environment. It has attracted the world's attention due to its high mobility and the ease with which it accumulates in organisms. Sensitive devices and methods specific for detecting mercury ions are, hence, in great need. Here, we have integrated a DNA strand displacement reaction with a whispering gallery mode (WGM) sensor for demonstrating the detection of Hg(2+) ions. Our approach relies on the displacement of a DNA hairpin structure, which forms after the binding of mercury ions to an aptamer DNA sequence. The strand displacement reaction of the DNA aptamer provides highly specific and quantitative means for determining the mercury ion concentration on a label-free WGM sensor platform. Our approach also shows the possibility for manipulating the kinetics of a strand displacement reaction with specific ionic species.
Wu, Fengchi; Wu, Yuqiang; Niu, Zhongwei; Vollmer, Frank
2016-01-01
Mercury is an extremely toxic chemical pollutant of our environment. It has attracted the world’s attention due to its high mobility and the ease with which it accumulates in organisms. Sensitive devices and methods specific for detecting mercury ions are, hence, in great need. Here, we have integrated a DNA strand displacement reaction with a whispering gallery mode (WGM) sensor for demonstrating the detection of Hg2+ ions. Our approach relies on the displacement of a DNA hairpin structure, which forms after the binding of mercury ions to an aptamer DNA sequence. The strand displacement reaction of the DNA aptamer provides highly specific and quantitative means for determining the mercury ion concentration on a label-free WGM sensor platform. Our approach also shows the possibility for manipulating the kinetics of a strand displacement reaction with specific ionic species. PMID:27483277
Voiniciuc, Catalin; Dean, Gillian H; Griffiths, Jonathan S; Kirchsteiger, Kerstin; Hwang, Yeen Ting; Gillett, Alan; Dow, Graham; Western, Tamara L; Estelle, Mark; Haughn, George W
2013-03-01
Pectins are complex polysaccharides that form the gel matrix of the primary cell wall and are abundant in the middle lamella that holds plant cells together. Their degree of methylesterification (DM) impacts wall strength and cell adhesion since unesterified pectin regions can cross-link via Ca(2+) ions to form stronger gels. Here, we characterize flying saucer1 (fly1), a novel Arabidopsis thaliana seed coat mutant, which displays primary wall detachment, reduced mucilage extrusion, and increased mucilage adherence. These defects appear to result from a lower DM in mucilage and are enhanced by the addition of Ca(2+) or completely rescued using alkaline Ca(2+) chelators. FLY1 encodes a transmembrane protein with a RING-H2 domain that has in vitro E3 ubiquitin ligase activity. FLY1 is orthologous to TRANSMEMBRANE UBIQUITIN LIGASE1, a Golgi-localized E3 ligase involved in the quality control of membrane proteins in yeast. However, FLY1-yellow fluorescent protein (YFP) fusions are localized in punctae that are predominantly distinct from the Golgi and the trans-Golgi network/early endosome in the seed coat epidermis. Wortmannin treatment, which induces the fusion of late endosomes in plants, resulted in enlarged FLY1-YFP bodies. We propose that FLY1 regulates the DM of pectin in mucilage, potentially by recycling pectin methylesterase enzymes in the endomembrane system of seed coat epidermal cells.
A polymerase chain reaction-based methodology to detect gene doping.
Carter, Adam; Flueck, Martin
2012-04-01
The non-therapeutic use of genes to enhance athletic performance (gene doping) is a novel threat to the world of sports. Skeletal muscle is a prime target of gene therapy and we asked whether we can develop a test system to produce and detect gene doping. Towards this end, we introduced a plasmid (pCMV-FAK, 3.8 kb, 50 μg) for constitutive expression of the chicken homologue for the regulator of muscle growth, focal adhesion kinase (FAK), via gene electro transfer in the anti-gravitational muscle, m. soleus, or gastrocnemius medialis of rats. Activation of hypertrophy signalling was monitored by assessing the ribosomal kinase p70S6K and muscle fibre cross section. Detectability of the introduced plasmid was monitored with polymerase chain reaction in deoxyribonucleic acids (DNA) from transfected muscle and serum. Muscle transfection with pCMV-FAK elevated FAK expression 7- and 73-fold, respectively, and increased mean cross section by 52 and 16% in targeted muscle fibres of soleus and gastrocnemius muscle 7 days after gene electro transfer. Concomitantly p70S6K content was increased in transfected soleus muscle (+110%). Detection of the exogenous plasmid sequence was possible in DNA and cDNA of muscle until 7 days after transfection, but not in serum except close to the site of plasmid deposition, 1 h after injection and surgery. The findings suggest that the reliable detection of gene doping in the immoral athlete is not possible unless a change in the current practice of tissue sampling is applied involving the collection of muscle biopsy close to the site of gene injection.
Fiuza, Maria; Canova, Marc J; Patin, Delphine; Letek, Michal; Zanella-Cléon, Isabelle; Becchi, Michel; Mateos, Luís M; Mengin-Lecreulx, Dominique; Molle, Virginie; Gil, José A
2008-12-26
The Mur ligases play an essential role in the biosynthesis of bacterial cell-wall peptidoglycan and thus represent attractive targets for the design of novel antibacterials. These enzymes catalyze the stepwise formation of the peptide moiety of the peptidoglycan disaccharide peptide monomer unit. MurC is responsible of the addition of the first residue (L-alanine) onto the nucleotide precursor UDP-MurNAc. Phosphorylation of proteins by Ser/Thr protein kinases has recently emerged as a major physiological mechanism of regulation in prokaryotes. Herein, the hypothesis of a phosphorylation-dependent mechanism of regulation of the MurC activity was investigated in Corynebacterium glutamicum. We showed that MurC was phosphorylated in vitro by the PknA protein kinase. An analysis of the phosphoamino acid content indicated that phosphorylation exclusively occurred on threonine residues. Six phosphoacceptor residues were identified by mass spectrometry analysis, and we confirmed that mutagenesis to alanine residues totally abolished PknA-dependent phosphorylation of MurC. In vitro and in vivo ligase activity assays showed that the catalytic activity of MurC was impaired following mutation of these threonine residues. Further in vitro assays revealed that the activity of the MurC-phosphorylated isoform was severely decreased compared with the non-phosphorylated protein. To our knowledge, this is the first demonstration of a MurC ligase phosphorylation in vitro. The finding that phosphorylation is correlated with a decrease in MurC enzymatic activity could have significant consequences in the regulation of peptidoglycan biosynthesis.
Frints, Suzanna G M; Ozanturk, Aysegul; Rodríguez Criado, Germán; Grasshoff, Ute; de Hoon, Bas; Field, Michael; Manouvrier-Hanu, Sylvie; E Hickey, Scott; Kammoun, Molka; Gripp, Karen W; Bauer, Claudia; Schroeder, Christopher; Toutain, Annick; Mihalic Mosher, Theresa; Kelly, Benjamin J; White, Peter; Dufke, Andreas; Rentmeester, Eveline; Moon, Sungjin; Koboldt, Daniel C; van Roozendaal, Kees E P; Hu, Hao; Haas, Stefan A; Ropers, Hans-Hilger; Murray, Lucinda; Haan, Eric; Shaw, Marie; Carroll, Renee; Friend, Kathryn; Liebelt, Jan; Hobson, Lynne; De Rademaeker, Marjan; Geraedts, Joep; Fryns, Jean-Pierre; Vermeesch, Joris; Raynaud, Martine; Riess, Olaf; Gribnau, Joost; Katsanis, Nicholas; Devriendt, Koen; Bauer, Peter; Gecz, Jozef; Golzio, Christelle; Gontan, Cristina; Kalscheuer, Vera M
2018-05-04
RLIM, also known as RNF12, is an X-linked E3 ubiquitin ligase acting as a negative regulator of LIM-domain containing transcription factors and participates in X-chromosome inactivation (XCI) in mice. We report the genetic and clinical findings of 84 individuals from nine unrelated families, eight of whom who have pathogenic variants in RLIM (RING finger LIM domain-interacting protein). A total of 40 affected males have X-linked intellectual disability (XLID) and variable behavioral anomalies with or without congenital malformations. In contrast, 44 heterozygous female carriers have normal cognition and behavior, but eight showed mild physical features. All RLIM variants identified are missense changes co-segregating with the phenotype and predicted to affect protein function. Eight of the nine altered amino acids are conserved and lie either within a domain essential for binding interacting proteins or in the C-terminal RING finger catalytic domain. In vitro experiments revealed that these amino acid changes in the RLIM RING finger impaired RLIM ubiquitin ligase activity. In vivo experiments in rlim mutant zebrafish showed that wild type RLIM rescued the zebrafish rlim phenotype, whereas the patient-specific missense RLIM variants failed to rescue the phenotype and thus represent likely severe loss-of-function mutations. In summary, we identified a spectrum of RLIM missense variants causing syndromic XLID and affecting the ubiquitin ligase activity of RLIM, suggesting that enzymatic activity of RLIM is required for normal development, cognition and behavior.
Tian, Miaomiao; Lou, Lijuan; Liu, Lijing; Yu, Feifei; Zhao, Qingzhen; Zhang, Huawei; Wu, Yaorong; Tang, Sanyuan; Xia, Ran; Zhu, Baoge; Serino, Giovanna; Xie, Qi
2015-04-01
Salt stress is a detrimental factor for plant growth and development. The response to salt stress has been shown to involve components in the intracellular trafficking system, as well as components of the ubiquitin-proteasome system (UPS). In this article, we have identified in Arabidopsis thaliana a little reported ubiquitin ligase involved in salt-stress response, which we named STRF1 (Salt Tolerance RING Finger 1). STRF1 is a member of RING-H2 finger proteins and we demonstrate that it has ubiquitin ligase activity in vitro. We also show that STRF1 localizes mainly at the plasma membrane and at the intracellular endosomes. strf1-1 loss-of-function mutant seedlings exhibit accelerated endocytosis in roots, and have altered expression of several genes involved in the membrane trafficking system. Moreover, protein trafficking inhibitor, brefeldin A (BFA), treatment has increased BFA bodies in strf1-1 mutant. This mutant also showed increased tolerance to salt, ionic and osmotic stresses, reduced accumulation of reactive oxygen species during salt stress, and increased expression of AtRbohD, which encodes a nicotinamide adenine dinucleotide phosphate (NADPH) oxidase involved in H2 O2 production. We conclude that STRF1 is a membrane trafficking-related ubiquitin ligase, which helps the plant to respond to salt stress by monitoring intracellular membrane trafficking and reactive oxygen species (ROS) production. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.
Insights into Cullin-RING E3 ubiquitin ligase recruitment: structure of the VHL-EloBC-Cul2 complex.
Nguyen, Henry C; Yang, Haitao; Fribourgh, Jennifer L; Wolfe, Leslie S; Xiong, Yong
2015-03-03
The von Hippel-Lindau tumor suppressor protein (VHL) recruits a Cullin 2 (Cul2) E3 ubiquitin ligase to downregulate HIF-1α, an essential transcription factor for the hypoxia response. Mutations in VHL lead to VHL disease and renal cell carcinomas. Inhibition of this pathway to upregulate erythropoietin production is a promising new therapy to treat ischemia and chronic anemia. Here, we report the crystal structure of VHL bound to a Cul2 N-terminal domain, Elongin B, and Elongin C (EloC). Cul2 interacts with both the VHL BC box and cullin box and a novel EloC site. Comparison with other cullin E3 ligase structures shows that there is a conserved, yet flexible, cullin recognition module and that cullin selectivity is influenced by distinct electrostatic interactions. Our structure provides a structural basis for the study of the pathogenesis of VHL disease and rationale for the design of novel compounds that may modulate cullin-substrate receptor interactions. Copyright © 2015 Elsevier Ltd. All rights reserved.
Deva, Taru; Pryor, KellyAnn D; Leiting, Barbara; Baker, Edward N; Smith, Clyde A
2003-08-01
UDP-N-acetylmuramoyl:L-alanine ligase (MurC) is involved in the pathway leading from UDP-N-glucosamine to the UDP-N-acetylmuramoyl:pentapeptide unit, which is the building block for the peptidoglycan layer found in all bacterial cell walls. The pathways leading to the biosynthesis of the peptidoglycan layer are important targets for the development of novel antibiotics, since animal cells do not contain these pathways. MurC is the first of four similar ATP-dependent amide-bond ligases which share primary and tertiary structural similarities. The crystal structures of three of these have been determined by X-ray crystallography, giving insights into the binding of the carbohydrate substrate and the ATP. Diffraction-quality crystals of the enzyme MurC have been obtained in both native and selenomethionine forms and X-ray diffraction data have been collected at the Se edge at a synchrotron source. The crystals are orthorhombic, with unit-cell parameters a = 73.9, b = 93.6, c = 176.8 A, and diffraction has been observed to 2.6 A resolution.
Dantuma, Nico P; Pfeiffer, Annika
2016-01-01
Ubiquitin and the ubiquitin-like modifier SUMO are intimately connected with the cellular response to various types of DNA damage. A striking feature is the local accumulation of these proteinaceous post-translational modifications in the direct vicinity to DNA double-strand breaks, which plays a critical role in the formation of ionizing radiation-induced foci. The functional significance of these modifications is the coordinated recruitment and removal of proteins involved in DNA damage signaling and repair in a timely manner. The central orchestrators of these processes are the ubiquitin and SUMO ligases that are responsible for accurately tagging a broad array of chromatin and chromatin-associated proteins thereby changing their behavior or destination. Despite many differences in the mode of action of these enzymes, they share some striking features that are of direct relevance for their function in the DNA damage response. In this review, we outline the molecular mechanisms that are responsible for the recruitment of ubiquitin and SUMO ligases and discuss the importance of chromatin proximity in this process.
Rodríguez, Jessica E.; Liao, Jie-Ying; He, Jun; Schisler, Jonathan C.; Newgard, Christopher B.; Drujan, Doreen; Glass, David L.; Frederick, C.Brandon; Yoder, Bryan C.; Lalush, David S.; Patterson, Cam; Willis, Monte S.
2015-01-01
The transcriptional regulation of peroxisome proliferator-activated receptor (PPAR) α by post-translational modification, such as ubiquitin, has not been described. We report here for the first time an ubiquitin ligase (muscle ring finger-1/MuRF1) that inhibits fatty acid oxidation by inhibiting PPARα, but not PPARβ/δ or PPARγ in cardiomyocytes in vitro. Similarly, MuRF1 Tg+ hearts showed significant decreases in nuclear PPARα activity and acyl-carnitine intermediates, while MuRF1−/− hearts exhibited increased PPARα activity and acyl-carnitine intermediates. MuRF1 directly interacts with PPARα, mono-ubiquitinates it, and targets it for nuclear export to inhibit fatty acid oxidation in a proteasome independent manner. We then identified a previously undescribed nuclear export sequence in PPARα, along with three specific lysines (292, 310, 388) required for MuRF1s targeting of nuclear export. These studies identify the role of ubiquitination in regulating cardiac PPARα, including the ubiquitin ligase that may be responsible for this critical regulation of cardiac metabolism in heart failure. PMID:26116825
Konomura, Naoto; Arai, Naoto; Shinohara, Takeshi; Kobayashi, Jun; Iwasaki, Wakana; Ikawa, Shukuko; Kusano, Kohji; Shibata, Takehiko
2017-01-01
RecA-family recombinase-catalyzed ATP-dependent homologous joint formation is critical for homologous recombination, in which RecA or Rad51 binds first to single-stranded (ss)DNA and then interacts with double-stranded (ds)DNA. However, when RecA or Rad51 interacts with dsDNA before binding to ssDNA, the homologous joint-forming activity of RecA or Rad51 is quickly suppressed. We found that under these and adenosine diphosphate (ADP)-generating suppressive conditions for the recombinase activity, RecA or Rad51 at similar optimal concentrations enhances the DNA ligase-catalyzed dsDNA end-joining (DNA ligation) about 30- to 40-fold. The DNA ligation enhancement by RecA or Rad51 transforms most of the substrate DNA into multimers within 2–5 min, and for this enhancement, ADP is the common and best cofactor. Adenosine triphosphate (ATP) is effective for RecA, but not for Rad51. Rad51/RecA-enhanced DNA ligation depends on dsDNA-binding, as shown by a mutant, and is independent of physical interactions with the DNA ligase. These observations demonstrate the common and unique activities of RecA and Rad51 to juxtapose dsDNA-ends in preparation for covalent joining by a DNA ligase. This new in vitro function of Rad51 provides a simple explanation for our genetic observation that Rad51 plays a role in the fidelity of the end-joining of a reporter plasmid DNA, by yeast canonical non-homologous end-joining (NHEJ) in vivo. PMID:27794044
Primers for polymerase chain reaction to detect genomic DNA of Toxocara canis and T. cati.
Wu, Z; Nagano, I; Xu, D; Takahashi, Y
1997-03-01
Primers for polymerase chain reaction to amplify genomic DNA of both Toxocara canis and T. cati were constructed by adapting cloning and sequencing random amplified polymorphic DNA. The primers are expected to detect eggs and/or larvae of T. canis and T. cati, both of which are known to cause toxocariasis in humans.
NASA Astrophysics Data System (ADS)
Singh, Jaideep; Bailey, Kevin G.; Lu, Zheng-Tian; Mueller, Peter; O'Connor, Thomas P.; Xu, Chen-Yu; Tang, Xiaodong
2013-04-01
Optical detection of single atoms captured in solid noble gas matrices provides an alternative technique to study rare nuclear reactions relevant to nuclear astrophysics. I will describe the prospects of applying this approach for cross section measurements of the ^22Ne,,),25Mg reaction, which is the crucial neutron source for the weak s process inside of massive stars. Noble gas solids are a promising medium for the capture, detection, and manipulation of atoms and nuclear spins. They provide stable and chemically inert confinement for a wide variety of guest species. Because noble gas solids are transparent at optical wavelengths, the guest atoms can be probed using lasers. We have observed that ytterbium in solid neon exhibits intersystem crossing (ISC) which results in a strong green fluorescence (546 nm) under excitation with blue light (389 nm). Several groups have observed ISC in many other guest-host pairs, notably magnesium in krypton. Because of the large wavelength separation of the excitation light and fluorescence light, optical detection of individual embedded guest atoms is feasible. This work is supported by DOE, Office of Nuclear Physics, under contract DE-AC02-06CH11357.
2012-01-01
Background Sulfamethoxazole (SMX) is a commonly used antibiotic for prevention of infectious diseases associated with HIV/AIDS and immune-compromised states. SMX-induced hypersensitivity is an idiosyncratic cutaneous drug reaction with genetic components. Here, we tested association of candidate genes involved in SMX bioactivation and antioxidant defense with SMX-induced hypersensitivity. Results Seventy seven single nucleotide polymorphisms (SNPs) from 14 candidate genes were genotyped and assessed for association with SMX-induced hypersensitivity, in a cohort of 171 HIV/AIDS patients. SNP rs761142 T > G, in glutamate cysteine ligase catalytic subunit (GCLC), was significantly associated with SMX-induced hypersensitivity, with an adjusted p value of 0.045. This result was replicated in a second cohort of 249 patients (p = 0.025). In the combined cohort, heterozygous and homozygous carriers of the minor G allele were at increased risk of developing hypersensitivity (GT vs TT, odds ratio = 2.2, 95% CL 1.4-3.7, p = 0.0014; GG vs TT, odds ratio = 3.3, 95% CL 1.6 – 6.8, p = 0.0010). Each minor allele copy increased risk of developing hypersensitivity 1.9 fold (95% CL 1.4 – 2.6, p = 0.00012). Moreover, in 91 human livers and 84 B-lymphocytes samples, SNP rs761142 homozygous G allele carriers expressed significantly less GCLC mRNA than homozygous TT carriers (p < 0.05). Conclusions rs761142 in GCLC was found to be associated with reduced GCLC mRNA expression and with SMX-induced hypersensitivity in HIV/AIDS patients. Catalyzing a critical step in glutathione biosynthesis, GCLC may play a broad role in idiosyncratic drug reactions. PMID:22824134
Polymerase chain reaction for detection of invasive Shigella flexneri in food.
Lampel, K A; Jagow, J A; Trucksess, M; Hill, W E
1990-06-01
The polymerase chain reaction (PCR) was used to amplify a 760-base-pair (bp) fragment with the 220-kbp invasive plasmids of enteroinvasive Escherichia coli, Shigella flexneri, Shigella dysenteriae, Shigella boydii, and Shigella sonnei as templates. This PCR product was easily detected by agarose gel electrophoresis. A 210-bp AccI-PstI fragment lying within the amplified region was used as a probe in Southern hybridization blots and showed that the PCR-generated product was derived from the invasive plasmid. The application of PCR as a rapid method to detect enteroinvasive bacteria in foods was tested by inoculating lettuce with 10(4) S. flexneri cells per g in shigella broth base. Plasmid DNA was isolated from cultures of inoculated and uninoculated lettuce in broth after 0, 4, and 24 h of incubation. With the PCR, the 760-bp fragment was generated only from lettuce inoculated with S. flexneri, as shown by gel electrophoresis and confirmed both by Southern blotting and by nucleotide sequencing of the amplified region. Because the isolation of plasmid DNA, the performance of PCR, and gel electrophoresis all can be completed in 6 to 7 h, invasive enteric bacteria can be detected in less than 1 day.
Degradation of human Lipin-1 by BTRC E3 ubiquitin ligase.
Ishimoto, Kenji; Hayase, Ayaka; Kumagai, Fumiko; Kawai, Megumi; Okuno, Hiroko; Hino, Nobumasa; Okada, Yoshiaki; Kawamura, Takeshi; Tanaka, Toshiya; Hamakubo, Takao; Sakai, Juro; Kodama, Tatsuhiko; Tachibana, Keisuke; Doi, Takefumi
2017-06-17
Lipin-1 has dual functions in the regulation of lipid and energy metabolism according to its subcellular localization, which is tightly controlled. However, it is unclear how Lipin-1 degradation is regulated. Here, we demonstrate that Lipin-1 is degraded through its DSGXXS motif. We show that Lipin-1 interacts with either of two E3 ubiquitin ligases, BTRC or FBXW11, and that this interaction is DSGXXS-dependent and mediates the attachment of polyubiquitin chains. Further, we demonstrate that degradation of Lipin-1 is regulated by BTRC in the cytoplasm and on membranes. These novel insights into the regulation of human Lipin-1 stability will be useful in planning further studies to elucidate its metabolic processes. Copyright © 2017 Elsevier Inc. All rights reserved.
Lou, Jing; Wang, Zhaoyin; Wang, Xiao; Bao, Jianchun; Tu, Wenwen; Dai, Zhihui
2015-10-07
A "signal-on" electrochemiluminescent DNA biosensing platform was proposed based on the dual quenching and strand displacement reaction. This novel "signal-on" detection strategy revealed its sensitivity in achieving a detection limit of 2.4 aM and its selectivity in distinguishing single nucleotide polymorphism of target DNA.
Yin, Huan-Shun; Li, Bing-Chen; Zhou, Yun-Lei; Wang, Hai-Yan; Wang, Ming-Hui; Ai, Shi-Yun
2017-10-15
MicroRNAs have been involved into many biological processes and are regarded as disease biomarkers. Simple, rapid, sensitive and selective method for microRNA detection is crucial for early diagnosis and therapy of diseases. In this work, sensitive fluorescence assay was developed for microRNA-21 detection based on DNA polymerase induced strand displacement amplification reaction, Mg 2+ -dependent DNAzyme catalysis reaction, and magnetic separation. In the presence of target microRNA-21, amounts of trigger DNA could be produced with DNA polymerase induced strand displacement amplification reaction, and the trigger DNA could be further hybridized with signal DNA, which was labeled with biotin and AMCA dye. After introduction of Mg 2+ , trigger DNA could form DNAzyme to cleave signal DNA. After magnetic separation, the DNA fragment with AMCA dye could give fluorescence signal, which was related to microRNA-21 concentration. Based on the two efficient signal amplifications, the developed method showed high detection sensitivity with low detection limit of 0.27fM (3σ). In addition, this fluorescence strategy also possessed excellent detection specificity, and could be applied to analyze microRNA-21 expression level in serum of cancer patient. According to the obtained results, the developed fluorescence method might be a promising detection platform for microRNA-21 quantitative analysis in biomedical research and clinical diagnosis. Copyright © 2017 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Miao, Min; School of Biotechnology and Food Engineering, Hefei University of Technology, Hefei 230009; Department of Plant, Soil and Entomological Sciences, University of Idaho, Moscow, ID 83844-2339
2014-08-08
Highlights: • We identify DDI1 as a DAMAGED DNA BINDING PROTEIN1 (DDB1)-interacting protein. • DDI1 interacts with the CUL4–DDB1-based ubiquitin ligase in the nucleus. • DDI1 plays a positive role in regulating abiotic stress response in tomato. - Abstract: CULLIN4(CUL4)–DAMAGED DNA BINDING PROTEIN1 (DDB1)-based ubiquitin ligase plays significant roles in multiple physiological processes via ubiquitination-mediated degradation of relevant target proteins. The DDB1–CUL4-associated factor (DCAF) acts as substrate receptor in the CUL4–DDB1 ubiquitin ligase complex and determines substrate specificity. In this study, we identified a tomato (Solanum lycopersicum) DDB1-interacting (DDI1) protein as a DCAF protein involved in response to abiotic stresses,more » including UV radiation, high salinity and osmotic stress. Co-immunoprecipitation and bimolecular fluorescence complementation assay indicated that DDI1 associates with CUL4–DDB1 in the nucleus. Quantitative RT-PCR analysis indicated the DDI1 gene is induced by salt, mannitol and UV-C treatment. Moreover, transgenic tomato plants with overexpression or knockdown of the DDI1 gene exhibited enhanced or attenuated tolerance to salt/mannitol/UV-C, respectively. Thus, our data suggest that DDI1 functions as a substrate receptor of the CUL4–DDB1 ubiquitin ligase, positively regulating abiotic stress response in tomato.« less
The E3 ligase Cbl-b and TAM receptors regulate cancer metastasis via natural killer cells.
Paolino, Magdalena; Choidas, Axel; Wallner, Stephanie; Pranjic, Blanka; Uribesalgo, Iris; Loeser, Stefanie; Jamieson, Amanda M; Langdon, Wallace Y; Ikeda, Fumiyo; Fededa, Juan Pablo; Cronin, Shane J; Nitsch, Roberto; Schultz-Fademrecht, Carsten; Eickhoff, Jan; Menninger, Sascha; Unger, Anke; Torka, Robert; Gruber, Thomas; Hinterleitner, Reinhard; Baier, Gottfried; Wolf, Dominik; Ullrich, Axel; Klebl, Bert M; Penninger, Josef M
2014-03-27
Tumour metastasis is the primary cause of mortality in cancer patients and remains the key challenge for cancer therapy. New therapeutic approaches to block inhibitory pathways of the immune system have renewed hopes for the utility of such therapies. Here we show that genetic deletion of the E3 ubiquitin ligase Cbl-b (casitas B-lineage lymphoma-b) or targeted inactivation of its E3 ligase activity licenses natural killer (NK) cells to spontaneously reject metastatic tumours. The TAM tyrosine kinase receptors Tyro3, Axl and Mer (also known as Mertk) were identified as ubiquitylation substrates for Cbl-b. Treatment of wild-type NK cells with a newly developed small molecule TAM kinase inhibitor conferred therapeutic potential, efficiently enhancing anti-metastatic NK cell activity in vivo. Oral or intraperitoneal administration using this TAM inhibitor markedly reduced murine mammary cancer and melanoma metastases dependent on NK cells. We further report that the anticoagulant warfarin exerts anti-metastatic activity in mice via Cbl-b/TAM receptors in NK cells, providing a molecular explanation for a 50-year-old puzzle in cancer biology. This novel TAM/Cbl-b inhibitory pathway shows that it might be possible to develop a 'pill' that awakens the innate immune system to kill cancer metastases.
Cukras, Scott; Morffy, Nicholas; Ohn, Takbum; Kee, Younghoon
2014-01-01
Protein neddylation is involved in a wide variety of cellular processes. Here we show that the DNA damage response is perturbed in cells inactivated with an E2 Nedd8 conjugating enzyme UBE2M, measured by RAD51 foci formation kinetics and cell based DNA repair assays. UBE2M knockdown increases DNA breakages and cellular sensitivity to DNA damaging agents, further suggesting heightened genomic instability and defective DNA repair activity. Investigating the downstream Cullin targets of UBE2M revealed that silencing of Cullin 1, 2, and 4 ligases incurred significant DNA damage. In particular, UBE2M knockdown, or defective neddylation of Cullin 2, leads to a blockade in the G1 to S progression and is associated with delayed S-phase dependent DNA damage response. Cullin 4 inactivation leads to an aberrantly high DNA damage response that is associated with increased DNA breakages and sensitivity of cells to DNA damaging agents, suggesting a DNA repair defect is associated. siRNA interrogation of key Cullin substrates show that CDT1, p21, and Claspin are involved in elevated DNA damage in the UBE2M knockdown cells. Therefore, UBE2M is required to maintain genome integrity by activating multiple Cullin ligases throughout the cell cycle.
Zou, Shenshan; Zhu, Yufu; Wang, Bin; Qian, Fengyuan; Zhang, Xiang; Wang, Lei; Fu, Chunling; Bao, Hanmo; Xie, Manyi; Gao, Shangfeng; Yu, Rutong; Shi, Hengliang
2017-09-01
Human glioma causes substantial morbidity and mortality worldwide. However, the molecular mechanisms underlying glioma progression are still largely unknown. COP1 (constitutively photomorphogenic 1), an E3 ubiquitin ligase, is important in cell survival, development, cell growth, and cancer biology by regulating different substrates. As is well known, both tumor suppressor p53 and oncogenic protein c-JUN could be ubiquitinated and degraded by ubiquitin ligase COP1, which may be the reason that COP1 serves as an oncogene or a tumor suppressor in different cancer types. Up to now, the possible role of COP1 in human glioma is still unclear. In the present study, we found that the expression of COP1 was upregulated in human glioma tissues. The role of COP1 in glioma cell proliferation was investigated using COP1 loss- and gain-of-function. The results showed that downregulation of COP1 by short hairpin RNA (shRNA) inhibited glioma cell proliferation, while overexpression of COP1 significantly promoted it. Furthermore, we demonstrated that COP1 only interacted with and regulated p53, but not c-JUN. Taken together, these results indicate that COP1 may play a role in promoting glioma cell proliferation by interacting with and downregulating tumor suppressor p53 rather than oncogenic protein c-JUN.
Bulatov, Emil; Ciulli, Alessio
2015-01-01
In the last decade, the ubiquitin–proteasome system has emerged as a valid target for the development of novel therapeutics. E3 ubiquitin ligases are particularly attractive targets because they confer substrate specificity on the ubiquitin system. CRLs [Cullin–RING (really interesting new gene) E3 ubiquitin ligases] draw particular attention, being the largest family of E3s. The CRLs assemble into functional multisubunit complexes using a repertoire of substrate receptors, adaptors, Cullin scaffolds and RING-box proteins. Drug discovery targeting CRLs is growing in importance due to mounting evidence pointing to significant roles of these enzymes in diverse biological processes and human diseases, including cancer, where CRLs and their substrates often function as tumour suppressors or oncogenes. In the present review, we provide an account of the assembly and structure of CRL complexes, and outline the current state of the field in terms of available knowledge of small-molecule inhibitors and modulators of CRL activity. A comprehensive overview of the reported crystal structures of CRL subunits, components and full-size complexes, alone or with bound small molecules and substrate peptides, is included. This information is providing increasing opportunities to aid the rational structure-based design of chemical probes and potential small-molecule therapeutics targeting CRLs. PMID:25886174
Microbial biotin protein ligases aid in understanding holocarboxylase synthetase deficiency.
Pendini, Nicole R; Bailey, Lisa M; Booker, Grant W; Wilce, Matthew C; Wallace, John C; Polyak, Steven W
2008-01-01
The attachment of biotin onto the biotin-dependent enzymes is catalysed by biotin protein ligase (BPL), also known as holocarboxylase synthase HCS in mammals. Mammals contain five biotin-enzymes that participate in a number of important metabolic pathways such as fatty acid biogenesis, gluconeogenesis and amino acid catabolism. All mammalian biotin-enzymes are post-translationally biotinylated, and therefore activated, through the action of a single HCS. Substrate recognition by BPLs occurs through conserved structural cues that govern the specificity of biotinylation. Defects in biotin metabolism, including HCS, give rise to multiple carboxylase deficiency (MCD). Here we review the literature on this important enzyme. In particular, we focus on the new information that has been learned about BPL's from a number of recently published protein structures. Through molecular modelling studies insights into the structural basis of HCS deficiency in MCD are discussed.
The Role of Ubiquitin E3 Ligase SCF-SKP2 in Prostate Cancer Development
2007-02-01
2004; 303:1371-4. 26. Nag A, Bondar T, Shiv S, Raychaudhuri P. The xeroderma pigmentosum group E gene product DDB2 is a specific target of cullin 4A...ubiquitin ligases. Nat Rev Mol Cell Biol 2005; 6:9-20. 2. Nag A, Bondar T, Shiv S, Raychaudhuri P. The xeroderma pigmentosum group E gene product DDB2 is... xeroderma pigmentosum group E patient and the subsequent inability to bind DDB1 (ref. 16). This motif is present in most of the WDR proteins we found (see
Structural insight into SUMO chain recognition and manipulation by the ubiquitin ligase RNF4
Xu, Yingqi; Plechanovová, Anna; Simpson, Peter; Marchant, Jan; Leidecker, Orsolya; Kraatz, Sebastian; Hay, Ronald T.; Matthews, Steve J.
2014-01-01
The small ubiquitin-like modifier (SUMO) can form polymeric chains that are important signals in cellular processes such as meiosis, genome maintenance and stress response. The SUMO-targeted ubiquitin ligase RNF4 engages with SUMO chains on linked substrates and catalyses their ubiquitination, which targets substrates for proteasomal degradation. Here we use a segmental labelling approach combined with solution nuclear magnetic resonance (NMR) spectroscopy and biochemical characterization to reveal how RNF4 manipulates the conformation of the SUMO chain, thereby facilitating optimal delivery of the distal SUMO domain for ubiquitin transfer. PMID:24969970
Synthesis and biological evaluation of N-acylhydrazones as inhibitors of MurC and MurD ligases.
Sink, Roman; Kovac, Andreja; Tomasić, Tihomir; Rupnik, Veronika; Boniface, Audrey; Bostock, Julieanne; Chopra, Ian; Blanot, Didier; Masic, Lucija Peterlin; Gobec, Stanislav; Zega, Anamarija
2008-09-01
The Mur ligases have an essential role in the intracellular biosynthesis of bacterial peptidoglycan, and they represent attractive targets for the design of novel antibacterials. A series of compounds with an N-acylhydrazone scaffold were synthesized and screened for inhibition of the MurC and MurD enzymes from Escherichia coli. Compounds with micromolar inhibitory activities against both MurC and MurD were identified, and some of them also showed antibacterial activity.
Liu, Yacui; Zhang, Jiangyan; Tian, Jingxiao; Fan, Xiaofei; Geng, Hao; Cheng, Yongqiang
2017-01-01
A simple, highly sensitive, and specific assay was developed for the homogeneous and multiplex detection of microRNAs (miRNAs) by combining molecular beacon (MB) probes and T7 exonuclease-assisted cyclic amplification. An MB probe with five base pairs in the stem region without special modification can effectively prevent the digestion by T7 exonuclease. Only in the presence of target miRNA is the MB probe hybridized with the target miRNA, and then digested by T7 exonuclease in the 5' to 3' direction. At the same time, the target miRNA is released and subsequently initiates the nuclease-assisted cyclic digestion process, generating enhanced fluorescence signal significantly. The results show that the combination of T7 exonuclease-assisted cyclic amplification reaction and MB probe possesses higher sensitivity for miRNA detection. Moreover, multiplex detection of miRNAs was successfully achieved by designing two MB probes labeled with FAM and Cy3, respectively. As a result, the method opens a new pathway for the sensitive and multiplex detection of miRNAs as well as clinical diagnosis. Graphical Abstract A simple, highly sensitive, and specific assay was developed for the detection of microRNAs by combining molecular beacon probes with T7 exonuclease-assisted cyclic amplification reaction.
The ubiquitin ligase tripartite-motif-protein 32 is induced in Duchenne muscular dystrophy.
Assereto, Stefania; Piccirillo, Rosanna; Baratto, Serena; Scudieri, Paolo; Fiorillo, Chiara; Massacesi, Manuela; Traverso, Monica; Galietta, Luis J; Bruno, Claudio; Minetti, Carlo; Zara, Federico; Gazzerro, Elisabetta
2016-08-01
Activation of the proteasome pathway is one of the secondary processes of cell damage, which ultimately lead to muscle degeneration and necrosis in Duchenne muscular dystrophy (DMD). In mdx mice, the proteasome inhibitor bortezomib up-regulates the membrane expression of members of the dystrophin complex and reduces the inflammatory reaction. However, chronic inhibition of the 26S proteasome may be toxic, as indicated by the systemic side-effects caused by this drug. Therefore, we sought to determine the components of the ubiquitin-proteasome pathway that are specifically activated in human dystrophin-deficient muscles. The analysis of a cohort of patients with genetically determined DMD or Becker muscular dystrophy (BMD) unveiled a selective up-regulation of the ubiquitin ligase tripartite motif-containing protein 32 (TRIM32). The induction of TRIM32 was due to a transcriptional effect and it correlated with disease severity in BMD patients. In contrast, atrogin1 and muscle RING-finger protein-1 (MuRF-1), which are strongly increased in distinct types of muscular atrophy, were not affected by the DMD dystrophic process. Knock-out models showed that TRIM32 is involved in ubiquitination of muscle cytoskeletal proteins as well as of protein inhibitor of activated STAT protein gamma (Piasγ) and N-myc downstream-regulated gene, two inhibitors of satellite cell proliferation and differentiation. Accordingly, we showed that in DMD/BMD muscle tissue, TRIM32 induction was more pronounced in regenerating myofibers rather than in necrotic muscle cells, thus pointing out a role of this protein in the regulation of human myoblast cell fate. This finding highlights TRIM32 as a possible therapeutic target to favor skeletal muscle regeneration in DMD patients.
Orian, Amir; Gonen, Hedva; Bercovich, Beatrice; Fajerman, Ifat; Eytan, Esther; Israël, Alain; Mercurio, Frank; Iwai, Kazuhiro; Schwartz, Alan L.; Ciechanover, Aaron
2000-01-01
Processing of the p105 precursor to form the active subunit p50 of the NF-κB transcription factor is a unique case in which the ubiquitin system is involved in limited processing rather than in complete destruction of the target substrate. A glycine-rich region along with a downstream acidic domain have been demonstrated to be essential for processing. Here we demonstrate that following IκB kinase (IκK)-mediated phosphorylation, the C-terminal domain of p105 (residues 918–934) serves as a recognition motif for the SCFβ-TrCP ubiquitin ligase. Expression of IκKβ dramatically increases processing of wild-type p105, but not of p105-Δ918–934. Dominant-negative β-TrCP inhibits IκK-dependent processing. Furthermore, the ligase and wild-type p105 but not p105-Δ918–934 associate physically following phosphorylation. In vitro, SCFβ-TrCP specifically conjugates and promotes processing of phosphorylated p105. Importantly, the TrCP recognition motif in p105 is different from that described for IκBs, β-catenin and human immunodeficiency virus type 1 Vpu. Since p105-Δ918–934 is also conjugated and processed, it appears that p105 can be recognized under different physiological conditions by two different ligases, targeting two distinct recognition motifs. PMID:10835356
Shanmugam, Anusuya; Natarajan, Jeyakumar
2012-06-01
Multi drug resistance capacity for Mycobacterium leprae (MDR-Mle) demands the profound need for developing new anti-leprosy drugs. Since most of the drugs target a single enzyme, mutation in the active site renders the antibiotic ineffective. However, structural and mechanistic information on essential bacterial enzymes in a pathway could lead to the development of antibiotics that targets multiple enzymes. Peptidoglycan is an important component of the cell wall of M. leprae. The biosynthesis of bacterial peptidoglycan represents important targets for the development of new antibacterial drugs. Biosynthesis of peptidoglycan is a multi-step process that involves four key Mur ligase enzymes: MurC (EC:6.3.2.8), MurD (EC:6.3.2.9), MurE (EC:6.3.2.13) and MurF (EC:6.3.2.10). Hence in our work, we modeled the three-dimensional structure of the above Mur ligases using homology modeling method and analyzed its common binding features. The residues playing an important role in the catalytic activity of each of the Mur enzymes were predicted by docking these Mur ligases with their substrates and ATP. The conserved sequence motifs significant for ATP binding were predicted as the probable residues for structure based drug designing. Overall, the study was successful in listing significant and common binding residues of Mur enzymes in peptidoglycan pathway for multi targeted therapy.
Samuel, Marcus A; Mudgil, Yashwanti; Salt, Jennifer N; Delmas, Frédéric; Ramachandran, Shaliny; Chilelli, Andrea; Goring, Daphne R
2008-08-01
The Arabidopsis (Arabidopsis thaliana) genome encompasses multiple receptor kinase families with highly variable extracellular domains. Despite their large numbers, the various ligands and the downstream interacting partners for these kinases have been deciphered only for a few members. One such member, the S-receptor kinase, is known to mediate the self-incompatibility (SI) response in Brassica. S-receptor kinase has been shown to interact and phosphorylate a U-box/ARM-repeat-containing E3 ligase, ARC1, which, in turn, acts as a positive regulator of the SI response. In an effort to identify conserved signaling pathways in Arabidopsis, we performed yeast two-hybrid analyses of various S-domain receptor kinase family members with representative Arabidopsis plant U-box/ARM-repeat (AtPUB-ARM) E3 ligases. The kinase domains from S-domain receptor kinases were found to interact with ARM-repeat domains from AtPUB-ARM proteins. These kinase domains, along with M-locus protein kinase, a positive regulator of SI response, were also able to phosphorylate the ARM-repeat domains in in vitro phosphorylation assays. Subcellular localization patterns were investigated using transient expression assays in tobacco (Nicotiana tabacum) BY-2 cells and changes were detected in the presence of interacting kinases. Finally, potential links to the involvement of these interacting modules to the hormone abscisic acid (ABA) were investigated. Interestingly, AtPUB9 displayed redistribution to the plasma membrane of BY-2 cells when either treated with ABA or coexpressed with the active kinase domain of ARK1. As well, T-DNA insertion mutants for ARK1 and AtPUB9 lines were altered in their ABA sensitivity during germination and acted at or upstream of ABI3, indicating potential involvement of these proteins in ABA responses.
Xu, Yao; Zheng, Zhi
2016-05-15
We have developed a convenient, robust and low-cost RNA detection system suitable for high-throughput applications. This system uses a highly specific sandwich hybridization to capture target RNA directly onto solid support, followed by on-site signal amplification via 2-dimensional, branched hybridizing chain polymerization through toehold-mediated strand displacement reaction. The assay uses SYBR Green to detect targets at concentrations as low as 1 pM, without involving nucleic acid purification or any enzymatic reaction, using ordinary oligonucleotides without modification or labeling. The system was demonstrated in the detection of malaria RNA in blood and GAPDH gene expression in cell lysate. Copyright © 2015 Elsevier B.V. All rights reserved.
Wang, Guoying; Jia, Shiming; Niu, Xiuli; Liu, Yanrong; Tian, Haoqi; Chen, Xuefu; Shi, Gaofeng
2018-01-22
Free radicals play an important role in the oxidizing power of polluted air, the development of aging-related diseases, the formation of ozone, and the production of secondary particulate matter. The high variability of peroxyl radical concentration has prevented the detection of possible trends or distributions in the concentration of free radicals. We present a new method, free radical reaction combined with liquid chromatography photodiode array detection, for identifying and quantifying peroxyl radicals in polluted air. Functionalized graphene was used for loading peroxyl radicals and reactive molecules in air sampling system, which can facilitate reaction kinetics (charge transfers) between peroxyl radicals and reaction molecules. Separation was performed with and without a preliminary exposure of the polluted air sample to reactive molecule(s) system. The integral chromatographic peak areas before and after air sampling are used to quantify the atmospheric peroxyl radicals in polluted air. The utility of the new technique was tested with measurements carried out in the field. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Aprataxin resolves adenylated RNA–DNA junctions to maintain genome integrity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tumbale, Percy; Williams, Jessica S.; Schellenberg, Matthew J.
2013-12-22
Faithful maintenance and propagation of eukaryotic genomes is ensured by three-step DNA ligation reactions used by ATP-dependent DNA ligases. Paradoxically, when DNA ligases encounter nicked DNA structures with abnormal DNA termini, DNA ligase catalytic activity can generate and/or exacerbate DNA damage through abortive ligation that produces chemically adducted, toxic 5'-adenylated (5'-AMP) DNA lesions. Aprataxin (APTX) reverses DNA adenylation but the context for deadenylation repair is unclear. Here we examine the importance of APTX to RNase-H2-dependent excision repair (RER) of a lesion that is very frequently introduced into DNA, a ribonucleotide. We show that ligases generate adenylated 5' ends containing amore » ribose characteristic of RNase H2 incision. APTX efficiently repairs adenylated RNA–DNA, and acting in an RNA–DNA damage response (RDDR), promotes cellular survival and prevents S-phase checkpoint activation in budding yeast undergoing RER. Structure–function studies of human APTX–RNA–DNA–AMP–Zn complexes define a mechanism for detecting and reversing adenylation at RNA–DNA junctions. This involves A-form RNA binding, proper protein folding and conformational changes, all of which are affected by heritable APTX mutations in ataxia with oculomotor apraxia 1. Together, these results indicate that accumulation of adenylated RNA–DNA may contribute to neurological disease.« less
Liger, D; Masson, A; Blanot, D; van Heijenoort, J; Parquet, C
1995-05-15
The UDP-N-acetylmuramate:L-alanine ligase of Escherichia coli was over-produced in strains harbouring recombinant plasmids bearing the murC gene under the control of the lac or trc promoter. Plasmid pAM1005, in which the promoter and ribosome-binding site region of murC were removed and in which the gene was directly under the control of promoter trc, led to a 2000-fold amplification of the L-alanine-adding activity after induction by isopropyl-thio-beta-D-galactopyranoside. The murC gene product was visualized as a 50-kDa protein accounting for approximately 50% of the cell protein. A two-step purification led to 1 g of a homogeneous protein from an 18-1 culture. The N-terminal sequence of the purified protein correlated with the nucleotide sequence of the murC gene. The presence of 2-mercaptoethanol and glycerol was essential for the stability of the enzyme. The Km values for UDP-N-acetylmuramic acid, L-alanine and ATP/Mg2+ were estimated at 100, 20 and 450 microM, respectively. Under the optimal in vitro conditions a turnover number of 928 min-1 was calculated and a copy number/cell of 600 could be roughly estimated. The specificity of the enzyme for its substrates was investigated with various analogues. The enzyme also catalysed the reverse reaction.
Fiuza, Maria; Canova, Marc J.; Patin, Delphine; Letek, Michal; Zanella-Cléon, Isabelle; Becchi, Michel; Mateos, Luís M.; Mengin-Lecreulx, Dominique; Molle, Virginie; Gil, José A.
2008-01-01
The Mur ligases play an essential role in the biosynthesis of bacterial cell-wall peptidoglycan and thus represent attractive targets for the design of novel antibacterials. These enzymes catalyze the stepwise formation of the peptide moiety of the peptidoglycan disaccharide peptide monomer unit. MurC is responsible of the addition of the first residue (l-alanine) onto the nucleotide precursor UDP-MurNAc. Phosphorylation of proteins by Ser/Thr protein kinases has recently emerged as a major physiological mechanism of regulation in prokaryotes. Herein, the hypothesis of a phosphorylation-dependent mechanism of regulation of the MurC activity was investigated in Corynebacterium glutamicum. We showed that MurC was phosphorylated in vitro by the PknA protein kinase. An analysis of the phosphoamino acid content indicated that phosphorylation exclusively occurred on threonine residues. Six phosphoacceptor residues were identified by mass spectrometry analysis, and we confirmed that mutagenesis to alanine residues totally abolished PknA-dependent phosphorylation of MurC. In vitro and in vivo ligase activity assays showed that the catalytic activity of MurC was impaired following mutation of these threonine residues. Further in vitro assays revealed that the activity of the MurC-phosphorylated isoform was severely decreased compared with the non-phosphorylated protein. To our knowledge, this is the first demonstration of a MurC ligase phosphorylation in vitro. The finding that phosphorylation is correlated with a decrease in MurC enzymatic activity could have significant consequences in the regulation of peptidoglycan biosynthesis. PMID:18974047
An, Jian-Ping; Liu, Xin; Li, Hao-Hao; You, Chun-Xiang; Wang, Xiao-Fei; Hao, Yu-Jin
2017-11-01
MdMYB1 is an important regulator for anthocyanin accumulation in apple (Malus × domestica). Here, an apple RING E3 ligase, MdMIEL1, was screened out as a partner of MdMYB1 with a yeast two-hybrid approach. Pull-down, bimolecular fluorescence complementation and coimmunoprecipitation assays further verified the interaction between MdMIEL1 and MdMYB1 proteins. Subsequently, in vitro and in vivo experiments indicated that MdMIEL1 functioned as a ubiquitin E3 ligase to ubiquitinate MdMYB1 protein, followed by degradation through a 26S proteasome pathway. Furthermore, transgenic studies in apple calli and Arabidopsis demonstrated that MdMIEL1 negatively regulated anthocyanin accumulation by modulating the degradation of MdMYB1 protein. Taken together, our findings provide a new insight into the molecular mechanism by which MdMIEL1 negatively regulates anthocyanin biosynthesis by ubiquitinating and degrading MdMYB1 protein. © The Author 2017. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Than, Leslie Thian Lung; Chong, Pei Pei; Ng, Kee Peng; Seow, Heng Fong
2015-01-01
The number of invasive candidiasis cases has risen especially with an increase in the number of immunosuppressed and immunocom promised patients. The early detection of Candida species which is specific and sensitive is important in determining the correct administration of antifungal drugs to patients. This study aims to develop a method for the detection, identification and quantitation of medically important Candida species through quantitative polymerase chain reaction (qPCR). The isocitrate lyase (ICL) gene which is not found in mammals was chosen as the target gene of real-time PCR. Absolute quantitation of the gene copy number was achieved by constructing the plasmid containing the ICL gene which is used to generate standard curve. Twenty fungal species, two bacterial species and human DNA were tested to check the specificity of the detection method. All eight Candida species were successfully detected, identified and quantitated based on the ICL gene. A seven-log range of the gene copy number and a minimum detection limit of 10(3) copies were achieved. A one-tube absolute quantification real-time PCR that differentiates medically important Candida species via individual unique melting temperature was achieved. Analytical sensitivity and specificity were not compromised.
Liu, Licheng; Sun, Yang; Kargbo, Brima; Zhang, Chuntao; Feng, Huahua; Lu, Huijun; Liu, Wenseng; Wang, Chengyu; Hu, Yi; Deng, Yongqiang; Jiang, Jiafu; Kang, Xiaoping; Yang, Honglei; Jiang, Yongqiang; Yang, Yinhui; Kargbo, David; Qian, Jun; Chen, Weijun
2015-09-15
During the 2014 Ebola virus disease (EVD) outbreak, a real-time quantitative polymerase chain reaction was established to detect and identify the Zaire Ebola virus. We describe the use of this assay to screen 315 clinical samples from EVD suspected person in Sierra Leone. The detection rate in blood samples was 77.81% (207/266), and there were relatively higher detection rate (79.32% and 81.42%, respectively) during the first two weeks after onset of symptoms. In the two weeks that followed, the detection rate declined to 66.67% and 25.00%, respectively. There was the highest virus load at the first week and then decreased. The detection rate in swab samples was 89.79% (44/49). This may be benefit from the included patients. 46 of 49 swab samples were collected from died patients. Taken together, the results presented here indicate that the assay specifically and sensitively detects Zaire Ebola virus. Copyright © 2015 Elsevier B.V. All rights reserved.
Popov, Georgy; Majhi, Bharat Bhusan; Sessa, Guido
2018-05-21
The type III effector XopAE from the Xanthomonas euvesicatoria strain 85-10 ( Xe 85-10) was previously shown to inhibit plant immunity and enhance pathogen-induced disease symptoms. Evolutionary analysis of 60 xopAE alleles ( AEal ) revealed that the xopAE locus is conserved in multiple Xanthomonas species. The majority of xopAE alleles (55 out of 60) encodes a single ORF ( xopAE ), while in 5 alleles, including AEal 37 of the Xe 85-10 strain, a frame-shift splits the locus into two ORFs ( hpaF and a truncated xopAE ). To test whether the second ORF of AEal 37 ( xopAE 85-10 ) is translated, we examined expression of YFP fused downstream to truncated or mutant forms of the locus in Xanthomonas bacteria. YFP fluorescence was detected at maximal levels when the reporter was in proximity of an internal ribosome-binding site upstream to a rare ATT start codon in the xopAE 85-10 ORF, but severely reduced when these elements were abolished. In agreement with the notion that xopAE 85- 10 is a functional gene, its protein product was translocated into plant cells by the type III secretion system and translocation was dependent on its upstream ORF hpaF. Homology modeling predicted that XopAE 85-10 contains an E3 ligase XL-box domain at the C-terminus, and in vitro assays demonstrated that this domain displays mono-ubiquitination activity. Remarkably, the XL-box was essential for XopAE 85-10 to inhibit PAMP-induced gene expression in Arabidopsis protoplasts. Together, these results indicate that the xopAE 85-10 gene resides in a functional operon, which utilizes the alternative start codon ATT, and encodes a novel XL-box E3 ligase. Importance Xanthomonas bacteria utilize a type III secretion system to cause disease in many crops. This study provides insights into evolution, translocation and biochemical function of the XopAE type III secreted effector contributing to the understanding of Xanthomonas-host interactions. We establish XopAE as core effector of seven Xanthomonas
Bailey, S M; Fauconnet, A L; Reinke, L A
1997-02-01
Hydroxylation of salicylate and D-phenylalanine was measured to test the usefulness of these compounds for hydroxyl radical (HO(•)) detection in chemical and biological systems. When HO(•) were produced by the photolytic decomposition of hydrogen peroxide, nearly equal amounts of 2,5- and 2,3-dihydroxybenzoic acid (DHBA) were produced from salicylate, with catechol as a minor product. In the photolytic reaction, nearly equal concentrations of p-,m-, and o-tyrosine were formed from D-phenylalanine. When salicylate or D-phenylalanine was present with Fenton reagents or in iron(II) autoxidation systems, the relative proportions of hydroxylated products were similar to those observed after photolysis, although less total products were usually detected. In contrast, when similar experiments were conducted with isolated hepatic microsomes and perfused livers, 2,5-DHBA was the primary product from salicylate, and p-tyrosine was the major product from D-phenylalanine. Cytochrome P-450 enzymes can hydroxylate salicylate to produce 2,5-DHBA, and it is likely that phenylalanine hydroxylase produces most of the p-tyrosine detected in hepatic tissues. Thus, although both salicylate and D-phenylalanine are useful probes for hydroxyl radical formation in chemical systems, hydroxylated products formed from enzymatic reactions complicate interpretation of data from both compounds in vivo.
Psifidi, Androniki; Dovas, Chrysostomos; Banos, Georgios
2011-01-01
Background Single nucleotide polymorphisms (SNP) have proven to be powerful genetic markers for genetic applications in medicine, life science and agriculture. A variety of methods exist for SNP detection but few can quantify SNP frequencies when the mutated DNA molecules correspond to a small fraction of the wild-type DNA. Furthermore, there is no generally accepted gold standard for SNP quantification, and, in general, currently applied methods give inconsistent results in selected cohorts. In the present study we sought to develop a novel method for accurate detection and quantification of SNP in DNA pooled samples. Methods The development and evaluation of a novel Ligase Chain Reaction (LCR) protocol that uses a DNA-specific fluorescent dye to allow quantitative real-time analysis is described. Different reaction components and thermocycling parameters affecting the efficiency and specificity of LCR were examined. Several protocols, including gap-LCR modifications, were evaluated using plasmid standard and genomic DNA pools. A protocol of choice was identified and applied for the quantification of a polymorphism at codon 136 of the ovine PRNP gene that is associated with susceptibility to a transmissible spongiform encephalopathy in sheep. Conclusions The real-time LCR protocol developed in the present study showed high sensitivity, accuracy, reproducibility and a wide dynamic range of SNP quantification in different DNA pools. The limits of detection and quantification of SNP frequencies were 0.085% and 0.35%, respectively. Significance The proposed real-time LCR protocol is applicable when sensitive detection and accurate quantification of low copy number mutations in DNA pools is needed. Examples include oncogenes and tumour suppressor genes, infectious diseases, pathogenic bacteria, fungal species, viral mutants, drug resistance resulting from point mutations, and genetically modified organisms in food. PMID:21283808
The E3 ligase c-Cbl regulates dendritic cell activation
Chiou, Shin-Heng; Shahi, Payam; Wagner, Ryan T; Hu, Hongbo; Lapteva, Natalia; Seethammagari, Mamatha; Sun, Shao-Cong; Levitt, Jonathan M; Spencer, David M
2011-01-01
The activation of innate and adaptive immunity is always balanced by inhibitory signalling mechanisms to maintain tissue integrity. We have identified the E3 ligase c-Cbl––known for its roles in regulating lymphocyte signalling––as a modulator of dendritic cell activation. In c-Cbl-deficient dendritic cells, Toll-like receptor-induced expression of proinflammatory factors, such as interleukin-12, is increased, correlating with a greater potency of dendritic-cell-based vaccines against established tumours. This proinflammatory phenotype is accompanied by an increase in nuclear factor (NF)-κB activity. In addition, c-Cbl deficiency reduces both p50 and p105 levels, which have been shown to modulate the stimulatory function of NF-κB. Our data indicate that c-Cbl has a crucial, RING-domain-dependent role in regulating dendritic cell maturation, probably by facilitating the regulatory function of p105 and/or p50. PMID:21799517
Wang, Hong-Qi; Wu, Zhan; Zhang, Yan; Tang, Li-Juan; Yu, Ru-Qin; Jiang, Jian-Hui
2012-01-13
Genotyping of cytochrome P450 monooxygenase 2D6*10 (CYP2D6*10) plays an important role in pharmacogenomics, especially in clinical drug therapy of Asian populations. This work reported a novel label-free technique for genotyping of CYP2D6*10 based on ligation-mediated strand displacement amplification (SDA) with DNAzyme-based chemiluminescence detection. Discrimination of single-base mismatch is firstly accomplished using DNA ligase to generate a ligation product. The ligated product then initiates a SDA reaction to produce aptamer sequences against hemin, which can be probed by chemiluminescence detection. The proposed strategy is used for the assay of CYP2D6*10 target and the genomic DNA. The results reveal that the proposed technique displays chemiluminescence responses in linear correlation to the concentrations of DNA target within the range from 1 pM to 1 nM. A detection limit of 0.1 pM and a signal-to-background ratio of 57 are achieved. Besides such high sensitivity, the proposed CYP2D6*10 genotyping strategy also offers superb selectivity, great robustness, low cost and simplified operations due to its label-free, homogeneous, and chemiluminescence-based detection format. These advantages suggest this technique may hold considerable potential for clinical CYP2D6*10 genotyping and association studies. Copyright © 2011 Elsevier B.V. All rights reserved.
Detection of Salmonella invA gene in shrimp enrichment culture by polymerase chain reaction.
Upadhyay, Bishnu Prasad; Utrarachkij, Fuangfa; Thongshoob, Jarinee; Mahakunkijcharoen, Yuvadee; Wongchinda, Niracha; Suthienkul, Orasa; Khusmith, Srisin
2010-03-01
Contamination of seafood with salmonellae is a major public health concern. Detection of Salmonella by standard culture methods is time consuming. In this study, an enrichment culture step prior to polymerase chain reaction (PCR) was applied to detect 284 bp fragment of Salmonella invA in comparison with the conventional culture method in 100 shrimp samples collected from four different shrimp farms and fresh food markets around Bangkok. Samples were pre-enriched in non-selective lactose broth (LB) and selective tetrathionate broth (TTB). PCR detection limit was 10 pg and 10(4) cfu/ml of viable salmonellae with 100% specificity. PCR assay detected 19 different Salmonella serovars belonging to 8 serogroups (B, C1, C2-C3, D1, E1, E4 and K) commonly found in clinical and environmental samples in Thailand. The detection rate of PCR following TTB enrichment (24%) was higher than conventional culture method (19%). PCR following TTB, but not in LB enrichment allowed salmonella detection with 84% sensitivity, 90% specificity and 89% accuracy. Shrimp samples collected from fresh food markets had higher levels of contaminated salmonellae than those from shrimp farms. The results indicated that incorporation of an enrichment step prior to PCR has the potential to be applied for detection of naturally contaminated salmonellae in food, environment and clinical samples.
Zheng, Ying; Chen, Zhuo; Zheng, Chengbin; Lee, Yong-Ill; Hou, Xiandeng; Wu, Li; Tian, Yunfei
2016-08-01
A facile method was developed for determination of trace volatile acetone by coupling a derivatization reaction to surface-enhanced Raman scattering (SERS). With iodide modified Ag nanoparticles (Ag IMNPs) as the SERS substrate, acetone without obvious Raman signal could be converted to SERS-sensitive species via a chemical derivatization reaction with 2,4-dinitrophenylhydrazine (2,4-DNPH). In addition, acetone can be effectively separated from liquid phase with a purge-sampling device and then any serious interference from sample matrices can be significantly reduced. The optimal conditions for the derivatization reaction and the SERS analysis were investigated in detail, and the selectivity and reproducibility of this method were also evaluated. Under the optimal conditions, the limit of detection (LOD) for acetone was 5mgL(-1) or 0.09mM (3σ). The relative standard deviation (RSD) for 80mgL(-1) acetone (n=9) was 1.7%. This method was successfully used for the determination of acetone in artificial urine and human urine samples with spiked recoveries ranging from 92% to 110%. The present method is convenient, sensitive, selective, reliable and suitable for analysis of trace acetone, and it could have a promising clinical application in early diabetes diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.
Zhao, Yang; Tan, Lu; Gao, Xiaoshan; Jie, Guifen; Huang, Tingyu
2018-07-01
Herein, we successfully devised a novel photoelectrochemical (PEC) platform for ultrasensitive detection of adenosine by target-triggering cascade multiple cycle amplification based on the silver nanoparticles-assisted ion-exchange reaction with CdTe quantum dots (QDs). In the presence of target adenosine, DNA s1 is released from the aptamer and then hybridizes with hairpin DNA (HP1), which could initiate the cycling cleavage process under the reaction of nicking endonuclease. Then the product (DNA b) of cycle I could act as the "DNA trigger" of cycle II to further generate a large number of DNA s1, which again go back to cycle I, thus a cascade multiple DNA cycle amplification was carried out to produce abundant DNA c. These DNA c fragments with the cytosine (C)-rich loop were captured by magnetic beads, and numerous silver nanoclusters (Ag NCs) were synthesized by AgNO 3 and sodium borohydride. The dissolved AgNCs released numerous silver ions which could induce ion exchange reaction with the CdTe QDs, thus resulting in greatly amplified change of photocurrent for target detection. The detection linear range for adenosine was 1.0 fM ~10 nM with the detection limit of 0.5 fM. The present PEC strategy combining cascade multiple DNA cycle amplification and AgNCs-induced ion-exchange reaction with QDs provides new insight into rapid, and ultrasensitive PEC detection of different biomolecules, which showed great potential for detecting trace amounts in bioanalysis and clinical biomedicine. Copyright © 2018 Elsevier B.V. All rights reserved.
Mudhasani, Rajini; Tran, Julie P.; Retterer, Cary; Kota, Krishna P.; Whitehouse, Chris A.; Bavari, Sina
2016-01-01
Activated protein kinase R (PKR) plays a vital role in antiviral defense primarily by inhibiting protein synthesis and augmenting interferon responses. Many viral proteins have adopted unique strategies to counteract the deleterious effects of PKR. The NSs (Non-structural s) protein which is encoded by Rift Valley fever virus (RVFV) promotes early PKR proteasomal degradation through a previously undefined mechanism. In this study, we demonstrate that NSs carries out this activity by assembling the SCF (SKP1-CUL1-F-box)FBXW11 E3 ligase. NSs binds to the F-box protein, FBXW11, via the six amino acid sequence DDGFVE called the degron sequence and recruits PKR through an alternate binding site to the SCFFBXW11 E3 ligase. We further show that disrupting the assembly of the SCFFBXW11-NSs E3 ligase with MLN4924 (a small molecule inhibitor of SCF E3 ligase activity) or NSs degron viral mutants or siRNA knockdown of FBXW11 can block PKR degradation. Surprisingly, under these conditions when PKR degradation was blocked, NSs was essential and sufficient to activate PKR causing potent inhibition of RVFV infection by suppressing viral protein synthesis. These antiviral effects were antagonized by the loss of PKR expression or with a NSs deleted mutant virus. Therefore, early PKR activation by disassembly of SCFFBXW11-NSs E3 ligase is sufficient to inhibit RVFV infection. Furthermore, FBXW11 and BTRC are the two homologues of the βTrCP (Beta-transducin repeat containing protein) gene that were previously described to be functionally redundant. However, in RVFV infection, among the two homologues of βTrCP, FBXW11 plays a dominant role in PKR degradation and is the limiting factor in the assembly of the SCFFBXW11 complex. Thus, FBXW11 serves as a master regulator of RVFV infection by promoting PKR degradation. Overall these findings provide new insights into NSs regulation of PKR activity and offer potential opportunities for therapeutic intervention of RVFV infection. PMID
Mudhasani, Rajini; Tran, Julie P; Retterer, Cary; Kota, Krishna P; Whitehouse, Chris A; Bavari, Sina
2016-02-01
Activated protein kinase R (PKR) plays a vital role in antiviral defense primarily by inhibiting protein synthesis and augmenting interferon responses. Many viral proteins have adopted unique strategies to counteract the deleterious effects of PKR. The NSs (Non-structural s) protein which is encoded by Rift Valley fever virus (RVFV) promotes early PKR proteasomal degradation through a previously undefined mechanism. In this study, we demonstrate that NSs carries out this activity by assembling the SCF (SKP1-CUL1-F-box)(FBXW11) E3 ligase. NSs binds to the F-box protein, FBXW11, via the six amino acid sequence DDGFVE called the degron sequence and recruits PKR through an alternate binding site to the SCF(FBXW11) E3 ligase. We further show that disrupting the assembly of the SCF(FBXW11-NSs) E3 ligase with MLN4924 (a small molecule inhibitor of SCF E3 ligase activity) or NSs degron viral mutants or siRNA knockdown of FBXW11 can block PKR degradation. Surprisingly, under these conditions when PKR degradation was blocked, NSs was essential and sufficient to activate PKR causing potent inhibition of RVFV infection by suppressing viral protein synthesis. These antiviral effects were antagonized by the loss of PKR expression or with a NSs deleted mutant virus. Therefore, early PKR activation by disassembly of SCF(FBXW11-NSs) E3 ligase is sufficient to inhibit RVFV infection. Furthermore, FBXW11 and BTRC are the two homologues of the βTrCP (Beta-transducin repeat containing protein) gene that were previously described to be functionally redundant. However, in RVFV infection, among the two homologues of βTrCP, FBXW11 plays a dominant role in PKR degradation and is the limiting factor in the assembly of the SCF(FBXW11) complex. Thus, FBXW11 serves as a master regulator of RVFV infection by promoting PKR degradation. Overall these findings provide new insights into NSs regulation of PKR activity and offer potential opportunities for therapeutic intervention of RVFV infection.
Mudhasani, Rajini; Tran, Julie P.; Retterer, Cary; ...
2016-02-02
Activated protein kinase R (PKR) plays a vital role in antiviral defense primarily by inhibiting protein synthesis and augmenting interferon responses. Many viral proteins have adopted unique strategies to counteract the deleterious effects of PKR. The NSs (Non-structural s) protein which is encoded by Rift Valley fever virus (RVFV) promotes early PKR proteasomal degradation through a previously undefined mechanism. In this study, we demonstrate that NSs carries out this activity by assembling the SCF (SKP1-CUL1-F-box)FBXW11 E3 ligase. NSs binds to the F-box protein, FBXW11, via the six amino acid sequence DDGFVE called the degron sequence and recruits PKR through anmore » alternate binding site to the SCFFBXW11 E3 ligase. We further show that disrupting the assembly of the SCFFBXW11-NSs E3 ligase with MLN4924 (a small molecule inhibitor of SCF E3 ligase activity) or NSs degron viral mutants or siRNA knockdown of FBXW11 can block PKR degradation. Surprisingly, under these conditions when PKR degradation was blocked, NSs was essential and sufficient to activate PKR causing potent inhibition of RVFV infection by suppressing viral protein synthesis. These antiviral effects were antagonized by the loss of PKR expression or with a NSs deleted mutant virus. Therefore, early PKR activation by disassembly of SCFFBXW11-NSs E3 ligase is sufficient to inhibit RVFV infection. Furthermore, FBXW11 and BTRC are the two homologues of the βTrCP (Beta-transducin repeat containing protein) gene that were previously described to be functionally redundant. However, in RVFV infection, among the two homologues of βTrCP, FBXW11 plays a dominant role in PKR degradation and is the limiting factor in the assembly of the SCFFBXW11 complex. Thus, FBXW11 serves as a master regulator of RVFV infection by promoting PKR degradation. Overall these findings provide new insights into NSs regulation of PKR activity and offer potential opportunities for therapeutic intervention of RVFV infection.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mudhasani, Rajini; Tran, Julie P.; Retterer, Cary
Activated protein kinase R (PKR) plays a vital role in antiviral defense primarily by inhibiting protein synthesis and augmenting interferon responses. Many viral proteins have adopted unique strategies to counteract the deleterious effects of PKR. The NSs (Non-structural s) protein which is encoded by Rift Valley fever virus (RVFV) promotes early PKR proteasomal degradation through a previously undefined mechanism. In this study, we demonstrate that NSs carries out this activity by assembling the SCF (SKP1-CUL1-F-box)FBXW11 E3 ligase. NSs binds to the F-box protein, FBXW11, via the six amino acid sequence DDGFVE called the degron sequence and recruits PKR through anmore » alternate binding site to the SCFFBXW11 E3 ligase. We further show that disrupting the assembly of the SCFFBXW11-NSs E3 ligase with MLN4924 (a small molecule inhibitor of SCF E3 ligase activity) or NSs degron viral mutants or siRNA knockdown of FBXW11 can block PKR degradation. Surprisingly, under these conditions when PKR degradation was blocked, NSs was essential and sufficient to activate PKR causing potent inhibition of RVFV infection by suppressing viral protein synthesis. These antiviral effects were antagonized by the loss of PKR expression or with a NSs deleted mutant virus. Therefore, early PKR activation by disassembly of SCFFBXW11-NSs E3 ligase is sufficient to inhibit RVFV infection. Furthermore, FBXW11 and BTRC are the two homologues of the βTrCP (Beta-transducin repeat containing protein) gene that were previously described to be functionally redundant. However, in RVFV infection, among the two homologues of βTrCP, FBXW11 plays a dominant role in PKR degradation and is the limiting factor in the assembly of the SCFFBXW11 complex. Thus, FBXW11 serves as a master regulator of RVFV infection by promoting PKR degradation. Overall these findings provide new insights into NSs regulation of PKR activity and offer potential opportunities for therapeutic intervention of RVFV infection.« less
Kim, Ju Youn; Leader, Andrew; Stoller, Michelle L.; Coen, Donald M.; Wilson, Angus C.
2017-01-01
Infection with herpes simplex virus-1 (HSV-1) brings numerous changes in cellular gene expression. Levels of most host mRNAs are reduced, limiting synthesis of host proteins, especially those involved in antiviral defenses. The impact of HSV-1 on host microRNAs (miRNAs), an extensive network of short non-coding RNAs that regulate mRNA stability/translation, remains largely unexplored. Here we show that transcription of the miR-183 cluster (miR-183, miR-96, and miR-182) is selectively induced by HSV-1 during productive infection of primary fibroblasts and neurons. ICP0, a viral E3 ubiquitin ligase expressed as an immediate-early protein, is both necessary and sufficient for this induction. Nuclear exclusion of ICP0 or removal of the RING (really interesting new gene) finger domain that is required for E3 ligase activity prevents induction. ICP0 promotes the degradation of numerous host proteins and for the most part, the downstream consequences are unknown. Induction of the miR-183 cluster can be mimicked by depletion of host transcriptional repressors zinc finger E-box binding homeobox 1 (ZEB1)/δ-crystallin enhancer binding factor 1 (δEF1) and zinc finger E-box binding homeobox 2 (ZEB2)/Smad-interacting protein 1 (SIP1), which we establish as new substrates for ICP0-mediated degradation. Thus, HSV-1 selectively stimulates expression of the miR-183 cluster by ICP0-mediated degradation of ZEB transcriptional repressors. PMID:28783105
Agardh, Elisabet; Gustavsson, Carin; Hagert, Per; Nilsson, Marie; Agardh, Carl-David
2006-02-01
The aim of the study was to evaluate messenger RNA and protein expression in limited amounts of tissue with low protein content. The Chomczynski method was used for simultaneous extraction of RNA, and protein was modified in the protein isolation step. Template mass and cycling time for the complementary DNA synthesis step of real-time reverse transcription-polymerase chain reaction (RT-PCR) for analysis of catalase, copper/zinc superoxide dismutase, manganese superoxide dismutase, the catalytic subunit of glutamylcysteine ligase, glutathione peroxidase 1, and the endogenous control cyclophilin B (CypB) were optimized before PCR. Polymerase chain reaction accuracy and efficacy were demonstrated by calculating the regression (R2) values of the separate amplification curves. Appropriate antibodies, blocking buffers, and running conditions were established for Western blot, and protein detection and multiplex assays with CypB were performed for each target. During the extraction procedure, the protein phase was dissolved in a modified washing buffer containing 0.1% sodium dodecyl sulfate, followed by ultrafiltration. Enzyme expression on real-time RT-PCR was accomplished with high reliability and reproducibility (R2, 0.990-0.999), and all enzymes except for glutathione peroxidase 1 were detectable in individual retinas on Western blot. Western blot multiplexing with CypB was possible for all targets. In conclusion, connecting gene expression directly to protein levels in the individual rat retina was possible by simultaneous extraction of RNA and protein. Real-time RT-PCR and Western blot allowed accurate detection of retinal protein expressions and levels.
Ubiquitin Ligase WWP1 Interacts with Ebola Virus VP40 To Regulate Egress.
Han, Ziying; Sagum, Cari A; Takizawa, Fumio; Ruthel, Gordon; Berry, Corbett T; Kong, Jing; Sunyer, J Oriol; Freedman, Bruce D; Bedford, Mark T; Sidhu, Sachdev S; Sudol, Marius; Harty, Ronald N
2017-10-15
Ebola virus (EBOV) is a member of the Filoviridae family and the cause of hemorrhagic fever outbreaks. The EBOV VP40 (eVP40) matrix protein is the main driving force for virion assembly and budding. Indeed, expression of eVP40 alone in mammalian cells results in the formation and budding of virus-like particles (VLPs) which mimic the budding process and morphology of authentic, infectious EBOV. To complete the budding process, eVP40 utilizes its PPXY L-domain motif to recruit a specific subset of host proteins containing one or more modular WW domains that then function to facilitate efficient production and release of eVP40 VLPs. In this report, we identified additional host WW-domain interactors by screening for potential interactions between mammalian proteins possessing one or more WW domains and WT or PPXY mutant peptides of eVP40. We identified the HECT family E3 ubiquitin ligase WWP1 and all four of its WW domains as strong interactors with the PPXY motif of eVP40. The eVP40-WWP1 interaction was confirmed by both peptide pulldown and coimmunoprecipitation assays, which also demonstrated that modular WW domain 1 of WWP1 was most critical for binding to eVP40. Importantly, the eVP40-WWP1 interaction was found to be biologically relevant for VLP budding since (i) small interfering RNA (siRNA) knockdown of endogenous WWP1 resulted in inhibition of eVP40 VLP egress, (ii) coexpression of WWP1 and eVP40 resulted in ubiquitination of eVP40 and a subsequent increase in eVP40 VLP egress, and (iii) an enzymatically inactive mutant of WWP1 (C890A) did not ubiquitinate eVP40 or enhance eVP40 VLP egress. Last, our data show that ubiquitination of eVP40 by WWP1 enhances egress of VLPs and concomitantly decreases cellular levels of higher-molecular-weight oligomers of eVP40. In sum, these findings contribute to our fundamental understanding of the functional interplay between host E3 ligases, ubiquitination, and regulation of EBOV VP40-mediated egress. IMPORTANCE Ebola
Zhu, Jing; Ding, Yongshun; Liu, Xingti; Wang, Lei; Jiang, Wei
2014-09-15
Highly sensitive and selective detection strategy for single-base mutations is essential for risk assessment of malignancy and disease prognosis. In this work, a fluorescent detection method for single-base mutation was proposed based on high selectivity of toehold-mediated strand displacement reaction (TSDR) and powerful signal amplification capability of isothermal DNA amplification. A discrimination probe was specially designed with a stem-loop structure and an overhanging toehold domain. Hybridization between the toehold domain and the perfect matched target initiated the TSDR along with the unfolding of the discrimination probe. Subsequently, the target sequence acted as a primer to initiate the polymerization and nicking reactions, which released a great abundant of short sequences. Finally, the released strands were annealed with the reporter probe, launching another polymerization and nicking reaction to produce lots of G-quadruplex DNA, which could bind the N-methyl mesoporphyrin IX to yield an enhanced fluorescence response. However, when there was even a single base mismatch in the target DNA, the TSDR was suppressed and so subsequent isothermal DNA amplification and fluorescence response process could not occur. The proposed approach has been successfully implemented for the identification of the single-base mutant sequences in the human KRAS gene with a detection limit of 1.8 pM. Furthermore, a recovery of 90% was obtained when detecting the target sequence in spiked HeLa cells lysate, demonstrating the feasibility of this detection strategy for single-base mutations in biological samples. Copyright © 2014 Elsevier B.V. All rights reserved.
Limberger, Jones; Leal, Bárbara C.; Monteiro, Adriano L.
2015-01-01
In recent years, charge-tagged ligands (CTLs) have become valuable tools in organometallic catalysis. Insertion of an ionic side chain into the molecular skeleton of a known ligand has become a useful protocol for anchoring ligands, and consequently catalysts, in polar and ionic liquid phases. In addition, the insertion of a cationic moiety into a ligand is a powerful tool that can be used to detect reaction intermediates in organometallic catalysis through electrospray ionisation mass spectrometry (ESI-MS) experiments. The insertion of an ionic tag ensures the charge in the intermediates independently of the ESI-MS. For this reason, these ligands have been used as ionic probes in mechanistic studies for several catalytic reactions. Here, we summarise selected examples on the use of CTLs as immobilising agents in organometallic catalysis and as probes for studying mechanisms through ESI-MS. PMID:28553458
Han, Xuemei; Koh, Charlynn Sher Lin; Lee, Hiang Kwee; Chew, Wee Shern; Ling, Xing Yi
2017-11-15
Miniaturizing the continuous multistep operations of a factory into a microchemical plant offers a safe and cost-effective approach to promote high-throughput screening in drug development and enforcement of industrial/environmental safety. While particle-assembled microdroplets in the form of liquid marble are ideal as microchemical plant, these platforms are mainly restricted to single-step reactions and limited to ex situ reaction monitoring. Herein, we utilize plasmonic liquid marble (PLM), formed by encapsulating liquid droplet with Ag nanocubes, to address these issues and demonstrate it as an ideal microchemical plant to conduct reaction-and-detection sequences on-demand in a nondisruptive manner. Utilizing a two-step azo-dye formation as our model reaction, our microchemical plant allows rapid and efficient diazotization of nitroaniline to form diazonium nitrobenzene, followed by the azo coupling of this intermediate with target aromatic compound to yield azo-dye. These molecular events are tracked in situ via SERS measurement through the plasmonic shell and further verified with in silico investigation. Furthermore, we apply our microchemical plant for ultrasensitive SERS detection and quantification of bisphenol A (BPA) with detection limit down to 10 amol, which is 50 000-fold lower than the BPA safety limit. Together with the protections offered by plasmonic shell against external environments, these collective advantages empower PLM as a multifunctional microchemical plant to facilitate small-volume testing and optimization of processes relevant in industrial and research contexts.
Voiniciuc, Cătălin; Dean, Gillian H.; Griffiths, Jonathan S.; Kirchsteiger, Kerstin; Hwang, Yeen Ting; Gillett, Alan; Dow, Graham; Western, Tamara L.; Estelle, Mark; Haughn, George W.
2013-01-01
Pectins are complex polysaccharides that form the gel matrix of the primary cell wall and are abundant in the middle lamella that holds plant cells together. Their degree of methylesterification (DM) impacts wall strength and cell adhesion since unesterified pectin regions can cross-link via Ca2+ ions to form stronger gels. Here, we characterize flying saucer1 (fly1), a novel Arabidopsis thaliana seed coat mutant, which displays primary wall detachment, reduced mucilage extrusion, and increased mucilage adherence. These defects appear to result from a lower DM in mucilage and are enhanced by the addition of Ca2+ or completely rescued using alkaline Ca2+ chelators. FLY1 encodes a transmembrane protein with a RING-H2 domain that has in vitro E3 ubiquitin ligase activity. FLY1 is orthologous to TRANSMEMBRANE UBIQUITIN LIGASE1, a Golgi-localized E3 ligase involved in the quality control of membrane proteins in yeast. However, FLY1–yellow fluorescent protein (YFP) fusions are localized in punctae that are predominantly distinct from the Golgi and the trans-Golgi network/early endosome in the seed coat epidermis. Wortmannin treatment, which induces the fusion of late endosomes in plants, resulted in enlarged FLY1-YFP bodies. We propose that FLY1 regulates the DM of pectin in mucilage, potentially by recycling pectin methylesterase enzymes in the endomembrane system of seed coat epidermal cells. PMID:23482858
Avanesian, Agnesa; Semnani, Sahar; Jafari, Mahtab
2009-08-01
Once a molecule is identified as a potential drug, the detection of adverse drug reactions is one of the key components of its development and the FDA approval process. We propose using Drosophila melanogaster to screen for reproductive adverse drug reactions in the early stages of drug development. Compared with other non-mammalian models, D. melanogaster has many similarities to the mammalian reproductive system, including putative sex hormones and conserved proteins involved in genitourinary development. Furthermore, the D. melanogaster model would present significant advantages in time efficiency and cost-effectiveness compared with mammalian models. We present data on methotrexate (MTX) reproductive adverse events in multiple animal models, including fruit flies, as proof-of-concept for the use of the D. melanogaster model.
Ubiquitin-protein ligases in muscle wasting: multiple parallel pathways?
NASA Technical Reports Server (NTRS)
Lecker, Stewart H.; Goldberg, A. L. (Principal Investigator)
2003-01-01
PURPOSE OF REVIEW: Studies in a wide variety of animal models of muscle wasting have led to the concept that increased protein breakdown via the ubiquitin-proteasome pathway is responsible for the loss of muscle mass seen as muscle atrophy. The complexity of the ubiquitination apparatus has hampered our understanding of how this pathway is activated in atrophying muscles and which ubiquitin-conjugating enzymes in muscle are responsible. RECENT FINDINGS: Recent experiments have shown that two newly identified ubiquitin-protein ligases (E3s), atrogin-1/MAFbx and MURF-1, are critical in the development of muscle atrophy. Other in-vitro studies also implicated E2(14k) and E3alpha, of the N-end rule pathway, as playing an important role in the process. SUMMARY: It seems likely that multiple pathways of ubiquitin conjugation are activated in parallel in atrophying muscle, perhaps to target for degradation specific classes of muscle proteins. The emerging challenge will be to define the protein targets for, as well as inhibitors of, these E3s.
Wang, Hao; Wang, Jialin; Yang, Shaoxiang; Tian, Hongyu; Sun, Baoguo; Liu, Yongguo
2018-01-01
A new reaction-based fluorescent probe 6-cyanonaphthalen-2-yl-2,4- dinitrobenzenesulfonate (probe 1) was designed and synthesized for detection of hydrogen sulfide (H 2 S). The addition of H 2 S to a solution of probe 1 resulted in a marked fluorescence increased accompanied by a visual color change from colorless to yellow. Importantly, this distinct color response indicates that probe 1 could be used as a visual tool for detection of H 2 S. H 2 S can be detected quantitatively in the concentration range 0 to 25 μM and the detection limit was 30 nM. Moreover, probe 1 was successfully used as a sensor to determine H 2 S levels in red wine and beer. Fluorescent probe 1 could be employed as a visible sensor for H 2 S. Probe 1 could be used to detect H 2 S quantitatively in food simple. © 2017 Institute of Food Technologists®.
Sensitive detection of Treponema pallidum by using the polymerase chain reaction.
Burstain, J M; Grimprel, E; Lukehart, S A; Norgard, M V; Radolf, J D
1991-01-01
We have developed a sensitive assay for Treponema pallidum subsp. pallidum (T. pallidum), the agent of veneral syphilis, based upon the polymerase chain reaction (PCR). A 658-bp portion of the gene encoding the 47-kDa membrane immunogen was amplified, and the PCR products were probed by DNA-DNA hybridization with a 496-bp fragment internal to the amplitifed DNA. The assay detected approximately 0.01 pg of purified T. pallidum DNA, and positive results were obtained routinely from suspensions of treponemes calculated to contain 10 or more organism and from some suspensions calculated to contain a single organism. Specific PCR products were obtained for the closely related agent of yaws, Treponema pallidum subsp. pertenue, but not with human DNA or DNAs from other spirochetes (including Borrelia burgdoferi), skin microorganisms, sexually transmitted disease pathogens, and central nervous system pathogens. T. pallidum DNA was detected in serum, cerebrospinal fluids, and amniotic fluids from syphilis patients but not in in nonsyphilitic controls. T. pallidum DNA was also amplified from paraffin-embedded tissue. The diagnosis of syphillis by using PCR may become a significant addition to the diagnostic armamentarium and a valuable technique for the investigation of syphilis pathogenesis.
Curreli, Francesca; Robles, Monica A; Friedman-Kien, Alvin E; Flore, Ornella
2003-02-01
Kaposi's sarcoma-associated herpesvirus is a novel herpesvirus linked to AIDS-related neoplasms. Currently it is difficult to evaluate the number of virions in viral preparation or in samples obtained from patients with Kaposi's sarcoma (KS), since no protocol for determining the plaque forming units of KSHV exists. We constructed a fragment of a different size than the target viral DNA to carry out a competitive-quantitative PCR. Both fragment and viral DNA were added to a single PCR reaction to compete for the same set of primers. By knowing the amount of the competitor added to the reaction, we could determine the number of viral DNA molecules. We used this assay successfully to detect and quantify KSHV genomes from KS skin biopsies and pleural effusion lymphoma, and from different viral preparations. To date, this is the most convenient and economic method that allows an accurate and fast viral detection/quantitation with a single PCR.
Martín, Maria Cruz; del Rio, Beatriz; Martínez, Noelia; Magadán, Alfonso H; Alvarez, Miguel A
2008-12-01
One of the main microbiological problems of the dairy industry is the susceptibility of starter bacteria to virus infections. Lactobacillus delbrueckii, a component of thermophilic starter cultures used in the manufacture of several fermented dairy products, including yogurt, is also sensitive to bacteriophage attacks. To avoid the problems associated with these viruses, quick and sensitive detection methods are necessary. In the present study, a fast real-time quantitative polymerase chain reaction assay for the direct detection and quantification of L. delbrueckii phages in milk was developed. A set of primers and a TaqMan MGB probe was designed, based on the lysin gene sequence of different L. delbrueckii phages. The results show the proposed method to be a rapid (total processing time 30 min), specific and highly sensitive technique for detecting L. delbrueckii phages in milk.